
Sample records for metabolicos inh dnp

  1. Effects of INH, DNP, 2,4-D and CMU on the photosynthetic activity of barley and maize plants; Efecto de cuatro inhibidores metabolicos (INH, DNP, 2, 4-D y CMU) sobre la actividad fotosintetica de plantular de cebada (Hordeum vulgare L.) y Maiz (Zea mais L.)

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez, J; Prieto, M P


    Determinations of the rate of photosynthesis were made in barley and maize leaves treated with INH, DNP, 2,4-D or CMU. 1 ppm of the chemicals in nutritive solutions was absorbed by roots during 24 or 48 hours in both dark and light conditions. After this period, photosynthetic activity, compensation point and 14{sup C}O{sub 2} assimilation were determined. Results show that INH increases the rate of photosynthesis, DNP and 2,4-D do not alter it sensibly and CMU acts as a strong inhibitor of photosynthesis. Some possible applications for ths obtention of labelled compounds by biosynthesis are discussed. (Author) 87 refs.

  2. Effects of INH, DNP, 2, 4-D and CMU on the sugar content of the barley and maize leaves; Efecto de cuatro inhibidores metabolicos (INH, DNP, 2, 3-D y CMU) sobre el contenido en azucares de hohas de cebada (Hordeum vulgare L.) y Maiz (Zea mais L.)

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez, J; Sancho, P


    1 ppm of the chemicals in nutritive solution was absorbed by barley and maize roots during 24 and 48 hours in dark or light conditioners in order to determine the best conditions. for the obtention of labelled sugars with high specific activity. Results show that the highest specific activity was obtained In maize plants treated with DNP for 24 hours in dark conditions. (Author) 51 refs.

  3. Effects of INH, DNP, 2,4-D and CMU on the photosynthetic activity of barley and maize plants

    International Nuclear Information System (INIS)

    Fernandez, J.; Prieto, M. P.


    Determinations of the rate of photosynthesis were made in barley and maize leaves treated with INH, DNP, 2,4-D or CMU. 1 ppm of the chemicals in nutritive solutions was absorbed by roots during 24 or 48 hours in both dark and light conditions. After this period, photosynthetic activity, compensation point and 14 C O 2 assimilation were determined. Results show that INH increases the rate of photosynthesis, DNP and 2,4-D do not alter it sensibly and CMU acts as a strong inhibitor of photosynthesis. Some possible applications for ths obtention of labelled compounds by biosynthesis are discussed. (Author) 87 refs

  4. Effects of INH, DNP, 2, 4-D and CMU on the sugar content of the barley and maize leaves

    International Nuclear Information System (INIS)

    Fernandez, J.; Sancho, P.


    1 ppm of the chemicals in nutritive solution was absorbed by barley and maize roots during 24 and 48 hours in dark or light conditioners in order to determine the best conditions for the obtention of labelled sugars with high specific activity. Results show that the highest specific activity was obtained in maize plants treated with DNP for 24 hours in dark conditions. (Author) 51 refs

  5. EPR spectroscopy at DNP conditions

    International Nuclear Information System (INIS)

    Heckmann, J.; Goertz, St.; Meyer, W.; Radtke, E.; Reicherz, G.


    In terms of dynamic nuclear polarization (DNP) studies and systematic target material research it is crucial to know the EPR lineshape of the DNP relevant paramagnetic centers. Therefore in Bochum an EPR spectrometer has been implemented into the 4 He evaporation DNP facility in order to perform EPR studies at DNP conditions (B=2.5 T, T=1 K). The spectrometer hardware and performance as well as first results are presented

  6. DNP Communication Function with RTDS

    DEFF Research Database (Denmark)

    Cha, Seung-Tae; Wu, Qiuwei; Saleem, Arshad


    A simulation case is implemented on RSCAD for testing their communication. The case has two binary status points (mapped to DNP binary input objects 1 & 2) and two binary control points (mapped to DNP binary output objects 10 and controlled via DNP objects 12). There is also one analog status poi...

  7. Towards Overhauser DNP in supercritical CO(2). (United States)

    van Meerten, S G J; Tayler, M C D; Kentgens, A P M; van Bentum, P J M


    Overhauser Dynamic Nuclear Polarization (ODNP) is a well known technique to improve NMR sensitivity in the liquid state, where the large polarization of an electron spin is transferred to a nucleus of interest by cross-relaxation. The efficiency of the Overhauser mechanism for dipolar interactions depends critically on fast local translational dynamics at the timescale of the inverse electron Larmor frequency. The maximum polarization enhancement that can be achieved for (1)H at high magnetic fields benefits from a low viscosity solvent. In this paper we investigate the option to use supercritical CO2 as a solvent for Overhauser DNP. We have investigated the diffusion constants and longitudinal nuclear relaxation rates of toluene in high pressure CO2. The change in (1)H T1 by addition of TEMPO radical was analyzed to determine the Overhauser cross-relaxation in such a mixture, and is compared with calculations based on the Force Free Hard Sphere (FFHS) model. By analyzing the relaxation data within this model we find translational correlation times in the range of 2-4ps, depending on temperature, pressure and toluene concentration. Such short correlation times may be instrumental for future Overhauser DNP applications at high magnetic fields, as are commonly used in NMR. Preliminary DNP experiments have been performed at 3.4T on high pressure superheated water and model systems such as toluene in high pressure CO2. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Russian roulette with unlicensed fat-burner drug 2,4-dinitrophenol (DNP): evidence from a multidisciplinary study of the internet, bodybuilding supplements and DNP users. (United States)

    Petróczi, Andrea; Ocampo, Jorge A Vela; Shah, Iltaf; Jenkinson, Carl; New, Rachael; James, Ricky A; Taylor, Glenn; Naughton, Declan P


    2,4-Dinitrophenol (DNP) poses serious health-risks to humans. The aims of this three-stage multidisciplinary project were, for the first time, to assess the risks to the general public from fraudulent sale of or adulteration/contamination with DNP; and to investigate motives, reasons and risk-management among DNP-user bodybuilders and avid exercisers. Using multiple search-engines and guidance for Internet research, online retailers and bodybuilding forums/blogs were systematically explored for availability of DNP, advice offered on DNP use and user profiles. Ninety-eight pre-workout and weight-loss supplements were purchased and analysed for DNP using liquid-chromatography-mass-spectrometry. Psychosocial variables were captured in an international sample of 35 DNP users (26.06 ± 6.10 years, 94.3 % male) with an anonymous, semi-qualitative self-reported survey. Although an industrial chemical, evidence from the Internet showed that DNP is sold 'as is', in capsules or tablets to suit human consumption, and is used 'uncut'. Analytical results confirmed that DNP is not on the supplement market disguised under fictitious supplement names, but infrequently was present as contaminant in some supplements (14/98) at low concentration (<100mcg/kg). Users make conscious and 'informed' decisions about DNP; are well-prepared for the side-effects and show nonchalant attitude toward self-experimentation with DNP. Steps are often taken to ensure that DNP is genuine. Personal experience with performance- and appearance enhancing substances appears to be a gateway to DNP. Advice on DNP and experiences are shared online. The significant discrepancy between the normative perception and the actual visibility suggests that DNP use is-contrary to the Internet accounts-a highly concealed and lonesome activity in real life. Positive experiences with the expected weight-loss prevail over the negative experiences from side effects (all but two users considered using DNP again) and help

  9. Screening of a Novel Fragment Library with Functional Complexity against Mycobacterium tuberculosis InhA. (United States)

    Prati, Federica; Zuccotto, Fabio; Fletcher, Daniel; Convery, Maire A; Fernandez-Menendez, Raquel; Bates, Robert; Encinas, Lourdes; Zeng, Jingkun; Chung, Chun-Wa; De Dios Anton, Paco; Mendoza-Losana, Alfonso; Mackenzie, Claire; Green, Simon R; Huggett, Margaret; Barros, David; Wyatt, Paul G; Ray, Peter C


    Our findings reported herein provide support for the benefits of including functional group complexity (FGC) within fragments when screening against protein targets such as Mycobacterium tuberculosis InhA. We show that InhA fragment actives with FGC maintained their binding pose during elaboration. Furthermore, weak fragment hits with functional group handles also allowed for facile fragment elaboration to afford novel and potent InhA inhibitors with good ligand efficiency metrics for optimization. © 2018 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  10. Herramientas DNP3 pentesting para redes de infraestructura critica

    Directory of Open Access Journals (Sweden)

    M. Sánchez


    Full Text Available Este artículo presenta un conjunto de herramientas de software que son capaces de realizar actividades Pentesting en la infraestructura crítica del sector eléctrico mediante el protocolo DNP3. Las herramientas son capaces de comprobar la capacidad de los controles de seguridad cibernética en el interior del perímetro de la red para evitar cualquier comando sensible falsificado pueda llegar a cualquier controlador de subestación

  11. Transmission Line for 258 GHz Gyrotron DNP Spectrometry (United States)

    Bogdashov, Alexandr A.; Belousov, Vladimir I.; Chirkov, Alexey V.; Denisov, Gregory G.; Korchagin, Vyacheslav V.; Kornishin, Sergey Yu.; Tai, Evgeny M.


    We describe the design and test results of the transmission line for liquid-state (LS) and solid-state (SS) DNP spectrometers with the second-harmonic 258.6 GHz gyrotron at the Institute of the Biophysical Chemistry Center of Goethe University (Frankfurt). The 13-meter line includes a mode converter, HE11 waveguides, 4 mitre bends, a variable polarizer-attenuator, directional couplers, a water-flow calorimeter and a mechanical switch. A microwave power of about 15 W was obtained in the pure HE11 mode at the spectrometer inputs.

  12. Building skills in organizational and systems changes: a DNP-FNP clinical curriculum. (United States)

    Hoyle, Christine; Johnson, Gail


    DNP-prepared nurse practitioner leaders play a pivotal role in organizational change and quality improvement consistent with the IHI Triple Aim: improving quality of care, health of populations, and reducing cost. A DNP-FNP curriculum is described, designed to build students' leadership competencies for systems change in healthcare settings.

  13. Phosphorylation of InhA inhibits mycolic acid biosynthesis and growth of Mycobacterium tuberculosis

    Energy Technology Data Exchange (ETDEWEB)

    Molle, Virginie; Gulten, Gulcin; Vilchèze, Catherine; Veyron-Churlet, Romain; Zanella-Cléon, Isabelle; Sacchettini, James C.; Jacobs, Jr, William R.; Kremer, Laurent (CNRS-UMR); (Einstein); (TAM)


    The remarkable survival ability of Mycobacterium tuberculosis in infected hosts is related to the presence of cell wall-associated mycolic acids. Despite their importance, the mechanisms that modulate expression of these lipids in response to environmental changes are unknown. Here we demonstrate that the enoyl-ACP reductase activity of InhA, an essential enzyme of the mycolic acid biosynthetic pathway and the primary target of the anti-tubercular drug isoniazid, is controlled via phosphorylation. Thr-266 is the unique kinase phosphoacceptor, both in vitro and in vivo. The physiological relevance of Thr-266 phosphorylation was demonstrated using inhA phosphoablative (T266A) or phosphomimetic (T266D/E) mutants. Enoyl reductase activity was severely impaired in the mimetic mutants in vitro, as a consequence of a reduced binding affinity to NADH. Importantly, introduction of inhA{_}T266D/E failed to complement growth and mycolic acid defects of an inhA-thermosensitive Mycobacterium smegmatis strain, in a similar manner to what is observed following isoniazid treatment. This study suggests that phosphorylation of InhA may represent an unusual mechanism that allows M. tuberculosis to regulate its mycolic acid content, thus offering a new approach to future anti-tuberculosis drug development.

  14. Phosphorylation of InhA inhibits mycolic acid biosynthesis and growth of Mycobacterium tuberculosis. (United States)

    Molle, Virginie; Gulten, Gulcin; Vilchèze, Catherine; Veyron-Churlet, Romain; Zanella-Cléon, Isabelle; Sacchettini, James C; Jacobs, William R; Kremer, Laurent


    The remarkable survival ability of Mycobacterium tuberculosis in infected hosts is related to the presence of cell wall-associated mycolic acids. Despite their importance, the mechanisms that modulate expression of these lipids in response to environmental changes are unknown. Here we demonstrate that the enoyl-ACP reductase activity of InhA, an essential enzyme of the mycolic acid biosynthetic pathway and the primary target of the anti-tubercular drug isoniazid, is controlled via phosphorylation. Thr-266 is the unique kinase phosphoacceptor, both in vitro and in vivo. The physiological relevance of Thr-266 phosphorylation was demonstrated using inhA phosphoablative (T266A) or phosphomimetic (T266D/E) mutants. Enoyl reductase activity was severely impaired in the mimetic mutants in vitro, as a consequence of a reduced binding affinity to NADH. Importantly, introduction of inhA_T266D/E failed to complement growth and mycolic acid defects of an inhA-thermosensitive Mycobacterium smegmatis strain, in a similar manner to what is observed following isoniazid treatment. This study suggests that phosphorylation of InhA may represent an unusual mechanism that allows M. tuberculosis to regulate its mycolic acid content, thus offering a new approach to future anti-tuberculosis drug development. © 2010 Blackwell Publishing Ltd.

  15. Cutaneous drug toxicity from 2,4-dinitrophenol (DNP): Case report and histological description. (United States)

    Le, Patricia; Wood, Benjamin; Kumarasinghe, Sujith Prasad


    The use of 2,4-dinitrophenol (DNP) has regained popularity as a weight loss aid in the last two decades due to increased marketing to bodybuilders and the increasing availability of this banned substance via the Internet. 2,4-DNP is a drug of narrow therapeutic index and toxicity results in hyperthermia, diaphoresis, tachycardia, tachypnoea and possible cardiac arrest and death. Skin toxicity from 2,4-DNP has not been reported since the 1930s. We report a case of a 21-year-old bodybuilding enthusiast who presented with a toxic exanthem after taking 2,4-DNP, and describe the first skin biopsy findings in a case of 2,4-DNP toxicity. © 2014 The Australasian College of Dermatologists.

  16. Antitubercular drugs for an old target: GSK693 as a promising InhA direct inhibitor

    Directory of Open Access Journals (Sweden)

    María Martínez-Hoyos


    Full Text Available Despite being one of the first antitubercular agents identified, isoniazid (INH is still the most prescribed drug for prophylaxis and tuberculosis (TB treatment and, together with rifampicin, the pillars of current chemotherapy. A high percentage of isoniazid resistance is linked to mutations in the pro-drug activating enzyme KatG, so the discovery of direct inhibitors (DI of the enoyl-ACP reductase (InhA has been pursued by many groups leading to the identification of different enzyme inhibitors, active against Mycobacterium tuberculosis (Mtb, but with poor physicochemical properties to be considered as preclinical candidates. Here, we present a series of InhA DI active against multidrug (MDR and extensively (XDR drug-resistant clinical isolates as well as in TB murine models when orally dosed that can be a promising foundation for a future treatment.

  17. From Metacognition to Practice Cognition: The DNP e-Portfolio to Promote Integrated Learning. (United States)

    Anderson, Kelley M; DesLauriers, Patricia; Horvath, Catherine H; Slota, Margaret; Farley, Jean Nelson


    Educating Doctor of Nursing Practice (DNP) students for an increasingly complex health care environment requires novel applications of learning concepts and technology. A deliberate and thoughtful process is required to integrate concepts of the DNP program into practice paradigm changes to subsequently improve students' abilities to innovate solutions to complex practice problems. The authors constructed or participated in electronic portfolio development inspired by theories of metacognition and integrated learning. The objective was to develop DNP student's reflection, integration of concepts, and technological capabilities to foster the deliberative competencies related to the DNP Essentials and the foundations of the DNP program. The pedagogical process demonstrates how e-portfolios adapted into the doctoral-level curriculum for DNP students can address the Essentials and foster the development of metacognitive capabilities, which translates into practice changes. The authors suggest that this pedagogical approach has the potential to optimize reflective and deliberative competencies among DNP students. [J Nurs Educ. 2017;56(8):497-500.]. Copyright 2017, SLACK Incorporated.

  18. Communication Test for ‘MatrikonOPC Server for SCADA DNP 3’ with RTDS

    DEFF Research Database (Denmark)

    Wu, Qiuwei; Cha, Seung-Tae; Saleem, Arshad


    The purpose of the communication test for ‘MatrikonOPC server for SCADA DNP 3’ with RTDS is to verify the data exchange between the ‘MatrikonOPC server for SCADA DNP 3’ and the RTDS using the DNP 3 protocol.The communication test is part of the work for the ‘Wind in Øresund’ project. The objective...... of the ‘Wind in Øresund’ project is to build a demonstration and education system of power system operation and control with a RTDS and a SCADA system....

  19. Radioimmunoassay of class-specific antibodies (RIACA): chicken antibodies to DNP

    International Nuclear Information System (INIS)

    Viljanen, M.K.; Granfors, K.; Toivanen, P.


    A radioimmunological method for the quantitation of class-specific antibodies has been developed. The method allows the quantitation of nanogram per ml concentrations of IgG and IgM-anti-DNP antibodies without any physical or chemical pretreatment of the sample. DNP was coupled covalently to a cyanogen bromide activated paper disk with the augmentation of lysine molecule. Anti-DNP antibodies were allowed to react with the coupled DNP and then quantitated by their capacity to bind 125 I-labelled anti-chicken-μ or anti-chicken-γ. The inter-assay variation coefficients ranged from 8.1 to 14.7% and the mean standard deviations of duplicate determinations were about 11%. The combination of this method with the exact immunoradiometric quantitation of the total serum IgM and IgG, and with an immunoabsorption technique, makes it possible to quantitate class-specific antibodies on weight units

  20. Investigating the CYP2E1 Potential Role in the Mechanisms Behind INH/LPS-Induced Hepatotoxicity

    Directory of Open Access Journals (Sweden)

    Hozeifa M. Hassan


    Full Text Available Tuberculosis (TB is one of the oldest infectious diseases that affected humankind and remains one of the world’s deadliest communicable diseases that could be considered as global emergency, but the discovery and development of isoniazid (INH in the 1950s paved the way to an effective single and/or combined first-line anti-TB therapy. However, administration of INH induces severe hepatic toxicity in some patients. Previously, we establish a rat model of INH hepatotoxicity utilizing the inflammatory stress theory, in which bacterial lipopolysaccharide (LPS potentially enhanced INH toxicity. These enhancing activities ranged between augmenting the inflammatory stress, oxidative stress, alteration of bile acid homeostasis, and CYP2E1 over-expression. Although pre-treatment with dexamethasone (DEX helped overcome both inflammatory and oxidative stress which ended-up in alleviation of LPS augmenting effects, but still minor toxicities were being detected, alongside with CYP2E1 over expression. This finding positively indicated the corner-stone role played by CYP2E1 in the pathogenesis of INH/LPS-induced liver damage. Therefore, we examined whether INH/LPS co-treatment with CYP2E1 inhibitor diallyl sulfide (DAS and DEX can protect against the INH/LPS-induced hepatotoxicity. Our results showed that pre-administration of both DAS and DEX caused significant reduction in serum TBA, TBil, and gamma-glutamyl transferase levels. Furthermore, the histopathological analysis showed that DAS and DEX could effectively reverse the liver lesions seen following INH/LPS treatment and protect against hepatic steatosis as indicated by absence of lipid accumulation. Pre-treatment with DAS alone could not completely block the CYP2E1 protein expression following INH/LPS treatment, as appeared in the immunoblotting and immunohistochemistry results. This is probably due to the fact that the combined enhancement activities of both INH and LPS on CYP2E1 protein expression

  1. DNP-enhanced solid-state NMR spectroscopy of active pharmaceutical ingredients. (United States)

    Zhao, Li; Pinon, Arthur C; Emsley, Lyndon; Rossini, Aaron J


    Solid-state NMR spectroscopy has become a valuable tool for the characterization of both pure and formulated active pharmaceutical ingredients (APIs). However, NMR generally suffers from poor sensitivity that often restricts NMR experiments to nuclei with favorable properties, concentrated samples, and acquisition of one-dimensional (1D) NMR spectra. Here, we review how dynamic nuclear polarization (DNP) can be applied to routinely enhance the sensitivity of solid-state NMR experiments by one to two orders of magnitude for both pure and formulated APIs. Sample preparation protocols for relayed DNP experiments and experiments on directly doped APIs are detailed. Numerical spin diffusion models illustrate the dependence of relayed DNP enhancements on the relaxation properties and particle size of the solids and can be used for particle size determination when the other factors are known. We then describe the advanced solid-state NMR experiments that have been enabled by DNP and how they provide unique insight into the molecular and macroscopic structure of APIs. For example, with large sensitivity gains provided by DNP, natural isotopic abundance, 13 C- 13 C double-quantum single-quantum homonuclear correlation NMR spectra of pure APIs can be routinely acquired. DNP also enables solid-state NMR experiments with unreceptive quadrupolar nuclei such as 2 H, 14 N, and 35 Cl that are commonly found in APIs. Applications of DNP-enhanced solid-state NMR spectroscopy for the molecular level characterization of low API load formulations such as commercial tablets and amorphous solid dispersions are described. Future perspectives for DNP-enhanced solid-state NMR experiments on APIs are briefly discussed. Copyright © 2017 John Wiley & Sons, Ltd.

  2. Discovery of cofactor-specific, bactericidal Mycobacterium tuberculosis InhA inhibitors using DNA-encoded library technology. (United States)

    Soutter, Holly H; Centrella, Paolo; Clark, Matthew A; Cuozzo, John W; Dumelin, Christoph E; Guie, Marie-Aude; Habeshian, Sevan; Keefe, Anthony D; Kennedy, Kaitlyn M; Sigel, Eric A; Troast, Dawn M; Zhang, Ying; Ferguson, Andrew D; Davies, Gareth; Stead, Eleanor R; Breed, Jason; Madhavapeddi, Prashanti; Read, Jon A


    Millions of individuals are infected with and die from tuberculosis (TB) each year, and multidrug-resistant (MDR) strains of TB are increasingly prevalent. As such, there is an urgent need to identify novel drugs to treat TB infections. Current frontline therapies include the drug isoniazid, which inhibits the essential NADH-dependent enoyl-acyl-carrier protein (ACP) reductase, InhA. To inhibit InhA, isoniazid must be activated by the catalase-peroxidase KatG. Isoniazid resistance is linked primarily to mutations in the katG gene. Discovery of InhA inhibitors that do not require KatG activation is crucial to combat MDR TB. Multiple discovery efforts have been made against InhA in recent years. Until recently, despite achieving high potency against the enzyme, these efforts have been thwarted by lack of cellular activity. We describe here the use of DNA-encoded X-Chem (DEX) screening, combined with selection of appropriate physical properties, to identify multiple classes of InhA inhibitors with cell-based activity. The utilization of DEX screening allowed the interrogation of very large compound libraries (10 11 unique small molecules) against multiple forms of the InhA enzyme in a multiplexed format. Comparison of the enriched library members across various screening conditions allowed the identification of cofactor-specific inhibitors of InhA that do not require activation by KatG, many of which had bactericidal activity in cell-based assays.

  3. Efficient DNP NMR of Membrane Proteins: Sample Preparation Protocols, Sensitivity, and Radical Location (United States)

    Liao, Shu Y.; Lee, Myungwoon; Wang, Tuo; Sergeyev, Ivan V.; Hong, Mei


    Although dynamic nuclear polarization (DNP) has dramatically enhanced solid-state NMR spectral sensitivities of many synthetic materials and some biological macromolecules, recent studies of membrane-protein DNP using exogenously doped paramagnetic radicals as polarizing agents have reported varied and sometimes surprisingly limited enhancement factors. This motivated us to carry out a systematic evaluation of sample preparation protocols for optimizing the sensitivity of DNP NMR spectra of membrane-bound peptides and proteins at cryogenic temperatures of ~110 K. We show that mixing the radical with the membrane by direct titration instead of centrifugation gives a significant boost to DNP enhancement. We quantify the relative sensitivity enhancement between AMUPol and TOTAPOL, two commonly used radicals, and between deuterated and protonated lipid membranes. AMUPol shows ~4 fold higher sensitivity enhancement than TOTAPOL, while deuterated lipid membrane does not give net higher sensitivity for the membrane peptides than protonated membrane. Overall, a ~100 fold enhancement between the microwave-on and microwave-off spectra can be achieved on lipid-rich membranes containing conformationally disordered peptides, and absolute sensitivity gains of 105–160 can be obtained between low-temperature DNP spectra and high-temperature non-DNP spectra. We also measured the paramagnetic relaxation enhancement of lipid signals by TOTAPOL and AMUPol, to determine the depths of these two radicals in the lipid bilayer. Our data indicate a bimodal distribution of both radicals, a surface-bound fraction and a membrane-bound fraction where the nitroxides lie at ~10 Å from the membrane surface. TOTAPOL appears to have a higher membrane-embedded fraction than AMUPol. These results should be useful for membrane-protein solid-state NMR studies under DNP conditions and provide insights into how biradicals interact with phospholipid membranes. PMID:26873390

  4. Efficient DNP NMR of membrane proteins: sample preparation protocols, sensitivity, and radical location

    Energy Technology Data Exchange (ETDEWEB)

    Liao, Shu Y.; Lee, Myungwoon; Wang, Tuo [Massachusetts Institute of Technology, Department of Chemistry (United States); Sergeyev, Ivan V. [Bruker Biospin (United States); Hong, Mei, E-mail: [Massachusetts Institute of Technology, Department of Chemistry (United States)


    Although dynamic nuclear polarization (DNP) has dramatically enhanced solid-state NMR spectral sensitivities of many synthetic materials and some biological macromolecules, recent studies of membrane-protein DNP using exogenously doped paramagnetic radicals as polarizing agents have reported varied and sometimes surprisingly limited enhancement factors. This motivated us to carry out a systematic evaluation of sample preparation protocols for optimizing the sensitivity of DNP NMR spectra of membrane-bound peptides and proteins at cryogenic temperatures of ~110 K. We show that mixing the radical with the membrane by direct titration instead of centrifugation gives a significant boost to DNP enhancement. We quantify the relative sensitivity enhancement between AMUPol and TOTAPOL, two commonly used radicals, and between deuterated and protonated lipid membranes. AMUPol shows ~fourfold higher sensitivity enhancement than TOTAPOL, while deuterated lipid membrane does not give net higher sensitivity for the membrane peptides than protonated membrane. Overall, a ~100 fold enhancement between the microwave-on and microwave-off spectra can be achieved on lipid-rich membranes containing conformationally disordered peptides, and absolute sensitivity gains of 105–160 can be obtained between low-temperature DNP spectra and high-temperature non-DNP spectra. We also measured the paramagnetic relaxation enhancement of lipid signals by TOTAPOL and AMUPol, to determine the depths of these two radicals in the lipid bilayer. Our data indicate a bimodal distribution of both radicals, a surface-bound fraction and a membrane-bound fraction where the nitroxides lie at ~10 Å from the membrane surface. TOTAPOL appears to have a higher membrane-embedded fraction than AMUPol. These results should be useful for membrane-protein solid-state NMR studies under DNP conditions and provide insights into how biradicals interact with phospholipid membranes.

  5. High resolution observed in 800 MHz DNP spectra of extremely rigid type III secretion needles

    International Nuclear Information System (INIS)

    Fricke, Pascal; Mance, Deni; Chevelkov, Veniamin; Giller, Karin; Becker, Stefan; Baldus, Marc; Lange, Adam


    The cryogenic temperatures at which dynamic nuclear polarization (DNP) solid-state NMR experiments need to be carried out cause line-broadening, an effect that is especially detrimental for crowded protein spectra. By increasing the magnetic field strength from 600 to 800 MHz, the resolution of DNP spectra of type III secretion needles (T3SS) could be improved by 22 %, indicating that inhomogeneous broadening is not the dominant effect that limits the resolution of T3SS needles under DNP conditions. The outstanding spectral resolution of this system under DNP conditions can be attributed to its low overall flexibility.

  6. High resolution observed in 800 MHz DNP spectra of extremely rigid type III secretion needles

    Energy Technology Data Exchange (ETDEWEB)

    Fricke, Pascal [Leibniz-Institut für Molekulare Pharmakologie, Department of Molecular Biophysics (Germany); Mance, Deni [Utrecht University, NMR Research Group, Bijvoet Center for Biomolecular Research (Netherlands); Chevelkov, Veniamin [Leibniz-Institut für Molekulare Pharmakologie, Department of Molecular Biophysics (Germany); Giller, Karin; Becker, Stefan [Max Planck Institute for Biophysical Chemistry, Department of NMR-Based Structural Biology (Germany); Baldus, Marc [Utrecht University, NMR Research Group, Bijvoet Center for Biomolecular Research (Netherlands); Lange, Adam, E-mail: [Leibniz-Institut für Molekulare Pharmakologie, Department of Molecular Biophysics (Germany)


    The cryogenic temperatures at which dynamic nuclear polarization (DNP) solid-state NMR experiments need to be carried out cause line-broadening, an effect that is especially detrimental for crowded protein spectra. By increasing the magnetic field strength from 600 to 800 MHz, the resolution of DNP spectra of type III secretion needles (T3SS) could be improved by 22 %, indicating that inhomogeneous broadening is not the dominant effect that limits the resolution of T3SS needles under DNP conditions. The outstanding spectral resolution of this system under DNP conditions can be attributed to its low overall flexibility.

  7. Strategic innovation between PhD and DNP programs: Collaboration, collegiality, and shared resources. (United States)

    Edwards, Joellen; Rayman, Kathleen; Diffenderfer, Sandra; Stidham, April


    At least 111 schools and colleges of nursing across the nation provide both PhD and DNP programs (AACN, 2014a). Collaboration between nurses with doctoral preparation as researchers (PhD) and practitioners (DNP) has been recommended as essential to further the profession; that collaboration can begin during the educational process. The purpose of this paper is to describe the development and implementation of successful DNP and PhD program collaboration, and to share the results of that collaboration in an educational setting. Faculty set strategic goals to maximize the effectiveness and efficiency of both new DNP and existing PhD programs. The goals were to promote collaboration and complementarity between the programs through careful capstone and dissertation differentiation, complementary residency activities, joint courses and inter-professional experiences; promote collegiality in a blended on-line learning environment through shared orientation and intensive on-campus sessions; and maximize resources in program delivery through a supportive organizational structure, equal access to technology support, and shared faculty responsibilities as appropriate to terminal degrees. Successes such as student and faculty accomplishments, and challenges such as managing class size and workload, are described. Collaboration, collegiality and the sharing of resources have strengthened and enriched both programs and contributed to the success of students, faculty. These innovative program strategies can provide a solid foundation for DNP and PhD collaboration. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. 75 FR 64694 - Approval for Expanded Manufacturing Authority; Foreign-Trade Subzone 33E; DNP IMS America... (United States)


    ... Manufacturing Authority; Foreign-Trade Subzone 33E; DNP IMS America Corporation (Thermal Transfer Ribbon Printer..., grantee of FTZ 33, has requested an expansion of the scope of manufacturing authority on behalf of DNP IMS...-6636, 2/10/2010) and the application has been processed pursuant to the FTZ Act and the Board's...

  9. Synthesis and crystal structure of acid indium phosphite In(H3PO3)3

    International Nuclear Information System (INIS)

    Zakharova, B.S.; Chudinova, N.N.; Ilyhkhin, A.B.


    A group of isostructural acid phosphites of trivalent metals M(H 2 PO 3 ) 3 , where M 3 =V, Fe, Ga, In, was synthesized. Crystal structure of In(H 2 PO 3 ) 3 was determined. The compound crystallizes in hexagonal syngony, a = 8.414(2), c = 7.069(2) A, V = 433.3(2) A 3 , Z = 2, P6 3 . In (H 2 PO 3 ) 3 structure is of frame type. 9 refs.; 3 tabs

  10. Evaluating resilience of DNP3-controlled SCADA systems against event buffer flooding

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Guanhua [Los Alamos National Laboratory; Nicol, David M [UNIV OF IL; Jin, Dong [UNIV OF IL


    The DNP3 protocol is widely used in SCADA systems (particularly electrical power) as a means of communicating observed sensor state information back to a control center. Typical architectures using DNP3 have a two level hierarchy, where a specialized data aggregator device receives observed state from devices within a local region, and the control center collects the aggregated state from the data aggregator. The DNP3 communication between control center and data aggregator is asynchronous with the DNP3 communication between data aggregator and relays; this leads to the possibility of completely filling a data aggregator's buffer of pending events, when a relay is compromised or spoofed and sends overly many (false) events to the data aggregator. This paper investigates how a real-world SCADA device responds to event buffer flooding. A Discrete-Time Markov Chain (DTMC) model is developed for understanding this. The DTMC model is validated by a Moebius simulation model and data collected on real SCADA testbed.

  11. Characterization and optimization of the visualization performance of continuous flow overhauser DNP hyperpolarized water MRI: Inversion recovery approach. (United States)

    Terekhov, Maxim; Krummenacker, Jan; Denysenkov, Vasyl; Gerz, Kathrin; Prisner, Thomas; Schreiber, Laura Maria


    Overhauser dynamic nuclear polarization (DNP) allows the production of liquid hyperpolarized substrate inside the MRI magnet bore as well as its administration in continuous flow mode to acquire MR images with enhanced signal-to-noise ratio. We implemented inversion recovery preparation in order to improve contrast-to-noise ratio and to quantify the overall imaging performance of Overhauser DNP-enhanced MRI. The negative enhancement created by DNP in combination with inversion recovery (IR) preparation allows canceling selectively the signal originated from Boltzmann magnetization and visualizing only hyperpolarized fluid. The theoretical model describing gain of MR image intensity produced by steady-state continuous flow DNP hyperpolarized magnetization was established and proved experimentally. A precise quantification of signal originated purely from DNP hyperpolarization was achieved. A temperature effect on longitudinal relaxation had to be taken into account to fit experimental results with numerical prediction. Using properly adjusted IR preparation, the complete zeroing of thermal background magnetization was achieved, providing an essential increase of contrast-to-noise ratio of DNP-hyperpolarized water images. To quantify and optimize the steady-state conditions for MRI with continuous flow DNP, an approach similar to that incorporating transient-state thermal magnetization equilibrium in spoiled fast field echo imaging sequences can be used. © 2015 Wiley Periodicals, Inc.

  12. Multiple receptor conformers based molecular docking study of fluorine enhanced ethionamide with mycobacterium enoyl ACP reductase (InhA). (United States)

    Khan, Akib Mahmud; Shawon, Jakaria; Halim, Mohammad A


    A major limitation in current molecular docking method is that of failure to account for receptor flexibility. Herein we report multiple receptor conformers based molecular docking as a practical alternative to account for the receptor flexibility. Multiple (forty) conformers of Mycobacterium Enoyl ACP Reductase (InhA) are generated from Molecular Dynamics simulation and twenty crystallographic structures of InhA bound to different inhibitors are obtained from the Protein Data Bank. Fluorine directed modifications are performed to currently available anti-tuberculosis drug ethionamide. The modified drugs are optimized using B3LYP 6-31G (d,p) level of theory. Dipole moment, frontier orbital gap and thermodynamical properties such as electronic energy, enthalpy and Gibbs free energy of these optimized drugs are investigated. These drugs are subsequently docked against the conformers of InhA. Molecular docking against multiple InhA conformations show variation in ligand binding affinity and suggest that Ser94, Gly96, Lys165 and Ile194 amino acids play critical role on strong drug-InhA interaction. Modified drug N1 showed greater binding affinity compared to EN in most conformations. Structure of PDB ID: 2NSD and snapshot conformer at 5.5ns show most favorable binding with N1 compared to other conformers. Fluorine participates in forming fluorine bonds and contributes significantly in increasing binding affinity. Our study reveal that addition of trifluoromethyl group explicitly shows promise in improving thermodynamic properties and in enhancing hydrogen bonding and non-bonded interactions. Molecular dynamics (MD) simulation show that EN and N1 remained in the binding pocket similar to the docked pose of EN-InhA and E1-InhA complexes and also suggested that InhA binds to its inhibitor in inhibitor-induced folding manner. ADMET calculations predict modified drugs to have improved pharmacokinetic properties. Our study concludes that multiple receptor conformers based

  13. Lessons from the Institute for New Heads (INH) Class of 2006: Ten Headships--134 Years of Hard-Earned Experience (United States)

    Raphel, Annette; Huber, John; Chandler, Carolyn; Vorenberg, Amy; Jones-Wilkins, Andy; Devey, Mark A.; Holford, Josie; Craig, Ian; Elam, Julie


    Ten years ago in July 2006, 64 mostly starry-eyed men and women attended the NAIS Institute for New Heads (INH) in order to learn the ropes of headship. These newly minted heads were filled with enthusiasm, commitment, and passion, along with humility and a bit of healthy trepidation. One core group connected under the careful guidance of…

  14. Enhancement of cadmium bioremediation by endophytic bacterium Bacillus sp. L14 using industrially used metabolic inhibitors (DCC or DNP)

    International Nuclear Information System (INIS)

    Luo Shenglian; Xiao Xiao; Xi Qiang; Wan Yong; Chen Liang; Zeng Guangming; Liu Chengbin; Guo Hanjun; Chen Jueliang


    Bioremediations of cadmium by endophytic bacterium (EB) L14 (Bacillus sp.) in the presence of industrially used metabolic inhibitors (DCC or DNP) were investigated. In the presence of DCC or DNP, the biomass population of EB L14 was greatly inhibited. However, the cadmium removal of EB L14 increased from 73.6% (in the absence of DCC or DNP) to 93.7% and 80.8%, respectively. The analysis of total and intracellular cadmium concentrations during 24 h of incubation indicated that this enhanced cadmium removal was the inhibition effect of DCC or DNP on the cations export resistance system of EB L14. This unique property strongly indicated the superiority of this endophyte for practical application in cadmium bioremediation in the presence of industrially used metabolic inhibitors.

  15. Effects of DNP on the cell surface properties of marine bacteria and its implication for adhesion to surfaces

    Digital Repository Service at National Institute of Oceanography (India)

    Jain, A.; Nishad, K.K.; Bhosle, N.B.

    The effect of 2, 4-dinitrophenol (DNP) on extracelluar polysaccharides (EPS), cell surface charge, and hydrophobicity of six marine bacterial cultures was studied, and its influence on attachment of these bacteria to glass and polystyrene...

  16. Preparation and LSC standardization of ''89 Sr (DNP) using the CIEMAT/NIST method

    International Nuclear Information System (INIS)

    Rodriguez Barquero, L.; Arcos Merino, J.M. Los; Grau Malonda, A.


    A procedure for preparation of liquid scintillation counting samples of the strontium DNP complex, labelled with ''89 Sr, is described. The chemical quench, the counting stability and spectral evolution of this compound is studied in six scintillators, Toluene, Toluene-alcohol, Dioxane-naphthalene, HiSafe II, Ultima-Gold and Instagel. The liquid scintillation standardization of ''89Sr-DNP by the CIEMAT/NIST method, using Hisafe II and Ultima-Gold scintillators, has been carried out. The discrepancies between experimental and computed efficiencies are lower than 0.38% and 0.48%, respectively. The solution has been standardized in terms of activity concentration to an overall uncertainty of 0.38%. (Author)

  17. EPR and DNP Properties of Certain Novel Single Electron Contrast Agents Intended for Oximetric Imaging

    DEFF Research Database (Denmark)

    Ardenkjær-Larsen, J. H.; Laursen, I; Leunbach, I.


    Parameters of relevance to oximetry with Overhauser magnetic resonance imaging (OMRI) have been measured for three single electron contrast agents of the triphenylmethyl type. The single electron contrast agents are stable and water soluble. Magnetic resonance properties of the agents have been...... examined with electron paramagnetic resonance (EPR), nuclear magnetic resonance (NMR), and dynamic nuclear polarization (DNP) at 9.5 mT in water, isotonic saline, plasma, and blood at 23 and 37°C. The relaxivities of the agents are about 0.2–0.4 mM−1s−1and the DNP enhancements extrapolate close...... to the dipolar limit. The agents have a single, narrow EPR line, which is analyzed as a Voigt function. The linewidth is measured as a function of the agent concentration and the oxygen concentration. The concentration broadenings are about 1–3 μT/mM and the Lorentzian linewidths at infinite dilution are less...

  18. Preparation and LSC Standardization of ''89Sr (DNP) Using the CIEMAT/NIST Method

    International Nuclear Information System (INIS)

    Rodriguez Barquero, L.; Los Arcos Merino, J. M.; Grau Malonda, A.


    A procedure for preparation of liquid scintillation counting samples of the strontium DNP complex, labelled with ''89Sr, is described, the chemical quench, the counting stability and spectral evolution of this compound is studied in six scintillators, Toluene, Toluene-alcohol, Dioxane-naphthalene, HiSafe II, Ultima- Gold and Instagel. The liquid scintillation standardization of 89Sr-DNP by the CIEMAT/NIST method, using HiSafe II and Ultima-Gold scintillators, has been carried out. The discrepancies between experimental and computed efficiencies are lower than 0.38% and 0.48%, respectively. The solution has been standardized in terms of activity concentration to an overall uncertainty of 0,38%. (Author) 10 refs

  19. The NNP/DNP shortage: transforming neonatal nurse practitioners into DNPs. (United States)

    Pressler, Jana L; Kenner, Carole A


    Neonatal nurse practitioners (NNPs) represent a high-demand specialty practice that is especially targeted for US secondary and tertiary care neonatal intensive care units (NICUs). NNPs make primary decisions about the caregiving of high-risk newborns at the time of admission, throughout hospitalization, at transfer, and at discharge that require an advanced knowledge base in neonatology as well as NICU clinical experience. NNPs prepared at the master's level are currently in very short supply, with some estimates suggesting that for each NNP who graduates, there are 80 positions open across the country. Even with the present shortage, due to the high cost of NNP education, NNP programs are diminishing and those that are remaining are not graduating a sufficient number of new NNPs each year to keep up with the demand. To add to the basic shortage problem, in 2004 the American Association of Colleges of Nursing decided that by 2015, the terminal degree for all nurse practitioners should move from the master's degree to the doctor of nursing practice (DNP) degree. That decision added a minimum of 12 months of full-time education to the advanced education requirements for nurse practitioners. What impact will the decision to require a DNP degree have on NNP specialty practice? Will even more NNP programs close because of faculty shortages of NNPs prepared at the DNP level? If a worse shortage occurs in the number of NNPs prepared to practice in NICUs, will physician assistants or other nonphysician clinicians who meet the need for advanced neonatal care providers replace NNPs? What steps, if any, can nursing take to ensure that NNP specialty practice is still needed and survives after supplementing the DNP requirement to NNP education?

  20. Water accessibility in a membrane-inserting peptide comparing Overhauser DNP and pulse EPR methods

    Energy Technology Data Exchange (ETDEWEB)

    Segawa, Takuya F., E-mail:; Doppelbauer, Maximilian; Garbuio, Luca; Doll, Andrin; Polyhach, Yevhen O.; Jeschke, Gunnar, E-mail: [Laboratory of Physical Chemistry, ETH Zurich, Vladimir-Prelog-Weg 2, CH-8093 Zurich (Switzerland)


    Water accessibility is a key parameter for the understanding of the structure of biomolecules, especially membrane proteins. Several experimental techniques based on the combination of electron paramagnetic resonance (EPR) spectroscopy with site-directed spin labeling are currently available. Among those, we compare relaxation time measurements and electron spin echo envelope modulation (ESEEM) experiments using pulse EPR with Overhauser dynamic nuclear polarization (DNP) at X-band frequency and a magnetic field of 0.33 T. Overhauser DNP transfers the electron spin polarization to nuclear spins via cross-relaxation. The change in the intensity of the {sup 1}H NMR spectrum of H{sub 2}O at a Larmor frequency of 14 MHz under a continuous-wave microwave irradiation of the nitroxide spin label contains information on the water accessibility of the labeled site. As a model system for a membrane protein, we use the hydrophobic α-helical peptide WALP23 in unilamellar liposomes of DOPC. Water accessibility measurements with all techniques are conducted for eight peptides with different spin label positions and low radical concentrations (10–20 μM). Consistently in all experiments, the water accessibility appears to be very low, even for labels positioned near the end of the helix. The best profile is obtained by Overhauser DNP, which is the only technique that succeeds in discriminating neighboring positions in WALP23. Since the concentration of the spin-labeled peptides varied, we normalized the DNP parameter ϵ, being the relative change of the NMR intensity, by the electron spin concentration, which was determined from a continuous-wave EPR spectrum.

  1. An Academic-Practice Partnership to Advance DNP Education and Practice. (United States)

    Howard, Patricia B; Williams, Tracy E

    During the past decade, the growth of doctor of nursing practice (DNP) programs in the United States has been phenomenal, with most focusing on the preparation of advanced practice registered nurses. Simultaneously, academic-practice partnerships have been a frequent subject of discussion for nursing's leading academic, administrative, and practice organizations. Numerous reports about academic-practice partnerships concerning aspects of baccalaureate nursing education exist, but partnership accounts for DNP programs are essentially nonexistent. The purpose of this article is to describe the initial phase of an academic-practice partnership between a multisystem health care organization and a college of nursing in a public land-grant university in the southeastern United States. The 7-year partnership agreement between Norton Healthcare and the University of Kentucky College of Nursing was designed to prepare 5 cohorts of 20 to 30 baccalaureate-prepared staff nurses as DNP graduates for advanced practice registered nurse eligibility. The description of partnering institution characteristics frames an emphasis on elements of the partnership proposal, contractual agreement, and partner responsibilities along with the logic model evaluation plan. Lessons learned include the importance of proposals and contracts to sustain the partnership, frequent communication to build trust, and strategic analysis for rapid response to challenging situations. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Direct detection of Mycobacterium tuberculosis and drug resistance in respiratory specimen using Abbott Realtime MTB detection and RIF/INH resistance assay. (United States)

    Tam, Kingsley King-Gee; Leung, Kenneth Siu-Sing; To, Sabrina Wai-Chi; Siu, Gilman Kit-Hang; Lau, Terrence Chi-Kong; Shek, Victor Chi-Man; Tse, Cindy Wing-Sze; Wong, Samson Sai-Yin; Ho, Pak-Leung; Yam, Wing-Cheong


    Abbott RealTime MTB (Abbott-RT) in conjunction with Abbott RealTime MTB RIF/INH Resistance (Abbott-RIF/INH) is a new, high-throughput automated nucleic acid amplification platform (Abbott-MDR) for detection of Mycobacterium tuberculosis complex (MTBC) and the genotypic markers for rifampicin (RIF) and isoniazid (INH) resistance directly from respiratory specimens. This prospective study evaluated the diagnostic performance of this new platform for MTBC and multidrug-resistant tuberculosis (MDR-TB) using 610 sputum specimens in a tuberculosis high-burden setting. Using conventional culture results and clinical background as reference standards, Abbott-RT exhibited an overall sensitivity and specificity of 95.2% and 99.8%, respectively. Genotypic RIF/INH resistance of 178 "MTB detected" specimens was subsequently analyzed by Abbott-RIF/INH. Compared to phenotypic drug susceptibility test results, Abbott-RIF/INH detected resistance genotypic markers in 84.6% MDR-TB, 80% mono-RIF-resistant and 66.7% mono-INH-resistant specimens. Two of the RIF-resistant specimens carried a novel single, nonsense mutation at rpoB Q513 and in silico simulation demonstrated that the truncated RpoB protein failed to bind with other subunits for transcription. Overall, Abbott-MDR platform provided high throughput and reliable diagnosis of MDR-TB within a TB high-burden region. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Identification and Functional Characterization of Sugarcane Invertase Inhibitor (ShINH1: A Potential Candidate for Reducing Pre- and Post-harvest Loss of Sucrose in Sugarcane

    Directory of Open Access Journals (Sweden)

    Suresha G. Shivalingamurthy


    Full Text Available In sugarcane, invertase enzymes play a key role in sucrose accumulation and are also involved in futile reactions where sucrose is continuously degraded during the pre- and post-harvest period, thereby reducing sugar yield and recovery. Invertase inhibitor (INVINH proteins play a key role in post-translation regulation of plant invertases through which sucrose hydrolysis is controlled. INVINH proteins are small (18 kDa members of the pectin methylesterase inhibitor superfamily and they are moderately conserved across plants. In the present study, we identified two INVINH genes from sugarcane, ShINH1 and ShINH2. In silico characterization of the encoded proteins revealed 43% sequence identity at the amino acid level, confirming the non-allelic nature of the proteins. The presence of putative signal peptide and subcellular targeting sequences revealed that ShINH1 and ShINH2 likely have apoplasmic and vacuolar localization, respectively. Experimental visualization of ShINH1–GFP revealed that ShINHI is indeed exported to the apoplast. Differential tissue-specific and developmental expression of ShINH1 between leaf, stalk, flower and root suggest that it plays a role in controlling source-sink metabolic regulation during sucrose accumulation in sugarcane. ShINH1 is expressed at relatively high levels in leaves and stalk compared to flowers and roots, and expression decreases significantly toward internodal maturity during stalk development. ShINH1 is expressed at variable levels in flowers with no specific association to floral maturity. Production of recombinant ShINH1 enabled experimental validation of protein function under in vitro conditions. Recombinant ShINH1 potently inhibited acid invertase (IC50 22.5 nM, making it a candidate for controlling pre- and post-harvest deterioration of sucrose in sugarcane. Our results indicate that ShINH1 and ShINH2 are likely to play a regulatory role in sucrose accumulation and contribute to the improvement

  4. Modeling DNP3 Traffic Characteristics of Field Devices in SCADA Systems of the Smart Grid

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Huan [Lehigh Univ., Bethlehem, PA (United States); Cheng, Liang [Lehigh Univ., Bethlehem, PA (United States); Chuah, Mooi Choo [Lehigh Univ., Bethlehem, PA (United States)


    In the generation, transmission, and distribution sectors of the smart grid, intelligence of field devices is realized by programmable logic controllers (PLCs). Many smart-grid subsystems are essentially cyber-physical energy systems (CPES): For instance, the power system process (i.e., the physical part) within a substation is monitored and controlled by a SCADA network with hosts running miscellaneous applications (i.e., the cyber part). To study the interactions between the cyber and physical components of a CPES, several co-simulation platforms have been proposed. However, the network simulators/emulators of these platforms do not include a detailed traffic model that takes into account the impacts of the execution model of PLCs on traffic characteristics. As a result, network traces generated by co-simulation only reveal the impacts of the physical process on the contents of the traffic generated by SCADA hosts, whereas the distinction between PLCs and computing nodes (e.g., a hardened computer running a process visualization application) has been overlooked. To generate realistic network traces using co-simulation for the design and evaluation of applications relying on accurate traffic profiles, it is necessary to establish a traffic model for PLCs. In this work, we propose a parameterized model for PLCs that can be incorporated into existing co-simulation platforms. We focus on the DNP3 subsystem of slave PLCs, which automates the processing of packets from the DNP3 master. To validate our approach, we extract model parameters from both the configuration and network traces of real PLCs. Simulated network traces are generated and compared against those from PLCs. Our evaluation shows that our proposed model captures the essential traffic characteristics of DNP3 slave PLCs, which can be used to extend existing co-simulation platforms and gain further insights into the behaviors of CPES.

  5. Contribution of katG, ahpC and inhA mutations to the detection of isoniazid-resistant Mycobacterium tuberculosis isolates from Lebanon and Syria

    Directory of Open Access Journals (Sweden)

    F Dabboussi


    Conclusions: This study showed that the pyrosequencing applied to katG, inhA promoter and ahpC-oxyR intergenic region was able to detect a relatively large proportion of Syrian INH-resistant MTB isolates (80.7% in Syria. This strategy may be inappropriate for Lebanese strains, as the genetic mechanisms of resistance remain unidentified for approximately half of the isolates, so it is quite possible to detect the presence of other mechanisms of resistance.


    Directory of Open Access Journals (Sweden)

    Devita Kusdianingrum


    Full Text Available ABSTRAK: Sekitar 8-20% isolate M. tuberculosis yang resisten terhadap isoniazid diketahui telah mengalami mutasi pada posisi regio promoter inhA [1]. Untuk memperoleh titik mutasi pada regio promoter, maka amplifikasi fragmen target perlu untuk dilakukan. Tujuan dilakukannya penelitian ini adalah untuk mengamplifikasi regio promoter inhA, mengetahui ada tidaknya mutasi dan jenis mutasi pada isolat 134 MDR-TB. Tahap isolasi DNA dilakukan menggunakan metode Boom yang telah dimodifikasi. Fragmen target diamplifikasi dengan teknik PCR menggunakan sepasang primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ dan reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’. Amplikon disekuensing secara satu arah menggunakan forward primer. Analisis homologi dilakukan menggunakan program online BLASTn, sementara identifikasi mutasi dilakukan menggunakan software MEGA4. Hasil penelitian menunjukkan bahwa analisis homologi isolate 134 terhadap M. tuberculosis H37Rv adalah sebesar 99%. Tahap analisis mutasi menemukan terjadinya perubahan sitosin menjadi timin (CàT pada posisi -15 isolat 134 MDR-TB   ABSTRACT: Approximately 8-20% M. tuberculosis isolates that are resistant to isoniazid habe been known to have a mutation in inhA promoter region [1]. To find the mutation in inhA promoter region, it is necessary to carry out the amplification of the target fragment. The purpose of this research were to amplify the inhA promoter region and to find out if there is a mutation and type of mutation at MDR-TB isolate. DNA isolation was done by a modified Boom method. Target fragment was amplified by a pair primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ and reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’ using Polymerase Chain Reaction (PCR technique. Amplicon was sequenced in one forward direction. Homology analysis was conducted by online BLASTn program, while the mutation was identified by MEGA4. The result of this research showed that homology analysis of 134 was homolog

  7. Performance of the Abbott RealTime MTB RIF/INH resistance assay when used to test Mycobacterium tuberculosis specimens from Bangladesh

    Directory of Open Access Journals (Sweden)

    Kostera J


    Full Text Available Joshua Kostera, Gregor Leckie, Klara Abravaya, Hong Wang Abbott Molecular, Abbott Laboratories, Des Plaines, IL, USA Introduction: The Abbott RealTime MTB RIF/INH Resistance Assay (RT MTB RIF/INH is an assay for the detection of rifampicin (RIF- and/or isoniazid (INH-resistant Mycobacterium tuberculosis (MTB. The assay can be used to test sputum, bronchial alveolar lavage, and N-Acetyl-L-Cysteine (NALC/NaOH pellets prepared from these samples. The assay can be used in direct testing mode, or in reflex mode following a MTB positive result produced by its companion assay, Abbott RT MTB. Methods: In this study, the direct testing mode was used to test paired sputum and NALC/NaOH pellets prepared from sputum collected from Bangladesh TB patients. One hundred and thirty two paired samples were tested. Results: The RT MTB RIF/INH inhibition rate was 0%. One hundred and twenty-two paired samples had results above the assay limit of detection and were analyzed by comparing with results from phenotypic drug sensitivity testing, GeneXpert MTB/RIF (Xpert, and MTBDR plus (Hain. RT MTB RIF/INH results were in good agreement with those of GeneXpert and Hain. Conclusion: The ability of this assay to detect RIF and INH resistance may contribute to the global control of multidrug resistant tuberculosis. Keywords: tuberculosis, rifampicin, isoniazid, resistance

  8. 1H DNP at 1.4 T of Water Doped with a Triarylmethyl-Based Radical

    DEFF Research Database (Denmark)

    Wind, Robert A.; Ardenkjær-Larsen, Jan Henrik


    Recently a triarylmethyl-based (TAM) radical has been developed for research in biological and other aqueous systems, and in low magnetic fields, 10 mT or less, large 1H dynamic nuclear polarization (DNP) enhancements have been reported. In this paper the DNP properties of this radical have been...... perpendicular to the electric component of the microwave field. It was found that with this probe the temperature increase in the sample after 4 s of microwave irradiation with an incident power of 10 W was only 16°C. For the investigations, 10 mM of the TAM radical was dissolved in deionized, but not degassed...... than the largest high-resolution magnet available to date. It is concluded that DNP MRM in this field, which corresponds to a standard microwave frequency of 9 GHz, has the potential to significantly increase the sensitivity in NMR and MRI experiments of small aqueous samples doped with the TAM radical....

  9. The Effect of Intermolecular Halogen Bond on 19F DNP Enhancement in 1, 4-Diiodotetrafluorobenzene/4-OH-TEMPO Supramolecular Assembly

    Directory of Open Access Journals (Sweden)

    GAO Shan


    Full Text Available Halogen bond, as hydrogen bond, is a non-covalent bond. Dynamic nuclear polarization (DNP technique has been used previously to study hydrogen bonds-mediated intermolecular interactions. However, no study has been carried out so far to study the halogen bond-mediated intermolecular interactions with DNP. In this work, 19F DNP polarization efficiency of the halogen bonds existing in supramolecular assembling by 4-OH-TEMPO and 1,4-diiodotetrafluorobenzene (DITFB was studied on a home-made DNP system. The formation of intermolecular halogen bonds appeared to increase 19F DNP polarization efficiency, suggesting that the spin-spin interactions among electrons were weakened by the halogen bonds, resulting in an increased T2e and a larger saturation factor.

  10. A Parametric Study on the Immunomodulatory Effects of Electroacupuncture in DNP-KLH Immunized Mice

    Directory of Open Access Journals (Sweden)

    Sun Kwang Kim


    Full Text Available This study was conducted to compare the effects of low frequency electroacupuncture (EA and high frequency EA at acupoint ST36 on the production of IgE and Th1/Th2 cytokines in BALB/c mice that had been immunized with 2,4-dinitrophenylated keyhole limpet protein (DNP-KLH, as well as to investigate the difference in the immunomodulatory effects exerted by EA stimulations at acupoint ST36 and at a non-acupoint (tail. Female BALB/c mice were divided into seven groups: normal (no treatments, IM (immunization only, ST36-PA (IM + plain acupuncture at ST36, ST36-LEA (IM + low frequency (1 Hz EA at ST36, ST36-HEA (IM + high frequency (120 Hz EA at ST36, NA-LEA (IM + low frequency (1 Hz EA at non-acupoint and NA-HEA (IM + high frequency (120 Hz EA at non-acupoint. EA stimulation was performed daily for two weeks, and total IgE, DNP-KLH specific IgE, IL-4 and IFN-γ levels were measured at the end of the experiment. The results of this study showed that the IgE and IL-4 levels were significantly suppressed in the ST36-LEA and ST36-HEA groups, but not in the NA-LEA and NA-HEA groups. However, there was little difference in the immunomodulatory effects observed in the ST36-LEA and ST36-HEA groups. Taken together, these results suggest that EA stimulation-induced immunomodulation is not frequency dependent, but that it is acupoint specific.

  11. Disruption of key NADH-binding pocket residues of the Mycobacterium tuberculosis InhA affects DD-CoA binding ability. (United States)

    Shaw, Daniel J; Robb, Kirsty; Vetter, Beatrice V; Tong, Madeline; Molle, Virginie; Hunt, Neil T; Hoskisson, Paul A


    Tuberculosis (TB) is a global health problem that affects over 10 million people. There is an urgent need to develop novel antimicrobial therapies to combat TB. To achieve this, a thorough understanding of key validated drug targets is required. The enoyl reductase InhA, responsible for synthesis of essential mycolic acids in the mycobacterial cell wall, is the target for the frontline anti-TB drug isoniazid. To better understand the activity of this protein a series of mutants, targeted to the NADH co-factor binding pocket were created. Residues P193 and W222 comprise a series of hydrophobic residues surrounding the cofactor binding site and mutation of both residues negatively affect InhA function. Construction of an M155A mutant of InhA results in increased affinity for NADH and DD-CoA turnover but with a reduction in V max for DD-CoA, impairing overall activity. This suggests that NADH-binding geometry of InhA likely permits long-range interactions between residues in the NADH-binding pocket to facilitate substrate turnover in the DD-CoA binding region of the protein. Understanding the precise details of substrate binding and turnover in InhA and how this may affect protein-protein interactions may facilitate the development of improved inhibitors enabling the development of novel anti-TB drugs.

  12. Correlations of mutations in katG, oxyR-ahpC and inhA genes and in vitro susceptibility in Mycobacterium tuberculosis clinical strains segregated by spoligotype families from tuberculosis prevalent countries in South America

    Directory of Open Access Journals (Sweden)

    Suffys Philip N


    Full Text Available Abstract Background Mutations associated with resistance to rifampin or streptomycin have been reported for W/Beijing and Latin American Mediterranean (LAM strain families of Mycobacterium tuberculosis. A few studies with limited sample sizes have separately evaluated mutations in katG, ahpC and inhA genes that are associated with isoniazid (INH resistance. Increasing prevalence of INH resistance, especially in high tuberculosis (TB prevalent countries is worsening the burden of TB control programs, since similar transmission rates are noted for INH susceptible and resistant M. tuberculosis strains. Results We, therefore, conducted a comprehensive evaluation of INH resistant M. tuberculosis strains (n = 224 from three South American countries with high burden of drug resistant TB to characterize mutations in katG, ahpC and inhA gene loci and correlate with minimal inhibitory concentrations (MIC levels and spoligotype strain family. Mutations in katG were observed in 181 (80.8% of the isolates of which 178 (98.3% was contributed by the katG S315T mutation. Additional mutations seen included oxyR-ahpC; inhA regulatory region and inhA structural gene. The S315T katG mutation was significantly more likely to be associated with MIC for INH ≥2 μg/mL. The S315T katG mutation was also more frequent in Haarlem family strains than LAM (n = 81 and T strain families. Conclusion Our data suggests that genetic screening for the S315T katG mutation may provide rapid information for anti-TB regimen selection, epidemiological monitoring of INH resistance and, possibly, to track transmission of INH resistant strains.

  13. Preparation and LSC Standardization of ''89Sr (DNP) Using the CIEMAT/NIST Method; Preparacion del ''89Sr(DNP) y calibracion por centelleo liquido, mediante el metodo CIEMAT/NIST

    Energy Technology Data Exchange (ETDEWEB)

    Rodriguez Barquero, L.; Los Arcos Merino, J. M.; Grau Malonda, A.


    A procedure for preparation of liquid scintillation counting samples of the strontium DNP complex, labelled with ''89Sr, is described, the chemical quench, the counting stability and spectral evolution of this compound is studied in six scintillators, Toluene, Toluene-alcohol, Dioxane-naphthalene, HiSafe II, Ultima- Gold and Instagel. The liquid scintillation standardization of 89Sr-DNP by the CIEMAT/NIST method, using HiSafe II and Ultima-Gold scintillators, has been carried out. The discrepancies between experimental and computed efficiencies are lower than 0.38% and 0.48%, respectively. The solution has been standardized in terms of activity concentration to an overall uncertainty of 0,38%. (Author) 10 refs.

  14. Isolation of a high malic and low acetic acid-producing sake yeast Saccharomyces cerevisiae strain screened from respiratory inhibitor 2,4-dinitrophenol (DNP)-resistant strains. (United States)

    Kosugi, Shingo; Kiyoshi, Keiji; Oba, Takahiro; Kusumoto, Kenichi; Kadokura, Toshimori; Nakazato, Atsumi; Nakayama, Shunichi


    We isolated 2,4-dinitrophenol (DNP)-resistant sake yeast strains by UV mutagenesis. Among the DNP-resistant mutants, we focused on strains exhibiting high malic acid and low acetic acid production. The improved organic acid composition is unlikely to be under the control of enzyme activities related to malic and acetic acid synthesis pathways. Instead, low mitochondrial activity was observed in DNP-resistant mutants, indicating that the excess pyruvic acid generated during glycolysis is not metabolized in the mitochondria but converted to malic acid in the cytosol. In addition, the NADH/NAD(+) ratio of the DNP-resistant strains was higher than that of the parental strain K901. These results suggest that the increased NADH/NAD(+) ratio together with the low mitochondrial activity alter the organic acid composition because malic acid synthesis requires NADH, while acetic acid uses NAD(+). Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  15. Encoded library technology as a source of hits for the discovery and lead optimization of a potent and selective class of bactericidal direct inhibitors of Mycobacterium tuberculosis InhA. (United States)

    Encinas, Lourdes; O'Keefe, Heather; Neu, Margarete; Remuiñán, Modesto J; Patel, Amish M; Guardia, Ana; Davie, Christopher P; Pérez-Macías, Natalia; Yang, Hongfang; Convery, Maire A; Messer, Jeff A; Pérez-Herrán, Esther; Centrella, Paolo A; Alvarez-Gómez, Daniel; Clark, Matthew A; Huss, Sophie; O'Donovan, Gary K; Ortega-Muro, Fátima; McDowell, William; Castañeda, Pablo; Arico-Muendel, Christopher C; Pajk, Stane; Rullás, Joaquín; Angulo-Barturen, Iñigo; Alvarez-Ruíz, Emilio; Mendoza-Losana, Alfonso; Ballell Pages, Lluís; Castro-Pichel, Julia; Evindar, Ghotas


    Tuberculosis (TB) is one of the world's oldest and deadliest diseases, killing a person every 20 s. InhA, the enoyl-ACP reductase from Mycobacterium tuberculosis, is the target of the frontline antitubercular drug isoniazid (INH). Compounds that directly target InhA and do not require activation by mycobacterial catalase peroxidase KatG are promising candidates for treating infections caused by INH resistant strains. The application of the encoded library technology (ELT) to the discovery of direct InhA inhibitors yielded compound 7 endowed with good enzymatic potency but with low antitubercular potency. This work reports the hit identification, the selected strategy for potency optimization, the structure-activity relationships of a hundred analogues synthesized, and the results of the in vivo efficacy studies performed with the lead compound 65.

  16. Experimental study of PLLA/INH slow release implant fabricated by three dimensional printing technique and drug release characteristics in vitro. (United States)

    Wu, Gui; Wu, Weigang; Zheng, Qixin; Li, Jingfeng; Zhou, Jianbo; Hu, Zhilei


    Local slow release implant provided long term and stable drug release in the lesion. The objective of this study was to fabricate biodegradable slow release INH/PLLA tablet via 3 dimensional printing technique (3DP) and to compare the drug release characteristics of three different structured tablets in vitro. Three different drug delivery systems (columnar-shaped tablet (CST), doughnut-shaped tablet (DST) and multilayer doughnut-shaped tablet (MDST)) were manufactured by the three dimensional printing machine and isoniazid was loaded into the implant. Dynamic soaking method was used to study the drug release characteristics of the three implants. MTT cytotoxicity test and direct contact test were utilized to study the biocompatibility of the implant. The microstructures of the implants' surfaces were observed with electron microscope. The PLLA powder in the tablet could be excellently combined through 3DP without disintegration. Electron microscope observations showed that INH distributed evenly on the surface of the tablet in a "nest-shaped" way, while the surface of the barrier layer in the multilayer doughnut shaped tablet was compact and did not contain INH. The concentration of INH in all of the three tablets were still higher than the effective bacteriostasis concentration (Isoniazid: 0.025 ~ 0.05 μg/ml) after 30 day's release in vitro. All of the tablets showed initial burst release of the INH in the early period. Drug concentration of MDST became stable and had little fluctuation starting from the 6th day of the release. Drug concentration of DST and CST decreased gradually and the rate of decrease in concentration was faster in DST than CST. MTT cytotoxicity test and direct contact test indicated that the INH-PLLA tablet had low cytotoxicity and favorable biocompatibility. Three dimensional printing technique was a reliable technique to fabricate complicated implants. Drug release pattern in MDST was the most stable among the three implants. It was


    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani


    Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

  18. UTAUT2 Based Predictions of Factors Influencing the Technology Acceptance of Phablets by DNP

    Directory of Open Access Journals (Sweden)

    Chi-Yo Huang


    Full Text Available The smart mobile devices have emerged during the past decade and have become one of the most dominant consumer electronic products. Therefore, exploring and understanding the factors which can influence the acceptance of novel mobile technology have become the essential task for the vendors and distributors of mobile devices. The Phablets, integrated smart devices combining the functionality and characteristics of both tablet PCs and smart phones, have gradually become possible alternatives for smart phones. Therefore, predicting factors which can influence the acceptance of Phablets have become indispensable for designing, manufacturing, and marketing of such mobile devices. However, such predictions are not easy. Meanwhile, very few researches tried to study related issues. Consequently, the authors aim to explore and predict the intentions to use and use behaviors of Phablets. The second generation of the Unified Theory of Acceptance and Use of Technology (UTAUT2 is introduced as a theoretic basis. The Decision Making Trial and Evaluation Laboratory (DEMATEL based Network Process (DNP will be used to construct the analytic framework. In light of the analytic results, the causal relationships being derived by the DEMATEL demonstrate the direct influence of the habit on other dimensions. Also, based on the influence weights being derived, the use intention, hedonic motivation, and performance expectancy are the most important dimensions. The analytic results can serve as a basis for concept developments, marketing strategy definitions, and new product designs of the future Phablets. The proposed analytic framework can also be used for predicting and analyzing consumers’ preferences toward future mobile devices.

  19. Cell Type Preference of a Novel Human Derived Cell-Permeable Peptide dNP2 and TAT in Murine Splenic Immune Cells.

    Directory of Open Access Journals (Sweden)

    Sangho Lim

    Full Text Available Cell-permeable peptides (CPPs have been widely studied as an attractive drug delivery system to deliver therapeutic macromolecules such as DNA, RNA, and protein into cells. However, its clinical application is still limited and controversial due to the lack of a complete understanding of delivery efficiency in target cells. Previously we identified and characterized the novel and superior CPP, named dNP2, and here we comparatively analyzed intracellular delivery efficiency of dNP2 and TAT in various immune cells of mouse spleen to demonstrate their cell type preference. dNP2- or TAT-conjugated fluorescent proteins were most efficiently taken up by phagocytic cells such as dendritic cells and macrophages while little protein uptake was seen by lymphocytes including T cells, B cells, and NK cells. Interestingly CD8+ lymphoid dendritic cells and CD62LloCD44hi memory like T cell subsets showed significantly better uptake efficiency in vitro and in vivo relative to other dendritic cells or T cells, respectively. In addition, activated macrophages, T cells, and B cells took up the proteins more efficiently relative to when in the resting state. Importantly, only dNP2, not TAT, shows significant intracellular protein delivery efficiency in vivo. Collectively, this study provides important information regarding heterogeneous intracellular delivery efficiency of CPPs such as dNP2 and TAT with cell type preference in the spleen needed for its application in phagocytic cells or activated immune cells.

  20. Disruption of key NADH-binding pocket residues of the Mycobacterium tuberculosis InhA affects DD-CoA binding ability


    Shaw, Daniel J.; Robb, Kirsty; Vetter, Beatrice V.; Tong, Madeline; Molle, Virginie; Hunt, Neil T.; Hoskisson, Paul A.


    Tuberculosis (TB) is a global health problem that affects over 10 million people. There is an urgent need to develop novel antimicrobial therapies to combat TB. To achieve this, a thorough understanding of key validated drug targets is required. The enoyl reductase InhA, responsible for synthesis of essential mycolic acids in the mycobacterial cell wall, is the target for the frontline anti-TB drug isoniazid. To better understand the activity of this protein a series of mutants, targeted to t...

  1. Proton polarization above 70% by DNP using photo-excited triplet states, a first step towards a broadband neutron spin filter

    International Nuclear Information System (INIS)

    Eichhorn, T.R.; Niketic, N.; Brandt, B. van den; Filges, U.; Panzner, T.; Rantsiou, E.; Wenckebach, W.Th.; Hautle, P.


    The use of polarized protons as neutron spin filter is an attractive alternative to the well established neutron polarization techniques, as the large, spin-dependent neutron scattering cross-section for protons is useful up to the sub-MeV region. Employing optically excited triplet states for the dynamic nuclear polarization (DNP) of the protons relieves the stringent requirements of classical DNP schemes, i.e low temperatures and strong magnetic fields, making technically simpler systems with open geometries possible. Using triplet DNP a record polarization of 71% has been achieved in a pentacene doped naphthalene single crystal at a field of 0.36 T using a simple helium flow cryostat for cooling. Furthermore, by placing the polarized crystal in a neutron optics focus and de-focus scheme, the actual sample cross-section could be increased by a factor 35 corresponding to an effective spin filter cross-section of 18×18mm 2

  2. Proton polarization above 70% by DNP using photo-excited triplet states, a first step towards a broadband neutron spin filter

    Energy Technology Data Exchange (ETDEWEB)

    Eichhorn, T.R. [Laboratory for Developments and Methods (LDM), Paul Scherrer Institute, CH-5232 Villigen PSI (Switzerland); Laboratory of Functional and Metabolic Imaging, École Polytechnique Fédérale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland); Niketic, N.; Brandt, B. van den; Filges, U.; Panzner, T.; Rantsiou, E.; Wenckebach, W.Th. [Laboratory for Developments and Methods (LDM), Paul Scherrer Institute, CH-5232 Villigen PSI (Switzerland); Hautle, P., E-mail: [Laboratory for Developments and Methods (LDM), Paul Scherrer Institute, CH-5232 Villigen PSI (Switzerland)


    The use of polarized protons as neutron spin filter is an attractive alternative to the well established neutron polarization techniques, as the large, spin-dependent neutron scattering cross-section for protons is useful up to the sub-MeV region. Employing optically excited triplet states for the dynamic nuclear polarization (DNP) of the protons relieves the stringent requirements of classical DNP schemes, i.e low temperatures and strong magnetic fields, making technically simpler systems with open geometries possible. Using triplet DNP a record polarization of 71% has been achieved in a pentacene doped naphthalene single crystal at a field of 0.36 T using a simple helium flow cryostat for cooling. Furthermore, by placing the polarized crystal in a neutron optics focus and de-focus scheme, the actual sample cross-section could be increased by a factor 35 corresponding to an effective spin filter cross-section of 18×18mm{sup 2}.

