WorldWideScience

Sample records for metabolic derangements myopathy

  1. Metabolic Myopathies.

    Tarnopolsky, Mark A

    2016-12-01

    Metabolic myopathies are genetic disorders that impair intermediary metabolism in skeletal muscle. Impairments in glycolysis/glycogenolysis (glycogen-storage disease), fatty acid transport and oxidation (fatty acid oxidation defects), and the mitochondrial respiratory chain (mitochondrial myopathies) represent the majority of known defects. The purpose of this review is to develop a diagnostic and treatment algorithm for the metabolic myopathies. The metabolic myopathies can present in the neonatal and infant period as part of more systemic involvement with hypotonia, hypoglycemia, and encephalopathy; however, most cases present in childhood or in adulthood with exercise intolerance (often with rhabdomyolysis) and weakness. The glycogen-storage diseases present during brief bouts of high-intensity exercise, whereas fatty acid oxidation defects and mitochondrial myopathies present during a long-duration/low-intensity endurance-type activity or during fasting or another metabolically stressful event (eg, surgery, fever). The clinical examination is often normal between acute events, and evaluation involves exercise testing, blood testing (creatine kinase, acylcarnitine profile, lactate, amino acids), urine organic acids (ketones, dicarboxylic acids, 3-methylglutaconic acid), muscle biopsy (histology, ultrastructure, enzyme testing), MRI/spectroscopy, and targeted or untargeted genetic testing. Accurate and early identification of metabolic myopathies can lead to therapeutic interventions with lifestyle and nutritional modification, cofactor treatment, and rapid treatment of rhabdomyolysis.

  2. [Metabolic myopathies].

    Papazian, Óscar; Rivas-Chacón, Rafael

    2013-09-06

    To review the metabolic myopathies manifested only by crisis of myalgias, cramps and rigidity of the muscles with decreased voluntary contractions and normal inter crisis neurologic examination in children and adolescents. These metabolic myopathies are autosomic recessive inherited enzymatic deficiencies of the carbohydrates and lipids metabolisms. The end result is a reduction of intra muscle adenosine triphosphate, mainly through mitochondrial oxidative phosphorylation, with decrease of available energy for muscle contraction. The one secondary to carbohydrates intra muscle metabolism disorders are triggered by high intensity brief (fatty acids metabolism disorders are triggered by low intensity prolonged (> 10 min) exercises. The conditions in the first group in order of decreasing frequency are the deficiencies of myophosforilase (GSD V), muscle phosphofructokinase (GSD VII), phosphoglycerate mutase 1 (GSD X) and beta enolase (GSD XIII). The conditions in the second group in order of decreasing frequency are the deficiencies of carnitine palmitoyl transferase II and very long chain acyl CoA dehydrogenase. The differential characteristics of patients in each group and within each group will allow to make the initial presumptive clinical diagnosis in the majority and then to order only the necessary tests to achieve the final diagnosis. Treatment during the crisis includes hydration, glucose and alkalinization of urine if myoglobin in blood and urine are elevated. Prevention includes avoiding exercise which may induce the crisis and fasting. The prognosis is good with the exception of rare cases of acute renal failure due to hipermyoglobinemia because of severe rabdomyolisis.

  3. Spectrum of metabolic myopathies.

    Angelini, Corrado

    2015-04-01

    Metabolic myopathies are disorders of utilization of carbohydrates or fat in muscles. The acute nature of energy failure is manifested either by a metabolic crisis with weakness, sometimes associated with respiratory failure, or by myoglobinuria. A typical disorder where permanent weakness occurs is glycogenosis type II (GSDII or Pompe disease) both in infantile and late-onset forms, where respiratory insufficiency is manifested by a large number of cases. In GSDII the pathogenetic mechanism is still poorly understood, and has to be attributed more to structural muscle alterations, possibly in correlation to macro-autophagy, rather than to energetic failure. This review is focused on recent advances about GSDII and its treatment, and the most recent notions about the management and treatment of other metabolic myopathies will be briefly reviewed, including glycogenosis type V (McArdle disease), glycogenosis type III (debrancher enzyme deficiency or Cori disease), CPT-II deficiency, and ETF-dehydrogenase deficiency (also known as riboflavin-responsive multiple acyl-CoA dehydrogenase deficiency or RR-MADD). The discovery of the genetic defect in ETF dehydrogenase confirms the etiology of this syndrome. Other metabolic myopathies with massive lipid storage and weakness are carnitine deficiency, neutral lipid storage-myopathy (NLSD-M), besides RR-MADD. Enzyme replacement therapy is presented with critical consideration and for each of the lipid storage disorders, representative cases and their response to therapy is included. This article is part of a Special Issue entitled: Neuromuscular Diseases: Pathology and Molecular Pathogenesis. Copyright © 2014. Published by Elsevier B.V.

  4. Exercise training in metabolic myopathies

    Vissing, J

    2016-01-01

    metabolic adaptations, such as increased dependence on glycogen use and a reduced capacity for fatty acid oxidation, which is detrimental in GSDs. Training has not been studied systematically in any FAODs and in just a few GSDs. However, studies on single bouts of exercise in most metabolic myopathies show......Metabolic myopathies encompass muscle glycogenoses (GSD) and disorders of muscle fat oxidation (FAOD). FAODs and GSDs can be divided into two main clinical phenotypes; those with static symptoms related to fixed muscle weakness and atrophy, and those with dynamic, exercise-related symptoms...... that are brought about by a deficient supply of ATP. Together with mitochondrial myopathies, metabolic myopathies are unique among muscle diseases, as the limitation in exercise performance is not solely caused by structural damage of muscle, but also or exclusively related to energy deficiency. ATP consumption...

  5. A diagnostic algorithm for metabolic myopathies.

    Berardo, Andres; DiMauro, Salvatore; Hirano, Michio

    2010-03-01

    Metabolic myopathies comprise a clinically and etiologically diverse group of disorders caused by defects in cellular energy metabolism, including the breakdown of carbohydrates and fatty acids to generate adenosine triphosphate, predominantly through mitochondrial oxidative phosphorylation. Accordingly, the three main categories of metabolic myopathies are glycogen storage diseases, fatty acid oxidation defects, and mitochondrial disorders due to respiratory chain impairment. The wide clinical spectrum of metabolic myopathies ranges from severe infantile-onset multisystemic diseases to adult-onset isolated myopathies with exertional cramps. Diagnosing these diverse disorders often is challenging because clinical features such as recurrent myoglobinuria and exercise intolerance are common to all three types of metabolic myopathy. Nevertheless, distinct clinical manifestations are important to recognize as they can guide diagnostic testing and lead to the correct diagnosis. This article briefly reviews general clinical aspects of metabolic myopathies and highlights approaches to diagnosing the relatively more frequent subtypes (Fig. 1). Fig. 1 Clinical algorithm for patients with exercise intolerance in whom a metabolic myopathy is suspected. CK-creatine kinase; COX-cytochrome c oxidase; CPT-carnitine palmitoyl transferase; cyt b-cytochrome b; mtDNA-mitochondrial DNA; nDNA-nuclear DNA; PFK-phosphofructokinase; PGAM-phosphoglycerate mutase; PGK-phosphoglycerate kinase; PPL-myophosphorylase; RRF-ragged red fibers; TFP-trifunctional protein deficiency; VLCAD-very long-chain acyl-coenzyme A dehydrogenase.

  6. Evidence-based treatment of metabolic myopathy

    Yan LIN

    2014-05-01

    Full Text Available Objective To evaluate the current treatments and possible adverse reactions of metabolic myopathy, and to develop the best solution for evidence-based treatment.  Methods Taking metabolic myopathy, mitochondrial myopathy, lipid storage myopathy, glycogen storage diseases, endocrine myopathy, drug toxicity myopathy and treatment as search terms, retrieve in databases such as PubMed, Cochrane Library, ClinicalKey database, National Science and Technology Library (NSTL, in order to collect the relevant literature database including clinical guidelines, systematic reviews (SR, randomized controlled trials (RCT, controlled clinical trials, retrospective case analysis and case study. Jadad Scale was used to evaluate the quality of literature.  Results Twenty-eight related articles were selected, including 6 clinical guidelines, 5 systematic reviews, 10 randomized controlled trials and 7 clinical controlled trials. According to Jadad Scale, 23 articles were evaluated as high-quality literature (≥ 4, and the remaining 5 were evaluated as low-quality literature (< 4. Treatment principles of these clinical trials, efficacy of different therapies and drug safety evaluation suggest that: 1 Acid α-glycosidase (GAA enzyme replacement therapy (ERT is the main treatment for glycogen storage diseases, with taking a high-protein diet, exercising before taking a small amount of fructose orally and reducing the patient's physical activity gradually. 2 Carnitine supplementation is used in the treatment of lipid storage myopathy, with carbohydrate and low fat diet provided before exercise or sports. 3 Patients with mitochondrial myopathy can take coenzyme Q10, vitamin B, vitamin K, vitamin C, etc. Proper aerobic exercise combined with strength training is safe, and it can also enhance the exercise tolerance of patients effectively. 4 The first choice to treat the endocrine myopathy is treating primary affection. 5 Myopathies due to drugs and toxins should

  7. Treatment Opportunities in Patients With Metabolic Myopathies

    Ørngreen, Mette Cathrine; Vissing, John

    2017-01-01

    the development of new therapeutic options. Enzyme replacement therapy with rGAA has revolutionized treatment of early onset Pompe disease. Supplements of riboflavin, carnitine, and sucrose show promise in patients with respectively riboflavin-responsive multiple acyl-CoA dehydrogenase deficiency, primary...... carnitine deficiency, and McArdle disease. Treatment with citric acid cycle intermediates supply by triheptanoin seems promising in patients with glucogenoses, and studies are ongoing in patients with McArdle disease. Summary Treatment of metabolic myopathies primarily relies on avoiding precipitating...

  8. Prenatal androgen excess programs metabolic derangements in pubertal female rats.

    Yan, Xiaonan; Dai, Xiaonan; Wang, Jing; Zhao, Nannan; Cui, Yugui; Liu, Jiayin

    2013-04-01

    Owing to the heterogeneity in the clinical symptoms of polycystic ovary syndrome (PCOS), the early pathophysiological mechanisms of PCOS remain unclear. Clinical, experimental, and genetic evidence supports an interaction between genetic susceptibility and the influence of maternal environment in the pathogenesis of PCOS. To determine whether prenatal androgen exposure induced PCOS-related metabolic derangements during pubertal development, we administrated 5α-dihydrotestosterone (DHT) in pregnant rats and observed their female offspring from postnatal 4 to 8 weeks. The prenatally androgenized (PNA) rats exhibited more numerous total follicles, cystic follicles, and atretic follicles than the controls. Fasting glucose, insulin, leptin levels, and homeostatic model assessment for insulin resistance were elevated in the PNA rats at the age of 5-8 weeks. Following intraperitoneal glucose tolerance tests, glucose and insulin levels did not differ between two groups; however, the PNA rats showed significantly higher 30- and 60-min glucose levels than the controls after insulin stimulation during 5-8 weeks. In addition, prenatal DHT treatment significantly decreased insulin-stimulated phosphorylation of AKT in the skeletal muscles of 6-week-old PNA rats. The abundance of IR substrate 1 (IRS1) and IRS2 was decreased in the skeletal muscles and liver after stimulation with insulin in the PNA group, whereas phosphorylation of insulin-signaling proteins was unaltered in the adipose tissue. These findings validate the contribution of prenatal androgen excess to metabolic derangements in pubertal female rats, and the impaired insulin signaling through IRS and AKT may result in the peripheral insulin resistance during pubertal development.

  9. Myopathies

    ... find appropri- ate therapists, and to locate and purchase important assistive devices. And today, people with disabilities ... in inheritable myopathies • Anesthesia: People with myopathies can experience a range of adverse reactions to certain anesthetic ...

  10. Myopathy

    ... alternating episodes of twitching and stiffness; and stiff-man syndrome: characterized by episodes of rigidity and reflex spasms common muscle cramps and stiffness, and tetany: characterized by prolonged spasms of the arms and legs × Definition The myopathies are neuromuscular disorders in which the ...

  11. Metabolic derangements in IUGR neonates detected at birth using ...

    M.A. Abd El-Wahed

    infancy and the metabolic syndrome during adulthood [4,5]. These consequences ... were obtained from parents or caregivers after explanation of the study purpose ... metabolism, primary bile acid biosynthesis, lysine degradation, pyrimidine ...

  12. Deranged Cardiac Metabolism and the Pathogenesis of Heart Failure

    2016-01-01

    Activation of the neuro-hormonal system is a pathophysiological consequence of heart failure. Neuro-hormonal activation promotes metabolic changes, such as insulin resistance, and determines an increased use of non-carbohydrate substrates for energy production. Fasting blood ketone bodies as well as fat oxidation are increased in patients with heart failure, yielding a state of metabolic inefficiency. The net result is additional depletion of myocardial adenosine triphosphate, phosphocreatine and creatine kinase levels with further decreased efficiency of mechanical work. In this context, manipulation of cardiac energy metabolism by modification of substrate use by the failing heart has produced positive clinical results. The results of current research support the concept that shifting the energy substrate preference away from fatty acid metabolism and towards glucose metabolism could be an effective adjunctive treatment in patients with heart failure. The additional use of drugs able to partially inhibit fatty acids oxidation in patients with heart failure may therefore yield a significant protective effect for clinical symptoms and cardiac function improvement, and simultaneously ameliorate left ventricular remodelling. Certainly, to clarify the exact therapeutic role of metabolic therapy in heart failure, a large multicentre, randomised controlled trial should be performed. PMID:28785448

  13. Nutritional and Metabolic Derangements in Pancreatic Cancer and Pancreatic Resection.

    Gilliland, Taylor M; Villafane-Ferriol, Nicole; Shah, Kevin P; Shah, Rohan M; Tran Cao, Hop S; Massarweh, Nader N; Silberfein, Eric J; Choi, Eugene A; Hsu, Cary; McElhany, Amy L; Barakat, Omar; Fisher, William; Van Buren, George

    2017-03-07

    Pancreatic cancer is an aggressive malignancy with a poor prognosis. The disease and its treatment can cause significant nutritional impairments that often adversely impact patient quality of life (QOL). The pancreas has both exocrine and endocrine functions and, in the setting of cancer, both systems may be affected. Pancreatic exocrine insufficiency (PEI) manifests as weight loss and steatorrhea, while endocrine insufficiency may result in diabetes mellitus. Surgical resection, a central component of pancreatic cancer treatment, may induce or exacerbate these dysfunctions. Nutritional and metabolic dysfunctions in patients with pancreatic cancer lack characterization, and few guidelines exist for nutritional support in patients after surgical resection. We reviewed publications from the past two decades (1995-2016) addressing the nutritional and metabolic status of patients with pancreatic cancer, grouping them into status at the time of diagnosis, status at the time of resection, and status of nutritional support throughout the diagnosis and treatment of pancreatic cancer. Here, we summarize the results of these investigations and evaluate the effectiveness of various types of nutritional support in patients after pancreatectomy for pancreatic adenocarcinoma (PDAC). We outline the following conservative perioperative strategies to optimize patient outcomes and guide the care of these patients: (1) patients with albumin 10% should postpone surgery and begin aggressive nutrition supplementation; (2) patients with albumin endocrine and exocrine pancreatic insufficiency alongside implementation of appropriate treatment to improve the patient's quality of life.

  14. Nutritional and Metabolic Derangements in Pancreatic Cancer and Pancreatic Resection

    Taylor M. Gilliland

    2017-03-01

    Full Text Available Pancreatic cancer is an aggressive malignancy with a poor prognosis. The disease and its treatment can cause significant nutritional impairments that often adversely impact patient quality of life (QOL. The pancreas has both exocrine and endocrine functions and, in the setting of cancer, both systems may be affected. Pancreatic exocrine insufficiency (PEI manifests as weight loss and steatorrhea, while endocrine insufficiency may result in diabetes mellitus. Surgical resection, a central component of pancreatic cancer treatment, may induce or exacerbate these dysfunctions. Nutritional and metabolic dysfunctions in patients with pancreatic cancer lack characterization, and few guidelines exist for nutritional support in patients after surgical resection. We reviewed publications from the past two decades (1995–2016 addressing the nutritional and metabolic status of patients with pancreatic cancer, grouping them into status at the time of diagnosis, status at the time of resection, and status of nutritional support throughout the diagnosis and treatment of pancreatic cancer. Here, we summarize the results of these investigations and evaluate the effectiveness of various types of nutritional support in patients after pancreatectomy for pancreatic adenocarcinoma (PDAC. We outline the following conservative perioperative strategies to optimize patient outcomes and guide the care of these patients: (1 patients with albumin < 2.5 mg/dL or weight loss > 10% should postpone surgery and begin aggressive nutrition supplementation; (2 patients with albumin < 3 mg/dL or weight loss between 5% and 10% should have nutrition supplementation prior to surgery; (3 enteral nutrition (EN should be preferred as a nutritional intervention over total parenteral nutrition (TPN postoperatively; and, (4 a multidisciplinary approach should be used to allow for early detection of symptoms of endocrine and exocrine pancreatic insufficiency alongside implementation of

  15. Potential utility of combination therapy with nateglinide and telmisartan for metabolic derangements in Zucker Fatty rats.

    Kajioka, T; Miura, K; Kitahara, Y; Yamagishi, S

    2007-12-01

    The metabolic syndrome is strongly associated with insulin resistance and has been recognized as a cluster of risk factors for cardiovascular disease. Insulin resistance and/or impaired early-phase insulin secretion are major determinants of postprandial hyperglycemia. In this study, we investigated the potential utility of combination therapy with telmisartan, an angiotensin II receptor blocker and nateglinide, a rapid-onset/short-duration insulinotropic agent, for the treatment of postprandial hyperglycemia and metabolic derangements in Zucker Fatty (ZF) rats. ZF rats fed twice daily were given vehicle, 50 mg/kg of nateglinide, 5 mg/kg of telmisartan, or both for 6 weeks. Combination therapy with nateglinide and telmisartan for 2 weeks ameliorated postprandial hyperglycemia in ZF rats fed twice daily. Furthermore, 6-week treatment with nateglinide and telmisartan not only decreased fasting plasma insulin, triglycerides, and free fatty acid levels, but also improved the responses of blood glucose to insulin and subsequently reduced the decremental glucose areas under the curve in the ZF rats. Combination therapy also restored the decrease of plasma adiponectin levels in the ZF rats. Monotherapy with nateglinide or telmisartan alone didnot significantly improve these metabolic parameters. These observations demonstrate that combination therapy with nateglinide and telmisartan may improve the metabolic derangements by ameliorating early phase of insulin secretion as well as insulin resistance in ZF rats fed twice daily. Our present findings suggest that the combination therapy with nateglinide and telmisartan could be a promising therapeutic strategy for the treatment of the metabolic syndrome.

  16. A Case of Chronic Ethylene Glycol Intoxication Presenting without Classic Metabolic Derangements

    Stephanie M. Toth-Manikowski

    2014-01-01

    Full Text Available Acute ethylene glycol ingestion classically presents with high anion gap acidosis, elevated osmolar gap, altered mental status, and acute renal failure. However, chronic ingestion of ethylene glycol is a challenging diagnosis that can present as acute kidney injury with subtle physical findings and without the classic metabolic derangements. We present a case of chronic ethylene glycol ingestion in a patient who presented with acute kidney injury and repeated denials of an exposure history. Kidney biopsy was critical to the elucidation of the cause of his worsening renal function.

  17. Pharmacologic modulation of cerebral metabolic derangement and excitotoxicity in a porcine model of traumatic brain injury and hemorrhagic shock

    Hwabejire, John O; Jin, Guang; Imam, Ayesha M

    2013-01-01

    Cerebral metabolic derangement and excitotoxicity play critical roles in the evolution of traumatic brain injury (TBI). We have shown previously that treatment with large doses of valproic acid (VPA) decreases the size of brain lesion. The goal of this experiment was to determine whether...

  18. [Rhabdomyolysis - may it be a metabolic myopathy? Case report and diagnostic algorithm].

    Sebők, Ágnes; Pál, Endre; Molnár, Gergő Attila; Wittmann, István; Berenténé Bene, Judit; Melegh, Béla; Komoly, Sámuel; Hidvégi, Tibor; Balogh, Lídia; Szabó, Attila; Zsidegh, Petra

    2017-11-01

    We report the case of a 46-year-old female patient with recurrent rhabdomyolysis. In the background of her metabolic myopathy an inherited metabolic disorder of the fatty acid oxidation, very long-chain acyl-coenzyme A-dehydrogenase deficiency was diagnosed. The diagnosis was based on abnormal acyl-carnitine- and urine organic-acid profile in addition to low residual enzyme activity, and was confirmed by genetic testing. After introduction of dietotherapy metabolic crisis necessitating hospital admission has not occurred neither have fixed myopathic changes developed. We present here the differential diagnosis of rhabdomyolysis and exertional muscle complaints, with the metabolic myopathies in focus. The main features of fatty acid oxidation disorders are highlighted, acute and chronic managements of very long-chain acyl-coenzyme A-dehydrogenase deficiency are discussed. Metabolic myopathies respond well to treatment, so good quality of life can be achieved. However, especially in fatty acid oxidation disorders, a metabolic crisis may develop quickly and can be fatal, albeit rarely. Some of these disorders can be identified by newborn screening, but occasionally the symptoms may manifest only in adulthood. With the presentation of this case we would like to point out that in the differential diagnosis of recurrent rhabdomyolysis inherited metabolic disorders should be considered regardless of the patient's age. Orv Hetil. 2017; 158(46): 1873-1882.

  19. Enterovirus related metabolic myopathy: a postviral fatigue syndrome

    Lane, R; Soteriou, B; Zhang, H; Archard, L

    2003-01-01

    Objective: To detect and characterise enterovirus RNA in skeletal muscle from patients with chronic fatigue syndrome (CFS) and to compare efficiency of muscle energy metabolism in enterovirus positive and negative CFS patients.

  20. Lactate metabolism during exercise in patients with mitochondrial myopathy

    Jeppesen, Tina Dysgaard; Ørngreen, Mette Cathrine; van Hall, Gerrit

    2013-01-01

    Patients with mitochondrial DNA mutations often have elevated plasma lactate at rest and during exercise, but it is unknown whether the high lactate levels are caused by a high production, an impaired oxidation or a combination. We studied lactate kinetics in 10 patients with mtDNA mutations and 10...... matched healthy control subjects at rest and during cycle exercise with a combination of femoral arterio-venous differences of lactate, and lactate tracer dilution methodology. During exercise, lactate concentration and production rates were several-fold higher in patients, but despite mitochondrial...... is not solely an indicator of impaired oxidative capacity, but an important fuel for oxidative metabolism, even in muscle with severely impaired mitochondrial function....

  1. Metabolic Myopathies

    ... OII) Timed Up & Go (TUG) Western Ontario & McMaster Universities Osteoarthritis Index (WOMAC) Young Investigators Resources for Doctoral Students/Post-Doctoral Fellows Evidence-Based Practice for Academic Researchers Responsible Data Management in Research Career Planning Treatments Patient ...

  2. A Nonsense Variant in the ACADVL Gene in German Hunting Terriers with Exercise Induced Metabolic Myopathy

    Vincent Lepori

    2018-05-01

    Full Text Available Several enzymes are involved in fatty acid oxidation, which is a key process in mitochondrial energy production. Inherited defects affecting any step of fatty acid oxidation can result in clinical disease. We present here an extended family of German Hunting Terriers with 10 dogs affected by clinical signs of exercise induced weakness, muscle pain, and suspected rhabdomyolysis. The combination of clinical signs, muscle histopathology and acylcarnitine analysis with an elevated tetradecenoylcarnitine (C14:1 peak suggested a possible diagnosis of acyl-CoA dehydrogenase very long chain deficiency (ACADVLD. Whole genome sequence analysis of one affected dog and 191 controls revealed a nonsense variant in the ACADVL gene encoding acyl-CoA dehydrogenase very long chain, c.1728C>A or p.(Tyr576*. The variant showed perfect association with the phenotype in the 10 affected and more than 500 control dogs of various breeds. Pathogenic variants in the ACADVL gene have been reported in humans with similar myopathic phenotypes. We therefore considered the detected variant to be the most likely candidate causative variant for the observed exercise induced myopathy. To our knowledge, this is the first description of this disease in dogs, which we propose to name exercise induced metabolic myopathy (EIMM, and the identification of the first canine pathogenic ACADVL variant. Our findings provide a large animal model for a known human disease and will enable genetic testing to avoid the unintentional breeding of affected offspring.

  3. A Nonsense Variant in the ACADVL Gene in German Hunting Terriers with Exercise Induced Metabolic Myopathy.

    Lepori, Vincent; Mühlhause, Franziska; Sewell, Adrian C; Jagannathan, Vidhya; Janzen, Nils; Rosati, Marco; Alves de Sousa, Filipe Miguel Maximiano; Tschopp, Aurélie; Schüpbach, Gertraud; Matiasek, Kaspar; Tipold, Andrea; Leeb, Tosso; Kornberg, Marion

    2018-05-04

    Several enzymes are involved in fatty acid oxidation, which is a key process in mitochondrial energy production. Inherited defects affecting any step of fatty acid oxidation can result in clinical disease. We present here an extended family of German Hunting Terriers with 10 dogs affected by clinical signs of exercise induced weakness, muscle pain, and suspected rhabdomyolysis. The combination of clinical signs, muscle histopathology and acylcarnitine analysis with an elevated tetradecenoylcarnitine (C14:1) peak suggested a possible diagnosis of acyl-CoA dehydrogenase very long chain deficiency (ACADVLD). Whole genome sequence analysis of one affected dog and 191 controls revealed a nonsense variant in the ACADVL gene encoding acyl-CoA dehydrogenase very long chain, c.1728C>A or p.(Tyr576*). The variant showed perfect association with the phenotype in the 10 affected and more than 500 control dogs of various breeds. Pathogenic variants in the ACADVL gene have been reported in humans with similar myopathic phenotypes. We therefore considered the detected variant to be the most likely candidate causative variant for the observed exercise induced myopathy. To our knowledge, this is the first description of this disease in dogs, which we propose to name exercise induced metabolic myopathy (EIMM), and the identification of the first canine pathogenic ACADVL variant. Our findings provide a large animal model for a known human disease and will enable genetic testing to avoid the unintentional breeding of affected offspring. Copyright © 2018 Lepori et al.

  4. Myopathy in acute hypothyroidism

    Ma, JTC; Yu, YL; Kung, AWC

    1987-01-01

    Hypothyroid myopathy has so far been reported in long standing cases of hypothyroidism. We describe two adult patients with myopathy associated with acute transient hypothyroidism. Both presented with severe muscle aches and cramps, stiffness and spasms. Muscle enzymes were markedly elevated and electromyography in one patient showed myopathic features. Histological changes were absent in muscle biopsy, probably because of the short duration of metabolic disturbance. The myopathy subsided pro...

  5. Myopathy in acute hypothyroidism.

    Kung, A. W.; Ma, J. T.; Yu, Y. L.; Wang, C. C.; Woo, E. K.; Lam, K. S.; Huang, C. Y.; Yeung, R. T.

    1987-01-01

    Hypothyroid myopathy has so far been reported in long standing cases of hypothyroidism. We describe two adult patients with myopathy associated with acute transient hypothyroidism. Both presented with severe muscle aches and cramps, stiffness and spasms. Muscle enzymes were markedly elevated and electromyography in one patient showed myopathic features. Histological changes were absent in muscle biopsy, probably because of the short duration of metabolic disturbance. The myopathy subsided pro...

  6. Systemic metabolic derangement, pulmonary effects, and insulin insufficiency following subchronic ozone exposure in rats

    Miller, Desinia B.; Snow, Samantha J.; Henriquez, Andres; Schladweiler, Mette C.; Ledbetter, Allen D.; Richards, Judy E.; Andrews, Debora L.; Kodavanti, Urmila P.

    2016-01-01

    Acute ozone exposure induces a classical stress response with elevated circulating stress hormones along with changes in glucose, protein and lipid metabolism in rats, with similar alterations in ozone-exposed humans. These stress-mediated changes over time have been linked to insulin resistance. We hypothesized that acute ozone-induced stress response and metabolic impairment would persist during subchronic episodic exposure and induce peripheral insulin resistance. Male Wistar Kyoto rats were exposed to air or 0.25 ppm or 1.00 ppm ozone, 5 h/day, 3 consecutive days/week (wk) for 13 wks. Pulmonary, metabolic, insulin signaling and stress endpoints were determined immediately after 13 wk or following a 1 wk recovery period (13 wk + 1 wk recovery). We show that episodic ozone exposure is associated with persistent pulmonary injury and inflammation, fasting hyperglycemia, glucose intolerance, as well as, elevated circulating adrenaline and cholesterol when measured at 13 wk, however, these responses were largely reversible following a 1 wk recovery. Moreover, the increases noted acutely after ozone exposure in non-esterified fatty acids and branched chain amino acid levels were not apparent following a subchronic exposure. Neither peripheral or tissue specific insulin resistance nor increased hepatic gluconeogenesis were present after subchronic ozone exposure. Instead, long-term ozone exposure lowered circulating insulin and severely impaired glucose-stimulated beta-cell insulin secretion. Thus, our findings in young-adult rats provide potential insights into epidemiological studies that show a positive association between ozone exposures and type 1 diabetes. Ozone-induced beta-cell dysfunction may secondarily contribute to other tissue-specific metabolic alterations following chronic exposure due to impaired regulation of glucose, lipid, and protein metabolism. - Highlights: • Subchronic episodic ozone exposure caused pulmonary and metabolic effects. • These

  7. Systemic metabolic derangement, pulmonary effects, and insulin insufficiency following subchronic ozone exposure in rats

    Miller, Desinia B. [Curriculum in Toxicology, University of North Carolina-Chapel Hill, Chapel Hill, North Carolina (United States); Snow, Samantha J. [Environmental Public Health Division, National Health and Environmental Effects Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Henriquez, Andres [Curriculum in Toxicology, University of North Carolina-Chapel Hill, Chapel Hill, North Carolina (United States); Schladweiler, Mette C.; Ledbetter, Allen D.; Richards, Judy E.; Andrews, Debora L. [Environmental Public Health Division, National Health and Environmental Effects Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Kodavanti, Urmila P., E-mail: kodavanti.urmila@epa.gov [Environmental Public Health Division, National Health and Environmental Effects Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States)

    2016-09-01

    Acute ozone exposure induces a classical stress response with elevated circulating stress hormones along with changes in glucose, protein and lipid metabolism in rats, with similar alterations in ozone-exposed humans. These stress-mediated changes over time have been linked to insulin resistance. We hypothesized that acute ozone-induced stress response and metabolic impairment would persist during subchronic episodic exposure and induce peripheral insulin resistance. Male Wistar Kyoto rats were exposed to air or 0.25 ppm or 1.00 ppm ozone, 5 h/day, 3 consecutive days/week (wk) for 13 wks. Pulmonary, metabolic, insulin signaling and stress endpoints were determined immediately after 13 wk or following a 1 wk recovery period (13 wk + 1 wk recovery). We show that episodic ozone exposure is associated with persistent pulmonary injury and inflammation, fasting hyperglycemia, glucose intolerance, as well as, elevated circulating adrenaline and cholesterol when measured at 13 wk, however, these responses were largely reversible following a 1 wk recovery. Moreover, the increases noted acutely after ozone exposure in non-esterified fatty acids and branched chain amino acid levels were not apparent following a subchronic exposure. Neither peripheral or tissue specific insulin resistance nor increased hepatic gluconeogenesis were present after subchronic ozone exposure. Instead, long-term ozone exposure lowered circulating insulin and severely impaired glucose-stimulated beta-cell insulin secretion. Thus, our findings in young-adult rats provide potential insights into epidemiological studies that show a positive association between ozone exposures and type 1 diabetes. Ozone-induced beta-cell dysfunction may secondarily contribute to other tissue-specific metabolic alterations following chronic exposure due to impaired regulation of glucose, lipid, and protein metabolism. - Highlights: • Subchronic episodic ozone exposure caused pulmonary and metabolic effects. • These

  8. Detection of regional derangements in myocardial metabolism by positron computed tomography in Duchenne's muscular dystrophy

    Henze, E.; Schelbert, H.R.; Perloff, J.K.; Schwaiger, M.; Phelps, M.E.

    1982-01-01

    Duchenne's Muscular Dystrophy is unique in genetically targeting for disease a specific region of myocardium: the postero-basal left ventricular wall. Postmortem examinations revealed focal fibrous degenerations in the postero-basal segment, while the coronary arteries were usually not affected. A predystrophic metabolic fault has been postulated for this region. This hypothesis was tested with positron computed tomography as a new means for the noninvasive study of regional myocadial perfusion and metabolism and to determine the incidence of regional and global left ventricular dysfunction and perfusion abnormalities using Thallium-201 and gated blood pool imaging. Myocardial perfusion was evaluated with N-13 ammonia while regional myocardial glucose uptake was studied with the glucose analog F-18 DG. The sensitivity of each diagnostic test for detecting cardiac involvement in Duchenne's Muscular Dystrophy was evaluated. It was highest for ammonia and glucose imaging and it was low for Thallium and radionuclide blood pool imaging

  9. Tryptophan metabolism in tsetse flies and the consequences of its derangement

    R. H. Gooding

    1987-01-01

    Full Text Available Literature comparing salmon and wild type Glossina morsitans morsitans and that comparing tan and wild type Glossina palpalis palpalis is reviewed. New information is presented on behaviour and biochemistry of salmon and wild type G. m. morsitans. The eye color mutants result from two lesions in the tryptophan to xanthommatin pathway: lack of tryptophan oxygenase in G. m morsitans and failure to produce or retain xanthommatin in eyes (but not in testes of G. p. palpalis. The salmon allele in G. m. morsitans is pleiotropic and profoundly affects many aspects of fly biology including longevity, reproductive capacity, vision, vectorial capacity and duration of flight, but not circadian rhythms. The tan allele in G. p. palpalis has little effect upon the biology of flies under laboratory conditions, except that tan flies appear less active than normal. Adult tsetse flies metabolize tryptophan to kynurenine which is excreted; fluctuations in activities of the enzymes producing kynurenine suggest this pathway is under metabolic control.

  10. Obesity-metabolic derangement exacerbates cardiomyocyte loss distal to moderate coronary artery stenosis in pigs without affecting global cardiac function.

    Li, Zi-Lun; Ebrahimi, Behzad; Zhang, Xin; Eirin, Alfonso; Woollard, John R; Tang, Hui; Lerman, Amir; Wang, Shen-Ming; Lerman, Lilach O

    2014-04-01

    Obesity associated with metabolic derangements (ObM) worsens the prognosis of patients with coronary artery stenosis (CAS), but the underlying cardiac pathophysiologic mechanisms remain elusive. We tested the hypothesis that ObM exacerbates cardiomyocyte loss distal to moderate CAS. Obesity-prone pigs were randomized to four groups (n = 6 each): lean-sham, ObM-sham, lean-CAS, and ObM-CAS. Lean and ObM pigs were maintained on a 12-wk standard or atherogenic diet, respectively, and left circumflex CAS was then induced by placing local-irritant coils. Cardiac structure, function, and myocardial oxygenation were assessed 4 wk later by computed-tomography and blood oxygenation level dependent (BOLD) MRI, the microcirculation with micro-computed-tomography, and injury mechanisms by immunoblotting and histology. ObM pigs showed obesity, dyslipidemia, and insulin resistance. The degree of CAS (range, 50-70%) was similar in lean and ObM pigs, and resting myocardial perfusion and global cardiac function remained unchanged. Increased angiogenesis distal to the moderate CAS observed in lean was attenuated in ObM pigs, which also showed microvascular dysfunction and increased inflammation (M1-macrophages, TNF-α expression), oxidative stress (gp91), hypoxia (BOLD-MRI), and fibrosis (Sirius-red and trichrome). Furthermore, lean-CAS showed increased myocardial autophagy, which was blunted in ObM pigs (downregulated expression of unc-51-like kinase-1 and autophagy-related gene-12; P < 0.05 vs. lean CAS) and associated with marked apoptosis. The interaction diet xstenosis synergistically inhibited angiogenic, autophagic, and fibrogenic activities. ObM exacerbates structural and functional myocardial injury distal to moderate CAS with preserved myocardial perfusion, possibly due to impaired cardiomyocyte turnover.

  11. Neutral lipid storage disease with myopathy: A whole-body nuclear MRI and metabolic study

    Laforet, Pascal; Stojkovic, Tanya; Wahbi, Karim; Eymard, Bruno; Bassez, Guillaume; Carlier, Pierre G.; Clement, Karine; Petit, Francois M.; Carlier, Robert-Yves

    2013-01-01

    Neutral lipid storage disease with myopathy (NLSDM) is caused by a mutation in the gene encoding adipose triglyceride lipase (ATGL), and is characterized by the presence of numerous triglyceride-containing cytoplasmic droplets in type I muscle fibers. Major clinical manifestations concern the heart and skeletal muscle, and some patients also present diabetes mellitus. We report the clinical, metabolic, and whole-body nuclear magnetic resonance imaging findings of three patients with NLSDM. Muscle MRI study was consistent with previous descriptions, and allowed to show a common pattern of fatty replacement. Muscle changes predominated in the paravertebral muscles, both compartments of legs, and posterior compartment of the thighs. A more variable distribution of muscle involvement was observed on upper limbs, with marked asymmetry in one patient, and alterations predominating on supra and infra spinatus, biceps brachialis and anterior compartment of arms. Cardiac NMR studies revealed anomalies despite normal echocardiography in two patients. Endocrine studies showed low leptin and adiponectine levels, a moderate increase in insulin levels at fasting state, and even greater increase after oral glucose tolerance test in one patient. Two patients had elevated triglycerides and low cholesterol-HDL. Based on these analyses, regular control of cardio-metabolic risks appear mandatory in the clinical follow-up of these subjects. (authors)

  12. Neutral lipid storage disease with myopathy: A whole-body nuclear MRI and metabolic study

    Laforet, Pascal; Stojkovic, Tanya; Wahbi, Karim; Eymard, Bruno [AP-HP, Centre de Reference de pathologie neuromusculaire Paris-Est, Groupe Hospitalier Pitie-Salpetriere, Assistance Publique-Hopitaux de Paris, Paris, (France); Bassez, Guillaume [AP-HP, Centre de Reference de Pathologie Neuromusculaire Paris-Ouest, CHU Henri Mondor, Creteil, (France); Carlier, Pierre G. [CEA, I2BM, MIRCen, IdM NMR Laboratory, T-75651 Paris, (France); Clement, Karine [AP-HP, Institute of Cardiometabolism and Nutrition, ICAN, Pitie-Salpetriere Hospital, University Pierre et Marie-Curie Paris6, Paris, INSERM, U872 team 7, Paris, (France); Petit, Francois M. [AP-HP, Molecular Genetics and Metabolic Diseases Laboratory, Antoine Beclere Hospital, Clamart, (France); Carlier, Robert-Yves [AP-HP, Departement d' imagerie Medicale et Centre d' innovation Technologique, CHU Raymond-Poincare, Garches, (France)

    2013-07-01

    Neutral lipid storage disease with myopathy (NLSDM) is caused by a mutation in the gene encoding adipose triglyceride lipase (ATGL), and is characterized by the presence of numerous triglyceride-containing cytoplasmic droplets in type I muscle fibers. Major clinical manifestations concern the heart and skeletal muscle, and some patients also present diabetes mellitus. We report the clinical, metabolic, and whole-body nuclear magnetic resonance imaging findings of three patients with NLSDM. Muscle MRI study was consistent with previous descriptions, and allowed to show a common pattern of fatty replacement. Muscle changes predominated in the paravertebral muscles, both compartments of legs, and posterior compartment of the thighs. A more variable distribution of muscle involvement was observed on upper limbs, with marked asymmetry in one patient, and alterations predominating on supra and infra spinatus, biceps brachialis and anterior compartment of arms. Cardiac NMR studies revealed anomalies despite normal echocardiography in two patients. Endocrine studies showed low leptin and adiponectine levels, a moderate increase in insulin levels at fasting state, and even greater increase after oral glucose tolerance test in one patient. Two patients had elevated triglycerides and low cholesterol-HDL. Based on these analyses, regular control of cardio-metabolic risks appear mandatory in the clinical follow-up of these subjects. (authors)

  13. Fat and Sugar Metabolism During Exercise in Patients With Metabolic Myopathy

    2017-08-31

    Metabolism, Inborn Errors; Lipid Metabolism, Inborn Errors; Carbohydrate Metabolism, Inborn Errors; Long-Chain 3-Hydroxyacyl-CoA Dehydrogenase Deficiency; Glycogenin-1 Deficiency (Glycogen Storage Disease Type XV); Carnitine Palmitoyl Transferase 2 Deficiency; VLCAD Deficiency; Medium-chain Acyl-CoA Dehydrogenase Deficiency; Multiple Acyl-CoA Dehydrogenase Deficiency; Carnitine Transporter Deficiency; Neutral Lipid Storage Disease; Glycogen Storage Disease Type II; Glycogen Storage Disease Type III; Glycogen Storage Disease Type IV; Glycogen Storage Disease Type V; Muscle Phosphofructokinase Deficiency; Phosphoglucomutase 1 Deficiency; Phosphoglycerate Mutase Deficiency; Phosphoglycerate Kinase Deficiency; Phosphorylase Kinase Deficiency; Beta Enolase Deficiency; Lactate Dehydrogenase Deficiency; Glycogen Synthase Deficiency

  14. Stepwise approach to myopathy in systemic disease.

    Chawla, Jasvinder

    2011-01-01

    Muscle diseases can constitute a large variety of both acquired and hereditary disorders. Myopathies in systemic disease results from several different disease processes including endocrine, inflammatory, paraneoplastic, infectious, drug- and toxin-induced, critical illness myopathy, metabolic, and myopathies with other systemic disorders. Patients with systemic myopathies often present acutely or sub acutely. On the other hand, familial myopathies or dystrophies generally present in a chronic fashion with exceptions of metabolic myopathies where symptoms on occasion can be precipitated acutely. Most of the inflammatory myopathies can have a chance association with malignant lesions; the incidence appears to be specifically increased only in patients with dermatomyositis. In dealing with myopathies associated with systemic illnesses, the focus will be on the acquired causes. Management is beyond the scope of this chapter. Prognosis is based upon the underlying cause and, most of the time, carries a good prognosis. In order to approach a patient with suspected myopathy from systemic disease, a stepwise approach is utilized.

  15. Muscle regeneration in mitochondrial myopathies

    Krag, T O; Hauerslev, S; Jeppesen, T D

    2013-01-01

    Mitochondrial myopathies cover a diverse group of disorders in which ragged red and COX-negative fibers are common findings on muscle morphology. In contrast, muscle degeneration and regeneration, typically found in muscular dystrophies, are not considered characteristic features of mitochondrial...... myopathies. We investigated regeneration in muscle biopsies from 61 genetically well-defined patients affected by mitochondrial myopathy. Our results show that the perturbed energy metabolism in mitochondrial myopathies causes ongoing muscle regeneration in a majority of patients, and some were even affected...

  16. Endocrine myopathy: Case-based review

    Babul Reddy Hanmayyagari

    2016-01-01

    Full Text Available Endocrine myopathy means muscle weakness in the presence of an abnormal endocrine state. Most of the endocrine disorders are associated with myopathy and it is usually reversible with correction of the underlying disturbance, though, there is an increasing knowledge of the metabolic effects of hormones, endocrine myopathy is a less recognized and often overlooked entity in clinical practice. Here, we describe this association in three of our patients, then, we discuss systematically about endocrine myopathy.

  17. DISTAL MYOPATHIES

    Dimachkie, Mazen M.; Barohn, Richard J.

    2014-01-01

    Over a century ago, Gowers described two young patients in whom distal muscles weakness involved the hand, foot, sternocleidomastoid, and facial muscles in the other case the shoulder and distal leg musculature. Soon after, , similar distal myopathy cases were reported whereby the absence of sensory symptoms and of pathologic changes in the peripheral nerves and spinal cord at postmortem examination allowed differentiation from Charcot-Marie-Tooth disease. In 1951, Welander described autosomal dominant (AD) distal arm myopathy in a large Scandanavian cohort. Since then the number of well-characterized distal myopathies has continued to grow such that the distal myopathies have formed a clinically and genetically heterogeneous group of disorders. Affected kindred commonly manifest weakness that is limited to foot and toe muscles even in advanced stages of the disease, with variable mild proximal leg, distal arm, neck and laryngeal muscle involvement in selected individuals. An interesting consequence of the molecular characterization of the distal myopathies has been the recognition that mutation in a single gene can lead to more than one clinical disorder. For example, Myoshi myopathy (MM) and limb girdle muscular dystrophy (LGMD) type 2B are allelic disorders due to defects in the gene that encodes dysferlin. The six well described distal myopathy syndromes are shown in Table 1. Table 2 lists advances in our understanding of the myofibrillar myopathy group and Table 3 includes more recently delineated and less common distal myopathies. In the same manner, the first section of this review pertains to the more traditional six distal myopathies followed by discussion of the myofibrillar myopathies. In the third section, we review other clinically and genetically distinctive distal myopathy syndromes usually based upon single or smaller family cohorts. The fourth section considers other neuromuscular disorders that are important to recognize as they display prominent

  18. Axial myopathy

    Witting, Nanna; Andersen, Linda K; Vissing, John

    2016-01-01

    Classically, myopathies are categorized according to limb or cranial nerve muscle affection, but with the growing use of magnetic resonance imaging it has become evident that many well-known myopathies have significant involvement of the axial musculature. New disease entities with selective axial...

  19. Carnitine supplementation alleviates lipid metabolism derangements and protects against oxidative stress in non-obese hereditary hypertriglyceridemic rats

    Cahová, M.; Chrastina, P.; Hansíková, H.; Drahota, Zdeněk; Trnovská, J.; Škop, V.; Spáčilová, J.; Malínská, H.; Oliyarnyk, O.; Papáčková, Z.; Páleníčková, E.; Kazdová, L.

    2015-01-01

    Roč. 40, č. 3 (2015), s. 280-291 ISSN 1715-5312 R&D Projects: GA MŠk(CZ) LL1204; GA ČR(CZ) GB14-36804G Institutional support: RVO:67985823 Keywords : metabolic syndrome * insulin resistance * antioxidant * liver steatosis * mass spectrometry Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.910, year: 2015

  20. Cerebrovascular Accidents In Myopathies

    Farzad Fatehi

    2017-02-01

    Full Text Available Several types of stroke in myopathies are described: ischemic, metabolic, or cryptogenic. Ischemic stroke may be categorized as cardioembolic, angiopathic, hemodynamic, or thrombophilic. Cardiac involvement in the form of atrial fibrillation/flutter, dilated cardiomyopathy, or non-compaction Cardioembolic could ensue in stroke. Angiopathic stroke occurs provided that there is atherosclerosis or mitochondrial disorders. Thrombophilic stroke may happen in polymyositis or dermatomyositis along with anti-phospholipid syndrome. Metabolic stroke usually manifests as stroke-like episode and is a distinct feature of various mitochondrial disorders, principally MELAS syndrome. The clinical manifestations are as a result of a vasogenic edema, demonstrating as hyperintensity on T2, DWI, and apparent diffusion coefficient mapping. Differentiation between ischemic and metabolic stroke is essential in terms of diagnosis, therapy, and prognosis. In conclusion, ischemic stroke attributable to cardioembolism, arteriopathy, or thrombophilia are occasional events in myopathies, but metabolic stroke is a frequent feature of mitochondrial disorders.

  1. Fatty liver associated with metabolic derangement in patients with chronic kidney disease: A controlled attenuation parameter study

    Chang-Yun Yoon

    2017-03-01

    Full Text Available Background: Hepatic steatosis measured with controlled attenuation parameter (CAP using transient elastography predicts metabolic syndrome in the general population. We investigated whether CAP predicted metabolic syndrome in chronic kidney disease patients. Methods: CAP was measured with transient elastography in 465 predialysis chronic kidney disease patients (mean age, 57.5 years. Results: The median CAP value was 239 (202–274 dB/m. In 195 (41.9% patients with metabolic syndrome, diabetes mellitus was more prevalent (105 [53.8%] vs. 71 [26.3%], P < 0.001, with significantly increased urine albumin-to-creatinine ratio (184 [38–706] vs. 56 [16–408] mg/g Cr, P = 0.003, high sensitivity C-reactive protein levels (5.4 [1.4–28.2] vs. 1.7 [0.6–9.9] mg/L, P < 0.001, and CAP (248 [210–302] vs. 226 [196–259] dB/m, P < 0.001. In multiple linear regression analysis, CAP was independently related to body mass index (β = 0.742, P < 0.001, triglyceride levels (β = 2.034, P < 0.001, estimated glomerular filtration rate (β = 0.316, P = 0.001, serum albumin (β = 1.386, P < 0.001, alanine aminotransferase (β = 0.064, P = 0.029, and total bilirubin (β = −0.881, P = 0.009. In multiple logistic regression analysis, increased CAP was independently associated with increased metabolic syndrome risk (per 10 dB/m increase; odds ratio, 1.093; 95% confidence interval, 1.009–1.183; P = 0.029 even after adjusting for multiple confounding factors. Conclusion: Increased CAP measured with transient elastography significantly correlated with and could predict increased metabolic syndrome risk in chronic kidney disease patients.

  2. Metabolic encephalopathy and lipid storage myopathy associated with a presumptive mitochondrial fatty acid oxidation defect in a dog

    Vanessa R Biegen

    2015-11-01

    Full Text Available A 1-year-old spayed female Shih Tzu presented for episodic abnormalities of posture and mentation. Neurologic examination was consistent with a bilaterally symmetric multifocal encephalopathy. The dog had a waxing-and-waning hyperlactemia and hypoglycemia. Magnetic resonance imaging revealed bilaterally symmetric cavitated lesions of the caudate nuclei with less severe abnormalities in the cerebellar nuclei. Empirical therapy was unsuccessful and the patient was euthanized. Post-mortem histopathology revealed bilaterally symmetric necrotic lesions of the caudate and cerebellar nuclei and multi-organ lipid accumulation, including a lipid storage myopathy. Malonic aciduria and ketonuria were found on urinary organic acid screen. Plasma acylcarnitine analysis suggested a fatty acid oxidation defect. Fatty acid oxidation disorders are inborn errors of metabolism documented in humans, but poorly described in dogs. Although neurologic signs have been described in humans with this group of diseases, descriptions of advanced imaging and histopathology are severely lacking. This report suggests that abnormalities of fatty acid metabolism may cause severe, bilateral gray matter necrosis and lipid accumulation in multiple organs including the skeletal muscles, liver, and kidneys. Veterinarians should be aware that fatty acid oxidation disorders, although potentially fatal, may be treatable. A timely definitive diagnosis is essential in guiding therapy.

  3. PGC-1alpha Deficiency Causes Multi-System Energy Metabolic Derangements: Muscle Dysfunction, Abnormal Weight Control and Hepatic Steatosis

    Leone Teresa C

    2005-01-01

    Full Text Available The gene encoding the transcriptional coactivator peroxisome proliferator-activated receptor-gamma coactivator-1alpha (PGC-1alpha was targeted in mice. PGC-1alpha null (PGC-1alpha-/- mice were viable. However, extensive phenotyping revealed multi-system abnormalities indicative of an abnormal energy metabolic phenotype. The postnatal growth of heart and slow-twitch skeletal muscle, organs with high mitochondrial energy demands, is blunted in PGC-1alpha-/- mice. With age, the PGC-1alpha-/- mice develop abnormally increased body fat, a phenotype that is more severe in females. Mitochondrial number and respiratory capacity is diminished in slow-twitch skeletal muscle of PGC-1alpha-/- mice, leading to reduced muscle performance and exercise capacity. PGC-1alpha-/- mice exhibit a modest diminution in cardiac function related largely to abnormal control of heart rate. The PGC-1alpha-/- mice were unable to maintain core body temperature following exposure to cold, consistent with an altered thermogenic response. Following short-term starvation, PGC-1alpha-/- mice develop hepatic steatosis due to a combination of reduced mitochondrial respiratory capacity and an increased expression of lipogenic genes. Surprisingly, PGC-1alpha-/- mice were less susceptible to diet-induced insulin resistance than wild-type controls. Lastly, vacuolar lesions were detected in the central nervous system of PGC-1alpha-/- mice. These results demonstrate that PGC-1alpha is necessary for appropriate adaptation to the metabolic and physiologic stressors of postnatal life.

  4. PGC-1alpha deficiency causes multi-system energy metabolic derangements: muscle dysfunction, abnormal weight control and hepatic steatosis.

    Teresa C Leone

    2005-04-01

    Full Text Available The gene encoding the transcriptional coactivator peroxisome proliferator-activated receptor-gamma coactivator-1alpha (PGC-1alpha was targeted in mice. PGC-1alpha null (PGC-1alpha(-/- mice were viable. However, extensive phenotyping revealed multi-system abnormalities indicative of an abnormal energy metabolic phenotype. The postnatal growth of heart and slow-twitch skeletal muscle, organs with high mitochondrial energy demands, is blunted in PGC-1alpha(-/- mice. With age, the PGC-1alpha(-/- mice develop abnormally increased body fat, a phenotype that is more severe in females. Mitochondrial number and respiratory capacity is diminished in slow-twitch skeletal muscle of PGC-1alpha(-/- mice, leading to reduced muscle performance and exercise capacity. PGC-1alpha(-/- mice exhibit a modest diminution in cardiac function related largely to abnormal control of heart rate. The PGC-1alpha(-/- mice were unable to maintain core body temperature following exposure to cold, consistent with an altered thermogenic response. Following short-term starvation, PGC-1alpha(-/- mice develop hepatic steatosis due to a combination of reduced mitochondrial respiratory capacity and an increased expression of lipogenic genes. Surprisingly, PGC-1alpha(-/- mice were less susceptible to diet-induced insulin resistance than wild-type controls. Lastly, vacuolar lesions were detected in the central nervous system of PGC-1alpha(-/- mice. These results demonstrate that PGC-1alpha is necessary for appropriate adaptation to the metabolic and physiologic stressors of postnatal life.

  5. Anthropometric parameters as indicators of metabolic derangements in schizophrenia patients stabilized on olanzapine in an Indian rural population

    Jayanta Kumar Rout

    2012-01-01

    Full Text Available Context: For any given body mass, Asian Indians have higher central obesity than Europeans. A periodic measurement of body mass index (BMI and waist hip ratio (WHR is practically more feasible than other parameters of metabolic syndrome by repeated blood collection. However, few studies are available on the relative importance of BMI and WHR as markers of dyslipidemia and insulin resistance in schizophrenia patients stabilized on second generation antipsychotics in Indian population. Aim: We conducted the present study on such patients to examine whether BMI or WHR can better predict dyslipidemia and insulin resistance in these patients in a rural area. Settings and Design: The study was a hospital based case control study under rural settings on 38 schizophrenia patients stabilized on olanzapine and 30 matched controls. Materials and Methods: Fasting concentrations of blood glucose, lipid parameters and serum insulin were assessed. Data for Homeostatic model for assessment of insulin resistance (HOMA-IR, BMI, and WHR were obtained to assess the insulin resistance, overall body fat distribution and abdominal fat dispensation respectively. Statistical analysis used: ′t′ test was performed to assay any difference in corresponding mean values between cases and controls. Dependence of HOMA-IR on key parameters was assessed by analysis of co-variance (ANCOVA study. Results: Cases exhibited significantly higher values for HOMA-IR, serum triglyceride and low density lipoprotein cholesterol (LDLc with a significantly lower high density lipoprotein cholesterol (HDLc level. ANCOVA study reflected that irrespective of age and sex, HOMA-IR was dependent on serum triglyceride level and WHR (F=8.3 and 5.7 respectively, P<0.05, but not on BMI (F<0.001, P=0.997. Conclusions: Central obesity could be more closely associated with the pathogenesis of prediabetic state in our case group. So, WHR is a better anthropometric parameter than BMI for an early

  6. The normal limits, subclinical significance, related metabolic derangements and distinct biological effects of body site-specific adiposity in relatively healthy population.

    Chun-Ho Yun

    Full Text Available BACKGROUND: The accumulation of visceral adipose tissue that occurs with normal aging is associated with increased cardiovascular risks. However, the clinical significance, biological effects, and related cardiometabolic derangements of body-site specific adiposity in a relatively healthy population have not been well characterized. MATERIALS AND METHODS: In this cross-sectional study, we consecutively enrolled 608 asymptomatic subjects (mean age: 47.3 years, 27% female from 2050 subjects undergoing an annual health survey in Taiwan. We measured pericardial (PCF and thoracic peri-aortic (TAT adipose tissue volumes by 16-slice multi-detector computed tomography (MDCT (Aquarius 3D Workstation, TeraRecon, San Mateo, CA, USA and related these to clinical characteristics, body fat composition (Tanita 305 Corporation, Tokyo, Japan, coronary calcium score (CCS, serum insulin, high-sensitivity C-reactive protein (Hs-CRP level and circulating leukocytes count. Metabolic risk was scored by Adult Treatment Panel III guidelines. RESULTS: TAT, PCF, and total body fat composition all increased with aging and higher metabolic scores (all p<0.05. Only TAT, however, was associated with higher circulating leukocyte counts (ß-coef.:0.24, p<0.05, serum insulin (ß-coef.:0.17, p<0.05 and high sensitivity C-reactive protein (ß-coef.:0.24, p<0.05. These relationships persisted after adjustment in multivariable models (all p<0.05. A TAT volume of 8.29 ml yielded the largest area under the receiver operating characteristic curve (AUROC: 0.79, 95%CI: 0.74-0.83 to identify metabolic syndrome. TAT but not PCF correlated with higher coronary calcium score after adjustment for clinical variables (all p<0.05. CONCLUSION: In our study, we observe that age-related body-site specific accumulation of adipose tissue may have distinct biological effects. Compared to other adiposity measures, peri-aortic adiposity is more tightly associated with cardiometabolic risk profiles and

  7. Ablation of Steroid Receptor Coactivator-3 resembles the human CACT metabolic myopathy

    York, Brian; Reineke, Erin L.; Sagen, Jørn V.; Nikolai, Bryan C.; Zhou, Suoling; Louet, Jean-Francois; Chopra, Atul R.; Chen, Xian; Reed, Graham; Noebels, Jeffrey; Adesina, Adekunle M.; Yu, Hui; Wong, Lee-Jun C.; Tsimelzon, Anna; Hilsenbeck, Susan

    2012-01-01

    Oxidation of lipid substrates is essential for survival in fasting and other catabolic conditions, sparing glucose for the brain and other glucose-dependent tissues. Here we show Steroid Receptor Coactivator-3 (SRC-3) plays a central role in long chain fatty acid metabolism by directly regulating carnitine/acyl-carnitine translocase (CACT) gene expression. Genetic deficiency of CACT in humans is accompanied by a constellation of metabolic and toxicity phenotypes including hypoketonemia, hypog...

  8. Lipoprotein metabolism and its derangements

    Repro

    The purpose of this article is to provide the medical ... carried on albumin or other proteins for protection. ... cells demands cholesterol for membrane formation. ... turbidity of plasma. .... detail in this review. ... the plant sterols (phytosterols.

  9. Ablation of steroid receptor coactivator-3 resembles the human CACT metabolic myopathy.

    York, Brian; Reineke, Erin L; Sagen, Jørn V; Nikolai, Bryan C; Zhou, Suoling; Louet, Jean-Francois; Chopra, Atul R; Chen, Xian; Reed, Graham; Noebels, Jeffrey; Adesina, Adekunle M; Yu, Hui; Wong, Lee-Jun C; Tsimelzon, Anna; Hilsenbeck, Susan; Stevens, Robert D; Wenner, Brett R; Ilkayeva, Olga; Xu, Jianming; Newgard, Christopher B; O'Malley, Bert W

    2012-05-02

    Oxidation of lipid substrates is essential for survival in fasting and other catabolic conditions, sparing glucose for the brain and other glucose-dependent tissues. Here we show Steroid Receptor Coactivator-3 (SRC-3) plays a central role in long chain fatty acid metabolism by directly regulating carnitine/acyl-carnitine translocase (CACT) gene expression. Genetic deficiency of CACT in humans is accompanied by a constellation of metabolic and toxicity phenotypes including hypoketonemia, hypoglycemia, hyperammonemia, and impaired neurologic, cardiac and skeletal muscle performance, each of which is apparent in mice lacking SRC-3 expression. Consistent with human cases of CACT deficiency, dietary rescue with short chain fatty acids drastically attenuates the clinical hallmarks of the disease in mice devoid of SRC-3. Collectively, our results position SRC-3 as a key regulator of β-oxidation. Moreover, these findings allow us to consider platform coactivators such as the SRCs as potential contributors to syndromes such as CACT deficiency, previously considered as monogenic. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. Mitochondrial myopathies.

    DiMauro, Salvatore

    2006-11-01

    Our understanding of mitochondrial diseases (defined restrictively as defects of the mitochondrial respiratory chain) is expanding rapidly. In this review, I will give the latest information on disorders affecting predominantly or exclusively skeletal muscle. The most recently described mitochondrial myopathies are due to defects in nuclear DNA, including coenzyme Q10 deficiency and mutations in genes controlling mitochondrial DNA abundance and structure, such as POLG, TK2, and MPV17. Barth syndrome, an X-linked recessive mitochondrial myopathy/cardiopathy, is associated with decreased amount and altered structure of cardiolipin, the main phospholipid of the inner mitochondrial membrane, but a secondary impairment of respiratory chain function is plausible. The role of mutations in protein-coding genes of mitochondrial DNA in causing isolated myopathies has been confirmed. Mutations in tRNA genes of mitochondrial DNA can also cause predominantly myopathic syndromes and--contrary to conventional wisdom--these mutations can be homoplasmic. Defects in the mitochondrial respiratory chain impair energy production and almost invariably involve skeletal muscle, causing exercise intolerance, cramps, recurrent myoglobinuria, or fixed weakness, which often affects extraocular muscles and results in droopy eyelids (ptosis) and progressive external ophthalmoplegia.

  11. Exertional Myopathy in a Juvenile Green Sea Turtle (Chelonia mydas Entangled in a Large Mesh Gillnet

    Brianne E. Phillips

    2015-01-01

    Full Text Available A juvenile female green sea turtle (Chelonia mydas was found entangled in a large mesh gillnet in Pamlico Sound, NC, and was weak upon presentation for treatment. Blood gas analysis revealed severe metabolic acidosis and hyperlactatemia. Plasma biochemistry analysis showed elevated aspartate aminotransferase and creatine kinase, marked hypercalcemia, hyperphosphatemia, and hyperkalemia. Death occurred within 24 hours of presentation despite treatment with intravenous and subcutaneous fluids and sodium bicarbonate. Necropsy revealed multifocal to diffuse pallor of the superficial and deep pectoral muscles. Mild, multifocal, and acute myofiber necrosis was identified by histopathological examination. While histological changes in the examined muscle were modest, the acid-base, mineral, and electrolyte abnormalities were sufficiently severe to contribute to this animal’s mortality. Exertional myopathy in reptiles has not been well characterized. Sea turtle mortality resulting from forced submergence has been attributed to blood gas derangements and seawater aspiration; however, exertional myopathy may also be an important contributing factor. If possible, sea turtles subjected to incidental capture and entanglement that exhibit weakness or dull mentation should be clinically evaluated prior to release to minimize the risk of delayed mortality. Treatment with appropriate fluid therapy and supportive care may mitigate the effects of exertional myopathy in some cases.

  12. Molecular and Genetic Studies of Congenital Myopathies

    2018-03-21

    Central Core Disease; Centronuclear Myopathy; Congenital Fiber Type Disproportion; Multiminicore Disease; Myotubular Myopathy; Nemaline Myopathy; Rigid Spine Muscular Dystrophy; Undefined Congenital Myopathy

  13. Case report of exercise and statin-fibrate combination therapy-caused myopathy in a patient with metabolic syndrome: contradictions between the two main therapeutic pathways.

    László, Andrea; Kalabay, László; Nemcsik, János

    2013-02-06

    Lifestyle modifications including exercise are beneficial and fundamentally part of the therapy of metabolic syndrome, although in most of the cases medical interventions are also required to reach the target values in the laboratory parameters. Statin and fibrate combination therapy is considered to be safe and effective in dyslipidaemia and metabolic syndrome. However, increased physical activity can enhance the statin and fibrate-associated myopathy. Myositis and the rare but life-threatening rhabdomyolysis are causing a conflict between exercise and statin-fibrate therapy, which is yet to be resolved. We present a case of a 43-year-old Caucasian man with metabolic syndrome who had the side-effect of exercise and drug-associated myositis. The patient had only transient moderate complaints and rhabdomyolysis could be avoided with the one-month creatine kinase control, a test which is not recommended routinely by the new guidelines. We would like to turn the spotlight on the possible complications of statin-fibrate therapy and exercise, when strict follow-up is recommended. In this condition high number of patients can be affected and the responsibility of general practitioners is accentuated.

  14. Metabolic consequences of adipose triglyceride lipase deficiency in humans: an in vivo study in patients with neutral lipid storage disease with myopathy.

    Natali, Andrea; Gastaldelli, Amalia; Camastra, Stefania; Baldi, Simona; Quagliarini, Fabiana; Minicocci, Ilenia; Bruno, Claudio; Pennisi, Elena; Arca, Marcello

    2013-09-01

    The role of adipose triglyceride lipase (ATGL) in intermediate substrates metabolism has not been fully elucidated in humans. Our objective was to evaluate the consequences of ATGL deficiency on body fat distribution, insulin sensitivity, fatty acids metabolism, and energy substrate utilization. Body composition and organ fat content were measured by bioimpedance and (1)H nuclear magnetic resonance spectroscopy; heart glucose metabolism by [(18)F]deoxyglucose positron emission tomography and insulin sensitivity and β-cell function by oral glucose tolerance and 2-step euglycemic-hyperinsulinemic clamp. Lipolysis ([(2)H5]glycerol turnover) and indirect calorimetry were evaluated at fasting, after oral glucose load, during the clamp, and also during an iv epinephrine infusion. These metabolic investigations were carried out during hospitalization. Three patients affected by neutral lipid storage disease with myopathy (NLSDM) due to homozygosity for loss-of-function mutations in the ATGL gene and 6 sex-, age-, and body mass index-matched controls were studied. As expected, NLSDM patients showed diffuse, although heterogeneous, fat infiltration in skeletal muscles associated with increased visceral fat. Although heart and liver were variably affected, fat content in the pancreas was increased in all patients. Compared with healthy controls, NLSDM patients showed impaired insulin response to glucose possibly related to the severe pancreatic steatosis, preserved whole-body insulin sensitivity, and a shift toward glucose metabolism in the heart. Fasting nonesterified fatty acid concentrations as well as basal lipolytic rates and the antilipolytic effect of insulin were normal in NLSDM patients, whereas the lipolytic effect of norepinephrine was impaired. Finally, no significant abnormality in the respiratory quotient was noted in NLSDM patients. In humans, ATGL has a remarkable effect on cellular lipid droplet handling, and its lack causes both perivisceral, skeletal

  15. Acquired multiple Acyl-CoA dehydrogenase deficiency in 10 horses with atypical myopathy.

    Westermann, C M; Dorland, L; Votion, D M; de Sain-van der Velden, M G M; Wijnberg, I D; Wanders, R J A; Spliet, W G M; Testerink, N; Berger, R; Ruiter, J P N; van der Kolk, J H

    2008-05-01

    The aim of the current study was to assess lipid metabolism in horses with atypical myopathy. Urine samples from 10 cases were subjected to analysis of organic acids, glycine conjugates, and acylcarnitines revealing increased mean excretion of lactic acid, ethylmalonic acid, 2-methylsuccinic acid, butyrylglycine, (iso)valerylglycine, hexanoylglycine, free carnitine, C2-, C3-, C4-, C5-, C6-, C8-, C8:1-, C10:1-, and C10:2-carnitine as compared with 15 control horses (12 healthy and three with acute myopathy due to other causes). Analysis of plasma revealed similar results for these predominantly short-chain acylcarnitines. Furthermore, measurement of dehydrogenase activities in lateral vastus muscle from one horse with atypical myopathy indeed showed deficiencies of short-chain acyl-CoA dehydrogenase (0.66 as compared with 2.27 and 2.48 in two controls), medium-chain acyl-CoA dehydrogenase (0.36 as compared with 4.31 and 4.82 in two controls) and isovaleryl-CoA dehydrogenase (0.74 as compared with 1.43 and 1.61 nmol min(-1) mg(-1) in two controls). A deficiency of several mitochondrial dehydrogenases that utilize flavin adenine dinucleotide as cofactor including the acyl-CoA dehydrogenases of fatty acid beta-oxidation, and enzymes that degrade the CoA-esters of glutaric acid, isovaleric acid, 2-methylbutyric acid, isobutyric acid, and sarcosine was suspected in 10 out of 10 cases as the possible etiology for a highly fatal and prevalent toxic equine muscle disease similar to the combined metabolic derangements seen in human multiple acyl-CoA dehydrogenase deficiency also known as glutaric acidemia type II.

  16. Epicardial adipose tissue relating to anthropometrics, metabolic derangements and fatty liver disease independently contributes to serum high-sensitivity C-reactive protein beyond body fat composition: a study validated with computed tomography.

    Lai, Yau-Huei; Yun, Chun-Ho; Yang, Fei-Shih; Liu, Chuan-Chuan; Wu, Yih-Jer; Kuo, Jen-Yuan; Yeh, Hung-I; Lin, Tin-Yu; Bezerra, Hiram G; Shih, Shou-Chuan; Tsai, Cheng-Ho; Hung, Chung-Lieh

    2012-02-01

    Epicardial adipose tissue (EAT) measured by echocardiography has been proposed to be associated with metabolic syndrome and increased cardiovascular risks. However, its independent association with fatty liver disease and systemic inflammation beyond clinical variables and body fat remains less well known. The relationships between EAT and various factors of metabolic derangement were retrospectively examined in consecutive 359 asymptomatic subjects (mean age, 51.6 years; 31% women) who participated in a cardiovascular health survey. Echocardiography-derived regional EAT thickness from parasternal long-axis and short-axis views was quantified. A subset of data from 178 randomly chosen participants were validated using 16-slice multidetector computed tomography. Body fat composition was evaluated using bioelectrical impedance from foot-to-foot measurements. Increased EAT was associated with increased waist circumference, body weight, and body mass index (all P values for trend = .005). Graded increases in serum fasting glucose, insulin resistance, and alanine transaminase levels were observed across higher EAT tertiles as well as a graded decrease of high-density lipoprotein (all P values for trend <.05). The areas under the receiver operating characteristic curves for identifying metabolic syndrome and fatty liver disease were 0.8 and 0.77, with odds ratio estimated at 3.65 and 2.63, respectively. In a multivariate model, EAT remained independently associated with higher high-sensitivity C-reactive protein and fatty liver disease. These data suggested that echocardiography-based epicardial fat measurement can be clinically feasible and was related to several metabolic abnormalities and independently associated fatty liver disease. In addition, EAT amount may contribute to systemic inflammation beyond traditional cardiovascular risks and body fat composition. Copyright © 2012 American Society of Echocardiography. Published by Mosby, Inc. All rights reserved.

  17. Meeting the challenges in the diagnosis of inflammatory myopathies ...

    Conditions that mimic IM include other causes of myopathy such as endocrine disorders, adverse effects of medication, metabolic myopathies and muscle dystrophies. Atypical features suggesting an alternative diagnosis are acute onset, severe pain, assymmetrical involvement, distal weakness and wasting. Appropriate ...

  18. Resveratrol and Myopathy

    Bastin, Jean; Djouadi, Fatima

    2016-01-01

    Resveratrol is a natural polyphenolic compound produced by plants under various stress conditions. Resveratrol has been reported to exhibit antioxidant, anti-inflammatory, and anti-proliferative properties in mammalian cells and animal models, and might therefore exert pleiotropic beneficial effects in different pathophysiological states. More recently, resveratrol has also been shown to potentially target many mitochondrial metabolic pathways, including fatty acid β-oxidation or oxidative phosphorylation, leading to the up-regulation of the energy metabolism via signaling pathways involving PGC-1α, SIRT1, and/or AMP-kinase, which are not yet fully delineated. Some of resveratrol beneficial effects likely arise from its cellular effects in the skeletal muscle, which, surprisingly, has been given relatively little attention, compared to other target tissues. Here, we review the potential for resveratrol to ameliorate or correct mitochondrial metabolic deficiencies responsible for myopathies, due to inherited fatty acid β-oxidation or to respiratory chain defects, for which no treatment exists to date. We also review recent data supporting therapeutic effects of resveratrol in the Duchenne Muscular Dystrophy, a fatal genetic disease affecting the production of muscle dystrophin, associated to a variety of mitochondrial dysfunctions, which likely contribute to disease pathogenesis. PMID:27136581

  19. Genetics Home Reference: Miyoshi myopathy

    ... links) Centers for Disease Control and Prevention: Muscular Dystrophy Cincinnati Children's Hospital: Molkentin Lab: Mechanisms of Duchenne and Miyoshi Myopathy Disease InfoSearch: Miyoshi myopathy Jain ...

