WorldWideScience

Sample records for messenger rna sequences

  1. A study of ribonucleoproteins: The sequence of rabbit 18S ribosomal RNA and the identification of proteins associated with messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Connaughton, J.F. Jr.

    1989-01-01

    This study considers the functional role of ribosomal RNA and messenger ribonucleoproteins in the translational regulation of gene expression. The primary structure of rabbit 18S ribosomal RNA was determined by nucleotide sequence analysis of the RNA directly. Rabbit 18S RNA was cleaved with either T{sub 1} ribonuclease or RNase H, using a Pst 1 DNA linker to generate a unique set of overlapping fragments spanning the entire molecule. Both intact and fragmented 18S RNA were end-labeled with {sup 32}P and base-specifically cleaved enzymatically and chemically. Nucleotide sequences were determined from long polyacrylamide sequencing gels run in formamide. To assess functional roles of RNA in gene expression, specific mRNA-protein interactions were also examined. Eukaryotic mRNA is associated with specific proteins that may be important in translational regulation and mRNA stability; mRNP complexes were reconstituted in a message-dependent, cell-free rabbit reticulocyte translation system, using unique mRNA species transcribed in vitro with SP6 polymerase. Transcripts of both rabbit and human {beta}-globin cDNA were labeled with {sup 32}P either throughout the molecule ore selectively at the 5{prime} and 3{prime} terminus.

  2. Nuclear Export of Messenger RNA

    Science.gov (United States)

    Katahira, Jun

    2015-01-01

    Transport of messenger RNA (mRNA) from the nucleus to the cytoplasm is an essential step of eukaryotic gene expression. In the cell nucleus, a precursor mRNA undergoes a series of processing steps, including capping at the 5' ends, splicing and cleavage/polyadenylation at the 3' ends. During this process, the mRNA associates with a wide variety of proteins, forming a messenger ribonucleoprotein (mRNP) particle. Association with factors involved in nuclear export also occurs during transcription and processing, and thus nuclear export is fully integrated into mRNA maturation. The coupling between mRNA maturation and nuclear export is an important mechanism for providing only fully functional and competent mRNA to the cytoplasmic translational machinery, thereby ensuring accuracy and swiftness of gene expression. This review describes the molecular mechanism of nuclear mRNA export mediated by the principal transport factors, including Tap-p15 and the TREX complex. PMID:25836925

  3. Chemical and structural effects of base modifications in messenger RNA

    Science.gov (United States)

    Harcourt, Emily M.; Kietrys, Anna M.; Kool, Eric T.

    2017-01-01

    A growing number of nucleobase modifications in messenger RNA have been revealed through advances in detection and RNA sequencing. Although some of the biochemical pathways that involve modified bases have been identified, research into the world of RNA modification -- the epitranscriptome -- is still in an early phase. A variety of chemical tools are being used to characterize base modifications, and the structural effects of known base modifications on RNA pairing, thermodynamics and folding are being determined in relation to their putative biological roles.

  4. Messenger RNA surveillance: neutralizing natural nonsense

    DEFF Research Database (Denmark)

    Weischelfeldt, Joachim Lütken; Lykke-Andersen, Jens; Porse, Bo

    2005-01-01

    Messenger RNA transcripts that contain premature stop codons are degraded by a process termed nonsense-mediated mRNA decay (NMD). Although previously thought of as a pathway that rids the cell of non-functional mRNAs arising from mutations and processing errors, new research suggests a more general...

  5. Messenger RNA sequence rather than protein sequence determines the level of self-synthesis and antigen presentation of the EBV-encoded antigen, EBNA1.

    Directory of Open Access Journals (Sweden)

    Judy T Tellam

    2012-12-01

    Full Text Available Unique purine-rich mRNA sequences embedded in the coding sequences of a distinct group of gammaherpesvirus maintenance proteins underlie the ability of the latently infected cell to minimize immune recognition. The Epstein-Barr virus nuclear antigen, EBNA1, a well characterized lymphocryptovirus maintenance protein has been shown to inhibit in cis antigen presentation, due in part to a large internal repeat domain encoding glycine and alanine residues (GAr encoded by a purine-rich mRNA sequence. Recent studies have suggested that it is the purine-rich mRNA sequence of this repeat region rather than the encoded GAr polypeptide that directly inhibits EBNA1 self-synthesis and contributes to immune evasion. To test this hypothesis, we generated a series of EBNA1 internal repeat frameshift constructs and assessed their effects on cis-translation and endogenous antigen presentation. Diverse peptide sequences resulting from alternative repeat reading frames did not alleviate the translational inhibition characteristic of EBNA1 self-synthesis or the ensuing reduced surface presentation of EBNA1-specific peptide-MHC class I complexes. Human cells expressing the EBNA1 frameshift variants were also poorly recognized by antigen-specific T-cells. Furthermore, a comparative analysis of the mRNA sequences of the corresponding repeat regions of different viral maintenance homologues highlights the high degree of identity between the nucleotide sequences despite very little homology in the encoded amino acid sequences. Based on these combined observations, we propose that the cis-translational inhibitory effect of the EBNA1 internal repeat sequence operates mechanistically at the nucleotide level, potentially through RNA secondary structural elements, and is unlikely to be mediated through the GAr polypeptide. The demonstration that the EBNA1 repeat mRNA sequence and not the encoded protein sequence underlies immune evasion in this class of virus suggests a

  6. RNA decay by messenger RNA interferases

    DEFF Research Database (Denmark)

    Christensen-Dalsgaard, Mikkel; Overgaard, Martin; Winther, Kristoffer Skovbo

    2008-01-01

    Two abundant toxin-antitoxin (TA) gene families, relBE and mazEF, encode mRNA cleaving enzymes whose ectopic overexpression abruptly inhibits translation and thereby induces a bacteriostatic condition. Here we describe and discuss protocols for the overproduction, purification, and analysis of mRNA...... cleaving enzymes such as RelE of Escherichia coli and the corresponding antitoxin RelB. In particular, we describe a set of plasmid vectors useful for the detailed analysis of cleavage sites in model mRNAs....

  7. ACTH Action on Messenger RNA Stability Mechanisms

    Science.gov (United States)

    Desroches-Castan, Agnès; Feige, Jean-Jacques; Cherradi, Nadia

    2017-01-01

    The regulation of mRNA stability has emerged as a critical control step in dynamic gene expression. This process occurs in response to modifications of the cellular environment, including hormonal variations, and regulates the expression of subsets of proteins whose levels need to be rapidly adjusted. Modulation of messenger RNA stability is usually mediated by stabilizing or destabilizing RNA-binding proteins (RNA-BP) that bind to the 3′-untranslated region regulatory motifs, such as AU-rich elements (AREs). Destabilizing ARE-binding proteins enhance the decay of their target transcripts by recruiting the mRNA decay machineries. Failure of such mechanisms, in particular misexpression of RNA-BP, has been linked to several human diseases. In the adrenal cortex, the expression and activity of mRNA stability regulatory proteins are still understudied. However, ACTH- or cAMP-elicited changes in the expression/phosphorylation status of the major mRNA-destabilizing protein TIS11b/BRF1 or in the subcellular localization of the stabilizing protein Human antigen R have been reported. They suggest that this level of regulation of gene expression is also important in endocrinology.

  8. THE LIFETIME OF BACTERIAL MESSENGER RNA

    Energy Technology Data Exchange (ETDEWEB)

    Moses, V.; Calvin, M.

    1963-12-01

    Puromycin, an inhibitor of protein synthesis, appears to act as an inhibitor at additional sites during the induction of {beta}-galactosidase synthesis. No inhibition of the reactions proceeding during the first 20 seconds of induction was observed, but puromycin seems to prevent the accumulation of messenger RNA during the period between 20 seconds and the first appearance of enzyme activity after 3 minutes. When cells from a stationary culture are placed in fresh medium containing inducer for {beta}-galactosidase, growth, as represented by increase in turbidity and by total protein synthesis, starts within 30 seconds. By contrast, {beta}-galactosidase synthesis is greatly delayed compared with induction during exponential growth. Two other inducible enzymes show similar lags, but malic dehydrogenase, which requires no external inducer, shows no lag. The lags are not due to catabolite repression phenomena. They cannot be reduced by pretreatment of the culture with inducer, or by supplementing the fresh medium with amino acids or nucleotides. The lag is also demonstrated by an i{sup -} mutant constitutive for {beta}-galactosidase synthesis. An inhibitor of RNA synthesis, 6-azauracil, preferentially inhibits {beta}-galactosidase synthesis compared with growth in both inducible and constitutive strains. It is suggested that these observations, together with many reports in the literature that inducible enzyme synthesis is more sensitive than total growth to some inhibitors and adverse growth conditions, can be explained by supposing that messenger RNA for normally inducible enzymes is biologically more labile than that for normally constitutive proteins. The implications of this hypothesis for the achievement of cell differentiation by genetic regulation of enzyme synthesis are briefly discussed.

  9. Pseudo-messenger RNA: phantoms of the transcriptome.

    Directory of Open Access Journals (Sweden)

    Martin C Frith

    2006-04-01

    Full Text Available The mammalian transcriptome harbours shadowy entities that resist classification and analysis. In analogy with pseudogenes, we define pseudo-messenger RNA to be RNA molecules that resemble protein-coding mRNA, but cannot encode full-length proteins owing to disruptions of the reading frame. Using a rigorous computational pipeline, which rules out sequencing errors, we identify 10,679 pseudo-messenger RNAs (approximately half of which are transposon-associated among the 102,801 FANTOM3 mouse cDNAs: just over 10% of the FANTOM3 transcriptome. These comprise not only transcribed pseudogenes, but also disrupted splice variants of otherwise protein-coding genes. Some may encode truncated proteins, only a minority of which appear subject to nonsense-mediated decay. The presence of an excess of transcripts whose only disruptions are opal stop codons suggests that there are more selenoproteins than currently estimated. We also describe compensatory frameshifts, where a segment of the gene has changed frame but remains translatable. In summary, we survey a large class of non-standard but potentially functional transcripts that are likely to encode genetic information and effect biological processes in novel ways. Many of these transcripts do not correspond cleanly to any identifiable object in the genome, implying fundamental limits to the goal of annotating all functional elements at the genome sequence level.

  10. Estrogen Regulation of Messenger RNA Stability

    Science.gov (United States)

    1990-08-17

    ribonuclease inhibitor, inhibits activity of RNase A-type enzymes. RNP-CS- ribonucleoprotein consensus sequence (K/R)G(F/Y)(G/A)FVX(F/Y) rRNA - ribosomal...CJ r i ɡ a 5S ^ S i C9 3 3 *» • - M 19 > • h- O C9 ^ h- 5 C9 > l - « < • - U f t - o CJ k u a u Q. < 2 C9 S C9 3 3 "ai t- 41 (9...mRNA molecules will need to be examined. Which of these factors degrade mRNAs? Which factors degrade other types of RNA molecules such as rRNA and

  11. Isolation and Translation of Hordein Messenger RNA from Wild Type and Mutant Endosperms in Barley

    DEFF Research Database (Denmark)

    Brandt, Anders Bøving; Ingwersen, J.

    1978-01-01

    Nucleotide sequences of four cDNA clones coding for the carboxy-terminal portion of at least two different B1 hordein polypeptides are presented. The open reading frame in the nucleotide sequence of the the largest clone (pc hor2-4, 720 nucleotides) translates into the 181 carboxy-terminal amino...... was found to be a major constituent of the total messenger RNA population of the endosperm cell. Polyadenylated hordein messenger RNA sedimented at 11S in sucrose gradients and electrophoretic analysis reveals the presence of at least three RNA species with apparent molecular weights of 0.45, 0.36 and 0.......30 megadaltons. The 11S messenger RNA was translated in vitro into hordein precursor polypeptides which are 2–4 kilodaltons larger than the native hordein polypeptides. The endosperm cell of mutant No. 1508 contained twice as much RNA as the wild type endosperm cell but the same amount of polyadenylated 11S RNA...

  12. CTLA-8, cloned from an activated T cell, bearing AU-rich messenger RNA instability sequences, and homologous to a herpesvirus saimiri gene.

    Science.gov (United States)

    Rouvier, E; Luciani, M F; Mattéi, M G; Denizot, F; Golstein, P

    1993-06-15

    To detect novel molecules involved in immune functions, a subtracted cDNA library between closely related murine lymphoid cells was prepared using improved technology. Differential screening of this library yielded several clones with a very restricted tissue specificity, including one that we named CTLA-8. CTLA-8 transcripts could be detected only in T cell hybridoma clones related to the one used to prepare the library. Southern blots showed that the CTLA-8 gene was single copy in mice, rats, and humans. By radioactive in situ hybridization, the CTLA-8 gene was mapped at a single site on mouse chromosome 1A and human chromosome 2q31, in a known interspecific syntenic region. The CTLA-8 cDNA sequence indicated the presence, in the 3'-untranslated region of the mRNA, of AU-rich repeats previously found in the mRNA of various cytokines, growth factors, and oncogenes. The CTLA-8 cDNA contained an open reading frame encoding a putative protein of 150 amino acids. This protein was 57% homologous to the putative protein encoded by the ORF13 gene of herpesvirus Saimiri, a T lymphotropic virus. These findings are discussed in the context of other genes of this herpesvirus homologous to known immunologically active molecules. More generally, CTLA-8 may belong to the growing set of virus-captured functionally important cellular genes related to the immune system or to cell death and cell survival.

  13. CTLA-8, cloned from an activated T cell, bearing AU-rich messenger RNA instability sequences, and homologous to a herpesvirus Saimiri gene

    Energy Technology Data Exchange (ETDEWEB)

    Rouvier, E.; Luciani, M.F.; Golstein, P. (Centre d' Immunologie INSERM-CNRS de Marseille-Luminy, Marseille (France)); Mattei, M.G. (INSERM U242, Marseille (France)); Denizot, F. (Centre de Sequencage d' ADN, Marseille (France))

    1993-06-15

    To detect novel molecules involved in immune functions, a subtracted cDNA library between closely related murine lymphoid cells was prepared using improved technology. Differential screening of this library yielded several clones with a very restricted tissue specificity, including one that was named CTLA-8. CTLA-8 transcripts could be detected only in T cell hybridoma clones related to the one used to prepare the library. Southern blots showed that the CTLA-8 gene was single copy in mice, rats, and humans. By radioactive in situ hybridization, the CTLA-8 gene was mapped at a single site on mouse chromosome 1A and human chromosome 2q31, in a known interspecific syntenic region. The CTLA-8 cDNA sequence indicated the presence, in the 3'-untranslated region of the mRNA, of AU-rich repeats previously found in the mRNA of various cytokines, growth factors, and oncogenes. The CTLA-8 cDNA contained an open reading frame encoding a putative protein of 150 amino acids. This protein was 57% homologous to the putative protein encoded by the ORF13 gene of herpesvirus Saimiri, a T lymphotropic virus. These findings are discussed in the context of other genes of this herpesvirus homologous to known immunologically active molecules. More generally, CTLA-8 may belong to the growing set of virus-captured functionally important cellular genes related to the immune system or to cell death and cell survival. 69 refs., 5 figs.

  14. Messenger RNA (mRNA) nanoparticle tumour vaccination

    Science.gov (United States)

    Phua, Kyle K. L.; Nair, Smita K.; Leong, Kam W.

    2014-06-01

    Use of mRNA-based vaccines for tumour immunotherapy has gained increasing attention in recent years. A growing number of studies applying nanomedicine concepts to mRNA tumour vaccination show that the mRNA delivered in nanoparticle format can generate a more robust immune response. Advances in the past decade have deepened our understanding of gene delivery barriers, mRNA's biological stability and immunological properties, and support the notion for engineering innovations tailored towards a more efficient mRNA nanoparticle vaccine delivery system. In this review we will first examine the suitability of mRNA for engineering manipulations, followed by discussion of a model framework that highlights the barriers to a robust anti-tumour immunity mediated by mRNA encapsulated in nanoparticles. Finally, by consolidating existing literature on mRNA nanoparticle tumour vaccination within the context of this framework, we aim to identify bottlenecks that can be addressed by future nanoengineering research.

  15. Tissue distribution of human acetylcholinesterase and butyrylcholinesterase messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Jbilo, O.; Barteles, C.F.; Chatonnet, A.; Toutant, J.P.; Lockridge, O.

    1994-12-31

    Tissue distribution of human acetyicholinesterase and butyryicholinesterase messenger RNA. 1 Cholinesterase inhibitors occur naturally in the calabar bean (eserine), green potatoes (solanine), insect-resistant crab apples, the coca plant (cocaine) and snake venom (fasciculin). There are also synthetic cholinesterase inhibitors, for example man-made insecticides. These inhibitors inactivate acetyicholinesterase and butyrylcholinesterase as well as other targets. From a study of the tissue distribution of acetylcholinesterase and butyrylcholinesterase mRNA by Northern blot analysis, we have found the highest levels of butyrylcholinesterase mRNA in the liver and lungs, tissues known as the principal detoxication sites of the human body. These results indicate that butyrylcholinesterase may be a first line of defense against poisons that are eaten or inhaled.

  16. Proteins encoded near the adenovirus late messenger RNA leader segments

    Energy Technology Data Exchange (ETDEWEB)

    Lewis, J.B.; Anderson, C.W.

    1983-01-01

    Small fragments of adenovirus 2 DNA cloned into the single-strand phage M13 were used to select adenoviral messenger RNAs transcribed from the R-strand between map positions 16 and 30. Cell-free translation of these mRNAs produced proteins of 13.5K, 13.6K, and 11.5K, respectively encoded between the first and second segments of the tripartite major late leader, within the ''i''-leader segment, and immediately preceding the third leader segment. Partial sequence analysis of the 13.6K protein is consistent with the hypothesis that it is encoded within the i-leader segment.

  17. Messenger RNA exchange between scions and rootstocks in grafted grapevines

    Science.gov (United States)

    We demonstrated the existence of genome-scale mRNA exchange in grafted grapevines, a woody fruit species with significant economic importance. By using diagnostic SNPs derived from high throughput genome sequencing, we identified more than three thousand genes transporting mRNAs across graft junctio...

  18. Translational regulation of MOS messenger RNA in pig oocytes.

    Science.gov (United States)

    Dai, Yanfeng; Newman, Barbara; Moor, Robert

    2005-11-01

    The temporal and spatial translation control of stored mRNA in oocytes is regulated by elements in their 3'-untranslated region (3'-UTR). The MOS 3'-UTR in pig oocytes is both heterogeneous (180, 480, or 530 nucleotides), and it contains multiple U-rich elements and extensive A-rich sequences (CA13CA5CA5CA6). We have examined the role of these potential regulatory elements by fusing wild-type or mutant MOS 3'-UTRs to luciferase mRNA and then injecting these chimeric transcripts into oocytes. We draw six main conclusions. First, the length of the MOS 3'-UTR tightly controls the level of translation of luciferase during oocyte maturation. Second, two U-rich (U5A) elements and the hexanucleotide signal (AAUAAA) are required for translation. Third, mutations, duplications, or relocations of the A-rich sequence reduce or block translation. Fourth, the relative importance of the A-rich and U-rich elements in controlling the level of translation differs. Fifth, none of our MOS 3'-UTR manipulations relieved translational repression before germinal vesicle breakdown. Sixth, all the MOS mRNA variants underwent polyadenylation during maturation. Whereas mutations to the hexanucleotide signal block both polyadenylation and translation, mutations to either the A-rich sequence or the U-rich elements block translation without fully blocking polyadenylation. We conclude that MOS mRNA translation in pig oocytes is subject to a more extensive series of controls than that in lower vertebrates.

  19. Messenger RNA patterns in rat liver nuclei before and after treat-ment with growth hormone.

    Science.gov (United States)

    Drews, J; Brawerman, G

    1967-06-09

    Like cortisol, growth hormone enhances RNA synthesis in rat liver nuclei. However, DNA-RNA hybridization experiments show that the application of growth hormone does not stimulate the formation of new species of messenger RNA. The latter phenomenon was observed after treatment with cortisol.

  20. Xp54 and related (DDX6-like) RNA helicases: roles in messenger RNP assembly, translation regulation and RNA degradation

    Science.gov (United States)

    Weston, Andrew; Sommerville, John

    2006-01-01

    The DEAD-box RNA helicase Xp54 is an integral component of the messenger ribonucleoprotein (mRNP) particles of Xenopus oocytes. In oocytes, several abundant proteins bind pre-mRNA transcripts to modulate nuclear export, RNA stability and translational fate. Of these, Xp54, the mRNA-masking protein FRGY2 and its activating protein kinase CK2α, bind to nascent transcripts on chromosome loops, whereas an Xp54-associated factor, RapA/B, binds to the mRNP complex in the cytoplasm. Over-expression, mutation and knockdown experiments indicate that Xp54 functions to change the conformation of mRNP complexes, displacing one subset of proteins to accommodate another. The sequence of Xp54 is highly conserved in a wide spectrum of organisms. Like Xp54, Drosophila Me31B and Caenorhabditis CGH-1 are required for proper meiotic development, apparently by regulating the translational activation of stored mRNPs and also for sorting certain mRNPs into germplasm-containing structures. Studies on yeast Dhh1 and mammalian rck/p54 have revealed a key role for these helicases in mRNA degradation and in earlier remodelling of mRNP for entry into translation, storage or decay pathways. The versatility of Xp54 and related helicases in modulating the metabolism of mRNAs at all stages of their lifetimes marks them out as key regulators of post-transcriptional gene expression. PMID:16769775

  1. A Contemporary, Laboratory-Intensive Course on Messenger RNA Transcription and Processing

    Science.gov (United States)

    Carson, Sue; Miller, Heather

    2012-01-01

    Messenger ribonucleic acid (mRNA) plays a pivotal role in the central dogma of molecular biology. Importantly, molecular events occurring during and after mRNA synthesis have the potential to create multiple proteins from one gene, leading to some of the remarkable protein diversity that genomes hold. The North Carolina State University…

  2. MicroRNA and messenger RNA profiling reveals new biomarkers and mechanisms for RDX induced neurotoxicity.

    Science.gov (United States)

    Deng, Youping; Ai, Junmei; Guan, Xin; Wang, Zhaohui; Yan, Bin; Zhang, Daqin; Liu, Chang; Wilbanks, Mitch S; Escalon, Barbara Lynn; Meyers, Sharon A; Yang, Mary Qu; Perkins, Edward J

    2014-01-01

    RDX is a well-known pollutant to induce neurotoxicity. MicroRNAs (miRNA) and messenger RNA (mRNA) profiles are useful tools for toxicogenomics studies. It is worthy to integrate MiRNA and mRNA expression data to understand RDX-induced neurotoxicity. Rats were treated with or without RDX for 48 h. Both miRNA and mRNA profiles were conducted using brain tissues. Nine miRNAs were significantly regulated by RDX. Of these, 6 and 3 miRNAs were up- and down-regulated respectively. The putative target genes of RDX-regulated miRNAs were highly nervous system function genes and pathways enriched. Fifteen differentially genes altered by RDX from mRNA profiles were the putative targets of regulated miRNAs. The induction of miR-71, miR-27ab, miR-98, and miR-135a expression by RDX, could reduce the expression of the genes POLE4, C5ORF13, SULF1 and ROCK2, and eventually induce neurotoxicity. Over-expression of miR-27ab, or reduction of the expression of unknown miRNAs by RDX, could up-regulate HMGCR expression and contribute to neurotoxicity. RDX regulated immune and inflammation response miRNAs and genes could contribute to RDX- induced neurotoxicity and other toxicities as well as animal defending reaction response to RDX exposure. Our results demonstrate that integrating miRNA and mRNA profiles is valuable to indentify novel biomarkers and molecular mechanisms for RDX-induced neurological disorder and neurotoxicity.