  3. Would You Use It With a Seal of Approval? Important Attributes of 2,4-Dinitrophenol (2,4-DNP as a Hypothetical Pharmaceutical Product

    Directory of Open Access Journals (Sweden)

    Emma E. Bleasdale


    Full Text Available Background2,4-Dinitrophenol (2,4-DNP is an effective but highly dangerous fat burner, not licensed for human consumption. Death cases reported for 2,4-DNP overdose, particularly among young adults, have raised concerns about the ineffective regulatory control, lack of education and risks associated with impurity, and the unknown concentration of 2,4-DNP purchased on the Internet.MethodsUsing a sequential mixed method design and based on a hypothetical scenario as if 2,4-DNP was a licensed pharmaceutical drug, first we conducted a qualitative study to explore what product attributes people consider when buying a weight-loss aid. Focus group interviews with six females and three males (mean age = 21.6 ± 1.8 years were audiorecorded, transcribed verbatim, and subjected to thematic analysis. Sixteen attributes were identified for the Best–Worst Scale (BWS in the quantitative survey with 106 participants (64% female, mean age = 27.1 ± 11.9 years, focusing on 2,4-DNP. Demographics, weight satisfaction, and risk for eating disorder data were collected.ResultsIn contrast to experienced users such as bodybuilders, our study participants approached 2,4-DNP cautiously. Attributes of 2,4-DNP as a hypothetical weight-loss drug comprised a range of desirable and avoidable features. Of the 16 selected attributes, BWS suggested that long-term side effects were the most and branding was the least important attribute. Effectiveness and short-term side effects were also essential. Those in the >25 year group showed least concerns for legality. Neutral BWS scores for cost, treatment, degree of lifestyle changes required, and specificity required for the hypothetical weight-loss drug to be effective were likely caused by disagreement about their importance among the participants, not indifference.ConclusionWith advances in research, 2,4-DNP as a pharmaceutical drug in the future for treating neurodegenerative diseases and potentially for

  4. Would You Use It With a Seal of Approval? Important Attributes of 2,4-Dinitrophenol (2,4-DNP) as a Hypothetical Pharmaceutical Product. (United States)

    Bleasdale, Emma E; Thrower, Sam N; Petróczi, Andrea


    2,4-Dinitrophenol (2,4-DNP) is an effective but highly dangerous fat burner, not licensed for human consumption. Death cases reported for 2,4-DNP overdose, particularly among young adults, have raised concerns about the ineffective regulatory control, lack of education and risks associated with impurity, and the unknown concentration of 2,4-DNP purchased on the Internet. Using a sequential mixed method design and based on a hypothetical scenario as if 2,4-DNP was a licensed pharmaceutical drug, first we conducted a qualitative study to explore what product attributes people consider when buying a weight-loss aid. Focus group interviews with six females and three males (mean age = 21.6 ± 1.8 years) were audiorecorded, transcribed verbatim, and subjected to thematic analysis. Sixteen attributes were identified for the Best-Worst Scale (BWS) in the quantitative survey with 106 participants (64% female, mean age = 27.1 ± 11.9 years), focusing on 2,4-DNP. Demographics, weight satisfaction, and risk for eating disorder data were collected. In contrast to experienced users such as bodybuilders, our study participants approached 2,4-DNP cautiously. Attributes of 2,4-DNP as a hypothetical weight-loss drug comprised a range of desirable and avoidable features. Of the 16 selected attributes, BWS suggested that long-term side effects were the most and branding was the least important attribute. Effectiveness and short-term side effects were also essential. Those in the >25 year group showed least concerns for legality. Neutral BWS scores for cost, treatment, degree of lifestyle changes required, and specificity required for the hypothetical weight-loss drug to be effective were likely caused by disagreement about their importance among the participants, not indifference. With advances in research, 2,4-DNP as a pharmaceutical drug in the future for treating neurodegenerative diseases and potentially for weight loss is not inconceivable. Caution is

  5. An Effective Approach for Clustering InhA Molecular Dynamics Trajectory Using Substrate-Binding Cavity Features.

    Directory of Open Access Journals (Sweden)

    Renata De Paris

    Full Text Available Protein receptor conformations, obtained from molecular dynamics (MD simulations, have become a promising treatment of its explicit flexibility in molecular docking experiments applied to drug discovery and development. However, incorporating the entire ensemble of MD conformations in docking experiments to screen large candidate compound libraries is currently an unfeasible task. Clustering algorithms have been widely used as a means to reduce such ensembles to a manageable size. Most studies investigate different algorithms using pairwise Root-Mean Square Deviation (RMSD values for all, or part of the MD conformations. Nevertheless, the RMSD only may not be the most appropriate gauge to cluster conformations when the target receptor has a plastic active site, since they are influenced by changes that occur on other parts of the structure. Hence, we have applied two partitioning methods (k-means and k-medoids and four agglomerative hierarchical methods (Complete linkage, Ward's, Unweighted Pair Group Method and Weighted Pair Group Method to analyze and compare the quality of partitions between a data set composed of properties from an enzyme receptor substrate-binding cavity and two data sets created using different RMSD approaches. Ensembles of representative MD conformations were generated by selecting a medoid of each group from all partitions analyzed. We investigated the performance of our new method for evaluating binding conformation of drug candidates to the InhA enzyme, which were performed by cross-docking experiments between a 20 ns MD trajectory and 20 different ligands. Statistical analyses showed that the novel ensemble, which is represented by only 0.48% of the MD conformations, was able to reproduce 75% of all dynamic behaviors within the binding cavity for the docking experiments performed. Moreover, this new approach not only outperforms the other two RMSD-clustering solutions, but it also shows to be a promising strategy to

  6. Rational Modulation of the Induced-Fit Conformational Change for Slow-Onset Inhibition in Mycobacterium tuberculosis InhA. (United States)

    Lai, Cheng-Tsung; Li, Huei-Jiun; Yu, Weixuan; Shah, Sonam; Bommineni, Gopal R; Perrone, Victoria; Garcia-Diaz, Miguel; Tonge, Peter J; Simmerling, Carlos


    Slow-onset enzyme inhibitors are the subject of considerable interest as an approach to increasing the potency of pharmaceutical compounds by extending the residence time of the inhibitor on the target (the lifetime of the drug-receptor complex). However, rational modulation of residence time presents significant challenges because it requires additional mechanistic insight, such as the nature of the transition state for postbinding isomerization. Our previous work, based on X-ray crystallography, enzyme kinetics, and molecular dynamics simulation, suggested that the slow step in inhibition of the Mycobacterium tuberculosis enoyl-ACP reductase InhA involves a change in the conformation of the substrate binding loop from an open state in the initial enzyme-inhibitor complex to a closed state in the final enzyme-inhibitor complex. Here, we use multidimensional free energy landscapes for loop isomerization to obtain a computational model for the transition state. The results suggest that slow-onset inhibitors crowd key side chains on helices that slide past each other during isomerization, resulting in a steric clash. The landscapes become significantly flatter when residues involved in the steric clash are replaced with alanine. Importantly, this lower barrier can be increased by rational inhibitor redesign to restore the steric clash. Crystallographic studies and enzyme kinetics confirm the predicted effects on loop structure and flexibility, as well as inhibitor residence time. These loss and regain of function studies validate our mechanistic hypothesis for interactions controlling substrate binding loop isomerization, providing a platform for the future design of inhibitors with longer residence times and better in vivo potency. Similar opportunities for slow-onset inhibition via the same mechanism are identified in other pathogens.

  7. Socioeconomic status and impact of the economic crisis on dietary habits in Italy: results from the INHES study. (United States)

    Bonaccio, Marialaura; Di Castelnuovo, Augusto; Bonanni, Americo; Costanzo, Simona; Persichillo, Mariarosaria; Cerletti, Chiara; Donati, Maria Benedetta; de Gaetano, Giovanni; Iacoviello, Licia


    There is lack of evidence about the likely impact of the economic crisis on dietary habits in Western societies. We aimed to assess dietary modifications that possibly occurred during the recession and to investigate major socioeconomic factors associated with such modifications. Cross-sectional analysis on 1829 subjects from the general population recruited in the larger INHES study (n = 9319) a telephone-based survey on nutrition and health conducted in Italy from 2010 to 2013. Association of socioeconomic (education, household income, occupation) with self-reported impact of the economic crisis on dietary habits was tested by multivariable logistic regression analysis. Low-educated subjects (OR = 2.30; 95% CI: 1.39-3.80), those with poor income (OR = 5.71; 95% CI: 3.68-8.85), and unemployed (OR = 3.93; 95% CI: 1.62-9.56) had higher odds of reporting undesirable dietary changes due to recession. Adherence to the Mediterranean diet was lower in subjects reporting a negative impact of the crisis on diet as compared to those declaring no effect, whereas the quality of grocery items was higher in the latter. Undesirable dietary changes due to the economic crisis were mainly reported by lower socioeconomic groups. Subjects perceiving a negative impact of the recession on their diet also showed a lower adherence to Mediterranean diet and reduced quality of grocery products. © The Author 2017. Published by Oxford University Press on behalf of Faculty of Public Health. All rights reserved. For permissions, please e-mail:

  8. dNP2-ctCTLA-4 inhibits German cockroach extract-induced allergic airway inflammation and hyper-responsiveness via inhibition of Th2 responses. (United States)

    Lim, Sangho; Ho Sohn, Jung; Koo, Ja-Hyun; Park, Jung-Won; Choi, Je-Min


    German cockroaches are major household allergens that can trigger allergic airway inflammatory diseases with sensitive T-cell responses. Although the use of immune modulatory biologics, such as antibodies, to mediate allergic responses has recently been examined, only systemic administration is available because of the size limitations on intranasal administration. Here we utilized a cell-permeable peptide, dNP2, to deliver the cytoplasmic domain of cytotoxic T-lymphocyte antigen-4 (ctCTLA-4) through the airway epithelium to modulate Th2 responses in a German cockroach extract (GCE)-induced allergic airway inflammation model. The intranasal delivery efficiency of the dNP2-dTomato protein to the lungs was higher in GCE-induced asthmatic lung parenchymal cells compared to the sham cells. Intranasal administration of the dNP2-ctCTLA-4 protein inhibited airway hyper-responsiveness and reduced airway inflammation and remodeling, including goblet cell metaplasia and collagen deposition around the bronchi. The number of infiltrated cells, including eosinophils, and the levels of IL-4, IL-5, IL-13 and IFN-γ in the lungs were significantly reduced, presumably owing to inhibition of Th2 differentiation. However, intranasal administration of CTLA4-Ig did not inhibit airway inflammation. These results collectively suggest that dNP2-ctCTLA-4 is an efficient intranasally applicable candidate biologic for treating allergic asthma.

  9. Design, Synthesis and DFT/DNP Modeling Study of New 2-Amino-5-arylazothiazole Derivatives as Potential Antibacterial Agents

    Directory of Open Access Journals (Sweden)

    Sraa Abu-Melha


    Full Text Available A new series of 2-amino-5-arylazothiazole derivatives has been designed and synthesized in 61–78% yields and screened as potential antibacterial drug candidates against the Gram negative bacterium Escherichia coli. The geometry of the title compounds were being studied using the Material Studio package and semi-core pseudopods calculations (dspp were performed with the double numerica basis sets plus polarization functional (DNP to predict the properties of materials using the hybrid FT/B3LYP method. Modeling calculations, especially the (EH-EL difference and the energetic parameters revealed that some of the title compounds may be promising tools for further research work and the activity is structure dependent.

  10. Insight into the Supramolecular Architecture of Intact Diatom Biosilica from DNP-Supported Solid-State NMR Spectroscopy. (United States)

    Jantschke, Anne; Koers, Eline; Mance, Deni; Weingarth, Markus; Brunner, Eike; Baldus, Marc


    Diatom biosilica is an inorganic/organic hybrid with interesting properties. The molecular architecture of the organic material at the atomic and nanometer scale has so far remained unknown, in particular for intact biosilica. A DNP-supported ssNMR approach assisted by microscopy, MS, and MD simulations was applied to study the structural organization of intact biosilica. For the first time, the secondary structure elements of tightly biosilica-associated native proteins in diatom biosilica were characterized in situ. Our data suggest that these proteins are rich in a limited set of amino acids and adopt a mixture of random-coil and β-strand conformations. Furthermore, biosilica-associated long-chain polyamines and carbohydrates were characterized, thereby leading to a model for the supramolecular organization of intact biosilica. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Analytical and clinical performance characteristics of the Abbott RealTime MTB RIF/INH Resistance, an assay for the detection of rifampicin and isoniazid resistant Mycobacterium tuberculosis in pulmonary specimens. (United States)

    Kostera, Joshua; Leckie, Gregor; Tang, Ning; Lampinen, John; Szostak, Magdalena; Abravaya, Klara; Wang, Hong


    Clinical management of drug-resistant tuberculosis patients continues to present significant challenges to global health. To tackle these challenges, the Abbott RealTime MTB RIF/INH Resistance assay was developed to accelerate the diagnosis of rifampicin and/or isoniazid resistant tuberculosis to within a day. This article summarizes the performance of the Abbott RealTime MTB RIF/INH Resistance assay; including reliability, analytical sensitivity, and clinical sensitivity/specificity as compared to Cepheid GeneXpert MTB/RIF version 1.0 and Hain MTBDRplus version 2.0. The limit of detection (LOD) of the Abbott RealTime MTB RIF/INH Resistance assay was determined to be 32 colony forming units/milliliter (cfu/mL) using the Mycobacterium tuberculosis (MTB) strain H37Rv cell line. For rifampicin resistance detection, the Abbott RealTime MTB RIF/INH Resistance assay demonstrated statistically equivalent clinical sensitivity and specificity as compared to Cepheid GeneXpert MTB/RIF. For isoniazid resistance detection, the assay demonstrated statistically equivalent clinical sensitivity and specificity as compared to Hain MTBDRplus. The performance data presented herein demonstrate that the Abbott RealTime MTB RIF/INH Resistance assay is a sensitive, robust, and reliable test for realtime simultaneous detection of first line anti-tuberculosis antibiotics rifampicin and isoniazid in patient specimens. Copyright © 2016 The Author. Published by Elsevier Ltd.. All rights reserved.

  12. Melanoma Vaccine--AVAX Technologies: DNP-VACC, M-Vax. (United States)


    Adis CommentsAVAX Technologies is developing a therapeutic melanoma vaccine [M-Vax, DNP-VACC] consisting of autologous tumour cells conjugated to a highly immunogenic hapten, dinitrophenyl, which makes the cancer cells more easily recognised by the immune system. AVAX licensed the autologous cell vaccine technology (AC Vaccine) from Thomas Jefferson University in Philadelphia, USA, where it was originally developed. M-Vax was launched in Australia in the first half of 2000, but was withdrawn from this market in September 2002 due to financial constraints faced by the company and its need to focus its resources on initiatives that provide the greatest return. Although AVAX applied for Federal Government price reimbursement in Australia through the Medical Services Advisory Committee during 2001, the vaccine is not reimbursed in Australia. Obtaining Federal Government reimbursement was a step AVAX considered essential for the success of the M-Vax. AVAX has not ruled out re-entering the Australian market again at a later date. AVAX will now concentrate on gaining approval in the US and Europe. M-Vax has received orphan drug designation from the US FDA. M-Vax is in preregistration in Germany, Japan and The Netherlands for treatment of stage III melanoma. In September 1999, the company announced that it expected to market M-Vax for treatment of stage III melanoma in Germany, Japan and the Netherlands. This announcement came after AVAX's continuing dialogue with senior regulatory authorities in several pharmaceutical markets. The commercial availability of M-Vax in Germany, Japan and The Netherlands will be subject to meeting certain requirements specified by the regulatory agency in each country. Phase II data have been submitted for regulatory approval in these countries; phase III data may not be required because the vaccine contains autologous tumour cells. This was the case with the Australian approval of M-Vax, which was on the basis of data from phase II trials

  13. Programación de un sistema de adquisición de datos utilizando el sistema embebido DNP/1110; Programming of a data acquisition system using the embedded system dil/netpc DNP/1110

    Directory of Open Access Journals (Sweden)

    Josnier Ramos Guardarrama


    Full Text Available En el trabajo se presenta una alternativa económica de un sistema de adquisición de datos (SAD basado en el kit dedesarrollo DIL/NetPC DNP/1110, el cual esta formado por un microcontrolador de INTEL SA-1110 StrongARM quetrabaja a 206 MHz y que tiene incorporado un controlador de Ethernet que permite desarrollar aplicaciones con el usode la red. El sistema embebido dispone de un sistema operativo Linux, kernel versión 2.4.18. Como parte del diseñose incorporan de forma compacta los elementos necesarios para que el SAD sea capaz de muestrear ocho señalescapturadas simultáneamente. De particular interés resulta la programación, presentándose dos variantes de solución:cuando se ejecuta la aplicación con un software que corre en el área de usuario y cuando el control se logra con unmódulo del sistema operativo específico para el trabajo del SAD. El sistema está soportado por la integración desoftware libre y propietario.  This work focuses on an economic alternative for developing a data acquisition system (DAS which is made up forThe DIL/NetPC DNP/1110, which provides a very compact Intel 206 MHz SA-1110 StrongARM-based low powerembedded controller with TCP/IP stack and web server for high-speed embedded networking applications. Theembedded system has an operating system Linux, kernel version 2.4.18. The built data acquisition system has thenecessary elements to take charge of governing the sampling process of eight signals. Of particular interest it is theprogramming, being presented two solution variants: when the application is executed with software that it runs inuser's area and when the control is achieved with a specific build module of the operating system for the work of theDAS.. The system is supported by the integration of free software and property software.

  14. Programación de un sistema de adquisición de datos utilizando el sistema embebido DNP/1110;Programming of a data acquisition system using the embedded system dil/netpc DNP/1110

    Directory of Open Access Journals (Sweden)

    Josnier Ramos - Guardarrama,et al.


    Full Text Available En el trabajo se presenta una alternativa económica de un sistema de adquisición de datos (SAD basado en el kit de desarrollo DIL/NetPC DNP/1110, el cual esta formado por un microcontrolador de INTEL SA-1110 StrongARM que trabaja a 206 MHz y que tiene incorporado un controlador de Ethernet que permite desarrollar aplicaciones con el uso de la red. El sistema embebido dispone de un sistema operativo Linux, kernel versión 2.4.18. Como parte del diseño se incorporan de forma compacta los elementos necesarios para que el SAD sea capaz de muestrear ocho señales capturadas simultáneamente. De particular interés resulta la programación, presentándose dos variantes de solución: cuando se ejecuta la aplicación con un software que corre en el área de usuario y cuando el control se logra con un módulo del sistema operativo específico para el trabajo del SAD. El sistema está soportado por la integración de software libre y propietario.This work focuses on an economic alternative for developing a data acquisition system (DAS which is made up for The DIL/NetPC DNP/1110, which provides a very compact Intel 206 MHz SA-1110 StrongARM-based low power embedded controller with TCP/IP stack and web server for high-speed embedded networking applications. The embedded system has an operating system Linux, kernel version 2.4.18. The built data acquisition system has the necessary elements to take charge of governing the sampling process of eight signals. Of particular interest it is the programming, being presented two solution variants: when the application is executed with software that it runs in user's area and when the control is achieved with a specific build module of the operating system for the work of the DAS.. The system is supported by the integration of free software and property software.

  15. Real-Time DNP NMR Observations of Acetic Acid Uptake, Intracellular Acidification, and of Consequences for Glycolysis and Alcoholic Fermentation in Yeast

    DEFF Research Database (Denmark)

    Jensen, Pernille Rose; Karlsson, Magnus; Lerche, Mathilde Hauge


    Uptake and upshot in vivo: Straightforward methods that permit the real-time observation of organic acid influx, intracellular acidification, and concomitant effects on cellular-reaction networks are crucial for improved bioprocess monitoring and control (see scheme). Herein, dynamic nuclear pola...... polarization (DNP) NMR is used to observe acetate influx, ensuing intracellular acidification and the metabolic consequences on alcoholic fermentation and glycolysis in living cells....

  16. Toxicology Study No. S.0024589d 15, Human Cell Line Activation Test of the Novel Energetic, 3,4 -Dinitropyrazole (DNP) (United States)


    Assay 1 0.259 0.278 Assay 2 0.299 6.3 CD54 and CD86 expression in response to DNP exposure of THP -1 cells Three independent tests were...2 Toxicology Study No. S.0024589d-15, April 2016 Toxicology Directorate Human Cell Line Activation Test of the Novel Energetic 3, 17-05-2016 Technical Report March 2016-April 2016 Toxicology Study No. S.0024589d-15 Human Cell Line Activation Test of the Novel

  17. Food group consumption in an Italian population using the updated food classification system FoodEx2: Results from the Italian Nutrition & HEalth Survey (INHES) study. (United States)

    Pounis, G; Bonanni, A; Ruggiero, E; Di Castelnuovo, A; Costanzo, S; Persichillo, M; Bonaccio, M; Cerletti, C; Riccardi, G; Donati, M B; de Gaetano, G; Iacoviello, L


    Dietary habits evolve over time, being influenced by many factors and complex interactions. This work aimed at evaluating the updated information on food group consumption in Italy. A total of 8944 (4768 women and 4176 men) participants aged >18 years from all over Italy recruited in 2010-13 (Italian Nutrition & HEalth Survey, INHES) was analyzed. The recruitment was performed using computer-assisted-telephone-interviewing and one-day 24-h dietary recall retrieved from all participants. The updated, second version, of FoodEx2 food classification system was applied to extract data on food group consumption. The participation rate was 53%; 6.2% of the participants declared to follow a special diet, the most prevalent being hypo-caloric diets (55.7% of special diets). Men compared to women presented significantly higher intakes of "grains and grain-based products", "meat and meat products", "animal and vegetable fats and oils and primary derivatives" and "alcoholic beverages" (P for alldiets, food imitates and food supplements" (P for all<0.001). Differences in food group intake among age groups, geographical regions and educational level groups were also identified (P for all<0.05). Data on the consumption of more than 70 food groups and sub-groups were illustrated in different strata. The present analysis could be considered as an updated source of information for future nutrition research in Italy and in the EU. Copyright © 2017 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human Nutrition, and the Department of Clinical Medicine and Surgery, Federico II University. Published by Elsevier B.V. All rights reserved.

  18. Measurement of 14N quadrupole couplings in biomolecular solids using indirect-detection 14N solid-state NMR with DNP. (United States)

    Jarvis, J A; Haies, I; Lelli, M; Rossini, A J; Kuprov, I; Carravetta, M; Williamson, P T F


    The quadrupolar interaction experienced by the spin-1 14 N nucleus is known to be extremely sensitive to local structure and dynamics. Furthermore, the 14 N isotope is 99.6% naturally abundant, making it an attractive target for characterisation of nitrogen-rich biological molecules by solid-state NMR. In this study, dynamic nuclear polarization (DNP) is used in conjunction with indirect 14 N detected solid-state NMR experiments to simultaneously characterise the quadrupolar interaction at multiple 14 N sites in the backbone of the microcrystalline protein, GB3. Considerable variation in the quadrupolar interaction (>700 kHz) is observed throughout the protein backbone. The distribution in quadrupolar interactions observed reports on the variation in local backbone conformation and subtle differences in hydrogen-bonding; demonstrating a new route to the structural and dynamic analysis of biomolecules.

  19. Excitation-energy dependence of the resonant Auger transitions to the 4p4(1D)np (n=5,6) states across the 3d3/2-15p and 3d5/2-16p resonances in Kr

    International Nuclear Information System (INIS)

    Sankari, A.; Alitalo, S.; Nikkinen, J.; Kivimaeki, A.; Aksela, S.; Aksela, H.; Fritzsche, S.


    The energy dependencies of the intensities and angular distribution parameters β of the resonant Auger final states 4p 4 ( 1 D)np (n=5,6) of Kr were determined experimentally in the excitation-energy region of the overlapping 3d 3/2 -1 5p and 3d 5/2 -1 6p resonances. The experimental results were compared with the outcome of multiconfiguration Dirac-Fock calculations. Combining experimental and calculated results allowed us to study interference effects between the direct and several resonant channels that populate the 4p 4 ( 1 D)np states. The inclusion of the direct channel was crucial in order to reproduce the observed energy behavior of the angular distribution parameters. It was also important to take into account experimentally observed shake transitions


    Directory of Open Access Journals (Sweden)

    Felisa Alonso Garcia,


    Full Text Available OBJETIVO: Estudiar las variaciones hemodinámicas y metabólicas de las primeras fases del Shock Séptico Experimental (SSE, inducidas por el tratamiento con distinta asociación de aminas. METODO: Investigación experimental en 22 perros. Se les indujo SSE mediante la administración de endotoxina de E. Coli (Serotipo 0111 B.M. Difco Laboratories. Michigan. USA. En función del tiempo se establecieron 5 fases: Basal ó "t=0" (considerado tiempo 0, SSE ó "t=30" (a los 30 minutos del inicio de la infusión del estímulo séptico, "t = 60", "t = 90" y "t = 120" a los 60, 90 y 120 minutos respectivamente de la administración de la endotoxina. En relación al tratamiento administrado, se distinguieron 3 grupos: Grupo A (n=7: tratamiento de soporte; Grupo B (n=8: Dopamina a 10 mcg/kg/min y Dobutamina a 5 mcg/kg/min (DPDB en la fase "t=60", DPDB más Noradrenalina (NA a 0,5 mcg/kg/min (NA0,5 en la fase "t=90"; DPDB más NA a 1 mcg/kg/min (NA1 en la fase "t=120"; Grupo C (n=7: Dopexamina a 12 mcg/kg/min (DX en la fase "t=60", DX más NA0,5 en la fase "t=90" y DX más NA1 en la fase "t=120". La comparación estadística se realizó mediante: "t" de Student-Fisher, Análisis de la Varianza, Chi Cuadrado y cálculo de la potencia estadística en caso necesario. RESULTADOS: Grupo B respecto al A: DP-DB NA0.5 aumentó la Frecuencia cardiaca (FC; DPDB-NA1 además incrementó la Presión diastólica (TAD. Grupo C respecto al A: DX- NA0,5 aumentó la FC; DX- NA1, incrementó la FC y TAD. CONCLUSIONES: La FC, TAS y TAD, se modificaron significativamente con las diversas asociaciones de aminas, mientras que no se evidenciaron variaciones intergrupo de la glucemia y plaquetas. Los cambios significativos en las últimas fases de la investigación experimental, de la glucemia y de las plaquetas, fueron secundarios a la progresión del shock séptico experimental y no a la diferente terapia recibida en cada grupo (ya que se comportaron de forma independiente al tratamiento administrado.

  1. DNP NMR of carbohydrate converting enzymes

    DEFF Research Database (Denmark)

    Kjeldsen, Christian; Ardenkjær-Larsen, Jan Henrik; Duus, Jens Øllgaard

    intermediate, however, this evidence is based on mutant of X-ray crystallography and simulations. As the natural substrate lactose does not have any quaternary carbon with long T1, the unnatural substrate o-nitrophenyl β-D-galactopyranoside was used (figure 1) as the quaternarypositions have T1 relaxations...... of ca. 15 s instead of hydrolysis of this substrate can be seen in figure 2, and another use of this substrate is for optimizing the conditions for a labelled substrate (figure 1), which would further increase the signal and allow monitoring of the carbohydrate...

  2. Determinação de efedrinas em urina por cromatografia em fase gasosa (CG/DNP para o controle da dopagem no esporte Gas chromatographic method for the determination of ephedrines in urine for doping control purposes

    Directory of Open Access Journals (Sweden)

    Paula Rodrigues Garcia


    Full Text Available Efedrinas são aminas simpatomiméticas componentes de diversas especialidades farmacêuticas, utilizadas no tratamento de doenças respiratórias devido à sua ação descongestionante e broncodilatora. Atualmente, diversos produtos comercializados como suplementos nutricionais contêm efedrinas e são amplamente utilizados no meio esportivo, com o objetivo de facilitar a queima de gorduras e melhorar o desempenho. Entretanto, o uso indiscriminado destas substâncias pode acarretar série de efeitos tóxicos como hipertensão, taquicardia, cefaléia e tremores. Devido à sua ação psicoestimulante, foram incluídas na lista de substâncias proibidas nas atividades esportivas pelo Comitê Olímpico Internacional (COI e estabelecidas concentrações na urina para o controle da dopagem (efedrina e metilefedrina: 10 µg/mL. O presente trabalho teve como objetivo a validação de um método para quantificação de efedrinas, por cromatografia em fase gasosa acoplada a detetor de nitrogênio/fósforo (CG/DNP, em amostras de urina com a finalidade de controle da dopagem. O método consistiu em extração líquido-líquido e posterior derivação das efedrinas com anidrido trifluoroacético, e demonstrou ser simples e prático, apresentando linearidade nas faixas de concentração estudadas. Amostras de urina de voluntários que relataram uso de efedrinas foram submetidas à análise pelo método proposto.Ephedrines are sympathomimetic amines present in many pharmaceutical preparations used in the treatment of respiratory diseases due to their actions against broncospasm and congestion. Nowadays, several products sold as nutritional supplements contain ephedrines and are widely used in a diverse range of sports as weight loss aids and enhancement of athletic performance. However, the abuse of ephedrines may lead to a number of adverse effects including hypertension, headache, tachycardia and seizure. Due to their CNS stimulating action, ephedrines are

  3. La ciudad inhóspita promovida por Heidegger

    Directory of Open Access Journals (Sweden)

    Rojas Jiménez, Alejandro


    Full Text Available A society that cares about strengthening the idea that no one can interfere in our convictions, just finally generating uncritical individuals incapable of self-reflective and thus, it fails the first condition of a free citizenry. If diversity does not mean arbitrariness, but only that no single practical reason, then you have to do is not practical reason to relegate to the private sphere, but to show the existence of other reasons to shake the security of particular beliefs and thus promote certain inhospitality constantly put to test personal convictions.

    Una sociedad que se preocupa por fortalecer la idea de que nadie puede interferir en nuestras convicciones, acaba finalmente generando individuos acríticos incapaces de autonomía reflexiva y, en esta medida, se incumple la primera condición de una ciudadanía libre. Si pluralidad no significa arbitrariedad, sino sólo que no hay una única razón práctica, entonces lo que hay que hacer no es relegar la razón práctica al ámbito privado, sino mostrar la existencia de otras razones para tambalear la seguridad de las convicciones particulares y así promover cierta inhospitalidad que ponga constantemente a prueba las convicciones más personales.

  4. Trends in carcinoma breast at INHS asvini, Mumbai

    Directory of Open Access Journals (Sweden)

    Hari Mukundan


    Conclusion: Carcinoma breast is a disease which affects both men and women. Age groups from 20 to 70 may be affected .The treatment involves surgery, chemotherapy and radiotherapy. Early detection and management is the cornerstone of treatment. However mastectomy remains the surgical option of choice due to the advanced stage of cancers seen in India.

  5. Application of compartmental metabolic models for determination of retention and excretion functions; Aplicacao de modelos metabolicos para a determinacao de funcoes de excrecao e retencao

    Energy Technology Data Exchange (ETDEWEB)

    Rodrigues, Junior, O


    After an intake of radioactive material, its behaviour in the human body can be described by mathematical models, where organs, tissues or regions of the body are treated as a chain of linked compartments. The mathematical approach for such metabolic models is usually done through a system of differential equations of first order with constant coefficients. The solutions of this system of equations associates the radionuclide intake, with the fraction excreted or retained in the organ of interest. A computer program - called INCORP and for running in PC compatible microcomputers - was developed in order to find the solutions of such system of equations, using an analytical method based on expansion of series of exponential matrices. The metabolic model presented in the ICRP-30 publication was simulated using the INCORP program, in order to find the respective retention and excretion curves for selected radionuclides. (author)

  6. Micro tomography prototype by positron emission. Spatial resolution and metabolic studies;Prototipo de microtomografo por emision de positrones. Resolucion espacial y estudios metabolicos

    Energy Technology Data Exchange (ETDEWEB)

    Alva S, H.; Murrieta, T.; Ruiz T, C.; Brandan, M. E.; Martinez D, A.; Rodriguez V, M., E-mail: halva@fisica.unam.m [UNAM, Instituto de Fisica, Circuito de la Investigacion Cientifica s/n, Ciudad Universitaria, 04510 Mexico D. F. (Mexico)


    During the past 4 years, the Medical Physics and Dosimetry Group at the Physics Institute, UNAM, has developed a positron emission tomography prototype for small-animal imaging (micro PET). The system is composed of pix elated, cerium-doped lutetium yttrium oxy orthosilicate scintillation crystal arrays coupled to position-sensitive photomultiplier tubes. Detector electronic signals are processed by nuclear instrumentation modules and are digitized by a multichannel data acquisition board. The tomographic reconstruction is performed by filtered backprojection from a set of distortion- and nonuniformity- corrected projections taken at different angles. In this work, the reconstructed spatial resolution was evaluated from the line spread function with a mean value of 2.36 +- 0.44 mm. In addition, the first metabolic studies of 30 g, healthy mice, injected with {sup 1}8{sup F} labeled fluorodeoxyglucose and sodium fluoride are reported. They display normal glucose uptake and skeletal structure, respectively. The micro PET can be a useful tool for radiation detector physics research and its applications in nuclear medicine. (Author)

  7. Radiation safety program in high dose rate brachytherapy facility at INHS Asvini

    Directory of Open Access Journals (Sweden)

    Kirti Tyagi


    Full Text Available Brachytherapy concerns primarily the use of radioactive sealed sources which are inserted into catheters or applicators and placed directly into tissue either inside or very close to the target volume. The use of radiation in treatment of patients involves both benefits and risks. It has been reported that early radiation workers had developed radiation induced cancers. These incidents lead to continuous work for the improvement of radiation safety of patients and personnel The use of remote afterloading equipment has been developed to improve radiation safety in the delivery of treatment in brachytherapy. The widespread adoption of high dose rate brachytherapy needs appropriate quality assurance measures to minimize the risks to both patients and medical staff. The radiation safety program covers five major aspects: quality control, quality assurance, radiation monitoring, preventive maintenance, administrative measures and quality audit. This paper will discuss the radiation safety program developedfor a high dose rate brachytherapy facility at our centre which may serve as a guideline for other centres intending to install a similar facility.

  8. Large dose hyperpolarized water with dissolution-DNP at high magnetic field

    DEFF Research Database (Denmark)

    Lipsø, Hans Kasper Wigh; Bowen, Sean; Rybalko, Oleksandr


    was polarized and dissolved in a fluid path compatible with clinical polarizers. The volume of hyperpolarized water produced by this method enables angiography and perfusion measurements in large animals, as well as NMR experiments for studies of e.g. proton exchange and polarization transfer to other nuclei....

  9. The DNP/MPH Dual Degree: An Innovative Graduate Education Program for Advanced Public Health Nursing. (United States)

    Shaw, Kathy; Harpin, Scott; Steinke, Geraldine; Stember, Marilyn; Krajicek, Marilyn


    Strong professional priorities, evolving Affordable Care Act requirements, and a significantly limited public health nursing workforce prompted the University of Colorado College of Nursing to collaborate with the School of Public Health to implement one of the first Doctor of Nursing Practice/Master of Public Health dual degree programs in the nation. Federal grant funding supported the development, implementation, and evaluation of this unique post-baccalaureate dual degree program, for which there were no roadmaps, models, or best practices to follow. Several key issues emerged that serve as lessons learned in creating a new, novel higher education pathway for Advanced Public Health Nursing. This paper highlights two of those: (1) marketing, admission, and matriculation across two programs, and (2) enhancing curricula through distance coursework and interprofessional education. When collaboration with a school of public health is possible, the Doctor of Nursing Practice/Master of Public Health dual degree is an efficient way to prepare public health nurses' with the highest level of public health knowledge, practice, and leadership expertise. © 2016 Wiley Periodicals, Inc.

  10. Monitoring of the incorporation of I-138 by inhalation in facilities of metabolic treatment; Vigilancia de la incorporacion de I{sub 1}31 por inhalacion en las instalaciones de tratamientos de metabolicos

    Energy Technology Data Exchange (ETDEWEB)

    Baquero, R.; Anton, D.; Miguel, D. de


    The measure of thyroid activity with a surface contamination meter allows you to rule out or confirm the presence of iodine in the thyroid of the nursing staff. You have these teams in all Nuclear Medicine facilities, which can be used with simplicity immediately. To carry out these measures is necessary to have a background environment in which are carried out low, so as the limit of detection got enable check low levels to determine. (Author)

  11. Measuring absolute spin polarization in dissolution-DNP by Spin PolarimetrY Magnetic Resonance (SPY-MR). (United States)

    Vuichoud, Basile; Milani, Jonas; Chappuis, Quentin; Bornet, Aurélien; Bodenhausen, Geoffrey; Jannin, Sami


    Dynamic nuclear polarization at 1.2 K and 6.7 T allows one to achieve spin temperatures on the order of a few millikelvin, so that the high-temperature approximation (ΔEPolarimetrY Magnetic Resonance (SPY-MR), is illustrated for various pairs of (13)C spins (I, S) in acetate and pyruvate. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  12. New vector/scalar Overhauser DNP magnetometers POS-4 for magnetic observatories and directional oil drilling support

    Directory of Open Access Journals (Sweden)

    Sapunov V.A., Denisov A.Y., Saveliev D.V., Soloviev A.A., Khomutov S.Y., Borodin P.B., Narkhov E.D., Sergeev A.V., Shirokov A.N.


    Full Text Available This paper covers same results of the research directed at developing an absolute vector proton magnetometer POS-4 based on the switching bias magnetic fields methods. Due to the high absolute precision and stability magnetometer POS-4 found application not only for observatories and to directional drilling support of oi and gas well. Also we discuss the some basic errors of measurements and discuss the long-term experience in the testing of magnetic observatories ART and PARATUNKA.

  13. Discovery of Intermediates of lacZ β-Galactosidase Catalyzed Hydrolysis Using dDNP NMR

    DEFF Research Database (Denmark)

    Kjeldsen, Christian; Ardenkjær-Larsen, Jan Henrik; Duus, Jens Ø.


    Using dissolution dynamic nuclear polarization, the sensitivity of single scan solution state 13C NMR can be improved up to 4 orders of magnitude. In this study, the enzyme lacZ β-galactosidase from Escherichia coli was subjected to hyperpolarized substrate, and previously unknown reaction...

  14. Discovery of Intermediates of lacZ beta-Galactosidase Catalyzed Hydrolysis Using dDNP NMR

    DEFF Research Database (Denmark)

    Kjeldsen, Christian; Ardenkjær-Larsen, Jan Henrik; Duus, Jens Øllgaard


    Using dissolution dynamic nuclear polarization, the sensitivity of single scan solution state C-13 NMR can be improved up to 4 orders of magnitude. In this study, the enzyme lacZ beta-galactosidase from Escherichia coli was subjected to hyperpolarized substrate, and previously unknown reaction...

  15. Measuring absolute spin polarization in dissolution-DNP by Spin PolarimetrY Magnetic Resonance (SPY-MR).


    Vuichoud , Basile; Milani , Jonas; Chappuis , Quentin; Bornet , Aurélien; Bodenhausen , Geoffrey; Jannin , Sami


    Dynamic nuclear polarization at 1.2 K and 6.7 T allows one to achieve spin temperatures on the order of a few millikelvin, so that the high-temperature approximation (Delta E < kT) is violated for the nuclear Zeeman interaction Delta E = gamma B(0)h/(2 pi) of most isotopes. Provided that, after rapid dissolution and transfer to an NMR or MRI system, the hyperpolarized molecules contain at least two nuclear spins I and S with a scalar coupling J(IS), the polarization of spin I (short for 'inve...

  16. Polymorphisms in PARP, IL1B, IL4, IL10, C1INH, DEFB1, and DEFA4 in meningococcal disease in three populations.

    NARCIS (Netherlands)

    Emonts, M.; Vermont, C.L.; Houwing-Duistermaat, J.J.; Haralambous, E.; Gaast-de Jongh, C.E. van der; Hazelzet, J.A.; Faust, S.N.; Betts, H.; Hermans, P.W.M.; Levin, M.; Groot, R. de


    The pathogenesis of meningococcal infections involves activation of the complement system, proinflammatory and anti-inflammatory mediators, antimicrobial peptides, and apoptosis. We hypothesized that variations in genes encoding these products are involved in the susceptibility to and severity of


    NARCIS (Netherlands)

    Emonts, Marieke; Vermont, Clementien L.; Houwing-Duistermaat, Jeanine J.; Haralambous, Elene; Gaast-de Jongh, Christa E.; Hazelzet, Jan A.; Faust, Saul N.; Betts, Helen; Hermans, Peter W. M.; Levin, Michael; de Groot, Ronald

    The pathogenesis of meningococcal infections involves activation of the complement system, proinflammatory and anti-inflammatory mediators, antimicrobial peptides, and apoptosis. We hypothesized that variations in genes encoding these products are involved in the susceptibility to and severity of

  18. Frequency and clinical, hormonal and ultrasonographic characteristics suggestive of polycystic ovarian syndrome in a group of females with metabolic syndrome; Frecuencia y caracteristicas clinicas, hormonales y ultrasonograficas sugestivas de sindrome de ovarios poliquisticos en un grupo de mujeres con sindrome metabolico

    Energy Technology Data Exchange (ETDEWEB)

    Ovies Carballo, Gisel; Dominguez Alonso, Emma; Verdeja Varela, Olga L; Zamora Recinos, Hugo [Instituto Nacional de Endocrinologia, La Habana (Cuba)


    The polycystic ovarian syndrome is the most frequent endocrine affection in females at reproductive age. Nowadays, it is known that insulin resistance and consequent hyperinsulinism seem to be the basis of the disorders characterizing it. That's why, it is not erroneous to think that in females with metabolic syndrome, whose physiopathological bases are insulin resistance and hyperinsulinism, there may appear clinical, humoral and ultrasonographic elements of the polycystic ovarian syndrome.

  19. Comportamiento metabolico en el periparto de vacas Hartón del Valle, bajo condiciones de trópico bajo Metabolic behaviour in the peripartum period of dairy cows Hartón del Valle creole breed, under tropical conditions

    Directory of Open Access Journals (Sweden)

    Erika Andrea Hernández


    Full Text Available El periodo de periparto o periodo de transición presenta variaciones fisiológicas significativas que inciden en posteriores sucesos productivos (pico de lactancia, reactivación ovárica). El ganado Hartón posee una excelente eficiencia reproductiva (estrecho intervalo entre partos), factor que podría originarse en procesos metabólicos relacionados con un mejor ajuste homeostático. El principal objetivo del presente trabajo fue evaluar la homeostasis en una raza bovina criolla durante el periodo postparto. Para el estudio se emplearon 10 vacas multíparas, muestreadas antes del parto (días 30 y 15 preparto) y diariamente en los tres primeros días del parto; posteriormente a partir del día 5, con intervalos de cinco días y hasta el día 60 postparto. En total para cada animal se analizaron 14 muestras, cada una de ellas correspondió a un periodo analítico. Mediante venipunción coccígea en tubos al vacío con y sin anticoagulante se colectó la muestra de sangre completa. Por centrifugación se obtuvo plasma y suero, los cuales fueron almacenados a -20°C, hasta su análisis. Las determinaciones de hormonas se realizaron mediante radioinmunoanálisis (RIA) de fase sólida. A través de pruebas enzimáticas colorimétricas en equipos automatizados, se determinaron los valores de los metabolitos para cada uno de los periodos definidos. Los valores medios fueron: BHB (β-Hidroxibutirato) 0.39 mmol/L, NEFA (ácidos Grasos No Esterificados) 0.76 mmol/L, triglicéridos 0.42 mmol/L, colesterol 2.43 mmol/L, insulina 4.77 mµl/ml, triyodotironina (T3) 2.69 nmol/L, tetrayodotironina (T4) 57.37 nmol/L, progesterona 5.54 nmol/L, cortisol 32.42 nmol/L. Los valores obtenidos para los diferentes metabolitos se encuentran dentro de los rangos reportados por la literatura para bovinos en condiciones tropicales.The peripartum period or transition period, presents significant physiological changes that affect production in subsequent production events (peak lactation, ovarian resumption). Creole bovine cattle "Hartón del Valle" has an excellent reproductive performance (short iterpartum period); this factor could have been originated from metabolic processes related to an improved homeostatic adjustment. The main aim of this study was to assess the homeostasis in a native cattle breed in the postpartum period. For this study, 10 multiparous cows were used and sampled before birth (days 30 and 15 prepartum) and daily in the first three days of birth, and afterwards from day 5, at intervals of five days and up to-day 60 postpartum. In total, for each animal 14 samples were analyzed which correspond to one analysis period. Using the coccygeal venipuncture technic, in vacuum tubes with and without anticoagulant the complete sample was collected. By centrifugation, plasma and serum were obtained and stored at -20°C until the metabolic analysis was done. Using a radioimmunoassay (RIA) of solid phase, hormone analysis were done. Through enzymatic colorimeter test in automated equipment the values of the metabolites for each of the defined period were determined. The mean values were: BHB (β-Hidroxibutirates) 0.39 mmol/L, NEFA (Non Esterified Fatid Acids) 0.76 mmol/L, triglycerides 0.42 mmol/L, cholesterol 2.43 mmol/L, triiodothyronine (T3) 2.69 nmol/L, tetraiodothyronine (T4) 57.37 nmol/L, insulin 4.77 mµl/ml, progesterone 5.54 nmol/L, cortisol 32.42 nmol/L. The values obtained for the different metabolites were within the biological ranges reported in the literature for cattle of tropical ecosystems.

  20. Synthesis, magnetic and spectral studies of lanthanide(III) chloride complexes of hydrazones of isonicotinic acid hydrazide

    International Nuclear Information System (INIS)

    Agarwal, R.K.; Agarwal, Himanshu; Prasad, Ram


    The synthesis, magnetic and spectral properties of trivalent lanthanide chlorides with N-isonicotinamidobenzalaldimine (INH-BENZ), N-isonicotinamidoanisalaldimine (INH-ANSL) and N-isonicotinamido-p-dimethylaminobenzalaldimine (INH-PDAB) are described. 13 refs., 2 tabs

  1. The effect of temperature on the mucosal IgM antibody response to DNP-KLH in channel catfish (Ictalurus punctatus) (United States)

    Bath immersion remains a practical route for immunizing against disease in channel catfish; however research efforts in this area have revealed variable results when activating mucosal Ab responses with different antigens. This is likely due to a number of factors including the individual species, ...

  2. Strategy-aligned fuzzy approach for market segment evaluation and selection: a modular decision support system by dynamic network process (DNP) (United States)

    Mohammadi Nasrabadi, Ali; Hosseinpour, Mohammad Hossein; Ebrahimnejad, Sadoullah


    In competitive markets, market segmentation is a critical point of business, and it can be used as a generic strategy. In each segment, strategies lead companies to their targets; thus, segment selection and the application of the appropriate strategies over time are very important to achieve successful business. This paper aims to model a strategy-aligned fuzzy approach to market segment evaluation and selection. A modular decision support system (DSS) is developed to select an optimum segment with its appropriate strategies. The suggested DSS has two main modules. The first one is SPACE matrix which indicates the risk of each segment. Also, it determines the long-term strategies. The second module finds the most preferred segment-strategies over time. Dynamic network process is applied to prioritize segment-strategies according to five competitive force factors. There is vagueness in pairwise comparisons, and this vagueness has been modeled using fuzzy concepts. To clarify, an example is illustrated by a case study in Iran's coffee market. The results show that success possibility of segments could be different, and choosing the best ones could help companies to be sure in developing their business. Moreover, changing the priority of strategies over time indicates the importance of long-term planning. This fact has been supported by a case study on strategic priority difference in short- and long-term consideration.

  3. Physical and chemical properties of chromatin and its fragments formed in the rat thymus during postirradiation autolysis and under the influence of DNA-ase and protease on DNP preparations

    International Nuclear Information System (INIS)

    Ermolaeva, N.V.; Vodolazskaya, N.A.


    It has been shown that the thymus chromatin degradation 2-8 hr after irradiation is followed by its cross-splitting and accumulation of several types of fragments differing in the degree of DNA association with the protein. Participation of proteases in the formation of fragments is hardly probable. Acid DNAase is involved in the autolysis perhaps in his maximum later 6 hr after irradiation

  4. Efectos de un programa de tratamiento multidisciplinar en obesos m??rbidos y obesos con comorbilidades candidatos a cirug??a bari??trica


    Delgado Floody, Pedro; Caama??o Navarrete, Felipe; Jerez Mayorga, Daniel; Campos Jara, Christian Alex; Ram??rez Campillo, Rodrigo; Osorio Poblete, Aldo; Alarc??n Hormaz??bal, Manuel; Thuillier Lepeley, Nicole; Saldivia Mansilla, Claudia


    Introducci??n: La obesidad morbida es una enfermedad que debe ser tratada de forma integral (i.e., multi/ interdisciplinar). Para esta condicion la cirugia bariatrica es efectiva y segura en el tratamiento, sin embargo, a mayor peso preoperatorio podria aumentar la morbimortalidad. Objetivo: El objetivo del estudio es determinar los efectos de un programa de tratamiento interdisciplinar sobre parametros metabolicos, antropometricos y la condicion fisica en candidatos a cirugia bariatrica. Mat...

  5. A novel assay to diagnose hereditary angioedema utilizing inhibition of bradykinin-forming enzymes

    DEFF Research Database (Denmark)

    Joseph, Kusumam; Bains, Sonia; Tholanikunnel, Baby G


    . This was evident regardless whether we measured factor XIIa-C1-INH or kallikrein-C1-INH complexes, and the two assays were in close agreement. By contrast, testing the same samples utilizing the commercial method (complex ELISA, Quidel Corp.) revealed levels of C1-INH between 0 and 57% of normal (mean, 38%) and 42...

  6. A versatile and modular quasi optics-based 200 GHz dual dynamic nuclear polarization and electron paramagnetic resonance instrument (United States)

    Siaw, Ting Ann; Leavesley, Alisa; Lund, Alicia; Kaminker, Ilia; Han, Songi


    Solid-state dynamic nuclear polarization (DNP) at higher magnetic fields (>3 T) and cryogenic temperatures (∼2-90 K) has gained enormous interest and seen major technological advances as an NMR signal enhancing technique. Still, the current state of the art DNP operation is not at a state at which sample and freezing conditions can be rationally chosen and the DNP performance predicted a priori, but relies on purely empirical approaches. An important step towards rational optimization of DNP conditions is to have access to DNP instrumental capabilities to diagnose DNP performance and elucidate DNP mechanisms. The desired diagnoses include the measurement of the "DNP power curve", i.e. the microwave (MW) power dependence of DNP enhancement, the "DNP spectrum", i.e. the MW frequency dependence of DNP enhancement, the electron paramagnetic resonance (EPR) spectrum, and the saturation and spectral diffusion properties of the EPR spectrum upon prolonged MW irradiation typical of continuous wave (CW) DNP, as well as various electron and nuclear spin relaxation parameters. Even basic measurements of these DNP parameters require versatile instrumentation at high magnetic fields not commercially available to date. In this article, we describe the detailed design of such a DNP instrument, powered by a solid-state MW source that is tunable between 193 and 201 GHz and outputs up to 140 mW of MW power. The quality and pathway of the transmitted and reflected MWs is controlled by a quasi-optics (QO) bridge and a corrugated waveguide, where the latter couples the MW from an open-space QO bridge to the sample located inside the superconducting magnet and vice versa. Crucially, the versatility of the solid-state MW source enables the automated acquisition of frequency swept DNP spectra, DNP power curves, the diagnosis of MW power and transmission, and frequency swept continuous wave (CW) and pulsed EPR experiments. The flexibility of the DNP instrument centered around the QO MW

  7. A versatile and modular quasi optics-based 200GHz dual dynamic nuclear polarization and electron paramagnetic resonance instrument. (United States)

    Siaw, Ting Ann; Leavesley, Alisa; Lund, Alicia; Kaminker, Ilia; Han, Songi


    Solid-state dynamic nuclear polarization (DNP) at higher magnetic fields (>3T) and cryogenic temperatures (∼ 2-90K) has gained enormous interest and seen major technological advances as an NMR signal enhancing technique. Still, the current state of the art DNP operation is not at a state at which sample and freezing conditions can be rationally chosen and the DNP performance predicted a priori, but relies on purely empirical approaches. An important step towards rational optimization of DNP conditions is to have access to DNP instrumental capabilities to diagnose DNP performance and elucidate DNP mechanisms. The desired diagnoses include the measurement of the "DNP power curve", i.e. the microwave (MW) power dependence of DNP enhancement, the "DNP spectrum", i.e. the MW frequency dependence of DNP enhancement, the electron paramagnetic resonance (EPR) spectrum, and the saturation and spectral diffusion properties of the EPR spectrum upon prolonged MW irradiation typical of continuous wave (CW) DNP, as well as various electron and nuclear spin relaxation parameters. Even basic measurements of these DNP parameters require versatile instrumentation at high magnetic fields not commercially available to date. In this article, we describe the detailed design of such a DNP instrument, powered by a solid-state MW source that is tunable between 193 and 201 GHz and outputs up to 140 mW of MW power. The quality and pathway of the transmitted and reflected MWs is controlled by a quasi-optics (QO) bridge and a corrugated waveguide, where the latter couples the MW from an open-space QO bridge to the sample located inside the superconducting magnet and vice versa. Crucially, the versatility of the solid-state MW source enables the automated acquisition of frequency swept DNP spectra, DNP power curves, the diagnosis of MW power and transmission, and frequency swept continuous wave (CW) and pulsed EPR experiments. The flexibility of the DNP instrument centered around the QO MW

  8. Elucidating the Mechanism of Gain of Toxic Function From Mutant C1 Inhibitor Proteins in Hereditary Angioedema (United States)


    antibodies to 5 specifically blot wild-type C1INH in the pathologic polymers.. A FLAG tag was placed into the wild-type C1INH cDNA located immediately...resulted in decreased secretion of the 3x-FLAG-WT-C1INH when cotransfected with the mutant cDNA . This was an important confirmation of our...C1INH plus mutant C1INH cDNA in the presence or absence of a lactacystin, a proteasome inhibitor. As shown in figure 2, blocking degradation of

  9. Intestinal absorption of dinitrophenyl-lysine and effect of immunization with dinitrophenylated bovine serum albumin

    International Nuclear Information System (INIS)

    Shimura, Fumio; Shimura, Junko; Shimazaki, Shigeki; Hosoya, Norimasa


    The intestinal absorption of dinitrophenyl-lysine (DNP-lys) was studied with a special interest on the role of the immune system in the absorption of small molecules which are recognized as nonself. [ 3 H]-DNP- lys was rapidly absorbed by ligated intestinal loops in situ via a saturable and unique route. When [ 3 H]-DNP-lys was preincubated with the immume serum obtained from rats immunized with dinitrophenylated bovine serum albumin (DNP-BSA), the [ 3 H]-DNP-lys absorption was depressed. The absorption of [ 3 H]-DNP-lys in DNP-BSA-immunized rats was depressed compared to the control. The results obtained suggest that the immune system play a role in avoiding the absorption of small molecules with antigenicity. (author)

  10. Multiple advanced logic gates made of DNA-Ag nanocluster and the application for intelligent detection of pathogenic bacterial genes† †Electronic supplementary information (ESI) available: Chemicals, materials and DNA sequences used in the investigation, the construction of YES, AND, OR, XOR and INH logic gates, CD and PAGE experimental results. See DOI: 10.1039/c7sc05246d (United States)

    Lin, Xiaodong; Deng, Jiankang; Lyu, Yanlong; Qian, Pengcheng; Li, Yunfei


    The integration of multiple DNA logic gates on a universal platform to implement advance logic functions is a critical challenge for DNA computing. Herein, a straightforward and powerful strategy in which a guanine-rich DNA sequence lighting up a silver nanocluster and fluorophore was developed to construct a library of logic gates on a simple DNA-templated silver nanoclusters (DNA-AgNCs) platform. This library included basic logic gates, YES, AND, OR, INHIBIT, and XOR, which were further integrated into complex logic circuits to implement diverse advanced arithmetic/non-arithmetic functions including half-adder, half-subtractor, multiplexer, and demultiplexer. Under UV irradiation, all the logic functions could be instantly visualized, confirming an excellent repeatability. The logic operations were entirely based on DNA hybridization in an enzyme-free and label-free condition, avoiding waste accumulation and reducing cost consumption. Interestingly, a DNA-AgNCs-based multiplexer was, for the first time, used as an intelligent biosensor to identify pathogenic genes, E. coli and S. aureus genes, with a high sensitivity. The investigation provides a prototype for the wireless integration of multiple devices on even the simplest single-strand DNA platform to perform diverse complex functions in a straightforward and cost-effective way. PMID:29675221

  11. Determination of isoniazid concentration in rabbit vertebrae by isotope tracing technique in conjunction with HPLC. (United States)

    Liu, Peng; Fu, Zhaozong; Jiang, Jianming; Yuan, Liang; Lin, Zhen


    Medications compounded with isoniazid (INH) are usually applied to surgical sites at the completion of surgery to locally kill postoperative residual tubercle bacilli. However, the distribution and elimination of INH in the vertebrae in vivo are not known. In this study, isotope tracing was used in conjunction with high-pressure liquid chromatography (HPLC) to address this. INH and technetium-99 m-labeled INH were applied to the vertebrae of rabbits. After 2 and 6 h, osseous tissues containing INH, as determined by radionuclide imaging, were collected for detection with HPLC. The results showed that INH mainly stayed around the vertebrae 6 h after its application and did not permeate widely into the blood or other organs, except for the kidneys. The standard deviations of INH concentrations in the technetium-99 m-INH group were approximately four-fold smaller than those in the INH group. This method of coupling isotope tracing and HPLC can effectively limit experimental error during sample collection, allowing accurate and reliable identification of the concentration levels of INH in osseous tissues in vivo. Copyright © 2013 John Wiley & Sons, Ltd.

  12. N,N'-dinitrosopiperazine--mediated heat-shock protein 70-2 expression is involved in metastasis of nasopharyngeal carcinoma.

    Directory of Open Access Journals (Sweden)

    Zhengke Peng

    Full Text Available N,N'-Dinitrosopiperazine (DNP is invovled in nasopharyngeal carcinoma (NPC development and metastasis, and it shows organ specificity to the nasopharyngeal epithelium. Herein, we demonstrate that DNP induces heat-shock protein (HSP 70-2 expression in NPC cells (6-10B at a non-cytotoxic concentration. DNP induced HSP70-2 expression in a dose- and time- dependent manner, but showed no effect on other HSP70 family members. Furthermore, DNP also increased HSP70-2 RNA transcription through directly binding to the hypoxia-responsive elements (HRE and heat shock elements (HSE located in the HSP70-2 promoter. DNP-mediated HSP70-2 expression might act through enhancing the transcription of HSP70-2 RNA. Importantly, DNP induced motility and invasion of 6-10B cells dose- and time-dependently, and DNP-mediated NPC metastasis was confirmed in nude mice, which showed high HSP70-2 expression in the metastatic tumor tissue. However, the motility and invasion of NPC cells that were stably transfected using short interfering RNA against HSP70-2 could not effectively induce DNP. These results indicate that DNP induces HSP70-2 expression through increasing HSP70-2 transcription, increases the motility and invasion of cells, and promotes NPC tumor metastasis. Therefore, DNP mediated HSP70-2 expression may be an important factor of NPC-high metastasis.

  13. Comparing acquired angioedema with hereditary angioedema (types I/II): findings from the Icatibant Outcome Survey. (United States)

    Longhurst, H J; Zanichelli, A; Caballero, T; Bouillet, L; Aberer, W; Maurer, M; Fain, O; Fabien, V; Andresen, I


    Icatibant is used to treat acute hereditary angioedema with C1 inhibitor deficiency types I/II (C1-INH-HAE types I/II) and has shown promise in angioedema due to acquired C1 inhibitor deficiency (C1-INH-AAE). Data from the Icatibant Outcome Survey (IOS) were analysed to evaluate the effectiveness of icatibant in the treatment of patients with C1-INH-AAE and compare disease characteristics with those with C1-INH-HAE types I/II. Key medical history (including prior occurrence of attacks) was recorded upon IOS enrolment. Thereafter, data were recorded retrospectively at approximately 6-month intervals during patient follow-up visits. In the icatibant-treated population, 16 patients with C1-INH-AAE had 287 attacks and 415 patients with C1-INH-HAE types I/II had 2245 attacks. Patients with C1-INH-AAE versus C1-INH-HAE types I/II were more often male (69 versus 42%; P = 0·035) and had a significantly later mean (95% confidence interval) age of symptom onset [57·9 (51·33-64·53) versus 14·0 (12·70-15·26) years]. Time from symptom onset to diagnosis was significantly shorter in patients with C1-INH-AAE versus C1-INH-HAE types I/II (mean 12·3 months versus 118·1 months; P = 0·006). Patients with C1-INH-AAE showed a trend for higher occurrence of attacks involving the face (35 versus 21% of attacks; P = 0·064). Overall, angioedema attacks were more severe in patients with C1-INH-HAE types I/II versus C1-INH-AAE (61 versus 40% of attacks were classified as severe to very severe; P types I/II, respectively. © 2016 British Society for Immunology.

  14. Potentiation of C1-esterase inhibitor by heparin and interactions with C1s protease as assessed by surface plasmon resonance. (United States)

    Rajabi, Mohsen; Struble, Evi; Zhou, Zhaohua; Karnaukhova, Elena


    Human C1-esterase inhibitor (C1-INH) is a multifunctional plasma protein with a wide range of inhibitory and non-inhibitory properties, mainly recognized as a key down-regulator of the complement and contact cascades. The potentiation of C1-INH by heparin and other glycosaminoglycans (GAGs) regulates a broad spectrum of C1-INH activities in vivo both in normal and disease states. SCOPE OF RESEARCH: We have studied the potentiation of human C1-INH by heparin using Surface Plasmon Resonance (SPR), circular dichroism (CD) and a functional assay. To advance a SPR for multiple-unit interaction studies of C1-INH we have developed a novel (consecutive double capture) approach exploring different immobilization and layout. Our SPR experiments conducted in three different design versions showed marked acceleration in C1-INH interactions with complement protease C1s as a result of potentiation of C1-INH by heparin (from 5- to 11-fold increase of the association rate). Far-UV CD studies suggested that heparin binding did not alter C1-INH secondary structure. Functional assay using chromogenic substrate confirmed that heparin does not affect the amidolytic activity of C1s, but does accelerate its consumption due to C1-INH potentiation. This is the first report that directly demonstrates a significant acceleration of the C1-INH interactions with C1s due to heparin by using a consecutive double capture SPR approach. The results of this study may be useful for further C-INH therapeutic development, ultimately for the enhancement of current C1-INH replacement therapies. Published by Elsevier B.V.

  15. Improved Stability of Tuberculosis Drug Fixed-Dose Combination Using Isoniazid-Caffeic Acid and Vanillic Acid Cocrystal. (United States)

    Battini, Swapna; Mannava, M K Chaitanya; Nangia, Ashwini


    The classic fixed-dose combination (FDC) of 4 tuberculosis drugs, namely rifampicin (RIF), isoniazid (INH), pyrazinamide (PZA), and ethambutol dihydrochloride (EDH) has the twin issues of physical stability and RIF cross-reaction in the 4-FDC. The major reason for these quality issues is the interaction between RIF and INH to yield isonicotinyl hydrazone in drug tablets. Pharmaceutical cocrystals of INH with caffeic acid (CFA) (PZA + EDH + RIF + INH-CFA cocrystal) and vanillic acid (VLA) (PZA + EDH + RIF + INH-VLA cocrystal) are able to stabilize the FDC formulation compared with the reference batch (PZA + EDH + RIF + INH). Stability studies under accelerated humidity and temperature stress conditions of 40°C and 75% relative humidity showed that the physical stability of the cocrystal formulation was superior by powder X-ray diffraction and scanning electron microscopy analysis, and chemical purity was analyzed by high-performance liquid chromatography. Changes in the composition and structure were monitored on samples drawn at 7, 15, 22, and 30 days of storage. FDC-INH-CFA cocrystal batch exhibited greater stability compared with FDC-INH-VLA cocrystal and FDC reference drug batches. The superior stability of INH-CFA cocrystal is attributed to the presence of stronger hydrogen bonds and cyclic O-H⋯O synthon in the crystal structure. Copyright © 2018 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  16. Isoniazid Prophylaxis of Latent Tuberculous Infection among Healthcare Workers in Bamrasnaradura Infectious Diseases Institute

    Directory of Open Access Journals (Sweden)

    Patama Suttha


    Full Text Available Background: Treatment of latent tuberculosis infection (LTBI is one of the essential measures for tuberculosis (TB control. The tuberculin skin test (TST is an important tool for the detection of LTBI and the identification of healthcare workers (HCWs who require chemoprophylaxis. Also, the rate of active TB should be evaluated among HCWs with and without isoniazid (INH prophylactic treatment for LTBI. Objective: To evaluate the rate of active TB disease among HCWs with or without INH prophylaxis for LTBI. Methods: We retrospectively studied the clinical records of HCWs with LTBI at the employee TB screening clinic in Bamrasnaradura Infectious Diseases Institute from January 2008 to December 2010. Voluntary INH prophylaxis was recommended by physicians and nurses at the TB clinic in case of recent positive 2-step TST. The rate of active TB disease in HCWs with and without INH prophylaxis for LTBI was evaluated and followed during a period of 5 years. As well, the compliance and adverse effects of INH prophylaxis were identified by history taking. Results: There were 29 from 113 HCWS (25.7% receiving INH prophylaxis for 6 months (23 HCWs and 9 months (6 HCWs. 2 HCWs in each 6- and 9-month group did not complete INH prophylaxis for LTBI. After 5 years of TST, no case of active TB disease was found in HCWS with or without INH prophylaxis. Moreover, no adverse drug reactions were reported. Conclusion: No active tuberculosis disease was noted between the INH treatment and the control groups.

  17. Dinitrosopiperazine-Mediated Phosphorylated-Proteins Are Involved in Nasopharyngeal Carcinoma Metastasis

    Directory of Open Access Journals (Sweden)

    Gongjun Tan


    Full Text Available N,N'-dinitrosopiperazine (DNP with organ specificity for nasopharyngeal epithelium, is involved in nasopharyngeal carcinoma (NPC metastasis, though its mechanism is unclear. To reveal the pathogenesis of DNP-induced metastasis, immunoprecipitation was used to identify DNP-mediated phosphoproteins. DNP-mediated NPC cell line (6-10B motility and invasion was confirmed. Twenty-six phosphoproteins were increased at least 1.5-fold following DNP exposure. Changes in the expression levels of selected phosphoproteins were verified by Western-blotting analysis. DNP treatment altered the phosphorylation of ezrin (threonine 567, vimentin (serine 55, stathmin (serine 25 and STAT3 (serine 727. Furthermore, it was shown that DNP-dependent metastasis is mediated in part through ezrin at threonine 567, as DNP-mediated metastasis was decreased when threonine 567 of ezrin was mutated. Strikingly, NPC metastatic tumors exhibited a higher expression of phosphorylated-ezrin at threonine 567 than the primary tumors. These findings provide novel insight into DNP-induced NPC metastasis and may contribute to a better understanding of the metastatic mechanisms of NPC tumors.

  18. ORF Alignment: NC_003454 [GENIUS II[Archive

    Lifescience Database Archive (English)


  19. Chief nursing officers' perceptions of the Doctorate of Nursing Practice degree. (United States)

    Swanson, Michelle L; Stanton, Marietta P


    Nurse executives practice in a business environment, which requires a skill set that has traditionally not been included in advanced nursing curriculum. The Doctorate of Nursing Practice (DNP) essentials are designed to address this gap in education while maintaining the focus on advanced nursing practice and executive management competency. Current literature supports the appropriateness of the DNP with practice focus areas of advanced practice specialties and nursing leadership. Although certification and educational bodies, and some professional nursing organizations, have embraced the DNP as the terminal degree for non-research-focused nurses, there remains a gap in the literature in regards to the perceptions of validity of the DNP for nurse executives. The purpose of this capstone project was to investigate the perceptions of practicing chief nursing officers (CNOs) in the acute care setting regarding the application of the DNP degree for nurse leaders. Utilizing an online survey, specific perceptions investigated included application and appropriateness of the DNP in a business-based practice model and managing daily nursing operations. CNOs practicing in the acute care setting differed on their responses regarding whether the DNP should be the recommended or the required degree in CNO development programs. CNOs with tenure responded more positively to the perception that the DNP curricula contains advanced nursing knowledge content appropriate to nurse executive practice. Practicing CNOs in the acute care setting do perceive the DNP as an appropriate degree option for nurse executive roles at aggregate, system, and organizational levels. © 2013 Wiley Periodicals, Inc.

  20. Adherence with isoniazid for prevention of tuberculosis among HIV-infected adults in South Africa

    Directory of Open Access Journals (Sweden)

    Muller F James


    Full Text Available Abstract Background Tuberculosis (TB is the most common opportunistic infection in HIV-infected adults in developing countries. Isoniazid (INH is recommended for treatment of latent TB infection, however non-adherence is common. The purpose of this study was to apply in-house prepared isoniazid (INH urine test strips in a clinical setting, and identify predictors of positive test results in an adherence questionnaire in HIV-infected adults taking INH for prevention of TB. Methods Cross-sectional study of adherence using a questionnaire and urine test strips for detection of INH metabolites at two hospitals in Pietermaritzburg, South Africa. Participants were aged at least 18 years, HIV positive, and receiving INH for prevention of tuberculosis disease. Univariate and multivariate analyses are used to identify factors relevant to adherence. Results 301 consecutive patients were recruited. 28% of participants had negative urine tests. 32 (37.2%, 95% CI25.4, 45.0 of the 86 patients who received INH from peripheral pharmacies said the pharmacy had run out of INH at some time, compared with central hospital pharmacies (p = 0.0001. In univariate analysis, a negative test was associated with self-reported missed INH doses (p = 0.043. Each 12-hour increment since last reported dose increased the likelihood of a negative test by 34% (p = 0.0007. Belief in INH safety was associated with a positive test (p = 0.021. In multivariate analysis, patients who believed INH is important for prevention of TB disease were more likely to be negative (p = 0.0086. Conclusion Adequate drug availability at peripheral pharmacies remains an important intervention for TB prevention. Key questions may identify potentially non-adherent patients. In-house prepared urine tests strips are an effective and cheap method of objectively assessing INH adherence, and could be used an important tool in TB control programs.

  1. International consensus on the diagnosis and management of pediatric patients with hereditary angioedema with C1 inhibitor deficiency. (United States)

    Farkas, H; Martinez-Saguer, I; Bork, K; Bowen, T; Craig, T; Frank, M; Germenis, A E; Grumach, A S; Luczay, A; Varga, L; Zanichelli, A


    The consensus documents published to date on hereditary angioedema with C1 inhibitor deficiency (C1-INH-HAE) have focused on adult patients. Many of the previous recommendations have not been adapted to pediatric patients. We intended to produce consensus recommendations for the diagnosis and management of pediatric patients with C1-INH-HAE. During an expert panel meeting that took place during the 9th C1 Inhibitor Deficiency Workshop in Budapest, 2015 (, pediatric data were presented and discussed and a consensus was developed by voting. The symptoms of C1-INH-HAE often present in childhood. Differential diagnosis can be difficult as abdominal pain is common in pediatric C1-INH-HAE, but also commonly occurs in the general pediatric population. The early onset of symptoms may predict a more severe subsequent course of the disease. Before the age of 1 year, C1-INH levels may be lower than in adults; therefore, it is advisable to confirm the diagnosis after the age of one year. All neonates/infants with an affected C1-INH-HAE family member should be screened for C1-INH deficiency. Pediatric patients should always carry a C1-INH-HAE information card and medicine for emergency use. The regulatory approval status of the drugs for prophylaxis and for acute treatment is different in each country. Plasma-derived C1-INH, recombinant C1-INH, and ecallantide are the only agents licensed for the acute treatment of pediatric patients. Clinical trials are underway with additional drugs. It is recommended to follow up patients in an HAE comprehensive care center. The pediatric-focused international consensus for the diagnosis and management of C1-INH-HAE patients was created. © 2016 The Authors. Allergy Published by John Wiley & Sons Ltd.