  20. [Descending ocular myopathy].

    de Freitas, M R; Nascimento, O J

    1975-06-01

    The case of a 23 years old female patient, with primary involvement of the extraocular and faringeal muscles without familiar history is reported. Electromyographic and muscular biopsy studies proved the myogenic nature of the process. A clinical comparison between the ocular myopathy and the descending ocular myopathy is made, the authors thinking that both of them would be variants of the same muscle disease.

  1. Lipid storage myopathies.

    Bruno, Claudio; Dimauro, Salvatore

    2008-10-01

    The aim of this review is to provide an update on disorders of lipid metabolism affecting skeletal muscle exclusively or predominantly and to summarize recent clinical, genetic, and therapeutic studies in this field. Over the past 5 years, new clinical phenotypes and genetic loci have been described, unusual pathogenic mechanisms have been elucidated, and novel pharmacological approaches have been developed. At least one genetic defect responsible for the myopathic form of CoQ10 deficiency has been identified, causing a disorder that is allelic with the late-onset riboflavine-responsive form of multiple acyl-coenzyme A dehydrogenation deficiency. Novel mechanisms involved in the lipolytic breakdown of cellular lipid depots have been described and have led to the identification of genes and mutations responsible for multisystemic neutral lipid storage disorders, characterized by accumulation of triglyceride in multiple tissues, including muscle. Defects in lipid metabolism can affect either the mitochondrial transport and oxidation of exogenous fatty acid or the catabolism of endogenous triglycerides. These disorders impair energy production and almost invariably involve skeletal muscle, causing progressive myopathy with muscle weakness, or recurrent acute episodes of rhabdomyolysis triggered by exercise, fasting, or infections. Clinical and genetic characterization of these disorders has important implications both for accurate diagnostic approach and for development of therapeutic strategies.

  2. Mitochondrial disorders in congenital myopathies

    D. A. Kharlamov

    2014-01-01

    Full Text Available The literature review gives data on the role of mitochondrial disorders in the pathogenesis of congenital myopathies: congenital muscular dystrophies and congenital structural myopathies. It describes changes in congenital muscular dystrophies with type VI collagen, in myodystrophy with giant mitochondria, in congenital central core myopathies, myotubular myopathy, etc. Clinical and experimental findings are presented. Approaches to therapy for energy disorders in congenital myopathies are depicted.

  3. Muscle Metabolic Responses During Dynamic In-Magnet Exercise Testing : A Pilot Study in Children with an Idiopathic Inflammatory Myopathy

    van Brussel, Marco; van Oorschot, Joep W. M.; Schmitz, Joep P. J.; Nicolay, Klaas; van Royen-Kerkhof, Annet; Takken, Tim; Jeneson, Jeroen A. L.

    Rationale and Objectives: The clinical utility of supine in-magnet bicycling in combination with phosphorus magnetic resonance spectroscopy (P-31 MRS) to evaluate quadriceps muscle metabolism was examined in four children with juvenile dermatomyositis (JDM) in remission and healthy age- and

  4. Nitric oxide-heat shock protein axis in menopausal hot flushes: neglected metabolic issues of chronic inflammatory diseases associated with deranged heat shock response.

    Miragem, Antônio Azambuja; Homem de Bittencourt, Paulo Ivo

    2017-09-01

    Although some unequivocal underlying mechanisms of menopausal hot flushes have been demonstrated in animal models, the paucity of similar approaches in humans impedes further mechanistic outcomes. Human studies might show some as yet unexpected physiological mechanisms of metabolic adaptation that permeate the phase of decreased oestrogen levels in both symptomatic and asymptomatic women. This is particularly relevant because both the severity and time span of hot flushes are associated with increased risk of chronic inflammatory disease. On the other hand, oestrogen induces the expression of heat shock proteins of the 70 kDa family (HSP70), which are anti-inflammatory and cytoprotective protein chaperones, whose expression is modulated by different types of physiologically stressful situations, including heat stress and exercise. Therefore, lower HSP70 expression secondary to oestrogen deficiency increases cardiovascular risk and predisposes the patient to senescence-associated secretory phenotype (SASP) that culminates in chronic inflammatory diseases, such as obesities, type 2 diabetes, neuromuscular and neurodegenerative diseases. This review focuses on HSP70 and its accompanying heat shock response (HSR), which is an anti-inflammatory and antisenescent pathway whose intracellular triggering is also oestrogen-dependent via nitric oxide (NO) production. The main goal of the manuscript was to show that the vasomotor symptoms that accompany hot flushes may be a disguised clue for important neuroendocrine alterations linking oestrogen deficiency to the anti-inflammatory HSR. Results from our own group and recent evidence on hypothalamic control of central temperature guided a search on PubMed and Google Scholar websites. Oestrogen elicits rapid production of the vasodilatory gas NO, a powerful activator of HSP70 expression. Whence, part of the protective effects of oestrogen over cardiovascular and neuroendocrine systems is tied to its capacity of inducing the NO

  5. Influence of chain length of pyrene fatty acids on their uptake and metabolism by Epstein-Barr-virus-transformed lymphoid cell lines from a patient with multisystemic lipid storage myopathy and from control subjects.

    Radom, J; Salvayre, R; Levade, T; Douste-Blazy, L

    1990-01-01

    The uptake and intracellular metabolism of 4-(1-pyrene)butanoic acid (P4), 10-(1-pyrene)decanoic acid (P10) and 12-(1-pyrene)dodecanoic acid (P12) were investigated in cultured lymphoid cell lines from normal individuals and from a patient with multisystemic lipid storage myopathy (MLSM). The cellular uptake was shown to be dependent on the fatty-acid chain length, but no significant difference in the uptake of pyrene fatty acids was observed between MLSM and control lymphoid cells. After inc...

  6. STATINS AND MYOPATHY: MOLECULAR MECHANISMS

    O. M. Drapkina

    2012-01-01

    Full Text Available The safety of statin therapy is considered. In particular the reasons of a complication such as myopathy are discussed in detail. The molecular mechanisms of statin myopathy , as well as its risk factors are presented. The role of coenzyme Q10 in the myopathy development and coenzyme Q10 application for the prevention of this complication are considered. 

  7. Short Report Biochemical derangements prior to emergency ...

    MMJ VOL 29 (1): March 2017. Biochemical derangements prior to emergency laparotomy at QECH 55. Malawi Medical Journal 29 (1): March 2017 ... Venepuncture was performed preoperatively for urgent cases, defined as those requiring.

  8. Genuine myotubular myopathy

    Edstroem, L.; Wroblewski, R.; Mair, W.G.

    1982-01-01

    Two patients, a father and his 14-year-old son, were suffering from a facioperoneal syndrome, and muscle biopsy findings were consistent with a myotubular myopathy. The father exhibited central nuclei in most muscle fibers, but his son had typical changes exclusively in hypotrophic type I fibers. The cytochemical and ultrastructural analysis revealed a spectrum of pathological changes typical of myotubular myopathy. Energy-dispersive electron probe x-ray microanalysis was performed on 6- to 12-microns thick freeze-dried cryosections visualized in the scanning or scanning transmission mode of electron microscopy. We found a high intracellular sodium and chlorine concentration and a low potassium concentration in comparison with control muscles. These changes pointed in the direction similar to results from human fetal muscle. The changes in the intracellular elemental composition may indicate a membrane pump dysfunction, which might be caused by a partial arrest in muscle fiber maturation

  9. MRI EVALUATION OF INTERNAL DERANGEMENT OF KNEE

    Ashok Srikar Chowdhary

    2018-01-01

    Full Text Available BACKGROUND Internal derangement of knee means loss of normal knee function due to ligament or meniscal injuries. MRI is a routinely utilised noninvasive modality for evaluation of various knee disorders including internal derangement. MRI provides excellent soft tissue contrast and multiplanar images when compared to other musculoskeletal imaging modalities. The aim of the study is to study the demographic profile of patients presenting with internal derangement of knee, identify the various ligament and meniscal injuries causing internal derangement of knee and describe the MRI features of the ligament and meniscal injuries. MATERIALS AND METHODS This study was undertaken from January 2016 to mid-December 2017 in the Department of Radiodiagnosis, MVJ Medical College and Research Hospital, Hoskote. The study population consisted of 108 patients with internal derangement of knee who underwent MRI of knee. All the MRI scans of the knee in this study were performed using Siemens Magnetom Essenza (A Tim+Dot system MR machine with a 1.5 tesla field strength magnet using a flex coil. RESULTS The study population consisted of 108 patients comprising of 90 males and 18 females. The age of the patients ranged from 16 to 67 years. Majority of the patients belonged to the age group of 21-30 years constituting about 41% of the total study population. Anterior cruciate ligament injury was the commonest followed by medial and lateral meniscus tears. Flap tear was the commonest type of meniscal tear. Posterior horn of the meniscus was the commonest tear site. CONCLUSION MRI is the investigation of choice in evaluating internal derangement of knee. MRI can accurately diagnose ligament and meniscal injuries and guide arthroscopy.

  10. Inherited myopathies and muscular dystrophies

    Cardamone, Michael; Darras, Basil T.; Ryan, Monique M.

    The inherited myopathies and muscular dystrophies are a diverse group of muscle diseases presenting with common complaints and physical signs: weakness, motor delay, and respiratory and bulbar dysfunction. The myopathies are caused by genetic defects in the contractile apparatus of muscle, and

  11. A note on some identities of derangement polynomials.

    Kim, Taekyun; Kim, Dae San; Jang, Gwan-Woo; Kwon, Jongkyum

    2018-01-01

    The problem of counting derangements was initiated by Pierre Rémond de Montmort in 1708 (see Carlitz in Fibonacci Q. 16(3):255-258, 1978, Clarke and Sved in Math. Mag. 66(5):299-303, 1993, Kim, Kim and Kwon in Adv. Stud. Contemp. Math. (Kyungshang) 28(1):1-11 2018. A derangement is a permutation that has no fixed points, and the derangement number [Formula: see text] is the number of fixed-point-free permutations on an n element set. In this paper, we study the derangement polynomials and investigate some interesting properties which are related to derangement numbers. Also, we study two generalizations of derangement polynomials, namely higher-order and r -derangement polynomials, and show some relations between them. In addition, we express several special polynomials in terms of the higher-order derangement polynomials by using umbral calculus.

  12. Refractory Hyperlactatemia with Organ Insufficiency in Lipid Storage Myopathy.

    Xu, Yuanda; Zhou, Li; Liang, Weibo; He, Weiqun; Liu, Xiaoqing; Liang, Xiuling; Zhong, Nanshan; Li, Yimin

    2015-08-01

    Lipid storage myopathy is a metabolic disorder characterized by abnormal lipid accumulation in muscle fibers and progressive muscle weakness. Here, we report the case of a 17-year-old woman with progressive muscle weakness, refractory hyperlactatemia, and multiple organ insufficiency. Severe pneumonia was the initial diagnosis. After anti-infective treatment, fluid resuscitation, and mechanical ventilation, the patient's symptoms improved but hyperlactatemia and muscle weakness persisted. She was empirically treated with carnitine. Biochemical tests, electromyography, and muscle biopsy confirmed lipid storage myopathy. After 7 weeks of treatment, the patient resumed normal daily life. An empirical treatment with carnitine may be beneficial for patients before an accurate diagnosis of lipid storage myopathy is made.

  13. Acylcarnitines profile best predicts survival in horses with atypical myopathy.

    François Boemer

    Full Text Available Equine atypical myopathy (AM is caused by hypoglycin A intoxication and is characterized by a high fatality rate. Predictive estimation of survival in AM horses is necessary to prevent unnecessary suffering of animals that are unlikely to survive and to focus supportive therapy on horses with a possible favourable prognosis of survival. We hypothesized that outcome may be predicted early in the course of disease based on the assumption that the acylcarnitine profile reflects the derangement of muscle energetics. We developed a statistical model to prognosticate the risk of death of diseased animals and found that estimation of outcome may be drawn from three acylcarnitines (C2, C10:2 and C18 -carnitines with a high sensitivity and specificity. The calculation of the prognosis of survival makes it possible to distinguish the horses that will survive from those that will die despite severe signs of acute rhabdomyolysis in both groups.

  14. Acylcarnitines profile best predicts survival in horses with atypical myopathy

    Detilleux, Johann; Cello, Christophe; Amory, Hélène; Marcillaud-Pitel, Christel; Richard, Eric; van Galen, Gaby; van Loon, Gunther; Lefère, Laurence; Votion, Dominique-Marie

    2017-01-01

    Equine atypical myopathy (AM) is caused by hypoglycin A intoxication and is characterized by a high fatality rate. Predictive estimation of survival in AM horses is necessary to prevent unnecessary suffering of animals that are unlikely to survive and to focus supportive therapy on horses with a possible favourable prognosis of survival. We hypothesized that outcome may be predicted early in the course of disease based on the assumption that the acylcarnitine profile reflects the derangement of muscle energetics. We developed a statistical model to prognosticate the risk of death of diseased animals and found that estimation of outcome may be drawn from three acylcarnitines (C2, C10:2 and C18 -carnitines) with a high sensitivity and specificity. The calculation of the prognosis of survival makes it possible to distinguish the horses that will survive from those that will die despite severe signs of acute rhabdomyolysis in both groups. PMID:28846683

  15. Genetics Home Reference: nemaline myopathy

    ... deformities, abnormal curvature of the spine ( scoliosis ), and joint deformities (contractures). Most people with nemaline myopathy are ... Centre for Rare Diseases Washington University, St. Louis: Neuromuscular Disease Center Patient Support and Advocacy Resources (3 ...

  16. Fat and carbohydrate metabolism during exercise in phosphoglucomutase type 1 deficiency

    Preisler, Nicolai; Laforêt, Pascal; Echaniz-Laguna, Andoni

    2013-01-01

    Phosphoglucomutase type 1 (PGM1) deficiency is a rare metabolic myopathy in which symptoms are provoked by exercise.......Phosphoglucomutase type 1 (PGM1) deficiency is a rare metabolic myopathy in which symptoms are provoked by exercise....

  17. Insuficiências respiratória e renal desencadeadas por miopatia metabólica por acúmulo de lipídios: relato de caso Respiratory and renal dysfunctions due to lipid storage metabolic myopathy: case report

    Walther de Oliveira Campos Filho

    2002-09-01

    Full Text Available Relatamos o caso de um paciente de 26 anos que apresentou quadro clínico de rabdomiólise e mioglobinúria associadas a insuficiência renal e respiratória, três dias após o início de infecção de vias aéreas superiores. Os dados clínicos e laboratoriais, eletroneuromiografia e biópsia muscular conduziram ao diagnóstico de miopatia metabólica por deficiência enzimática relacionada ao metabolismo dos ácidos graxos. O paciente evoluiu favoravelmente com a instituição de suporte avançado de vida, incluindo assistência ventilatória e terapia dialítica, adequação dietética e reposição de L-carnitina. Discorremos sobre as diversas miopatias metabólicas, o diagnóstico, o diagnóstico diferencial e o tratamento.We report a case of a 26-years old male patient with rhabdomyolisis with myoglobinuria associated with acute renal and respiratory failure, that occurred three days after upper airway infection. In the clinical and laboratory investigation of the patient, including electromyography and muscular biopsy, the diagnostic lead to a metabolic myopathy due to an enzymatic deficiency related to a disorder of lipid metabolism. The patient improved successfully with institution of advanced life support, including ventilatory assistence, dialysis, dietary adjust and L-carnitine reposition.

  18. Combined MRI and ³¹P-MRS investigations of the ACTA1(H40Y mouse model of nemaline myopathy show impaired muscle function and altered energy metabolism.

    Charlotte Gineste

    Full Text Available Nemaline myopathy (NM is the most common disease entity among non-dystrophic skeletal muscle congenital diseases. Mutations in the skeletal muscle α-actin gene (ACTA1 account for ∼25% of all NM cases and are the most frequent cause of severe forms of NM. So far, the mechanisms underlying muscle weakness in NM patients remain unclear. Additionally, recent Magnetic Resonance Imaging (MRI studies reported a progressive fatty infiltration of skeletal muscle with a specific muscle involvement in patients with ACTA1 mutations. We investigated strictly noninvasively the gastrocnemius muscle function of a mouse model carrying a mutation in the ACTA1 gene (H40Y. Skeletal muscle anatomy (hindlimb muscles and fat volumes and energy metabolism were studied using MRI and (31Phosphorus magnetic resonance spectroscopy. Skeletal muscle contractile performance was investigated while applying a force-frequency protocol (from 1-150 Hz and a fatigue protocol (80 stimuli at 40 Hz. H40Y mice showed a reduction of both absolute (-40% and specific (-25% maximal force production as compared to controls. Interestingly, muscle weakness was associated with an improved resistance to fatigue (+40% and an increased energy cost. On the contrary, the force frequency relationship was not modified in H40Y mice and the extent of fatty infiltration was minor and not different from the WT group. We concluded that the H40Y mouse model does not reproduce human MRI findings but shows a severe muscle weakness which might be related to an alteration of intrinsic muscular properties. The increased energy cost in H40Y mice might be related to either an impaired mitochondrial function or an alteration at the cross-bridges level. Overall, we provided a unique set of anatomic, metabolic and functional biomarkers that might be relevant for monitoring the progression of NM disease but also for assessing the efficacy of potential therapeutic interventions at a preclinical level.

  19. Amyloid myopathy: a diagnostic challenge

    Heli Tuomaala

    2009-08-01

    Full Text Available Amyloid myopathy (AM is a rare manifestation of primary systemic amyloidosis (AL. Like inflammatory myopathies, it presents with proximal muscle weakness and an increased creatine kinase level. We describe a case of AL with severe, rapidly progressive myopathy as the initial symptom. The clinical manifestation and muscle biopsy were suggestive of inclusion body myositis. AM was not suspected until amyloidosis was seen in the gastric mucosal biopsy. The muscle biopsy was then re-examined more specifically, and Congo red staining eventually showed vascular and interstitial amyloid accumulation, which led to a diagnosis of AM. The present case illustrates the fact that the clinical picture of AM can mimic that of inclusion body myositis.

  20. Idiopathic Inflammatory Myopathies: An update

    Bulent KURT

    2016-06-01

    Full Text Available Idiopathic inflammatory myopathies (IIM are a heterogeneous group of disease with complex clinical features. It has been sub-classified as: (1 Dermatomyositis, (2 Polymyositis, and (3 Inclusion body myositis (IBM. Nowadays, there are some studies in literature suggest necrotizing autoimmune myopathy and immune-mediated necrotizing myopathy should also be added to this group of disease. There is a debate in the diagnosis of IIMs and up until now, about 12 criteria systems have been proposed. Some of the criteria systems have been used widely such as Griggs et al.'s proposal for IBM. Clinical findings, autoantibodies, enzymes, electrophysiological, and muscle biopsy findings are diagnostic tools. Because of diseases' complexity, none of the findings are diagnostic alone. In this study, we discussed the diagnostic criteria of IMMs and described detailed morphological features. [J Interdiscipl Histopathol 2016; 4(2.000: 41-45

  1. Effect of dietary fats with odd or even numbers of carbon atoms on metabolic response and muscle damage with exercise in Quarter Horse-type horses with type 1 polysaccharide storage myopathy.

    Borgia, Lisa A; Valberg, Stephanie J; McCue, Molly E; Pagan, Joe D; Roe, Charles R

    2010-03-01

    To evaluate effects of fats with odd and even numbers of carbon atoms on muscle metabolism in exercising horses with polysaccharide storage myopathy (PSSM). 8 horses with PSSM (6 females and 2 males; mean +/- SD age, 6.3 +/- 3.9 years). Isocaloric diets (grain, triheptanoin, corn oil, and high-fat, low-starch [HFLS] feed) were fed for 3 weeks each; horses performed daily treadmill exercise. Grain was fed to establish an exercise target, and HFLS feed was fed as a negative control diet. Daily plasma samples were obtained. For each diet, a 15-minute exercise test was performed, and gluteus medius muscle specimens and blood samples were obtained before and after exercise. Feeding triheptanoin, compared with the corn oil diet, resulted in exercise intolerance; higher plasma creatine kinase (CK) activity and concentrations of C3:0- and C7:0-acylcarnitine and insulin; and lower concentrations of nonesterified fatty acids (NEFA) and C16:0-, C18:1-, and C18:2-acylcarnitine, without changes in concentrations of plasma glucose or resting muscle substrates and metabolites. Feeding grain induced higher CK activity and insulin concentrations and lower NEFA concentrations than did corn oil or HFLS feed. Feeding grain induced higher glucose concentrations than did triheptanoin and corn oil. In muscle, feeding grain resulted in lower glucose-6-phosphate, higher citrate, and higher postexercise lactate concentrations than did the other diets. Triheptanoin had detrimental effects, reflecting decreased availability of NEFA, increased insulin stimulation of glycogen synthesis, and potential inhibition of lipid oxidation. Long-chain fats are the best dietetic for PSSM.

  2. Fulminant lipid storage myopathy due to multiple acyl-coenzyme a dehydrogenase deficiency.

    Whitaker, Charles H; Felice, Kevin J; Silvers, David; Wu, Qian

    2015-08-01

    The lipid storage myopathies, primary carnitine deficiency, neutral lipid storage disease, and multiple acyl coenzyme A dehydrogenase deficiency (MADD), are progressive disorders that cause permanent weakness. These disorders of fatty acid metabolism and intracellular triglyceride degradation cause marked fat deposition and damage to muscle cells. We describe a rapidly progressive myopathy in a previously healthy 33-year-old woman. Over 4 months, she developed a proximal and axial myopathy associated with diffuse myalgia and dysphagia, ultimately leading to respiratory failure and death. Muscle biopsy showed massive accumulation of lipid. Plasma acylcarnitine and urine organic acid analysis was consistent with MADD. This was confirmed by molecular genetic testing, which revealed 2 pathogenic mutations in the ETFDH gene. This report illustrates a late-onset case of MADD and reviews the differential diagnosis and evaluation of patients with proximal myopathy and excessive accumulation of lipid on muscle biopsy. © 2014 Wiley Periodicals, Inc.

  3. REV-ERB and ROR: therapeutic targets for treating myopathies

    Welch, Ryan D.; Flaveny, Colin A.

    2017-08-01

    Muscle is primarily known for its mechanical roles in locomotion, maintenance of posture, and regulation of cardiac and respiratory function. There are numerous medical conditions that adversely affect muscle, myopathies that disrupt muscle development, regeneration and protein turnover to detrimental effect. Skeletal muscle is also a vital secretory organ that regulates thermogenesis, inflammatory signaling and directs context specific global metabolic changes in energy substrate preference on a daily basis. Myopathies differ in the causative factors that drive them but share common features including severe reduction in quality of life and significantly increased mortality all due irrefutably to the loss of muscle mass. Thus far clinically viable approaches for preserving muscle proteins and stimulating new muscle growth without unwanted side effects or limited efficacy has been elusive. Over the last few decades, evidence has emerged through in vitro and in vivo studies that suggest the nuclear receptors REV-ERB and ROR might modulate pathways involved in myogenesis and mitochondrial biogenesis. Hinting that REV-ERB and ROR might be targeted to treat myopathies. However there is still a need for substantial investigation into the roles of these nuclear receptors in in vivo rodent models of degenerative muscle diseases and acute injury. Although exciting, REV-ERB and ROR have somewhat confounding roles in muscle physiology and therefore more studies utilizing in vivo models of skeletal muscle myopathies are needed. In this review we highlight the molecular forces driving some of the major degenerative muscular diseases and showcase two promising molecular targets that may have the potential to treat myopathies: ROR and REV-ERB.

  4. Influence of chain length of pyrene fatty acids on their uptake and metabolism by Epstein-Barr-virus-transformed lymphoid cell lines from a patient with multisystemic lipid storage myopathy and from control subjects.

    Radom, J; Salvayre, R; Levade, T; Douste-Blazy, L

    1990-01-01

    The uptake and intracellular metabolism of 4-(1-pyrene)butanoic acid (P4), 10-(1-pyrene)decanoic acid (P10) and 12-(1-pyrene)dodecanoic acid (P12) were investigated in cultured lymphoid cell lines from normal individuals and from a patient with multisystemic lipid storage myopathy (MLSM). The cellular uptake was shown to be dependent on the fatty-acid chain length, but no significant difference in the uptake of pyrene fatty acids was observed between MLSM and control lymphoid cells. After incubation for 1 h the distribution of fluorescent fatty acids taken up by the lymphoid cell lines also differed with the chain length, most of the fluorescence being associated with phospholipid and triacylglycerols. In contrast with P10 and P12, P4 was not incorporated into neutral lipids. When the cells were incubated for 24 h with the pyrene fatty acids, the amount of fluorescent lipids synthesized by the cells was proportional to the fatty acid concentration in the culture medium. After a 24 h incubation in the presence of P10 or P12, at any concentration, the fluorescent triacylglycerol content of MLSM cells was 2-5-fold higher than that of control cells. Concentrations of pyrene fatty acids higher than 40 microM seemed to be more toxic for mutant cells than for control cells. This cytotoxicity was dependent on the fluorescent-fatty-acid chain length (P12 greater than P10 greater than P4). Pulse-chase experiments permitted one to demonstrate the defect in the degradation of endogenously biosynthesized triacylglycerols in MLSM cells (residual activity was around 10-25% of controls on the basis of half-lives and initial rates of P10- or P12-labelled-triacylglycerol catabolism); MLSM lymphoid cells exhibited a mild phenotypic expression of the lipid storage (less severe than that observed in fibroblasts). P4 was not utilized in the synthesis of triacylglycerols, and thus did not accumulate in MLSM cells: this suggests that natural short-chain fatty acids might induce a lesser

  5. Late conversion from tacrolimus to a belatacept-based immuno-suppression regime in kidney transplant recipients improves renal function, acid-base derangement and mineral-bone metabolism.

    Schulte, Kevin; Vollmer, Clara; Klasen, Vera; Bräsen, Jan Hinrich; Püchel, Jodok; Borzikowsky, Christoph; Kunzendorf, Ulrich; Feldkamp, Thorsten

    2017-08-01

    Calcineurin inhibitor (CNI)-induced nephrotoxicity and chronic graft dysfunction with deteriorating glomerular filtration rate (GFR) are common problems of kidney transplant recipients. The aim of this study was to analyze the role of belatacept as a rescue therapy in these patients. In this retrospective, observational study we investigated 20 patients (10 females, 10 males) who were switched from a CNI (tacrolimus) to a belatacept-based immunosuppression because of CNI intolerance or marginal transplant function. Patient follow-up was 12 months. Patients were converted to belatacept in mean 28.8 months after transplantation. Reasons for conversion were CNI intolerance (14 patients) or marginal transplant function (6 patients). Mean estimated GFR (eGFR) before conversion was 22.2 ± 9.4 ml/min at baseline and improved significantly to 28.3 ± 10.1 ml/min at 4 weeks and to 32.1 ± 12.6 ml/min at 12 months after conversion. Serum bicarbonate significantly increased from 24.4 ± 3.2 mmol/l at baseline to 28.7 ± 2.6 mmol/l after 12 months. Conversion to belatacept decreased parathyroid hormone and phosphate concentrations significantly, whereas albumin levels significantly increased. In 6 cases an acute rejection preceded clinically relevant CNI toxicity; only two patients suffered from an acute rejection after conversion. Belatacept was well tolerated and there was no increase in infectious or malignant side effects. A late conversion from a tacrolimus-based immunosuppression to belatacept is safe, effective and significantly improves renal function in kidney transplant recipients. Additionally, the conversion to belatacept has a beneficial impact on acid-base balance, mineral-bone and protein metabolism, independently of eGFR.

  6. Lipid myopathy associated with renal tubular acidosis and spastic diplegia in two brothers.

    Tung, Y C; Tsau, Y K; Chu, L W; Young, C; Shen, Y Z

    2001-07-01

    Lipid myopathy is a group of disorders involving mitochondrial fatty acid oxidation. We describe two brothers, 3 years 8 months old and 2 years 9 months old, respectively, with progressive spastic diplegia, developmental delay, failure to thrive, and chronic metabolic acidosis who had lipid myopathy and renal tubular acidosis. Brain magnetic resonance imaging revealed demyelinating changes in the periventricular white matter, which was compatible with spastic diplegia. These symptoms may be related to errors in fatty acid metabolism. Cerebral palsy had been misdiagnosed in both of these patients at another hospital. Therefore, for patients with late-onset and progressive spastic diplegia, detailed investigations for underlying diseases are warranted.

  7. Immune-mediated statin myopathy.

    Loganathan, Priyadarshini; Oddis, Chester V; Aggarwal, Rohit

    2016-01-01

    Statin-induced necrotizing autoimmune myopathy (SINAM) is associated with a unique clinical 5 phenotype of severe proximal muscle weakness during or after exposure to statins in patients with high creatine kinase (CK) levels. Electromyography (EMG) and muscle biopsy reveal features of a necrotizing myopathy and the anti-HMGCR autoantibody is frequently detected. Treatment requires a combination of statin discontinuation as well as immunomodulatory or immunosuppressive therapy. HLA typing (HLADRB1*1101) is strongly associated with anti-10 HMGCR autoantibody positivity in statin-exposed patients. It is well documented that statin triggers autoimmune disease in those with a genetic susceptibility. With the commercial availability of an accurate ELISA test, the natural history of the disease and its phenotypic features are becoming increasingly understood.

  8. Localized scleroderma and regional inflammatory myopathy.

    Zivković, Saša A; Freiberg, William; Lacomis, David; Domsic, Robyn T; Medsger, Thomas A

    2014-05-01

    Inflammatory myopathy is rare in localized scleroderma. We report 2 new cases of regional inflammatory myopathy associated with localized scleroderma and review 10 reported cases of localized scleroderma associated with an inflammatory myopathy with regional muscle involvement, more often in the upper extremities. Serum creatine kinase was mildly elevated or normal. Histopathology often showed perimysial inflammation and plasma cell infiltration. These cases demonstrate that inflammatory myopathy should be considered in patients with localized scleroderma and regional muscle weakness, pain or atrophy. Muscle biopsy can confirm the diagnosis of myositis, which if identified, will require anti-inflammatory and/or immunosuppressive therapy. Published by Elsevier B.V.

  9. Hepatic metabolic derangement following preoperative irradiation gastric neoplasms

    Berdov, B A; D' yakova, A M; Stefani, N V; Senokosov, N I [Akademiya Meditsinskikh Nauk SSSR, Obninsk. Nauchno-Issledovatel' skij Inst. Meditsinskoj Radiologii

    1980-08-01

    Preoperative irradiation of gastric cancer results in glycogene buildup in the heratic cells and activation of a number of tissue enzymes such as glutamate-and lactate dehydrogenases, hexogenase, choline esterase and aspartate aminotransferase in the left lobe of the liver which is included in a zone of direct irradiation. The enzyme activation is observed on the 4-7th day after the course of radiotherapy, glycogene maximum content - on the 5th day. The enzyme activity and glycogene content on the 11th day after irradiation decreases to the level of their content in the patients who have not been subjected to radiotherapy.

  10. Acquired multiple Acyl-CoA dehydrogenase deficiency in 10 horses with atypical myopathy

    Westermann, C. M.; Dorland, L.; Votion, D. M.; de Sain-van der Velden, M. G. M.; Wijnberg, I. D.; Wanders, R. J. A.; Spliet, W. G. M.; Testerink, N.; Berger, R.; Ruiter, J. P. N.; van der Kolk, J. H.

    2008-01-01

    The aim of the current study was to assess lipid metabolism in horses with atypical myopathy. Urine samples from 10 cases were subjected to analysis of organic acids, glycine conjugates, and acylcarnitines revealing increased mean excretion of lactic acid, ethylmalonic acid, 2-methylsuccinic acid,

  11. Lipid storage myopathy with clinical markers of Marfan syndrome: A rare association

    Subasree Ramakrishnan

    2012-01-01

    Full Text Available Disorders of lipid metabolism can cause variable clinical presentations, often involving skeletal muscle, alone or together with other tissues. A 19-year-old boy presented with a 2-year history of muscle pain, cramps, exercise intolerance and progressive weakness of proximal lower limbs. Examination revealed skeletal markers of Marfan syndrome in the form of increased arm span compared with height, Kyphoscoliois, moderate pectus excavatum, high arched palate and wrist sign. He also had mild neck flexor weakness and proximal lower limb weakness with areflexia. Pathologic findings revealed lipid-laden fine vacuoles in the muscle fibers. Possibility of carnitine deficiency myopathy was considered and the patient was started on carnitine and Co Q. The patient made remarkable clinical improvement over the next 2 months. This case is reported for rarity of the association of clinical markers of Marfan syndrome and lipid storage myopathy and sparse literature on lipid storage myopathy in the Indian context.

  12. Genetics Home Reference: idiopathic inflammatory myopathy

    ... stumble while walking and find it difficult to grasp items. As in dermatomyositis and polymyositis, swallowing can ... and development? More about Mutations and Health Inheritance Pattern Most cases of idiopathic inflammatory myopathy are sporadic, ...

  13. Pattern Of Biochemical Derangements Seen In Chronic Renal ...

    Objective: To study the pattern of biochemical derangements in advanced renal failure patients. Subjects and Methods: Ninety adult patients [54 males and 36 females] were recruited from the renal clinic of the University of Nigeria Teaching Hospital (UNTH) Enugu over a period of one year. History and physical ...

  14. Deranged liver among Sudanese patients with dengue virus ...

    Background: Deranged liver is a well-recognized feature of dengue infection, often demonstrated by coagulopathy and mild to moderate increase in transaminase levels although jaundice and fulminant hepatic failure are generally uncommon. Objective: This study aimed to evaluate the hepatic effect of dengue fever ...

  15. Hematological derangement patterns in Nigerian dogs infected with ...

    Hematological derangement patterns in Nigerian dogs infected with Trypanosoma brucei : A simple prototype for assessing tolerance to trypanosome infections ... The packed cell volume (PCV), red blood cell (RBC) counts, total and differential white blood cell (WBC) counts and rates of both red blood cell and white blood ...

  16. Statin-associated myopathy: from genetic predisposition to clinical management.

    Vrablik, M; Zlatohlavek, L; Stulc, T; Adamkova, V; Prusikova, M; Schwarzova, L; Hubacek, J A; Ceska, R

    2014-01-01

    Statin-associated myopathy (SAM) represents a broad spectrum of disorders from insignificant myalgia to fatal rhabdomyolysis. Its frequency ranges from 1-5 % in clinical trials to 15-20 % in everyday clinical practice. To a large extent, these variations can be explained by the definition used. Thus, we propose a scoring system to classify statin-induced myopathy according to clinical and biochemical criteria as 1) possible, 2) probable or 3) definite. The etiology of this disorder remains poorly understood. Most probably, an underlying genetic cause is necessary for overt SAM to develop. Variants in a few gene groups that encode proteins involved in: i) statin metabolism and distribution (e.g. membrane transporters and enzymes; OATP1B1, ABCA1, MRP, CYP3A4), ii) coenzyme Q10 production (e.g. COQ10A and B), iii) energy metabolism of muscle tissue (e.g. PYGM, GAA, CPT2) and several others have been proposed as candidates which can predispose to SAM. Pharmacological properties of individual statin molecules (e.g. lipophilicity, excretion pathways) and patients´ characteristics influence the likelihood of SAM development. This review summarizes current data as well as our own results.

  17. Understanding mitochondrial myopathies: a review

    Abhimanyu S. Ahuja

    2018-05-01

    Full Text Available Mitochondria are small, energy-producing structures vital to the energy needs of the body. Genetic mutations cause mitochondria to fail to produce the energy needed by cells and organs which can cause severe disease and death. These genetic mutations are likely to be in the mitochondrial DNA (mtDNA, or possibly in the nuclear DNA (nDNA. The goal of this review is to assess the current understanding of mitochondrial diseases. This review focuses on the pathology, causes, risk factors, symptoms, prevalence data, symptomatic treatments, and new research aimed at possible preventions and/or treatments of mitochondrial diseases. Mitochondrial myopathies are mitochondrial diseases that cause prominent muscular symptoms such as muscle weakness and usually present with a multitude of symptoms and can affect virtually all organ systems. There is no cure for these diseases as of today. Treatment is generally supportive and emphasizes symptom management. Mitochondrial diseases occur infrequently and hence research funding levels tend to be low in comparison with more common diseases. On the positive side, quite a few genetic defects responsible for mitochondrial diseases have been identified, which are in turn being used to investigate potential treatments. Speech therapy, physical therapy, and respiratory therapy have been used in mitochondrial diseases with variable results. These therapies are not curative and at best help with maintaining a patient’s current abilities to move and function.

  18. An integrated diagnosis strategy for congenital myopathies.

    Johann Böhm

    Full Text Available Congenital myopathies are severe muscle disorders affecting adults as well as children in all populations. The diagnosis of congenital myopathies is constrained by strong clinical and genetic heterogeneity. Moreover, the majority of patients present with unspecific histological features, precluding purposive molecular diagnosis and demonstrating the need for an alternative and more efficient diagnostic approach. We used exome sequencing complemented by histological and ultrastructural analysis of muscle biopsies to identify the causative mutations in eight patients with clinically different skeletal muscle pathologies, ranging from a fatal neonatal myopathy to a mild and slowly progressive myopathy with adult onset. We identified RYR1 (ryanodine receptor mutations in six patients and NEB (nebulin mutations in two patients. We found novel missense and nonsense mutations, unraveled small insertions/deletions and confirmed their impact on splicing and mRNA/protein stability. Histological and ultrastructural findings of the muscle biopsies of the patients validated the exome sequencing results. We provide the evidence that an integrated strategy combining exome sequencing with clinical and histopathological investigations overcomes the limitations of the individual approaches to allow a fast and efficient diagnosis, accelerating the patient's access to a better healthcare and disease management. This is of particular interest for the diagnosis of congenital myopathies, which involve very large genes like RYR1 and NEB as well as genetic and phenotypic heterogeneity.

  19. Systemic calciphylaxis presenting as a painful, proximal myopathy.

    Edelstein, C. L.; Wickham, M. K.; Kirby, P. A.

    1992-01-01

    A renal transplant patient who presented with a painful, proximal myopathy due to systemic calciphylaxis is described. The myopathy preceded the characteristic skin and soft tissue necrosis. Systemic calciphylaxis should be considered in a dialysis or a renal transplant patient presenting with a painful proximal myopathy even in the absence of necrotic skin lesions.

  20. Adult-onset nemaline myopathy presenting as respiratory failure.

    Kelly, Emer

    2008-11-01

    Nemaline myopathy is a rare congenital myopathy that generally presents in childhood. We report a case of a 44-year-old man who presented with severe hypoxic hypercapnic respiratory failure as the initial manifestation of nemaline myopathy. After starting noninvasive ventilation, his pulmonary function test results improved substantially, and over the 4 years since diagnosis his respiratory function remained stable. There are few reported cases of respiratory failure in patients with adult-onset nemaline myopathy, and the insidious onset in this case is even more unusual. This case highlights the varied presenting features of adult-onset nemaline myopathy and that noninvasive ventilation improves respiratory function.

  1. Neurobiology of the metabolic syndrome : An allostatic perspective

    van Dijk, Gertjan; Buwalda, Bauke

    2008-01-01

    The metabolic syndrome is a cluster of more or less related metabolic and cardiovascular derangements including visceral obesity, insulin resistance, blood and tissue dislipidemia, high blood pressure and it is often associated with neuroendocrine and immunological dysregulations. The aetiology of

  2. Gut microbiota and nuclear receptors in bile acid and lipid metabolism : bile acids, more than soaps

    Out, Carolien

    2014-01-01

    Metabolic syndrome refers to the combination of obesity, hypertension, dyslipidemia and insulin resistance. Metabolic syndrome increases the chance on cardiovascular disease and type 2 diabetes. Strategies to prevent and treat these metabolic derangements are therefore urgently needed. For this

  3. Myopathies of endocrine disorders: A prospective clinical and biochemical study

    Vikas Sharma

    2014-01-01

    Full Text Available Introduction: Major categories of endocrine myopathy include those associated with: Adrenal dysfunction (as in Cushing′s disease or steroid myopathy; thyroid dysfunction (as in myxedema coma or thyrotoxic myopathy; vitamin D deficiency; parathyroid dysfunction; and pituitary dysfunction. Steroid myopathy is the most common endocrine myopathy. Objective: To study the etiology, varied presentations, and outcome after therapy of patients with endocrine myopathies. Materials and Methods: Myopathy was evaluated by the standard clinical procedures: Detailed clinical history, manual muscle strength testing, and creatine phosphokinase (CPK. Endocrine disorders were diagnosed as per clinical features and biochemical parameters. The treatment was given to patients as per underlying endocrine disease. Myopathy was assessed before and after treatment. Results: Out of the 37 patients who were diagnosed with endocrine myopathies, thyroid dysfunction was the most common cause (17 cases, followed by vitamin D deficiency in nine, adrenal dysfunction in six, parathyroid dysfunction in three, and pituitary dysfunction in two. Some patients had atypical presentation (repeated falls in one, tongue fasciculations in one, neck weakness in five, one with ptosis and facial weakness, asymmetrical onset in one, and calf hypertrophy in one. The serum creatine kinase (CK concentration did not correlate with muscle weakness. Following the treatment regimen which was specific for a given myopathy, 26 patients recovered fully. Conclusion: We found varied clinical presentations of endocrine myopathies. All the patients with neuromuscular complaints should be investigated for endocrine causes because significant number of them recovers fully with specific treatment.

  4. Acute steroid myopathy: a highly overlooked entity.

    Haran, Michal; Schattner, Ami; Kozak, Natasha; Mate, Andras; Berrebi, Alain; Shvidel, Lev

    2018-02-15

    Myopathy in patients being treated with corticosteroids is known primarily among chronically-treated patients or in critically ill and mechanically-ventilated patients receiving corticosteroids, often in high doses. To highlight the entity of acute, early-onset corticosteroid-treatment-associated myopathy and its characteristics. Reporting our experience with four patients and reviewing all published reports of myopathy developing ≤14 days of initiating corticosteroid-treatment. Acute corticosteroid myopathy (ASM) exists, though the syndrome appears to be rare. It is characterized by unpredictability and heterogeneity, sometimes developing within 1-3 days, after a single dose, which may not be high and administered by varied routes. Proximal limb muscle weakness is the most common form, but distal limb, bulbar and respiratory muscles may be involved. Steroid cessation often leads to improvement/resolution, but irreversibility may occur. A high index of suspicion for the possibility of ASM is necessary, to ensure drug discontinuation and recovery. This is particularly true since the entity is not widely recognized and its symptoms are often erroneously interpreted as due to the patient's underlying disease.

  5. Dietary intervention rescues myopathy associated with neurofibromatosis type 1.

    Summers, Matthew A; Rupasinghe, Thusitha; Vasiljevski, Emily R; Evesson, Frances J; Mikulec, Kathy; Peacock, Lauren; Quinlan, Kate GR; Cooper, Sandra T; Roessner, Ute; Stevenson, David A; Little, David G; Schindeler, Aaron

    2018-02-15

    Neurofibromatosis type 1 (NF1) is an autosomal dominant genetic disorder with complex symptomology. In addition to a predisposition to tumors, children with NF1 can present with reduced muscle mass, global muscle weakness, and impaired motor skills, which can have a significant impact on quality of life. Genetic mouse models have shown a lipid storage disease phenotype may underlie muscle weakness in NF1. Herein we confirm that biopsy specimens from six individuals with NF1 similarly manifest features of a lipid storage myopathy, with marked accumulation of intramyocellular lipid, fibrosis, and mononuclear cell infiltrates. Intramyocellular lipid was also correlated with reductions in neurofibromin protein expression by western analysis. An RNASeq profile of Nf1null muscle from a muscle-specific Nf1 knockout mouse (Nf1MyoD-/-) revealed alterations in genes associated with glucose regulation and cell signaling. Comparison by lipid mass spectrometry demonstrated that Nf1null muscle specimens were enriched for long chain fatty acid (LCFA) containing neutral lipids, such as cholesterol esters and triacylglycerides, suggesting fundamentally impaired LCFA metabolism. The subsequent generation of a limb-specific Nf1 knockout mouse (Nf1Prx1-/-) recapitulated all observed features of human NF1 myopathy, including lipid storage, fibrosis, and muscle weakness. Collectively, these insights led to the evaluation of a dietary intervention of reduced LCFAs, and enrichment of medium-chain fatty acids (MCFAs) with L-carnitine. Following 8-weeks of dietary treatment, Nf1Prx1-/- mice showed a 45% increase in maximal grip strength, and a 71% reduction in intramyocellular lipid staining compared with littermates fed standard chow. These data link NF1 deficiency to fundamental shifts in muscle metabolism, and provide strong proof of principal that a dietary intervention can ameliorate symptoms. © The Author(s) 2017. Published by Oxford University Press. All rights reserved. For

  6. Finger millet arabinoxylan protects mice from high-fat diet induced lipid derangements, inflammation, endotoxemia and gut bacterial dysbiosis.

    Sarma, Siddhartha Mahadeva; Singh, Dhirendra Pratap; Singh, Paramdeep; Khare, Pragyanshu; Mangal, Priyanka; Singh, Shashank; Bijalwan, Vandana; Kaur, Jaspreet; Mantri, Shrikant; Boparai, Ravneet Kaur; Mazumder, Koushik; Bishnoi, Mahendra; Bhutani, Kamlesh Kumar; Kondepudi, Kanthi Kiran

    2018-01-01

    Arabinoxylan (AX), a non-starch polysaccharide extracted from cereals such as wheat, rice and millets, is known to impart various health promoting effects. Our earlier study suggested that finger millet (FM) could ameliorate high fat diet (HFD)-induced metabolic derangements. The present study is aimed to evaluate the effect of FM-AX supplementation, a key bioactive from finger millet, on HFD-induced metabolic and gut bacterial derangements. Male Swiss albino mice were fed with normal chow diet (NPD) or HFD (60%kcal from fat) for 10 weeks. FM-AX was orally supplemented at doses of 0.5 and 1.0g/kg bodyweight on every alternate day for 10 weeks. Glucose tolerance, serum hormones, hepatic lipid accumulation and inflammation, white adipose tissue marker gene expression, adipocyte size and inflammation; metagenomic alterations in cecal bacteria; cecal short chain fatty acids and colonic tight junction gene expressions were studied. FM-AX supplementation prevented HFD-induced weight gain, alerted glucose tolerance and serum lipid profile, hepatic lipid accumulation and inflammation. Hepatic and white adipose tissue gene expressions were beneficially modulated. Further, AX supplementation prevented metagenomic alterations in cecum; improved ileal and colonic health and overall prevented metabolic endotoxemia. Present work suggests that AX from finger millet can be developed as a nutraceutical for the management of HFD- induced obesity. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Cardiovascular magnetic resonance imaging (CMR) reveals characteristic pattern of myocardial damage in patients with mitochondrial myopathy.

    Yilmaz, Ali; Gdynia, Hans-Jürgen; Ponfick, Matthias; Rösch, Sabine; Lindner, Alfred; Ludolph, Albert C; Sechtem, Udo

    2012-04-01

    Mitochondrial myopathy comprises various clinical subforms of neuromuscular disorders that are characterised by impaired mitochondrial energy metabolism due to dysfunction of the mitochondrial respiratory chain. No comprehensive and targeted cardiovascular magnetic resonance (CMR) studies have been performed so far in patients with mitochondrial disorders. The present study aimed at characterising cardiac disease manifestations in patients with mitochondrial myopathy and elucidating the in vivo cardiac damage pattern of patients with different subforms of mitochondrial disease by CMR studies. In a prospective study, 37 patients with mitochondrial myopathy underwent comprehensive neurological and cardiac evaluations including physical examination, resting ECG and CMR. The CMR studies comprised cine-CMR, T2-weighted "edema" imaging and T1-weighted late-gadolinium-enhancement (LGE) imaging. Various patterns and degrees of skeletal myopathy were present in the participants of this study, whereas clinical symptoms such as chest pain symptoms (in eight (22%) patients) and various degrees of dyspnea (in 16 (43%) patients) were less frequent. Pathological ECG findings were documented in eight (22%) patients. T2-weighted "edema" imaging was positive in one (3%) patient with MELAS (mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes) only. LGE imaging demonstrated the presence of non-ischemic LGE in 12 (32%) patients: 10 out of 24 (42%) patients with CPEO (chronic progressive external ophthalmoplegia) or KSS (Kearns-Sayre syndrome) and 2 of 3 (67%) patients with MELAS were LGE positive. All 10 LGE-positive patients with CPEO or KSS demonstrated a potentially typical pattern of diffuse intramural LGE in the left-ventricular (LV) inferolateral segments. Cardiac involvement is a frequent finding in patients with mitochondrial myopathy. A potentially characteristic pattern of diffuse intramural LGE in the LV inferolateral segments was identified in

  8. Temporomandibular joint arthrocentesis for internal derangement with disc displacement without reduction.

    Bhargava, Darpan; Jain, Megha; Deshpande, Ashwini; Singh, Ajita; Jaiswal, Jagdish

    2015-06-01

    Temporomandibular joint (TMJ) disc derangement is defined as a malpositioning of the articular disc relative to the condyle and eminence. Arthrocentesis of the TMJ is a minimally invasive chair side procedure for the patients with TMJ internal derangement. This case report presents convincing results to keep arthrocentesis as an imperative procedure to relieve such patients of their acute symptoms. TMJ dynamics has also been discussed for an in-depth understanding of the pathology in cases with internal derangement.

  9. Centronuclear myopathy in a Border collie dog.

    Eminaga, S; Cherubini, G B; Shelton, G D

    2012-10-01

    A two-year old, male entire Border collie was presented with a one-year history of exercise-induced collapsing on the pelvic limbs. Physical examination revealed generalised muscle atrophy. Neurological examination supported a generalised neuromuscular disorder. Electromyography revealed spontaneous electrical activity in almost all muscles. Unfixed and formaldehyde-fixed biopsy samples were collected from the triceps brachii, longissimus and vastus lateralis muscles. Histopathological, histochemical and ultrastructural examinations of biopsy specimens were consistent with either centronuclear or myotubular myopathy. The dog clinically improved with supportive treatment with L-carnitine, co-enzyme Q10 and vitamin B compound. To the authors' knowledge, this is the first report of centronuclear/myotubular myopathy in a Border collie. © 2012 British Small Animal Veterinary Association.

  10. Aerobic Training in Patients with Congenital Myopathy

    Hedermann, Gitte; Vissing, Christoffer Rasmus; Jensen, Karen

    2016-01-01

    INTRODUCTION: Congenital myopathies (CM) often affect contractile proteins of the sarcomere, which could render patients susceptible to exercise-induced muscle damage. We investigated if exercise is safe and beneficial in patients with CM. METHODS: Patients exercised on a stationary bike for 30......: The Regional Committee on Health Research Ethics of the Capital Region of Denmark H-2-2013-066 and ClinicalTrials.gov H2-2013-066....

  11. Bethlem myopathy: An autosomal dominant myopathy with flexion contractures, keloids, and follicular hyperkeratosis.

    Saroja, Aralikatte Onkarappa; Naik, Karkal Ravishankar; Nalini, Atcharayam; Gayathri, Narayanappa

    2013-10-01

    Bethlem myopathy and Ullrich congenital muscular dystrophy form a spectrum of collagenopathies caused by genetic mutations encoding for any of the three subunits of collagen VI. Bethlem phenotype is relatively benign and is characterized by proximal dominant myopathy, keloids, contractures, distal hyperextensibility, and follicular hyperkeratosis. Three patients from a single family were diagnosed to have Bethlem myopathy based on European Neuromuscular Centre Bethlem Consortium criteria. Affected father and his both sons had slowly progressive proximal dominant weakness and recurrent falls from the first decade. Both children aged 18 and 20 years were ambulant at presentation. All had flexion contractures, keloids, and follicular hyperkeratosis without muscle hypertrophy. Creatinine kinase was mildly elevated and electromyography revealed myopathic features. Muscle imaging revealed severe involvement of glutei and vasti with "central shadow" in rectus femoris. Muscle biopsy in the father showed dystrophic changes with normal immmunostaining for collagen VI, sarcoglycans, and dysferlin.

  12. Bethlem myopathy: An autosomal dominant myopathy with flexion contractures, keloids, and follicular hyperkeratosis

    Aralikatte Onkarappa Saroja

    2013-01-01

    Full Text Available Bethlem myopathy and Ullrich congenital muscular dystrophy form a spectrum of collagenopathies caused by genetic mutations encoding for any of the three subunits of collagen VI. Bethlem phenotype is relatively benign and is characterized by proximal dominant myopathy, keloids, contractures, distal hyperextensibility, and follicular hyperkeratosis. Three patients from a single family were diagnosed to have Bethlem myopathy based on European Neuromuscular Centre Bethlem Consortium criteria. Affected father and his both sons had slowly progressive proximal dominant weakness and recurrent falls from the first decade. Both children aged 18 and 20 years were ambulant at presentation. All had flexion contractures, keloids, and follicular hyperkeratosis without muscle hypertrophy. Creatinine kinase was mildly elevated and electromyography revealed myopathic features. Muscle imaging revealed severe involvement of glutei and vasti with "central shadow" in rectus femoris. Muscle biopsy in the father showed dystrophic changes with normal immmunostaining for collagen VI, sarcoglycans, and dysferlin.

  13. TMJ ARTICULAR DISC POSITION AND CONFIGURATION 30 YEARS AFTER INITIAL DIAGNOSIS OF INTERNAL DERANGEMENT

    DELEEUW, R; BOERING, G; STEGENGA, B; DEBONT, LGM

    Purpose: This study evaluates disc position and configuration on magnetic resonance imaging (MRI) in temporomandibular joints (TMJs) with a long history of internal derangement. Patients and Methods: Sagittal T1-weighted MRIs of 55 TMJs that were diagnosed with internal derangement approximately 30

  14. The expanding phenotype of mitochondrial myopathy.

    DiMauro, Salvatore; Gurgel-Giannetti, Juliana

    2005-10-01

    Our understanding of mitochondrial diseases (defined restrictively as defects in the mitochondrial respiratory chain) continues to progress apace. In this review we provide an update of information regarding disorders that predominantly or exclusively affect skeletal muscle. Most recently described mitochondrial myopathies are due to defects in nuclear DNA, including coenzyme Q10 deficiency, and mutations in genes that control mitochondrial DNA (mtDNA) abundance and structure such as POLG and TK2. Barth syndrome, an X-linked recessive mitochondrial myopathy/cardiopathy, is associated with altered lipid composition of the inner mitochondrial membrane, but a putative secondary impairment of the respiratory chain remains to be documented. Concerning the 'other genome', the role played by mutations in protein encoding genes of mtDNA in causing isolated myopathies has been confirmed. It has also been confirmed that mutations in tRNA genes of mtDNA can cause predominantly myopathic syndromes and - contrary to conventional wisdom - these mutations can be homoplasmic. Defects in the mitochondrial respiratory chain impair energy production and almost invariably involve skeletal muscle, causing exercise intolerance, myalgia, cramps, or fixed weakness, which often affects extraocular muscles and results in droopy eyelids (ptosis) and progressive external ophthalmoplegia.

  15. Cine MR imaging of internal derangements of the knee

    Niitsu, M.; Anno, I.; Ishikawa, N.; Akisada, M.; Fukubayashi, T.

    1990-01-01

    This paper assesses internal derangements of the knee joint by a new method of cine MR imaging. Cine MR imaging, involving cine acquisition of kinematic sagittal images during knee movement, was used to evaluate 51 symptomatic patients and 19 healthy subjects. Cine MR images of cruciate ligament fears showed disappearance of low-intensity bundles during knee movement, periodic appearance of joint fluid in the area of the ligament, and irregular tibial movement. Cine MR images of meniscal tears showed independent movement of meniscal fragments and periodic tear opening and closing. Twenty-seven of the 28 anterior cruciate ligament (ACL) tears confirmed arthroscopically were correctly identified with cine MR imaging, with a sensitivity of 96% and a specificity of 92%

  16. How long does it take to treat a Derangement?

    Melbye, Martin; Nymand, Camilla; Balskilde, Troels

    2008-01-01

    , functional restoration exercises and prophylactic instructions. A total of 66 lumbar and 26 cervical spine patients were included and treated for an average of 4.3 and 2.4 weeks respectively. Scores for pain, functional level and self efficacy improved significantly and to a clinically relevant extent...... to conservative management. Previous randomised controlled trials have reported clinically relevant outcomes for low back patients, following a two and eight week treatment programme. The purpose of this study is to track treatment duration for cervical and lumbar patients classified into the derangement syndrome....... Patients self reported scores for pain, functional level and self efficacy at intake and discharge to evaluate whether the duration of treatment was sufficient to allow for clinical relevant changes in health status. Patients were treated with home exercise, therapist generated forces, posture correction...

  17. Benign intracranial hypertension associated to blood coagulation derangements

    Niglio Alferio

    2006-12-01

    Full Text Available Abstract Background Benign Intracranial Hypertension (BIH may be caused, at least in part, by intracranial sinus thrombosis. Thrombosis is normally due to derangements in blood coagulation cascade which may predispose to abnormal clotting activation or deficiency in natural inhibitors' control. The aim of the study is to examine the strength of the association between risk factors for thrombosis and BIH. Patients and methods The incidence of prothrombotic abnormalities among a randomly investigated cohort of 17 patients with BIH, was compared with 51 healthy subjects matched for sex, age, body mass index, height and social background. Results The number of subjects with protein C deficiency was significantly higher in patients than in controls (3 vs 1, p Increased plasma levels of prothrombin fragment 1+2, fibrinopeptide A (FPA, and PAI-1 were demonstrated in patients group (5.7 ± 1.15 nM vs 0.45 ± 0.35 nM; 8.7 ± 2.5 ng/mL vs 2.2 ± 1.25 ng/mL; 45.7 ± 12.5 ng/mL vs 8.5 ± 6.7 ng/mL, respectively; p Discussion In agreement with other authors our data suggest a state of hypercoagulability in BIH associated with gene polymorphisms. Our findings also showed that mutations in cardiovascular genes significantly discriminate subjects with a BIH history. The association between coagulation and gene derangements, usually regarded to as cryptogenic, may suggest a possible pathogenetic mechanism in BIH. So, a prothrombotic tendency may exist that would, at least in part, explain some cases of BIH. Although based on a small population, these findings raise the exciting possibility of using these haemostatic factors as markers for selecting high-risk subjects in BIH disease.

  18. Hereditary myopathies with early respiratory insufficiency in adults.

    Naddaf, Elie; Milone, Margherita

    2017-11-01

    Hereditary myopathies with early respiratory insufficiency as a predominant feature of the clinical phenotype are uncommon and underestimated in adults. We reviewed the clinical and laboratory data of patients with hereditary myopathies who demonstrated early respiratory insufficiency before the need for ambulatory assistance. Only patients with disease-causing mutations or a specific histopathological diagnosis were included. Patients with cardiomyopathy were excluded. We identified 22 patients; half had isolated respiratory symptoms at onset. The diagnosis of the myopathy was often delayed, resulting in delayed ventilatory support. The most common myopathies were adult-onset Pompe disease, myofibrillar myopathy, multi-minicore disease, and myotonic dystrophy type 1. Single cases of laminopathy, MELAS (mitochondrial encephalomyopathy with lactic acidosis and strokelike events), centronuclear myopathy, and cytoplasmic body myopathy were identified. We highlighted the most common hereditary myopathies associated with early respiratory insufficiency as the predominant clinical feature, and underscored the importance of a timely diagnosis for patient care. Muscle Nerve 56: 881-886, 2017. © 2017 Wiley Periodicals, Inc.

  19. Hypothyroid myopathy. A clinical and pathologaical study.

    McKeran, R O; Slavin, G; Ward, P; Paul, E; Mair, W G

    1980-09-01

    Ten patients with varying degrees of hypothroid myopathy were studied clinically and by serial percutaneous needle muscle biopsies before and during treatment with L-thyroxine. The biochemical evidence of hypothyroidism was related to the severity of the myopathic and signs before treatment. The severity of myopathic symptoms before and during treatment correlated with the biochemical evidence of hypothyrodism, a type II fibre atrophy and increased central nuclear counts. Likewise, the clinical evidence of a myopathy before and during treatment was correlated with both a type II fibre atrophy and loss and increased central nuclear counts but was not related to the biochemical parameters of hypothyroidism, except the level of thyroid stimulating hormone. In the muscle, before and during treatment, of the two most severely affected patients, intracellular glycogen inclusions were seen in scattered muscle fibres. On light microscopy and on electronmicroscopy, numerous mitochondria were seen responding to L-thyroxine with accumulations of subsarcolemmal honey-combing. Vesicular abnormalities, an electron dense matrix or occasional crystalline deposits were seen in muscle mitochondria from less severely azffected patients. Severely myopathic muscle contained excessive glycogen, membrane bound glycogen and excess lipid in a mainly perinuclear distribution. Occasional myelin and membranous bodies were seen and satellite cells during the recovery phase. A group of patients with hypothyroid myopathy who are likely to have a delayed recovery of full muscle strength on L-thyroxine may be recognised by the presence of severe proximal muscle weakness and characteristic changes on histochemical and electronmicroscopic examination of muscle. The spectrum of histochemical and electronmicroscopic abnormalities of muscle revealed with increasing degree of hypothyrodism, suggests that a generally reversible acquired glycogen storage and mictochondrial disorder is an important feature

  20. [Cardiac myopathy due to overt hypothyroidism].

    Harbeck, B; Berndt, M J; Lehnert, H

    2014-03-01

    A 51-year-old man presented with progressive tiredness, proximal muscle weakness, hair loss and weight gain for months. The patient showed mild pretibial myxedema and dry skin. Laboratory findings revealed strongly elevated cardiac enzymes as well as marked hypothyroidism. The electrocardiogram, echocardiography, abdominal sonography and chest X-ray were unremarkable. Thyroid ultrasound demonstrated features of Hashimoto thyroiditis. The findings supported the diagnosis of an overt hypothyroidism with myxedema and rhabdomyolysis. After starting levothyroxine and volume substitution laboratory parameters and clinical condition slowly normalized. Severe overt hypothyroidism may rarely present primarily as myopathy with myositis and cardiac involvement. © Georg Thieme Verlag KG Stuttgart · New York.

  1. Bethlem myopathy is not allelic to limb-girdle muscular dystrophy type 1A

    Speer, M.C.; Yamaoka, L.H.; Stajich, J.; Lewis, K. [and others

    1995-08-28

    The Bethlem myopathy, an autosomal-dominant myopathy, shows a distribution of proximal muscle weakness similar to that observed in dominant limb-girdle muscular dystrophy (LGMD). Yet the Bethlem myopathy differs from most limb-girdle dystrophies in two important regards. First, the Bethlem myopathy presents with joint contractures most commonly observed at the elbows, ankles, and neck. Secondly, disease onset in the Bethlem myopathy is in early childhood, while most dominant LGMDs present with adult onset. 6 refs., 1 fig.

  2. Magnetic resonance imaging for the internal derangement of the knee

    Obara, Noboru; Yamauchi, Kazunori; Ohyama, Naoki; Kura, Hideharu; Tokita, Fumio; Sasaki, Tetsuhito

    1990-01-01

    To assess the usefulness of magnetic resonance imaging (MRI) in the preoperative diagnosis of internal derangement of the knee, MRI findings of 44 knees were reviewed. Definitive diagnoses were made by arthroscopy or arthrotomy: posterior cruciate ligament failure (8 knees), anterior cruciate ligament failure (21), inner meniscus injury (16), and outer meniscus injury (13). T1- and T2-weighted images were obtained by using a 1.5-T superconducting Signa MRI unit. The diagnostic accuracy was 100% for posterior cruciate ligament failure and anterior cruciate ligament failure, 89% for inner meniscus injury, and 93% for outer meniscus injury, suggesting the great potential of MRI in the preoperative diagnosis. For anterior cruciate ligament failure, the diagnostic accuracy was even more increased by combined use of T1-weighted sagittal imaging and T2-weighted coronal imaging. False positive findings for meniscus disorder included rupture of the posterior segment of meniscus, especially in the cnemis end. Longitudinal fissure of the posterior segment of the outer meniscus was misdiagnosed as lacuna of the popliteal muscle tendon. (N.K.)

  3. [Biologic therapy in idiopathic inflammatory myopathy].

    Selva-O'Callaghan, Albert; Ramos Casals, Manel; Grau Junyent, Josep M

    2014-09-15

    The aim of this article is to study the evidence-based knowledge related to the use of biological therapies in patients diagnosed with idiopathic inflammatory myopathy (dermatomyositis, polymyositis and inclusion body myositis). In this review the leading published studies related to the use of biological therapy in patients with myositis are analysed; mainly those with high methodological standards, that means randomized and controlled studies. Methodological drawbacks due to the rarity and heterogeneity of these complex diseases are also addressed. Up to now is not possible to ascertain the biologics as a recommended therapy in patients with myositis, at least based in the current evidence-based knowledge, although it can not be neglected as a therapeutic option in some clinical situations, taking into account the scarce of effective treatments in those patients, especially in refractory myositis. Future studies probably will help to better define the role of biological therapies in patients with idiopathic inflammatory myopathy. Copyright © 2013 Elsevier España, S.L.U. All rights reserved.

  4. Flaccid quadriplegia due to thyrotoxic myopathy.

    Couillard, Philippe; Wijdicks, Eelco F M

    2014-04-01

    Acute flaccid paralysis is an important clinical problem in neurological critical care. After implementing life-supporting measures, it is imperative to identify the correct diagnosis to provide timely appropriate care. Thyrotoxicosis is a recognized cause of myopathy, but rarely of quadriplegia. Here, we report a case of hyperthyroidism with severe weakness. Case report and video demonstration of clinical examination. We describe a case of a 59-year-old woman with Grave's disease who presented to the hospital with progressive shortness of breath secondary to atrial fibrillation with rapid ventricular response. Following contrast administration, she had a pulseless electrical activity arrest from which she recovered without cognitive sequelae, but with flaccid quadriplegia, facial diplegia, and hypophonia. CK was mildly elevated and electrolytes were essentially normal. Nerve conduction studies and electromyography demonstrated features supporting an acute myopathy without evidence of neuromuscular junction conduction abnormality. Normalization of thyroid hormones resulted in slow, but steady improvement over months after which she regained ambulation. Acute flaccid quadriplegia can result from thyrotoxicosis. With normalization of thyroid function, recovery can be expected.

  5. CLASSIFICATION OF TEMPOROMANDIBULAR-JOINT OSTEOARTHROSIS AND INTERNAL DERANGEMENT .2. SPECIFIC DIAGNOSTIC-CRITERIA

    STEGENGA, B; DEBONT, LGM; BOERING, G

    Separate entities of temporomandibular joint osteoarthrosis and internal derangement are operationally defined. Criteria are based on an analysis of the diagnostic significance of symptoms and signs, principles of synovial joint pathology in general, and on therapeutic considerations. The primary

  6. Evaluation of bone and disc configuration in TMJ internal derangement

    Park, Cheol Woo; Hwang, Eui Hwan; Lee, Sang Rae

    2001-01-01

    To investigate bone and disc configuration on MR images in internal derangement related to age. MR images of 150 TMJs in 107 patients were analyzed to determine the morphologic changes. Two groups were distinguished to be correlated with age. Group 1 consisted of TMJs that were diagnosed as having anterior disc displacement with reduction (ADDwR), and Group 2 consisted of TMJs that were diagnosed as having anterior disc displacement without reduction (ADDwR). We assessed the configuration of the articular disc, degree of anterior disc displacement, and osseous changes of TMJs. The third decade (83 of 150 joints) was most frequent in this study. In the ADDwR group biconcave disc was most frequent at all ages except fifth decade, but in the ADDwoR group deformed discs was most frequent at third and forth decades. In the ADDwR group slightly displaced discs was most frequent at all ages, but in the ADDwoR group severely displaced discs was most frequent at second decade, and the degree of disc displacement was increased with aging over 30 years of age. TM joints showed osseous changes in 17% of the ADDwR group, and in 30% of the ADDwoR group. MR findings of osseous changes of the TMJ were not found to be significantly correlated with age. The prevalence of deformation of disc, displacement of disc, and osseous changes of TMJ was higher in the ADDwoR group than in the ADDwR group. MR findings of disc configuration and degree of disc displacement were found to be correlated with age

  7. Atypical presentation of GNE myopathy with asymmetric hand weakness

    de Dios, John Karl L.; Shrader, Joseph A.; Joe, Galen O.; McClean, Jeffrey C.; Williams, Kayla; Evers, Robert; Malicdan, May Christine V.; Ciccone, Carla; Mankodi, Ami; Huizing, Marjan; McKew, John C.; Bluemke, David A.; Gahl, William A.; Carrillo-Carrasco, Nuria

    2014-01-01

    GNE myopathy is a rare autosomal recessive muscle disease caused by mutations in GNE, the gene encoding the rate-limiting enzyme in sialic acid biosynthesis. GNE myopathy usually manifests in early adulthood with distal myopathy that progresses slowly and symmetrically, first involving distal muscles of the lower extremities, followed by proximal muscles with relative sparing of the quadriceps. Upper extremities are typically affected later in the disease. We report a patient with GNE myopathy who presented with asymmetric hand weakness. He had considerably decreased left grip strength, atrophy of the left anterior forearm and fibro-fatty tissue replacement of left forearm flexor muscles on T1-weighted magnetic resonance imaging. The patient was an endoscopist and thus the asymmetric hand involvement may be associated with left hand overuse in daily repetitive pinching and gripping movements, highlighting the possible impact of environmental factors on the progression of genetic muscle conditions. PMID:25182749

  8. Genetics Home Reference: early-onset myopathy with fatal cardiomyopathy

    ... in childhood, people with EOMFC may also develop joint deformities called contractures that restrict the movement of ... Home Edition for Patients and Caregivers: Dilated Cardiomyopathy Neuromuscular Disease Center, Washington University Orphanet: Early-onset myopathy ...

  9. Statin Induced Myopathy a Patient with Multiple Systemic Diseases

    Özgül Uçar

    2011-04-01

    Full Text Available Hydroxymethylglutaryl-coenzyme A reductase inhibitors (statins are the most successful class of drugs for the treatment of hypercholesterolaemia and dyslipidaemia. However, the popular profile of statins in terms of efficacy has been maligned by theiradverse effects. Statin induced myopathy, which can be seen at any time during the course of therapy, is a clinically important cause of statin intolerance and discontinuation. When a patient with multiple systemic diseases who use numerous medications represent with myalgia and muscle cramps, statin induced myopathy may not be remembered at first. We present a patient with multiple systemic diseases, alcohol and morphine abuse in whom myopathy developed. After exclusion of other etiologies, we concluded that myopathy was related to statin therapy.

  10. Congenital myopathy is caused by mutation of HACD1

    Muhammad, Emad; Reish, Orit; Ohno, Yusuke; Scheetz, Todd; DeLuca, Adam; Searby, Charles; Regev, Miriam; Benyamini, Lilach; Fellig, Yakov; Kihara, Akio; Sheffield, Val C.; Parvari, Ruti

    2013-01-01

    Congenital myopathies are heterogeneous inherited diseases of muscle characterized by a range of distinctive histologic abnormalities. We have studied a consanguineous family with congenital myopathy. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous non-sense mutation in 3-hydroxyacyl-CoA dehydratase 1 (HACD1) in affected individuals. The mutation results in non-sense mediated decay of the HACD1 mRNA to 31% of control levels in patient muscle and completely abro...

  11. Skeletal muscle repair in a mouse model of nemaline myopathy

    Sanoudou, Despina; Corbett, Mark A.; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T.; Vlahovich, Nicole; Hardeman, Edna C.; Beggs, Alan H.

    2006-01-01

    Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five d...

  12. Aerobic Training in Patients with Congenital Myopathy.

    Gitte Hedermann

    Full Text Available Congenital myopathies (CM often affect contractile proteins of the sarcomere, which could render patients susceptible to exercise-induced muscle damage. We investigated if exercise is safe and beneficial in patients with CM.Patients exercised on a stationary bike for 30 minutes, three times weekly, for 10 weeks at 70% of their maximal oxygen uptake (VO2max. Creatine kinase (CK was monitored as a marker of muscle damage. VO2max, functional tests, and questionnaires evaluated efficacy.Sixteen patients with CM were included in a controlled study. VO2max increased by 14% (range, 6-25%; 95% CI 7-20; p < 0.001 in the seven patients who completed training, and tended to decrease in a non-intervention group (n = 7; change -3.5%; range, -11-3%, p = 0.083. CK levels were normal and remained stable during training. Baseline Fatigue Severity Scale scores were high, 4.9 (SE 1.9, and tended to decrease (to 4.4 (SE 1.7; p = 0.08 with training. Nine patients dropped out of the training program. Fatigue was the major single reason.Ten weeks of endurance training is safe and improves fitness in patients with congenital myopathies. The training did not cause sarcomeric injury, even though sarcomeric function is affected by the genetic abnormalities in most patients with CM. Severe fatigue, which characterizes patients with CM, is a limiting factor for initiating training in CM, but tends to improve in those who train.The Regional Committee on Health Research Ethics of the Capital Region of Denmark H-2-2013-066 and ClinicalTrials.gov H2-2013-066.

  13. Metabolism

    ... Are More Common in People With Type 1 Diabetes Metabolic Syndrome Your Child's Weight Healthy Eating Endocrine System Blood Test: Basic Metabolic Panel (BMP) Activity: Endocrine System Growth Disorders Diabetes Center Thyroid Disorders Your Endocrine System Movie: Endocrine ...