  3. Comment on "Length-dependent translation of messenger RNA by ribosomes"

    CERN Document Server

    Zhang, Yunxin

    2011-01-01

    In recent paper [Phys. Rev. E {\\bf 83}, 042903 (2011)], a simple model for the translation of messenger RNA by ribosomes is provided, and the expression of translational ratio of protein is given. In this comments, varied methods to get this ratio are addressed. Depending on a different method, we find that, roughly speaking, this translational ratio decays exponentially with mRNA length in prokaryotic cell, and reciprocally with mRNA length in eukaryotic cells.

  4. MicroRNA Seed Region Length Impact on Target Messenger RNA Expression and Survival in Colorectal Cancer.

    Directory of Open Access Journals (Sweden)

    Lila E Mullany

    Full Text Available microRNAs (miRNA repress messenger RNAs post-transcriptionally through binding to the 3' UTR of the mRNA with the miRNA seed region. It has been purported that longer seed regions have a greater efficacy on mRNA repression. We tested this hypothesis by evaluating differential expression of miRNAs involved in regulating the immune response, an important mechanism in colorectal cancer (CRC, by seed length category. We subsequently evaluated differential expression of these miRNAs' targets in colonic tissue and the impact of these miRNAs on CRC survival. We determined sequence complementarity between each miRNA seed region and the 3' UTR of each experimentally verified mRNA target gene. We classified miRNAs into groups based on seed regions matching perfectly to a mRNA UTR with six bases beginning at position two, seven bases beginning at position one, seven bases beginning at position two, or eight bases beginning at position one. We analyzed these groups in terms of miRNA differential expression between carcinoma and normal colorectal mucosa, differential colonic target mRNA expression, and risk of dying from CRC. After correction for multiple comparisons, the proportion of the miRNAs that were associated with differential mRNA expression was 0% for the 6-mer, 13.64% for the 7α-mer group, 12.82% for the 7β-mer group, and 8.70% for the 8-mer group. The proportion of miRNAs associated with survival was 20% for the 6-mer group, 27.27% for the 7α-mer group, 10.23% for the 7β-mer group, and 21.74% for the 8-mer group. We did not see a linear relationship between seed length and miRNA expression dysregulation, mRNA expression, or survival. Our findings do not support the hypothesis the seed region length alone influences mRNA repression.

  5. Kinetic models for nucleocytoplasmic transport of messenger RNA.

    Science.gov (United States)

    Schröder, H C; Müller, W E; Agutter, P S

    1995-05-21

    Much is known about the mechanism by which mRNAs cross the nuclear envelope (the translocation stage of nucleocytoplasmic transport), but far less is known about the preceding (intranuclear migration/release) and succeeding (cytoplasmic binding) stages. Therefore, existing information suffices for articulating detailed kinetic models of translocation, but not models for the overall mRNA transport process. In this paper, we show that simple kinetic models of translocation can (i) accommodate data about nucleocytoplasmic distributions of endogenous transcripts; (ii) predict the overall effects on these distributions of effectors such as insulin and epidermal growth factor; (iii) throw some light on the mechanism(s) of action of the HIV-1 protein Rev and produce experimentally testable predictions about this mechanism; and (iv) account for the action of influenza virus NS1 protein. However, the simplest forms of translocation models apparently fail to account for some properties of viral regulators such as HIV Rev and adenovirus E1B-E4 complex. To elucidate these topics, less narrowly focused models of mRNA transport are required, describing intranuclear binding/release as well as translocation. On the basis of our examination of translocation models, we suggest some criteria that the requisite broadly based models must satisfy.

  6. DNA-water interactions distinguish messenger RNA genes from transfer RNA genes.

    Science.gov (United States)

    Khandelwal, Garima; Jayaram, B

    2012-05-30

    Physicochemical properties of DNA sequences as a guide to developing insights into genome organization has received little attention. Here, we utilize the energetics of DNA to further advance the knowledge on its language at a molecular level. Specifically, we ask the question whether physicochemical properties of different functional units on genomes differ. We extract intramolecular and solvation energies of different DNA base pair steps from a comprehensive set of molecular dynamics simulations. We then investigate the solvation behavior of DNA sequences coding for mRNAs and tRNAs. Distinguishing mRNA genes from tRNA genes is a tricky problem in genome annotation without assumptions on length of DNA and secondary structure of the product of transcription. We find that solvation energetics of DNA behaves as an extremely efficient property in discriminating 2,063,537 genes coding for mRNAs from 56,251 genes coding for tRNAs in all (~1500) completely sequenced prokaryotic genomes.

  7. The Role of RNA Binding Proteins in Insulin Messenger Stability and Translation

    OpenAIRE

    2010-01-01

    Although the reason for insufficient release of insulin in diabetes mellitus may vary depending on the type and stage of the disease, it is of vital importance that an amplified insulin biosynthesis can meet the increased need during periods of hyperglycemia. The insulin mRNA is highly abundant in beta cells and changes in insulin mRNA levels are, at least in part, controlled by altered rates of mRNA degradation. Since the mechanisms behind the control of insulin messenger stability and trans...

  8. Selective Pyramidal Cell Reduction of GABAA Receptor α1 Subunit Messenger RNA Expression in Schizophrenia

    OpenAIRE

    Glausier, Jill R; Lewis, David A.

    2011-01-01

    Levels of messenger RNA (mRNA) for the α1 subunit of the GABAA receptor, which is present in 60% of cortical GABAA receptors, have been reported to be lower in layer 3 of the prefrontal cortex (PFC) in subjects with schizophrenia. This subunit is expressed in both pyramidal cells and interneurons, and thus lower α1 subunit levels in each cell population would have opposite effects on net cortical excitation. We used dual-label in situ hybridization to quantify GABAA α1 subunit mRNA expression...

  9. Means to an end: mechanisms of alternative polyadenylation of messenger RNA precursors

    OpenAIRE

    Gruber, Andreas R; Martin, Georges; Keller, Walter; Zavolan, Mihaela

    2013-01-01

    Expression of mature messenger RNAs (mRNAs) requires appropriate transcription initiation and termination, as well as pre-mRNA processing by capping, splicing, cleavage, and polyadenylation. A core 3′-end processing complex carries out the cleavage and polyadenylation reactions, but many proteins have been implicated in the selection of polyadenylation sites among the multiple alternatives that eukaryotic genes typically have. In recent years, high-throughput approaches to map both the 3′-end...

  10. Transfer-messenger RNA controls the translation of cell-cycle and stress proteins in Streptomyces

    DEFF Research Database (Denmark)

    Barends, Sharief; Zehl, Martin; Bialek, Sylwia

    2010-01-01

    , elongation factor Tu3, and the cell-cycle control proteins DasR, SsgA, SsgF and SsgR. Although tmRNA-tagged proteins are degraded swiftly, the translation of dnaK and dasR messenger RNAs (mRNAs) depends fully on tmRNA, whereas transcription is unaffected. The data unveil a surprisingly dedicated......The transfer-messenger RNA (tmRNA)-mediated trans-translation mechanism is highly conserved in bacteria and functions primarily as a system for the rescue of stalled ribosomes and the removal of aberrantly produced proteins. Here, we show that in the antibiotic-producing soil bacterium Streptomyces...... coelicolor, trans-translation has a specialized role in stress management. Analysis of proteins that were carboxy-terminally His(8)-tagged by a recombinant tmRNA identified only 10 targets, including the stress proteins: DnaK heat-shock protein 70, thiostrepton-induced protein A, universal stress protein A...

  11. Messenger RNA fluctuations and regulatory RNAs shape the dynamics of a negative feedback loop

    Science.gov (United States)

    Rodríguez Martínez, María; Soriano, Jordi; Tlusty, Tsvi; Pilpel, Yitzhak; Furman, Itay

    2010-03-01

    Single-cell experiments of simple regulatory networks can markedly differ from cell population experiments. Such differences arise from stochastic events in individual cells that are averaged out in cell populations. For instance, while individual cells may show sustained oscillations in the concentrations of some proteins, such oscillations may appear damped in the population average. In this paper we investigate the role of RNA stochastic fluctuations as a leading force to produce a sustained excitatory behavior at the single-cell level. As opposed to some previous models, we build a fully stochastic model of a negative feedback loop that explicitly takes into account the RNA stochastic dynamics. We find that messenger RNA random fluctuations can be amplified during translation and produce sustained pulses of protein expression. Motivated by the recent appreciation of the importance of noncoding regulatory RNAs in post-transcription regulation, we also consider the possibility that a regulatory RNA transcript could bind to the messenger RNA and repress translation. Our findings show that the regulatory transcript helps reducing gene expression variability both at the single-cell level and at the cell population level.

  12. Messenger RNA Fluctuations and Regulatory RNAs Shape the Dynamics of Negative Feedback Loop

    CERN Document Server

    Martínez, María Rodríguez; Tlusty, Tsvi; Pilpel, Yitzhak; Furman, Itay; 10.1103/PhysRevE.81.031924

    2010-01-01

    Single cell experiments of simple regulatory networks can markedly differ from cell population experiments. Such differences arise from stochastic events in individual cells that are averaged out in cell populations. For instance, while individual cells may show sustained oscillations in the concentrations of some proteins, such oscillations may appear damped in the population average. In this paper we investigate the role of RNA stochastic fluctuations as a leading force to produce a sustained excitatory behavior at the single cell level. Opposed to some previous models, we build a fully stochastic model of a negative feedback loop that explicitly takes into account the RNA stochastic dynamics. We find that messenger RNA random fluctuations can be amplified during translation and produce sustained pulses of protein expression. Motivated by the recent appreciation of the importance of non--coding regulatory RNAs in post--transcription regulation, we also consider the possibility that a regulatory RNA transcri...

  13. Postage for the messenger: Designating routes for Nuclear mRNA Export

    Science.gov (United States)

    Natalizio, Barbara J.; Wente, Susan R.

    2013-01-01

    Transcription of messenger(m) RNA occurs in the nucleus, making the translocation of mRNA across the nuclear envelope (NE) boundary a critical determinant of proper gene expression and cell survival. A major mRNA export route occurs via the NXF1-dependent pathway through the nuclear pore complexes (NPCs) embedded in the NE. However, recent findings have discovered new evidence supporting the existence of multiple mechanisms for crossing the NE, including both NPC-mediated and NE budding-mediated pathways. An analysis of the trans-acting factors and cis components that define these pathways reveals shared elements as well as mechanistic differences. We review here the current understanding of the mechanisms that characterize each pathway and highlight the determinants that influence mRNA transport fate. PMID:23583578

  14. Exploring the recovery and detection of messenger RNA and DNA from enhanced fingermarks in blood.

    Science.gov (United States)

    Fox, A; Gittos, M; Harbison, S A; Fleming, R; Wivell, R

    2014-05-01

    Often in the examination of bloodstained fingermarks discussion occurs around whether to prioritise the fingerprint evidence or focus on the biological evidence. Collecting a sample for genetic profiling may result in the loss of ridge detail that could have been used for fingerprint comparison. Fingermark enhancement and recovery methods along with sample collection methods could also compromise downstream genetic analysis. Previous forensic casework has highlighted circumstances where, after enhancement had been performed, it would have been extremely valuable to both identify the body fluid and generate a DNA profile from the same sample. We enhanced depletion series of fingermarks made in blood, using single treatments consisting of aqueous amido black, methanol-based amido black, acid yellow and leucocrystal violet, and exposure to long wave UV light. We then extracted the DNA and RNA for profiling, to assess the recovery and detection of genetic material from the enhanced fingermarks. We have shown that genetic profiling of bloodstained fingermarks can be successful after chemical enhancement; however it may still be necessary to prioritise evidence types in certain circumstances. From our results it appears that even with visible bloodstained fingermarks, leucocrystal violet can reduce the effectiveness of subsequent messenger RNA profiling. Aqueous amido black and acid yellow also have adverse effects on messenger RNA profiling of depleted fingermarks with low levels of cellular material. These results help with forensic decision-making by expanding knowledge of the extent of the detrimental effects of blood-enhancement reagents on both DNA profiling and body fluid identification using messenger RNA profiling.

  15. Relationship between expression of muscle-specific uncoupling protein 2 messenger RNA and genetic selection toward growth in channel catfish.

    Science.gov (United States)

    Kobayashi, Y; Peterson, B C; Waldbieser, G C

    2015-04-01

    This study tested the hypothesis that increased growth in channel catfish is associated with expression of the genes that code for uncoupling proteins (UCP) 2 and 3, members of the mitochondrial channel proteins involved in nutrient sensing and metabolism. The specific objective was to contrast the levels of UCP2 messenger RNA (mRNA) in fast vs slow growing catfish as well as in fed vs fasted catfish. Two distinct UCP2 transcripts were identified and named UCP2a and UCP2b, respectively. Nucleotide and amino acid sequence of catfish UCP2s were highly similar to UCP2 and other UCPs from other fish and mammals (>75%). Expression of UCP2a mRNA was detectable at very low levels in various metabolically active tissues, whereas the expression of UCP2b mRNA was readily detectable in the muscle and heart. In a 21-wk feeding study, fish that grew faster had a greater percent body fat at the end of the study (P muscle was increased (P growth and associated fat accumulation appears to be independent of muscle UCP2b mRNA expression and UCP2b-mediated mechanisms. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Cadmium-induced accumulation of metallothionein messenger RNA in rat liver

    Energy Technology Data Exchange (ETDEWEB)

    Ohi, S.; Cardenosa, G.; Pine, R.; Huang, P.C.

    1981-03-10

    Multiple injections of nontoxic levels of cadmium to a rat result in much higher level of metallothionein (MT) production in the liver than does the single injection. In order to understand the underlying mechanisms we have quantitated and compared the metallothionein-specific messenger RNA contents in the livers following the two induction regimens. Cell-free translation assays coupled with specific immunoprecipitation of MT revealed that MT-mRNA activity in livers of animals multiply injected with Cd is 7- to 10-fold higher than that in livers 4 h after a single Cd-induction. By oligo(dT)-cellulose chromatography, sucrose density gradient centrifugation, and methylmercuric hydroxide-agarose gel electrophoresis this mRNA has been enriched approximately 100-fold from the total RNA. The size of the mRNA is about 400 nucleotides. Hybridization assays with a complementary DNA probe synthesized against the enriched MT-mRNA showed a 4-fold difference in the level of MT-mRNA between the two induction regimens in agreement with the results obtained by the cell-free translation assays. The possible mechanisms for these observations in consideration of the short lived nature of MT-mRNA are discussed.

  17. Aberrant herpesvirus-induced polyadenylation correlates with cellular messenger RNA destruction.

    Directory of Open Access Journals (Sweden)

    Yeon J Lee

    2009-05-01

    Full Text Available Regulation of messenger RNA (mRNA stability plays critical roles in controlling gene expression, ensuring transcript fidelity, and allowing cells to respond to environmental cues. Unregulated enhancement of mRNA turnover could therefore dampen cellular responses to such signals. Indeed, several herpesviruses instigate widespread destruction of cellular mRNAs to block host gene expression and evade immune detection. Kaposi's sarcoma-associated herpesvirus (KSHV promotes this phenotype via the activity of its viral SOX protein, although the mechanism of SOX-induced mRNA turnover has remained unknown, given its apparent lack of intrinsic ribonuclease activity. Here, we report that KSHV SOX stimulates cellular transcriptome turnover via a unique mechanism involving aberrant polyadenylation. Transcripts in SOX-expressing cells exhibit extended poly(A polymerase II-generated poly(A tails and polyadenylation-linked mRNA turnover. SOX-induced polyadenylation changes correlate with its RNA turnover function, and inhibition of poly(A tail formation blocks SOX activity. Both nuclear and cytoplasmic poly(A binding proteins are critical cellular cofactors for SOX function, the latter of which undergoes striking nuclear relocalization by SOX. SOX-induced mRNA turnover therefore represents both a novel mechanism of host shutoff as well as a new model system to probe the regulation of poly(A tail-stimulated mRNA turnover in mammalian cells.

  18. Genetic recombination in plant-infecting messenger-sense RNA viruses: overview and research perspectives

    Directory of Open Access Journals (Sweden)

    Jozef Julian Bujarski

    2013-03-01

    Full Text Available RNA recombination is one of the driving forces of genetic variability in (+-strand RNA viruses. Various types of RNA-RNA crossovers were described including crosses between the same or different viral RNAs or between viral and cellular RNAs. Likewise, a variety of molecular mechanisms are known to support RNA recombination, such as replicative events (based on internal or end-to-end replicase switchings along with nonreplicative joining among RNA fragments of viral and/or cellular origin. Such mechanisms as RNA decay or RNA interference are responsible for RNA fragmentation and trans-esterification reactions which are likely accountable for ligation of RNA fragments. Numerous host factors were found to affect the profiles of viral RNA recombinants and significant differences in recombination frequency were observed among various RNA viruses. Comparative analyses of viral sequences allowed for the development of evolutionary models in order to explain adaptive phenotypic changes and co-evolving sites. Many questions remain to be answered by forthcoming RNA recombination research. (i How various factors modulate the ability of viral replicase to switch templates, (ii What is the intracellular location of RNA-RNA template switchings, (iii Mechanisms and factors responsible for non-replicative RNA recombination, (iv Mechanisms of integration of RNA viral sequences with cellular genomic DNA, and (v What is the role of RNA splicing and ribozyme activity. From an evolutionary stand point, it is not known how RNA viruses parasitize new host species via recombination, nor is it obvious what the contribution of RNA recombination is among other RNA modification pathways. We do not understand why the frequency of RNA recombination varies so much among RNA viruses and the status of RNA recombination as a form of sex is not well documented.

  19. Circulating thyroid stimulating hormone receptor messenger RNA and differentiated thyroid cancer: A diagnostic meta-analysis

    Science.gov (United States)

    Kong, Chao-Yue; Li, Zhan-Ming; Wang, Li-Shun

    2017-01-01

    Thyroid stimulating hormone receptor messenger RNA (TSHR-mRNA) is over-expressed in thyroid cancer patients, which indicates that TSHR-mRNA is a potential biomarker of thyroid cancer. However, system evaluation for TSHR-mRNA as a diagnostic biomarker of thyroid cancer is deficient. The performance of TSHR-mRNA for thyroid cancer diagnosis was evaluated in this study. Three common international databases as well as a Chinese database were applied for literature researching. Quality assessment of the included literatures was conducted by the QUADAS-2 tool. Totally, 1027 patients from nine studies eligible for the meta-analysis were included in this study. Global sensitivity and specificity for the positivity of TSHR-mRNA in the thyroid cancer diagnosis is 72% and 82%. The value of AUC for this test performance was 0.84. Our meta-analysis suggests that TSHR-mRNA might be a potential biomarker to complete present diagnostic methods for early and precision diagnosis of thyroid cancer. Notably, this findings need validation thorough large-scale clinical studies. PMID:28036261

  20. Gene Expression in Archaea: Studies of Transcriptional Promoters, Messenger RNA Processing, and Five Prime Untranslated Regions in "Methanocaldococcus Jannashchii"

    Science.gov (United States)

    Zhang, Jian

    2009-01-01

    Gene expression in Archaea is less understood than those in Bacteria and Eucarya. In general, three steps are involved in gene expression--transcription, RNA processing, and translation. To expand our knowledge of these processes in Archaea, I have studied transcriptional promoters, messenger RNA processing, and 5'-untranslated regions in…

  1. Differential intragraft cytokine messenger RNA profiles during rejection and repair of clinical heart transplants. A longitudinal study

    NARCIS (Netherlands)

    de Groot-Kruseman, Hester A; Mol, Wendy M; Niesters, Hubert G M; Maat, Alex P W; van Gelder, Teun; Balk, Aggie H M M; Weimar, Willem; Baan, Carla C

    2003-01-01

    After clinical heart transplantation, ischemia, acute rejection, and repair mechanisms can trigger the up-regulation of cytokines. To investigate the cytokine profile early after transplantation, we monitored messenger RNA (mRNA) expression levels of tumor necrosis factor-alpha (TNF-alpha), monocyte

  2. Gene Expression in Archaea: Studies of Transcriptional Promoters, Messenger RNA Processing, and Five Prime Untranslated Regions in "Methanocaldococcus Jannashchii"

    Science.gov (United States)

    Zhang, Jian

    2009-01-01

    Gene expression in Archaea is less understood than those in Bacteria and Eucarya. In general, three steps are involved in gene expression--transcription, RNA processing, and translation. To expand our knowledge of these processes in Archaea, I have studied transcriptional promoters, messenger RNA processing, and 5'-untranslated regions in…

  3. Comment on ``Length-dependent translation of messenger RNA by ribosomes''

    Science.gov (United States)

    Zhang, Yunxin

    2012-02-01

    In a recent paper by Valleriani [Phys. Rev. EPLEEE81539-375510.1103/PhysRevE.83.042903 83, 042903 (2011)], a simple model for the translation of messenger RNA (mRNA) is presented. Using this model, the protein translational ratio r, defined as the ratio of protein translation rate ωtl from mRNA to protein degradation rate ωp, is obtained. The key point in obtaining the translational ratio r is to get the protein translation rate ωtl. In Valleriani 's paper, ωtl is obtained as the mean value of the measured translation rate, which is the ratio of the synthesized protein number to the mRNA lifetime. However, in experiments, different methods might be used to obtain the value of ωtl. Therefore, to apply Valleriani 's model to more general experiments, in this Comment three methods to obtain the translation rate ωtl, and consequently the translational ratio r, are presented. Based on one of the methods which might be employed in most of the experiments, we find that the translational ratio r decays exponentially with mRNA length in prokaryotic cells, and decays reciprocally with mRNA length in eukaryotic cells. This result is slight different from that which was obtained in Valleriani 's paper.