  2. The lectin complement pathway serine proteases (MASPs) represent a possible crossroad between the coagulation and complement systems in thromboinflammation

    DEFF Research Database (Denmark)

    Kozarcanin, H; Lood, C; Fog, Lea Munthe


    by AT during clotting without the assistance of heparin. In all other cases the MASPs were, as previously reported, inactivated by C1-INH. In systemic lupus erythematosus patients with thrombotic disease and in polytrauma patients, the levels of activated MASP-1 and MASP-2 in complex with both AT and C1-INH...

  3. ethambutol in the treatment of patients with chronic pulmonary

    African Journals Online (AJOL)


    Feb 13, 1971 ... that INH may have a beneficial effect in patients with primary INH resistance ..... 50, suppl. March, 12. 4. Forbes, M., Kuck, N. A. and Peets, E. A. (1962): J. Bac!., 84. ... Joo LaCQuer, L. M. and Vanden· bergh•• E. (J968): Amer.

  4. International consensus on the diagnosis and management of pediatric patients with hereditary angioedema with C1 inhibitor deficiency

    DEFF Research Database (Denmark)

    Farkas, H; Martinez-Saguer, I; Bork, K


    : The symptoms of C1-INH-HAE often present in childhood. Differential diagnosis can be difficult as abdominal pain is common in pediatric C1-INH-HAE, but also commonly occurs in the general pediatric population. The early onset of symptoms may predict a more severe subsequent course of the disease. Before...

  5. Current scenario

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Current scenario. India , like other parts of the world, is also facing the problem of increase in the incidence of drug resistance in tuberculosis. Multi-drug resistance (MDR, resistance to RIF & INH) and extensively drug resistant strains (X-DR, resistance to RIF, INH, FQs ...

  6. Evaluating the efficacy of subcutaneous C1-esterase inhibitor administration for use in rat models of inflammatory diseases

    NARCIS (Netherlands)

    Emmens, Reindert W.; Naaijkens, Benno A.; Roem, Dorina; Kramer, Klaas; Wouters, Diana; Zeerleder, Sacha; van Ham, Marieke S.; Niessen, Hans W.; Krijnen, Paul A.


    Context: C1-esterase inhibitor (C1-inh) therapy is currently administered to patients with C1-inh deficiency through intravenous injections. The possibility of subcutaneous administration is currently being explored since this would alleviate need for hospitalization and increase mobility and

  7. Specific, sensitive, precise, and rapid functional chromogenic assay of activated first complement component (C1) in plasma

    DEFF Research Database (Denmark)

    Munkvad, S; Jespersen, J; Sidelmann, Johannes Jakobsen


    We present a new functional assay for the first complement component (C1) in plasma, based on its activation by inhibition of the C1-esterase inhibitor (C1-inh) when monospecific antiserum to C1-inh is added to the plasma. After maximal activation, we can determine the concentration of activated ...

  8. Microwave-gated dynamic nuclear polarization

    DEFF Research Database (Denmark)

    Bornet, Aurélien; Pinon, Arthur; Jhajharia, Aditya


    Dissolution dynamic nuclear polarization (D-DNP) has become a method of choice to enhance signals in nuclear magnetic resonance (NMR). Recently, we have proposed to combine cross-polarization (CP) with D-DNP to provide high polarization P((13)C) in short build-up times. In this paper, we show...


    NARCIS (Netherlands)


    The B cell immune response to 2,4-dinitrophenyl (DNP) keyhole limpet hemocyanin was compared in antigen-free, germ-free and conventional BALB/c mice. The numbers of total and of DNP-specific IgM-, IgG- and IgA-secreting cells in the spleen were determined by enzyme-linked immunosorbent plaque assays

  10. Just Care: Learning from and with Graduate Students in a Doctor of Nursing Practice Program (United States)

    Boquet, Elizabeth; Kazer, Meredith; Manister, Nancy; Lucas, Owen; Shaw, Michael; Madaffari, Valerie; Gannett, Cinthia


    In 2010, Fairfield University, a Jesuit Carnegie Masters Level 1 University located in the Northeast, established its first doctoral-level program: the Doctorate of Nursing Practice (DNP). In a developing program such as the DNP, some of the most pressing concerns of current rhetoric and writing in the disciplines align and interact with the…

  11. A Comparison of the Democratic Security Policy in Colombia and Provincial Reconstruction Teams in Iraq (United States)


    program. Republica de Colombia. Departamento Nacional de Planeacion , Porgrama de Desarrollo Alternativo, Documento CONPES 2734-DNP-UDA-UJS, Bogotá...Ministry of Defense, 2003. Republica de Colombia. “Departmento Nacional de Planeacion , Porgrama de Desarrollo Alternativo, Documento CONPES 2734-DNP

  12. Dendroaspis natriuretic peptide binds to the natriuretic peptide clearance receptor

    International Nuclear Information System (INIS)

    Johns, Douglas G.; Ao, Zhaohui; Heidrich, Bradley J.; Hunsberger, Gerald E.; Graham, Taylor; Payne, Lisa; Elshourbagy, Nabil; Lu, Quinn; Aiyar, Nambi; Douglas, Stephen A.


    Dendroaspis natriuretic peptide (DNP) is a newly-described natriuretic peptide which lowers blood pressure via vasodilation. The natriuretic peptide clearance receptor (NPR-C) removes natriuretic peptides from the circulation, but whether DNP interacts with human NPR-C directly is unknown. The purpose of this study was to test the hypothesis that DNP binds to NPR-C. ANP, BNP, CNP, and the NPR-C ligands AP-811 and cANP(4-23) displaced [ 125 I]-ANP from NPR-C with pM-to-nM K i values. DNP displaced [ 125 I]-ANP from NPR-C with nM potency, which represents the first direct demonstration of binding of DNP to human NPR-C. DNP showed high pM affinity for the GC-A receptor and no affinity for GC-B (K i > 1000 nM). DNP was nearly 10-fold more potent than ANP at stimulating cGMP production in GC-A expressing cells. Blockade of NPR-C might represent a novel therapeutic approach in augmenting the known beneficial actions of DNP in cardiovascular diseases such as hypertension and heart failure

  13. Analysis of protein oxidation in serum of fetal and newborn piglets and the influence of iron dextran on induction of protein carbonyls. (United States)

    Methods were employed to evaluate serum biomarkers associated with protein oxidative stress and damage, to determine potential sources of metabolic stress in baby pigs. Protein carbonyls in serum were converted to dinitrophenyl (DNP) derivatives with DNP-hydrazine, precipitated with TCA, extracted i...

  14. Role of p73 Dinucleotide Polymorphism in Prostate Cancer and p73 Protein Isoform Balance

    Directory of Open Access Journals (Sweden)

    L. Michael Carastro


    Full Text Available Background. Molecular markers for prostate cancer (PCa risks are currently lacking. Here we address the potential association of a dinucleotide polymorphism (DNP in exon 2 of the p73 gene with PCa risk/progression and discern any disruption of p73 protein isoforms levels in cells harboring a p73 DNP allele. Methods. We investigated the association between p73 DNP genotype and PCa risk/aggressiveness and survival by fitting logistic regression models in 1,292 incident cases and 682 controls. Results. Although we detected no association between p73 DNP and PCa risk, a significant inverse relationship between p73 DNP and PCa aggressiveness (AT/AT + GC/AT versus GC/GC, OR = 0.55, 95%Cl = 0.31–0.99 was detected. Also, p73 DNP is marginally associated with overall death (dominant model, HR = 0.76, 95%Cl = 0.57–1.00, P=0.053 as well as PCa specific death (HR = 0.69, 95%Cl = 0.45–1.06, P=0.09. Western blot analyses for p73 protein isoforms indicate that cells heterozygous for the p73 DNP have lower levels of ∆Np73 relative to TAp73 (P<0.001. Conclusions. Our findings are consistent with an association between p73 DNP and low risk for PCa aggressiveness by increasing the expressed TAp73/∆Np73 protein isoform ratio.


    NARCIS (Netherlands)


    We previously investigated the primary and secondary responses and hyperimmunization to the T cell-dependent antigen 2,4-dinitrophenyl keyhole limpet hemocyanin (DNP-KLH) in antigen-free (AF), germ-free (GF) and conventional (CV) mice. Both the absolute and relative numbers of DNP-specific

  16. Efficiencies of Low-Level Laser Therapy (LLLT) and Gabapentin in the Management of Peripheral Neuropathy: Diabetic Neuropathy. (United States)

    Abdel-Wahhab, Khaled G; Daoud, Eitedal M; El Gendy, Aliaa; Mourad, Hagar H; Mannaa, Fathia A; Saber, Maha M


    Diabetic neuropathy (DN) is the highly occurred complication of diabetes mellitus; it has been defined as an event of peripheral nerve dysfunction characterized by pain, allodynia, hyperalgesia, and paraesthesia. The current study was conducted to evaluate the efficacy of low-level laser therapy (LLLT) in the management of neuropathy in diabetic rats. The used animals were divided into the following groups: negative control, streptozotocin-induced diabetic rats, and diabetic rats with peripheral neuropathy (DNP) and DNP treated with gabapentin or with LLLT. Behavioral tests were carried out through hotplate test for the determination of pain sensations and the Morris water maze test for spatial reference memory evaluation. Blood samples were collected at the end of treatment for biochemical determinations. In the current study, the latency of hind-paw lick decreased significantly when DNP are treated with gabapentin or LLLT. The Morris water maze test showed that LLLT treatment improved memory that deteriorated in DNP more than gabapentin do. The results of the biochemical study revealed that LLLT could not affect the level of beta-endorphin that decreased in DNP but significantly decreased S100B that rose in DNP. PGE2 and cytokines IL-1β, IL-10, and TNF-α showed significant increase in DNP compared with control group. The gabapentin administration or LLLT application significantly reversed the levels of the mentioned markers towards the normal values of the controls. Levels of serum MDA and nitric oxide increased significantly in the DNP but rGSH showed significant decrease. These markers were improved significantly when the DNP were treated with gabapentin or LLLT. The treatment with gabapentin or LLLT significantly decreased the raised level in total cholesterol in DNP but could not decrease the elevated level of triglycerides, while LDL cholesterol decreased significantly in DNP treated with gabapentin but not affected by LLLT. Values of serum alanine

  17. Safety and Usage of C1-Inhibitor in Hereditary Angioedema

    DEFF Research Database (Denmark)

    Riedl, Marc A; Bygum, Anette; Lumry, William


    , international patient registry documented widespread implementation of pnfC1-INH self-administration outside of a health care setting consistent with current HAE guidelines. These real-world data revealed pnfC1-INH usage for a variety of reasons in patients with HAE and showed a high level of safety regardless...... of this study was to describe safety and usage patterns of pnfC1-INH. METHODS: A multicenter, observational, registry was conducted between 2010 and 2014 at 30 United States and 7 European sites to obtain both prospective (occurring after enrollment) and retrospective (occurring before enrollment) safety...... and usage data on subjects receiving pnfC1-INH for any reason. RESULTS: Of 343 enrolled patients, 318 received 1 or more doses of pnfC1-INH for HAE attacks (11,848 infusions) or for prophylaxis (3142 infusions), comprising the safety population. Median dosages per infusion were 10.8 IU/kg (attack treatment...

  18. Reagent Precoated Targets for Rapid In-Tissue Derivatization of the Anti-Tuberculosis Drug Isoniazid Followed by MALDI Imaging Mass Spectrometry (United States)

    Manier, M. Lisa; Reyzer, Michelle L.; Goh, Anne; Dartois, Veronique; Via, Laura E.; Barry, Clifton E.; Caprioli, Richard M.


    Isoniazid (INH) is an important component of front-line anti-tuberculosis therapy with good serum pharmacokinetics but unknown ability to penetrate tuberculous lesions. However, endogenous background interferences hinder our ability to directly analyze INH in tissues. Chemical derivatization has been successfully used to measure isoniazid directly from tissue samples using matrix-assisted laser desorption/ionization (MALDI) imaging mass spectrometry (IMS). MALDI targets were pretreated with trans-cinnamaldehyde (CA) prior to mounting tissue slices. Isoniazid present in the tissues was efficiently derivatized and the INH-CA product measured by MS/MS. Precoating of MALDI targets allows the tissues to be directly thaw-mounted and derivatized, thus simplifying the preparation. A time-course series of tissues from tuberculosis infected/INH dosed animals were assayed and the MALDI MS/MS response correlates well with the amount of INH determined to be in the tissues by high-performance liquid chromatography (HPLC)-MS/MS.

  19. In Vitro Fertilization Using Luteinizing Hormone-Releasing Hormone Injections Resulted in Healthy Triplets without Increased Attack Rates in a Hereditary Angioedema Case

    Directory of Open Access Journals (Sweden)

    Ceyda Tunakan Dalgıç


    Full Text Available Hereditary angioedema due to C1-inhibitor deficiency (C1-INH-HAE is a rare, autosomal dominant disorder. The management of pregnant patients with C1-INH-HAE is a challenge for the physician. Intravenous plasma-derived nanofiltered C1-INH (pdC1INH is the only recommended option throughout pregnancy, postpartum, and breastfeeding period. In order to increase pregnancy rates, physicians use fertilization therapies increasing endogen levels of estrogens. Therefore, these techniques can provoke an increase in the number and severity of edema attacks in C1-INH-HAE. Our patient is a 32-year-old female, diagnosed with C1-INH-HAE type 1 since 2004. She had been taking danazol 50–200 mg/day for 9 years. Due to her pregnancy plans in 2013, danazol was discontinued. PdC1INH was prescribed regularly for prophylactic purpose. Triplet pregnancy occurred by in vitro fertilization using luteinizing hormone-releasing hormone (LHRH injections. In our patient, LHRH injections were done four times without causing any severe attack during in vitro fertilization. Angioedema did not worsen during pregnancy and delivery due to the prophylactic use of intravenous pdC1INH in our patient. According to the attack frequency and severity, there was no difference between the three pregnancy trimesters. To our knowledge, this is the first published case of C1-INH-HAE receiving in vitro fertilization therapies without any angioedema attacks during pregnancy and delivery and eventually having healthy triplets with the prophylactic use of intravenous pdC1INH.

  20. Effects of new-generation TMEM16A inhibitors on calcium-activated chloride currents in rabbit urethral interstitial cells of Cajal. (United States)

    Fedigan, Stephen; Bradley, Eamonn; Webb, Timothy; Large, Roddy J; Hollywood, Mark A; Thornbury, Keith D; McHale, Noel G; Sergeant, Gerard P


    Interstitial cells of Cajal (ICC) isolated from the rabbit urethra exhibit Ca 2+ -activated Cl - currents (I ClCa ) that are important for the development of urethral tone. Here, we examined if TMEM16A (ANO1) contributed to this activity by examining the effect of "new-generation" TMEM16A inhibitors, CACC inh -A01 and T16A inh -A01, on I ClCa recorded from freshly isolated rabbit urethral ICC (RUICC) and on contractions of intact strips of rabbit urethra smooth muscle. Real-time quantitative PCR experiments demonstrated that TMEM16A was highly expressed in rabbit urethra smooth muscle, in comparison to TMEM16B and TMEM16F. Single-cell RT-PCR experiments revealed that only TMEM16A was expressed in freshly isolated RUICC. Depolarization-evoked I ClCa in isolated RUICC, recorded using voltage clamp, were inhibited by CACC inh -A01 and T16A inh -A01 with IC 50 values of 1.2 and 3.4 μM, respectively. Similarly, spontaneous transient inward currents (STICs) recorded from RUICC voltage clamped at -60 mV and spontaneous transient depolarizations (STDs), recorded in current clamp, were also inhibited by CACC inh -A01 and T16A inh -A01. In contrast, spontaneous Ca 2+ waves in isolated RUICC were only partially reduced by CACC inh -A01 and T16A inh -A01. Finally, neurogenic contractions of strips of rabbit urethra smooth muscle (RUSM), evoked by electric field stimulation (EFS), were also significantly reduced by CACC inh -A01 and T16A inh -A01. These data are consistent with the idea that TMEM16A is involved with CACCs in RUICC and in contraction of rabbit urethral smooth muscle.

  1. Exposure‐Response Model of Subcutaneous C1‐Inhibitor Concentrate to Estimate the Risk of Attacks in Patients With Hereditary Angioedema (United States)

    Tortorici, Michael A.; Pawaskar, Dipti; Pragst, Ingo; Machnig, Thomas; Hutmacher, Matthew; Zuraw, Bruce; Cicardi, Marco; Craig, Timothy; Longhurst, Hilary; Sidhu, Jagdev


    Subcutaneous C1‐inhibitor (HAEGARDA, CSL Behring), is a US Food and Drug Administration (FDA)‐approved, highly concentrated formulation of a plasma‐derived C1‐esterase inhibitor (C1‐INH), which, in the phase III Clinical Studies for Optimal Management in Preventing Angioedema with Low‐Volume Subcutaneous C1‐inhibitor Replacement Therapy (COMPACT) trial, reduced the incidence of hereditary angioedema (HAE) attacks when given prophylactically. Data from the COMPACT trial were used to develop a repeated time‐to‐event model to characterize the timing and frequency of HAE attacks as a function of C1‐INH activity, and then develop an exposure–response model to assess the relationship between C1‐INH functional activity levels (C1‐INH(f)) and the risk of an attack. The C1‐INH(f) values of 33.1%, 40.3%, and 63.1% were predicted to correspond with 50%, 70%, and 90% reductions in the HAE attack risk, respectively, relative to no therapy. Based on trough C1‐INH(f) values for the 40 IU/kg (40.2%) and 60 IU/kg (48.0%) C1‐INH (SC) doses, the model predicted that 50% and 67% of the population, respectively, would see at least a 70% decrease in the risk of an attack. PMID:29316335

  2. Quantitative analysis of crystalline pharmaceuticals in tablets by pattern-fitting procedure using X-ray diffraction pattern. (United States)

    Takehira, Rieko; Momose, Yasunori; Yamamura, Shigeo


    A pattern-fitting procedure using an X-ray diffraction pattern was applied to the quantitative analysis of binary system of crystalline pharmaceuticals in tablets. Orthorhombic crystals of isoniazid (INH) and mannitol (MAN) were used for the analysis. Tablets were prepared under various compression pressures using a direct compression method with various compositions of INH and MAN. Assuming that X-ray diffraction pattern of INH-MAN system consists of diffraction intensities from respective crystals, observed diffraction intensities were fitted to analytic expression based on X-ray diffraction theory and separated into two intensities from INH and MAN crystals by a nonlinear least-squares procedure. After separation, the contents of INH were determined by using the optimized normalization constants for INH and MAN. The correction parameter including all the factors that are beyond experimental control was required for quantitative analysis without calibration curve. The pattern-fitting procedure made it possible to determine crystalline phases in the range of 10-90% (w/w) of the INH contents. Further, certain characteristics of the crystals in the tablets, such as the preferred orientation, size of crystallite, and lattice disorder were determined simultaneously. This method can be adopted to analyze compounds whose crystal structures are known. It is a potentially powerful tool for the quantitative phase analysis and characterization of crystals in tablets and powders using X-ray diffraction patterns. Copyright 2010 Elsevier B.V. All rights reserved.

  3. Tailored release drug delivery system for rifampicin and isoniazid for enhanced bioavailability of rifampicin. (United States)

    Avachat, Amelia M; Bhise, Satish B


    The front line antitubercular drugs rifampicin (RMP) and isoniazid (INH), when co-administered, face the problem of reduced bioavailability of RMP. Stabilization of RMP in the presence of INH under acidic environment may improve the bioavailability of RMP. In vitro degradation studies showed around 15-25% degradation of RMP under the aforesaid conditions if the ratio of RMP: INH is above 1:0.5.This degradation is reduced to less than 10% when the ratio of RMP: INH is below 1:0.25. Based on these findings, an innovative drug delivery system was designed with the immediate release of RMP and tailored prolonged release of INH. The bilayer tablets prepared with this concept were subjected to relative bioavailability studies in healthy human volunteers in an open label, balanced, randomized, single-dose, cross-over study under fasted state. A validated LC-MS/MS bioanalytical method was employed for estimation of RMP and INH in plasma. Bioavailability studies revealed that C(max) and AUC for RMP increased by 18 and 20%, respectively, confirming the above innovative concept. Even in the case of INH, AUC increased significantly by around 30% and thus time above minimum inhibitory concentration (MIC) would also increase, which may result in further improved clinical outcome.

  4. Overview of hereditary angioedema caused by C1-inhibitor deficiency: assessment and clinical management. (United States)

    Bork, K; Davis-Lorton, M


    Hereditary angioedema due to C1-inhibitor deficiency (HAE-C1-INH) is a rare, autosomal-dominant disease. HAE-C1-INH is characterized by recurrent attacks of marked, diffuse, nonpitting and nonpruritic skin swellings, painful abdominal attacks, and laryngeal edema. The extremities and the gastrointestinal tract are most commonly affected. Swelling of the upper respiratory mucosa poses the greatest risk because death from asphyxiation can result from laryngealedema. HAE-C1-INH attacks are variable, unpredictable, and may be induced by a variety of stimuli, including stress or physical trauma. Because the clinical presentation of HAE-C1-INH is similar to other types of angioedema, the condition may be a challenge to diagnose. Accurate identification of HAE-C1-INH is critical in order to avoid asphyxiation by laryngeal edema and to improve the burden of disease. Based on an understanding of the underlying pathophysiology of IHAE-C1-INH, drugs targeted specifically to the disease, such as C1-inhibitor therapy, bradykinin B2-receptor antagonists, and kallikrein-inhibitors, have become available for both treatment and prevention of angioedema attacks. This article reviews the clinical features, differential diagnosis, and current approaches to management of HAE-C1-INH.

  5. Suppression of complement regulatory protein C1 inhibitor in vascular endothelial activation by inhibiting vascular cell adhesion molecule-1 action

    International Nuclear Information System (INIS)

    Zhang, Haimou; Qin, Gangjian; Liang, Gang; Li, Jinan; Chiu, Isaac; Barrington, Robert A.; Liu, Dongxu


    Increased expression of adhesion molecules by activated endothelium is a critical feature of vascular inflammation associated with the several diseases such as endotoxin shock and sepsis/septic shock. Our data demonstrated complement regulatory protein C1 inhibitor (C1INH) prevents endothelial cell injury. We hypothesized that C1INH has the ability of an anti-endothelial activation associated with suppression of expression of adhesion molecule(s). C1INH blocked leukocyte adhesion to endothelial cell monolayer in both static assay and flow conditions. In inflammatory condition, C1INH reduced vascular cell adhesion molecule (VCAM-1) expression associated with its cytoplasmic mRNA destabilization and nuclear transcription level. Studies exploring the underlying mechanism of C1INH-mediated suppression in VCAM-1 expression were related to reduction of NF-κB activation and nuclear translocation in an IκBα-dependent manner. The inhibitory effects were associated with reduction of inhibitor IκB kinase activity and stabilization of the NF-κB inhibitor IκB. These findings indicate a novel role for C1INH in inhibition of vascular endothelial activation. These observations could provide the basis for new therapeutic application of C1INH to target inflammatory processes in different pathologic situations

  6. Rapid detection of multidrug-resistant Mycobacterium tuberculosis using the malachite green decolourisation assay (United States)

    Coban, Ahmet Yilmaz; Uzun, Meltem


    Early detection of drug resistance in Mycobacterium tuberculosis isolates allows for earlier and more effective treatment of patients. The aim of this study was to investigate the performance of the malachite green decolourisation assay (MGDA) in detecting isoniazid (INH) and rifampicin (RIF) resistance in M. tuberculosis clinical isolates. Fifty M. tuberculosis isolates, including 19 multidrug-resistant, eight INH-resistant and 23 INH and RIF-susceptible samples, were tested. The sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV) and agreement of the assay for INH were 92.5%, 91.3%, 92.5%, 91.3% and 92%, respectively. Similarly, the sensitivity, specificity, PPV, NPV and agreement of the assay for RIF were 94.7%, 100%, 100%, 96.8% and 98%, respectively. There was a major discrepancy in the tests of two isolates, as they were sensitive to INH by the MGDA test, but resistant by the reference method. There was a minor discrepancy in the tests of two additional isolates, as they were sensitive to INH by the reference method, but resistant by the MGDA test. The drug susceptibility test results were obtained within eight-nine days. In conclusion, the MGDA test is a reliable and accurate method for the rapid detection of INH and RIF resistance compared with the reference method and the MGDA test additionally requires less time to obtain results. PMID:24402143

  7. Rapid detection of multidrug-resistant Mycobacterium tuberculosis using the malachite green decolourisation assay

    Directory of Open Access Journals (Sweden)

    Ahmet Yilmaz Coban


    Full Text Available Early detection of drug resistance in Mycobacterium tuberculosis isolates allows for earlier and more effective treatment of patients. The aim of this study was to investigate the performance of the malachite green decolourisation assay (MGDA in detecting isoniazid (INH and rifampicin (RIF resistance in M. tuberculosis clinical isolates. Fifty M. tuberculosis isolates, including 19 multidrug-resistant, eight INH-resistant and 23 INH and RIF-susceptible samples, were tested. The sensitivity, specificity, positive predictive value (PPV, negative predictive value (NPV and agreement of the assay for INH were 92.5%, 91.3%, 92.5%, 91.3% and 92%, respectively. Similarly, the sensitivity, specificity, PPV, NPV and agreement of the assay for RIF were 94.7%, 100%, 100%, 96.8% and 98%, respectively. There was a major discrepancy in the tests of two isolates, as they were sensitive to INH by the MGDA test, but resistant by the reference method. There was a minor discrepancy in the tests of two additional isolates, as they were sensitive to INH by the reference method, but resistant by the MGDA test. The drug susceptibility test results were obtained within eight-nine days. In conclusion, the MGDA test is a reliable and accurate method for the rapid detection of INH and RIF resistance compared with the reference method and the MGDA test additionally requires less time to obtain results.

  8. Bis-gadolinium complexes for solid effect and cross effect dynamic nuclear polarization

    Energy Technology Data Exchange (ETDEWEB)

    Kaushik, Monu; Corzilius, Bjoern [Goethe-Universitaet Frankfurt am Main, Institut fuer Physikalische und Theoretische Chemie, Institut fuer Biophysikalische Chemie und Biomolekulares Magnetresonanzzentrum (BMRZ) (Germany); Qi, Mian; Godt, Adelheid [Fakultaet fuer Chemie und Centrum fuer Molekulare Materialien (CM2), Universitaet Bielefeld (Germany)


    High-spin complexes act as polarizing agents (PAs) for dynamic nuclear polarization (DNP) in solid-state NMR spectroscopy and feature promising aspects towards biomolecular DNP. We present a study on bis(Gd-chelate)s which enable cross effect (CE) DNP owing to spatial confinement of two dipolar-coupled electron spins. Their well-defined Gd..Gd distances in the range of 1.2-3.4 nm allowed us to elucidate the Gd..Gd distance dependence of the DNP mechanism and NMR signal enhancement. We found that Gd..Gd distances above 2.1 nm result in solid effect DNP while distances between 1.2 and 2.1 nm enable CE for {sup 1}H, {sup 13}C, and {sup 15}N nuclear spins. We compare 263 GHz electron paramagnetic resonance (EPR) spectra with the obtained DNP field profiles and discuss possible CE matching conditions within the high-spin system and the influence of dipolar broadening of the EPR signal. Our findings foster the understanding of the CE mechanism and the design of high-spin PAs for specific applications of DNP. (copyright 2017 Wiley-VCH Verlag GmbH and Co. KGaA, Weinheim)

  9. Low-temperature dynamic nuclear polarization at 9.4 T with a 30 mW microwave source. (United States)

    Thurber, Kent R; Yau, Wai-Ming; Tycko, Robert


    Dynamic nuclear polarization (DNP) can provide large signal enhancements in nuclear magnetic resonance (NMR) by transfer of polarization from electron spins to nuclear spins. We discuss several aspects of DNP experiments at 9.4 T (400 MHz resonant frequency for (1)H, 264 GHz for electron spins in organic radicals) in the 7-80K temperature range, using a 30 mW, frequency-tunable microwave source and a quasi-optical microwave bridge for polarization control and low-loss microwave transmission. In experiments on frozen glycerol/water doped with nitroxide radicals, DNP signal enhancements up to a factor of 80 are observed (relative to (1)H NMR signals with thermal equilibrium spin polarization). The largest sensitivity enhancements are observed with a new triradical dopant, DOTOPA-TEMPO. Field modulation with a 10 G root-mean-squared amplitude during DNP increases the nuclear spin polarizations by up to 135%. Dependencies of (1)H NMR signal amplitudes, nuclear spin relaxation times, and DNP build-up times on the dopant and its concentration, temperature, microwave power, and modulation frequency are reported and discussed. The benefits of low-temperature DNP can be dramatic: the (1)H spin polarization is increased approximately 1000-fold at 7 K with DNP, relative to thermal polarization at 80K. (c) 2010 Elsevier Inc. All rights reserved.

  10. Low-Temperature Dynamic Nuclear Polarization at 9.4 Tesla With a 30 Milliwatt Microwave Source (United States)

    Thurber, Kent R.; Yau, Wai-Ming; Tycko, Robert


    Dynamic nuclear polarization (DNP) can provide large signal enhancements in nuclear magnetic resonance (NMR) by transfer of polarization from electron spins to nuclear spins. We discuss several aspects of DNP experiments at 9.4 Tesla (400 MHz resonant frequency for 1H, 264 GHz for electron spins in organic radicals) in the 7–80 K temperature range, using a 30 mW, frequency-tunable microwave source and a quasi-optical microwave bridge for polarization control and low-loss microwave transmission. In experiments on frozen glycerol/water doped with nitroxide radicals, DNP signal enhancements up to a factor of 80 are observed (relative to 1H NMR signals with thermal equilibrium spin polarization). The largest sensitivity enhancements are observed with a new triradical dopant, DOTOPA-TEMPO. Field modulation with a 10 G root-mean-squared amplitude during DNP increases the nuclear spin polarizations by up to 135%. Dependencies of 1H NMR signal amplitudes, nuclear spin relaxation times, and DNP build-up times on the dopant and its concentration, temperature, microwave power, and modulation frequency are reported and discussed. The benefits of low-temperature DNP can be dramatic: the 1H spin polarization is increased approximately 1000-fold at 7 K with DNP, relative to thermal polarization at 80 K. PMID:20392658

  11. The evolution of a doctor of nursing practice capstone process: programmatic revisions to improve the quality of student projects. (United States)

    Nelson, Joan M; Cook, Paul F; Raterink, Ginger


    The past several years have seen explosive growth in the number of doctor of nursing practice (DNP) degree programs offered by colleges of nursing in the United States. Through a process of trial and error since 2005, the faculty at the University of Colorado, College of Nursing, have revised the course structure and procedures related to the DNP capstone project to improve the quality and usefulness of these student projects. Efforts have focused on educating and involving all nursing faculty in the DNP capstone process, distinguishing between competencies for our PhD and DNP projects, clearly aligning the DNP capstone project with quality improvement methods rather than with research, working with our campus institutional review board to clarify regulatory review requirements for quality improvement studies, developing a review committee to oversee DNP students' projects, and structuring our sequential course requirements to encourage students' professional presentations and publications. Our current capstone process reflects 7 years of iterative work, which we summarize in this article in hopes that it will help institutions currently in the process of developing a DNP program. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. Approaches to a markedly increased sensitivity of the radioimmunoassay for thyrotropin-releasing hormone by derivatization

    Energy Technology Data Exchange (ETDEWEB)

    Visser, T J; Klootwijk, W [Erasmus Universiteit, Rotterdam (Netherlands). Dept. of Internal Medicine 3 and Clinical Endocrinology


    Studies on the specificity of the antisera obtained suggested that the sensitivity of the radioimmunoassay for TRH may be increased substantially by prior conversion of the hormone into dinitrophenylene derivatives. To test this possibility, several TRH-Dnp derivatives were prepared by reaction of TRH with equimolar amounts of 1,5-difluoro-2,4-dinitrobenzene yielding N/sup im/-(5-fluoro-2,4-dinitrophenyl)TRH. This intermediate was reacted with ammonia, histamine, tyramine or N/sup ..cap alpha../-acetyl-lysine methyl ester (N/sup ..cap alpha../Ac-LysOMe) to yield the respective unsubstituted and N-substituted N/sup im/-(5-amino-2,4-dinitrophenyl)TRH derivatives: TRH-Dnp-NH/sub 2/, TRH-Dnp-histamine, TRH-Dnp-tyramine and TRH-Dnp-N/sup ..cap alpha../Ac-Lys-OMe. N/sup im/-(2,4-Dinitrophenyl)TRH was prepared similarly by reaction of TRH with 1-fluoro-2,4-dinitrobenzene. The products were isolated by means of high-performance liquid chromatography (HPLC) and were found to be pure by HPLC and thin-layer chromatography using several solvent systems. TRH-Dnp-histamine and TRH-Dnp-tyramine were labelled with /sup 125/I using the chloramine-T method. The labelled products were purified to homogeneity by ion-exchange chromography on SP-Sephadex and adsorption chromatography on Sephadex LH-20, respectively, and were found by HPLC to be pure.

  13. Utilizing Team Debate to Increase Student Abilities for Mentoring and Critical Appraisal of Global Health Care in Doctor of Nursing Practice Programs. (United States)

    Elliott, Naomi; Farnum, Karen; Beauchesne, Michelle


    Although graduates of doctor of nursing practice (DNP) programs are expected to demonstrate competence in advanced clinical scholarship, mentoring, and leadership, little is published about how team debate on a global health care topic supports DNP student learning and skill development. This article reports on an illuminative evaluation of DNP student learning experiences of team debate in the context of a 2-week international school program in Ireland. A focused illuminative evaluation approach involving a cohort of seven DNP students, who had participated in an international school team debate, was used. Data were collected using a Web-based qualitative questionnaire designed to elicit in-depth reflective accounts of DNP students' learning experiences. Content analysis revealed that team debate on a global health care topic enhanced learning in relation to fostering critical thinking and critical appraisal skills; encouraging teamwork; providing opportunities for mentoring, relationship building, and socialization into profession; and, from the DNP student perspective, increasing knowledge and global understanding of health care. This evaluation provides insights for nurse educators into the benefits of introducing team debate as a group activity to enhancing scholarly inquiry and mentoring skills of DNP students. Further research to evaluate team debate in other nurse education programs is needed. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. The effect of motion on dynamic nuclear polarization: A new theoretical development

    International Nuclear Information System (INIS)

    Coffino, A.R.


    Dynamic Nuclear Polarization (DNP) is a magnetic resonance technique which uses two different radiation sources: a radiofrequency field and microwave field to radiate nuclei and electrons, respectively. The DNP experiment probes the nature of the interaction between nuclei and electrons. The maximum of the resonance signal from the nucleus is plotted as a function of microwave frequency for the case of the microwaves on and off. The DNP signal is the ratio of these two signals and is termed the enhancement of the nuclear signal. This thesis considers the theory of the DNP signal based on the density matrix formulation of the Stochastic Liouville Equation, which incorporates the spin-spin interactions, spin-field interactions and a stochastic dynamics process which modulates these interactions. The case of one electron coupled to one spin one-half nucleus is considered. Such a formulation has never been developed. The thesis demonstrates that previous partial theories have attempted to incorporate dynamics have been incorrect. This theoretical development demonstrates, for the first time, how dynamics affects the DNP lineshapes. This theory predicts that DNP spectra change smoothly from the no motion to the fast motion region, and reproduces the known analytic answers in both the no-motion and the fast-motion limit. The most important observation of the results is that a DNP signal for a motional rate in the intermediate motional region looks like a superposition of a no-motion and fast-motion signal

  15. Dynamic Nuclear Polarization and other magnetic ideas at EPFL. (United States)

    Bornet, Aurélien; Milani, Jonas; Wang, Shutao; Mammoli, Daniele; Buratto, Roberto; Salvi, Nicola; Segaw, Takuya F; Vitzthum, Veronika; Miéville, Pascal; Chinthalapalli, Srinivas; Perez-Linde, Angel J; Carnevale, Diego; Jannin, Sami; Caporinia, Marc; Ulzega, Simone; Rey, Martial; Bodenhausen, Geoffrey


    Although nuclear magnetic resonance (NMR) can provide a wealth of information, it often suffers from a lack of sensitivity. Dynamic Nuclear Polarization (DNP) provides a way to increase the polarization and hence the signal intensities in NMR spectra by transferring the favourable electron spin polarization of paramagnetic centres to the surrounding nuclear spins through appropriate microwave irradiation. In our group at EPFL, two complementary DNP techniques are under investigation: the combination of DNP with magic angle spinning at temperatures near 100 K ('MAS-DNP'), and the combination of DNP at 1.2 K with rapid heating followed by the transfer of the sample to a high-resolution magnet ('dissolution DNP'). Recent applications of MAS-DNP to surfaces, as well as new developments of magnetization transfer of (1)H to (13)C at 1.2 K prior to dissolution will illustrate the work performed in our group. A second part of the paper will give an overview of some 'non-enhanced' activities of our laboratory in liquid- and solid-state NMR.

  16. Clinical characteristics and treatment outcomes of patients with low- and high-concentration isoniazid-monoresistant tuberculosis.

    Directory of Open Access Journals (Sweden)

    Tsai-Yu Wang

    Full Text Available BACKGROUND: Isoniazid (INH resistance is now the most common type of tuberculosis (TB infection resistance worldwide. The aim of this study was to evaluate the clinical characteristics and treatment outcomes of patients with low- and high-concentration INH-monoresistant TB. METHODS: One hundred and thirty-four patients with culture-confirmed INH-monoresistant TB during 2006 January to 2007 December were retrospectively enrolled. INH resistance was classified as either low-concentration or high-concentration resistance according to the critical concentrations of 0.2 µg/mL or 1 µg/mL of INH, respectively. The patients' clinical outcomes, treatment regimens, and treatment duration were analyzed. RESULTS: The treatment success rates between low- and high-concentration INH-resistant TB were similar (81.8% vs. 86.7%. The treatment regimens and treatment duration were similar between both groups. Only a minor percentage of the patients in both groups received 6-month treatment regimens (low vs. high concentration resistance, 9.1% vs. 13.3%; respectively, p = 0.447 The most common reason for treatment duration longer than 6 months was pyrazinamide given for less than 6 months, followed by a delay in clinical response to treatment. Multivariable analysis showed that prior tuberculosis treatment (Odds ratio, 2.82, 95% C.I., 1.02-7.77, p = 0.045 was the only independent risk factor for unsuccessful treatment outcome. CONCLUSION: Different levels of INH resistance did not affect the treatment outcomes of patients with INH-monoresistant tuberculosis. Prolonged Rifampin-containing regimens may achieve those good outcomes in patients with low- and high-concentration INH-monoresistant TB.

  17. Metabolism of isoniazid by neutrophil myeloperoxidase leads to isoniazid-NAD(+) adduct formation: A comparison of the reactivity of isoniazid with its known human metabolites. (United States)

    Khan, Saifur R; Morgan, Andrew G M; Michail, Karim; Srivastava, Nutan; Whittal, Randy M; Aljuhani, Naif; Siraki, Arno G


    The formation of isonicotinyl-nicotinamide adenine dinucleotide (INH-NAD(+)) via the mycobacterial catalase-peroxidase enzyme, KatG, has been described as the major component of the mode of action of isoniazid (INH). However, there are numerous human peroxidases that may catalyze this reaction. The role of neutrophil myeloperoxidase (MPO) in INH-NAD(+) adduct formation has never been explored; this is important, as neutrophils are recruited at the site of tuberculosis infection (granuloma) through infected macrophages' cell death signals. In our studies, we showed that neutrophil MPO is capable of INH metabolism using electron paramagnetic resonance (EPR) spin-trapping and UV-Vis spectroscopy. MPO or activated human neutrophils (by phorbol myristate acetate) catalyzed the oxidation of INH and formed several free radical intermediates; the inclusion of superoxide dismutase revealed a carbon-centered radical which is considered to be the reactive metabolite that binds with NAD(+). Other human metabolites, including N-acetyl-INH, N-acetylhydrazine, and hydrazine did not show formation of carbon-centered radicals, and either produced no detectable free radicals, N-centered free radicals, or superoxide, respectively. A comparison of these free radical products indicated that only the carbon-centered radical from INH is reducing in nature, based on UV-Vis measurement of nitroblue tetrazolium reduction. Furthermore, only INH oxidation by MPO led to a new product (λmax=326nm) in the presence of NAD(+). This adduct was confirmed to be isonicotinyl-NAD(+) using LC-MS analysis where the intact adduct was detected (m/z=769). The findings of this study suggest that neutrophil MPO may also play a role in INH pharmacological activity. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. The relationship between anxiety and quality of life in children with hereditary angioedema. (United States)

    Kessel, Aharon; Farkas, Henriette; Kivity, Shmuel; Veszeli, Nóra; Kőhalmi, Kinga V; Engel-Yeger, Batya


    The severe life-threatening characteristics of hereditary angioedema (HAE) with C1-inhibitor deficiency (C1-INH-HAE) can affect anxiety levels among pediatric patients. This emotional burden together with the physical restrictions of C1-INH-HAE may decrease children's health-related quality of life (HRQoL). (i) To compare anxiety state and trait between children with C1-INH-HAE and healthy controls; (ii) to examine the relationship between the level of anxiety of children with C1-INH-HAE, their disease activity/affected sites and their HRQoL; and (iii) to predict the HRQoL of children with C1-INH-HAE based on their anxiety level and disease activity/affected sites METHODS: Thirty-three children with C1-INH-HAE (aged 5-18 years) and 52 healthy controls were recruited from Israel and Hungary. All children completed the State-Trait Anxiety Inventory for Children (STAIC), the Pediatric Quality of Life Inventory (Peds-QL) demographic questionnaire and a disease activity and site questionnaire . Disease activity was defined as the number of attacks in last year. Both anxiety state and trait were significantly higher among children with C1-INH-HAE as compared to the controls (44.74±10.56 vs 38.76±10.67, Panxiety state (F 56,2 =4.69, P=.001) and trait (F 56,2 =9.06, Panxiety trait was correlated with the number of angioedema-affected sites (r=.52, P=.003). The presence of HAE attacks and higher anxiety trait predicted a lower HRQoL in children with C1-INH-HAE. C1-INH-HAE children have higher anxiety trait and state, which correlate with reduced HRQoL domains. © 2017 EAACI and John Wiley and Sons A/S. Published by John Wiley and Sons Ltd.

  19. Carprofen-induced oxidative stress in mitochondria of the colonic mucosa of the dog. (United States)

    Snow, Lynne A; McConnico, Rebecca S; Morgan, Timothy W; Hartmann, Erica; Davidson, Jacqueline R; Hosgood, Giselle


    The purpose of the study was to compare the conductance and mannitol permeability of canine colonic mucosa in response to carprofen or 2,4-dinitrophenol (DNP) with or without tempol pretreatment. Ten colonic mucosa sections per dog were mounted in Ussing chambers. Treatments were done in duplicate. Mucosa was exposed to carprofen (200 μg/mL) or DNP (0.25 mM), both with and without tempol (1 mM) pretreatment. Conductance was calculated every 15 min for 240 min. Mannitol flux was calculated over 3 consecutive 60-minute periods. Histology or electron microscopy was done after exposure. Conductance over time, mannitol flux, frequency of histologic categories, and electron microscopic changes were analyzed for treatment effects. The mean ± standard deviation (SD) conductance over time for carprofen or DNP-treated colons was not significantly different from control regardless of tempol pretreatment. Period 3 mannitol fluxes for carprofen and DNP-treated colon were not significantly different, but were greater than control. Period 3 mannitol flux for tempol + carprofen was significantly less than tempol + DNP-treated colon. Sloughing of cells and erosions were seen in the mucosa of carprofen-treated colon. Mitochondrial damage was seen more often in carprofen-treated than DNP-treated or control colon. Tempol pretreatment resulted in more ruptured mitochondria in the carprofen-treated colon; however, other mitochondrial changes were not significantly affected by tempol pretreatment in either carprofen or DNP treated colon. Treatment with carprofen or DNP increased the mannitol flux, but pretreatment with tempol mitigated the carprofen effect. It is apparent that structural mitochondrial damage occurs in the canine colonic mucosa after carprofen and DNP exposure.

  20. Notes from the field: national shortage of isoniazid 300 mg tablets. (United States)


    On November 16, 2012, the Illinois State tuberculosis (TB) program notified CDC's Division of Tuberculosis Elimination of a national shortage of 300 mg tablets of the antituberculosis medication isoniazid (INH). Subsequently, other state TB programs (e.g., California, Indiana, Maryland, New York, Virginia, and Wisconsin) reported difficulty obtaining INH 300 mg tablets. Other programs (e.g., San Diego) have experienced difficulties obtaining at least one of the commercially available anti-TB preparations containing the combination of rifampin and INH (IsonaRif [VersaPharm]).

  1. Magneto and spectral behaviour of lanthanide(III) perchlorate complexes of n-isonicotinamidoanisalaldimine

    International Nuclear Information System (INIS)

    Agarwal, R.K.; Agarwal, Himanshu; Sarin, R.K.


    A new series of lanthanide(III) perchlorate complexes of N-isonicotinamidoanisalaldimine (INH-SAL) with the general composition (Ln(INH-SAL) 4 )(ClO) 4 ) 3 (Ln=La, Pr, Nd, Sm, Gd, Tb or Dy) were synthesized and characterized by elemental analyses, conductance, molecular weight, infrared and electronic spectral data. INH-SAL acts as a bidentate (N, O) chelating agents. The tentative coordination number eight has been assigned. Thermal behaviour of some representative chelates has also been investigated. (author). 14 refs., 2 tabs

  2. Depressed activation of the lectin pathway of complement in hereditary angioedema

    DEFF Research Database (Denmark)

    Varga, L; Széplaki, G; Laki, J


    ) in three complement activation pathways. Functional activity of the CP, LP and AP were measured in the sera of 68 adult patients with hereditary angioedema (HAE) and 64 healthy controls. In addition, the level of C1q, MBL, MBL-associated serine protease-2 (MASP-2), C4-, C3- and C1INH was measured...... by standard laboratory methods. MBL-2 genotypes were determined by polymerase chain reaction. Besides the complement alterations (low CP and C1INH activity, low C4-, C1INH concentrations), which characterize HAE, the level of MASP-2 was also lower (P = 0.0001) in patients compared with controls. Depressed LP...

  3. Synthesis and antimycobacterial activity of isoniazid derivatives from renewable fatty acids. (United States)

    Rodrigues, Marieli O; Cantos, Jéssica B; D'Oca, Caroline R Montes; Soares, Karina L; Coelho, Tatiane S; Piovesan, Luciana A; Russowsky, Dennis; da Silva, Pedro A; D'Oca, Marcelo G Montes


    This work describes the synthesis of a series of fatty acid hydrazide derivatives of isoniazid (INH). The compounds were tested against Mycobacterium tuberculosis H37Rv (ATCC 27294) as well as INH-resistant (ATCC 35822 and 1896 HF) and rifampicin-resistant (ATCC 35338) M. tuberculosis strains. The fatty acid derivatives of INH showed high antimycobacterial potency against the studied strains, which is desirable for a pharmaceutical compound, suggesting that the increased lipophilicity of isoniazid plays an important role in its antimycobacterial activity. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Safety of C1-Esterase Inhibitor in Acute and Prophylactic Therapy of Hereditary Angioedema

    DEFF Research Database (Denmark)

    Busse, Paula; Bygum, Anette; Edelman, Jonathan


    BACKGROUND: The plasma-derived, pasteurized C1-inhibitor (C1-INH) concentrate, Berinert has a 4-decade history of use in hereditary angioedema (HAE), with a substantial literature base that demonstrates safety and efficacy. Thromboembolic events have rarely been reported with C1-INH products......, typically with off-label use or at supratherapeutic doses. OBJECTIVES: Active surveillance of safety and clinical usage patterns of pasteurized C1-inhibitor concentrate and the more recent pasteurized, nanofiltered C1-INH, with a particular interest in thromboembolic events. METHODS: A registry...

  5. On complex compounds of molybdenum(5) with nicotinic amide, isonicotinic acid hydrazide and some of its derivatives

    International Nuclear Information System (INIS)

    Azizov, M.M.; Kushakbaev, A.; Parpiev, N.A.


    Oxychloride complexes of molybdenum (5) with polyfunctional ligands (L), namely with nicotinamide (NA), isonicotinic acid hydrazide (INH) and its derivatives (ftivazide, saluzide and larusan) have been synthesized and investigated. In ethanol all the ligands independently of their molar ratio form with MoCl 5 a non-electrolite compound MoOCl 3 xL 2 . Infrared spectra of the complexes suggest that in Mo(5) complexeS with NA and INH the central atom is bound through the pyridine nitrogen, whereas in the complexes with INH derivatives it is bound throught the carbonyl group oxygen

  6. The ethics curriculum for doctor of nursing practice programs. (United States)

    Peirce, Anne Griswold; Smith, Jennifer A


    Ethical questions dealt with by nurses who have Doctor of Nursing Practice (DNP) degrees include traditional bioethical questions, but also business and legal ethics. Doctorally prepared nurses are increasingly in positions to make ethical decisions rather than to respond to decisions made by others. The traditional master's-degree advanced practice nursing curriculum does not address the extended expertise and decision-making skills needed by DNP practitioners as they face these new types of ethical dilemmas. We propose that a curricular framework that addresses clinical, research, business, and legal ethics is needed by all DNP students.

  7. Frozen Acrylamide Gels as Dynamic Nuclear Polarization Matrices.

    KAUST Repository

    Viger-Gravel, Jasmine; Berruyer, Pierrick; Gajan, David; Basset, Jean-Marie; Lesage, Anne; Tordo, Paul; Ouari, Olivier; Emsley, Lyndon


    We show that aqueous acrylamide gels can be used to provide dynamic nuclear polarization (DNP) NMR signal enhancements of around 200 at 9.4 T and 100 K. The enhancements are shown to increase with cross linker concentration and low concentrations of the AMUPol biradical. We show that this DNP matrix can be used in situations where conventional incipient wetness methods fail, such as to obtain DNP surface enhanced NMR spectra from inorganic nanoparticles. In particular, we obtain 113Cd spectra from CdTe-COOH NPs in minutes. The spectra clearly indicate a highly-disordered cadmium rich surface.

  8. Doctor of Nursing Practice: The Role of the Advanced Practice Nurse. (United States)

    Walker, Deborah Kirk; Polancich, Shea


    To explore the evolution and emerging roles of the Doctor of Nursing Practice (DNP) Advanced Practice Nurse (APN). Published peer reviewed literature, cancer-related professional resources, and Web-based resources. The DNP education has prepared the APN for process improvement initiatives, providing quality care, and evidence-based practice translation, which are critical with the emerging trends in this complex health care environment. DNP-prepared APNs have the opportunity to impact oncology care across the cancer trajectory, in various settings, and in various innovative roles as entrepreneurs. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Frozen Acrylamide Gels as Dynamic Nuclear Polarization Matrices.

    KAUST Repository

    Viger-Gravel, Jasmine


    We show that aqueous acrylamide gels can be used to provide dynamic nuclear polarization (DNP) NMR signal enhancements of around 200 at 9.4 T and 100 K. The enhancements are shown to increase with cross linker concentration and low concentrations of the AMUPol biradical. We show that this DNP matrix can be used in situations where conventional incipient wetness methods fail, such as to obtain DNP surface enhanced NMR spectra from inorganic nanoparticles. In particular, we obtain 113Cd spectra from CdTe-COOH NPs in minutes. The spectra clearly indicate a highly-disordered cadmium rich surface.

  10. On the numerical solution of fault trees

    International Nuclear Information System (INIS)

    Demichela, M.; Piccinini, N.; Ciarambino, I.; Contini, S.


    In this paper an account will be given of the numerical solution of the logic trees directly extracted from the Recursive Operability Analysis. Particular attention will be devoted to the use of the NOT and INH logic gates for correct logical representation of Fault Trees prior to their quantitative resolution. The NOT gate is needed for correct logical representation of events when both non-intervention and correct intervention of a protective system may lead to a Top Event. The INH gate must be used to correctly represent the time link between two events that are both necessary, but must occur in sequence. Some numerical examples will be employed to show both the correct identification of the events entering the INH gates and how use of the AND gate instead of the INH gate leads to overestimation of the probability of occurrence of a Top Event

  11. Effects of treatment on free radicals in patients with pulmonary ...

    African Journals Online (AJOL)

    fense against Mycobacteria, enhanced ROS generation may promote tissue injury .... time of analysis for electrolytes and free radicals. The sputum of patients .... with high level INH resistance in MTB by using real time technology PCR with 3 ...

  12. Three cases of intentional isoniazid overdose – a life-threatening ...

    African Journals Online (AJOL)

    . Lactic acidosis is thought to occur by INH inhibition of lactate dehydrogenase via its effect on the co-enzyme nicotinamide adenine dinucleotide. This is exacerbated by increased lactate production during seizures. For the management of an ...

  13. Tinidazole (United States)

    ... suspension (liquid) prepared by the pharmacist and a tablet to take by mouth. It is usually taken ... inhibitors such as indinavir (Crixivan) and ritonavir (Norvir); isoniazid (INH, Nydrazid); lithium (Lithobid); metronidazole (Flagyl); nefazodone (Serzone); ...

  14. Effect of Bushen yixue decoction on follicular development in ...

    African Journals Online (AJOL)

    its possible mechanism of action. Hai-Ning ... Conclusion: BSY promotes follicular development of anovulatory rats via regulating INH-ACT-FS .... the National Institutes for Food and Drug Control .... Finally, the protein bands were detected by.

  15. Segmental tuberculosis verrucosa cutis

    Directory of Open Access Journals (Sweden)

    Hanumanthappa H


    Full Text Available A case of segmental Tuberculosis Verrucosa Cutis is reported in 10 year old boy. The condition was resembling the ascending lymphangitic type of sporotrichosis. The lesions cleared on treatment with INH 150 mg daily for 6 months.

  16. Penetration of isoniazid, rifampicin and pyrazinamide in tuberculous pleural effusion and psoas abscess

    NARCIS (Netherlands)

    Jutte, P.C.; Rutgers, S.R.; Van Altena, R.; Uges, D.R.; van Horn, J.R.


    SETTING: Tuberculosis Centre, University Medical Centre, Groningen, The Netherlands. OBJECTIVES: To study intralesional concentrations of isoniazid (INH), rifampicin (RMP) and pyrazinamide (PZA) in tuberculous pleural effusions and psoas abscesses, and to compare these to reference serum values and

  17. Penetration of isoniazid, refampicin and pyrazinamide in tuberculous pleural effusion and psoas abscess

    NARCIS (Netherlands)

    Jutte, PC; Rutgers, [No Value; Van Altena, R; Uges, DR; Van Horn, [No Value

    SETTING: Tuberculosis Centre, University Medical Centre, Groningen, The Netherlands. OBJECTIVES: To study intralesional concentrations of isoniazid (INH), rifampicin (RMP) and pyrazinamide (PZA) in tuberculous pleural effusions and psoas abscesses, and to compare these to reference serum values and

  18. Health Effects Associated with Inhalation Exposure to Diesel Emission Generated with and without CeO2 Nano Fuel Additive (United States)

    Diesel exhaust (DE) exposure induces adverse cardiopulmonary effects. Addition of nano cerium (Ce) oxide additive to diesel fuel (DECe) increases fuel burning efficiency resulting in altered emission characteristics and potentially altered health effects. We hypothesized that inh...

  19. Neuropathy secondary to drugs (United States)

    ... Paclitaxel Suramin Vincristine Drugs used to fight infections: Chloroquine Dapsone Isoniazid (INH), used against tuberculosis Metronidazole (Flagyl) ... to treat gout) Disulfiram (used to treat alcohol use) Arsenic Gold Symptoms Symptoms may include any of ...

  20. Lindane (United States)

    ... from getting scabies or lice. You should only use lindane if you already have these conditions, not ... acid (NegGram), norfloxacin (Noroxin), ofloxacin (Floxin), and penicillin; chloroquine sulfate; isoniazid (INH, Laniazid, Nydrazid); medications for mental ...

  1. Choroidal thickness alterations in diabetic nephropathy patients with early or no diabetic retinopathy. (United States)

    Kocasarac, Can; Yigit, Yavuz; Sengul, Erkan; Sakalar, Yildirim Beyazit


    To assess changes in choroidal thickness (CT) in diabetes patients with and without diabetic nephropathy using enhanced depth imaging spectral domain optical coherence tomography (EDI-OCT). Thirty-five type 2 diabetes patients with a diagnosis of diabetic nephropathy (DNP) in nephrology department and 35 type 2 diabetes patients without nephropathy (non-DNP) were included in our prospective study consecutively. The control group comprised 34 healthy individuals. CT measurements were recorded under the fovea and at 1500 µm from the foveal center in the nasal and temporal sides. The study parameters also included age, refractive error, axial length, intraocular pressure, HbA1c, glomerular filtration rate and proteinuria amount. The subfoveal, temporal and nasal choroidal thickness was noted to be thinner in patients with DNP compared with non-DNP and normal subjects (p diabetic patients when diabetic nephropathy accompanies diabetes mellitus.

  2. Polarisation properties of irradiated ammonia (NH3 and ND3) at 1 K and 25 kG

    International Nuclear Information System (INIS)

    Riechert, H.


    Dynamic Nuclear Polarisation (DNP) of irradiated ammonia was examined in some detail at 1 K and 25 kG. In continuation of earlier studies conducted in Bonn, it was attempted to gain information about the prevailing mechanism of DNP in this material. Therefore the frequency dependence of DNP in NH 3 , of deuterons and unsubstituted protons in ND 3 , as well as the polarising time tau and the relaxation time T 1 in NH 3 were measured. Also the shape of the deuteron polarisation signal observed in ND 3 is discussed. The polarisation measurements in ND 3 rule out the equal spin temperature (EST) behaviour of proton and deuteron DNP that is observed in most of the currently used target materials. It is attempted to explain the observations with a differential solid state effect model. Results of calculations for NH 3 and ND 3 incorporating the measured EPR-spectra are presented. (orig.)

  3. Recommendations for Creating a Resource Management System to Support the Colombian Army in a New Environment (United States)


    World Military and Social Expenditures. 1991. 4. Republica de Colombia, Departamento Nacional de Planeacion , Documento DNP-2570-UIP-MinHacienda...Center, The Planning. Programmina and Budgeting System (PPBS), Technical Report, 1991. Departamento Nacional de Planeacion de Colombia, Plan ouinuenal

  4. Dynamic nuclear polarization for magnetic resonance imaging. An in-bore approach

    Energy Technology Data Exchange (ETDEWEB)

    Krummenacker, Jan G.


    In this thesis, the development of an in-bore liquid state DNP polarizer for MRI applications operating in flow through mode at a magnetic field strength of 1.5 T was described. After an introductory chapter 1 and a chapter 2 on the theoretical background, chapter 3 dealt chiefly with the challenge of performing liquid state DNP at a high magnetic field of 9.2 T. The feasibility of performing liquid state DNP at this field was demonstrated for various solvents, as well as for metabolites in solution. Chapter 4 then moved to the aim of this work, the application of liquid state DNP for MRI experiments. It introduced the rationale of our approach, the hardware that was developed and demonstrated its performance in a clinical MRI tomograph.

  5. Using implementation science as the core of the doctor of nursing practice inquiry project. (United States)

    Riner, Mary E


    New knowledge in health care needs to be implemented for continuous practice improvement. Doctor of nursing practice (DNP) programs are designed to increase clinical practice knowledge and leadership skills of graduates. This article describes an implementation science course developed in a DNP program focused on advancing graduates' capacity for health systems leadership. Curriculum and course development are presented, and the course is mapped to depict how the course objectives and assignments were aligned with DNP Essentials. Course modules with rational are described, and examples of how students implemented assignments are provided. The challenges of integrating this course into the life of the school are discussed as well as steps taken to develop faculty for this capstone learning experience. This article describes a model of using implementation science to provide DNP students an experience in designing and managing an evidence-based practice change project. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Decomposition of nuclear chromatin of the rat thymus within the postirradiation period

    International Nuclear Information System (INIS)

    Vodolazskaya, N.A.


    Fractional composition of DNP histones and of salt extracts of the thymus of rats has been studied 2 to 8 hours after γ-irradiation with 600r (Co 60 ). Simultaneously, histones/DNA ratio has been determined in the nucleoprotein and in its salt-soluble fragments after fractionation of the salt extracts on phosphatecellulose. It has been shown that 2 to 4 hours following the exposure, the histone/DNA ratio in DNP preparations does not vary from the control. Subsequently, however, it slightly decreases. It has been found that the postirradiation DNP decomposition is accompanied by the formation of fragments which, in addition to a free DNA, comprise complexes with the decreased and increased histone/DNA ratio as compared to the original DNP

  7. Dynamic nuclear polarization for magnetic resonance imaging. An in-bore approach

    International Nuclear Information System (INIS)

    Krummenacker, Jan G.


    In this thesis, the development of an in-bore liquid state DNP polarizer for MRI applications operating in flow through mode at a magnetic field strength of 1.5 T was described. After an introductory chapter 1 and a chapter 2 on the theoretical background, chapter 3 dealt chiefly with the challenge of performing liquid state DNP at a high magnetic field of 9.2 T. The feasibility of performing liquid state DNP at this field was demonstrated for various solvents, as well as for metabolites in solution. Chapter 4 then moved to the aim of this work, the application of liquid state DNP for MRI experiments. It introduced the rationale of our approach, the hardware that was developed and demonstrated its performance in a clinical MRI tomograph.

  8. Is IQG-607 a Potential Metallodrug or Metallopro-Drug With a Defined Molecular Target in Mycobacterium tuberculosis?

    Directory of Open Access Journals (Sweden)

    Bruno L. Abbadi


    Full Text Available The emergence of strains of Mycobacterium tuberculosis resistant to isoniazid (INH has underscored the need for the development of new anti-tuberculosis agents. INH is activated by the mycobacterial katG-encoded catalase-peroxidase, forming an acylpyridine fragment that is covalently attached to the C4 of NADH. This isonicotinyl-NAD adduct inhibits the activity of 2-trans-enoyl-ACP(CoA reductase (InhA, which plays a role in mycolic acid biosynthesis. A metal-based INH analog, Na3[FeII(CN5(INH]·4H2O, IQG-607, was designed to have an electronic redistribution on INH moiety that would lead to an intramolecular electron transfer to bypass KatG activation. HPLC and EPR studies showed that the INH moiety can be oxidized by superoxide or peroxide yielding similar metabolites and isonicotinoyl radical only when associated to IQG-607, thereby supporting redox-mediated drug activation as a possible mechanism of action. However, IQG-607 was shown to inhibit the in vitro activity of both wild-type and INH-resistant mutant InhA enzymes in the absence of KatG activation. IQG-607 given by the oral route to M. tuberculosis-infected mice reduced lung lesions. Experiments using early and late controls of infection revealed a bactericidal activity for IQG-607. HPLC and voltammetric methods were developed to quantify IQG-607. Pharmacokinetic studies showed short half-life, high clearance, moderate volume of distribution, and low oral bioavailability, which was not altered by feeding. Safety and toxic effects of IQG-607 after acute and 90-day repeated oral administrations in both rats and minipigs showed occurrence of mild to moderate toxic events. Eight multidrug-resistant strains (MDR-TB were resistant to IQG-607, suggesting an association between katG mutation and increasing MIC values. Whole genome sequencing of three spontaneous IQG-607-resistant strains harbored katG gene mutations. MIC measurements and macrophage infection experiments with a laboratorial

  9. International consensus on the diagnosis and management of pediatric patients with hereditary angioedema with C1 inhibitor deficiency


    Farkas, H.; Martinez?Saguer, I.; Bork, K.; Bowen, T.; Craig, T.; Frank, M.; Germenis, A. E.; Grumach, A. S.; Luczay, A.; Varga, L.; Zanichelli, A.; Aberer, Werner; Andrejevic, Sladjana; Aygoeren?P?rs?n, Emel; Banerji, Alena


    BACKGROUND: The consensus documents published to date on hereditary angioedema with C1 inhibitor deficiency (C1-INH-HAE) have focused on adult patients. Many of the previous recommendations have not been adapted to pediatric patients. We intended to produce consensus recommendations for the diagnosis and management of pediatric patients with C1-INH-HAE.METHODS: During an expert panel meeting that took place during the 9th C1 Inhibitor Deficiency Workshop in Budapest, 2015 (, ped...

  10. Electrocatalytic Determination of Isoniazid by a Glassy Carbon Electrode Modified with Poly (Eriochrome Black T)


    Karim Asadpour-Zeynali; Venus Baghalabadi


    In this work poly eriochrome black T (EBT) was electrochemically synthesized on the glassy carbon electrode as electrode modifier. On the modified electrode, voltammetric behavior of isoniazid (INH) was investigated. The poly (EBT)-modified glassy carbon electrode has excellent electrocatalytic ability for the electrooxidation of isoniazid. This fact was appeared as a reduced overpotential of INH oxidation in a wide operational pH range from 2 to 13. It has been found that the catalytic peak ...

  11. An open, randomized, parallel-group study to compare the efficacy and safety profile of inhaled human insulin (exubera) with meformin as adjunctive therapy in patients with type 2 diabetes poorly controlled on a sulfonylurea: response to mikhail and cope

    DEFF Research Database (Denmark)

    Barnett, Anthony H.; Dreyer, Manfred; Lange, Peter


    OBJECTIVE: To compare the efficacy and safety profile of adding inhaled human insulin (INH; Exubera) or metformin to sulfonylurea monotherapy in patients with poorly controlled type 2 diabetes. RESEARCH DESIGN AND METHODS: We performed an open-label, parallel, 24-week, multicenter trial. At week -1......: In patients with type 2 diabetes poorly controlled on a sulfonylurea (A1C >9.5%), the addition of premeal INH significantly improves glycemic control compared with adjunctive metformin and is well tolerated....

  12. C1-esterase inhibitor protects against early vein graft remodeling under arterial blood pressure. (United States)

    Krijnen, Paul A J; Kupreishvili, Koba; de Vries, Margreet R; Schepers, Abbey; Stooker, Wim; Vonk, Alexander B A; Eijsman, Leon; Van Hinsbergh, Victor W M; Zeerleder, Sacha; Wouters, Diana; van Ham, Marieke; Quax, Paul H A; Niessen, Hans W M


    Arterial pressure induced vein graft injury can result in endothelial loss, accelerated atherosclerosis and vein graft failure. Inflammation, including complement activation, is assumed to play a pivotal role herein. Here, we analyzed the effects of C1-esterase inhibitor (C1inh) on early vein graft remodeling. Human saphenous vein graft segments (n=8) were perfused in vitro with autologous blood either supplemented or not with purified human C1inh at arterial pressure for 6h. The vein segments and perfusion blood were analyzed for cell damage and complement activation. In addition, the effect of purified C1inh on vein graft remodeling was analyzed in vivo in atherosclerotic C57Bl6/ApoE3 Leiden mice, wherein donor caval veins were interpositioned in the common carotid artery. Application of C1inh in the in vitro perfusion model resulted in significantly higher blood levels and significantly more depositions of C1inh in the vein wall. This coincided with a significant reduction in endothelial loss and deposition of C3d and C4d in the vein wall, especially in the circular layer, compared to vein segments perfused without supplemented C1inh. Administration of purified C1inh significantly inhibited vein graft intimal thickening in vivo in atherosclerotic C57Bl6/ApoE3 Leiden mice, wherein donor caval veins were interpositioned in the common carotid artery. C1inh significantly protects against early vein graft remodeling, including loss of endothelium and intimal thickening. These data suggest that it may be worth considering its use in patients undergoing coronary artery bypass grafting. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  13. Solid Polarized Targets and Applications

    International Nuclear Information System (INIS)

    Crabb, D. G.


    Examples are given of dynamically polarized targets in use today and how the subsystems have changed to meet the needs of todays experiments. Particular emphasis is placed on target materials such as ammonia and lithium deuteride. Recent polarization studies of irradiated materials such as butanol, deuterated butanol, polyethylene, and deuterated polyethylene are presented. The operation of two non-DNP target systems as well as applications of traditional DNP targets are briefly discussed

  14. Using a single tablet daily to treat latent tuberculosis infection in Brazil: bioequivalence of two different isoniazid formulations (300 mg and 100 mg) demonstrated by a sensitive and rapid high-performance liquid chromatography-tandem mass spectrometry method in a randomised, crossover study. (United States)

    Daher, André; Pitta, Luciana; Santos, Tereza; Barreira, Draurio; Pinto, Douglas


    The recommended treatment for latent tuberculosis (TB) infection in adults is a daily dose of isoniazid (INH) 300 mg for six months. In Brazil, INH was formulated as 100 mg tablets. The treatment duration and the high pill burden compromised patient adherence to the treatment. The Brazilian National Programme for Tuberculosis requested a new 300 mg INH formulation. The aim of our study was to compare the bioavailability of the new INH 300 mg formulation and three 100 mg tablets of the reference formulation. We conducted a randomised, single dose, open label, two-phase crossover bioequivalence study in 28 healthy human volunteers. The 90% confidence interval for the INH maximum concentration of drug observed in plasma and area under the plasma concentration vs. time curve from time zero to the last measurable concentration "time t" was 89.61-115.92 and 94.82-119.44, respectively. The main limitation of our study was that neither adherence nor the safety profile of multiple doses was evaluated. To determine the level of INH in human plasma, we developed and validated a sensitive, simple and rapid high-performance liquid chromatography-tandem mass spectrometry method. Our results showed that the new formulation was bioequivalent to the 100 mg reference product. This finding supports the use of a single 300 mg tablet daily strategy to treat latent TB. This new formulation may increase patients' adherence to the treatment and quality of life.

  15. Design and evaluation of enteric-coated tablets for rifampicin and isoniazid combinations. (United States)

    Wang, Yongjun; Liu, Hongzhuo; Liu, Kai; Sun, Jin; He, Zhonggui


    In order to improve the bioavailability of rifampicin (RIF) from rifampicin and isoniazid (INH) combination formulations, the physicochemical characteristics of RIF, stability of RIF in different pH buffers in the presence of INH, as well as the effect of particle size of RIF materials on the dissolution rate were investigated. On the basis of the above examinations, enteric-coated tablets for RIF and INH combinations were designed and prepared. RIF showed low solubility and high apparent distribution coefficient in the intestinal pH (pH 4.0-7.4). With the decrease in pH, the degradation of RIF increase and the presence of INH deepen the degradation. Enteric-coated tablets were prepared after grinding the RIF materials by dry granulation technique. The pharmacokinetics of RIF and INH of self-made enteric-coated tablets in dogs were studied by comparing with the reference tablets. The AUC(0-48) of RIF in both reference and test tablets were 304.77 ± 42.27 and 353.79 ± 31.63 µg·h·mL(-1), respectively. The AUC(0-48) of INH in both reference and test tablets were 17.14 ± 8.59 and 19.62 ± 10.57 µg·h·mL(-1), respectively. Enteric-coated tablets may minimize the decomposition of RIF in gastrointestinal tract and improve the bioavailability.

  16. Evaluation of four colourimetric susceptibility tests for the rapid detection of multidrug-resistant Mycobacterium tuberculosisisolates

    Directory of Open Access Journals (Sweden)

    Ahmet Yilmaz Coban


    Full Text Available The purpose of this study is to evaluate four rapid colourimetric methods, including the resazurin microtitre assay (REMA, malachite green decolourisation assay (MGDA, microplate nitrate reductase assay (MNRA and crystal violet decolourisation assay (CVDA, for the rapid detection of multidrug-resistant (MDR tuberculosis. Fifty Mycobacterium tuberculosisisolates were used in this study. Eighteen isolates were MDR, two isolates were only resistant to isoniazid (INH and the remaining isolates were susceptible to both INH and rifampicin (RIF. INH and RIF were tested in 0.25 µg/mL and 0.5 µg/mL, respectively. The agar proportion method was used as a reference method. MNRA and REMA were performed with some modifications. MGDA and CVDA were performed as defined in the literature. The agreements of the MNRA for INH and RIF were 96% and 94%, respectively, while the agreement of the other assays for INH and RIF were 98%. In this study, while the specificities of the REMA, MGDA and CVDA were 100%, the specificity of the MNRA was lower than the others (93.3% for INH and 90.9% for RIF. In addition, while the sensitivity of the MNRA was 100%, the sensitivities of the others were lower than that of the MNRA (from 94.1-95%. The results were reported on the seventh-10th day of the incubation. All methods are reliable, easy to perform, inexpensive and easy to evaluate and do not require special equipment.