  14. Association between statin-associated myopathy and skeletal muscle damage.

    Mohaupt, Markus G; Karas, Richard H; Babiychuk, Eduard B; Sanchez-Freire, Verónica; Monastyrskaya, Katia; Iyer, Lakshmanan; Hoppeler, Hans; Breil, Fabio; Draeger, Annette

    2009-07-07

    Many patients taking statins often complain of muscle pain and weakness. The extent to which muscle pain reflects muscle injury is unknown. We obtained biopsy samples from the vastus lateralis muscle of 83 patients. Of the 44 patients with clinically diagnosed statin-associated myopathy, 29 were currently taking a statin, and 15 had discontinued statin therapy before the biopsy (minimal duration of discontinuation 3 weeks). We also included 19 patients who were taking statins and had no myopathy, and 20 patients who had never taken statins and had no myopathy. We classified the muscles as injured if 2% or more of the muscle fibres in a biopsy sample showed damage. Using reverse transcriptase polymerase chain reaction, we evaluated the expression levels of candidate genes potentially related to myocyte injury. Muscle injury was observed in 25 (of 44) patients with myopathy and in 1 patient without myopathy. Only 1 patient with structural injury had a circulating level of creatine phosphokinase that was elevated more than 1950 U/L (10x the upper limit of normal). Expression of ryanodine receptor 3 was significantly upregulated in patients with biopsy evidence of structural damage (1.7, standard error of the mean 0.3). Persistent myopathy in patients taking statins reflects structural muscle damage. A lack of elevated levels of circulating creatine phosphokinase does not rule out structural muscle injury. Upregulation of the expression of ryanodine receptor 3 is suggestive of an intracellular calcium leak.

  15. The role of molecular pain biomarkers in temporomandibular joint internal derangement.

    Ernberg, M

    2017-06-01

    There is evidence that low-grade inflammation may be responsible for pain and development of degenerative changes in temporomandibular joint internal derangement. This article reviews the current knowledge of the molecular mechanisms behind TMJ internal derangements. A non-systematic search was carried out in PubMed, Embase and the Cochrane library for studies regarding pathophysiological mechanisms behind internal derangements focusing on pain-mediating inflammatory and cartilage-degrading molecules. Recent data suggest that release of cytokines may be the key event for pain and cartilage destruction in TMJ internal derangements. Cytokines promote the release of matrix metalloproteinases (MMPs), and due to hypoxia, vascular endothelial growth factor (VEGF) is released. This activates chondrocytes to produce MMPs and reduce their tissue inhibitors (TIMPs) as well as the recruitment of osteoclasts, ultimately leading to cartilage and bone resorption. Also, proteoglycans have an important role in this process. Several cytokines, MMPs, TIMPs and VEGF have been identified in higher concentrations in the TMJ synovial fluid of patients with painful internal derangements and shown to be associated with the degree of degeneration. Other molecules that show elevated levels include hyaluronic acid synthase, disintegrin and metalloproteinase with thrombospondin motifs (ADAMTs), aggrecan, fibromodulin, biglycan and lumican. Taken together, more or less pronounced inflammation of TMJ structures with release of cytokines, MMPs and other molecular markers that interact in a complex manner may be responsible for tissue degeneration in internal derangements. As internal derangements may be symptom-free, the degree of inflammation, but also other mechanisms, may be important for pain development. © 2017 John Wiley & Sons Ltd.

  16. Gene expression profiling in equine polysaccharide storage myopathy revealed inflammation, glycogenesis inhibition, hypoxia and mitochondrial dysfunctions

    Benech Philippe

    2009-08-01

    Full Text Available Abstract Background Several cases of myopathies have been observed in the horse Norman Cob breed. Muscle histology examinations revealed that some families suffer from a polysaccharide storage myopathy (PSSM. It is assumed that a gene expression signature related to PSSM should be observed at the transcriptional level because the glycogen storage disease could also be linked to other dysfunctions in gene regulation. Thus, the functional genomic approach could be conducted in order to provide new knowledge about the metabolic disorders related to PSSM. We propose exploring the PSSM muscle fiber metabolic disorders by measuring gene expression in relationship with the histological phenotype. Results Genotypying analysis of GYS1 mutation revealed 2 homozygous (AA and 5 heterozygous (GA PSSM horses. In the PSSM muscles, histological data revealed PAS positive amylase resistant abnormal polysaccharides, inflammation, necrosis, and lipomatosis and active regeneration of fibers. Ultrastructural evaluation revealed a decrease of mitochondrial number and structural disorders. Extensive accumulation of an abnormal polysaccharide displaced and partially replaced mitochondria and myofibrils. The severity of the disease was higher in the two homozygous PSSM horses. Gene expression analysis revealed 129 genes significantly modulated (p Conclusion The main disorders observed in PSSM muscles could be related to mitochondrial dysfunctions, glycogenesis inhibition and the chronic hypoxia of the PSSM muscles.

  17. Nutritional status evaluation in patients affected by bethlem myopathy and ullrich congenital muscular dystrophy.

    Toni, Silvia; Morandi, Riccardo; Busacchi, Marcello; Tardini, Lucia; Merlini, Luciano; Battistini, Nino Carlo; Pellegrini, Massimo

    2014-01-01

    Collagen VI mutations lead to disabling myopathies like Bethlem myopathy (BM) and Ullrich congenital muscular dystrophy (UCMD). We have investigated the nutritional and metabolic status of one UCMD and seven BM patients (five female, three male, mean age 31 ± 9 years) in order to find a potential metabolic target for nutritional intervention. For this study, we used standard anthropometric tools, such as BMI evaluation and body circumference measurements. All results were compared to dual-energy X-ray absorptiometry (DXA), considered the "gold standard" method. Energy intake of each patient was evaluated through longitudinal methods (7-day food diary) while resting energy expenditure (REE) was predicted using specific equations and measured by indirect calorimetry. Clinical evaluation included general and nutritional blood and urine laboratory analyses and quantitative muscle strength measurement by hand-held dynamometry. BM and UCMD patients showed an altered body composition, characterized by low free fat mass (FFM) and high fat mass (FM), allowing us to classify them as sarcopenic, and all but one as sarcopenic-obese. Another main result was the negative correlation between REE/FFM ratio (basal energy expenditure per kilograms of fat-free mass) and the severity of the disease, as defined by the muscle megascore (correlation coefficient -0.955, P-value nutritional intervention in these patients.

  18. Acute afterload-imposed change in porcine cardiac metabolism imaged by hyperpolarized [1-13C]Pyruvate

    Tougaard, Rasmus Stilling; Søvsø Szocska Hansen, Esben; Laustsen, Christoffer

    Deranged metabolism is now considered a key causal factor in heart failure and has therefore gained considerable scientific interest. The novel technique hyperpolarized MR has emerged as a leading methodological candidate to study these derangements. We employed a clinically relevant, large animal...

  19. Comorbidity of internal derangement of the temporomandibular joint and silent dysfunction of the cervical spine.

    Stiesch-Scholz, M; Fink, M; Tschernitschek, H

    2003-04-01

    The aim of this evaluation was to examine correlations between internal derangement of the temporomandibular joint (TMJ) and cervical spine disorder (CSD). A prospective controlled clinical study was carried out. Thirty patients with signs and symptoms of internal derangement but without any subjective neck problems and 30 age- and gender-matched control subjects without signs and symptoms of internal derangement were examined. The investigation of the temporomandibular system was carried out using a 'Craniomandibular Index'. Afterwards an examiner-blinded manual medical investigation of the craniocervical system was performed. This included muscle palpation of the cervical spine and shoulder girdle as well as passive movement tests of the cervical spine, to detect restrictions in the range of movement as well as segmental intervertebral dysfunction. The internal derangement of the TMJ was significantly associated with 'silent' CSD (t-test, P temporomandibular system exhibited significantly more often pain on pressure of the neck muscles than patients without muscle tenderness of the temporomandibular system (t-test, P < 0.05). As a result of the present study, for patients with internal derangement of the TMJ an additional examination of the craniocervical system should be recommended.

  20. Genetics Home Reference: hereditary fibrosing poikiloderma with tendon contractures, myopathy, and pulmonary fibrosis

    ... Hereditary fibrosing poikiloderma with tendon contractures, myopathy, and pulmonary fibrosis Printable PDF Open All Close All Enable Javascript ... Fibrosing Poikiloderma with Tendon Contractures, Myopathy, and Pulmonary ... Lung, and Blood Institute (NHLBI): Pulmonary Function Tests National ...

  1. Acute liver failure after recommended doses of acetaminophen in patients with myopathies

    I. Ceelie (Ilse); L.P. James (Laura); V.M.G.J. Gijsen (Violette); R.A.A. Mathôt (Ron); S. Ito (Shinya); C.D. Tesselaar (Coranne); D. Tibboel (Dick); G. Koren (Gideon); S.N. de Wildt (Saskia)

    2011-01-01

    textabstractObjective: To determine the likelihood that recommended doses of acetaminophen are associated with acute liver failure in patients with myopathies. Design: Retrospective analysis. Setting: Level III pediatric intensive care unit. Patients: Two pediatric patients with myopathies and acute

  2. Acute liver failure after recommended doses of acetaminophen in patients with myopathies

    Ceelie, Ilse; James, Laura P.; Gijsen, Violette; Mathot, Ron A. A.; Ito, Shinya; Tesselaar, Coranne D.; Tibboel, Dick; Koren, Gideon; de Wildt, Saskia N.

    2011-01-01

    To determine the likelihood that recommended doses of acetaminophen are associated with acute liver failure in patients with myopathies. Retrospective analysis. Level III pediatric intensive care unit. Two pediatric patients with myopathies and acute liver failure. CLINICAL INVESTIGATIONS: We

  3. Genetics Home Reference: myopathy with deficiency of iron-sulfur cluster assembly enzyme

    ... Myopathy with deficiency of iron-sulfur cluster assembly enzyme Printable PDF Open All Close All Enable Javascript ... Myopathy with deficiency of iron-sulfur cluster assembly enzyme is an inherited disorder that primarily affects muscles ...

  4. Genetics Home Reference: inclusion body myopathy with early-onset Paget disease and frontotemporal dementia

    ... Share: Email Facebook Twitter Home Health Conditions IBMPFD Inclusion body myopathy with early-onset Paget disease and ... Javascript to view the expand/collapse boxes. Description Inclusion body myopathy with early-onset Paget disease and ...

  5. Correlation between internal derangement and osteoarthrosis in the temporomandibular joint using magnetic resonance imaging

    Song, Haeng Un; Choi, Sun Young; Koh, Kwang Joon [School of Dentistry, Chonbuk National University, Jeonju (Korea, Republic of)

    2002-12-15

    To evaluate the relationship between internal derangement and osteoarthrosis in the temporomandibular joint (TMJ) using magnetic resonance imaging (MRI). One hundred and six MR images of TMJs in 53 patients were evaluated. Disc displacements and osseous changes of the TMJs were assessed. Lateral and rotational disc displacements were also evaluated on coronal images. No significant differences in the frequency of osseous changes of the TMJs between disc displacement with reduction and disc displacement without reduction groups were found. The erosion of the condylar head and the sclerosis of the articular eminence were more frequent in the internal derangement group than in the no disc displacement group. The flattening was the most frequently observed osseous change of both the condylar head and articular eminence. The relationship between internal derangement and osteoarthrosis is obscure, but it is thought that both disorders adversely affect each other.

  6. Correlation between internal derangement and osteoarthrosis in the temporomandibular joint using magnetic resonance imaging

    Song, Haeng Un; Choi, Sun Young; Koh, Kwang Joon

    2002-01-01

    To evaluate the relationship between internal derangement and osteoarthrosis in the temporomandibular joint (TMJ) using magnetic resonance imaging (MRI). One hundred and six MR images of TMJs in 53 patients were evaluated. Disc displacements and osseous changes of the TMJs were assessed. Lateral and rotational disc displacements were also evaluated on coronal images. No significant differences in the frequency of osseous changes of the TMJs between disc displacement with reduction and disc displacement without reduction groups were found. The erosion of the condylar head and the sclerosis of the articular eminence were more frequent in the internal derangement group than in the no disc displacement group. The flattening was the most frequently observed osseous change of both the condylar head and articular eminence. The relationship between internal derangement and osteoarthrosis is obscure, but it is thought that both disorders adversely affect each other.

  7. Evaluation of osseous changes of TMJ in internal derangement and osteoarthritis patients using MRI

    Cho, Su Beom; Koh, Kwang Joon

    2001-01-01

    To evaluate the osseous changes of TMJ in internal derangement and osteoarthritis patients using MRI. MR images of 111 TMJs in 64 patients were analyzed to evaluate the osseous changes. 111 TMJs were divided into 6 groups according to the radiologic Stages by Schellhas and Wilkes. On MR images, we evaluate the osseous changes of articular eminence and condylar head. The most frequent Stage in internal derangement of TMJ was Stage Ι. And 38 joints (25.2%) revealed osteoarthritis with internal derangement. When osseous change of articular eminence and condylar head occur, flattening was the most common osseous change. Sclerosis was observed in all Stages and osteophytosis of condylar head was observed in Stage ΙΙ (1.8%) and ΙΙΙ (0.9%). Out of 28 joints with osteoarthritis, 6 joints (21.4%) showed joint effusion. MR image revealed abnormal configuration of disk, but the detection of minimal osseous change was subtle

  8. Metabolism

    ... lin), which signals cells to increase their anabolic activities. Metabolism is a complicated chemical process, so it's not ... how those enzymes or hormones work. When the metabolism of body chemicals is ... Hyperthyroidism (pronounced: hi-per-THIGH-roy-dih-zum). Hyperthyroidism ...

  9. BAG3 myofibrillar myopathy presenting with cardiomyopathy.

    Konersman, Chamindra G; Bordini, Brett J; Scharer, Gunter; Lawlor, Michael W; Zangwill, Steven; Southern, James F; Amos, Louella; Geddes, Gabrielle C; Kliegman, Robert; Collins, Michael P

    2015-05-01

    Myofibrillar myopathies (MFMs) are a heterogeneous group of neuromuscular disorders distinguished by the pathological hallmark of myofibrillar dissolution. Most patients present in adulthood, but mutations in several genes including BCL2-associated athanogene 3 (BAG3) cause predominantly childhood-onset disease. BAG3-related MFM is particularly severe, featuring weakness, cardiomyopathy, neuropathy, and early lethality. While prior cases reported either neuromuscular weakness or concurrent weakness and cardiomyopathy at onset, we describe the first case in which cardiomyopathy and cardiac transplantation (age eight) preceded neuromuscular weakness by several years (age 12). The phenotype comprised distal weakness and severe sensorimotor neuropathy. Nerve biopsy was primarily axonal with secondary demyelinating/remyelinating changes without "giant axons." Muscle biopsy showed extensive neuropathic changes that made myopathic changes difficult to interpret. Similar to previous cases, a p.Pro209Leu mutation in exon 3 of BAG3 was found. This case underlines the importance of evaluating for MFMs in patients with combined neuromuscular weakness and cardiomyopathy. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Myofibrillar myopathies: State of the art, present and future challenges.

    Béhin, A; Salort-Campana, E; Wahbi, K; Richard, P; Carlier, R-Y; Carlier, P; Laforêt, P; Stojkovic, T; Maisonobe, T; Verschueren, A; Franques, J; Attarian, S; Maues de Paula, A; Figarella-Branger, D; Bécane, H-M; Nelson, I; Duboc, D; Bonne, G; Vicart, P; Udd, B; Romero, N; Pouget, J; Eymard, B

    2015-10-01

    Myofibrillar myopathies (MFM) have been described in the mid-1990s as a group of diseases sharing common histological features, including an abnormal accumulation of intrasarcoplasmic proteins, the presence of vacuoles and a disorganization of the intermyofibrillar network beginning at the Z-disk. The boundaries of this concept are still uncertain, and whereas six genes (DES, CRYAB, LDB3/ZASP, MYOT, FLNC and BAG3) are now classically considered as responsible for MFM, other entities such as FHL1 myopathy or Hereditary Myopathy with Early Respiratory Failure linked to mutations of titin can now as well be included in this group. The diagnosis of MFM is not always easy; as histological lesions can be focal, and muscle biopsy may be disappointing; this has led to a growing importance of muscle imaging, and the selectivity of muscle involvement has now been described in several disorders. Due to the rarity of these myopathies, if some clinical patterns (such as distal myopathy associated with cardiomyopathy due to desmin mutations) are now well known, surprises remain possible and should lead to systematic testing of the known genes in case of a typical histological presentation. In this paper, we aim at reviewing the data acquired on the six main genes listed above as well as presenting the experience from two French reference centres, Paris and Marseilles. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  11. Mitochondrial myopathy presenting as fibromyalgia: a case report

    Abdullah Mishal

    2012-02-01

    Full Text Available Abstract Introduction To the best of our knowledge, we describe for the first time the case of a woman who met the diagnostic criteria for fibromyalgia, did not respond to therapy for that disorder, and was subsequently diagnosed by biochemical and genetic studies with a mitochondrial myopathy. Treatment of the mitochondrial myopathy resulted in resolution of symptoms. This case demonstrates that mitochondrial myopathy may present in an adult with a symptom complex consistent with fibromyalgia. Case presentation Our patient was a 41-year-old Caucasian woman with symptoms of fatigue, exercise intolerance, headache, and multiple trigger points. Treatment for fibromyalgia with a wide spectrum of medications including non-steroidal anti-inflammatory drugs, antidepressants, gabapentin and pregabalin had no impact on her symptoms. A six-minute walk study demonstrated an elevated lactic acid level (5 mmol/L; normal Conclusions This case demonstrates that adults diagnosed with fibromyalgia may have their symptom complex related to an adult onset mitochondrial myopathy. This is an important finding since treatment of mitochondrial myopathy resulted in resolution of symptoms.

  12. Autosomal dominant distal myopathy: Linkage to chromosome 14

    Laing, N.G.; Laing, B.A.; Wilton, S.D.; Dorosz, S.; Mastaglia, F.L.; Kakulas, B.A. [Australian Neuromuscular Research Institute, Perth (Australia); Robbins, P.; Meredith, C.; Honeyman, K.; Kozman, H.

    1995-02-01

    We have studied a family segregating a form of autosomal dominant distal myopathy (MIM 160500) and containing nine living affected individuals. The myopathy in this family is closest in clinical phenotype to that first described by Gowers in 1902. A search for linkage was conducted using microsatellite, VNTR, and RFLP markers. In total, 92 markers on all 22 autosomes were run. Positive linkage was obtained with 14 of 15 markers tested on chromosome 14, with little indication of linkage elsewhere in the genome. Maximum two-point LOD scores of 2.60 at recombination fraction .00 were obtained for the markers MYH7 and D14S64 - the family structure precludes a two-point LOD score {ge} 3. Recombinations with D14S72 and D14S49 indicate that this distal myopathy locus, MPD1, should lie between these markers. A multipoint analysis assuming 100% penetrance and using the markers D14S72, D14S50, MYH7, D14S64, D14S54, and D14S49 gave a LOD score of exactly 3 at MYH7. Analysis at a penetrance of 80% gave a LOD score of 2.8 at this marker. This probable localization of a gene for distal myopathy, MPD1, on chromosome 14 should allow other investigators studying distal myopathy families to test this region for linkage in other types of the disease, to confirm linkage or to demonstrate the likely genetic heterogeneity. 24 refs., 3 figs., 1 tab.

  13. Prevalence and phenotypes of congenital myopathy due to α-actin 1 gene mutations

    Witting, Nanna; Werlauff, Ulla; Duno, Morten

    2016-01-01

    airway pressure. Limb flexor/extensor muscles and upper and lower extremities were affected equally. Pronounced neck flexor weakness was noted. CONCLUSIONS: Congenital myopathy caused by ACTA1 mutations is fatal in infancy in most cases. This study shows that the prevalence of α-actin myopathy in older...... patients with congenital myopathy is not negligible and that phenotypes can be quite mild....

  14. Is Vitamin D Deficiency a Confounder in Alcoholic Skeletal Muscle Myopathy?

    Wijnia, J.W.; Wielders, J.P.M.; Lips, P.T.A.M.; van der Wiel, A.; Mulder, C.L.; Nieuwenhuis, K.G.A.

    2013-01-01

    Background: Excessive intake of alcohol is often associated with low or subnormal levels of vitamin D even in the absence of active liver disease. As vitamin D deficiency is a well-recognized cause of myopathy, alcoholic myopathy might be related to vitamin D deficiency. Chronic alcoholic myopathy

  15. Hypothyroid myopathy: A peculiar clinical presentation of thyroid failure. Review of the literature.

    Sindoni, Alessandro; Rodolico, Carmelo; Pappalardo, Maria Angela; Portaro, Simona; Benvenga, Salvatore

    2016-12-01

    Abnormalities in thyroid function are common endocrine disorders that affect 5-10 % of the general population, with hypothyroidism occurring more frequently than hyperthyroidism. Clinical symptoms and signs are often nonspecific, particularly in hypothyroidism. Muscular symptoms (stiffness, myalgias, cramps, easy fatigability) are mentioned by the majority of patients with frank hypothyroidism. Often underestimated is the fact that muscle symptoms may represent the predominant or the only clinical manifestation of hypothyroidism, raising the issue of a differential diagnosis with other causes of myopathy, which sometimes can be difficult. Elevated serum creatine kinase, which not necessarily correlates with the severity of the myopathic symptoms, is certainly suggestive of muscle impairment, though it does not explain the cause. Rare muscular manifestations, associated with hypothyroidism, are rhabdomyolysis, acute compartment syndrome, Hoffman's syndrome and Kocher-Debré-Sémélaigne syndrome. Though the pathogenesis of hypothyroid myopathy is not entirely known, proposed mechanisms include altered glycogenolytic and oxidative metabolism, altered expression of contractile proteins, and neuro-mediated damage. Correlation studies of haplotype, muscle gene expression and protein characterization, could help understanding the pathophysiological mechanisms of this myopathic presentation of hypothyroidism.

  16. A Rare Manifestation of Hypothyroid Myopathy: Hoffmann's Syndrome

    Kang Won Lee

    2015-12-01

    Full Text Available Hypothyroid myopathy is observed frequently and the resolution of the clinical manifestations of myopathy following thyroid hormone replacement is well known. However, a specific subtype of hypothyroid myopathy, Hoffmann's syndrome, characterized by increased muscular mass (pseudohypertrophy, proximal muscle weakness, muscle stiffness and cramps, is rarely reported. Herein, we describe a 34-year-old male who presented with proximal muscle weakness and non-pitting edema of the lower extremities. He initially visited the neurology department where he was suspected of having polymyositis. Additional laboratory evaluation revealed profound autoimmune hypothyroidism and elevated muscle enzymes including creatine kinase. The patient was started on levothyroxine treatment and, subsequently, clinical symptoms and biochemical parameters resolved with the treatment. The present case highlights that hypothyroidism should be considered in the differential diagnosis of musculoskeletal symptoms even in the absence of overt manifestations of hypothyroidism. To our knowledge, this is the first case reported in Korea.

  17. A Case Report of Inflammatory Myopathy and Sideroblastic Anemia

    F Binesh

    2007-01-01

    Full Text Available Mitochondrial myopathy, lactic acidosis, and siderobastic anemia (MLA SA syndrome is one of the newly reported mitochondrial diseases, seven cases of which have been reported. We report a child with inflammatory myopathy, sideroblastic anemia and lactic acidosis .The patient is a 8.5 year old boy with normal cognitive function suffering from chronic progressive weakness in lower extremities, inability to walk since four months and pallor. In paraclinical evaluation, sideroblastic anemia, mild lactic acidosis and elevated muscle enzymes were seen. Inflammatory myopathy (myositis in muscle biopsy was detected as well .The patient was administered oral prednisolone, folic acid, B6 and underwent regular physiotherapy. He ambulated after four months and resumed education and schooling.

  18. Magnetic resonance imaging findings of the retrodiskal tissue in TMJ internal derangement

    Cho, Bong Hae

    2003-01-01

    To describe the MRI findings of the retrodiskal tissue in patients presenting with TMJ internal derangement and to correlate these findings with clinical and other MRI manifestations. One hundred eighteen joints of 63 patients with TMJ internal derangement were examined by MRI. T1-weighted sagittal MR images taken in both closed- and open-mouth were evaluated for the presence of demarcation between disk and retrodiskal tissue, the presence of low signal intensity, and the depiction of the temporal part of the posterior attachment. The results were correlated with the duration of TMJ internal derangement, the presence of pain, and other MRI findings, including the type of internal derangement, the extent of disk displacement, the degree of disc deformation, and the presence of osteoarthrosis. A significant relationship between the presence of low signal intensity in the retrodiskal tissue and other MRI findings was determined. Low signal intensity on the open-mouth view was observed more frequently in patients with disc displacement without reduction, severe disc displacement and deformation, and osteoarthrosis (p<0.05). The demarcation between disk and retrodiskal tissue, and the depiction of the temporal part of the posterior attachment (TPA) were correlated neither with clinical, nor with other MRI findings. This study suggests that low signal intensity in the retrodiskal tissue on open-mouth MR image can be indicative of advanced stages of disk displacement.

  19. Hoffmann's disease: MR imaging of hypothyroid myopathy

    Chung, Jeewon; Ahn, Kyung-Sik; Kang, Chang Ho; Hong, Suk-Joo; Kim, Beak Hyun

    2015-01-01

    Hoffmann's syndrome is a hypothyroid myopathy presenting as muscle stiffness and hypertrophy. It is a rare complication of hypothyroidism. MRI features of this syndrome have seldom been described in the literature. We present a case of Hoffmann's syndrome in a 34-year-old man who underwent lower extremity contrast-enhanced MRI. MRI can demonstrate the hypertrophic configuration, T2 hyperintensity, and enhancement of the involved muscles in Hoffmann's syndrome. Along with clinical, laboratory, and electromyography findings, MRI may be helpful in distinguishing between inflammatory myopathy, myonecrosis, subacute muscle denervation, and infectious myositis. (orig.)

  20. Hoffmann's disease: MR imaging of hypothyroid myopathy

    Chung, Jeewon; Ahn, Kyung-Sik; Kang, Chang Ho [Korea University Anam Hospital, Korea University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Hong, Suk-Joo [Korea University Guro Hospital, Korea University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Kim, Beak Hyun [Korea University Ansan Hospital, Korea University College of Medicine, Department of Radiology, Gyeonggi-do (Korea, Republic of)

    2015-11-15

    Hoffmann's syndrome is a hypothyroid myopathy presenting as muscle stiffness and hypertrophy. It is a rare complication of hypothyroidism. MRI features of this syndrome have seldom been described in the literature. We present a case of Hoffmann's syndrome in a 34-year-old man who underwent lower extremity contrast-enhanced MRI. MRI can demonstrate the hypertrophic configuration, T2 hyperintensity, and enhancement of the involved muscles in Hoffmann's syndrome. Along with clinical, laboratory, and electromyography findings, MRI may be helpful in distinguishing between inflammatory myopathy, myonecrosis, subacute muscle denervation, and infectious myositis. (orig.)

  1. Glucocorticoid-induced myopathy in the intensive care unit

    Eddelien, Heidi Shil; Hoffmeyer, Henrik Westy; Lund, Eva Charlotte Løbner

    2015-01-01

    Glucocorticoids (GC) are used for intensive care unit (ICU) patients on several indications. We present a patient who was admitted to the ICU due to severe respiratory failure caused by bronchospasm requiring mechanical ventilation and treated with methylprednisolone 240 mg/day in addition...... to antibiotics and bronchiolytics. When the sedation was lifted on day 10, the patient was awake but quadriplegic. Blood samples revealed elevated muscle enzymes, electromyography showed myopathy, and a muscle biopsy was performed. Glucocorticoid-induced myopathy was suspected, GC treatment was tapered...

  2. Mitochondrial Myopathy: A Rare Cause of Early-Onset Vocal Fold Atrophy

    Kelly, Elizabeth A.; Bock, Jonathan M.; Peltier, Amanda C.; Oh, Shin J.; Garrett, C. Gaelyn

    2014-01-01

    Objectives We present the second published case of laryngeal involvement in mitochondrial myopathy. Methods A patient with laryngeal involvement of mitochondrial myopathy is presented, together with a literature review. Results A 41-year-old man presented with progressive breathy dysphonia. His brother had mitochondrial myopathy. Biopsy of the biceps muscle demonstrated cytochrome C oxidase–negative ragged blue fibers confirming mitochondrial myopathy. Videostroboscopy showed marked vocal fold atrophy, but subsequent injection laryngoplasty did not significantly improve the patient’s voice, despite improved postoperative glottic closure. Conclusions Mitochondrial myopathy should be considered in the differential diagnosis of severe early-onset vocal fold atrophy. PMID:23577570

  3. Quantification of disc displacement in internal derangement of the temporomandibular joint using magnetic resonance imaging.

    Arayasantiparb, Raweewan; Tsuchimochi, Makoto

    2010-02-01

    Many measures have been developed to determine the extent of disc displacement in internal derangements of the temporomandibular joint (TMJ) using magnetic resonance imaging. The purpose of this study was to develop a quantitative method of analyzing disc position and to evaluate the positions of the disc in internal derangements of the TMJ (group 1, with reduction; group 2, without reduction). Magnetic resonance images of 150 TMJs in 20 healthy volunteers and 55 patients with internal derangements were evaluated. The anatomical points of interest of the TMJ, including the anterior (DA) and posterior (DP) points of the disc, were marked on parasagittal magnetic resonance images of the TMJ disc taken in both the closed- and the open-mouth positions. All points were recorded using an x-y coordinate system, with reference to a referral line. In the closed-mouth position, the DP in patients in group 1 was situated in a more-anterior direction than the DP in volunteers. The DP in group 2 was located further anterior and inferior than the DP in group 1. However, the position of the DA did not differ between group 1 and group 2. In the open-mouth position, the DP was displaced anteroinferiorly to a greater extent in group 2 than in group 1 (one-way ANOVA, followed by Scheffe's test; P displaced TMJ discs revealed no significant difference. In conclusion, most of our results quantitatively support previously reported findings in imaging, surgical, and histopathological studies of TMJ internal derangement. We suggest that our measure of disc position of the TMJ would be useful to assess the status and response to treatment of internal derangements of the TMJ.

  4. DNAJB6 myopathies: Focused review on an emerging and expanding group of myopathies

    Alessandra Ruggieri

    2016-09-01

    Full Text Available Mutations in the DNAJB6 gene have been associated with the autosomal dominant limb girdle muscular dystrophy type 1D (LGMD1D, a disorder characterized by abnormal protein aggregates and rimmed vacuoles in muscle fibers. DNAJB6 is a ubiquitously expressed Hsp40 co-chaperone characterized by a J domain that specifies Hsp70 functions in the cellular environment. DNAJB6 is also a potent inhibitor of expanded polyglutamine (polyQ aggregation preventing aggregate toxicity in cells. In DNAJB6-mutated patients this anti-aggregation property is significantly reduced, albeit not completely lost. To elucidate the pathogenetic mechanisms underlying the DNAJB6-related myopathy, animal models have been created showing that, indeed, conditional muscular expression of a DNAJB6 mutant in the mouse causes a LGMD1D myofibrillary muscle tissue phenotype. Both mutations and phenotypes reported until recently were rather homogeneous, being exclusively missense mutations of a few amino acids of the protein G/F domain, and with a phenotype characterized by adult-onset slowly progressive muscular dystrophy predominantly affecting proximal muscles. Lately, several novel mutations and new phenotypes of DNAJB6 have been described. These mutations once more affect the G/F domain of DNAJB6 with missense changes and a splice site mutation; and the phenotypes include childhood onset and distal involvement of muscles, or childhood-onset LGMD1D with loss of ambulation in early adulthood and respiratory involvement. Thus, the spectrum of DNAJB6-related phenotypes is widening. Although our knowledge about the role of DNAJB6 in the pathogenesis of muscle diseases has made great progression, several questions remain unsolved, including why a ubiquitous protein affects only, or predominantly, skeletal muscle; why only the G/F domain is involved; and what is the possible role of the DNAJB6a isoform. Clarification of these issues will provide clues to implement possible therapeutic

  5. Gyrate atrophy of choroid and retina with myopia, cataract and systemic proximal myopathy: A rare case report from rural India

    Surekha Bangal

    2012-12-01

    Full Text Available AbstractGyrate atrophy is a rare metabolic disease with autosomal recessive inheritance pattern characterised by hyperornithinemia and typical ocular findings. This report presents a 17-year-old intellectually challenged girl consulting for a progressive fall of visual acuity with night blindness. Fundus examination showed patches of chorioretinal atrophy with typical scalloped borders and peri vascular pigmentation in the equatorial region. Fundus fluroscein angiography revealed characteristic staining pattern. Other ocular associations included myopia and posterior sub capsular cataract. Progressive systemic proximal myopathy was one of the associated features. Dietary supplementation of vitamin B6 was advised.

  6. Genetics Home Reference: CAV3-related distal myopathy

    ... gene causes a peculiar form of distal myopathy. Neurology. 2002 Jan 22;58(2):323-5. Erratum in: Neurology 2002 Mar 12;58(5):839. Itoyoma Y [ ... 3 cause four distinct autosomal dominant muscle diseases. Neurology. 2004 Feb 24;62(4):538-43. Review. ...

  7. Congenital myopathy is caused by mutation of HACD1.

    Muhammad, Emad; Reish, Orit; Ohno, Yusuke; Scheetz, Todd; Deluca, Adam; Searby, Charles; Regev, Miriam; Benyamini, Lilach; Fellig, Yakov; Kihara, Akio; Sheffield, Val C; Parvari, Ruti

    2013-12-20

    Congenital myopathies are heterogeneous inherited diseases of muscle characterized by a range of distinctive histologic abnormalities. We have studied a consanguineous family with congenital myopathy. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous non-sense mutation in 3-hydroxyacyl-CoA dehydratase 1 (HACD1) in affected individuals. The mutation results in non-sense mediated decay of the HACD1 mRNA to 31% of control levels in patient muscle and completely abrogates the enzymatic activity of dehydration of 3-hydroxyacyl-CoA, the third step in the elongation of very long-chain fatty acids (VLCFAs). We describe clinical findings correlated with a deleterious mutation in a gene not previously known to be associated with congenital myopathy in humans. We suggest that the mutation in the HACD1 gene causes a reduction in the synthesis of VLCFAs, which are components of membrane lipids and participants in physiological processes, leading to congenital myopathy. These data indicate that HACD1 is necessary for muscle function.

  8. Eosinophilic fasciitis in a child mimicking a myopathy.

    Pillen, S.; Engelen, B.G.M. van; Hoogen, F.H.J. van den; Fiselier, T.J.W.; Vossen, P. van der; Drost, G.

    2006-01-01

    A 14-year-old boy was suspected of having a myopathy with joint contractures. He presented with progressive painless joint contractures of his right wrist and fingers, and reduced muscle strength of his right arm, without obvious skin changes. Laboratory investigation showed a normal CK,

  9. GNE Myopathy in Turkish Sisters with a Novel Homozygous Mutation

    Diniz, Gulden; Secil, Yaprak; Ceylaner, Serdar; Tokucoglu, Figen; Türe, Sabiha; Celebisoy, Mehmet; İncesu, Tülay Kurt; Akhan, Galip

    2016-01-01

    Background. Hereditary inclusion body myopathy is caused by biallelic defects in the GNE gene located on chromosome 9p13. It generally affects adults older than 20 years of age. Methods and Results. In this study, we present two Turkish sisters with progressive myopathy and describe a novel mutation in the GNE gene. Both sisters had slightly higher levels of creatine kinase (CK) and muscle weakness. The older sister presented at 38 years of age with an inability to climb steps, weakness, and a steppage gait. Her younger sister was 36 years old and had similar symptoms. The first symptoms of the disorder were seen when the sisters were 30 and 34 years old, respectively. The muscle biopsy showed primary myopathic features and presence of rimmed vacuoles. DNA analysis demonstrated the presence of previously unknown homozygous mutations [c.2152 G>A (p.A718T)] in the GNE genes. Conclusion. Based on our literature survey, we believe that ours is the first confirmed case of primary GNE myopathy with a novel missense mutation in Turkey. These patients illustrate that the muscle biopsy is still an important method for the differential diagnosis of vacuolar myopathies in that the detection of inclusions is required for the definitive diagnosis. PMID:27298745

  10. Clinical, serologic, and immunogenetic features of familial idiopathic inflammatory myopathy

    Rider, L. G.; Gurley, R. C.; Pandey, J. P.; Garcia de la Torre, I.; Kalovidouris, A. E.; O'Hanlon, T. P.; Love, L. A.; Hennekam, R. C.; Baumbach, L. L.; Neville, H. E.; Garcia, C. A.; Klingman, J.; Gibbs, M.; Weisman, M. H.; Targoff, I. N.; Miller, F. W.

    1998-01-01

    OBJECTIVE: To describe the clinical, serologic, and immunogenetic features of familial idiopathic inflammatory myopathy (IIM) and to compare these with the features of sporadic IIM. METHODS: Clinical signs and symptoms, autoantibodies, HLA-DRB1 and DQA1 alleles, and GM/KM phenotypes were compared

  11. Severe polysaccharide storage myopathy in Belgian and Percheron draught horses.

    Valentine, B A; Credille, K M; Lavoie, J P; Fatone, S; Guard, C; Cummings, J F; Cooper, B J

    1997-05-01

    A severe myopathy leading to death or euthanasia was identified in 4 Belgian and 4 Percheron draught horses age 2-21 years. Clinical signs ranged from overt weakness and muscle atrophy in 2 horses age 2 and 3 years, to recumbency with inability to rise in 6 horses age 4-21 years. In 5 horses there was mild to severe increases in muscle enzyme levels. Clinical diagnoses included equine motor neuron disease (2 horses), post anaesthetic myopathy (2 horses), exertional myopathy (2 horses), myopathy due to unknown (one horse), and equine protozoal myelitis (one horse). Characteristic histopathology of muscle from affected horses was the presence of excessive complex polysaccharide and/or glycogen, revealed by periodic acid-Schiff staining in all cases and by electron microscopy in one case. Evaluation of frozen section histochemistry performed on 2 cases indicated that affected fibres were Type 2 glycolytic fibres. Subsarcolemmal and intracytoplasmic vacuoles were most prominent in 3 horses age 2-4 years, and excessive glycogen, with little or no complex polysaccharide, was the primary compound stored in affected muscle in these young horses. Myopathic changes, including fibre size variation, fibre hypertrophy, internal nuclei, and interstitial fat infiltration, were most prominent in 5 horses age 6-21 years, and the accumulation of complex polysaccharide appeared to increase with age. Mild to moderate segmental myofibre necrosis was present in all cases.

  12. Systemic Metabolic Derangement, Pulmonary Effects, and Insulin Insufficiency Following Subchronic Ozone Exposure in Rats

    U.S. Environmental Protection Agency — This data set includes individual animal data collected for various biological endpoints that are included in the manuscript. Miller DB, Snow SJ, Henriquez A,...

  13. Supportive Management of Mucositis and Metabolic Derangements in Head and Neck Cancer Patients

    Bonomi, Marcelo; Batt, Katharine

    2015-01-01

    Oral mucositis (OM) is among the most undesirable, painful, and expensive toxicities of cytotoxic cancer therapy, and is disheartening for patients and frustrating for caregivers. Accurate assessment of the incidence of OM has been elusive, but accumulating data suggests that reported OM frequency is significantly less than its actual occurrence. It has been suggested that over 90% of head and neck cancer (HNC) patients receiving radiotherapy (RT) with concurrent cisplatin experience severe OM with symptoms of extreme pain, mucosal ulceration and consequent limitations in swallowing and achieving adequate nutritional intake. This panoply of symptoms inevitably impacts a patients’ quality of life and their willingness to continue treatment. In spite of all the advances made in understanding the pathophysiology of OM, there is still no prophylactic therapy with proven efficacy. Strategies to limit the extent of OM and to manage its symptomatology include basic oral care, supportive medications, nutritional support and targeting aggressive treatments to high-risk patients. This review focuses on OM recognition, preventive measurements, and symptom-management strategies

  14. Supportive Management of Mucositis and Metabolic Derangements in Head and Neck Cancer Patients

    Bonomi, Marcelo, E-mail: mbonomi@wakehealth.edu; Batt, Katharine [Section of Hematology and Medical Oncology, Wake Forest School of Medicine, Medical Center Boulevard, Winston-Salem, NC 27157 (United States)

    2015-09-03

    Oral mucositis (OM) is among the most undesirable, painful, and expensive toxicities of cytotoxic cancer therapy, and is disheartening for patients and frustrating for caregivers. Accurate assessment of the incidence of OM has been elusive, but accumulating data suggests that reported OM frequency is significantly less than its actual occurrence. It has been suggested that over 90% of head and neck cancer (HNC) patients receiving radiotherapy (RT) with concurrent cisplatin experience severe OM with symptoms of extreme pain, mucosal ulceration and consequent limitations in swallowing and achieving adequate nutritional intake. This panoply of symptoms inevitably impacts a patients’ quality of life and their willingness to continue treatment. In spite of all the advances made in understanding the pathophysiology of OM, there is still no prophylactic therapy with proven efficacy. Strategies to limit the extent of OM and to manage its symptomatology include basic oral care, supportive medications, nutritional support and targeting aggressive treatments to high-risk patients. This review focuses on OM recognition, preventive measurements, and symptom-management strategies.

  15. Are Peripheral Blood Mononuclear Cells Derived from Patients with Certain Myopathies Suitable for Personalized Drug Screening?

    Andriy V. Shatillo

    2014-12-01

    Full Text Available Background: Limb girdle muscular dystrophies (LGMDs and several other disorders which share their specific phenotype are rare, predominantly hereditary conditions with no curative treatment. Differential diagnosis of these myopathies is quite challenging and expensive in many cases. Therefore, a significant proportion of patients remains undiagnosed and untreated for a long time. At the same time there is a huge amount of drugs and supplements potentially able to modify the course of some of these muscular dystrophies. That is why a simple empirical approach able to define a patient’s reaction to a specific compound seems rational. Because most common basic pathogenetic mechanisms for these quite different disorders increase the vulnerability of muscle cells (or decrease ability for reparation during mechanical stress, we propose a simple, noninvasive and inexpensive approach for individualized drug screening based on the drug’s influence on the mechanical vulnerability of peripheral blood mononuclear cells (PBMC. Methods: PBMC derived from 8 patients with Duchenne muscular dystrophy (DMD, 2 patients with LGMD2A, 1 patient with LGMD2B, 1 with MERRF syndrome, 1 with facioscapulohumeral muscular dystrophy (FSHD and 13 matched control subjects were irradiated by ultrasound in the presence of several compounds (lisinopril, vitamin D3, prednisolon, tocopherol, topiramate, glutargin, α-lipoic acid, essentiale, and physiological solution. Then viability indexes of the samples were detected by citotoxic assays based on vital dye (neutral red and resazurin metabolism. Results: In cytotoxicity tests with active transport of neutral red into PBMC derived from DMD patients, the cells showed signs of destruction at 1.06±0.52 minutes of ultrasounding compared to 1.75±0.6 minutes in control. PBMCs from patients with other myopathies have either normal or decreased resistance to ultrasound. The addition of tocopherol significantly changes the PBMC

  16. Bezafibrate induces a mitochondrial derangement in human cell lines: a PPAR-independent mechanism for a peroxisome proliferator.

    Scatena, R; Bottoni, P; Vincenzoni, F; Messana, I; Martorana, G E; Nocca, G; De Sole, P; Maggiano, N; Castagnola, M; Giardina, B

    2003-11-01

    Bezafibrate is a hypolipidemic drug that belongs to the group of peroxisome proliferators because it binds to peroxisome proliferator-activated receptors type alpha (PPARs). Peroxisome proliferators produce a myriad of extraperoxisomal effects, which are not necessarily dependent on their interaction with PPARs. An investigation on the peculiar activities of bezafibrate could clarify some of the molecular events and the relationship with the biochemical and pharmacological properties of this class of compounds. In this view, the human acute promyelocytic leukemia HL-60 cell line and human rabdomiosarcoma TE-671 cell line were cultured in media containing bezafibrate and a number of observations such as spectrophotometric analysis of mitochondrial respiratory chain enzymes, NMR metabolite determinations, phosphofructokinase enzymatic analysis, and differentiation assays were carried on. Bezafibrate induced a derangement of NADH cytochrome c reductase activity accompanied by metabolic alterations, mainly a shift to anaerobic glycolysis and an increase of fatty acid oxidation, as shown by NMR analysis of culture supernatants where acetate, lactate, and alanine levels increased. On the whole, the present results suggest a biochemical profile and a therapeutic role of this class of PPARs ligands more complex than those previously proposed.

  17. Metabolic Profiles in Children During Fasting

    van Veen, Merel R.; van Hasselt, Peter M.; de Sain-van der Velden, Monique G. M.; Verhoeven, Nanda; Hofstede, Floris C.; de Koning, Tom J.; Visser, Gepke

    BACKGROUND: Hypoglycemia is one of the most common metabolic derangements in childhood. To establish the cause of hypoglycemia, fasting tolerance tests can be used. Currently available reference values for fasting tolerance tests have limitations in their use in daily practice. OBJECTIVE: The aim of

  18. Internal derangements of the temporomandibular joint: findings in the pediatric age group

    Katzberg, R.W.; Tallents, R.H.; Hayakawa, K.; Miller, T.L.; Goske, M.J.; Wood, B.P.

    1985-01-01

    Findings in 31 pediatric patients with pain and dysfunction of the temporomandibular joint (TMJ) are reported. The average age was 14 years and the average duration of symptoms was 21.4 months. Internal derangements were found in 29 patients (94%) and degenerative arthritis in 13 (42%). In 12 patients (39%), the problem could be traced to an injury to the jaw. Secondary condylar hypoplasia was associated with the meniscal abnormality in 3 patients (10%). Further awareness of internal derangements of the TMJ in the pediatric population should permit greater recognition of their etiology. It is important that threatment be initiated as soon as possible, not only to minimize the development of osseous disease in young adults but also to prevent facial growth deformities

  19. Evaluation of body posture in individuals with internal temporomandibular joint derangement.

    Munhoz, Wagner Cesar; Marques, Amélia Pasqual; de Siqueira, José Tadeu Tesseroli

    2005-10-01

    Temporomandibular dysfunctions (TMD) comprise a great number of disruptions that may affect the temporomandibular joint (TMJ), the masticatory muscles, or both. TMJ internal derangement is a specific type of TMD, of which the etiology and physiopathology are broadly unknown, but have been suggested to be linked to head, neck, and body posture factors. This study aimed at verifying possible relationships between body posture and TMJ internal derangements (TMJ-id), by comparing 30 subjects presenting typical TMJ-id signs to 20 healthy subjects. Subjects' clinical evaluations included anamnesis, stomatognatic system evaluation, and plotting analysis on body posture photographs. No statistically significant differences were found between the groups. Results do not support the assertion that body posture plays a role in causing or enhancing TMD; however, these results should be cautiously considered because of the small number of subjects evaluated and the many posture variables submitted to statistical procedures that lead to high standard deviations.

  20. Internal derangements of the temporomandibular joint: A review of the anatomy, diagnosis, and management

    Andrew L Young

    2015-01-01

    Full Text Available Internal derangements of the temporomandibular joint are conditions in which the articular disc has become displaced from its original position the condylar head. Relevant anatomic structures and their functional relationships are briefly discussed. The displacement of the disc can result in numerous presentations, with the most common being disc displacement with reduction (with or without intermittent locking, and disc displacement without reduction (with or without limited opening. These are described in this article according to the standardized Diagnostic Criteria for Temporomandibular Disorders, as well as the less common posterior disc displacement. Appropriate management usually ranges from patient education and monitoring to splints, physical therapy, and medications. In rare and select cases, surgery may be necessary. However, in for the majority of internal derangements, the prognosis is good, particularly with conservative care.

  1. Shoulder Internal Derangement and Osteoarthritis in a 25-Year-Old Female Softball Athlete.

    Cornelson, Stacey M; Hogarth, William; Ault, Daniel L; Kettner, Norman W

    2016-06-01

    The purpose of this report is to describe osteoarthritis and internal derangement of the shoulder in a collegiate softball player. A 25-year-old female softball athlete presented with a history of chronic right shoulder pain. A thorough clinical examination and multiple imaging studies were performed. Osteoarthritis was demonstrated on radiographs, and ligamentous and rotator cuff tendon tears were displayed on magnetic resonance imaging. The patient's treatment plan included full spine manipulation, cold laser therapy, kinesiotaping, stretching, and neuromuscular reeducation of the right shoulder. The patient reported a decrease in symptoms after 1 month, although treatment was sporadic because of poor patient compliance. Osteoarthritis and internal derangement may occur in overhead-throwing athletes, and correct imaging is needed for timely and accurate diagnoses. Following a timely diagnosis, the young patient in this case had a good recovery with multimodal chiropractic care.

  2. Chewing movements altered in the presence of temporomandibular joint internal derangements.

    Radke, John C; Kull, Robert S; Sethi, Manminder S

    2014-07-01

    The objectives were to find specific factors that are mathematically distinct between the chewing timings, movement pattern shapes, variability, and movement velocities of: (1) normal asymptomatic subjects and (2) a group of subjects with verified temporomandibular joint (TMJ) internal derangements. Left- and right-sided chewing movement recordings of 28 subjects (34.5 ± 14.0 years) were randomly selected from a large database of patients exhibiting verified unilateral or bilateral TMJ internal derangements. The chewing movements of an age- and gender-matched control group of 20 asymptomatic subjects (32.5 ± 11.6 years, P>0.60) with verified normal TMJ function were also recorded. Means and standard deviations of the opening, closing, turning point, terminal chewing position, and velocity patterns were calculated. A two-tailed Student's t-test with unequal variances was used to compare the parameters between the two groups (alpha = 0.05). The dysfunctional group functioned significantly slower and with greater variability than the control group. The vertical dimension was consistently smaller in the dysfunctional group (Pchewing position was significantly less precise in the dysfunctional group (vertical: Pchewing patterns than the control group. The functional pattern of mastication appears to be significantly altered in the presence of an internal derangement of the TMJ.

  3. The effects of temporomandibular joint internal derangement and degenerative joint disease on tomographic and arthrotomographic images.

    Brand, J W; Whinery, J G; Anderson, Q N; Keenan, K M

    1989-02-01

    In a blind study, 243 arthrograms were interpreted as showing normal disk position, anterior disk displacement with reduction, or anterior disk displacement without reduction. The presence or absence of a perforation of the posterior attachment or disk was recorded. Later, tomograms of the same patient were interpreted. The presence or absence of evidence of temporomandibular degenerative joint disease (TMDJD) was recorded. The condyle-to-fossa relationship was characterized as retropositioned or not retropositioned. O the 106 cases with tomographic evidence of TMDJD, 100 (94%) had arthrographic evidence of internal derangement (p less than 0.0001), whereas 47% of the cases with internal derangement (211) had evidence of TMDJD. Perforations were seen in 29 (27%) of the cases with degenerative joint disease and in none (0%) of the cases without TMDJD (p less than 0.001). In cases without TMDJD, 90% of the cases with internal derangement revealed condylar retropositioning (p less than 0.0001). With tomographic evidence of TMDJD present, the relationship between condylar position and disk position was not significant.

  4. Neurogenic myopathies and imaging of muscle denervation; Neurogene Myopathien und Bildgebung der Muskeldenervation

    Wolf, M. [Universitaetsklinikum Heidelberg, Abteilung fuer Neuroradiologie, Heidelberg (Germany); Wolf, C. [Reha-Zentrum Gernsbach, Neurologie, Gernsbach (Germany); Weber, M.A. [Universitaetsklinikum Heidelberg, Abteilung fuer Diagnostische und Interventionelle Radiologie, Heidelberg (Germany)

    2017-12-15

    Neurogenic myopathies are primary diseases of the nervous system, which secondarily result in denervation of the target musculature. The spectrum of potential causes is manifold ranging from acute traumatic injuries and chronic compression to neurodegenerative, inflammatory, metabolic and neoplastic processes. The medical history, clinical neurological examination, and electrophysiological tests including electromyography and nerve conduction studies are crucial in diagnosing neuropathic myopathies. Electromyography is the gold standard for diagnosing muscle denervation. Additional imaging methods and magnetic resonance imaging (MRI) in particular, are capable of contributing valuable information. The MRI examination of denervated musculature shows edema, an increase in the apparent diffusion coefficient (ADC) and hyperperfusion. Chronic denervation results in fatty degeneration and atrophy of affected muscles, which are also detectable by MRI. Although the MRI findings in muscle denervation are relatively unspecific, they show a high sensitivity, comparable to electromyography. Dedicated MR neurography may often visualize the underlying lesion(s) of the innervating nerve(s). Besides high sensitivity, comparable to electromyography, MRI is capable of evaluating muscles which are inaccessible for needle electromyography. Due to its non-invasive character, MRI is ideal for follow-up examinations. The use of MRI is often a meaningful addition to the diagnostics of neurogenic myopathies. The extent and distribution pattern of muscular alterations often provide information on the localization of the causative nerve damage. A correct diagnosis or at least a narrowing down of possible differential diagnoses can often be achieved using MRI. (orig.) [German] Neurogene Myopathien sind Erkrankungen des Nervensystems, die sekundaer zur Denervierung der Zielmuskulatur fuehren. Das Spektrum potenzieller Ursachen ist vielfaeltig und umfasst akute traumatische Verletzungen

  5. Diabetic Myopathy: Impact of Diabetes Mellitus on Skeletal Muscle Progenitor Cells

    Donna M D'Souza

    2013-12-01

    Full Text Available Diabetes mellitus is defined as a group of metabolic diseases that are associated with the presence of a hyperglycemic state due to impairments in insulin function. While the development of each form of diabetes (Type 1 or Type 2 drastically differs, resultant pathologies often overlap. In each diabetic condition a failure to maintain healthy muscle is often observed, and is termed diabetic myopathy. This significant, but often overlooked, complication is believed to contribute to the progression of additional diabetic pathologies due to the vital importance of skeletal muscle for our physical and metabolic well-being. While studies have investigated the link between changes to skeletal muscle metabolic health following diabetes mellitus onset (particularly Type 2 diabetes mellitus, few have examined the negative impact of diabetes mellitus on the growth and reparative capacities of skeletal muscle that often coincides with disease development. Importantly, evidence is accumulating that the muscle progenitor cell population (particularly the muscle satellite cell population is also negatively affected by the diabetic environment, and as such, likely contributes to the declining skeletal muscle health observed in diabetes mellitus. In this review, we summarize the current knowledge surrounding the influence of diabetes mellitus on skeletal muscle growth and repair, with a particular emphasis on the impact of diabetes mellitus on the progenitor cell population of skeletal muscle.

  6. The effect of coenzyme Q10 in statin myopathy.

    Zlatohlavek, Lukas; Vrablik, Michal; Grauova, Barbora; Motykova, Eva; Ceska, Richard

    2012-01-01

    Statins significantly reduce CV morbidity and mortality. Unfortunately, one of the side effects of statins is myopathy, for which statins cannot be administered in sufficient doses or administered at all. The aim of this study was to demonstrate the effect of coenzyme Q10 in patients with statin myopathy. Twenty eight patients aged 60.6±10.7 years were monitored (18 women and 10 men) and treated with different types and doses of statin. Muscle weakness and pain was monitored using a scale of one to ten, on which patients expressed the degree of their inconvenience. Examination of muscle problems was performed prior to administration of CQ10 and after 3 and 6 months of dosing. Statistical analysis was performed using Friedman test, Annova and Students t-test. Pain decreased on average by 53.8% (pmuscle weakness by 44.4% (pmuscle pain and sensitivity statistically significantly decreased.

  7. Myopathy in Childhood Muscle-Specific Kinase Myasthenia Gravis.

    Kirzinger, Lukas; Khomenko, Andrei; Schulte-Mattler, Wilhelm; Backhaus, Roland; Platen, Sabine; Schalke, Berthold

    2016-12-01

    Adult and pediatric patients suffering from MuSK (muscle-specific kinase) -antibody positive myasthenia gravis exhibit similar features to individuals with acetylcholine receptor (AChR) antibodies, but they differ in several characteristics such as a predominant bulbar, respiratory and neck weakness, a generally worse disease severity and a tendency to develop muscle atrophy. Muscle atrophy is a rare phenomenon that is usually restricted to the facial muscles. We describe a girl with MuSK-antibody positive myasthenia gravis who developed a myopathy with severe generalized muscular weakness, muscle atrophy, and myopathic changes on electromyography. This is the first published example of a generalized myopathic syndrome in myasthenia gravis. We review the relevant literature and discuss the hypothesis of a mitochondrial myopathy as a pathogenic mechanism in MuSK-antibody positive myasthenia gravis. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Miopatia ocular descendente Descending ocular myopathy: a case report

    Marcos R. G. de Freitas

    1975-06-01

    Full Text Available Os autores apresentam caso de paciente jovem, do sexo feminino, com afecção muscular primária ocular e faríngea sem caráter familial. Foram feitos estudos eletromiográficos e histopatológicos musculares que confirmam o caráter miogênico do processo. É feita comparação entre a miopatia ocular e a miopatia ocular descendente, acreditando os autores que seriam variantesThe case of a 23 years old female patient, with primary involvement of the extraocular and faringeal muscles without familiar history is reported. Electromyographic and muscular biopsy studies proved the myogenic nature of the process. A clinical comparison between the ocular myopathy and the descending ocular myopathy is made, the authors thinking that both of them would be variants of the same muscle disease.

  9. Sarcoidosis Presenting as Löfgren’s Syndrome with Myopathy

    Şenol Kobak

    2013-01-01

    Full Text Available A 34-year-old female patient, who had proximal muscle weakness for 8 months, presented with erythema nodosum lesions on the pretibial region in addition to pain, swelling, and movement restriction in both ankles for the last one month. Thoracic CT demonstrated hilar and mediastinal lymphadenopathy. She underwent mediastinoscopic lymph node biopsy; biopsy result was consistent with noncaseating granuloma. Serum angiotensin converting enzyme level and muscle enzymes have been elevated. Muscular MRI and EMG findings were consistent with myositis. Muscle biopsy was done, and myopathy was found. The patient was diagnosed with sarcoidosis, Löfgren's syndrome, and sarcoid myopathy. The patient displayed remarkable clinical and radiological regression after 6-month corticosteroid and MTX therapy.

  10. Analysis of lipid profile in lipid storage myopathy.

    Aguennouz, M'hammed; Beccaria, Marco; Purcaro, Giorgia; Oteri, Marianna; Micalizzi, Giuseppe; Musumesci, Olimpia; Ciranni, Annmaria; Di Giorgio, Rosa Maria; Toscano, Antonio; Dugo, Paola; Mondello, Luigi

    2016-09-01

    Lipid dysmetabolism disease is a condition in which lipids are stored abnormally in organs and tissues throughout the body, causing muscle weakness (myopathy). Usually, the diagnosis of this disease and its characterization goes through dosage of Acyl CoA in plasma accompanied with evidence of droplets of intra-fibrils lipids in the patient muscle biopsy. However, to understand the pathophysiological mechanisms of lipid storage diseases, it is useful to identify the nature of lipids deposited in muscle fiber. In this work fatty acids and triglycerides profile of lipid accumulated in the muscle of people suffering from myopathies syndromes was characterized. In particular, the analyses were carried out on the muscle biopsy of people afflicted by lipid storage myopathy, such as multiple acyl-coenzyme A dehydrogenase deficiency, and neutral lipid storage disease with myopathy, and by the intramitochondrial lipid storage dysfunctions, such as deficiencies of carnitine palmitoyltransferase II enzyme. A single step extraction and derivatization procedure was applied to analyze fatty acids from muscle tissues by gas chromatography with a flame ionization detector and with an electronic impact mass spectrometer. Triglycerides, extracted by using n-hexane, were analyzed by high performance liquid chromatography coupled to mass spectrometer equipped with an atmospheric pressure chemical ionization interface. The most representative fatty acids in all samples were: C16:0 in the 13-24% range, C18:1n9 in the 20-52% range, and C18:2n6 in the 10-25% range. These fatty acids were part of the most representative triglycerides in all samples. The data obtained was statistically elaborated performing a principal component analysis. A satisfactory discrimination was obtained among the different diseases. Using component 1 vs component 3 a 43.3% of total variance was explained. Such results suggest the important role that lipid profile characterization can have in supporting a correct

  11. Quantitative nailfold video capillaroscopy in patients with idiopathic inflammatory myopathy

    Mercer, Louise K.; Moore, Tonia L.; Chinoy, Hector; Murray, Andrea K.; Vail, Andy; Cooper, Robert G.; Herrick, Ariane L.

    2010-01-01

    Objectives. To quantify nailfold capillary density and dimensions in patients with idiopathic inflammatory myopathy (IIM) and compare them with those in healthy controls; to look for associations with microvascular disease in IIM; and to determine whether nailfold capillary density and dimensions change over time. Methods. Nailfold video microscopy (×300 magnification) was performed on 24 patients with IIM and 35 healthy controls. Capillary density and dimensions (total width and apical width...

  12. Cardiac involvement in adult and juvenile idiopathic inflammatory myopathies

    Schwartz, TThomas W; Diederichsen, L. P.; Lundberg, Ingrid E.

    2016-01-01

    Idiopathic inflammatory myopathies (IIM) include the main subgroups polymyositis (PM), dermatomyositis (DM), inclusion body myositis (IBM) and juvenile DM ( JDM). The mentioned subgroups are characterised by inflammation of skeletal muscles leading to muscle weakness and other organs can also...... that statins might worsen muscle symptoms mimicking myositis relapse. On the basis of recent studies, we recommend a low threshold for cardiac workup and follow-up in patients with IIM. © 2016 Published by the BMJ Publishing Group Limited....

  13. Diagnosis and treatment of the idiopathic inflammatory myopathies

    Gazeley, David J.; Cronin, Mary E.

    2011-01-01

    The idiopathic inflammatory myopathies (IIMs) are rare disorders with the unifying feature of proximal muscle weakness. These diseases include polymyositis(PM), dermatomyositis (DM) and inclusion body myositis (IBM) as the most common. The diagnosis is based on the finding of weakness on exam, elevated muscles enzymes, characteristic histopathology of muscle biopsies, electromyography abnormalities and rash in DM. Myositis-specific antibodies have been helpful in defining subsets of patients ...

  14. Association between statin-associated myopathy and skeletal muscle damage.

    Mohaupt Markus G; Karas Richard H; Babiychuk Eduard B; Sanchez-Freire Verónica; Monastyrskaya Katia; Iyer Lakshmanan; Hoppeler Hans; Breil Fabio; Draeger Annette

    2009-01-01

    BACKGROUND Many patients taking statins often complain of muscle pain and weakness. The extent to which muscle pain reflects muscle injury is unknown. METHODS We obtained biopsy samples from the vastus lateralis muscle of 83 patients. Of the 44 patients with clinically diagnosed statin associated myopathy 29 were currently taking a statin and 15 had discontinued statin therapy before the biopsy (minimal duration of discontinuation 3 weeks). We also included 19 patients who were taking stat...

  15. Schistosomiasis and nutritional myopathy in a Brazilian tapir (Tapirus terrestris).

    Yamini, B; Schillhorn van Veen, T W

    1988-10-01

    Gross lesions suggestive of severe hepatoenteropathy and myopathy were noted in a 4.5-yr-old Brazilian tapir (Tapirus terrestris) from a zoo in Michigan (USA). The major microscopic lesions were granulomatous hepatitis and hemorrhagic enteritis associated with non-operculated eggs compatible with those of the Schistosomatidae (Digenea). Skeletal muscle and tongue contained foci of severe acute myodegeneration and necrosis. The hepatic vitamin E value of 1.3 ppm dry weight was considered critically low.

  16. Search for Pompe disease among patients with undetermined myopathies.

    Lindberg, C; Anderson, B; Engvall, M; Hult, M; Oldfors, A

    2015-07-20

    Pompe disease is a rare treatable glycogen storage disease with in adults - a limb-girdle muscle weakness. Muscle biopsy may fail to show the typical vacuolar myopathy. We asked if we had un-diagnosed patients with Pompe disease in western Sweden. We searched the muscle biopsy registry during the time period 1986 until 2006 including 3665 biopsies and included patients at our Neuromuscular Center with unspecified myopathy or limb-girdle muscular dystrophy. The dry blood spot test was used to identify patients with Pompe disease. A total of 82 patients (46 from the biopsy register and 36 from our center) were seen and dry blood spot test was obtained. No patient with Pompe disease was found. The dry blood spot test was low in three cases (11, 16, and 18% of normal) but a second blood sample showed a normal result based on GAA enzyme activity in lymphocytes in all three patients. In one patient with low normal result of the analysis in lymphocytes a genetic test showed no pathogenic mutations. Further investigation gave a definite diagnose of another myopathy in 12 patients. The prevalence of Pompe disease in western Sweden (3 in 1.27 million or 0.24 per 100.000 inhabitants) is lower than in the Netherlands and New York. Re-evaluation of patients with myopathies but without definite diagnosis is rewarding since 12 of 82 patients in our study had a definite molecular diagnosis after workup. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Morphologic imaging in muscular dystrophies and inflammatory myopathies

    Degardin, Adrian; Lacour, Arnaud; Vermersch, Patrick; Morillon, David; Cotten, Anne; Stojkovic, Tanya

    2010-01-01

    To determine if magnetic resonance imaging (MR imaging) is useful in the diagnostic workup of muscular dystrophies and idiopathic inflammatory myopathies for describing the topography of muscle involvement. MR imaging was performed in 31 patients: 8 with dystrophic myotony types 1 (n = 4) or 2 (n = 4); 11 with limb-girdle muscular dystrophy, including dysferlinopathy, calpainopathy, sarcoglycanopathy, and dystrophy associated with fukutin-related protein mutation; 3 with Becker muscular dystrophy; and 9 with idiopathic inflammatory myopathies, including polymyositis, dermatomyositis, and sporadic inclusion body myositis. Analysis of T1 images enabled us to describe the most affected muscles and the muscles usually spared for each muscular disease. In particular, examination of pelvis, thigh, and leg muscles demonstrated significant differences between the muscular diseases. On STIR images, hyperintensities were present in 62% of our patients with muscular dystrophies. A specific pattern of muscular involvement was established for each muscular disease. Hyperintensities observed on STIR images precede fatty degeneration and are not specific for inflammatory myopathies. (orig.)

  18. Morphologic imaging in muscular dystrophies and inflammatory myopathies

    Degardin, Adrian; Lacour, Arnaud; Vermersch, Patrick [CHU de Lille, Clinique neurologique, Lille (France); Morillon, David; Cotten, Anne [CHRU de Lille, Service de Radiologie Osteoarticulaire, Hopital Roger Salengro, Lille (France); Stojkovic, Tanya [G-H Pitie-Salpetriere, Institut de Myologie, Paris (France)

    2010-12-15

    To determine if magnetic resonance imaging (MR imaging) is useful in the diagnostic workup of muscular dystrophies and idiopathic inflammatory myopathies for describing the topography of muscle involvement. MR imaging was performed in 31 patients: 8 with dystrophic myotony types 1 (n = 4) or 2 (n = 4); 11 with limb-girdle muscular dystrophy, including dysferlinopathy, calpainopathy, sarcoglycanopathy, and dystrophy associated with fukutin-related protein mutation; 3 with Becker muscular dystrophy; and 9 with idiopathic inflammatory myopathies, including polymyositis, dermatomyositis, and sporadic inclusion body myositis. Analysis of T1 images enabled us to describe the most affected muscles and the muscles usually spared for each muscular disease. In particular, examination of pelvis, thigh, and leg muscles demonstrated significant differences between the muscular diseases. On STIR images, hyperintensities were present in 62% of our patients with muscular dystrophies. A specific pattern of muscular involvement was established for each muscular disease. Hyperintensities observed on STIR images precede fatty degeneration and are not specific for inflammatory myopathies. (orig.)

  19. Zidovudine-induced myopathy: A study in Indian patients.

    Sagar, Amitabh; Mohanty, Ambika P; Bahal, Ashish

    2010-07-01

    Literature is replete with studies on zidovudine-induced myopathy after prolonged use (use beyond 270 days on an average). However, all these studies have been done on patients of Caucasian, American and African ethnic origin. No such study has been carried out in Indian patients to our knowledge. To determine the correlation of zidovudine usage with serum creatine phosphokinase (CK) levels, clinical muscular weakness and muscle histology in Indian patients, we studied 147 physically active, Human Immunodeficiency Virus infected men on prolonged zidovudine-based antiretroviral therapy (ART). Cross-sectional study on hospital follow-up patients of HIV infection. All cases on ART who reported to our canter during a period of 18 months were evaluated for symptoms (muscle fatigue, myalgia), objective muscle strength (testing clinically) and serum CK levels, and a select group was evaluated by muscle biopsy. These patients were on zidovudine for 1 to 7 years. None of the patients studied had significant symptoms or objective muscle weakness and only a small fraction (10.8% of cases) had marginally raised serum CK levels. All muscle biopsies were normal on light microscopy. Zidovudine myopathy may be a constraint for use of the drug in the western population; however, it is a well-tolerated drug as regards myopathy in our study on Indian patients.

  20. CT and the diagnosis of myopathies. Preliminary findings in 42 cases

    Calgo, M; Crisi, G; Martinelli, C; Colombo, A; Schoenhuber, R; Gibertoni, M

    1986-01-01

    A total of 42 patients with myopathies underwent CT scans in order to study the relationship between CT images and clinical findings. CT is a valuable diagnostic aid to distinguish primary from neurogenic myopathies, to facilitate directed biopsy and finally to classify the disease according to the degree and extent of the muscular lesion. (orig.).

  1. Myopathy and hepatic lipidosis in weaned lambs due to vitamin E deficiency.

    Menzies, Paula; Langs, Lisa; Boermans, Herman; Martin, John; McNally, John

    2004-03-01

    A sheep flock experienced losses in weaned lambs from myopathy and hepatic lipidosis. Investigation revealed painful ambulation, illthrift, and unexpected death in lambs with normal selenium levels, deficient vitamin E levels, and elevated muscle and liver enzyme levels. Vitamin E deficiency should be considered when investigating myopathy and illthrift in lambs.

  2. Myopathy and hepatic lipidosis in weaned lambs due to vitamin E deficiency

    Menzies, Paula; Langs, Lisa; Boermans, Herman; Martin, John; McNally, John

    2004-01-01

    A sheep flock experienced losses in weaned lambs from myopathy and hepatic lipidosis. Investigation revealed painful ambulation, illthrift, and unexpected death in lambs with normal selenium levels, deficient vitamin E levels, and elevated muscle and liver enzyme levels. Vitamin E deficiency should be considered when investigating myopathy and illthrift in lambs.

  3. Clinical study on myocardial imaging with. beta. -methyl-p-( sup 123 I)-iodophenyl-pentadecanoic acid in patients with mitochondrial myopathy

    Kihara, Koichi; Nakajo, Masayuki; Shono, Hirohisa (Kagoshima Univ. (Japan). Faculty of Medicine) (and others)

    1992-04-01

    Myocardial imaging with {beta}-methyl-p-({sup 123}I)-iodophenyl-pentadecanoic acid ({sup 123}I-BMIPP), a new radiopharmaceutical designed to evaluate myocardial fatty acid metabolism, was performed in 7 patients with mitochondrial myopathy to detect their myocardial damages in comparison with {sup 201}Tl myocardial imaging. These patients were divided into 4 chronic progressive external ophthalmoplegia (CPEO) cases, 2 mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) cases and 1 myoclonus epilepsy with ragged-red fibers (MERRF). In visual assessment, we observed more myocardial segments with decreased uptake of {sup 123}I-BMIPP compared to {sup 201}Tl in MELAS cases than in CPEO cases. The mean myocardial uptake of {sup 123}I-BMIPP was higher than that of {sup 201}Tl in CPEO cases. On the other hand, in MELAS and MERRF cases, the mean myocardial uptake of {sup 123}I-BMIPP was lower than that of {sup 201}Tl. Abnormal findings suggesting myocardial damages were observed in echocardiogram and/or in electrocardiogram in MELAS and MERRF cases, while no such abnormal findings were observed in CPEO cases. Along with the previously reported experimental result that the impairment of rat myocardial mitochondria decreased myocardial uptake of {sup 123}I-BMIPP, these results suggest that {sup 123}I-BMIPP may be useful to detect myocardial damages in patients with mitochondrial myopathy. (author)

  4. Clinical study on myocardial imaging with β-methyl-p-(123I)-iodophenyl-pentadecanoic acid in patients with mitochondrial myopathy

    Kihara, Koichi; Nakajo, Masayuki; Shono, Hirohisa

    1992-01-01

    Myocardial imaging with β-methyl-p-( 123 I)-iodophenyl-pentadecanoic acid ( 123 I-BMIPP), a new radiopharmaceutical designed to evaluate myocardial fatty acid metabolism, was performed in 7 patients with mitochondrial myopathy to detect their myocardial damages in comparison with 201 Tl myocardial imaging. These patients were divided into 4 chronic progressive external ophthalmoplegia (CPEO) cases, 2 mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) cases and 1 myoclonus epilepsy with ragged-red fibers (MERRF). In visual assessment, we observed more myocardial segments with decreased uptake of 123 I-BMIPP compared to 201 Tl in MELAS cases than in CPEO cases. The mean myocardial uptake of 123 I-BMIPP was higher than that of 201 Tl in CPEO cases. On the other hand, in MELAS and MERRF cases, the mean myocardial uptake of 123 I-BMIPP was lower than that of 201 Tl. Abnormal findings suggesting myocardial damages were observed in echocardiogram and/or in electrocardiogram in MELAS and MERRF cases, while no such abnormal findings were observed in CPEO cases. Along with the previously reported experimental result that the impairment of rat myocardial mitochondria decreased myocardial uptake of 123 I-BMIPP, these results suggest that 123 I-BMIPP may be useful to detect myocardial damages in patients with mitochondrial myopathy. (author)

  5. Study of cognitive sphere in children and adolescents with congenital myopathy (theoretical review

    V. A. Erokhina

    2013-08-01

    Full Text Available This paper presents an analysis of current approaches to the study of states of higher mental functions in children and adolescents suffering from various forms of hereditary myopathies. The aim of this work is to study the theoretical rationale and the possibility of specific disorders of mental function in children and adolescents with congenital myopathies. To achieve this objective during the study it was necessary to solve the following problems: give a description of the various groups and forms of congenital myopathies, their clinical characteristics; justify the possibility of considering the hereditary myopathies as a factor in the formation of changes in visual-spatial activities and thinking; evaluate the possibility to use complex neuropsychological psycho-diagnostic techniques for investigating the state of the higher mental functions of children with congenital myopathies. The possibility of neuropsychological correction for this category of patients is discussed also.