  4. Antigen-presenting cells transfected with Hsp65 messenger RNA fail to treat experimental tuberculosis

    Energy Technology Data Exchange (ETDEWEB)

    Rocha, C.D.; Trombone, A.P.F.; Lorenzi, J.C.C.; Almeida, L.P.; Gembre, A.F.; Padilha, E. [Departamento de Bioquímica e Imunologia, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil); Ramos, S.G. [Departamento de Patologia, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil); Silva, C.L.; Coelho-Castelo, A.A.M. [Departamento de Bioquímica e Imunologia, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil)

    2012-09-21

    In the last several years, the use of dendritic cells has been studied as a therapeutic strategy against tumors. Dendritic cells can be pulsed with peptides or full-length protein, or they can be transfected with DNA or RNA. However, comparative studies suggest that transfecting dendritic cells with messenger RNA (mRNA) is superior to other antigen-loading techniques in generating immunocompetent dendritic cells. In the present study, we evaluated a new therapeutic strategy to fight tuberculosis using dendritic cells and macrophages transfected with Hsp65 mRNA. First, we demonstrated that antigen-presenting cells transfected with Hsp65 mRNA exhibit a higher level of expression of co-stimulatory molecules, suggesting that Hsp65 mRNA has immunostimulatory properties. We also demonstrated that spleen cells obtained from animals immunized with mock and Hsp65 mRNA-transfected dendritic cells were able to generate a mixed Th1/Th2 response with production not only of IFN-γ but also of IL-5 and IL-10. In contrast, cells recovered from mice immunized with Hsp65 mRNA-transfected macrophages were able to produce only IL-5. When mice were infected with Mycobacterium tuberculosis and treated with antigen-presenting cells transfected with Hsp65 mRNA (therapeutic immunization), we did not detect any decrease in the lung bacterial load or any preservation of the lung parenchyma, indicating the inability of transfected cells to confer curative effects against tuberculosis. In spite of the lack of therapeutic efficacy, this study reports for the first time the use of antigen-presenting cells transfected with mRNA in experimental tuberculosis.

  5. Translational Influence on Messenger Stability

    DEFF Research Database (Denmark)

    Eriksen, Mette

    , on messenger stability was examined. Depending on the translation initiation frequency, the chance of an initial ribosome trailing the RNA polymerase get better for better initiation sites, thus protecting transcription from termination by Rho. A polarity assay in which the activity of the downstream lac......-termination to be a global phenomena in gene regulation. The influence of codon usage in the early coding region on messenger stability was examined, in order to establish how fast or slow the ribosome has to decode the sequence for it to protect the messenger from degradation. The experiments demonstrated that very fast...

  6. Exercise does not influence myostatin and follistatin messenger RNA expression in young women.

    Science.gov (United States)

    Jensky, Nicole E; Sims, Jennifer K; Dieli-Conwright, Christina M; Sattler, Fred R; Rice, Judd C; Schroeder, E Todd

    2010-02-01

    We evaluated changes in myostatin, follistatin, and MyoD messenger RNA (mRNA) gene expression using eccentric exercise (EE) and concentric exercise (CE) as probes to better understand the mechanisms of muscle hypertrophy in young women. Twelve women performed single-leg maximal eccentric (n = 6, 25 +/- 1 years, 59 +/- 7 kg) or concentric (n = 6, 24 +/- 1 years, 65 +/- 7 kg) isokinetic knee extension exercise for 7 sessions. Muscle biopsies were taken from the vastus lateralis at baseline, 8 hours after the first exercise session, and 8 hours after the seventh exercise session. In the EE group, there were no changes in myostatin and follistatin (p > or = 0.17); however, MyoD expression increased after 1 exercise bout (p = 0.02). In the CE group, there were no changes in myostatin, follistatin, or MyoD mRNA gene expression (p > or = 0.07). Differences between the EE and CE groups were not significant (p > or = 0.05). These data suggest that a single bout or multiple bouts of maximal EE or CE may not significantly alter myostatin or follistatin mRNA gene expression in young women. However, MyoD mRNA expression seems to increase only after EE.

  7. Characterization of striatal neurons expressing high levels of glutamic acid decarboxylase messenger RNA.

    Science.gov (United States)

    Chesselet, M F; Robbins, E

    1989-07-17

    Two types of labelled cells are detected in sections of rat and mouse striata processed for in situ hybridization histochemistry with 35S-radiolabelled RNA probes complementary to the messenger RNA (mRNA) encoding glutamic acid decarboxylase (GAD), the synthesis enzyme for gamma-aminobutyric acid (GABA): numerous lightly, and fewer very densely labelled neurons. In order to determine whether the densely labelled cells correspond to the striatal somatostatinergic neurons with which they share morphological characteristics, the presence of GAD mRNA was examined in brain sections processed successively for dihydronicotinamide adenine dinucleotide phosphate (NADPH) diaphorase histochemistry, a marker of striatal somatostatinergic neurons, and in situ hybridization histochemistry. In addition, the distribution of GABAergic interneurons was analyzed with regard to striatal compartments (striosomes) indicated by patches of dense opiate binding sites. The results show that NADPH diaphorase activity and GAD mRNA do not co-exist in striatal neurons. Furthermore, in contrast to the somatostatinergic neurons which are almost exclusively located in the extrastriosomal matrix, densely labelled GAD cells were present both in the striosomes and the matrix, further suggesting that GABAergic and somatostatinergic neurons form two distinct interneuronal systems in the striatum of rats and mice.

  8. Messenger RNA profiling for forensic body fluid identification: research and applications.

    Science.gov (United States)

    Wang, Zheng; Zhang, Su-hua; Di, Zhou; Zhao, Shu-min; Li, Cheng-tao

    2013-10-01

    Identifying the origin of body fluids left at a crime scene can give a significant insight into crime scene reconstruction by supporting a link between sample donors and actual criminal acts. However, the conventional body fluid identification methods are prone to various limitations, such as time consumption, intensive labor, nonparallel manner, varying degrees of sensitivity and limited specificity. Recently, the analysis of cell-specific messenger RNA expression (mRNA profiling) has been proposed to supplant conventional methods for body fluid identification. Since 2011, the collaborative exercises have been organized by the European DNA Profiling Group (EDNAP) in order to evaluate the robustness and reproducibility of mRNA profiling for body fluid identification. The major advantages of mRNA profiling, compared to the conventional methods, include higher sensitivity, greater specificity, the ability of detecting several body fluids in one multiplex reaction, and compatibility with current DNA extraction and analysis procedure. In the current review, we provided an overview of the present knowledge and detection methodologies of mRNA profiling for forensic body fluid identification and discussed its possible practical application to forensic casework.

  9. Messenger RNA Profiling for Forensic Body Fluid Identifica-tion:Research and Applications

    Institute of Scientific and Technical Information of China (English)

    WANG Zheng; ZHANG Su-hua; ZHOU Di; ZHAO Shu-min; LI Cheng-tao

    2013-01-01

    Identifying the origin of body fluids left at a crime scene can give a significant insight into crime scene reconstruction by supporting a link betw een sample donors and actual criminal acts. How ev-er, the conventional body fluid identification methods are prone to various limitations, such as time con-sumption, intensive labor, nonparallel manner, varying degrees of sensitivity and limited specificity. Re-cently, the analysis of cell-specific messenger RNA expression (mRNA profiling) has been proposed to supplant conventional methods for body fluid identification. Since 2011, the collaborative exercises have been organized by the European DNA Profiling Group (EDNAP ) in order to evaluate the robustness and reproducibility of mRNA profiling for body fluid identification. The major advantages of mRNA profil-ing, compared to the conventional methods, include higher sensitivity, greater specificity, the ability of detecting several body fluids in one multiplex reaction, and compatibilitywith current DNA extraction and analysis procedure. In the current review ,we provided an overview of the present know ledge and detection methodologies of mRNA profiling for forensic body fluid identification and discussed its possi-ble practical application to forensic casew ork.

  10. Emergence of the β-CASP ribonucleases: highly conserved and ubiquitous metallo-enzymes involved in messenger RNA maturation and degradation.

    Science.gov (United States)

    Dominski, Zbigniew; Carpousis, Agamemnon J; Clouet-d'Orval, Béatrice

    2013-01-01

    The β-CASP ribonucleases, which are found in the three domains of life, have in common a core of 460 residues containing seven conserved sequence motifs involved in the tight binding of two catalytic zinc ions. A hallmark of these enzymes is their ability to catalyze both endo- and exo-ribonucleolytic degradation. Exo-ribonucleolytic degradation proceeds in the 5' to 3' direction and is sensitive to the phosphorylation state of the 5' end of a transcript. Recent phylogenomic analyses have shown that the β-CASP ribonucleases can be partitioned into two major subdivisions that correspond to orthologs of eukaryal CPSF73 and bacterial RNase J. We discuss the known functions of the CPSF73 and RNase J orthologs, their association into complexes, and their structure as it relates to mechanism of action. Eukaryal CPSF73 is part of a large multiprotein complex that is involved in the maturation of the 3' end of RNA Polymerase II transcripts and the polyadenylation of messenger RNA. RNase J1 and J2 are paralogs in Bacillus subtilis that are involved in the degradation of messenger RNA and the maturation of non-coding RNA. RNase J1 and J2 co-purify as a heteromeric complex and there is recent evidence that they interact with other enzymes to form a bacterial RNA degradosome. Finally, we speculate on the evolutionary origin of β-CASP ribonucleases and on their functions in Archaea. Orthologs of CPSF73 with endo- and exo-ribonuclease activity are strictly conserved throughout the archaea suggesting a role for these enzymes in the maturation and/or degradation of messenger RNA. This article is part of a Special Issue entitled: RNA Decay mechanisms. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Messenger RNA- versus retrovirus-based induced pluripotent stem cell reprogramming strategies: analysis of genomic integrity.

    Science.gov (United States)

    Steichen, Clara; Luce, Eléanor; Maluenda, Jérôme; Tosca, Lucie; Moreno-Gimeno, Inmaculada; Desterke, Christophe; Dianat, Noushin; Goulinet-Mainot, Sylvie; Awan-Toor, Sarah; Burks, Deborah; Marie, Joëlle; Weber, Anne; Tachdjian, Gérard; Melki, Judith; Dubart-Kupperschmitt, Anne

    2014-06-01

    The use of synthetic messenger RNAs to generate human induced pluripotent stem cells (iPSCs) is particularly appealing for potential regenerative medicine applications, because it overcomes the common drawbacks of DNA-based or virus-based reprogramming strategies, including transgene integration in particular. We compared the genomic integrity of mRNA-derived iPSCs with that of retrovirus-derived iPSCs generated in strictly comparable conditions, by single-nucleotide polymorphism (SNP) and copy number variation (CNV) analyses. We showed that mRNA-derived iPSCs do not differ significantly from the parental fibroblasts in SNP analysis, whereas retrovirus-derived iPSCs do. We found that the number of CNVs seemed independent of the reprogramming method, instead appearing to be clone-dependent. Furthermore, differentiation studies indicated that mRNA-derived iPSCs differentiated efficiently into hepatoblasts and that these cells did not load additional CNVs during differentiation. The integration-free hepatoblasts that were generated constitute a new tool for the study of diseased hepatocytes derived from patients' iPSCs and their use in the context of stem cell-derived hepatocyte transplantation. Our findings also highlight the need to conduct careful studies on genome integrity for the selection of iPSC lines before using them for further applications.

  12. Expression of estrogen receptor and estrogen receptor messenger RNA in gastric carcinoma tissues

    Institute of Scientific and Technical Information of China (English)

    Xin-Han Zhao; Shan-Zhi Gu; Shan-Xi Liu; Bo-Rong Pan

    2003-01-01

    AIM: To study estrogen receptor (ER) and estrogen receptor messenger RNA (ERmRNA) expression in gastric carcinoma tissues and to investigate their association with the pathologic types of gastric carcinoma.METHODS: The expression of ER and ERmRNA in gastric carcinoma tissues (15 males and 15 females, 42-70 years old) was detected by immunohistochemistry and in situ hybridization, respectively.RESULTS: The positive rate of ER (immunohistochemistry)was 33.3% in males and 46.7% in females. In Borrmann Ⅳ gastric carcinoma ER positive rate was greater than that in other pathologic types, and in poorly differentiated adenocarcinoma and signet ring cell carcinoma the positive rates were greater than those in other histological types of both males and females (P<0.05). The ER was more highly expressed in diffused gastric carcinoma than in non-diffused gastric carcinoma (P<0.05). The ER positive rate was also related to regional lymph nodes metastases (P<0.05), and was significantly higher in females above 55 years old, and higher in males under 55 years old (P<0.05). The ERmRNA (in situ hybridization) positive rate was 73.3% in males and 86.7% in females. The ERmRNA positive rates were almost the same in Borrmann Ⅰ, Ⅱ, Ⅲ and Ⅳ gastric carcinoma (P>0.05). ERmRNA was expressed in all tubular adenocarcinoma, poorly differentiated adenocarcinoma and signet ring cell carcinoma (P<0.05). The ERmRNA positive rate was related to both regional lymph nodes metastases and gastric carcinoma growth patterns, and was higher in both sexes above 55 years old but without statistical significance (P>0.05). The positive rate of ERmRNA expression by in situ hybridization was higher than that of ER expression by immunohistochemistry (P<0.05).CONCLUSION: ERmRNA expression is related to the pathological behaviors of gastric carcinoma, which might help to predict the prognosis and predict the effectiveness of endocrine therapy for gastric carcinoma.

  13. Integrated microRNA and messenger RNA analysis in aortic stenosis.

    Science.gov (United States)

    Coffey, Sean; Williams, Michael J A; Phillips, L Vicky; Galvin, Ivor F; Bunton, Richard W; Jones, Gregory T

    2016-11-23

    Aortic valve stenosis (AS) is a major cause of morbidity and mortality, with no effective medical therapies. Investigation into the underlying biology of AS in humans is limited by difficulties in obtaining healthy valvular tissue for use as a control group. However, micro-ribonucleic acids (miRNAs) are stable in post-mortem tissue. We compared valve specimens from patients undergoing aortic valve replacement for AS to non-diseased cadaveric valves. We found 106 differentially expressed miRNAs (p Integrated miRNA/gene expression analysis validated the microarray results as a whole, while quantitative polymerase chain reaction confirmed downregulation of miR-122-5p, miR-625-5p, miR-30e-5p and upregulation of miR-21-5p and miR-221-3p. Pathway analysis of the integrated miRNA/mRNA network identified pathways predominantly involved in extracellular matrix function. A number of currently available therapies target products of upregulated genes in the integrated miRNA/mRNA network, with these genes being predominantly more peripheral members of the network. The identification of a group of tissue miRNA associated with AS may contribute to the development of new therapeutic approaches to AS. This study highlights the importance of systems biology-based approaches to complex diseases.

  14. Systemic delivery of factor IX messenger RNA for protein replacement therapy

    Science.gov (United States)

    Ramaswamy, Suvasini; Tonnu, Nina; Tachikawa, Kiyoshi; Limphong, Pattraranee; Vega, Jerel B.; Karmali, Priya P.; Chivukula, Pad; Verma, Inder M.

    2017-01-01

    Safe and efficient delivery of messenger RNAs for protein replacement therapies offers great promise but remains challenging. In this report, we demonstrate systemic, in vivo, nonviral mRNA delivery through lipid nanoparticles (LNPs) to treat a Factor IX (FIX)-deficient mouse model of hemophilia B. Delivery of human FIX (hFIX) mRNA encapsulated in our LUNAR LNPs results in a rapid pulse of FIX protein (within 4–6 h) that remains stable for up to 4–6 d and is therapeutically effective, like the recombinant human factor IX protein (rhFIX) that is the current standard of care. Extensive cytokine and liver enzyme profiling showed that repeated administration of the mRNA–LUNAR complex does not cause any adverse innate or adaptive immune responses in immune-competent, hemophilic mice. The levels of hFIX protein that were produced also remained consistent during repeated administrations. These results suggest that delivery of long mRNAs is a viable therapeutic alternative for many clotting disorders and for other hepatic diseases where recombinant proteins may be unaffordable or unsuitable. PMID:28202722

  15. Comparison of circulating, hepatocyte specific messenger RNA and microRNA as biomarkers for chronic hepatitis B and C.

    Science.gov (United States)

    Zhang, Xiaonan; Zhang, Zhanqing; Dai, Fahui; Shi, Bisheng; Chen, Liang; Zhang, Xinxin; Zang, Guoqing; Zhang, Jiming; Chen, Xiaorong; Qian, Fangxing; Hu, Yunwen; Yuan, Zhenghong

    2014-01-01

    Circulating microRNAs have been widely recognized as a novel category of biomarker in a variety of physiological and pathological conditions. Other reports revealed that fragments of organ specific messenger RNAs are also detectable in serum/plasma and can be utilized as sensitive indicators of liver pathology and cancer. In order to assess the sensitivity and reliability of these two class of RNAs as marker of hepatitis B or C induced chronic liver disease, we collected plasma samples from 156 chronic hepatitis B or C patients (HBV active n = 112, HBV carrier n = 19, hepatitis C n = 25) and 22 healthy donors and quantified their circulating mRNA for albumin, HP (haptoglobin), CYP2E1 (cytochrome P450, family 2, subfamily E) and ApoA2 (Apolipoprotein A2) in conjunction with microRNA-122, a well established marker for acute and chronic liver injury. We found that plasma microRNA-122 level is significantly elevated in patients with active HBV but not in HBV carriers. Furthermore, microRNA-122 is not elevated in HCV patients even though their median serum alanine aminotransferase (sALT) was three fold of the healthy donors. Nevertheless, circulating mRNAs, especially albumin mRNA, showed much more sensitivity in distinguishing active hepatitis B, hepatitis B carrier or HCV patients from healthy control. Correlation and multiple linear regression analysis suggested that circulating mRNAs and miRNAs are much more related to HBsAg titre than to sALT. Immunoprecipitation of HBsAg in HBV patients' plasma resulted in enrichment of albumin and HP mRNA suggesting that fragments of liver specific transcripts can be encapsidated into HBsAg particles. Taken together, our results suggest that hepatocyte specific transcripts in plasma like albumin mRNA showed greater sensitivity and specificity in differentiating HBV or HCV induced chronic liver disease than microRNA-122. Circulating mRNA fragments merit more attention in the quest of next generation biomarkers for

  16. Gingival Toll-like receptor and cytokine messenger RNA levels in equine periodontitis and oral health.

    Science.gov (United States)

    Kennedy, R; Lappin, D F; Dixon, P M; Bennett, D; Riggio, M P

    2017-05-01

    Equine periodontitis is a common and painful condition. However, the disease often goes unnoticed by owners and is thus a major welfare concern. The aetiopathogenesis of the condition remains poorly understood and has been investigated in few studies. The innate immune system is known to play an important role in human periodontitis, but its role in equine periodontitis has not been examined. To quantify the messenger (m)RNA levels of Toll-like receptors (TLRs) and cytokines in gingival tissue from orally healthy horses and those affected by periodontitis. Observational study. Gingival tissue samples were taken post-mortem from 13 horses with no clinical signs of oral disease and 20 horses with periodontitis. mRNA levels of TLR2, TLR4 and TLR9 and cytokines interleukin-1β (IL-1β), tumour necrosis factor-α (TNF-α), IL-4, IL-6, IL-10, IL-12, IL-17 and interferon-γ (IFN-γ) were determined using quantitative real-time PCR. The statistical significance of results was assessed using appropriate t tests. mRNA levels of all TLRs and cytokines were upregulated in equine periodontitis. Significant increases in mRNA levels of TLR2, TLR9, IL-4, IL-10, IL-12 (P≤0.05) and IFN-γ (P≤0.01) were observed for both unweighted and age-weighted analyses of diseased gingival tissue samples compared with healthy gingival samples. In comparisons of samples of periodontitis lesions with healthy gingival control samples from the same horse, significant increases in mRNA levels of TLR4, TLR9, IL-10, IFN-γ (P≤0.05), TLR2, IL-1β and IL-12p35 (P≤0.01) were observed. This study has provided an initial insight into the involvement of the immune system in equine periodontitis. Increased mRNA levels of TLR2, TLR4 and TLR9 indicate substantial microbial challenge in diseased gingival tissue. A mixed Th1/Th2/Th17 cytokine response is produced in equine periodontitis. Further studies are required to more fully characterise the role of the innate immune system in this disease. © 2016

  17. Genome-Wide Scleral Micro- and Messenger-RNA Regulation During Myopia Development in the Mouse.

    Science.gov (United States)

    Metlapally, Ravikanth; Park, Han Na; Chakraborty, Ranjay; Wang, Kevin K; Tan, Christopher C; Light, Jacob G; Pardue, Machelle T; Wildsoet, Christine F

    2016-11-01

    MicroRNA (miRNAs) have been previously implicated in scleral remodeling in normal eye growth. They have the potential to be therapeutic targets for prevention/retardation of exaggerated eye growth in myopia by modulating scleral matrix remodeling. To explore this potential, genome-wide miRNA and messenger RNA (mRNA) scleral profiles in myopic and control eyes from mice were studied. C57BL/6J mice (n = 7; P28) reared under a 12L:12D cycle were form-deprived (FD) unilaterally for 2 weeks. Refractive error and axial length changes were measured using photorefraction and 1310-nm spectral-domain optical coherence tomography, respectively. Scleral RNA samples from FD and fellow control eyes were processed for microarray assay. Statistical analyses were performed using National Institute of Aging array analysis tool; group comparisons were made using ANOVA, and gene ontologies were identified using software available on the Web. Findings were confirmed using quantitative PCR in a separate group of mice (n = 7). Form-deprived eyes showed myopic shifts in refractive error (-2.02 ± 0.47 D; P RNA profiles of test eyes with those of control eyes revealed 54 differentially expressed miRNAs and 261 mRNAs fold-change >1.25 (maximum fold change = 1.63 and 2.7 for miRNAs and mRNAs, respectively) (P < 0.05; minimum, P = 0.0001). Significant ontologies showing gene over-representation (P < 0.05) included intermediate filament organization, scaffold protein binding, detection of stimuli, calcium ion, G protein, and phototransduction. Significant differential expression of Let-7a and miR-16-2, and Smok4a, Prph2, and Gnat1 were confirmed. Scleral mi- and mRNAs showed differential expression linked to myopia, supporting the involvement of miRNAs in eye growth regulation. The observed general trend of relatively small fold-changes suggests a tightly controlled, regulatory mechanism for scleral gene expression.

  18. Parathyroid hormone induces c-fos and c-jun messenger RNA in rat osteoblastic cells

    Science.gov (United States)

    Clohisy, J. C.; Scott, D. K.; Brakenhoff, K. D.; Quinn, C. O.; Partridge, N. C.