  17. Using a single tablet daily to treat latent tuberculosis infection in Brazil: bioequivalence of two different isoniazid formulations (300 mg and 100 mg demonstrated by a sensitive and rapid high-performance liquid chromatography-tandem mass spectrometry method in a randomised, crossover study

    Directory of Open Access Journals (Sweden)

    André Daher


    Full Text Available The recommended treatment for latent tuberculosis (TB infection in adults is a daily dose of isoniazid (INH 300 mg for six months. In Brazil, INH was formulated as 100 mg tablets. The treatment duration and the high pill burden compromised patient adherence to the treatment. The Brazilian National Programme for Tuberculosis requested a new 300 mg INH formulation. The aim of our study was to compare the bioavailability of the new INH 300 mg formulation and three 100 mg tablets of the reference formulation. We conducted a randomised, single dose, open label, two-phase crossover bioequivalence study in 28 healthy human volunteers. The 90% confidence interval for the INH maximum concentration of drug observed in plasma and area under the plasma concentration vs. time curve from time zero to the last measurable concentration “time t” was 89.61-115.92 and 94.82-119.44, respectively. The main limitation of our study was that neither adherence nor the safety profile of multiple doses was evaluated. To determine the level of INH in human plasma, we developed and validated a sensitive, simple and rapid high-performance liquid chromatography-tandem mass spectrometry method. Our results showed that the new formulation was bioequivalent to the 100 mg reference product. This finding supports the use of a single 300 mg tablet daily strategy to treat latent TB. This new formulation may increase patients’ adherence to the treatment and quality of life.

  18. Significance of Coexisting Mutations on Determination of the Degree of Isoniazid Resistance in Mycobacterium tuberculosis Strains. (United States)

    Karunaratne, Galbokka Hewage Roshanthi Eranga; Wijesundera, Sandhya Sulochana; Vidanagama, Dhammika; Adikaram, Chamila Priyangani; Perera, Jennifer


    The emergence and spread of drug-resistant tuberculosis (TB) pose a threat to TB control in Sri Lanka. Isoniazid (INH) is a key element of the first-line anti-TB treatment regimen. Resistance to INH is mainly associated with point mutations in katG, inhA, and ahpC genes. The objective of this study was to determine mutations of these three genes in INH-resistant Mycobacterium tuberculosis (MTb) strains in Sri Lanka. Complete nucleotide sequence of the three genes was amplified by polymerase chain reaction and subjected to DNA sequencing. Point mutations in the katG gene were identified in 93% isolates, of which the majority (78.6%) were at codon 315. Mutations at codons 212 and 293 of the katG gene have not been reported previously. Novel mutations were recognized in the promoter region of the inhA gene (C deletion at -34), fabG1 gene (codon 27), and ahpC gene (codon 39). Single S315T mutation in the katG gene led to a high level of resistance, while a low level of resistance with high frequency (41%) was observed when katG codon 315 coexisted with the mutation at codon 463. Since most of the observed mutations of all three genes coexisted with the katG315 mutation, screening of katG315 mutations will be a useful marker for molecular detection of INH resistance of MTb in Sri Lanka.

  19. Dynamic nuclear polarization of nucleic acid with endogenously bound manganese

    International Nuclear Information System (INIS)

    Wenk, Patricia; Kaushik, Monu; Richter, Diane; Vogel, Marc; Suess, Beatrix; Corzilius, Björn


    We report the direct dynamic nuclear polarization (DNP) of 13 C nuclei of a uniformly [ 13 C, 15 N]-labeled, paramagnetic full-length hammerhead ribozyme (HHRz) complex with Mn 2+ where the enhanced polarization is fully provided by the endogenously bound metal ion and no exogenous polarizing agent is added. A 13 C enhancement factor of ε = 8 was observed by intra-complex DNP at 9.4 T. In contrast, “conventional” indirect and direct DNP experiments were performed using AMUPol as polarizing agent where we obtained a 1 H enhancement factor of ε ≈ 250. Comparison with the diamagnetic (Mg 2+ ) HHRz complex shows that the presence of Mn 2+ only marginally influences the (DNP-enhanced) NMR properties of the RNA. Furthermore two-dimensional correlation spectra ( 15 N– 13 C and 13 C– 13 C) reveal structural inhomogeneity in the frozen, amorphous state indicating the coexistence of several conformational states. These demonstrations of intra-complex DNP using an endogenous metal ion as well as DNP-enhanced MAS NMR of RNA in general yield important information for the development of new methods in structural biology

  20. Activated microglia in the spinal cord underlies diabetic neuropathic pain. (United States)

    Wang, Dongmei; Couture, Réjean; Hong, Yanguo


    Diabetes mellitus is an increasingly common chronic medical condition. Approximately 30% of diabetic patients develop neuropathic pain, manifested as spontaneous pain, hyperalgesia and allodynia. Hyperglycemia induces metabolic changes in peripheral tissues and enhances oxidative stress in nerve fibers. The damages and subsequent reactive inflammation affect structural properties of Schwann cells and axons leading to the release of neuropoietic mediators, such as pro-inflammatory cytokines and pro-nociceptive mediators. Therefore, diabetic neuropathic pain (DNP) shares some histological features and underlying mechanisms with traumatic neuropathy. DNP displays, however, other distinct features; for instance, sensory input to the spinal cord decreases rather than increasing in diabetic patients. Consequently, development of central sensitization in DNP involves mechanisms that are distinct from traumatic neuropathic pain. In DNP, the contribution of spinal cord microglia activation to central sensitization and pain processes is emerging as a new concept. Besides inflammation in the periphery, hyperglycemia and the resulting production of reactive oxygen species affect the local microenvironment in the spinal cord. All these alterations could trigger resting and sessile microglia to the activated phenotype. In turn, microglia synthesize and release pro-inflammatory cytokines and neuroactive molecules capable of inducing hyperactivity of spinal nociceptive neurons. Hence, it is imperative to elucidate glial mechanisms underlying DNP for the development of effective therapeutic agents. The present review highlights the recent developments regarding the contribution of spinal microglia as compelling target for the treatment of DNP. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Dynamic nuclear polarization of nucleic acid with endogenously bound manganese

    Energy Technology Data Exchange (ETDEWEB)

    Wenk, Patricia [University of Tübingen, Werner Siemens Imaging Center and Department of Preclinical Imaging and Radiopharmacy (Germany); Kaushik, Monu; Richter, Diane [Goethe University, Institute of Physical und Theoretical Chemistry, Institute of Biophysical Chemistry und Center for Biomolecular Magnetic Resonance (BMRZ) (Germany); Vogel, Marc; Suess, Beatrix [Technical University Darmstadt, Department of Biology (Germany); Corzilius, Björn, E-mail: [Goethe University, Institute of Physical und Theoretical Chemistry, Institute of Biophysical Chemistry und Center for Biomolecular Magnetic Resonance (BMRZ) (Germany)


    We report the direct dynamic nuclear polarization (DNP) of {sup 13}C nuclei of a uniformly [{sup 13}C,{sup 15}N]-labeled, paramagnetic full-length hammerhead ribozyme (HHRz) complex with Mn{sup 2+} where the enhanced polarization is fully provided by the endogenously bound metal ion and no exogenous polarizing agent is added. A {sup 13}C enhancement factor of ε = 8 was observed by intra-complex DNP at 9.4 T. In contrast, “conventional” indirect and direct DNP experiments were performed using AMUPol as polarizing agent where we obtained a {sup 1}H enhancement factor of ε ≈ 250. Comparison with the diamagnetic (Mg{sup 2+}) HHRz complex shows that the presence of Mn{sup 2+} only marginally influences the (DNP-enhanced) NMR properties of the RNA. Furthermore two-dimensional correlation spectra ({sup 15}N–{sup 13}C and {sup 13}C–{sup 13}C) reveal structural inhomogeneity in the frozen, amorphous state indicating the coexistence of several conformational states. These demonstrations of intra-complex DNP using an endogenous metal ion as well as DNP-enhanced MAS NMR of RNA in general yield important information for the development of new methods in structural biology.

  2. Multiple metabolic hits converge on CD36 as novel mediator of tubular epithelial apoptosis in diabetic nephropathy.

    Directory of Open Access Journals (Sweden)

    Katalin Susztak


    Full Text Available Diabetic nephropathy (DNP is a common complication of type 1 and type 2 diabetes mellitus and the most common cause of kidney failure. While DNP manifests with albuminuria and diabetic glomerulopathy, its progression correlates best with tubular epithelial degeneration (TED and interstitial fibrosis. However, mechanisms leading to TED in DNP remain poorly understood.We found that expression of scavenger receptor CD36 coincided with proximal tubular epithelial cell (PTEC apoptosis and TED specifically in human DNP. High glucose stimulated cell surface expression of CD36 in PTECs. CD36 expression was necessary and sufficient to mediate PTEC apoptosis induced by glycated albumins (AGE-BSA and CML-BSA and free fatty acid palmitate through sequential activation of src kinase, and proapoptotic p38 MAPK and caspase 3. In contrast, paucity of expression of CD36 in PTECs in diabetic mice with diabetic glomerulopathy was associated with normal tubular epithelium and the absence of tubular apoptosis. Mouse PTECs lacked CD36 and were resistant to AGE-BSA-induced apoptosis. Recombinant expression of CD36 in mouse PTECs conferred susceptibility to AGE-BSA-induced apoptosis.Our findings suggest a novel role for CD36 as an essential mediator of proximal tubular apoptosis in human DNP. Because CD36 expression was induced by glucose in PTECs, and because increased CD36 mediated AGE-BSA-, CML-BSA-, and palmitate-induced PTEC apoptosis, we propose a two-step metabolic hit model for TED, a hallmark of progression in DNP.

  3. Characterization of mutations causing rifampicin and isoniazid resistance of Mycobacterium tuberculosis in Syria. (United States)

    Madania, Ammar; Habous, Maya; Zarzour, Hana; Ghoury, Ifad; Hebbo, Barea


    In order to characterize mutations causing rifampicin and isoniazid resistance of M. tuberculosis in Syria, 69 rifampicin resistant (Rif(r)) and 72 isoniazid resistant (Inh(r)) isolates were screened for point mutations in hot spots of the rpoB, katG and inhA genes by DNA sequencing and real time PCR. Of 69 Rif(r) isolates, 62 (90%) had mutations in the rifampin resistance determining region (RRDR) of the rpoB gene, with codons 531 (61%), 526 (13%), and 516 (8.7%) being the most commonly mutated. We found two new mutations (Asp516Thr and Ser531Gly) described for the first time in the rpoB-RRDR in association with rifampicin resistance. Only one mutation (Ile572Phe) was found outside the rpoB-RRDR. Of 72 Inh(r) strains, 30 (41.6%) had a mutation in katGcodon315 (with Ser315Thr being the predominant alteration), and 23 (32%) harbored the inhA(-15C-->T) mutation. While the general pattern of rpoB-RRDR and katG mutations reflected those found worldwide, the prevalence of the inhA(-15C-->T mutation was above the value found in most other countries, emphasizing the great importance of testing the inhA(-15C-->T) mutation for prediction of isoniazid resistance in Syria. Sensitivity of a rapid test using real time PCR and 3'-Minor groove binder (MGB) probes in detecting Rif(r) and Inh(r) isolates was 90% and 69.4%, respectively. This demonstrates that a small set of MGB-probes can be used in real time PCR in order to detect most mutations causing resistance to rifampicin and isoniazid.

  4. HAEdb: a novel interactive, locus-specific mutation database for the C1 inhibitor gene. (United States)

    Kalmár, Lajos; Hegedüs, Tamás; Farkas, Henriette; Nagy, Melinda; Tordai, Attila


    Hereditary angioneurotic edema (HAE) is an autosomal dominant disorder characterized by episodic local subcutaneous and submucosal edema and is caused by the deficiency of the activated C1 esterase inhibitor protein (C1-INH or C1INH; approved gene symbol SERPING1). Published C1-INH mutations are represented in large universal databases (e.g., OMIM, HGMD), but these databases update their data rather infrequently, they are not interactive, and they do not allow searches according to different criteria. The HAEdb, a C1-INH gene mutation database ( was created to contribute to the following expectations: 1) help the comprehensive collection of information on genetic alterations of the C1-INH gene; 2) create a database in which data can be searched and compared according to several flexible criteria; and 3) provide additional help in new mutation identification. The website uses MySQL, an open-source, multithreaded, relational database management system. The user-friendly graphical interface was written in the PHP web programming language. The website consists of two main parts, the freely browsable search function, and the password-protected data deposition function. Mutations of the C1-INH gene are divided in two parts: gross mutations involving DNA fragments >1 kb, and micro mutations encompassing all non-gross mutations. Several attributes (e.g., affected exon, molecular consequence, family history) are collected for each mutation in a standardized form. This database may facilitate future comprehensive analyses of C1-INH mutations and also provide regular help for molecular diagnostic testing of HAE patients in different centers.

  5. Isoniazid suppresses antioxidant response element activities and impairs adipogenesis in mouse and human preadipocytes

    International Nuclear Information System (INIS)

    Chen, Yanyan; Xue, Peng; Hou, Yongyong; Zhang, Hao; Zheng, Hongzhi; Zhou, Tong; Qu, Weidong; Teng, Weiping; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo


    Transcriptional signaling through the antioxidant response element (ARE), orchestrated by the Nuclear factor E2-related factor 2 (Nrf2), is a major cellular defense mechanism against oxidative or electrophilic stress. Here, we reported that isoniazid (INH), a widely used antitubercular drug, displays a substantial inhibitory property against ARE activities in diverse mouse and human cells. In 3T3-L1 preadipocytes, INH concentration-dependently suppressed the ARE-luciferase reporter activity and mRNA expression of various ARE-dependent antioxidant genes under basal and oxidative stressed conditions. In keeping with our previous findings that Nrf2-ARE plays a critical role in adipogenesis by regulating expression of CCAAT/enhancer-binding protein β (C/EBPβ) and peroxisome proliferator-activated receptor γ (PPARγ), suppression of ARE signaling by INH hampered adipogenic differentiation of 3T3-L1 cells and human adipose-derived stem cells (ADSCs). Following adipogenesis induced by hormonal cocktails, INH-treated 3T3-L1 cells and ADSCs displayed significantly reduced levels of lipid accumulation and attenuated expression of C/EBPα and PPARγ. Time-course studies in 3T3-L1 cells revealed that inhibition of adipogenesis by INH occurred in the early stage of terminal adipogenic differentiation, where reduced expression of C/EBPβ and C/EBPδ was observed. To our knowledge, the present study is the first to demonstrate that INH suppresses ARE signaling and interrupts with the transcriptional network of adipogenesis, leading to impaired adipogenic differentiation. The inhibition of ARE signaling may be a potential underlying mechanism by which INH attenuates cellular antioxidant response contributing to various complications. - Highlights: • Isoniazid suppresses ARE-mediated transcriptional activity. • Isoniazid inhibits adipogenesis in preadipocytes. • Isoniazid suppresses adipogenic gene expression during adipogenesis

  6. Rapid screening of rpoB and katG mutations in Mycobacterium tuberculosis isolates by high-resolution melting curve analysis

    Directory of Open Access Journals (Sweden)

    M Haeili


    Full Text Available Background: Early detection of multidrug-resistant tuberculosis (MDR-TB is essential to prevent its transmission in the community and initiate effective anti-TB treatment regimen. Materials and Methods: High-resolution melting curve (HRM analysis was evaluated for rapid detection of resistance conferring mutations in rpoB and katG genes. We screened 95 Mycobacterium tuberculosis clinical isolates including 20 rifampin resistant (RIF-R, 21 isoniazid resistant (INH-R and 54 fully susceptible (S isolates determined by proportion method of drug susceptibility testing. Nineteen M. tuberculosis isolates with known drug susceptibility genotypes were used as references for the assay validation. The nucleotide sequences of the target regions rpoB and katG genes were determined to investigate the frequency and type of mutations and to confirm HRM results. Results: HRM analysis of a 129-bp fragment of rpoB allowed correct identification of 19 of the 20 phenotypically RIF-R and all RIF-S isolates. All INH-S isolates generated wild-type HRM curves and 18 out of 21 INH-R isolates harboured any mutation in 109-bp fragment of katG exhibited mutant type HRM curves. However, 1 RIF-R and 3 INH-R isolates were falsely identified as susceptible which were confirmed for having no mutation in their target regions by sequencing. The main mutations involved in RIF and INH resistance were found at codons rpoB531 (60% of RIF-R isolates and katG315 (85.7% of INH-R isolates, respectively. Conclusion: HRM was found to be a reliable, rapid and low cost method to characterise drug susceptibility of clinical TB isolates in resource-limited settings.

  7. Elderly Men Have Low Levels of Anti-Müllerian Hormone and Inhibin B, but with High Interpersonal Variation: A Cross-Sectional Study of the Sertoli Cell Hormones in 615 Community-Dwelling Men (United States)

    Chong, Yih Harng; Dennis, Nicola A.; Connolly, Martin J.; Teh, Ruth; Jones, Gregory T.; van Rij, Andre M.; Farrand, Stephanie; Campbell, A. John; MLennan, Ian S.


    The Sertoli cells of the testes secrete anti-Müllerian hormone (Müllerian inhibiting Substance, AMH) and inhibin B (InhB). AMH triggers the degeneration of the uterine precursor in male embryos, whereas InhB is part of the gonadal-pituitary axis for the regulation of sperm production in adults. However, both hormones are also putative regulators of homeostasis, and age-related changes in these hormones may therefore be important to the health status of elderly men. The levels of AMH in elderly men are unknown, with limited information being available about age-related changes in InhB. We have therefore used ELISAs to measure Sertoli cell hormone levels in 3 cohorts of community-dwelling men in New Zealand. In total, 615 men were examined, 493 of which were aged 65 or older. Serum AMH and InhB levels inversely correlated with age in men older than 50 years (p<0.001) but not in the younger men. A minority of elderly men had undetectable levels of AMH and InhB. The variation in hormone levels between similarly aged men increased with the age of men. AMH and InhB partially correlated with each other as expected (r = 0.48, p<0.001). However, the ratio of the two Sertoli hormones varied significantly between men, with this variation increasing with age. Elderly men selected for the absence of cardiovascular disease had AMH levels similar to those of young men whereas their InhB levels did not differ from aged-matched controls. These data suggests that Sertoli cell number and function changes with age, but with the extent and nature of the changes varying between men. PMID:23940675

  8. Functional antigen binding by the defective B cells of CBA/N mice. (United States)

    Snippe, H; Merchant, B; Lizzio, E F; Inman, J K


    CBA/N mice have an X-linked B cell defect which prevents them from responding to nonmitogenic thymic independent (TI-2) antigens such as dinitrophenylated DNP-Ficoll (1,2). The F1 male progeny of CBA/N female mice express the same defect. Spleen cell suspensions from such defective mice (CBA/N X C3H/HeN F1 males) could not respond to DNP-Ficoll following in vitro immunization and subsequent transfer into irradiated, syngeneic, F1 male recipients as expected. In contrast, normal CBA/N X C3H/HeN F1 female spleen cells could respond and effect a "rescue"; they mounted strong plaque-forming cell responses 7 days after in vitro exposure to DNP-Ficoll and subsequent transfer into irradiated F1 male recipients. Defective F1 male spleen cells, however, could bind significant quantities of 125I-DNP-Ficoll after in vitro exposure. Extensive washing of these spleen cells could not reverse this binding. Such DNP-Ficoll-exposed and washed F1 male spleen cells could, after transfer, aid normal untreated F1 female cells in their rescue function. The defective F1 male spleen cells could convey immunogenic quantities of DNP-Ficoll to the "rescuing" F1 female cells. Mitomycin treatment of F1 male cells did not interfere with their conveyor function. Goat anti-mouse mu serum impeded the passive antigen conveyor function of defective F1 male cells as did prior exposure to high concentrations of free DNP hapten. Our data support the view that the B cell defect of CBA/N X C3H/HeN F1 male mice does not relate to antigen binding, but rather to an inability to be effectively triggered by certain cell-bound polymeric antigens.

  9. Being in control? A thematic content analysis of 14 in-depth interviews with 2,4-dinitrophenol users. (United States)

    Ainsworth, Neha Prasad; Vargo, Elisabeth Julie; Petróczi, Andrea


    2,4-Dinitrophenol (2,4-DNP) is a compound with multiple industrial purposes. Currently unlicensed for human consumption, it is used by the gym-going population for drastic, short-term body fat loss. Nonetheless, physiological mechanisms can lead to potentially fatal hyperthermia. Reported fatal incidents have caused concern and highlighted the need for intervention. Understanding decision-making leading to 2,4-DNP use alongside the perceived outgroup attitudes is vital to forming effective harm minimisation policies targeting current and potential users. First-hand accounts from this elusive population are scarce. Fourteen novel and experienced users (13 male, 1 female) were recruited via "snowballing" techniques. Semi-structured interviews were conducted, comprising 28 questions. Thematic content analysis was conducted using 37 codes. Four characteristic themes emerged: 1. Users considered the Internet to be a crucial multifunctional resource directly impacting their 2,4-DNP use. 2. Users "respected" 2,4-DNP, proactively taking harm reduction measures. 3. Attitudinal polarisation towards 2,4-DNP within the gym-going community was consistent in all accounts. 4. Users perceived outgroup populations to have inherently negative attitudes towards their use. These themes fell under the all-encompassing theme of "being in control". For the first time, this study offers a rich detail of attitudes toward 2,4-DNP use by giving a collective voice to users. The element of control over every aspect of the users' life appears to be a significant contributor to the successful risk-management of 2,4-DNP use. In the absence of an established safe upper limit and effective regulatory control, education is critical to harm minimisation. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Dynamic Nuclear Polarization enhanced NMR at 187 GHz/284 MHz using an Extended Interaction Klystron amplifier. (United States)

    Kemp, Thomas F; Dannatt, Hugh R W; Barrow, Nathan S; Watts, Anthony; Brown, Steven P; Newton, Mark E; Dupree, Ray


    A Dynamic Nuclear Polarisation (DNP) enhanced solid-state Magic Angle Spinning (MAS) NMR spectrometer which uses a 187 GHz (corresponding to (1)H NMR frequency of 284 MHz) Extended Interaction Klystron (EIK) amplifier as the microwave source is briefly described. Its performance is demonstrated for a biomolecule (bacteriorhodopsin), a pharmaceutical, and surface functionalised silica. The EIK is very compact and easily incorporated into an existing spectrometer. The bandwidth of the amplifier is sufficient that it obviates the need for a sweepable magnetic field, once set, for all commonly used radicals. The variable power (CW or pulsed) output from the EIK is transmitted to the DNP-NMR probe using a quasi-optic system with a high power isolator and a corrugated waveguide which feeds the microwaves into the DNP-NMR probe. Curved mirrors inside the probe project the microwaves down the axis of the MAS rotor, giving a very efficient system such that maximum DNP enhancement is achieved with less than 3 W output from the microwave source. The DNP-NMR probe operates with a sample temperature down to 90K whilst spinning at 8 kHz. Significant enhancements, in excess of 100 for bacteriorhodopsin in purple membrane (bR in PM), are shown along with spectra which are enhanced by ≈25 with respect to room temperature, for both the pharmaceutical furosemide and surface functionalised silica. These enhancements allow hitherto prohibitively time consuming experiments to be undertaken. The power at which the DNP enhancement in bR in PM saturates does not change significantly between 90K and 170 K even though the enhancement drops by a factor of ≈11. As the DNP build up time decreases by a factor 3 over this temperature range, the reduction in T1n is presumably a significant contribution to the drop in enhancement. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  11. Health-Related Quality of Life with Subcutaneous C1-Inhibitor for Prevention of Attacks of Hereditary Angioedema. (United States)

    Lumry, William R; Craig, Timothy; Zuraw, Bruce; Longhurst, Hilary; Baker, James; Li, H Henry; Bernstein, Jonathan A; Anderson, John; Riedl, Marc A; Manning, Michael E; Keith, Paul K; Levy, Donald S; Caballero, Teresa; Banerji, Aleena; Gower, Richard G; Farkas, Henriette; Lawo, John-Philip; Pragst, Ingo; Machnig, Thomas; Watson, Douglas J


    Hereditary angioedema with C1-inhibitor deficiency (C1-INH-HAE) impairs health-related quality of life (HRQoL). The objective of this study was to assess HRQoL outcomes in patients self-administering subcutaneous C1-INH (C1-INH[SC]; HAEGARDA) for routine prevention of HAE attacks. Post hoc analysis of data from the placebo-controlled, crossover phase III COMPACT study (Clinical Studies for Optimal Management of Preventing Angioedema with Low-Volume Subcutaneous C1-Inhibitor Replacement Therapy). Ninety patients with C1-INH-HAE were randomized to 1 of 4 treatment sequences: C1-INH(SC) 40 or 60 IU/kg twice weekly for 16 weeks, preceded or followed by 16 weeks of twice weekly placebo injections. All HAE attacks were treated with open-label on-demand treatment as necessary. HRQoL assessments at week 14 (last visit) included the European Quality of Life-5 Dimensions Questionnaire (EQ-5D-3L), the Hospital Anxiety and Depression Scale (HADS), the Work Productivity and Activity Impairment Questionnaire (WPAI), and the Treatment Satisfaction Questionnaire for Medication (TSQM). Compared with placebo (on-demand treatment alone), treatment with twice weekly C1-INH(SC) (both doses combined) was associated with better EQ-5D visual analog scale general health, less HADS anxiety, less WPAI presenteeism, work productivity loss, and activity impairment, and greater TSQM effectiveness and overall treatment satisfaction. More patients self-reported a "good/excellent" response during routine prevention with C1-INH(SC) compared with on-demand only (placebo prophylaxis) management. For each HRQoL measure, a greater proportion of patients had a clinically meaningful improvement during C1-INH(SC) treatment compared with placebo. In patients with frequent HAE attacks, a treatment strategy of routine prevention with self-administered twice weekly C1-INH(SC) had a greater impact on improving multiple HAE-related HRQoL impairments, most notably anxiety and work productivity, compared with on

  12. Anti-Müllerian Hormone and Inhibin-A, but not Inhibin-B or Insulin-Like Peptide-3, may be Used as Surrogates in the Diagnosis of Polycystic Ovary Syndrome in Adolescents: Preliminary Results. (United States)

    Yetim, Aylin; Yetim, Çağcıl; Baş, Firdevs; Erol, Oğuz Bülent; Çığ, Gülnaz; Uçar, Ahmet; Darendeliler, Feyza


    Polycystic ovary syndrome (PCOS) is a common endocrine problem in adolescents with an increasing prevalence of 30%. Pursuing new biomarkers with high specificity and sensitivity in the diagnosis of PCOS in adolescents is currently an active area of research. We aimed to investigate the diagnostic value of anti-Müllerian hormone (AMH), insulin-like peptide-3 (INSL3), inhibin-A (INH-A), and inhibin-B (INH-B) in adolescents with PCOS and also to determine the association, if any, between these hormones and clinical/laboratory findings related with hyperandrogenism. The study group comprised 53 adolescent girls aged between 14.5 and 20 years who were admitted to our outpatient clinic with symptoms of hirsutism and/or irregular menses and diagnosed as having PCOS in accordance with the Rotterdam criteria. Twenty-six healthy peers, eumenorrheic for at least two years and body mass index-matched, constituted the controls. Fasting blood samples for hormones [luteinizing hormone (LH), follicle-stimulating hormone (FSH), dehydroepiandrosterone-sulfate (DHEAS), androstenedione (D4-A), total/free testosterone (T/fT), sex hormone binding globulin (SHBG), AMH, INSL3, INH-A, INH-B] were drawn after an overnight fast. In the PCOS group, 83% of the subjects were oligomenorrheic/amenorrheic and 87% had hirsutism. The LH, LH/FSH ratio, total T, fT, free androgen-index (FAI), DHEAS levels were significantly higher (p=0.005, p=0.042, p=0.047, pPCOS patients as compared to the controls. Although the INSL-3 and INH-B levels showed no difference between the groups (p>0.05), AMH and INH-A levels were found to be significantly higher in the PCOS group compared to the controls (pPCOS. When AMH and INH-A were used in combination, the sensitivity (96.2%) increased. INSL3 and INH-B were not found to have diagnostic value in adolescents with PCOS. On the other hand, it was shown that INH-A could be used as a new diagnostic biomarker in addition to AMH.

  13. Separate and interactive contributions of weak inhibitory control and threat sensitivity to prediction of suicide risk. (United States)

    Venables, Noah C; Sellbom, Martin; Sourander, Andre; Kendler, Kenneth S; Joiner, Thomas E; Drislane, Laura E; Sillanmäki, Lauri; Elonheimo, Henrik; Parkkola, Kai; Multimaki, Petteri; Patrick, Christopher J


    Biobehavioral dispositions can serve as valuable referents for biologically oriented research on core processes with relevance to many psychiatric conditions. The present study examined two such dispositional variables-weak response inhibition (or disinhibition; INH-) and threat sensitivity (or fearfulness; THT+)-as predictors of the serious transdiagnostic problem of suicide risk in two samples: male and female outpatients from a U.S. clinic (N=1078), and a population-based male military cohort from Finland (N=3855). INH- and THT+ were operationalized through scores on scale measures of disinhibition and fear/fearlessness, known to be related to DSM-defined clinical conditions and brain biomarkers. Suicide risk was assessed by clinician ratings (clinic sample) and questionnaires (both samples). Across samples and alternative suicide indices, INH- and THT+ each contributed uniquely to prediction of suicide risk-beyond internalizing and externalizing problems in the case of the clinic sample where diagnostic data were available. Further, in both samples, INH- and THT+ interactively predicted suicide risk, with individuals scoring concurrently high on both dispositions exhibiting markedly augmented risk. Findings demonstrate that dispositional constructs of INH- and THT+ are predictive of suicide risk, and hold potential as referents for biological research on suicidal behavior. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  14. Study on the serum levels of inhibin in patients with polycystic ovary syndrome

    International Nuclear Information System (INIS)

    Fang Aixian; Yang Jianlan


    Objective: To investigate the changes of serum inhibin B (inhibin. INH-B) levels in women with polycystic ovary syndrome (PCOS) and the relationship with body mass index (BMI). Methods: Serum insulin-like growth factor-I (IGF-I), fasting insulin (In), and leptin ( with RIA) inhibin B (INH-B) (with ELISA) and luteinizing hormone (LH), follicle-stimulating hormone (FSH), human prolactin (PRL), estradiol (E 2 ) testosterone (T) (with CLIA) levels were measured in 40 patients with PCOS and 40 controls. 24 of the 40 PCOS patients were of the obese group (BMI>25) and 16 were non-obese. Results: Serum leptin, In, LH, T levels were significantly higher but INH-B, IGF levels were significantly lower in obese group than those in non-obese group (P<0.05). There were negative correlations between LH and INH levels (r=-0.730, P<0.05 in obese group but none in non-obese group serum). INH-B, IGF, LH, T levels in non-obese group were significantly higher than those in the controls (P<0.05). Conclusion: Inhibin is closely related to the development of PCOS, the level of serum inhibin is lower in obese patients with PCOS. (authors)

  15. Use of a C1 Inhibitor Concentrate in Adults ≥65 Years of Age with Hereditary Angioedema

    DEFF Research Database (Denmark)

    Bygum, Anette; Martinez-Saguer, Inmaculada; Bas, Murat


    BACKGROUND: Treatment of hereditary angioedema (HAE) in 'older adults' (those aged ≥65 years) has not been well studied. The international Berinert Patient Registry collected data on the use of intravenous plasma-derived, pasteurized, nanofiltered C1-inhibitor concentrate (pnfC1-INH; Berinert......(®)/CSL Behring) in patients of any age, including many older adults. METHODS: This observational registry, conducted from 2010 to 2014 at 30 US and seven European sites, gathered prospective (post-enrollment) and retrospective (pre-enrollment) usage and adverse event (AE) data on subjects treated with pnfC1-INH....... RESULTS: The registry documented 1701 pnfC1-INH infusions in 27 older adults. A total of 1511 HAE attacks treated with pnfC1-INH administration were reported among 25 of the 27 (92.6 %) older adults. Among the older adults, mean (standard deviation [SD]) (8.8 [4.1] IU/kg) and median (6.4 IU/kg) pnfC1-INH...

  16. Therapeutic drug monitoring of isoniazid and rifampicin during anti-tuberculosis treatment in Auckland, New Zealand. (United States)

    Maze, M J; Paynter, J; Chiu, W; Hu, R; Nisbet, M; Lewis, C


    There is uncertainty as to the optimal therapeutic concentrations of anti-tuberculosis drugs to achieve cure. To characterise the use of therapeutic drug monitoring (TDM), and identify risk factors and outcomes for those with concentrations below the drug interval. Patients treated for tuberculosis (TB) who had rifampicin (RMP) or isoniazid (INH) concentrations measured between 1 January 2005 and 31 December 2012 were studied retrospectively. Matched concentrations and drug dosing time were assessed according to contemporary regional drug intervals (RMP > 6 μmol/l, INH > 7.5 μmol/l) and current international recommendations (RMP > 10 μmol/l, INH > 22 μmol/l). Outcomes were assessed using World Health Organization criteria. Of 865 patients, 121 had concentrations of either or both medications. RMP concentrations were within the regional drug intervals in 106/114 (93%) and INH in 91/100 (91%). Concentrations were within international drug intervals for RMP in 76/114 (67%) and INH in 53/100 (53%). Low weight-based dose was the only statistically significant risk factor for concentrations below the drug interval. Of the 35 patients with low concentrations, 21 were cured, 9 completed treatment and 5 transferred out. There were no relapses during follow-up (mean 66.5 months). There were no clinically useful characteristics to guide use of TDM. Many patients had concentrations below international therapeutic intervals, but were successfully treated.

  17. Solubility and dissolution thermodynamics of N-(4-chlorophenyl)-2-(pyridin-4-ylcarbonyl)hydrazinecarbothioamide in PG + water co-solvent mixtures at (298.15 to 338.15) K

    Energy Technology Data Exchange (ETDEWEB)

    Bhat, Mashooq A. [Department of Pharmaceutical Chemistry, College of Pharmacy, King Saud University, P.O. Box 2457, Riyadh 11451 (Saudi Arabia); Haq, Nazrul [Center of Excellence in Biotechnology Research, College of Science, King Saud University, P.O. Box 2460, Riyadh 11451 (Saudi Arabia); Shakeel, Faiyaz, E-mail: [Center of Excellence in Biotechnology Research, College of Science, King Saud University, P.O. Box 2460, Riyadh 11451 (Saudi Arabia)


    Highlights: • Solubility of isoniazid analog in various PG + water mixtures was measured. • The solubility was observed highest in pure PG. • Experimental solubilities were correlated well with Apelblat and Yalkowsky model. • Solubilities were increased with increase in temperature and mass fraction of PG. - Abstract: The objective of present investigation was to measure the solubility and dissolution thermodynamics of N-(4-chlorophenyl)-2-(pyridin-4-ylcarbonyl)hydrazinecarbothioamide [isoniazid (INH) analog] in various propylene glycol (PG) + water co-solvent mixtures from (298.15 to 338.15) K. The experimental solubilities of INH analog were correlated with Apelblat and Yalkowsky models. The root mean square deviations were found to be (1.13–3.98)% and (1.45–5.73)% for Apelblat equation and Yalkowsky model, respectively. Good correlation was observed between experimental and calculated solubilities of INH analog with correlation coefficients in the range of 0.995–0.999. The mole fraction solubility of INH analog was found to be highest and lowest in pure PG (7.38 × 10{sup −3} at 298.15 K) and pure water (5.17 × 10{sup −7} at 298.15 K), respectively. The results of dissolution thermodynamics indicated endothermic and non-spontaneous dissolution of INH analog.

  18. Antimicrobial susceptibility determined by the E test, Löwenstein-Jensen proportion, and DNA sequencing methods among Mycobacterium tuberculosis isolates discrepancies, preliminary results

    Directory of Open Access Journals (Sweden)

    Maria Inês Moura Freixo


    Full Text Available Mycobacterium tuberculosis strains resistant to streptomycin (SM, isoniazid (INH, and/or rifampin (RIF as determined by the conventional Löwenstein-Jensen proportion method (LJPM were compared with the E test, a minimum inhibitory concentration susceptibility method. Discrepant isolates were further evaluated by BACTEC and by DNA sequence analyses for mutations in genes most often associated with resistance to these drugs (rpsL, katG, inhA, and rpoB. Preliminary discordant E test results were seen in 75% of isolates resistant to SM and in 11% to INH. Discordance improved for these two drugs (63% for SM and none for INH when isolates were re-tested but worsened for RIF (30%. Despite good agreement between phenotypic results and sequencing analyses, wild type profiles were detected on resistant strains mainly for SM and INH. It should be aware that susceptible isolates according to molecular methods might contain other mechanisms of resistance. Although reproducibility of the LJPM susceptibility method has been established, variable E test results for some M. tuberculosis isolates poses questions regarding its reproducibility particularly the impact of E test performance which may vary among laboratories despite adherence to recommended protocols. Further studies must be done to enlarge the evaluated samples and looked possible mutations outside of the hot spot sequenced gene among discrepant strains.

  19. Free Radical Imaging Using In Vivo Dynamic Nuclear Polarization-MRI. (United States)

    Utsumi, Hideo; Hyodo, Fuminori


    Redox reactions that generate free radical intermediates are essential to metabolic processes, and their intermediates can produce reactive oxygen species, which may promote diseases related to oxidative stress. The development of an in vivo electron spin resonance (ESR) spectrometer and its imaging enables us noninvasive and direct measurement of in vivo free radical reactions in living organisms. The dynamic nuclear polarization magnetic resonance imaging (DNP-MRI), also called PEDRI or OMRI, is also a new imaging method for observing free radical species in vivo. The spatiotemporal resolution of free radical imaging with DNP-MRI is comparable with that in MRI, and each of the radical species can be distinguished in the spectroscopic images by changing the frequency or magnetic field of ESR irradiation. Several kinds of stable nitroxyl radicals were used as spin probes to detect in vivo redox reactions. The signal decay of nitroxyl probes, which is determined with in vivo DNP-MRI, reflects the redox status under oxidative stress, and the signal decay is suppressed by prior administration of antioxidants. In addition, DNP-MRI can also visualize various intermediate free radicals from the intrinsic redox molecules. This noninvasive method, in vivo DNP-MRI, could become a useful tool for investigating the mechanism of oxidative injuries in animal disease models and the in vivo effects of antioxidant drugs. © 2015 Elsevier Inc. All rights reserved.

  20. Thermal performance enhancement in nanofluids containing diamond nanoparticles

    International Nuclear Information System (INIS)

    Xie Huaqing; Yu Wei; Li Yang


    Nanofluids, nanoparticle suspensions prepared by dispersing nanoscale particles in a base fluid, have been gaining interest lately due to their potential to greatly outperform traditional thermal transport liquids. Diamond has the highest thermal transport capacity in nature and diamond particles are often used as filler in mixtures for upgrading the performance of a matrix. It is reasonable to expect that the addition of diamond nanoparticles (DNPs) would lead to thermal performance enhancement in a base fluid. In this study, homogeneous and stable nanofluids composed of DNPs as the inclusions and a mixture of ethylene glycol (EG) and water as base fluid have been prepared. Acid mixtures of perchloric acid, nitric acid and hydrochloric acid were employed to purify and tailor the DNPs to eliminate impurities and to enhance their dispersibilty. Ultrasound and the alkalinity of solution are beneficial to the deaggregation of the soft DNP aggregations. The thermal conductivity enhancement of the DNP nanofluids increases with DNP loading and the thermal conductivity enhancement is more than 18.0% for a nanofluid at a DNP volume fraction of 0.02. Viscosity measurements show that the DNP nanofluids demonstrate Newtonian behaviour, and the viscosity significantly decreases with temperature. With increasing volume fraction of DNPs, the convective heat transfer coefficient increases first, and then decreases with a further increase in the volume fraction of DNPs. The nanofluid with a volume fraction of 0.005 has optimal overall thermal performance.

  1. Evaluation of Baffle Fixes Film up Flow Sludge Blanket Filtration (BFUSBF System in Treatment of Wastewaters from Phenol and 2,4-Dinitrophenol Using Daphnia Magna Bioassay

    Directory of Open Access Journals (Sweden)

    Mohammad Javad Ghannadzadeh


    Full Text Available Background: Phenol and nitrophenol are common compounds found in different types of industrial wastewater known as serious threats to human health and natural environment. In this study, Daphnia magna was used to evaluate the effectiveness of "baffle fixes film up flow sludge blanket filtration" (BFUSBF system in elimination of phenolic compounds from water. Methods: D. magna cultures were used as toxicity index of phenol and 2,4-DNP mixtures after treatment by a pilot BFUSBF system which consisted of baffle in anoxic section and biofilm in aerobic sections. Initial concentrations were 312 mg/L phenol and 288 mg/L 2,4-dinitrophenol (2,4-DNP. Results: Bioassay tests showed that D. magna was influenced by the toxicity of phenol and 2,4 DNP mixtures. The comparison between the toxicity of initial phenol and 2,4-DNP mixtures and the output toxic unit (TU derived from BFUSBF treatment system showed that the TU of the effluent from BFUSBF reactor was much lower than that of the solution that entered the reactor. Conclusion: Based on the acute toxicity test, BFUSBF process could reduce phenol and 2,4-DNP in aqueous solutions. Therefore, it is possible to use BFUSBF process as an appropriate treatment option for wastewaters containing phenolic compounds.

  2. Carbon Nanofiber/3D Nanoporous Silicon Hybrids as High Capacity Lithium Storage Materials. (United States)

    Park, Hyeong-Il; Sohn, Myungbeom; Kim, Dae Sik; Park, Cheolho; Choi, Jeong-Hee; Kim, Hansu


    Carbon nanofiber (CNF)/3D nanoporous (3DNP) Si hybrid materials were prepared by chemical etching of melt-spun Si/Al-Cu-Fe alloy nanocomposites, followed by carbonization using a pitch. CNFs were successfully grown on the surface of 3DNP Si particles using residual Fe impurities after acidic etching, which acted as a catalyst for the growth of CNFs. The resulting CNF/3DNP Si hybrid materials showed an enhanced cycle performance up to 100 cycles compared to that of the pristine Si/Al-Cu-Fe alloy nanocomposite as well as that of bare 3DNP Si particles. These results indicate that CNFs and the carbon coating layer have a beneficial effect on the capacity retention characteristics of 3DNP Si particles by providing continuous electron-conduction pathways in the electrode during cycling. The approach presented here provides another way to improve the electrochemical performances of porous Si-based high capacity anode materials for lithium-ion batteries. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Expression of reductases in continuous mammal cell cultures and its significance for the activation of nitroaromatics shown for the example of 1.6 dinitropyrene

    International Nuclear Information System (INIS)

    Reuter, U.


    The aim of the first part of the work was to establish the metabolism of 1,3- and 1,6-DNP in intact cells. This gave rise to the following questions. What metabolites are formed in cell lines with different enzyme outfits? What influence does the induction of P450 have on the metabolism of the two nitroaromates? Does the metabolism found in the different test cell lines permit any conclusions as to the activating mechanism of 1,6- and 1,3-DNP. In the second part these test cell lines were studied with respect to the expression of the reductases that might be involved in the metabolism of aromates. The following questions were of focal interest: Are cytochrome reductase, DT diaphorase and xanthine-oxidase expressed in the cell lines? If so, to what extent? Can these enzymes be induced in the test cell lines? In the last part the enzymes that reduce 1,6-DNP to gene-toxic products were identified. This required clarifying the following: What role do the above-mentioned reductases play in the activation of 1,6-DNP in individual cell lines? Are there other enzymes responsible for the activation of 1,6-DNP? (MG) [de

  4. Many-body kinetics of dynamic nuclear polarization by the cross effect (United States)

    Karabanov, A.; Wiśniewski, D.; Raimondi, F.; Lesanovsky, I.; Köckenberger, W.


    Dynamic nuclear polarization (DNP) is an out-of-equilibrium method for generating nonthermal spin polarization which provides large signal enhancements in modern diagnostic methods based on nuclear magnetic resonance. A particular instance is cross-effect DNP, which involves the interaction of two coupled electrons with the nuclear spin ensemble. Here we develop a theory for this important DNP mechanism and show that the nonequilibrium nuclear polarization buildup is effectively driven by three-body incoherent Markovian dissipative processes involving simultaneous state changes of two electrons and one nucleus. We identify different parameter regimes for effective polarization transfer and discuss under which conditions the polarization dynamics can be simulated by classical kinetic Monte Carlo methods. Our theoretical approach allows simulations of the polarization dynamics on an individual spin level for ensembles consisting of hundreds of nuclear spins. The insight obtained by these simulations can be used to find optimal experimental conditions for cross-effect DNP and to design tailored radical systems that provide optimal DNP efficiency.

  5. Structural Analysis and Immuno-Stimulating Activity of an Acidic Polysaccharide from the Stems of Dendrobium nobile Lindl. (United States)

    Wang, Jun-Hui; Zuo, Shu-Rong; Luo, Jian-Ping


    Dendrobium nobile Lindl., an epiphytic herb distributed in the Southeast Asia, is used as a tonic and antipyretic herbal medicine in China. In this study, a water-soluble acidic heteropolysaccharide, DNP-W4, containing mannose, glucose, galactose, xylose, rhamnose, and galacturonic acid, in the molar ratios of 1.0:4.9:2.5:0.5:1.0:0.9, was obtained from the stems of Dendrobium nobile Lindl. Using methylation analysis, partial acid hydrolysis, pectolyase treatment, NMR, and ESI-MS, the structure of DNP-W4 was elucidated. The obtained data indicated that DNP-W4 was a complex heteropolysaccharide and possessed a backbone composed of (1→4)-linked β-d-Glcp, (1→6)-linked β-d-Glcp, and (1→6)-linked β-d-Galp, with substitutes at O-4/6 of Glcp residues and O-3 of Galp. The branches of DNP-W4 were composed of terminal Manp, (1→6)-linked β-d-Manp, (1→3)-linked β-d-Glcp, β-d-Glcp, β-d-Galp, (1→4)-linked α-d-GalAp, (1→2)-linked α-L-Rhap, and Xylp. DNP-W4 had little immunological activities, but its derivatives had immuno-stimulating activities to some extent.

  6. Program of home telemonitoring in patients with cystic fibrosis over a period of 2 years: a contribution to the rationalization of care. (United States)

    Bella, S; Murgia, F; Cotognini, C; Alghisi, F; Montemitro, E


    In present study we tested the possible presence of a saving for Italian National Health Service (INHS) when using telemonitoring in the follow-up at home of patients with Cystic Fibrosis (CF), in the aim to assess the possible role of Telemedicine in rationalization of hospital admissions. We performed an economic analysis of the costs incurred by the INHS for patients with CF followed at home by telemonitoring, recalled to hospital under suspicion or diagnosis of acute pulmonary recurrence. We calculated, for 19 patients retrieved in the period of the study, a total saving compared to traditional home care of € 132.144,91 in 24 months, corresponding to € 3.303,62/year/patient. The presence of an economic advantage for the INHS is confirmed once again, although not significant. The data from this study are encouraging regarding the possible role of telemedicine in the organization of homecare of CF patients.

  7. Application of pressure ultrafiltration in determining the binding capacity of drugs to human albumin and to plasma proteins of intact and irradiated rat females

    International Nuclear Information System (INIS)

    Zima, M.


    The significance of the binding of drugs to plasma proteins has repeatedly been demonstrated and draws the interest of many pharmacologists. The described experiments served to study the binding of isoniazid (INH) to human albumin of various dilution and to whole plasma proteins of irradiated (on the Oth, 3rd and 6th day after exposure to 154.8 mC/kg=600 R) and non-irradiated rats using the technique of modified accelerated ultrafiltration through cellophane. The total characteristics of the binding and its changes were demonstrated by the equilibrium constant, the numbers of binding sites and the changes of free binding energy. The results show that the dilution of human albumin affects the strength of the INH binding on this albumin and further that the normally weak INH binding is diminished even more in irradiated rats. This cannot be explained by the change in the percentage composition of the rat plasma. (author)

  8. Effect of Schizonepeta tenuifolia extract on mast cell-mediated immediate-type hypersensitivity in rats. (United States)

    Shin, T Y; Jeong, H J; Jun, S M; Chae, H J; Kim, H R; Baek, S H; Kim, H M


    We investigated the effect of an aqueous extract of Schizonepeta tenuifolia (STAE) on mast cell-mediated immediate-type hypersensitivity. STAE inhibited systemic allergic reaction induced by compound 48/80 in rats dose-dependently. STAE also inhibited plasma histamine levels induced by compound 48/80. STAE inhibited local allergic reaction activated by anti-dinitrophenyl (DNP) IgE. In addition, STAE does-dependently inhibited histamine release from rat peritoneal mast cells (RPMC) activated by compound 48/80 or anti-DNP IgE. However, STAE had a significant enhancing effect on anti-DNP IgE-induced tumor necrosis factor-alpha (TNF-alpha) production from RPMC. These results indicate that STAE inhibits immediate-type hypersensitivity and suggest that STAE can selectively activate the TNF-alpha production from RPMC.

  9. Dynamic nuclear polarization methods in solids and solutions to explore membrane proteins and membrane systems. (United States)

    Cheng, Chi-Yuan; Han, Songi


    Membrane proteins regulate vital cellular processes, including signaling, ion transport, and vesicular trafficking. Obtaining experimental access to their structures, conformational fluctuations, orientations, locations, and hydration in membrane environments, as well as the lipid membrane properties, is critical to understanding their functions. Dynamic nuclear polarization (DNP) of frozen solids can dramatically boost the sensitivity of current solid-state nuclear magnetic resonance tools to enhance access to membrane protein structures in native membrane environments. Overhauser DNP in the solution state can map out the local and site-specific hydration dynamics landscape of membrane proteins and lipid membranes, critically complementing the structural and dynamics information obtained by electron paramagnetic resonance spectroscopy. Here, we provide an overview of how DNP methods in solids and solutions can significantly increase our understanding of membrane protein structures, dynamics, functions, and hydration in complex biological membrane environments.

  10. Academic and Institutional Review Board Collaboration to Ensure Ethical Conduct of Doctor of Nursing Practice Projects. (United States)

    Foote, Jan M; Conley, Virginia; Williams, Janet K; McCarthy, Ann Marie; Countryman, Michele


    Navigating the regulations to protect human subjects and private health information for Doctor of Nursing Practice (DNP) projects can be a formidable task for students, faculty, and the institutional review board (IRB). Key stakeholders from the University of Iowa College of Nursing and the Human Subjects Office developed a standardized process for DNP students to follow, using a decision algorithm, a student orientation to the human subjects review process conducted by faculty and IRB chairs and staff, and a brief Human Subjects Research Determination form. Over 2 years, 109 students completed the process, and 96.3% of their projects were deemed not to be human subjects research. Every student submitted documentation of adherence to the standardized process. Less time was spent by students, faculty, and the IRB in preparing and processing review requests. The interprofessional collaboration resulted in a streamlined process for the timely review of DNP projects. Copyright 2015, SLACK Incorporated.

  11. Instrumentation for cryogenic magic angle spinning dynamic nuclear polarization using 90L of liquid nitrogen per day. (United States)

    Albert, Brice J; Pahng, Seong Ho; Alaniva, Nicholas; Sesti, Erika L; Rand, Peter W; Saliba, Edward P; Scott, Faith J; Choi, Eric J; Barnes, Alexander B


    Cryogenic sample temperatures can enhance NMR sensitivity by extending spin relaxation times to improve dynamic nuclear polarization (DNP) and by increasing Boltzmann spin polarization. We have developed an efficient heat exchanger with a liquid nitrogen consumption rate of only 90L per day to perform magic-angle spinning (MAS) DNP experiments below 85K. In this heat exchanger implementation, cold exhaust gas from the NMR probe is returned to the outer portion of a counterflow coil within an intermediate cooling stage to improve cooling efficiency of the spinning and variable temperature gases. The heat exchange within the counterflow coil is calculated with computational fluid dynamics to optimize the heat transfer. Experimental results using the novel counterflow heat exchanger demonstrate MAS DNP signal enhancements of 328±3 at 81±2K, and 276±4 at 105±2K. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Identification of oxidised proteins in the matrix of rice leaf mitochondria by immunoprecipitation and two-dimensional liquid chromatography-tandem mass spectrometry

    DEFF Research Database (Denmark)

    Kristensen, B.K.; Askerlund, P.; Bykova, N.V.


    .2 mM CuSO4 for 10 min at room temperature). The oxidised proteins in both samples were tagged with dinitrophenylhydrazine (DNP), which forms a covalent bond with carbonyl groups. The DNP-tagged proteins were immunoprecipitated using anti-DNP antibodies and digested with trypsin. The mixture...... of peptides was analysed by nano-HPLC coupled online to an ESI-Quad-TOF mass spectrometer. The peptides were separated by stepwise ion exchange chromatography followed by reverse phase chromatography (2D-LC), and analysed by MS/MS. Proteins were identified by un-interpreted fragment ion database searches...... blots showed that neither the isolation of mitochondria, nor their subfractionation introduced carbonyl groups. We therefore conclude that a number of proteins are oxidised in the matrix of rice leaf mitochondria in vivo and further identify a group of proteins that are particularly susceptible to mild...

  13. Dynamic nuclear polarization by frequency modulation of a tunable gyrotron of 260GHz. (United States)

    Yoon, Dongyoung; Soundararajan, Murari; Cuanillon, Philippe; Braunmueller, Falk; Alberti, Stefano; Ansermet, Jean-Philippe


    An increase in Dynamic Nuclear Polarization (DNP) signal intensity is obtained with a tunable gyrotron producing frequency modulation around 260GHz at power levels less than 1W. The sweep rate of frequency modulation can reach 14kHz, and its amplitude is fixed at 50MHz. In water/glycerol glassy ice doped with 40mM TEMPOL, the relative increase in the DNP enhancement was obtained as a function of frequency-sweep rate for several temperatures. A 68 % increase was obtained at 15K, thus giving a DNP enhancement of about 80. By employing λ/4 and λ/8 polarizer mirrors, we transformed the polarization of the microwave beam from linear to circular, and achieved an increase in the enhancement by a factor of about 66% for a given power. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. E-Mentoring for Doctor of Nursing Practice Students: A Pilot Program. (United States)

    Harris, Robin; Birk, Stefanie B; Sherman, Jan


    The growing number of online Doctor of Nursing Practice (DNP) programs, steady attrition rates, and shortage of faculty created an opportunity to explore the use of distance-mediated mentoring. Twenty first-year DNP Nursing Leadership students were matched with DNP-prepared mentors in a formalized e-mentoring program. The Ideal Mentor Scale was used to determine what students desired most from the mentoring relationship in addition to midpoint and end-of-program surveys. Quantitative analysis revealed mentors and mentees found the relationship to be beneficial (p mentors (92%) noted the program supplied adequate resources, and the majority of students would recommend the program. Having a mentor leads to both mentor- and mentee-perceived benefits. Recommendations include continuing to seek ways to improve the communication and commitment between the mentor and mentee in order to receive reciprocal program benefits. [J Nurs Educ. 2016;55(8):458-462.]. Copyright 2016, SLACK Incorporated.

  15. 2,4-Dinitrophenol: A threat to Chinese body-conscious groups

    Directory of Open Access Journals (Sweden)

    Han Chih Hencher Lee


    Full Text Available 2,4-Dinitrophenol (2,4-DNP, a yellowish compound, has historically been used in the manufacture of dyes, explosives, and fungicides. As it uncouples mitochondrial oxidative phosphorylation, the compound was also used as an antiobesity agent early in the past century. The compound was subsequently banned by the United States Food and Drug Administration in 1938 due to its potentially fatal adverse effects, including hyperthermia, cataract, agranulocytosis, hepatoxicity, nephrotoxicity, and cardiotoxicity. However, the popularity of 2,4-DNP as a slimming aid has appeared to increase again in recent years. The Hong Kong Hospital Authority Toxicology Reference Laboratory recently confirmed two cases of self-administered 2,4-DNP with different clinical presentations to hospitals in the area. Here we describe those two cases, in an attempt to underscore the potential of misuse of this substance by body-conscious groups among the Chinese population.

  16. Beware the yellow slimming pill: fatal 2,4-dinitrophenol overdose. (United States)

    Holborow, Alexander; Purnell, Richard M; Wong, Jenny Frederina


    An industrial chemical, 2,4-dinitrophenol (DNP), has found use as a weight loss drug. It is extremely toxic in overdose and has a narrow therapeutic window with significant interindividual variability in metabolism. The rise in internet-based sales and distribution of this drug has seen an increased incidence of both accidental and intentional overdose presenting to emergency departments across the UK. No antidote currently exists and overdose is often fatal despite management based on current recommendations. We report a case of intentional overdose of DNP in a young man and discuss the current treatment guidelines. The case highlights the need for an increased awareness among frontline medical staff of the effects of DNP poisoning and questions the need for a more aggressive approach in the management of acute toxicity. 2016 BMJ Publishing Group Ltd.

  17. The Doctor of Nursing Practice: defining the next steps. (United States)

    Grey, Margaret


    The purpose of this article is to summarize the previous articles in this special issue of the Journal of Nursing Education that are based on the Committee on Institutional Cooperation's Dean's Conference on the Doctor of Nursing Practice (DNP) and to identify areas of consensus, as well as areas of controversy. Areas of consensus include the high level of interest in DNP programs and the intent to expand the role of the advanced practice nurse to population health, policy, and leadership. Areas of controversy include the nature of the DNP product, the definition of clinical experiences, the nature of the capstone project, the outcomes of these new practitioners, and the impact on schools. Suggestions for achieving higher levels of consensus, including the need for respective, inclusive dialogue, are provided. Copyright 2013, SLACK Incorporated.

  18. Reactive surface organometallic complexes observed using dynamic nuclear polarization surface enhanced NMR spectroscopy

    KAUST Repository

    Pump, Eva; Viger-Gravel, Jasmine; Abou-Hamad, Edy; Samantaray, Manoja; Hamzaoui, Bilel; Gurinov, Andrei; Anjum, Dalaver H.; Gajan, David; Lesage, Anne; Bendjeriou-Sedjerari, Anissa; Emsley, Lyndon; Basset, Jean-Marie


    Dynamic Nuclear Polarization Surface Enhanced NMR Spectroscopy (DNP SENS) is an emerging technique that allows access to high-sensitivity NMR spectra from surfaces. However, DNP SENS usually requires the use of radicals as an exogenous source of polarization, which has so far limited applications for organometallic surface species to those that do not react with the radicals. Here we show that reactive surface species can be studied if they are immobilized inside porous materials with suitably small windows, and if bulky nitroxide bi-radicals (here TEKPol) are used as the polarization source and which cannot enter the pores. The method is demonstrated by obtaining significant DNP enhancements from highly reactive complelxes [(equivalent to Si-O-)W(Me)(5)] supported on MCM-41, and effects of pore size (6.0, 3.0 and 2.5 nm) on the performance are discussed.

  19. The immunological properties of haptens coupled to thymus-independent carrier molecules. IV. The IgG response to dinitrophenylated Ficoll. (United States)

    Klaus, G G; Phillips, J M; Humphrey, J H; Dresser, D W; Cross, A M


    Dinitrophenylated polysucrose (DNP-Ficoll) elicits T cell-independent IgM anti-DNP antibody formation in mice. This antigen also elicits a heterogeneous IgG1 and IgG2 anti-DNP response, which is operationally as T-independent as the IgM response. However, a concomitant graft-versus-host reaction markedly enhances the IgG response (allogeneic effect). These results confirm those of others, indicating that a certain proportion of the precursors of IgG-producing cells can be triggered by some T-independent antigens. However, our results suggest that even with such antigens optimal triggering of IgG precursors requires T cell help.

  20. Environmental conditions influence the plant functional diversity effect on potential denitrification.

    Directory of Open Access Journals (Sweden)

    Ariana E Sutton-Grier


    Full Text Available Global biodiversity loss has prompted research on the relationship between species diversity and ecosystem functioning. Few studies have examined how plant diversity impacts belowground processes; even fewer have examined how varying resource levels can influence the effect of plant diversity on microbial activity. In a field experiment in a restored wetland, we examined the role of plant trait diversity (or functional diversity, (FD and its interactions with natural levels of variability of soil properties, on a microbial process, denitrification potential (DNP. We demonstrated that FD significantly affected microbial DNP through its interactions with soil conditions; increasing FD led to increased DNP but mainly at higher levels of soil resources. Our results suggest that the effect of species diversity on ecosystem functioning may depend on environmental factors such as resource availability. Future biodiversity experiments should examine how natural levels of environmental variability impact the importance of biodiversity to ecosystem functioning.

  1. Electron paramagnetic resonance and dynamic nuclear polarization of char suspensions: surface science and oximetry

    International Nuclear Information System (INIS)

    Clarkson, R.B.; Odintsov, B.M.; Ceroke, P.J.; Ardenkjaer-Larsen, J.H.; Fruianu, M.; Belford, R.L.


    Carbon chars have been synthesized in our laboratory from a variety of starting materials, by means of a highly controlled pyrolysis technique. These chars exhibit electron paramagnetic resonance (EPR) line shapes which change with the local oxygen concentration in a reproducible and stable fashion; they can be calibrated and used for oximetry. Biological stability and low toxicity make chars good sensors for in vivo measurements. Scalar and dipolar interactions of water protons at the surfaces of chars may be utilized to produce dynamic nuclear polarization (DNP) of the 1 H nuclear spin population in conjunction with electron Zeeman pumping. Low-frequency EPR, DNP and DNP-enhanced MRI all show promise as oximetry methods when used with carbon chars. (author)

  2. Reactive surface organometallic complexes observed using dynamic nuclear polarization surface enhanced NMR spectroscopy

    KAUST Repository

    Pump, Eva


    Dynamic Nuclear Polarization Surface Enhanced NMR Spectroscopy (DNP SENS) is an emerging technique that allows access to high-sensitivity NMR spectra from surfaces. However, DNP SENS usually requires the use of radicals as an exogenous source of polarization, which has so far limited applications for organometallic surface species to those that do not react with the radicals. Here we show that reactive surface species can be studied if they are immobilized inside porous materials with suitably small windows, and if bulky nitroxide bi-radicals (here TEKPol) are used as the polarization source and which cannot enter the pores. The method is demonstrated by obtaining significant DNP enhancements from highly reactive complelxes [(equivalent to Si-O-)W(Me)(5)] supported on MCM-41, and effects of pore size (6.0, 3.0 and 2.5 nm) on the performance are discussed.

  3. Mild mitochondrial uncoupling and calorie restriction increase fasting eNOS, akt and mitochondrial biogenesis. (United States)

    Cerqueira, Fernanda M; Laurindo, Francisco R M; Kowaltowski, Alicia J


    Enhanced mitochondrial biogenesis promoted by eNOS activation is believed to play a central role in the beneficial effects of calorie restriction (CR). Since treatment of mice with dinitrophenol (DNP) promotes health and lifespan benefits similar to those observed in CR, we hypothesized that it could also impact biogenesis. We found that DNP and CR increase citrate synthase activity, PGC-1α, cytochrome c oxidase and mitofusin-2 expression, as well as fasting plasma levels of NO• products. In addition, eNOS and Akt phosphorylation in skeletal muscle and visceral adipose tissue was activated in fasting CR and DNP animals. Overall, our results indicate that systemic mild uncoupling activates eNOS and Akt-dependent pathways leading to mitochondrial biogenesis.

  4. Mild mitochondrial uncoupling and calorie restriction increase fasting eNOS, akt and mitochondrial biogenesis.

    Directory of Open Access Journals (Sweden)

    Fernanda M Cerqueira


    Full Text Available Enhanced mitochondrial biogenesis promoted by eNOS activation is believed to play a central role in the beneficial effects of calorie restriction (CR. Since treatment of mice with dinitrophenol (DNP promotes health and lifespan benefits similar to those observed in CR, we hypothesized that it could also impact biogenesis. We found that DNP and CR increase citrate synthase activity, PGC-1α, cytochrome c oxidase and mitofusin-2 expression, as well as fasting plasma levels of NO• products. In addition, eNOS and Akt phosphorylation in skeletal muscle and visceral adipose tissue was activated in fasting CR and DNP animals. Overall, our results indicate that systemic mild uncoupling activates eNOS and Akt-dependent pathways leading to mitochondrial biogenesis.

  5. Comparative bioequivalence study of rifampicin and isoniazid combinations in healthy volunteers. (United States)

    Padgaonkar, K A; Revankar, S N; Bhatt, A D; Vaz, J A; Desai, N D; D'Sa, S; Shah, V; Gandewar, K


    To assess the bioavailability of rifampicin (RMP) in three brands of combination formulations of anti-tuberculosis drugs. A three-way double-blind, cross-over bioavailability study of RMP and isoniazid (INH), consisting of a comparison of a two-drug combination of tablets of RMP and INH each separately (reference brand R) and a tablet of RMP + INH (brand N), and a capsule of RMP + INH (brand L) was carried out in 12 healthy male volunteers. Coded plasma samples were analysed for levels of RMP as well as INH and acetylisoniazid (ACINH) by two high performance liquid chromatography (HPLC) methods. The mean values of RMP in brand N (Cmax 6.49+/-0.52 microg/mL, Tmax 2.33+/-0.18 h, AUC(0-24h) 39.83+/-3.44 microg/mL.h) were comparable with those obtained with brand R (Cmax 5.22+/-0.59 microg/mL, Tmax 2.50+/-0.12 h, AUC(0-24h) 33.33+/-3.47 microg/mL.h). The mean values of RMP in brand L (Cmax 3.05+/-0.52 microg/ mL, Tmax 3.79+/-0.57 h and AUC(0-24h) 21.78+/-3.67 microg/ mL.h) were significantly different from those in brand R. Nevertheless, all of the pharmacokinetic parameters obtained for INH and ACINH in all three brands were comparable. Using brand R as a comparison, brand N was bioequivalent and brand L was not bioequivalent.

  6. Conjugation of isoniazid to a zinc phthalocyanine via hydrazone linkage for pH-dependent liposomal controlled release (United States)

    Nkanga, Christian Isalomboto; Krause, Rui Werner Maçedo


    Tuberculosis (TB) remains the leading cause of mortality from infectious diseases. Extended TB treatment and frequent adverse effects, due to poor bioavailability of anti-tubercular drugs (ATBDs), represent the main rationales behind liposomal encapsulation for controlled delivery. Liposomes have been reported as potential vehicles for targeted delivery of ATBDs due to their rapid uptake by macrophages, which are known as the main host cells for TB causative agent (Mycobacterium tuberculosis). Additionally, the need for controlled release of ATBDs arises because leakage is part of the key liposome challenges for hydrophilic compounds like isoniazid (INH). In this study, INH was conjugated to a highly hydrophobic photosensitizer, zinc (II) phthalocyanine (PC), through hydrazone bonding. The obtained conjugate (PC-INH) was encapsulated in liposomes by film hydration method. PC-INH loaded liposomes (PILs) were characterized using dynamic light scattering, transmission electron microscopy, energy-dispersive X-ray spectrometry and UV-Vis absorption spectrometry, which was used also for estimation of encapsulation efficiency (%EE). INH release was evaluated in different pH media using dialysis. Particle size, zeta potential and %EE of PILs were about 506 nm, - 55 mV and 72%, respectively. Over 12 h, PILs exhibited 22, 41, 97 and 100% of INH, respectively, released in pH 7.4, 6.4, 5.4 and 4.4 media. This pH-dependent behavior is attractive for site-specific delivery. These findings suggest the conjugation of chemotherapeutics to phthalocyanines using pH-labile linkages as a potential strategy for liposomal controlled release.

  7. Economic impact of the use of rifaximin 550 mg twice daily for the treatment of overt hepatic encephalopathy in Italy. (United States)

    Roggeri, Daniela Paola; Roggeri, Alessandro


    Hepatic encephalopathy (HE) is associated with a reduced survival, an increased risk of hospitalization for recurrences, and a reduced health-related quality of life. The purpose of the present economic analysis was to evaluate the impact on the Italian National Health Service (INHS) expenditure of the treatment with rifaximin 550 mg twice daily (Tixteller ® /Tixtar ® ) for the reduction of the recurrences of overt HE, with respect to the current treatment approach. Costs associated with patients treated with rifaximin 550 mg twice daily were estimated considering the reduction in hospitalizations for HE recurrences revealed by registrative clinical trial (-50%) applied to the hospitalization rate (42.5%) emerging from an Italian observational real-world study; costs associated with patients not treated with rifaximin were estimated based on the hospitalization rate, resulting from the same Italian observational study. Sensitivity analyses considering possible different discount levels to INHS structures for rifaximin were performed. The INHS perspective for a period of 3 years was considered. The treatment with rifaximin 550 mg twice daily, although increasing drug costs, is associated with a reduction in hospitalizations for HE recurrences that leads to an overall reduction of total costs charged to INHS, which could be estimated, based on the forecasted uptake of the treatment, at about €130,000 in the first year, reaching ~€260,000 in the third year. Considering a possible discount for rifaximin 550 mg to INHS structure of 20%, the total saving at the third year accounts for ~€3,000,000. Moreover, a relevant reduction in the number of hospitalizations and bed days is associated with rifaximin treatment. The treatment with rifaximin 550 mg twice daily, even if associated with an increase in drug expenditure, results in a reduction in total health care costs charged to INHS due to a reduction in hospitalizations for HE recurrences.

  8. Risk of Damage to the Somatic Innervation of the Penis during the AdVanceProcedure: An Anatomical Study. (United States)

    Hogewoning, Cornelis R C; Elzevier, Henk W; Pelger, Rob C M; Bekker, Milou D; DeRuiter, Marco C


    One of the methods to treat post radical prostatectomy stress urinary incontinence is the AdVance (American Medical Systems, Minnetonka, MN, USA) male sling procedure. During this procedure, the somatic innervation of the penis may be at risk for injury. Six AdVance procedures were performed in six donated bodies at the Anatomy and Embryology Department of the Leiden University Medical Centre. The pelves were dissected and the shortest distance between the sling and the dorsal nerve of the penis (DNP) was documented. The aim of this study was to describe the anatomical relation between the AdVance male sling and penile nerves based on the dissection of six adult male pelves. The AdVance male sling procedure was conducted in six donated male bodies. After placement, the pelves were dissected and the shortest distance between sling and the DNP was documented. The main outcome measure was the distance between the AdVance male sling and the DNP. The mean distance of the sling to the DNP was 4.1 mm and was found situated directly next to the nerve (distance 0 mm) in 4 out of 12 (33%) hemipelves. The distance of the sling to the obturator neurovascular bundle was 30 mm or more in all six bodies. Damage to the DNP caused by the AdVance male sling procedure appears to be an extremely rare complication, which has not been described in current literature. The proximity of the AdVance to the DNP could, however, pose a risk that should be taken into consideration by physicians and patients when opting for surgery. © 2015 International Society for Sexual Medicine.

  9. Peptide conjugated polymeric nanoparticles as a carrier for targeted delivery of docetaxel. (United States)

    Kulhari, Hitesh; Pooja, Deep; Shrivastava, Shweta; V G M, Naidu; Sistla, Ramakrishna


    The aim of this research work was to develop Bombesin peptide (BBN) conjugated, docetaxel loaded nanocarrier for the treatment of breast cancer. Docetaxel loaded nanoparticles (DNP) were prepared by solvent evaporation method using sodium cholate as surfactant. BBN was conjugated to DNP surface through covalent bonding. Both DNP and BBN conjugated DNP (BDNP) were characterized by various techniques such as dynamic light scattering, Fourier transform infrared spectroscopy (FTIR), atomic force microscopy (AFM), powder X-ray diffraction (PXRD), differential scanning calorimetry (DSC) and thermogravimetric analysis. The particle diameter and zeta potential of BDNP were 136±3.95 nm and -10.8±2.7 mV, respectively. The change in surface charge and FTIR studies confirmed the formation of amide linkage between BBN and DNP. AFM analysis showed that nanoparticles were spherical in shapes. In nanoparticles, docetaxel was present in its amorphous form as confirmed by DSC and PXRD analysis and was stable during the thermal studies. The formulations showed the sustained release of DTX over the period of 120 h. During cellular toxicity assay in gastrin releasing peptide receptor positive breast cancer cells (MDA-MB-231), BDNP were found to be 12 times more toxic than pure DTX and Taxotere. The IC50 value for DTX, Taxotere, DNP and BDNP was >375, >375, 142.23 and 35.53 ng/ml, respectively. The above studies showed that Bombesin conjugated nanocarrier system could be a promising carrier for active targeting of anticancer drugs in GRP receptor over expressing cancer cells. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Some high coordination compounds of lanthanides(III derived from N-isonicotinamidosalicyaldimine

    Directory of Open Access Journals (Sweden)

    Ram K. Agarwal


    Full Text Available A new series of lanthanide(III nitrates, isothiocyanates and perchlorates coordination complexes of N-isonicotinamidosalicyaldimine (INH-SAL with the general composition LnX3.n(INH-SAL (Ln = La, Pr, Nd, Sm, Gd, Tb or Dy; X = NO3-, n = 2; X = NCS-, n = 2 or 3 and X = ClO4-, n = 4 have been reported. All the complexes were characterized by chemical analyses, conductance, molar weight, magnetic moment measurements, infrared and electronic spectra. IR spectra indicate that the ligand behaves as a neutral N,O-donors. Thermal properties of the complexes have also been studied.