  6. Clinical pathological and genetic analysis of 2 cases of mitochondrial myopathy presented as acute motor axonal neuropathy

    Hou-min YIN

    2014-06-01

    Full Text Available Background The main clinical manifestations of mitochondrial myopathy are chronic limb weakness and muscular soreness. Subclinical peripheral nerve injury is also reported, but acute axonal neuropathy.like syndrome concurrent with lactic acidosis is rare. In this paper the clinical features of 2 patients presenting as acute lactic acidosis and sudden muscle weakness were analyzed. Pathological changes and genetic mutations were detected.  Methods Electromyography (EMG and muscle biopsy were performed. Modified Gomori trichrome (MGT and succinodehydrogenase (SDH staining were used to identify pathological changes. Changes of ultra microstructure of muscular tissue were observed under electron microscope. Mitochondrial DNA (mtDNA full length sequencing was performed using 24 pairs of partially overlapping primers.  Results EMG showed a coexistence of neurogenic and myogenic changes. Dramatic decrease of motor nerve amplitude and moderately reduced sensory nerve amplitude were observed but nerve conduction velocity was normal in both patients. Impressive ragged red fibers were seen on MGT staining. Electron microscope showed dramatic mitochondrial abnormalities in Case 1 and paracrystaline inclusions in Case 2. mtDNA sequencing showed 3243A > G mutation in Case 1 and 8344A > G mutation in Case 2. Conclusions Mitochondrial myopathy can present as metabolic crisis like acute lactic acidosis, dyspnea and acute motor axonal neuropathy.like syndrome. It is a life.threatening phenotype that needs more attention. doi: 10.3969/j.issn.1672-6731.2014.06.007

  7. Association of bone marrow edema with temporomandibular joint (TMJ) osteoarthritis and internal derangements.

    Wahaj, Aiyesha; Hafeez, Kashif; Zafar, Muhammad Sohail

    2017-01-01

    This study reviewed the dental literature in order to determine the association of bone marrow edema with osteoarthritis and temporomandibular joint (TMJ) internal derangement disorders. A literature search was performed using electronic databases PubMed/Medline (National Library of Medicine, Bethesda, Maryland) and Cochrane for articles published during the last 15 years (January 2000-December 2014). A predetermined inclusion and exclusion criteria were used for filtering the scientific papers. Research articles fulfilling the basic inclusion criteria were included in the review. The reviewed studies showed that bone marrow edema is found in painful joints with osteoarthritis in a majority of cases. A few cases with no pain or significant degenerative changes are reported to have a bone marrow edema pattern as well. Bone marrow edema, increased fluid level, and pain are associated with osteoarthritis in the majority of patients reporting TMJ arthritis. Degenerative and disc displacement conditions are multifactorial and require further investigations. Magnetic resonance imaging can be employed to detect bone marrow edema even in the absence of pain and clinical symptoms in the patients of internal derangements.

  8. MRI STUDY OF TYPES AND INCIDENCE OF INTERNAL DERANGEMENTS OF TRAUMATIC KNEE JOINT

    Bomidi Sudha Rani

    2016-12-01

    Full Text Available BACKGROUND MRI has been accepted as the best imaging modality for noninvasive evaluation of knee injuries and it has proved reliable, safe and offers advantages over diagnostic arthroscopy, which is currently regarded as the reference standard for the diagnosis of internal derangements of the knee. 1 METHODS AND MATERIALS A prospective study of fifty patients who underwent MRI for the diagnosis of internal derangement of knee was conducted between the period of January 2015 to January 2016 in Government General Hospital, Kakinada. All the patients with history of knee joint pain following trauma and clinically suspected to have meniscal and ligament tears are included in the study. Patients were evaluated using GE 1.5 T MRI machine with pulsar gradient system using a sensor extremity coil. RESULTS Commonest lesion detected in our study was ACL tear followed by medial meniscal tear and medial collateral ligament injury. The most common sign of cruciate ligament injury was hyperintensity in the ligament. Grade 3 was the most common grade of meniscal tear. CONCLUSION MRI is an excellent, noninvasive, radiation free imaging modality and is unique in its ability to evaluate the internal structure as well as soft tissue delineation. Many anatomical variants can mimic a tear on MRI. MRI is an excellent noninvasive modality for imaging the knee and helps in arriving at a correct anatomical diagnosis there by guiding further management of the patient.

  9. Historical perspectives of the metabolic syndrome.

    Oda, Eiji

    The metabolic syndrome (MetS) or insulin resistance syndrome is a constellation of obesity-related metabolic derangements predisposing to type 2 diabetes and cardiovascular disease. In 1998, WHO defined the first criteria of MetS. Three years later, the user-friendly National Cholesterol Education Program criteria of MetS were proposed. Different criteria were issued by the International Diabetes Federation in 2005, making abdominal obesity a necessary component. Several international societies, including The International Diabetes Federation, jointly adopted the revised National Cholesterol Education Program criteria as harmonizing criteria of MetS in 2009. WHO warned the next year that MetS has limited practical utility as a management tool. Adipose tissue inflammation has been shown to be a fundamental mechanism of metabolic derangements, associated with ectopic lipid deposit and mitochondrial dysfunction in skeletal muscle and the liver. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Muscle structural changes in mitochondrial myopathy relate to genotype

    Olsen, David B.; Langkilde, Annika Reynberg; Ørngreen, Mette C.

    2003-01-01

    It is well known that morphological changes at the cellular level occur in muscle of patients with mitochondrial myopathy (MM), but changes in muscle structure with fat infiltration and gross variation of muscle fiber size with giant fibers, normally encountered in the muscular dystrophies, have...... typically not been associated with mitochondrial disease. We investigated gross and microscopic muscle morphology in thigh muscles by muscle biopsy and MRI in 16 patients with MM, and compared findings with those obtained in muscular dystrophy patients and healthy subjects. Changes of muscle architecture...

  11. [Insight into the training of patients with idiopathic inflammatory myopathy].

    Váncsa, Andrea

    2016-09-01

    Using current recommended treatment, a majority of patients with idiopathic inflammatory myopathy develop muscle impairment and poor health. Beneficial effects of exercise have been reported on muscle performance, aerobic capacity and health in chronic polymyositis and dermatomyositis, as well as in active disease and inclusion body myositis to some extent. Importantly, randomized controlled trials indicate that improved health and decreased clinical disease activity could be mediated through increased aerobic capacity. Recently, reports seeking pathomechanisms of the underlying effects of exercise on skeletal muscle indicate increased aerobic capacity (i.e. increased mitochondrial capacity and capillary density, reduced lactate levels), activation of genes of aerobic phenotype and muscle growth programs and down regulation of genes related to inflammation. Exercise contributes to both systemic and within-muscle adaptations demonstrating that it is fundamental for improving muscle performance and health in patients with idiopathic inflammatory myopathy. There is a need for randomized controlled trials to study the effects of exercise in patients with active disease and inclusion body myositis. Orv. Hetil., 2016, 157(39), 1557-1562.

  12. Novel autosomal dominant TNNT1 mutation causing nemaline myopathy.

    Konersman, Chamindra G; Freyermuth, Fernande; Winder, Thomas L; Lawlor, Michael W; Lagier-Tourenne, Clotilde; Patel, Shailendra B

    2017-11-01

    Nemaline myopathy (NEM) is one of the three major forms of congenital myopathy and is characterized by diffuse muscle weakness, hypotonia, respiratory insufficiency, and the presence of nemaline rod structures on muscle biopsy. Mutations in troponin T1 (TNNT1) is 1 of 10 genes known to cause NEM. To date, only homozygous nonsense mutations or compound heterozygous truncating or internal deletion mutations in TNNT1 gene have been identified in NEM. This extended family is of historical importance as some members were reported in the 1960s as initial evidence that NEM is a hereditary disorder. Proband and extended family underwent Sanger sequencing for TNNT1. We performed RT-PCR and immunoblot on muscle to assess TNNT1 RNA expression and protein levels in proband and father. We report a novel heterozygous missense mutation of TNNT1 c.311A>T (p.E104V) that segregated in an autosomal dominant fashion in a large family residing in the United States. Extensive sequencing of the other known genes for NEM failed to identify any other mutant alleles. Muscle biopsies revealed a characteristic pattern of nemaline rods and severe myofiber hypotrophy that was almost entirely restricted to the type 1 fiber population. This novel mutation alters a residue that is highly conserved among vertebrates. This report highlights not only a family with autosomal dominant inheritance of NEM, but that this novel mutation likely acts via a dominant negative mechanism. © 2017 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  13. Skeletal muscle repair in a mouse model of nemaline myopathy.

    Sanoudou, Despina; Corbett, Mark A; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T; Vlahovich, Nicole; Hardeman, Edna C; Beggs, Alan H

    2006-09-01

    Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five different skeletal muscles from affected mice, which are representative of muscles with differing fiber-type compositions, different physiological specializations and variable degrees of pathology. Although these same muscles in non-affected mice showed marked variation in patterns of gene expression, with diaphragm being the most dissimilar, the presence of the mutant protein in nemaline muscles resulted in a more similar pattern of gene expression among the muscles. This result suggests a common process or mechanism operating in nemaline muscles independent of the variable degrees of pathology. Transcriptional and protein expression data indicate the presence of a repair process and possibly delayed maturation in nemaline muscles. Markers indicative of satellite cell number, activated satellite cells and immature fibers including M-Cadherin, MyoD, desmin, Pax7 and Myf6 were elevated by western-blot analysis or immunohistochemistry. Evidence suggesting elevated focal repair was observed in nemaline muscle in electron micrographs. This analysis reveals that NM is characterized by a novel repair feature operating in multiple different muscles.

  14. A clinical and radiological study on the internal derangement of TMJ

    Han, Won Jeong; Kim, Eun Kyung

    1992-01-01

    Internal derangement of the temporomandibular joint can be defined an abnormal relationships of the meniscus relative to the mandibular condyle, articular fossa and dminence. This may cause variable mandibular dysfunctions and pain. For diagnosis, arthrography, computed tomography and amgnetic resonance imaging are used. In this study, the author reviewed 98 TMJs of 88 patients who were diagnosed as internal derangement through inferior joint space arthrography at the department of Oral and Maxillofacial Radiology, Dental Hospital, Dankook university through 1986 to 1992. 98 TMJs consisting of 30 disc displacement with reduction, 48 disc displacement without reduction and 20 perforation were studied about clinical and radiological findings. The results were as follows: 1. Internal derangement was found most frequently in the 2nd, 3rd decades and the average age of perforation was higher than that of disc displacement with higher than that of disc displacement with reduction. The sexual predilection was 2 times higher in females. 2. The most frequent chief complaints were TMJ sound in disc displacement with reduction, pain and limitation of mouth opening in disc displacement without reduction and pain in perforation. The duration of the chief complaints was longer in disc displacement with reduction with than in perforation and disc displacement without reduction. 3. Reciprocal click was the most frequently TMJ sound in disc displacement with reduction. History of joint sound in disc displacement without reduction an crepitus in perforation was the most frequent one. 4. The average maximum opening was 45.4 mm in disc displacement with reduction, 31.4 mm in disc displacement without reduction and 33.8 mm in perforation. 5. In the centric occlusion, posterior condylar position was the most frequent in disc displacement with reduction. Posterior and concentric condylar position was frequent in disc displacement without reduction, concentric and anterior condylar

  15. Statin-associated immune-mediated myopathy: biology and clinical implications.

    Christopher-Stine, Lisa; Basharat, Pari

    2017-04-01

    In the last 6 years, our understanding of statin-associated myopathy expanded to include not only a toxic myopathy with limited and reversible side-effects but also an autoimmune variety in which statins likely induce an autoimmune myopathy that is both associated with a specific autoantibody and responsive to immunosuppression and immune modulation. This review widens the reader's understanding of statin myopathy to include an autoimmune process. Statin-associated immune-mediated myopathy provides an example of an environmental trigger (statins) directly implicated in an autoimmune disease associated with a genetic predisposition as well as potential risk factors including concomitant diseases and specific statins. Given a median exposure to statins of 38 months, providers should be aware that anti-3-hydroxy-3-methyl-glutaryl-coenzyme A reductase (HMGCR) myopathy may occur even after several years of statin exposure. It is important for the reader to understand the clinical presentation of statin-associated immune-mediated myopathy and the difference in its clinical presentation to that of statins as direct myotoxins. Prompt recognition of such an entity allows the clinician to immediately stop the offending agent if it has not already been discontinued as well as to recognize that statin rechallenge is not a likely option, and that prompt treatment with immunosuppression and/or immunomodulation is usually of enormous benefit to the patient in restoring muscle strength and physical function. VIDEO ABSTRACT.

  16. Myopathy With SQSTM1 and TIA1 Variants: Clinical and Pathological Features

    Zhiyv Niu

    2018-03-01

    Full Text Available ObjectiveThe aim of this study is to identify the molecular defect of three unrelated individuals with late-onset predominant distal myopathy; to describe the spectrum of phenotype resulting from the contributing role of two variants in genes located on two different chromosomes; and to highlight the underappreciated complex forms of genetic myopathies.Patients and methodsClinical and laboratory data of three unrelated probands with predominantly distal weakness manifesting in the sixth-seventh decade of life, and available affected and unaffected family members were reviewed. Next-generation sequencing panel, whole exome sequencing, and targeted analyses of family members were performed to elucidate the genetic etiology of the myopathy.ResultsGenetic analyses detected two contributing variants located on different chromosomes in three unrelated probands: a heterozygous pathogenic mutation in SQSTM1 (c.1175C>T, p.Pro392Leu and a heterozygous variant in TIA1 (c.1070A>G, p.Asn357Ser. The affected fraternal twin of one proband also carries both variants, while the unaffected family members harbor one or none. Two unrelated probands (family 1, II.3, and family 3, II.1 have a distal myopathy with rimmed vacuoles that manifested with index extensor weakness; the other proband (family 2, I.1 has myofibrillar myopathy manifesting with hypercapnic respiratory insufficiency and distal weakness.ConclusionThe findings indicate that all the affected individuals have a myopathy associated with both variants in SQSTM1 and TIA1, respectively, suggesting that the two variants determine the phenotype and likely functionally interact. We speculate that the TIA1 variant is a modifier of the SQSTM1 mutation. We identify the combination of SQSTM1 and TIA1 variants as a novel genetic defect associated with myofibrillar myopathy and suggest to consider sequencing both genes in the molecular investigation of myopathy with rimmed vacuoles and myofibrillar myopathy

  17. Myopathy With SQSTM1 and TIA1 Variants: Clinical and Pathological Features.

    Niu, Zhiyv; Pontifex, Carly Sabine; Berini, Sarah; Hamilton, Leslie E; Naddaf, Elie; Wieben, Eric; Aleff, Ross A; Martens, Kristina; Gruber, Angela; Engel, Andrew G; Pfeffer, Gerald; Milone, Margherita

    2018-01-01

    The aim of this study is to identify the molecular defect of three unrelated individuals with late-onset predominant distal myopathy; to describe the spectrum of phenotype resulting from the contributing role of two variants in genes located on two different chromosomes; and to highlight the underappreciated complex forms of genetic myopathies. Clinical and laboratory data of three unrelated probands with predominantly distal weakness manifesting in the sixth-seventh decade of life, and available affected and unaffected family members were reviewed. Next-generation sequencing panel, whole exome sequencing, and targeted analyses of family members were performed to elucidate the genetic etiology of the myopathy. Genetic analyses detected two contributing variants located on different chromosomes in three unrelated probands: a heterozygous pathogenic mutation in SQSTM1 (c.1175C>T, p.Pro392Leu) and a heterozygous variant in TIA1 (c.1070A>G, p.Asn357Ser). The affected fraternal twin of one proband also carries both variants, while the unaffected family members harbor one or none. Two unrelated probands (family 1, II.3, and family 3, II.1) have a distal myopathy with rimmed vacuoles that manifested with index extensor weakness; the other proband (family 2, I.1) has myofibrillar myopathy manifesting with hypercapnic respiratory insufficiency and distal weakness. The findings indicate that all the affected individuals have a myopathy associated with both variants in SQSTM1 and TIA1 , respectively, suggesting that the two variants determine the phenotype and likely functionally interact. We speculate that the TIA1 variant is a modifier of the SQSTM1 mutation. We identify the combination of SQSTM1 and TIA1 variants as a novel genetic defect associated with myofibrillar myopathy and suggest to consider sequencing both genes in the molecular investigation of myopathy with rimmed vacuoles and myofibrillar myopathy although additional studies are needed to investigate the

  18. Comparison of MRI findings with clinical symptoms in temporomandibular joint internal derangement

    Kwon, Ki Jeong [Chonbuk National University College of Medicine, Gwangju (Korea, Republic of)

    2005-06-15

    To determine the clinical correlation of magnetic resonance imaging (MRI) findings of temporomandibular joint internal derangements. The MR images of 150 TMJs in 75 patients were analyzed. The clinical symptoms were pain in the pre auricular area and masticatory muscles and TMJ sounds. There was a statistically significant relationship between the MRI diagnoses of different types of disc displacements and clinical findings of pain, clicking, and crepitus. The risk of TMJ pain was increased when the disc displacement without reduction occurred at the same time in combination with the osteoarthrosis and effusion. Regardless of the results, the data indicate that each of these MR imaging variables may not be regarded as the unique and dominant factor in defining TMJ pain occurrence.

  19. Adenylyl Cyclase Signaling in the Developing Chick Heart: The Deranging Effect of Antiarrhythmic Drugs

    Lucie Hejnova

    2014-01-01

    Full Text Available The adenylyl cyclase (AC signaling system plays a crucial role in the regulation of cardiac contractility. Here we analyzed the key components of myocardial AC signaling in the developing chick embryo and assessed the impact of selected β-blocking agents on this system. Application of metoprolol and carvedilol, two commonly used β-blockers, at embryonic day (ED 8 significantly downregulated (by about 40% expression levels of AC5, the dominant cardiac AC isoform, and the amount of Gsα protein at ED9. Activity of AC stimulated by forskolin was also significantly reduced under these conditions. Interestingly, when administered at ED4, these drugs did not produce such profound changes in the myocardial AC signaling system, except for markedly increased expression of Giα protein. These data indicate that β-blocking agents can strongly derange AC signaling during the first half of embryonic heart development.

  20. Fibrous Myopathy as a Complication of Repeated Intramuscular Injections for Chronic Headache

    R Burnham

    2006-01-01

    Full Text Available Two cases of fibrous myopathy associated with repeated, long-term intramuscular injections for treatment of chronic temporomandibular joint pain and chronic headache, respectively, are described. Both patients developed severe, function-limiting contractures in upper and lower extremity muscles used as injection sites. In one of the cases, the contractures were painful. Electrophysiological testing, magnetic resonance imaging and muscle biopsy results were all consistent with myopathy and replacement of skeletal muscle with noncontractile fibrous tissue. These cases are presented to increase awareness of fibrous myopathy and to promote surveillance for this serious potential complication of long-term intramuscular injections in chronic headache and other pain patients.

  1. Reactive arthritis in relation to internal derangements of the temporomandibular joint: a case control study.

    Lund, Bodil; Holmlund, Anders; Wretlind, Bengt; Jalal, Shah; Rosén, Annika

    2015-09-01

    The aim of this study was to find out if reactive arthritis was involved in the aetiology of chronic closed lock of the temporomandibular joint (TMJ) by looking for bacterial antigens in the synovial membrane of the TMJ, and by studying the antibody serology and carriage of human leucocyte antigen (HLA) B27 in patients with chronic closed lock. Patients with reciprocal clicking and healthy subjects acted as controls. We studied a total of 43 consecutive patients, 15 with chronic closed lock, 13 with reciprocal clicking, and 15 healthy controls with no internal derangements of the TMJ. Venous blood samples were collected from all subjects for measurement of concentrations of HLA tissue antigen and serology against Chlamydia trachomatis, Yersinia enterocolitica, Salmonella spp., Campylobacter jejuni, and Mycoplasma pneumoniae. Samples of synovial tissue from patients with closed lock and reciprocal clicking were obtained during discectomy and divided into two pieces, the first of which was tested by strand displacement amplification for the presence of C trachomatis, and the second of which was analysed for the presence of species-specific bacterial DNA using 16s rRNA pan-polymerase chain reaction (PCR). There were no significant differences between the groups in the incidence of antibodies against M pneumoniae, Salmonella spp. or Y enterocolitica. No patient had antibodies towards C trachomatis or C jejuni. We found no bacterial DNA in the synovial fluid from any patient. The HLA B27 antigen was present in 2/15 subjects in both the closed lock and control groups, and none in the reciprocal clicking group. In conclusion, reactive arthritis does not seem to be the mechanism of internal derangement of the TMJ. Copyright © 2015. Published by Elsevier Ltd.

  2. Impaired Insulin/IGF Signaling in Experimental Alcohol-Related Myopathy

    Elizabeth Silbermann

    2012-08-01

    Full Text Available Alcohol-related myopathy (Alc-M is highly prevalent among heavy drinkers, although its pathogenesis is not well understood. We hypothesize that Alc-M is mediated by combined effects of insulin/IGF resistance and oxidative stress, similar to the effects of ethanol on liver and brain. We tested this hypothesis using an established model in which adult rats were pair-fed for 8 weeks with isocaloric diets containing 0% (N = 8 or 35.5% (N = 13 ethanol by caloric content. Gastrocnemius muscles were examined by histology, morphometrics, qRT-PCR analysis, and ELISAs. Chronic ethanol feeding reduced myofiber size and mRNA expression of IGF-1 polypeptide, insulin, IGF-1, and IGF-2 receptors, IRS-1, and IRS-2. Multiplex ELISAs demonstrated ethanol-associated inhibition of insulin, IRS-1, Akt, and p70S6K signaling, and increased activation of GSK-3β. In addition, ethanol-exposed muscles had increased 4-hydroxy-2-nonenal immunoreactivity, reflecting lipid peroxidation, and reduced levels of mitochondrial Complex IV, Complex V, and acetylcholinesterase. These results demonstrate that experimental Alc-M is associated with inhibition of insulin/IGF/IRS and downstream signaling that mediates metabolism and cell survival, similar to findings in alcoholic liver and brain degeneration. Moreover, the increased oxidative stress, which could be mediated by mitochondrial dysfunction, may have led to inhibition of acetylcholinesterase, which itself is sufficient to cause myofiber atrophy and degeneration.

  3. Mechanisms of Hyperhomocysteinemia Induced Skeletal Muscle Myopathy after Ischemia in the CBS−/+ Mouse Model

    Sudhakar Veeranki

    2015-01-01

    Full Text Available Although hyperhomocysteinemia (HHcy elicits lower than normal body weights and skeletal muscle weakness, the mechanisms remain unclear. Despite the fact that HHcy-mediated enhancement in ROS and consequent damage to regulators of different cellular processes is relatively well established in other organs, the nature of such events is unknown in skeletal muscles. Previously, we reported that HHcy attenuation of PGC-1α and HIF-1α levels enhanced the likelihood of muscle atrophy and declined function after ischemia. In the current study, we examined muscle levels of homocysteine (Hcy metabolizing enzymes, anti-oxidant capacity and focused on protein modifications that might compromise PGC-1α function during ischemic angiogenesis. Although skeletal muscles express the key enzyme (MTHFR that participates in re-methylation of Hcy into methionine, lack of trans-sulfuration enzymes (CBS and CSE make skeletal muscles more susceptible to the HHcy-induced myopathy. Our study indicates that elevated Hcy levels in the CBS−/+ mouse skeletal muscles caused diminished anti-oxidant capacity and contributed to enhanced total protein as well as PGC-1α specific nitrotyrosylation after ischemia. Furthermore, in the presence of NO donor SNP, either homocysteine (Hcy or its cyclized version, Hcy thiolactone, not only increased PGC-1α specific protein nitrotyrosylation but also reduced its association with PPARγ in C2C12 cells. Altogether these results suggest that HHcy exerts its myopathic effects via reduction of the PGC-1/PPARγ axis after ischemia.

  4. Recurrent myoglobinuria and deranged acylcarnitines due to a mutation in the mtDNA MT-CO2 gene

    Vissing, Christoffer Rasmus; Duno, Morten; Olesen, Jess Have

    2013-01-01

    Mitochondrial myopathies commonly present with exercise intolerance typified by breathlessness and fatigue on exercise. In contrast, exercise-induced rhabdomyolysis and myoglobinuria occur rarely. We present a 43-year-old man with a lifelong history of exercise intolerance associated with myalgia...

  5. The myositis autoantibody phenotypes of the juvenile idiopathic inflammatory myopathies.

    Rider, Lisa G; Shah, Mona; Mamyrova, Gulnara; Huber, Adam M; Rice, Madeline Murguia; Targoff, Ira N; Miller, Frederick W

    2013-07-01

    The juvenile idiopathic inflammatory myopathies (JIIM) are systemic autoimmune diseases characterized by skeletal muscle weakness, characteristic rashes, and other systemic features. In follow-up to our study defining the major clinical subgroup phenotypes of JIIM, we compared demographics, clinical features, laboratory measures, and outcomes among myositis-specific autoantibody (MSA) subgroups, as well as with published data on adult idiopathic inflammatory myopathy patients enrolled in a separate natural history study. In the present study, of 430 patients enrolled in a nationwide registry study who had serum tested for myositis autoantibodies, 374 had either a single specific MSA (n = 253) or no identified MSA (n = 121) and were the subject of the present report. Following univariate analysis, we used random forest classification and exact logistic regression modeling to compare autoantibody subgroups. Anti-p155/140 autoantibodies were the most frequent subgroup, present in 32% of patients with juvenile dermatomyositis (JDM) or overlap myositis with JDM, followed by anti-MJ autoantibodies, which were seen in 20% of JIIM patients, primarily in JDM. Other MSAs, including anti-synthetase, anti-signal recognition particle (SRP), and anti-Mi-2, were present in only 10% of JIIM patients. Features that characterized the anti-p155/140 autoantibody subgroup included Gottron papules, malar rash, "shawl-sign" rash, photosensitivity, cuticular overgrowth, lowest creatine kinase (CK) levels, and a predominantly chronic illness course. The features that differed for patients with anti-MJ antibodies included muscle cramps, dysphonia, intermediate CK levels, a high frequency of hospitalization, and a monocyclic disease course. Patients with anti-synthetase antibodies had higher frequencies of interstitial lung disease, arthralgia, and "mechanic's hands," and had an older age at diagnosis. The anti-SRP group, which had exclusively juvenile polymyositis, was characterized by high

  6. Oculopharyngeal Weakness, Hypophrenia, Deafness, and Impaired Vision: A Novel Autosomal Dominant Myopathy with Rimmed Vacuoles

    Ting Chen

    2016-01-01

    Conclusions: We reported a novel autosomal dominant myopathy with rimmed vacuoles characterized by dysarthria, dysphagia, external ophthalmoplegia, limb weakness, hypophrenia, deafness, and impaired vision, but the causative gene has not been found and needs further study.

  7. Nuclear actin aggregation is a hallmark of anti-synthetase syndrome-induced dysimmune myopathy

    Stenzel, Werner; Preuße, Corinna; Allenbach, Yves; Pehl, Debora; Junckerstorff, Reimar; Heppner, Frank L.; Nolte, Kay; Aronica, Eleonora; Kana, Veronika; Rushing, Elisabeth; Schneider, Udo; Claeys, Kristl G.; Benveniste, Olivier; Weis, Joachim; Goebel, Hans H.

    2015-01-01

    To analyze antisynthetase syndrome-associated myositis by modern myopathologic methods and to define its place in the spectrum of idiopathic inflammatory myopathies (IIMs). Skeletal muscle biopsies from antisynthetase syndrome-associated myositis and other IIMs from different institutions worldwide

  8. Diagnostic value of MHC class I staining in idiopathic inflammatory myopathies.

    Pas, J. van der; Hengstman, G.J.D.; Laak, H.J. ter; Borm, G.F.; Engelen, B.G.M. van

    2004-01-01

    BACKGROUND: Identification of mononuclear cellular infiltrates in skeletal muscle tissue is the histological cornerstone of the diagnosis of idiopathic inflammatory myopathy (IIM). However, these infiltrates are not always present. OBJECTIVE: To determine whether MHC class I antigen expression on

  9. Organophosphate-induced intermediate syndrome: aetiology and relationships with myopathy.

    Karalliedde, Lakshman; Baker, David; Marrs, Timothy C

    2006-01-01

    -15 days and even up to 21 days. Weaning from ventilatory care is best carried out in stages, with provision of continuous positive airway pressure prior to complete weaning. Continuous and close monitoring of respiratory function (arterial oxygen saturation, partial pressure of oxygen in arterial blood, partial pressure of carbon dioxide in arterial blood) and acid-base status are an absolute necessity. Prophylactic antibiotics are usually not required unless there has been evidence of aspiration of material into the lungs. Close monitoring of fluid and electrolyte balance is mandatory in view of the profuse offensive diarrhoea that most patients develop. Maintenance of nutrition, physiotherapy, prevention of bed sores and other routine measures to minimise discomfort during ventilatory care are necessary. Recovery from the intermediate syndrome is normally complete and without any sequelae. The usefulness of oximes during the IMS remains uncertain. In animal experiments, very early administration of oximes has prevented the occurrence of myopathy. There are reports from developed countries where administration of oximes at recommended doses and within 2 hours of ingestion of OP insecticide did not prevent the onset of the IMS. Controlled randomised clinical studies are necessary to evaluate the efficacy of oximes in combating the IMS. Electrophysiological studies following OP poisoning have revealed three characteristic phenomena: (i) repetitive firing following a single stimulus; (ii) gradual reduction in twitch height or compound muscle action potential followed by an increase with repetitive stimulation (the 'decrement-increment response'); and (iii) continued reduction in twitch height or compound muscle action potential with repetitive simulation ('decrementing response'). Of these, the decrementing response is the most frequent finding during the IMS, whilst repetitive firing is observed during the acute cholinergic syndrome. The distribution of the weakness in

  10. Restrictive extraocular myopathy: A presenting feature of acromegaly

    Steven Heireman

    2011-01-01

    Full Text Available A 45-year-old man presented with binocular diplopia in primary gaze for 1 year. Orthoptic evaluation showed 10-prism diopter right eye hypotropia and 6-prism diopter right eye esotropia. The elevation and abduction of the right eye were mechanically restricted. This was associated with systemic features suggestive of acromegaly. Magnetic resonance imaging (MRI of the brain demonstrated a pituitary macroadenoma. An elevated serum insulin-like growth factor I level and the failure of growth hormone suppression after an oral glucose load biochemically confirmed the diagnosis of acromegaly. Computed tomography (CT of the orbit demonstrated bilateral symmetrical enlargement of the medial rectus and inferior rectus muscle bellies. All tests regarding Graves-Basedow disease were negative. Although rare, diplopia due to a restrictive extraocular myopathy could be the presenting symptom of acromegaly.

  11. A case of congenital myopathy masquerading as paroxysmal dyskinesia

    Harsh Patel

    2014-01-01

    Full Text Available Gastroesophageal reflux (GER disease is a significant comorbidity of neuromuscular disorders. It may present as paroxysmal dyskinesia, an entity known as Sandifer syndrome. A 6-week-old neonate presented with very frequent paroxysms of generalized stiffening and opisthotonic posture since day 22 of life. These were initially diagnosed as seizures and he was started on multiple antiepileptics which did not show any response. After a normal video electroencephalogram (VEEG was documented, possibility of dyskinesia was kept. However, when he did not respond to symptomatic therapy, Sandifer syndrome was thought of and GER scan was done, which revealed severe GER. After his symptoms got reduced to some extent, a detailed clinical examination revealed abnormal facies with flaccid quadriparesis. Muscle biopsy confirmed the diagnosis of a specific congenital myopathy. On antireflux measures, those episodic paroxysms reduced to some extent. Partial response to therapy in GER should prompt search for an underlying secondary etiology.

  12. The genetic basis of pectoralis major myopathies in modern broiler chicken lines

    Bailey, Richard A.; Watson, Kellie A.; Bilgili, S. F.; Avendano, Santiago

    2015-01-01

    This is the first report providing estimates of the genetic basis of breast muscle myopathies (BMM) and their relationship with growth and yield in broiler chickens. In addition, this paper addresses the hypothesis that genetic selection for increase breast yield has contributed to the onset of BMM. Data were analyzed from ongoing recording of BMM within the Aviagen breeding program. This study focused on three BMM: deep pectoral myopathy (DPM; binary trait), white striping (WS; 4 categories)...

  13. Hereditary vacuolar internal anal sphincter myopathy causing proctalgia fugax and constipation: a new case contribution.

    de la Portilla, Fernando; Borrero, Juan José; Rafel, Enrique

    2005-03-01

    Hereditary anal sphincter myopathy is rare. We present a family with one affected member with proctalgia fugax, constipation and internal anal sphincter hypertrophy. Ultrastructural findings show vacuolization of smooth muscle cells without the characteristic polyglucosan inclusion. Further relief of symptoms was obtained using an oral calcium antagonist. Based on clinical presentation, endosonography and morphological findings, we consider our case is a histological variant of the vacuolar myopathy originally described.

  14. Statin induced myopathy presenting as mechanical musculoskeletal pain observed in two chiropractic patients

    Rodine, Robert J; Tibbles, Anthony C; Kim, Peter SY; Alikhan, Neetan

    2010-01-01

    Lipid lowering drugs, such as statins, are commonly used to treat approximately 10 million Canadians affected by hypercholesterolemia. The most commonly experienced side-effect of statin medication is muscle pain. Statin induced myopathy consists of a spectrum of myopathic disorders ranging from mild myalgia to fatal rhabdomyolysis. The following is a presentation of 2 cases of statin induced myopathy in patients presenting in a chiropractic setting. In addition, discussion will surround the ...

  15. White striping and woody breast myopathies in the modern poultry industry: a review.

    Kuttappan, V A; Hargis, B M; Owens, C M

    2016-11-01

    Myopathies are gaining the attention of poultry meat producers globally. White Striping (WS) is a condition characterized by the occurrence of white striations parallel to muscle fibers on breast, thigh, and tender muscles of broilers, while Woody Breast (WB) imparts tougher consistency to raw breast fillets. Histologically, both conditions have been characterized with myodegeneration and necrosis, fibrosis, lipidosis, and regenerative changes. The occurrence of these modern myopathies has been associated with increased growth rate in birds. The severity of the myopathies can adversely affect consumer acceptance of raw cut up parts and/or quality of further processed poultry meat products, resulting in huge economic loss to the industry. Even though gross and/or histologic characteristics of modern myopathies are similar to some of the known conditions, such as hereditary muscular dystrophy, nutritional myopathy, toxic myopathies, and marbling, WS and WB could have a different etiology. As a result, there is a need for future studies to identify markers for WS and WB in live birds and genetic, nutritional, and/or management strategies to alleviate the condition. © 2016 Poultry Science Association Inc.

  16. Whole-body muscle MRI to detect myopathies in non-extrapyramidal bent spine syndrome

    Ohana, Mickael; Durand, Marie-Christine; Marty, Catherine; Lazareth, Jean-Philippe; Maisonobe, Thierry; Mompoint, Dominique; Carlier, Robert-Yves

    2014-01-01

    Bent spine syndrome (BSS), defined as an abnormal forward flexion of the trunk resolving in supine position, is usually related to parkinsonism, but can also be encountered in myopathies. This study evaluates whole-body muscle MRI (WB-mMRI) as a tool for detecting underlying myopathy in non-extrapyramidal BSS. Forty-three patients (90 % women; 53-86 years old) with a non-extrapyramidal BSS were prospectively included. All underwent a 1.5-T WB-mMRI and a nerve conduction study. Muscle biopsy was performed if a myopathy could not be eliminated based on clinical examination and all tests. Systematic MRI interpretation focused on peripheral and axial muscle injury; spinal posture and incidental findings were also reported. WB-mMRI was completed for all patients, with 13 muscle biopsies ultimately needed and myopathy revealed as the final etiological diagnosis in five cases (12 %). All biopsy-proven myopathies were detected by the WB-mMRI. Relevant incidental MRI findings were made in seven patients. This study supports WB-mMRI as a sensitive and feasible tool for detecting myopathy in BSS patients. Associated with electroneuromyography, it can better indicate when a muscle biopsy is needed and guide it when required. Rigorous radiological interpretation is mandatory, so as not to miss incidental findings of clinical consequence. (orig.)

  17. Whole-body muscle MRI to detect myopathies in non-extrapyramidal bent spine syndrome

    Ohana, Mickael [Nouvel Hopital Civil - Hopitaux Universitaires de Strasbourg, Service de Radiologie B, Strasbourg (France); Durand, Marie-Christine [AP-HP - Hopital Raymond Poincare, Service de Neurologie, Garches (France); Marty, Catherine; Lazareth, Jean-Philippe [AP-HP - Hopital Raymond Poincare, Service de Rhumatologie, Garches (France); Maisonobe, Thierry [APH-HP - Hopital de la Pitie-Salpetriere, Service de Neuropathologie, Paris (France); Mompoint, Dominique; Carlier, Robert-Yves [AP-HP - Hopital Raymond Poincare, Service de Radiologie, Garches (France)

    2014-08-15

    Bent spine syndrome (BSS), defined as an abnormal forward flexion of the trunk resolving in supine position, is usually related to parkinsonism, but can also be encountered in myopathies. This study evaluates whole-body muscle MRI (WB-mMRI) as a tool for detecting underlying myopathy in non-extrapyramidal BSS. Forty-three patients (90 % women; 53-86 years old) with a non-extrapyramidal BSS were prospectively included. All underwent a 1.5-T WB-mMRI and a nerve conduction study. Muscle biopsy was performed if a myopathy could not be eliminated based on clinical examination and all tests. Systematic MRI interpretation focused on peripheral and axial muscle injury; spinal posture and incidental findings were also reported. WB-mMRI was completed for all patients, with 13 muscle biopsies ultimately needed and myopathy revealed as the final etiological diagnosis in five cases (12 %). All biopsy-proven myopathies were detected by the WB-mMRI. Relevant incidental MRI findings were made in seven patients. This study supports WB-mMRI as a sensitive and feasible tool for detecting myopathy in BSS patients. Associated with electroneuromyography, it can better indicate when a muscle biopsy is needed and guide it when required. Rigorous radiological interpretation is mandatory, so as not to miss incidental findings of clinical consequence. (orig.)

  18. Mutation Spectrum of GNE Myopathy in the Indian Sub-Continent.

    Bhattacharya, Sudha; Khadilkar, Satish V; Nalini, Atchayaram; Ganapathy, Aparna; Mannan, Ashraf U; Majumder, Partha P; Bhattacharya, Alok

    GNE myopathy is an adult onset recessive genetic disorder that affects distal muscles sparing the quadriceps. GNE gene mutations have been identified in GNE myopathy patients all over the world. Homozygosity is a common feature in GNE myopathy patients worldwide. The major objective of this study was to investigate the mutation spectrum of GNE myopathy in India in relation to the population diversity in the country. We have collated GNE mutation data of Indian GNE myopathy patients from published literature and from recently identified patients. We also used data of people of Indian subcontinent from 1000 genomes database, South Asian Genome database and Strand Life Science database to determine frequency of GNE mutations in the general population. A total of 67 GNE myopathy patients were studied, of whom 21% were homozygous for GNE variants, while the rest were compound heterozygous. Thirty-five different mutations in the GNE gene were recorded, of which 5 have not been reported earlier. The most frequent mutation was p.Val727Met (65%) found mainly in the heterozygous form. Another mutation, p.Ile618Thr was also common (16%) but was found mainly in patients from Rajasthan, while p.Val727Met was more widely distributed. The latter was also seen at a high frequency in general population of Indian subcontinent in all the databases. It was also present in Thailand but was absent in general population elsewhere in the world. p.Val727Met is likely to be a founder mutation of Indian subcontinent.

  19. Of monkeys and men: A metabolomic analysis of static and dynamic urinary metabolic phenotypes in two species

    Saccenti, E.; Tenori, L.; Verbruggen, P.; Timmerman, M.E.; Bouwman, J.; Greef, J. van der; Luchinat, C.; Smilde, A.K.

    2014-01-01

    Background: Metabolomics has attracted the interest of the medical community for its potential in predicting early derangements from a healthy to a diseased metabolic phenotype. One key issue is the diversity observed in metabolic profiles of different healthy individuals, commonly attributed to the

  20. Of Monkeys and Men: A Metabolomic Analysis of Static and Dynamic Urinary Metabolic Phenotypes in Two Species

    Saccenti, E.; Tenori, L.; Verbruggen, P.; Timmerman, M.E.; Bouwman, J.; Greef, de J.; Luchinat, C.; Smilde, A.K.

    2014-01-01

    Background Metabolomics has attracted the interest of the medical community for its potential in predicting early derangements from a healthy to a diseased metabolic phenotype. One key issue is the diversity observed in metabolic profiles of different healthy individuals, commonly attributed to the

  1. Of Monkeys and Men : A Metabolomic Analysis of Static and Dynamic Urinary Metabolic Phenotypes in Two Species

    Saccenti, E.; Tenori, L.; Verbruggen, P.; Timmerman, Marieke; Bouwman, J.; van der Greef, J.; Luchinat, C.; Smilde, Age K.

    2014-01-01

    Background Metabolomics has attracted the interest of the medical community for its potential in predicting early derangements from a healthy to a diseased metabolic phenotype. One key issue is the diversity observed in metabolic profiles of different healthy individuals, commonly attributed to the

  2. Calcium metabolism in birds.

    de Matos, Ricardo

    2008-01-01

    Calcium is one of the most important plasma constituents in mammals and birds. It provides structural strength and support (bones and eggshell) and plays vital roles in many of the biochemical reactions in the body. The control of calcium metabolism in birds is highly efficient and closely regulated in a number of tissues, primarily parathyroid gland, intestine, kidney, and bone. The hormones with the greatest involvement in calcium regulation in birds are parathyroid hormone, 1,25-dihydroxyvitamin D(3) (calcitriol), and estrogen, with calcitonin playing a minor and uncertain role. The special characteristics of calcium metabolism in birds, mainly associated with egg production, are discussed, along with common clinical disorders secondary to derangements in calcium homeostasis.

  3. Adipose tissue NAD+-homeostasis, sirtuins and poly(ADP-ribose) polymerases -important players in mitochondrial metabolism and metabolic health.

    Jokinen, Riikka; Pirnes-Karhu, Sini; Pietiläinen, Kirsi H; Pirinen, Eija

    2017-08-01

    Obesity, a chronic state of energy overload, is characterized by adipose tissue dysfunction that is considered to be the major driver for obesity associated metabolic complications. The reasons for adipose tissue dysfunction are incompletely understood, but one potential contributing factor is adipose tissue mitochondrial dysfunction. Derangements of adipose tissue mitochondrial biogenesis and pathways associate with obesity and metabolic diseases. Mitochondria are central organelles in energy metabolism through their role in energy derivation through catabolic oxidative reactions. The mitochondrial processes are dependent on the proper NAD + /NADH redox balance and NAD + is essential for reactions catalyzed by the key regulators of mitochondrial metabolism, sirtuins (SIRTs) and poly(ADP-ribose) polymerases (PARPs). Notably, obesity is associated with disturbed adipose tissue NAD + homeostasis and the balance of SIRT and PARP activities. In this review we aim to summarize existing literature on the maintenance of intracellular NAD + pools and the function of SIRTs and PARPs in adipose tissue during normal and obese conditions, with the purpose of comprehending their potential role in mitochondrial derangements and obesity associated metabolic complications. Understanding the molecular mechanisms that are the root cause of the adipose tissue mitochondrial derangements is crucial for developing new effective strategies to reverse obesity associated metabolic complications. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  4. Functional disorders of the temporomandibular joints: Internal derangement of the temporomandibular joint.

    Chang, Chih-Ling; Wang, Ding-Han; Yang, Mu-Chen; Hsu, Wun-Eng; Hsu, Ming-Lun

    2018-04-01

    Temporomandibular joint (TMJ) is one of the most complex joints of the human body. Due to its unique movement, in terms of combination of rotation and translator movement, disc of the joint plays an important role to maintain its normal function. In order to sustain the normal function of the TMJ, disc must be kept in proper position as well as maintain normal shape in all circumstances. Once the disc is not any more in its normal position during function of the joint, disturbance of the joint can be occurred which will lead to subsequent distortion of the disc. Shape of the disc can be influenced by many factors i.e.: abnormal function or composition of the disc itself. Etiology of the internal derangement of the disc remains controversial. Multifactorial theory has been postulated in most of previous manuscripts. Disc is composed of mainly extracellular matrix. Abnormal proportion of collagen type I & III may also leads to joint hypermobility which may be also a predisposing factor of this disorder. Thus it can be recognized as local manifestation of a systemic disorder. Different treatment modalities with from conservative treatment to surgical intervention distinct success rate have been reported. Recently treatment with extracellular matrix injection becomes more and more popular to strengthen the joint itself. Since multifactorial in character, the best solution of the treatment modalities should be aimed to resolve possible etiology from different aspects. Team work may be indication to reach satisfied results. Copyright © 2018. Published by Elsevier Taiwan.

  5. Radiographic changes of TMJ components with an advancement of TMJ internal derangement

    Kurita, Hiroshi

    2006-01-01

    Internal derangement (ID) of the temporomandibular joint (TMJ) relates to a mechanical and anatomical disturbance interfering with the smooth joint function. The ID usually develops in a benign and self-limiting fashion and does not always lead to progressing disorders. Radiographically visible degenerative changes occur with advancement of ID. It is thought that most of these changes closely correlate with the self-limiting nature of ID. In this report, a variety of radiographically visible degenerative changes were shown to develop with advancing ID. These changes, including a total and more anterior displacement of the TMJ disk, deviations in configuration of the TMJ disk, resorption of lateral pole of TMJ condyle, regression in horizontal size of the TMJ condyle, and flattening of the articular eminence, developed reflecting each other and might play an important role in an improvement of clinical signs and symptoms in the long run. It is also suggested that most of the acute and destructive radiographically visible degenerative changes were arrested or slowed in those patients whose symptoms and signs were successfully resolved or reduced. (author)

  6. Spiral CT arthrography of the knee: technique and value in the assessment of internal derangement of the knee

    Berg, Vande B.C.; Lecouvet, F.E.; Maldague, B.; Malghem, J. [Department of Radiology, Cliniques Universitaires St. Luc, Universite Catholique de Louvain, Brussels (Belgium); Poilvache, P. [Department of Orthopedic Surgery, Cliniques Universitaires St. Luc, Universite Catholique de Louvain, Brussels (Belgium)

    2002-07-01

    Computed tomography imaging has achieved excellent multiplanar capability and submillimeter spatial resolution due to the development of the spiral acquisition mode and multidetector row technology. Multidetector spiral CT arthrography (CTA) yields valuable information for the assessment of internal derangement of the joints. This article focuses on the value of spiral CTA of the knee in the assessment of the meniscus, anterior cruciate ligament, and hyaline cartilage lesions. Advantages and disadvantages of spiral CTA with respect to MR imaging are presented. (orig.)

  7. Severe metabolic alkalosis due to baking soda ingestion: case reports of two patients with unsuspected antacid overdose.

    Fitzgibbons, L J; Snoey, E R

    1999-01-01

    Oral ingestion of baking soda (sodium bicarbonate) has been used for decades as a home remedy for acid indigestion. Excessive bicarbonate ingestion places patients at risk for a variety of metabolic derangements including metabolic alkalosis, hypokalemia, hypernatremia, and even hypoxia. The clinical presentation is highly variable but can include seizures, dysrhythmias, and cardiopulmonary arrest. We present two cases of severe metabolic alkalosis in patients with unsuspected antacid overdose. The presentation and pathophysiology of antacid-related metabolic alkalosis is reviewed.

  8. Rapid resolution of chronic shoulder pain classified as derangement using the McKenzie method: a case series

    Aytona, Maria Corazon; Dudley, Karlene

    2013-01-01

    The McKenzie method, also known as Mechanical Diagnosis and Therapy (MDT), is primarily recognized as an evaluation and treatment method for the spine. However, McKenzie suggested that this method could also be applied to the extremities. Derangement is an MDT classification defined as an anatomical disturbance in the normal resting position of the joint, and McKenzie proposed that repeated movements could be applied to reduce internal joint displacement and rapidly reduce derangement symptoms. However, the current literature on MDT application to shoulder disorders is limited. Here, we present a case series involving four patients with chronic shoulder pain from a duration of 2–18 months classified as derangement and treated using MDT principles. Each patient underwent mechanical assessment and was treated with repeated movements based on their directional preference. All patients demonstrated rapid and clinically significant improvement in baseline measures and the disabilities of the arm, shoulder, and hand (QuickDASH) scores from an average of 38% at initial evaluation to 5% at discharge within 3–5 visits. Our findings suggest that MDT may be an effective treatment approach for shoulder pain. PMID:24421633

  9. A comparative study of mandibular movements with their MR images in patients with internal derangement of the TMJ

    Miyamoto, Satoshi; Ogawa, Takumi; Hosoda, Yutaka

    1993-01-01

    Thirty one patients with internal derangement of the TMJ and 12 subjects with normal TMJ were selected and their MR imaging and border movements of the mandible were recorded. In addition, the relationship between them were examined. In this study, the disk position and configuration in MR findings were classified as follows. Disk position: superior, anterior and anterolateral (medial and lateral were omitted), grade of anterior disk displacement (with and without reduction): slight, moderate and severe, disk configuration: biconcave, enlargement of posterior band, even thickness and biconvex. Border movements of the mandible were influenced not only by unilateral or bilateral interior derangement but also by with or without reduction of the disk. Border movements in patients with anterolateral disk displacement were more severely restricted than those with anterior disk displacement. Border movements were remarkably limited in patients with slight disk displacement, especially in unilateral cases with reduction of the disk. Border movements in patients with even thickness and biconvex types of disk configuration were a little restricted and rather similar to those of normal subjects. There was significant correlation between border movements and disk position and configuration. It means that measurement of the mandibular movements is very significant to diagnose the condition of internal derangements of the TMJ. (author)

  10. Diagnostic criteria for idiopathic inflammatory myopathies. Problems of their optimization

    O. A. Antelava

    2014-01-01

    Full Text Available The paper deals with the problems of optimizing the diagnostic criteria for idiopathic inflammatory myopathies (IIM, a group of heterogeneous rare autoimmune diseases characterized by inflammatory lesion in the skeletal muscles. The representatives of this group are traditionally considered to be polymyositis (PM, dermatomyositis (DM, and inclusion-body myositis. The authors detail the history of classification criteria for IIM from those proposed by T.A. Medsger et al. (1970 relying on its clinical picture, laboratory data and instrumental findings, as well as the criteria (including the first introduced exclusion ones elaborated by A. Bohan and J.B. Peter in 1975, which remain fundamental in both clinical practice and researches. The basis for the clinical and serological criteria proposed by Y. Troyanov et al. (2005 for IIM is the identification of myositis-overlap syndromes. The classificational (subtype identification and therapeutic value of the criteria based on clinical and serological characteristics was supported by the Hungarian investigators A. Vancsa et al. (2010 who investigated the relationship between the clinical and therapeutic characteristics of IIM and positivity for myositis-specific and myositis-associated antibodies. The criteria developed by M.C. Dalakas (1991, 2003 are based on the specific immunopathological features of a histological pattern, which allow the differentiation of DM, PM, and inclusion-body myositis from other myopathic syndromes. The 2004 European Neuromuscular Center (ENMC criteria first identify necrotizing autoimmune myopathy and nonspecific myositis as individual subtypes. The serological classification of IIM, which is based onthe assessment of autoantibodies that play an important role in the pathogenesis of the disease, is of indubitable interest. There is an obvious need for the correct and timely diagnosis of both IIM as a whole and its subtypes in particular, which is complicated by

  11. Differential Diagnosis of Nongap Metabolic Acidosis: Value of a Systematic Approach

    Kraut, Jeffrey A.; Madias, Nicolaos E.

    2012-01-01

    Nongap metabolic acidosis is a common form of both acute and chronic metabolic acidosis. Because derangements in renal acid-base regulation are a common cause of nongap metabolic acidosis, studies to evaluate renal acidification often serve as the mainstay of differential diagnosis. However, in many cases, information obtained from the history and physical examination, evaluation of the electrolyte pattern (to determine if a nongap acidosis alone or a combined nongap and high anion gap metabo...

  12. Quantitative nailfold video capillaroscopy in patients with idiopathic inflammatory myopathy.

    Mercer, Louise K; Moore, Tonia L; Chinoy, Hector; Murray, Andrea K; Vail, Andy; Cooper, Robert G; Herrick, Ariane L

    2010-09-01

    To quantify nailfold capillary density and dimensions in patients with idiopathic inflammatory myopathy (IIM) and compare them with those in healthy controls; to look for associations with microvascular disease in IIM; and to determine whether nailfold capillary density and dimensions change over time. Nailfold video microscopy (x300 magnification) was performed on 24 patients with IIM and 35 healthy controls. Capillary density and dimensions (total width and apical width) were quantified. Patients were clinically assessed and disease activity recorded using the Myositis Disease Activity Assessment Tool. Disease severity and physical function were assessed using the myositis damage index and Stanford HAQ, respectively. Findings were analysed using linear and logistic regression, adjusted for age and sex. In a subgroup of 16 patients with IIM and 27 controls, the process was repeated 6-12 months later and the results were analysed using Student's t-test. Capillary density was lower and dimensions were higher in patients with IIM compared with healthy controls (P nailfold capillaroscopy, suggesting that nailfold capillaroscopy may be useful as an outcome measure of microvascular disease in studies of IIM.

  13. Muscle sonography in six patients with hereditary inclusion body myopathy

    Adler, Ronald S.; Garolfalo, Giovanna; Paget, Stephen; Kagen, Lawrence

    2008-01-01

    To evaluate the morphological changes of muscle with sonography in six patients affected by hereditary inclusion body myopathy (HIBM). We studied a group of six Persian Jews diagnosed with HIBM. All were homozygous for the GNE mutation M712T. Ultrasonographic examinations of the quadriceps femoris and hamstring muscle groups were performed. A follow-up ultrasound examination was performed, after an interval of 3 years, in four of these patients. Muscles were assessed subjectively as to echogenicity, determined by gray-scale assessment, and loss of normal muscle morphology. Power Doppler sonography (PDS) was used to assess vascularity. A sonographic finding of central atrophy and peripheral sparing resulting in a target-like appearance was noted in the hamstring compartment of all six patients. The quadriceps compartment also showed involvement of the rectus femoris of all patients, which, in some cases, was the only muscle involved in the quadriceps. Vascularity was markedly reduced in the affected areas, with blood flow demonstrated in the peripherally spared areas. The severity of atrophy increased with disease duration. In this case series, we describe a new sonographic finding as well as document progression of HIBM disease, which has generally been described as quadriceps sparing. The myopathic target lesion, as well as isolated rectus femoris atrophy, may provide a useful adjunct to disease diagnosis. (orig.)

  14. Myopathy in CRPS-I: disuse or neurogenic?

    Hulsman, Natalie M; Geertzen, Jan H B; Dijkstra, Pieter U; van den Dungen, Jan J A M; den Dunnen, Wilfred F A

    2009-08-01

    The diagnosis Complex Regional Pain Syndrome type I (CRPS-I) is based on clinical symptoms, including motor symptoms. Histological changes in muscle tissue may be present in the chronic phase of CRPS-I. Aim of this study was to analyze skeletal muscle tissue from amputated limbs of patients with CRPS-I, in order to gain more insight in factors that may play a role in changes in muscles in CRPS-I. These changes may be helpful in clarifying the pathophysiology of CRPS-I. Fourteen patients with therapy resistant and longstanding CRPS-I, underwent an amputation of the affected limb. In all patients histological analysis showed extensive changes in muscle tissue, such as fatty degeneration, fibre atrophy and nuclear clumping, which was not related to duration of CRPS-I prior to amputation. In all muscles affected, both type 1 and type 2 fibre atrophy was found, without selective type 2 fibre atrophy. In four patients, type grouping was observed, indicating a sequence of denervation and reinnervation of muscle tissue. In two patients even large group atrophy was present, suggesting new denervation after reinnervation. Comparison between subgroups in arms and legs showed no difference in the number of changes in muscle tissue. Intrinsic and extrinsic muscles were affected equally. Our findings show that in the chronic phase of CRPS-I extensive changes can be seen in muscle tissue, not related to duration of CRPS-I symptoms. Signs of neurogenic myopathy were present in five patients.

  15. OCULAR ASPECTS OF HYPERTHYROIDISM WITH SPECIAL REFERENCE TO OCULAR MYOPATHY

    Mallika O. U

    2017-04-01

    Full Text Available BACKGROUND Hyperthyroidism can result in ocular manifestations even before systemic signs and symptoms develop. It is seen more in females and severe forms are more common in males. Early detection of ocular involvement can prevent vision threatening complications and troublesome discomforts affecting quality of vision. This clinical study highlights the importance of detailed ocular examination in hyperthyroidism. MATERIALS AND METHODS Fifty consecutive patients with ocular signs of hyperthyroidism were evaluated and followed up for an average period of 1 year. Detailed ocular examination included exophthalmometric measurements, ocular movements and Worth four-dot test. T3, T4, TSH, CT scan and antimicrosomal antibodies and antithyroglobulin antibodies were done along with routine investigations. Study Design- Prospective cohort study. RESULTS Statistical analysis did not reveal any correlation between the level of serum T3 and severity of ocular findings. Majority of the cases were euthyroid with moderate ocular myopathy having multiple muscle involvement. Inferior rectus was affected most. CONCLUSION The ocular signs of hyperthyroidism in the present study seem to be mild. The severe eye changes like corneal involvement and optic nerve changes were less common.

  16. [Statin associated myopathy in clinical practice. Results of DAMA study].

    Millán, Jesús; Pedro-Botet, Juan; Climent, Elisenda; Millán, Joaquín; Rius, Joan

    Muscle symptoms, with or without elevation of creatin kinase are one of the main adverse effects of statin therapy, a fact that sometimes limits their use. The aim of this study was to evaluate the clinical characteristics of patients treated with statins who have complained muscle symptoms and to identify possible predictive factors. A cross-sectional one-visit, non-interventional, national multicenter study including patients of both sexes over 18 years of age referred for past or present muscle symptoms associated with statin therapy was conducted. 3,845 patients were recruited from a one-day record from 2,001 physicians. Myalgia was present in 78.2% of patients included in the study, myositis in 19.3%, and rhabdomyolysis in 2.5%. Patients reported muscle pain in 77.5% of statin-treated individuals, general weakness 42.7%, and cramps 28.1%. Kidney failure, intense physical exercise, alcohol consumption (>30g/d in men and 20g/d in women) and abdominal obesity were the clinical situations associated with statin myopathy. Myalgia followed by myositis are the most frequent statin-related side effects. It should be recommended control environmental factors such as intense exercise and alcohol intake as well as abdominal obesity and renal function of the patient treated with statins. Copyright © 2016 Sociedad Española de Arteriosclerosis. Publicado por Elsevier España, S.L.U. All rights reserved.

  17. Mutation update and genotype-phenotype correlations of novel and previously described mutations in TPM2 and TPM3 causing congenital myopathies

    Marttila, Minttu; Lehtokari, Vilma-Lotta; Marston, Steven; Nyman, Tuula A.; Barnerias, Christine; Beggs, Alan H.; Bertini, Enrico; Ceyhan-Birsoy, Ozge; Cintas, Pascal; Gerard, Marion; Gilbert-Dussardier, Brigitte; Hogue, Jacob S.; Longman, Cheryl; Eymard, Bruno; Frydman, Moshe; Kang, Peter B.; Klinge, Lars; Kolski, Hanna; Lochmüller, Hans; Magy, Laurent; Manel, Véronique; Mayer, Michèle; Mercuri, Eugenio; North, Kathryn N.; Peudenier-Robert, Sylviane; Pihko, Helena; Probst, Frank J.; Reisin, Ricardo; Stewart, Willie; Taratuto, Ana Lia; de Visser, Marianne; Wilichowski, Ekkehard; Winer, John; Nowak, Kristen; Laing, Nigel G.; Winder, Tom L.; Monnier, Nicole; Clarke, Nigel F.; Pelin, Katarina; Grönholm, Mikaela; Wallgren-Pettersson, Carina

    2014-01-01

    Mutations affecting skeletal muscle isoforms of the tropomyosin genes may cause nemaline myopathy, cap myopathy, core-rod myopathy, congenital fiber-type disproportion, distal arthrogryposes, and Escobar syndrome. We correlate the clinical picture of these diseases with novel (19) and previously

  18. Role Of Serum Lectin In Derangement Of PUBERTAL Timing In Thalassaemic Patients

    MOAWAD, A.T.; NASSAR, E.M.; EL-NASHAR, N.A.

    2010-01-01

    The purpose of this study was to investigate the association between serum leptin and pubertal derangement in β-thalassemia major (TM) patients. This study was conducted on forty TM patients (25 males and 15 females) with mean age 15.6 ±1.47 and twenty healthy children with normal pubertal development served as control (10 males and 10 females). Clinical, anthropometric and pubertal assessment using tanner classification were done for all patients and controls in addition to estimation of serum ferritin, leptin, follicle stimulating hormone (FSH), luteinizing hormone (LH), testosterone (T) in boys and estradiol (E 2 ) in girls. Thalassaemic patients were subdivided into 27 patients with normal puberty and 13 delayed puberty patients. The results showed that failure of puberty was confirmed in 70% of boys and in 67% of girls. Body mass index (BMI) was significantly decreased in both patient groups as compared to controls. Mean serum ferritin levels were significantly increased in TM patients with delayed puberty (male: 2865.5±274.7 and female: 2704.5±477.1 ng/ml) than the levels in euogonadal patients (male: 1594.1±408.8 and female: 1524.1±349.6 ng/ml). However, a significant difference in serum ferritin was also detected between euogonadal patients and controls. Although the mean serum leptin levels were significantly higher in normal pubertal patients (male: 3.7± 0.4 and female: 7.6±1.2 ng/ml) comparing to the levels in delayed puberty patients (male: 0.9± 0.4 and female: 2.6±0.9 ng/ml), it was still lower than levels in control group (male: 8.4±2.8 and female: 12.3±1.9 ng/ml). The mean serum levels of FSH and LH were significantly decreased in delayed puberty patients when compared to each of normal puberty patients and controls. However, the comparison between normal patients and controls was non-significant. A close positive correlation was observed between serum leptin and BMI in normal pubertal patients, but such correlation was not obtained in

  19. Derangement of cellular plasma membranes due to non-lethal radiation doses

    Koeteles, G.J.; Kubasova, T.; Somosy, Z.; Horvath, L.

    1983-01-01

    Earlier observations in the laboratory on fibroblasts and various blood cells of animal and human origins pointed to alteration of concanavalin A binding sites of plasma membranes as well as to concomitant morphological changes and scanning electron microscopic appearance of cell surfaces following sub-lethal doses of X-, fission neutron and beta irradiations. The effects appeared early and existed temporarily; their intensities and the restitution of membrane function depended on radiation doses, types and conditions of cells. In the present paper further aspects of structural and functional derangements of plasma membranes are introduced which were provoked by X- and tritium beta irradiation in the dose range up to 2.5 Gy and in the concentration range from 3.7 kBq/mL, respectively. The state of membrane structure was followed by bindings of various ligands of different receptor requirements, concanavalin A, cationized ferritin and polio virus. In the case of X-irradiation the binding conditions suggest the shift of overall negative surface charges to less negative ones. It was also found that radiation-induced phenomena appear on the cell surface unevenly. Long- and short-term treatments of cells with 3 H-thymidine and 3 H-water also perturb the plasma membrane; beta irradiation affects it directly. Membrane structure and function are suggested to offer good biological models to study correlation of energy deposition and biological effects, both restricted to domains of nanometre range. The data give evidence for radiation-induced membrane alterations in the sub-lethal or non-lethal ranges which might have consequences in the development of stochastic and non-stochastic effects. (author)

  20. TVP1022 Protects Neonatal Rat Ventricular Myocytes against Doxorubicin-Induced Functional Derangements

    Berdichevski, Alexandra; Meiry, Gideon; Milman, Felix; Reiter, Irena; Sedan, Oshra; Eliyahu, Sivan; Duffy, Heather S.; Youdim, Moussa B.; Binah, Ofer

    2010-01-01

    Our recent studies demonstrated that propargylamine derivatives such as rasagiline (Azilect, Food and Drug Administration-approved anti-Parkinson drug) and its S-isomer TVP1022 protect cardiac and neuronal cell cultures against apoptotic-inducing stimuli. Studies on structure-activity relationship revealed that their neuroprotective effect is associated with the propargylamine moiety, which protects mitochondrial viability and prevents apoptosis by activating Bcl-2 and protein kinase C-ε and by down-regulating the proapoptotic protein Bax. Based on the established cytoprotective and neuroprotective efficacies of propargylamine derivatives, as well as on our recent study showing that TVP1022 attenuates serum starvation-induced and doxorubicin-induced apoptosis in neonatal rat ventricular myocytes (NRVMs), we tested the hypothesis that TVP1022 will also provide protection against doxorubicin-induced NRVM functional derangements. The present study demonstrates that pretreatment of NRVMs with TVP1022 (1 μM, 24 h) prevented doxorubicin (0.5 μM, 24 h)-induced elevation of diastolic [Ca2+]i, the slowing of [Ca2+]i relaxation kinetics, and the decrease in the rates of myocyte contraction and relaxation. Furthermore, pretreatment with TVP1022 attenuated the doxorubicin-induced reduction in the protein expression of sarco/endoplasmic reticulum calcium (Ca2+) ATPase, Na+/Ca2+ exchanger 1, and total connexin 43. Finally, TVP1022 diminished the inhibitory effect of doxorubicin on gap junctional intercellular coupling (measured by means of Lucifer yellow transfer) and on conduction velocity, the amplitude of the activation phase, and the maximal rate of activation (dv/dtmax) measured by the Micro-Electrode-Array system. In summary, our results indicate that TVP1022 acts as a novel cardioprotective agent against anthracycline cardiotoxicity, and therefore potentially can be coadmhence, the inistered with doxorubicin in the treatment of malignancies in humans. PMID:19915070

  1. Derangements of liver tissue bioenergetics in Concanavalin A-induced hepatitis

    Al-Shamsi Mariam

    2013-01-01

    Full Text Available Abstract Background A novel in vitro system was employed to investigate liver tissue respiration (mitochondrial O2 consumption in mice treated with concanavalin A (Con A. This study aimed to investigate hepatocyte bioenergetics in this well-studied hepatitis model. Methods C57Bl/6 and C57Bl/6 IFN-γ−/− mice were injected intravenously with 12 mg ConA/kg. Liver specimens were collected at various timepoints after injection and analyzed for cellular respiration and caspase activation. Serum was analyzed for interferon-gamma (IFN-γ and aminotransferases. Fluorescence activated cell sorting analysis was used to determine the phenotype of infiltrating cells, and light and electron microscopy were used to monitor morphological changes. Phosphorescence analyzer that measured dissolved O2 as function of time was used to evaluate respiration. Results In sealed vials, O2 concentrations in solutions containing liver specimen and glucose declined linearly with time, confirming zero-order kinetics of hepatocyte respiration. O2 consumption was inhibited by cyanide, confirming the oxidation occurred in the respiratory chain. Enhanced liver respiration (by ≈68%, pp=0.005 was noted 12 hr after ConA treatment, and occurred in conjunction with deranged mitochondria, areas of necrosis, and prominent infiltrations with immune cells, most significantly, CD3+NKT+ cells. Increases in intracellular caspase activity and serum IFN-γ and aminotransferase levels were noted 3 hr after ConA treatment and progressed with time. The above-noted changes were less pronounced in C57Bl/6 IFN-γ−/− mice treated with ConA. Conclusions Based on these results, liver tissue bioenergetics is increased 3 hr after ConA exposure. This effect is driven by the pathogenesis of the disease, in which IFN-γ and other cytokines contribute to. Subsequent declines in liver bioenergetics appear to be a result of necrosis and active caspases targeting the mitochondria within hepatocytes.

  2. MRI of the internal derangement of temporomandibular joint: Comparison with arthrographic and operation

    Kim, Mi Hye; Kim, Dong Ik; Kim, Hyung Gon; Suh, Jung Ho; Jung, Tae Sub

    1993-01-01

    We retrospectively reviewed the MRI findings of 100 temporomandibular joints in 78 patients who had complained temporomandibular joint dysfunction. MRI findings were classified according to Wilke's staging criteria. And these findings were compared with arthographic findings in 22 joint and surgical findings in 44 joints. According to Wilke's staging, they were classified into 6 stages of abnormality: stage 0 (33 cases), stage I (19 cases), stage II (10 cases), stage III (18 cases), stage IV (6 cases), stage V (14 cases). Among the 22 cases in which arthography and MRI were done, both studies were well correlated in 10 joints. In 7 joints, MRI was superior to arthography, which correctly demonstrated the meniscal displacement in 2 joints and meniscal deformity in 5 joints. In 5 joints, arthography was superior to MR, which demonstrated the perforation (1 joint), adhesion (2 joints) and recapture of meniscus (2 joints). Compared with surgical findings, MRI correctly demonstrated the displacement of meniscus in all 44 joints. However, in case of the 10 meniscal perforation, MRI demonstrated the meniscal discontinuity in only 4 joints. Retrospective MR findings in 10 proven cases were the defect in posterior attachment in 4, far anterior meniscal displacement without recapture in 8, condylar spur in 4, and close bone to bone contact in 1. In conclusion, MRI as a primary diagnostic modality of temporomandibular joint derangement, is superior for the grading of displacement and deformity of meniscus but inferior for the evaluation of perforation, adhesion and recapture of meniscus to conventional arthrography. In case of the suspected meniscal perforation, arthrographic correlation is recommended preoperatively

  3. Clinical study of internal derangement of the temporomandibular joint with closed lock, 2

    Moriya, Yoshiyuki; Murakami, Ken-ichiro; Fujimura, Kazuma; Yokoyama, Tadaaki; Nose, Masahiro; Miyaki, Katsuaki; Segami, Natsuki; Iizuka, Tadahiko

    1990-01-01

    Fifty-three closed lock cases of internal derangement of the temporomandibular joint (TMJ) were studied on the correlation between disk configuration at MR imaging and nine clinical parameters composed of opening degree, age, clicking and locking duration, visual analogue scale of pain (VAS), pain score, jaw dysfunction score, life activity limited score, and TMJ X-ray photo findings. Disk configuration and degree of anterior disk displacement were assessed on MR imaging in closed mouth position: the antero-posterior length of disk and the distance from condyle to anterior and posterior portion of disk were measured, respectively. Duration of clicking and locking were not correlated with MR index except that there was a strong correlation between clicking duration and the distance from condyle to anterior portion of the disk at MR imaging. Opening degree was related to the disk deformity and the access of posterior portion of the disk to condyle. Disk configuration and degree of anterior disk displacement were not correlated with TMJ pain, but jaw dysfunction was related to the disk deformity and the distance from posterior portion of the disk to condyle. TMJ X-ray photo findings were not correlated with clicking duration (below 3 years), locking duration (below 30 weeks), opening degree and disk configuration at MR imaging. In evaluation of factors related to opening degree in 53 patients with closed lock by means of multiple regression analysis, age, locking and clicking duration, TMJ pain, life activity limited score were more strongly correlated to opening degree than the others. (author)

  4. Derangement of a factor upstream of RARalpha triggers the repression of a pleiotropic epigenetic network.

    Francesca Corlazzoli

    Full Text Available Chromatin adapts and responds to extrinsic and intrinsic cues. We hypothesize that inheritable aberrant chromatin states in cancer and aging are caused by genetic/environmental factors. In previous studies we demonstrated that either genetic mutations, or loss, of retinoic acid receptor alpha (RARalpha, can impair the integration of the retinoic acid (RA signal at the chromatin of RA-responsive genes downstream of RARalpha, and can lead to aberrant repressive chromatin states marked by epigenetic modifications. In this study we tested whether the mere interference with the availability of RA signal at RARalpha, in cells with an otherwise functional RARalpha, can also induce epigenetic repression at RA-responsive genes downstream of RARalpha.To hamper the availability of RA at RARalpha in untransformed human mammary epithelial cells, we targeted the cellular RA-binding protein 2 (CRABP2, which transports RA from the cytoplasm onto the nuclear RARs. Stable ectopic expression of a CRABP2 mutant unable to enter the nucleus, as well as stable knock down of endogenous CRABP2, led to the coordinated transcriptional repression of a few RA-responsive genes downstream of RARalpha. The chromatin at these genes acquired an exacerbated repressed state, or state "of no return". This aberrant state is unresponsive to RA, and therefore differs from the physiologically repressed, yet "poised" state, which is responsive to RA. Consistent with development of homozygosis for epigenetically repressed loci, a significant proportion of cells with a defective CRABP2-mediated RA transport developed heritable phenotypes indicative of loss of function.Derangement/lack of a critical factor necessary for RARalpha function induces epigenetic repression of a RA-regulated gene network downstream of RARalpha, with major pleiotropic biological outcomes.