    1992-01-01

    PTH is a potent regulator of osteoblast gene expression, yet the nuclear events that mediate PTH action are poorly understood. We were interested in identifying immediate early genes which may regulate PTH-altered gene expression in the osteoblast. Therefore, we examined the effects of PTH on c-fos and c-jun gene expression in a rat osteoblastic cell line (UMR 106-01). Under control conditions, c-fos and c-jun mRNAs were present at low basal levels. After PTH treatment, c-fos mRNA abundance dramatically increased, with a maximal and transient response at 30 min. PTH also stimulated an increase in c-jun mRNA, but in a biphasic manner, with maximal levels at 30 min and 2 h. These responses were dose dependent, not altered by cotreatment with the protein synthesis inhibitor cycloheximide, and preceded PTH-induced expression of matrix metallo-proteinase-1 mRNA. Nuclear run-on assays demonstrated an increased rate of c-fos and c-jun transcription after PTH exposure. To determine the signal transduction pathways involved, second messenger analogs were tested for their ability to mimic the effects of PTH. 8-Bromo-cAMP and phorbol 12-myristate 13-acetate (PMA) caused increases in the abundance of c-fos and c-jun transcripts. Ionomycin had no effect on the expression of these genes. Pretreatment of the cells with PMA resulted in a decrease in basal c-jun expression, but did not alter the PTH-mediated increase in c-fos, c-jun, or matrix metalloproteinase-1 mRNAs.(ABSTRACT TRUNCATED AT 250 WORDS).

  19. Light-induced appearance of polysomal poly(A)-rich messenger RNA during greening of barley plants.

    Science.gov (United States)

    Heinze, H; Herzfeld, F; Kiper, M

    1980-10-01

    Changes in polysomal poly(A)-rich mRNA during greening of etiolated barley plants were studied by the technique of cDNA-mRNa hybridization. Hybridizaiton data of the homologous reactions reveal that in etiolated as well as in greened shoots a complexity of 5 X 10(7) nucleotides or about 33000 different average-sized mRNAs are present. These are organized in different abundancy classes with 94% of the total complexicity present in each of the slowest reacting class representing rare messengers. Heterologous hybridizations indicate that 92% of all polysomal poly(A)-rich mRNAs in etiolated shoots are complementary to those of greened and 82% of 'green' poly(A)-rich mRNAs are complementary to white ones. It is shown that the abundant mRNA clases are essentially responsible for these differences. The prevalent classes making up 15% ('white') and 31% ('green') of the poly(A)-rich mRNA mass but comprising only a complexity of 1.8 X 10(4) and 2.1 X 10(4) nucleotides are identical to 50% with each other. Hybridization of isolated prevalent 'green' cDNA with whole 'white' poly(A)-rich mRNA indicates that the additionally appearing 50% prevalent green messengers must be regarded as green-specific, only present in polysomal poly(A)-rich mRNA after illumination. This conclusion is underlined by the hybridization of the 'green' cDNA with total polysomal RNa of etiolated shoots. Evidently appearance of these prevalent messengers in functional polysomes is not caused by a shift from poly(A)-free mRNA to poly(A)-rich mRNA. The results clearly demonstrate that light induces greening by turning on genes or influencing post-transcriptional processing to produce mature green-specific poly(A)-rich mRNA.

  20. RNAome sequencing delineates the complete RNA landscape

    NARCIS (Netherlands)

    K.W.J. Derks (Kasper); J. Pothof (Joris)

    2015-01-01

    textabstractStandard RNA expression profiling methods rely on enrichment steps for specific RNA classes, thereby not detecting all RNA species. For example, small and large RNAs from the same sample cannot be sequenced in a single sequence run. We designed RNAome sequencing, which is a strand-specif

  1. Deciphering the RNA landscape by RNAome sequencing

    NARCIS (Netherlands)

    K.W.J. Derks (Kasper); B. Misovic (Branislav); M.C.G.N. van den hout (Mirjam); C. Kockx (Christel); C.P. Gomez (Cesar Payan); R.W.W. Brouwer (Rutger); H. Vrieling (Harry); J.H.J. Hoeijmakers (Jan); W.F.J. van IJcken (Wilfred); J. Pothof (Joris)

    2015-01-01

    textabstractCurrent RNA expression profiling methods rely on enrichment steps for specific RNA classes, thereby not detecting all RNA species in an unperturbed manner. We report strand-specific RNAome sequencing that determines expression of small and large RNAs from rRNA-depleted total RNA in a

  2. Deciphering the RNA landscape by RNAome sequencing

    NARCIS (Netherlands)

    K.W.J. Derks (Kasper); B. Misovic (Branislav); M.C.G.N. van den hout (Mirjam); C. Kockx (Christel); C.P. Gomez (Cesar Payan); R.W.W. Brouwer (Rutger); H. Vrieling (Harry); J.H.J. Hoeijmakers (Jan); W.F.J. van IJcken (Wilfred); J. Pothof (Joris)

    2015-01-01

    textabstractCurrent RNA expression profiling methods rely on enrichment steps for specific RNA classes, thereby not detecting all RNA species in an unperturbed manner. We report strand-specific RNAome sequencing that determines expression of small and large RNAs from rRNA-depleted total RNA in a sin

  3. The microRNA and messengerRNA profile of the RNA-induced silencing complex in human primary astrocyte and astrocytoma cells.

    Directory of Open Access Journals (Sweden)

    Joanna J Moser

    Full Text Available BACKGROUND: GW/P bodies are cytoplasmic ribonucleoprotein-rich foci involved in microRNA (miRNA-mediated messenger RNA (mRNA silencing and degradation. The mRNA regulatory functions within GW/P bodies are mediated by GW182 and its binding partner hAgo2 that bind miRNA in the RNA-induced silencing complex (RISC. To date there are no published reports of the profile of miRNA and mRNA targeted to the RISC or a comparison of the RISC-specific miRNA/mRNA profile differences in malignant and non-malignant cells. METHODOLOGY/PRINCIPAL FINDINGS: RISC mRNA and miRNA components were profiled by microarray analysis of malignant human U-87 astrocytoma cells and its non-malignant counterpart, primary human astrocytes. Total cell RNA as well as RNA from immunoprecipitated RISC was analyzed. The novel findings were fourfold: (1 miRNAs were highly enriched in astrocyte RISC compared to U-87 astrocytoma RISC, (2 astrocytoma and primary astrocyte cells each contained unique RISC miRNA profiles as compared to their respective cellular miRNA profiles, (3 miR-195, 10b, 29b, 19b, 34a and 455-3p levels were increased and the miR-181b level was decreased in U-87 astrocytoma RISC as compared to astrocyte RISC, and (4 the RISC contained decreased levels of mRNAs in primary astrocyte and U-87 astrocytoma cells. CONCLUSIONS/SIGNIFICANCE: The observation that miR-34a and miR-195 levels were increased in the RISC of U-87 astrocytoma cells suggests an oncogenic role for these miRNAs. Differential regulation of mRNAs by specific miRNAs is evidenced by the observation that three miR34a-targeted mRNAs and two miR-195-targeted mRNAs were downregulated while one miR-195-targeted mRNA was upregulated. Biological pathway analysis of RISC mRNA components suggests that the RISC plays a pivotal role in malignancy and other conditions. This study points to the importance of the RISC and ultimately GW/P body composition and function in miRNA and mRNA deregulation in astrocytoma cells and

  4. Cancer-Associated Perturbations in Alternative Pre-messenger RNA Splicing.

    Science.gov (United States)

    Shkreta, Lulzim; Bell, Brendan; Revil, Timothée; Venables, Julian P; Prinos, Panagiotis; Elela, Sherif Abou; Chabot, Benoit

    2013-01-01

    For most of our 25,000 genes, the removal of introns by pre-messenger RNA (pre-mRNA) splicing represents an essential step toward the production of functional messenger RNAs (mRNAs). Alternative splicing of a single pre-mRNA results in the production of different mRNAs. Although complex organisms use alternative splicing to expand protein function and phenotypic diversity, patterns of alternative splicing are often altered in cancer cells. Alternative splicing contributes to tumorigenesis by producing splice isoforms that can stimulate cell proliferation and cell migration or induce resistance to apoptosis and anticancer agents. Cancer-specific changes in splicing profiles can occur through mutations that are affecting splice sites and splicing control elements, and also by alterations in the expression of proteins that control splicing decisions. Recent progress in global approaches that interrogate splicing diversity should help to obtain specific splicing signatures for cancer types. The development of innovative approaches for annotating and reprogramming splicing events will more fully establish the essential contribution of alternative splicing to the biology of cancer and will hopefully provide novel targets and anticancer strategies. Metazoan genes are usually made up of several exons interrupted by introns. The introns are removed from the pre-mRNA by RNA splicing. In conjunction with other maturation steps, such as capping and polyadenylation, the spliced mRNA is then transported to the cytoplasm to be translated into a functional protein. The basic mechanism of splicing requires accurate recognition of each extremity of each intron by the spliceosome. Introns are identified by the binding of U1 snRNP to the 5' splice site and the U2AF65/U2AF35 complex to the 3' splice site. Following these interactions, other proteins and snRNPs are recruited to generate the complete spliceosomal complex needed to excise the intron. While many introns are constitutively

  5. RNA sequencing of the nephron transcriptome: a technical note

    Directory of Open Access Journals (Sweden)

    Jae Wook Lee

    2015-12-01

    Full Text Available To understand the functions of the kidney, the transcriptome of each part of the nephron needs to be profiled using a highly sensitive and unbiased tool. RNA sequencing (RNA-seq has revolutionized transcriptomic research, enabling researchers to define transcription activity and functions of genomic elements with unprecedented sensitivity and precision. Recently, RNA-seq for polyadenylated messenger RNAs [poly(A′-mRNAs] and classical microdissection were successfully combined to investigate the transcriptome of glomeruli and 14 different renal tubule segments. A rat kidney is perfused with and incubated in collagenase solution, and the digested kidney was manually dissected under a stereomicroscope. Individual glomeruli and renal tubule segments are identified by their anatomical and morphological characteristics and collected in phosphate-buffered saline. Poly(A′-tailed mRNAs are released from cell lysate, captured by oligo-dT primers, and made into complementary DNAs (cDNAs using a highly sensitive reverse transcription method. These cDNAs are sheared by sonication and prepared into adapter-ligated cDNA libraries for Illumina sequencing. Nucleotide sequences reported from the sequencing reaction are mapped to the rat reference genome for gene expression analysis. These RNA-seq transcriptomic data were highly consistent with prior knowledge of gene expression along the nephron. The gene expression data obtained in this work are available as a public Web page (https://helixweb.nih.gov/ESBL/Database/NephronRNAseq/ and can be used to explore the transcriptomic landscape of the nephron.

  6. A Novel Route Controlling Begomovirus Resistance by the Messenger RNA Surveillance Factor Pelota.

    Directory of Open Access Journals (Sweden)

    Moshe Lapidot

    2015-10-01

    Full Text Available Tomato yellow leaf curl virus (TYLCV is a devastating disease of tomato (Solanum lycopersicum that can be effectively controlled by the deployment of resistant cultivars. The TYLCV-resistant line TY172 carries a major recessive locus for TYLCV resistance, designated ty-5, on chromosome 4. In this study, the association between 27 polymorphic DNA markers, spanning the ty-5 locus, and the resistance characteristics of individual plants inoculated with TYLCV in 51 segregating recombinant populations were analyzed. These analyses localized ty-5 into a 425 bp region containing two transversions: one in the first exon of a gene encoding the tomato homolog of the messenger RNA surveillance factor Pelota (Pelo, and a second in its proximal promoter. Analyses of susceptible and resistant lines revealed that the relative transcript level of the gene remained unchanged, regardless of whether the plants were infected with TYLCV or not. This suggests that the polymorphism discovered in the coding region of the gene controls the resistance. Silencing of Pelo in a susceptible line rendered the transgenic plants highly resistant, while in the resistant line TY172 had no effect on symptom development. In addition, over-expression of the susceptible allele of the gene in the resistant TY172 line rendered it susceptible, while over-expression of the resistant allele in susceptible plants had no effect. These results confirm that Pelo is the gene controlling resistance at the ty-5 locus. Pelo, implicated in the ribosome recycling-phase of protein synthesis, offers an alternative route to promote resistance to TYLCV and other viruses.

  7. RNA-RNA interaction prediction based on multiple sequence alignments

    CERN Document Server

    Li, Andrew X; Qin, Jing; Reidys, Christian M

    2010-01-01

    Recently, $O(N^6)$ time and $O(N^4)$ space dynamic programming algorithms have become available that compute the partition function of RNA-RNA interaction complexes for pairs of RNA sequences. These algorithms and the biological requirement of more reliable interactions motivate to utilize the additional information contained in multiple sequence alignments and to generalize the above framework to the partition function and base pairing probabilities for multiple sequence alignments.

  8. Active and accurate trans-translation requires distinct determinants in the C-terminal tail of SmpB protein and the mRNA-like domain of transfer messenger RNA (tmRNA).

    Science.gov (United States)

    Camenares, Devin; Dulebohn, Daniel P; Svetlanov, Anton; Karzai, A Wali

    2013-10-18

    Unproductive ribosome stalling in eubacteria is resolved by the actions of SmpB protein and transfer messenger (tm) RNA. We examined the functional significance of conserved regions of SmpB and tmRNA to the trans-translation process. Our investigations reveal that the N-terminal 20 residues of SmpB, which are located near the ribosomal decoding center, are dispensable for all known SmpB activities. In contrast, a set of conserved residues that reside at the junction between the tmRNA-binding core and the C-terminal tail of SmpB play an important role in tmRNA accommodation. Our data suggest that the highly conserved glycine 132 acts as a flexible hinge that enables movement of the C-terminal tail, thus permitting proper positioning and establishment of the tmRNA open reading frame (ORF) as the surrogate template. To gain further insights into the function of the SmpB C-terminal tail, we examined the tagging activity of hybrid variants of tmRNA and the SmpB protein, in which the tmRNA ORF or the SmpB C-terminal tail was substituted with the equivalent but highly divergent sequences from Francisella tularensis. We observed that the hybrid tmRNA was active but resulted in less accurate selection of the resume codon. Cognate hybrid SmpB was necessary to restore activity. Furthermore, accurate tagging was observed when the identity of the resume codon was reverted from GGC to GCA. Taken together, these data suggest that the engagement of the tmRNA ORF and the selection of the correct translation resumption point are distinct activities that are influenced by independent tmRNA and SmpB determinants.

  9. Network of tRNA Gene Sequences

    Institute of Scientific and Technical Information of China (English)

    WEI Fang-ping; LI Sheng; MA Hong-ru

    2008-01-01

    A network of 3719 tRNA gene sequences was constructed using simplest alignment. Its topology, degree distribution and clustering coefficient were studied. The behaviors of the network shift from fluctuated distribution to scale-free distribution when the similarity degree of the tRNA gene sequences increases. The tRNA gene sequences with the same anticodon identity are more self-organized than those with different anticodon identities and form local clusters in the network. Some vertices of the local cluster have a high connection with other local clusters, and the probable reason was given. Moreover, a network constructed by the same number of random tRNA sequences was used to make comparisons. The relationships between the properties of the tRNA similarity network and the characters of tRNA evolutionary history were discussed.

  10. Effects of cold stress on hypothalamic corticotrophin-releasing and thyrotropin-releasing hormone messenger RNA levels in chickens

    Institute of Scientific and Technical Information of China (English)

    WANG Jintao; XU Shiwen

    2007-01-01

    There is increasing evidence that stress can activate the hypothalamic-pituitary-adrenal-axis and hypothalamic-pituitarythyroid-axis, and further affect the synthesis and secretion of corticotrophin-releasing hormone (CRH) and thyrotropin-releasing hormone (TRH). To evaluate the effect of cold stress on the hypothalamic CRH and TRH messenger RNA (mRNA) levels in Yisha chickens, male Yisha chickens were subjected to acute (1, 6, 12 h) and chronic (5, 10, 20 d) cold stress (12±1)℃. Hypothalami were collected for assessment of mRNA levels by semi-quantitative RT-PCR. Acute stress resulted in a significant decrease of CRH mRNA levels at 6 and 12 h, and a significant increase of TRH mRNA levels at every stress time point. Chronic cold stress resulted in a significant increase of CRH mRNA levels and a significant decrease of TRH mRNA levels compared with the control group at every stress time point. The results suggest that the two genes differently respond to cold stress at the mRNA levels. And the different degrees of cold stress will produce different effects on the identical gene.

  11. Translational Influence on Messenger Stability

    DEFF Research Database (Denmark)

    Eriksen, Mette

    , on messenger stability was examined. Depending on the translation initiation frequency, the chance of an initial ribosome trailing the RNA polymerase get better for better initiation sites, thus protecting transcription from termination by Rho. A polarity assay in which the activity of the downstream lac......A in the lac operon was measured, demonstrated that Rho dependent transcriptional pre-termination correlated with ribosome translation initiation frequency. It was further shown that Rho terminates RNA polymerases during transcription on messengers normally considered stable, suggesting Rho transcriptional pre...... pulls out the nascent transcript. Finally this thesis also focussed on the cell stress caused by an artificial and very strong RNA psudoknot used in a fusion gene. The technique of ribosomal foot printing and whole transcriptome deep sequencing was employed to facilitate an overview of the changes...

  12. Propionic and Methylmalonic Acidemia: Antisense Therapeutics for Intronic Variations Causing Aberrantly Spliced Messenger RNA

    OpenAIRE

    Rincón, A. ; Aguado, C. ; Desviat, L. R. ; Sánchez-Alcudia, R. ; Ugarte, M. ; Pérez, B. 

    2007-01-01

    We describe the use of antisense morpholino oligonucleotides (AMOs) to restore normal splicing caused by intronic molecular defects identified in methylmalonic acidemia (MMA) and propionic acidemia (PA). The three new point mutations described in deep intronic regions increase the splicing scores of pseudoexons or generate consensus binding motifs for splicing factors, such as SRp40, which favor the intronic inclusions in MUT (r.1957ins76), PCCA (r.1284ins84), or PCCB (r.654ins72) messenger R...

  13. Recombinant messenger RNA technology and its application in cancer immunotherapy, transcript replacement therapies, pluripotent stem cell induction, and beyond.

    Science.gov (United States)

    Vallazza, Britta; Petri, Sebastian; Poleganov, Marco A; Eberle, Florian; Kuhn, Andreas N; Sahin, Ugur

    2015-01-01

    In recent years, the interest in using messenger RNA (mRNA) as a therapeutic means to tackle different diseases has enormously increased. This holds true not only for numerous preclinical studies, but mRNA has also entered the clinic to fight cancer. The advantages of using mRNA compared to DNA were recognized very early on, e.g., the lack of risk for genomic integration, or the expression of the encoded protein in the cytoplasm without the need to cross the nuclear membrane. However, it was generally assumed that mRNA is just not stable enough to give rise to sufficient expression of the encoded protein. Yet, an initially small group of mRNA aficionados could demonstrate that the stability of mRNA and the efficiency, by which the encoded protein is translated, can be significantly increased by selecting the right set of cis-acting structural elements (including the 5'-cap, 5'- and 3'-untranslated regions, poly(A)-tail, and modified building blocks). In parallel, significant advances in RNA packaging and delivery have been made, extending the potential for this molecule. This paved the way for further work to prove mRNA as a promising therapeutic for multiple diseases. Here, we review the developments to optimize mRNA regarding stability, translational efficiency, and immune-modulating properties to enhance its functionality and efficacy as a therapeutic. Furthermore, we summarize the current status of preclinical and clinical studies that use mRNA for cancer immunotherapy, for the expression of functional proteins as so-called transcript (or protein) replacement therapy, as well as for induction of pluripotent stem cells.

  14. Quantitative correlation between promoter methylation and messenger RNA levels of the reduced folate carrier

    Directory of Open Access Journals (Sweden)

    Kheradpour Albert

    2008-05-01

    Full Text Available Abstract Background Methotrexate (MTX uptake is mediated by the reduced folate carrier (RFC. Defective drug uptake in association with decreased RFC expression is a common mechanism of MTX resistance in many tumor types. Heavy promoter methylation was previously identified as a basis for the complete silencing of RFC in MDA-MB-231 breast cancer cells, its role and prevalence in RFC transcription regulation are, however, not widely studied. Methods In the current study, RFC promoter methylation was assessed using methylation specific PCR in a panel of malignant cell lines (n = 8, including MDA-MB-231, and M805, a MTX resistant cell line directly established from the specimen of a patient with malignant fibrohistocytoma, whom received multiple doses of MTX. A quantitative approach of real-time PCR for measuring the extent of RFC promoter methylation was developed, and was validated by direct bisulfite genomic sequencing. RFC mRNA levels were determined by quantitative real-time RT-PCR and were related to the extent of promoter methylation in these cell lines. Results A partial promoter methylation and RFC mRNA down-regulation were observed in M805. Using the quantitative approach, a reverse correlation (correlation coefficient = -0.59, p Conclusion This study further suggests that promoter methylation is a potential basis for MTX resistance. The quantitative correlation identified in this study implies that promoter methylation is possibly a mechanism involved in the fine regulation of RFC transcription.

  15. Contrasting responses to interferon β-1b treatment in relapsing-remitting multiple sclerosis: Does baseline interleukin- 12p35 messenger RNA predict the efficacy of treatment?

    NARCIS (Netherlands)

    Boxel van-Dezaire, A.H.H.; Trigt van-Hoff, S.C.J.; Killestein, J.; Schrijver, H.M.; Houwelingen, J.C. van; Polman, C.H.; Nagelkerken, L.

    2000-01-01

    Interferon (IFN)-β treatment is effective in relapsing-remitting multiple sclerosis (RR-MS) via an as yet unidentified mechanism. In the present study, we investigated whether the expression of messenger RNA (mRNA) encoding the interleukin (IL)-12 subunits p40 and p35, IL-12 receptor chains, IL-18,

  16. Proopiomelanocortin messenger RNA levels are increased in the anterior pituitary of the sheep fetus after adrenalectomy in late gestation.

    Science.gov (United States)

    McMillen, I C; Antolovich, G C; Mercer, J E; Perry, R A; Silver, M

    1990-09-01

    We have investigated the effect of bilateral adrenalectomy at 116-119 days' gestation on the levels of the messenger (m) RNA for proopiomelanocortin (POMC) in the anterior pituitary of the fetal sheep and in the ovine placentome during late gestation (134-136 days' gestation). After fetal adrenalectomy there was a significant (p less than 0.001) and sustained increase in circulating ACTH concentrations in the adrenalectomised group (1,838 +/- 155 ng/l at 130-136 days) when compared with the intact control group (131 +/- 25 ng/l at 130-136 days). The mean levels of POMCmRNA relative to 18S RNA were also significantly higher (p less than 0.001) in the adrenalectomised fetal sheep pituitaries (2.8 +/- 0.12; n = 4) than in the intact/control fetal sheep pituitaries (1.31 +/- 0.13; n = 4). In contrast to the findings in the anterior pituitary, POMCmRNA was not detected in RNA extracted from the placentomes of either the adrenalectomised or intact fetal sheep. There was also a significant arteriovenous difference in ACTH concentrations in the umbilical circulation in both adrenalectomised and intact fetal sheep at 134-136 days' gestation. This study demonstrates therefore that the fetal adrenals act to suppress POMCmRNA levels in late gestation and also that the increase in circulating ACTH after adrenalectomy originates from the pituitary and not the placentome.