  11. Public dentistry, which direction? The Italian anomaly and its new perspectives


    Reali, Daniela; Dinelli, Francesca; Rolla, Paolo


    Italian National Health Service (INHS) provides hospital, district and preventive cares in many medical areas but dental cares are a small part of all treatments provided. It is estimated that it only answers a 5% of need. In Italy dental treatments are predominantly provided by private practitioners: it means little access equity to cares. Nowadays, just 1,5% of the INHS expense is aimed at public dentistry because most of dental cares are believed “not urgent”. Why oral diseases are not con...

  12. Brazilian energy overview

    International Nuclear Information System (INIS)

    Souza, J.A.M. de.


    The Brazilian energy overview compared with the rest of the world is presented, as well as the current situation and prospects for the future. In a first part, the evalution from the past through the present time is considered, and in a second part, attention is given on the future prospects for Brazil and the different countries in connection with the energy field. It is expected that the current per capita energy consumption in Brazil, in all of its various forms, now totalling 6 million kcal/inh, will reach at least 22 million kcal/inh toward the end of this century

  13. High Work, High-Efficiency Turbines for Uninhabited Aerial Vehicles (UAVs) Addendum to AFRL-RQ-WP-TR-2013-0198 (United States)


    upstream and total pressure in the wake of the blades. A -0.2 to 0.8 in-H20 Druck pressure transducer was used for wake loss measurements, and 0 to...2.0 in-H20 Druck pressure transducer for Cp calculations. A single element hotwire was used to measure inlet velocity and calculate Reynolds number...Sheet for Conformal Surface Diagnostics A novel technique that generates curved laser-sheets of arbitrary wrappable 3D shapes has been developed

  14. An open, randomized, parallel-group study to compare the efficacy and safety profile of inhaled human insulin (Exubera) with glibenclamide as adjunctive therapy in patients with type 2 diabetes poorly controlled on metformin

    DEFF Research Database (Denmark)

    Barnett, AH; Dreyer, M; Lange, Peter


    OBJECTIVE: To compare the efficacy and safety profile of adding inhaled human insulin (INH) (Exubera) or glibenclamide to metformin monotherapy in patients with poorly controlled type 2 diabetes. RESEARCH DESIGN AND METHODS: We conducted an open-label, parallel, 24-week multicenter trial. Patients...... associated clinical manifestations. CONCLUSIONS: In patients with type 2 diabetes poorly controlled on metformin, adding INH or glibenclamide was similarly effective in improving glycemic control, and both were well tolerated. A predefined subgroup with very high A1C (>9.5%) was more effectively treated...

  15. Aged dominant negative p38α MAPK mice are resistant to age-dependent decline in adult-neurogenesis and context discrimination fear conditioning. (United States)

    Cortez, IbDanelo; Bulavin, Dmitry V; Wu, Ping; McGrath, Erica L; Cunningham, Kathryn A; Wakamiya, Maki; Papaconstantinou, John; Dineley, Kelly T


    A major aspect of mammalian aging is the decline in functional competence of many self-renewing cell types, including adult-born neuronal precursors. Since age-related senescence of self-renewal occurs simultaneously with chronic up-regulation of the p38MAPKalpha (p38α) signaling pathway, we used the dominant negative mouse model for attenuated p38α activity (DN-p38α AF/+ ) in which Thr180 and Tyr182 are mutated (T→A/Y→F) to prevent phosphorylation activation (DN-p38α AF/+ ) and kinase activity. As a result, aged DN-p38α AF/+ mice are resistant to age-dependent decline in proliferation and regeneration of several peripheral tissue progenitors when compared to wild-type littermates. Aging is the major risk factor for non-inherited forms of Alzheimer's disease (AD); environmental and genetic risk factors that accelerate the senescence phenotype are thought to contribute to an individual's relative risk. In the present study, we evaluated aged DN-p38α AF/+ and wildtype littermates in a series of behavioral paradigms to test if p38α mutant mice exhibit altered baseline abnormalities in neurological reflexes, locomotion, anxiety-like behavior, and age-dependent cognitive decline. While aged DN-p38α AF/+ and wildtype littermates appear equal in all tested baseline neurological and behavioral parameters, DN-p38α AF/+ exhibit superior context discrimination fear conditioning. Context discrimination is a cognitive task that is supported by proliferation and differentiation of adult-born neurons in the dentate gyrus of the hippocampus. Consistent with enhanced context discrimination in aged DN-p38α AF/+ , we discovered enhanced production of adult-born neurons in the dentate gyrus of DN-p38α AF/+ mice compared to wildtype littermates. Our findings support the notion that p38α inhibition has therapeutic utility in aging diseases that affect cognition, such as AD. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Generating highly polarized nuclear spins in solution using dynamic nuclear polarization

    DEFF Research Database (Denmark)

    Wolber, J.; Ellner, F.; Fridlund, B.


    A method to generate strongly polarized nuclear spins in solution has been developed, using Dynamic Nuclear Polarization (DNP) at a temperature of 1.2K, and at a field of 3.354T, corresponding to an electron spin resonance frequency of 94GHz. Trityl radicals are used to directly polarize 13C...... and other low-γ nuclei. Subsequent to the DNP process, the solid sample is dissolved rapidly with a warm solvent to create a solution of molecules with highly polarized nuclear spins. Two main applications are proposed: high-resolution liquid state NMR with enhanced sensitivity, and the use...

  17. Verdazyl-ribose: A new radical for solid-state dynamic nuclear polarization at high magnetic field. (United States)

    Thurber, Kent R; Le, Thanh-Ngoc; Changcoco, Victor; Brook, David J R


    Solid-state dynamic nuclear polarization (DNP) using the cross-effect relies on radical pairs whose electron spin resonance (ESR) frequencies differ by the nuclear magnetic resonance (NMR) frequency. We measure the DNP provided by a new water-soluble verdazyl radical, verdazyl-ribose, under both magic-angle spinning (MAS) and static sample conditions at 9.4 T, and compare it to a nitroxide radical, 4-hydroxy-TEMPO. We find that verdazyl-ribose is an effective radical for cross-effect DNP, with the best relative results for a non-spinning sample. Under non-spinning conditions, verdazyl-ribose provides roughly 2× larger 13 C cross-polarized (CP) NMR signal than the nitroxide, with similar polarization buildup times, at both 29 K and 76 K. With MAS at 7 kHz and 1.5 W microwave power, the verdazyl-ribose does not provide as much DNP as the nitroxide, with the verdazyl providing less NMR signal and a longer polarization buildup time. When the microwave power is decreased to 30 mW with 5 kHz MAS, the two types of radical are comparable, with the verdazyl-doped sample having a larger NMR signal which compensates for its longer polarization buildup time. We also present electron spin relaxation measurements at Q-band (1.2 T) and ESR lineshapes at 1.2 and 9.4 T. Most notably, the verdazyl radical has a longer T 1e than the nitroxide (9.9 ms and 1.3 ms, respectively, at 50 K and 1.2 T). The verdazyl electron spin lineshape is significantly affected by the hyperfine coupling to four 14 N nuclei, even at 9.4 T. We also describe 3000-spin calculations to illustrate the DNP potential of possible radical pairs: verdazyl-verdazyl, verdazyl-nitroxide, or nitroxide-nitroxide pairs. These calculations suggest that the verdazyl radical at 9.4 T has a narrower linewidth than optimal for cross-effect DNP using verdazyl-verdazyl pairs. Because of the hyperfine coupling contribution to the electron spin linewidth, this implies that DNP using the verdazyl

  18. Dynamic proton polarisation on polymers in solution: creating contrast in neutron scattering

    International Nuclear Information System (INIS)

    Grinten, M.G.D. van der


    Dynamic nuclear polarisation (DNP) as an alternative or additional method to create contrast in neutron small angle scattering has been investigated with emphasis on the study of polymers in solution. The need for high polarisations imposes specific requirements on the sample and its environment. Vitreous beads have been used as samples. Nuclear relaxation times show that they contain dissolved air. Parasitic scattering from the solvent is observed, probably arising from nanometer air bubbles. DNP is shown to be useful, in particular for samples that consist of mixtures of hydrogen-free and hydrogen-rich molecules, where the different molecules can be highlighted by changing the polarisation. ((orig.))

  19. Distribution of intravenously administered acetylcholinesterase inhibitor and acetylcholinesterase activity in the adrenal gland: 11C-donepezil PET study in the normal rat. (United States)

    Watabe, Tadashi; Naka, Sadahiro; Ikeda, Hayato; Horitsugi, Genki; Kanai, Yasukazu; Isohashi, Kayako; Ishibashi, Mana; Kato, Hiroki; Shimosegawa, Eku; Watabe, Hiroshi; Hatazawa, Jun


    Acetylcholinesterase (AChE) inhibitors have been used for patients with Alzheimer's disease. However, its pharmacokinetics in non-target organs other than the brain has not been clarified yet. The purpose of this study was to evaluate the relationship between the whole-body distribution of intravenously administered (11)C-Donepezil (DNP) and the AChE activity in the normal rat, with special focus on the adrenal glands. The distribution of (11)C-DNP was investigated by PET/CT in 6 normal male Wistar rats (8 weeks old, body weight  = 220 ± 8.9 g). A 30-min dynamic scan was started simultaneously with an intravenous bolus injection of (11)C-DNP (45.0 ± 10.7 MBq). The whole-body distribution of the (11)C-DNP PET was evaluated based on the Vt (total distribution volume) by Logan-plot analysis. A fluorometric assay was performed to quantify the AChE activity in homogenized tissue solutions of the major organs. The PET analysis using Vt showed that the adrenal glands had the 2nd highest level of (11)C-DNP in the body (following the liver) (13.33 ± 1.08 and 19.43 ± 1.29 ml/cm(3), respectively), indicating that the distribution of (11)C-DNP was the highest in the adrenal glands, except for that in the excretory organs. The AChE activity was the third highest in the adrenal glands (following the small intestine and the stomach) (24.9 ± 1.6, 83.1 ± 3.0, and 38.5 ± 8.1 mU/mg, respectively), indicating high activity of AChE in the adrenal glands. We demonstrated the whole-body distribution of (11)C-DNP by PET and the AChE activity in the major organs by fluorometric assay in the normal rat. High accumulation of (11)C-DNP was observed in the adrenal glands, which suggested the risk of enhanced cholinergic synaptic transmission by the use of AChE inhibitors.

  20. An improved autoradiographic technique for the detection of antibody-forming cells

    International Nuclear Information System (INIS)

    Mason, D.W.


    An autoradiographic technique for the detection of antibody-forming cells has been developed for the assay of anti-DNP responses. The lymphoid cell suspension to be assayed was allowed to sediment on to a glass slide coated with DNP-conjugated gelatin to which the secreted antibody bound during subsequent incubation. The bound antibody and its Ig class was revealed by a second incubation using 125 I-anti-immunoglobulin reagents followed by autoradiography. Studies on the sensitivity and specificity of the method are presented and its advantages over other techniques described. The technique should be readily applicable to other haptens

  1. Verdazyl-ribose: A new radical for solid-state dynamic nuclear polarization at high magnetic field (United States)

    Thurber, Kent R.; Le, Thanh-Ngoc; Changcoco, Victor; Brook, David J. R.


    Solid-state dynamic nuclear polarization (DNP) using the cross-effect relies on radical pairs whose electron spin resonance (ESR) frequencies differ by the nuclear magnetic resonance (NMR) frequency. We measure the DNP provided by a new water-soluble verdazyl radical, verdazyl-ribose, under both magic-angle spinning (MAS) and static sample conditions at 9.4 T, and compare it to a nitroxide radical, 4-hydroxy-TEMPO. We find that verdazyl-ribose is an effective radical for cross-effect DNP, with the best relative results for a non-spinning sample. Under non-spinning conditions, verdazyl-ribose provides roughly 2× larger 13C cross-polarized (CP) NMR signal than the nitroxide, with similar polarization buildup times, at both 29 K and 76 K. With MAS at 7 kHz and 1.5 W microwave power, the verdazyl-ribose does not provide as much DNP as the nitroxide, with the verdazyl providing less NMR signal and a longer polarization buildup time. When the microwave power is decreased to 30 mW with 5 kHz MAS, the two types of radical are comparable, with the verdazyl-doped sample having a larger NMR signal which compensates for its longer polarization buildup time. We also present electron spin relaxation measurements at Q-band (1.2 T) and ESR lineshapes at 1.2 and 9.4 T. Most notably, the verdazyl radical has a longer T1e than the nitroxide (9.9 ms and 1.3 ms, respectively, at 50 K and 1.2 T). The verdazyl electron spin lineshape is significantly affected by the hyperfine coupling to four 14N nuclei, even at 9.4 T. We also describe 3000-spin calculations to illustrate the DNP potential of possible radical pairs: verdazyl-verdazyl, verdazyl-nitroxide, or nitroxide-nitroxide pairs. These calculations suggest that the verdazyl radical at 9.4 T has a narrower linewidth than optimal for cross-effect DNP using verdazyl-verdazyl pairs. Because of the hyperfine coupling contribution to the electron spin linewidth, this implies that DNP using the verdazyl radical would improve at lower

  2. Strategic Planning and Doctor Of Nursing Practice Education: Developing Today's and Tomorrow's Leaders. (United States)

    Falk, Nancy L; Garrison, Kenneth F; Brown, Mary-Michael; Pintz, Christine; Bocchino, Joseph


    Strategic planning and thinking skills are essential for today's nurse leaders. Doctor of nursing practice (DNP) programs provide an opportunity for developing effective nurse strategists. A well-designed strategy course can stimulate intellectual growth at all levels of Bloom's Taxonomy. Discussion forums in online education provide new opportunities for rich interaction among peers en route to development of well-informed strategic plans. An interprofessional perspective adds a rich and vital aspect to doctoral nursing education and it serves to inform strategic plan development. A roadmap for teaching strategic planning to current and future nursing leaders will guide the integration of essential content into DNP programs.

  3. Distribution of intravenously administered acetylcholinesterase inhibitor and acetylcholinesterase activity in the adrenal gland: 11C-donepezil PET study in the normal rat.

    Directory of Open Access Journals (Sweden)

    Tadashi Watabe

    Full Text Available PURPOSE: Acetylcholinesterase (AChE inhibitors have been used for patients with Alzheimer's disease. However, its pharmacokinetics in non-target organs other than the brain has not been clarified yet. The purpose of this study was to evaluate the relationship between the whole-body distribution of intravenously administered (11C-Donepezil (DNP and the AChE activity in the normal rat, with special focus on the adrenal glands. METHODS: The distribution of (11C-DNP was investigated by PET/CT in 6 normal male Wistar rats (8 weeks old, body weight  = 220 ± 8.9 g. A 30-min dynamic scan was started simultaneously with an intravenous bolus injection of (11C-DNP (45.0 ± 10.7 MBq. The whole-body distribution of the (11C-DNP PET was evaluated based on the Vt (total distribution volume by Logan-plot analysis. A fluorometric assay was performed to quantify the AChE activity in homogenized tissue solutions of the major organs. RESULTS: The PET analysis using Vt showed that the adrenal glands had the 2nd highest level of (11C-DNP in the body (following the liver (13.33 ± 1.08 and 19.43 ± 1.29 ml/cm(3, respectively, indicating that the distribution of (11C-DNP was the highest in the adrenal glands, except for that in the excretory organs. The AChE activity was the third highest in the adrenal glands (following the small intestine and the stomach (24.9 ± 1.6, 83.1 ± 3.0, and 38.5 ± 8.1 mU/mg, respectively, indicating high activity of AChE in the adrenal glands. CONCLUSIONS: We demonstrated the whole-body distribution of (11C-DNP by PET and the AChE activity in the major organs by fluorometric assay in the normal rat. High accumulation of (11C-DNP was observed in the adrenal glands, which suggested the risk of enhanced cholinergic synaptic transmission by the use of AChE inhibitors.

  4. Directory of Open Access Journals (Sweden)

    Pola Becerril-Montes


    Full Text Available The resistance of 139 Mycobacterium tuberculosis (MTB isolates from the city of Monterrey, Northeast Mexico, to first and second-line anti-TB drugs was analysed. A total of 73 isolates were susceptible and 66 were resistant to anti-TB drugs. Monoresistance to streptomycin, isoniazid (INH and ethambutol was observed in 29 cases. Resistance to INH was found in 52 cases and in 29 cases INH resistance was combined with resistance to two or three drugs. A total of 24 isolates were multidrug-resistant (MDR resistant to at least INH and rifampicin and 11 MDR cases were resistant to five drugs. The proportion of MDR-TB among new TB cases in our target population was 0.72% (1/139 cases. The proportion of MDR-TB among previously treated cases was 25.18% (35/139 cases. The 13 polyresistant and 24 MDR isolates were assayed against the following seven second-line drugs: amikacin (AMK, kanamycin (KAN, capreomycin (CAP, clofazimine (CLF, ethionamide (ETH, ofloxacin (OFL and cycloserine (CLS. Resistance to CLF, OFL or CLS was not observed. Resistance was detected to ETH (10.80% and to AMK (2.70%, KAN (2.70% and CAP (2.70%. One isolate of MDR with primary resistance was also resistant to three second-line drugs. Monterrey has a high prevalence of MDR-TB among previously treated cases and extensively drug-resistant-MTB strains may soon appear.

  5. A population-based study of first and second-line drug-resistant tuberculosis in a high-burden area of the Mexico/United States border

    Directory of Open Access Journals (Sweden)

    Pola Becerril-Montes


    Full Text Available The resistance of 139 Mycobacterium tuberculosis (MTB isolates from the city of Monterrey, Northeast Mexico, to first and second-line anti-TB drugs was analysed. A total of 73 isolates were susceptible and 66 were resistant to anti-TB drugs. Monoresistance to streptomycin, isoniazid (INH and ethambutol was observed in 29 cases. Resistance to INH was found in 52 cases and in 29 cases INH resistance was combined with resistance to two or three drugs. A total of 24 isolates were multidrug-resistant (MDR resistant to at least INH and rifampicin and 11 MDR cases were resistant to five drugs. The proportion of MDR-TB among new TB cases in our target population was 0.72% (1/139 cases. The proportion of MDR-TB among previously treated cases was 25.18% (35/139 cases. The 13 polyresistant and 24 MDR isolates were assayed against the following seven second-line drugs: amikacin (AMK, kanamycin (KAN, capreomycin (CAP, clofazimine (CLF, ethionamide (ETH, ofloxacin (OFL and cycloserine (CLS. Resistance to CLF, OFL or CLS was not observed. Resistance was detected to ETH (10.80% and to AMK (2.70%, KAN (2.70% and CAP (2.70%. One isolate of MDR with primary resistance was also resistant to three second-line drugs. Monterrey has a high prevalence of MDR-TB among previously treated cases and extensively drug-resistant-MTB strains may soon appear.

  6. In vivo/in vitro pharmacokinetic and pharmacodynamic study of spray-dried poly-(dl-lactic-co-glycolic) acid nanoparticles encapsulating rifampicin and isoniazid

    CSIR Research Space (South Africa)

    Booysen, LLIJ


    Full Text Available . tb.) (strain H(sub37)Rv). Sustained drug release over seven days were observed for these drugs following once-off oral administration in mice with subsequent drug distribution of up to 10 days in the liver and lungs for RIF and INH, respectively...

  7. Functional C1-inhibitor diagnostics in hereditary angioedema: Assay evaluation and recommendations

    NARCIS (Netherlands)

    Wagenaar-Bos, Ineke G. A.; Drouet, Christian; Aygoeren-Pursun, Emel; Bork, Konrad; Bucher, Christoph; Bygum, Anette; Farkas, Henriette; Fust, George; Gregorek, Hanna; Hack, C. Erik; Hickey, Alaco; Joller-Jemelka, Helen I.; Kapusta, Maria; Kreuz, Wolfhart; Longhurst, Hilary; Lopez-Trascasa, Margarita; Madalinski, Kazimierz; Naskalski, Jerzy; Nieuwenhuys, Ed; Ponard, Denise; Truedsson, Lennart; Varga, Lilian; Nielsen, Erik Waage; Wagner, Eric; Zingale, Lorenza; Cicardi, Marco; van Ham, S. Marieke


    Hereditary angioedema (HAE) is an autosomal dominant disease characterized by recurrent episodes of potentially life-threatening angioedema. The most widespread underlying genetic deficiency is a heterozygous deficiency of the serine protease inhibitor Cl esterase inhibitor (C1-Inh). In addition to

  8. Breakthrough attacks in patients with hereditary angioedema receiving long-term prophylaxis are responsive to icatibant

    DEFF Research Database (Denmark)

    Aberer, Werner; Maurer, Marcus; Bouillet, Laurence


    BACKGROUND: Patients with hereditary angioedema (HAE) due to C1-inhibitor deficiency (C1-INH-HAE) experience recurrent attacks of cutaneous or submucosal edema that may be frequent and severe; prophylactic treatments can be prescribed to prevent attacks. However, despite the use of long-term prop...

  9. Disease: H01143 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available H01143 Vitamin D-dependent rickets Rickets is the failure of growing bone to miner...ldup of unossified cartilage. Vitamin D-dependent rickets type I results from abnormalities in the gene hypocalcemia, secondary hyperparathyroidism and early onset severe rickets. Musculoskeletal disease; Inhe

  10. Comparison of different treatments for isoniazid-resistant tuberculosis: an individual patient data meta-analysis.

    NARCIS (Netherlands)

    Fregonese, Federica; Ahuja, Shama D; Akkerman, Onno W; Arakaki-Sanchez, Denise; Ayakaka, Irene; Baghaei, Parvaneh; Bang, Didi; Bastos, Mayara; Benedetti, Andrea; Bonnet, Maryline; Cattamanchi, Adithya; Cegielski, Peter; Chien, Jung-Yien; Cox, Helen; Dedicoat, Martin; Erkens, Connie; Escalante, Patricio; Falzon, Dennis; Garcia-Prats, Anthony J; Gegia, Medea; Gillespie, Stephen H; Glynn, Judith R; Goldberg, Stefan; Griffith, David; Jacobson, Karen R; Johnston, James C; Jones-López, Edward C; Khan, Awal; Koh, Won-Jung; Kritski, Afranio; Lan, Zhi Yi; Lee, Jae Ho; Li, Pei Zhi; Maciel, Ethel L; Galliez, Rafael Mello; Merle, Corinne S C; Munang, Melinda; Narendran, Gopalan; Nguyen, Viet Nhung; Nunn, Andrew; Ohkado, Akihiro; Park, Jong Sun; Phillips, Patrick P J; Ponnuraja, Chinnaiyan; Reves, Randall; Romanowski, Kamila; Seung, Kwonjune; Schaaf, H Simon; Skrahina, Alena; Soolingen, Dick van; Tabarsi, Payam; Trajman, Anete; Trieu, Lisa; Banurekha, Velayutham V; Viiklepp, Piret; Wang, Jann-Yuan; Yoshiyama, Takashi; Menzies, Dick

    Isoniazid-resistant, rifampicin-susceptible (INH-R) tuberculosis is the most common form of drug resistance, and is associated with failure, relapse, and acquired rifampicin resistance if treated with first-line anti-tuberculosis drugs. The aim of the study was to compare success, mortality, and

  11. Comparison of different treatments for isoniazid-resistant tuberculosis : an individual patient data meta-analysis

    NARCIS (Netherlands)

    Fregonese, Federica; Ahuja, Shama D; Akkerman, Onno W; Arakaki-Sanchez, Denise; Ayakaka, Irene; Baghaei, Parvaneh; Bang, Didi; Bastos, Mayara; Benedetti, Andrea; Bonnet, Maryline; Cattamanchi, Adithya; Cegielski, Peter; Chien, Jung-Yien; Cox, Helen; Dedicoat, Martin; Erkens, Connie; Escalante, Patricio; Falzon, Dennis; Garcia-Prats, Anthony J; Gegia, Medea; Gillespie, Stephen H; Glynn, Judith R; Goldberg, Stefan; Griffith, David; Jacobson, Karen R; Johnston, James C; Jones-López, Edward C; Khan, Awal; Koh, Won-Jung; Kritski, Afranio; Lan, Zhi Yi; Lee, Jae Ho; Li, Pei Zhi; Maciel, Ethel L; Galliez, Rafael Mello; Merle, Corinne S C; Munang, Melinda; Narendran, Gopalan; Nguyen, Viet Nhung; Nunn, Andrew; Ohkado, Akihiro; Park, Jong Sun; Phillips, Patrick P J; Ponnuraja, Chinnaiyan; Reves, Randall; Romanowski, Kamila; Seung, Kwonjune; Schaaf, H Simon; Skrahina, Alena; Soolingen, Dick van; Tabarsi, Payam; Trajman, Anete; Trieu, Lisa; Banurekha, Velayutham V; Viiklepp, Piret; Wang, Jann-Yuan; Yoshiyama, Takashi; Menzies, Dick

    BACKGROUND: Isoniazid-resistant, rifampicin-susceptible (INH-R) tuberculosis is the most common form of drug resistance, and is associated with failure, relapse, and acquired rifampicin resistance if treated with first-line anti-tuberculosis drugs. The aim of the study was to compare success,

  12. U.S. EPA, Pesticide Product Label, METHYL BROMIDE 89.5%, 09/06/1989 (United States)


    ... a .. d V' • ..ut .. r.. Liquid (inh.laU .... h .... d). Do not ahlp ... ' : .~; t:~ ': . nee.allty to .n'" "0'" pt'iof to dllc .... 'OI. ... booll. . ,-·t··:, . j, .. ·· laM •• wh". ...

  13. Usefulness of C1 Esterase Inhibitor Protein Concentrate in the ...

    African Journals Online (AJOL)


    Apr 4, 2018 ... 2018 Nigerian Journal of Clinical Practice | Published by Wolters Kluwer ‑ Medknow ... of this case report is to describe the lifesaving use of a novel C1‑INH protein ... edema of the upper lip, uvula, and tongue [Figure 1].

  14. Respiratory tract tumors in Syrian hamsters following inhalation of Pu--ZrO2 particles

    International Nuclear Information System (INIS)

    Thomas, R.G.; Smith, D.M.


    Inhalation of radionuclide-bearing particles remains one of the most intensely pursued problems concerning the nuclear industry. This route of entry is generally accepted as the most probable, in case of human exposure, with ingestion being the other prominent source of concern. Many laboratory investigations, such as those reported here, continue to evaluate the possible consequences that may present health problems to the public domain. Syrian hamsters of both sexes received either inhaled (INH) PuO 2 /ZrO 2 particles, intravenous (IV) PuO 2 /ZrO 2 microspheres, a combination of INH PuO 2 /ZrO 2 particles and injected PuO 2 /ZrO 2 microspheres, or no radionuclides (controls). The INH particles and IV microspheres were tagged with γ-emitting 57 Co to facilitate whole body counting and establishment of retention curves. Total lung burdens ranged from 8 nCi to 143 nCi. Significant numbers of primary lung tumors (5 to 50% per group) were induced in those animals that received INH exposures. Additional α radiation administered via Pu-laden IV microspheres had little or no effect on tumor production or nonneoplastic, degenerative changes in the respiratory tract

  15. Functional C1-inhibitor diagnostics in hereditary angioedema: assay evaluation and recommendations

    DEFF Research Database (Denmark)

    Wagenaar-Bos, Ineke G A; Drouet, Christian; Aygören-Pursun, Emel


    Hereditary angioedema (HAE) is an autosomal dominant disease characterized by recurrent episodes of potentially life-threatening angioedema. The most widespread underlying genetic deficiency is a heterozygous deficiency of the serine protease inhibitor C1 esterase inhibitor (C1-Inh). In addition ...

  16. Tolazamide (United States)

    Tolazamide comes as a tablet to take by mouth. It is usually taken once a day with breakfast or the first main meal of the ... medications to treat high blood sugar or diabetes; isoniazid (INH); MAO inhibitors such as isocarboxazid (Marplan), phenelzine ( ...

  17. Tolbutamide (United States)

    Tolbutamide comes as a tablet to take by mouth. It is usually taken once a day in the morning. Tell your doctor if tolbutamide upsets ... medications to treat high blood sugar or diabetes; isoniazid (INH); MAO inhibitors such as isocarboxazid (Marplan), phenelzine ( ...

  18. Alosetron (United States)

    Alosetron comes as a tablet to take by mouth. It is usually taken twice a day with or without food. Take alosetron at around the ... Levaquin), norfloxacin (Noroxin), ofloxacin (Floxin), others; hydralazine (apresoline); isoniazid (INH, Nydrazid); certain medications for human immunodeficiency virus ( ...

  19. Glimepiride (United States)

    Glimepiride comes as a tablet to take by mouth. It is usually taken once a day with breakfast or the first main meal of the ... medications to treat high blood sugar or diabetes; isoniazid (INH); MAO inhibitors such as isocarboxazid (Marplan), phenelzine ( ...

  20. Ketoconazole (United States)

    Ketoconazole comes as a tablet to take by mouth. It is usually taken once a day Take ketoconazole at around the same time every day. ... ranitidine (Zantac); medications to treat tuberculosis such as isoniazid (INH, Nydrazid), rifabutin (Mycobutin), rifampin (Rifadin, Rimactane); methylprednisolone ( ...

  1. Glyburide (United States)

    Glyburide comes as a tablet to take by mouth. It is usually taken once a day with breakfast or the first main meal of the ... medications to treat high blood sugar or diabetes; isoniazid (INH); MAO inhibitors such as isocarboxazid (Marplan), phenelzine ( ...

  2. Chlorpropamide (United States)

    Chlorpropamide comes as a tablet to take by mouth. It is usually taken with breakfast once a day. Tell your doctor if chlorpropamide upsets your ... medications to treat high blood sugar or diabetes; isoniazid (INH); MAO inhibitors such as isocarboxazid (Marplan), phenelzine ( ...

  3. Plasma-derived human C1-esterase inhibitor does not prevent mechanical ventilation-induced pulmonary complement activation in a rat model of Streptococcus pneumoniae pneumonia

    NARCIS (Netherlands)

    de Beer, F. M.; Aslami, H.; Hoeksma, J.; van Mierlo, G.; Wouters, D.; Zeerleder, S.; Roelofs, J. J. T. H.; Juffermans, N. P.; Schultz, M. J.; Lagrand, W. K.


    Mechanical ventilation has the potential to cause lung injury, and the role of complement activation herein is uncertain. We hypothesized that inhibition of the complement cascade by administration of plasma-derived human C1-esterase inhibitor (C1-INH) prevents ventilation-induced pulmonary


    Coral reefs are declining at unprecedented rates worldwide due to multiple interactive stressors including climate change and land-based sources of pollution. The Clean Water Act (CWA) can be a powerful legal instrument for protecting water resources, including the biological inh...

  5. Synergistic Effect of Azadirachta Indica Extract and Iodide Ions on the Corrosion Inhibition of Aluminium in Acid Media

    Energy Technology Data Exchange (ETDEWEB)

    Arab, S. T.; Al- Turkustani, A. M.; Al- Dhahiri, R. H. [King Abd El- Aziz University, Jeddah (Saudi Arabia)


    The synergistic action caused by iodide ions on the corrosion inhibition of aluminium (Al) in 0.5 M HCl in the presence of Azadirachta Indica (AZI) plant extract has been investigated using potintiodynamic polarization and impedance techniques. It is found that AZI extract inhibits the corrosion of aluminium in 0.5 M HCl. The inhibition efficiency increases with the increase in AZI extract concentration, until 24% v/v of AZI extract, then Inh.% is decreased with father increase in AZI extract concentration. The adsorption of this extract in the studied concentration is found to obey Frewendlish adsorption isotherm. The addition of iodide ions enhances the inhibition efficiency to a considerable extent. The increase in Inh.% values in presence of fixed concentration of iodide ions indicates that AZI extract forms an insoluble complex at lower AZI extract concentrations by undergoing a joint adsorption. But at higher concentrations of AZI extract, competitive adsorption is found between iodide ions and the formed complex leading to less Inh.%. The Inh.% decreased in presence of iodide ions with AZI extract than in presence of AZI extract alone at all studied iodide concentrations. The synergism parameter S {sub θ} is defined and calculated from surface coverage values. This parameter in the case of AZI extract is found to be more than unity, indicating that the enhanced inhibition efficiency caused by the addition of iodide ions.

  6. Studies in Intelligence. Volume 51, Number 2, 2007 (United States)


    double agent tasking, have been fitted against a larger tap - estry of the adversary’s strategic purpose to inform a CI plan for dealing with the...north of Tay Ninh City. The au thor ( right) with o ther P RU lea ders, l eft to righ t, Mr. Ngiem , Tay N inh Ci ty tea m lead er, MSgt Smith (US

  7. EST Table: FS911502 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available eritance modifier 19 [Culex quinquefasciatus] gb|EDS39679.1| sensitized chromosome inheritance...FS911502 E_FL_fufe_23G14_F_0 11/12/09 n.h 10/09/28 35 %/234 aa ref|XP_001842174.1| sensitized chromosome inh

  8. Sequence Classification: 889834 [

    Lifescience Database Archive (English)

    Full Text Available ritance; deletion reveals defects in precursor tRNA splicing, sporulation and cell separation; Ptc1p || ... ...C protein phosphatase (PP2C); inactivates the osmosensing MAPK cascade by dephosphorylating Hog1p; mutation delays mitochondrial inhe

  9. A monoclonal antibody-based ELISA for the hedgehog inhibitors cyclopamine and cyclopamine derivatives (United States)

    In the late 1960’s cyclopamine was isolated from the plant Veratrum californicum and identified as the teratogen responsible for craniofacial birth defects including cyclops in the offspring of sheep grazing on mountain ranges in the western United States. More recently, cyclopamine was found to inh...

  10. International consensus and practical guidelines on the gynecologic and obstetric management of female patients with hereditary angioedema caused by C1 inhibitor deficiency

    DEFF Research Database (Denmark)

    Caballero, Teresa; Farkas, Henriette; Bouillet, Laurence


    devices, and progestins can be used. Pregnancy: Attenuated androgens are contraindicated and should be discontinued before attempting conception. Plasma-derived human C1 inhibitor concentrate (pdhC1INH) is preferred for acute treatment, short-term prophylaxis, or long-term prophylaxis. Tranexamic acid...

  11. Novel Isoniazid cocrystals with aromatic carboxylic acids: Crystal engineering, spectroscopy and thermochemical investigations (United States)

    Diniz, Luan F.; Souza, Matheus S.; Carvalho, Paulo S.; da Silva, Cecilia C. P.; D'Vries, Richard F.; Ellena, Javier


    Four novel cocrystals of the anti-tuberculosis drug Isoniazid (INH), including two polymorphs, with the aromatic carboxylic acids p-nitrobenzoic (PNBA), p-cyanobenzoic (PCNBA) and p-aminobenzoic (PABA) were rationally designed and synthesized by solvent evaporation. Aiming to explore the possible supramolecular synthons of this API, these cocrystals were fully characterized by X-ray diffraction (SCXRD, PXRD), spectroscopic (FT-IR) and thermal (TGA, DSC, HSM) techniques. The cocrystal formation was found to be mainly driven by the synthons formed by the pyridine and hydrazide moieties. In both INH-PABA polymorphs, the COOH acid groups are H-bonded to pyridine and hydrazide groups giving rise to the acid⋯pyridine and acid⋯hydrazide heterosynthons. In INH-PNBA and INH-PCNBA cocrystals these acid groups are only related to the pyridine moiety. In addition to the structural study, supramolecular and Hirshfeld surface analysis were also performed based on the structural data. The cocrystals were identified from the FT-IR spectra and their thermal behaviors were studied by a combination of DSC, TGA and HSM techniques.

  12. The Tomato Hybrid Proline-Rich Protein regulates the abcission zone competence to respond to ethylene signals (United States)

    The Tomato Hybrid Proline-Rich Protein (THyPRP) gene was specifically expressed in the tomato (Solanum lycopersicum) flower abscission zone (FAZ), and its stable antisense silencing under the control of an abscission zone (AZ)-specific promoter, Tomato Abscission Polygalacturonase4,significantly inh...

  13. 2010 International consensus algorithm for the diagnosis, therapy and management of hereditary angioedema

    DEFF Research Database (Denmark)

    Bowen, Tom; Cicardi, Marco; Farkas, Henriette


    ABSTRACT: BACKGROUND: We published the Canadian 2003 International Consensus Algorithm for the Diagnosis, Therapy, and Management of Hereditary Angioedema (HAE; C1 inhibitor [C1-INH] deficiency) and updated this as Hereditary angioedema: a current state-of-the-art review: Canadian Hungarian 2007 ...

  14. [5-(1,3-Diphenyl-1H-pyrazol-4-yl-3-phenyl-4,5-dihydropyrazol-1-yl](pyridin-4-ylmethanone

    Directory of Open Access Journals (Sweden)

    Tarawanti Verma


    Full Text Available A novel pyrazoline derivative 2 was synthesized by reaction of an α,β-unsaturated ketone 1 with isonicotinic acid hydrazide (INH in glacial acetic acid. The structure of the title compound 2 was established on basis of IR, 1H-NMR, 13C-NMR and mass spectral data.

  15. The Complex Interaction Between Polycystic Ovary Syndrome and Hereditary Angioedema: Case Reports and Review of the Literature. (United States)

    Iahn-Aun, Marina; Aun, Marcelo Vivolo; Motta, Antonio Abílio; Kalil, Jorge; Giavina-Bianchi, Pedro; Hayashida, Sylvia Asaka; Baracat, Edmund Chada; Maciel, Gustavo Arantes


    Hereditary angioedema (HAE) is a rare but severe disease, with high risk of death, and attacks have been associated to high estrogen levels. Polycystic ovary syndrome (PCOS) is a common hyperandrogenic condition, which is frequently treated with combined oral contraceptives. The aim of this study was to describe 2 clinical cases of young women diagnosed as having PCOS who developed HAE attacks after the introduction of combined estrogen-progestin pills to treat PCOS symptoms. Literature review of sex hormones' role in genesis of HAE attacks and possible mechanisms involved. In the cases reported, after initiation of combined contraceptives, patients presented with facial swelling with airway involvement (laryngeal edema) and abdominal pain. They had a familial history of angioedema and normal C1 inhibitor (C1-INH) levels, leading to the diagnosis of HAE with normal C1-INH (HAEnC1-INH) or HAE type III. After suspension of exogenous estrogen, patients remained asymptomatic from HAE. HAEnC1-INH is an estrogen-dependent form of HAE. It is well established that exogenous estrogen triggers attacks of all types of HAE. However, this is the first description of the association between PCOS and HAE, in which PCOS could be masking HAE symptoms. We propose that PCOS might have a protective role regarding HAE attacks, because of its particular hormonal features, that is, hyperandrogenism and relative stable levels of estradiol. The use of combined estrogen-progestin compounds in women with PCOS and HAE must be avoided, and treatment must be individualized.

  16. Simple, direct drug susceptibility testing technique for diagnosis of drug-resistant tuberculosis in resource-poor settings. (United States)

    Kim, C-K; Joo, Y-T; Lee, E P; Park, Y K; Kim, H-J; Kim, S J


    The Korean Institute of Tuberculosis, Seoul, Republic of Korea. To develop a simple, direct drug susceptibility testing (DST) technique using Kudoh-modified Ogawa (KMO) medium. The critical concentrations of isoniazid (INH), rifampicin (RMP), kanamycin (KM) and ofloxacin (OFX) for KMO medium were calibrated by comparing the minimal inhibitory concentrations (MICs) against clinical isolates of Mycobacterium tuberculosis on KMO with those on Löwenstein-Jensen (LJ). The performance of the direct KMO DST technique was evaluated on 186 smear-positive sputum specimens and compared with indirect LJ DST. Agreement of MICs on direct vs. indirect DST was high for INH, RMP and OFX. KM MICs on KMO were ∼10 g/ml higher than those on LJ. The critical concentrations of INH, RMP, OFX and KM for KMO were therefore set at 0.2, 40.0, 2.0, and 40.0 g/ml. The evaluation of direct DST of smear-positive sputum specimens showed 100% agreement with indirect LJ DST for INH and RMP. However, the respective susceptible and resistant predictive values were 98.8% and 100% for OFX, and 100% and 80% for KM. Direct DST using KMO is useful, with clear advantages of a shorter turnaround time, procedural simplicity and low cost compared to indirect DST. It may be most indicated in resource-poor settings for programmatic management of drug-resistant tuberculosis.

  17. Field Testing of Activated Carbon Mixing and In Situ Stabilization of PCBs in Sediment (United States)


    tract irritation Carcinogen, lung, GI system disease Zinc Inh, Ing Metal fume fever, skin irritation GI system effects, dermatitis GI...Metal Slag Areas, Parcel E, Hunters Point Shipyard, San Francisco, California. Appendix D: Final Radiation Control Plan. June 18. Draft Hunters...printed) Signature Final Radiological Control Plan Metal Debris Reef and Metal Slag Areas Parcel E, Hunters Point

  18. A Prospective Study of Tuberculosis Drug Susceptibility in Sabah, Malaysia, and an Algorithm for Management of Isoniazid Resistance (United States)

    Rashid Ali, Muhammad Redzwan S.; Parameswaran, Uma; William, Timothy; Bird, Elspeth; Wilkes, Christopher S.; Lee, Wai Khew; Yeo, Tsin Wen; Anstey, Nicholas M.; Ralph, Anna P.


    Introduction. The burden of tuberculosis is high in eastern Malaysia, and rates of Mycobacterium tuberculosis drug resistance are poorly defined. Our objectives were to determine M. tuberculosis susceptibility and document management after receipt of susceptibility results. Methods. Prospective study of adult outpatients with smear-positive pulmonary tuberculosis (PTB) in Sabah, Malaysia. Additionally, hospital clinicians accessed the reference laboratory for clinical purposes during the study. Results. 176 outpatients were enrolled; 173 provided sputum samples. Mycobacterial culture yielded M. tuberculosis in 159 (91.9%) and nontuberculous Mycobacterium (NTM) in three (1.7%). Among outpatients there were no instances of multidrug resistant M. tuberculosis (MDR-TB). Seven people (4.5%) had isoniazid resistance (INH-R); all were switched to an appropriate second-line regimen for varying durations (4.5–9 months). Median delay to commencement of the second-line regimen was 13 weeks. Among 15 inpatients with suspected TB, 2 had multidrug resistant TB (one extensively drug resistant), 2 had INH-R, and 4 had NTM. Conclusions. Current community rates of MDR-TB in Sabah are low. However, INH-resistance poses challenges, and NTM is an important differential diagnosis in this setting, where smear microscopy is the usual diagnostic modality. To address INH-R management issues in our setting, we propose an algorithm for the treatment of isoniazid-resistant PTB. PMID:25838829

  19. Epidemiology of Non-hereditary Angioedema

    DEFF Research Database (Denmark)

    Madsen, Flemming; Attermann, Jorn; Linneberg, Allan


    The prevalence of non-hereditary angioedema was investigated in a general population sample (n = 7,931) and in a sample of Danish patients (n = 7,433) tested for deficiency of functional complement C1 esterase inhibitor protein (functional C1 INH). The general population sample (44% response rate...

  20. Epidemiology of Non-hereditary Angioedema

    DEFF Research Database (Denmark)

    Madsen, Flemming; Attermann, Jørn; Linneberg, Allan


    The prevalence of non-hereditary angioedema was investigated in a general population sample (n¿=¿7,931) and in a sample of Danish patients (n¿=¿7,433) tested for deficiency of functional complement C1 esterase inhibitor protein (functional C1 INH). The general population sample (44% response rate...

  1. [2- (2, 4-dimethylphenylthio) phenyl] aniline and it

    Indian Academy of Sciences (India)


    MgSO4, 0.5 g aspargine and 2 ml glycerol in distilled water (100 ml) followed by pH ..... aniline and its derivatives with the crystal structure of. Page 13. 13. Mycobacterium tuberculosis enoyl-acyl carrier protein reductase (InhA) (PDB ID: 4TZK).

  2. Gennemgang af en ny type hereditært angioødem med normal komplement C1-inhibitor

    DEFF Research Database (Denmark)

    Okholm-Hansen, Maria Bach; Winther, Anna Hillert; Fagerberg, Christina


    Hereditary angio-oedema (HAE) is a rare, potentially fatal disease characterized by recurrent swelling of skin and mucosa. Besides HAE with quantitative (type I) or qualitative (type II) deficiency of complement C1-inhibitor (C1-INH), a new subtype of HAE is now described with normal levels of C1...

  3. C1-esterase inhibitor blocks T lymphocyte proliferation and cytotoxic T lymphocyte generation in vitro

    DEFF Research Database (Denmark)

    Nissen, Mogens Holst; Bregenholt, S; Nording, J A


    We have previously shown that activated C1s complement and activated T cells cleave beta2-microglobulin (beta2m) in vitro leading to the formation of desLys58 beta2m. This process can specifically be inhibited by C1-esterase inhibitor (C1-inh). Furthermore we showed that exogenously added desLys58...

  4. Wild-type catalase peroxidase vs G279D mutant type: Molecular basis of Isoniazid drug resistance in Mycobacterium tuberculosis. (United States)

    Singh, Aishwarya; Singh, Aditi; Grover, Sonam; Pandey, Bharati; Kumari, Anchala; Grover, Abhinav


    Mycobacterium tuberculosis katG gene is responsible for production of an enzyme catalase peroxidase that peroxidises and activates the prodrug Isoniazid (INH), a first-line antitubercular agent. INH interacts with catalase peroxidase enzyme within its heme pocket and gets converted to an active form. Mutations occurring in katG gene are often linked to reduced conversion rates for INH. This study is focussed on one such mutation occurring at residue 279, where glycine often mutates to aspartic acid (G279D). In the present study, several structural analyses were performed to study the effect of this mutation on functionality of KatG protein. On comparison, mutant protein exhibited a lower docking score, smaller binding cavity and reduced affinity towards INH. Molecular dynamics analysis revealed the mutant to be more rigid and less compact than the native protein. Essential dynamics analysis determined correlated motions of residues within the protein structure. G279D mutant was found to have many residues that showed related motions and an undesirable effect on the functionality of protein. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. ELISA to measure neutralizing capacity of anti-C1-inhibitor antibodies in plasma of angioedema patients

    NARCIS (Netherlands)

    Engel, Ruchira; Rensink, Irma; Roem, Dorina; Brouwer, Mieke; Kalei, Asma; Perry, Dawn; Zeerleder, Sacha; Wouters, Diana; Hamann, Dörte


    Neutralizing autoantibodies (NAbs) against plasma serpin C1-inhibitor (C1-inh) are implicated in the rare disorder, acquired angioedema (AAE). There is insufficient understanding of the process of antibody formation and its correlation with disease progression and severity. We have developed an

  6. Investigation of isoniazid and ethionamide cross-resistance by whole genome sequencing and association with poor treatment outcomes of multidrug-resistant tuberculosis patients in South Africa

    Directory of Open Access Journals (Sweden)

    L Malinga


    Conclusion: Baseline ETH molecular resistance before second-line treatment is a concern. Unfavorable treatment outcomes of patients with ethA, ethR, and inhA mutations highlight the importance of genotypic testing before initiation of treatment containing ETH. The clinical significance of whole genome analysis for early detection of mutations predictive of treatment failure needs further investigation.

  7. Evaluation of the efficacy of valproic acid and suberoylanilide hydroxamic acid (vorinostat in enhancing the effects of first-line tuberculosis drugs against intracellular Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Martin Rao


    Full Text Available Background: New tuberculosis (TB drug treatment regimens are urgently needed. This study evaluated the potential of the histone deacetylase inhibitors (HDIs valproic acid (VPA and suberoylanilide hydroxamic acid (SAHA to enhance the effects of first-line anti-TB drugs against intracellular Mycobacterium tuberculosis. Methods: M. tuberculosis H37Rv cultures were exposed to VPA or SAHA over 6 days, in the presence or absence of isoniazid (INH and rifampicin (RIF. The efficacy of VPA and SAHA against intracellular M. tuberculosis with and without INH or RIF was tested by treating infected macrophages. Bactericidal activity was assessed by counting mycobacterial colony-forming units (CFU. Results: VPA treatment exhibited superior bactericidal activity to SAHA (2-log CFU reduction, while both HDIs moderately improved the activity of RIF against extracellular M. tuberculosis. The bactericidal effect of VPA against intracellular M. tuberculosis was greater than that of SAHA (1-log CFU reduction and equalled that of INH (1.5-log CFU reduction. INH/RIF and VPA/SAHA combination treatment inhibited intracellular M. tuberculosis survival in a shorter time span than monotherapy (3 days vs. 6 days. Conclusions: VPA and SAHA have adjunctive potential to World Health Organization-recommended TB treatment regimens. Clinical evaluation of the two drugs with regard to reducing the treatment duration and improving treatment outcomes in TB is warranted. Keywords: Mycobacterium tuberculosis, Adjunct host-directed therapy, Tuberculosis, Histone deacetylase inhibitors, Repurposed drugs

  8. Flexibility and conformational change of IgG molecule

    International Nuclear Information System (INIS)

    Alpert, Y.; Ostanevich, Yu.M.


    The dynamic behaviour of pig anti-Dnp-immunoglobulin (IgG) investigated by the neutron spin echo technique gave evidence of internal motion of a biological macromolecule. It is suggested that this motion belongs to the wobbling of the Fab parts of the investigated IgG molecule around its so called hinge region. (author)

  9. Deoxyribonucleoside kinases in mitochondrial DNA depletion. (United States)

    Saada-Reisch, Ann


    Mitochondrial DNA (mtDNA) depletion syndromes (MDS) are a heterogeneous group of mitochondrial disorders, manifested by a decreased mtDNA copy number and respiratory chain dysfunction. Primary MDS are inherited autosomally and may affect a single organ or multiple tissues. Mutated mitochondrial deoxyribonucleoside kinases; deoxyguanosine kinase (dGK) and thymidine kinase 2 (TK2), were associated with the hepatocerebral and myopathic forms of MDS respectively. dGK and TK2 are key enzymes in the mitochondrial nucleotide salvage pathway, providing the mitochondria with deoxyribonucleotides (dNP) essential for mtDNA synthesis. Although the mitochondrial dNP pool is physically separated from the cytosolic one, dNP's may still be imported through specific transport. Non-replicating tissues, where cytosolic dNP supply is down regulated, are thus particularly vulnerable to dGK and TK2 deficiency. The overlapping substrate specificity of deoxycytidine kinase (dCK) may explain the relative sparing of muscle in dGK deficiency, while low basal TK2 activity render this tissue susceptible to TK2 deficiency. The precise pathophysiological mechanisms of mtDNA depletion due to dGK and TK2 deficiencies remain to be determined, though recent findings confirm that it is attributed to imbalanced dNTP pools.

  10. Real-time cardiac metabolism assessed with hyperpolarized [1-13C]acetate in a large-animal model

    DEFF Research Database (Denmark)

    Flori, Alessandra; Liserani, Matteo; Frijia, Francesca


    Dissolution-dynamic nuclear polarization (dissolution-DNP) for magnetic resonance (MR) spectroscopic imaging has recently emerged as a novel technique for noninvasive studies of the metabolic fate of biomolecules in vivo. Since acetate is the most abundant extra- and intracellular short-chain fat...

  11. An approach to clinical data management for the doctor of nursing practice curriculum. (United States)

    Sylvia, Martha; Terhaar, Mary


    Strong data management skills are essential to doctor of nursing practice (DNP) education and necessary for DNP practice. Completion of the DNP scholarly project requires application of these skills to understand and address a complex practice, process, or systems problem; develop, implement, and monitor an innovative evidence-based intervention to address that problem; and evaluate the outcomes. The purposes of this paper were to describe the demand and context for clinical data management (CDM) within the DNP curriculum; provide an overview of CDM content; describe the process for content delivery; propose a set of course objectives; and describe initial successes and challenges. A two-pronged approach of consultation and a CDM course were developed. Students who participated in this approach were more likely to create and implement an evaluation plan; apply techniques for data cleansing and manipulation; apply concepts of sample size determination using power analysis; use exploratory data analysis techniques to understand population attributes and sampling bias; apply techniques to adjust for bias; apply statistical significance testing; and present project results in a meaningful way. On the basis of this evaluation, CDM has evolved from an elective to a required course integrated in a thread that crosses the entire curriculum. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Restoring Penis Sensation in Patients With Low Spinal Cord Lesions: The Role of the Remaining Function of the Dorsal Nerve in a Unilateral or Bilateral TOMAX Procedure

    NARCIS (Netherlands)

    Overgoor, Max L. E.; Braakhekke, Jan P.; Kon, Moshe; de Jong, Tom P. V. M.


    Aims: The recently developed TOMAX-procedure restores unilateral genital sensation, improving sexual health in men with a low spinal lesion (LSL). It connects one dorsal nerve of the penis (DNP) to the intact ipsilateral ilioinguinal nerve. We proposed bilateral neurotization for full sensation of

  13. Resonance-inclined optical nuclear spin polarization of liquids in diamond structures (United States)

    Chen, Q.; Schwarz, I.; Jelezko, F.; Retzker, A.; Plenio, M. B.


    Dynamic nuclear polarization (DNP) of molecules in a solution at room temperature has the potential to revolutionize nuclear magnetic resonance spectroscopy and imaging. The prevalent methods for achieving DNP in solutions are typically most effective in the regime of small interaction correlation times between the electron and nuclear spins, limiting the size of accessible molecules. To solve this limitation, we design a mechanism for DNP in the liquid phase that is applicable for large interaction correlation times. Importantly, while this mechanism makes use of a resonance condition similar to solid-state DNP, the polarization transfer is robust to a relatively large detuning from the resonance due to molecular motion. We combine this scheme with optically polarized nitrogen-vacancy (NV) center spins in nanodiamonds to design a setup that employs optical pumping and is therefore not limited by room temperature electron thermal polarization. We illustrate numerically the effectiveness of the model in a flow cell containing nanodiamonds immobilized in a hydrogel, polarizing flowing water molecules 4700-fold above thermal polarization in a magnetic field of 0.35 T, in volumes detectable by current NMR scanners.

  14. Effects of curcumin on TTX-R sodium currents of dorsal root ganglion neurons in type 2 diabetic rats with diabetic neuropathic pain. (United States)

    Meng, Bo; Shen, Lu-Lu; Shi, Xiao-Ting; Gong, Yong-Sheng; Fan, Xiao-Fang; Li, Jun; Cao, Hong


    Type 2 diabetic mellitus (T2DM) has reached pandemic status and shows no signs of abatement. Diabetic neuropathic pain (DNP) is generally considered to be one of the most common complications of T2DM, which is also recognized as one of the most difficult types of pain to treat. As one kind of peripheral neuropathic pain, DNP manifests typical chronic neuralgia symptoms, including hyperalgesia, allodynia, autotomy, and so on. The injured dorsal root ganglion (DRG) is considered as the first stage of the sensory pathway impairment, whose neurons display increased frequency of action potential generation and increased spontaneous activities. These are mainly due to the changed properties of voltage-gated sodium channels (VGSCs) and the increased sodium currents, especially TTX-R sodium currents. Curcumin, one of the most important phytochemicals from turmeric, has been demonstrated to effectively prevent and/or ameliorate diabetic mellitus and its complications including DNP. The present study demonstrates that the TTX-R sodium currents of small-sized DRG neurons isolated from DNP rats are significantly increased. Such abnormality can be efficaciously ameliorated by curcumin. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  15. Zonal down-regulation and redistribution of the multidrug resistance protein 2 during bile duct ligation in rat liver

    NARCIS (Netherlands)

    Paulusma, C. C.; Kothe, M. J.; Bakker, C. T.; Bosma, P. J.; van Bokhoven, I.; van Marle, J.; Bolder, U.; Tytgat, G. N.; Oude Elferink, R. P.


    We have studied regulation of the multidrug resistance protein 2 (mrp2) during bile duct ligation (BDL) in the rat. In hepatocytes isolated after 16, 48, and 72 hours of BDL, mrp2-mediated dinitrophenyl-glutathione (DNP-GS) transport was decreased to 65%, 33%, and 33% of control values,

  16. Recycling and imaging of nuclear singlet hyperpolarization

    DEFF Research Database (Denmark)

    Pileio, Giuseppe; Bowen, Sean; Laustsen, Christoffer


    observation of the same batch of polarized nuclei over a period of 30 min and more. We report a recycling protocol in which the enhanced nuclear polarization achieved by dissolution-DNP is observed with full intensity and then returned to singlet order. MRI experiments may be run on a portion of the available...

  17. Adaptation to a Curriculum Delivered via iPad: The Challenge of Being Early Adopters (United States)

    Stec, Melissa; Bauer, Melanie; Hopgood, Daniel; Beery, Theresa


    This convergent mixed methods study was designed to examine the skills and attitudes toward using an iPad to deliver nursing curriculum and enhance active learning strategies for sophomore Bachelor of Science in Nursing (BSN) and Doctor of Nursing Practice (DNP) students at a Midwestern university. Quantitative data were collected using an…

  18. Delta-cyclodextrin as novel chiral probe for enantiomeric separation by electromigration methods

    DEFF Research Database (Denmark)

    Wistuba, Dorothee; Bogdanski, Anja; Larsen, Kim Lambertsen


    Native d-CD has been employed as chiral selector in CE and MEKC. To investigate the potential of the enantiodiscriminating properties of d-CD, negatively charged 5-dimethylamino-1-naphthalene-sulfonyl (dansyl)-, 2,4-dinitrophenyl (DNP)- and FMOC-derivatives of several amino acids, 1,1’-binaphthyl-2...

  19. A 282 GHz Probe for Dynamic Nuclear Polarization

    DEFF Research Database (Denmark)

    Rybalko, Oleksandr; Bowen, Sean; Zhurbenko, Vitaliy

    Introduction In DNP, microwave irradiation of a sample facilitates the transfer of spin polarization from electrons tonuclei. One of the way to improve the DNP enhancement is to transfer microwave power from the mm-wave source tothe sample more effectively. Several methods and techniques to effic......Introduction In DNP, microwave irradiation of a sample facilitates the transfer of spin polarization from electrons tonuclei. One of the way to improve the DNP enhancement is to transfer microwave power from the mm-wave source tothe sample more effectively. Several methods and techniques......: microwave can with RF coil; the rest of the probe consists of a waveguide, sample tube and coaxial transmission line. The probe is designed to study cylindrical samples with diameter - 9 mm, and height – 2-20 mm. An RF coil which is housed in cylindrical Macor coil form (dielectric with ε=5.64 and tangent δ...... is 0.0025) surrounds the sample. The RF coil has a saddle form and was madeout of two current loops run on opposite sides of a cylinder (in parallel). Material of the coil is copper wire with diameterequal to 0.7 mm. Coil dimensions are: diameter - 13 mm; height - 22.0 mm. The self resonant frequency...

  20. Cluster formation restricts dynamic nuclear polarization of xenon in solid mixtures

    DEFF Research Database (Denmark)

    Kuzma, N. N.; Pourfathi, M.; Kara, H.


    During dynamic nuclear polarization (DNP) at 1.5 K and 5 T, Xe-129 nuclear magnetic resonance (NMR) spectra of a homogeneous xenon/1-propanol/trityl-radical solid mixture exhibit a single peak, broadened by H-1 neighbors. A second peak appears upon annealing for several hours at 125 K. Its...

  1. Overhauser effects in insulating solids

    NARCIS (Netherlands)

    Can, T. V.; Caporini, M. A.; Mentink-Vigier, F.; Corzilius, B.; Walish, J. J.; Rosay, M.; Maas, W. E.; Baldus, M.|info:eu-repo/dai/nl/314410864; Vega, S.; Swager, T. M.; Griffin, R. G.


    We report magic angle spinning, dynamic nuclear polarization (DNP) experiments at magnetic fields of 9.4 T, 14.1 T, and 18.8 T using the narrow line polarizing agents 1,3-bisdiphenylene-2-phenylallyl (BDPA) dispersed in polystyrene, and sulfonated-BDPA (SA-BDPA) and trityl OX063 in glassy

  2. A novel MR contrast agent for angiography and perfusion: Hyperpolarized water

    DEFF Research Database (Denmark)

    Lipsø, Hans Kasper Wigh

    , hyperpolarized by dissolution Dynamic Nuclear Polarization (d-DNP), can be applied as an MRI contrast agent for angiography and perfusion. The first part of the project focuses on development of a protocol for production of large samples of hyperpolarized protons in D2O. The samples are polarized and dissolved...

  3. Influence of PUVA and UVB radiation on delayed hypersensitivity in the guinea pig

    International Nuclear Information System (INIS)

    Morison, W.L.; Parrish, J.A.; Woehler, M.E.; Krugler, J.I.; Bloch, K.J.


    Exposure of guinea pigs to UVA (320--400 nm) radiation following administration of 8-methoxypsoralen by gavage (referred to by the acronym, PUVA) or exposure to UVB (290--320 nm) radiation, produced suppression of the cutaneous delayed hypersensitivity reaction at the site of exposure to radiation and at distant nonexposed sites. In these experiments, the animals were immunized by injection of dinitrophenyl-bovine gamma-globulin (DNP-BGG) in complete Freund's adjuvant and delayed hypersensitivity responses were provoked by intradermal injections of DNP-BGG, DNP and BGG on the flanks. Exposure to erythemogenic doses of either PUVA or UVB radiation for 7 days prior to immunization and for the 7 days between immunization and challenge (total period of radiation: 14 days) produced inhibiton of responses to each of the test substances. In addition, treatment with erythemogenic doses of PUVA either for 7 days prior to immunization or during the interval between immunization and challenge with DNP-BGG, inhibited the delayed hypersensitivity responses at the site of irradiation and at a nonexposed site. These findings suggest that in vivo exposure to nonionizing radiation leads to both local and systemic alteration of certain immune responses

  4. Quantitative dynamic nuclear polarization‐NMR on blood plasma for assays of drug metabolism

    DEFF Research Database (Denmark)

    Lerche, Mathilde Hauge; Meier, Sebastian; Jensen, Pernille Rose


    ‐scan 13C DNP‐NMR. An internal standard is used for the accurate quantification of drug and metabolite. Comparison of quantitative DNP‐NMR data with an established analytical method (liquid chromatography‐mass spectrometry) yields a Pearson correlation coefficient r of 0.99. Notably, all DNP...

  5. Simulation and Advanced Practice Nursing Education (United States)

    Blue, Dawn I.


    This quantitative study compared changes in level of confidence resulting from participation in simulation or traditional instructional methods for BSN (Bachelor of Science in Nursing) to DNP (Doctor of Nursing Practice) students in a nurse practitioner course when they entered the clinical practicum. Simulation has been used in many disciplines…

  6. Evaluation of uptake and systemicity of 14C - fosthiazate in tomato (Lycopersicon esculentum L.)

    International Nuclear Information System (INIS)

    Mukherjee, Santanu; Srivastava, Anjana; Kumar, Surendra; Srivastava, P.C.


    Nematodes are round worm species that are found in almost all habitats. Beneficial species are usually referred to free living nematodes, other nematode species are parasitic and harmful to plants, animals and humans. Soil provides an excellent habitat for nematodes. Plant parasitic nematodes may live within plant roots or inhabit in the rhizosphere. The percent yield loss due to root knot nematodes in vegetable crops has been studied under All India Co-ordinated Research Project (Nematodes). The fosthiazate is a new compound incorporated in the market. The uptake and systemicity of fosthiazate in intact tomato plants was studied through 14 C-labeled fosthiazate in presence and absence of DNP. It was found that fosthiazate function as a systemic nematicide in tomato, the accumulation rate of fosthiazate was found higher in roots and shoots part upto 15 hrs. uptake period and after that accumulation slowly becomes saturated in the absence of DNP. In the presence of DNP (10 -2 mM) the amount of fosthiazate in roots as well as shoots was found to be decreased with respect to the uptake time.There was more inhibition on the uptake of fosthiazate in shoots than roots by DNP. (author)

  7. Doctor of Professional Counseling: The Next Step (United States)

    Southern, Stephen; Cade, Rochelle; Locke, Don W.


    Professional doctorates have been established in the allied health professions by clinicians seeking the highest levels of independent practice. Allied health professional doctorates include nursing practice (DNP), occupational therapy (OTD), psychology (PsyD), social work (DSW), and marriage and family therapy (DMFT). Lessons learned from the…

  8. Colombia’s Resurrection: Alternative Development is the Key to Democratic Security (United States)


    regional economic strength. This implies 73 Sesin. 74 Departamento Nacional de Planeación (DNP), Bases del Plan Nacional de Desarrollo “Hacia un...Estado Comunitario .” Page 54 (Web version). 38 that the government is willing to adopt more flexible

  9. Theory of coherent dynamic nuclear polarization in quantum dots

    DEFF Research Database (Denmark)

    Neder, Izhar; Rudner, Mark Spencer; Halperin, Bertrand


    We consider the production of dynamic nuclear spin polarization (DNP) in a two-electron double quantum dot, in which the electronic levels are repeatedly swept through a singlet-triplet avoided crossing. Our analysis helps to elucidate the intriguing interplay between electron-nuclear hyperfine...

  10. The influence of administrative leadership: an interview with Dr Karen S. Hill. (United States)

    Hill, Karen S; Adams, Jeffrey M


    This department highlights nursing leaders who have demonstrated a commitment to patient care leadership and innovation in practice, policy, research, education, and theory. This interview profiles Karen Hill, DNP, RN, NEA-BC, FACHE, FAAN, chief operating officer and chief nursing officer of Baptist Health in Lexington, Kentucky, and editor-in-chief of the Journal of Nursing Administration.

  11. Frequency-agile gyrotron for electron decoupling and pulsed dynamic nuclear polarization (United States)

    Scott, Faith J.; Saliba, Edward P.; Albert, Brice J.; Alaniva, Nicholas; Sesti, Erika L.; Gao, Chukun; Golota, Natalie C.; Choi, Eric J.; Jagtap, Anil P.; Wittmann, Johannes J.; Eckardt, Michael; Harneit, Wolfgang; Corzilius, Björn; Th. Sigurdsson, Snorri; Barnes, Alexander B.


    We describe a frequency-agile gyrotron which can generate frequency-chirped microwave pulses. An arbitrary waveform generator (AWG) within the NMR spectrometer controls the microwave frequency, enabling synchronized pulsed control of both electron and nuclear spins. We demonstrate that the acceleration of emitted electrons, and thus the microwave frequency, can be quickly changed by varying the anode voltage. This strategy results in much faster frequency response than can be achieved by changing the potential of the electron emitter, and does not require a custom triode electron gun. The gyrotron frequency can be swept with a rate of 20 MHz/μs over a 670 MHz bandwidth in a static magnetic field. We have already implemented time-domain electron decoupling with dynamic nuclear polarization (DNP) magic angle spinning (MAS) with this device. In this contribution, we show frequency-swept DNP enhancement profiles recorded without changing the NMR magnet or probe. The profile of endofullerenes exhibits a DNP profile with a <10 MHz linewidth, indicating that the device also has sufficient frequency stability, and therefore phase stability, to implement pulsed DNP mechanisms such as the frequency-swept solid effect. We describe schematics of the mechanical and vacuum construction of the device which includes a novel flanged sapphire window assembly. Finally, we discuss how commercially available continuous-wave gyrotrons can potentially be converted into similar frequency-agile high-power microwave sources.

  12. Stable isotope-resolved analysis with quantitative dissolution dynamic nuclear polarization

    DEFF Research Database (Denmark)

    Lerche, Mathilde Hauge; Yigit, Demet; Frahm, Anne Birk


    Metabolite profiles and their isotopomer distributions can be studied non-invasively in complex mixtures with NMR. The advent of dissolution Dynamic Nuclear Polarization (dDNP) and isotope enrichment add sensitivity and resolution to such met-abolic studies. Metabolic pathways and networks can be...

  13. Investigating the Tolerance of Tomato (Lycopersicon esculentum Cultivars to Broomrape (Orobanche aegyptiaca pers in Khorassan Razavi

    Directory of Open Access Journals (Sweden)

    M. Zafarian,


    Full Text Available To investigate the tolerance of tomato cultivars to Egyptian broomrape (Orobanche aegyptiaca pers., an experiment was conducted in a randomized complete block design with 11 treatments and 3 replications in mazrae Nemoune Astan Quds Razavi in Mashhad, Iran, 2012. Treatment were 11 varieties (Peto early CH, Sterling (Karon, Khorram, Petorak, DNP 3005, PS 6515, SPEEDY, IDEN, VADI STAR, FIRINZEH and DNP 3001 which were transplanted in the field along with broomrape. Sampling was done at two stages: 1- after appearance and establishment of broomrape on tomato root where the dry weight, stem number and node numbers of broomrape on tomato root and tomato dry weight were measured and 2- at the end of growing season where tomato fruit weight and its yield were determined. Result indicated that Sterling and Khorram cultivars did have the least broomrape dry weight, stem number and node numbers of broomrape on tomato root and while produced highest plant dry weight, fruit and yield as compared to the other cultivars. Thus, may be considered as tolerant cultivars. Petorak and DNP 3001 on the other hand, presented the most broomrape dry weight, stem number and node number on tomato root. However, Petorak, Peto early CH and FIRINZEH cultivars produced the least plant weight, fruit and yield and thus, they can be called the sensitive cultivars. DNP 3001 being highly attacked by broomrape produced increased fruit yield and therefore compensated its ill effects.

  14. Electron paramagnetic resonance and dynamic nuclear polarization of char suspensions: surface science and oximetry

    DEFF Research Database (Denmark)

    Clarkson, R B; Odintsov, B M; Ceroke, P J


    ; they can be calibrated and used for oximetry. Biological stability and low toxicity make chars good sensors for in vivo measurements. Scalar and dipolar interactions of water protons at the surfaces of chars may be utilized to produce dynamic nuclear polarization (DNP) of the nuclear spin population...

  15. NMR of insensitive nuclei enhanced by dynamic nuclear polarization. (United States)

    Miéville, Pascal; Jannin, Sami; Helm, Lothar; Bodenhausen, Geoffrey


    Despite the powerful spectroscopic information it provides, Nuclear Magnetic Resonance (NMR) spectroscopy suffers from a lack of sensitivity, especially when dealing with nuclei other than protons. Even though NMR can be applied in a straightforward manner when dealing with abundant protons of organic molecules, it is very challenging to address biomolecules in low concentration and/or many other nuclei of the periodic table that do not provide as intense signals as protons. Dynamic Nuclear Polarization (DNP) is an important technique that provides a way to dramatically increase signal intensities in NMR. It consists in transferring the very high electron spin polarization of paramagnetic centers (usually at low temperature) to the surrounding nuclear spins with appropriate microwave irradiation. DNP can lead to an enhancement of the nuclear spin polarization by up to four orders of magnitude. We present in this article some basic concepts of DNP, describe the DNP apparatus at EPFL, and illustrate the interest of the technique for chemical applications by reporting recent measurements of the kinetics of complexation of 89Y by the DOTAM ligand.

  16. Analgesic and Antipyretic Activities of Drymaria cordata (Linn.) Willd ...

    African Journals Online (AJOL)

    Also, D. cordata produced significant (p<0.05) dose-dependent inhibition of temperature elevation in the 2,4-DNP and yeast-induced hyperthermia models with ... that the aqueous whole plant extract of Drymaria cordata possesses analgesic and antipyretic properties mediated through peripheral and central mechanisms.

  17. Untitled

    Indian Academy of Sciences (India)

    ,10-dihalo compounds) and their triplet formation. T Nakayama, K Ibuki and K Hamanoue ... Electron-nuclear cross-relaxation effect on the photochemical reaction of benzaldehyde as studied by CIDNP and DNP Y Yamakage,. Q Meng, S S Ali, ...