  5. Diagnostic studies on the internal derangement of temporomandibular joint in MR imaging (MRI)

    Tange, Kazuhisa

    1991-01-01

    The T1 and T2 relaxation times of the phantom were measured in the magnetic resonance imaging (MRI) using the headcoil and the surface coil for the temporomandibular joint (TMJ). The purpose of this study on the phantom was to investigate the feature of the surface coil for TMJ (TMJ-coil). Two spin echo (TR=2,000 msec, TE=30 msec and TR=2,000 msec, TE=80 msec) and one inversion recovery (TR=2,000 msec, TI=500 msec) pulse sequence with a 256 x 256 matrix and two excitations were used, and the T1 and T2 values were obtained by the ROI (region of interest) in the maps of T1 and T2. As a result of the phantom study, I acquired the knowledge that I have to set an object on the center of the TMJ-coil with a distance more than 3 cm. With the TMJ-coil, measurements of T1 and T2 relaxation times of meniscus and lateral pterygoid muscle were performed on 30 normal volunteers and 30 patients who had been diagnosed internal derangement of the TMJ. The 30 patients were classified into two groups; one composed of 15 patients diagnosed as meniscal displacement with reduction (group MDWR) and the other was of 15 patients diagnosed as meniscal displacement without reduction (group MDWOR). Between the volunteers and patients, there was a significant decrease in T1 and T2 relaxation times of meniscus and T1 relaxation times of lateral pterygoid muscle. There was no significant difference between group MDWR and group MDWOR. There was no significant difference in sex or age, either. The more long-term the patients were, the more the T1 relaxation times decreased. The decrease in T1 and T2 relaxation times of meniscus probably represented water loss. The decrease in T1 and T2 relaxation times of lateral pterygoid muscle was slight compared with that of meniscus. (author)

  6. Differential effect of the rs4149056 variant in SLCO1B1 on myopathy associated with simvastatin and atorvastatin

    Brunham, L. R.; Lansberg, P. J.; Zhang, L.; Miao, F.; Carter, C.; Hovingh, G. K.; Visscher, H.; Jukema, J. W.; Stalenhoef, A. F.; Ross, C. J. D.; Carleton, B. C.; Kastelein, J. J. P.; Hayden, M. R.

    2012-01-01

    Statins reduce cardiovascular morbidity and mortality in appropriately selected patients. However, statin-associated myopathy is a significant risk associated with these agents. Recently, variation in the SLCO1B1 gene was reported to predict simvastatin-associated myopathy. The aim of this study was

  7. The Role of Docosahexaenoic Acid (DHA) in the Control of Obesity and Metabolic Derangements in Breast Cancer.

    Molfino, Alessio; Amabile, Maria Ida; Monti, Massimo; Arcieri, Stefano; Rossi Fanelli, Filippo; Muscaritoli, Maurizio

    2016-04-05

    Obesity represents a major under-recognized preventable risk factor for cancer development and recurrence, including breast cancer (BC). Healthy diet and correct lifestyle play crucial role for the treatment of obesity and for the prevention of BC. Obesity is significantly prevalent in western countries and it contributes to almost 50% of BC in older women. Mechanisms underlying obesity, such as inflammation and insulin resistance, are also involved in BC development. Fatty acids are among the most extensively studied dietary factors, whose changes appear to be closely related with BC risk. Alterations of specific ω-3 polyunsaturated fatty acids (PUFAs), particularly low basal docosahexaenoic acid (DHA) levels, appear to be important in increasing cancer risk and its relapse, influencing its progression and prognosis and affecting the response to treatments. On the other hand, DHA supplementation increases the response to anticancer therapies and reduces the undesired side effects of anticancer therapies. Experimental and clinical evidence shows that higher fish consumption or intake of DHA reduces BC cell growth and its relapse risk. Controversy exists on the potential anticancer effects of marine ω-3 PUFAs and especially DHA, and larger clinical trials appear mandatory to clarify these aspects. The present review article is aimed at exploring the capacity of DHA in controlling obesity-related inflammation and in reducing insulin resistance in BC development, progression, and response to therapies.

  8. Calciphylaxis: a devastating complication of derangements of calcium-phosphorus metabolism--a case report and review of the literature.

    Carter, Trish; Ratnam, Shobha

    2013-01-01

    Calciphylaxis is a rare and potentially devastating condition also referred to as uremic gangrene syndrome, calcific uremic arteriolopathy, metastatic calcification, and uremic small-vessel disease that can present in patients with end stage renal disease. This article reports a case of a 38-year-old African-American female on peritoneal dialysis for six years with a known history of non-adherence with diet, medications, and prescribed peritoneal dialysis treatment regimen. At her monthly clinic visit, the patient complained of burning sensation in the fingers of both hands with limited fine motor movement due to edema and severe pain. A presumptive diagnosis of calciphylaxis led to hospital admission with confirmation by X-ray of her hands. The patient was switched to hemodialysis with low calcium dialysate, aggressive reduction in phosphorus, diet counseling, use of cinacalcet, and six weeks of intravenous sodium thiosulfate infusion with hemodialysis treatments. The patient's condition improved with resolution of symptoms. This case was chosen based on the rarity of a calciphylaxis presentation and paucity of knowledge regarding diagnosis and treatment.

  9. Technological quality, mineral profile, and sensory attributes of broiler chicken breasts affected by White Striping and Wooden Breast myopathies.

    Tasoniero, G; Cullere, M; Cecchinato, M; Puolanne, E; Dalle Zotte, A

    2016-11-01

    The aim of the research was to study the impact of white striping and wooden breast myopathies on the technological quality, mineral, and sensory profile of poultry meat. With this purpose, a total of 138 breasts were selected for a control group with normal breasts (N), a group of breasts characterised by white striping (WS) myopathy, and a group of breasts having both white striping and wooden breast myopathies (WSWB). Data revealed that the simultaneous presence of the two myopathies, with respect to the WS lesion individually considered, had a further detrimental effect on pH (6.04 vs. 5.96; P white striping and wooden breast myopathies. © 2016 Poultry Science Association Inc.

  10. Proximal myopathy in lacto-vegetarian Asian patients responding to Vitamin D and calcium supplement therapy - two case reports and review of the literature

    Thabit, Hood

    2011-05-13

    Abstract Introduction Severe proximal myopathy can occasionally be the first presenting complaint of patients with osteomalacia. This may lead to investigations and misdiagnosis of a neuromuscular disease, rather than a metabolic bone disease. Case presentations We present here two cases of severe proximal myopathy in patients who were both of South Asian origin and lacto-vegetarians: a 31-year-old Indian man and a 34-year-old Indian woman. In both cases, their clinical symptoms fully resolved following vitamin D and calcium replacement therapy. These patients were at risk of osteomalacia due to their dietary intake and ethnicity. The role of dietary intake and sunlight exposure in the development of osteomalacia in certain ethnic groups living in Western Europe is reviewed here. Conclusion These two cases emphasize the importance of recognizing osteomalacia in at-risk individuals, as the condition is reversible and easily treated with vitamin D and calcium supplementation. It may also help avoid prolonged and unnecessary investigations of these patients.

  11. Proximal myopathy in lacto-vegetarian Asian patients responding to Vitamin D and calcium supplement therapy - two case reports and review of the literature

    Sreenan Seamus

    2011-05-01

    Full Text Available Abstract Introduction Severe proximal myopathy can occasionally be the first presenting complaint of patients with osteomalacia. This may lead to investigations and misdiagnosis of a neuromuscular disease, rather than a metabolic bone disease. Case presentations We present here two cases of severe proximal myopathy in patients who were both of South Asian origin and lacto-vegetarians: a 31-year-old Indian man and a 34-year-old Indian woman. In both cases, their clinical symptoms fully resolved following vitamin D and calcium replacement therapy. These patients were at risk of osteomalacia due to their dietary intake and ethnicity. The role of dietary intake and sunlight exposure in the development of osteomalacia in certain ethnic groups living in Western Europe is reviewed here. Conclusion These two cases emphasize the importance of recognizing osteomalacia in at-risk individuals, as the condition is reversible and easily treated with vitamin D and calcium supplementation. It may also help avoid prolonged and unnecessary investigations of these patients.

  12. Proximal myopathy in lacto-vegetarian Asian patients responding to Vitamin D and calcium supplement therapy - two case reports and review of the literature.

    Thabit, Hood

    2012-02-01

    INTRODUCTION: Severe proximal myopathy can occasionally be the first presenting complaint of patients with osteomalacia. This may lead to investigations and misdiagnosis of a neuromuscular disease, rather than a metabolic bone disease. CASE PRESENTATIONS: We present here two cases of severe proximal myopathy in patients who were both of South Asian origin and lacto-vegetarians: a 31-year-old Indian man and a 34-year-old Indian woman. In both cases, their clinical symptoms fully resolved following vitamin D and calcium replacement therapy. These patients were at risk of osteomalacia due to their dietary intake and ethnicity. The role of dietary intake and sunlight exposure in the development of osteomalacia in certain ethnic groups living in Western Europe is reviewed here. CONCLUSION: These two cases emphasize the importance of recognizing osteomalacia in at-risk individuals, as the condition is reversible and easily treated with vitamin D and calcium supplementation. It may also help avoid prolonged and unnecessary investigations of these patients.

  13. Muscle imaging in patients with tubular aggregate myopathy caused by mutations in STIM1

    Tasca, Giorgio; D'Amico, Adele; Monforte, Mauro

    2015-01-01

    Tubular aggregate myopathy is a genetically heterogeneous disease characterized by tubular aggregates as the hallmark on muscle biopsy. Mutations in STIM1 have recently been identified as one genetic cause in a number of tubular aggregate myopathy cases. To characterize the pattern of muscle...... involvement in this disease, upper and lower girdles and lower limbs were imaged in five patients with mutations in STIM1, and the scans were compared with two patients with tubular aggregate myopathy not caused by mutations in STIM1. A common pattern of involvement was found in STIM1-mutated patients...... of thigh and posterior leg with sparing of gracilis, tibialis anterior and, to a lesser extent, short head of biceps femoris. Mutations in STIM1 are associated with a homogeneous involvement on imaging despite variable clinical features. Muscle imaging can be useful in identifying STIM1-mutated patients...

  14. A novel mutation in PNPLA2 leading to neutral lipid storage disease with myopathy.

    Ash, Daniel B; Papadimitriou, Dimitra; Hays, Arthur P; Dimauro, Salvatore; Hirano, Michio

    2012-09-01

    Mutations in PNPLA2, a gene encoding adipose triglyceride lipase, lead to neutral lipid storage disease with myopathy. To report the clinical and molecular features of a case of neutral lipid storage disease with myopathy resulting from a novel mutation in PNPLA2. Case report. University hospital. A 65-year-old man with progressive muscle weakness and high serum creatine kinase levels. Direct sequencing of the PNPLA2 gene. Identification of a novel homozygous mutation in the patient's PNPLA2 gene confirmed the suspected diagnosis of neutral lipid storage disease with myopathy. Screening of the PNPLA2 gene should be considered for patients presenting with high levels of creatine kinase, progressive muscle weakness, and systemic lipid accumulation. The presence of Jordans anomaly can be a strong diagnostic clue.

  15. Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone: A case report.

    Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu

    2017-07-01

    Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Relative hypothyroidism-induced myopathy. Antithyroid drug (ATD) dosage was reduced without levothyroxine replacement. The muscular symptoms were recovered with CK level returned to normal after adoption of the euthyroid status. Differentiation of relative hypothyroidism from other causes of myopathy, especially with the effect of ATD, is important for clinical practice, although difficult in many cases.

  16. Role of Autophagy in Glycogen Breakdown and Its Relevance to Chloroquine Myopathy

    Zirin, Jonathan; Nieuwenhuis, Joppe; Perrimon, Norbert

    2013-01-01

    Several myopathies are associated with defects in autophagic and lysosomal degradation of glycogen, but it remains unclear how glycogen is targeted to the lysosome and what significance this process has for muscle cells. We have established a Drosophila melanogaster model to study glycogen autophagy in skeletal muscles, using chloroquine (CQ) to simulate a vacuolar myopathy that is completely dependent on the core autophagy genes. We show that autophagy is required for the most efficient degradation of glycogen in response to starvation. Furthermore, we show that CQ-induced myopathy can be improved by reduction of either autophagy or glycogen synthesis, the latter possibly due to a direct role of Glycogen Synthase in regulating autophagy through its interaction with Atg8. PMID:24265594

  17. Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone

    Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu

    2017-01-01

    Abstract Rationale: Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. Patient concerns: We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Diagnoses: Relative hypothyroidism-induced myopathy. Interventions: Antithyroid drug (ATD) dosage was reduced without levothyroxine replacement. Outcomes: The muscular symptoms were recovered with CK level returned to normal after adoption of the euthyroid status. Lessons: Differentiation of relative hypothyroidism from other causes of myopathy, especially with the effect of ATD, is important for clinical practice, although difficult in many cases. PMID:28746208

  18. Identification of methylenecyclopropyl acetic acid in serum of European horses with atypical myopathy.

    Votion, D-M; van Galen, G; Sweetman, L; Boemer, F; de Tullio, P; Dopagne, C; Lefère, L; Mouithys-Mickalad, A; Patarin, F; Rouxhet, S; van Loon, G; Serteyn, D; Sponseller, B T; Valberg, S J

    2014-03-01

    It is hypothesised that European atypical myopathy (AM) has a similar basis as seasonal pasture myopathy in North America, which is now known to be caused by ingestion of hypoglycin A contained in seeds from the tree Acer negundo. Serum from horses with seasonal pasture myopathy contained the conjugated toxic metabolite of hypoglycin A, methylenecyclopropyl acetic acid (MCPA). Retrospective study on archived samples. 1) To determine whether MCPA-carnitine was present in serum of European horses confirmed to have AM; 2) to determine whether Acer negundo or related Acer species were present on AM pastures in Europe. Concentrations of MCPA-carnitine were analysed in banked serum samples of 17 AM horses from Europe and 3 diseased controls (tetanus, neoplasia and exertional rhabdomyolysis) using tandem mass spectrometry. Atypical myopathy was diagnosed by characteristic serum acylcarnitine profiles. Pastures of 12 AM farms were visited by experienced botanists and plant species were documented. Methylenecyclopropyl acetic acid-carnitine at high concentrations (20.39 ± 17.24 nmol/l; range 0.95-57.63 nmol/l; reference: <0.01 nmol/l) was identified in serum of AM but not disease controls (0.00 ± 0.00 nmol/l). Acer pseudoplatanus but not Acer negundo was present on all AM farms. Atypical myopathy in Europe, like seasonal pasture myopathy in North America, is highly associated with the toxic metabolite of hypoglycin A, MCPA-carnitine. This finding coupled with the presence of a tree of which seeds are known to also contain hypoglycin A indicates that ingestion of Acer pseudoplatanus is the probable cause of AM. This finding has major implications for the prevention of AM. © 2013 EVJ Ltd.

  19. Interleaved MRI/MRS study of muscle perfusion, oxygenation and high energy phosphate metabolism in normal subjects and Becker's myopathic patients

    Toussaint, J.F.; Brillault-Salvat, C.; Giacomini, E.; Bloch, G.; Duboc, D.; Jehenson, P.

    1998-01-01

    We present the first results of a study comparing patients suffering from Becker's myopathy and normal volunteers. We simultaneously assessed perfusion, oxygenation and high-energy phosphate metabolism using an interleaved NMR/NMRS approach. Muscle metabolism does not seem to differ in Becker's patients, except for myoglobin reoxygenation rates. (authors)

  20. A study of acute muscle dysfunction with particular reference to dengue myopathy

    Rajesh Verma

    2017-01-01

    Full Text Available Background: Acute myopathy is a common cause of acute motor quadriparesis which has various etiologies with different courses of illness and prognosis depending on the cause. Understanding this diversity helps us in proper approach toward diagnosis, predicting the prognosis, and possible complications and in improving the treatments that are being provided. This study was planned to study the clinical, electrophysiological, and etiological profile of patients presenting with acute myopathy. We also studied how dengue-related acute myopathy differs from other causes and also difference between myopathy due to myositis and hypokalemia in cases of dengue. Materials and Methods: This was a prospective, observational study involving all clinically suspected cases of acute myopathy of not more than 4 weeks duration with raised serum creatine kinase (CK level. They were subjected to detailed clinical evaluation along with hematological, biochemical, microbiological, and electrophysiological studies and followed-up for outcome at 1 and 3 months. Muscle biopsy and histopathological examination were done in selected patients after taking informed consent. Statistical analysis was performed by appropriate methods using SPSS version 16.0 (Chicago, IL, USA. Results: We evaluated thirty patients of acute myopathy with raised CK level. Seventeen patients had fever, 11 had myalgia, and 5 had skin lesions. All presented with symmetric weakness, 17 (56.7% patients having predominantly proximal weakness, neck or truncal weakness in 6 (20%, hyporeflexia in 12 (40%, with mean Medical Research Council (MRC sum score of 46.67 ± 6.0. Eight (mean modified Barthel index [MBI] at presentation - 15 ± 3.7 patients had poor functional status according to MBI and 15 according to modified Rankin scale (MRS (mean MRS score - 2.5 ± 1.2. Etiology was dengue viral infection in 14 patients; hypokalemia due to various causes other than dengue in 8; pyomyositis in 3

  1. Collagen XII myopathy with rectus femoris atrophy and collagen XII retention in fibroblasts

    Witting, Nanna; Krag, Thomas; Werlauff, Ulla

    2018-01-01

    INTRODUCTION: Mutation in the collagen XII gene (COL12A1) was recently reported to induce Bethlem myopathy. We describe a family affected by collagen XII-related myopathy in 3 generations. METHODS: Systematic interview, clinical examination, skin biopsies, and MRI of muscle were used. RESULTS...... affection and abnormal collagen XII retention in fibroblasts. MRI disclosed a selective wasting of the rectus femoris muscle. DISCUSSION: COL12A1 mutations should be considered in patients with a mild Bethlem phenotype who present with selective wasting of the rectus femoris, absence of the outside......-in phenomenon on MRI, and abnormal collagen XII retention in fibroblasts. Muscle Nerve, 2018....

  2. Phenotypes, genotypes, and prevalence of congenital myopathies older than 5 years in Denmark

    Witting, Nanna; Werlauff, Ulla; Duno, Morten

    2017-01-01

    .3% NEB mutations. Less than 5% had mutations in ACTA1, TPM2/3, MTM1, TTN, SEPN1, or SC4NA. A genetic cause was established in 83% with specific histology (cores/rods/centronuclear myopathy) vs 29% with unspecific histology. The detailed clinical examination found gene-dependent discrepancies...... in the pattern of muscle affection and walking ability. Although walking ability was delayed in patients with ACTA1, TPM2/3, and RYR1 mutations, it was within normal limits in patients with NEB and DNM2 mutations. CONCLUSIONS: We found that overall, genetic and histologic prevalence of congenital myopathy...

  3. Treatment of critical illness polyneuropathy and/or myopathy - a systematic review

    Ydemann, Mogens; Eddelien, Heidi Shil; Lauritsen, Anne Øberg

    2012-01-01

    The objective was to search the literature with a view to providing a general description of critical illness myopathy/polyneuropathy (CIM/CIP), including its genesis and prevention. Furthermore, it was our aim to determine whether new treatments have occurred in the past five years.......The objective was to search the literature with a view to providing a general description of critical illness myopathy/polyneuropathy (CIM/CIP), including its genesis and prevention. Furthermore, it was our aim to determine whether new treatments have occurred in the past five years....

  4. Autophagy, inflammation and innate immunity in inflammatory myopathies.

    Cristina Cappelletti

    Full Text Available Autophagy has a large range of physiological functions and its dysregulation contributes to several human disorders, including autoinflammatory/autoimmune diseases such as inflammatory myopathies (IIMs. In order to better understand the pathogenetic mechanisms of these muscular disorders, we sought to define the role of autophagic processes and their relation with the innate immune system in the three main subtypes of IIM, specifically sporadic inclusion body myositis (sIBM, polymyositis (PM, dermatomyositis (DM and juvenile dermatomyositis (JDM. We found that although the mRNA transcript levels of the autophagy-related genes BECN1, ATG5 and FBXO32 were similar in IIM and controls, autophagy activation in all IIM subgroups was suggested by immunoblotting results and confirmed by immunofluorescence. TLR4 and TLR3, two potent inducers of autophagy, were highly increased in IIM, with TLR4 transcripts significantly more expressed in PM and DM than in JDM, sIBM and controls, and TLR3 transcripts highly up-regulated in all IIM subgroups compared to controls. Co-localization between autophagic marker, LC3, and TLR4 and TLR3 was observed not only in sIBM but also in PM, DM and JDM muscle tissues. Furthermore, a highly association with the autophagic processes was observed in all IIM subgroups also for some TLR4 ligands, endogenous and bacterial HSP60, other than the high-mobility group box 1 (HMGB1. These findings indicate that autophagic processes are active not only in sIBM but also in PM, DM and JDM, probably in response to an exogenous or endogenous 'danger signal'. However, autophagic activation and regulation, and also interaction with the innate immune system, differ in each type of IIM. Better understanding of these differences may lead to new therapies for the different IIM types.

  5. Derangements of lacrimal drainage-associated lymphoid tissue (LDALT) in human chronic dacryocystitis.

    Ali, Mohammad Javed; Mulay, Kaustubh; Pujari, Aditi; Naik, Milind N

    2013-12-01

    epithelium (54.5%, 109/200), and stromal fibrosis (88%, 176/200). This study presents the largest series to date (n = 200 lacrimal sacs) exclusively on changes in lacrimal drainage-associated lymphoid tissue in human chronic dacryocystitis. This study could be the starting point for further exploration into the molecular biology, immunological implications, and possible implications of LDALT derangements on etiopathogenesis of primary acquired nasolacrimal duct obstruction.

  6. Cerebral Metabolic Changes Related to Oxidative Metabolism in a Model of Bacterial Meningitis Induced by Lipopolysaccharide

    Munk, Michael; Rom Poulsen, Frantz; Larsen, Lykke

    2018-01-01

    BACKGROUND: Cerebral mitochondrial dysfunction is prominent in the pathophysiology of severe bacterial meningitis. In the present study, we hypothesize that the metabolic changes seen after intracisternal lipopolysaccharide (LPS) injection in a piglet model of meningitis is compatible...... with mitochondrial dysfunction and resembles the metabolic patterns seen in patients with bacterial meningitis. METHODS: Eight pigs received LPS injection in cisterna magna, and four pigs received NaCl in cisterna magna as a control. Biochemical variables related to energy metabolism were monitored by intracerebral...... dysfunction with increasing cerebral LPR due to increased lactate and normal pyruvate, PbtO2, and ICP. The metabolic pattern resembles the one observed in patients with bacterial meningitis. Metabolic monitoring in these patients is feasible to monitor for cerebral metabolic derangements otherwise missed...

  7. Preeclampsia: A review of the pathogenesis and possible management strategies based on its pathophysiological derangements.

    El-Sayed, Amel A F

    2017-10-01

    This review is divided into three parts. The first part briefly describes the pathogenesis of preeclampsia. This is followed by reviewing previously reported management strategies of the disease based on its pathophysiological derangements. Finally, the author defines the safe and acceptable methods/medications that may be used to 'prevent' preeclampsia (in high risk patients) and those that may be used to 'treat' preeclampsia (meant to prolong the pregnancy in patients with established preeclampsia). The review concludes that multi-center trials are required to include multiple drugs in the same management protocol. Copyright © 2017. Published by Elsevier B.V.

  8. Absence of anti-HMG-CoA reductase autoantibodies in severe self-limited statin-related myopathy.

    Floyd, James S; Brody, Jennifer A; Tiniakou, Eleni; Psaty, Bruce M; Mammen, Andrew

    2016-06-01

    Patients with self-limited statin-related myopathy improve spontaneously when statins are stopped. In contrast, patients with statin-associated autoimmune myopathy have autoantibodies recognizing 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase (HMGCR) and usually require immunosuppressive therapy to control their disease. On initial presentation, it can sometimes be difficult to distinguish between these 2 diseases, as both present with muscle pain, weakness, and elevated serum creatine kinase (CK) levels. The goal of this study was to determine whether patients with severe self-limited statin-related myopathy also make anti-HMGCR autoantibodies. We screened 101 subjects with severe self-limited cerivastatin-related myopathy for anti-HMGCR autoantibodies. No patient with severe self-limited cerivastatin-related myopathy had anti-HMGCR autoantibodies. Anti-HMGCR autoantibody testing can be used to help differentiate whether a patient has self-limited myopathy due to cerivastatin or autoimmune statin-associated myopathy; these findings may apply to other statins as well. Muscle Nerve 54: 142-144, 2016. © 2016 Wiley Periodicals, Inc.

  9. The heart in Becker muscular dystrophy, facioscapulohumeral dystrophy, and Bethlem myopathy

    de Visser, M.; de Voogt, W. G.; la Rivière, G. V.

    1992-01-01

    We report a study, assessing involvement of the heart in 33 familial cases of Becker muscular dystrophy (BMD), 31 familiar cases of facioscapulohumeral (FSH) dystrophy, and 27 familial cases of Bethlem myopathy. In the patients with BMD, correlations of myocardial involvement with age and extent of

  10. Management of cases suffering from atypical myopathy: interpretations of descriptive, epidemiological and pathophysiological findings

    van Galen Verwilghen, Gaby; Votion, D.-M.

    2013-01-01

    Atypical myopathy is highly fatal, but about a quarter of affected horses survive. This highlights the need for provision of supportive treatment for these cases. This review is a practical guideline for equine practitioners and includes suggestions for close monitoring of involved organ systems ...

  11. [External progressive ophthalmoplegia secondary to mitochondrial myopathy. Report of a case and review of the literature].

    Calderón-Garcidueñas, A L; Pérez-Loria, O; Alberto-Sagástegui, J; Farías-García, R

    2000-01-01

    Progressive limitation of occular motility, accompanied by ptosis but usually without diplopia, occurs in many pathologic states, including mitochondrial diseases. A case with chronic progressive external ophthalmoplegia with onset during childhood, associated with proximal myopathy and dysphasia is presented. The muscle biopsy showed a myopathic pattern and abnormal subsarcolemmal mitochondrial deposits. Muscle biopsy for important in the correct diagnosis of this entity.

  12. Congenital myotonic myopathy in the miniature schnauzer: an autosomal recessive trait.

    Vite, C H; Melniczek, J; Patterson, D; Giger, U

    1999-01-01

    Myotonia is a clinical sign characterized by a delay in skeletal muscle relaxation following electrical or mechanical stimulation. A series of related miniature schnauzer dogs with congenital myotonic myopathy were studied. A composite pedigree of six affected litters and the results of a planned breeding between two affected animals are consistent with an autosomal recessive mode of inheritance.

  13. Suspected myofibrillar myopathy in Arabian horses with a history of exertional rhabdomyolysis.

    Valberg, S J; McKenzie, E C; Eyrich, L V; Shivers, J; Barnes, N E; Finno, C J

    2016-09-01

    Although exertional rhabdomyolysis (ER) is common in Arabian horses, there are no dedicated studies describing histopathological characteristics of muscle from Arabian horses with ER. To prospectively identify distinctive histopathological features of muscle from Arabian endurance horses with a history of ER (pro-ER) and to retrospectively determine their prevalence in archived samples from Arabian horses with exertional myopathies (retro-ER). Prospective and retrospective histopathological description. Middle gluteal muscle biopsies obtained from Arabian controls (n = 14), pro-ER (n = 13) as well as archived retro-ER (n = 25) muscle samples previously classified with type 2 polysaccharide storage myopathy (15/25), recurrent exertional rhabdomyolysis (7/25) and no pathology (3/25) were scored for histopathology and immunohistochemical staining of cytoskeletal proteins. Glutaraldehyde-fixed samples (2 pro-ER, one control) were processed for electron microscopy. Pro-ER and retro-ER groups were compared with controls using Mann-Whitney U and Fisher's exact tests. Centrally located myonuclei in mature myofibres were found in significantly more (Prhabdomyolysis, ectopic accumulation of cytoskeletal proteins and Z-disc degeneration bear a strong resemblance to a myofibrillar myopathy. While many of these horses were previously diagnosed with type 2 polysaccharide storage myopathy, pools of glycogen forming within disrupted myofibrils appeared to give the false appearance of a glycogen storage disorder. © 2015 EVJ Ltd.

  14. Atypical myopathy in Denmark confirmed with the aTRAQ assay

    Høffer, Sofie Esbjørn; Votion, Dominique-Marie; Anderberg, Marie

    2016-01-01

    Atypical myopathy is a severe form of rhabdomyolysis that occurs in grazing horses. Over the past decades, the disease has been emerging in Europe. The disease is widespread in Europe and has been suspected in Denmark since 2000, yet no cases have been confirmed. The objective of this study...

  15. Evaluating the Atrial Myopathy Underlying Atrial Fibrillation: Identifying the Arrhythmogenic and Thrombogenic Substrate

    Goldberger, Jeffrey J.; Arora, Rishi; Green, David; Greenland, Philip; Lee, Daniel C.; Lloyd-Jones, Donald M.; Markl, Michael; Ng, Jason; Shah, Sanjiv J.

    2015-01-01

    Atrial disease or myopathy forms the substrate for atrial fibrillation (AF) and underlies the potential for atrial thrombus formation and subsequent stroke. Current diagnostic approaches in patients with AF focus on identifying clinical predictors with evaluation of left atrial size by echocardiography serving as the sole measure specifically evaluating the atrium. Although the atrial substrate underlying AF is likely developing for years prior to the onset of AF, there is no current evaluation to identify the pre-clinical atrial myopathy. Atrial fibrosis is one component of the atrial substrate that has garnered recent attention based on newer MRI techniques that have been applied to visualize atrial fibrosis in humans with prognostic implications regarding success of treatment. Advanced ECG signal processing, echocardiographic techniques, and MRI imaging of fibrosis and flow provide up-to-date approaches to evaluate the atrial myopathy underlying AF. While thromboembolic risk is currently defined by clinical scores, their predictive value is mediocre. Evaluation of stasis via imaging and biomarkers associated with thrombogenesis may provide enhanced approaches to assess risk for stroke in patients with AF. Better delineation of the atrial myopathy that serves as the substrate for AF and thromboembolic complications might improve treatment outcomes. Furthermore, better delineation of the pathophysiologic mechanisms underlying the development of the atrial substrate for AF, particularly in its earlier stages, could help identify blood and imaging biomarkers that could be useful to assess risk for developing new onset AF and suggest specific pathways that could be targeted for prevention. PMID:26216085

  16. Effects of ubiquinone (coenzyme Q10) on myopathy in statin users.

    Schaars, C.F.; Stalenhoef, A.F.H.

    2008-01-01

    PURPOSE OF REVIEW: Statins are associated with muscle complaints, including myositis. The mechanism through which statin use causes muscle toxicity is unknown. One of the theories is that statin therapy reduces coenzyme Q10 levels in muscle mitochondria, which leads to muscle injury and myopathy.

  17. Whole-body MRI in adult inflammatory myopathies: Do we need imaging of the trunk?

    Filli, Lukas; Manoliu, Andrei; Andreisek, Gustav; Guggenberger, Roman; Maurer, Britta

    2015-01-01

    To evaluate whether imaging of the trunk could be omitted in patients with inflammatory myopathies without losing diagnostic accuracy using a restricted whole-body magnetic resonance imaging (rWB-MRI) protocol. After approval by the institutional review board, this study was performed in 63 patients (male/female, 13/50; median age, 52 years; range, 20-81 years) with new-onset myopathic symptoms (group 1, n = 41) or previously diagnosed inflammatory myopathy (group 2, n = 22). After performing whole-body MRI (WB-MRI) at 3.0 Tesla, myositis and fatty atrophy were evaluated in different muscles by two independent radiologists. The intra-class correlation coefficient (ICC) was calculated to evaluate inter-observer reliability. Acquisition time was 56:01 minutes for WB-MRI and 37:37 minutes (32.8 % shorter) for rWB-MRI. In group 1, 14 patients were diagnosed with inflammatory myopathy based on muscle biopsy. rWB-MRI and WB-MRI showed equal sensitivity (42.9 %) and specificity (100 %) for myositis, and showed equal sensitivity (71.4 %) and similar specificity (63.0 % and 48.1 %, respectively) for fatty atrophy. No myositis was found in the body trunk in any patient. Inter-observer reliability was between substantial and perfect (ICC, 0.77-1.00). rWB-MRI showed diagnostic accuracy similar to WB-MRI for inflammatory myopathy at markedly reduced overall acquisition time. (orig.)

  18. Whole-body MRI in adult inflammatory myopathies: Do we need imaging of the trunk?

    Filli, Lukas; Manoliu, Andrei; Andreisek, Gustav; Guggenberger, Roman [University Hospital Zurich, University of Zurich, Institute of Diagnostic and Interventional Radiology, Zurich (Switzerland); Maurer, Britta [University Hospital Zurich, University of Zurich, Division of Rheumatology, Zurich (Switzerland)

    2015-12-15

    To evaluate whether imaging of the trunk could be omitted in patients with inflammatory myopathies without losing diagnostic accuracy using a restricted whole-body magnetic resonance imaging (rWB-MRI) protocol. After approval by the institutional review board, this study was performed in 63 patients (male/female, 13/50; median age, 52 years; range, 20-81 years) with new-onset myopathic symptoms (group 1, n = 41) or previously diagnosed inflammatory myopathy (group 2, n = 22). After performing whole-body MRI (WB-MRI) at 3.0 Tesla, myositis and fatty atrophy were evaluated in different muscles by two independent radiologists. The intra-class correlation coefficient (ICC) was calculated to evaluate inter-observer reliability. Acquisition time was 56:01 minutes for WB-MRI and 37:37 minutes (32.8 % shorter) for rWB-MRI. In group 1, 14 patients were diagnosed with inflammatory myopathy based on muscle biopsy. rWB-MRI and WB-MRI showed equal sensitivity (42.9 %) and specificity (100 %) for myositis, and showed equal sensitivity (71.4 %) and similar specificity (63.0 % and 48.1 %, respectively) for fatty atrophy. No myositis was found in the body trunk in any patient. Inter-observer reliability was between substantial and perfect (ICC, 0.77-1.00). rWB-MRI showed diagnostic accuracy similar to WB-MRI for inflammatory myopathy at markedly reduced overall acquisition time. (orig.)

  19. RYR1-related myopathies: a wide spectrum of phenotypes throughout life

    Snoeck, M.; Engelen, B.G.M. van; Kusters, B.; Lammens, M.M.; Meijer, R.; Molenaar, J.P.F.; Raaphorst, J.; Verschuuren-Bemelmans, C.C.; Straathof, C.S.; Sie, L.T.L.; Coo, I.F.M. de; Pol, W.L. van der; Visser, M de; Scheffer, H.; Treves, S.; Jungbluth, H.; Voermans, N.C.; Kamsteeg, E.J.

    2015-01-01

    BACKGROUND AND PURPOSE: Although several recent studies have implicated RYR1 mutations as a common cause of various myopathies and the malignant hyperthermia susceptibility (MHS) trait, many of these studies have been limited to certain age groups, confined geographical regions or specific

  20. Management of cases suffering from atypical myopathy: interpretations of descriptive, epidemiological and pathophysiological findings

    van Galen Verwilghen, Gaby; Votion, D.-M.

    2013-01-01

    Atypical myopathy is highly fatal, but about a quarter of affected horses survive. This highlights the need for provision of supportive treatment for these patients. This review is a practical guideline for equine practitioners and includes suggestions for close monitoring of involved organ systems...

  1. Leiomodin-3-deficient mice display nemaline myopathy with fast-myofiber atrophy

    Lei Tian

    2015-06-01

    Full Text Available Nemaline myopathy (NM is one of the most common forms of congenital myopathy, and affects either fast myofibers, slow myofibers, or both. However, an animal model for congenital myopathy with fast-myofiber-specific atrophy is not available. Furthermore, mutations in the leiomodin-3 (LMOD3 gene have recently been identified in a group of individuals with NM. However, it is not clear how loss of LMOD3 leads to NM. Here, we report a mouse mutant in which the piggyBac (PB transposon is inserted into the Lmod3 gene and disrupts its expression. Lmod3PB/PB mice show severe muscle weakness and postnatal growth retardation. Electron microscopy and immunofluorescence studies of the mutant skeletal muscles revealed the presence of nemaline bodies, a hallmark of NM, and disorganized sarcomeric structures. Interestingly, Lmod3 deficiency caused muscle atrophy specific to the fast fibers. Together, our results show that Lmod3 is required in the fast fibers for sarcomere integrity, and this study offers the first NM mouse model with muscle atrophy that is specific to fast fibers. This model could be a valuable resource for interrogating myopathy pathogenesis and developing therapeutics for NM as well as other pathophysiological conditions with preferential atrophy of fast fibers, including cancer cachexia and sarcopenia.

  2. Hypoglycin A in maple trees in the Netherlands and the risk of equine atypical myopathy

    Westermann, C.M.; van Leeuwen, Robbert; Mol, Hans

    2016-01-01

    The Acer (maple) genus of trees comprises over 120 species worldwide. Some of these contain the plant-toxin hypoglycin-A which has been proven to be a cause of the highly fatal condition called atypical myopathy (AM) in horses and ponies. In an earlier study of maple-tree samples (leaves and seeds)

  3. Autosomal dominant distal myopathy due to a novel ACTA1 mutation.

    Liewluck, Teerin; Sorenson, Eric J; Walkiewicz, Magdalena A; Rumilla, Kandelaria M; Milone, Margherita

    2017-08-01

    Mutations in skeletal muscle α-actin 1-encoding gene (ACTA1) cause autosomal dominant or recessive myopathies with marked clinical and pathological heterogeneity. Patients typically develop generalized or limb-girdle pattern of weakness, but recently a family with scapuloperoneal myopathy was reported. We describe a father and 2 children with childhood-to-juvenile onset distal myopathy, carrying a novel dominant ACTA1 variant, c.757G>C (p.Gly253Arg). Father had delayed motor development and developed significant proximal weakness later in life; he was initially misdiagnosed as having spinal muscular atrophy based on electromyographic findings. His children had predominant anterior distal leg and finger extensor involvement. Nemaline rods were abundant on the daughter's biopsy, absent on the father's initial biopsy, and extremely rare on the father's subsequent biopsy a decade later. The father's second biopsy also showed myofibrillar pathology and rare fibers with actin filament aggregates. The present family expands the spectrum of actinopathy to include a distal myopathy. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Fatigue in patients with spinal muscular atrophy type II and congenital myopathies

    Werlauff, Ulla; Højberg, A; Firla-Holme, R

    2014-01-01

    PURPOSE: The aim of this study was to evaluate whether the fatigue severity scale (FSS) is an appropriate instrument to assess fatigue in patients with spinal muscular atrophy type II (SMA II) and congenital myopathies (CM). METHODS: FSS and visual analog scale (VAS) were administered to 33 SMA II...

  5. Triacylglycerol infusion improves exercise endurance in patients with mitochondrial myopathy due to complex I deficiency

    Roef, MJ; de Meer, K; Reijngoud, DJ; Straver, HWHC; de Barse, M; Kalhan, SC; Berger, R

    Background: A high-fat diet has been recommended for the treatment of patients with mitochondrial myopathy due to complex I (NADH dehydrogenase) deficiency (CID). Objective: This study evaluated the effects of intravenous infusion of isoenergetic amounts of triacylglycerol or glucose on substrate

  6. Ileocolonic transfer of solid chyme in small intestinal neuropathies and myopathies

    Greydanus, M.P.; Camilleri, M.; Colemont, L.J.; Phillips, S.F.; Brown, M.L.; Thomforde, G.M. (Mayo Clinic and Foundation, Rochester, MN (USA))

    1990-07-01

    The aims of this study were to assess gastric emptying, small bowel transit and colonic filling in patients with motility disorders, with particular attention to the patterns of colonic filling. Gastrointestinal transit was assessed using a previously validated radiolabeled mixed meal. Fourteen patients with clinical and manometric features of chronic intestinal pseudoobstruction classified as intestinal neuropathy and 6 as intestinal myopathy, were studied. The results were compared with those from 10 healthy controls studied similarly. Gastric emptying and small bowel transit of solids were significantly slower in both groups of patients than in healthy controls (P less than 0.05). In health, the ileocolonic transit of solid chyme was characterized by intermittent bolus transfers. The mean size of boluses transferred to the colon (expressed as a percentage of ingested radiolabel) was significantly less (P less than 0.05) in patients with intestinal myopathy (10% +/- 4% (SEM)) than in healthy controls (25% +/- 4%) or in patients with intestinal neuropathy (25% +/- 4%). The intervals between bolus transfer of solids (plateaus in the colonic filling curve) were longer (P less than 0.05) in myopathies (212 +/- 89 minutes) than in health (45 +/- 7 minutes) or neuropathies (53 +/- 11 minutes). Thus, gastric emptying and small bowel transit were delayed in small bowel neuropathies and myopathies. Bolus filling of the colon was less frequent and less effective in patients with myopathic intestinal pseudoobstruction, whereas bolus transfer was preserved in patients with neuropathic intestinal pseudoobstruction.

  7. The Impact of Exercise on Statin-Associated Skeletal Muscle Myopathy

    Chung, Hae R.; Vakil, Mayand; Munroe, Michael; Parikh, Alay; Meador, Benjamin M.; Wu, Pei T.; Jeong, Jin H.; Woods, Jeffrey A.; Wilund, Kenneth R.; Boppart, Marni D.

    2016-01-01

    HMG-CoA reductase inhibitors (statins) are the most effective pharmacological means of reducing cardiovascular disease risk. The most common side effect of statin use is skeletal muscle myopathy, which may be exacerbated by exercise. Hypercholesterolemia and training status are factors that are rarely considered in the progression of myopathy. The purpose of this study was to determine the extent to which acute and chronic exercise can influence statin-induced myopathy in hypercholesterolemic (ApoE-/-) mice. Mice either received daily injections of saline or simvastatin (20 mg/kg) while: 1) remaining sedentary (Sed), 2) engaging in daily exercise for two weeks (novel, Nov), or 3) engaging in daily exercise for two weeks after a brief period of training (accustomed, Acct) (2x3 design, n = 60). Cholesterol, activity, strength, and indices of myofiber damage and atrophy were assessed. Running wheel activity declined in both exercise groups receiving statins (statin x time interaction, pstatin treatment (statin main effect, pstatin x exercise interaction, pstatin treatment. Exercise (Acct and Nov) increased atrogin-1 mRNA in combination with statin treatment, yet enhanced fiber damage or atrophy was not observed. The results from this study suggest that exercise (Nov, Acct) does not exacerbate statin-induced myopathy in ApoE-/- mice, yet statin treatment reduces activity in a manner that prevents muscle from mounting a beneficial adaptive response to training. PMID:27936249

  8. Emerging opportunities for the treatment of metabolic diseases

    Finan, Brian; Clemmensen, Christoffer; Müller, Timo D

    2015-01-01

    with integrated activities derived from multiple hormones involved in the physiological control of metabolism have emerged as one of the more promising candidates for reversing obesity. The inclusion of glucagon-like peptide-1 (GLP-1) as one of the constituents is a unifying factor amongst the majority......Obesity is a pathogenic gateway to the metabolic syndrome and the complications thereof, thus interventions aimed at preventing or reversing the metabolic derangements underlying obesity hold great therapeutic promise. However, the complexity of energy balance regulation, combined...

  9. A rare case report of simultaneous presentation of myopathy, Addison's disease, primary hypoparathyroidism, and Fanconi syndrome in a child diagnosed with Kearns-Sayre syndrome.

    Tzoufi, Meropi; Makis, Alexandros; Chaliasos, Nikolaos; Nakou, Iliada; Siomou, Ekaterini; Tsatsoulis, Agathoklis; Zikou, Anastasia; Argyropoulou, Maria; Bonnefont, Jean Paul; Siamopoulou, Antigone

    2013-04-01

    Kearns-Sayre syndrome (KSS) is a rare mitochondrial DNA deletion syndrome defined as the presence of ophthalmoplegia, pigmentary retinopathy, onset less than age 20 years, and one of the following: cardiac conduction defects, cerebellar syndrome, or cerebrospinal fluid protein above 100 mg/dl. KSS may affect many organ systems causing endocrinopathies, encephalomyopathy, sensorineural hearing loss, and renal tubulopathy. Clinical presentation at diagnosis is quite heterogeneous and, usually, few organs are affected with progression to generalized disease early in adulthood. We present the case of a boy with KSS presenting at the age of 5 years with myopathy, Addison's disease, primary hypoparathyroidism, and Fanconi syndrome. The proper replacement treatment along with the administration of mitochondrial metabolism-improving agents had a brief ameliorating effect, but gradual severe multisystemic deterioration was inevitable over the next 5 years. This report highlights the fact that in case of simultaneous presentation of polyendocrinopathies and renal disease early in childhood, KSS should be considered.

  10. Evaluation of ubiquinone concentration and mitochondrial function relative to cerivastatin-induced skeletal myopathy in rats

    Schaefer, William H.; Lawrence, Jeffery W.; Loughlin, Amy F.; Stoffregen, Dana A.; Mixson, Lori A.; Dean, Dennis C.; Raab, Conrad E.; Yu, Nathan X.; Lankas, George R.; Frederick, Clay B.

    2004-01-01

    As a class, hydroxymethylglutaryl-coenzyme A (HMG-CoA) reductase inhibitors can potentially cause skeletal myopathy. One statin, cerivastatin, has recently been withdrawn from the market due to an unacceptably high incidence of rhabdomyolysis. The mechanism underlying statin-induced myopathy is unknown. This paper sought to investigate the relationship among statin-induced myopathy, mitochondrial function, and muscle ubiquinone levels. Rats were administered cerivastatin at 0.1, 0.5, and 1.0 (mg/kg)/day or dose vehicle (controls) by oral gavage for 15 days. Samples of type I-predominant skeletal muscle (soleus) and type II-predominant skeletal muscle [quadriceps and extensor digitorum longus (EDL)], and blood were collected on study days 5, 10, and 15 for morphological evaluation, clinical chemistry, mitochondrial function tests, and analysis of ubiquinone levels. No histological changes were observed in any of the animals on study days 5 or 10, but on study day 15, mid- and high-dose animals had necrosis and inflammation in type II skeletal muscle. Elevated creatine kinase (CK) levels in blood (a clinical marker of myopathy) correlated with the histopathological diagnosis of myopathy. Ultrastructural characterization of skeletal muscle revealed disruption of the sarcomere and altered mitochondria only in myofibers with degeneration, while adjacent myofibers were unaffected and had normal mitochondria. Thus, mitochondrial effects appeared not to precede myofiber degeneration. Mean coenzyme Q9 (CoQ9) levels in all dose groups were slightly decreased relative to controls in type II skeletal muscle, although the difference was not significantly different in most cases. Mitochondrial function in skeletal muscle was not affected by the changes in ubiquinone levels. The ubiquinone levels in high-dose-treated animals exhibiting myopathy were not significantly different from low-dose animals with no observable toxic effects. Furthermore, ubiquinone levels did not correlate

  11. Statin-Associated Autoimmune Myopathy: A Systematic Review of 100 Cases.

    Nazir, Salik; Lohani, Saroj; Tachamo, Niranjan; Poudel, Dilliram; Donato, Anthony

    2017-04-01

    Statins are a group of drugs that reduce the levels of triglycerides and cholesterol in blood by inhibiting HMG-CoA reductase, an enzyme involved in rate limiting step in cholesterol synthesis. About 2-20% patients on statins develop toxic myopathies, which usually resolve on discontinuation of statin. More recently, an immune-mediated necrotizing myopathy has been found to be associated with statin use which in most cases requires treatment with immunosuppressants. To perform a systematic review on published case reports and case series of statin-associated autoimmune myopathy. A comprehensive search of PUBMED, EMBASE, Cochrane library and ClinicalTrials.gov databases was performed for relevant articles from inception until March 19, 2016 to identify cases of statin-associated necrotizing myopathy and characterize their symptoms, evaluation and response to treatment. A total of 16 articles describing 100 patients with statin-associated autoimmune myopathy were identified. The mean age of presentation was 64.72 years, and 54.44% were males. The main presenting clinical feature was proximal muscle weakness, which was symmetric in 83.33% of patients. The mean creatine kinase (CK) was 6853 IU/l. Anti-HMG-CoA reductase antibody was positive in all cases tested (n = 57/57, 100%). In patients with no anti-HMG-CoA antibody results, diagnosis was established by findings of necrotizing myopathy on biopsy. Among the 83 cases where muscle biopsy information was available, 81.48% had necrosis, while 18.51% had combination of necrosis and inflammation. Most (83.82%) patients received two or more immunosuppressants to induce remission. Ninety-one percent had resolution of symptoms after treatment. Statin-associated necrotizing myopathy is a symmetric proximal muscle weakness associated with extreme elevations of CK. It is common in males and can occur after months of statin use. It is associated with necrosis on muscle biopsy and the presence of anti-HMG-CoA reductase antibodies

  12. Recurrent myocardial infarction: Mechanisms of free-floating adaptation and autonomic derangement in networked cardiac neural control

    Ardell, Jeffrey L.; Shivkumar, Kalyanam; Armour, J. Andrew

    2017-01-01

    The cardiac nervous system continuously controls cardiac function whether or not pathology is present. While myocardial infarction typically has a major and catastrophic impact, population studies have shown that longer-term risk for recurrent myocardial infarction and the related potential for sudden cardiac death depends mainly upon standard atherosclerotic variables and autonomic nervous system maladaptations. Investigative neurocardiology has demonstrated that autonomic control of cardiac function includes local circuit neurons for networked control within the peripheral nervous system. The structural and adaptive characteristics of such networked interactions define the dynamics and a new normal for cardiac control that results in the aftermath of recurrent myocardial infarction and/or unstable angina that may or may not precipitate autonomic derangement. These features are explored here via a mathematical model of cardiac regulation. A main observation is that the control environment during pathology is an extrapolation to a setting outside prior experience. Although global bounds guarantee stability, the resulting closed-loop dynamics exhibited while the network adapts during pathology are aptly described as ‘free-floating’ in order to emphasize their dependence upon details of the network structure. The totality of the results provide a mechanistic reasoning that validates the clinical practice of reducing sympathetic efferent neuronal tone while aggressively targeting autonomic derangement in the treatment of ischemic heart disease. PMID:28692680

  13. Successful renal transplantation from a brain-dead deceased donor with head injury, disseminated intravascular coagulation and deranged renal functions

    P P Ghuge

    2013-01-01

    Full Text Available Deceased donors (DDs with the brain death due to head injury are the major source of organs for transplantation. The incidence of post-head injury disseminated intravascular coagulation (DIC ranges from 24% to 50%. Many centers do not accept organs from donors with DIC due to increased risk of primary graft non-function and/or high chances of morbidity/mortality. We performed two successful renal transplants from a DD with head injury with DIC and deranged renal function. One of the recipients developed transient thrombocytopenia, but there was no evidence of DIC or delayed graft functions in either of the recipients. Over a follow-up of 1 month, both are doing well with stable graft function and hematological profile. Thus, a carefully selected DD with severe DIC even with deranged renal function is not a contraindication for organ donation if other risk factors for primary non-function are excluded. This approach will also help in overcoming organ shortage.

  14. The relationship between the TMJ internal derangement state including rotational displacement and perforation and the clinical characteristics

    Jeong, Hwan Seok; You Dong Soo

    1998-01-01

    This study was designed to reveal the correlationship between the internal derangement state of TMJ and clinical characteristics including pain and mandibular dysfuntion. One hundred and twenty five subjects with TMJ signs and symptoms were chosen for two years. The level of pain and mandibular dysfuntion were evaluated by Visual Analog Scale (VAS) and Craniomandibular Index (CMI). The diagnostic categories of TMJ internal derangement were determined by arthrography and they included normal disc position, anterior disc displacement with reduction (ADDR), rotational disc displacement with reduction (RDDR), andterior disc displacement without reduction (ADDNR), and rotational disc displacement without reduction (RDDNR). Also disc perforation was used as a criteria to divide the diagnostic subgroups. The obtained results were as follows ; 1. The patient distribution of each group was 5 in normal disc position (4%), 40 in ADDR (32%), 30 in RDDR (24%), 34 in ADDNR (27%), and 16 in RDDNR (13%). 2. Perforation was observed in 8% of ADDR, 10% of RDDR, 32% of ADDNR, and 19% of RDDNR. 3. CMI of perforation group was higher than that of reduction or normal group(p 0.05).

  15. Efficacy of Arthrocentesis with Injection of Hyaluronic Acid in the Treatment of Internal Derangement of Temporomandibular Joint

    Pramila Shakya

    2010-07-01

    Full Text Available This cross-sectional study was designed to find out the effect of arthrocentesis with injection hyaluronic acid in thetreatment of internal derangement of temporomandibular joint (TMJ ID for the restoration of TMJ function. The studyincluded 25 patients, aged 13 to 50 years with symptoms of TMJ pain and clicking during function and limited mouthopening. TMJ ID was assessed with clinical examination and conformed with MRI. Arthrocentesis was done withinsertion of two 21gauze needles in the upper joint compartment and joint lavaged with 200 ml of ringer’s lactate solutionand at the end 1ml of hyaluronic acid was injected. Intensity of TMJ pain and clicking was assessed using visual analogscale, maximum mouth opening, lateral jaw movement and protrusion were assessed with millimeter scale. All theparameters were measured before the procedure , immediately after the procedure then after 2 weeks, 1 month , 3 monthsand 6 months procedure. During 6 months follow-up, clinical examination and comparison of the results showed 84%reduction in TMJ pain, 92% improvement in mouth opening and clicking disappear in 80% of patients.Key words: TMJ pain; clicking; internal derangement; arthrocentesis; hyaluronic acid.DOI: 10.3329/bsmmuj.v3i1.5509BSMMU J 2010; 3(1: 18-22

  16. Recurrent myocardial infarction: Mechanisms of free-floating adaptation and autonomic derangement in networked cardiac neural control.

    Kember, Guy; Ardell, Jeffrey L; Shivkumar, Kalyanam; Armour, J Andrew

    2017-01-01

    The cardiac nervous system continuously controls cardiac function whether or not pathology is present. While myocardial infarction typically has a major and catastrophic impact, population studies have shown that longer-term risk for recurrent myocardial infarction and the related potential for sudden cardiac death depends mainly upon standard atherosclerotic variables and autonomic nervous system maladaptations. Investigative neurocardiology has demonstrated that autonomic control of cardiac function includes local circuit neurons for networked control within the peripheral nervous system. The structural and adaptive characteristics of such networked interactions define the dynamics and a new normal for cardiac control that results in the aftermath of recurrent myocardial infarction and/or unstable angina that may or may not precipitate autonomic derangement. These features are explored here via a mathematical model of cardiac regulation. A main observation is that the control environment during pathology is an extrapolation to a setting outside prior experience. Although global bounds guarantee stability, the resulting closed-loop dynamics exhibited while the network adapts during pathology are aptly described as 'free-floating' in order to emphasize their dependence upon details of the network structure. The totality of the results provide a mechanistic reasoning that validates the clinical practice of reducing sympathetic efferent neuronal tone while aggressively targeting autonomic derangement in the treatment of ischemic heart disease.

  17. Recurrent myocardial infarction: Mechanisms of free-floating adaptation and autonomic derangement in networked cardiac neural control.

    Guy Kember

    Full Text Available The cardiac nervous system continuously controls cardiac function whether or not pathology is present. While myocardial infarction typically has a major and catastrophic impact, population studies have shown that longer-term risk for recurrent myocardial infarction and the related potential for sudden cardiac death depends mainly upon standard atherosclerotic variables and autonomic nervous system maladaptations. Investigative neurocardiology has demonstrated that autonomic control of cardiac function includes local circuit neurons for networked control within the peripheral nervous system. The structural and adaptive characteristics of such networked interactions define the dynamics and a new normal for cardiac control that results in the aftermath of recurrent myocardial infarction and/or unstable angina that may or may not precipitate autonomic derangement. These features are explored here via a mathematical model of cardiac regulation. A main observation is that the control environment during pathology is an extrapolation to a setting outside prior experience. Although global bounds guarantee stability, the resulting closed-loop dynamics exhibited while the network adapts during pathology are aptly described as 'free-floating' in order to emphasize their dependence upon details of the network structure. The totality of the results provide a mechanistic reasoning that validates the clinical practice of reducing sympathetic efferent neuronal tone while aggressively targeting autonomic derangement in the treatment of ischemic heart disease.

  18. Noninvasive evaluation of adult onset myopathy from carnitine palmitoyl transferase II deficiency using proton magnetic resonance spectroscopy.

    Videen, J S; Haseler, L J; Karpinski, N C; Terkeltaub, R A

    1999-08-01

    The adult onset metabolic myopathy of carnitine palmitoyl transferase II (CPT II) deficiency is under-recognized, in part due to variable degrees of enzyme deficiency and symptomatology, as well as limitations in means for noninvasive evaluation. We describe a proton magnetic resonance spectroscopy (MRS) technique, using a standard clinical magnetic resonance imaging scanner, to diagnose and help monitor the response to therapy in adult CPT II deficiency. A 53-year-old woman presented with a long standing history of diffuse aching and fatigue provoked by high fat intake, fasting, or prolonged exertion. Muscle biopsy revealed myopathic features and a deficiency (33% of control) of CPT II activity with elevated palmitoyl carnitine. Proton MRS of the soleus muscle was performed using a 1.5 Tesla scanner before and during dietary therapy. Proton MRS revealed shortening of the transverse relaxation time (T2), consistent with increased acetylation of the carnitine pool. The symptoms resolved completely by treatment with frequent feedings of a high carbohydrate diet low in long chain fatty acids supplemented with medium chain triglycerides and L-carnitine. Recovery of normal muscle MRS and carnitine T2 relaxation was documented by the third month of therapy. Proton MRS is a novel, potentially useful, and readily available adjunct in the diagnosis and therapeutic monitoring of muscle CPT II deficiency.

  19. Genetics Home Reference: neutral lipid storage disease with myopathy

    ... named? Additional Information & Resources MedlinePlus (6 links) Encyclopedia: Hypothyroidism Encyclopedia: Type 2 Diabetes Health Topic: Cardiomyopathy Health Topic: Lipid Metabolism Disorders Health Topic: Muscle Disorders Health Topic: Pancreatitis Genetic and Rare Diseases ...

  20. Genetics Home Reference: myoclonic epilepsy myopathy sensory ataxia

    ... Ardinger HH, Wallace SE, Amemiya A, Bean LJH, Bird TD, Ledbetter N, Mefford HC, Smith RJH, Stephens ... Influence of mitochondrial DNA level on cellular energy metabolism: implications for mitochondrial diseases. J Bioenerg Biomembr. 2008 ...

  1. Evidence for marsh mallow (Malva parviflora) toxicosis causing myocardial disease and myopathy in four horses.

    Bauquier, J; Stent, A; Gibney, J; Jerrett, I; White, J; Tennent-Brown, B; Pearce, A; Pitt, J

    2017-05-01

    Investigation of toxicosis caused by Malva parviflora was required after 4 horses from the same farm developed severe muscle fasciculations, tachycardia, sweating and periods of recumbency leading to death or euthanasia after ingesting the plant. To describe historical, clinical, clinicopathological and pathological findings of 4 horses with suspected M. parviflora toxicosis. The role of cyclopropene fatty acids (found in M. parviflora) and mechanism for toxicosis are proposed. Case series. Historical, physical examination, clinicopathological and pathological findings are reported. Due to similarities with atypical myopathy or seasonal pasture myopathy acyl carnitine profiles were performed on sera from 2 cases and equine controls. Presence of cyclopropene fatty acids was also examined in sera of 2 cases. M. parviflora had been heavily grazed by the horses with little other feed available. Horse 1 deteriorated rapidly and was subjected to euthanasia. Horse 2 was referred to hospital where severe myocardial disease and generalised myopathy was determined; this horse was subjected to euthanasia 36 h after admission. Horse 3 died rapidly and Horse 4 was subjected to euthanasia at onset of clinical signs. Post-mortem examinations performed on 3 horses revealed acute, multifocal cardiac and skeletal myonecrosis. Myocyte glycogen accumulation was absent when examined in Horse 2. Acyl carnitine profiles revealed increased C14-C18 acyl carnitine concentrations in cases relative to controls. Cyclopropene fatty acids were detected in sera of cases but not controls. These findings suggest aetiology different to that of atypical myopathy or seasonal pasture myopathy. We hypothesise that cyclopropene fatty acids in M. parviflora interfere with fatty acid β-oxidation in horses in negative energy balance, causing the clinical signs and abnormal acyl carnitine profiles. These equine cases suggest a pathophysiological course that closely mimics the human genetic condition very

  2. ColVI myopathies: where do we stand, where do we go?

    Allamand Valérie

    2011-09-01

    Full Text Available Abstract Collagen VI myopathies, caused by mutations in the genes encoding collagen type VI (ColVI, represent a clinical continuum with Ullrich congenital muscular dystrophy (UCMD and Bethlem myopathy (BM at each end of the spectrum, and less well-defined intermediate phenotypes in between. ColVI myopathies also share common features with other disorders associated with prominent muscle contractures, making differential diagnosis difficult. This group of disorders, under-recognized for a long time, has aroused much interest over the past decade, with important advances made in understanding its molecular pathogenesis. Indeed, numerous mutations have now been reported in the COL6A1, COL6A2 and COL6A3 genes, a large proportion of which are de novo and exert dominant-negative effects. Genotype-phenotype correlations have also started to emerge, which reflect the various pathogenic mechanisms at play in these disorders: dominant de novo exon splicing that enables the synthesis and secretion of mutant tetramers and homozygous nonsense mutations that lead to premature termination of translation and complete loss of function are associated with early-onset, severe phenotypes. In this review, we present the current state of diagnosis and research in the field of ColVI myopathies. The past decade has provided significant advances, with the identification of altered cellular functions in animal models of ColVI myopathies and in patient samples. In particular, mitochondrial dysfunction and a defect in the autophagic clearance system of skeletal muscle have recently been reported, thereby opening potential therapeutic avenues.

  3. Elucidation of the mechanism of atorvastatin-induced myopathy in a rat model.

    El-Ganainy, Samar O; El-Mallah, Ahmed; Abdallah, Dina; Khattab, Mahmoud M; Mohy El-Din, Mahmoud M; El-Khatib, Aiman S

    2016-06-01

    Myopathy is among the well documented and the most disturbing adverse effects of statins. The underlying mechanism is still unknown. Mitochondrial dysfunction related to coenzyme Q10 decline is one of the proposed theories. The present study aimed to investigate the mechanism of atorvastatin-induced myopathy in rats. In addition, the mechanism of the coenzyme Q10 protection was investigated with special focus of mitochondrial alterations. Sprague-Dawely rats were treated orally either with atorvastatin (100mg/kg) or atorvastatin and coenzyme Q10 (100mg/kg). Myopathy was assessed by measuring serum creatine kinase (CK) and myoglobin levels together with examination of necrosis in type IIB fiber muscles. Mitochondrial dysfunction was evaluated by measuring muscle lactate/pyruvate ratio, ATP level, pAkt as well as mitochondrial ultrastructure examination. Atorvastatin treatment resulted in a rise in both CK (2X) and myoglobin (6X) level with graded degrees of muscle necrosis. Biochemical determinations showed prominent increase in lactate/pyruvate ratio and a decline in both ATP (>80%) and pAkt (>50%) levels. Ultrastructure examination showed mitochondrial swelling with disrupted organelle membrane. Co-treatment with coenzyme Q10 induced reduction in muscle necrosis as well as in CK and myoglobin levels. In addition, coenzyme Q10 improved all mitochondrial dysfunction parameters including mitochondrial swelling and disruption. These results presented a model for atorvastatin-induced myopathy in rats and proved that mitochondrial dysfunction is the main contributor in statin-myopathy pathophysiology. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  4. Proteomic analysis reveals changes in carbohydrate and protein metabolism associated with broiler breast myopathy.

    Kuttappan, Vivek A; Bottje, Walter; Ramnathan, Ranjith; Hartson, Steven D; Coon, Craig N; Kong, Byung-Whi; Owens, Casey M; Vazquez-Añon, Mercedes; Hargis, Billy M

    2017-08-01

    White Striping (WS) and Woody Breast (WB) are 2 conditions that adversely affect consumer acceptance as well as quality of poultry meat and meat products. Both WS and WB are characterized with degenerative myopathic changes. Previous studies showed that WS and WB in broiler fillets could result in higher ultimate pH, increased drip loss, and decreased marinade uptake. The main objective of the present study was to compare the proteomic profiles of muscle tissue (n = 5 per group) with either NORM (no or few minor myopathic lesions) or SEV (with severe myopathic changes). Proteins were extracted from these samples and analyzed using a hybrid LTQ-OrbitrapXL mass spectrometer (LC-MS/MS). Over 800 proteins were identified in the muscle samples, among which 141 demonstrated differential (P < 0.05) expression between NORM and SEV. The set of differentially (P < 0.05) expressed proteins was uploaded to Ingenuity Pathway Analysis® (IPA) software to determine the associated biological networks and pathways. The IPA analysis showed that eukaryotic initiation factor-2 (eIF-2) signaling, mechanistic target of rapamycin (mTOR) signaling, as well as regulation of eIF4 and p70S6K signaling were the major canonical pathways up-regulated (P < 0.05) in SEV muscle compared to NORM. The up-regulation of these pathways indicate an increase in protein synthesis which could be part of the rapid growth as well as cellular stress associated with ongoing muscle degeneration and the attempt to repair tissue damage in SEV birds. Furthermore, IPA analysis revealed that glycolysis and gluconeogenesis were the major down-regulated (P < 0.05) canonical pathways in SEV with respect to NORM muscle. Down-regulation of these pathways could be the reason for higher ultimate pH seen in SEV muscle samples indicating reduced glycolytic potential. In conclusion, comparison of proteomic profiles of NORM and SEV muscle samples showed differences in protein profile which explains some of the observed differences in meat quality parameters. Future studies based on these differences could provide valuable insights into various cellular changes and identification of biomarkers related to WS and WB. © 2017 Poultry Science Association Inc.

  5. Muscle-fiber conduction velocity and electromyography as diagnostic tools in patients with suspected inflammatory myopathy: a prospective study.

    Blijham, P.J.; Hengstman, G.J.D.; Laak, H.J. ter; Engelen, B.G.M. van; Zwarts, M.J.

    2004-01-01

    Combinations of different techniques can increase the diagnostic yield from neurophysiological examination of muscle. In 25 patients with suspected inflammatory myopathy, we prospectively performed needle electromyography (EMG) and measured muscle-fiber conduction velocity (MFCV) in a single muscle,

  6. Substrate kinetics in patients with disorders of skeletal muscle metabolism.

    Ørngreen, Mette Cathrine

    2016-07-01

    The main purpose of the following studies was to investigate pathophysiological mechanisms in fat and carbohydrate metabolism and effect of nutritional interventions in patients with metabolic myopathies and in patients with severe muscle wasting. Yet there is no cure for patients with skeletal muscle disorders. The group of patients is heterozygous and this thesis is focused on patients with metabolic myopathies and low muscle mass due to severe muscle wasting. Disorders of fatty acid oxidation (FAO) are, along with myophosphorylase deficiency (McArdle disease), the most common inborn errors of metabolism leading to recurrent episodes of rhabdomyolysis in adults. Prolonged exercise, fasting, and fever are the main triggering factors for rhabdomyolysis in these conditions, and can be complicated by acute renal failure. Patients with low muscle mass are in risk of loosing their functional skills and depend on a wheel chair and respiratory support. We used nutritional interventions and metabolic studies with stable isotope technique and indirect calorimetry in patients with metabolic myopathies and patients with low muscle mass to get information of the metabolism of the investigated diseases, and to gain knowledge of the biochemical pathways of intermediary metabolism in human skeletal muscle. We have shown that patients with fat metabolism disorders in skeletal muscle affecting the transporting enzyme of fat into the mitochondria (carnitine palmitoyltransferase II deficiency) and affecting the enzyme responsible for breakdown of the long-chain fatty acids (very long chain acyl-CoA dehydrogenase deficiency) have a normal fatty acid oxidation at rest, but enzyme activity is too low to increase fatty acid oxidation during exercise. Furthermore, these patients benefit from a carbohydrate rich diet. Oppositely is exercise capacity worsened by a fat-rich diet in these patients. The patients also benefit from IV glucose, however, when glucose is given orally just before

  7. Opposed-phase MR imaging of lipid storage myopathy in a case of Chanarin-Dorfman disease

    Gaeta, Michele; Celona, Antonio; Racchiusa, Sergio; Mazziotti, Silvio; Minutoli, Fabio; Toscano, Antonio; Musumeci, Olimpia

    2008-01-01

    Chanarin-Dorfman disease (CDD) is a rare genetic disorder characterized by ichthyosis, myopathy, central nervous system disturbances, and intracellular lipid storage in muscle fibers, hepatocytes, and granulocytes. We describe skeletal muscle magnetic resonance imaging findings in a case of CDD, outlining the potential role of GE T1-weighted opposed-phase sequence (chemical shift imaging) in the evaluation of lipid storage myopathies. (orig.)

  8. Opposed-phase MR imaging of lipid storage myopathy in a case of Chanarin-Dorfman disease

    Gaeta, Michele; Celona, Antonio; Racchiusa, Sergio; Mazziotti, Silvio [University of Messina, Department of Radiological Sciences, Messina (Italy); Minutoli, Fabio [University of Messina, Department of Radiological Sciences, Messina (Italy); A.O.U. ' ' Policlinico G. Martino' ' , Dipartimento di Scienze Radiologiche, Messina (Italy); Toscano, Antonio; Musumeci, Olimpia [University of Messina, Department of Neurosciences, Psychiatry and Anaesthesiology, Messina (Italy)

    2008-11-15

    Chanarin-Dorfman disease (CDD) is a rare genetic disorder characterized by ichthyosis, myopathy, central nervous system disturbances, and intracellular lipid storage in muscle fibers, hepatocytes, and granulocytes. We describe skeletal muscle magnetic resonance imaging findings in a case of CDD, outlining the potential role of GE T1-weighted opposed-phase sequence (chemical shift imaging) in the evaluation of lipid storage myopathies. (orig.)

  9. Acute quadriplegia caused by necrotizing myopathy in a renal transplant recipient with severe pneumonia: acute onset and complete recovery.

    Tu, Guo-Wei; Song, Jie-Qiong; Ting, Simon Kang Seng; Ju, Min-Jie; He, Hong-Yu; Dong, Ji-Hong; Luo, Zhe

    2015-02-03

    Critical illness polyneuropathy and myopathy are multifaceted complications that follow severe illnesses involving the sensorimotor axons and proximal skeletal muscles. These syndromes have rarely been reported among renal transplant recipients. In this paper, we report a case of acute quadriplegia caused by necrotizing myopathy in a renal transplant recipient with severe pneumonia. The muscle strength in the patient's extremities improved gradually after four weeks of comprehensive treatment, and his daily life activities were normal a year after being discharged.

  10. MR image assessment of disc configuration and degree of anterior disc displacement in internal derangement related to age

    Igarashi, Chinami; Kobayashi, Kaoru; Imanaka, Masahiro; Yuasa, Masao; Yamamoto, Akira

    1999-01-01

    This study was designed to evaluate the configuration of the articular disc and degree of anterior disc displacement on magnetic resonance (MR) imagings in temporomandibular joints (TMJs) with internal derangement. A total of 363 joints diagnosed as having anterior disc displacement with reduction (ADD w R) and 523 joints diagnosed as having anterior disc displacement without reduction (ADD wo R) by MR imaging were examined. These joints did not show severe osseous changes on the condylar head or glenoid fossa. We assessed the configuration of the articular disc and degree of anterior disc displacement. In the ADD w R group, 82.6% of the articular discs showed biconcave configuration; enlargement of the posterior band in 4.6%, biconvex configuration in 0.5%, and others in 10.7%. Moreover 62.5% of the discs showed a slight degree of anterior disc displacement; were 27.2% moderately displaced and were 10.2% severe displaced. The prevalence of slightly displaced discs was higher in the TMJs of cases over 50 years of age than in cases under 30 years in the ADD w R group. On the other hand, in the ADD wo R group 35.9% of the articular discs showed biconcave configuration; enlargement of the posterior band in 12.6%, biconvex configuration in 25.4%, and others in 22.3%. Furthermore, 4.4% of the discs were slightly displaced; 43.9% moderately displaced and 51.6% were severely displaced. The prevalence of severely displaced and deformed discs in joints of cases over 40 years of age was high in the ADD wo R group. The prevalence of slightly displaced biconcave discs was higher in the ADD w R group. The other hand, the prevalence of severely displaced deformed discs was higher in the ADD wo R group. MR findings of internal derangement of the TMJ were found to be significantly correlated with age. (author)

  11. Differences in Adipose Tissue and Lean Mass Distribution in Patients with Collagen VI Related Myopathies Are Associated with Disease Severity and Physical Ability.