  17. Experimental investigation of an RNA sequence space

    Science.gov (United States)

    Lee, Youn-Hyung; Dsouza, Lisa; Fox, George E.

    1993-12-01

    Modern rRNAs are the historic consequence of an ongoing evolutionary exploration of a sequence space. These extant sequences belong to a special subset of the sequence space that is comprised only of those primary sequences that can validly perform the biological function(s) required of the particular RNA. If it were possible to readily identify all such valid sequences, stochastic predictions could be made about the relative likelihood of various evolutionary pathways available to an RNA. Herein an experimental system which can assess whether a particular sequence is likely to have validity as a eubacterial 5S rRNA is described. A total of ten naturally occurring, and hence known to be valid, sequences and two point mutants of unknown validity were used to test the usefulness of the approach. Nine of the ten valid sequences tested positive whereas both mutants tested as clearly defective. The tenth valid sequence gave results that would be interpreted as reflecting a borderline status were the answer not known. These results demonstrate that it is possible to experimentally determine which sequences in local regions of the sequence space are potentially valid 5S rRNAs. This approach will allow direct study of the constraints governing RNA evolution and allow inquiry into how the last common ancestor of extant life apparently came to have very complex ribosomal RNAs that subsequently were very conserved.

  18. antaRNA: ant colony-based RNA sequence design

    National Research Council Canada - National Science Library

    Kleinkauf, Robert; Mann, Martin; Backofen, Rolf

    2015-01-01

    ... ,: specific sequence constraints and additional fuzzy structure constraints. antaRNA applies ant colony optimization meta-heuristics and its superior performance is shown on a biological datasets. http://www.bioinf.uni-freiburg.de/Software/antaRNA CONTACT: backofen@informatik.uni-freiburg.de Supplementary data are available at Bioinformatics online.

  19. Translation affects YoeB and MazF messenger RNA interferase activities by different mechanisms

    DEFF Research Database (Denmark)

    Christensen-Dalsgaard, Mikkel; Gerdes, Kenn

    2008-01-01

    Prokaryotic toxin-antitoxin loci encode mRNA cleaving enzymes that inhibit translation. Two types are known: those that cleave mRNA codons at the ribosomal A site and those that cleave any RNA site specifically. RelE of Escherichia coli cleaves mRNA at the ribosomal A site in vivo and in vitro...

  20. Messenger RNA Turnover Processes in Escherichia coli, Bacillus subtilis, and Emerging Studies in Staphylococcus aureus

    Directory of Open Access Journals (Sweden)

    Kelsi L. Anderson

    2009-01-01

    Full Text Available The regulation of mRNA turnover is a recently appreciated phenomenon by which bacteria modulate gene expression. This review outlines the mechanisms by which three major classes of bacterial trans-acting factors, ribonucleases (RNases, RNA binding proteins, and small noncoding RNAs (sRNA, regulate the transcript stability and protein production of target genes. Because the mechanisms of RNA decay and maturation are best characterized in Escherichia coli, the majority of this review will focus on how these factors modulate mRNA stability in this organism. However, we also address the effects of RNases, RNA binding proteins, sRNAs on mRNA turnover, and gene expression in Bacillus subtilis, which has served as a model for studying RNA processing in gram-positive organisms. We conclude by discussing emerging studies on the role modulating mRNA stability has on gene expression in the important human pathogen Staphylococcus aureus.

  1. MCT-1 protein interacts with the cap complex and modulates messenger RNA translational profiles

    DEFF Research Database (Denmark)

    Reinert, Line; Shi, B; Nandi, S;

    2006-01-01

    MCT-1 is an oncogene that was initially identified in a human T cell lymphoma and has been shown to induce cell proliferation as well as activate survival-related pathways. MCT-1 contains the PUA domain, a recently described RNA-binding domain that is found in several tRNA and rRNA modification e...

  2. Transforming growth factor-beta1 induces transforming growth factor-beta1 and transforming growth factor-beta receptor messenger RNAs and reduces complement C1qB messenger RNA in rat brain microglia.

    Science.gov (United States)

    Morgan, T E; Rozovsky, I; Sarkar, D K; Young-Chan, C S; Nichols, N R; Laping, N J; Finch, C E

    2000-01-01

    Transforming growth factor-beta1 is a multifunctional peptide with increased expression during Alzheimer's disease and other neurodegenerative conditions which involve inflammatory mechanisms. We examined the autoregulation of transforming growth factor-beta1 and transforming growth factor-beta receptors and the effects of transforming growth factor-beta1 on complement C1q in brains of adult Fischer 344 male rats and in primary glial cultures. Perforant path transection by entorhinal cortex lesioning was used as a model for the hippocampal deafferentation of Alzheimer's disease. In the hippocampus ipsilateral to the lesion, transforming growth factor-beta1 peptide was increased >100-fold; the messenger RNAs encoding transforming growth factor-beta1, transforming growth factor-beta type I and type II receptors were also increased, but to a smaller degree. In this acute lesion paradigm, microglia are the main cell type containing transforming growth factor-beta1, transforming growth factor-beta type I and II receptor messenger RNAs, shown by immunocytochemistry in combination with in situ hybridization. Autoregulation of the transforming growth factor-beta1 system was examined by intraventricular infusion of transforming growth factor-beta1 peptide, which increased hippocampal transforming growth factor-beta1 messenger RNA levels in a dose-dependent fashion. Similarly, transforming growth factor-beta1 increased levels of transforming growth factor-beta1 messenger RNA and transforming growth factor-beta type II receptor messenger RNA (IC(50), 5pM) and increased release of transforming growth factor-beta1 peptide from primary microglia cultures. Interactions of transforming growth factor-beta1 with complement system gene expression are also indicated, because transforming growth factor-beta1 decreased C1qB messenger RNA in the cortex and hippocampus, after intraventricular infusion, and in cultured glia. These indications of autocrine regulation of transforming growth

  3. Quantitative in situ hybridization analysis of glutamic acid decarboxylase messenger RNA in developing rat cerebellum.

    Science.gov (United States)

    Willcutts, M D; Morrison-Bogorad, M

    1991-11-19

    The appearance and relative amounts of GAD mRNA in rat cerebellar neurons during postnatal development was studied by in situ hybridization. GAD mRNA content within all GABAergic neurons increased during the first month of postnatal development, but the degree and time course of the increase varied among different neuronal types. In newborn rats, GAD mRNA was present only in the prenatally-formed Purkinje and Golgi cells. GAD mRNA in Golgi cells had reached adult levels by postnatal day 14, while GAD mRNA levels in Purkinje cells reached adult levels one week later. Most basket cells expressed GAD mRNA by postnatal day 14, and final levels were attained one week later. Stellate cells in the bottom two-thirds of the molecular layer attained their final GAD mRNA content by postnatal day 21 whereas stellate cells in close proximity to the pial surface were not yet mature at this age. No GAD mRNA was detected within the external granular layer at any time during development. In adult rat, approximately 40% of cerebellar GAD mRNA was contained within the Purkinje cell population, 38% within the stellate cells, 17% within the basket cells, and only 5% within the Golgi cells. Increases in GAD mRNA within GABAergic neurons during cerebellar development correlated with the timing of neuronal maturation and synaptogenesis in these cell populations, suggesting that synaptic activity affects GAD gene expression in developing cerebellum.

  4. Partial purification and characterization of the messenger RNA for cell fibronectin.

    Science.gov (United States)

    Fagan, J B; Yamada, K M; de Crombrugghe, B; Pastan, I

    1979-08-10

    Fibronectin mRNA has been partially purified by guanidine extraction, oligo-(dT)-cellulose chromatography and sucrose density gradient centrifugation. We obtain a fraction which programs a wheat germ in vitro translation system to synthesize a polypeptide species which co-electrophoreses with fibronectin in SDS-polyacrylamide gels and which is immunoprecipitated with affinity purified fibronectin-specific IgG. Analysis of this RNA fraction by methyl mercury hydroxide-agarose gel electrophoresis reveals the presence of a band accounting for 30 percent to 50 percent of the ethidium bromide-staining material in the fraction. The RNA of this band has an estimated molecular weight of about 3 million daltons and is greatly reduced in the corresponding RNA fraction from RSV transformed CEF. This RNA has been tentatively identified as fibronectin mRNA.

  5. Messenger RNA vaccine based on recombinant MS2 virus-like particles against prostate cancer.

    Science.gov (United States)

    Li, Jinming; Sun, Yanli; Jia, Tingting; Zhang, Rui; Zhang, Kuo; Wang, Lunan

    2014-04-01

    Prostate cancer (PCa) is the most diagnosed cancer in the western male population with high mortality. Recently, alternative approaches based on immunotherapy including mRNA vaccines for PCa have shown therapeutic promise. However, for mRNA vaccine, several disadvantages such as the instability of mRNA, the high cost of gold particles, the limited production scale for mRNA-transfected dendritic cells in vitro, limit their development. Herein, recombinant bacteriophage MS2 virus-like particles (VLPs), which based on the interaction of a 19-nucleotide RNA aptamer and the coat protein of bacteriophage MS2, successfully addressed these questions, in which target mRNA was packaged by MS2 capsid. MS2 VLP-based mRNA vaccines were easily prepared by recombinant protein technology, nontoxic and RNase-resistant. We show the packaged mRNA was translated into protein as early as 12 hr after phagocytosed by macrophages. Moreover, MS2 VLP-based mRNA vaccines induced strong humoral and cellular immune responses, especially antigen-specific cytotoxic T-lymphocyte (CTL) and balanced Th1/Th2 responses without upregulation of CD4(+) regulatory T cells, and protected C57BL/6 mice against PCa completely. As a therapeutic vaccine, MS2 VLP-based mRNA vaccines delayed tumor growth. Our results provide proof of concept on the efficacy and safety of MS2 VLP-based mRNA vaccine, which provides a new delivery approach for mRNA vaccine and implies important clinical value for the prevention and therapy of PCa.

  6. [Synthesis of messenger-like RNA in plasma cels producing different clases of immunoglobulins].

    Science.gov (United States)

    Nikitin, A V; Babichev, V A

    1976-01-01

    Electrophoretic analysis of the nuclear poly A RNA cells of the MOPC 21, MOPC 406 and MOPC 41 plasmocytomas demonstrated a similarity in their distribution by the mol wt. Kinetics of the label accumulation in the nuclear poly A RNA of different plasma cells was unitypical. Individual peculiarities of the distribution of the cytoplasmic poly A RNA were expressed for each individual line of the myeloma cells. The majority of the molecules of the heterogenous RNA in the plasma cells were subjected to posttranscription polyadenylation.

  7. Detection of colony-stimulating factor messenger RNA in single T cells by in situ hybridization

    DEFF Research Database (Denmark)

    Williamson, D J; Owens, T; Pearse, M

    1989-01-01

    RNA being detected earlier and at a lower concentration of stimulus. The rise in intracellular mRNA was accompanied by an increase in the corresponding CSF bioactivity in the supernatant. In situ hybridization was of comparable sensitivity to Northern blot analysis and revealed significant heterogeneity...

  8. Alternative applications for distinct RNA sequencing strategies

    Science.gov (United States)

    Han, Leng; Vickers, Kasey C.; Samuels, David C.

    2015-01-01

    Recent advances in RNA library preparation methods, platform accessibility and cost efficiency have allowed high-throughput RNA sequencing (RNAseq) to replace conventional hybridization microarray platforms as the method of choice for mRNA profiling and transcriptome analyses. RNAseq is a powerful technique to profile both long and short RNA expression, and the depth of information gained from distinct RNAseq methods is striking and facilitates discovery. In addition to expression analysis, distinct RNAseq approaches also allow investigators the ability to assess transcriptional elongation, DNA variance and exogenous RNA content. Here we review the current state of the art in transcriptome sequencing and address epigenetic regulation, quantification of transcription activation, RNAseq output and a diverse set of applications for RNAseq data. We detail how RNAseq can be used to identify allele-specific expression, single-nucleotide polymorphisms and somatic mutations and discuss the benefits and limitations of using RNAseq to monitor DNA characteristics. Moreover, we highlight the power of combining RNA- and DNAseq methods for genomic analysis. In summary, RNAseq provides the opportunity to gain greater insight into transcriptional regulation and output than simply miRNA and mRNA profiling. PMID:25246237

  9. The nucleolin targeting aptamer AS1411 destabilizes Bcl-2 messenger RNA in human breast cancer cells.

    Science.gov (United States)

    Soundararajan, Sridharan; Chen, Weiwei; Spicer, Eleanor K; Courtenay-Luck, Nigel; Fernandes, Daniel J

    2008-04-01

    We sought to determine whether nucleolin, a bcl-2 mRNA-binding protein, has a role in the regulation of bcl-2 mRNA stability in MCF-7 and MDA-MB-231 breast cancer cells. Furthermore, we examined the efficacy of the aptamer AS1411 in targeting nucleolin and inducing bcl-2 mRNA instability and cytotoxicity in these cells. AS1411 at 5 micromol/L inhibited the growth of MCF-7 and MDA-MB-231 cells, whereas 20 micromol/L AS1411 had no effect on the growth rate or viability of normal MCF-10A mammary epithelial cells. This selectivity of AS1411 was related to a greater uptake of AS1411 into the cytoplasm of MCF-7 cells compared with MCF-10A cells and to a 4-fold higher level of cytoplasmic nucleolin in MCF-7 cells. Stable siRNA knockdown of nucleolin in MCF-7 cells reduced nucleolin and bcl-2 protein levels and decreased the half-life of bcl-2 mRNA from 11 to 5 hours. Similarly, AS1411 (10 micromol/L) decreased the half-life of bcl-2 mRNA in MCF-7 and MDA-MB-231 cells to 1.0 and 1.2 hours, respectively. In contrast, AS1411 had no effect on the stability of bcl-2 mRNA in normal MCF-10A cells. AS1411 also inhibited the binding of nucleolin to the instability element AU-rich element 1 of bcl-2 mRNA in a cell-free system and in MCF-7 cells. Together, the results suggest that AS1411 acts as a molecular decoy by competing with bcl-2 mRNA for binding to cytoplasmic nucleolin in these breast cancer cell lines. This interferes with the stabilization of bcl-2 mRNA by nucleolin and may be one mechanism by which AS1411 induces tumor cell death.

  10. Analysis of messenger RNA expression by in situ hybridization using RNA probes synthesized via in vitro transcription

    Science.gov (United States)

    Carter, Bradley S.; Fletcher, Jonathan S.; Thompson, Robert C.

    2010-01-01

    The analysis of the spatial patterning of mRNA expression is critically important for assigning functional and physiological significance to a given gene product. Given the tens of thousands of mRNAs in the mammalian genome, a full assessment of individual gene functions would ideally be overlaid upon knowledge of the specific cell types expressing each mRNA. In situ hybridization approaches represent a molecular biological/histological method that can reveal cellular patterns of mRNA expression. Here, we present detailed procedures for the detection of specific mRNAs using radioactive RNA probes in tissue sections followed by autoradiographic detection. These methods allow for the specific and sensitive detection of spatial patterns of mRNA expression, thereby linking mRNA expression with cell type and function. Radioactive detection methods also facilitate semi-quantitative analyses of changes in mRNA gene expression. PMID:20699122

  11. TRANSLATION START SITE MULTIPLICITY OF THE CCAAT ENHANCER-BINDING PROTEIN-ALPHA MESSENGER-RNA IS DICTATED BY A SMALL 5' OPEN READING FRAME

    NARCIS (Netherlands)

    CALKHOVEN, CF; BOUWMAN, PRJ; SNIPPE, L; AB, G

    1994-01-01

    The CCAAT/enhancer binding proteins (C/EBP) alpha and beta of the bZIP family of transcription factors each occur as multiple forms due to translation initiation at different in-frame AUG codons from the same messenger RNA. The C/EBP alpha mRNAs of chicken, rat and Xenopus all contain a small 5' ope

  12. Fecal bile acid excretion and messenger RNA expression levels of ileal transporters in high risk gallstone patients

    Directory of Open Access Journals (Sweden)

    Miquel Juan

    2009-12-01

    Full Text Available Abstract Background Cholesterol gallstone disease (GS is highly prevalent among Hispanics and American Indians. In GS, the pool of bile acids (BA is decreased, suggesting that BA absorption is impaired. In Caucasian GS patients, mRNA levels for ileal BA transporters are decreased. We aimed to determine fecal BA excretion rates, mRNA levels for ileal BA transporter genes and of regulatory genes of BA synthesis in Hispanic GS patients. Results Excretion of fecal BA was measured in seven GS females and in ten GS-free individuals, all with a body mass index 2O3 (300 mg/day for 10 days, and fecal specimens were collected on the last 3 days. Chromium was measured by a colorimetric method, and BA was quantitated by gas chromatography/mass spectroscopy. Intake of calories, nutrients, fiber and cholesterol were similar in the GS and GS-free subjects. Mean BA excretion levels were 520 ± 80 mg/day for the GS-free group, and 461 ± 105 mg/day for the GS group. Messenger RNA expression levels were determined by RT-PCR on biopsy samples obtained from ileum during diagnostic colonoscopy (14 GS-free controls and 16 GS patients and from liver during surgery performed at 8 and 10 AM (12 GS and 10 GS-free patients operated on for gastrointestinal malignancies, all with a body mass index Conclusion Hispanics with GS have fecal BA excretion rates and mRNA levels of genes for ileal BA transporters that are similar to GS-free subjects. However, mRNA expression levels of Cyp7A1 are increased in GS, indicating that regulation of BA synthesis is abnormal in Hispanics with GS.

  13. In situ hybridization of oxytocin messenger RNA: macroscopic distribution and quantitation in rat hypothalamic cell groups

    Energy Technology Data Exchange (ETDEWEB)

    Burbach, J.P.; Voorhuis, T.A.; van Tol, H.H.; Ivell, R.

    1987-05-29

    Oxytocin mRNA was detected in the rat hypothalamus by in situ hybridization to a single stranded /sup 35/S-labelled DNA probe and the distribution of oxytocin mRNA-containing cell groups was studied at the macroscopic level. Specificity of hybridization was confirmed by comparison to vasopressin mRNA hybridization in parallel tissue sections. Cell groups containing oxytocin mRNA were confined to a set of hypothalamic cell groups, i.c. the supraoptic, paraventricular, anterior commissural nuclei, nucleus circularis and scattered hypothalamic islets. These cell groups displayed similar densities of autoradiographic signals indicating that the oxytocin gene is expressed at approximately the same average level at these various sites.

  14. Diversifying microRNA sequence and function.

    Science.gov (United States)

    Ameres, Stefan L; Zamore, Phillip D

    2013-08-01

    MicroRNAs (miRNAs) regulate the expression of most genes in animals, but we are only now beginning to understand how they are generated, assembled into functional complexes and destroyed. Various mechanisms have now been identified that regulate miRNA stability and that diversify miRNA sequences to create distinct isoforms. The production of different isoforms of individual miRNAs in specific cells and tissues may have broader implications for miRNA-mediated gene expression control. Rigorously testing the many discrepant models for how miRNAs function using quantitative biochemical measurements made in vivo and in vitro remains a major challenge for the future.

  15. Expression of {mu}, {kappa}, and {delta} opioid receptor messenger RNA in the human CNS: a {sup 33}P in situ hybridization study

    Energy Technology Data Exchange (ETDEWEB)

    Peckys, D.; Landwehrmeyer, G.B. [Department of Neurology, Albert-Ludwigs-University Freiburg, Neurozentrum, Breisacherstrasse 64, D-79106 Freiburg (Germany)

    1999-02-01

    The existence of at least three opioid receptor types, referred to as {mu}, {kappa}, and {delta}, is well established. Complementary DNAs corresponding to the pharmacologically defined {mu}, {kappa}, and {delta} opioid receptors have been isolated in various species including man. The expression patterns of opioid receptor transcripts in human brain has not been established with a cellular resolution, in part because of the low apparent abundance of opioid receptor messenger RNAs in human brain. To visualize opioid receptor messenger RNAs we developed a sensitive in situ hybridization histochemistry method using {sup 33}P-labelled RNA probes. In the present study we report the regional and cellular expression of {mu}, {kappa}, and {delta} opioid receptor messenger RNAs in selected areas of the human brain. Hybridization of the different opioid receptor probes resulted in distinct labelling patterns. For the {mu} and {kappa} opioid receptor probes, the most intense regional signals were observed in striatum, thalamus, hypothalamus, cerebral cortex, cerebellum and certain brainstem areas as well as the spinal cord. The most intense signals for the {delta} opioid receptor probe were found in cerebral cortex. Expression of opioid receptor transcripts was restricted to subpopulations of neurons within most regions studied demonstrating differences in the cellular expression patterns of {mu}, {kappa}, and {delta} opioid receptor messenger RNAs in numerous brain regions. The messenger RNA distribution patterns for each opioid receptor corresponded in general to the distribution of opioid receptor binding sites as visualized by receptor autoradiography. However, some mismatches, for instance between {mu} opioid receptor receptor binding and {mu} opioid receptor messenger RNA expression in the anterior striatum, were observed. A comparison of the distribution patterns of opioid receptor messenger RNAs in the human brain and that reported for the rat suggests a homologous

  16. Organism-specific rRNA capture system for application in next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Sai-Kam Li

    Full Text Available RNA-sequencing is a powerful tool in studying RNomics. However, the highly abundance of ribosomal RNAs (rRNA and transfer RNA (tRNA have predominated in the sequencing reads, thereby hindering the study of lowly expressed genes. Therefore, rRNA depletion prior to sequencing is often performed in order to preserve the subtle alteration in gene expression especially those at relatively low expression levels. One of the commercially available methods is to use DNA or RNA probes to hybridize to the target RNAs. However, there is always a concern with the non-specific binding and unintended removal of messenger RNA (mRNA when the same set of probes is applied to different organisms. The degree of such unintended mRNA removal varies among organisms due to organism-specific genomic variation. We developed a computer-based method to design probes to deplete rRNA in an organism-specific manner. Based on the computation results, biotinylated-RNA-probes were produced by in vitro transcription and were used to perform rRNA depletion with subtractive hybridization. We demonstrated that the designed probes of 16S rRNAs and 23S rRNAs can efficiently remove rRNAs from Mycobacterium smegmatis. In comparison with a commercial subtractive hybridization-based rRNA removal kit, using organism-specific probes is better in preserving the RNA integrity and abundance. We believe the computer-based design approach can be used as a generic method in preparing RNA of any organisms for next-generation sequencing, particularly for the transcriptome analysis of microbes.

  17. Regulation of amylase messenger RNA concentration in rat pancreas by food content.

    OpenAIRE

    Giorgi, D; Bernard, J. P.; Lapointe, R.; Dagorn, J C

    1984-01-01

    Regulation of the expression of pancreatic amylase genes was studied by comparing groups of rats fed diets with high (75%), intermediate (20%) and low (11%) carbohydrate content. Animals on the high carbohydrate diet had nine times as much amylase mRNA as those on low carbohydrate diet, and twice as much as the intermediate group, as determined by filter hybridization of equal amounts of total pancreatic RNA to an excess of a cloned rat amylase cDNA probe. Parallel results were obtained when ...