  18. Evaluation of B1 inhomogeneity effect on DCE-MRI data analysis of brain tumor patients at 3T. (United States)

    Sengupta, Anirban; Gupta, Rakesh Kumar; Singh, Anup


    Dynamic-contrast-enhanced (DCE) MRI data acquired using gradient echo based sequences is affected by errors in flip angle (FA) due to transmit B 1 inhomogeneity (B 1 inh). The purpose of the study was to evaluate the effect of B 1 inh on quantitative analysis of DCE-MRI data of human brain tumor patients and to evaluate the clinical significance of B 1 inh correction of perfusion parameters (PPs) on tumor grading. An MRI study was conducted on 35 glioma patients at 3T. The patients had histologically confirmed glioma with 23 high-grade (HG) and 12 low-grade (LG). Data for B 1 -mapping, T 1 -mapping and DCE-MRI were acquired. Relative B 1 maps (B 1rel ) were generated using the saturated-double-angle method. T 1 -maps were computed using the variable flip-angle method. Post-processing was performed for conversion of signal-intensity time (S(t)) curve to concentration-time (C(t)) curve followed by tracer kinetic analysis (K trans , Ve, Vp, Kep) and first pass analysis (CBV, CBF) using the general tracer-kinetic model. DCE-MRI data was analyzed without and with B 1 inh correction and errors in PPs were computed. Receiver-operating-characteristic (ROC) analysis was performed on HG and LG patients. Simulations were carried out to understand the effect of B 1 inhomogeneity on DCE-MRI data analysis in a systematic way. S(t) curves mimicking those in tumor tissue, were generated and FA errors were introduced followed by error analysis of PPs. Dependence of FA-based errors on the concentration of contrast agent and on the duration of DCE-MRI data was also studied. Simulations were also done to obtain K trans of glioma patients at different B 1rel values and see whether grading is affected or not. Current study shows that B 1rel value higher than nominal results in an overestimation of C(t) curves as well as derived PPs and vice versa. Moreover, at same B 1rel values, errors were large for larger values of C(t). Simulation results showed that grade of patients can change

  19. Will availability of inhaled human insulin (Exubera® improve management of type 2 diabetes? The design of the Real World trial

    Directory of Open Access Journals (Sweden)

    Freemantle Nick


    Full Text Available Abstract Background Common deterrents to insulin therapy for both physicians and patients are the complexity and burden of daily injections. In January 2006, the first inhaled human insulin (INH, Exubera® (insulinhuman [rDNA origin]InhalationPowder was approved for use in adult patients with type 1 diabetes mellitus (T1DM or type 2 diabetes mellitus (T2DM in the United States and European Union. Results from the INH clinical trial program have shown comparable efficacy of INH to subcutaneous (SC insulin and superior efficacy versus oral antidiabetic agents; thus providing effective glycemic control in adult patients with T2DM without the requirement for preprandial injections. However, because subjects in those trials were randomized to either INH or an alternative, the studies could not estimate the effect of INH on patient acceptance of insulin therapy. Therefore, traditional study designs cannot provide answers to important and practical questions regarding real world effectiveness, which is influenced by psychological and other access barriers. Methods To overcome these limitations, the Real World Trial was designed to estimate the effect of the availability of INH as a treatment option for glycemic control. A total of approximately 700 patients from Canada, France, Germany, Italy, Spain, United Kingdom, and the United States with T2DM poorly controlled by oral agent therapy will be randomized to two different treatment settings. Patients and clinicians in both groups (A & B may choose from all licensed therapies for diabetes including SC insulin delivered by pens; INH will be an additional treatment option only available in Group A. The Real World Trial (Protocol A2171018 has been registered with, registration id NCT00134147. Results The primary outcome for the trial will be the difference in mean glycosylated hemoglobin (HbA1c at 6 months between groups. The design was based on a preceding feasibility study examining the

  20. Inhibition of oxidative phosphorylation for enhancing citric acid production by Aspergillus niger. (United States)

    Wang, Lu; Zhang, Jianhua; Cao, Zhanglei; Wang, Yajun; Gao, Qiang; Zhang, Jian; Wang, Depei


    The spore germination rate and growth characteristics were compared between the citric acid high-yield strain Aspergillus niger CGMCC 5751 and A. niger ATCC 1015 in media containing antimycin A or DNP. We inferred that differences in citric acid yield might be due to differences in energy metabolism between these strains. To explore the impact of energy metabolism on citric acid production, the changes in intracellular ATP, NADH and NADH/NAD+ were measured at various fermentation stages. In addition, the effects of antimycin A or DNP on energy metabolism and citric acid production was investigated by CGMCC 5751. By comparing the spore germination rate and the extent of growth on PDA plates containing antimycin A or DNP, CGMCC 5751 was shown to be more sensitive to antimycin A than ATCC 1015. The substrate-level phosphorylation of CGMCC 5751 was greater than that of ATCC 1015 on PDA plates with DNP. DNP at tested concentrations had no apparent effect on the growth of CGMCC 5751. There were no apparent effects on the mycelial morphology, the growth of mycelial pellets or the dry cell mass when 0.2 mg L(-1) antimycin A or 0.1 mg L(-1) DNP was added to medium at the 24-h time point. The concentrations of intracellular ATP, NADH and NADH/NAD+ of CGMCC 5751 were notably lower than those of ATCC 1015 at several fermentation stages. Moreover, at 96 h of fermentation, the citric acid production of CGMCC 5751 reached up to 151.67 g L(-1) and 135.78 g L(-1) by adding 0.2 mg L(-1) antimycin A or 0.1 mg L(-1) DNP, respectively, at the 24-h time point of fermentation. Thus, the citric acid production of CGMCC 5751 was increased by 19.89% and 7.32%, respectively. The concentrations of intracellular ATP, NADH and NADH/NAD+ of the citric acid high-yield strain CGMCC 5751 were notably lower than those of ATCC 1015. The excessive ATP has a strong inhibitory effect on citric acid accumulation by A. niger. Increasing NADH oxidation and appropriately reducing the concentration of

  1. Weaknesses in the reporting of cross-sectional studies according to the STROBE statement: the case of metabolic syndrome in adults from Peru. (United States)

    Tapia, Jose Carlos; Ruiz, Eloy F; Ponce, Oscar J; Malaga, German; Miranda, Jaime


    The inadequate reporting of cross-sectional studies, as in the case of the prevalence of metabolic syndrome, could cause problems in the synthesis of new evidence and lead to errors in the formulation of public policies. To evaluate the reporting quality of the articles regarding metabolic syndrome prevalence in Peruvian adults using the STROBE recommendations. We conducted a thorough literature search with the terms "Metabolic Syndrome", "Sindrome Metabolico" and "Peru" in MEDLINE/PubMed, LILACS, SciELO, LIPECS and BVS-Peru until December 2014. We selected those who were population-based observational studies with randomized sampling that reported prevalence of metabolic syndrome in adults aged 18 or more of both sexes. Information was analysed through the STROBE score per item and recommendation. Seventeen articles were included in this study. All articles met the recommendations related to the report of the study's rationale, design, and provision of summary measures. The recommendations with the lowest scores were those related to the sensitivity analysis (8%, n= 1/17), participant flowchart (18%, n= 3/17), missing data analysis (24%, n= 4/17), and number of participants in each study phase (24%, n= 4/17). Cross-sectional studies regarding the prevalence of metabolic syndrome in peruvian adults have an inadequate reporting on the methods and results sections. We identified a clear need to improve the quality of such studies.

  2. La actividad física, el entrenamiento continuo e intervalo: una solución para la salud

    Directory of Open Access Journals (Sweden)

    Ricardo Ortiz-Pulido


    Full Text Available El propósito de este documento fue reportar los beneficios de la actividad física, entrenamientointervalo y entrenamiento continuo moderado en adultos sedentarios y físicamente activos.La actividad física involucra cualquier movimiento corporal que produce un aumento en elgasto energético en el metabolismo, mientras que el entrenamiento intervalo y entrenamientocontinuo moderado puede ser utilizado para controlar el programa de cargas de entrenamiento(intensidad, volumen y pausa. Los beneficios que se han reportado cuando se realiza actividadfísica son: el incremento o mantenimiento de la condición física muscular, funciones cognitivas,cardiorespiratoria, equilibrio, peso corporal, control de la obesidad; todos ellos disminuyen losriesgos de enfermedades cardiovasculares, enfernedades crónicorrespiratorias, diabetes, presiónalterial alta, sindrome metabolico, cáncer de colon, depresión y todas las causas de mortalidad.En contraste, la falta de actividad fisica ha ha sido identificada como factor de riesgo y estáasociada a diversas enfemedades no transmisibles a nivel mundial. En este documento puntua-lizamos dos tipos de entrenamiento que han tenido aplicaciones para la salud en adultos. Estetrabajo podría ayudar a promover la salud calidad de vida de la población adulta y eliminar elsedentarismo mediante la prescripción de la actividad física para la salud.

  3. Weaknesses in the reporting of cross-sectional studies according to the STROBE statement (United States)

    Malaga, German; Miranda, Jaime


    Introduction: The inadequate reporting of cross-sectional studies, as in the case of the prevalence of metabolic syndrome, could cause problems in the synthesis of new evidence and lead to errors in the formulation of public policies. Objective: To evaluate the reporting quality of the articles regarding metabolic syndrome prevalence in Peruvian adults using the STROBE recommendations. Methods: We conducted a thorough literature search with the terms "Metabolic Syndrome", "Sindrome Metabolico" and "Peru" in MEDLINE/PubMed, LILACS, SciELO, LIPECS and BVS-Peru until December 2014. We selected those who were population-based observational studies with randomized sampling that reported prevalence of metabolic syndrome in adults aged 18 or more of both sexes. Information was analysed through the STROBE score per item and recommendation. Results: Seventeen articles were included in this study. All articles met the recommendations related to the report of the study's rationale, design, and provision of summary measures. The recommendations with the lowest scores were those related to the sensitivity analysis (8%, n= 1/17), participant flowchart (18%, n= 3/17), missing data analysis (24%, n= 4/17), and number of participants in each study phase (24%, n= 4/17). Conclusion: Cross-sectional studies regarding the prevalence of metabolic syndrome in peruvian adults have an inadequate reporting on the methods and results sections. We identified a clear need to improve the quality of such studies. PMID:26848197

  4. Inhibition of cell proliferation by a selective inhibitor of the Ca{sup 2+}-activated Cl{sup -} channel, Ano1

    Energy Technology Data Exchange (ETDEWEB)

    Mazzone, Amelia; Eisenman, Seth T.; Strege, Peter R. [Enteric NeuroScience Program, Mayo Clinic, Rochester, MN (United States); Yao, Zhen [Laboratory of Molecular Genetics, UCSF, San Francisco, CA (United States); Ordog, Tamas; Gibbons, Simon J. [Enteric NeuroScience Program, Mayo Clinic, Rochester, MN (United States); Farrugia, Gianrico, E-mail: [Enteric NeuroScience Program, Mayo Clinic, Rochester, MN (United States)


    Highlights: Black-Right-Pointing-Pointer T16A{sub inh}-A01 blocked Ano1 currents in HEK cells expressing Ano1. Black-Right-Pointing-Pointer T16A{sub inh}-A01 reduced proliferation in ICC primary cultures and CFPAC-1 cell line. Black-Right-Pointing-Pointer T16A{sub inh}-A01 reduced proliferation of ICC in intact smooth muscle strips. -- Abstract: Background: Ion channels play important roles in regulation of cellular proliferation. Ano1 (TMEM16A) is a Ca{sup 2+}-activated Cl{sup -} channel expressed in several tumors and cell types. In the muscle layers of the gastrointestinal tract Ano1 is selectively expressed in interstitial cells of Cajal (ICC) and appears to be required for normal gastrointestinal slow wave electrical activity. However, Ano1 is expressed in all classes of ICC, including those that do not generate slow waves suggesting that Ano1 may have other functions. Indeed, a role for Ano1 in regulating proliferation of tumors and ICC has been recently suggested. Recently, a high-throughput screen identified a small molecule, T16A{sub inh}-A01 as a specific inhibitor of Ano1. Aim: To investigate the effect of the T16A{sub inh}-A01 inhibitor on proliferation in ICC and in the Ano1-expressing human pancreatic cancer cell line CFPAC-1. Methods: Inhibition of Ano1 was demonstrated by whole cell voltage clamp recordings of currents in cells transfected with full-length human Ano1. The effect of T16A{sub inh}-A01 on ICC proliferation was examined in situ in organotypic cultures of intact mouse small intestinal smooth muscle strips and in primary cell cultures prepared from these tissues. ICC were identified by Kit immunoreactivity. Proliferating ICC and CFPAC-1 cells were identified by immunoreactivity for the nuclear antigen Ki67 or EdU incorporation, respectively. Results: T16A{sub inh}-A01 inhibited Ca{sup 2+}-activated Cl{sup -} currents by 60% at 10 {mu}M in a voltage-independent fashion. Proliferation of ICC was significantly reduced in primary cultures

  5. Bacterial β-glucuronidase inhibition protects mice against enteropathy induced by indomethacin, ketoprofen or diclofenac: mode of action and pharmacokinetics. (United States)

    Saitta, Kyle S; Zhang, Carmen; Lee, Kang Kwang; Fujimoto, Kazunori; Redinbo, Matthew R; Boelsterli, Urs A


    1.  We have previously demonstrated that a small molecule inhibitor of bacterial β-glucuronidase (Inh-1; [1-((6,8-dimethyl-2-oxo-1,2-dihydroquinolin-3-yl)-3-(4-ethoxyphenyl)-1-(2-hydroxyethyl)thiourea]) protected mice against diclofenac (DCF)-induced enteropathy. Here we report that Inh-1 was equally protective against small intestinal injury induced by other carboxylic acid-containing non-steroidal anti-inflammatory drugs (NSAIDs), indomethacin (10 mg/kg, ip) and ketoprofen (100 mg/kg, ip). 2.  Inh-1 provided complete protection if given prior to DCF (60 mg/kg, ip), and partial protection if administered 3-h post-DCF, suggesting that the temporal window of mucosal protection can be extended for drugs undergoing extensive enterohepatic circulation. 3.  Pharmacokinetic analysis of Inh-1 revealed an absolute bioavailability (F) of 21% and a short t1/2 of <1 h. This low F was shown to be due to hepatic first-pass metabolism, as confirmed with the pan-CYP inhibitor, 1-aminobenzotriazole. 4.  Using the fluorescent probe 5 (and 6)-carboxy-2',7'-dichlorofluorescein, we demonstrated that Inh-1 did not interfere with hepatobiliary export of glucuronides in gall bladder-cannulated mice. 5.  These data are compatible with the hypothesis that pharmacological inhibition of bacterial β-glucuronidase-mediated cleavage of NSAID glucuronides in the small intestinal lumen can protect against NSAID-induced enteropathy caused by locally high concentrations of NSAID aglycones.

  6. Phosphodiesterase-4 inhibition alters gene expression and improves isoniazid-mediated clearance of Mycobacterium tuberculosis in rabbit lungs.

    Directory of Open Access Journals (Sweden)

    Selvakumar Subbian


    Full Text Available Tuberculosis (TB treatment is hampered by the long duration of antibiotic therapy required to achieve cure. This indolent response has been partly attributed to the ability of subpopulations of less metabolically active Mycobacterium tuberculosis (Mtb to withstand killing by current anti-TB drugs. We have used immune modulation with a phosphodiesterase-4 (PDE4 inhibitor, CC-3052, that reduces tumor necrosis factor alpha (TNF-α production by increasing intracellular cAMP in macrophages, to examine the crosstalk between host and pathogen in rabbits with pulmonary TB during treatment with isoniazid (INH. Based on DNA microarray, changes in host gene expression during CC-3052 treatment of Mtb infected rabbits support a link between PDE4 inhibition and specific down-regulation of the innate immune response. The overall pattern of host gene expression in the lungs of infected rabbits treated with CC-3052, compared to untreated rabbits, was similar to that described in vitro in resting Mtb infected macrophages, suggesting suboptimal macrophage activation. These alterations in host immunity were associated with corresponding down-regulation of a number of Mtb genes that have been associated with a metabolic shift towards dormancy. Moreover, treatment with CC-3052 and INH resulted in reduced expression of those genes associated with the bacterial response to INH. Importantly, CC-3052 treatment of infected rabbits was associated with reduced ability of Mtb to withstand INH killing, shown by improved bacillary clearance, from the lungs of co-treated animals compared to rabbits treated with INH alone. The results of our study suggest that changes in Mtb gene expression, in response to changes in the host immune response, can alter the responsiveness of the bacteria to antimicrobial agents. These findings provide a basis for exploring the potential use of adjunctive immune modulation with PDE4 inhibitors to enhance the efficacy of existing anti-TB treatment.

  7. Simultaneous Voltammetric Determination of Acetaminophen and Isoniazid (Hepatotoxicity-Related Drugs) Utilizing Bismuth Oxide Nanorod Modified Screen-Printed Electrochemical Sensing Platforms. (United States)

    Mahmoud, Bahaa G; Khairy, Mohamed; Rashwan, Farouk A; Banks, Craig E


    To overcome the recent outbreaks of hepatotoxicity-related drugs, a new analytical tool for the continuously determination of these drugs in human fluids is required. Electrochemical-based analytical methods offer an effective, rapid, and simple tool for on-site determination of various organic and inorganic species. However, the design of a sensitive, selective, stable, and reproducible sensor is still a major challenge. In the present manuscript, a facile, one-pot hydrothermal synthesis of bismuth oxide (Bi 2 O 2.33 ) nanostructures (nanorods) was developed. These BiO nanorods were cast onto mass disposable graphite screen-printed electrodes (BiO-SPEs), allowing the ultrasensitive determination of acetaminophen (APAP) in the presence of its common interference isoniazid (INH), which are both found in drug samples. The simultaneous electroanalytical sensing using BiO-SPEs exhibited strong electrocatalytic activity toward the sensing of APAP and INH with an enhanced analytical signal (voltammetric peak) over that achievable at unmodified (bare) SPEs. The electroanalytical sensing of APAP and INH are possible with accessible linear ranges from 0.5 to 1250 μM and 5 to 1760 μM with limits of detection (3σ) of 30 nM and 1.85 μM, respectively. The stability, reproducibility, and repeatability of BiO-SPE were also investigated. The BiO-SPEs were evaluated toward the sensing of APAP and INH in human serum, urine, saliva, and tablet samples. The results presented in this paper demonstrate that BiO-SPEs sensing platforms provide a potential candidate for the accurate determination of APAP and INH within human fluids and pharmaceutical formulations.

  8. [Application of near infrared spectroscopy in rapid and simultaneous determination of essential components in five varieties of anti-tuberculosis tablets]. (United States)

    Teng, Le-sheng; Wang, Di; Song, Jia; Zhang, Yi-bo; Guo, Wei-liang; Teng, Li-rong


    Since 1980s, tuberculosis has become increasingly serious. Rifampicin tablets, isoniazide tablets, pyrazinamide tablets, rifampicin and isoniazide tablets and rifampicin isoniazide and pyrazinamide tablets are currently relatively efficacious antituberculosis drugs. In the present paper, near infrared spectroscopy (NIRS) with partial least squares (PLS) was applied to the simultaneous determination of rifampicin (RMP), isoniazide (INH) and pyrazinamide (PZA) contents in 5 varieties of anti-tuberculosis tablets. As the results showed, all of the models for the determination of RMP, INH and PZA contents applied the original NIR spectra. The most efficacious wavelength range for the determination of RMP contents was 1981-2195 nm, it was 1540-1717 nm and 2086-2197 nm for the determination of INH contents, and it was 1460-1537 nm, 1956-2022 nm and 2268-2393 nm for determination of PZA contents. The root mean square error of the calibration set obtained by cross-validation (RMSECV) of the optimum models for the quantitative analysis of RMP, INH and PZA contents was 0.0494, 0.0257 and 0.0307, respectively. Using these optimum models for the determination of RMP, INH and PZA contents in prediction set, the root mean square error of prediction set (RMSEP) was 0.0182, 0.0166 and 0.0134, respectively. The correlation coefficient (r(p)) between the predicted values and actual values was 0.9864, 0.9989 and 0.9993, respectively. These results demonstrated that this method was precise and reliable, and is significative for in situ measurement and the on-line quality control for anti-tuberculosis tablets production.

  9. Diabetes insipidus is an unfavorable prognostic factor for response to glucocorticoids in patients with autoimmune hypophysitis. (United States)

    Lupi, Isabella; Cosottini, Mirco; Caturegli, Patrizio; Manetti, Luca; Urbani, Claudio; Cappellani, Daniele; Scattina, Ilaria; Martino, Enio; Marcocci, Claudio; Bogazzi, Fausto


    Autoimmune hypophysitis (AH) has a variable clinical presentation and natural history; likewise, its response to glucocorticoid therapy is often unpredictable. To identify clinical and radiological findings associated with response to glucocorticoids. 12 consecutive patients with AH, evaluated from 2008 to 2016. AH was the exclusion diagnosis after ruling out other pituitary masses and secondary causes of hypophysitis. Mean follow-up time was 30 ± 27 months (range 12-96 months). MRI identified two main patterns of presentation: global enlargement of the pituitary gland or panhypophysitis ( n  = 4, PH), and pituitary stalk abnormality only, or infundibulo-neuro-hypophysitis ( n  = 8, INH). Multiple tropin defects were more common in PH (100%) than those in INH (28% P  = 0.014), whereas diabetes insipidus was more common in INH (100%) than that in PH (50%; P  = 0.028). All 4 PH and 4 out of 8 INH were treated with glucocorticoids. Pituitary volume significantly reduced in all PH patients ( P  = 0.012), defective anterior pituitary function recovered only in the two patients without diabetes insipidus (50%) and panhypopituitarism persisted, along with diabetes insipidus, in the remaining 2 (50%). In all INH patients, either treated or untreated, pituitary stalk diameter reduced ( P  = 0.008) but diabetes insipidus persisted in all. Glucocorticoid therapy may improve anterior pituitary function in a subset of patients but has no effect on restoring posterior pituitary function. Diabetes insipidus appears as a negative prognostic factor for response to glucocorticoids. © 2017 European Society of Endocrinology.

  10. Molecular characterization of multidrug-resistant Mycobacterium tuberculosis isolated in Nepal. (United States)

    Poudel, Ajay; Nakajima, Chie; Fukushima, Yukari; Suzuki, Haruka; Pandey, Basu Dev; Maharjan, Bhagwan; Suzuki, Yasuhiko


    Despite the fact that Nepal is one of the first countries globally to introduce multidrug-resistant tuberculosis (MDR-TB) case management, the number of MDR-TB cases is continuing to rise in Nepal. Rapid molecular tests applicable in this setting to identify resistant organisms would be an effective tool in reversing this trend. To develop such tools, information about the frequency and distribution of mutations that are associated with phenotypic drug resistance in Mycobacterium tuberculosis is required. In the present study, we investigated the prevalence of mutations in rpoB and katG genes and the inhA promoter region in 158 M. tuberculosis isolates (109 phenotypically MDR and 49 non-MDR isolates collected in Nepal) by DNA sequencing. Mutations affecting the 81-bp rifampin (RIF) resistance-determining region (RRDR) of rpoB were identified in 106 of 109 (97.3%) RIF-resistant isolates. Codons 531, 526, and 516 were the most commonly affected, at percentages of 58.7, 15.6, and 15.6%, respectively. Of 113 isoniazid (INH)-resistant isolates, 99 (87.6%) had mutations in the katG gene, with Ser315Thr being the most prevalent (81.4%) substitution. Mutations in the inhA promoter region were detected in 14 (12.4%) INH-resistant isolates. The results from this study provide an overview of the current situation of RIF and INH resistance in M. tuberculosis in Nepal and can serve as a basis for developing or improving rapid molecular tests to monitor drug-resistant strains in this country.

  11. Characterization of domestic graywater and graywater solids. (United States)

    Sievers, Jan Christian; Londong, Jörg


    The knowledge of loads and concentrations is fundamental for the design of graywater treatment units, but the data on the characteristics of graywater and in particular graywater solids are weak. As general design values regarding graywater treatment facilities are not available for Germany, the objective of this article is to elaborate the characteristics of graywater and graywater solids. This paper describes the results of six sampling campaigns carried out on graywater systems in the German cities Berlin, Lübeck and Kiel. All graywater samples were collected proportional to the flow and the graywater solids were gathered separately. The collected data include graywater volumes and characteristics regarding the organic pollution (chemical oxygen demand (COD), 5-day biochemical oxygen demand (BOD 5 )) and nutrients (total nitrogen (TN), total phosphorus (TP)). The graywater volume fluctuated depending on the location. The specific average flow was 68 litre per inhabitant per day (L/inh.d). Inhabitant-specific loads of 49.3 gCOD t /inh·d, 28 gBOD 5 /inh.d, 1 gTN t /inh.d and 0.38 gTP t /inh.d (subscript 't' = total) were found. Information about the composition of graywater solids in terms of quantity and quality is seriously lacking. Therefore, graywater solids were examined with respect to organic matter (COD) and nutrients (TN, TP). The contribution of graywater solids with particle sizes over 200 microns in relation to the total inhabitant-specific load was approximately 3-8% depending on the parameter. The qualitative and quantitative characteristics of the investigated graywater fractions may serve as a base for the estimation of design values.

  12. Treatment outcomes for isoniazid-resistant tuberculosis under program conditions in British Columbia, Canada. (United States)

    Romanowski, Kamila; Chiang, Leslie Y; Roth, David Z; Krajden, Mel; Tang, Patrick; Cook, Victoria J; Johnston, James C


    Every year, over 1 million people develop isoniazid (INH) resistant tuberculosis (TB). Yet, the optimal treatment regimen remains unclear. Given increasing prevalence, the clinical efficacy of regimens used by physicians is of interest. This study aims to examine treatment outcomes of INH resistant TB patients, treated under programmatic conditions in British Columbia, Canada. Medical charts were retrospectively reviewed for cases of culture-confirmed INH mono-resistant TB reported to the BC Centre for Disease Control (BCCDC) from 2002 to 2014. Treatment regimens, patient and strain characteristics, and clinical outcomes were analysed. One hundred sixty five cases of INH mono-resistant TB were included in analysis and over 30 different treatment regimens were prescribed. Median treatment duration was 10.5 months (IQR 9-12 months) and treatment was extended beyond 12 months for 26 patients (15.8%). Fifty six patients (22.6%) experienced an adverse event that resulted in a drug regimen modification. Overall, 140 patients (84.8%) had a successful treatment outcome while 12 (7.2%) had an unsuccessful treatment outcome of failure (n = 2; 1.2%), relapse (n = 4; 2.4%) or all cause mortality (n = 6; 3.6%). Our treatment outcomes, while consistent with findings reported from other studies in high resource settings, raise concerns about current recommendations for INH resistant TB treatment. Only a small proportion of patients completed the recommended treatment regimens. High quality studies to confirm the effectiveness of standardized regimens are urgently needed, with special consideration given to trials utilizing fluoroquinolones.

  13. Hepatoprotective potential of ethanolic extract of Ziziphus oenoplia (L.) Mill roots against antitubercular drugs induced hepatotoxicity in experimental models. (United States)

    Rao, Ch V; Rawat, A K S; Singh, Anil P; Singh, Arpita; Verma, Neeraj


    To evaluate the hepatoprotective potential of ethanolic (50%) extract of Ziziphus oenoplia (L.) Mill (Z. oenoplia) root against isoniazid (INH) and rifampicin (RIF) induced liver damage in animal models. Five groups of six rats each were selected for the study. Ethanolic extract at a dose of 150 and 300 mg/kg as well as silymarin (100 mg/kg) were administered orally once daily for 21 d in INH + RIF treated groups. The serum levels of glutamic oxaloacetic transaminase (SGOT), glutamate pyruvate transaminase (SGPT), alkaline phosphatase (SALP), and bilirubin were estimated along with activities of superoxide dismutase, catalase, glutathione S-transferase, glutathione peroxidase, and hepatic melondialdehyde formation. Histopathological analysis was carried out to assess injury to the liver. The considerably elevated serum enzymatic activities of glutamic oxaloacetic transaminase, glutamate pyruvate transaminase, alkaline phosphatase and bilirubin due to INH + RIF treatment were restored towards normal in a dose dependent manner after the treatment with ethanolic extract of Z. oenoplia roots. Meanwhile, the decreased activities of superoxide dismutase, catalase, glutathione S-transferase and glutathione peroxidase were also restored towards normal dose dependently. In addition, ethanolic extract also significantly prevented the elevation of hepatic melondialdehyde formation in the liver of INH + RIF intoxicated rats in a dose dependent manner. The biochemical observations were supplemented with histopathological examination of rat liver sections. The results of this study strongly indicate that ethanolic extract of Z. oenoplia has a potent hepatoprotective action against INH + RIF induced hepatic damage in rats. Copyright © 2012 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

  14. Mutation of katG in a clinical isolate of Mycobacterium tuberculosis: effects on catalase-peroxidase for isoniazid activation. (United States)

    Purkan; Ihsanawati; Natalia, D; Syah, Y M; Retnoningrum, D S; Kusuma, H S


    Mutations in katG gene are often associated with isoniazid (INH) resistance in Mycobacterium tuberculosis strain. This research was perfomed to identify the katG mutation in clinical isolate (L8) that is resistant to INH at 1 μg/ml. In addition to characterize the catalase-peroxidase of KatG L8 and perform the ab initio structural study of the protein to get a more complete understanding in drug activation and the resistan­ce mechanism. The katG gene was cloned and expressed in Escherichia coli, then followed by characterization of catalase-peroxidase of KatG. The structure modelling was performed to know a basis of alterations in enzyme activity. A substitution of A713G that correspond to Asn238Ser replacement was found in the L8 katG. The Asn238Ser modification leads to a decline in the activity of catalase-peroxidase and INH oxidation of the L8 KatG protein. The catalytic efficiency (Kcat/KM) of mutant KatGAsn238Ser respectively decreases to 41 and 52% for catalase and peroxidase. The mutant KatGAsn238Ser also shows a decrease of 62% in INH oxidation if compared to a wild type KatG (KatGwt). The mutant Asn238Ser might cause instability in the substrate binding­ site of KatG, because of removal of a salt bridge connecting the amine group of Asn238 to the carbo­xyl group of Glu233, which presents in KatGwt. The lost of the salt bridge in the substrate binding site in mutant KatGAsn238Ser created changes unfavorable for enzyme activities, which in turn emerge as INH resistan­ce in the L8 isolate of M. tuberculosis.

  15. Conjugated and Entrapped HPMA-PLA Nano-Polymeric Micelles Based Dual Delivery of First Line Anti TB Drugs: Improved and Safe Drug Delivery against Sensitive and Resistant Mycobacterium Tuberculosis. (United States)

    Upadhyay, Seema; Khan, Iliyas; Gothwal, Avinash; Pachouri, Praveen K; Bhaskar, N; Gupta, Umesh D; Chauhan, Devendra S; Gupta, Umesh


    First line antiTB drugs have several physical and toxic manifestations which limit their applications. RIF is a hydrophobic drug and has low water solubility and INH is hepatotoxic. The main objective of the study was to synthesize, characterize HPMA-PLA co-polymeric micelles for the effective dual delivery of INH and RIF. HPMA-PLA co-polymer and HPMA-PLA-INH (HPI) conjugates were synthesized and characterized by FT-IR and 1 H-NMR spectroscopy. Later on RIF loaded HPMA-PLA-INH co-polymeric micelles (PMRI) were formulated and characterized for size, zeta potential and surface morphology (SEM, TEM) as well as critical micellar concentration. The safety was assessed through RBC's interaction study. The prepared PMRI were evaluated through MABA assay against sensitive and resistant strains of M. Tuberculosis. Size, zeta and entrapment efficiency for RIF loaded HPMA-PLA-INH polymeric micelles (PMRI) was 87.64 ± 1.98 nm, -19 ± 1.93 mV and 97.2 ± 1.56%, respectively. In vitro release followed controlled and sustained delivery pattern. Sustained release was also supported by release kinetics. Haemolytic toxicity of HPI and PMRI was 8.57 and 7.05% (p PLA polymeric micelles (PMRI) were more effective against sensitive and resistant M tuberculosis. The developed approach can lead to improved patient compliance and reduced dosing in future, offering improved treatment of tuberculosis.

  16. Sex pheromone in the moth Heliothis virescens is produced as a mixture of two pools: de novo and via precursor storage in glycerolipids. (United States)

    Foster, Stephen P; Anderson, Karin G; Casas, Jérôme


    Most species of moths use a female-produced volatile sex pheromone, typically produced via de novo fatty acid synthesis in a specialized gland, for communication among mates. While de novo biosynthesis of pheromone (DNP) is rapid, suggesting transient precursor acids, substantial amounts of pheromone precursor (and other) acids are stored, predominantly in triacylglycerols in the pheromone gland. Whether these stored acids are converted to pheromone later or not has been the subject of some debate. Using a tracer/tracee approach, in which we fed female Heliothis virescens U- 13 C-glucose, we were able to distinguish two pools of pheromone, in which precursors were temporally separated (after and before feeding on labeled glucose): DNP synthesized from a mixed tracer/tracee acetyl CoA pool after feeding, and pheromone made from precursor acids primarily synthesized before feeding, which we call recycled precursor fat pheromone (RPP). DNP titer varied from high (during scotophase) to low (photophase) and with presence/absence of pheromone biosynthesis activating neuropeptide (PBAN), in accord with native pheromone titer previously observed. By contrast, RPP was constant throughout the photoperiod and did not change with PBAN presence/absence. The amount of RPP (6.3-10.3 ng/female) was typically much lower than that of DNP, especially during the scotophase (peak DNP, 105 ng/female). We propose an integral role for stored fats in pheromone biosynthesis, in which they are hydrolyzed and re-esterified throughout the photoperiod, with a small proportion of liberated precursor acyl CoAs being converted to pheromone. During the sexually active period, release of PBAN results in increased flux of glucose (from trehalose) and hydrolyzed acids entering the mitochondria, producing acetyl CoA precursor for de novo fat and pheromone biosynthesis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Novel design for centrifugal counter-current chromatography: VI. Ellipsoid column. (United States)

    Gu, Dongyu; Yang, Yi; Xin, Xuelei; Aisa, Haji Akber; Ito, Yoichiro


    A novel ellipsoid column was designed for centrifugal counter-current chromatography. Performance of the ellipsoid column with a capacity of 3.4 mL was examined with three different solvent systems composed of 1-butanol-acetic acid-water (4:1:5, v/v) (BAW), hexane-ethyl acetate-methanol-0.1 M HCl (1:1:1:1, v/v) (HEMH), and 12.5% (w/w) PEG1000 and 12.5% (w/w) dibasic potassium phosphate in water (PEG-DPP) each with suitable test samples. In dipeptide separation with BAW system, both stationary phase retention (Sf) and peak resolution (Rs) of the ellipsoid column were much higher at 0° column angle (column axis parallel to the centrifugal force) than at 90° column angle (column axis perpendicular to the centrifugal force), where elution with the lower phase at a low flow rate produced the best separation yielding Rs at 2.02 with 27.8% Sf at a flow rate of 0.07 ml/min. In the DNP-amino acid separation with HEMW system, the best results were obtained at a flow rate of 0.05 ml/min with 31.6% Sf yielding high Rs values at 2.16 between DNP-DL-glu and DNP-β-ala peaks and 1.81 between DNP-β-ala and DNP-L-ala peaks. In protein separation with PEG-DPP system, lysozyme and myolobin were resolved at Rs of 1.08 at a flow rate of 0.03 ml/min with 38.9% Sf. Most of those Rs values exceed those obtained from the figure-8 column under similar experimental conditions previously reported.

  18. Therapeutic potential of Mucuna pruriens (Linn.) on ageing induced damage in dorsal nerve of the penis and its implication on erectile function: an experimental study using albino rats. (United States)

    Seppan, Prakash; Muhammed, Ibrahim; Mohanraj, Karthik Ganesh; Lakshmanan, Ganesh; Premavathy, Dinesh; Muthu, Sakthi Jothi; Wungmarong Shimray, Khayinmi; Sathyanathan, Sathya Bharathy


    To study the effect of ethanolic seed extract of Mucuna pruriens on damaged dorsal nerve of the penis (DNP) in aged rat in relation to penile erection. The rats were divided into four groups Young (3 months), Aged (24 - 28 months), Aged + M. pruriens, and Young + M. pruriens (200 mg/kg b.w/60 days) and were subjected to the hypophysial - gonadal axis, nerve conduction velocity (NCV), and penile reflex. DNP sections were stained with nitric oxide synthase (nNOS), nicotinamide adenine dinucleotide phosphate (NaDPH) diaphorase, androgen receptor (AR), and osmium tetroxide. Terminal deoxynucleotidyl transferase (TdT) dUTP Nick-End Labeling (TUNEL) staining, electron microscopy(EM) and histometric analyses were done. Significant disturbance in hypophysial - gonadal axis was noted in aged rat. With reduced number of myelinated fibers, diameter, vacuolization, indentation of the myelin sheath, and degeneration. nNOS and its cofactor (NaDPH diaphorase) were reduced in aged rat DNP. NCV was slow in aged rats and concomitant poor penile reflex was also noted. AR showed reduced expression in aged rat DNP when compared to young and control groups. TUNEL positive cells were increased in aged rat DNP. These pathological changes were remarkably reduced or recovered in M. pruriens treated aged rats. The results indicate a multi-factorial therapeutic activity in penile innervations towards sustaining the penile erection in the presence of the extract in aged rats and justifying the claim of traditional usage.

  19. A quasi-optical and corrugated waveguide microwave transmission system for simultaneous dynamic nuclear polarization NMR on two separate 14.1 T spectrometers (United States)

    Dubroca, Thierry; Smith, Adam N.; Pike, Kevin J.; Froud, Stuart; Wylde, Richard; Trociewitz, Bianca; McKay, Johannes; Mentink-Vigier, Frederic; van Tol, Johan; Wi, Sungsool; Brey, William; Long, Joanna R.; Frydman, Lucio; Hill, Stephen


    Nuclear magnetic resonance (NMR) is an intrinsically insensitive technique, with Boltzmann distributions of nuclear spin states on the order of parts per million in conventional magnetic fields. To overcome this limitation, dynamic nuclear polarization (DNP) can be used to gain up to three orders of magnitude in signal enhancement, which can decrease experimental time by up to six orders of magnitude. In DNP experiments, nuclear spin polarization is enhanced by transferring the relatively larger electron polarization to NMR active nuclei via microwave irradiation. Here, we describe the design and performance of a quasi-optical system enabling the use of a single 395 GHz gyrotron microwave source to simultaneously perform DNP experiments on two different 14.1 T (1H 600 MHz) NMR spectrometers: one configured for magic angle spinning (MAS) solid state NMR; the other configured for solution state NMR experiments. In particular, we describe how the high power microwave beam is split, transmitted, and manipulated between the two spectrometers. A 13C enhancement of 128 is achieved via the cross effect for alanine, using the nitroxide biradical AMUPol, under MAS-DNP conditions at 110 K, while a 31P enhancement of 160 is achieved via the Overhauser effect for triphenylphosphine using the monoradical BDPA under solution NMR conditions at room temperature. The latter result is the first demonstration of Overhauser DNP in the solution state at a field of 14.1 T (1H 600 MHz). Moreover these results have been produced with large sample volumes (∼100 μL, i.e. 3 mm diameter NMR tubes).

  20. Contribution of tryptophan residues to the combining site of a monoclonal anti dinitrophenyl spin-label antibody

    International Nuclear Information System (INIS)

    Anglister, J.; Bond, M.W.; Frey, T.; Leahy, D.; Levitt, M.; McConnell, H.M.; Rule, G.S.; Tomasello, J.; Whittaker, M.


    Two Fab fragments of the monoclonal anti dinitrophenyl (DNP) spin-label antibody AN02 were prepared by recombination of specifically deuterated heavy and light chains. In the recombinant H(I)L(II) all the tyrosines and phenylalanines were perdeuterated as were the tryptophan residues of the heavy chain. In the recombinant H(II)L(I) all the tyrosines and phenylalanines were perdeuterated as were the tryptophan residues of the light chain. Saturation of three resonances of H(I)L(II), assigned to tryptophan protons of the light chain, resulted in magnetization transfer to the aromatic proton at position 6 of the DNP ring and to the CH2 protons of the glycines linked to the DNP in a diamagnetic hapten (DNP-DG). Saturation of three resonances of H(II)L(I) assigned to tryptophan protons of the heavy chain resulted in magnetization transfer to the CH2 protons of the glycines in DNP-DG. From the dependence of the magnetization transfer on the irradiation time, the cross relaxation rates between the involved protons were estimated. The inferred distances between these protons of the hapten and certain tryptophan protons are 3-4 A. It is concluded that in the combining site of AN02 there is one tryptophan from the light chain and one tryptophan from the heavy chain that are very near the hapten. When all tyrosines and phenylalanines were perdeuterated and all tryptophan aromatic protons were deuterated except for the protons at positions 2 and 5, titration of the Fab fragments with variable amounts of paramagnetic hapten showed that one proton from the light chain tryptophan is near (less than 7 A) the unpaired electron and that three other protons are significantly closer than 15 A

  1. Contribution of tryptophan residues to the combining site of a monoclonal anti dinitrophenyl spin-label antibody

    Energy Technology Data Exchange (ETDEWEB)

    Anglister, J.; Bond, M.W.; Frey, T.; Leahy, D.; Levitt, M.; McConnell, H.M.; Rule, G.S.; Tomasello, J.; Whittaker, M.


    Two Fab fragments of the monoclonal anti dinitrophenyl (DNP) spin-label antibody AN02 were prepared by recombination of specifically deuterated heavy and light chains. In the recombinant H(I)L(II) all the tyrosines and phenylalanines were perdeuterated as were the tryptophan residues of the heavy chain. In the recombinant H(II)L(I) all the tyrosines and phenylalanines were perdeuterated as were the tryptophan residues of the light chain. Saturation of three resonances of H(I)L(II), assigned to tryptophan protons of the light chain, resulted in magnetization transfer to the aromatic proton at position 6 of the DNP ring and to the CH2 protons of the glycines linked to the DNP in a diamagnetic hapten (DNP-DG). Saturation of three resonances of H(II)L(I) assigned to tryptophan protons of the heavy chain resulted in magnetization transfer to the CH2 protons of the glycines in DNP-DG. From the dependence of the magnetization transfer on the irradiation time, the cross relaxation rates between the involved protons were estimated. The inferred distances between these protons of the hapten and certain tryptophan protons are 3-4 A. It is concluded that in the combining site of AN02 there is one tryptophan from the light chain and one tryptophan from the heavy chain that are very near the hapten. When all tyrosines and phenylalanines were perdeuterated and all tryptophan aromatic protons were deuterated except for the protons at positions 2 and 5, titration of the Fab fragments with variable amounts of paramagnetic hapten showed that one proton from the light chain tryptophan is near (less than 7 A) the unpaired electron and that three other protons are significantly closer than 15 A.

  2. Internalized insulin-receptor complexes are unidirectionally translocated to chloroquine-sensitive degradative sites. Dependence on metabolic energy

    International Nuclear Information System (INIS)

    Berhanu, P.


    Insulin receptors on the surface of isolated rat adipocytes were photoaffinity labeled at 12 degrees C with the iodinated photoreactive insulin analogue, 125I-B2 (2-nitro-4-azidophenylacetyl)-des-PheB1-insulin, and the pathways in the intracellular processing of the labeled receptors were studied at 37 degrees C. During 37 degrees C incubations, the labeled 440-kDa insulin receptors were continuously internalized (as assessed by trypsin inaccessibility) and degraded such that up to 50% of the initially labeled receptors were lost by 120 min. Metabolic poisons (0.125-0.75 mM 2,4-dinitrophenol (DNP) and 1-10 mM NaF), which led to dose-dependent depletion of adipocyte ATP pools, inhibited receptor loss, and caused up to 3-fold increase in intracellular receptor accumulation. This effect was due to inhibition of intracellular receptor degradation, and there was no apparent effect of the metabolic poisons on initial internalization of the receptors. Following maximal intracellular accumulation of labeled insulin receptors in the presence of NaF or DNP, removal of these agents resulted in a subsequent, time-dependent degradation of the accumulated receptors. However, when the lysosomotropic agent, chloroquine (0.2 mM), was added immediately following removal of the metabolic poisons, further degradation of the intracellularly accumulated receptors was prevented, suggesting that the chloroquine-sensitive degradation of insulin receptors occurs distal to the site of inhibition by NaF or DNP. To confirm this, maximal intracellular accumulation of labeled receptors was first allowed to occur in the presence of chloroquine and the cells were then washed and reincubated in chloroquine-free media in the absence or presence of NaF or DNP. Under these conditions, degradation of the intracellularly accumulated receptors continued to occur, and NaF or DNP failed to block the degradation

  3. Increasing frequency of severe clinical toxicity after use of 2,4-dinitrophenol in the UK: a report from the National Poisons Information Service. (United States)

    Kamour, Ashraf; George, Nathan; Gwynnette, David; Cooper, Gillian; Lupton, David; Eddleston, Michael; Thompson, John Paul; Vale, John Allister; Thanacoody, Harry Krishna Ruben; Hill, Simon; Thomas, Simon Hugh Lynton


    2,4-Dinitrophenol (DNP) increases energy consumption by uncoupling oxidative phosphorylation. Although not licensed as a medicine, it is sometimes used by 'body sculptors' and for weight loss as a 'fat burning' agent. This research was performed to characterise patterns of presentation, clinical features and outcomes of patients reported to the National Poisons Information Service (NPIS) in the UK after exposure to DNP. NPIS telephone enquiry records and user sessions for TOXBASE, the NPIS online information database, related to DNP, were reviewed from 1 January 2007 to 31 December 2013. Of the 30 separate systemic exposures to DNP reported by telephone to NPIS during the study period (27 males, 3 females, with a median age of 23.5 years), there were 3 during 2007-2011 (inclusive), 5 during 2012 and 22 during 2013. TOXBASE user sessions also increased sharply from 6 in 2011 to 35 in 2012 and 331 in 2013. The modes of exposure reported in telephone enquiries were chronic (n=2), acute (n=12) and subacute (n=16). Commonly reported clinical features were fever (47%), tachycardia (43%), sweating (37%), nausea or vomiting (27%), skin discolouration or rash (23%), breathing difficulties (23%), abdominal pain (23%), agitation (13%) and headache (13%). There were five (17%, 95% CI 6.9% to 34%) fatalities, four involving acute overdose. The study indicates a substantial recent increase in clinical presentations with toxicity caused by exposure to DNP in the UK with an associated high mortality. Further steps are needed to warn potential users of the severe and sometimes fatal toxicity that may occur after exposure to this compound. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to

  4. A quasi-optical and corrugated waveguide microwave transmission system for simultaneous dynamic nuclear polarization NMR on two separate 14.1 T spectrometers. (United States)

    Dubroca, Thierry; Smith, Adam N; Pike, Kevin J; Froud, Stuart; Wylde, Richard; Trociewitz, Bianca; McKay, Johannes; Mentink-Vigier, Frederic; van Tol, Johan; Wi, Sungsool; Brey, William; Long, Joanna R; Frydman, Lucio; Hill, Stephen


    Nuclear magnetic resonance (NMR) is an intrinsically insensitive technique, with Boltzmann distributions of nuclear spin states on the order of parts per million in conventional magnetic fields. To overcome this limitation, dynamic nuclear polarization (DNP) can be used to gain up to three orders of magnitude in signal enhancement, which can decrease experimental time by up to six orders of magnitude. In DNP experiments, nuclear spin polarization is enhanced by transferring the relatively larger electron polarization to NMR active nuclei via microwave irradiation. Here, we describe the design and performance of a quasi-optical system enabling the use of a single 395 GHz gyrotron microwave source to simultaneously perform DNP experiments on two different 14.1 T ( 1 H 600 MHz) NMR spectrometers: one configured for magic angle spinning (MAS) solid state NMR; the other configured for solution state NMR experiments. In particular, we describe how the high power microwave beam is split, transmitted, and manipulated between the two spectrometers. A 13 C enhancement of 128 is achieved via the cross effect for alanine, using the nitroxide biradical AMUPol, under MAS-DNP conditions at 110 K, while a 31 P enhancement of 160 is achieved via the Overhauser effect for triphenylphosphine using the monoradical BDPA under solution NMR conditions at room temperature. The latter result is the first demonstration of Overhauser DNP in the solution state at a field of 14.1 T ( 1 H 600 MHz). Moreover these results have been produced with large sample volumes (∼100 µL, i.e. 3 mm diameter NMR tubes). Copyright © 2018 Elsevier Inc. All rights reserved.

  5. Effects of electroacupuncture at 2 and 100 Hz on rat type 2 diabetic neuropathic pain and hyperalgesia-related protein expression in the dorsal root ganglion. (United States)

    He, Xiao-Fen; Wei, Jun-Jun; Shou, Sheng-Yun; Fang, Jian-Qiao; Jiang, Yong-Liang

    To investigate the analgesic effects of electroacupuncture (EA) at 2 and 100 Hz on type 2 diabetic neuropathic pain (DNP) and on the expressions of the P2X3 receptor and calcitonin gene-related peptide (CGRP) in the dorsal root ganglion (DRG). Rat type 2 DNP was induced by a high calorie and high sugar diet fed for 7 weeks, plus a single intraperitoneal injection of streptozotocin (STZ) after 5 weeks. EA at 2 and 100 Hz was carried out once every day after 7 weeks for 7 consecutive days. Body weight, serum fasting insulin (FINS), fasting blood glucose (FBG), insulin sensitivity index (ISI), and paw withdrawal latency (PWL) were measured. The expressions of L4-L6 DRG P2X3 receptors and CGRP were assessed by immunofluorescence. Type 2 DNP was successfully induced as shown by the increased body weight, FINS, and FBG, as well as the reduced ISI and PWL. Expressions of P2X3 receptors and CGRP in L4-L6 DRGs increased. EA at both 2 and 100 Hz relieved type 2 DNP, but the analgesic effect of EA was stronger at 2 Hz. P2X3 receptor expression decreased in L4-L6 DRGs following EA at 2 Hz and in L5 and L6 DRGs following EA at 100 Hz. EA at both 2 and 100 Hz down-regulated CGRP overexpression in L4-L6 DRGs. These findings indicate that EA at 2 Hz is a good option for the management of type 2 DNP. The EA effect may be related to its down-regulation of the overexpressions of the DRG P2X3 receptors and CGRP in this condition.

  6. Quantum mechanical aspects of dynamical neutron polarization

    International Nuclear Information System (INIS)

    Betz, T.; Badurek, G.; Jericha, E.


    Dynamic Neutron Polarization (DNP) is a concept which allows to achieve complete polarization of slow neutrons, virtually without any loss of intensity. There the neutrons pass through a combination of a static and a rotating magnetic field in resonance, like in a standard NMR apparatus. Depending on their initial spin state, they end up with different kinetic energies and therefore different velocity. In a succeeding magnetic precession field this distinction causes a different total precession angle. Tuning the field strength can lead to a final state where two original anti-parallel spin states are aligned parallel and hence to polarization. The goal of this work is to describe the quantum mechanical aspects of DNP and to work out the differences to the semi-classical treatment. We show by quantum mechanical means, that the concept works and DNP is feasible, indeed. Therefore, we have to take a closer look to the behavior of neutron wave functions in magnetic fields. In the first Section we consider a monochromatic continuous beam. The more realistic case of a pulsed, polychromatic beam requires a time-dependent field configuration and will be treated in the second Section. In particular the spatial separation of the spin up- and down-states is considered, because it causes an effect of polarization damping so that one cannot achieve a fully polarized final state. This effect is not predicted by the semi-classical treatment of DNP. However, this reduction of polarization is very small and can be neglected in realistic DNP-setups

  7. A peripheral component interconnect express-based scalable and highly integrated pulsed spectrometer for solution state dynamic nuclear polarization

    Energy Technology Data Exchange (ETDEWEB)

    He, Yugui; Liu, Chaoyang, E-mail: [Wuhan National Laboratory for Optoelectronics, School of Optical and Electronic Information, Huazhong University of Science and Technology, Wuhan 430074 (China); State Key Laboratory of Magnet Resonance and Atomic and Molecular Physics, Wuhan Institute of Physics and Mathematics, Chinese Academy of Sciences, Wuhan 430071 (China); Feng, Jiwen; Wang, Dong; Chen, Fang; Liu, Maili [State Key Laboratory of Magnet Resonance and Atomic and Molecular Physics, Wuhan Institute of Physics and Mathematics, Chinese Academy of Sciences, Wuhan 430071 (China); Zhang, Zhi; Wang, Chao [State Key Laboratory of Magnet Resonance and Atomic and Molecular Physics, Wuhan Institute of Physics and Mathematics, Chinese Academy of Sciences, Wuhan 430071 (China); University of Chinese Academy of Sciences, Beijing 100048 (China)


    High sensitivity, high data rates, fast pulses, and accurate synchronization all represent challenges for modern nuclear magnetic resonance spectrometers, which make any expansion or adaptation of these devices to new techniques and experiments difficult. Here, we present a Peripheral Component Interconnect Express (PCIe)-based highly integrated distributed digital architecture pulsed spectrometer that is implemented with electron and nucleus double resonances and is scalable specifically for broad dynamic nuclear polarization (DNP) enhancement applications, including DNP-magnetic resonance spectroscopy/imaging (DNP-MRS/MRI). The distributed modularized architecture can implement more transceiver channels flexibly to meet a variety of MRS/MRI instrumentation needs. The proposed PCIe bus with high data rates can significantly improve data transmission efficiency and communication reliability and allow precise control of pulse sequences. An external high speed double data rate memory chip is used to store acquired data and pulse sequence elements, which greatly accelerates the execution of the pulse sequence, reduces the TR (time of repetition) interval, and improves the accuracy of TR in imaging sequences. Using clock phase-shift technology, we can produce digital pulses accurately with high timing resolution of 1 ns and narrow widths of 4 ns to control the microwave pulses required by pulsed DNP and ensure overall system synchronization. The proposed spectrometer is proved to be both feasible and reliable by observation of a maximum signal enhancement factor of approximately −170 for {sup 1}H, and a high quality water image was successfully obtained by DNP-enhanced spin-echo {sup 1}H MRI at 0.35 T.

  8. Comparative evaluation of GenoType MTBDRplus line probe assay with solid culture method in early diagnosis of multidrug resistant tuberculosis (MDR-TB at a tertiary care centre in India.

    Directory of Open Access Journals (Sweden)

    Raj N Yadav

    Full Text Available The objectives of the study were to compare the performance of line probe assay (GenoType MTBDRplus with solid culture method for an early diagnosis of multidrug resistant tuberculosis (MDR-TB, and to study the mutation patterns associated with rpoB, katG and inhA genes at a tertiary care centre in north India.In this cross-sectional study, 269 previously treated sputum-smear acid-fast bacilli (AFB positive MDR-TB suspects were enrolled from January to September 2012 at the All India Institute of Medical Sciences hospital, New Delhi. Line probe assay (LPA was performed directly on the sputum specimens and the results were compared with that of conventional drug susceptibility testing (DST on solid media [Lowenstein Jensen (LJ method].DST results by LPA and LJ methods were compared in 242 MDR-TB suspects. The LPA detected rifampicin (RIF resistance in 70 of 71 cases, isoniazid (INH resistance in 86 of 93 cases, and MDR-TB in 66 of 68 cases as compared to the conventional method. Overall (rifampicin, isoniazid and MDR-TB concordance of the LPA with the conventional DST was 96%. Sensitivity and specificity were 98% and 99% respectively for detection of RIF resistance; 92% and 99% respectively for detection of INH resistance; 97% and 100% respectively for detection of MDR-TB. Frequencies of katG gene, inhA gene and combined katG and inhA gene mutations conferring all INH resistance were 72/87 (83%, 10/87 (11% and 5/87 (6% respectively. The turnaround time of the LPA test was 48 hours.The LPA test provides an early diagnosis of monoresistance to isoniazid and rifampicin and is highly sensitive and specific for an early diagnosis of MDR-TB. Based on these findings, it is concluded that the LPA test can be useful in early diagnosis of drug resistant TB in high TB burden countries.

  9. Economic impact of the use of rifaximin 550 mg twice daily for the treatment of overt hepatic encephalopathy in Italy

    Directory of Open Access Journals (Sweden)

    Roggeri DP


    Full Text Available Daniela Paola Roggeri, Alessandro Roggeri ProCure Solutions, Nembro, Bergamo, Italy Purpose: Hepatic encephalopathy (HE is associated with a reduced survival, an increased risk of hospitalization for recurrences, and a reduced health-related quality of life. The purpose of the present economic analysis was to evaluate the impact on the Italian National Health Service (INHS expenditure of the treatment with rifaximin 550 mg twice daily (Tixteller®/Tixtar® for the reduction of the recurrences of overt HE, with respect to the current treatment approach. Patients and methods: Costs associated with patients treated with rifaximin 550 mg twice daily were estimated considering the reduction in hospitalizations for HE recurrences revealed by registrative clinical trial (−50% applied to the hospitalization rate (42.5% emerging from an Italian observational real-world study; costs associated with patients not treated with rifaximin were estimated based on the hospitalization rate, resulting from the same Italian observational study. Sensitivity analyses considering possible different discount levels to INHS structures for rifaximin were performed. The INHS perspective for a period of 3 years was considered. Results: The treatment with rifaximin 550 mg twice daily, although increasing drug costs, is associated with a reduction in hospitalizations for HE recurrences that leads to an overall reduction of total costs charged to INHS, which could be estimated, based on the forecasted uptake of the treatment, at about €130,000 in the first year, reaching ~€260,000 in the third year. Considering a possible discount for rifaximin 550 mg to INHS structure of 20%, the total saving at the third year accounts for ~€3,000,000. Moreover, a relevant reduction in the number of hospitalizations and bed days is associated with rifaximin treatment. Conclusion: The treatment with rifaximin 550 mg twice daily, even if associated with an increase in drug expenditure

  10. Epidemiology of infections by HIV, Syphilis, Gonorrhea and Lymphogranuloma Venereum in Barcelona City: a population-based incidence study. (United States)

    Martí-Pastor, Marc; García de Olalla, Patricia; Barberá, Maria-Jesús; Manzardo, Christian; Ocaña, Inma; Knobel, Hernando; Gurguí, Mercè; Humet, Victoria; Vall, Martí; Ribera, Esteban; Villar, Judit; Martín, Gemma; Sambeat, Maria A; Marco, Andres; Vives, Alvaro; Alsina, Mercè; Miró, Josep M; Caylà, Joan A


    The aim of this study was to determine the evolution of HIV infection, gonorrhea, syphilis and lymphogranuloma venereum (LGV), and their epidemiological characteristics in Barcelona city. Population-based incidence study of all newly occurring diagnoses of HIV infection, syphilis, gonorrhea and LGV detected in Barcelona between January 2007 and December 2011. A descriptive analysis was performed. The annual incidence rates per 100,000 inhabitants were calculated by sex, sexual conduct and educational level. To estimate global sex-specific rates we used the Barcelona city census; for the calculation of rates by sexual conduct and educational level we used estimates of the Barcelona Health Interview Survey. Trends were analysed using the chi-squared test for linear trend. HIV. 66.8 % of the HIV cases were men who had sex with men (MSM). The incidence rates in MSM over the study period were from 692.67/100,000 to 909.88/100,000 inh. Syphilis. 74.2 % of the syphilis cases were MSM. The incidence rates in MSM were from 224.9/100,000 to 891.97/100,000 inh. and the MSM with a university education ranged from 196.3/100,000 to 1020.8/100,000. Gonorrhea. 45.5 % of the gonorrhea cases were MSM. The incidence rates in MSM were from 164.24/100,000 to 404.79/100,000 inh. and the MSM with university education ranged from 176.7/100,000 to 530.1/100,000 inh.. Lymphogranuloma venereum (LGV). 95.3 % of the LGV cases are MSM. The incidence rates in MSM were from 24.99/100,000 to 282.99/100,000 inh. and the MSM with university education ranged from 9.3/100,000 to 265/100,000 inh. An increase in cases of STI was observed. These STI mainly affected MSM with a university education. Continuing to monitor changes in the epidemiology of STI, and identifying the most affected groups should permit redesigning preventive programs, with the goal of finding the most efficient way to reach these population groups.

  11. Short-term Outcomes following Concussion in the NFL: An 11-year Retrospective Study of Player Release Rate and Financial Loss (United States)

    Ramkumar, Prem; Navarro, Sergio Michael


    Objectives: The primary goal of this study was to assess the short-term outcomes among National Football League (NFL) players following concussion in terms of: (1) DNP protocol activation, (2) release rate at one and three years, and (3) mean salary reduction. A secondary goal of the study was to stratify the post-concussive release rate by franchise and player position. Methods: NFL player transaction records and publicly available weekly injury reports from August 2005 to January 2016 for NFL players were analyzed. All players immediately sustaining recorded concussions were evaluated for a change to inactive or do-not-play (DNP) status. The one-year and three-year release rate following concussion was defined as any player transitioning to inactivation, retirement, free agency, or any failure to return for a successive season on the same team’s active roster after one or three years from the initial concussion. Student’s t-test was used to compare release rates between non-concussed and concussed players at one and three years. Mean salary reduction per year following concussion was calculated using publicly available player contracts. Additionally, franchise-level and position-based analyses of the release rate were performed. Results: Of the total 5,451 NFL players retrospectively analyzed over the 11-year period, 373 sustained publicly reported concussions resulting in DNP protocol activation. The release rate of the post-concussive versus non-concussive player was 26% vs. 20% at 1 year (pfranchise to release an athlete following concussion within one and three years. Table 1 reports a position-based analysis in terms of concussion rate, mean salary reduction, and NFL career longevity. Conclusion: Our retrospective study demonstrates that NFL concussions resulting in DNP protocol activation leads to a statistically greater release rate among concussed NFL players than non-concussed players. Released players suffered reduction in year-over-year accumulated

  12. Antigen-decorated shell cross-linked nanoparticles: synthesis, characterization, and antibody interactions. (United States)

    Joralemon, Maisie J; Smith, Norah L; Holowka, David; Baird, Barbara; Wooley, Karen L


    Antigen-decorated shell cross-linked knedel-like nanoparticles (SCKs) were synthesized and studied as multivalent nanoscale surfaces from which antibody-binding units were presented in a manner that was designed to approach virus particle surfaces. The SCK nanostructures were fabricated with control over the number of antigenic groups, from mixed micellization of amphiphilic diblock copolymer building blocks that contained either an antigen (2,4-dinitrophenyl) or an ethylpropionate group at the hydrophilic alpha-chain terminus. Amphiphilic diblock copolymers were synthesized by atom transfer radical polymerization of tert-butyl acrylate and methyl acrylate sequentially from either a 2,4-dinitrophenyl-functionalized initiator or ethyl 2-bromopropionate, followed by selective removal of the tert-butyl groups to afford 2,4-dinitrophenyl-poly(acrylic acid)60-b-poly(methyl acrylate)60 (DNP-PAA(60)-b-PMA60) and poly(acrylic acid)70-b-poly(methyl acrylate) (PAA70-b-PMA70). Micelles were assembled via addition of water to THF solutions of the polymers in 0:1, 1:1, and 1:0 molar ratios of DNP-PAA60-b-PMA60 to PAA70-b-PMA70, followed by dialysis against water. The acrylic acid groups of the micelle coronas were partially cross-linked (nominally 50%) with 2,2'-(ethylenedioxy)bis(ethylamine), in the presence of 1-(3'-dimethylaminopropyl)-3-ethylcarbodiimide methiodide. Following extensive dialysis against water, the 0%, 50%, and 100% dinitrophenylated shell cross-linked nanoparticles (DNP-SCKs) were characterized with dynamic light scattering (DLS), transmission electron microscopy (TEM), atomic force microscopy (AFM), differential scanning calorimetry (DSC), thermogravimetric analysis (TGA), infrared and UV-vis spectroscopies, and analytical ultracentrifugation (AU). The surface accessibility and bioavailability of the DNP units upon the DNP-SCKs were investigated by performing quenching titrations of fluorescein-labeled IgE antibody in solution and degranulation of Ig

  13. Spectroscopic and theoretical study of the o-vanillin hydrazone of the mycobactericidal drug isoniazid (United States)

    González-Baró, Ana C.; Pis-Diez, Reinaldo; Parajón-Costa, Beatriz S.; Rey, Nicolás A.


    A complete and detailed study of the hydrazone obtained from condensation of antituberculous isoniazid (hydrazide of the isonicotinic acid, INH) and o-vanillin (2-hydroxy-3-methoxybenzaldehyde, o-HVa) is performed. It includes structural and spectroscopic analyses, comparing experimental and theoretical results. The compound was obtained as a chloride of the pyridinic salt (INHOVA +Cl -) but it will be referred as INHOVA for the sake of simplicity. The conformational space was searched and optimized geometries were determined both in gas phase and including solvent effects. Vibrational (IR and Raman), electronic and NMR spectra were registered and assigned with the help of computational methods based on the Density Functional Theory. Isoniazid hydrazones are good candidates for therapeutic agents against tuberculosis with conserved efficiency and lower toxicity and resistance than parent INH.

  14. Isoniazid completion rates for latent tuberculosis infection among college students managed by a community pharmacist. (United States)

    Hess, Karl; Goad, Jeffery; Wu, Joanne; Johnson, Kathleen


    The authors' objective was to document 9-month and previously recommended 6-month treatment completion rates for latent tuberculosis infection (LTBI) in a pharmacist-managed LTBI clinic in a community pharmacy on a college campus, and to describe patient characteristics. Participants were university students diagnosed with LTBI. The authors conducted a retrospective review of pharmacy records from 2000 to 2006. Main outcome measures included 6-month and 9-month LTBI treatment completion rates, total isoniazid (INH) tablets taken, characteristics of completers versus noncompleters, average time to treatment completion, and reported adverse drug events. The 9-month completion rate was 59%, and the 6-month completion rate was 67%. Among those not completing treatment, 15.2% experienced fatigue and 2.2% experienced a rash (p=.04 and p=.03, respectively). LTBI clinics are a unique niche for community pharmacies and can provide individualized patient care to ensure LTBI treatment adherence, monitoring for disease progression, and safety of INH.

  15. Adherence to and outcome of isoniazid chemoprophylaxis among household contact children of adults having pulmonary tuberculosis in Alexandria, Egypt. (United States)

    Mohamed, Aida M


    Current international guidelines recommend 6-9 months of isoniazid (INH) preventive chemotherapy to prevent the development of active tuberculosis (TB) in susceptible children exposed to Mycobacterium tuberculosis. However, this is dependent on good adherence, as shown by previous studies. This study was conducted to describe the outcome of screening of contact children aged 5 years or less with household exposure to an adult pulmonary TB index case to determine the prevalence and possible risk factors of infection among contact children and to determine the extent and outcome of adherence of contact children to unsupervised INH chemoprophylaxis for 6 months. A descriptive facility-based cross-sectional study was conducted from March 2009 to August 2010. Research settings were three of the National TB control program chest dispensaries (primary care facilities) in Alexandria, Egypt. Facility-based TB treatment registers of the previous 3 months were used to identify all new adult pulmonary TB cases. All children aged 5 years or less living in the same house as the index cases were identified and screened for TB. The contact children were given unsupervised INH preventive chemotherapy once active TB was excluded. Adherence to and outcome of preventive chemotherapy were followed up. Preventive chemotherapy consisted of unsupervised INH monotherapy for 6 months with monthly collection of tablets from the clinic. Adherence was documented after completion of the 6-month preventive treatment period. Adherence was considered reasonable if tablets were collected for more than 4 months, poor if collected for 2-4 months, and very poor if collected for less than 2 months. (a) Prevalence of infection and disease and the possible risk factors among contacts. (b) The extent and outcome of adherence to unsupervised INH chemoprophylaxis among contact children. (c) Factors behind poor adherence. In total, 197 adult TB index cases from 187 households were identified. In all, 297

  16. Nanoparticle Drones to Target Lung Cancer with Radiosensitizers and Cannabinoids

    Directory of Open Access Journals (Sweden)

    Wilfred Ngwa


    Full Text Available Nanotechnology has opened up a new, previously unimaginable world in cancer diagnosis and therapy, leading to the emergence of cancer nanomedicine and nanoparticle-aided radiotherapy. Smart nanomaterials (nanoparticle drones can now be constructed with capability to precisely target cancer cells and be remotely activated with radiation to emit micrometer-range missile-like electrons to destroy the tumor cells. These nanoparticle drones can also be programmed to deliver therapeutic payloads to tumor sites to achieve optimal therapeutic efficacy. In this article, we examine the state-of-the-art and potential of nanoparticle drones in targeting lung cancer. Inhalation (INH (air versus traditional intravenous (“sea” routes of navigating physiological barriers using such drones is assessed. Results and analysis suggest that INH route may offer more promise for targeting tumor cells with radiosensitizers and cannabinoids from the perspective of maximizing damage to lung tumors cells while minimizing any collateral damage or side effects.

  17. Hepatoprotective agent tethered isoniazid for the treatment of drug-induced hepatotoxicity: Synthesis, biochemical and histopathological evaluation

    Directory of Open Access Journals (Sweden)

    Charan Singh


    Full Text Available The aim of the study was to investigate the protective effect of isoniazid–curcumin conjugate (INH–CRM in INH-induced hepatic injury by biochemical analysis and histology examination of liver in Wistar rats. The biochemical analysis included determination of the levels of plasma cholesterol, triglycerides (TG, albumin content, and lipid peroxidation (MDA. INH–CRM administration resulted in a significant decrease in plasma cholesterol, TG, and MDA levels in the liver tissue homogenate with an elevation in albumin level indicating its hepatoprotective activity. Histology of the liver further confirmed the reduction in hepatic injury. The hepatoprotective with INH–CRM can be attributed to the antioxidant activity of curcumin. The conjugate probably stabilizes the curcumin molecule, preventing its presystemic metabolism thereby enhancing its bioavailability and therefore, its hepatoprotective activity. Thus, the novel INH–CRM has the potential to alleviate INH-induced liver toxicity in antitubercular treatment.

  18. Preventive therapy in children exposed to Mycobacterium tuberculosis: problems and solutions. (United States)

    Rutherford, Merrin E; Hill, Philip C; Triasih, Rina; Sinfield, Rebecca; van Crevel, Reinout; Graham, Stephen M


    Young children living with a tuberculosis patient are at high risk of Mycobacterium tuberculosis infection and disease. WHO guidelines promote active screening and isoniazid (INH) preventive therapy (PT) for such children under 5 years, yet this well-established intervention is seldom used in endemic countries. We review the literature regarding barriers to implementation of PT and find that they are multifactorial, including difficulties in screening, poor adherence, fear of increasing INH resistance and poor acceptability among primary caregivers and healthcare workers. These barriers are largely resolvable, and proposed solutions such as the adoption of symptom-based screening and shorter drug regimens are discussed. Integrated multicomponent and site-specific solutions need to be developed and evaluated within a public health framework to overcome the policy-practice gap and provide functional PT programmes for children in endemic settings. © 2012 Blackwell Publishing Ltd.

  19. Psychometric Field Study of Hereditary Angioedema Quality of Life Questionnaire for Adults

    DEFF Research Database (Denmark)

    Prior, Nieves; Remor, Eduardo; Pérez-Fernández, Elia


    BACKGROUND: Hereditary angioedema due to C1 inhibitor deficiency (C1-INH-HAE) may affect health-related quality of life (HRQoL). A specific HRQoL questionnaire for adult patients with C1-INH-HAE, the HAE-QoL, has recently been developed in Spain. OBJECTIVE: The objective of this study...... was to perform a cross-cultural validation and psychometric study of the HAE-QoL in an international setting. METHODS: Cross-cultural adaptation of the Spanish HAE-QoL draft version and an international rating phase with experts were performed. The resultant version of the HAE-QoL, a clinical questionnaire...... with and without psychiatric and/or psychological care (median: 74 vs 103; P ≤ .001). CONCLUSIONS: The HAE-QoL, currently available in 18 languages, showed good reliability and validity evidence....

  20. Evaluation of genotype MTBDRplus assay for rapid detection of isoniazid and rifampicin resistance in Mycobacterium tuberculosis clinical isolates from Pakistan

    Directory of Open Access Journals (Sweden)

    Hasnain Javed


    Conclusions: As evidenced in this study, the major concern with the GenoType MTBDRplus assay were false negative results. In comparison to conventional drug susceptibility testing, the assay was unable to detect 30 (30/100; 30% strains resistant to INH and 23 (23/100; 23% strains resistant to RMP. The GenoType MTBDRplus failed to identify 38 MDR (38/100; 38% strains. Resistance in those strains probably originate from mutations in other codons and/or genes than those covered by the test. For detecting INH and RMP resistance in TB cases, especially in high TB incidence countries, such as Pakistan, molecular approaches should still be a complement rather than areplacement to conventional drug susceptibility testing.

  1. [DNA mutations associated to rifampicin or isoniazid resistance in M. tuberculosis clinical isolates from Sonora, Mexico]. (United States)

    Bolado-Martínez, Enrique; Pérez-Mendoza, Ansix; Alegría-Morquecho, Francisco Monserrat; Candia-Plata, María del Carmen; Aguayo-Verdugo, María del Rosario; Alvarez-Hernández, Gerardo


    To perform the analysis of specific regions of the major genes associated with resistance to isoniazid or rifampin. Twenty two M. tuberculosis strains, isolated from human samples obtained in Sonora, Mexico. Specific primers for hotspots of the rpoB, katG, inhA genes and the ahpC-oxyR intergenic region were used. The purified PCR products were sequenced. Mutations in the promoter of inhA, the ahpC-oxyR region, and codon 315 of katG and in 451 or 456 codons of rpoB, were identified. Detection of mutations not previously reported requires further genotypic analysis of Mycobacterium tuberculosis isolates in Sonora.