    Rodríguez, M A; Del Rio Barquero, Luís M; Ortez, Carlos I; Jou, Cristina; Vigo, Meritxell; Medina, Julita; Febrer, Anna; Ramon-Krauel, Marta; Diaz-Manera, Jorge; Olive, Montse; González-Mera, Laura; Nascimento, Andres; Jimenez-Mallebrera, Cecilia

    2017-01-01

    Mutations in human collagen VI genes cause a spectrum of musculoskeletal conditions in children and adults collectively termed collagen VI-related myopathies (COL6-RM) characterized by a varying degree of muscle weakness and joint contractures and which include Ullrich Congenital Muscular Dystrophy (UCMD) and Bethlem Myopathy (BM). Given that collagen VI is one of the most abundant extracellular matrix proteins in adipose tissue and its emerging role in energy metabolism we hypothesized that collagen VI deficiency might be associated with alterations in adipose tissue distribution and adipokines serum profile. We analyzed body composition by means of dual-energy X-ray absorptiometry in 30 pediatric and adult COL6-RM myopathy patients representing a range of severities (UCMD, intermediate-COL6-RM, and BM). We found a distinctive pattern of regional adipose tissue accumulation which was more evident in children at the most severe end of the spectrum. In particular, the accumulation of fat in the android region was a distinguishing feature of UCMD patients. In parallel, there was a decrease in lean mass compatible with a state of sarcopenia, particularly in ambulant children with an intermediate phenotype. All children and adult patients that were sarcopenic were also obese. These changes were significantly more pronounced in children with collagen VI deficiency than in children with Duchenne Muscular Dystrophy of the same ambulatory status. High molecular weight adiponectin and leptin were significantly increased in sera from children in the intermediate and BM group. Correlation analysis showed that the parameters of fat mass were negatively associated with motor function according to several validated outcome measures. In contrast, lean mass parameters correlated positively with physical performance and quality of life. Leptin and adiponectin circulating levels correlated positively with fat mass parameters and negatively with lean mass and thus may be relevant to

  12. Differences in Adipose Tissue and Lean Mass Distribution in Patients with Collagen VI Related Myopathies Are Associated with Disease Severity and Physical Ability

    M. A. Rodríguez

    2017-08-01

    Full Text Available Mutations in human collagen VI genes cause a spectrum of musculoskeletal conditions in children and adults collectively termed collagen VI-related myopathies (COL6-RM characterized by a varying degree of muscle weakness and joint contractures and which include Ullrich Congenital Muscular Dystrophy (UCMD and Bethlem Myopathy (BM. Given that collagen VI is one of the most abundant extracellular matrix proteins in adipose tissue and its emerging role in energy metabolism we hypothesized that collagen VI deficiency might be associated with alterations in adipose tissue distribution and adipokines serum profile. We analyzed body composition by means of dual-energy X-ray absorptiometry in 30 pediatric and adult COL6-RM myopathy patients representing a range of severities (UCMD, intermediate-COL6-RM, and BM. We found a distinctive pattern of regional adipose tissue accumulation which was more evident in children at the most severe end of the spectrum. In particular, the accumulation of fat in the android region was a distinguishing feature of UCMD patients. In parallel, there was a decrease in lean mass compatible with a state of sarcopenia, particularly in ambulant children with an intermediate phenotype. All children and adult patients that were sarcopenic were also obese. These changes were significantly more pronounced in children with collagen VI deficiency than in children with Duchenne Muscular Dystrophy of the same ambulatory status. High molecular weight adiponectin and leptin were significantly increased in sera from children in the intermediate and BM group. Correlation analysis showed that the parameters of fat mass were negatively associated with motor function according to several validated outcome measures. In contrast, lean mass parameters correlated positively with physical performance and quality of life. Leptin and adiponectin circulating levels correlated positively with fat mass parameters and negatively with lean mass and thus may

  13. Role of Exercise Therapy in Prevention of Decline in Aging Muscle Function: Glucocorticoid Myopathy and Unloading

    Teet Seene

    2012-01-01

    Full Text Available Changes in skeletal muscle quantity and quality lead to disability in the aging population. Physiological changes in aging skeletal muscle are associated with a decline in mass, strength, and inability to maintain balance. Glucocorticoids, which are in wide exploitation in various clinical scenarios, lead to the loss of the myofibrillar apparatus, changes in the extracellular matrix, and a decrease in muscle strength and motor activity, particularly in the elderly. Exercise therapy has shown to be a useful tool for the prevention of different diseases, including glucocorticoid myopathy and muscle unloading in the elderly. The purpose of the paper is to discuss the possibilities of using exercise therapy in the prevention of glucocorticoid caused myopathy and unloading in the elderly and to describe relationships between the muscle contractile apparatus and the extracellular matrix in different types of aging muscles.

  14. Free radicals in alcoholic myopathy: indices of damage and preventive studies.

    Preedy, Victor R; Adachi, Junko; Asano, Migiwa; Koll, Michael; Mantle, David; Niemela, Onni; Parkkila, Seppo; Paice, Alistair G; Peters, Timothy; Rajendram, Rajkumar; Seitz, Helmut; Ueno, Yasuhiro; Worrall, Simon

    2002-04-15

    Chronic alcoholic myopathy affects up to two-thirds of all alcohol misusers and is characterized by selective atrophy of Type II (glycolytic, fast-twitch, anaerobic) fibers. In contrast, the Type I fibers (oxidative, slow-twitch, aerobic) are relatively protected. Alcohol increases the concentration of cholesterol hydroperoxides and malondialdehyde-protein adducts, though protein-carbonyl concentration levels do not appear to be overtly increased and may actually decrease in some studies. In alcoholics, plasma concentrations of alpha-tocopherol may be reduced in myopathic patients. However, alpha-tocopherol supplementation has failed to prevent either the loss of skeletal muscle protein or the reductions in protein synthesis in alcohol-dosed animals. The evidence for increased oxidative stress in alcohol-exposed skeletal muscle is thus inconsistent. Further work into the role of ROS in alcoholic myopathy is clearly warranted.

  15. Fatal hepatic hemorrhage by peliosis hepatis in X-linked myotubular myopathy: a case report.

    Motoki, T; Fukuda, M; Nakano, T; Matsukage, S; Fukui, A; Akiyoshi, S; Hayashi, Y K; Ishii, E; Nishino, I

    2013-11-01

    We report a 5-year-old boy with X-linked myotubular myopathy complicated by peliosis hepatis. At birth, he was affected with marked generalized muscle hypotonia and weakness, which required permanent ventilatory support, and was bedridden for life. He died of acute fatal hepatic hemorrhage after using a mechanical in-exsufflator. Peliosis hepatis, defined as multiple, variable-sized, cystic blood-filled spaces through the liver parenchyma, was confirmed by autopsy. To avoid fatal hepatic hemorrhage by peliosis hepatis, routine hepatic function tests and abdominal imaging tests should be performed for patients with X-linked myotubular myopathy, especially at the time of using artificial respiration. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Neutral lipid-storage disease with myopathy and extended phenotype with novel PNPLA2 mutation.

    Massa, Roberto; Pozzessere, Simone; Rastelli, Emanuele; Serra, Laura; Terracciano, Chiara; Gibellini, Manuela; Bozzali, Marco; Arca, Marcello

    2016-04-01

    Neutral lipid-storage disease with myopathy is caused by mutations in PNPLA2, which produce skeletal and cardiac myopathy. We report a man with multiorgan neutral lipid storage and unusual multisystem clinical involvement, including cognitive impairment. Quantitative brain MRI with voxel-based morphometry and extended neuropsychological assessment were performed. In parallel, the coding sequences and intron/exon boundaries of the PNPLA2 gene were screened by direct sequencing. Neuropsychological assessment revealed global cognitive impairment, and brain MRI showed reduced gray matter volume in the temporal lobes. Molecular characterization revealed a novel homozygous mutation in exon 5 of PNPLA2 (c.714C>A), resulting in a premature stop codon (p.Cys238*). Some PNPLA2 mutations, such as the one described here, may present with an extended phenotype, including brain involvement. In these cases, complete neuropsychological testing, combined with quantitative brain MRI, may help to characterize and quantify cognitive impairment. © 2016 Wiley Periodicals, Inc.

  17. Homozygous LIPE Mutation in Siblings with Multiple Symmetric Lipomatosis, Partial Lipodystrophy, and Myopathy

    Zolotov, Sagit; Xing, Chao; Mahamid, Riad; Shalata, Adel; Sheikh-Ahmad, Mohammed; Garg, Abhimanyu

    2016-01-01

    Despite considerable progress in identifying causal genes for lipodystrophy syndromes, the molecular basis of some peculiar adipose tissue disorders remains obscure. In an Israeli–Arab pedigree with a novel autosomal recessive, multiple symmetric lipomatosis (MSL), partial lipodystrophy and myopathy, we conducted exome sequencing of two affected siblings to identify the disease-causingmutation. The 41-year-old female proband and her 36-year-old brother reported marked accumulation of subcutan...

  18. Cardiac abnormalities assessed by non-invasive techniques in patients with newly diagnosed idiopathic inflammatory myopathies

    Diederichsen, Louise Pyndt; Simonsen, Jane Angel; Diederichsen, Axel Cosmus Pyndt

    2015-01-01

    inflammatory myopathies (IIM) by means of non-invasive techniques. METHODS: Fourteen patients with IIM (8 polymyositis, 4 dermatomyositis, 2 cancer-associated dermatomyositis) and 14 gender- and age- matched healthy control subjects were investigated. Participant assessments included a cardiac questionnaire...... in 8 (57%) of the patients compared to none of the controls (pgroup (p=0.01). Two patients had systolic dysfunction, and one diastolic dysfunction...

  19. Case Report: Elevated CPK, an indicator of idiopathic inflammatory myopathy? [version 1; referees: 2 approved

    Hina N. Khan

    2016-02-01

    Full Text Available Polymyositis is a rare disease with incidence rates at about 1 per 100,000 people annually. In this case report we will review a case of proximal muscle weakness with an elevated creatine phosphokinase that was initially misdiagnosed twice as rhabdomyolysis. Therefore, emphasizing that idiopathic inflammatory myopathy is a potential cause of myasthenia that must be considered in the differential. The case will also describe the current treatment and treatment response in polymyositis.

  20. Toxic myopathy in a dog associated with the presence of monensin in dry food.

    Wilson, J S

    1980-01-01

    This report describes a case of toxic myopathy in a two year old sheltie dog with clinical signs of profound weakness, myoglobinuria, and muscle enzyme elevations. The clinical signs were likely related to the accidental inclusion of monensin sodium in the dog's food. This food was prepared by a small feed milling company that also prepares cattle and chicken rations. A change of dog food resulted in remission of the clinical signs.

  1. Toxic Myopathy in a Dog Associated with the Presence of Monensin in Dry Food

    Wilson, J. S.

    1980-01-01

    This report describes a case of toxic myopathy in a two year old sheltie dog with clinical signs of profound weakness, myoglobinuria, and muscle enzyme elevations. The clinical signs were likely related to the accidental inclusion of monensin sodium in the dog's food. This food was prepared by a small feed milling company that also prepares cattle and chicken rations. A change of dog food resulted in remission of the clinical signs.

  2. Whole-body MRI for full assessment and characterization of diffuse inflammatory myopathy

    Saleh Saleh Elessawy

    2016-09-01

    Full Text Available Background Conventional magnetic resonance imaging (MRI is a highly valuable tool for full assessment of the extent of bilateral symmetrical diffuse inflammatory myopathy, owing to its high sensitivity in the detection of edema which correlates with, and sometimes precedes, clinical findings. Purpose To evaluate the use of whole-body (WB-MRI in characterization and full assessment of the extent and distribution of diffuse inflammatory myopathy. Material and Methods A prospective study on 15 patients presenting with clinical evidence of inflammatory myopathy. It included 4 boys/men and 11 girls/women (age range, 6–44 years; mean age, 25.5 years. 1.5 T WB-MRI was performed and the distribution and extent of disease severity was assessed according to muscle edema on STIR images. Results Four cases of dermatomyositis showed lower limb disease predilection with edema in gluteal, thigh, and calf muscles. The same finding was seen in one case with recurrent polymyositis and three cases with overlap myositis with systemic lupus erythematosus (SLE. Bilateral upper and lower limb myositis was demonstrated in three cases of polymyositis and one case of overlap myositis with scleroderma. Bilateral edema involving all scanned muscle groups was detected in three cases of polymyositis with paraneoplastic syndrome, SLE, and severe active dermatomyositis (including the neck muscles. Conclusion WB-MRI is the diagnostic modality of choice for cases of inflammatory myopathy. It accurately detects the most severely affected muscles candidate for biopsy and provides a reliable baseline study for follow-up of disease progression as well as response to treatment.

  3. Apparent diffusion coefficient (ADC) does not correlate with different serological parameters in myositis and myopathy.

    Meyer, Hans-Jonas; Ziemann, Oliver; Kornhuber, Malte; Emmer, Alexander; Quäschling, Ulf; Schob, Stefan; Surov, Alexey

    2018-06-01

    Background Magnetic resonance imaging (MRI) is widely used in several muscle disorders. Diffusion-weighted imaging (DWI) is an imaging modality, which can reflect microstructural tissue composition. The apparent diffusion coefficient (ADC) is used to quantify the random motion of water molecules in tissue. Purpose To investigate ADC values in patients with myositis and non-inflammatory myopathy and to analyze possible associations between ADC and laboratory parameters in these patients. Material and Methods Overall, 17 patients with several myositis entities, eight patients with non-inflammatory myopathies, and nine patients without muscle disorder as a control group were included in the study (mean age = 55.3 ± 14.3 years). The diagnosis was confirmed by histopathology in every case. DWI was obtained in a 1.5-T scanner using two b-values: 0 and 1000 s/mm 2 . In all patients, the blood sample was acquired within three days to the MRI. The following serological parameters were estimated: C-reactive protein, lactate dehydrogenase, alanine aminotransferase, aspartate aminotransferase, creatine kinase, and myoglobine. Results The estimated mean ADC value for the myositis group was 1.89 ± 0.37 × 10 -3  mm 2 /s and for the non-inflammatory myopathy group was 1.79 ± 0.33 × 10 -3  mm 2 /s, respectively. The mean ADC values (1.15 ± 0.37 × 10 -3  mm 2 /s) were significantly higher to unaffected muscles (vs. myositis P = 0.0002 and vs. myopathy P = 0.0021). There were no significant correlations between serological parameters and ADC values. Conclusion Affected muscles showed statistically significantly higher ADC values than normal muscles. No linear correlations between ADC and serological parameters were identified.

  4. Nuclear actin aggregation is a hallmark of anti-synthetase syndrome-induced dysimmune myopathy

    Stenzel, W; Preusse, C; Allenbach, Y; Pehl, D; Junckerstorff, R; Heppner, F L; Nolte, K; Aronica, E; Kana, V; Rushing, E; Schneider, U; Claeys, K G; Benveniste, O; Weis, J; Goebel, H H

    2015-01-01

    Objective: To analyze antisynthetase syndrome–associated myositis by modern myopathologic methods and to define its place in the spectrum of idiopathic inflammatory myopathies (IIMs). Methods: Skeletal muscle biopsies from antisynthetase syndrome–associated myositis and other IIMs from different institutions worldwide were analyzed by histopathology, quantitative PCR, and electron microscopy. Results: Myonuclear actin filament inclusions were identified as a unique morphologic hallmark of a...

  5. Mutation-specific effects on thin filament length in thin filament myopathy.

    Winter, Josine M de; Joureau, Barbara; Lee, Eun-Jeong; Kiss, Balázs; Yuen, Michaela; Gupta, Vandana A; Pappas, Christopher T; Gregorio, Carol C; Stienen, Ger J M; Edvardson, Simon; Wallgren-Pettersson, Carina; Lehtokari, Vilma-Lotta; Pelin, Katarina; Malfatti, Edoardo; Romero, Norma B; Engelen, Baziel G van; Voermans, Nicol C; Donkervoort, Sandra; Bönnemann, C G; Clarke, Nigel F; Beggs, Alan H; Granzier, Henk; Ottenheijm, Coen A C

    2016-06-01

    Thin filament myopathies are among the most common nondystrophic congenital muscular disorders, and are caused by mutations in genes encoding proteins that are associated with the skeletal muscle thin filament. Mechanisms underlying muscle weakness are poorly understood, but might involve the length of the thin filament, an important determinant of force generation. We investigated the sarcomere length-dependence of force, a functional assay that provides insights into the contractile strength of muscle fibers as well as the length of the thin filaments, in muscle fibers from 51 patients with thin filament myopathy caused by mutations in NEB, ACTA1, TPM2, TPM3, TNNT1, KBTBD13, KLHL40, and KLHL41. Lower force generation was observed in muscle fibers from patients of all genotypes. In a subset of patients who harbor mutations in NEB and ACTA1, the lower force was associated with downward shifted force-sarcomere length relations, indicative of shorter thin filaments. Confocal microscopy confirmed shorter thin filaments in muscle fibers of these patients. A conditional Neb knockout mouse model, which recapitulates thin filament myopathy, revealed a compensatory mechanism; the lower force generation that was associated with shorter thin filaments was compensated for by increasing the number of sarcomeres in series. This allowed muscle fibers to operate at a shorter sarcomere length and maintain optimal thin-thick filament overlap. These findings might provide a novel direction for the development of therapeutic strategies for thin filament myopathy patients with shortened thin filament lengths. Ann Neurol 2016;79:959-969. © 2016 American Neurological Association.

  6. Unfolded protein response and activated degradative pathways regulation in GNE myopathy.

    Honghao Li

    Full Text Available Although intracellular beta amyloid (Aβ accumulation is known as an early upstream event in the degenerative course of UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE myopathy, the process by which Aβdeposits initiate various degradative pathways, and their relationship have not been fully clarified. We studied the possible secondary responses after amyloid beta precursor protein (AβPP deposition including unfolded protein response (UPR, ubiquitin proteasome system (UPS activation and its correlation with autophagy system. Eight GNE myopathy patients and five individuals with normal muscle morphology were included in this study. We performed immunofluorescence and immunoblotting to investigate the expression of AβPP, phosphorylated tau (p-tau and endoplasmic reticulum molecular chaperones. Proteasome activities were measured by cleavage of fluorogenic substrates. The expression of proteasome subunits and linkers between proteasomal and autophagy systems were also evaluated by immunoblotting and relative quantitative real-time RT-PCR. Four molecular chaperones, glucose-regulated protein 94 (GRP94, glucose-regulated protein 78 (GRP78, calreticulin and calnexin and valosin containing protein (VCP were highly expressed in GNE myopathy. 20S proteasome subunits, three main proteasome proteolytic activities, and the factors linking UPS and autophagy system were also increased. Our study suggests that AβPP deposition results in endoplasmic reticulum stress (ERS and highly expressed VCP deliver unfolded proteins from endoplasmic reticulum to proteosomal system which is activated in endoplasmic reticulum associated degradation (ERAD in GNE myopathy. Excessive ubiquitinated unfolded proteins are exported by proteins that connect UPS and autophagy to autophagy system, which is activated as an alternative pathway for degradation.

  7. Computed tomography and angiography in MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes)

    Hasuo, K.; Tamura, S.; Yasumori, K.; Uchino, A.; Masuda, K.; Goda, S.; Ishimoto, S.; Kamikaseda, K.; Wakuta, Y.; Kishi, M.

    1987-01-01

    Among mitochondrial encephalomyopathies, MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes, Pavlakis et al., 1983) is recognized as a distinct syndrome characterized by generalized convulsions and recurrrent stroke-like episodes. The neuroradiological findings of three patients with MELAS are reported here. Retrospective review shows that MELAS should be included in the differential diagnosis of infarct-like lesions of the cerebrum. (orig.)

  8. Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone

    Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu

    2017-01-01

    Abstract Rationale: Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. Patient concerns: We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Diagnoses: Relative hypothyroidism-i...

  9. Radiological features of Paget disease of bone associated with VCP myopathy

    Farpour, Farzin [University of California, Department of Radiology, VA Long Beach Health Care, Irvine, CA (United States); Queens Hospital Center, Mount Sinai School of Medicine, New York, NY (United States); Tehranzadeh, Jamshid [University of California, Department of Radiology, VA Long Beach Health Care, Irvine, CA (United States); Donkervoort, Sandra; Vanjara, Pari [University of California, Division of Genetics and Metabolism, Department of Pediatrics, Irvine, CA (United States); Smith, Charles [University of Kentucky, Department of Neurology and Sanders-Brown Center on Aging, Lexington, KY (United States); Martin, Barbara [University of Kentucky, Lexington, KY (United States); Osann, Kathryn [University of California, Department of Medicine, Division of Hematology/Oncology, Irvine, CA (United States); Kimonis, Virginia E. [University of California, Division of Genetics and Metabolism, Department of Pediatrics, Irvine, CA (United States); UC Irvine Medical Center, Division of Genetics and Metabolism, Orange, CA (United States)

    2012-03-15

    Mutations in the Valosin-containing protein (VCP) gene cause a unique disorder characterized by classic Paget disease of bone (PDB), inclusion body myopathy, and frontotemporal dementia (IBMPFD). Our objective was to analyze the radiographic features of PDB associated with VCP mutations since there is a dearth of literature on the PDB component of VCP disease. Radiographic bone surveys were examined in 23 individuals with VCP mutation and compared with their unaffected relatives. Laboratory testing relevant for VCP disease was performed in all individuals. Of the 17 affected individuals with clinical manifestations of VCP disease, 16 of whom had myopathy, radiographic analysis revealed classic PDB in 11 individuals (65%). The mean age of diagnosis for myopathy was 43.8 years and for PDB was 38.1 years of age. Radiological evidence of PDB was seen in one individual (16%) amongst six clinically asymptomatic VCP mutation carriers. Alkaline phosphatase was a useful marker for diagnosing PDB in VCP disease. Radiographic findings of classic PDB are seen in 52% of individuals carrying VCP mutations at a significantly younger age than conventional PDB. Screening for PDB is warranted in at-risk individuals because of the benefit of early treatment with the new powerful bisphosphonates that hold the potential for prevention of disease. (orig.)

  10. Insulin resistance and increased muscle cytokine levels in patients with mitochondrial myopathy.

    Rue, Nana; Vissing, John; Galbo, Henrik

    2014-10-01

    Mitochondrial dysfunction has been proposed to cause insulin resistance and that might stimulate cytokine production. The objective of the study was to elucidate the association between mitochondrial myopathy, insulin sensitivity, and cytokine levels in muscle. This was an experimental, controlled study in outpatients. Eight overnight-fasted patients (P) with various inherited mitochondrial myopathies and eight healthy subjects (C) matched for sex, age, weight, height, and physical activity participated in the study. The intervention included a 120-minute hyperinsulinemic, euglycemic clamp. Another morning, microdialysis of both vastus lateralis muscles for 4 hours, including one-legged, knee extension exercise for 30 minutes, was performed. Glucose infusion rate during 90-120 minutes of insulin infusion was measured. Cytokine concentrations in dialysate were also measured. Muscle strength, percentage fat mass, and creatine kinase in plasma did not differ between groups. The maximal oxygen uptake was 21 ± 3 (SE) (P) and 36 ± 3(C) mL/kg·min (2P fatty acids and glycerol at 120 minutes were higher in P vs C (2P myopathies, insulin sensitivity of muscle, adipose tissue, and pancreatic A cells is reduced, supporting that mitochondrial function influences insulin action. Furthermore, a local, low-grade inflammation of potential clinical importance exists in the muscle of these patients.

  11. Rapid diagnosis of hypoglycin A intoxication in atypical myopathy of horses.

    Sander, Johannes; Cavalleri, Jessika-M V; Terhardt, Michael; Bochnia, Mandy; Zeyner, Annette; Zuraw, Aleksandra; Sander, Stefanie; Peter, Michael; Janzen, Nils

    2016-03-01

    Hypoglycin A (2-amino-3-(2-methylidenecyclopropyl)propanoic acid) is the plant toxin shown to cause atypical myopathy in horses. It is converted in vivo to methylenecyclopropyl acetic acid, which is transformed to a coenzyme A ester that subsequently blocks beta oxidation of fatty acids. Methylenecyclopropyl acetic acid is also conjugated with carnitine and glycine. Acute atypical myopathy may be diagnosed by quantifying the conjugates of methylenecyclopropyl acetic acid plus a selection of acyl conjugates in urine and serum. We describe a new mass spectrometric method for sample volumes of acid in urine, the coefficients of variation for intraday quantification were 2.9% and 3.0%, respectively. The respective values for interday were 9.3% and 8.0%. Methylenecyclopropyl acetyl carnitine was detected as high as 1.18 µmol/L in serum (median: 0.46 µmol/L) and 1.98 mmol/mol creatinine in urine (median: 0.79 mmol/mol creatinine) of diseased horses, while the glycine derivative accumulated up to 1.97 mmol/mol creatinine in urine but was undetectable in most serum samples. In serum samples from horses with atypical myopathy, the intraday coefficients of variation for C4-C8 carnitines and glycines were ≤4.5%. Measured concentrations exceeded those in healthy horses by ~10 to 1,400 times. © 2015 The Author(s).

  12. The genetic basis of pectoralis major myopathies in modern broiler chicken lines.

    Bailey, Richard A; Watson, Kellie A; Bilgili, S F; Avendano, Santiago

    2015-12-01

    This is the first report providing estimates of the genetic basis of breast muscle myopathies (BMM) and their relationship with growth and yield in broiler chickens. In addition, this paper addresses the hypothesis that genetic selection for increase breast yield has contributed to the onset of BMM. Data were analyzed from ongoing recording of BMM within the Aviagen breeding program. This study focused on three BMM: deep pectoral myopathy (DPM; binary trait), white striping (WS; 4 categories) and wooden breast (WB; 3 categories). Data from two purebred commercial broiler lines (A and B) were utilized providing greater than 40,000 meat quality records per line. The difference in selection history between these two lines has resulted in contrasting breast yield (BY): 29% for Line A and 21% for Line B. Data were analyzed to estimate genetic parameters using a multivariate animal model including six traits: body weight (BW), processing body weight (PW), BY, DPM, WB, and WS, in addition to the appropriate fixed effects and permanent environmental effect of the dam. Results indicate similar patterns of heritability and genetic correlations for the two lines. Heritabilities (h2) of BW, PW and BY ranged from 0.271-0.418; for DPM and WB h2white striping of breast muscle and more than 90% of the variance of the incidence of wooden breast and deep pectoral myopathy in broiler chickens. © The Author 2015. Published by Oxford University Press on behalf of Poultry Science Association.

  13. Genetic factors affecting statin concentrations and subsequent myopathy: a HuGENet systematic review

    Canestaro, William J.; Austin, Melissa A.; Thummel, Kenneth E.

    2015-01-01

    Statins, 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase inhibitors, have proven efficacy in both lowering low-density-lipoprotein levels and preventing major coronary events, making them one of the most commonly prescribed drugs in the United States. Statins exhibit a class-wide side effect of muscle toxicity and weakness, which has led regulators to impose both dosage limitations and a recall. This review focuses on the best-characterized genetic factors associated with increased statin muscle concentrations, including the genes encoding cytochrome P450 enzymes (CYP2D6, CYP3A4, and CYP3A5), a mitochondrial enzyme (GATM), an influx transporter (SLCO1B1), and efflux transporters (ABCB1 and ABCG2). A systematic literature review was conducted to identify relevant research evaluating the significance of genetic variants predictive of altered statin concentrations and subsequent statin-related myopathy. Studies eligible for inclusion must have incorporated genotype information and must have associated it with some measure of myopathy, either creatine kinase levels or self-reported muscle aches and pains. After an initial review, focus was placed on seven genes that were adequately characterized to provide a substantive review: CYP2D6, CYP3A4, CYP3A5, GATM, SLCO1B1, ABCB1, and ABCG2. All statins were included in this review. Among the genetic factors evaluated, statin-related myopathy appears to be most strongly associated with variants in SLCO1B1. PMID:24810685

  14. Tc-99m ECD brain SPECT in MELAS syndrome and mitochondrial myopathy: comparison with MR findings

    Park, Sang Joon; Ryu, Young Hoon; Jeon, Tae Joo; Kim, Jai Keun; Nam, Ji Eun; Yoon, Pyeong Ho; Yoon, Choon Sik; Lee, Jong Doo

    1998-01-01

    We evaluated brain perfusion SPECT findings of MELAS syndrome and mitochondrial myopathy in correlation with MR imaging in search of specific imaging features. Subjects were five patients (four females and one male; age range, 1 to 25 year) who presented with repeated stroke like episodes, seizures or developmental delay or asymptomatic but had elevated lactic acid in CSF and serum. Conventional non-contrast MR imaging and Tc-99m-ethyl cysteinate dimer (ECD) brain perfusion SPECT were performed and imaging features were analyzed. MRI demonstrated increased T2 signal intensities in the affected areas of gray and white matters mainly in the parietal (4/5) and occipital lobes (4/5) and in the basal ganglia (1/5), which were not restricted to a specific vascular territory. SPECT demonstrated decreased perfusion in the corresponding regions of MRI lesions. In addition, there were perfusion defects in parietal (1 patient), temporal (2), and frontal (1) lobes and basal ganglia (1) and thalami (2). In a patient with mitochondrial myopathy who had normal MRI, decreased perfusion was noted in left parietal area and bilateral thalami. Tc-99m ECD SPECT imaging in patients with MELAS syndrome and mitochondrial myopathy showed hypoperfusion of parieto-occipital cortex, basal ganglia, thalamus and temporal cortex, which were not restricted to a specific vascular territory. There were no specific imaging features on SPECT. The significance of abnormal perfusion on SPECT without corresponding MR abnormalities needs to be evaluated further in larger number of patients

  15. [Value of MRI in the treatment of Grave's disease orbital myopathy].

    Oğuz, V; Yolar, M; Yetik, H; Cakirer, D; Uysal, O; Pazarli, H

    2001-10-01

    In order to evaluate the predictability of the results in the treatment of myopathy in cases with the clinical signs of muscle involvement, 177 extraocular muscles of 27 cases whose oedematous status was detected by MRI and who were given antiinflammatory treatment according to the data of this method, were studied. The nature of involvement was detected in respect with the signal intensity and thickness of each rectus muscle prior to the treatment and at the end of the sixth month following a three months' application of combined treatment of steroids and irradiation of 2000 rads. When the initial and final results were compared, the signal intensities of four involved recti showed significant decrease at the end of the treatment, as they were evaluated separately or together. Besides the thicknesses of these groups of involved recti which were evaluated separately showed significant decrease. The evaluation of the signal intensities by MRI is a way that enables noninvasive detection of the edema and prediction of the anti-inflammatory treatment's results of dysthyroid myopathy. Therefore a systematic follow up by MRI is recommended for the treatment choice in dysthyroid myopathy.

  16. High-Fat Diet Triggers Inflammation-Induced Cleavage of SIRT1 in Adipose Tissue To Promote Metabolic Dysfunction

    Chalkiadaki, Angeliki; Guarente, Leonard

    2012-01-01

    Adipose tissue plays an important role in storing excess nutrients and preventing ectopic lipid accumulation in other organs. Obesity leads to excess lipid storage in adipocytes, resulting in the generation of stress signals and the derangement of metabolic functions. SIRT1 is an important regulatory sensor of nutrient availability in many metabolic tissues. Here we report that SIRT1 functions in adipose tissue to protect from inflammation and obesity under normal feeding conditions, and to f...

  17. Leucine metabolism in patients with Hepatic Encephalopathy

    McGhee, A.S.; Kassouny, M.E.; Matthews, D.E.; Millikan, W.

    1986-01-01

    A primed continuous infusion of [ 15 N, 1- 13 C]leucine was used to determine whether increased oxidation and/or protein synthesis of leucine occurs in patients with cirrhosis. Five controls and patients were equilibrated on a metabolic balance diet [0.6 g protein per kg ideal body weight (IBW)]. An additional four patients were equilibrated in the same manner with the same type of diet with a protein level of 0.75 g per kg IBW. Plasma leucine and breath CO 2 enrichments were measured by mass spectrometry. Protein synthesis and leucine metabolism were identical in controls and patients when both were fed a diet with 0.6 g protein/kg IBW. Results indicate that systemic derangements of leucine metabolism are not the cause of Hepatic Encephalopathy

  18. Actin Nemaline Myopathy Mouse Reproduces Disease, Suggests Other Actin Disease Phenotypes and Provides Cautionary Note on Muscle Transgene Expression

    Ravenscroft, Gianina; Jackaman, Connie; Sewry, Caroline A.; McNamara, Elyshia; Squire, Sarah E.; Potter, Allyson C.; Papadimitriou, John; Griffiths, Lisa M.; Bakker, Anthony J.; Davies, Kay E.; Laing, Nigel G.; Nowak, Kristen J.

    2011-01-01

    Mutations in the skeletal muscle α-actin gene (ACTA1) cause congenital myopathies including nemaline myopathy, actin aggregate myopathy and rod-core disease. The majority of patients with ACTA1 mutations have severe hypotonia and do not survive beyond the age of one. A transgenic mouse model was generated expressing an autosomal dominant mutant (D286G) of ACTA1 (identified in a severe nemaline myopathy patient) fused with EGFP. Nemaline bodies were observed in multiple skeletal muscles, with serial sections showing these correlated to aggregates of the mutant skeletal muscle α-actin-EGFP. Isolated extensor digitorum longus and soleus muscles were significantly weaker than wild-type (WT) muscle at 4 weeks of age, coinciding with the peak in structural lesions. These 4 week-old mice were ∼30% less active on voluntary running wheels than WT mice. The α-actin-EGFP protein clearly demonstrated that the transgene was expressed equally in all myosin heavy chain (MHC) fibre types during the early postnatal period, but subsequently became largely confined to MHCIIB fibres. Ringbinden fibres, internal nuclei and myofibrillar myopathy pathologies, not typical features in nemaline myopathy or patients with ACTA1 mutations, were frequently observed. Ringbinden were found in fast fibre predominant muscles of adult mice and were exclusively MHCIIB-positive fibres. Thus, this mouse model presents a reliable model for the investigation of the pathobiology of nemaline body formation and muscle weakness and for evaluation of potential therapeutic interventions. The occurrence of core-like regions, internal nuclei and ringbinden will allow analysis of the mechanisms underlying these lesions. The occurrence of ringbinden and features of myofibrillar myopathy in this mouse model of ACTA1 disease suggests that patients with these pathologies and no genetic explanation should be screened for ACTA1 mutations. PMID:22174871

  19. Caffeine inhibits erythrocyte membrane derangement by antioxidant activity and by blocking caspase 3 activation.

    Tellone, Ester; Ficarra, Silvana; Russo, Annamaria; Bellocco, Ersilia; Barreca, Davide; Laganà, Giuseppina; Leuzzi, Ugo; Pirolli, Davide; De Rosa, Maria Cristina; Giardina, Bruno; Galtieri, Antonio

    2012-02-01

    The aim of this research was to investigate the effect of caffeine on band 3 (the anion exchanger protein), haemoglobin function, caspase 3 activation and glucose-6-phosphate metabolism during the oxygenation-deoxygenation cycle in human red blood cells. A particular attention has been given to the antioxidant activity by using in vitro antioxidant models. Caffeine crosses the erythrocyte membrane and interacts with the two extreme conformational states of haemoglobin (the T and the R-state within the framework of the simple two states allosteric model) with different binding affinities. By promoting the high affinity state (R-state), the caffeine-haemoglobin interaction does enhance the pentose phosphate pathway. This is of benefit for red blood cells since it leads to an increase of NADPH availability. Moreover, caffeine effect on band 3, mediated by haemoglobin, results in an extreme increase of the anion exchange, particularly in oxygenated erythrocytes. This enhances the transport of the endogenously produced CO(2) thereby avoiding the production of dangerous secondary radicals (carbonate and nitrogen dioxide) which are harmful to the cellular membrane. Furthermore caffeine destabilizes the haeme-protein interactions within the haemoglobin molecule and triggers the production of superoxide and met-haemoglobin. However this damaging effect is almost balanced by the surprising scavenger action of the alkaloid with respect to the hydroxyl radical. These experimental findings are supported by in silico docking and molecular dynamics studies and by what we may call the "caspase silence"; in fact, there is no evidence of any caspase 3 activity enhancement; this is likely due to the promotion of positive metabolic conditions which result in an increase of the cellular reducing power. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  20. Detection of differentially expressed genes in broiler pectoralis major muscle affected by White Striping - Wooden Breast myopathies.

    Zambonelli, Paolo; Zappaterra, Martina; Soglia, Francesca; Petracci, Massimiliano; Sirri, Federico; Cavani, Claudio; Davoli, Roberta

    2016-12-01

    White Striping and Wooden Breast (WS/WB) are abnormalities increasingly occurring in the fillets of high breast yield and growth rate chicken hybrids. These defects lead to consistent economic losses for poultry meat industry, as affected broiler fillets present an impaired visual appearance that negatively affects consumers' acceptability. Previous studies have highlighted in affected fillets a severely damaged muscle, showing profound inflammation, fibrosis, and lipidosis. The present study investigated the differentially expressed genes and pathways linked to the compositional changes observed in WS/WB breast muscles, in order to outline a more complete framework of the gene networks related to the occurrence of this complex pathological picture. The biochemical composition was performed on 20 pectoralis major samples obtained from high breast yield and growth rate broilers (10 affected vs. 10 normal) and 12 out of the 20 samples were used for the microarray gene expression profiling (6 affected vs. 6 normal). The obtained results indicate strong changes in muscle mineral composition, coupled to an increased deposition of fat. In addition, 204 differentially expressed genes (DEG) were found: 102 up-regulated and 102 down-regulated in affected breasts. The gene expression pathways found more altered in WS/WB muscles are those related to muscle development, polysaccharide metabolic processes, proteoglycans synthesis, inflammation, and calcium signaling pathway. On the whole, the findings suggest that a multifactorial and complex etiology is associated with the occurrence of WS/WB muscle abnormalities, contributing to further defining the transcription patterns associated with these myopathies. © 2016 Poultry Science Association Inc.

  1. Diagnosis of myocardial involvement in patients with systemic myopathies with 15-(p-[I-123]iodophenyl) pentadecanoic acid (IPPA) SPECT

    Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St. [Bonn Univ. (Germany); Knapp, F.F. [Oak Ridge National Lab., TN (United States)

    1992-03-01

    Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-[I-123]iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of {beta}-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques.

  2. Diagnosis of myocardial involvement in patients with systemic myopathies with 15-(p-(I-123)iodophenyl) pentadecanoic acid (IPPA) SPECT

    Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St. (Bonn Univ. (Germany)); Knapp, F.F. (Oak Ridge National Lab., TN (United States))

    1992-01-01

    Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-(I-123)iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of {beta}-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques.

  3. Diagnosis of myocardial involvement in patients with systemic myopathies with 15-(p-[I-123]iodophenyl) pentadecanoic acid (IPPA) SPECT

    Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St.; Knapp, F.F.

    1992-01-01

    Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-[I-123]iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of β-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques

  4. Statin myopathy: the fly in the ointment for the prevention of cardiovascular disease in the 21st century?

    Keen, Helen I; Krishnarajah, Janakan; Bates, Timothy R; Watts, Gerald F

    2014-09-01

    Cardiovascular disease (CVD) remains the leading cause of death in industrialized nations. Despite clear evidence of CVD risk reduction with HMG-CoA reductase inhibitors (statins), the side effects of these medications, particularly myopathy, limit their effectiveness. Studies into the mechanisms, aetiology and management of statin myopathy are limited by lack of an internationally agreed clinical definition and tools for assessing outcomes. Currently there is a paucity of evidence to guide the management of patients affected by statin myopathy; with the exception of dose reduction, there is little evidence that other strategies can improve statin tolerance, and even less evidence to suggest these alternate dosing strategies reduce cardiovascular risk. This review will cover current definitions, clinical presentations, risk factors, pathogenesis and management. PubMed was searched (English language, to 2014) for key articles pertaining to statin myopathy. This review then briefly describes our experience of managing this condition in a tertiary lipid disorders clinic, in the setting of limited guiding evidence. Knowledge gaps in the field of statin myopathy are identified and future research directions are suggested. We urge the need for international attention to address this important, but largely neglected clinical problem, that if unresolved will remain an impediment to the effective prevention and treatment of CVD.

  5. Exercise Training Prevents Cardiovascular Derangements Induced by Fructose Overload in Developing Rats.

    Daniela Farah

    Full Text Available The risks of chronic diseases associated with the increasing consumption of fructose-laden foods are amplified by the lack of regular physical activity and have become a serious public health issue worldwide. Moreover, childhood eating habits are strongly related to metabolic syndrome in adults. Thus, we aimed to investigate the preventive role of exercise training undertaken concurrently with a high fructose diet on cardiac function, hemodynamics, cardiovascular autonomic modulation and oxidative stress in male rats after weaning. Male Wistar rats were divided into 4 groups (n = 8/group: Sedentary control (SC, Trained control (TC, Sedentary Fructose (SF and Trained Fructose (TF. Training was performed on a treadmill (8 weeks, 40-60% of maximum exercise test. Evaluations of cardiac function, hemodynamics, cardiovascular autonomic modulation and oxidative stress in plasma and in left ventricle (LV were performed. Chronic fructose overload induced glucose intolerance and an increase in white adipose tissue (WAT weight, in myocardial performance index (MPI (SF:0.42±0.04 vs. SC:0.24±0.05 and in arterial pressure (SF:122±3 vs. SC:113±1 mmHg associated with increased cardiac and vascular sympathetic modulation. Fructose also induced unfavorable changes in oxidative stress profile (plasmatic protein oxidation- SF:3.30±0.09 vs. SC:1.45±0.08 nmol/mg prot; and LV total antioxidant capacity (TRAP- SF: 2.5±0.5 vs. SC:12.7±1.7 uM trolox. The TF group showed reduced WAT, glucose intolerance, MPI (0.35±0.04, arterial pressure (118±2mmHg, sympathetic modulation, plasmatic protein oxidation and increased TRAP when compared to SF group. Therefore, our findings indicate that cardiometabolic dysfunctions induced by fructose overload early in life may be prevented by moderate aerobic exercise training.

  6. Exercise Training Prevents Cardiovascular Derangements Induced by Fructose Overload in Developing Rats

    Farah, Daniela; Nunes, Jonas; Sartori, Michelle; Dias, Danielle da Silva; Sirvente, Raquel; Silva, Maikon B.; Fiorino, Patrícia; Morris, Mariana; Llesuy, Susana; Farah, Vera; Irigoyen, Maria-Cláudia; De Angelis, Kátia

    2016-01-01

    The risks of chronic diseases associated with the increasing consumption of fructose-laden foods are amplified by the lack of regular physical activity and have become a serious public health issue worldwide. Moreover, childhood eating habits are strongly related to metabolic syndrome in adults. Thus, we aimed to investigate the preventive role of exercise training undertaken concurrently with a high fructose diet on cardiac function, hemodynamics, cardiovascular autonomic modulation and oxidative stress in male rats after weaning. Male Wistar rats were divided into 4 groups (n = 8/group): Sedentary control (SC), Trained control (TC), Sedentary Fructose (SF) and Trained Fructose (TF). Training was performed on a treadmill (8 weeks, 40–60% of maximum exercise test). Evaluations of cardiac function, hemodynamics, cardiovascular autonomic modulation and oxidative stress in plasma and in left ventricle (LV) were performed. Chronic fructose overload induced glucose intolerance and an increase in white adipose tissue (WAT) weight, in myocardial performance index (MPI) (SF:0.42±0.04 vs. SC:0.24±0.05) and in arterial pressure (SF:122±3 vs. SC:113±1 mmHg) associated with increased cardiac and vascular sympathetic modulation. Fructose also induced unfavorable changes in oxidative stress profile (plasmatic protein oxidation- SF:3.30±0.09 vs. SC:1.45±0.08 nmol/mg prot; and LV total antioxidant capacity (TRAP)- SF: 2.5±0.5 vs. SC:12.7±1.7 uM trolox). The TF group showed reduced WAT, glucose intolerance, MPI (0.35±0.04), arterial pressure (118±2mmHg), sympathetic modulation, plasmatic protein oxidation and increased TRAP when compared to SF group. Therefore, our findings indicate that cardiometabolic dysfunctions induced by fructose overload early in life may be prevented by moderate aerobic exercise training. PMID:27930685

  7. Protective role of ginger on lead induced derangement in plasma testosterone and luteinizing hormone levels of male sprague dawley rats

    Riaz, F.; Ayub, M.; Shaukat, S.

    2011-01-01

    Background: Lead is one of the most serious environmental threats to human health especially in developing countries. It damages multiple body systems including the reproductive system. Ginger's antioxidant and androgenic activity is reported in multiple animal studies. The aim of this study was to investigate the ameliorative effect of Zingiber officinale (ginger) on lead induced derangement in plasma testosterone and luteinizing hormone (LH) levels of male rats. Methods: Sixty adult male Sprague Dawley rats were used in this study in four groups. Group A served as normal control, Group B received 0.3% lead acetate in drinking water, Group C and group D received supplementary 0.5 and 1 gm/Kg bodyweight of ginger respectively along with lead acetate in drinking water. Five rats from each group were sacrificed at the end of 2nd, 4th and 6th weeks. Serum testosterone and LH levels were analysed using ELISA technique. Results: After co administration with different doses of ginger, serum testosterone level which was significantly decreased in lead treated group, showed a significant rise as compared to lead treated group. LH levels which had exhibited no significant change by lead treatment, after co administration with different doses of ginger, again showed no significant change. Conclusion: Oral administration of ginger ameliorated lead induced testicular toxicity in male rats by increasing serum testosterone level at all durations which might be a product of both its androgenic and antioxidant properties. (author)

  8. Amelioration of pancreatic and renal derangements in streptozotocin-induced diabetic rats by polyphenol extracts of Ginger (Zingiber officinale) rhizome.

    Kazeem, Mutiu Idowu; Akanji, Musbau Adewunmi; Yakubu, Musa Toyin

    2015-12-01

    Free and bound polyphenol extracts of Zingiber officinale rhizome were investigated for their antidiabetic potential in the pancreatic and renal tissues of diabetic rats at a dose of 500mg/kg body weight. Forty Wistar rats were completely randomized into five groups: A-E consisting of eight animals each. Group A (control) comprises normal healthy animals and were orally administered 1.0mL distilled water on a daily basis for 42 days while group B-E were made up of 50mg/kg streptozotocin (STZ)-induced diabetic rats. Group C and D received 1.0mL 500mg/kg body weight free and bound polyphenol extracts respectively while group E received 1.0mL 0.6mg/kg of glibenclamide. Administration of the extracts to the diabetic rats significantly reduced (pZingiber officinale could ameliorate diabetes-induced pancreatic and renal derangements in rats. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  9. An ex vivo study on immunohistochemical localization of MMP-7 and MMP-9 in temporomandibular joint discs with internal derangement

    C. Loreto

    2013-04-01

    Full Text Available Internal derangement (ID is among the most common disorders of the temporomandibular joint (TMJ. Previous research by our group highlighted a correlation between apoptosis and TMJ ID. Metalloproteinases (MMP-7 and -9 have been shown to play an important role in extracellular matrix ECM homeostasis and, through it, in joint disc remodelling. The immunohistochemical expression of MMP-7 and -9 was investigated in discs from patients with TMJ ID and from healthy donors and compared with the degree of histological tissue degeneration. The collagen fibre arrangement in pathological discs exhibited varying degrees of disruption. New vessels were consistently detected; endothelial cells from these vessels were immunolabelled with both MMP-7 and MMP-9. More or less intense MMP-7 and MMP-9 immunolabelling was detected in the cytoplasm of disc cells from all patients. MMP-7 and MMP-9 immunostaining was significantly different between pathological and normal discs and correlated with the extent of histopathological degeneration. MMP-7 and MMP-9 upregulation in discs from patients with TMJ ID demonstrates their involvement in disc damage in this disorder. A greater understanding of these processes could help identify ways to curb MMP overproduction without affecting their tissue remodelling action. The design of specific inhibitors for these MMPs would not only help to gain insights into the biological roles of MMPs, but would also aid in developing therapeutic interventions for diseases associated with abnormal ECM degradation.

  10. The neurosteroid pregnenolone reverts microtubule derangement induced by the loss of a functional CDKL5-IQGAP1 complex.

    Barbiero, Isabella; Peroni, Diana; Tramarin, Marco; Chandola, Chetan; Rusconi, Laura; Landsberger, Nicoletta; Kilstrup-Nielsen, Charlotte

    2017-09-15

    CDKL5 is a protein kinase that plays a key role for neuronal functions as testified by the onset of complex neuronal dysfunctions in patients with genetic lesions in CDKL5. Here we identify a novel interactor of CDKL5, IQGAP1, a fundamental regulator of cell migration and polarity. In accordance with a functional role of this interaction, depletion of CDKL5 impairs cell migration and impedes the localization of IQGAP1 at the leading edge. Moreover, we demonstrate that CDKL5 is required for IQGAP1 to form a functional complex with its effectors, Rac1 and the microtubule plus end tracking protein CLIP170. These defects eventually impact on the microtubule association of CLIP170, thus deranging their dynamics. CLIP170 is a cellular target of the neurosteroid pregnenolone; by blocking CLIP170 in its active conformation, pregnenolone is capable of restoring the microtubule association of CLIP170 in CDKL5 deficient cells and rescuing morphological defects in neurons devoid of CDKL5. These findings provide novel insights into CDKL5 functions and pave the way for target-specific therapeutic strategies for individuals affected with CDKL5-disorder. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. A cross-sectional study of the relationship between serum sexual hormone levels and internal derangement of temporomandibular joint.

    Madani, A S; Shamsian, A A; Hedayati-Moghaddam, M R; Fathi-Moghadam, F; Sabooni, M R; Mirmortazavi, A; Golmohamadi, M

    2013-08-01

    Temporomandibular disorders (TMD) are defined as clinical conditions that involve the masticatory muscles, temporomandibular joint (TMJ) or both. The aim of this study was to evaluate serum 17β-oestradiol and progesterone levels in menstruating women affected by internal derangement of the TMJ. A total of 142 women (mean age 30·2 ± 6·7) who referred to medical diagnostic laboratory of Iranian Academic Centre for Education, Culture and Research (ACECR), Mashhad Branch, were enrolled during 2007 and 2008. Forty-seven individuals had disc displacement with reduction (Group IIa) according to Research Diagnostic Criteria (RDC)/TMD Axis I diagnosis. Radioimmunoassay was used for the detection of serum 17β-oestradiol and progesterone levels in all 142 subjects. The mean progesterone level was significantly higher in control group (11·6 ± 10·4 ng mL(-1) ) compared to women with TMD (8·4 ± 6·8 ng mL(-1) , P = 0·03). No significant difference was found in two groups regarding 17β-oestradiol level. Lower progesterone level in women with TMD can suggest the more important role of this hormone in the development of the disorder. © 2013 John Wiley & Sons Ltd.

  12. Gd-DTPA (gadolinium diethylenetriamine pentaacetic acid) in MR imaging of the internal derangement of temporomandibular joint

    Tange, Kazuhisa; Mihara, Manabu; Maeda, Sanae; Iwata, Hiroyuki; Ito, Noboru; Fukaya, Masahiko.

    1990-01-01

    Magnetic resonance (MR) imaging was performed in five internal derangement of temporomandibular joint (TMJ) patients, before and after intravenous administration of gadolinium-DTPA (Gd-DTPA) as a contrast agent. MR imaging was performed with a 0.5 tesla unit (VISTA MR; PICKER INTERNATIONAL) using a surface coil. We obtained multiple 5 mm sagital images with open and closed jaw positions. Precontrast proton density images were obtained with a repetition time (TR) of 1,000 msec and an echo time (TE) of 40 msec (TR/TE=1,000/40). Gd-DTPA was administered intravenously in a dose of 0.2 ml per kilogram of body weight. After the injection, postcontrast T1 weighted images (500/20) or postcontrast proton density images (1,000/40) were obtained. In the postcontrast T1 weighted images, the soft tissue surrounding the articular disk was enhanced and it provided helpful information for assessing the disk position. On the other hand, there was no effect of the contrast agent in the postcontrast proton density images. None of the patients experienced allergic reactions or other side effects. Gd-DTPA appeared to be a safe and effective contrast agent for MR imaging with T1 weighted images. However, compared with our usual imaging of the TMJ, the imaging did not indicate greater MR sensitivity for detecting the articular disk by means of Gd-DTPA enhancement. (author)

  13. Skeletal muscle-specific HMG-CoA reductase knockout mice exhibit rhabdomyolysis: A model for statin-induced myopathy.

    Osaki, Yoshinori; Nakagawa, Yoshimi; Miyahara, Shoko; Iwasaki, Hitoshi; Ishii, Akiko; Matsuzaka, Takashi; Kobayashi, Kazuto; Yatoh, Shigeru; Takahashi, Akimitsu; Yahagi, Naoya; Suzuki, Hiroaki; Sone, Hirohito; Ohashi, Ken; Ishibashi, Shun; Yamada, Nobuhiro; Shimano, Hitoshi

    2015-10-23

    HMG-CoA reductase (HMGCR) catalyzes the conversion of HMG-CoA to mevalonic acid (MVA); this is the rate-limiting enzyme of the mevalonate pathway that synthesizes cholesterol. Statins, HMGCR inhibitors, are widely used as cholesterol-reducing drugs. However, statin-induced myopathy is the most adverse side effect of statins. To eludicate the mechanisms underlying statin the myotoxicity and HMGCR function in the skeletal muscle, we developed the skeletal muscle-specific HMGCR knockout mice. Knockout mice exhibited postnatal myopathy with elevated serum creatine kinase levels and necrosis. Myopathy in knockout mice was completely rescued by the oral administration of MVA. These results suggest that skeletal muscle toxicity caused by statins is dependent on the deficiencies of HMGCR enzyme activity and downstream metabolites of the mevalonate pathway in skeletal muscles rather than the liver or other organs. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. One-year glargine treatment can improve the course of lung disease in children and adolescents with cystic fibrosis and early glucose derangements.

    Mozzillo, Enza; Franzese, Adriana; Valerio, Giuliana; Sepe, Angela; De Simone, Ilaria; Mazzarella, Gianfranco; Ferri, Pasqualina; Raia, Valeria

    2009-05-01

    Diabetes increases morbidity and mortality in cystic fibrosis (CF) patients, but several studies indicate that also prediabetic status may have a potential impact on both nutrition and lung function. To evaluate the effect of glargine on the clinical course in CF patients with early glucose derangements. CF population was screened for glucose tolerance. CF patients with age >10 yr were screened with fasting hyperglycemia (FH). CF patients with age >10 yr without FH and those with age <10 yr with occasional FH were evaluated for glucose abnormalities on the basis of oral glucose tolerance test and/or continuous glucose monitoring system. All CF patients with glucose derangements were enrolled in an open clinical trial with glargine. Body mass index (BMI) z-score, forced expiratory volume in the first second (FEV(1)), number of acute pulmonary exacerbations and hemoglobin A1c, were as outcome measures at baseline and after 1 yr of treatment. After 12 months of therapy, BMI z-score improved only in patients with baseline BMI z-score less than -1 (p = 0.017). An 8.8% increase in FEV(1) (p = 0.01) and 42% decrease in the number of pulmonary exacerbations (p = 0.003) were found in the whole group compared with previous 12 months of therapy. Glargine could represent an innovative strategy to prevent lung disease progression in CF patients with early glucose derangements. Larger controlled trials are needed to better clarify the effects of insulin on clinical status in CF patients with early glucose derangements.

  15. Evaluation of inflammatory biomarkers associated with oxidative stress and histological assessment of magnetic therapy on experimental myopathy in rats.

    Vignola, María Belén; Dávila, Soledad; Cremonezzi, David; Simes, Juan C; Palma, José A; Campana, Vilma R

    2012-12-01

    The effect of pulsed electromagnetic field (PEMF) therapy, also called magnetic therapy, upon inflammatory biomarkers associated with oxidative stress plasma fibrinogen, nitric oxide (NO), L-citrulline, carbonyl groups, and superoxide dismutase (SOD) was evaluated through histological assessment, in rats with experimental myopathy. The groups studied were: (A) control (intact rats that received PEMF sham exposures); (B) rats with myopathy and sacrificed 24 h later; (C) rats with myopathy; (D) rats with myopathy and treated with PEMF; and (E) intact rats treated with PEMF. Groups A, C, D, and E were sacrificed 8 days later. Myopathy was induced by injecting 50 μl of 1% carrageenan λ (type IV) once sub-plantar. Treatment was carried out with PEMF emitting equipment with two flat solenoid disks for 8 consecutive days in groups D and E, at 20 mT and 50 Hz for 30 min/day/rat. The biomarkers were determined by spectrophotometry. The muscles (5/8) were stained with Hematoxylin-Eosin and examined by optic microscopy. Quantitative variables were statistically analyzed by the Fisher test, and categorical applying Pearson's Chi Squared test at p < 0.05 for all cases. In Groups B and C, the biomarkers were significantly increased compared to A, D, and E groups: fibrinogen (p < 0.001); NO, L-citrulline and carbonyl groups (p < 0.05); SOD (p < 0.01) as well as the percentage of area with inflammatory infiltration (p < 0.001). PEMF caused decreased levels of fibrinogen, L-citrulline, NO, SOD, and carbonyl groups and significant muscle recovery in rats with experimental myopathies.

  16. Subclinical myopathy in patients with colorectal cancer: clinical-pathological characterization and search for tissue markers

    Massimo Vecchiato

    2012-03-01

    Full Text Available Skeletal muscle in patients with cancer undergoes many morphological changes due to immuno-inflammatory factors of tumor origin or treatment.T he latest event of these changes is cancer cachexia. Aim of the study is to identify myopathic features in skeletal muscle biopsies from weight stable patients with colorectal cancer and without cachexia or asthenia / weakness, that could possibly provide new diagnostic and prognostic cancer biomarkers. Morphometric analyses and immunohistochemical studies were performed on intraoperative muscle biopsies from patients with colorectal cancer and from weight stable patients undergoing surgery for benign non-inflammatory conditions. A rectus abdominis biopsy was taken in all patients and controls.A correlation between histopathologic findings and clinical characteristics, circulating inflammatory biomarkers and markers of muscle necrosis,surgery data and cancer phenotype were investigated.. Forty four patients (21male/23 female and 17 controls (6 male/11 female (p=NS were studied. In cancer patients’biopsies we observed asubclinical myopathy characterized by an abnormal distribution of myonuclei, which are localized inside the myofiber rather than at the periphery, and by the presence of regenerating muscle fibers. The percentage of myofibers with internalized nuclei is significantly higher in patients (median= 9%, IQR= 3.7-18.8 than in controls (median= 2.7%, IQR= 1.7-3.2 ( p=0.0002. In patients we observed an inverse correlation between the number of centronucleated fibers and the presence of node metastasis (N+(ρ=-0.64 (p=0.002. Patients affected with colorectal cancer display early sign of a myopathy, characterized by centronucleated and regenerating myofibers. This myopathy appears to be associated with an early stage of neoplasia and it could be an adaptive response of muscle to cancer. We hope a future application of these findings as a possible early diagnostic and prognostic biomarker of

  17. Autism in the Son of a Woman with Mitochondrial Myopathy and Dysautonomia: A Case Report.

    Brown, Bradley D; Rais, Theodore

    2015-01-01

    The relationship between autism spectrum disorders and mitochondrial dysfunction, including mitochondrial myopathies and other mitochondrial diseases, is an area of ongoing research. All autism spectrum disorders are known to be heritable, via genetic and/or epigenetic mechanisms, but specific modes of inheritance are not well characterized. Nevertheless, autism spectrum disorders have been linked to many specific genes associated with mitochondrial function, especially to genes involved in mitochondrial tRNA and the electron transport chain, both particularly vulnerable to point mutations, and clinical research also supports a relationship between the two pathologies. Although only a small minority of patients with autism have a mitochondrial disease, many patients with mitochondrial myopathies have autism spectrum disorder symptoms, and these symptoms may be the presenting symptoms, which presents a diagnostic challenge for clinicians. The authors report the case of a 15-year-old boy with a history of autism spectrum disorder and neurocardiogenic syncope, admitted to the inpatient unit for self-injury, whose young mother, age 35, was discovered to suffer from mitochondrial myopathy, dysautonomia, neurocardiogenic syncope, Ehler-Danlos syndrome, and other uncommon multisystem pathologies likely related to mitochondrial dysfunction. This case illustrates the need for a high index of suspicion for mitochondrial disease in patients with autism, as they have two orders of magnitude greater risk for such diseases than the general population. The literature shows that mitochondrial disease is underdiagnosed in autism spectrum disorder patients and should not be viewed as a "zebra" (i.e., an obscure diagnosis that is made when a more common explanation is more likely).

  18. Craniopharyngioma presenting with severe hyponatremia, hyponatremia-induced myopathy, and panhypopituitarism: a case report.

    Dilrukshi, M D S A; Sandakumari, G V N; Abeysundara, P K; Chang, T

    2017-02-05

    Craniopharyngiomas are rare intracranial tumors commonly presenting with neurological symptoms. Reports of severe hyponatremia as a presenting manifestation of a craniopharyngioma and hyponatremia-induced myopathy are rare. We report the case of a patient with craniopharyngioma presenting with severe hyponatremia, panhypopituitarism, and hyponatremia-induced myopathy. A 52-year-old Sri Lankan man presented with anorexia, nausea, fatigue, generalized muscle weakness, and cramps for 1 week. The onset of his illness had been preceded by vomiting and diarrhea for 1 day which he attributed to food poisoning. On examination, he had an apathetic disposition with a generalized "sallow complexion." He was not dehydrated. Apart from reduced muscle power (4/5) and hyporeflexia, the neurological examination was normal. His serum sodium was 102 mmol/l; potassium 4.1 mmol/l; chloride 63 mmol/l; plasma osmolality 272 mosm/KgH 2 O; urine osmolality 642 mosm/KgH 2 O; and urine sodium 79 mmol/l. His creatine phosphokinase was 12,400 U/l, lactate dehydrogenase 628 U/l, aspartate aminotransferase 360 U/l, and alanine aminotransferase 64 U/l. His hormone profile revealed panhypopituitarism. An electromyogram showed nonspecific abnormalities while a muscle biopsy did not show any pathology. Magnetic resonance imaging of his brain demonstrated a well-defined craniopharyngioma with suprasellar extension. His pituitary gland was compressed and the pituitary stalk was displaced by the tumor. He had marked improvement in muscle power and rapid reduction of serum creatine phosphokinase levels paralleling the correction of severe hyponatremia, even before the initiation of hormone replacement. This case illustrates the rare presentation of severe hyponatremia and hyponatremia-induced myopathy in patients with craniopharyngioma, awareness of which would facilitate early appropriate investigations and treatment.

  19. BAG3-related myopathy, polyneuropathy and cardiomyopathy with long QT syndrome.

    Kostera-Pruszczyk, Anna; Suszek, Małgorzata; Płoski, Rafał; Franaszczyk, Maria; Potulska-Chromik, Anna; Pruszczyk, Piotr; Sadurska, Elżbieta; Karolczak, Justyna; Kamińska, Anna M; Rędowicz, Maria Jolanta

    2015-12-01

    BAG3 belongs to BAG family of molecular chaperone regulators interacting with HSP70 and anti-apoptotic protein Bcl-2. It is ubiquitously expressed with strong expression in skeletal and cardiac muscle, and is involved in a panoply of cellular processes. Mutations in BAG3 and aberrations in its expression cause fulminant myopathies, presenting with progressive limb and axial muscle weakness, and respiratory insufficiency and neuropathy. Herein, we report a sporadic case of a 15-years old girl with symptoms of myopathy, demyelinating polyneuropathy and asymptomatic long QT syndrome. Genetic testing demonstrated heterozygous mutation Pro209Leu (c.626C > T) in exon 3 of BAG3 gene causing severe myopathy and neuropathy, often associated with restrictive cardiomyopathy. We did not find a mutation in any known LQT syndrome genes. Analysis of muscle biopsy revealed profound disintegration of Z-discs with extensive accumulation of granular debris and large inclusions within fibers. We demonstrated profound alterations in BAG3 distribution as the protein localized to long filamentous structures present across the fibers that were positively stained not only for α-actinin but also for desmin and filamin indicating that those disintegrated Z-disc regions contained also other sarcomeric proteins. The mutation caused a decrease in the content of BAG3 and HSP70, and also of α-actinin desmin, filamin and fast myosin heavy chain, confirming its severe effect on the muscle fiber morphology and thus function. We provide further evidence that BAG3 is associated with Z-disc maintenance, and the Pro209Leu mutation may occur worldwide. We also provide a summary of cases associated with this mutation reported so far.

  20. Equine atypical myopathy caused by hypoglycin A intoxication associated with ingestion of sycamore maple tree seeds.

    Żuraw, A; Dietert, K; Kühnel, S; Sander, J; Klopfleisch, R

    2016-07-01

    Evidence suggest there is a link between equine atypical myopathy (EAM) and ingestion of sycamore maple tree seeds. To further evaluate the hypothesis that the ingestion of hypoglycin A (HGA) containing sycamore maple tree seeds causes acquired multiple acyl-CoA dehydrogenase deficiency and might be associated with the clinical and pathological signs of EAM. Case report. Necropsy and histopathology, using hematoxylin and eosin and Sudan III stains, were performed on a 2.5-year-old mare that died following the development of clinical signs of progressive muscle stiffness and recumbency. Prior to death, the animal ingested sycamore maple tree seeds (Acer pseudoplatanus). Detection of metabolites in blood and urine obtained post mortem was performed by rapid ultra-performance liquid chromatography-tandem mass spectrometry. Data from this case were compared with 3 geldings with no clinical history of myopathy. Macroscopic examination revealed fragments of maple tree seeds in the stomach and severe myopathy of several muscle groups including Mm. intercostales, deltoidei and trapezii. Histologically, the affected muscles showed severe, acute rhabdomyolysis with extensive accumulation of finely dispersed fat droplets in the cytoplasm of degenerated skeletal muscle cells not present in controls. Urine and serum concentrations of several acyl carnitines and acyl glycines were increased, and both contained metabolites of HGA, a toxic amino acid present in sycamore maple tree seeds. The study supports the hypothesis that ingestion of HGA-containing maple tree seeds may cause EAM due to acquired multiple acyl-CoA dehydrogenase deficiency. © 2015 EVJ Ltd.

  1. Toxic myopathies: muscle biopsy features Miopatia tóxica: biópsia muscular

    Rosana Herminia Scola

    2007-03-01

    Full Text Available Several drugs and toxic substances can cause muscular abnormalities and are frequent causes of acquired myopathies. We present a series of 32 patients, predominance of young adult patients, diagnosed with toxic myopathy. The most common substances inducing myopathy were corticosteroids (56.2% followed by the propoxyphene, neuroleptics, zidovudine and drug-induced hypokalemia. The investigation showed normal serum creatine kinase levels in 65.4%, myopathic pattern of the needle electromyography in 40% and the more frequent histological diagnosis of the muscle biopsy was type 2 fiber atrophy (59.3%. Clinical features, etiology, course of the disease, serum levels of muscular enzymes, electromyographic features and, especially, muscle biopsy features are discussed.Diversos medicamentos e substâncias tóxicas podem causar alterações musculares e são causas freqüentes de miopatia adquirida. Apresentamos uma série de 32 pacientes, predomínio de pacientes adulto jovens, com miopatia tóxica. As substâncias mais relacionadas com a miopatia foram os corticosteróides (56,2% seguidos pelo propoxifeno, neurolépticos, zidovudina e drogas indutoras de hipocalemia. A investigação mostrou níveis normais de creatino quinase sérica em 65,4%, eletromiografia de agulha com padrão miopático em 40% e o mais freqüente diagnóstico histológico da biópsia muscular foi atrofia de fibras do tipo 2 (59,3%. As manifestações clínicas, etiologia, tempo de evolução, nível sérico das enzimas musculares, alterações da eletroneuromiografia e, especialmente, da biópsia muscular são discutidos.

  2. A Case of Myopathy, Encephalopathy, Lactic Acidosis and Stroke-Like Episodes (MELAS) Syndrome with Intracardiac Thrombus [corrected].

    Joo, Jung-Chul; Seol, Myung Do; Yoon, Jin Won; Lee, Young Soo; Kim, Dong-Keun; Choi, Yong Hoon; Ahn, Hyo Seong; Cho, Wook Hyun

    2013-03-01

    Myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS) is a multisystem clinical syndrome manifested by mitochondrial myopathy, encephalopathy, lactic acidosis and recurrent stroke-like episodes. A 27-year-old female with MELAS syndrome presented with cerebral infarction. Echocardiography revealed a thrombus attached to the apex of the hypertrophied left ventricle, with decreased systolic function. The embolism of the intracardiac thrombus might have been the cause of stroke. There should be more consideration given to the increased possibility of intracardiac thrombus formation when a MELAS patient with cardiac involvement is encountered.

  3. X linked neonatal centronuclear/myotubular myopathy: evidence for linkage to Xq28 DNA marker loci.

    Thomas, N S; Williams, H; Cole, G; Roberts, K; Clarke, A; Liechti-Gallati, S; Braga, S; Gerber, A; Meier, C; Moser, H

    1990-01-01

    We have studied the inheritance of several polymorphic Xq27/28 DNA marker loci in two three generation families with the X linked neonatal lethal form of centronuclear/myotubular myopathy (XL MTM). We found complete linkage of XLMTM to all four informative Xq28 markers analysed, with GCP/RCP (Z = 3.876, theta = 0.00), with DXS15 (Z = 3.737, theta = 0.00), with DXS52 (Z = 2.709, theta = 0.00), and with F8C (Z = 1.020, theta = 0.00). In the absence of any observable recombination, we are unable...

  4. Serum and tissue markers of myopathy in patients with colorectal cancer

    Nicoletta Adami

    2012-09-01

    Full Text Available Skeletal muscles in patients with cancer undergo many changes due to immuno-inflammatory factors of tumor origin, or to chemotherapy and irradiation. Aim of the present study is to identify serological biomarkers and early myopathic features in skeletal muscle biopsies from weight stable patients bearing colorectal cancer at the onset of disease. Morphometric analyses by histochemistry and immunohistochemistry were performed on intraoperative muscle biopsies from patients with early colorectal cancer and from weight stable patients undergoing surgery for benign non-inflammatory conditions. Serological analyses for testing markers of inflammation (C Reactive Protein, CRP, muscle enzymes, (Creatin Kinase, CK, soluble isoforms of adhesion molecules (Neural Cell Adhesion Molecule, NCAM, and a marker of protein turnover (prealbumin, a typical indicator of caloric and protein malnutrition were also performed. Fifty oncologic patients (28 male/22 female and 25 non oncologic patients (18 male/7 female (p=N.S. were studied. In muscles from cancer patients we observed a subclinical myopathy characterized by an abnormal distribution of myonuclei. The percentage of myofibers with internalized nuclei was significantly higher in oncologic (median= 13.1%, IQR= 6.0-20.3 than in non oncologic patients (median= 3%, IQR= 2.5-6.1 (p<0.0001. The frequency of these internally nucleated myofibers is even higher in a subgroup of oncologic patients taking myotoxic drugs. In cancer patients, we observed an inverse correlation between the number of internally nucleated fibers and the presence of node metastasis (N+ (ρ=-0.30 (p=0.03. Moreover, in patients with colorectal cancer, low serum levels of preoperative prealbumin (median= 167,7 mg/L, normal range 200-400 mg/L, were detected. The link between the observed early myopathy and long-term cachexia is supported also by the altered expression of sarcolemma associated proteins, in particular laminin and dystrophin

  5. Miopatia por corpos esferóides: relato de caso Spheroid body myopathy: case report

    Rosana Hermínia Scola

    2005-06-01

    Full Text Available A miopatia por corpos esferóides é doença rara, classificada no grupo das miopatias congênitas relacionadas aos distúrbios da desmina; apresenta, em geral, origem autossômica dominante e com início dos sintomas na fase adulta. Relatamos o caso de menina de sete anos, com diparesia facial, hipotrofia e hipotonia muscular generalizadas, arreflexia profunda generalizada, força muscular proximal nos membros superiores e inferiores e distal dos membros superiores grau 3 e distal nos membros inferiores grau 1. A eletromiografia de agulha evidenciou recrutamento aumentado e potenciais de unidade motora de curta duração e baixa amplitude, caracterizando um padrão miopático. A biópsia muscular revelou padrão misto para miopatia e desinervação e presença de corpos esferóides intracitoplasmáticos compatíveis com a miopatia por corpos esferóides. No presente caso, a paciente apresentou precocemente o início dos sintomas e não há relatos de casos semelhantes na família.Spheroid body myopathy is a rare illness classified in the group of the congenital myopathies as a desmin-related neuromuscular disorder, presenting dominant autosomical origin with the beginning of the symptoms in the adult phase. We report on a seven years old girl with facial paresia, generalized muscular hypotrophy and hypotony, generalized deep areflexia, proximal upper and lower limbs muscular strengh and distal upper limbs grade 3 and distal lower limbs grade 1. Needle electromyography evidenced increased conscription and potentials of motor unit of short duration and low amplitude, characterizing a myopathic standard. The muscle biopsy disclosed mixed standard to myopathy, denervation and inclusion bodies that are consistent to spheroid body myopathy. In this case, the patient presented, in advance, early beginning of the symptoms and there are no similar cases in the family.