  18. Compilation of tRNA sequences.

    Science.gov (United States)

    Sprinzl, M; Grueter, F; Spelzhaus, A; Gauss, D H

    1980-01-11

    This compilation presents in a small space the tRNA sequences so far published. The numbering of tRNAPhe from yeast is used following the rules proposed by the participants of the Cold Spring Harbor Meeting on tRNA 1978 (1,2;Fig. 1). This numbering allows comparisons with the three dimensional structure of tRNAPhe. The secondary structure of tRNAs is indicated by specific underlining. In the primary structure a nucleoside followed by a nucleoside in brackets or a modification in brackets denotes that both types of nucleosides can occupy this position. Part of a sequence in brackets designates a piece of sequence not unambiguosly analyzed. Rare nucleosides are named according to the IUPACIUB rules (for complicated rare nucleosides and their identification see Table 1); those with lengthy names are given with the prefix x and specified in the footnotes. Footnotes are numbered according to the coordinates of the corresponding nucleoside and are indicated in the sequence by an asterisk. The references are restricted to the citation of the latest publication in those cases where several papers deal with one sequence. For additional information the reader is referred either to the original literature or to other tRNA sequence compilations (3-7). Mutant tRNAs are dealt with in a compilation by J. Celis (8). The compilers would welcome any information by the readers regarding missing material or erroneous presentation. On the basis of this numbering system computer printed compilations of tRNA sequences in a linear form and in cloverleaf form are in preparation.

  19. Probabilistic error correction for RNA sequencing.

    Science.gov (United States)

    Le, Hai-Son; Schulz, Marcel H; McCauley, Brenna M; Hinman, Veronica F; Bar-Joseph, Ziv

    2013-05-01

    Sequencing of RNAs (RNA-Seq) has revolutionized the field of transcriptomics, but the reads obtained often contain errors. Read error correction can have a large impact on our ability to accurately assemble transcripts. This is especially true for de novo transcriptome analysis, where a reference genome is not available. Current read error correction methods, developed for DNA sequence data, cannot handle the overlapping effects of non-uniform abundance, polymorphisms and alternative splicing. Here we present SEquencing Error CorrEction in Rna-seq data (SEECER), a hidden Markov Model (HMM)-based method, which is the first to successfully address these problems. SEECER efficiently learns hundreds of thousands of HMMs and uses these to correct sequencing errors. Using human RNA-Seq data, we show that SEECER greatly improves on previous methods in terms of quality of read alignment to the genome and assembly accuracy. To illustrate the usefulness of SEECER for de novo transcriptome studies, we generated new RNA-Seq data to study the development of the sea cucumber Parastichopus parvimensis. Our corrected assembled transcripts shed new light on two important stages in sea cucumber development. Comparison of the assembled transcripts to known transcripts in other species has also revealed novel transcripts that are unique to sea cucumber, some of which we have experimentally validated. Supporting website: http://sb.cs.cmu.edu/seecer/.

  20. Rational design of avian metapneumovirus live attenuated vaccines by inhibiting viral messenger RNA cap methyltransferase

    Science.gov (United States)

    Avian metapneumovirus (aMPV), also known as avian pneumovirus or turkey rhinotracheitis, is a non-segmented negative-sense RNA virus belonging to the family of Paramyxoviridae, the subfamily Pneumovirinae, and the genus Metapneumovirus. aMPV is the causative agent of respiratory tract infection and ...

  1. INDUCTION OF INTERLEUKIN-1-BETA MESSENGER-RNA AFTER FOCAL CEREBRAL-ISCHEMIA IN THE RAT

    NARCIS (Netherlands)

    BUTTINI, M; SAUTER, A; BODDEKE, HWGM

    1994-01-01

    The expression of interleukin-1beta (IL-1beta) mRNA in the brain in response to cerebral ischaemia in rats was examined using in situ hybridization histochemistry. Focal cerebral ischaemia was induced in spontaneously hypertensive rats by permanent occlusion of the left middle cerebral artery (MCAO)

  2. Prolactin increases hepatic Na+/taurocholate co-transport activity and messenger RNA post partum.

    Science.gov (United States)

    Ganguly, T C; Liu, Y; Hyde, J F; Hagenbuch, B; Meier, P J; Vore, M

    1994-01-01

    We have shown that Na+/taurocholate co-transport activity is decreased in pregnancy, but rebounds post partum relative to non-pregnant controls, and that activity can be increased by treatment with ovine prolactin [Ganguly, Hyde and Vore (1993) J. Pharmacol. Exp. Ther. 267, 82-87]. To determine the basis for these effects, Na+/taurocholate co-transport was determined in purified basolateral liver plasma-membrane (bLPM) vesicles and compared with steady-state mRNA levels encoding the Na+/taurocholate-co-transporting polypeptide (Ntcp) in non-pregnant controls, pregnant rats (19-20 days pregnant), rats post partum (48 h post partum) and rats post partum treated with bromocriptine to inhibit prolactin secretion. Na+/taurocholate co-transport activity (nmol/5 s per mg of protein) in bLPM was decreased from 10.4 +/- 1.8 in non-pregnant controls to 7.9 +/- 0.6 in bLPM in pregnant rats, but rebounded to 17.5 +/- 1.3 post partum; treatment of rats post partum with bromocriptine to inhibit prolactin secretion decreased activity to 14.1 +/- 0.9. Northern and slot-blot analyses revealed similar changes in mRNA for Ntcp, so that a positive correlation was observed between Na+/taurocholate co-transport activity and Ntcp mRNA. Furthermore, treatment of ovariectomized rats with ovine prolactin increased Ntcp mRNA 10-fold compared with solvent-treated controls, consistent with the 2-fold increase in Vmax, for Na+/taurocholate co-transport in isolated hepatocytes. These data are the first to demonstrate endogenous physiological regulation by prolactin of Ntcp mRNA in parallel with Na+/taurocholate co-transport activity. Images Figure 2 PMID:7945260

  3. Detection and Quantification of N (6)-Methyladenosine in Messenger RNA by TLC.

    Science.gov (United States)

    Bodi, Zsuzsanna; Fray, Rupert G

    2017-01-01

    The base-modified nucleotide, N (6)-methyladenosine, is a relatively abundant modification found in the mRNA of most higher eukaryotes. Methylation levels can change dependent upon environmental conditions, cell differentiation state, or following knockdown of members of the methylase complex, and it is often useful to directly measure and compare N (6)-methyladenosine levels between samples. Two dimensional chromatography of radiolabeled nucleotides, following specific nuclease treatments, provides a robust, sensitive, and reproducible assay for this modification.

  4. The selective elimination of messenger RNA underlies the mitosis-meiosis switch in fission yeast.

    Science.gov (United States)

    Yamamoto, Masayuki

    2010-01-01

    The cellular programs for meiosis and mitosis must be strictly distinguished but the mechanisms controlling the entry to meiosis remain largely elusive in higher organisms. In contrast, recent analyses in yeast have shed new light on the mechanisms underlying the mitosis-meiosis switch. In this review, the current understanding of these mechanisms in the fission yeast Schizosaccharomyces pombe is discussed. Meiosis-inducing signals in this microbe emanating from environmental conditions including the nutrient status converge on the activity of an RRM-type RNA-binding protein, Mei2. This protein plays pivotal roles in both the induction and progression of meiosis and has now been found to govern the meiotic program in a quite unexpected manner. Fission yeast contains an RNA degradation system that selectively eliminates meiosis-specific mRNAs during the mitotic cell cycle. Mmi1, a novel RNA-binding protein of the YTH-family, is essential for this process. Mei2 tethers Mmi1 and thereby stabilizes the transcripts necessary for the progression of meiosis.

  5. Models for solid-state transport: messenger RNA movement from nucleus to cytoplasm.

    Science.gov (United States)

    Agutter, P S

    1994-09-01

    This paper explores the idea that mRNAs are transported between their transcription and processing sites in the nucleus, and their translation and degradation sites in the cytoplasm, by a 'solid-state' process. The underlying assumption is that negligible quantities of mRNA and of mRNA precursors are in solution in vivo. Therefore, mRNA transport cannot be considered as movement in the aqueous phase of the cell. The main lines of experimental evidence supporting this 'solid-state' concept are summarized and related controversies are outlined. Three possible models for a solid-state transport mechanism are discussed: a direct transfer model, with receptors organized analogously to the components of a multienzyme complex; a motor-driven model, analogous to synaptic vesicle transport in axons; and an assembly-driven model which assumes net movement along a fibril resulting from differential activities at the poles. Qualitative evaluation indicates that each of these models has characteristic advantages and disadvantages. The possibility that other nucleocytoplasmic transport processes might operate by solid-state mechanisms is briefly discussed.

  6. Characterization of human endothelial cell urokinase-type plasminogen activator receptor protein and messenger RNA

    DEFF Research Database (Denmark)

    Barnathan, E S; Kuo, Alan; Kariko, K

    1990-01-01

    of a single 1.4-kilobase (Kb) mRNA transcript on Northern blot analysis predict an unglycosylated receptor protein of approximately 35 Kd. Third, synthesis of 35S-labeled 46-Kd cell surface receptor protein was inhibited when the cells were grown in the presence of tunicamycin, while the synthesis of the 36....... First, a polyclonal antibody against u-PA receptor isolated from phorbol myristate acetate (PMA) stimulated U-937 cells reacted with both the 36- and 46-Kd proteins on Western blotting. Second, the size of the unmodified receptor was estimated by amplifying a full-length cDNA for u-PA receptor from...

  7. Messenger RNA expression of chicken CLOCK gene in the response to Campylobacter jejuni inoculation.

    Science.gov (United States)

    Liu, Xiaoyi; Liu, Liying; Zhang, Maozhi; Yang, Ning; Qi, Yukai; Sun, Yu; Li, Xianyao

    2015-09-01

    Campylobacter jejuni (C. jejuni) is a leading cause of human bacterial gastroenteritis worldwide. Previous research has shown that circadian rhythm plays a critical role in host response to C. jejuni colonization. The CLOCK gene is one of the core genes regulating circadian rhythms and shows significant expression on 7 d post-C. jejuni inoculation. The objective of this study was to investigate temporal and spatial expression of chicken CLOCK gene post-C. jejuni inoculation. Cecal and splenic RNA were isolated from 2 distinct chicken breeds and used to compare the mRNA expression of CLOCK gene between inoculated and noninoculated chickens within each breed and between breeds within each of inoculated and noninoculated groups. Our results showed that the CLOCK gene was significantly down-regulated at 20 h postinoculation (hpi) in cecum and spleen in Jiningbairi chicken. CLOCK gene was significantly down-regulated at 4 and 16 hpi and up-regulated at 8 hpi in cecum and spleen in specific pathogen free white leghorn noninoculated chicken. The findings suggested that expression of CLOCK gene was significantly changed post C. jejuin inoculation. This change was affected by genetic background, tissue, and time points postinoculation. © 2015 Poultry Science Association Inc.

  8. A POSSIBLE CONTRIBUTION OF MESSENGER-RNA SECONDARY STRUCTURE TO TRANSLATION INITIATION EFFICIENCY IN LACTOCOCCUS-LACTIS

    NARCIS (Netherlands)

    VANDEGUCHTE, M; VANDERLENDE, T; KOK, J; VENEMA, G

    1991-01-01

    Gene expression signals derived from Lactococcus lactis were linked to lacZ-fused genes with different 5'-nucleotide sequences. Computer predictions of mRNA secondary structure were combined with lacZ expression studies to direct base-substitutions that could possibly influence gene expression. Muta

  9. Skeletal muscle microRNA and messenger RNA profiling in cofilin-2 deficient mice reveals cell cycle dysregulation hindering muscle regeneration.

    Directory of Open Access Journals (Sweden)

    Sarah U Morton

    Full Text Available Congenital myopathies are rare skeletal muscle diseases presenting in early age with hypotonia and weakness often linked to a genetic defect. Mutations in the gene for cofilin-2 (CFL2 have been identified in several families as a cause of congenital myopathy with nemaline bodies and cores. Here we explore the global messenger and microRNA expression patterns in quadriceps muscle samples from cofillin-2-null mice and compare them with sibling-matched wild-type mice to determine the molecular pathways and mechanisms involved. Cell cycle processes are markedly dysregulated, with altered expression of genes involved in mitotic spindle formation, and evidence of loss of cell cycle checkpoint regulation. Importantly, alterations in cell cycle, apoptosis and proliferation pathways are present in both mRNA and miRNA expression patterns. Specifically, p21 transcript levels were increased, and the expression of p21 targets, such as cyclin D and cyclin E, was decreased. We therefore hypothesize that deficiency of cofilin-2 is associated with interruption of the cell cycle at several checkpoints, hindering muscle regeneration. Identification of these pathways is an important step towards developing appropriate therapies against various congenital myopathies.

  10. Addition of polyadenylate sequences to virus-specific RNA during adenovirus replication.

    Science.gov (United States)

    Philipson, L; Wall, R; Glickman, G; Darnell, J E

    1971-11-01

    Adenovirus-specific nuclear and polysomal RNA, both early and late in the infectious cycle, contain a covalently linked region of polyadenylic acid 150-250 nucleotides long. A large proportion of the adenovirus-specific messenger RNA contains poly(A). As revealed by hybridization experiments, the poly(A) is not transcribed from adenovirus DNA. Furthermore, an adenosine analogue, cordycepin, blocks the synthesis of poly(A) and also inhibits the accumulation of adenovirus messenger RNA on polysomes. Addition of poly(A) to viral RNA may involve a host-controlled mechanism that regulates the processing and transport of messenger RNA.

  11. Electrochemical branched-DNA assay for polymerase chain reaction-free detection and quantification of oncogenes in messenger RNA.

    Science.gov (United States)

    Lee, Ai-Cheng; Dai, Ziyu; Chen, Baowei; Wu, Hong; Wang, Jun; Zhang, Aiguo; Zhang, Lurong; Lim, Tit-Meng; Lin, Yuehe

    2008-12-15

    We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcripts in the population of messenger ribonucleic acid (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify the target signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-naphthyl phosphate. The voltammetric characteristics of substrate and enzymatic product as well as the parameters of SWV analysis were systematically optimized. A detection limit of 1 fM (1 x 10(-19) mol of target transcripts in 100 microL) and a 3-order-wide dynamic range of target concentration were achieved by the electrochemical bDNA assay. Such limit corresponded to approximately 17 fg of the p185 BCR-ABL fusion transcripts. The specificity and sensitivity of assay enabled direct detection of target transcripts in as little as 4.6 ng of mRNA population without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcripts in mRNA population. A mean transcript copy number of 62,900/ng of mRNA was determined, which was at least 50-fold higher than that of real-time quantitative PCR (qPCR). The finding was consistent with the underestimation of targets by qPCR reported earlier. In addition, the unique design based on bDNA technology increases the assay specificity as only the p185 BCR-ABL fusion transcripts will respond to the detection. The approach thus provides a simple, sensitive, accurate, and quantitative tool alternative to the qPCR for early disease diagnosis.

  12. Leishmania pifanoi: kinetics of messenger RNA expression during amastigote to promastigote transformation in vitro.

    Science.gov (United States)

    Campbell, S M; Rainey, P M

    1993-08-01

    Conditions have been developed which induce axenically grown Leishmania pifanoi amastigotes to transform into the promastigote stage in a highly reproducible fashion. Transformation was induced by a temperature shift from 31 to 22 degrees C, was inhibited by high cell concentration (> or = 40 x 10(6) cells/ml), and was unaffected by pH from 5.5-7.2. Morphologic transformation was first evident at 8 hr after induction, had occurred in > 50% of cells by 24 hr, and was > 90% complete by 48 hr. This system enabled study of the kinetics of mRNA expression during the transformation of Leishmania. The differentially expressed mRNAs for ATPase 1a and 1b, alpha- and beta-tubulin, P100/11E, Pro-1, and pLm 2, 7, 14, and 16 exhibited complex patterns of temporal expression, suggesting a highly regulated process. Differentiation on the biochemical level was evident within an hour and continued throughout the course of morphologic transformation. In addition, transformed L. pifanoi promastigotes in the plateau growth phase expressed genes characteristic of metacyclic promastigotes. Axenically cultured L. pifanoi should provide an excellent model for the study of differentiation in Leishmania.

  13. Compensatory evolution of a precursor messenger RNA secondary structure in the Drosophila melanogaster Adh gene

    Science.gov (United States)

    Chen, Ying; Stephan, Wolfgang

    2003-01-01

    Evidence for the evolutionary maintenance of a hairpin structure possibly involved in intron processing had been found in intron 1 of the alcohol dehydrogenase gene (Adh) in diverse Drosophila species. In this study, the putative hairpin structure was evaluated systematically in Drosophila melanogaster by elimination of either side of the stem using site-directed mutagenesis. The effects of these mutations and the compensatory double mutant on intron splicing efficiency and ADH protein production were assayed in Drosophila melanogaster Schneider L2 cells and germ-line transformed adult flies. Mutations that disrupt the putative hairpin structure right upstream of the intron branch point were found to cause a significant reduction in both splicing efficiency and ADH protein production. In contrast, the compensatory double mutant that restores the putative hairpin structure was indistinguishable from the WT in both splicing efficiency and ADH level. It was also observed by mutational analysis that a more stable secondary structure (with a longer stem) in this intron decreases both splicing efficiency and ADH protein production. Implications for RNA secondary structure and intron evolution are discussed. PMID:12972637

  14. Culture temperature affects human chondrocyte messenger RNA expression in monolayer and pellet culture systems.

    Directory of Open Access Journals (Sweden)

    Akira Ito

    Full Text Available Cell-based therapy has been explored for articular cartilage regeneration. Autologous chondrocyte implantation is a promising cell-based technique for repairing articular cartilage defects. However, there are several issues such as chondrocyte de-differentiation. While numerous studies have been designed to overcome some of these issues, only a few have focused on the thermal environment that can affect chondrocyte metabolism and phenotype. In this study, the effects of different culture temperatures on human chondrocyte metabolism- and phenotype-related gene expression were investigated in 2D and 3D environments. Human chondrocytes were cultured in a monolayer or in a pellet culture system at three different culture temperatures (32°C, 37°C, and 41°C for 3 days. The results showed that the total RNA level, normalized to the threshold cycle value of internal reference genes, was higher at lower temperatures in both culture systems. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH and citrate synthase (CS, which are involved in glycolysis and the citric acid cycle, respectively, were expressed at similar levels at 32°C and 37°C in pellet cultures, but the levels were significantly lower at 41°C. Expression of the chondrogenic markers, collagen type IIA1 (COL2A1 and aggrecan (ACAN, was higher at 37°C than at 32°C and 41°C in both culture systems. However, this phenomenon did not coincide with SRY (sex-determining region Y-box 9 (SOX9, which is a fundamental transcription factor for chondrogenesis, indicating that a SOX9-independent pathway might be involved in this phenomenon. In conclusion, the expression of chondrocyte metabolism-related genes at 32°C was maintained or enhanced compared to that at 37°C. However, chondrogenesis-related genes were further induced at 37°C in both culture systems. Therefore, manipulating the culture temperature may be an advantageous approach for regulating human chondrocyte metabolic activity and

  15. Ribosomal protein S7 from Escherichia coli uses the same determinants to bind 16S ribosomal RNA and its messenger RNA.

    Science.gov (United States)

    Robert, F; Brakier-Gingras, L

    2001-02-01

    Ribosomal protein S7 from Escherichia coli binds to the lower half of the 3' major domain of 16S rRNA and initiates its folding. It also binds to its own mRNA, the str mRNA, and represses its translation. Using filter binding assays, we show in this study that the same mutations that interfere with S7 binding to 16S rRNA also weaken its affinity for its mRNA. This suggests that the same protein regions are responsible for mRNA and rRNA binding affinities, and that S7 recognizes identical sequence elements within the two RNA targets, although they have dissimilar secondary structures. Overexpression of S7 is known to inhibit bacterial growth. This phenotypic growth defect was relieved in cells overexpressing S7 mutants that bind poorly the str mRNA, confirming that growth impairment is controlled by the binding of S7 to its mRNA. Interestingly, a mutant with a short deletion at the C-terminus of S7 was more detrimental to cell growth than wild-type S7. This suggests that the C-terminal portion of S7 plays an important role in ribosome function, which is perturbed by the deletion.

  16. Nuclear transfer protocol affects messenger RNA expression patterns in cloned bovine blastocysts.

    Science.gov (United States)

    Wrenzycki, C; Wells, D; Herrmann, D; Miller, A; Oliver, J; Tervit, R; Niemann, H

    2001-07-01

    The successful production of embryos by nuclear transfer (NT) employing cultured somatic donor cells depends upon a variety of factors. The objective of the present study was to investigate the effects 1) of two different activation protocols, 2) the use of quiescent or nonquiescent donor cells (G(0) or G(1) of the cell cycle), and 3) passage number of donor cells on the relative abundance (RA) of eight specific mRNAs (DNA methyltransferase, DNMT; mammalian achaete-scute homologue, Mash2; glucose transporter-1, Glut-1; heat shock protein 70.1, Hsp; desmocollin II, Dc II; E-cadherin, E-cad; interferon tau, IF; insulin-like growth factor 2 receptor, Igf2r) in single blastocysts employing a semiquantitative reverse transcription-polymerase chain reaction assay. The results were compared with those for their in vitro (IVP)- and in vivo-generated noncloned counterparts. In experiment 1, employing either FBA (fusion before activation) or AFS (fusion and activation simultaneously) to generate NT blastocysts, Hsp mRNAs were not found in NT embryos from either protocol, whereas Hsp transcripts were detectable in IVP embryos. The relative abundance (RA) of IF transcripts was significantly increased in the AFS and IVP groups compared to the FBA treatment. In experiment 2, the use of either G(0) or G(1) donor cells to produce cloned embryos both significantly reduced the relative amount of DNMT transcripts and significantly increased the RA of Mash2 compared to the IVP embryos. In addition, IF transcript levels were significantly elevated in NT blastocysts employing G(1) donor cells for NT compared to IVP embryos and those generated using G(0) cells. In experiment 3, donor cells, either from passsage 5/6 or 8, were employed for NT. DNMT transcripts were significantly decreased, whereas Mash2 transcripts were significantly increased in both NT groups compared to their IVP counterparts. The amount of IF mRNA was significantly higher in P8-derived than in P5/6 and IVP embryos. In

  17. Short RNA indicator sequences are not completely degraded by autoclaving

    Science.gov (United States)

    Unnithan, Veena V.; Unc, Adrian; Joe, Valerisa; Smith, Geoffrey B.