  2. Studies on mycobacterium tuberculosis sensitivity test by using the method of rapid radiometry with appendixes of clinical results

    International Nuclear Information System (INIS)

    Yang Yongqing; Jiang Yimin; Lu Wendong; Zhu Rongen


    Three standard strains of mycobacterium tuberculosis (H 37 RV-fully sensitive, SM-R1000 μg/ml, RFP-R 100 μg/ml) were tested with 10 concentration of 5 antitubercular agent, INH, SM, PAS, RFP and EB. 114 isolates of mycobacterium tuberculosis taken from patients were tested with INH, PAS, SM and RFP. They were agreed with the results of standard Lowenstein-Jensen method in 81.7%. 82% of the isolate test were completed within 5 days. The method may be used in routine clinical work. The liquid media prepared by authors do not require human serum albumin and it is less expensive and readily available

  3. Nanoparticle Drones to Target Lung Cancer with Radiosensitizers and Cannabinoids (United States)

    Ngwa, Wilfred; Kumar, Rajiv; Moreau, Michele; Dabney, Raymond; Herman, Allen


    Nanotechnology has opened up a new, previously unimaginable world in cancer diagnosis and therapy, leading to the emergence of cancer nanomedicine and nanoparticle-aided radiotherapy. Smart nanomaterials (nanoparticle drones) can now be constructed with capability to precisely target cancer cells and be remotely activated with radiation to emit micrometer-range missile-like electrons to destroy the tumor cells. These nanoparticle drones can also be programmed to deliver therapeutic payloads to tumor sites to achieve optimal therapeutic efficacy. In this article, we examine the state-of-the-art and potential of nanoparticle drones in targeting lung cancer. Inhalation (INH) (air) versus traditional intravenous (“sea”) routes of navigating physiological barriers using such drones is assessed. Results and analysis suggest that INH route may offer more promise for targeting tumor cells with radiosensitizers and cannabinoids from the perspective of maximizing damage to lung tumors cells while minimizing any collateral damage or side effects. PMID:28971063

  4. Nanoparticle Drones to Target Lung Cancer with Radiosensitizers and Cannabinoids. (United States)

    Ngwa, Wilfred; Kumar, Rajiv; Moreau, Michele; Dabney, Raymond; Herman, Allen


    Nanotechnology has opened up a new, previously unimaginable world in cancer diagnosis and therapy, leading to the emergence of cancer nanomedicine and nanoparticle-aided radiotherapy. Smart nanomaterials (nanoparticle drones) can now be constructed with capability to precisely target cancer cells and be remotely activated with radiation to emit micrometer-range missile-like electrons to destroy the tumor cells. These nanoparticle drones can also be programmed to deliver therapeutic payloads to tumor sites to achieve optimal therapeutic efficacy. In this article, we examine the state-of-the-art and potential of nanoparticle drones in targeting lung cancer. Inhalation (INH) (air) versus traditional intravenous ("sea") routes of navigating physiological barriers using such drones is assessed. Results and analysis suggest that INH route may offer more promise for targeting tumor cells with radiosensitizers and cannabinoids from the perspective of maximizing damage to lung tumors cells while minimizing any collateral damage or side effects.

  5. Pancreas tumor interstitial pressure catheter measurement (United States)

    Nieskoski, Michael D.; Gunn, Jason; Marra, Kayla; Trembly, B. Stuart; Pogue, Brian W.


    This paper highlights the methodology in measuring interstitial pressure in pancreatic adenocarcinoma tumors. A Millar Mikrotip pressure catheter (SPR-671) was used in this study and a system was built to amplify and filter the output signal for data collection. The Millar pressure catheter was calibrated prior to each experiment in a water column at 37°C, range of 0 to 60 inH2O (112 mmHg), resulting in a calibration factor of 33 mV / 1 inH2O. The interstitial pressures measured in two orthotopically grown pancreatic adenocarcinoma tumor were 57 mmHg and 48 mmHg, respectively. Verteporfin uptake into the pancreatic adenocarcinoma tumor was measured using a probe-based experimental dosimeter.

  6. Spin filtering neutrons with a proton target dynamically polarized using photo-excited triplet states

    International Nuclear Information System (INIS)

    Haag, M.; Brandt, B. van den; Eichhorn, T.R.; Hautle, P.; Wenckebach, W.Th.


    In a test of principle a neutron spin filter has been built, which is based on dynamic nuclear polarization (DNP) using photo-excited triplet states. This DNP method has advantages over classical concepts as the requirements for cryogenic equipment and magnets are much relaxed: the spin filter is operated in a field of 0.3 T at a temperature of about 100 K and has performed reliably over periods of several weeks. The neutron beam was also used to analyze the polarization of the target employed as a spin filter. We obtained an independent measurement of the proton spin polarization of ∼0.13 in good agreement with the value determined with NMR. Moreover, the neutron beam was used to measure the proton spin polarization as a function of position in the naphthalene sample. The polarization was found to be homogeneous, even at low laser power, in contradiction to existing models describing the photo-excitation process.

  7. Waveguide transition with vacuum window for multiband dynamic nuclear polarization systems

    Energy Technology Data Exchange (ETDEWEB)

    Rybalko, Oleksandr; Bowen, Sean; Zhurbenko, Vitaliy [Technical University of Denmark, Ørsteds Plads 349, 2800 Kgs. Lyngby (Denmark); Ardenkjær-Larsen, Jan Henrik, E-mail: [Technical University of Denmark, Ørsteds Plads 349, 2800 Kgs. Lyngby (Denmark); GE Healthcare, Park Alle 295, Brøndby (Denmark)


    A low loss waveguide transition section and oversized microwave vacuum window covering several frequency bands (94 GHz, 140 GHz, 188 GHz) is presented. The transition is compact and was optimized for multiband Dynamic Nuclear Polarization (DNP) systems in a full-wave simulator. The window is more broadband than commercially available windows, which are usually optimized for single band operation. It is demonstrated that high-density polyethylene with urethane adhesive can be used as a low loss microwave vacuum window in multiband DNP systems. The overall assembly performance and dimensions are found using full-wave simulations. The practical aspects of the window implementation in the waveguide are discussed. To verify the design and simulation results, the window is tested experimentally at the three frequencies of interest.

  8. Opposite effects of total lymphoid irradiation on T cell-dependent and T cell-independent antibody responses

    Energy Technology Data Exchange (ETDEWEB)

    Tanay, A.; Strober, S.


    The effect of total lymphoid irradiation (TLI) on the primary antibody response to the dinitrophenylated heterologous protein, keyhole limpet hemocyanin (DNP-KLH), in complete Freund's adjuvant (CFA), and to the trinitrophenylated polysaccharide antigen, Brucella abortus (TNP-BA), was studied in BALB/c mice. The antibody response to both antigens was diminished in comparison with nonirradiated mice when antigens were injected within 3 days after TLI. When the mice were immunized 30 days after completion of TLI the antibody response to DNP-KLH in CFA was still diminished, but the antibody response to TNP-BA was enhanced 5- to 10-fold as compared with that of control animals. The opposite effect of TLI on the two antibody responses was also observed in a syngeneic primary adoptive transfer system.

  9. Post-Electrophoretic Identification of Oxidized Proteins (United States)

    Conrad, Craig C; Talent, John M; Malakowsky, Christina A


    The oxidative modification of proteins has been shown to play a major role in a number of human diseases. However, the ability to identify specific proteins that are most susceptible to oxidative modifications is difficult. Separation of proteins using polyacrylamide gel electrophoresis (PAGE) offers the analytical potential for the recovery, amino acid sequencing, and identification of thousands of individual proteins from cells and tissues. We have developed a method to allow underivatized proteins to be electroblotted onto PVDF membranes before derivatization and staining. Since both the protein and oxidation proteins are quantifiable, the specific oxidation index of each protein can be determined. The optimal sequence and conditions for the staining process are (a) electrophoresis, (b) electroblotting onto PVDF membranes, (c) derivatization of carbonyls with 2,4-DNP, (d) immunostaining with anti DNP antibody, and (e) protein staining with colloidal gold. PMID:12734585

  10. Study of a number of biochemical indices of the blood and tissue of dogs after prolonged gamma-radiation (United States)

    Alers, I.; Alersova, E.; Praslichka, T.; Mishurova, E.; Sedlakova, A.; Malatova, Z.; Akhunov, A. A.; Markelov, B. A.


    The glucose content in blood and the lipid content in serum and tissues of dogs exposed to chronic radiation for 3 and 5 years were studied. In tissues of these animals, the concentration of soluble DNA and DNA contained in DNP was studied in the spleen, lymph node (deep cervical node) and bone marrow of thigh bones. Results indicate that chronic gamma irradiation significantly changes concentrations of glucose in the blood, and that of several lipids in serum and tissues. A reduction in the concentration of DNP in tested organs reflects changes in the relative number of cells with various nuclear cytoplasmic ratios; most pronounced changes in biochemical indices occur in dogs exposed to chronic gamma radiation in doses of 125 rad per year.

  11. Electron spin resonance and its implication on the maximum nuclear polarization of deuterated solid target materials

    International Nuclear Information System (INIS)

    Heckmann, J.; Meyer, W.; Radtke, E.; Reicherz, G.; Goertz, S.


    ESR spectroscopy is an important tool in polarized solid target material research, since it allows us to study the paramagnetic centers, which are used for the dynamic nuclear polarization (DNP). The polarization behavior of the different target materials is strongly affected by the properties of these centers, which are added to the diamagnetic materials by chemical doping or irradiation. In particular, the ESR linewidth of the paramagnetic centers is a very important parameter, especially concerning the deuterated target materials. In this paper, the results of the first precise ESR measurements of the deuterated target materials at a DNP-relevant magnetic field of 2.5 T are presented. Moreover, these results allowed us to experimentally study the correlation between ESR linewidth and maximum deuteron polarization, as given by the spin-temperature theory

  12. Development of an institutional review board preapproval process for Doctor of Nursing Practice students: process and outcome. (United States)

    Szanton, Sarah L; Taylor, Holly A; Terhaar, Mary


    As Doctor of Nursing Practice (DNP) programs proliferate, effective collaboration with institutional review boards (IRBs) is important to protect human subjects. It is particularly important that faculty and students recognize which DNP students' projects should be considered as "human subjects research" or "quality improvement." The former require IRB review, whereas the latter may be eligible for expedited review or may be considered exempt. We report outcomes following implementation of a combination of didactic training, one-to-one consultation, and a decision support protocol to improve preparation for and collaboration with the IRB at a large university. In the first year of using this protocol, 53% of projects were deemed human subjects research and received IRB review. The other 47% were deemed quality improvement projects and did not require IRB review. We offer our experience as an approach for teaching students how to protect the subjects included in their quality improvement activities. Copyright 2012, SLACK Incorporated.

  13. Binding of polycyclic and nitropolycyclic aromatic hydrocarbons to specific fractions of rat lung chromatin

    International Nuclear Information System (INIS)

    Mitchell, C.E.; Akkaraju, S.


    Binding of polycyclic aromatic hydrocarbons and nitropolycyclic aromatic hydrocarbons (NPAH) to rat lung nuclei was investigated. Following carcinogen exposure, nuclei were fractionated into active chromatin, nuclear matrix, low salt, and high salt fractions. Preferential binding to active chromatin and nuclear matrix fractions was observed for benzo(a)pyrene (BP), 6-nitro benzo(a)pyrene, 1,6-dinitropyrene (1,6-DNP), and 1-nitropyrene. Incubation of nuclei with BP, benzo(a)pyrene diolepoxide (BPDE), and 1,6-DNP showed that the selective binding was dependent upon the concentration of chemical with less selectivity at higher concentrations. This study shows that NPAH should be considered as another class of compounds that may exert their biological effects by binding to selected regions of chromatin that are involved in DNA replication and translation. (author)

  14. Aggregation of fragmented chromatin associated with the appearance of products of its nuclease treatment

    International Nuclear Information System (INIS)

    Lobanenkov, V.V.; Mironov, N.M.; Kupriyanova, E.I.; Shapot, V.S.


    Isolated cell nuclei were incubated with nucleases, and then the chromatin was extracted with a low-salt buffer. When degradation of the nuclear chromatin DNase I or micrococcal nuclease is intensified, solubilization of the deoxyribonucleoprotein (DNP) in low-salt buffer at first increases, reaching a maximum in the case of hydrolysis of 2-4% of the nuclear DNA, but after intensive treatment with nucleases, it decreases sharply. Soluble fragmented chromatin is aggregated during treatment with DNase I. The addition of exogenous products of nuclease treatment of isolated nuclei to a preparation of gelatinous chromatin induces its aggregation. Pretreatment of nuclear chromatin with RNase prevents the solubilization of DNP by solutions with low ionic strength. Certain experimental data obtained using rigorous nuclease treatment are discussed; for their interpretation it is necessary to consider the effect of aggregation of fragmented chromatin by products of its nuclease degradation

  15. Preparation of Pillar[5]arene-Based [2]Rotaxanes by a Stopper-Exchange Strategy. (United States)

    Nierengarten, Iwona; Meichsner, Eric; Holler, Michel; Pieper, Pauline; Deschenaux, Robert; Delavaux-Nicot, Béatrice; Nierengarten, Jean-François


    A pillar[5]arene-containing rotaxane building block bearing exchangeable stoppers has been prepared in multigram scale quantities with high yields from the reaction of 2,4-dinitrophenol (DNP) with the inclusion complex resulting from the association of dodecanedioyl chloride with 1,4-diethoxypillar[5]arene. Stopper exchange reactions have been achieved by treatment of the resulting DNP diester with various amines through an addition-elimination mechanism preventing the unthreading of the axle component during the reaction and thus preserving the [2]rotaxane structures. The resulting diamide [2]rotaxane derivatives have thus been obtained in good to excellent yields. Importantly, [2]rotaxanes difficult or impossible to prepare by direct introduction of the two stoppers in a single synthetic step are now easily available. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Homogeneous antibodies in lethally irradiated and autologous bone marrow reconstituted Rhesus monkeys

    International Nuclear Information System (INIS)

    Berg, P. Van Den; Radl, J.; Loewenberg, B.; Swart, A.C.W.


    Ten Rhesus monkeys were lethally irradiated and reconstituted with autologous bone marrow. During the restoration period, the animals were immunized with DNP-Rhesus albumin and IgA1lambda-10S human paraprotein. One or more transient homogenous immunoglobulin components appeared in sera of all experimental monkeys. In four animals, these homogeneous immunoglobulins were shown to be specific antibodies against DNP-Rhesus albumin. They gradually became as heterogeneous as those in control monkeys which were immunized but not irradiated and transplanted. The onset of the specific antibody response after immunization was slightly delayed in the experimental group. On determining the time necessary to reach normalization of the overall immunoglobulin levels and the normal heterogeneity of the immunoglobulin spectrum, it was found to be more than 1 year in most of the animals. (author)

  17. Voices of chief nursing executives informing a doctor of nursing practice program. (United States)

    Embree, Jennifer L; Meek, Julie; Ebright, Patricia

    The purpose of this article is to describe the business case framework used to guide doctor of nursing practice (DNP) program enhancements and to discuss methods used to gain chief nurse executives' (CNEs) perspectives for desired curricular and experiential content for doctor of nursing practice nurses in health care system executive roles. Principal results of CNE interview responses were closely aligned to the knowledge, skills and/or attitudes identified by the national leadership organizations. Major conclusions of this article are that curriculum change should include increased emphasis on leadership, implementation science, and translation of evidence into practice methods. Business, information and technology management, policy, and health care law content would also need to be re-balanced to facilitate DNP graduates' health care system level practice. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. THz-waves channeling in a monolithic saddle-coil for Dynamic Nuclear Polarization enhanced NMR (United States)

    Macor, A.; de Rijk, E.; Annino, G.; Alberti, S.; Ansermet, J.-Ph.


    A saddle coil manufactured by electric discharge machining (EDM) from a solid piece of copper has recently been realized at EPFL for Dynamic Nuclear Polarization enhanced Nuclear Magnetic Resonance experiments (DNP-NMR) at 9.4 T. The corresponding electromagnetic behavior of radio-frequency (400 MHz) and THz (263 GHz) waves were studied by numerical simulation in various measurement configurations. Moreover, we present an experimental method by which the results of the THz-wave numerical modeling are validated. On the basis of the good agreement between numerical and experimental results, we conducted by numerical simulation a systematic analysis on the influence of the coil geometry and of the sample properties on the THz-wave field, which is crucial in view of the optimization of DNP-NMR in solids.


    Metzger, Henry; Mannik, Mart


    Conditions were developed by which the separated H and L chains of gamma2 globulins recombined to form four-chained molecules in good yields. In the absence of antigen, anti-2,4-dinitrophenyl (anti-DNP) H chains randomly reassociated with a mixture of antibody and non-specific gamma2 globulin L chains. In the presence of a specific hapten, however, the antibody H chains preferentially interacted with the anti-DNP L chains. Antibody H chain-antibody L chain recombinants formed in the presence of hapten were more active than the corresponding recombinants formed in the absence of hapten. Speculations are made regarding the possible mechanisms and biological significance of these effects. PMID:14247718

  20. Innovación en hidrocarburos en Colombia

    Directory of Open Access Journals (Sweden)

    Juan Benavides Estévez-Bretón


    Full Text Available Este artículo presenta parte del Proyecto DNP- Uniandes sobre Clusters en la industria minero energética. El análisis se centrará en la innovación en hidrocarburos: primero, el planteamiento básico; segundo, los retos y oportunidades, y tercero, las líneas de acción en las que Colombia puede trabajar.//This article presents a fragment of the DNP- Uniandes project on Clusters in the energy mining industry. Specifically, the analysis focuses on innovation in hydrocarbons, starting with the project's basic approach. Next, it exposes the challenges and opportunities present in the Colombian context. Finally, it discusses the lines of action within which Colombia will move forward.

  1. Detection of multidrug-resistant tuberculosis from stored DNA Samples: A multicenter study


    Marie Sylvianne Rabodoarivelo; A Brandao; M C Cergole Novella; A G C. Bombonatte; B Imperiale; N Rakotosamimanana; N Morcillo; V Rasolofo; J C Palomino; A Martin


    Background: In low-income countries, rapid detection of tuberculosis (TB) drug resistance is often restricted by the difficulties of transporting and storing sputum samples from remote health centers to the reference laboratories where molecular tests are available. The aim of this study was to evaluate the performance of four transport and storage systems for molecular detection of rifampicin (RIF) and isoniazid (INH) resistance. Methods: This was a multicenter study. Molecular detection of ...

  2. World Epidemiology Review, Number 111. (United States)


    years are required to achieve 100 percent use of safe drinking water. So, if what the ministry says is true , in 15 to 20 years we will be free of...employee must have had hls lungs examined and must take an INH pill daily while employed. ^Xt0" th! 8r^n0r ab°Ut the need f°r a horoscope which would

  3. Anti-Müllerian Hormone and Ovarian Morphology in Women With Isolated Hypogonadotropic Hypogonadism/Kallmann Syndrome: Effects of Recombinant Human FSH. (United States)

    Bry-Gauillard, Hélène; Larrat-Ledoux, Florence; Levaillant, Jean-Marc; Massin, Nathalie; Maione, Luigi; Beau, Isabelle; Binart, Nadine; Chanson, Philippe; Brailly-Tabard, Sylvie; Hall, Janet E; Young, Jacques


    Isolated hypogonadotropic hypogonadism (IHH), characterized by gonadotropin deficiency and absent puberty, is very rare in women. IHH prevents pubertal ovarian stimulation, but anti-Müllerian hormone (AMH) and antral follicle count (AFC) have not been studied. (1) To compare, in IHH vs controls, AMH, ovarian volume (OV), and AFC. (2) To compare, in IHH, ovarian responses to recombinant human follicle-stimulating hormone (rhFSH) and rhFSH plus recombinant human luteinizing hormone (rhLH). Sixty-eight IHH women; 51 matched healthy women. Serum LH, FSH, sex steroids, inhibin B (InhB), AMH, and OV and AFC (sonography) were compared. Ovarian response during rhFSH administration was assessed in 12 IHH women with low AMH levels and low AFC and compared with hormonal changes observed in six additional IHH women receiving rhFSH plus rhLH. InhB was lower in IHH than in controls. AMH levels were also significantly lower in the patients, but two-thirds had normal values. Mean OV and total, larger, and smaller AFCs were lower in IHH than in controls. Ovarian stimulation by rhFSH led to a significant increase in serum estradiol and InhB levels and in the number of larger antral follicles. AMH and smaller AFC increased early during rhFSH stimulation but then declined despite continued stimulation. rhFSH plus rhLH stimulation led to a significantly higher increase in estradiol levels but to similar changes in circulating InhB and AMH than with rhFSH alone. IHH women have both low AMH levels and low AFC. However, their decrease can be reversed by follicle-stimulating hormone. Serum AMH and AFC should not serve as prognostic markers of fertility in this population. Copyright © 2017 by the Endocrine Society

  4. Surface-bound capsular polysaccharide of type Ia group B Streptococcus mediates C1 binding and activation of the classic complement pathway

    International Nuclear Information System (INIS)

    Levy, N.J.; Kasper, D.L.


    The role of surface-bound type Ia group B Streptococcus (GBS) capsular polysaccharide in anti-body-independent binding of C1 and activation of the classic component pathway was investigated. In a radiolabeled bacterial-polymorphonuclear leukocyte (PMN) association assay, a measure of bacterial opsonization, preincubation of 3 H-type Ia GBS with purified F(ab') 2 to the organism blocked the association of the bacteria with PMN', and the inhibitory effect was dose dependent. The specificity of F(ab') 2 blocking was shown after adsorption of F(ab') 2 with type Ia polysaccharide-sensitized erythrocytes. Polysaccharide-adsorbed F(ab') 2 had a 70% decrease in ability to block the association of bacteria with PMN. Neuraminidase digestion removed 80% of the terminal sialic acid residues from the native polysaccharide. These neuraminidase-digested organisms had a 72% decrease in binding and transfer of purified C1 compared with non-enzyme-treated organisms. Type Ia capsular polysaccharide bound to sheep erythrocytes promoted classic complement pathway-mediated hemolysis of the cells. The role of C1 inhibitor (INH) in modulation of C1 activation by the organisms was investigated. The possibility existed that the C1 INH could be bound by the bacteria, allowing C1 activation to occur in the fluid phase. The inhibitor was purified from human serum, and its activity was measured before and after incubation with type Ia GBS. The organisms had no effect on C1 INH activity. Thus surface-bound capsular polysacchardie of type Ia GBS mediates C1 binding and classic pathway activation, and this does not involve the C1 INH

  5. Military Services Fitness Database: Development of a Computerized Physical Fitness and Weight Management Database for the U.S. Army (United States)


    lilt’ \\P1T \\ p,I,𔃻 ’lloch .11 \\\\"lIl.k.-k \\1�\\ \\Inh,.ll t <�<𔃻 1,ŕ Br... ~’ J.’llk ’’’󈧏 ’’’’\\I Ih"l Ill<" mnh ,’,lll’ �’.111\\1" ’hill:! Ih

  6. A Comparison of numerical simulation models for predicting temperature in solidification analysis with reference to air gap formation


    Kron , J.; Bellet , Michel; Ludwig , Andreas; Pustal , Bjorn; Wendt , Joachim; Fredriksson , Hasse


    International audience; As a result of its influence on heat transfer between cast part and mould, air gap formation is an important problem for many casting processes. The general explanation for gap formation is that, as a result of stresses and distortions that are created from inhomogeneous cooling, shrinkage of the casting and expansion of the mould occur. In this paper, different thermomechanical approaches are applied to a well defined casting process using three commercial and one inh...

  7. Status Asetilator Gen NAT2 pada Pasien Tuberkulosis dan Tuberkulosis dengan Diabetes Melitus di Kupang, Nusa Tenggara Timur

    Directory of Open Access Journals (Sweden)

    Alvinsyah Adhityo Pramono


    Full Text Available Indonesia is the second highest country with TB patients in the world. Diabetes mellitus (DM is a comorbid of TB. Arylamine N-acetyltransferase 2 (NAT2, encoded by the NAT2 gene, is an enzyme that metabolizes isoniazid (INH. NAT2 gene has some polimorphysims that may play a role in INH acetylating process. Those who are slow acetylators may develop liver intoxication as a consequence of slow INH metabolism process. Slow acetylator TBDM patients may complicate both TB and DM treatment, causing them to be less optimal. The aim of this study was to explore the acetylator status of TBDM patients in Kupang, Indonesia. A cross-sectional study was conducted by obtaining DNA of 122 TB patients in Kupang in June–November 2011. NAT2 gene was amplified and sequenced to determine the acetylator status. There were 5 TB patients who had a glucose serum level of >200mg/dL and was catagorized as TBDM. Result showed that there was 1 TBDM patient who was a rapid acetylator (NAT2*4/NAT2*4, 2 patients as intermediate acetylators (NAT2*13A/NAT2*6J, and 2 patients as slow acetylators (NAT2*5/NAT2*5G, NAT2*6A/ NAT2*6A, NAT2*7B/ NAT2*7B. Meanwhile,  there were 2 TB patients who was rapid acetylators (NAT2*4/NAT2*4 and 3 patients as intermediate acetylators (NAT2*4/NAT2*6A, NAT2*13A/NAT2*6J. Slow NAT2 acetylator TBDM patients potentially face more problems during therapy. As INH may cause liver intoxication, these patients may also experience unoptimum DM treatment. Therefore, it is strongly recommended to do a study on the role of pharmacogenomics in TBDM.

  8. Epicutaneous Immunization with Type II Collagen Inhibits both Onset and Progression of Chronic Collagen-Induced Arthritis


    Strid, Jessica; Tan, Lee Aun; Strobel, Stephan; Londei, Marco; Callard, Robin


    Epicutaneous immunization is a potential non-invasive technique for antigen-specific immune-modulation. Topical application of protein antigens to barrier-disrupted skin induces potent antigen-specific immunity with a strong Th2-bias. In this study, we investigate whether the autoimmune inflammatory response of chronic collagen-induced arthritis (CCIA) in DBA/1-TCR-beta Tg mice can be modified by epicutaneous immunization. We show that epicutaneous immunization with type II collagen (CII) inh...

  9. Extrasynaptic glycine receptors of rodent dorsal raphe serotonergic neurons:a sensitive target for ethanol


    Maguire, Edward P.; Mitchell, Elizabeth A.; Greig, Scott J.; Corteen, Nicole; Balfour, David J. K.; Swinny, Jerome; Lambert, Jeremy J.; Belelli, Delia


    Alcohol abuse is a significant medical and social problem. Several neurotransmitter systems are implicated in ethanol's actions, with certain receptors and ion channels emerging as putative targets. The dorsal raphe (DR) nucleus is associated with the behavioral actions of alcohol, but ethanol actions on these neurons are not well understood. Here, using immunohistochemistry and electrophysiology we characterize DR inhibitory transmission and its sensitivity to ethanol. DR neurons exhibit inh...

  10. Administration of a dipeptidyl peptidase IV inhibitor enhances the intestinal adaptation in a mouse model of short bowel syndrome

    DEFF Research Database (Denmark)

    Okawada, Manabu; Holst, Jens Juul; Teitelbaum, Daniel H


    Glucagon-like peptide-2 induces small intestine mucosal epithelial cell proliferation and may have benefit for patients who suffer from short bowel syndrome. However, glucagon-like peptide-2 is inactivated rapidly in vivo by dipeptidyl peptidase IV. Therefore, we hypothesized that selectively inh...... inhibiting dipeptidyl peptidase IV would prolong the circulating life of glucagon-like peptide-2 and lead to increased intestinal adaptation after development of short bowel syndrome....

  11. Occurrence of illicit drugs and selected pharmaceuticals in Slovak municipal wastewater. (United States)

    Bodík, Igor; Mackuľak, Tomáš; Fáberová, Milota; Ivanová, Lucia


    We analyzed illicit drugs and their metabolites and pharmaceuticals in wastewater from 15 selected wastewater treatment plants (WWTPs) in Slovakia. Our results indicate that methamphetamine is one of the most commonly used illegal drugs in all the regions of Slovakia monitored in this study. Compared with the international results, the Slovak cities of Dunajská Streda (479 mg/day/1000inh) and Trnava (354 mg/day/1000inh) are among the cities with the largest numbers of methamphetamine users in Europe. These results indicate an increase in the incidence of drugs in big cities and in the satellite cities (Trnava and Dunajská Streda) near Bratislava. These results also confirm the police statistics about production and use of illicit drugs in Slovakia. The highest specific loads of cocaine were found in Bratislava (112 mg/day/1000inh), followed by Petržalka (74 mg/day/1000inh). Compared with other European cities, Bratislava and the other Slovak cities in this study have a relatively low number of COC consumers. The ecstasy load in wastewater from larger cities also significantly increased over the weekend and during music festivals. The highest 2-year mean concentrations of THC-COOH, a cannabis biomarker, were observed in the sewage from BA-Petržalka and BA-Central (191 and 171 ng/L, respectively). A first complex monitoring of pharmaceuticals in all therapeutic groups was also realized in selected Slovak WWTPs. Occurrence of wide spectrum of pharmaceuticals with very high concentrations as well as consumptions were observed mainly in small Slovak cities. Considering all 120 monitored pharmaceuticals, Valsartan had the highest concentrations: 6000 ng/L, on average.

  12. Inhibin B and anti-Müllerian hormone/Müllerian-inhibiting substance may contribute to the male bias in autism. (United States)

    Pankhurst, M W; McLennan, I S


    The autistic spectrum disorders have a significant male bias in incidence, which is unexplained. The Sertoli cells of the immature testes secrete supra-adult levels of Müllerian-inhibiting substance/anti-Müllerian hormone (AMH) and inhibin B (InhB), with both hormones being putative regulators of brain development. We report here, that 82 boys with an autism spectrum disorder have normal levels of InhB and AMH. However, the boys' level of InhB correlated with their autism diagnostic interview-revised (ADI-R) scores for the social interaction (R=0.29, P=0.009, N=82) and communication domains (R=0.29, P=0.022, N=63), and with the number of autistic traits the boys exhibited (R=0.34 and 0.27, respectively). The strengths of the abovementioned correlates were stronger in the boys with milder autism (R=0.42 and 0.50, respectively), with AMH exhibiting a significant negative correlation to the ADI-R score in these boys (R=-0.44 and R=-0.39, respectively). Neither hormone correlated to the incidence of stereotyped and repetitive behaviours. This suggests that the male bias in the autistic spectrum has multiple determinants, which modulate the effects of an otherwise non-dimorphic pathology. Furthermore, AMH and InhB have opposing effects on the SMAD1/5/8 pathway, and opposing correlates to autistic traits, implicating the SMAD pathways as a putative point of molecular convergence for the autistic spectrum.

  13. Concurrent object-oriented programming: The MP-Eiffel approach


    Silva, Miguel Augusto Mendes Oliveira e


    This article evaluates several possible approaches for integrating concurrency into object-oriented programming languages, presenting afterwards, a new language named MP-Eiffel. MP-Eiffel was designed attempting to include all the essential properties of both concurrent and object-oriented programming with simplicity and safety. A special care was taken to achieve the orthogonality of all the language mechanisms, allowing their joint use without unsafe side-effects (such as inh...

  14. Polymorphisms in Isoniazid and Prothionamide Resistance Genes of the Mycobacterium tuberculosis Complex

    KAUST Repository

    Projahn, M.; Koser, C. U.; Homolka, S.; Summers, D. K.; Archer, John A.C.; Niemann, S.


    Sequence analyses of 74 strains that encompassed major phylogenetic lineages of the Mycobacterium tuberculosis complex revealed 10 polymorphisms in mshA (Rv0486) and four polymorphisms in inhA (Rv1484) that were not responsible for isoniazid or prothionamide resistance. Instead, some of these mutations were phylogenetically informative. This genetic diversity must be taken into consideration for drug development and for the design of molecular tests for drug resistance.

  15. Hereditary angioedema: what the gastroenterologist needs to know

    Directory of Open Access Journals (Sweden)

    Ali MA


    Full Text Available M Aamir Ali, Marie L Borum Division of Gastroenterology and Liver Diseases, George Washington University, Washington, DC, USA Abstract: Up to 93% of patients with hereditary angioedema (HAE experience recurrent abdominal pain. Many of these patients, who often present to emergency departments, primary care physicians, general surgeons, or gastroenterologists, are misdiagnosed for years and undergo unnecessary testing and surgical procedures. Making the diagnosis of HAE can be challenging because symptoms and attack locations are often inconsistent from one episode to the next. Abdominal attacks are common and can occur without other attack locations. An early, accurate diagnosis is central to managing HAE. Unexplained abdominal pain, particularly when accompanied by swelling of the face and extremities, suggests the diagnosis of HAE. A family history and radiologic imaging demonstrating edematous bowel also support an HAE diagnosis. Once HAE is suspected, C4 and C1 esterase inhibitor (C1-INH laboratory studies are usually diagnostic. Patients with HAE may benefit from recently approved specific treatments, including plasma-derived C1-INH or recombinant C1-INH, a bradykinin B2-receptor antagonist, or a kallikrein inhibitor as first-line therapy and solvent/detergent-treated or fresh frozen plasma as second-line therapy for acute episodes. Short-term or long-term prophylaxis with nanofiltered C1-INH or attenuated androgens will prevent or reduce the frequency and severity of episodes. Gastroenterologists can play a critical role in identifying and treating patients with HAE, and should have a high index of suspicion when encountering patients with recurrent, unexplained bouts of abdominal pain. Given the high rate of abdominal attacks in HAE, it is important for gastroenterologists to appropriately diagnose and promptly recognize and treat HAE, or refer patients with HAE to an allergist. Keywords: hereditary angioedema, abdominal pain, diagnosis

  16. Mutaciones asociadas con resistencia a rifampicina o isoniazida en aislamientos clínicos de M. tuberculosis de Sonora, México DNA mutations associated to rifampicin or isoniazid resistance in M. tuberculosis clinical isolates from Sonora, Mexico

    Directory of Open Access Journals (Sweden)

    Enrique Bolado-Martínez


    Full Text Available OBJETIVO: Realizar el análisis de regiones específicas de genes asociados con resistencia a isoniazida o rifampicina. MATERIAL Y MÉTODOS: Se estudiaron 22 cepas de M. tuberculosis, aisladas en Sonora, México. Se utilizaron iniciadores para regiones específicas de los genes rpoB, katG e inhA y la región ahpC-oxyR. Los productos de PCR se secuenciaron y analizaron. RESULTADOS: Se identificaron mutaciones en la región promotora del gen inhA, región ahpC-oxyR, codón 315 del gen katG y codones 451 ó 456 del gen rpoB. CONCLUSIONES: La identificación de mutaciones no descritas previamente obliga a continuar el análisis genotípico de cepas aisladas en Sonora.OBJECTIVE: To perform the analysis of specific regions of the major genes associated with resistance to isoniazid or rifampin. MATERIALS AND METHODS: Twenty two M. tuberculosis strains, isolated from human samples obtained in Sonora, Mexico. Specific primers for hotspots of the rpoB, katG, inhA genes and the ahpC-oxyR intergenic region were used. The purified PCR products were sequenced. RESULTS: Mutations in the promoter of inhA, the ahpC-oxyR region, and codon 315 of katG and in 451 or 456 codons of rpoB, were identified. CONCLUSIONS: Detection of mutations not previously reported requires further genotypic analysis of Mycobacterium tuberculosis isolates in Sonora.

  17. Kininogen Cleavage Assay: Diagnostic Assistance for Kinin-Mediated Angioedema Conditions.

    Directory of Open Access Journals (Sweden)

    Rémi Baroso

    Full Text Available Angioedema without wheals (AE is a symptom characterised by localised episodes of oedema presumably caused by kinin release from kininogen cleavage. It can result from a hereditary deficiency in C1 Inhibitor (C1Inh, but it can present with normal level of C1Inh. These forms are typically difficult to diagnose although enhanced kinin production is suspected or demonstrated in some cases.We wanted to investigate bradykinin overproduction in all AE condition with normal C1Inh, excluding cases with enhanced kinin catabolism, and to propose this parameter as a disease biomarker.We retrospectively investigated high molecular weight kininogen (HK cleavage pattern, using gel electrophoresis and immunorevelation. Plasma samples were drawn using the same standardised procedure from blood donors or AE patients with normal C1Inh conditions, normal kinin catabolism, and without prophylaxis.Circulating native HK plasma concentrations were similar in the healthy men (interquartile range: 98-175μg/mL, n = 51 and in healthy women (90-176μg/mL, n = 74, while HK cleavage was lower (p14.4% HK cleavage for men; 33.0% HK cleavage for women, with >98% specificity achieved for all parameters. In plasma from patients undergoing recovery two months after oestrogen/progestin combination withdrawal (n = 13 or two weeks after AE attack (n = 2, HK cleavage was not fully restored, suggesting its use as a post-attack assay.As a diagnostic tool, HK cleavage can offer physicians supportive arguments for kinin production in suspected AE cases and improve patient follow-up in clinical trials or prophylactic management.

  18. C1 Inhibitor in Acute Antibody-Mediated Rejection Nonresponsive to Conventional Therapy in Kidney Transplant Recipients: A Pilot Study. (United States)

    Viglietti, D; Gosset, C; Loupy, A; Deville, L; Verine, J; Zeevi, A; Glotz, D; Lefaucheur, C


    Complement inhibitors have not been thoroughly evaluated in the treatment of acute antibody-mediated rejection (ABMR). We performed a prospective, single-arm pilot study to investigate the potential effects and safety of C1 inhibitor (C1-INH) Berinert added to high-dose intravenous immunoglobulin (IVIG) for the treatment of acute ABMR that is nonresponsive to conventional therapy. Kidney recipients with nonresponsive active ABMR and acute allograft dysfunction were enrolled between April 2013 and July 2014 and received C1-INH and IVIG for 6 months (six patients). The primary end point was the change in eGFR at 6 months after inclusion (M+6). Secondary end points included the changes in histology and DSA characteristics and adverse events as evaluated at M+6. All patients showed an improvement in eGFR between inclusion and M+6: from 38.7 ± 17.9 to 45.2 ± 21.3 mL/min/1.73 m(2) (p = 0.0277). There was no change in histological features, except a decrease in the C4d deposition rate from 5/6 to 1/6 (p = 0.0455). There was a change in DSA C1q status from 6/6 to 1/6 positive (p = 0.0253). One deep venous thrombosis was observed. In a secondary analysis, C1-INH patients were compared with a similar historical control group (21 patients). C1-INH added to IVIG is safe and may improve allograft function in kidney recipients with nonresponsive acute ABMR. © Copyright 2015 The American Society of Transplantation and the American Society of Transplant Surgeons.

  19. N- and O-glycosylation Analysis of Human C1-inhibitor Reveals Extensive Mucin-type O-Glycosylation. (United States)

    Stavenhagen, Kathrin; Kayili, H Mehmet; Holst, Stephanie; Koeleman, Carolien A M; Engel, Ruchira; Wouters, Diana; Zeerleder, Sacha; Salih, Bekir; Wuhrer, Manfred


    Human C1-inhibitor (C1-Inh) is a serine protease inhibitor and the major regulator of the contact activation pathway as well as the classical and lectin complement pathways. It is known to be a highly glycosylated plasma glycoprotein. However, both the structural features and biological role of C1-Inh glycosylation are largely unknown. Here, we performed for the first time an in-depth site-specific N - and O -glycosylation analysis of C1-Inh combining various mass spectrometric approaches, including C18-porous graphitized carbon (PGC)-LC-ESI-QTOF-MS/MS applying stepping-energy collision-induced dissociation (CID) and electron-transfer dissociation (ETD). Various proteases were applied, partly in combination with PNGase F and exoglycosidase treatment, in order to analyze the (glyco)peptides. The analysis revealed an extensively O -glycosylated N-terminal region. Five novel and five known O -glycosylation sites were identified, carrying mainly core1-type O -glycans. In addition, we detected a heavily O -glycosylated portion spanning from Thr 82 -Ser 121 with up to 16 O -glycans attached. Likewise, all known six N -glycosylation sites were covered and confirmed by this site-specific glycosylation analysis. The glycoforms were in accordance with results on released N -glycans by MALDI-TOF/TOF-MS/MS. The comprehensive characterization of C1-Inh glycosylation described in this study will form the basis for further functional studies on the role of these glycan modifications. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Antibacterial and antagonistic activity of selected traditional ...

    African Journals Online (AJOL)

    S.pneumonia was found to be the most susceptible bacteria for the methanol extract of the root of Ricinus communis with inhibition zones of 20mm and MIC of 25 mg/mL. However; S.tphyrium was the most resistant to all extracts of the selected plants with no inh bition zone. The methanol extracts of all plants were most ...

  1. Polymorphisms in Isoniazid and Prothionamide Resistance Genes of the Mycobacterium tuberculosis Complex

    KAUST Repository

    Projahn, M.


    Sequence analyses of 74 strains that encompassed major phylogenetic lineages of the Mycobacterium tuberculosis complex revealed 10 polymorphisms in mshA (Rv0486) and four polymorphisms in inhA (Rv1484) that were not responsible for isoniazid or prothionamide resistance. Instead, some of these mutations were phylogenetically informative. This genetic diversity must be taken into consideration for drug development and for the design of molecular tests for drug resistance.

  2. Rituximab therapy in a patient with low grade B-cell lymphoproliferative disease and concomitant acquired angioedema

    Directory of Open Access Journals (Sweden)

    Kaur R


    Full Text Available Ravdeep Kaur, Aerik Anthony Williams, Catherine Baker Swift, Jason W Caldwell Wake Forest University School of Medicine, Wake Forest University, Winston-Salem, NC, USA Abstract: Acquired angioedema is often associated with significant morbidity. An underlying lymphatic malignancy, autoimmune disorder, adenocarcinoma, or other malignancy may be present. Screening for these disorders should occur in all patients with acquired angioedema as treatment may result in resolution of angioedema. Keywords: complement, C1-INH deficiency, ecallantide, hemopathy

  3. Non-Topotactic Transformation of Silicate Nanolayers into Mesostructured MFI Zeolite Frameworks During Crystallization. (United States)

    Berkson, Zachariah J; Messinger, Robert J; Na, Kyungsu; Seo, Yongbeom; Ryoo, Ryong; Chmelka, Bradley F


    Mesostructured MFI zeolite nanosheets are established to crystallize non-topotactically through a nanolayered silicate intermediate during hydrothermal synthesis. Solid-state 2D NMR analyses, with sensitivity enhanced by dynamic nuclear polarization (DNP), provide direct evidence of shared covalent 29 Si-O- 29 Si bonds between intermediate nanolayered silicate moieties and the crystallizing MFI zeolite nanosheet framework. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Development of mannose functionalized dendrimeric nanoparticles for targeted delivery to macrophages: use of this platform to modulate atherosclerosis. (United States)

    He, Hongliang; Yuan, Quan; Bie, Jinghua; Wallace, Ryan L; Yannie, Paul J; Wang, Jing; Lancina, Michael G; Zolotarskaya, Olga Yu; Korzun, William; Yang, Hu; Ghosh, Shobha


    Dysfunctional macrophages underlie the development of several diseases including atherosclerosis where accumulation of cholesteryl esters and persistent inflammation are 2 of the critical macrophage processes that regulate the progression as well as stability of atherosclerotic plaques. Ligand-dependent activation of liver-x-receptor (LXR) not only enhances mobilization of stored cholesteryl ester but also exerts anti-inflammatory effects mediated via trans-repression of proinflammatory transcription factor nuclear factor kappa B. However, increased hepatic lipogenesis by systemic administration of LXR ligands (LXR-L) has precluded their therapeutic use. The objective of the present study was to devise a strategy to selectively deliver LXR-L to atherosclerotic plaque-associated macrophages while limiting hepatic uptake. Mannose-functionalized dendrimeric nanoparticles (mDNP) were synthesized to facilitate active uptake via the mannose receptor expressed exclusively by macrophages using polyamidoamine dendrimer. Terminal amine groups were used to conjugate mannose and LXR-L T091317 via polyethylene glycol spacers. mDNP-LXR-L was effectively taken up by macrophages (and not by hepatocytes), increased expression of LXR target genes (ABCA1/ABCG1), and enhanced cholesterol efflux. When administered intravenously to LDLR-/- mice with established plaques, significant accumulation of fluorescently labeled mDNP-LXR-L was seen in atherosclerotic plaque-associated macrophages. Four weekly injections of mDNP-LXR-L led to significant reduction in atherosclerotic plaque progression, plaque necrosis, and plaque inflammation as assessed by expression of nuclear factor kappa B target gene matrix metalloproteinase 9; no increase in hepatic lipogenic genes or plasma lipids was observed. These studies validate the development of a macrophage-specific delivery platform for the delivery of anti-atherosclerotic agents directly to the plaque-associated macrophages to attenuate plaque

  5. Degradation of 2,4-dinitrophenol using a combination of hydrodynamic cavitation, chemical and advanced oxidation processes. (United States)

    Bagal, Manisha V; Gogate, Parag R


    In the present work, degradation of 2,4-dinitrophenol (DNP), a persistent organic contaminant with high toxicity and very low biodegradability has been investigated using combination of hydrodynamic cavitation (HC) and chemical/advanced oxidation. The cavitating conditions have been generated using orifice plate as a cavitating device. Initially, the optimization of basic operating parameters have been done by performing experiments over varying inlet pressure (over the range of 3-6 bar), temperature (30 °C, 35 °C and 40 °C) and solution pH (over the range of 3-11). Subsequently, combined treatment strategies have been investigated for process intensification of the degradation process. The effect of HC combined with chemical oxidation processes such as hydrogen peroxide (HC/H2O2), ferrous activated persulfate (HC/Na2S2O8/FeSO4) and HC coupled with advanced oxidation processes such as conventional Fenton (HC/FeSO4/H2O2), advanced Fenton (HC/Fe/H2O2) and Fenton-like process (HC/CuO/H2O2) on the extent of degradation of DNP have also been investigated at optimized conditions of pH 4, temperature of 35 °C and inlet pressure of 4 bar. Kinetic study revealed that degradation of DNP fitted first order kinetics for all the approaches under investigation. Complete degradation with maximum rate of DNP degradation has been observed for the combined HC/Fenton process. The energy consumption analysis for hydrodynamic cavitation based process has been done on the basis of cavitational yield. Degradation intermediates have also been identified and quantified in the current work. The synergistic index calculated for all the combined processes indicates HC/Fenton process is more feasible than the combination of HC with other Fenton like processes. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Kinetics of neptunim(6) reduction by hydroxylamine in chloric acid solutions

    International Nuclear Information System (INIS)

    Shilov, V.P.; Stepanova, E.S.; Krot, N.N.


    Stoichiometry and kinetics of neptunium (6) reaction with hydroxylamine is studied by spectrophotometric method at the ionic strength equal to unity and at 20-30 deg C. The reaction obeys the equation: -d[Np(6)]/dt = k 0 [Np(6)][NH 3 OH + ]/[H + ]sup(0.74), where k 0 = 2.6 M -1 min -1 at 25 deg C. Possible mechanism of the process includes two steps

  7. Evaluation of Baffle Fixes Film up Flow Sludge Blanket Filtration (BFUSBF) System in Treatment of Wastewaters from Phenol and 2,4-Dinitrophenol Using Daphnia Magna Bioassay


    Mohammad Javad Ghannadzadeh; Ahmad Jonidi Jafari; Abbas Rezaee; Fatemeh Eftekharian; Ali Koolivand


    Background: Phenol and nitrophenol are common compounds found in different types of industrial wastewater known as serious threats to human health and natural environment. In this study, Daphnia magna was used to evaluate the effectiveness of "baffle fixes film up flow sludge blanket filtration" (BFUSBF) system in elimination of phenolic compounds from water. Methods: D. magna cultures were used as toxicity index of phenol and 2,4-DNP mixtures after treatment by a pilot BFUSBF system which...

  8. Rational Design of Therapeutic and Diagnostic Against Botulinum Neurotoxin (United States)


    induced fluorescence Da, kDa Dalton, Kilodalton DMPS 2, 3-dimercaptopropanesulfonate DMSO Dimethylsulfoxide Dnp 2, 4-dinitrophenol DRDC Defence...high performance liquid chromatography electrospray ionization mass spectrometry (HPLC-ESI-MS) experiment. H1R3 was dissolved in 10% DMSO / 0.1...separation of peptides. A linear solvent gradient was used in the HPLC separation at an initial condition of 5% acetonitrile in 0.1% TFA/water, up to

  9. Tunable 13C/1H dual channel matching circuit for dynamic nuclear polarization system with cross-polarization

    DEFF Research Database (Denmark)

    Rybalko, Oleksandr; Bowen, Sean; Zhurbenko, Vitaliy


    In this paper we report initial results of design and practical implementation of tuning and matching circuit to estimate a performance of Dynamic Nuclear Polarization (DNP) at a magnetic field of 6.7 T. It is shown that developed circuit for signal observation is compact, easy to make and provides....... Measurement results with a tuning and matching circuit prototype are presented including obtained spectra (13C and 1H) and estimation of the signal-to-noise ratio....

  10. Risk for Sporadic Breast Cancer in Ataxia Telangiectasia Heterozygotes (United States)


    cervix , kidney and colon cancer ) and 1 large benign ovarian tumour (serous cystadenoma), DNp73 was specifically upregulated 3 to 78-fold in 10...solos, alliances and feuds among family members. This article is in press in Biochimica and Biophysica Acta Reviews on Cancer . Appendix: manuscript...role in carcinogenesis, no related genes were known for HPV -mediated cancers (23). However, the adenovirus E4orf6 20 years. In 1997, two novel family

  11. Prion Replication Elicits Cytopathic Changes in Differentiated Neurosphere Cultures (United States)

    Iwamaru, Yoshifumi; Takenouchi, Takato; Imamura, Morikazu; Shimizu, Yoshihisa; Miyazawa, Kohtaro; Mohri, Shirou; Yokoyama, Takashi


    The molecular mechanisms of prion-induced cytotoxicity remain largely obscure. Currently, only a few cell culture models have exhibited the cytopathic changes associated with prion infection. In this study, we introduced a cell culture model based on differentiated neurosphere cultures isolated from the brains of neonatal prion protein (PrP)-null mice and transgenic mice expressing murine PrP (dNP0 and dNP20 cultures). Upon exposure to mouse Chandler prions, dNP20 cultures supported the de novo formation of abnormal PrP and the resulting infectivity, as assessed by bioassays. Furthermore, this culture was susceptible to various prion strains, including mouse-adapted scrapie, bovine spongiform encephalopathy, and Gerstmann-Sträussler-Scheinker syndrome prions. Importantly, a subset of the cells in the infected culture that was mainly composed of astrocyte lineage cells consistently displayed late-occurring, progressive signs of cytotoxicity as evidenced by morphological alterations, decreased cell viability, and increased lactate dehydrogenase release. These signs of cytotoxicity were not observed in infected dNP0 cultures, suggesting the requirement of endogenous PrP expression for prion-induced cytotoxicity. Degenerated cells positive for glial fibrillary acidic protein accumulated abnormal PrP and exhibited features of apoptotic death as assessed by active caspase-3 and terminal deoxynucleotidyltransferase nick-end staining. Furthermore, caspase inhibition provided partial protection from prion-mediated cell death. These results suggest that differentiated neurosphere cultures can provide an in vitro bioassay for mouse prions and permit the study of the molecular basis for prion-induced cytotoxicity at the cellular level. PMID:23740992

  12. Restoring penis sensation in patients with low spinal cord lesions: the role of the remaining function of the dorsal nerve in a unilateral or bilateral TOMAX procedure. (United States)

    Overgoor, Max L E; Braakhekke, Jan P; Kon, Moshe; De Jong, Tom P V M


    The recently developed TOMAX-procedure restores unilateral genital sensation, improving sexual health in men with a low spinal lesion (LSL). It connects one dorsal nerve of the penis (DNP) to the intact ipsilateral ilioinguinal nerve. We proposed bilateral neurotization for full sensation of the glans but this entails cutting both DNPs, risking patients' erection/ejaculation ability. The objective was to select patients for a bilateral TOMAX-procedure by measuring remaining DNP function, and perform the first bilateral cases. In 30 LSL patients with no penile- but normal groin sensation selected for a unilateral TOMAX-procedure the integrity of the sacral-reflex-arc and DNP function was tested pre-operatively using bilateral needle electromyography (EMG)-bulbocavernosus reflex (BCR) measurements, and an interview about reflex erections (RE) ability. In 13 spina bifida- and 17 spinal cord injury patients [median age 29.5 years (range 13-59 years), spinal lesion T12 (incomplete) to sacral], seven (23%) patients reported RE, four (57%) with intact BCR, and of nine (30%) patients with intact BCR, four reported RE (44%). Even patients with a LSL and no penile sensation can have signs of remaining DNP function, but cutting both DNPs to restore full glans sensation in a bilateral TOMAX-procedure might interfere with their RE/ejaculation. To avoid this risk, we propose a selecting-protocol for a unilateral- or bilateral procedure using RE and BCR measurements. Using this protocol, three patients were bilaterally operated with promising preliminary results. Full sensation of the glans could lead to further improvement in sexual function. © 2014 Wiley Periodicals, Inc.

  13. Genetic analysis of sunflower chlorophyll mutants

    International Nuclear Information System (INIS)

    Mashkina, E.V.; Guskov, E.P.


    The method of getting the chlorophyll mutations in sunflower was developed by Y.D. Beletskii in 1969 with the use of N-nitroso-N-methylurea (NMH). Certain concentrations of NMH are known to induce plastid mutations in growing seeds, and their yield depends on the duration of the exposure. The given work presented studies on the influence of rifampicin (R) and 2,4-dinitrophenol (DNP) on the genetic activity NMH, as an inductor of plastid and nuclear mutations

  14. Using Standardized Patients to Teach Interprofessional Competencies to Dental Students. (United States)

    Anders, Patrick L; Scherer, Yvonne Krall; Hatton, Michael; Antonson, Donald; Austin-Ketch, Tammy; Campbell-Heider, Nancy


    The aims of this study were to develop, implement, and evaluate a novel interprofessional standardized patient exercise (ISPE) with oral-systemic and interprofessional collaborative practice (IPCP) components. Dental students and doctor of nursing practice (DNP) students at one U.S. university participated in the simulation, which was primarily designed to test their teamwork skills. In spring 2014, DNP students worked in the dental clinics with dental students under the supervision of nursing and dental faculty members. To test the teamwork outcomes for both groups of students, a standardized patient (SP) scenario was designed to include multiple chronic medical diagnoses and an oral-systemic component. The exercise was filmed for later review. Outcomes measures included SP and student self-evaluations and faculty evaluation of student documentation. The primary outcome of interest from a dental standpoint was faculty evaluation of IPCP competencies derived from the Core Competencies of Interprofessional Collaborative Practice and were deemed to be observable by faculty when viewing the videotaped scenario. Eight teams of students participated with an SP trained in the scenario. Each team consisted of a DNP student, a fourth-year dental student, and a second-year dental student. All eligible students in the DNP class (n=20) and eight students from each dental class (approximately 110 each) participated. The results showed that the teams scored highest on the role/responsibilities subscale, indicating students were respectful of each other's roles and expertise and effectively engaged each other to develop strategies to meet the patient's needs. Scores on the three other subscales (values/ethics, interprofessional communication, and teams/teamwork) were also high. These findings appeared to support IPCP as a method to foster knowledge and respect for other roles and responsibilities, improve appreciation of teamwork, and encourage better communication among health

  15. Developing an Acquisition Strategy for the Colombian Navy’s New Strategic Surface Ships (United States)


    37 Departamento Nacional de Planeacion (2006), “Visión Colombia II Centenario: 2019.” Retrieved 14 May 2007 from http...40 Jefatura Oficina Planeacion A.R.C. (July 2006), Plan de Desarrollo 2007–2010, conference presented at Dirección General Marítima, Bogota...Departamento Nacional de Planeacion (2006). “Visión Colombia II Centenario: 2019”. Retrieved 14 May 2007 from

  16. High-field Overhauser dynamic nuclear polarization in silicon below the metal-insulator transition. (United States)

    Dementyev, Anatoly E; Cory, David G; Ramanathan, Chandrasekhar


    Single crystal silicon is an excellent system to explore dynamic nuclear polarization (DNP), as it exhibits a continuum of properties from metallic to insulating as a function of doping concentration and temperature. At low doping concentrations DNP has been observed to occur via the solid effect, while at very high-doping concentrations an Overhauser mechanism is responsible. Here we report the hyperpolarization of (29)Si in n-doped silicon crystals, with doping concentrations in the range of (1-3) × 10(17) cm(-3). In this regime exchange interactions between donors become extremely important. The sign of the enhancement in our experiments and its frequency dependence suggest that the (29)Si spins are directly polarized by donor electrons via an Overhauser mechanism within exchange-coupled donor clusters. The exchange interaction between donors only needs to be larger than the silicon hyperfine interaction (typically much smaller than the donor hyperfine coupling) to enable this Overhauser mechanism. Nuclear polarization enhancement is observed for a range of donor clusters in which the exchange energy is comparable to the donor hyperfine interaction. The DNP dynamics are characterized by a single exponential time constant that depends on the microwave power, indicating that the Overhauser mechanism is a rate-limiting step. Since only about 2% of the silicon nuclei are located within 1 Bohr radius of the donor electron, nuclear spin diffusion is important in transferring the polarization to all the spins. However, the spin-diffusion time is much shorter than the Overhauser time due to the relatively weak silicon hyperfine coupling strength. In a 2.35 T magnetic field at 1.1 K, we observed a DNP enhancement of 244 ± 84 resulting in a silicon polarization of 10.4 ± 3.4% following 2 h of microwave irradiation.

  17. A Secure, Intelligent, and Smart-Sensing Approach for Industrial System Automation and Transmission over Unsecured Wireless Networks. (United States)

    Shahzad, Aamir; Lee, Malrey; Xiong, Neal Naixue; Jeong, Gisung; Lee, Young-Keun; Choi, Jae-Young; Mahesar, Abdul Wheed; Ahmad, Iftikhar


    In Industrial systems, Supervisory control and data acquisition (SCADA) system, the pseudo-transport layer of the distributed network protocol (DNP3) performs the functions of the transport layer and network layer of the open systems interconnection (OSI) model. This study used a simulation design of water pumping system, in-which the network nodes are directly and wirelessly connected with sensors, and are monitored by the main controller, as part of the wireless SCADA system. This study also intends to focus on the security issues inherent in the pseudo-transport layer of the DNP3 protocol. During disassembly and reassembling processes, the pseudo-transport layer keeps track of the bytes sequence. However, no mechanism is available that can verify the message or maintain the integrity of the bytes in the bytes received/transmitted from/to the data link layer or in the send/respond from the main controller/sensors. To properly and sequentially keep track of the bytes, a mechanism is required that can perform verification while bytes are received/transmitted from/to the lower layer of the DNP3 protocol or the send/respond to/from field sensors. For security and byte verification purposes, a mechanism needs to be proposed for the pseudo-transport layer, by employing cryptography algorithm. A dynamic choice security buffer (SB) is designed and employed during the security development. To achieve the desired goals of the proposed study, a pseudo-transport layer stack model is designed using the DNP3 protocol open library and the security is deployed and tested, without changing the original design.

  18. A Secure, Intelligent, and Smart-Sensing Approach for Industrial System Automation and Transmission over Unsecured Wireless Networks (United States)

    Shahzad, Aamir; Lee, Malrey; Xiong, Neal Naixue; Jeong, Gisung; Lee, Young-Keun; Choi, Jae-Young; Mahesar, Abdul Wheed; Ahmad, Iftikhar


    In Industrial systems, Supervisory control and data acquisition (SCADA) system, the pseudo-transport layer of the distributed network protocol (DNP3) performs the functions of the transport layer and network layer of the open systems interconnection (OSI) model. This study used a simulation design of water pumping system, in-which the network nodes are directly and wirelessly connected with sensors, and are monitored by the main controller, as part of the wireless SCADA system. This study also intends to focus on the security issues inherent in the pseudo-transport layer of the DNP3 protocol. During disassembly and reassembling processes, the pseudo-transport layer keeps track of the bytes sequence. However, no mechanism is available that can verify the message or maintain the integrity of the bytes in the bytes received/transmitted from/to the data link layer or in the send/respond from the main controller/sensors. To properly and sequentially keep track of the bytes, a mechanism is required that can perform verification while bytes are received/transmitted from/to the lower layer of the DNP3 protocol or the send/respond to/from field sensors. For security and byte verification purposes, a mechanism needs to be proposed for the pseudo-transport layer, by employing cryptography algorithm. A dynamic choice security buffer (SB) is designed and employed during the security development. To achieve the desired goals of the proposed study, a pseudo-transport layer stack model is designed using the DNP3 protocol open library and the security is deployed and tested, without changing the original design. PMID:26950129

  19. A Secure, Intelligent, and Smart-Sensing Approach for Industrial System Automation and Transmission over Unsecured Wireless Networks

    Directory of Open Access Journals (Sweden)

    Aamir Shahzad


    Full Text Available In Industrial systems, Supervisory control and data acquisition (SCADA system, the pseudo-transport layer of the distributed network protocol (DNP3 performs the functions of the transport layer and network layer of the open systems interconnection (OSI model. This study used a simulation design of water pumping system, in-which the network nodes are directly and wirelessly connected with sensors, and are monitored by the main controller, as part of the wireless SCADA system. This study also intends to focus on the security issues inherent in the pseudo-transport layer of the DNP3 protocol. During disassembly and reassembling processes, the pseudo-transport layer keeps track of the bytes sequence. However, no mechanism is available that can verify the message or maintain the integrity of the bytes in the bytes received/transmitted from/to the data link layer or in the send/respond from the main controller/sensors. To properly and sequentially keep track of the bytes, a mechanism is required that can perform verification while bytes are received/transmitted from/to the lower layer of the DNP3 protocol or the send/respond to/from field sensors. For security and byte verification purposes, a mechanism needs to be proposed for the pseudo-transport layer, by employing cryptography algorithm. A dynamic choice security buffer (SB is designed and employed during the security development. To achieve the desired goals of the proposed study, a pseudo-transport layer stack model is designed using the DNP3 protocol open library and the security is deployed and tested, without changing the original design.

  20. Experience of Soviet Medicine in a Great Patriotic War 1941-1945. Part 2 (Opyt Sovetskoy Meditsimy v Velikoy Otechestvennoy Voyne 1941-1945), (United States)


    splints. First of all gave grounds to suspect break anamnesis and complaints of casualty. Anamsesis was always short: felt the strong blow into the hand...stage consisted of the rendering to the necessary aid and the rapid evacuation of casualty on DNP. Diagnosis was placed on the basis of anamnesis and... anamnesis , assembled in further stages, this gap/spacing was completed with the indication of Iccal anesthetization. The primary surgical prccessing of

  1. Produção de álcoois superiores por linhagens de Saccharomyces durante a fermentação alcoólica Production of higher alcohols by Saccharomyces strains during alcoholic fermentation

    Directory of Open Access Journals (Sweden)

    L.E. Gutierrez


    Full Text Available A produção de álcoois superiores pelas leveduras Saccharomyces cerevisiae M-300-A, Saccharomyces uvarum IZ-1904 e levedura de panificação (Saccharomyces cerevisiae foi estudada em diversas condições de temperatura, concentração de sacarose, pH, fontes de nitrogênio e com inibidor 2-4 dinitrofenol (DNP. Em todas as condições estudadas, a levedura Saccharomyces uvarum IZ-1904 apresentou a menor formação de álcoois superiores enquanto a levedura de panifícação apresentou os teores mais elevados. Com o aumento de temperatura e da concentração de sacarose ocorreu maior formação de álcool isoamílico pelas leveduras estudadas. Em pH 4,5 ocorreu menor produção de álcoois superiores do que em pH 3,0. Na presença do inibidor DNP ocorreu significativa redução (pThe production of higher alcohols by Saccharomyces cerevisiae M-300-A, Saccharomyces uvarum IZ-1904 and baker's yeast (5. cerevisiae was studied under several temperature conditions, sucrose level, pH, nitrogen sources and with 2-4 dinitrophenol (DNP. The yeast IZ-1904 showed lower production of higher alcohols than other yeasts in all conditions studied. With the increase of temperature and higher level of sucrose an increase of isoamyl alcohol production was observed. A lower formation of higher alcohols was observed at pH 4.5 than at pH 3.0. With the addition of DNP occurred a significant reduction in isoamyl alcohol content. The yeasts did not show the sanie production of higher alcohols in relation to urea and ammonium sulfate.

  2. Physical Mechanism of the Lower-Hybrid-Drift Instability in a Collisional Plasma. (United States)


    8217 70Q SaCE .A-.D A> AT TN R~~ . WIL.IAMRS 01CI " CUT% 755O -řA ol2’ 4’TN E_."D-NP F. WIMItNITZ 01:y A’ ’N. LOGE 02CY ATTN D’E_,D).p C. MOAZED 0:2’ All% c


    Directory of Open Access Journals (Sweden)

    G. B. Lazzarotto


    Full Text Available This work presents a game like educational software (courseware to study metabolic pathways, calledDiagrama Metabolico Din^amico Virtual (DMDV of Krebs Cycle. The experience acquired teachingwith the logical sequence tray games in the FFFCMPAs Biochemistry Course provides the beddingswith the use of this model as education method. With DMDV, students can assembly the sequenceof reactions that describe the desired metabolic pathway, create situational models which can guidehis/her choices, reduce the subject complexity of the scheme in knowledge construction presentingin a graphical way the current interrelations. Biochemistry teachers can use the present software inclassroom as well as distance classes. This product integrates multimedia resources extensively andis distributed in CD-ROM format. The virtual environment will make possible interaction of thestudent with the environment and with colleagues and teachers, through tools as chats and forum.Experience with the use of this method was carried through with two distinct groups of students.The rst group was composed by 11 students, who were more familiar with the content and answereda specic questionnaire to previously evaluate the software. The second group was formed by 24students regularly registered in the FFFCMPAs Biochemistry Course, who used the software as astudy method. The rst group considered DMDV of easy and pleasant navigation. The knowledgeevaluation of the second group students was made by a written test and the analysis of three conceptualmaps constructed by each one of them: one map before initiating the study with the DMDV, thesecond just after the study and the third one two months later. Every conceptual maps producedafter DMDV method showed an expansion of valid concepts if compared with the rst maps. Simplevisual comparison of maps shows that new elements where added. All students who passed throughthe experiment reached a greater than ve grade in the subjects written

  4. Poblaciones microbianas ruminales en novillas alimentadas con Leucaena leucocephala en el Bosque Seco Tropical colombiano.

    Directory of Open Access Journals (Sweden)

    Erika Angarita


    Full Text Available La fermentación y metanogénesis ruminal son procesos metabolicos vitales para los bovinos y son llevados a cabo por poblaciones microbianas, las cuales se afectan por factores como la presencia de metabolitos secundarios, la composición nutricional y la degradabilidad de la dieta. El objetivo de este trabajo fue monitorear las poblaciones de bacterias totales, metanógenos totales y Butirivibrio fibrisolvens en el rumen de novillas raza Lucerna, alimentadas con dietas típicas de un sistema silvopastoril intensivo y un sistema tradicional. Para ello, se colectó contenido ruminal (CR por vía oral a ocho novillas que consumían 100% Cynodon plectostachyus (control y 76% C. plectostachyus + 24% Leucaena leucocephala siguiendo un diseño de sobre-cambio. A partir del CR se extrajo y cuantificó ADN mediante PCR cuantitativa. Las poblaciones [Log10 (ng/g CR] fueron 5.6 y 5.8 para bacterias totales (P= 0.5343, 3.6 y 3.5 para B. fibrisolvens (P= 0.4742, y 5.0 y 5.3 para metanógenos totales (P= 0.2661, para la dieta control y la dieta con leucaena respectivamente. Las poblaciones monitoreadas cuantitativamente no difirieron de manera significativa con la inclusión de L. leucocephala. Esto indica la importancia de investigar la estructura, función e interacciones de las poblaciones más allá del análisis cuantitativo para determinar cómo la dieta afecta las poblaciones microbianas ruminales y su función.

  5. Development of a three component complex to increase isoniazid efficacy against isoniazid resistant and nonresistant Mycobacterium tuberculosis. (United States)

    Manning, Thomas; Plummer, Sydney; Baker, Tess; Wylie, Greg; Clingenpeel, Amy C; Phillips, Dennis


    The bacterium responsible for causing tuberculosis has evolved resistance to antibiotics used to treat the disease, resulting in new multidrug resistant Mycobacterium tuberculosis (MDR-TB) and extensively drug resistant M. tuberculosis (XDR-TB) strains. Analytical techniques (1)H and (13)C Nuclear Magnetic Resonance (NMR), Fourier Transform-Ion Cyclotron Resonance with Electrospray Ionization (FT-ICR/ESI), and Matrix Assisted Laser Desorption Ionization-Mass Spectrometry (MALDI-TOF-MS) were used to study different aspects of the Cu(II)-polyethylene glycol (PEG-3350)-sucrose-isoniazid and Cu(II)-polyethylene glycol (PEG3350)-glucose-isoniazid complexes. The Cu(II) cation, sucrose or glucose, and the aggregate formed by PEG primarily serve as a composite drug delivery agent for the frontline antibiotic, however the improvement in MIC values produced with the CU-PEG-SUC-INH complex suggest an additional effect. Several Cu-PEG-SUC-INH complex variations were tested against INH resistant and nonresistant strains of M. tuberculosis. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. [The outpatient use of beta lactam antibiotics in Montenegro before the introduction of new reform strategy on drug market]. (United States)

    Duborija-Kovacević, Natasa


    The study represents the first investigation of outpatient use of beta lactam antibiotics in Montenegro carried out in accordance with internationally approved methodology (DDD/ATC). The objective of our study was to establish both the scope and overall use of beta lactam antibiotics, and to assess their compatibility with current pharmacotherapeutic guidelines and their use in developed countries. The retrospective pharmaco-epidemiological study comprised a 100%-sample of beta lactams that were used in the period prior to introduction of new reform strategy on drug market. Beta lactam antibiotics (J01C, J01D) were the most frequently applied anti-infectives for systemic use (ATC group J) in 2000 (11.3 DDD/1000 inh./day, 61%). Penicillins (J01C) were the most utilized (8.0 DDD/1000 inh./day, 71%). Cephalosporin derivatives (cephalexin and cefaclor) accounted for the remaining 29% (3.3 DDD/1000 inh./day). Aminopenicillins were prevailing among penicillins (85%). Beta lactamase sensitive penicillins were in the second place and approximately accounted for 14%. The results of our study showed that the use of beta lactam antibacterials could be estimated as partially satisfactory. There is a need to make additional efforts with a view of further rationalization.

  7. Preparation and characterization of isoniazid-loaded crude soybean lecithin liposomes. (United States)

    Nkanga, Christian Isalomboto; Krause, Rui Werner; Noundou, Xavier Siwe; Walker, Roderick Bryan


    Tuberculosis (TB) is a poverty related infectious disease that is rapidly giving rise to public health concerns. Lengthy drug administration and frequent adverse side-effects associated with TB treatment make anti-tubercular drugs (ATDs) good candidates for drug delivery studies. This work aimed to formulate and prepare liposomes as a cost-effective option for ATD delivery. Liposomes were prepared by film hydration using crude soybean lecithin (CL) and not pure phospholipids as in the normal practice. Cholesterol was also used (up to 25% mass ratio), and isoniazid (INH) was encapsulated as model drug using a freeze-thaw loading technique. Purified soybean lecithin (PL) was also used for comparative purposes, under the same conditions. INH-loaded liposomes were characterized for particle size, Zeta Potential (ZP), encapsulation efficiency (EE) and drug release. Physicochemical properties were investigated using thermogravimetric analysis, differential scanning calorimetry, X-ray diffraction and Fourier transform infrared. INH-loaded CL-based liposomes showed high EE (79±2.45%). The average particle size (813.00±9.21nm) and ZP (-42.80±4.31mV) of this formulation are promising for the treatment of TB by pulmonary delivery. These findings suggest the possibility of encapsulating ATDs in liposomes made of crude soybean lecithin that is cheap and readily available. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Assessment of bioequivalence of rifampicin, isoniazid and pyrazinamide in a four drug fixed dose combination with separate formulations at the same dose levels. (United States)

    Agrawal, Shrutidevi; Kaur, Kanwal Jit; Singh, Inderjit; Bhade, Shantaram R; Kaul, Chaman Lal; Panchagnula, Ramesh


    Tuberculosis (TB) needs treatment with three to five different drugs simultaneously, depending on the patient category. These drugs can be given as single drug preparations or fixed dose combinations (FDCs) of two more drugs in a single formulation. World Health Organization and International Union against Tuberculosis and Lung Disease (IUATLD) recommend FDCs only of proven bioavailability. The relative bioavailability of rifampicin (RIF), isoniazid (INH) and pyrazinamide (PYZ) was assessed on a group of 13 healthy male subjects from a four drug FDC versus separate formulations at the same dose levels. The study was designed to be an open, crossover experiment. A total of nine blood samples each of 3 ml volume were collected over a period of 24-h. The concentrations of RIF, its main metabolite desacetyl RIF (DRIF), INH and PYZ in plasma were assessed by HPLC analysis. Pharmacokinetic parameters namely AUC(0-24), AUC(0-inf), C(max), T(max), were calculated and subjected to different statistical tests (Hauschke analysis, two way ANOVA, normal and log transformed confidence interval) at 90% confidence interval. In addition, elimination rate constant (K(el)) and absorption efficiencies for each drug were also calculated. It was concluded that four drugs FDC tablet is bioequivalent for RIF, INH and PYZ to separate formulation at the same dose levels.