  6. Severe insulin-resistant diabetes mellitus in patients with congenital muscle fiber type disproportion myopathy

    Vestergaard, H; Klein, H H; Hansen, T

    1995-01-01

    Congenital muscle fiber type disproportion myopathy (CFTDM) is a chronic, nonprogressive muscle disorder characterized by universal muscle hypotrophy and growth retardation. Histomorphometric examination of muscle shows a preponderance of smaller than normal type 1 fibers and overall fiber size....... Insulin receptor function and glycogen synthase (GS) activity and expression were examined in biopsies of vastus lateralis muscle. Despite a 45-90-fold increase in both fasting and postprandial serum insulin levels, both CFTDM patients had diabetes mellitus. Clamp studies revealed that the oldest boy had...

  7. Magnetic resonance imaging signal intensity of temporomandibular joint disk and posterior attachment in patients with internal derangement

    Jeong, Yeon Hwa; Cho, Bong Hae

    2001-01-01

    To analyze the possible association between magnetic resonance imaging signal intensity of temporomandibular joint disk and posterior attachment, and the type and extent of disk displacement, disk donfiguration, effusion and clinical signs in patients with internal derangement. Magnetic resonance images of the 132 temporomandibular joints of 66 patients with temporomandibular joint displacement were analyzed. The clinical findings were obtained by retrospective review of the patients' records. The type and extent of disk displacement, disk configuration and effusion were evaluated on the proton density MR images. The signal intensity from the anterior band, posterior band and posterior attachment were measured on MR images. The associations between the type and extent of disk displacement, disk configuration, effusion and clinical signs and the MR signal intensity of disk and posterior attachment were statistically analyzed by student's t-test. Of 132 joints, 87 (65.9%) showed anterior disk displacement with reduction (ADR) and 45 (34.1%) showed anterior disk displacement without reduction (ADnR). This signals from posterior attachments were lower in joints with ADnR than those of ADR (p<0.05). The results showed statistically significant (p<0.05) association between the type and extent of disk displacement and disk configuration, and decreased signal intensity of posterior attachment. There were no statistical associations between pain, noise and limited mouth opening, and signal intensity of disk and posterior attachment. The average signal from posterior attachment was lower in joints with ADnR than that of ADR. The type and extent of disk displacement and disk configuration appeared to be correlated with the signal intensity from posterior attachment

  8. The prevalence of deranged C-reactive protein and albumin in patients with incurable cancer approaching death.

    Gray, Sarah; Axelsson, Bertil

    2018-01-01

    Amongst patients with incurable cancer approaching death, cachexia is common and associated with adverse outcomes. The term cachexia lacks a universally accepted definition and there is no consensus regarding which variables are to be measured. Furthermore, an elevated C-reactive protein is a common clinical challenge in this patient group. This study aims to add to the ongoing discussion regarding the definition of cancer cachexia and to study the role of C-reactive protein and s-albumin in this context. A 1-year cohort, consisting of 155 cancer patients enrolled in a specialized palliative home care team in the city of Östersund, Sweden, that were deceased during the year of 2015 was studied. Laboratory measures were studied within 0-30 and 31-60 days prior to death. C-reactive protein >10 mg/L and coinciding s-albumin death was noted. The prevalence of "laboratory cachexia" was 85% 0-30 days prior to death compared to 66% 31-60 days prior to death (pdeath, with a median of 47 days. The median values for C-reactive protein and s-albumin within 0-30 days prior to death were 84mg/L and 23g/L respectively. Could markedly deranged values of C-reactive protein and s-albumin, such as found in this study, signal a relatively short remaining survival time in patients with incurable cancer and no clinical signs of ongoing infection? The role of "laboratory cachexia" in this context as well as the cut off values for the laboratory measures included may be further discussed.

  9. The prevalence of deranged C-reactive protein and albumin in patients with incurable cancer approaching death.

    Sarah Gray

    Full Text Available Amongst patients with incurable cancer approaching death, cachexia is common and associated with adverse outcomes. The term cachexia lacks a universally accepted definition and there is no consensus regarding which variables are to be measured. Furthermore, an elevated C-reactive protein is a common clinical challenge in this patient group. This study aims to add to the ongoing discussion regarding the definition of cancer cachexia and to study the role of C-reactive protein and s-albumin in this context.A 1-year cohort, consisting of 155 cancer patients enrolled in a specialized palliative home care team in the city of Östersund, Sweden, that were deceased during the year of 2015 was studied. Laboratory measures were studied within 0-30 and 31-60 days prior to death. C-reactive protein >10 mg/L and coinciding s-albumin <30 g/L was referred to as "laboratory cachexia". Also, the number of days from the first found "laboratory cachexia" until death was noted.The prevalence of "laboratory cachexia" was 85% 0-30 days prior to death compared to 66% 31-60 days prior to death (p<0.01. The majority of patients (75% had an onset of "laboratory cachexia" within 0-120 days prior to death, with a median of 47 days. The median values for C-reactive protein and s-albumin within 0-30 days prior to death were 84mg/L and 23g/L respectively.Could markedly deranged values of C-reactive protein and s-albumin, such as found in this study, signal a relatively short remaining survival time in patients with incurable cancer and no clinical signs of ongoing infection? The role of "laboratory cachexia" in this context as well as the cut off values for the laboratory measures included may be further discussed.

  10. Frequency of Metabolic Risk Factors in Children with Urinary Tract Stones Referred to Hamadan Pediatric Nephrology Clinic

    H.E. Momtaz

    2012-07-01

    Full Text Available Introduction & Objective: Urinary stones are among the most common complaints referred to nephrologist and urologists. Although incidence of urolithiasis is low in children compared to adults and only 7% of all urinary stones are diagnosed before the age of 16 but stones are detected more frequently in pediatric age group in recent years. Metabolic derangements, infection, neurogenic bladder and urinary obstruction are major risk factors of urolithiasis. Common metabolic risk factors of urolithiasis in children are hypercalciuria, uricosuria, hypocitraturia, hyperoxaluria, metabolic acidosis and cystinuria. There are many clinical studies about the frequency of these metabolic risk factors with different results reflecting difference in diet, geographic area and genetics in study populations. In this study we tried to evaluate the frequency of metabolic causes of urinary stones in children referred to Hamadan pediatric nephrology clinic.Materials & Methods: In this cross sectional-descriptive study 156 patients referred due to urinary stones to pediatric nephrology clinic underwent thorough metabolic evaluations including: serum calcium,phosphorus, uric acid, creatinine and non fasting random urine sample for calcium, creatinine , uric acid , oxalate, citrate and cystine . urine solute: creatinine ratios were calculated and compared with normative data.Results: Of 156 patients 136(87.2% had metabolic derangements including: hyperuricosuria in 71 (45.5%, hypercalciuria in 41(26.3%, hypocitraturia in 26 (16.7%, hyperoxaluria in 16(10.3%,cystinuria in 1(0.6% and metabolic acidosis in 39 (25%.Conclusion: High rate of metabolic derangement in pediatric urinary stone patients mandates proper metabolic evaluation in all of them. hyperuricosuria was the most common metbolic finding instead of hypercalciuria in this study. This could be due to differences in diet, geographic area and genetic background in various populations.(Sci J Hamadan Univ Med Sci

  11. The Effect of the Wooden Breast Myopathy on Sarcomere Structure and Organization.

    Velleman, Sandra G; Clark, Daniel L; Tonniges, Jeffrey R

    2018-03-01

    The wooden breast (WB) has been classically identified by the phenotypic presence of a wood-like pectoralis major (p. major) muscle. The WB-affected p. major muscle is characterized by necrotic muscle fibers and the replacement of muscle with connective tissue, water, and fat. The objective of the current study was to determine the effect of the WB myopathy on sarcomere organization by transmission electron microscopy. Sarcomere structure and organization were examined in two broiler lines with a high incidence of WB (Lines A and B) and another broiler line without WB (Line C). Affected muscle had an increase in smaller myofibers with diameters of 20 μm or less. Sarcomere organization decreased with fiber diameter in both Lines A and B. The structure and organization of sarcomeres in Line C were similar to WB-unaffected muscle in Lines A and B. Taken together, these data demonstrate that the WB myopathy detrimentally affects sarcomere organization in a broiler line-specific manner. Disorganization of sarcomere structure will affect the function of the p. major muscle as well as meat quality.

  12. Homozygous LIPE mutation in siblings with multiple symmetric lipomatosis, partial lipodystrophy, and myopathy.

    Zolotov, Sagit; Xing, Chao; Mahamid, Riad; Shalata, Adel; Sheikh-Ahmad, Mohammed; Garg, Abhimanyu

    2017-01-01

    Despite considerable progress in identifying causal genes for lipodystrophy syndromes, the molecular basis of some peculiar adipose tissue disorders remains obscure. In an Israeli-Arab pedigree with a novel autosomal recessive, multiple symmetric lipomatosis (MSL), partial lipodystrophy and myopathy, we conducted exome sequencing of two affected siblings to identify the disease-causing mutation. The 41-year-old female proband and her 36-year-old brother reported marked accumulation of subcutaneous fat in the face, neck, axillae, and trunk but loss of subcutaneous fat from the lower extremities and progressive distal symmetric myopathy during adulthood. They had increased serum creatine kinase levels, hypertriglyceridemia and low levels of high-density lipoprotein cholesterol. Exome sequencing identified a novel homozygous NC_000019.9:g.42906092C>A variant on chromosome 19, leading to a NM_005357.3:c.3103G>T nucleotide change in coding DNA and corresponding p.(Glu1035*) protein change in hormone sensitive lipase (LIPE) gene as the disease-causing variant. Sanger sequencing further confirmed the segregation of the mutation in the family. Hormone sensitive lipase is the predominant regulator of lipolysis from adipocytes, releasing free fatty acids from stored triglycerides. The homozygous null LIPE mutation could result in marked inhibition of lipolysis from some adipose tissue depots and thus may induce an extremely rare phenotype of MSL and partial lipodystrophy in adulthood associated with complications of insulin resistance, such as diabetes, hypertriglyceridemia and hepatic steatosis. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  13. Inflammatory myopathies in childhood: correlation between nailfold capillaroscopy findings and clinical and laboratory data.

    Nascif, Ana K S; Terreri, Maria T R A; Len, Cláudio A; Andrade, Luis E C; Hilário, Maria O E

    2006-01-01

    Nailfold capillaroscopy is an important tool for the diagnosis and follow-up of patients with rheumatic diseases, in particular dermatomyositis and scleroderma. A relationship has been observed in adults between improved capillaroscopic findings and reduced disease activity. Our aim was to correlate disease activity (clinical and laboratory data) and nailfold capillaroscopy findings in 18 patients with inflammatory myopathies. This prospective study included 13 juvenile dermatomyositis patients (Bohan and Peter criteria) (mean age of 8.8 years) and five patients with overlap syndrome (mean age of 15.7 years). We evaluated disease activity (skin abnormalities and muscle weakness, muscle enzymes and acute phase reactants) and its correlation with nailfold capillaroscopy findings (dilatation of isolated loops, dropout of surrounding vessels and giant capillary loops). We used a microscope with special light and magnification of 10 to 16X. Eighteen patients underwent a total of 26 capillaroscopic examinations, seven of them on two or more occasions (13 were performed during the active disease phase and 13 during remission). Twelve of the 13 examinations performed during the active phase exhibited scleroderma pattern and 8 of the 13 examinations performed during remission were normal. Therefore, in 20 of the 26 examinations clinical and laboratory data and nailfold capillaroscopy findings correlated (p = 0.01). Nailfold capillaroscopy is a non-invasive examination that offers satisfactory correlation with disease activity and could be a useful tool for the diagnosis and follow-up of inflammatory myopathies.

  14. MYOPATHY AS A SIDE EFFECT OF STATIN THERAPY: MECHANISMS OF DEVELOPMENT AND PROSPECTS FOR TREATMENT

    O. M. Drapkina

    2015-01-01

    Full Text Available Statins are lipid-lowering drugs with proven efficacy that reduce cardiovascular risk and are well tolerated by most patients. Myopathy as a side effect of statin therapy is one of the most common reasons for their withdrawal. Its severity can range from asymptomatic increase of serum CPK to life-threatening rhabdomyolysis. Therefore it is necessary to remember about the possibility of its occurrence.The exact molecular mechanisms of muscle damage by statins are still unknown. Various hypotheses are suggested in this respect: fatty acid oxidation disorders, mitochondrial dysfunction, increased protein degradation in myocytes due to changes in atrogin-1 and ubiquitin activity, activation of autoimmune processes, intracellular depletion of essential metabolites, destabilization of cell membranes, impaired expression of genes involved in apoptosis and protein degradation. The theory that the reduction of intramuscular CoQ10 level is the cause of myopathy prevails. Additional intake of CoQ10 seems promising, but is not evidence-based.

  15. Anaesthetic management of a paediatric patient with congenital fibre type disproportion myopathy.

    Buisán, F; de la Varga, O; Flores, M; Sánchez-Ruano, J

    2018-04-23

    Congenital fibre type disproportion (CFTD) is a rare type of myopathy that is characterised by muscle weakness and hypotonia during childhood. Clinical features include motor delay, feeding difficulties, limb weakness, joint contractures, and scoliosis. A report is presented of the anaesthetic management of a 3-year-old girl with CFTD myopathy associated with a mutation of the TPM3 gene, scheduled for adenotonsillectomy because of obstructive sleep apnoea hypopnoea syndrome (OSAHS). The main concerns were the possible susceptibility to malignant hyperthermia, the risk of anaesthesia-induced rhabdomyolysis, a greater sensitivity to non-depolarising muscle relaxants, and the presence of OSAHS. Total intravenous anaesthesia with propofol and the use of rocuronium/sugammadex appear to be safe options. Given the high risk of respiratory compromise and other complications, patients should be closely monitored in the post-operative period. Copyright © 2018 Sociedad Española de Anestesiología, Reanimación y Terapéutica del Dolor. Publicado por Elsevier España, S.L.U. All rights reserved.

  16. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  17. Uremic myopathy: Is oxidative stress implicated in muscle dysfunction in uremia?

    Antonia eKaltsatou

    2015-03-01

    Full Text Available Renal failure is accompanied by progressive muscle weakness and premature fatigue, in part linked to hypokinesis and in part to uremic toxicity. These changes are associated with various detrimental biochemical and morphological alterations. All of these pathological parameters are collectively termed ureamic myopathy. Various interventions while helpful can’t fully remedy the pathological phenotype. Complex mechanisms that stimulate muscle dysfunction in uremia have been proposed, and oxidative stress could be implicated. Skeletal muscles continuously produce reactive oxygen species (ROS and reactive nitrogen species (RNS at rest and more so during contraction. The aim of this mini review is to provide an update on recent advances in our understanding of how ROS and RNS generation might contribute to muscle dysfunction in uremia. Thus a systematic review was conducted searching PubMed and Scopus by using the Cochrane and PRISMA guidelines. While few studies met our criteria their findings are discussed making reference to other available literature data. Oxidative stress can direct muscle cells into a catabolic state and chronic exposure to it leads to wasting. Moreover, redox disturbances can significantly affect force production per se. We conclude that oxidative stress can be in part responsible for some aspects of uremic myopathy. Further research is needed to discern clear mechanisms and to help efforts to counteract muscle weakness and exercise intolerance in uremic patients.

  18. Elevated risk of venous thromboembolic events in patients with inflammatory myopathies

    Nowak M

    2016-06-01

    Full Text Available Michał Nowak, Katarzyna Królak-Nowak, Aleksandra Sobolewska-Włodarczyk, Jakub Fichna, Marcin Włodarczyk Department of Biochemistry, Faculty of Medicine, Medical University of Lodz, Lodz, Poland Abstract: Venous thromboembolism (VTE is a multifactorial disease manifesting as either deep vein thrombosis or pulmonary embolism. Its prevalence makes VTE a significant issue for both the individual – as a negative factor influencing the quality of life and prognosis – and the society due to economic burden. VTE is the third most common vascular disorder in Western countries, after myocardial infarction and stroke, making it a major cause of in-hospital mortality, responsible for 5%–10% of hospital deaths. Despite many studies conducted, only 50%–60% provoking factors have been identified, while the remaining 40%–50% have been classified as idiopathic or unprovoked. Chronic inflammatory disorders, with their underlying prothrombotic state, reveal an increased risk of VTE (six to eight times compared with the general population. Among the inflammatory disorders, we can identify inflammatory myopathies – a group of rare, chronic diseases featuring weakness and inflammation of muscles with periods of exacerbation and remission; their main classes are polymyositis and dermatomyositis. The objective of this review is to emphasize the need of VTE prophylaxis in individuals with inflammatory myopathies in order to reduce morbidity and mortality rates among those patients and improve their quality of life and prognosis. Keywords: deep vein thrombosis, pulmonary embolism, inflammation, polymyositis, dermatomyositis, prothrombotic state

  19. Hereditary internal anal sphincter myopathy causing proctalgia fugax and constipation. A newly identified condition.

    Kamm, M A; Hoyle, C H; Burleigh, D E; Law, P J; Swash, M; Martin, J E; Nicholls, R J; Northover, J M

    1991-03-01

    A newly identified myopathy of the internal anal sphincter is described. In the affected family, at least one member from each of five generations had severe proctalgia fugax; onset was usually in the third to fifth decades of life. Three members of the family have been studied in detail. Each had severe pain intermittently during the day and hourly during the night. Constipation was an associated symptom, in particular difficulty with rectal evacuation. Clinically the internal anal sphincter was thickened and of decreased compliance. The maximum anal canal pressure was usually increased with marked ultraslow wave activity. Anal endosonography confirmed a grossly thickened internal anal sphincter. Two patients were treated by internal anal sphincter strip myectomy; one showed marked improvement and one was relieved of the constipation but had only slight improvement of the pain. The hypertrophied muscle in two of the patients showed unique myopathic changes, consisting of vacuolar changes with periodic acid-Schiff-positive polyglycosan bodies in the smooth muscle fibers and increased endomysial fibrosis. In vitro organ-bath studies showed insensitivity of the muscle to noradrenaline, isoprenaline, carbachol, dimethylpiperazinium, and electrical-field stimulation. Immunohistochemical studies for substance P, calcitonin gene-related peptide, galanin, neuropeptide Y, and vasoactive intestinal peptide showed staining in a similar distribution to that in control tissue. A specific autosomal-dominant inherited myopathy of the internal anal sphincter that causes anal pain and constipation has been identified and characterized.

  20. MYOPATHY AS A SIDE EFFECT OF STATIN THERAPY: MECHANISMS OF DEVELOPMENT AND PROSPECTS FOR TREATMENT

    O. M. Drapkina

    2015-09-01

    Full Text Available Statins are lipid-lowering drugs with proven efficacy that reduce cardiovascular risk and are well tolerated by most patients. Myopathy as a side effect of statin therapy is one of the most common reasons for their withdrawal. Its severity can range from asymptomatic increase of serum CPK to life-threatening rhabdomyolysis. Therefore it is necessary to remember about the possibility of its occurrence.The exact molecular mechanisms of muscle damage by statins are still unknown. Various hypotheses are suggested in this respect: fatty acid oxidation disorders, mitochondrial dysfunction, increased protein degradation in myocytes due to changes in atrogin-1 and ubiquitin activity, activation of autoimmune processes, intracellular depletion of essential metabolites, destabilization of cell membranes, impaired expression of genes involved in apoptosis and protein degradation. The theory that the reduction of intramuscular CoQ10 level is the cause of myopathy prevails. Additional intake of CoQ10 seems promising, but is not evidence-based.

  1. Idiopathic Inflammatory Myopathies; Association with Overlap Myositis and Syndromes: Classification, Clinical Characteristics, and Associated Autoantibodies

    Pari Basharat

    2016-07-01

    Full Text Available Idiopathic inflammatory myopathies (IIM are traditionally identified as a group of disorders that target skeletal muscle due to autoimmune dysfunction. The IIM can be divided into subtypes based on certain clinical characteristics, and several classification schemes have been proposed. The predominant diagnostic criteria for IIM is the Bohan and Peter criteria, which subdivides IIM into primary polymyositis (PM, primary dermatomyositis (DM, myositis with another connective tissue disease, and myositis associated with cancer. However, this measure has been criticised for several reasons including lack of specific criteria to help distinguish between muscle biopsy findings of PM, DM, and immune-mediated necrotising myopathy, as well as the lack of identification of cases of overlap myositis (OM. Because of this issue, other classification criteria for IIM have been proposed, which include utilising myositis-associated antibodies and myositis-specific antibodies, as well as overlap features such as Raynaud’s phenomenon, polyarthritis, oesophageal abnormalities, interstitial lung disease, small bowel abnormalities such as hypomotility and malabsorption, and renal crises, amongst others. Indeed, the identification of autoantibodies associated with certain clinical phenotypes of myositis, in particular connective tissue disease-myositis overlap, has further helped divide IIM into distinct clinical subsets, which include OM and overlap syndromes (OS. This paper reviews the concepts of OM and OS as they pertain to IIM, including definitions in the literature, clinical characteristics, and overlap autoantibodies.

  2. Treatment options for mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome.

    Santa, Kristin M

    2010-11-01

    Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome is a rare neurodegenerative disease caused by the decreased ability of cells to produce sufficient energy in the form of adenosine 5'-triphosphate. Although it is one of the most common maternally inherited mitochondrial disorders, its exact incidence is unknown. Caused most frequently by an A-to-G point mutation at the 3243 position in the mitochondrial DNA, MELAS syndrome has a broad range of clinical manifestations and a highly variable course. The classic neurologic characteristics include encephalopathy, seizures, and stroke-like episodes. In addition to its neurologic manifestations, MELAS syndrome exhibits multisystem effects including cardiac conduction defects, diabetes mellitus, short stature, myopathy, and gastrointestinal disturbances. Unfortunately, no consensus guidelines outlining standard drug regimens exist for this syndrome. Many of the accepted therapies used in treating MELAS syndrome have been identified through a small number of clinical trials or isolated case reports. Currently, the drugs most often used include antioxidants and various vitamins aimed at minimizing the demands on the mitochondria and supporting and maximizing their function. Some of the most frequently prescribed agents include coenzyme Q(10), l-arginine, B vitamins, and levocarnitine. Although articles describing MELAS syndrome are available, few specifically target education for clinical pharmacists. This article will provide pharmacists with a practical resource to enhance their understanding of MELAS syndrome in order to provide safe and effective pharmaceutical care.

  3. Effects of aerobic training on exercise-related oxidative stress in mitochondrial myopathies.

    Siciliano, Gabriele; Simoncini, Costanza; Lo Gerfo, Annalisa; Orsucci, Daniele; Ricci, Giulia; Mancuso, Michelangelo

    2012-12-01

    In mitochondrial myopathies with respiratory chain deficiency impairment of energy cell production may lead to in excess reactive oxygen species generation with consequent oxidative stress and cell damage. Aerobic training has been showed to increase muscle performance in patients with mitochondrial myopathies. Aim of this study has been to evaluate, in 7 patients (6 F e 1M, mean age 44.9 ± 12.1 years) affected by mitochondrial disease, concomitantly to lactate exercise curve, the occurrence of oxidative stress, as indicated by circulating levels of lipoperoxides, in rest condition and as effect of exercise, and also, to verify if an aerobic training program is able to modify, in these patients, ox-redox balance efficiency. At rest and before training blood level of lipoperoxides was 382.4 ± 37.8 AU, compared to controls (318.7 ± 63.8; Pstress degree according to the adopted scale. During incremental exercise blood level of lipoperoxides did not increase, but maintained significantly higher compared to controls. After an aerobic training of 10 weeks the blood level of lipoperoxides decreased by 13.7% at rest (Pexercise test (P=0.06). These data indicate that, in mitochondrial patients, oxidative stress occurs and that an aerobic training is useful in partially reverting this condition. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Muscle spindles exhibit core lesions and extensive degeneration of intrafusal fibers in the Ryr1I4895T/wt mouse model of core myopathy

    Zvaritch, Elena; MacLennan, David H.

    2015-01-01

    Muscle spindles from the hind limb muscles of adult Ryr1 I4895T/wt (IT/+) mice exhibit severe structural abnormalities. Up to 85% of the spindles are separated from skeletal muscle fascicles by a thick layer of connective tissue. Many intrafusal fibers exhibit degeneration, with Z-line streaming, compaction and collapse of myofibrillar bundles, mitochondrial clumping, nuclear shrinkage and pyknosis. The lesions resemble cores observed in the extrafusal myofibers of this animal model and of core myopathy patients. Spindle abnormalities precede those in extrafusal fibers, indicating that they are a primary pathological feature in this murine Ryr1-related core myopathy. Muscle spindle involvement, if confirmed for human core myopathy patients, would provide an explanation for an array of devastating clinical features characteristic of these diseases and provide novel insights into the pathology of RYR1-related myopathies. - Highlights: • Muscle spindles exhibit structural abnormalities in a mouse model of core myopathy. • Myofibrillar collapse and mitochondrial clumping is observed in intrafusal fibers. • Myofibrillar degeneration follows a pattern similar to core formation in extrafusal myofibers. • Muscle spindle abnormalities are a part of the pathological phenotype in the mouse model of core myopathy. • Direct involvement of muscle spindles in the pathology of human RYR1-related myopathies is proposed

  5. EULAR/ACR classification criteria for adult and juvenile idiopathic inflammatory myopathies and their major subgroups: a methodology report

    Bottai, Matteo; Tjärnlund, Anna; Santoni, Giola; Werth, Victoria P.; Pilkington, Clarissa; de Visser, Marianne; Alfredsson, Lars; Amato, Anthony A.; Barohn, Richard J.; Liang, Matthew H.; Singh, Jasvinder A.; Aggarwal, Rohit; Arnardottir, Snjolaug; Chinoy, Hector; Cooper, Robert G.; Danko, Katalin; Dimachkie, Mazen M.; Feldman, Brian M.; García-de la Torre, Ignacio; Gordon, Patrick; Hayashi, Taichi; Katz, James D.; Kohsaka, Hitoshi; Lachenbruch, Peter A.; Lang, Bianca A.; Li, Yuhui; Oddis, Chester V.; Olesinka, Marzena; Reed, Ann M.; Rutkowska-Sak, Lidia; Sanner, Helga; Selva-O'Callaghan, Albert; Wook Song, Yeong; Vencovsky, Jiri; Ytterberg, Steven R.; Miller, Frederick W.; Rider, Lisa G.; Lundberg, Ingrid E.; Amoruso, Maria; Andersson, Helena; Bayat, Nastaran; Bhansing, Kavish J.; Bucher, Sara; Champbell, Richard; Charles-Schoeman, Christina; Chaudhry, Vinay; Christopher-Stine, Lisa; Chung, Lorinda; Cronin, Mary; Curry, Theresa; Dahlbom, Kathe; Distler, Oliver; Efthimiou, Petros; van Engelen, Baziel G. M.; Faiq, Abdullah; Farhadi, Payam Noroozi; Fiorentino, David; Hengstman, Gerald; Hoogendijk, Jessica; Huber, Adam; Kataoka, Hiroshi; Katsumata, Yasuhiro; Kim, Susan; Kong-Rosario, Michelle; Kontzias, Apostolos; Krol, Petra; Kurita, Takashi; Li, Zhan-Guo; Lindvall, Björn; Linklater, Helen; Maillard, Sue; Mamyrova, Gulnara; Mantegazza, Renato; Marder, Galina S.; Nagahashi Marie, Suely Kazue; Mathiesen, Pernille; Mavragani, Clio P.; McHugh, Neil J.; Michaels, Mimi; Mohammed, Reem; Morgan, Gabrielle; Moser, David W.; Moutsopoulos, Haralampos M.

    2017-01-01

    To describe the methodology used to develop new classification criteria for adult and juvenile idiopathic inflammatory myopathies (IIMs) and their major subgroups. An international, multidisciplinary group of myositis experts produced a set of 93 potentially relevant variables to be tested for

  6. Implications of compound heterozygous insulin receptor mutations in congenital muscle fibre type disproportion myopathy for the receptor kinase activation

    Klein, H H; Müller, R; Vestergaard, H

    1999-01-01

    We studied insulin receptor kinase activation in two brothers with congenital muscle fibre type disproportion myopathy and compound heterozygous mutations of the insulin receptor gene, their parents, and their unaffected brother. In the father who has a heterozygote Arg1174-->Gln mutation, in sit...

  7. Characterization of DLK1+ cells emerging during skeletal muscle remodeling in response to myositis, myopathies, and acute injury

    Andersen, Ditte C; Petersson, Stine J; Jørgensen, Louise H

    2009-01-01

    , DLK1 was upregulated in all human myopathies analyzed, including Duchenne- and Becker muscular dystrophies. Substantial numbers of DLK1(+) satellite cells were observed in normal neonatal and Duchenne muscle, and furthermore, myogenic DLK1(+) cells were identified during muscle regeneration in animal...

  8. Characterization of sarcoplasmic reticulum Ca(2+) ATPase pumps in muscle of patients with myotonic dystrophy and with hypothyroid myopathy.

    Guglielmi, V; Oosterhof, A; Voermans, N C; Cardani, R; Molenaar, J P; van Kuppevelt, T H; Meola, G; van Engelen, B G; Tomelleri, G; Vattemi, G

    2016-06-01

    Sarcoplasmic/endoplasmic reticulum Ca(2+) ATPase (SERCA) pumps play the major role in lowering cytoplasmic calcium concentration in skeletal muscle by catalyzing the ATP-dependent transport of Ca(2+) from the cytosol to the lumen of the sarcoplasmic reticulum (SR). Although SERCA abnormalities have been hypothesized to contribute to the dysregulation of intracellular Ca(2+) homeostasis and signaling in muscle of patients with myotonic dystrophy (DM) and hypothyroid myopathy, the characterization of SERCA pumps remains elusive and their impairment is still unclear. We assessed the activity of SR Ca(2+)-ATPase, expression levels and fiber distribution of SERCA1 and SERCA2, and oligomerization of SERCA1 protein in muscle of patients with DM type 1 and 2, and with hypothyroid myopathy. Our data provide evidence that SR Ca(2+) ATPase activity, protein levels and muscle fiber distribution of total SERCA1 and SERCA2, and SERCA1 oligomerization pattern are similar in patients with both DM1 and DM2, hypothyroid myopathy and in control subjects. We prove that SERCA1b, the neonatal isoform of SERCA1, is expressed at protein level in muscle of patients with DM2 and, in lower amount, of patients with DM1. Our present study demonstrates that SERCA function is not altered in muscle of patients with DM and with hypothyroid myopathy. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Loss-of-function mutations in SCN4A> cause severe foetal hypokinesia or 'classical' congenital myopathy

    Zaharieva, Irina T; Thor, Michael G; Oates, Emily C

    2016-01-01

    Congenital myopathies are a clinically and genetically heterogeneous group of muscle disorders characterized by congenital or early-onset hypotonia and muscle weakness, and specific pathological features on muscle biopsy. The phenotype ranges from foetal akinesia resulting in in utero or neonatal...

  10. Lactate disposal via gluconeogenesis is increased during exercise in patients with mitochondrial myopathy due to complex I deficiency

    Roef, MJ; Kalhan, SC; Reijngoud, DJ; De Meer, K; Berger, Ruud

    This study evaluated lactate disposal via gluconeogenesis as well as effects of FFA availability on gluconeogenesis via pyruvate (GNG(PYR)) in patients with mitochondrial myopathy due to complex I deficiency (CID). The rates of GNG(PYR) were measured in three CID patients and six healthy controls at

  11. Hereditary internal anal sphincter myopathy causing proctalgia fugax and constipation: further clinical and histological characterization in a patient.

    König, P; Ambrose, N S; Scott, N

    2000-01-01

    Hereditary internal anal sphincter myopathy is a very rare condition, only three families have so far been described in the literature. In this case report further clinical and histological findings of one affected member of one of the above families are presented.

  12. Hypoglycin A Concentrations in Maple Tree Species in the Netherlands and the Occurrence of Atypical Myopathy in Horses

    Westermann, C.M.; Van Leeuwen, Robbert; Van Raamsdonk, L.W.D.; Mol, H.G.J.

    BACKGROUND: Atypical myopathy (AM) in horses is caused by the plant toxin hypoglycin A, which in Europe typically is found in the sycamore maple tree (Acer pseudoplatanus). Owners are concerned about whether their horses are in danger if they graze near maple trees. HYPOTHESIS/OBJECTIVES: To measure

  13. Hypoglycin A Concentrations in Maple Tree Species in the Netherlands and the Occurrence of Atypical Myopathy in Horses

    Westermann, C.M.; Leeuwen, van R.; Raamsdonk, van L.W.D.; Mol, H.G.J.

    2016-01-01

    Background: Atypical myopathy (AM) in horses is caused by the plant toxin hypoglycin A, which in Europe typically is found in the sycamore maple tree (Acer pseudoplatanus). Owners are concerned about whether their horses are in danger if they graze near maple trees. Hypothesis/Objectives: To

  14. Mutation spectrum in the large GTPase dynamin 2, and genotype-phenotype correlation in autosomal dominant centronuclear myopathy

    Böhm, Johann; Biancalana, Valérie; Dechene, Elizabeth T

    2012-01-01

    Centronuclear myopathy (CNM) is a genetically heterogeneous disorder associated with general skeletal muscle weakness, type I fiber predominance and atrophy, and abnormally centralized nuclei. Autosomal dominant CNM is due to mutations in the large GTPase dynamin 2 (DNM2), a mechanochemical enzym...

  15. Morphology of the mitochondria in heat shock protein 60 deficient fibroblasts from mitochondrial myopathy patients : Effects of stress conditions

    Huckriede, A; Heikema, A; Sjollema, K; Briones, P; Agsteribbe, E

    1995-01-01

    We have described two mitochondrial (mt) myopathy patients with reduced activities of various mt enzymes associated with significantly decreased amounts of heat shock protein 60 (hsp60). Experimental evidence suggested that the lack of hsp60 was the primary defect. Since hsp60 is essential for the

  16. Dietary nitrate does not reduce oxygen cost of exercise or improve muscle mitochondrial function in patients with mitochondrial myopathy

    Nabben, M.; Schmitz, J.P.J.; Ciapaite, J.; le Clercq, C.M.P.; van Riel, N.A.; Haak, H.R.; Nicolay, K.; de Coo, I.F.M.; Smeets, H.; Praet, S.F.; van Loon, L.J.; Prompers, J.J.

    2017-01-01

    Muscle weakness and exercise intol erance negatively affect the quality of life of patients with mitochondrial myopathy. Short-term dietary nitrate supplementation has been shown to improve exercise performance and reduce oxygen cost of exercise in healthy humans and trained athletes. We

  17. Novel duplication mutation in the patatin domain of adipose triglyceride lipase (PNPLA2) in neutral lipid storage disease with severe myopathy.

    Akiyama, Masashi; Sakai, Kaori; Ogawa, Masaya; McMillan, James R; Sawamura, Daisuke; Shimizu, Hiroshi

    2007-12-01

    Recently, mutations in PNPLA2 encoding adipose triglyceride lipase (ATGL) were reported to underlie a neutral lipid storage disease (NLSD) subgroup characterized by mild myopathy and the absence of ichthyosis. In the present study a novel homozygous PNPLA2 mutation c.475_478dupCTCC (p.Gln160ProfsX19) in the patatin domain, the ATGL active site, was detected in a woman with NLSD and severe myopathy. The present results suggest that a premature truncation mutation in the patatin domain causes NLSD with severe myopathy.

  18. Chronic primary intestinal pseudo-obstruction from visceral myopathy Pseudo-osbtrucción intestinal crónica primaria debida a miopatía visceral

    M. T. Muñoz-Yagüe

    2006-04-01

    Full Text Available Chronic intestinal pseudo-obstruction is an uncommon syndrome characterized by relapsing episodes suggesting intestinal obstruction during which no mechanical causes are identified to account for symptoms. Etiologic factors may be manifold. Among them a number of neurologic conditions, gastrointestinal smooth muscle myopathies, endocrino-metabolic and autoimmune diseases, and the use of selected drugs stand out. We report a case of chronic intestinal pseudo-obstruction originating in a sporadic, primary intestinal myopathy that corresponds to no type thus far described. A histological study of the intestinal wall showed disrupted muscle bundles and the presence of interstitial edema. Myocytes had severe degenerative changes, and no alterations were seen in submucosal and myenteric plexus neurons. The activity of enzyme complexes in the mitochondrial respiratory chain, and of thymidine phosphorylase was normal. No mitochondrial DNA changes were seen.La pseudo-obstrucción intestinal crónica es un síndrome infrecuente caracterizado por episodios recidivantes, sugestivos de obstrucción intestinal, durante los cuales no se detectan causas mecánicas que justifiquen la sintomatología. Los factores etiológicos pueden ser múltiples. Entre ellos destacan diversas enfermedades neurológicas, miopatías de la musculatura lisa gastrointestinal, enfermedades endocrino-metabólicas y autoinmunes y el uso de determinados fármacos. Presentamos un caso de pseudo-obstrucción intestinal crónica originada por una miopatía intestinal primaria y esporádica que no corresponde a ningún tipo descrito hasta el momento. El estudio histológico de la pared intestinal mostró que los haces musculares estaban desestructurados y que existía edema intersticial. Los miocitos presentaban marcados cambios degenerativos y no existían alteraciones en las neuronas de los plexos submucoso y mientérico. La actividad de los complejos enzimáticos de la cadena

  19. Frequency of non alcoholic fatty liver disease (NAFLD) and its biochemical derangements in Type-2 diabetic patients

    Taseer, I.H.; Hussain, L.; Safdar, S.; Mirbahar, A.M.; Ahmad, I.

    2010-01-01

    Objective: To see the frequency of non-alcoholic fatty liver disease in Type-2 diabetic patients and to see iochemical derangements in NAFLD patients. Methodology: It is a cross-sectional study, conducted at Diabetic Research Centre and outpatient department Nishtar Hospital and PMRC Research Centre Nishtar Medical College, Multan. One hundred patients of either sex having type 2 diabetes mellitus attending diabetic out-patient department Nishtar Hospital Multan were included in the study. A pre-designed study proforma was filled with relevant investigations and clinical assessments were carried out in all cases. All the patients underwent abdominal ultrasonography. Data were entered in SPSS-11 and analyzed. Results: Out of one hundred patients, 51 (51%) were female and 49 (49%) were male. Mean age of the patients was 47.93 +- 8.57 years. Fifty one (51%) of the diabetic patients had fatty liver. Out of these 32 (62.75%) were female and 19 (37.25%) were male. Fatigue was present in 49 (53.26%), generalized weakness in 48 (52.18%), heaviness right upper abdomen in 22 (64.70%) and pain right upper abdomen in 20 (58.82%) of fatty liver patients. Corresponding figure in Non Fatty Liver Patients were 43 (46.74%), 44 (47.82%), 12 (35.30%) and 14(41.18%), respectively. Itching was noted in 19 (44.18%) patients of fatty liver while it was 24(55.82%) in non-fatty liver patients. Serum triglyceride level more than 160 mg/dl in 47 (92.15%) patients of fatty liver while serum cholesterol level more than 200 mg/dl was seen in 24(47.05%). Aspartate amino transferase (AST) more than 35 u/l was noted in seven (13.72%), alanine amino-transferase (ALT) more than 40u/l was noted in 6(11.76%) fatty liver patients while serum albumin and serum bilirubin were within normal range in all fatty liver and non-fatty liver patients. Conclusion: Nonalcoholic fatty liver disease (NAFLD) is more commonly seen in Type-2 diabetic patients. Serum triglyceride and serum cholesterol are significantly

  20. What Variables Are Associated With the Outcome of Arthroscopic Lysis and Lavage Surgery for Internal Derangement of the Temporomandibular Joint?

    Haeffs, Tyler H; D'Amato, Lindsay N; Khawaja, Shehryar N; Keith, David A; Scrivani, Steven J

    2018-04-26

    Arthroscopic lysis and lavage surgery (AS) is an effective modality that can decrease pain and increase maximum interincisal opening (MIO) in patients with internal derangement (ID) of the temporomandibular joint (TMJ). However, some patients remain in pain or have limited mandibular range of motion despite AS. The purpose of this study was to determine the effectiveness, prevalence of adverse effects, and predictors of response to TMJ AS in patients with TMJ arthralgia and ID. A retrospective cohort study was conducted using data of patients who had undergone AS by a single surgeon (D.A.K.) from September 2010 to April 2015 in the Department of Oral and Maxillofacial Surgery at Massachusetts General Hospital (Boston, MA). Variables, including demographic data, medical history, and clinical presentation, were extracted and analyzed. Criteria for surgical success were defined as a postoperative MIO of at least 35 mm and a postoperative pain level no higher than 3 on an 11-point Likert-type numeric verbal pain rating scale. Appropriate descriptive and analytic statistics were computed and significance was set at a P value less than .05. Of the 247 participants, 226 (91.5%) were women. The mean age of the sample was 38 ± 15.4 years. Successful surgical outcome was achieved in 62.3% of patients. Based on logistic regression analysis, higher initial mean pain score and concurrent use of benzodiazepines were the only variables that predicted an unsuccessful surgical outcome (P < .001; P = .005). Adverse effects were reported by 13.4% of patients, the most common being postoperative increase in pain (13.4%), temporary malocclusion (1.2%), and temporary paresthesia in the preauricular region (0.4%). The results from this study indicate that in patients with ID of the TMJ unresponsive to noninvasive treatments, high initial pain scores and concurrent use of benzodiazepines are correlated with an unsuccessful outcome after AS. Copyright © 2018. Published by

  1. Elevated Cardiac Troponin T in Patients With Skeletal Myopathies.

    Schmid, Johannes; Liesinger, Laura; Birner-Gruenberger, Ruth; Stojakovic, Tatjana; Scharnagl, Hubert; Dieplinger, Benjamin; Asslaber, Martin; Radl, Roman; Beer, Meinrad; Polacin, Malgorzata; Mair, Johannes; Szolar, Dieter; Berghold, Andrea; Quasthoff, Stefan; Binder, Josepha S; Rainer, Peter P

    2018-04-10

    Cardiac troponins are often elevated in patients with skeletal muscle disease who have no evidence of cardiac disease. The goal of this study was to characterize cardiac troponin concentrations in patients with myopathies and derive insights regarding the source of elevated troponin T measurements. Cardiac troponin T (cTnT) and cardiac troponin I (cTnI) concentrations were determined by using high sensitivity assays in 74 patients with hereditary and acquired skeletal myopathies. Patients underwent comprehensive cardiac evaluation, including 12-lead electrocardiogram, 24-h electrocardiogram, cardiac magnetic resonance imaging, and coronary artery computed tomography. cTnT and cTnI protein expression was determined in skeletal muscle samples of 9 patients and in control tissues derived from autopsy using antibodies that are used in commercial assays. Relevant Western blot bands were subjected to liquid chromatography tandem mass spectrometry for protein identification. Levels of cTnT (median: 24 ng/l; interquartile range: 11 to 54 ng/l) were elevated (>14 ng/l) in 68.9% of patients; cTnI was elevated (>26 ng/l) in 4.1% of patients. Serum cTnT levels significantly correlated with creatine kinase and myoglobin (r = 0.679 and 0.786, respectively; both p < 0.001). Based on cTnT serial testing, 30.1% would have fulfilled current rule-in criteria for myocardial infarction. Noncoronary cardiac disease was present in 23%. Using cTnT antibodies, positive bands were found in both diseased and healthy skeletal muscle at molecular weights approximately 5 kDa below cTnT. Liquid chromatography tandem mass spectrometry identified the presence of skeletal troponin T isoforms in these bands. Measured cTnT concentrations were chronically elevated in the majority of patients with skeletal myopathies, whereas cTnI elevation was rare. Our data indicate that cross-reaction of the cTnT immunoassay with skeletal muscle troponin isoforms was the likely cause. Copyright © 2018 The

  2. A Comprehensive Overview on Myositis-Specific Antibodies: New and Old Biomarkers in Idiopathic Inflammatory Myopathy

    Satoh, Minoru; Tanaka, Shin; Ceribelli, Angela; Calise, S. John; Chan, Edward K. L.

    2018-01-01

    Autoantibodies specific for idiopathic inflammatory myopathy (myositis-specific autoantibodies (MSAs)) are clinically useful biomarkers to help the diagnosis of polymyositis/dermatomyositis (PM/DM). Many of these are also associated with a unique clinical subset of PM/DM, making them useful in predicting and monitoring certain clinical manifestations. Classic MSAs known for over 30 years include antibodies to Jo-1 (histidyl transfer RNA (tRNA) synthetase) and other aminoacyl tRNA synthetases (ARS), anti-Mi-2, and anti-signal recognition particle (SRP). Anti-Jo-1 is the first autoantibodies to ARS detected in 15–25 % of patients. In addition to anti-Jo-1, antibodies to seven other aminoacyl tRNA synthetases (ARS) have been reported with prevalence, usually 1–5 % or lower. Patients with any antiARS antibodies are associated with anti-synthetase syndrome characterized by myositis, interstitial lung disease (ILD), arthritis, Raynaud’s phenomenon, and others. Several recent studies suggested heterogeneity in clinical features among different anti-ARS antibody-positive patients and anti-ARS may also be found in idiopathic ILD without myositis. Anti-Mi-2 is a classic marker for DM and associated with good response to steroid treatment and good prognosis. Anti-SRP is specific for PM and associated with treatment-resistant myopathy histologically characterized as necrotizing myopathy. In addition to classic MSAs, several new autoantibodies with strong clinical significance have been described in DM. Antibodies to transcription intermediary factor 1γ/α (TIF1γ/α, p155/140) are frequently found in DM associated with malignancy while anti-melanoma differentiation-associated gene 5 (MDA5; CADM140) are associated with clinically amyopathic DM (CADM) complicated by rapidly progressive ILD. Also, anti-MJ/nuclear matrix protein 2 (NXP-2) and anti-small ubiquitin-like modifier-1 (SUMO-1) activating enzyme (SAE) are recognized as new DM-specific autoantibodies. Addition of

  3. [Hot spot mutation screening of RYR1 gene in diagnosis of congenital myopathies].

    Chang, Xing-zhi; Jin, Yi-wen; Wang, Jing-min; Yuan, Yun; Xiong, Hui; Wang, Shuang; Qin, Jiong

    2014-10-18

    To detect hot spot mutation of RYR1 gene in 15 cases of congenital myopathy with different subtypes, and to discuss the value of RYR1 gene hot spot mutation detection in the diagnosis of the disease. Clinical data were collected in all the patients, including clinical manifestations and signs, serum creatine kinase, electromyography. Fourteen of the patients accepted the muscle biopsy. Hot spot mutation in the C-terminal of RYR1 gene (extron 96-106) had been detected in all the 15 patients. All the patients presented with motor development delay, and they could walk at the age of 1 to 3.5 years,but were always easy to fall and could not run or jump. There were no progressive deteriorations. Physical examination showed different degrees of muscle weakness and hypotonia.High arched palates were noted in 3 patients. The serum levels of creatine kinase were mildly elevated in 3 cases, and normal in 12 cases. Electromyography showed "myogenic" features in 11 patients, being normal in the other 4 patients. Muscle biopsy pathologic diagnosis was the central core disease in 3 patients, the central nuclei in 2 patients, the congenital fiber type disproportion in 2 patients, the nameline myopathy in 3 patient, the multiminicore disease in 1 patient, and nonspecific minimal changes in the other 3 patients; one patient was diagnosed with central core disease according to positive family history and gene mutation. In the family case (Patient 2) of central core disease, the c.14678G>A (p.Arg4893Gln) mutation in 102 extron of RYR1 was identified in three members of the family, which had been reported to be a pathogenic mutation. The c.14596A>G(p.Lys4866Gln) mutation in 101 extron was found in one patient with central core disease(Patient 1), and the c.14719G>A(p.Gly4907Ser) mutation in 102 extron was found in another case of the central core disease(Patient 3).The same novel mutation was verified in one of the patients' (Patient 3) asymptomatic father. Congenital myopathies in

  4. Validation and clinical significance of the childhood myositis assessment scale for assessment of muscle function in the juvenile idiopathic inflammatory myopathies

    Huber, AM; Feldman, BM; Rennebohm, RM; Hicks, JE; Lindsley, CB; Perez, MD; Zemel, LS; Wallace, CA; Ballinger, SH; Passo, MH; Reed, AM; Summers, RM; Katona, IM; Miller, FW; Lachenbruch, PA; Rider, LG; White, P.H.

    Objective. To examine the measurement characteristics of the Childhood Myositis Assessment Scale (CMAS) in children with juvenile idiopathic inflammatory myopathy (juvenile IIM), and to obtain preliminary data on the clinical significance of CMAS scores. Methods. One hundred eight children with

  5. Rimmed vacuoles in Becker muscular dystrophy have similar features with inclusion myopathies.

    Momma, Kazunari; Noguchi, Satoru; Malicdan, May Christine V; Hayashi, Yukiko K; Minami, Narihiro; Kamakura, Keiko; Nonaka, Ikuya; Nishino, Ichizo

    2012-01-01

    Rimmed vacuoles in myofibers are thought to be due to the accumulation of autophagic vacuoles, and can be characteristic in certain myopathies with protein inclusions in myofibers. In this study, we performed a detailed clinical, molecular, and pathological characterization of Becker muscular dystrophy patients who have rimmed vacuoles in muscles. Among 65 Becker muscular dystrophy patients, we identified 12 patients who have rimmed vacuoles and 11 patients who have deletions in exons 45-48 in DMD gene. All patients having rimmed vacuoles showed milder clinical features compared to those without rimmed vacuoles. Interestingly, the rimmed vacuoles in Becker muscular dystrophy muscles seem to represent autophagic vacuoles and are also associated with polyubiquitinated protein aggregates. These findings support the notion that rimmed vacuoles can appear in Becker muscular dystrophy, and may be related to the chronic changes in muscle pathology induced by certain mutations in the DMD gene.

  6. Rimmed vacuoles in Becker muscular dystrophy have similar features with inclusion myopathies.

    Kazunari Momma

    Full Text Available Rimmed vacuoles in myofibers are thought to be due to the accumulation of autophagic vacuoles, and can be characteristic in certain myopathies with protein inclusions in myofibers. In this study, we performed a detailed clinical, molecular, and pathological characterization of Becker muscular dystrophy patients who have rimmed vacuoles in muscles. Among 65 Becker muscular dystrophy patients, we identified 12 patients who have rimmed vacuoles and 11 patients who have deletions in exons 45-48 in DMD gene. All patients having rimmed vacuoles showed milder clinical features compared to those without rimmed vacuoles. Interestingly, the rimmed vacuoles in Becker muscular dystrophy muscles seem to represent autophagic vacuoles and are also associated with polyubiquitinated protein aggregates. These findings support the notion that rimmed vacuoles can appear in Becker muscular dystrophy, and may be related to the chronic changes in muscle pathology induced by certain mutations in the DMD gene.

  7. Insulin Resistance and Increased Muscle Cytokine Levels in Patients With Mitochondrial Myopathy

    Rue, Nana; Vissing, John; Galbo, Henrik

    2014-01-01

    CONTEXT: Mitochondrial dysfunction has been proposed to cause insulin resistance and that might stimulate cytokine production. OBJECTIVE: The objective of the study was to elucidate the association between mitochondrial myopathy, insulin sensitivity, and cytokine levels in muscle. DESIGN......: The intervention included a 120-minute hyperinsulinemic, euglycemic clamp. Another morning, microdialysis of both vastus lateralis muscles for 4 hours, including one-legged, knee extension exercise for 30 minutes, was performed. MAIN OUTCOME MEASURES: Glucose infusion rate during 90-120 minutes of insulin infusion...... was measured. Cytokine concentrations in dialysate were also measured. RESULTS: Muscle strength, percentage fat mass, and creatine kinase in plasma did not differ between groups. The maximal oxygen uptake was 21 ± 3 (SE) (P) and 36 ± 3(C) mL/kg·min (2P insulin, C-peptide, and glucagon were higher...

  8. Exertional myopathy in a grizzly bear (Ursus arctos) captured by leghold snare.

    Cattet, Marc; Stenhouse, Gordon; Bollinger, Trent

    2008-10-01

    We diagnosed exertional myopathy (EM) in a grizzly bear (Ursus arctos) that died approximately 10 days after capture by leghold snare in west-central Alberta, Canada, in June 2003. The diagnosis was based on history, post-capture movement data, gross necropsy, histopathology, and serum enzyme levels. We were unable to determine whether EM was the primary cause of death because autolysis precluded accurate evaluation of all tissues. Nevertheless, comparison of serum aspartate aminotransferase and creatine kinase concentrations and survival between the affected bear and other grizzly bears captured by leghold snare in the same research project suggests EM also occurred in other bears, but that it is not generally a cause of mortality. We propose, however, occurrence of nonfatal EM in grizzly bears after capture by leghold snare has potential implications for use of this capture method, including negative effects on wildlife welfare and research data.

  9. X-linked Myotubular Myopathy with a Novel MTM1 Mutation in a Taiwanese Child

    Chia-Ying Chang

    2008-12-01

    Full Text Available We report a male, preterm newborn infant with X-linked myotubular myopathy, the most severe type of the disease. He presented at birth with generalized hypotonia, difficulty in swallowing, and respiratory distress with frequent episodes of atelectasis. The infant had a long thin face, generalized hypotonia, and arachnodactyly. Diagnosis was based on fetal history, muscle histopathology, electron microscopy and a genetic study. A base pair change was detected in exon 11 of the MTM1 gene: c.1160C > A, which caused an amino acid change, p.S387Y. The father's gene was normal but the mother had the same mutation as her son and was thus a carrier.

  10. Adult-onset nemaline myopathy in a dog presenting with persistent atrial standstill and primary hypothyroidism.

    Nakamura, R K; Russell, N J; Shelton, G D

    2012-06-01

    A nine-year-old neutered female mixed breed dog presented for evaluation following a five-day history of lethargy, inappetence, weakness, abdominal distension and generalised muscle atrophy. Persistent vatrial standstill with a junctional rhythm was identified on electrocardiogram. Echocardiogram identified moderate dilation of all cardiac chambers and mild thickening of the mitral and tricuspid valves. Serology was negative for Neospora caninum and Toxoplasma gondii. Permanent pacemaker implantation was performed in addition to endomyocardial and skeletal muscle biopsies. Cryosections from the biceps femoris muscle showed numerous nemaline rod bodies while endomyocardial biopsies were possibly consistent with end-stage myocarditis. Rod bodies have rarely been reported in the veterinary literature. To the authors' knowledge, this is the first report of adult-onset nemaline rod myopathy and hypothyroidism with concurrent cardiac disease in a dog. © 2012 British Small Animal Veterinary Association.

  11. Myopathy Associated with Acute Hypothyroidism following Radioiodine Therapy for Graves Disease in an Adolescent

    Rivkees ScottA

    2010-08-01

    Full Text Available We describe acute myopathy following I-131 treatment for hyperthyroidism due to Graves Disease (GD in an adolescent. A 15 year-old diagnosed with GD required treatment with radioactive iodine (I-131 therapy. Six weeks post I-131, he developed generalized muscle cramps. The CK was 19.800 U/L, the total thyroxine was 2.3 mcg/dL (29.6 nmol/L SI and the estimated free thyroxine (EFT was 0.5 ng/dL (6.4 pmol/L SI. The ALT was 112 U/L and AST was 364 U/L (normal

  12. Two families with MYH7 distal myopathy associated with cardiomyopathy and core formations.

    Naddaf, Elie; Waclawik, Andrew J

    2015-03-01

    Laing distal myopathy is caused by MYH7 gene mutations. Multiple families have been reported with varying patterns of skeletal and cardiac involvement as well as histopathological findings. We report 2 families with p.Glu1508del mutation with detailed electrophysiological and muscle pathology findings. All patients displayed the classic phenotype with weakness starting in the anterior compartment of the legs with a "hanging great toe." It was followed by finger extensors involvement, relatively sparing the extensor indicis proprius, giving the appearance of a "pointing index" finger. All the affected individuals had a dilated cardiomyopathy and core formations on muscle biopsy. Unexpectedly, neurogenic changes were also observed in some individuals. Both families were initially misdiagnosed with either central core disease or hereditary neuropathy. Recognizing the classic phenotype, screening for cardiac involvement that may be clinically silent, and determining the mode of inheritance help with selecting the appropriate genetic test.

  13. X linked neonatal centronuclear/myotubular myopathy: evidence for linkage to Xq28 DNA marker loci.

    Thomas, N S; Williams, H; Cole, G; Roberts, K; Clarke, A; Liechti-Gallati, S; Braga, S; Gerber, A; Meier, C; Moser, H

    1990-05-01

    We have studied the inheritance of several polymorphic Xq27/28 DNA marker loci in two three generation families with the X linked neonatal lethal form of centronuclear/myotubular myopathy (XL MTM). We found complete linkage of XLMTM to all four informative Xq28 markers analysed, with GCP/RCP (Z = 3.876, theta = 0.00), with DXS15 (Z = 3.737, theta = 0.00), with DXS52 (Z = 2.709, theta = 0.00), and with F8C (Z = 1.020, theta = 0.00). In the absence of any observable recombination, we are unable to sublocalise the XLMTM locus further within the Xq28 region. This evidence for an Xq28 localisation may allow us to carry out useful genetic counselling within such families.

  14. When should MELAS (Mitochondrial myopathy, Encephalopathy, Lactic Acidosis, and Stroke-like episodes) be the diagnosis?

    Lorenzoni, Paulo José; Werneck, Lineu Cesar; Kay, Cláudia Suemi Kamoi; Silvado, Carlos Eduardo Soares; Scola, Rosana Herminia

    2015-11-01

    Mitochondrial myopathy, Encephalopathy, Lactic Acidosis, and Stroke-like episodes (MELAS) is a rare mitochondrial disorder. Diagnostic criteria for MELAS include typical manifestations of the disease: stroke-like episodes, encephalopathy, evidence of mitochondrial dysfunction (laboratorial or histological) and known mitochondrial DNA gene mutations. Clinical features of MELAS are not necessarily uniform in the early stages of the disease, and correlations between clinical manifestations and physiopathology have not been fully elucidated. It is estimated that point mutations in the tRNALeu(UUR) gene of the DNAmt, mainly A3243G, are responsible for more of 80% of MELAS cases. Morphological changes seen upon muscle biopsy in MELAS include a substantive proportion of ragged red fibers (RRF) and the presence of vessels with a strong reaction for succinate dehydrogenase. In this review, we discuss mainly diagnostic criterion, clinical and laboratory manifestations, brain images, histology and molecular findings as well as some differential diagnoses and current treatments.

  15. Role of Myofibrillar Protein Catabolism in Development of Glucocorticoid Myopathy: Aging and Functional Activity Aspects

    Teet Seene

    2016-05-01

    Full Text Available Muscle weakness in corticosteroid myopathy is mainly the result of the destruction and atrophy of the myofibrillar compartment of fast-twitch muscle fibers. Decrease of titin and myosin, and the ratio of nebulin and MyHC in myopathic muscle, shows that these changes of contractile and elastic proteins are the result of increased catabolism of the abovementioned proteins in skeletal muscle. Slow regeneration of skeletal muscle is in good correlation with a decreased number of satellite cells under the basal lamina of muscle fibers. Aging causes a reduction of AMP-activated protein kinase (AMPK activity as the result of the reduced function of the mitochondrial compartment. AMPK activity increases as a result of increased functional activity. Resistance exercise causes anabolic and anticatabolic effects in skeletal muscle: muscle fibers experience hypertrophy while higher myofibrillar proteins turn over. These changes are leading to the qualitative remodeling of muscle fibers. As a result of these changes, possible maximal muscle strength is increasing. Endurance exercise improves capillary blood supply, increases mitochondrial biogenesis and muscle oxidative capacity, and causes a faster turnover rate of sarcoplasmic proteins as well as qualitative remodeling of type I and IIA muscle fibers. The combination of resistance and endurance exercise may be the fastest way to prevent or decelerate muscle atrophy due to the anabolic and anticatabolic effects of exercise combined with an increase in oxidative capacity. The aim of the present short review is to assess the role of myofibrillar protein catabolism in the development of glucocorticoid-caused myopathy from aging and physical activity aspects.

  16. Masseter muscle myofibrillar protein synthesis and degradation in an experimental critical illness myopathy model.

    Hazem Akkad

    Full Text Available Critical illness myopathy (CIM is a debilitating common consequence of modern intensive care, characterized by severe muscle wasting, weakness and a decreased myosin/actin (M/A ratio. Limb/trunk muscles are primarily affected by this myopathy while cranial nerve innervated muscles are spared or less affected, but the mechanisms underlying these muscle-specific differences remain unknown. In this time-resolved study, the cranial nerve innervated masseter muscle was studied in a unique experimental rat intensive care unit (ICU model, where animals were exposed to sedation, neuromuscular blockade (NMB, mechanical ventilation, and immobilization for durations varying between 6 h and 14d. Gel electrophoresis, immunoblotting, RT-PCR and morphological staining techniques were used to analyze M/A ratios, myofiber size, synthesis and degradation of myofibrillar proteins, and levels of heat shock proteins (HSPs. Results obtained in the masseter muscle were compared with previous observations in experimental and clinical studies of limb muscles. Significant muscle-specific differences were observed, i.e., in the masseter, the decline in M/A ratio and muscle fiber size was small and delayed. Furthermore, transcriptional regulation of myosin and actin synthesis was maintained, and Akt phosphorylation was only briefly reduced. In studied degradation pathways, only mRNA, but not protein levels of MuRF1, atrogin-1 and the autophagy marker LC3b were activated by the ICU condition. The matrix metalloproteinase MMP-2 was inhibited and protective HSPs were up-regulated early. These results confirm that the cranial nerve innervated masticatory muscles is less affected by the ICU-stress response than limb muscles, in accordance with clinical observation in ICU patients with CIM, supporting the model' credibility as a valid CIM model.

  17. Mutations in the satellite cell gene MEGF10 cause a recessive congenital myopathy with minicores.

    Boyden, Steven E; Mahoney, Lane J; Kawahara, Genri; Myers, Jennifer A; Mitsuhashi, Satomi; Estrella, Elicia A; Duncan, Anna R; Dey, Friederike; DeChene, Elizabeth T; Blasko-Goehringer, Jessica M; Bönnemann, Carsten G; Darras, Basil T; Mendell, Jerry R; Lidov, Hart G W; Nishino, Ichizo; Beggs, Alan H; Kunkel, Louis M; Kang, Peter B

    2012-05-01

    We ascertained a nuclear family in which three of four siblings were affected with an unclassified autosomal recessive myopathy characterized by severe weakness, respiratory impairment, scoliosis, joint contractures, and an unusual combination of dystrophic and myopathic features on muscle biopsy. Whole genome sequence from one affected subject was filtered using linkage data and variant databases. A single gene, MEGF10, contained nonsynonymous mutations that co-segregated with the phenotype. Affected subjects were compound heterozygous for missense mutations c.976T > C (p.C326R) and c.2320T > C (p.C774R). Screening the MEGF10 open reading frame in 190 patients with genetically unexplained myopathies revealed a heterozygous mutation, c.211C > T (p.R71W), in one additional subject with a similar clinical and histological presentation as the discovery family. All three mutations were absent from at least 645 genotyped unaffected control subjects. MEGF10 contains 17 atypical epidermal growth factor-like domains, each of which contains eight cysteine residues that likely form disulfide bonds. Both the p.C326R and p.C774R mutations alter one of these residues, which are completely conserved in vertebrates. Previous work showed that murine Megf10 is required for preserving the undifferentiated, proliferative potential of satellite cells, myogenic precursors that regenerate skeletal muscle in response to injury or disease. Here, knockdown of megf10 in zebrafish by four different morpholinos resulted in abnormal phenotypes including unhatched eggs, curved tails, impaired motility, and disorganized muscle tissue, corroborating the pathogenicity of the human mutations. Our data establish the importance of MEGF10 in human skeletal muscle and suggest satellite cell dysfunction as a novel myopathic mechanism.

  18. Mutations in the collagen XII gene define a new form of extracellular matrix-related myopathy.

    Hicks, Debbie; Farsani, Golara Torabi; Laval, Steven; Collins, James; Sarkozy, Anna; Martoni, Elena; Shah, Ashoke; Zou, Yaqun; Koch, Manuel; Bönnemann, Carsten G; Roberts, Mark; Lochmüller, Hanns; Bushby, Kate; Straub, Volker

    2014-05-01

    Bethlem myopathy (BM) [MIM 158810] is a slowly progressive muscle disease characterized by contractures and proximal weakness, which can be caused by mutations in one of the collagen VI genes (COL6A1, COL6A2 and COL6A3). However, there may be additional causal genes to identify as in ∼50% of BM cases no mutations in the COL6 genes are identified. In a cohort of -24 patients with a BM-like phenotype, we first sequenced 12 candidate genes based on their function, including genes for known binding partners of collagen VI, and those enzymes involved in its correct post-translational modification, assembly and secretion. Proceeding to whole-exome sequencing (WES), we identified mutations in the COL12A1 gene, a member of the FACIT collagens (fibril-associated collagens with interrupted triple helices) in five individuals from two families. Both families showed dominant inheritance with a clinical phenotype resembling classical BM. Family 1 had a single-base substitution that led to the replacement of one glycine residue in the triple-helical domain, breaking the Gly-X-Y repeating pattern, and Family 2 had a missense mutation, which created a mutant protein with an unpaired cysteine residue. Abnormality at the protein level was confirmed in both families by the intracellular retention of collagen XII in patient dermal fibroblasts. The mutation in Family 2 leads to the up-regulation of genes associated with the unfolded protein response (UPR) pathway and swollen, dysmorphic rough-ER. We conclude that the spectrum of causative genes in extracellular matrix (ECM)-related myopathies be extended to include COL12A1.

  19. Mitochondrial Myopathy

    ... these disorders and to find ways to effectively treat, prevent, or potentially cure them. Information from the National Library of Medicine’s MedlinePlus ... neuromuscular diseases caused by damage to the mitochondria—small, energy-producing structures that serve as the cells' "power plants." Nerve cells in the brain and muscles ...

  20. Inflammatory Myopathies

    ... National Institutes of Health, the leading supporter of biomedical research in the world. The NINDS, along with other ... Testimony Legislative Updates Impact NINDS Contributions to Approved Therapies ... Director, Division of Intramural Research

  1. Mitochondrial Myopathy

    ... Institutes of Health (NIH), the leading supporter of biomedical research in the world. In conjunction with other NIH ... Testimony Legislative Updates Impact NINDS Contributions to Approved Therapies ... Director, Division of Intramural Research

  2. Mitochondrial Myopathies

    ... noting “soft signs” in unaffected relatives. These include deaf- ness, short stature, migraine headaches and PEO. Muscle ... mitochondrial defects and provide valuable information for family planning. Perhaps most important, knowing the genetic defects that ...

  3. Thyrotoxic Myopathy

    ... potassium levels (known as periodic paralysis). View Full Definition Treatment Treatment involves restoring normal levels of thyroid hormone and may include thyroid drugs, radioactive iodine, and sometimes partial or complete surgical ...

  4. Treatment, Therapy and Management of Metabolic Epilepsy: A Systematic Review

    Vanessa Lin Lin Lee

    2018-03-01

    Full Text Available Metabolic epilepsy is a metabolic abnormality which is associated with an increased risk of epilepsy development in affected individuals. Commonly used antiepileptic drugs are typically ineffective against metabolic epilepsy as they do not address its root cause. Presently, there is no review available which summarizes all the treatment options for metabolic epilepsy. Thus, we systematically reviewed literature which reported on the treatment, therapy and management of metabolic epilepsy from four databases, namely PubMed, Springer, Scopus and ScienceDirect. After applying our inclusion and exclusion criteria as per the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA guidelines, we reviewed a total of 43 articles. Based on the reviewed articles, we summarized the methods used for the treatment, therapy and management of metabolic epilepsy. These methods were tailored to address the root causes of the metabolic disturbances rather than targeting the epilepsy phenotype alone. Diet modification and dietary supplementation, alone or in combination with antiepileptic drugs, are used in tackling the different types of metabolic epilepsy. Identification, treatment, therapy and management of the underlying metabolic derangements can improve behavior, cognitive function and reduce seizure frequency and/or severity in patients.

  5. Morphological study in internal derangement of the temporomandibular joint with MRI. The relationships between the state of the articular disc and limitation of motion of the mandibular head

    Miyazu, Hiroko; Sakurai, Takashi; Numayama, Sukenao; Furuya, Nobuaki; Kashima, Isamu

    1997-01-01

    In this study, we used MRI to investigate the relationships between these factors in temporomandibular joint (TMJ) patients, especially with regard to the range of condylar movement. Bone configurations and articular disc conditions were analyzed in a total of 367 TMJ of 255 internal derangement patients using MRI. We examined the influence of articular disc condition on functional disorder and identified the tendencies of the pathology of patients with internal derangements. Anterolateral displacement was more frequent than anteromedial displacement, and lateral rotary displacement was more frequent than medial rotary displacement. Therefore, the articular disc displaced more readily laterally, rather than medially. With regard to the relationship between the articular disc configuration and reduction, enlargement of the posterior band and biconvex discs showed a tendency for articular disc displacement that did not reduce, while discs with even thickness showed a tendency of articular disc displacement which would reduce. Folding and biconvexity tended to limit condylar movement while less limitation occurred with discs of even thickness. In cases of disc displacement without reduction, there was a significantly higher percentage of cases with limited condylar movement than in cases of displacement with reduction. (K.H.)

  6. Comparison between arthroscopy and 3 dimensional double echo steady state 3D-DESS sequences in magnetic resonance imaging of internal derangements of the knee

    Dongola, Nagwa A.; Gishen, Philip

    2004-01-01

    This study was performed with the aim of evaluating the usefulness of 3 dimensional double-echo steady state sequences in examining the internal derangements of the knee. Arthroscopy was used as a referral standard. The study was performed in the Radiology and Arthroscopy Departments of Kings College Hospital, London, United Kingdom, during a 6-month period from January 1997 to June 1997. All patients who had knee magnetic resonance imaging within 3 months of arthroscopy were retrospectively studied. Thirty-three patients fulfilled these criteria and were selected. Three dimensional double-echo steady state sequences produced sensitivity for detecting meniscal tears of 87.5% for medial menisci (MM) and 75% for lateral menisci (LM). Specificity was 76% for MM and 96% for LM; positive predictive value (PPV) was 46.1% for MM and 85.7% for LM and negative predictive value (NPV) of 95% for MM and 96% for LM. The sensitivity for the anterior cruciate ligament was 83.3%, specificity was 77.7%, PPV was 45.4% and NPV was 95.4%. Three dimensional double-echo steady state sequences are useful in evaluating internal derangement of the knee, especially in advanced cartilage lesions. (author)

  7. Pediatric neurological syndromes and inborn errors of purine metabolism.

    Camici, Marcella; Micheli, Vanna; Ipata, Piero Luigi; Tozzi, Maria Grazia

    2010-02-01

    This review is devised to gather the presently known inborn errors of purine metabolism that manifest neurological pediatric syndromes. The aim is to draw a comprehensive picture of these rare diseases, characterized by unexpected and often devastating neurological symptoms. Although investigated for many years, most purine metabolism disorders associated to psychomotor dysfunctions still hide the molecular link between the metabolic derangement and the neurological manifestations. This basically indicates that many of the actual functions of nucleosides and nucleotides in the development and function of several organs, in particular central nervous system, are still unknown. Both superactivity and deficiency of phosphoribosylpyrophosphate synthetase cause hereditary disorders characterized, in most cases, by neurological impairments. The deficiency of adenylosuccinate lyase and 5-amino-4-imidazolecarboxamide ribotide transformylase/IMP cyclohydrolase, both belonging to the de novo purine synthesis pathway, is also associated to severe neurological manifestations. Among catabolic enzymes, hyperactivity of ectosolic 5'-nucleotidase, as well as deficiency of purine nucleoside phosphorylase and adenosine deaminase also lead to syndromes affecting the central nervous system. The most severe pathologies are associated to the deficiency of the salvage pathway enzymes hypoxanthine-guanine phosphoribosyltransferase and deoxyguanosine kinase: the former due to an unexplained adverse effect exerted on the development and/or differentiation of dopaminergic neurons, the latter due to a clear impairment of mitochondrial functions. The assessment of hypo- or hyperuricemic conditions is suggestive of purine enzyme dysfunctions, but most disorders of purine metabolism may escape the clinical investigation because they are not associated to these metabolic derangements. This review may represent a starting point stimulating both scientists and physicians involved in the study of

  8. Fat metabolism during exercise in patients with mitochondrial disease

    Jeppesen, Tina Dysgaard; Orngreen, Mette Cathrine; Van Hall, Gerrit

    2009-01-01

    . Fat metabolism was determined by means of indirect calorimetry and stable isotope technique in patients and healthy subjects. Patients carried various types and loads (mean [SE], 72% [5%]) of mitochondrial DNA (mtDNA) mutations in skeletal muscle. All subjects exercised at the same absolute workload......OBJECTIVE: To determine whether patients with defects of the respiratory chain have metabolic adaptations that promote a preferential use of fats or carbohydrates, similar to what is observed in metabolic myopathies affecting glycolysis or fat oxidation. DESIGN: Causation and case-control study...... (mean [SE], 65 [10] W), corresponding to 72% (in patients) and 30% (in healthy subjects) of maximum oxygen consumption. SETTING: Neuromuscular research unit. PARTICIPANTS: Ten patients with mtDNA mutations and 10 sex-matched healthy subjects. MAIN OUTCOME MEASURES: Fat turnover, plasma concentrations...