    2014-01-01

    Short indicator RNA sequences (autoclaving and are recovered intact by molecular amplification. Primers targeting longer sequences are most likely to produce false positives due to amplification errors easily verified by melting curves analyses. If short indicator RNA sequences are used for virus identification and quantification then post autoclave RNA degradation methodology should be employed, which may include further autoclaving. PMID:24518856

  18. Bisphenol S alters embryonic viability, development, gallbladder size, and messenger RNA expression in chicken embryos exposed via egg injection.

    Science.gov (United States)

    Crump, Doug; Chiu, Suzanne; Williams, Kim L

    2016-06-01

    Amid concerns about the toxicological effects and environmental prevalence of bisphenol A (BPA), efforts to find suitable, safer replacement alternatives are essential. Bisphenol S (BPS) is a potential chemical substitute for BPA; however, few studies are available confirming that it has a more desirable ecotoxicological profile. In the present study, BPS was injected into the air cell of unincubated, fertilized chicken embryos at 6 concentrations ranging from 0 μg/g to 207 μg/g egg to determine effects on pipping success, development, hepatic messenger ribonucleic acid (mRNA) expression, thyroid hormone levels, and circulating bile acid concentrations. Concentrations of BPS increased in a dose-dependent manner in whole-embryo homogenates, and exposure to the highest dose, 207 μg/g, resulted in decreased pipping success (estimated median lethal dose  = 279 μg/g; 95% confidence interval = 161-486 μg/g). Exposure to BPS also reduced growth metrics including embryo mass and tarsus length, whereas the most pronounced phenotypic effect was the concentration-dependent, significant increase in gallbladder size at concentrations ≥52.8 μg/g. These adverse phenotypic outcomes were associated with the modulation of gene targets from a chicken ToxChip polymerase chain reaction array, which are involved with xenobiotic metabolism, lipid homeostasis, bile acid synthesis, and the thyroid hormone pathway. Expression levels of 2 estrogen-responsive genes, apolipoprotein II and vitellogenin, were too low at the sampling time point assessed (i.e., pipping embryos) to quantify changes, and no effects were observed on circulating free thyroxine or bile acid concentrations. The present study provides novel, whole-animal toxicological data for a BPA replacement alternative that is not well characterized. Environ Toxicol Chem 2016;35:1541-1549. © 2015 SETAC.

  19. Plant serine/arginine-rich proteins: roles in precursor messenger RNA splicing, plant development, and stress responses.

    Science.gov (United States)

    Reddy, Anireddy S N; Shad Ali, Gul

    2011-01-01

    Global analyses of splicing of precursor messenger RNAs (pre-mRNAs) have revealed that alternative splicing (AS) is highly pervasive in plants. Despite the widespread occurrence of AS in plants, the mechanisms that control splicing and the roles of splice variants generated from a gene are poorly understood. Studies on plant serine/arginine-rich (SR) proteins, a family of highly conserved proteins, suggest their role in both constitutive splicing and AS of pre-mRNAs. SR proteins have a characteristic domain structure consisting of one or two RNA recognition motifs at the N-terminus and a C-terminal RS domain rich in arginine/serine dipeptides. Plants have many more SR proteins compared to animals including several plant-specific subfamilies. Pre-mRNAs of plant SR proteins are extensively alternatively spliced to increase the transcript complexity by about six-fold. Some of this AS is controlled in a tissue- and development-specific manner. Furthermore, AS of SR pre-mRNAs is altered by various stresses, raising the possibility of rapid reprogramming of the whole transcriptome by external signals through regulation of the splicing of these master regulators of splicing. Most SR splice variants contain a premature termination codon and are degraded by up-frameshift 3 (UPF3)-mediated nonsense-mediated decay (NMD), suggesting a link between NMD and regulation of expression of the functional transcripts of SR proteins. Limited functional studies with plant SRs suggest key roles in growth and development and plant responses to the environment. Here, we discuss the current status of research on plant SRs and some promising approaches to address many unanswered questions about plant SRs.

  20. Targeted Mutagenesis in Plant Cells through Transformation of Sequence-Specific Nuclease mRNA.

    Directory of Open Access Journals (Sweden)

    Thomas J Stoddard

    Full Text Available Plant genome engineering using sequence-specific nucleases (SSNs promises to advance basic and applied plant research by enabling precise modification of endogenous genes. Whereas DNA is an effective means for delivering SSNs, DNA can integrate randomly into the plant genome, leading to unintentional gene inactivation. Further, prolonged expression of SSNs from DNA constructs can lead to the accumulation of off-target mutations. Here, we tested a new approach for SSN delivery to plant cells, namely transformation of messenger RNA (mRNA encoding TAL effector nucleases (TALENs. mRNA delivery of a TALEN pair targeting the Nicotiana benthamiana ALS gene resulted in mutation frequencies of approximately 6% in comparison to DNA delivery, which resulted in mutation frequencies of 70.5%. mRNA delivery resulted in three-fold fewer insertions, and 76% were 10bp. In an effort to increase mutation frequencies using mRNA, we fused several different 5' and 3' untranslated regions (UTRs from Arabidopsis thaliana genes to the TALEN coding sequence. UTRs from an A. thaliana adenine nucleotide α hydrolases-like gene (At1G09740 enhanced mutation frequencies approximately two-fold, relative to a no-UTR control. These results indicate that mRNA can be used as a delivery vehicle for SSNs, and that manipulation of mRNA UTRs can influence efficiencies of genome editing.

  1. 5'-heterogeneity of glucocorticoid receptor messenger RNA is tissue specific: differential regulation of variant transcripts by early-life events.

    Science.gov (United States)

    McCormick, J A; Lyons, V; Jacobson, M D; Noble, J; Diorio, J; Nyirenda, M; Weaver, S; Ester, W; Yau, J L; Meaney, M J; Seckl, J R; Chapman, K E

    2000-04-01

    Glucocorticoid receptor (GR) gene expression is regulated in a complex tissue-specific manner, notably by early-life environmental events that program tissue GR levels. We have identified and characterized several new rat GR mRNAs. All encode a common protein, but differ in their 5'-leader sequences as a consequence of alternate splicing of, potentially, 11 different exon 1 sequences. Most are located in a 3-kb CpG island, upstream of exon 2, that exhibits substantial promoter activity in transfected cells. Ribonuclease (RNase) protection analysis demonstrated significant levels of six alternate exons 1 in vivo in rat, with differences between liver, hippocampus, and thymus reflecting tissue-specific differences in promoter activity. Two of the alternate exons 1 (exons 1(6) and 1(10)) were expressed in all tissues examined, together present in 77-87% of total GR mRNA. The remaining GR transcripts contained tissue-specific alternate first exons. Importantly, tissue-specific first exon usage was altered by perinatal environmental manipulations. Postnatal handling, which permanently increases GR in the hippocampus, causing attenuation of stress responses, selectively elevated GR mRNA containing the hippocampus-specific exon 1(7). Prenatal glucocorticoid exposure, which increases hepatic GR expression and produces adult hyperglycemia, decreased the proportion of hepatic GR mRNA containing the predominant exon 1(10), suggesting an increase in a minor exon 1 variant. Such tissue specificity of promoter usage allows differential GR regulation and programming.

  2. A telescope for the RNA universe : novel bioinformatic approaches to analyze RNA sequencing data

    NARCIS (Netherlands)

    Pulyakhina, Irina

    2016-01-01

    In this thesis I focus on the application of bioinformatics to analyze RNA. The type of experimental data of interest is sequencing data generated with various Next Generation Sequencing technique: nuclear RNA, cytoplasmic RNA, captured polyadenylated RNA fragments, etc. I highlight the necessity in

  3. In vitro Study of a Novel Stent Coating Using Modified CD39 Messenger RNA to Potentially Reduce Stent Angioplasty-Associated Complications.

    Directory of Open Access Journals (Sweden)

    Meike-Kristin Abraham

    Full Text Available Stent angioplasty provides a minimally invasive treatment for atherosclerotic vessels. However, no treatment option for atherosclerosis-associated endothelial dysfunction, which is accompanied by a loss of CD39, is available, and hence, adverse effects like thromboembolism and restenosis may occur. Messenger RNA (mRNA-based therapy represents a novel strategy, whereby de novo synthesis of a desired protein is achieved after delivery of a modified mRNA to the target cells.Our study aimed to develop an innovative bioactive stent coating that induces overexpression of CD39 in the atherosclerotic vessel. Therefore, a modified CD39-encoding mRNA was produced by in vitro transcription. Different endothelial cells (ECs were transfected with the mRNA, and CD39 expression and functionality were analyzed using various assays. Furthermore, CD39 mRNA was immobilized using poly(lactic-co-glycolic-acid (PLGA, and the transfection efficiency in ECs was analyzed. Our data show that ECs successfully translate in vitro-generated CD39 mRNA after transfection. The overexpressed CD39 protein is highly functional in hydrolyzing ADP and in preventing platelet activation. Furthermore, PLGA-immobilized CD39 mRNA can be delivered to ECs without losing its functionality.In summary, we present a novel and promising concept for a stent coating for the treatment of atherosclerotic blood vessels, whereby patients could be protected against angioplasty-associated complications.

  4. The DEAD-box RNA helicase DDX3 associates with export messenger ribonucleoproteins as well as tip-associated protein and participates in translational control.

    Science.gov (United States)

    Lai, Ming-Chih; Lee, Yan-Hwa Wu; Tarn, Woan-Yuh

    2008-09-01

    Nuclear export of mRNA is tightly linked to transcription, nuclear mRNA processing, and subsequent maturation in the cytoplasm. Tip-associated protein (TAP) is the major nuclear mRNA export receptor, and it acts coordinately with various factors involved in mRNA expression. We screened for protein factors that associate with TAP and identified several candidates, including RNA helicase DDX3. We demonstrate that DDX3 directly interacts with TAP and that its association with TAP as well as mRNA ribonucleoprotein complexes may occur in the nucleus. Depletion of TAP resulted in nuclear accumulation of DDX3, suggesting that DDX3 is, at least in part, exported along with messenger ribonucleoproteins to the cytoplasm via the TAP-mediated pathway. Moreover, the observation that DDX3 localizes transiently in cytoplasmic stress granules under cell stress conditions suggests a role for DDX3 in translational control. Indeed, DDX3 associates with translation initiation complexes. However, DDX3 is probably not critical for general mRNA translation but may instead promote efficient translation of mRNAs containing a long or structured 5' untranslated region. Given that the DDX3 RNA helicase activity is essential for its involvement in translation, we suggest that DDX3 facilitates translation by resolving secondary structures of the 5'-untranslated region in mRNAs during ribosome scanning.

  5. Delivery of messenger RNA using poly(ethylene imine)-poly(ethylene glycol)-copolymer blends for polyplex formation: biophysical characterization and in vitro transfection properties.

    Science.gov (United States)

    Debus, Heiko; Baumhof, Patrick; Probst, Jochen; Kissel, Thomas

    2010-12-20

    Nucleic acid based therapies have so far mainly been focused on plasmid DNA (pDNA), small interfering RNA (siRNA), antisense and immunostimulatory oligonucleotides. Messenger RNA (mRNA) was the subject of only a few studies. The objective of this investigation was the preparation of new composite polyplexes with mRNA consisting of poly(ethylene imine) (PEI) and poly(ethylene imine)-poly(ethylene glycol)-copolymers (PEI-PEG) as blends. These complexes were designed to increase the stability of mRNA, to improve transfection efficiency and to reduce cytotoxicity. Hydrodynamic diameters of the polyplexes were measured by dynamic light scattering, polyplex stability was analyzed by gel retardation assay and transfection efficiency of luciferase (Luc) encoding mRNA was evaluated under in vitro conditions. Most of the polyplexes generated showed small particle sizes application of mRNA merit further investigation under in vitro and in vivo conditions. Copyright © 2010 Elsevier B.V. All rights reserved.

  6. Depletion of Ribosomal RNA Sequences from Single-Cell RNA-Sequencing Library.

    Science.gov (United States)

    Fang, Nan; Akinci-Tolun, Rumeysa

    2016-07-01

    Recent advances in single-cell RNA sequencing technologies have revealed high heterogeneity of gene expression profiles in individual cells. However, most current single-cell RNA-seq methods use oligo-dT priming in the reverse transcription steps and detect only polyA-positive for more accuracy, since there are also polyA-positive non-coding RNAs transcripts, not other important RNA species, such as polyA-negative noncoding RNA. Reverse transcription using random oligos enables detection of not only the noncoding RNA species without polyA tails, but also ribosomal RNA (rRNA). rRNA comprises more than 90% of the total RNA and should be depleted from the RNA-seq library to ensure efficient usage of the sequencing capacity. Commonly used hybridization-based rRNA depletion methods can preserve noncoding RNA in the standard RNA-seq library. However, such rRNA depletion methods require high input amounts of total RNA and do not work at the single-cell level or with limited input DNA. This unit describes a novel procedure for RNA-seq library construction from single cells or a minimal amount of RNA. A thermostable duplex-specific nuclease is used in this method to effectively remove ribosomal RNA sequences following whole-transcriptome amplification and sequencing library construction. © 2016 by John Wiley & Sons, Inc.

  7. Approaching marine bioprospecting in hexacorals by RNA deep sequencing.

    Science.gov (United States)

    Johansen, Steinar D; Emblem, Ase; Karlsen, Bård Ove; Okkenhaug, Siri; Hansen, Hilde; Moum, Truls; Coucheron, Dag H; Seternes, Ole Morten

    2010-07-31

    RNA deep sequencing represents a new complementary approach in marine bioprospecting. Next-generation sequencing platforms have recently been developed for de novo whole transcriptome analysis, small RNA discovery and gene expression profiling. Deep sequencing transcriptomics (sequencing the complete set of cellular transcripts at a specific stage or condition) leads to sequential identification of all expressed genes in a sample. When combined to high-throughput bioinformatics and protein synthesis, RNA deep sequencing represents a new powerful approach in gene product discovery and bioprospecting. Here we summarize recent progress in the analyses of hexacoral transcriptomes with the focus on cold-water sea anemones and related organisms.

  8. Differential effect of functional olfactory bulb deafferentation on tyrosine hydroxylase and glutamic acid decarboxylase messenger RNA levels in rodent juxtaglomerular neurons.

    Science.gov (United States)

    Stone, D M; Grillo, M; Margolis, F L; Joh, T H; Baker, H

    1991-09-08

    Expression of the dopaminergic phenotype in olfactory bulb (OB) juxtaglomerular neurons (constituting a population of periglomerular and external tufted cells) is dependent upon functional innervation by peripheral olfactory receptors. Loss of functional input in rodents, by either peripheral deafferentation or deprivation of odorant access, results in a profound decrease in the expression of juxtaglomerular tyrosine hydroxylase (TH). We have examined the effects of such treatments on the expression of the neurotransmitter biosynthetic enzyme glutamic acid decarboxylase (GAD), which is colocalized with TH in the majority of TH-containing juxtaglomerular neurons. Following either chemically induced OB deafferentation in adult mice or unilateral odor deprivation in neonatal rats, steady-state OB GAD messenger RNA levels remained essentially unchanged as assessed by Northern blot analysis 20-40 days after treatment. These results were confirmed by in situ hybridization analysis, which demonstrated a profound loss of juxtaglomerular TH messenger RNA but no accompanying decrease in regionally colocalized GAD message. Since GAD is found in nearly all dopaminergic OB cells, the preservation of juxtaglomerular GAD message implies that olfactory receptor neurons exert a differential transneuronal regulation of TH and GAD gene transcription.

  9. Role of Dopaminergic D2 Receptors in the Regulation of Glutamic Acid Decarboxylase Messenger RNA in the Striatum of the Rat.

    Science.gov (United States)

    Caboche, Jocelyne; Vernier, Philippe; Rogard, Monique; Julien, Jean-François; Mallet, Jacques; Besson, Marie-Jo

    1992-01-01

    Levels of messenger RNA (mRNA) encoding glutamic acid decarboxylase (GAD) and preproenkephalin (PPE) were measured by Northern blot and in situ hybridization analyses in the striatum of the rat, after chronic injections of two neuroleptics, sulpiride and haloperidol. The Northern blot analysis showed that the chronic injection of sulpiride at high doses (80 mg/kg, twice a day, 14 days) increased striatal GAD and PPE mRNA levels by 120% and 78% respectively, when compared to vehicle-injected rats. Haloperidol injections at relatively low doses (1 mg/kg, once a day, 14 days) produced parallel increases in GAD (40%) and PPE (52%) mRNA levels. After in situ hybridization densitometric measurements were performed on autoradiograms from rats treated with sulpiride, haloperidol or vehicle. The distribution of GAD and PPE mRNA signals in control rats was homogeneous along the rostrocaudal extension of the striatum. A similar increase was found along this axis after sulpiride (20%) and haloperidol (30%) treatments. The cellular observation of hybridization signals showed that grain density for GAD mRNA was increased in a majority of striatal cells after both treatments. By contrast, the PPE mRNA hybridization signal only increased in a subpopulation of neurons. The effects of such treatments were also analysed by measuring GAD activity in the striatum and in its output structures, the globus pallidus and the substantia nigra. After the administration of sulpiride, GAD activity was not modified in the striatum but increased in the globus pallidus (by 17%). After haloperidol treatment, GAD activity was increased in the globus pallidus (20%) and the substantia nigra (17%). It is concluded that the interruption of dopaminergic transmission, more precisely the D2 receptor blockade, promotes in striatopallidal neurons an increase in GAD mRNA accompanied by an increase in GAD activity and PPE mRNA. A possible regulation of GAD mRNA and GAD activity in striatonigral neurons is also

  10. Involvement of second messengers in the signaling pathway of vitellogenesis-inhibiting hormone and their effects on vitellogenin mRNA expression in the whiteleg shrimp, Litopenaeus vannamei.

    Science.gov (United States)

    Bae, Sun-Hye; Okutsu, Tomoyuki; Tsutsui, Naoaki; Kang, Bong Jung; Chen, Hsiang-Yin; Wilder, Marcy N

    2017-05-15

    We incubated fragments of Litopenaeus vannamei ovary to investigate second messengers involved in the regulation of vitellogenin (vg) mRNA levels. The use of 100nM recombinant vitellogenesis-inhibiting hormone (VIH) (corresponding to recombinant L. vannamei sinus gland peptide-G: rLiv-SGP-G) significantly reduced vg mRNA expression in sub-adults after 8h incubation to less than 20% of the control. The concentration of intracellular cyclic guanosine monophosphate (cGMP) increased 3.2-fold relative to the control after 2h incubation with rLiv-SGP-G. However, it reached levels 18-fold relative to the control after 0.5h incubation with rLiv-SGP-G where 3-isobutyl-1-methylxanthine (a phosphodiesterase inhibitor) was also added. Moreover, vg mRNA expression was significantly reduced to less than 50% of the control after 24h incubation with 1μM A23187 (a calcium ionophore). Thus, rLiv-SGP-G and calcium ionophore reduced vg mRNA expression in in vitro-cultured ovary, and cGMP may be involved in the signaling pathway of VIH. Overall, the above results suggest that vg mRNA expression might be inhibited in vitro by increasing intracellular cGMP and Ca(2+) in L. vannamei ovary. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Consequence of nigrostriatal denervation and L-dopa therapy on the expression of glutamic acid decarboxylase messenger RNA in the pallidum.

    Science.gov (United States)

    Herrero, M T; Levy, R; Ruberg, M; Luquin, M R; Villares, J; Guillen, J; Faucheux, B; Javoy-Agid, F; Guridi, J; Agid, Y; Obeso, J A; Hirsch, E C

    1996-07-01

    To examine the consequences of nigrostriatal denervation and L-dopa treatment on the basal ganglia output system, we analyzed, by quantitative in situ hybridization, the messenger RNA coding for glutamic acid decarboxylase (Mr 67,000) (GAD67 mRNA) in pallidal cells from patients with Parkinson's disease (PD), monkeys rendered parkinsonian by 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) receiving or not receiving L-dopa, and their respective control subjects. In MPTP-treated monkeys, the expression of GAD67 mRNA was increased in cells from the internal pallidum, and this effect was abolished by L-dopa treatment. There were no differences in the levels of GAD67 mRNA between patients with PD, who were all treated with L-dopa, and control subjects. These results indicate that the level of GAD67 mRNA is increased in the cells of the internal pallidum after nigrostriatal dopaminergic denervation and that this increase can be reversed by L-dopa therapy.

  12. Finding Common Sequence and Structure Motifs in a set of RNA sequences

    DEFF Research Database (Denmark)

    Gorodkin, Jan; Heyer, Laurie J.; Stormo, Gary D.

    1997-01-01

    We present a computational scheme to search for the most common motif, composed of a combination of sequence and structure constraints, among a collection of RNA sequences. The method uses a simplified version of the Sankoff algorithm for simultaneous folding and alignment of RNA sequences...

  13. Alternative messenger RNA splicing of autophagic gene Beclin 1 in human B-cell acute lymphoblastic leukemia cells.

    Science.gov (United States)

    Niu, Yu-Na; Liu, Qing-Qing; Zhang, Su-Ping; Yuan, Na; Cao, Yan; Cai, Jin-Yang; Lin, Wei-Wei; Xu, Fei; Wang, Zhi-Jian; Chen, Bo; Wang, Jian-Rong

    2014-01-01

    Beclin 1 is a key factor for initiation and regulation of autophagy, which is a cellular catabolic process involved in tumorigenesis. To investigate the role of alternative splicing of Beclin1 in the regulation of autophagy in leukemia cells, Beclin1 mRNA from 6 different types of cell lines and peripheral blood mononuclear cells from 2 healthy volunteers was reversely transcribed, subcloned, and screened for alternative splicing. New transcript variants were analyzed by DNA sequencing. A transcript variant of Beclin 1 gene carrying a deletion of exon 11, which encoded a C-terminal truncation of Beclin 1 isoform, was found. The alternative isoform was assessed by bioinformatics, immunoblotting and subcellular localization. The results showed that this variable transcript is generated by alternative 3' splicing, and its translational product displayed a reduced activity in induction of autophagy by starvation, indicating that the spliced isoform might function as a dominant negative modulator of autophagy. Our findings suggest that the alternative splicing of Beclin 1 might play important roles in leukemogenesis regulated by autophagy.

  14. Comparative Diagnosis of Human Bocavirus 1 Respiratory Infection With Messenger RNA Reverse-Transcription Polymerase Chain Reaction (PCR), DNA Quantitative PCR, and Serology.