  9. Development and Validation of an HPLC Method for Simultaneous Determination of Rifampicin, Isoniazid, Pyrazinamide, and Ethambutol Hydrochloride in Pharmaceutical Formulations. (United States)

    Chellini, Paula R; Lages, Eduardo B; Franco, Pedro H C; Nogueira, Fernando H A; César, Isabela C; Pianetti, Gerson A


    Tuberculosis treatment consists of a fixed dose combination of rifampicin (RIF), isoniazid (INH), pyrazinamide (PYZ), and ethambutol hydrochloride (EMB). The combined treatment using various drugs is necessary for patient curing, without recrudescence, and for prevention of drug-resistant mutants, which may occur during treatment. An HPLC-diode array detector (DAD) method for the simultaneous determination of RIF, INH, PYZ, and EMB in fixed dose combination tablets was developed and validated. Chromatographic experiments were performed on an Agilent 1200 HPLC system, and the separation was carried out on a Purospher STAR RP18e (250×4.6 mm id, 5 μm, Merck) analytical column. Gradient elution was carried out with a mobile phase of 20 mM monobasic sodium phosphate buffer with 0.2% triethylamine (pH 7.0) and acetonitrile at a flow rate of 1.5 mL/min. The total run time was 12 min, and the re-equilibration time was 5 min. EMB detection was performed at 210 nm, and RIF, INH, and PYZ were detected at 238 nm, using a DAD. The method proved to be specific, linear (r2>0.99), precise (RSD<2%), accurate, and robust and may be applied to the QC analysis of pharmaceutical formulations.

  10. Bioequivalence of fixed-dose combination RIN®-150 to each reference drug in loose combination. (United States)

    Wang, H F; Wang, R; O'Gorman, M; Crownover, P; Damle, B


    RIN(®)-150 is a fixed-dose combination (FDC) tablet containing rifampicin (RMP, 150 mg) and isoniazid (INH, 75 mg) developed for the treatment of tuberculosis. This study was conducted at a single center: the Pfizer Clinical Research Unit in Singapore. To demonstrate bioequivalence of each drug component between RIN-150 and individual products in a loose combination. This was a randomized, open-label, single-dose, two-way crossover study. Subjects received single doses of RIN-150 or two individual reference products under fasting conditions in a crossover fashion, with at least 7 days washout between doses. The primary measures for comparison were peak plasma concentration (Cmax) and the area under plasma concentration-time curve (AUC). Of 28 subjects enrolled, 26 completed the study. The adjusted geometric mean ratios of Cmax and AUClast between the FDC and single-drug references and 90% confidence intervals were respectively 91.63% (90%CI 83.13-101.01) and 95.45% (90%CI 92.07-98.94) for RMP, and 107.58% (90%CI 96.07-120.47) and 103.45% (90%CI 99.33-107.75) for INH. Both formulations were generally well tolerated in this study. The RIN-150 FDC tablet formulation is bioequivalent to the two single-drug references for RMP and INH at equivalent doses.

  11. Electrocatalytic Determination of Isoniazid by a Glassy Carbon Electrode Modified with Poly (Eriochrome Black T

    Directory of Open Access Journals (Sweden)

    Karim Asadpour-Zeynali


    Full Text Available In this work poly eriochrome black T (EBT was electrochemically synthesized on the glassy carbon electrode as electrode modifier. On the modified electrode, voltammetric behavior of isoniazid (INH was investigated. The poly (EBT-modified glassy carbon electrode has excellent electrocatalytic ability for the electrooxidation of isoniazid. This fact was appeared as a reduced overpotential of INH oxidation in a wide operational pH range from 2 to 13. It has been found that the catalytic peak current depends on the concentration of INH and solution pH. The number of electrons involved in the rate determining step was found 1. The diffusion coefficient of isoniazid was also estimated using chronoamperometry technique. The experimental results showed that the mediated oxidation peak current of isoniazid is linearly dependent on the concentration of isoniazid in the ranges of 8.0 × 10-6 – 1.18 × 10-3 M and 2.90 × 10-5 M – 1.67× 10-3 M with differential pulse voltammetry (DPV and amperometry methods, respectively. The detection limits (S/N = 3 were found to be 6.0 μM and 16.4 μM by DPV and amperometry methods, respectively. This developed method was applied to the determination of isoniazid in tablet samples with satisfactory results.

  12. Crosslinked electrospun PVA nanofibrous membranes: elucidation of their physicochemical, physicomechanical and molecular disposition

    International Nuclear Information System (INIS)

    Shaikh, Rubina P; Kumar, Pradeep; Choonara, Yahya E; Du Toit, Lisa C; Pillay, Viness


    The effects of modifying electrospun poly(vinyl alcohol) (PVA) nanofibers through crosslinking using glutaraldehyde (GA) are explored in this paper. Various concentrations of PVA solutions containing model drugs rifampicin (RIF) and isoniazid (INH) were electrospun and thereafter crosslinked using GA vapors. PVA nanofibers demonstrated high drug entrapment efficiency of 98.77% ± 1.384% and 95.07% ± 1.988% for the INH- and RIF-loaded PVA nanofibers, respectively. The surface morphology, molecular vibrational transitions, tensile attributes and in vitro drug release were characterized and supported by in silico molecular mechanics simulations. Results indicated that crosslinking caused a significant reduction in the rate of drug release where 81.11% ± 2.35% of INH and 59.31% ± 2.57% of RIF were released after 12 h. Tensile properties such as the ultimate strength and Young's modulus increased after crosslinking, caused by crosslinks forming between PVA nanofibers as was revealed through scanning electron microscopy analysis. Fourier Transform infrared analysis was conducted to further support the mode of crosslinking. Additionally, image processing analysis was carried out to quantify the effect of formulation variables on the morphology of nanofibers. Furthermore, the effect of GA-induced crosslinking and addition of drugs on the performance of electrospun fibers was further elucidated and conceptualized using a molecular mechanics assisted model building and energy refinement approach via molecular mechanics energy relationships by exploring the spatial disposition of energy-minimized molecular structures of the polymer, crosslinker and the drugs. (paper)

  13. Drug resistance detection and mutation patterns of multidrug resistant tuberculosis strains from children in Delhi

    Directory of Open Access Journals (Sweden)

    Jyoti Arora


    Full Text Available A total of 312 sputum samples from pediatric patients presumptive of multidrug resistant tuberculosis were tested for the detection of drug resistance using the GenoTypeMTBDRplus assay. A total of 193 (61.8% patients were smear positive and 119 (38.1% were smear negative by Ziehl–Neelsen staining. Line probe assay (LPA was performed for 208 samples/cultures (193 smear positive samples and 15 cultures from smear negative samples. Valid results were obtained from 198 tests. Of these, 125/198 (63.1% were sensitive to both rifampicin (RIF and isoniazid (INH. 73/198 (36.9% were resistant to at least INH/RIF, out of which 49 (24.7% were resistant to both INH and RIF (multidrug resistant. Children with tuberculosis are often infected by someone close to them, so strengthening of contact tracing in the program may help in early diagnosis to identify additional cases within the household. There is a need to evaluate newer diagnostic assays which have a high sensitivity in the case of smear negative samples, additional samples other than sputum among young children not able to expectorate, and also to fill the gap between estimated and reported cases under the program.

  14. Proteomic Analysis of Bacillus thuringiensis Strain 4.0718 at Different Growth Phases

    Directory of Open Access Journals (Sweden)

    Xiaohui Li


    Full Text Available The growth process of Bacillus thuringiensis Bt4.0718 strain was studied using proteomic technologies. The proteins of Bt whole cells at three phases—middle vegetative, early sporulation, and late sporulation—were extracted with lysis buffer, followed with separation by 2-DE and identified by MALDI-TOF/TOF MS. Bioactive factors such as insecticidal crystal proteins (ICPs including Cry1Ac(3, Cry2Aa, and BTRX28, immune inhibitor (InhA, and InhA precursor were identified. InhA started to express at the middle vegetative phase, suggesting its contribution to the survival of Bt in the host body. At the early sporulation phase, ICPs started their expression. CotJC, OppA, ORF1, and SpoIVA related to the formation of crystals and spores were identified, the expression characteristics of which ensured the stable formation of crystals and spores. This study provides an important foundation for further exploration of the stable expression of ICPs, the smooth formation of crystals, and the construction of recombinant strains.

  15. Plasma complement biomarkers distinguish multiple sclerosis and neuromyelitis optica spectrum disorder. (United States)

    Hakobyan, Svetlana; Luppe, Sebastian; Evans, David Rs; Harding, Katharine; Loveless, Samantha; Robertson, Neil P; Morgan, B Paul


    Multiple sclerosis (MS) and neuromyelitis optica spectrum disorder (NMOSD) are autoimmune inflammatory demyelinating diseases of the central nervous system. Although distinguished by clinicoradiological and demographic features, early manifestations can be similar complicating management. Antibodies against aquaporin-4 support the diagnosis of NMOSD but are negative in some patients. Therefore, there is unmet need for biomarkers that enable early diagnosis and disease-specific intervention. We investigated whether plasma complement proteins are altered in MS and NMOSD and provide biomarkers that distinguish these diseases. Plasma from 54 NMOSD, 40 MS and 69 control donors was tested in multiplex assays measuring complement activation products and proteins. Using logistic regression, we tested whether combinations of complement analytes distinguished NMOSD from controls and MS. All activation products were elevated in NMOSD compared to either control or MS. Four complement proteins (C1inh, C1s, C5 and FH) were higher in NMOSD compared to MS or controls. A model comprising C1inh and terminal complement complex (TCC) distinguished NMOSD from MS (area under the curve (AUC): 0.98), while C1inh and C5 distinguished NMOSD from controls (AUC: 0.94). NMOSD is distinguished from MS by plasma complement biomarkers. Selected complement analytes enable differential diagnosis. Findings support trials of anti-complement therapies in NMOSD.

  16. Health-related quality of life in Danish children with hereditary angioedema

    DEFF Research Database (Denmark)

    Aabom, Anne; Nguyen, Dan; Fisker, Niels


    have considerable impact on the health-related quality of life (HRQoL) in adult patients. Half the patients with C1-INH-HAE develop symptoms before the age of 10 years. However, the HRQoL in children with C1-INH-HAE is almost unexplored. Objective: To investigate HRQoL in Danish children with C1...... were the PedsQL (Child Self-Report and Parent Proxy-Report forms); the Children's Dermatology Life Quality Index; a nonvalidated, diseasespecific quality-of-life questionnaire; and two visual analog scales that rated general health. Results: The HRQoL scores in our study were comparable with the normal...... the Parent Proxy-Report form carried the disease. Conclusion: Overall, the children assessed on average had a normal HRQoL and better than those with other common skin disorders. However, according to our findings, health care providers should be especially attentive to HRQoL when children with C1-INH...

  17. Prevalence of multidrug resistance among retreatment pulmonary tuberculosis cases in a tertiary care hospital, Hyderabad, India

    Directory of Open Access Journals (Sweden)

    Subhakar Kandi


    Full Text Available Background: India is one of the high tuberculosis (TB burden countries in the world. India ranks second in harboring multi drug resistant (MDR-TB cases. About 50,000 of MDR cases are recorded in retreatment pulmonary TB cases. This study was conducted in a tertiary care facility (Government General and Chest Hospital in Hyderabad, India. Objectives: Toassess: Proportion of the TB patients having MDR-TB at the initiation of retreatment regimen; the prevalence of isoniazid (INH resistance in this geographical area. Materials and Methods: An analytical, observational, prospective cohort study of patients attending the out-patient department from December 2010 to March 2011. Results: Sputum samples from 100 patients were subjected to acid fast bacilli (AFB culture and drug sensitivity testing. Of these, 28 (28% were MDR-TB, 42 (42% were non-MDR-TB and 39% being INH resistance. Conclusions: In conclusion, one third of the retreatment pulmonary TB cases attending a tertiary care institute for TB will be MDR-TB at the initiation of treatment and there is a need to include ethambutol in the continuation phase of new TB case treatment in view of high INH resistance.

  18. The rise of governmentality in the Italian National Health System: physiology or pathology of a decentralized and (ongoing) federalist system? (United States)

    Lega, Federico; Sargiacomo, Massimo; Ianni, Luca


    In this paper, we aim to discuss the implications and lessons that can be learnt from the ongoing process of federalism affecting the Italian National Health System (INHS). Many countries are currently taking decisions concerning the decentralization or re-centralization of their health-care systems, with several key issues that are illustrated in the recent history of the INHS. The decentralization process of INHS has produced mixed results, as some regions took advantage of it to strengthen their systems, whereas others were not capable of developing an effective steering role. We argue that the mutual reinforcement of the decentralization and recentralization processes is not paradoxical, but is actually an effective way for the State to maintain control over the equity and efficiency of its health-care system while decentralizing at a regional level. In this perspective, we provide evidence backing up some of the assumptions made in previous works as well as new food-for thought - specifically on how governmentality and federalism should meet - to reshape the debate on decentralization in health care.

  19. A new rapid colourimetric method for testing Mycobacterium tuberculosis susceptibility to isoniazid and rifampicin: a crystal violet decolourisation assay

    Directory of Open Access Journals (Sweden)

    Ahmet Yilmaz Coban


    Full Text Available The aim of this study was to investigate the performance of a new and accurate method for the detection of isoniazid (INH and rifampicin (RIF resistance among Mycobacterium tuberculosis isolates using a crystal violet decolourisation assay (CVDA. Fifty-five M. tuberculosis isolates obtained from culture stocks stored at -80ºC were tested. After bacterial inoculation, the samples were incubated at 37ºC for seven days and 100 µL of CV (25 mg/L stock solution was then added to the control and sample tubes. The tubes were incubated for an additional 24-48 h. CV (blue/purple was decolourised in the presence of bacterial growth; thus, if CV lost its colour in a sample containing a drug, the tested isolate was reported as resistant. The sensitivity, specificity, positive predictive value, negative predictive value and agreement for INH were 92.5%, 96.4%, 96.1%, 93.1% and 94.5%, respectively, and 88.8%, 100%, 100%, 94.8% and 96.3%, respectively, for RIF. The results were obtained within eight-nine days. This study shows that CVDA is an effective method to detect M. tuberculosis resistance to INH and RIF in developing countries. This method is rapid, simple and inexpensive. Nonetheless, further studies are necessary before routine laboratory implementation.

  20. Mechanisms of first-line antimicrobial resistance in multi-drug and extensively drug resistant strains of Mycobacterium tuberculosis in KwaZulu-Natal, South Africa

    Directory of Open Access Journals (Sweden)

    Navisha Dookie


    Full Text Available Abstract Background In South Africa, drug resistant tuberculosis is a major public health crisis in the face of the colossal HIV pandemic. Methods In an attempt to understand the distribution of drug resistance in our setting, we analysed the rpoB, katG, inhA, pncA and embB genes associated with resistance to key drugs used in the treatment of tuberculosis in clinical isolates of Mycobacterium tuberculosis in the KwaZulu-Natal province. Results Classical mutations were detected in the katG, inhA and embB genes associated with resistance to isoniazid and ethambutol. Diverse mutations were recorded in the multidrug resistant (MDR and extensively drug resistant (XDR isolates for the rpoB and pncA gene associated with resistance to rifampicin and pyrazinamide. Conclusions M.tuberculosis strains circulating in our setting display a combination of previously observed mutations, each mediating resistance to a different drug. The MDR and XDR TB isolates analysed in this study displayed classical mutations linked to INH and EMB resistance, whilst diverse mutations were linked to RIF and PZA resistance. The similarity of the XDR strains confirms reports of the clonality of the XDR epidemic. The successful dissemination of the drug resistant strains in the province underscores the need for rapid diagnostics to effectively diagnose drug resistance and guide treatment.

  1. Detection of multidrug-resistant tuberculosis from stored DNA Samples: A multicenter study

    Directory of Open Access Journals (Sweden)

    Marie Sylvianne Rabodoarivelo


    Full Text Available Background: In low-income countries, rapid detection of tuberculosis (TB drug resistance is often restricted by the difficulties of transporting and storing sputum samples from remote health centers to the reference laboratories where molecular tests are available. The aim of this study was to evaluate the performance of four transport and storage systems for molecular detection of rifampicin (RIF and isoniazid (INH resistance. Methods: This was a multicenter study. Molecular detection of RIF and INH resistance was performed directly from smear-positive TB sputa spotted on a slide, FTA card, GenoCard, and ethanol using the Genotype MTBDRplus assay. The performance of the DNA extraction method from each storage support to detect drug resistance was assessed by calculating their sensitivity and specificity compared to the phenotypic method. Results: From all sites, the overall sensitivity and specificity for RIF-resistance detection was 88% and 85%, respectively, for slides, 86% and 92%, respectively, for GenoCard, 87% and 89%, respectively, for FTA card, and 88% and 92%, respectively, for ethanol. For INH-resistance detection, the overall sensitivity and specificity was 82% and 90%, respectively, for slides, 85% and 96%, respectively, for GenoCard, 86% and 92%, respectively, for FTA card, and 86% and 94%, respectively, for ethanol. Conclusion: Smear slides and filter cards showed to be very useful tools to facilitate DNA extraction from sputum samples with the potential to accelerate the detection of drug resistance in remote areas.

  2. Detection of multidrug-resistant tuberculosis from stored DNA Samples: A multicenter study. (United States)

    Rabodoarivelo, Marie Sylvianne; Brandao, A; Cergole Novella, M C; C Bombonatte, A G; Imperiale, B; Rakotosamimanana, N; Morcillo, N; Rasolofo, V; Palomino, J C; Martin, A


    In low-income countries, rapid detection of tuberculosis (TB) drug resistance is often restricted by the difficulties of transporting and storing sputum samples from remote health centers to the reference laboratories where molecular tests are available. The aim of this study was to evaluate the performance of four transport and storage systems for molecular detection of rifampicin (RIF) and isoniazid (INH) resistance. This was a multicenter study. Molecular detection of RIF and INH resistance was performed directly from smear-positive TB sputa spotted on a slide, FTA card, GenoCard, and ethanol using the Genotype MTBDRplus assay. The performance of the DNA extraction method from each storage support to detect drug resistance was assessed by calculating their sensitivity and specificity compared to the phenotypic method. From all sites, the overall sensitivity and specificity for RIF-resistance detection was 88% and 85%, respectively, for slides, 86% and 92%, respectively, for GenoCard, 87% and 89%, respectively, for FTA card, and 88% and 92%, respectively, for ethanol. For INH-resistance detection, the overall sensitivity and specificity was 82% and 90%, respectively, for slides, 85% and 96%, respectively, for GenoCard, 86% and 92%, respectively, for FTA card, and 86% and 94%, respectively, for ethanol. Smear slides and filter cards showed to be very useful tools to facilitate DNA extraction from sputum samples with the potential to accelerate the detection of drug resistance in remote areas.

  3. Rapid antibiotic susceptibility testing of Mycobacterium tuberculosis : Its utility in resource poor settings

    Directory of Open Access Journals (Sweden)

    Poojary A


    Full Text Available Purpose: To compare the rapid colorimetric nitrate reductase based antibiotic susceptibility (CONRAS test performed on Mycobacterium tuberculosis isolates with the conventional method i.e., the proportion method. Methods: One hundred clinical isolates of M. tuberculosis were tested for susceptibility to isoniazid (INH and rifampicin (RIF by the conventional proportion method and CONRAS in Middlebrook 7H9 liquid medium enriched with growth supplements (MB7H9S. Results: The performance of the CONRAS test was evaluated using proportion method as the gold standard. The sensitivity (ability to detect true drug resistance and specificity (ability to detect true drug susceptibility of the CONRAS test to INH was 93.75 and 98.52% and for RIF it was 96.10 and 100% respectively. The mean time for reporting was 6.3 days and the test showed excellent reproducibility. The kappa (k value for INH was 0.92 and for RIF was 0.99, indicating excellent agreement between the two methods. Conclusions: CONRAS test is a rapid and reliable method of drug susceptibility for M. tuberculosis.

  4. [Anaesthesic management of vaginal delivery in a parturient with C1 esterase deficiency]. (United States)

    Libert, N; Schérier, S; Dubost, C; Franck, L; Rouquette, I; Tortosa, J-C; Rousseau, J-M


    Hereditary and acquired angioedema (HAE/AAE) are the clinical translation of a qualitative or a quantitative deficit of C1 esterase inhibitor (C1 INH). The frequency and severity of clinical manifestations vary greatly, ranging from a moderate swelling of the extremities to obstruction of upper airway. Anaesthesiologists and intensivists must be prepared to manage acute manifestations of this disease in case of life-threatening laryngeal edema. Surgery, physical trauma and labour are classical triggers of the disease. The anaesthesiologists should be aware of the drugs used as prophylaxis and treatment of acute attacks when considering labour and caesarean section. Androgens are contraindicated during pregnancy. If prophylaxis is required, tranexamic acid may be used with caution. The safest obstetric approach appears to be to administer a predelivery infusion of C1 INH concentrate. It is important to avoid manipulation of the airway as much as possible by relying on regional techniques. We report the case of a patient suffering from an HAE discovered during pregnancy. The management included administration of C1 INH during labor and early epidural analgesia for pain relief. A short review of the pathophysiology and therapeutic options follows.

  5. Increased androgen response to follicle-stimulating hormone administration in women with polycystic ovary syndrome. (United States)

    Wachs, Deborah S; Coffler, Mickey S; Malcom, Pamela J; Shimasaki, Shunichi; Chang, R Jeffrey


    In women with polycystic ovary syndrome (PCOS), excess ovarian androgen production is driven by increased LH secretion. Studies conducted in animals suggest that the granulosa cell may influence LH-stimulated theca cell androgen production. The objective of this study was to determine whether FSH enhances androgen production in women with PCOS compared with that of normal women. A prospective study was conducted to compare androgen production in response to FSH in two groups of women. The study was conducted in a General Clinical Research Center in a tertiary academic medical center. Women with PCOS, 18-35 yr (n = 20), and normal ovulatory controls, 18-35 yr (n = 10), were recruited for study. Serial blood samples were obtained over a 24-h period after an iv injection of recombinant human FSH (150 IU). The main outcome measures were serum 17-hydroxyprogesterone (17-OHP), androstenedione (A), dehydroepiandrosterone (DHEA), testosterone (T), and inhibin B (Inh B) responses after FSH administration. Basal serum 17-OHP, A, and T levels were markedly increased in women with PCOS compared with that observed in normal women. Basal DHEA and Inh B levels were similar to those of normal controls. After FSH injection, PCOS women demonstrated enhanced production of 17-OHP, A, DHEA, and Inh B, whereas in normal women no increases were observed. T levels declined slightly in both groups. These findings provide evidence that, in PCOS women, theca cell androgen production is enhanced by FSH administration and suggest a granulosa-theca cell paracrine mechanism.

  6. Effects of initial supersaturation on spontaneous precipitation of calcium carbonate in the presence of charged poly-L-amino acids. (United States)

    Njegić-Dzakula, Branka; Falini, Giuseppe; Brecević, Ljerka; Skoko, Zeljko; Kralj, Damir


    Spontaneous precipitation of calcium carbonate was investigated in two precipitation systems: (1) with initial supersaturation lower than that corresponding to the solubility of amorphous calcium carbonate (ACC), at which vaterite precipitated, and (2) with initial supersaturation higher than that of ACC solubility, at which a mixture of calcite and vaterite was formed. After the addition of an acidic polypeptide, poly-L-glutamic acid (pGlu) or poly-L-aspartic acid (pAsp), into (1) a significant inhibition of nucleation, expressed as an increase in induction time, and growth of vaterite, perceived as a dead zone, was observed. Extent of inhibition decreased in the order: Inh(pAps)>Inh(pGlu)>Inh(pLys). The addition of a polypeptide into (2) caused the inhibition of precipitation and changed the morphology and polymorphic composition of the precipitate; only vaterite appeared at approximately c(pAsp)=3 ppm, c(pGlu)=6 ppm, or c(pLys)=7 ppm. This finding is explained as a consequence of kinetic constraints through the inhibition of calcite nucleation and stronger binding of acidic polypeptide by the calcite surfaces than by the vaterite surfaces. Laboratory precipitation studies using conditions that resemble those in living organism should be run at an initial supersaturation corresponding to the solubility of ACC as a limiting condition. 2009 Elsevier Inc. All rights reserved.

  7. Goethite promoted biodegradation of 2,4-dinitrophenol under nitrate reduction condition. (United States)

    Tang, Ting; Yue, Zhengbo; Wang, Jin; Chen, Tianhu; Qing, Chengsong


    Iron oxide may interact with other pollutants in the aquatic environments and further influence their toxicity, transport and fate. The current study was conducted to investigate the biodegradation of 2,4-dinitrophenol (2,4-DNP) in the presence of iron oxide of goethite under anoxic condition using nitrate as the electron acceptor. Experiment results showed that the degradation rate of 2,4-DNP was improved by goethite. High performance liquid chromatography-mass spectra analysis results showed that goethite promoted degradation and transformation of 2,4-diaminophenol and 2-amino-4-nitrophenol (2-nitro-4-aminophenol). Microbial community analysis results showed that the abundance of Actinobacteria, which have the potential ability to degrade PAHs, was increased when goethite was available. This might partially explain the higher degradation of 2,4-DNP. Furthermore, another bacterium of Desulfotomaculum reducens which could reduce soluble Fe(III) and nitrate was also increased. Results further confirmed that nanomaterials in the aquatic environment will influence the microbial community and further change the transformation process of toxic pollutants. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Compact type-I coil planet centrifuge for counter-current chromatography. (United States)

    Yang, Yi; Gu, Dongyu; Liu, Yongqiang; Aisa, Haji Akber; Ito, Yoichiro


    A compact type-I coil planet centrifuge has been developed for performing counter-current chromatography. It has a revolution radius of 10 cm and a column holder height of 5 cm compared with 37 and 50 cm in the original prototype, respectively. The reduction in the revolution radius and column length permits application of higher revolution speed and more stable balancing of the rotor which leads us to learn more about its performance and the future potential of type-I coil planet centrifuge. The chromatographic performance of this apparatus was evaluated in terms of retention of the stationary phase (S(f)), peak resolution (R(s)), theoretical plate (N) and peak retention time (t(R)). The results of the experiment indicated that increasing the revolution speed slightly improved both the retention of the stationary phase and the peak resolution while the separation time is remarkably shortened to yield an excellent peak resolution at a revolution speed of 800 rpm. With a 12 ml capacity coiled column, DNP-DL-glu, DNP-beta-ala and DNP-l-ala were resolved at R(s) of 2.75 and 2.16 within 90 min at a flow rate of 0.4 ml/min. We believe that the compact type-I coil planet centrifuge has a high analytical potential. Published by Elsevier B.V.

  9. Unsuitability of using the DNPH-coated solid sorbent cartridge for determination of airborne unsaturated carbonyls (United States)

    Ho, Steven Sai Hang; Ho, K. F.; Liu, W. D.; Lee, S. C.; Dai, W. T.; Cao, J. J.; Ip, H. S. S.


    Measurements of aldehydes and ketones are typically conducted by derivatization using sorbent cartridges coated with 2,4-dinitrophenylhydrazine (DNPH). The collected samples are eluted with acetonitrile and analyzed by high-pressure liquid chromatography coupled with an ultra-violet detector (HPLC/UV). This paper intends to examine artifacts about its suitability in identification of unsaturated carbonyls. Kinetic tests for acrolein, crotonaldehyde, methacrolein and methyl vinyl ketone (MVK) showed formations of carbonyl-DNP-hydrazone during sampling, which could further react with DNPH, resulting in undesired UV absorption products [e.g., carbonyl-DNP-hydrazone-DNPH (dimer) and 2(carbonyl-DNP-hydrazone)-DNPH (trimer)]. The dimerization and trimerization occurred for acrolein and MVK whereas only dimerization for crotonaldehyde and methacrolein. The polymerization products undoubtedly affect the integrity of the chromatogram, leading to misidentification and inaccurate quantification. Whether precautions taken during sampling and/or sample treatment could avoid or minimize this artifact has not been thoughtfully investigated. More often, such artifacts are usually overlooked by scientists when the data are reported.

  10. Low-temperature dynamic nuclear polarization with helium-cooled samples and nitrogen-driven magic-angle spinning. (United States)

    Thurber, Kent; Tycko, Robert


    We describe novel instrumentation for low-temperature solid state nuclear magnetic resonance (NMR) with dynamic nuclear polarization (DNP) and magic-angle spinning (MAS), focusing on aspects of this instrumentation that have not been described in detail in previous publications. We characterize the performance of an extended interaction oscillator (EIO) microwave source, operating near 264 GHz with 1.5 W output power, which we use in conjunction with a quasi-optical microwave polarizing system and a MAS NMR probe that employs liquid helium for sample cooling and nitrogen gas for sample spinning. Enhancement factors for cross-polarized (13)C NMR signals in the 100-200 range are demonstrated with DNP at 25K. The dependences of signal amplitudes on sample temperature, as well as microwave power, polarization, and frequency, are presented. We show that sample temperatures below 30K can be achieved with helium consumption rates below 1.3 l/h. To illustrate potential applications of this instrumentation in structural studies of biochemical systems, we compare results from low-temperature DNP experiments on a calmodulin-binding peptide in its free and bound states. Published by Elsevier Inc.

  11. Prospects for sub-micron solid state nuclear magnetic resonance imaging with low-temperature dynamic nuclear polarization. (United States)

    Thurber, Kent R; Tycko, Robert


    We evaluate the feasibility of (1)H nuclear magnetic resonance (NMR) imaging with sub-micron voxel dimensions using a combination of low temperatures and dynamic nuclear polarization (DNP). Experiments are performed on nitroxide-doped glycerol-water at 9.4 T and temperatures below 40 K, using a 30 mW tunable microwave source for DNP. With DNP at 7 K, a 0.5 microL sample yields a (1)H NMR signal-to-noise ratio of 770 in two scans with pulsed spin-lock detection and after 80 db signal attenuation. With reasonable extrapolations, we infer that (1)H NMR signals from 1 microm(3) voxel volumes should be readily detectable, and voxels as small as 0.03 microm(3) may eventually be detectable. Through homonuclear decoupling with a frequency-switched Lee-Goldburg spin echo technique, we obtain 830 Hz (1)H NMR linewidths at low temperatures, implying that pulsed field gradients equal to 0.4 G/d or less would be required during spatial encoding dimensions of an imaging sequence, where d is the resolution in each dimension.

  12. Theory for cross effect dynamic nuclear polarization under magic-angle spinning in solid state nuclear magnetic resonance: the importance of level crossings. (United States)

    Thurber, Kent R; Tycko, Robert


    We present theoretical calculations of dynamic nuclear polarization (DNP) due to the cross effect in nuclear magnetic resonance under magic-angle spinning (MAS). Using a three-spin model (two electrons and one nucleus), cross effect DNP with MAS for electron spins with a large g-anisotropy can be seen as a series of spin transitions at avoided crossings of the energy levels, with varying degrees of adiabaticity. If the electron spin-lattice relaxation time T(1e) is large relative to the MAS rotation period, the cross effect can happen as two separate events: (i) partial saturation of one electron spin by the applied microwaves as one electron spin resonance (ESR) frequency crosses the microwave frequency and (ii) flip of all three spins, when the difference of the two ESR frequencies crosses the nuclear frequency, which transfers polarization to the nuclear spin if the two electron spins have different polarizations. In addition, adiabatic level crossings at which the two ESR frequencies become equal serve to maintain non-uniform saturation across the ESR line. We present analytical results based on the Landau-Zener theory of adiabatic transitions, as well as numerical quantum mechanical calculations for the evolution of the time-dependent three-spin system. These calculations provide insight into the dependence of cross effect DNP on various experimental parameters, including MAS frequency, microwave field strength, spin relaxation rates, hyperfine and electron-electron dipole coupling strengths, and the nature of the biradical dopants.

  13. New Security Development and Trends to Secure the SCADA Sensors Automated Transmission during Critical Sessions

    Directory of Open Access Journals (Sweden)

    Aamir Shahzad


    Full Text Available Modern technology enhancements have been used worldwide to fulfill the requirements of the industrial sector, especially in supervisory control and data acquisition (SCADA systems as a part of industrial control systems (ICS. SCADA systems have gained popularity in industrial automations due to technology enhancements and connectivity with modern computer networks and/or protocols. The procurement of new technologies has made SCADA systems important and helpful to processing in oil lines, water treatment plants, and electricity generation and control stations. On the other hand, these systems have vulnerabilities like other traditional computer networks (or systems, especially when interconnected with open platforms. Many international organizations and researchers have proposed and deployed solutions for SCADA security enhancement, but most of these have been based on node-to-node security, without emphasizing critical sessions that are linked directly with industrial processing and automation. This study concerns SCADA security measures related to critical processing with specified sessions of automated polling, analyzing cryptography mechanisms and deploying the appropriate explicit inclusive security solution in a distributed network protocol version 3 (DNP3 stack, as part of a SCADA system. The bytes flow through the DNP3 stack with security computational bytes within specified critical intervals defined for polling. We took critical processing knowledge into account when designing a SCADA/DNP3 testbed and deploying a cryptography solution that did not affect communications.

  14. Reconceptualizing the core of nurse practitioner education and practice. (United States)

    Burman, Mary E; Hart, Ann Marie; Conley, Virginia; Brown, Julie; Sherard, Pat; Clarke, Pamela N


    The movement to the doctor of nursing practice (DNP) is progressing rapidly with new programs emerging and curricular documents being developed. We argue that the implementation of the DNP is a good move for nursing, provided that we use the opportunity to reconceptualize the core of advanced practice nursing, especially nurse practitioner (NP) practice. Theory and research articles from nursing focused on advanced practice nursing, NPs, and doctoral education. The foundation of NP education is currently based essentially on borrowed or shared content in assessment, pharmacology, and pathophysiology. We argue that the heart and soul of nursing is in health promotion, both in healthy persons and in those dealing with chronic illness. Current master's programs do not prepare NPs to assume high-level practice focused on health promotion and disease management using the latest theoretical developments in health behavior change, behavioral sciences, exercise physiology, nutrition, and medical anthropology. Although these are touched upon in most NP programs, they do not represent the core science of NP education and need to be a critical part of any DNP program. Ultimately, our vision is for NP care to be consistently "different," yet just as essential as physician care, leading to positive outcomes in health promotion and disease management.

  15. Sequences of 12 monoclonal anti-dinitrophenyl spin-label antibodies for NMR studies

    International Nuclear Information System (INIS)

    Leahy, D.J.; Rule, G.S.; Whittaker, M.M.; McConnell, H.M.


    Eleven monoclonal antibodies specific for a spin-labeled dinitrophenyl hapten (DNP-SL) have been produces for use in NMR studies. They have been named AN01 and ANO3-AN12. The stability constants for the association of these antibodies with DNP-SL and related haptens were measured by fluorescence quenching. cDNA clones coding for the heavy and light chains of each antibody and of an additional anti-DNP-SL monoclonal antibody, ANO2, have been isolated. The nucleic acid sequence of the 5' end of each clone has been determined, and the amino acid sequence of the variable regions of each antibody has been deduced from the cDNA sequence. The sequences are relatively heterogeneous, but both the heavy and the light chains of ANO1 and ANO3 are derived from the same variable-region gene families as those of the ANO2 antibody. ANO7 has a heavy chain that is related to that of ANO2, and ANO9 has a related light chain. ANO5 and ANO6 are unrelated to ANO2 but share virtually identical heavy and light chains. Preliminary NMR difference spectra comparing related antibodies show that sequence-specific assignment of resonances is possible. Such spectra also provide a measure of structural relatedness

  16. Thermosetting polymer for dynamic nuclear polarization: Solidification of an epoxy resin mixture including TEMPO

    Energy Technology Data Exchange (ETDEWEB)

    Noda, Yohei, E-mail: [Quantum Beam Science Centre, Sector of Nuclear Science Research, Japan Atomic Energy Agency, Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Kumada, Takayuki [Quantum Beam Science Centre, Sector of Nuclear Science Research, Kansai Photon Science Institute, Japan Atomic Energy Agency, Kizugawa, Kyoto 619-0215 (Japan); Yamaguchi, Daisuke; Shamoto, Shin-ichi [Quantum Beam Science Centre, Sector of Nuclear Science Research, Japan Atomic Energy Agency, Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan)


    We investigated the dynamic nuclear polarization (DNP) of typical thermosetting polymers (two-component type epoxy resins; Araldite{sup ®} Standard or Araldite{sup ®} Rapid) doped with a (2,2,6,6-tetramethylpiperidine-1-yl)oxy (TEMPO) radical. The doping process was developed by carefully considering the decomposition of TEMPO during the solidification of the epoxy resin. The TEMPO electron spin in each two-component paste decayed slowly, which was favorable for our study. Furthermore, despite the dissolved TEMPO, the mixture of the two-component paste successfully solidified. With the resulting TEMPO-doped epoxy-resin samples, DNP experiments at 1.2 K and 3.35 T indicated a magnitude of a proton-spin polarization up to 39%. This polarization is similar to that (35%) obtained for TEMPO-doped polystyrene (PS), which is often used as a standard sample for DNP. To combine this solidification of TEMPO-including mixture with a resin-casting technique enables a creation of polymeric target materials with a precise and complex structure.

  17. Design and Development of Layered Security: Future Enhancements and Directions in Transmission (United States)

    Shahzad, Aamir; Lee, Malrey; Kim, Suntae; Kim, Kangmin; Choi, Jae-Young; Cho, Younghwa; Lee, Keun-Kwang


    Today, security is a prominent issue when any type of communication is being undertaken. Like traditional networks, supervisory control and data acquisition (SCADA) systems suffer from a number of vulnerabilities. Numerous end-to-end security mechanisms have been proposed for the resolution of SCADA-system security issues, but due to insecure real-time protocol use and the reliance upon open protocols during Internet-based communication, these SCADA systems can still be compromised by security challenges. This study reviews the security challenges and issues that are commonly raised during SCADA/protocol transmissions and proposes a secure distributed-network protocol version 3 (DNP3) design, and the implementation of the security solution using a cryptography mechanism. Due to the insecurities found within SCADA protocols, the new development consists of a DNP3 protocol that has been designed as a part of the SCADA system, and the cryptographically derived security is deployed within the application layer as a part of the DNP3 stack. PMID:26751443

  18. Dynamic nuclear polarization using frequency modulation at 3.34 T. (United States)

    Hovav, Y; Feintuch, A; Vega, S; Goldfarb, D


    During dynamic nuclear polarization (DNP) experiments polarization is transferred from unpaired electrons to their neighboring nuclear spins, resulting in dramatic enhancement of the NMR signals. While in most cases this is achieved by continuous wave (cw) irradiation applied to samples in fixed external magnetic fields, here we show that DNP enhancement of static samples can improve by modulating the microwave (MW) frequency at a constant field of 3.34 T. The efficiency of triangular shaped modulation is explored by monitoring the (1)H signal enhancement in frozen solutions containing different TEMPOL radical concentrations at different temperatures. The optimal modulation parameters are examined experimentally and under the most favorable conditions a threefold enhancement is obtained with respect to constant frequency DNP in samples with low radical concentrations. The results are interpreted using numerical simulations on small spin systems. In particular, it is shown experimentally and explained theoretically that: (i) The optimal modulation frequency is higher than the electron spin-lattice relaxation rate. (ii) The optimal modulation amplitude must be smaller than the nuclear Larmor frequency and the EPR line-width, as expected. (iii) The MW frequencies corresponding to the enhancement maxima and minima are shifted away from one another when using frequency modulation, relative to the constant frequency experiments. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. An Academic-Practice Partnership Model to Grow and Sustain Advanced Practice Nursing. (United States)

    Williams, Tracy E; Howard, Patricia B


    The aims of this article were to describe the implementation of an academic-practice partnership for healthcare system workforce development and provide preliminary outcomes of the associated pilot study. The demand for cross-continuum healthcare delivery models necessitates creation of workforce development structures for advanced practice nursing. An academic-practice partnership specified enrollment of 5 cohorts of BSN staff nurses in a 3-year DNP program. Qualitative methods were used to explore pilot data at midpoint of cohort 1 student progression to determine learning outcomes and DNP projects with potential for impact on organization goals. Partnership implementation experiences indicate that contractual agreements and an established evaluation plan are keys to academic-practice partnership success. Pilot study findings suggest that curriculum core courses provide a foundation for designing DNP projects congruent with acute and primary care health system goals. Implementing an academic-practice partnership is a strategy for workforce development to increase retention of advanced practice nurses. Academic-practice partnerships can serve as a catalyst for a paradigm shift for changing models of care, thus enhancing workforce development succession planning for sustainable growth in healthcare systems.

  20. Diet pills and the cataract outbreak of 1935: reflections on the evolution of consumer protection legislation. (United States)

    Margo, Curtis E; Harman, Lynn E


    An outbreak of cataracts in 1935 caused by dinitrophenol (DNP), the active ingredient of popular diet pills, highlighted the inability of the U.S. Food and Drug Administration (FDA) to prevent harmful drugs from entering the marketplace. Just two years earlier, the FDA used horrific images of ocular surface injury caused by cosmetics at the World's Fair in Chicago to garner public support for legislative reform. The FDA had to walk a fine line between a public awareness campaign and lobbying Congress while lawmakers debated the need for consumer protection. The cataract outbreak of 1935 was conspicuous in the medical literature during the height of New Deal legislation, but questions persist as to how much it affected passage of the proposed Food, Drug, and Cosmetic Act (of 1938). The legislation languished in committee for years. The cataract outbreak probably had little impact on the eventual outcome, but medical opinion concerning the safety of DNP may have contributed to the voluntary withdrawal of the diet drug from the market. We review the DNP cataract outbreak and examine it in context of the challenges facing regulatory reform at that time. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Solid-State NMR on bacterial cells: selective cell wall signal enhancement and resolution improvement using dynamic nuclear polarization

    International Nuclear Information System (INIS)

    Takahashi, Hiroki; Bardet, Michel; De Paepe, Gael; Hediger, Sabine; Ayala, Isabel; Simorre, Jean-Pierre


    Dynamic nuclear polarization (DNP) enhanced solid-state nuclear magnetic resonance (NMR) has recently emerged as a powerful technique for the study of material surfaces. In this study, we demonstrate its potential to investigate cell surface in intact cells. Using Bacillus subtilis bacterial cells as an example, it is shown that the polarizing agent 1-(TEMPO-4-oxy)-3-(TEMPO-4-amino)propan-2-ol (TOTAPOL) has a strong binding affinity to cell wall polymers (peptidoglycan). This particular interaction is thoroughly investigated with a systematic study on extracted cell wall materials, disrupted cells, and entire cells, which proved that TOTAPOL is mainly accumulating in the cell wall. This property is used on one hand to selectively enhance or suppress cell wall signals by controlling radical concentrations and on the other hand to improve spectral resolution by means of a difference spectrum. Comparing DNP-enhanced and conventional solid-state NMR, an absolute sensitivity ratio of 24 was obtained on the entire cell sample. This important increase in sensitivity together with the possibility of enhancing specifically cell wall signals and improving resolution really opens new avenues for the use of DNP-enhanced solid-state NMR as an on-cell investigation tool. (authors)

  2. Solid-state NMR on bacterial cells: selective cell wall signal enhancement and resolution improvement using dynamic nuclear polarization. (United States)

    Takahashi, Hiroki; Ayala, Isabel; Bardet, Michel; De Paëpe, Gaël; Simorre, Jean-Pierre; Hediger, Sabine


    Dynamic nuclear polarization (DNP) enhanced solid-state nuclear magnetic resonance (NMR) has recently emerged as a powerful technique for the study of material surfaces. In this study, we demonstrate its potential to investigate cell surface in intact cells. Using Bacillus subtilis bacterial cells as an example, it is shown that the polarizing agent 1-(TEMPO-4-oxy)-3-(TEMPO-4-amino)propan-2-ol (TOTAPOL) has a strong binding affinity to cell wall polymers (peptidoglycan). This particular interaction is thoroughly investigated with a systematic study on extracted cell wall materials, disrupted cells, and entire cells, which proved that TOTAPOL is mainly accumulating in the cell wall. This property is used on one hand to selectively enhance or suppress cell wall signals by controlling radical concentrations and on the other hand to improve spectral resolution by means of a difference spectrum. Comparing DNP-enhanced and conventional solid-state NMR, an absolute sensitivity ratio of 24 was obtained on the entire cell sample. This important increase in sensitivity together with the possibility of enhancing specifically cell wall signals and improving resolution really opens new avenues for the use of DNP-enhanced solid-state NMR as an on-cell investigation tool.

  3. Design and Development of Layered Security: Future Enhancements and Directions in Transmission

    Directory of Open Access Journals (Sweden)

    Aamir Shahzad


    Full Text Available Today, security is a prominent issue when any type of communication is being undertaken. Like traditional networks, supervisory control and data acquisition (SCADA systems suffer from a number of vulnerabilities. Numerous end-to-end security mechanisms have been proposed for the resolution of SCADA-system security issues, but due to insecure real-time protocol use and the reliance upon open protocols during Internet-based communication, these SCADA systems can still be compromised by security challenges. This study reviews the security challenges and issues that are commonly raised during SCADA/protocol transmissions and proposes a secure distributed-network protocol version 3 (DNP3 design, and the implementation of the security solution using a cryptography mechanism. Due to the insecurities found within SCADA protocols, the new development consists of a DNP3 protocol that has been designed as a part of the SCADA system, and the cryptographically derived security is deployed within the application layer as a part of the DNP3 stack.

  4. Parametric Cost Modeling of Space Missions Using the Develop New Projects (DMP) Implementation Process (United States)

    Rosenberg, Leigh; Hihn, Jairus; Roust, Kevin; Warfield, Keith


    This paper presents an overview of a parametric cost model that has been built at JPL to estimate costs of future, deep space, robotic science missions. Due to the recent dramatic changes in JPL business practices brought about by an internal reengineering effort known as develop new products (DNP), high-level historic cost data is no longer considered analogous to future missions. Therefore, the historic data is of little value in forecasting costs for projects developed using the DNP process. This has lead to the development of an approach for obtaining expert opinion and also for combining actual data with expert opinion to provide a cost database for future missions. In addition, the DNP cost model has a maximum of objective cost drivers which reduces the likelihood of model input error. Version 2 is now under development which expands the model capabilities, links it more tightly with key design technical parameters, and is grounded in more rigorous statistical techniques. The challenges faced in building this model will be discussed, as well as it's background, development approach, status, validation, and future plans.

  5. Characterization of Chemical Exchange Using Relaxation Dispersion of Hyperpolarized Nuclear Spins. (United States)

    Liu, Mengxiao; Kim, Yaewon; Hilty, Christian


    Chemical exchange phenomena are ubiquitous in macromolecules, which undergo conformational change or ligand complexation. NMR relaxation dispersion (RD) spectroscopy based on a Carr-Purcell-Meiboom-Gill pulse sequence is widely applied to identify the exchange and measure the lifetime of intermediate states on the millisecond time scale. Advances in hyperpolarization methods improve the applicability of NMR spectroscopy when rapid acquisitions or low concentrations are required, through an increase in signal strength by several orders of magnitude. Here, we demonstrate the measurement of chemical exchange from a single aliquot of a ligand hyperpolarized by dissolution dynamic nuclear polarization (D-DNP). Transverse relaxation rates are measured simultaneously at different pulsing delays by dual-channel 19 F NMR spectroscopy. This two-point measurement is shown to allow the determination of the exchange term in the relaxation rate expression. For the ligand 4-(trifluoromethyl)benzene-1-carboximidamide binding to the protein trypsin, the exchange term is found to be equal within error limits in neutral and acidic environments from D-DNP NMR spectroscopy, corresponding to a pre-equilibrium of trypsin deprotonation. This finding illustrates the capability for determination of binding mechanisms using D-DNP RD. Taking advantage of hyperpolarization, the ligand concentration in the exchange measurements can reach on the order of tens of μM and protein concentration can be below 1 μM, i.e., conditions typically accessible in drug discovery.

  6. Dynamic nuclear polarization of irradiated target materials

    International Nuclear Information System (INIS)

    Seely, M.L.


    Polarized nucleon targets used in high energy physics experiments usually employ the method of dynamic nuclear polarization (DNP) to polarize the protons or deuterons in an alcohol. DNP requires the presence of paramagnetic centers, which are customarily provided by a chemical dopant. These chemically doped targets have a relatively low polarizable nucleon content and suffer from loss of polarization when subjected to high doses of ionizing radiation. If the paramagnetic centers formed when the target is irradiated can be used in the DNP process, it becomes possible to produce targets using materials which have a relatively high polarizable nucleon content, but which are not easily doped by chemical means. Furthermore, the polarization of such targets may be much more radiation resistant. Dynamic nuclear polarization in ammonia, deuterated ammonia, ammonium hydroxide, methylamine, borane ammonia, butonal, ethane and lithium borohydride has been studied. These studies were conducted at the Stanford Linear Accelerator Center using the Yale-SLAC polarized target system. Results indicate that the use of ammonia and deuterated ammonia as polarized target materials would make significant increases in polarized target performance possible

  7. Effect of Nitrooxy Compounds with Different Molecular Structures on the Rumen Methanogenesis, Metabolic Profile, and Methanogenic Community. (United States)

    Jin, Wei; Meng, Zhenxiang; Wang, Jing; Cheng, Yanfen; Zhu, Weiyun


    Rumen in vitro fermentation was used to evaluate the capacity of nitrooxy compounds to mitigate rumen methane production. The following three nitrooxy compounds, each with different molecular structures, were evaluated: 2,2-dimethyl-3-(nitrooxy) propanoic (DNP), N-[2-(Nitrooxy)ethyl]-3-pyridinecarboxamide (NPD), and nitroglycerin (NG). All three compounds substantially decreased the total gas production, methane production, and the acetate:propionate ratio, while increasing hydrogen production. The growth of methanogens was specifically inhibited by all three compounds, without affecting the abundance of bacteria, anaerobic fungi, or protozoa. However, inhibition of methanogenesis required a much higher dose of DNP when compared to NPD or NG. Further investigations were conducted on NG to determine its effects on the methanogenic community. NG reduced the relative abundance of Methanomassiliicoccales, while increasing the relative abundance of Methanobrevibacter and Methanosphaera. Overall, the results suggested that all three of these nitrooxy compounds could specifically inhibit rumen methanogenesis, but NPD and NG were much more efficient than DNP at rumen methane mitigation.

  8. Dynamic nuclear-polarization studies of paramagnetic species in solution

    International Nuclear Information System (INIS)

    Glad, W.E.


    Dynamic Nuclear Polarization (DNP) was used to measure the electron spin lattice relaxation times, T 1 , of transition metal ions in aqueous solution. Saturation which is induced in the electron spin system is transferred to the solvent proton spins by dipole-dipole interactions. The change in the polarization of the proton spins is much larger than it is in the electron spins. The change in proton polarization is easily measured by proton Nuclear Magnetic Resonance (NMR). In one experimental arrangement the sample solution was continuously flowed through a microwave cavity to the NMR coil. The NMR was observed with a continuous wave NMR spectrometer. In a second arrangement the whole sample tube was moved from within the microwave cavity to the NMR coil in less than 40 ms by a blast of compressed air. The NMR was then observed with a pulse-Fourier-transform spectrometer. With the second arrangement a mean-square microwave magnetic field at the sample of more than 10 G 2 is obtainable with 14 W of microwave power. Measurements of DNP at 9 GHz were made on aqueous solutions of VO 2+ , Mn 2+ , Cr(CN) 6 3- , Cu 2+ and Cu(ethylenediamine) 2 (H 2 0) 2 2+ ions from 3 to 60 0 C. It was also possible to observe DNP on resolved proton resonances from mixed water-acetonitrile solutions of VO 2+ and Cr(CN) 6 3- ions

  9. Suppressive effects of anti-allergic agent suplatast tosilate (IPD-1151T on the expression of co-stimulatory molecules on mouse splenocytes in vivo

    Directory of Open Access Journals (Sweden)

    Masatsugu Kurokawa


    Full Text Available The effects of IPD-1151T on the expression of costimulatory molecules, CD40, CD80 and CD86, were investigated in vivo using mice with allergic disorders. BALB/c mice were immunized intraperitoneally with two doses of dinitrophenylated ovalbumin (DNP-OVA at 1-week intervals. These mice then were treated intraperitoneally with 100μg/kg of IPD1151T once a day for 14 days, starting 7 days after the first immunization. On day 21, some mice were challenged intraperitoneally with DNP-OVA and the other mice were not challenged. All mice were autopsied on day 22 and assayed for immunoglobulin E, interleuken (IL-4 and IL-5 productions following DNP-OVA immunization. The intraperitoneal treatment with IPD-1151T strongly suppressed immunoglobulin E contents in serum, which were enhanced by DNA-OVA immunization. IPD-1151T also caused a decrease in both IL-4 and IL-5 levels in splenic lymphocytes. We next examined the influence of IPD1151T on co-stimulatory molecule expression on splenic lymphocytes. IPD-1151T caused suppression of CD40 and CD86 expression; however, the treatments did not affect CD80 expression.

  10. Proanthocyanidin-rich Pinus radiata bark extract inhibits mast cell-mediated anaphylaxis-like reactions. (United States)

    Choi, Yun Ho; Song, Chang Ho; Mun, Sung Phil


    Mast cells play a critical role in the effector phase of immediate hypersensitivity and allergic reactions. Pinus radiata bark extract exerts multiple biological effects and exhibits immunomodulatory and antioxidant properties. However, its role in mast cell-mediated anaphylactic reactions has not been thoroughly investigated. In this study, we examined the effects of proanthocyanidin-rich water extract (PAWE) isolated from P. radiata bark on compound 48/80-induced or antidinitrophenyl (DNP) immunoglobulin E (IgE)-mediated anaphylaxis-like reactions in vivo. In addition, we evaluated the mechanism underlying the inhibitory effect of PAWE on mast cell activation, with a specific focus on histamine release, using rat peritoneal mast cells. PAWE attenuated compound 48/80-induced or anti-DNP IgE-mediated passive cutaneous anaphylaxis-like reactions in mice, and it inhibited histamine release triggered by compound 48/80, ionophore A23187, or anti-DNP IgE in rat peritoneal mast cells in vitro. Moreover, PAWE suppressed compound 48/80-elicited calcium uptake in a concentration-dependent manner and promoted a transient increase in intracellular cyclic adenosine-3',5'-monophosphate levels. Together, these results suggest that proanthocyanidin-rich P. radiata bark extract effectively inhibits anaphylaxis-like reactions. Copyright © 2017 John Wiley & Sons, Ltd.

  11. Synthesis, characterization, and efficacy of antituberculosis isoniazid zinc aluminum-layered double hydroxide based nanocomposites

    Directory of Open Access Journals (Sweden)

    Saifullah B


    Full Text Available Bullo Saifullah,1 Mohamed Ezzat El Zowalaty,2,3 Palanisamy Arulselvan,3 Sharida Fakurazi,3,4 Thomas J Webster,5–7 Benjamin Mahler Geilich,5,6 Mohd Zobir Hussein1 1Materials Synthesis and Characterization Laboratory, Institute of Advanced Technology, (ITMA, Universiti Putra Malaysia, Serdang, Selangor, Malaysia; 2School of Health Sciences, University of KwaZulu-Natal, Westville Campus, Durban, South Africa; 3Laboratory of Vaccines and Immunotherapeutics, Institute of Bioscience, 4Department of Human Anatomy, Faculty of Medicine and Health Science, Universiti Putra Malaysia, Serdang, Selangor, Malaysia; 5Department of Chemical Engineering, 6Department of Bioengineering, Northeastern University, Boston, MA, USA; 7Center of Excellence for Advanced Materials Research, King Abdulaziz University, Jeddah, Saudi Arabia Abstract: The chemotherapy for tuberculosis (TB is complicated by its long-term treatment, its frequent drug dosing, and the adverse effects of anti-TB drugs. In this study, we have developed two nanocomposites (A and B by intercalating the anti-TB drug isoniazid (INH into Zn/Al-layered double hydroxides. The average size of the nanocomposites was found to be ~164 nm. The efficacy of the Zn/Al-layered double hydroxides intercalated INH against Mycobacterium tuberculosis was increased by approximately three times more than free INH. The nanocomposites were also found to be active against Gram-positive and -negative bacteria. Compared to the free INH, the nanodelivery formulation was determined to be three times more biocompatible with human normal lung fibroblast MRC-5 cells and 3T3 fibroblast cells at a very high concentration of 50 µg/mL for up to 72 hours. The in vitro release of INH from the Zn/Al-layered double hydroxides was found to be sustained in human body-simulated buffer solutions of pH 4.8 and 7.4. This research is a step forward in making the TB chemotherapy patient friendly. Keywords: tuberculosis, Zn/Al-LDHs, drug

  12. 19-Hydroxyeicosatetraenoic acid and isoniazid protect against angiotensin II-induced cardiac hypertrophy

    Energy Technology Data Exchange (ETDEWEB)

    Elkhatali, Samya; El-Sherbeni, Ahmed A.; Elshenawy, Osama H. [Faculty of Pharmacy and Pharmaceutical Sciences, University of Alberta, Edmonton, Alberta T6G 2E1 (Canada); Abdelhamid, Ghada [Faculty of Pharmacy and Pharmaceutical Sciences, University of Alberta, Edmonton, Alberta T6G 2E1 (Canada); Department of Pharmacology and Toxicology, Faculty of Pharmacy, Helwan University, Helwan (Egypt); El-Kadi, Ayman O.S., E-mail: [Faculty of Pharmacy and Pharmaceutical Sciences, University of Alberta, Edmonton, Alberta T6G 2E1 (Canada)


    We have recently demonstrated that 19-hydroxyeicosatetraenoic acid (19-HETE) is the major subterminal-HETE formed in the heart tissue, and its formation was decreased during cardiac hypertrophy. In the current study, we examined whether 19-HETE confers cardioprotection against angiotensin II (Ang II)-induced cardiac hypertrophy. The effect of Ang II, with and without 19-HETE (20 μM), on the development of cellular hypertrophy in cardiomyocyte RL-14 cells was assessed by real-time PCR. Also, cardiac hypertrophy was induced in Sprague–Dawley rats by Ang II, and the effect of increasing 19-HETE by isoniazid (INH; 200 mg/kg/day) was assessed by heart weight and echocardiography. Also, alterations in cardiac cytochrome P450 (CYP) and their associated arachidonic acid (AA) metabolites were determined by real-time PCR, Western blotting and liquid-chromatography–mass-spectrometry. Our results demonstrated that 19-HETE conferred a cardioprotective effect against Ang II-induced cellular hypertrophy in vitro, as indicated by the significant reduction in β/α-myosin heavy chain ratio. In vivo, INH improved heart dimensions, and reversed the increase in heart weight to tibia length ratio caused by Ang II. We found a significant increase in cardiac 19-HETE, as well as a significant reduction in AA and its metabolite, 20-HETE. In conclusion, 19-HETE, incubated with cardiomyocytes in vitro or induced in the heart by INH in vivo, provides cardioprotection against Ang II-induced hypertrophy. This further confirms the role of CYP, and their associated AA metabolites in the development of cardiac hypertrophy. - Highlights: • We found 19-hydroxy arachidonic acid to protect cardiomyocytes from hypertrophy. • We validated the use of isoniazid as a cardiac 19-hydroxy arachidonic acid inducer. • We found isoniazid to increase protective and inhibit toxic eicosanoides. • We found isoniazid to protect against angiotensin-induced cardiac hypertrophy. • This will help to

  13. [Management of tuberculosis during pregnancy and puerperium]. (United States)

    Toyota, Emiko; Minoura, Shigeki; Miyazawa, Hirofumi


    We reported 22 cases with tuberculosis in pregnancy and puerperium, who were treated in our hospital from 1993 to 2001. Nine out of 22 cases were foreign women and the onset of tuberculosis was not clear and the diagnosis tended to be delayed in most cases. In the reports from industrial countries, most of those patients are foreign bone and the delay in diagnosis is common because symptoms are apt to be mixed up those for pregnancy and puerperium. In 10 of 22 cases, extrapulmonary lesions were noted. Most of our cases were treated with INH, RFP and EB, and in some severer cases PZA was added. WHO and BTS recommend standard therapy with PZA but ATS recommends INH, RFP and EB without PZA. Generally SM is contraindicated because of adverse effect of hearing loss for all pregnant periods, and the data for PZA and other second line drugs are insufficient. Our cases and their neonates showed normal course and no malformation nor congenital tuberculosis. 2 cases could not keep adherence for drugs and 2 babies got active tuberculosis. Precaution for infection is one of most important problem to deal with cases with tuberculosis during pregnancy and postpartum in the hospital. If she is still infectious on delivery, we should consider prevention for transmission and manage her in isolated manner. CDC recommends not to treat for latent tuberculosis during pregnancy because of high frequency of hepatic damage due to INH. It is the best way to check and treat latent tuberculosis before gestation if she is at high risk with tuberculosis.

  14. Community-based short-course treatment of pulmonary tuberculosis in a developing nation. Initial report of an eight-month, largely intermittent regimen in a population with a high prevalence of drug resistance. (United States)

    Manalo, F; Tan, F; Sbarbaro, J A; Iseman, M D


    A community-based tuberculosis case-finding and short-course chemotherapy program was conducted in a suburb of Manila and featured 1 month of daily isoniazid (INH), rifampin (RIF), ethambutol (EMB), and pyrazinamide (PZA) followed by 7 months of twice-weekly, high dose, directly observed INH + EMB + PZA. Church-affiliated lay workers obtained 1,990 sputum specimens from subjects who complained of chronic cough or wasting symptoms; 207 of the specimens were positive on Ziehl-Neelsen smears. On culture, 176 yielded a significant growth of M. tuberculosis. Of these 176 patients, 144 were selected to enter the study; 10 were lost because of withdrawal or death and four (2.7%) because of drug toxicity. This left 130 patients who were followed long-term. Remarkably, 80% (104) were initially shedding drug-resistant organisms; 26% (34) were resistant to one drug, 30% (40) were resistant to two drugs, and 24% (30) were resistant to three or more drugs. Responses to therapy corresponded closely to the extent of drug resistance: 80% (48 of 60) of patients with drug-susceptible or single resistance had a favorable outcome; 43% (28 of 65) were resistant to two or three drugs, and 0% (0 of 5) of those were resistant to four or more drugs. Notable findings of this study were the success of a community-based program in conducting prolonged, directly observed treatment, the unexpectedly high prevalence of multiple-drug-resistant organisms in this population, and the inadequacy of INH + PZA + EMB during the continuation phase of therapy in this setting.

  15. [Tranexamic acid as first-line emergency treatment for episodes of bradykinin-mediated angioedema induced by ACE inhibitors]. (United States)

    Beauchêne, C; Martins-Héricher, J; Denis, D; Martin, L; Maillard, H


    Episodes of acquired bradykinin-mediated angioedema due to angiotensin-converting enzyme (ACE) inhibitors may result in fatal outcomes. There is no consensus regarding emergency pharmacological management of these episodes. Treatment options include icatibant and C1INH concentrate. Tranexamic acid is administered for moderate episodes. Its efficacy in the treatment of ACE inhibitor-induced episodes of angioedema is not established. The aim of this retrospective study is to assess the benefits of emergency tranexamic acid administration in the management of ACE inhibitor-induced episodes of angioedema. Retrospective analysis of the medical files of patients who consulted between 2010 and 2016 in two French tertiary care hospitals for a bradykinic angioedema attributed to an ACE treatment. All of them had received tranexamic acid as a first line treatment. Thirty three patients who had experienced severe episode of angioedema were included. Twenty seven patients showed significant improvement when treated with tranexamic acid alone. The six remaining patients were treated with icatibant (5/33) or C1INH concentrate (1/33), due to partial improvement after tranexamic acid therapy. None of the patients were intubated, no fatalities were recorded and no side effects were reported. Tranexamic acid is an easily accessible and affordable therapy that may provide effective treatment for ACE inhibitor-induced episodes of angioedema. It may help while waiting for a more specific treatment (icatibant and C1INH concentrate) that is at times unavailable in emergency departments. Copyright © 2018 Société Nationale Française de Médecine Interne (SNFMI). Published by Elsevier SAS. All rights reserved.

  16. Public dentistry, which direction? The Italian anomaly and its new perspectives

    Directory of Open Access Journals (Sweden)

    Daniela Reali


    Full Text Available Italian National Health Service (INHS provides hospital, district and preventive cares in many medical areas but dental cares are a small part of all treatments provided. It is estimated that it only answers a 5% of need. In Italy dental treatments are predominantly provided by private practitioners: it means little access equity to cares. Nowadays, just 1,5% of the INHS expense is aimed at public dentistry because most of dental cares are believed “not urgent”. Why oral diseases are not considered so invalidating to have relief in INHS? They should get the same attention of the other pathologies because they worsen the quality of life in term of physical and psychological health. Need of public dentistry performances has recently increased, as confirmed by larger and larger waiting lists: it has revealed the growing dental need of the weakest part of the Italian society that, because of economic, social, cultural reasons, can hardly afford private cares (private practitioners are now facing a crisis, too. Dentists’ ethical code is not essentially different from physicians’ one even if most of the oral pathology is not worrying about patients’ life. “Bioethics in Dentistry” (2005, an issue by the National Bioethics Committee says: “public dentistry is actually absent in helping the weak part of the society. Just consider that in Italy oral cares are not included in Essential Care Levels (ECL and they are not provided by Local Health Authorities whereas requirements to State exams include minimum tooth number and good oral health, because of the high importance of oral wellness.

  17. Genotypic characterization of multi-drug-resistant Mycobacterium tuberculosis isolates in Myanmar. (United States)

    Aye, Khin Saw; Nakajima, Chie; Yamaguchi, Tomoyuki; Win, Min Min; Shwe, Mu Mu; Win, Aye Aye; Lwin, Thandar; Nyunt, Wint Wint; Ti, Ti; Suzuki, Yasuhiko


    The number of multi-drug-resistant tuberculosis (MDR-TB) cases is rising worldwide. As a countermeasure against this situation, the implementation of rapid molecular tests to identify MDR-TB would be effective. To develop such tests, information on the frequency and distribution of mutations associating with phenotypic drug resistance in Mycobacterium tuberculosis is required in each country. During 2010, the common mutations in the rpoB, katG and inhA of 178 phenotypically MDR M. tuberculosis isolates collected by the National Tuberculosis Control Program (NTP) in Myanmar were investigated by DNA sequencing. Mutations affecting the 81-bp rifampicin (RIF) resistance-determining region (RRDR) of the rpoB were identified in 127 of 178 isolates (71.3%). Two of the most frequently affected codons were 531 and 526, with percentages of 48.3% and 14.0% respectively. For isoniazid (INH) resistance, 114 of 178 MDR-TB isolates (64.0%) had mutations in the katG in which a mutation-conferring amino acid substitution at codon 315 from Ser to Thr was the most common. Mutations in the inhA regulatory region were also detected in 20 (11.2%) isolates, with the majority at position -15. Distinct mutation rate and pattern from surrounding countries might suggest that MDR-TB has developed and spread domestically in Myanmar. Copyright © 2015 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  18. M. tuberculosis genotypic diversity and drug susceptibility pattern in HIV- infected and non-HIV-infected patients in northern Tanzania

    Directory of Open Access Journals (Sweden)

    van Soolingen Dick


    Full Text Available Abstract Background Tuberculosis (TB is a major health problem and HIV is the major cause of the increase in TB. Sub-Saharan Africa is endemic for both TB and HIV infection. Determination of the prevalence of M. tuberculosis strains and their drug susceptibility is important for TB control. TB positive culture, BAL fluid or sputum samples from 130 patients were collected and genotyped. The spoligotypes were correlated with anti-tuberculous drug susceptibility in HIV-infected and non-HIV patients from Tanzania. Results One-third of patients were TB/HIV co-infected. Forty-seven spoligotypes were identified. Fourteen isolates (10.8% had new and unique spoligotypes while 116 isolates (89.2% belonged to 33 known spoligotypes. The major spoligotypes contained nine clusters: CAS1-Kili 30.0%, LAM11- ZWE 14.6%, ND 9.2%, EAI 6.2%, Beijing 5.4%, T-undefined 4.6%, CAS1-Delhi 3.8%, T1 3.8% and LAM9 3.8%. Twelve (10.8% of the 111 phenotypically tested strains were resistant to anti-TB drugs. Eight (7.2% were monoresistant strains: 7 to isoniazid (INH and one to streptomycin. Four strains (3.5% were resistant to multiple drugs: one (0.9% was resistant to INH and streptomycin and the other three (2.7% were MDR strains: one was resistant to INH, rifampicin and ethambutol and two were resistant to all four anti-TB drugs. Mutation in the katG gene codon 315 and the rpoB hotspot region showed a low and high sensitivity, respectively, as predictor of phenotypic drug resistance. Conclusion CAS1-Kili and LAM11-ZWE were the most common families. Strains of the Beijing family and CAS1-Kili were not or least often associated with resistance, respectively. HIV status was not associated with spoligotypes, resistance or previous TB treatment.

  19. Acquisition of C1 inhibitor by Bordetella pertussis virulence associated gene 8 results in C2 and C4 consumption away from the bacterial surface. (United States)

    Hovingh, Elise S; van den Broek, Bryan; Kuipers, Betsy; Pinelli, Elena; Rooijakkers, Suzan H M; Jongerius, Ilse


    Whooping cough, or pertussis, is a contagious disease of the respiratory tract that is re-emerging worldwide despite high vaccination coverage. The causative agent of this disease is the Gram-negative Bordetella pertussis. Knowledge on complement evasion strategies of this pathogen is limited. However, this is of great importance for future vaccine development as it has become apparent that a novel pertussis vaccine is needed. Here, we unravel the effect of Virulence associated gene 8 (Vag8) of B. pertussis on the human complement system at the molecular level. We show that both recombinant and endogenously secreted Vag8 inhibit complement deposition on the bacterial surface at the level of C4b. We reveal that Vag8 binding to human C1-inhibitor (C1-inh) interferes with the binding of C1-inh to C1s, C1r and MASP-2, resulting in the release of active proteases that subsequently cleave C2 and C4 away from the bacterial surface. We demonstrate that the depletion of these complement components in the bacterial surrounding and subsequent decreased deposition on B. pertussis leads to less complement-mediated bacterial killing. Vag8 is the first protein described that specifically prevents C1s, C1r and MASP-2 binding to C1-inh and thereby mediates complement consumption away from the bacterial surface. Unravelling the mechanism of this unique complement evasion strategy of B. pertussis is one of the first steps towards understanding the interactions between the first line of defense complement and B. pertussis.

  20. Theoretical Study of Indium Compounds of Interest for Organometallic Chemical Vapor Deposition (United States)

    Cardelino, B. H.; Moore, C. E.; Cardelino, C. A.; Frazier, D. O.; Backmann, K. J.


    The structural. electronic and therinochemical properties of indium compounds which are of interest in halide transport and organometallic chemical vapor deposition processes have been studied by ab initio and statistical mechanics methods. The compounds reported include: indium halides and hydrides (InF, InCl, InCl3, InH, InH2, InH3); indium clusters (In2, In3); methylindium, dimethylindium, and their hydrogen derivatives [In(CH3), In(CH3)H, In(CH3)H2, In(CH3)2, In(CH3)2H]; dimethyl-indium dimer [In2(CH3)4], trimethyl-indium [In(CH3)3]; dehydrogenated methyl, dimethyl and trimethylindium [In(CH3)2CH2, In(CH3)CH2, In(CH2)], trimethylindium adducts with ammonia, trimethylamine and hydrazine [(CH3)3In:NH3, (CH3)3In:N(CH3)3, (CH3)3In:N(H2)N(H2)]; dimethylamino-indium and methylimino-indium [In(CH3)2(NH2), In(CH3)(NH)]; indium nitride and indium nitride dimer (InN, In2N2), indium phosphide, arsenide and antimonide ([InP, InAs, InSb). The predicted electronic properties are based on density functional theory calculations; the calculated thermodynamic properties are reported following the format of the JANAF (Joint Army, Navy, NASA, Air Force) Tables. Equilibrium compositions at two temperatures (298 and 1000 K) have been analyzed for groups of competing simultaneous reactions.