  9. Hypocalcemic myopathy without tetany due to idiopathic hypoparathyroidism: case report Miopatia hipocalcêmica secundária a hipoparatireiodismo idiopático sem tetamia: relato de caso

    Daniel Bocchese Nora

    2004-03-01

    Full Text Available Myopathy due to idiopathic hypoparathyroidism is very unusual. We report on a 30 years-old man referred with complaints of sporadic muscle pain and mild global weakness for 10 years. His physical examination showed normal strength in distal muscle and slightly weakness in the pelvic and scapular girdles with no atrophy. Deep muscle reflexes were slightly hypoactive. Trousseau's and Chvostek's signs were absent. He had bilateral cataract and complex partial seizures. His laboratory tests showed decreased ionised and total calcium and parathyroid hormone and increased muscle enzymes. EMG and muscle biopsy was compatible with metabolic myopathy. After treatment with calcium and vitamin D supplementation he showed clinical, neurophisiological and laboratorial improvement. In conclusion: patients with muscle symptoms, even when non-specific and with normal neurological examination, should have serum calcium checked, as myopathy due to idiopathic hypoparathyroidism, even being rare, is treatable and easy to diagnose.Miopatia secundária a hipoparatireidismo idiopático é enfermidade raramente descrita. Relatamos o caso de homem de 30 anos que procurou atendimento médico com queixas de dores musculares e discreta fraqueza há cerca de 10 anos. Ao exame físico apresentava leve diminuição de força na musculatura pélvica e escapular, sem atrofia, ou fraqueza distal. Os reflexos miotáticos fásicos eram hipoativos e não havia sinais de Trousseau ou Chevostek. Havia história de catarata bilateral e crises parciais complexas. Os exames laboratoriais demonstraram hipocalcemia, com diminuição do paratormônio, hiperfosfatemia e enzimas musculares elevadas. A EMG e a biópsia de músculo foram compatíveis com miopatia metabólica. Após reposição de cálcio e vitamina D houve melhora clínica e neurofisiológica. Em conclusão: em pacientes com sintomas musculares, mesmo não específicos para miopatia ou com exame neurológico normal, deve

  10. Mutation in TWINKLE in a Large Iranian Family with Progressive External Ophthalmoplegia, Myopathy, Dysphagia and Dysphonia, and Behavior Change.

    Tafakhori, Abbas; Yu Jin Ng, Alvin; Tohari, Sumanty; Venkatesh, Byrappa; Lee, Hane; Eskin, Ascia; Nelson, Stanley F; Bonnard, Carine; Reversade, Bruno; Kariminejad, Ariana

    2016-02-01

    TWINKLE (c10orf2) gene is responsible for autosomal dominant progressive external ophthalmoplegia (PEO). In rare cases, additional features such as muscle weakness, peripheral neuropathy, ataxia, cardiomyopathy, dysphagia, dysphonia, cataracts, depression, dementia, parkinsonism, and hearing loss have been reported in association with heterozygous mutations of the TWINKLE gene. We have studied a large Iranian family with myopathy, dysphonia, dysphagia, and behavior change in addition to PEO in affected members. We identified a missense mutation c.1121G > A in the c10orf2 gene in all affected members. Early death is a novel feature seen in affected members of this family that has not been reported to date. The association of PEO, myopathy, dysphonia, dysphagia, behavior change and early death has not been previously reported in the literature or other patients with this mutation.

  11. Internal anal sphincter myopathy causing proctalgia fugax and constipation: further clinical and radiological characterization in a patient.

    Guy, R J; Kamm, M A; Martin, J E

    1997-02-01

    We report a case of a distinctive familial internal anal sphincter myopathy with unique histological and radiological features. A 67-year-old woman presented with a 20-year history of proctalgia fugax and outlet obstruction; other family members were similarly affected. Computed tomograpy and magnetic resonance imaging demonstrated a grossly hypertrophied internal anal sphincter. Strip myectomy of the sphincter was carried out with improvement in evacuation but little relief of proctalgia. Further relief of symptoms was obtained using oral and transdermal nitrates and a calcium antagonist. Histological examination of the excised muscle revealed hypertrophy and an abnormal arrangement of fibres in whorls; many fibres contained vacuoles with inclusion bodies positive for periodic acid-Schiff. This description of a specific anal sphincter myopathy illustrates the potential importance of histopathological studies of smooth muscle in functional disorders of the gut.

  12. Specific binding of Ulex europaeus agglutinin I lectin to sarcolemma of distal myopathy with rimmed vacuole formation.

    Yatabe, K; Kawai, M

    1997-08-01

    Ulex europaeus agglutinin I (UEA I) binding was studied in 83 patients with various neuromuscular disorders. UEA I labelled endomysial capillaries and endothelial cells of perimysial blood vessels in all the examined muscles. There was no UEA I binding to muscle fibres except for all (9) cases of distal myopathy with rimmed vacuole formation (DMRV), 1 of 5 cases of inclusion body myositis and 1 of 36 cases of inflammatory myopathies. The UEA I binding was completely eliminated by preincubation of UEA I solution with L-fucose. Using electron microscopy, the UEA I binding was localized to sarcolemma and intrasarco-plasmic membranous organelles other than mitochondria. Myosatellite cells were not labelled. These findings revealed the existence of fucosylated proteins or lipids in a subset of skeletal muscles suffering from DMRV. Biochemical identification of the fucosylated substance and further detailed study on subcellular localization of UEA I binding may yield important clues to the unknown pathogenesis of DMRV.

  13. Muscle MRI in neutral lipid storage disease with myopathy carrying mutation c.187+1G>A.

    Xu, Chunxiao; Zhao, Yawen; Liu, Jing; Zhang, Wei; Wang, Zhaoxia; Yuan, Yun

    2015-06-01

    We describe the clinical and muscle MRI changes in 2 siblings with neutral lipid storage disease with myopathy (NLSDM) carrying the mutation c.187+1G>A. Peripheral blood smears, genetic tests, and muscle biopsies were performed. Thigh MRI was performed to observe fatty replacement, muscle edema, and muscle bulk from axial sections. Both siblings had similar fatty infiltration and edema. T1-weighted images of the gluteus maximus, adductor magnus, semitendinosus, and semimembranosus revealed marked and diffuse fatty infiltration. There was asymmetric involvement in biceps femoris and quadriceps. There was extensive fatty infiltration in the quadriceps, except for the rectus femoris. Gracilis and sartorius were relatively spared. Thigh muscle volume was decreased, while the gracilis and sartorius appeared to show compensatory hypertrophy. Compared with previous reports in NLSDM, MRI changes in this myopathy tended to be more severe. Asymmetry and relatively selective fatty infiltration were characteristics. © 2014 Wiley Periodicals, Inc.

  14. Stac3 is a component of the excitation-contraction coupling machinery and mutated in Native American myopathy

    Horstick, Eric J.; Linsley, Jeremy W.; Dowling, James J.; Hauser, Michael A.; McDonald, Kristin K.; Ashley-Koch, Allison; Saint-Amant, Louis; Satish, Akhila; Cui, Wilson W.; Zhou, Weibin; Sprague, Shawn M.; Stamm, Demetra S.; Powell, Cynthia M.; Speer, Marcy C.; Franzini-Armstrong, Clara; Hirata, Hiromi; Kuwada, John Y.

    2013-01-01

    Excitation-contraction coupling, the process that regulates contractions by skeletal muscles, transduces changes in membrane voltage by activating release of Ca2+ from internal stores to initiate muscle contraction. Defects in EC coupling are associated with muscle diseases. Here we identify Stac3 as a novel component of the EC coupling machinery. Using a zebrafish genetic screen, we generate a locomotor mutation that is mapped to stac3. We provide electrophysiological, Ca2+ imaging, immunocytochemical and biochemical evidence that Stac3 participates in excitation-contraction coupling in muscles. Furthermore, we reveal that a mutation in human STAC3 as the genetic basis of the debilitating Native American myopathy (NAM). Analysis of NAM stac3 in zebrafish shows that the NAM mutation decreases excitation-contraction coupling. These findings enhance our understanding of both excitation-contraction coupling and the pathology of myopathies. PMID:23736855

  15. To Assess the Association between Glucose Metabolism and Ectopic Lipid Content in Different Clinical Classifications of PCOS

    Göbl, Christian S.; Ott, Johannes; Bozkurt, Latife; Feichtinger, Michael; Rehmann, Victoria; Cserjan, Anna; Heinisch, Maike; Steinbrecher, Helmut; JustKukurova, Ivica; Tuskova, Radka; Leutner, Michael; Vytiska-Binstorfer, Elisabeth; Kurz, Christine; Weghofer, Andrea; Tura, Andrea; Egarter, Christian; Kautzky-Willer, Alexandra

    2016-01-01

    Aims There are emerging data indicating an association between PCOS (polycystic ovary syndrome) and metabolic derangements with potential impact on its clinical presentation. This study aims to evaluate the pathophysiological processes beyond PCOS with particular focus on carbohydrate metabolism, ectopic lipids and their possible interaction. Differences between the two established classifications of the disease should be additionally evaluated. Methods A metabolic characterization was performed in 53 untreated PCOS patients as well as 20 controls including an extended oral glucose tolerance test (OGTT, to assess insulin sensitivity, secretion and ß-cell function) in addition to a detailed examination of ectopic lipid content in muscle and liver by nuclear magnetic resonance spectroscopy. Results Women with PCOS classified by the original NIH 1990 definition showed a more adverse metabolic risk profile compared to women characterized by the additional Rotterdam 2003 phenotypes. Subtle metabolic derangements were observed in both subgroups, including altered shapes of OGTT curves, impaired insulin action and hyperinsulinemia due to increased secretion and attenuated hepatic extraction. No differences were observed for ectopic lipids between the groups. However, particularly hepatocellular lipid content was significantly related to clinical parameters of PCOS like whole body insulin sensitivity, dyslipidemia and free androgen index. Conclusions Subtle alterations in carbohydrate metabolism are present in both PCOS classifications, but more profound in subjects meeting the NIH 1990 criteria. Females with PCOS and controls did not differ in ectopic lipids, however, liver fat was tightly related to hyperandrogenism and an adverse metabolic risk profile. PMID:27505055

  16. Mild trifunctional protein deficiency is associated with progressive neuropathy and myopathy and suggests a novel genotype-phenotype correlation.

    Ibdah, J A; Tein, I; Dionisi-Vici, C; Bennett, M J; IJlst, L; Gibson, B; Wanders, R J; Strauss, A W

    1998-01-01

    Human mitochondrial trifunctional protein (TFP) is a heterooctamer of four alpha- and four beta-subunits that catalyzes three steps in the beta-oxidation spiral of long-chain fatty acids. TFP deficiency causes a Reye-like syndrome, cardiomyopathy, or sudden, unexpected death. We delineated the molecular basis for TFP deficiency in two patients with a unique phenotype characterized by chronic progressive polyneuropathy and myopathy without hepatic or cardiac involvement. Single-stranded confor...

  17. Performance, meat quality, and pectoral myopathies of broilers fed either corn or sorghum based diets supplemented with guanidinoacetic acid.

    Córdova-Noboa, H A; Oviedo-Rondón, E O; Sarsour, A H; Barnes, J; Ferzola, P; Rademacher-Heilshorn, M; Braun, U

    2018-04-13

    One experiment was conducted to evaluate the effects of guanidinoacetic acid (GAA) supplementation in broilers fed corn or sorghum-based diets on live performance, carcass and cut up yields, meat quality, and pectoral myopathies. The treatments consisted of corn or sorghum-based diets with or without the addition of GAA (600 g/ton). A total of 800 one-d-old male Ross 708 broiler chicks were randomly placed in 40 floor pens with 10 replicates (20 birds per pen) per each of the four treatments. At hatch, 14, 35, and 50 d, BW and feed intake were recorded. BW gain and FCR were calculated at the end of each phase. Four broilers per pen were selected and slaughtered at 51d and 55d of age to determine carcass and cut up yields, meat quality and myopathies (spaghetti muscle, white striping, and wooden breast) severity in the Pectoralis major. Data were analyzed as a randomized complete block design in a 2 × 2 factorial arrangement with grain type and GAA supplementation as main effects. At 50 d, diets containing GAA improved (P broilers fed corn diets with GAA had higher breast meat yield (P 0.05) by GAA supplementation at any slaughter ages. However, GAA decreased (P broilers supplemented with GAA had double (P broilers fed non-supplemented diets, therefore reducing the severity of this myopathy. In conclusion, GAA supplementation improved broiler live performance in broilers raised up to 50 d independently of grain source, increased breast meat yield in corn-based diets and reduced the severity of wooden breast myopathy.

  18. Mutation in the novel nuclear-encoded mitochondrial protein CHCHD10 in a family with autosomal dominant mitochondrial myopathy.

    Ajroud-Driss, Senda; Fecto, Faisal; Ajroud, Kaouther; Lalani, Irfan; Calvo, Sarah E; Mootha, Vamsi K; Deng, Han-Xiang; Siddique, Nailah; Tahmoush, Albert J; Heiman-Patterson, Terry D; Siddique, Teepu

    2015-01-01

    Mitochondrial myopathies belong to a larger group of systemic diseases caused by morphological or biochemical abnormalities of mitochondria. Mitochondrial disorders can be caused by mutations in either the mitochondrial or nuclear genome. Only 5% of all mitochondrial disorders are autosomal dominant. We analyzed DNA from members of the previously reported Puerto Rican kindred with an autosomal dominant mitochondrial myopathy (Heimann-Patterson et al. 1997). Linkage analysis suggested a putative locus on the pericentric region of the long arm of chromosome 22 (22q11). Using the tools of integrative genomics, we established chromosome 22 open reading frame 16 (C22orf16) (later designated as CHCHD10) as the only high-scoring mitochondrial candidate gene in our minimal candidate region. Sequence analysis revealed a double-missense mutation (R15S and G58R) in cis in CHCHD10 which encodes a coiled coil-helix-coiled coil-helix protein of unknown function. These two mutations completely co-segregated with the disease phenotype and were absent in 1,481 Caucasian and 80 Hispanic (including 32 Puerto Rican) controls. Expression profiling showed that CHCHD10 is enriched in skeletal muscle. Mitochondrial localization of the CHCHD10 protein was confirmed using immunofluorescence in cells expressing either wild-type or mutant CHCHD10. We found that the expression of the G58R, but not the R15S, mutation induced mitochondrial fragmentation. Our findings identify a novel gene causing mitochondrial myopathy, thereby expanding the spectrum of mitochondrial myopathies caused by nuclear genes. Our findings also suggest a role for CHCHD10 in the morphologic remodeling of the mitochondria.

  19. [Fenofibrate--induced myopathy in a patient with undiagnosed hypothyroidism--case report and a review of the literature].

    Lukjanowicz, Małgorzata; Trzcińska-Butkiewicz, Beata; Brzosko, Marek

    2006-01-01

    Hypothyroidism is one of the common causes of the secondary hypercholesterolemia. The prevalence of hypothyroidism in the general population is estimated to be as high as about 1.5%. Frequency of the hypothyroidism in patients with hyperlipidemia is high, and can be observed in 4.2-10% in different populations. Most commonly, there is no need to treat the hypothyroid patients with the hypolipidemic drugs. Substitution treatment with the thyroid hormones usually results in either normalization or significant decreasing of the lipid levels. Hypothyroidism with symptoms of involvement of skeletal muscles is referred as to hypothyroid myopathy in English literature, and can be present in 30-80% patients with deficiency of the thyroid hormones. Hypothyroidism is a risk factor of developing of toxic injury of muscles, what is thought to be related to hypolipidemic drug intake. We report a case of a patient with undiagnosed hypothyroidism with muscle involvement manifestation, who was treated with fenofibrate due to accidentally diagnosed hypercholesterolemia. Hypolipidemic management resulted in rapid exacerbation of previously moderate myopathy. High concentrations of muscle enzymes and moderate increasing of creatinine concentration were detected. Improvement was observed after discontinuation of fenofibrate administration, but muscle symptoms and elevation of muscle enzymes and creatinine persisted. After administration of levothyroxin, muscle weakness and laboratory abnormalities were observed no longer. After several months of follow-up we believe that treatment with fenofibrate in our patient was complicated with muscle tissue damage and exacerbated symptoms of myopathy originally related to decompensated hypothyroidism.

  20. Nemaline myopathy and heart failure: role of ivabradine; a case report.

    Sarullo, Filippo M; Vitale, Giuseppe; Di Franco, Antonino; Sarullo, Silvia; Salerno, Ylenia; Vassallo, Laura; Baviera, Emanuela Petrona; Marazia, Stefania; Mandalà, Giorgio; Lanza, Gaetano A

    2015-01-19

    Nemaline myopathy (NM) is a rare congenital myopathy characterized by muscle weakness, hypotonia and the presence in muscle fibers of inclusions known as nemaline bodies and a wide spectrum of clinical phenotypes, ranging from severe forms with neonatal onset to asymptomatic forms. The adult-onset form is heterogeneous in terms of clinical presentation and disease progression. Cardiac involvement occurs in the minority of cases and little is known about medical management in this subgroup of NM patients. We report a rare case of heart failure (HF) in a patient with adult-onset NM in whom ivabradine proved to be able to dramatically improve the clinical picture. We report a case of a 37-year-old man with adult-onset NM, presenting with weakness and hypotonia of the proximal limb muscles and shoulder girdle, severely limiting daily activities. He developed progressive HF over a period of 6 months while attending a rehabilitation program, with reduced left ventricular ejection fraction (LVEF = 20%), manifested by dyspnea and signs of systemic congestion. The patient was started HF therapy with enalapril, carvedilol, spironolactone and loop diuretics. Target HF doses of these drugs (including carvedilol) were not reached because of symptomatic hypotension causing a high resting heart rate (HR) ≥70 beats per minute (bpm). Further deterioration of the clinical picture occurred with several life-threatening arrhythmic episodes requiring external defibrillation. An implantable cardioverter defibrillator (ICD) was then implanted. Persistent high resting HR was successfully treated with ivabradine with HR lowering from 90 bpm to 55 bpm at 1 month follow up, LVEF rising to 50% at 3 month follow up and to 54% at 2,5 year follow up. To date no more hospitalizations for heart failure occurred. A single hospitalization due to aspiration pneumonia required insertion of a tracheostomy tube to protect airways from further aspiration. At present, the patient is attending

  1. Evaluation of the condylar movement on MRI during maximal mouth opening in patients with internal derangement of TMJ; comparison with transcranial view

    Cho, Bong Hae

    2001-01-01

    To evaluate the condylar movement at maximal mouth opening on MRI in patients with internal derangement. MR images and transcranial views for 102 TMJs in 51 patients were taken in closed and maximal opening positions, and the amount of condylar movement was analyzed annotatively and qualitatively. For MR images, the mean condylar movements were 9.4 mm horizontally, 4.6 mm vertically and 10.9 mm totally, while those for transcranial views were 12.5 mm, 4.6 mm, and 13.7 mm respectively. The condyle moved forward beyond the summit of the articular eminence in 41 TMJs (40.2%) for MR images than in transcranial views

  2. The prevalence of erosive osseous changes of the articular eminence in the temporomandibular joint in patients with mandibular prognathism without internal derangement. MR and helical CT findings

    Hayashi, Takafumi; Ito, Jusuke; Tanaka, Rei; Koyama, Jun-ichi; Kobayashi, Fukiko [Niigata Univ. (Japan). Graduate School of Medical and Dental Sciences

    2002-06-01

    The aim of this study was to assess the prevalence of erosive osseous changes of the articular eminence in the temporomandibular joint without internal derangement. Sixty joints of 30 consecutive patients with mandibular prognathism were evaluated with both MR imaging and helical CT. On MPR images obtained with helical CT, erosive osseous changes of the articular eminence were observed in 18 joints (30%) of 13 patients. None of the joints studied demonstrated an osseous change in the mandibular condyle. MR imaging failed to detect erosive osseous changes of the articular eminence in all of the joints studied. In conclusion, MPR images obtained with helical CT were of value to detect erosive osseous changes of the articular eminence. (author)

  3. The prevalence of erosive osseous changes of the articular eminence in the temporomandibular joint in patients with mandibular prognathism without internal derangement. MR and helical CT findings

    Hayashi, Takafumi; Ito, Jusuke; Tanaka, Rei; Koyama, Jun-ichi; Kobayashi, Fukiko

    2002-01-01

    The aim of this study was to assess the prevalence of erosive osseous changes of the articular eminence in the temporomandibular joint without internal derangement. Sixty joints of 30 consecutive patients with mandibular prognathism were evaluated with both MR imaging and helical CT. On MPR images obtained with helical CT, erosive osseous changes of the articular eminence were observed in 18 joints (30%) of 13 patients. None of the joints studied demonstrated an osseous change in the mandibular condyle. MR imaging failed to detect erosive osseous changes of the articular eminence in all of the joints studied. In conclusion, MPR images obtained with helical CT were of value to detect erosive osseous changes of the articular eminence. (author)

  4. The DAMASK trial protocol: a pragmatic randomised trial to evaluate whether GPs should have direct access to MRI for patients with suspected internal derangement of the knee

    Orchard Jo

    2006-10-01

    Full Text Available Abstract Background Though new technologies like Magnetic Resonance Imaging (MRI may be accurate, they often diffuse into practice before thorough assessment of their value in diagnosis and management, and of their effects on patient outcome and costs. MRI of the knee is a common investigation despite concern that it is not always appropriate. There is wide variation in general practitioners (GPs access to, and use of MRI, and in the associated costs. The objective of this study was to resolve uncertainty whether GPs should refer patients with suspected internal derangement of the knee for MRI or to an orthopaedic specialist in secondary care. Methods/Design The design consisted of a pragmatic multi-centre randomised trial with two parallel groups and concomitant economic evaluation. Patients presenting in general practice with suspected internal derangement of the knee and for whom their GP was considering referral to an orthopaedic specialist in secondary care were eligible for inclusion. Within practices, GPs or practice nurses randomised eligible and consenting participants to the local radiology department for an MRI examination, or for consultation with an orthopaedic specialist. To ensure that the waiting time from GP consultation to orthopaedic appointment was similar for both trial arms, GPs made a provisional referral to orthopaedics when requesting the MRI examination. Thus we evaluated the more appropriate sequence of events independent of variations in waiting times. Follow up of participants was by postal questionnaires at six, twelve and 24 months after randomisation. This was to ensure that the evaluation covered all events up to and including arthroscopy. Discussion The DAMASK trial should make a major contribution to the development of evidence-based partnerships between primary and secondary care professionals and inform the debate when MRI should enter the diagnostic pathway.

  5. The DAMASK trial protocol: a pragmatic randomised trial to evaluate whether GPs should have direct access to MRI for patients with suspected internal derangement of the knee

    Brealey, Stephen D; Atwell, Christine; Bryan, Stirling; Coulton, Simon; Cox, Helen; Cross, Ben; Fylan, Fiona; Garratt, Andrew; Gilbert, Fiona J; Gillan, Maureen GC; Hendry, Maggie; Hood, Kerenza; Houston, Helen; King, David; Morton, Veronica; Orchard, Jo; Robling, Michael; Russell, Ian T; Torgerson, David; Wadsworth, Valerie; Wilkinson, Clare

    2006-01-01

    Background Though new technologies like Magnetic Resonance Imaging (MRI) may be accurate, they often diffuse into practice before thorough assessment of their value in diagnosis and management, and of their effects on patient outcome and costs. MRI of the knee is a common investigation despite concern that it is not always appropriate. There is wide variation in general practitioners (GPs) access to, and use of MRI, and in the associated costs. The objective of this study was to resolve uncertainty whether GPs should refer patients with suspected internal derangement of the knee for MRI or to an orthopaedic specialist in secondary care. Methods/Design The design consisted of a pragmatic multi-centre randomised trial with two parallel groups and concomitant economic evaluation. Patients presenting in general practice with suspected internal derangement of the knee and for whom their GP was considering referral to an orthopaedic specialist in secondary care were eligible for inclusion. Within practices, GPs or practice nurses randomised eligible and consenting participants to the local radiology department for an MRI examination, or for consultation with an orthopaedic specialist. To ensure that the waiting time from GP consultation to orthopaedic appointment was similar for both trial arms, GPs made a provisional referral to orthopaedics when requesting the MRI examination. Thus we evaluated the more appropriate sequence of events independent of variations in waiting times. Follow up of participants was by postal questionnaires at six, twelve and 24 months after randomisation. This was to ensure that the evaluation covered all events up to and including arthroscopy. Discussion The DAMASK trial should make a major contribution to the development of evidence-based partnerships between primary and secondary care professionals and inform the debate when MRI should enter the diagnostic pathway. PMID:17040558

  6. Effects of intermittent fasting on metabolism in men.

    Azevedo, Fernanda Reis de; Ikeoka, Dimas; Caramelli, Bruno

    2013-01-01

    This review analyzes the available literature on the impact of intermittent fasting (IF), a nutritional intervention, on different aspects of metabolism. The epidemic of metabolic disturbances, such as obesity, metabolic syndrome (MS), and diabetes mellitus type 2 has led to an increase in the prevalence of cardiovascular diseases, and affected patients might significantly benefit from modifications in nutritional habits. Recent experimental studies have elucidated some of the metabolic mechanisms involved with IF. Animal models have shown positive changes in glucose (lower plasma glucose and insulin levels) and in lipid metabolism (reduced visceral fat tissue and increased plasma adiponectin level), and an increased resistance to stress. Despite the limited number of samples studied, positive results have been reported on the impact of IF for human health. IF is reported to improve the lipid profile; to decrease inflammatory responses, reflected by changes in serum adipokine levels; and to change the expression of genes related to inflammatory response and other factors. Studies on obese individuals have shown that patient compliance was greater for IF than other traditional nutritional approaches (calorie restriction), and IF was found to be associated with low oxidative stress. Recent reports suggest that IF exerts a positive impact on the metabolic derangements commonly associated with cardiovascular diseases, and that it may be a viable and accessible intervention for most individuals. Therefore, further clinical studies are essential to test the effectiveness of IF in preventing and controlling metabolic and cardiovascular diseases. Copyright © 2013 Elsevier Editora Ltda. All rights reserved.

  7. Hepatitis C, human immunodeficiency virus and metabolic syndrome: interactions.

    Kotler, Donald P

    2009-03-01

    Significant concerns have been raised about the metabolic effects of antiretroviral medication, including the classic triad of dyslipidaemia, insulin resistance (IR) and characteristic alterations in fat distribution (lipoatrophy and lipohypertrophy). Co-infection with hepatitis C appears to exacerbate IR, reduce serum lipids and induce prothrombotic changes in the treated human immunodeficiency virus patient. The effects of co-infection are complex. While combination antiretroviral therapy has been shown to be associated with an increased risk of cardiovascular events through promotion of dyslipidaemia, IR and fat redistribution, co-infection exacerbates IR while reducing serum lipids. Co-infection also promotes a prothrombotic state characterized by endothelial dysfunction and platelet activation, which may enhance risk for cardiovascular disease. Consideration must be given to selection of appropriate treatment regimens and timing of therapy in co-infected patients to minimize metabolic derangements and, ultimately, reduce cardiovascular risk.

  8. Flex Sensor Based Biofeedback Monitoring for Post-Stroke Fingers Myopathy Patients

    Garda, Y. R.; Caesarendra, W.; Tjahjowidodo, T.; Turnip, A.; Wahyudati, S.; Nurhasanah, L.; Sutopo, D.

    2018-04-01

    Hands are one of the crucial parts of the human body in carrying out daily activities. Accidents on the hands decreasing in motor skills of the hand so that therapy is necessary to restore motor function of the hand. In addition to accidents, hand disabilities can be caused by certain diseases, e.g. stroke. Stroke is a partial destruction of the brain. It occurs if the arteries that drain blood to the brain are blocked, or if torn or leak. The purpose of this study to make biofeedback monitoring equipment for post-stroke hands myopathy patients. Biofeedback is an alternative method of treatment that involves measuring body functions measured subjects such as skin temperature, sweat activity, blood pressure, heart rate and hand paralysis due to stroke. In this study, the sensor used for biofeedback monitoring tool is flex sensor. Flex sensor is a passive resistive device that changes its resistance as the sensor is bent. Flex sensor converts the magnitude of the bend into electrical resistance, the greater the bend the greater the resistance value. The monitoring used in this biofeedback monitoring tool uses Graphical User Interface (GUI) in C# programming language. The motivation of the study is to monitor and record the progressive improvement of the hand therapy. Patients who experienced post-stroke can see the therapy progress quantitatively.

  9. Myotubular myopathy and the neuromuscular junction: a novel therapeutic approach from mouse models

    James J. Dowling

    2012-11-01

    Myotubular myopathy (MTM is a severe congenital muscle disease characterized by profound weakness, early respiratory failure and premature lethality. MTM is defined by muscle biopsy findings that include centralized nuclei and disorganization of perinuclear organelles. No treatments currently exist for MTM. We hypothesized that aberrant neuromuscular junction (NMJ transmission is an important and potentially treatable aspect of the disease pathogenesis. We tested this hypothesis in two murine models of MTM. In both models we uncovered evidence of a disorder of NMJ transmission: fatigable weakness, improved strength with neostigmine, and electrodecrement with repetitive nerve stimulation. Histopathological analysis revealed abnormalities in the organization, appearance and size of individual NMJs, abnormalities that correlated with changes in acetylcholine receptor gene expression and subcellular localization. We additionally determined the ability of pyridostigmine, an acetylcholinesterase inhibitor, to ameliorate aspects of the behavioral phenotype related to NMJ dysfunction. Pyridostigmine treatment resulted in significant improvement in fatigable weakness and treadmill endurance. In all, these results describe a newly identified pathological abnormality in MTM, and uncover a potential disease-modifying therapy for this devastating disorder.

  10. Role of TGF-β signaling in inherited and acquired myopathies

    Burks Tyesha N

    2011-05-01

    Full Text Available Abstract The transforming growth factor-beta (TGF-β superfamily consists of a variety of cytokines expressed in many different cell types including skeletal muscle. Members of this superfamily that are of particular importance in skeletal muscle are TGF-β1, mitogen-activated protein kinases (MAPKs, and myostatin. These signaling molecules play important roles in skeletal muscle homeostasis and in a variety of inherited and acquired neuromuscular disorders. Expression of these molecules is linked to normal processes in skeletal muscle such as growth, differentiation, regeneration, and stress response. However, chronic elevation of TGF-β1, MAPKs, and myostatin is linked to various features of muscle pathology, including impaired regeneration and atrophy. In this review, we focus on the aberrant signaling of TGF-β in various disorders such as Marfan syndrome, muscular dystrophies, sarcopenia, and critical illness myopathy. We also discuss how the inhibition of several members of the TGF-β signaling pathway has been implicated in ameliorating disease phenotypes, opening up novel therapeutic avenues for a large group of neuromuscular disorders.

  11. Vitamin D Receptor Gene Polymorphisms and Haplotypes in Hungarian Patients with Idiopathic Inflammatory Myopathy

    Levente Bodoki

    2015-01-01

    Full Text Available Idiopathic inflammatory myopathies are autoimmune diseases characterized by symmetrical proximal muscle weakness. Our aim was to identify a correlation between VDR polymorphisms or haplotypes and myositis. We studied VDR-BsmI, VDR-ApaI, VDR-TaqI, and VDR-FokI polymorphisms and haplotypes in 89 Hungarian poly-/dermatomyositis patients (69 females and 93 controls (52 females. We did not obtain any significant differences for VDR-FokI, BsmI, ApaI, and TaqI genotypes and allele frequencies between patients with myositis and healthy individuals. There was no association of VDR polymorphisms with clinical manifestations and laboratory profiles in myositis patients. Men with myositis had a significantly different distribution of BB, Bb, and bb genotypes than female patients, control male individuals, and the entire control group. Distribution of TT, Tt, and tt genotypes was significantly different in males than in females in patient group. According to four-marker haplotype prevalence, frequencies of sixteen possible haplotypes showed significant differences between patient and control groups. The three most frequent haplotypes in patients were the fbAt, FBaT, and fbAT. Our findings may reveal that there is a significant association: Bb and Tt genotypes can be associated with myositis in the Hungarian population we studied. We underline the importance of our result in the estimated prevalence of four-marker haplotypes.

  12. Clinical significance of magnetic resonance imaging of skeletal muscles in idiopathic inflammatory myopathies of adults

    Nishikai, Masahiko; Akiya, Kumiko [National Tokyo Medical Center (Japan)

    2000-12-01

    The purpose of this study was to evaluate the clinical significance of magnetic resonance imaging (MRI) of skeletal muscles in Japanese patients with idiopathic inflammatory myopathies (IIM). MRI was performed in 23 adult patients with IIM, including 10 with polymyositis, 12 with dermatomyositis, and 1 with focal myositis. Seven (73%) of 11 patients with active IIM and 2 (17%) of 12 patients with inactive IIM showed hyperintensity of T2-weighted images and normal intensity of T1-weighted images, indicating 'edema-like abnormalities' (MRI findings for active myositis). Muscle lipomatosis and fibrosis were demonstrated in four patients and 1 patient, respectively. Considerable selectivity of muscles in developing inflammatory disorders was found. In quadriceps muscles, for example, vastus muscles seemed to be more often affected in DM patients, whereas adductors were more often affected in PM patients. Serial examination of muscle MRIs was carried out in 4 patients and the findings paralleled the disease activities. The muscle MRI findings did not necessarily correlate with other findings, such as the presence of muscle weakness, elevated serum creatine kinase levels, myogenic electromyogram, or muscle biopsy findings. The muscle MRI was considered to be an additional useful tool for the diagnosis, evaluation of disease activity, and planning treatment of IIM. (author)

  13. Rare myositis-specific autoantibody associations among Hungarian patients with idiopathic inflammatory myopathy.

    Bodoki, L; Nagy-Vincze, M; Griger, Z; Betteridge, Z; Szöllősi, L; Jobanputra, R; Dankó, K

    2015-01-01

    Idiopathic inflammatory myopathies are systemic, chronic autoimmune diseases characterized by symmetrical, proximal muscle weakness. Homogeneous groups present with similar symptoms. The response to therapy and prognosis could be facilitated by myositis-specific autoantibodies, and in this way, give rise to immunoserological classification. The myositis-specific autoantibodies are directed against specific proteins found in the cytoplasm or in the nucleus of the cells. To date, literature suggests the rarity of the co-existence of two myositis-specific autoantibodies. In this study the authors highlight rare associations of myositis-specific autoantibodies. Three hundred and thirty-seven Hungarian patients with polymyositis or dermatomyositis were studied. Their clinical findings were noted retrospectively. Specific blood tests identified six patients with the rare co-existence of myositis-specific autoantibodies, anti-Jo-1 and anti-SRP, anti-Jo-1 and anti-Mi-2, anti-Mi-2 and anti-PL-12, anti-Mi-2 and anti-SRP, and anti-SRP and anti-PL-7, respectively. This case review aims to identify the clinical importance of these rare associations and their place within the immunoserological classification.

  14. Clinical significance of magnetic resonance imaging of skeletal muscles in idiopathic inflammatory myopathies of adults

    Nishikai, Masahiko; Akiya, Kumiko

    2000-01-01

    The purpose of this study was to evaluate the clinical significance of magnetic resonance imaging (MRI) of skeletal muscles in Japanese patients with idiopathic inflammatory myopathies (IIM). MRI was performed in 23 adult patients with IIM, including 10 with polymyositis, 12 with dermatomyositis, and 1 with focal myositis. Seven (73%) of 11 patients with active IIM and 2 (17%) of 12 patients with inactive IIM showed hyperintensity of T2-weighted images and normal intensity of T1-weighted images, indicating 'edema-like abnormalities' (MRI findings for active myositis). Muscle lipomatosis and fibrosis were demonstrated in four patients and 1 patient, respectively. Considerable selectivity of muscles in developing inflammatory disorders was found. In quadriceps muscles, for example, vastus muscles seemed to be more often affected in DM patients, whereas adductors were more often affected in PM patients. Serial examination of muscle MRIs was carried out in 4 patients and the findings paralleled the disease activities. The muscle MRI findings did not necessarily correlate with other findings, such as the presence of muscle weakness, elevated serum creatine kinase levels, myogenic electromyogram, or muscle biopsy findings. The muscle MRI was considered to be an additional useful tool for the diagnosis, evaluation of disease activity, and planning treatment of IIM. (author)

  15. Hemolysis, myopathy, and cardiac disease associated with hereditary phosphofructokinase deficiency in two Whippets

    Gerber, Karen; Harvey, John W.; D'Agorne, Sara; Wood, Jonathan; Giger, Urs

    2009-01-01

    Two male castrated Whippet littermates were presented at 1 year of age for pallor, tachycardia, systolic heart murmur, dark yellow to orange feces, intermittent lethargy, pigmenturia, and muscle shivering or cramping after exercise. Persistent macrocytic hypochromic anemia with marked reticulocytosis and metarubricytosis was found when CBC results were compared with reference values for Whippets. Increased serum creatine kinase activity and hyperkalemia also were sometimes present over the 4-year period of evaluation. Progressively increasing serum concentrations of N-terminal prohormone brain natriuretic peptide suggested cardiac disease. Erythrocytes from the whippets were less osmotically fragile but more alkaline fragile than those from control dogs. Erythrocyte phosphofructokinase (PFK) activities and 2,3-diphosphoglycerate concentrations were decreased. Restriction enzyme-based DNA test screening and DNA sequencing revealed the same mutation in the muscle-PFK gene of the Whippets as seen in English Springer Spaniel dogs with PFK deficiency. This is the first report of PFK deficiency in Whippet dogs. In addition to causing hemolysis and exertional myopathy, heart disease may be a prominent clinical component of PFK deficiency in this breed and has not been previously recognized in PFK-deficient English Springer Spaniels. PMID:19228357

  16. Two desmin gene mutations associated with myofibrillar myopathies in Polish families.

    Jakub Piotr Fichna

    Full Text Available Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P and a small deletion of nine nucleotides (A357_E359del, previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization.

  17. Mitochondrial myopathy, encephalopathy, lactate acidosis with stroke-like episodes syndrome (MELAS: A case report

    Petrović Igor N.

    2012-01-01

    Full Text Available Introduction. Mitochondrial encephalopathy, lactacidosis and stroke-like episodes (MELAS represent a multisystemic dysfunction due to various mutations in mitochondrial DNA. Here we report a patient with genetically confirmed MELAS. Case Outline. A patient is presented whose clinical features involved short stature, easy tendency to fatigue, recurrent seizures, progressive cognitive decline, myopathy, sensorineural deafness, diabetes mellitus as well as stroke-like episodes. The major clinical feature of migraine type headache was not present. Neuroimaging studies revealed signs of ischemic infarctions localized in the posterior regions of the brain cortex. Electron microscopy of the skeletal muscle biopsy showed subsarcolemmal accumulation of a large number of mitochondria with paracristal inclusions in the skeletal muscle cells. The diagnosis of MELAS was definitively confirmed by the detection of a specific point mutation A to G at nucleotide position 3243 of mitochondrial DNA. Conclusion. When a relatively young patient without common risk factors for ischemic stroke presents with signs of occipitally localized brain infarctions accompanied with multisystemic dysfunction, MELAS syndrome, it is necessary to conduct investigations in order to diagnose the disease.

  18. MiR-320a as a Potential Novel Circulating Biomarker of Arrhythmogenic CardioMyopathy.

    Sommariva, Elena; D'Alessandra, Yuri; Farina, Floriana Maria; Casella, Michela; Cattaneo, Fabio; Catto, Valentina; Chiesa, Mattia; Stadiotti, Ilaria; Brambilla, Silvia; Dello Russo, Antonio; Carbucicchio, Corrado; Vettor, Giulia; Riggio, Daniela; Sandri, Maria Teresa; Barbuti, Andrea; Vernillo, Gianluca; Muratori, Manuela; Dal Ferro, Matteo; Sinagra, Gianfranco; Moimas, Silvia; Giacca, Mauro; Colombo, Gualtiero Ivanoe; Pompilio, Giulio; Tondo, Claudio

    2017-07-06

    Diagnosis of Arrhythmogenic CardioMyopathy (ACM) is challenging and often late after disease onset. No circulating biomarkers are available to date. Given their involvement in several cardiovascular diseases, plasma microRNAs warranted investigation as potential non-invasive diagnostic tools in ACM. We sought to identify circulating microRNAs differentially expressed in ACM with respect to Healthy Controls (HC) and Idiopathic Ventricular Tachycardia patients (IVT), often in differential diagnosis. ACM and HC subjects were screened for plasmatic expression of 377 microRNAs and validation was performed in 36 ACM, 53 HC, 21 IVT. Variable importance in data partition was estimated through Random Forest analysis and accuracy by Receiver Operating Curves. Plasmatic miR-320a showed 0.53 ± 0.04 fold expression difference in ACM vs. HC (p ACM (n = 13) and HC (n = 17) with athletic lifestyle, a ACM precipitating factor. Importantly, ACM patients miR-320a showed 0.78 ± 0.05 fold expression change vs. IVT (p = 0.03). When compared to non-invasive ACM diagnostic parameters, miR-320a ranked highly in discriminating ACM vs. IVT and it increased their accuracy. Finally, miR-320a expression did not correlate with ACM severity. Our data suggest that miR-320a may be considered a novel potential biomarker of ACM, specifically useful in ACM vs. IVT differentiation.

  19. Ascending paresis as presentation of an unusual association between necrotizing autoimmune myopathy and systemic lupus erythematosus.

    García-Reynoso, Marco Julio; Veramendi-Espinoza, Liz Eliana; Ruiz-Garcia, Henry Jeison

    2014-01-01

    A 45 year-old man went to the emergency room due to disease duration of 15 days of insidious onset and progressive course. It began with symmetrical weakness and pain in feet and ankles that extends upward to the knees. Later, this progressed to paraparesis with Creatine phosphokinase levels of 44,270 U/L and respiratory failure that required mechanical ventilation. Electromyography and muscle biopsy of quadriceps were made. The patient responded to corticotherapy in pulses and supporting management. The presentation of ascending paresis suggested the diagnosis of Guillain-Barré syndrome. However, the degree of muscle involvement with rhabdomyolysis explains the neurological damage by itself. The biopsy revealed pathological criteria for necrotizing autoimmune myopathy (NAM), as well as other clinical and laboratory evidence. Patient disease continued and reached criteria for systemic lupus erythematosus (SLE). To our best knowledge, this is the first report of the NAM and SLE association. Copyright © 2012 Elsevier España, S.L. All rights reserved.

  20. Neuropatia na miopatia miotubular ou centronuclear Neuropathy in myotubular or centronuclear myopathy

    Roberto E. P. Sica

    1975-06-01

    Full Text Available Un estudio electrofisiológico detallado fué hecho en los músculos extensor corto de los dedos, de la eminencia tenar, de la eminencia hipotenar y soleo en un paciente con el diagnóstico de miopatía miotubular o centronuclear. El hallazgo principal fué una notoria reducción en el número de unidades motoras activas en todos los músculos investigados, en tanto que las unidades remanentes mostraron tamaño conservado. Las observaciones hechas se han interpretado como favoreciéndo la génesis neurógena en el desarrollo de este proceso.A detailed electrophysiological study has been made of the extensor digitorum brevis, thenar, hypothenar and soleus muscles in one patient with myotubular or centronuclear myopathy. The main finding was a noticeable reduction in the population of active motor units in all the investigated muscles. The remainer units showed normal sizes. The experimental observations have been interpreted in terms of a neuropathic process.

  1. The spectrum of myopathies in the city of São Paulo

    José A. Levy

    1976-12-01

    Full Text Available A review of all myopathic patients treated at the Neurologic Clinic of the Medical School of the University of São Paulo during the past 15 years is reported. A total of 466 cases were examined and distributed as follows: 56% of progressive muscular dystrophy; 31% of myasthenia gravis; 6% of polymyositis; 4% of myotonic dystrophy; and the remainder of several different diseases (central core disease, Kearns-syndrome, myotonia congenita, adynamia episodica hereditaria, diabetic myopathy and Eaton-Lambert syndrome. Enzymatic dosages, electromyography, muscle biopsy, electrocardiography and genetic counselling are also reported.Os autores fazem uma revisão de todos os casos de miopatias tratados na Clínica Neurológica da F.M.U.S.P. durante os últimos 15 anos. Foram examinados 466 casos, assim distribuídos: 56% de distrofia muscular progressiva; 31% de miastenia grave; 6% de polimiosite; 4% de distrofia miotônica e, o restante, de várias outras moléstias (Central core disease, síndrome de Kearns, miotonia congênita, adinamia episódica hereditária, miopatia diabética e síndrome de Eaton-Lambert. São relatadas também as dosagens enzimáticas, eletromiografia, biópsia muscular, eletrocardiografia e aconselhamento genético.

  2. Two Desmin Gene Mutations Associated with Myofibrillar Myopathies in Polish Families

    Berdynski, Mariusz; Sikorska, Agata; Filipek, Slawomir; Redowicz, Maria Jolanta; Kaminska, Anna; Zekanowski, Cezary

    2014-01-01

    Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES) cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P) and a small deletion of nine nucleotides (A357_E359del), previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization. PMID:25541946

  3. The "parallel pathway": a novel nutritional and metabolic approach to cancer patients.

    Muscaritoli, Maurizio; Molfino, Alessio; Gioia, Gianfranco; Laviano, Alessandro; Rossi Fanelli, Filippo

    2011-04-01

    Cancer-associated malnutrition results from a deadly combination of anorexia, which leads to reduced food intake, and derangements of host metabolism inducing body weight loss, and hindering its reversal with nutrient supplementation. Cancer patients often experience both anorexia and weight loss, contributing to the onset of the clinical feature named as anorexia-cachexia syndrome. This condition has a negative impact upon patients' nutritional status. The pathogenesis of the anorexia-cachexia syndrome is multifactorial, and is related to: tumour-derived factors, host-derived factors inducing metabolic derangements, and side effects of anticancer therapies. In addition, the lack of awareness of cancer patients' nutritional issues and status by many oncologists, frequently results in progressive weight loss going undiagnosed until it becomes severe. The critical involvement of host inflammatory response in the development of weight loss, and, in particular, lean body mass depletion, limits the response to the provision of standard nutrition support. A novel nutritional and metabolic approach, named "parallel pathway", has been devised that may help maintain or improve nutritional status, and prevent or delay the onset of cancer cachexia. Such an approach may improve tolerance to aggressive anticancer therapies, and ameliorate the functional capacity and quality of life even in advanced disease stages. The "parallel pathway" implies a multiprofessional and multimodal approach aimed at ensuring early, appropriate and continuous nutritional and metabolic support to cancer patients in any phase of their cancer journey.

  4. Characteristic cardiac phenotypes are detected by cardiovascular magnetic resonance in patients with different clinical phenotypes and genotypes of mitochondrial myopathy.

    Florian, Anca; Ludwig, Anna; Stubbe-Dräger, Bianca; Boentert, Matthias; Young, Peter; Waltenberger, Johannes; Rösch, Sabine; Sechtem, Udo; Yilmaz, Ali

    2015-05-22

    Mitochondrial myopathies (MM) are a heterogeneous group of inherited conditions resulting from a primary defect in the mitochondrial respiratory chain with consecutively impaired cellular energy metabolism. Small sized studies using mainly electrocardiography (ECG) and echocardiography have revealed cardiac abnormalities ranging from conduction abnormalities and arrhythmias to hypertrophic or dilated cardiomyopathy in these patients. Recently, characteristic patterns of cardiac involvement were documented by cardiovascular magnetic resonance (CMR) in patients with chronic progressive external ophthalmoplegia (CPEO)/Kearns-Sayre syndrome (KSS) and with mitochondrial encephalopathy with lactic acidosis and stroke-like episodes (MELAS). The present study aimed to characterize the prevalence and pattern of cardiac abnormalities and to test the additional diagnostic value of CMR in this patient population. The hypothesis that different neuromuscular MM syndromes present with different cardiac disease phenotypes was evaluated. Sixty-four MM patients (50 ± 15 years, 44% male) and 25 matched controls (52 ± 14 years, 36% male) prospectively underwent cardiac evaluations including CMR (comprising cine- and late-gadolinium-enhancement (LGE) imaging). Based on the neuromuscular phenotype and genotype, the patients were grouped: (a) CPEO/KSS (N = 33); (b) MELAS/-like (N = 11); c) myoclonic epilepsy with ragged-red fibers (MERRF) (N = 3) and d) other non-specific MM forms (N = 17). Among the 64 MM patients, 34 (53%) had at least one abnormal CMR finding: 18 (28%) demonstrated an impaired left ventricular ejection-fraction (LV-EF patients showed significantly higher maximal wall thickness (10 ± 3 vs. 8 ± 2 mm, p = 0.005) and concentricity (LV mass to end-diastolic volume: 0.84 ± 0.27 vs. 0.67 ± 0.11, p patients showed the highest frequency of cardiac disease (in 10/11 (91%)), a mostly concentric LV hypertrophy (6/9; 67%) with or

  5. A novel Ile1455Thr variant in the skeletal muscle sodium channel alpha-subunit in a patient with a severe adult-onset proximal myopathy with electrical myotonia and a patient with mild paramyotonia phenotype

    Bednarz, M.; Stunnenberg, B.C.; Kusters, B.; Kamsteeg, E.J.; Saris, C.G.J.; Groome, J.; Winston, V.; Meola, G.; Jurkat-Rott, K.; Voermans, N.C.

    2017-01-01

    In sodium channelopathies, a severe fixed myopathy caused by a dominant mutation is rare. We describe two unrelated patients with a novel variant, p.Ile1455Thr, with phenotypes of paramyotonia in one case and fixed proximal myopathy with latent myotonia in another. In-vitro whole cell patch-clamp

  6. Transcriptomic profiling of TK2 deficient human skeletal muscle suggests a role for the p53 signalling pathway and identifies growth and differentiation factor-15 as a potential novel biomarker for mitochondrial myopathies

    2014-01-01

    Background Mutations in the gene encoding thymidine kinase 2 (TK2) result in the myopathic form of mitochondrial DNA depletion syndrome which is a mitochondrial encephalomyopathy presenting in children. In order to unveil some of the mechanisms involved in this pathology and to identify potential biomarkers and therapeutic targets we have investigated the gene expression profile of human skeletal muscle deficient for TK2 using cDNA microarrays. Results We have analysed the whole transcriptome of skeletal muscle from patients with TK2 mutations and compared it to normal muscle and to muscle from patients with other mitochondrial myopathies. We have identified a set of over 700 genes which are differentially expressed in TK2 deficient muscle. Bioinformatics analysis reveals important changes in muscle metabolism, in particular, in glucose and glycogen utilisation, and activation of the starvation response which affects aminoacid and lipid metabolism. We have identified those transcriptional regulators which are likely to be responsible for the observed changes in gene expression. Conclusion Our data point towards the tumor suppressor p53 as the regulator at the centre of a network of genes which are responsible for a coordinated response to TK2 mutations which involves inflammation, activation of muscle cell death by apoptosis and induction of growth and differentiation factor 15 (GDF-15) in muscle and serum. We propose that GDF-15 may represent a potential novel biomarker for mitochondrial dysfunction although further studies are required. PMID:24484525

  7. Skeletal muscle metabolism during prolonged exercise in Pompe disease

    Preisler, Nicolai; Laforêt, Pascal; Madsen, Karen Lindhardt

    2017-01-01

    OBJECTIVE: Pompe disease (glycogenosis type II) is caused by lysosomal alpha-glucosidase deficiency, which leads to a block in intra-lysosomal glycogen breakdown. In spite of enzyme replacement therapy, Pompe disease continues to be a progressive metabolic myopathy. Considering the health benefits...... of exercise, it is important in Pompe disease to acquire more information about muscle substrate use during exercise. METHODS: Seven adults with Pompe disease were matched to a healthy control group (1:1). We determined (1) peak oxidative capacity (VO2peak) and (2) carbohydrate and fatty acid metabolism...... during submaximal exercise (33 W) for 1 h, using cycle-ergometer exercise, indirect calorimetry and stable isotopes. RESULTS: In the patients, VO2peak was less than half of average control values; mean difference -1659 mL/min (CI: -2450 to -867, P = 0.001). However, the respiratory exchange ratio...

  8. Cerebral metabolic abnormalities in congestive heart failure detected by proton magnetic resonance spectroscopy.

    Lee, C W; Lee, J H; Kim, J J; Park, S W; Hong, M K; Kim, S T; Lim, T H; Park, S J

    1999-04-01

    Using proton magnetic resonance spectroscopy, we investigated cerebral metabolism and its determinants in congestive heart failure (CHF), and the effects of cardiac transplantation on these measurements. Few data are available about cerebral metabolism in CHF. Fifty patients with CHF (ejection fraction OGM) and parietal white matter (PWM). Absolute levels of the metabolites (N-acetylaspartate, creatine, choline, myo-inositol) were calculated. In PWM only creatine level was significantly lower in CHF than in control subjects, but in OGM all four metabolite levels were decreased in CHF. The creatine level was independently correlated with half-recovery time and duration of heart failure symptoms in PWM (r = -0.56, p OGM (r = 0.58, p < 0.05). Cerebral metabolic abnormalities were improved after successful cardiac transplantation. This study shows that cerebral metabolism is abnormally deranged in advanced CHF and it may serve as a potential marker of the disease severity.

  9. Metabolic imaging of patients with cardiomyopathy

    Geltman, E.M.

    1991-01-01

    The cardiomyopathies comprise a diverse group of illnesses that can be characterized functionally by several techniques. However, the delineation of derangements of regional perfusion and metabolism have been accomplished only relatively recently with positron emission tomography (PET). Regional myocardial accumulation and clearance of 11C-palmitate, the primary myocardial substrate under most conditions, demonstrate marked spatial heterogeneity when studied under fasting conditions or with glucose loading. PET with 11C-palmitate permits the noninvasive differentiation of patients with nonischemic from ischemic dilated cardiomyopathy, since patients with ischemic cardiomyopathy demonstrate large zones of intensely depressed accumulation of 11C-palmitate, probably reflecting prior infarction. Patients with hypertrophic cardiomyopathy and Duchenne's muscular dystrophy demonstrate relatively unique patterns of myocardial abnormalities of perfusion and metabolism. The availability of new tracers and techniques for the evaluation of myocardial metabolism (11C-acetate), perfusion (H2(15)O), and autonomic tone (11-C-hydroxyephedrine) should facilitate further understanding of the pathogenesis of the cardiomyopathies

  10. Two novel MYH7 proline substitutions cause Laing Distal Myopathy-like phenotypes with variable expressivity and neck extensor contracture.

    Feinstein-Linial, Miora; Buvoli, Massimo; Buvoli, Ada; Sadeh, Menachem; Dabby, Ron; Straussberg, Rachel; Shelef, Ilan; Dayan, Daniel; Leinwand, Leslie Anne; Birk, Ohad S

    2016-08-12

    Human skeletal muscles express three major myosin heavy chain (MyHC) isoforms: MyHCIIx (MYH1) in fast type 2B muscle fibers, MyHCIIa (MYH2) in fast type 2A fibers and MyHCI/β-cardiac MyHC (MYH7) in slow type I skeletal fibers and cardiac ventricles. In line with its expression pattern, MYH7 mutations have been reported in association with hypertrophic or dilated cardiomyopathy, skeletal myopathies or a combination of both. We analyzed the clinical and molecular phenotype of two unrelated families of Jewish Moroccan ancestry that presented with apparently autosomal dominant inheritance of progressive Laing-like distal myopathy with non-specific myopathic changes, but uncommon marked contractures and wasting of the neck extensors. Clinical phenotyping, whole exome sequencing and restriction analysis, generation of mutants followed by cell culture transfection and imaging. Using whole exome sequencing we identified in both families two novel heterozygous proline substitutions located in exon 31 of MYH7 within its rod domain: c.4309G>C (p.Ala1437Pro) and c.4301G>C (p.Arg1434Pro). Here we show that the phenotype caused by these mutations includes marked cervical muscle contracture, and report that the severity of the phenotype varies significantly, to the extent of non-penetrance in one of the families. Finally, we provide evidence that both proline substitutions impair myosin self-assembly in non-muscle cells transfected with β-myosin constructs carrying the mutations, but do not prevent incorporation of the mutant molecules into the sarcomere. This study expands our clinical and molecular knowledge of MYH7 rod mutations causing skeletal myopathies, and underscores the importance of discussing disease penetrance during genetic counseling.

  11. Hepatic Steatosis as a Marker of Metabolic Dysfunction

    Fabbrini, Elisa; Magkos, Faidon

    2015-01-01

    Nonalcoholic fatty liver disease (NAFLD) is the liver manifestation of the complex metabolic derangements associated with obesity. NAFLD is characterized by excessive deposition of fat in the liver (steatosis) and develops when hepatic fatty acid availability from plasma and de novo synthesis exceeds hepatic fatty acid disposal by oxidation and triglyceride export. Hepatic steatosis is therefore the biochemical result of an imbalance between complex pathways of lipid metabolism, and is associated with an array of adverse changes in glucose, fatty acid, and lipoprotein metabolism across all tissues of the body. Intrahepatic triglyceride (IHTG) content is therefore a very good marker (and in some cases may be the cause) of the presence and the degree of multiple-organ metabolic dysfunction. These metabolic abnormalities are likely responsible for many cardiometabolic risk factors associated with NAFLD, such as insulin resistance, type 2 diabetes mellitus, and dyslipidemia. Understanding the factors involved in the pathogenesis and pathophysiology of NAFLD will lead to a better understanding of the mechanisms responsible for the metabolic complications of obesity, and hopefully to the discovery of novel effective treatments for their reversal. PMID:26102213

  12. mtDNA depletion myopathy: elucidation of the tissue specificity in the mitochondrial thymidine kinase (TK2) deficiency.

    Saada, Ann; Shaag, Avraham; Elpeleg, Orly

    2003-05-01

    Decreased mitochondrial thymidine kinase (TK2) activity is associated with mitochondrial DNA (mtDNA) depletion and respiratory chain dysfunction and is manifested by isolated, fatal skeletal myopathy. Other tissues such as liver, brain, heart, and skin remain unaffected throughout the patients' life. In order to elucidate the mechanism of tissue specificity in the disease we have investigated the expression of the mitochondrial deoxynucleotide carrier, the mtDNA content and the activity of TK2 in mitochondria of various tissues. Our results suggest that low basal TK2 activity combined with a high requirement for mitochondrial encoded proteins in muscle predispose this tissue to the devastating effect of TK2 deficiency.

  13. Novel Variants in Individuals with RYR1-Related Congenital Myopathies: Genetic, Laboratory, and Clinical Findings

    Joshua J. Todd

    2018-03-01

    Full Text Available The ryanodine receptor 1-related congenital myopathies (RYR1-RM comprise a spectrum of slow, rare neuromuscular diseases. Affected individuals present with a mild-to-severe symptomatology ranging from proximal muscle weakness, hypotonia and joint contractures to scoliosis, ophthalmoplegia, and respiratory involvement. Although there is currently no FDA-approved treatment for RYR1-RM, our group recently conducted the first clinical trial in this patient population (NCT02362425. This study aimed to characterize novel RYR1 variants with regard to genetic, laboratory, muscle magnetic resonance imaging (MRI, and clinical findings. Genetic and histopathology reports were obtained from participant’s medical records. Alamut Visual Software was used to determine if participant’s variants had been previously reported and to assess predicted pathogenicity. Physical exams, pulmonary function tests, T1-weighted muscle MRI scans, and blood measures were completed during the abovementioned clinical trial. Six novel variants (two de novo, three dominant, and one recessive were identified in individuals with RYR1-RM. Consistent with established RYR1-RM histopathology, cores were observed in all biopsies, except Case 6 who exhibited fiber-type disproportion. Muscle atrophy and impaired mobility with Trendelenburg gait were the most common clinical symptoms and were identified in all cases. Muscle MRI revealed substantial inter-individual variation in fatty infiltration corroborating the heterogeneity of the disease. Two individuals with dominant RYR1 variants exhibited respiratory insufficiency: a clinical symptom more commonly associated with recessive RYR1-RM cases. This study demonstrates that a genetics-led approach is suitable for the diagnosis of suspected RYR1-RM which can be corroborated through histopathology, muscle MRI and clinical examination.

  14. The occurrence of deep pectoral myopathy in broilers and associated changes in breast meat quality.

    Yalcin, S; Ozkan, S; Acar, M Comert; Meral, O

    2018-02-01

    1. Two experiments were conducted to determine the effect of slaughter weight on the incidence and intensity of deep pectoral myopathy (DPM) of M. pectoralis minor (p. minor muscle) in commercial conditions in Turkey and to evaluate the impact of DPM on meat quality traits of pectoralis major (p. major) muscle in broilers. 2. In Experiment 1, a total of 116 250 carcasses from 59 Ross-308 broiler flocks, classified according to slaughter weight as 2.0-2.2, 2.2-2.4, 2.4-2.6 and >2.6 kg, were evaluated for occurrence of DPM. In Experiment 2, p. major samples from unaffected broilers and each DPM stage were evaluated for meat quality, oxidant and antioxidant properties, nutritional value and fatty acid profile. DPM was characterised as 1: muscles with coagulative necrosis, 2: muscles with fibrous tissue texture and pink to plumb and 3: muscles with green necrotic area. 3. The average incidence of DPM was found to be 0.73% in Experiment 1 and independent of slaughter weight. 4. In Experiment 2, p. major muscle of broilers with DPM 1 and 2 had higher pH values with higher redness and drip loss. All DPM stages resulted in an increase in lipid content and malondialdehyde activity and lowered ash content of p. major muscle compared with unaffected birds. DPM 2 increased superoxide dismutase and glutathione peroxidase activities in M. p. major. The p. major of broilers with DPM had lower content of C18:2 conjugated linoleic and C20:3n-6 fatty acids than those of unaffected broilers. Lower Δ6 desaturase and thiosterase activities and 18:2n-6 to 18:3n-3 ratio were observed for all DPM stages compared to unaffected. 5. It was concluded that these changes obtained in p. major muscle of broilers with DPM might indicate biochemical characteristics of muscle degenerations.

  15. Biomechanics, diagnosis, and treatment outcome in inflammatory myopathy presenting as oropharyngeal dysphagia

    Williams, R B; Grehan, M J; Hersch, M; Andre, J; Cook, I J

    2003-01-01

    Aims: In patients with inflammatory myopathy and dysphagia, our aims were to determine: (1) the diagnostic utility of clinical and laboratory indicators; (2) the biomechanical properties of the pharyngo-oesophageal segment; (3) the usefulness of pharyngeal videomanometry in distinguishing neuropathic from myopathic dysphagia; and (4) clinical outcome. Methods: Clinical, laboratory, and videomanometric assessment was performed in 13 patients with myositis and dysphagia, in 17 disease controls with dysphagia (due to proven CNS disease), and in 22 healthy age matched controls. The diagnostic accuracy of creatine kinase (CPK), erythrocyte sedimentation rate, antinuclear antibody, and electromyography (EMG) were compared with the gold standard muscle biopsy. The biomechanical properties of the pharyngo-oesophageal segment were assessed by videomanometry. Results: Mean time from dysphagia onset to the diagnosis of myositis was 55 months (range 1–180). One third had no extrapharyngeal muscle weakness; 25% had normal CPK, and EMG was unhelpful in 28%. Compared with neurogenic controls, myositis patients had more prevalent cricopharyngeal restrictive disorders (69% v 14%; p=0.0003), reduced upper oesophageal sphincter (UOS) opening (p=0.01), and elevated hypopharyngeal intrabolus pressures (p=0.001). Videomanometric features favouring a myopathic over a neuropathic aetiology were: preserved pharyngeal swallow response, complete UOS relaxation, and normal swallow coordination. The 12 month mortality was 31%. Conclusions: The notable lack of supportive clinical signs and significant false negative rates for laboratory tests contribute to the marked delay in diagnosis. The myopathic process is strongly associated with restricted sphincter opening suggesting that cricopharyngeal disruption is a useful adjunct to immunosuppressive therapy. The condition has a poor prognosis. PMID:12631653

  16. Intravenous immune globulin in hereditary inclusion body myopathy: a pilot study

    Dorward Heidi

    2007-01-01

    Full Text Available Abstract Background Hereditary Inclusion Body Myopathy (HIBM is an autosomal recessive, adult onset, non-inflammatory neuromuscular disorder with no effective treatment. The causative gene, GNE, codes for UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase, which catalyzes the first two reactions in the synthesis of sialic acid. Reduced sialylation of muscle glycoproteins, such as α-dystroglycan and neural cell adhesion molecule (NCAM, has been reported in HIBM. Methods We treated 4 HIBM patients with intravenous immune globulin (IVIG, in order to provide sialic acid, because IgG contains 8 μmol of sialic acid/g. IVIG was infused as a loading dose of 1 g/kg on two consecutive days followed by 3 doses of 400 mg/kg at weekly intervals. Results For all four patients, mean quadriceps strength improved from 19.0 kg at baseline to 23.2 kg (+22% directly after IVIG loading to 25.6 kg (+35% at the end of the study. Mean shoulder strength improved from 4.1 kg at baseline to 5.9 kg (+44% directly after IVIG loading to 6.0 kg (+46% at the end of the study. The composite improvement for 8 other muscle groups was 5% after the initial loading and 19% by the end of the study. Esophageal motility and lingual strength improved in the patients with abnormal barium swallows. Objective measures of functional improvement gave variable results, but the patients experienced improvements in daily activities that they considered clinically significant. Immunohistochemical staining and immunoblotting of muscle biopsies for α-dystroglycan and NCAM did not provide consistent evidence for increased sialylation after IVIG treatment. Side effects were limited to transient headaches and vomiting. Conclusion The mild benefits in muscle strength experienced by HIBM patients after IVIG treatment may be related to the provision of sialic acid supplied by IVIG. Other sources of sialic acid are being explored as treatment options for HIBM.

  17. Relationship between work rate and oxygen uptake in mitochondrial myopathy during ramp-incremental exercise

    A.C. Gimenes

    2011-04-01

    Full Text Available We determined the response characteristics and functional correlates of the dynamic relationship between the rate (Δ of oxygen consumption ( O2 and the applied power output (work rate = WR during ramp-incremental exercise in patients with mitochondrial myopathy (MM. Fourteen patients (7 males, age 35.4 ± 10.8 years with biopsy-proven MM and 10 sedentary controls (6 males, age 29.0 ± 7.8 years took a ramp-incremental cycle ergometer test for the determination of the O2 on-exercise mean response time (MRT and the gas exchange threshold (GET. The ΔO2/ΔWR slope was calculated up to GET (S1, above GET (S2 and over the entire linear portion of the response (S T. Knee muscle endurance was measured by isokinetic dynamometry. As expected, peak O2 and muscle performance were lower in patients than controls (P O2/ΔWR than controls, especially the S2 component (6.8 ± 1.5 vs 10.3 ± 0.6 mL·min-1·W-1, respectively; P O2/ΔWR (S T and muscle endurance, MRT-O2, GET and peak O2 in MM patients (P O2/ΔWR below 8 mL·min-1·W-1 had severely reduced peak O2 values (O2 had lower ΔO2/ΔWR (P O2/ΔWR is typically reduced in patients with MM, being related to increased functional impairment and higher cardiopulmonary stress.

  18. High prevalence of metabolic syndrome in antisynthetase syndrome.

    Araujo, Paula A O; Silva, Marilda Guimarães; Borba, Eduardo Ferreira; Shinjo, Samuel K

    2018-01-01

    A high frequency of metabolic syndrome (MetS) has been recently described in different idiopathic inflammatory myopathies, but not in antisynthetase syndrome (ASS). Therefore, the aim of the present study was to determine the prevalence of MetS in ASS and also its possible association with cardiovascular the risk factors and ASS-related disease characteristics. A cross-sectional single centre study of 42 consecutive ASS patients was conducted from 2012 to 2015 and compared to 84 healthy individuals matched for gender, age, ethnicity and body mass index-matched (control group). MetS was defined according to the 2009 Join Interim Statement. Clinical and laboratory data were assessed according to a standardised protocol. ASS patients had a median age of 41.1 years with a predominance of female gender and white race. ASS patients had a higher frequency of MetS (42.9% vs. 13.1%; pASS patients had higher resistin, lower leptin and similar adiponectin levels in serum than controls. Further analysis of ASS patients with (n=18) and without (n=24) MetS revealed that older age at disease onset (48.7 vs. 35.4 years; pASS patients that also had serum resistin and low leptin levels. As also identified in other idiopathic inflammatory myopathies, MetS in ASS is more prevalent in older patients.

  19. Lumbar internal disc derangement in patients with chronic low back pain: diagnostic value of the MR imaging findings as compared with provoked discography as the standard

    Park, Hyeon Seon; Park, Jee Young; Lee, Sang Ho; Ahn, Yong; Lee, Sang Yeun

    2006-01-01

    The aim of this study was to evaluate the diagnostic value of the MR imaging findings with provoked discography used as the standard for painful lumbar disc derangement. Two hundred patients (412 discs), (age rang: 21-77 year), with chronic low back pain underwent MRI and provoked discography. We evaluated the MRI T2-WI findings such as disc degeneration, high-Intensity zones and endplate abnormalities. Subsequently, provocative discography was independently performed with using MR imaging, and a painful disc was defined when moderate to severe and concordant pain was provoked. We calculated the sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) of the MRI findings with using provoked discography as the standard. 400 discs showed abnormal findings such as disc degeneration, HIZ and endplate abnormalities on the T2-WI images. 12 discs showed normal finding. HIZ or endplate abnormalities were always combined with disc degeneration. The prevalence of each findings were disc degeneration (400 discs: 97.1%), HIZ (111 discs: 26.9%), type I endplate abnormalities (34 discs: 8.3%), type II endplate abnormalities (75 discs: 18.2%), the combined findings of HIZ and type I endplate abnormalities (2 discs: 0.5%) and the combined findings of HIZ and type II endplate abnormalities (7 discs: 1.7%). The disc degeneration showed high sensitivity (99.5%) and low specificity (5.0%), so only the NPV (91.7%) was significant, and not the PPV (47.8%). Each findings of HIZ (sensitivity, 36.5%, specificity, 81.4%; PPV, 63.18%; NPV, 59.5%), type I endplate abnormalities (11.0%, 94.1%, 61.8% and 54.8%, respectively), type II endplate abnormalities (19.8%, 83.2%, 50.7% and 54.3%, respectively), the combined findings of HIZ and type I endplate abnormalities (0.5%, 99.6%, 50.0% and 53.4%, respectively) and the combined findings of HIZ and type II endplate abnormalities (26.0%, 99.1%, 71.4% and 53.8%, respectively) show high specificity, but low

  20. Early Glucose Derangement Detected by Continuous Glucose Monitoring and Progression of Liver Fibrosis in Nonalcoholic Fatty Liver Disease: An Independent Predictive Factor?

    Schiaffini, Riccardo; Liccardo, Daniela; Alisi, Anna; Benevento, Danila; Cappa, Marco; Cianfarani, Stefano; Nobili, Valerio

    2016-01-01

    Glucose derangement has been reported to increase oxidative stress, one of the most important factors underlying the progression of hepatic fibrosis in adults with nonalcoholic fatty liver disease (NAFLD). To date, careful evaluation of the glucose profile in pediatric NAFLD has not been performed. A total of 30 severely obese children (15 males; mean age 12.87 ± 2.19 years) with biopsy-proven NAFLD were enrolled in this study from September to December 2013. All patients underwent anthropometric and laboratory evaluation, including the oral glucose tolerance test (OGTT) and continuous glucose monitoring (CGM). Our study reveals some differences between OGTT and CGM in detecting NAFLD children with impaired fasting glucose (IFG) and impaired glucose tolerance (IGT). OGTT showed 2 (6.67%) patients with IFG and 1 (3.34%) with IGT, while CGM showed 5 (16.67%) patients with IFG and 6 (20%) with IGT. The daily blood glucose profile positively correlated with the baseline blood glucose (r = 0.39, p = 0.04) and the homeostatic model assessment (r = 0.56, p = 0.05). A positive correlation between hyperglycemia and liver fibrosis was found (r = 0.65, p < 0.05). Mean glucose values (F3-F4 group: 163.2 ± 35.92 mg/dl vs. F1 group: 136.58 ± 46.83 mg/dl and F2 group: 154.12 ± 22.51 mg/dl) and the difference between the minimum and maximum blood glucose levels (F3-F4 group: 110.21 ± 25.26 mg/dl vs. F1 group: 91.67 ± 15.97 mg/dl and F2 group: 92 ± 15.48 mg/dl) were significantly (p < 0.05) higher in the F3-F4 group compared to the F1 and F2 groups. Glucose profile derangement as detected by CGM is associated with the severity of hepatic fibrosis in children with NAFLD. © 2015 S. Karger AG, Basel.