    Science.gov (United States)

    Xu, Man; Arku, Benedict; Jartti, Tuomas; Koskinen, Janne; Peltola, Ville; Hedman, Klaus; Söderlund-Venermo, Maria

    2017-05-15

    Human bocavirus (HBoV) 1 can cause life-threatening respiratory tract infection in children. Diagnosing acute HBoV1 infection is challenging owing to long-term airway persistence. We assessed whether messenger RNA (mRNA) detection would correlate better than DNA detection with acute HBoV1 infection. Paired serum samples from 121 children with acute wheezing were analyzed by means of serology. Quantitative polymerase chain reaction (PCR) and reverse-transcription (RT) PCR were applied to nasopharyngeal swab (NPS) samples from all acutely HBoV1-infected children and from controls with nonacute infection. By serology, 16 of 121 children (13.2%) had acute HBoV1 infection, all of whom had HBoV1 DNA in NPS samples, and 12 of 16 (75%) had HBoV1 mRNA. Among 25 children with nondiagnostic results, 6 had HBoV1 DNA in NPS samples, and 1 had mRNA. All 13 mRNA-positive samples exhibited high DNA loads (≥106 copies/mL). No mRNA persisted for 2 weeks, whereas HBoV1 DNA persisted for 2 months in 4 children; 1 year later all 15 samples were DNA negative. Compared with serology, DNA PCR had high clinical sensitivity (100%) but, because of viral persistence, low specificity (76%). In contrast, mRNA RT-PCR had low clinical sensitivity (75%) but high specificity (96%). A combination of HBoV1 serology and nasopharyngeal DNA quantitative PCR and mRNA RT-PCR should be used for accurate diagnosis of HBoV1 infection.

  15. DSAP: deep-sequencing small RNA analysis pipeline.

    Science.gov (United States)

    Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus

    2010-07-01

    DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (http://rfam.sanger.ac.uk/); and (iv) known miRNA matching: detection of known miRNAs in miRBase (http://www.mirbase.org/) based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at http://dsap.cgu.edu.tw.

  16. Mutation of miRNA target sequences during human evolution

    DEFF Research Database (Denmark)

    Gardner, Paul P; Vinther, Jeppe

    2008-01-01

    It has long-been hypothesized that changes in non-protein-coding genes and the regulatory sequences controlling expression could undergo positive selection. Here we identify 402 putative microRNA (miRNA) target sequences that have been mutated specifically in the human lineage and show that genes...... containing such deletions are more highly expressed than their mouse orthologs. Our findings indicate that some miRNA target mutations are fixed by positive selection and might have been involved in the evolution of human-specific traits.......It has long-been hypothesized that changes in non-protein-coding genes and the regulatory sequences controlling expression could undergo positive selection. Here we identify 402 putative microRNA (miRNA) target sequences that have been mutated specifically in the human lineage and show that genes...

  17. Dietary iron supplements and Moringa oleifera leaves influence the liver hepcidin messenger RNA expression and biochemical indices of iron status in rats.

    Science.gov (United States)

    Saini, R K; Manoj, P; Shetty, N P; Srinivasan, K; Giridhar, P

    2014-07-01

    In this study, the effects of iron depletion and repletion on biochemical and molecular indices of iron status were investigated in growing male Wistar rats. We hypothesized that iron from Moringa leaves could overcome the effects of iron deficiency and modulate the expression of iron-responsive genes better than conventional iron supplements. Iron deficiency was induced by feeding rats an iron-deficient diet for 10 weeks, whereas control rats were maintained on an iron-sufficient diet (35.0-mg Fe/kg diet). After the depletion period, animals were repleted with different source of iron, in combination with ascorbic acid. Iron deficiency caused a significant (P Moringa leaf was found to be superior compared with ferric citrate in overcoming the effects of iron deficiency in rats. These results suggest that changes in the relative expression of liver hepcidin messenger RNA can be used as a sensitive molecular marker for iron deficiency. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. Overexpression of interleukin 2 receptor, thymidine kinase and immunoglobulin-associated alpha-1 messenger RNA in a clinical case of enzootic bovine leukosis.

    Science.gov (United States)

    Tawfeeq, Mohammad Monir; Tagawa, Michihito; Itoh, Yuuki; Sugimoto, Kazuya; Kobayashi, Yoshiyasu; Inokuma, Hisashi

    2012-09-01

    A 49-month-old Holstein cow with anorexia, tachypnea, enlarged peripheral lymph nodes, and difficulty standing up was suspected of bovine leukosis. Hematological examination revealed lymphocytosis with the presence of neoplastic cells. Increased total lactate dehydrogenase (LDH) activity, isozymes of LDH-2 and LDH-3 activities and thymidine kinase activity were observed. Cytological findings of fine needle aspiration of subiliac lymph nodes indicated lymphosarcoma. Histopathology and antibody analysis confirmed the diagnosis of enzootic bovine leukosis, a B-cell bovine lymphoma caused by bovine leukemia virus. Gene expressions known as biomarkers of hematopoietic neoplasia in human were also examined in the present case. Increased messenger RNA expression of interleukin 2 receptor, thymidine kinase, and immunoglobulin-associated alpha-1 was observed in the case animal.

  19. Relationship between expression of α-fetoprotein messenger RNA and some clinical parameters of human hepatocellular carcinoma

    Institute of Scientific and Technical Information of China (English)

    1999-01-01

    AIM To certify the relationship between AFP mRNA and some pathological parameters of he-patocellular carcinoma (HCC).METHOD We detected the expression of AFP in mRNA level in tissue samples from 52 patients suffering from HCC by RT-PCR method.RESULTS The positive rate of AFP mRNA was 76.9% in the HCC tumor tissues, and 69.4% in the paratumor tissues from the HCC patients with severe cirrhosis. However, in HCC patients without cirrhosis, the positive rate reached 50% in tumor tissues, but no AFP mRNA expression was found in the related paratumor tissues.CONCLUSION The AFP protein was specially expressed by HCC cells and mutated hepatocytes. The AFP mRNA was positively related with cirrhosis, but no significant relationship was found between AFP mRNA and tumor size, capsule status and tumor metastasis.

  20. Erythropoietin messenger RNA levels in developing mice and transfer of /sup 125/I-erythropoietin by the placenta

    Energy Technology Data Exchange (ETDEWEB)

    Koury, M.J.; Bondurant, M.C.; Graber, S.E.; Sawyer, S.T.

    1988-07-01

    Erythropoietin (EP) mRNA was measured in normal and anemic mice during fetal and postnatal development. Normal fetal livers at 14 d of gestation contained a low level of EP mRNA. By day 19 of gestation, no EP mRNA was detected in normal or anemic fetal livers or normal fetal kidneys, but anemic fetal kidneys had low levels of EP mRNA. Newborn through adult stage mice responded to anemia by accumulating renal and hepatic EP mRNA. However, total liver EP mRNA was considerably less than that of the kidneys. Juvenile animals, 1-4 wk old, were hyperresponsive to anemia in that they produced more EP mRNA than adults. Moreover, nonanemic juveniles had readily measured renal EP mRNA, whereas the adult level was at the lower limit of detection. Because of the very low level of fetal EP mRNA, placental transfer of EP was evaluated. When administered to the pregnant mouse, /sup 125/I-EP was transferred in significant amounts to the fetuses. These results indicate that in mice the kidney is the main organ of EP production at all stages of postnatal development and that adult kidney may also play some role in providing EP for fetal erythropoiesis via placental transfer of maternal hormone.

  1. Protein and messenger RNA expression of interleukin 1 system members in bovine ovarian follicles and effects of interleukin 1β on primordial follicle activation and survival in vitro.

    Science.gov (United States)

    Passos, J R S; Costa, J J N; da Cunha, E V; Silva, A W B; Ribeiro, R P; de Souza, G B; Barroso, P A A; Dau, A M P; Saraiva, M V A; Gonçalves, P B D; van den Hurk, R; Silva, J R V

    2016-01-01

    This study aimed to investigate the expression of interleukin 1 (IL-1) system members (proteins and messenger RNA of ligands and receptors) and its distribution in ovarian follicles of cyclic cows and to evaluate the effects of IL-1β on the survival and activation of primordial follicles in vitro. The ovaries were processed for localization of IL-1 system in preantral and antral follicles by immunohistochemical, real-time polymerase chain reaction, and Western blot analysis. For in vitro studies, ovarian fragments were cultured in α-MEM(+) supplemented with IL-1β (0, 1, 10, 50, or 100 ng/mL), and after 6 d, the cultured tissues were processed for histologic analysis. Immunohistochemical results showed that the IL-1 system proteins IL-1β, IL-1RA, IL-1RI, and IL-1RII were detected in the cytoplasm of oocytes and granulosa cells from all follicular categories and theca cells of antral follicles. Variable levels of messenger RNA for the IL-1 system members were observed at different stages of development. After 6 d of culture, the presence of IL-1β (10 or 50 ng/mL) was effective in maintaining the percentage of normal follicles and in promoting primordial follicle activation. In conclusion, IL-1 system members are differentially expressed in ovarian follicles according to their stage of development. Moreover, IL-1β promotes the development of primordial follicles. These results indicate an important role of the IL-1 system in the regulation of bovine folliculogenesis. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Translating RNA sequencing into clinical diagnostics: opportunities and challenges.

    Science.gov (United States)

    Byron, Sara A; Van Keuren-Jensen, Kendall R; Engelthaler, David M; Carpten, John D; Craig, David W

    2016-05-01

    With the emergence of RNA sequencing (RNA-seq) technologies, RNA-based biomolecules hold expanded promise for their diagnostic, prognostic and therapeutic applicability in various diseases, including cancers and infectious diseases. Detection of gene fusions and differential expression of known disease-causing transcripts by RNA-seq represent some of the most immediate opportunities. However, it is the diversity of RNA species detected through RNA-seq that holds new promise for the multi-faceted clinical applicability of RNA-based measures, including the potential of extracellular RNAs as non-invasive diagnostic indicators of disease. Ongoing efforts towards the establishment of benchmark standards, assay optimization for clinical conditions and demonstration of assay reproducibility are required to expand the clinical utility of RNA-seq.

  3. Phylogenetic relationships of Salmonella based on rRNA sequences

    DEFF Research Database (Denmark)

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    To establish the phylogenetic relationships between the subspecies of Salmonella enterica (official name Salmonella choleraesuis), Salmonella bongori and related members of Enterobacteriaceae, sequence comparison of rRNA was performed by maximum-likelihood analysis. The two Salmonella species wer...

  4. A Nucleolar PUF RNA-binding Protein with Specificity for a Unique RNA Sequence.

    Science.gov (United States)

    Zhang, Chi; Muench, Douglas G

    2015-12-11

    PUF proteins are a conserved group of sequence specific RNA-binding proteins that bind to RNA in a modular fashion. The RNA-binding domain of PUF proteins typically consists of eight clustered Puf repeats. Plant genomes code for large families of PUF proteins that show significant variability in their predicted Puf repeat number, organization, and amino acid sequence. Here we sought to determine whether the observed variability in the RNA-binding domains of four plant PUFs results in a preference for nonclassical PUF RNA target sequences. We report the identification of a novel RNA binding sequence for a nucleolar Arabidopsis PUF protein that contains an atypical RNA-binding domain. The Arabidopsis PUM23 (APUM23) binding sequence was 10 nucleotides in length, contained a centrally located UUGA core element, and had a preferred cytosine at nucleotide position 8. These RNA sequence characteristics differ from those of other PUF proteins, because all natural PUFs studied to date bind to RNAs that contain a conserved UGU sequence at their 5' end and lack specificity for cytosine. Gel mobility shift assays validated the identity of the APUM23 binding sequence and supported the location of 3 of the 10 predicted Puf repeats in APUM23, including the cytosine-binding repeat. The preferred 10-nucleotide sequence bound by APUM23 is present within the 18S rRNA sequence, supporting the known role of APUM23 in 18S rRNA maturation. This work also reveals that APUM23, an ortholog of yeast Nop9, could provide an advanced structural backbone for Puf repeat engineering and target-specific regulation of cellular RNAs.

  5. Expression of endogenous and exogenous growth hormone (GH) messenger (m) RNA in a GH-transgenic tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Caelers, Antje; Maclean, Norman; Hwang, Gyulin; Eppler, Elisabeth; Reinecke, Manfred

    2005-02-01

    We have previously produced transgenic fish from crosses between a wild-type female tilapia (Oreochromis niloticus) and a G transgenic male. This line of growth-enhanced tilapia carries a single copy of a chinook salmon (s) growth hormone (GH) gene spliced to an ocean pout antifreeze promoter (OPA-FPcsGH) co-ligated to a carp beta-actin/lacZ reporter gene construct, integrated into the tilapia genome. Because little is known about the expression sites of transgenes, we have characterised the gene expression patterns of sGH and tilapia (t)GH in transgenic tilapia using a newly established real-time PCR to measure the absolute mRNA amounts of both hormones. The sGH gene, which was expected to be expressed mainly in liver, was also found to be expressed in other organs, such as gills, heart, brain, skeletal muscle, kidney, spleen, intestine and testes. However, in pituitary no sGH mRNA but only tGH mRNA was found. Tilapia GH mRNA in wild-type pituitary amounted to 226 +/- 30 pg/microg total RNA but in transgenics only to 187 +/- 43 pg/microg total RNA. Liver exhibited the highest level of sGH mRNA (8.3 +/- 2.5 pg/microg total RNA) but the extrahepatic sites expressed considerable amounts of sGH mRNA ranging from 4.1 +/- 2.0 pg/microg total RNA in gills to 0.2 +/- 0.08 pg/microg total RNA in kidney. The widespread expression of the sGH gene is assumed to be due to the tissue specificity of the type III AFP gene promoter. It is assumed that our transgenic experiments, which in contrast to some other approaches caused no obvious organ abnormalities, mimick the GH expression during ontogeny. Because sGH mRNA is expressed both in liver and in extrahepatic sites it may not only promote secretion and release of liver-derived (endocrine) IGF-I leading to an overall growth enhancement but also stimulate IGF-I expression within the different organs in a paracrine/autocrine manner and, thus, further promote organ growth.

  6. A comparison between ribo-minus RNA-sequencing and polyA-selected RNA-sequencing.

    Science.gov (United States)

    Cui, Peng; Lin, Qiang; Ding, Feng; Xin, Chengqi; Gong, Wei; Zhang, Lingfang; Geng, Jianing; Zhang, Bing; Yu, Xiaomin; Yang, Jin; Hu, Songnian; Yu, Jun

    2010-11-01

    To compare the two RNA-sequencing protocols, ribo-minus RNA-sequencing (rmRNA-seq) and polyA-selected RNA-sequencing (mRNA-seq), we acquired transcriptomic data-52 and 32 million alignable reads of 35 bases in length-from the mouse cerebrum, respectively. We found that a higher proportion, 44% and 25%, of the uniquely alignable rmRNA-seq reads, is in intergenic and intronic regions, respectively, as compared to 23% and 15% from the mRNA-seq dataset. Further analysis made an additional discovery of transcripts of protein-coding genes (such as Histone, Heg1, and Dux), ncRNAs, snoRNAs, snRNAs, and novel ncRNAs as well as repeat elements in rmRNA-seq dataset. This result suggests that rmRNA-seq method should detect more polyA- or bimorphic transcripts. Finally, through comparative analyses of gene expression profiles among multiple datasets, we demonstrated that different RNA sample preparations may result in significant variations in gene expression profiles. Copyright © 2010 Elsevier Inc. All rights reserved.

  7. Acceptability and Accuracy of Cervical Cancer Screening Using a Self-Collected Tampon for HPV Messenger-RNA Testing among HIV-Infected Women in South Africa.

    Directory of Open Access Journals (Sweden)

    Paul C Adamson

    Full Text Available HIV increases women's risk for high-risk human papillomavirus (hrHPV infection and invasive cervical cancer. South Africa has a high HIV prevalence but low cervical cancer screening coverage. Self-collection of cervical specimens and hrHPV testing, including hrHPV messenger-RNA (mRNA testing, are methods aimed at increasing screening rates. However, data are limited on the acceptability and accuracy of tampon-based self-collection for hrHPV mRNA testing in HIV-infected women.We recruited 325 HIV-infected women seeking care at a government HIV clinic in Pretoria, South Africa. A clinician performed a pelvic examination and obtained an endocervical specimen. Study participants performed self-collection using a tampon. Both clinician- and self-collected specimens were tested for hrHPV mRNA. Acceptability of both collection methods was assessed, the prevalence of hrHPV mRNA in our study population was estimated, test positivity of the two collection methods were compared, and test agreement was assessed by calculating the κ-statistic, sensitivity, and specificity.Over 90% of women reported no difficulties self-collecting specimens and 82% were willing to perform the tampon-collection at home. Based on clinician-collection specimens, the prevalence of hrHPV mRNA in our study population was 36.7% (95% CI: 31.4%- 42.0%. There was no difference in test positivity between clinician-collection, 36.7%, and tampon-collection, 43.5% (p-value = 0.08. Using clinician-collection as the reference test, the sensitivity and specificity for hrHPV mRNA of tampon-collection were 77.4% (95% CI: 69.8-85.0% and 77.8% (95% CI: 71.9-83.6%, respectively.Tampon-based self-collection is acceptable to women and has similar hrHPV mRNA positivity rates as clinician-collection, but has reduced sensitivity and specificity compared to clinician-collection. The hrHPV mRNA prevalence in our study population is high, but similar to other high-risk populations, and highlights the

  8. Myocardial ischemic preconditioning in a porcine model leads to rapid changes in cardiac extracellular vesicle messenger RNA content

    Directory of Open Access Journals (Sweden)

    Kristina Svennerholm

    2015-09-01

    Conclusions: These findings demonstrate in an in vivo model that myocardial ischemic preconditioning influences the composition of mRNA in EV, including gene transcripts for proteins associated with the protective effect of ischemic preconditioning. The finding that preconditioned parental cells release EV containing mRNA that is qualitatively different from those released by non-preconditioned cells shows the importance of the external milieu on parental cell EV production.

  9. Expression of glutamic acid decarboxylase messenger RNA in rat medial preoptic area neurones during the oestrous cycle and after ovariectomy.

    Science.gov (United States)

    Herbison, A E; Augood, S J; McGowan, E M

    1992-08-01

    Evidence suggests that medial preoptic area (MPOA) neurones containing gamma-aminobutyric acid (GABA) are modulated directly by oestrogen. We have used an alkaline phosphatase-labelled antisense oligonucleotide probe to examine glutamic acid decarboxylase67 (GAD) mRNA expression within individual cells of the MPOA, diagonal band of Broca (DBB) and parietal cortex in rats killed at noon on each day of the oestrous cycle and after ovariectomy (n = 4-5). As a fall in extracellular GABA concentrations occurs in the MPOA on the afternoon of proestrus, the GAD67 mRNA content of cells was also examined in proestrous rats at 15:00h immediately prior to the preovulatory luteinising hormone (LH) surge. The MPOA was found to have an intermediate number of GAD67 mRNA-containing cells compared with the DBB and cortex (P less than 0.01) but expressed the lowest mean hybridisation signal (P less than 0.01). The parietal cortex had significantly fewer (P less than 0.01) GAD mRNA-containing cells than either the MPOA or DBB but these contained higher mean density of signal (P less than 0.01). The hybridisation signal for GAD mRNA was abolished by either ribonuclease pre-treatment or the use of excess non-labelled probe. No significant (P greater than 0.05) differences in GAD67 mRNA were detected in animals killed at noon throughout the oestrous cycle or after ovariectomy. On the afternoon of proestrus (15:00h) there was a significant 40% reduction in mean GAD67 mRNA content within cells of only the MPOA compared with noon (P less than 0.05). The numbers of cells in the MPOA expressing GAD67 mRNA were not significantly different.(ABSTRACT TRUNCATED AT 250 WORDS)

  10. Hypocalcemia increases and hypercalcemia decreases the steady-state level of parathyroid hormone messenger RNA in the rat.

    Science.gov (United States)

    Yamamoto, M; Igarashi, T; Muramatsu, M; Fukagawa, M; Motokura, T; Ogata, E

    1989-01-01

    To examine the effects of serum calcium concentrations on PTH biosynthesis, rats were made hyper- (serum total calcium, approximately 3.5 mM) or hypocalcemic (approximately 1.25 mM) and steady-state levels of PTH mRNA in parathyroid cells were measured by the primer extension method using a 32P-labeled synthetic oligomer. PTH mRNA levels increased about twofold in the rats made slightly hypocalcemic by infusion of calcium-free solution and decreased slightly in those made hypercalcemic by CaCl2 infusion (120-150 mumol/h) compared with the levels present in nonfasting control rats. Infusion of calcitonin (0.5 U/h) or EGTA (90 mumol/h) with calcium-free solution increased PTH mRNA levels further (two- to sevenfold) above the levels present in animals infused with calcium-free solution alone. These changes in PTH mRNA levels were observed after 48- but not 24-h infusion, and there was an inverse correlation between PTH mRNA levels and serum calcium concentrations. The results suggest that changes in serum calcium concentrations in the near physiological range regulate the biosynthesis of PTH by affecting steady-state levels of PTH mRNA when hypercalcemia or hypocalcemia continues for a relatively long period. Images PMID:2493484

  11. The chemical structure of DNA sequence signals for RNA transcription

    Science.gov (United States)

    George, D. G.; Dayhoff, M. O.

    1982-01-01

    The proposed recognition sites for RNA transcription for E. coli NRA polymerase, bacteriophage T7 RNA polymerase, and eukaryotic RNA polymerase Pol II are evaluated in the light of the requirements for efficient recognition. It is shown that although there is good experimental evidence that specific nucleic acid sequence patterns are involved in transcriptional regulation in bacteria and bacterial viruses, among the sequences now available, only in the case of the promoters recognized by bacteriophage T7 polymerase does it seem likely that the pattern is sufficient. It is concluded that the eukaryotic pattern that is investigated is not restrictive enough to serve as a recognition site.

  12. Predicting RNA-Protein Interactions Using Only Sequence Information

    Directory of Open Access Journals (Sweden)

    Muppirala Usha K

    2011-12-01

    Full Text Available Abstract Background RNA-protein interactions (RPIs play important roles in a wide variety of cellular processes, ranging from transcriptional and post-transcriptional regulation of gene expression to host defense against pathogens. High throughput experiments to identify RNA-protein interactions are beginning to provide valuable information about the complexity of RNA-protein interaction networks, but are expensive and time consuming. Hence, there is a need for reliable computational methods for predicting RNA-protein interactions. Results We propose RPISeq, a family of classifiers for predicting RNA-protein interactions using only sequence information. Given the sequences of an RNA and a protein as input, RPIseq predicts whether or not the RNA-protein pair interact. The RNA sequence is encoded as a normalized vector of its ribonucleotide 4-mer composition, and the protein sequence is encoded as a normalized vector of its 3-mer composition, based on a 7-letter reduced alphabet representation. Two variants of RPISeq are presented: RPISeq-SVM, which uses a Support Vector Machine (SVM classifier and RPISeq-RF, which uses a Random Forest classifier. On two non-redundant benchmark datasets extracted from the Protein-RNA Interface Database (PRIDB, RPISeq achieved an AUC (Area Under the Receiver Operating Characteristic (ROC curve of 0.96 and 0.92. On a third dataset containing only mRNA-protein interactions, the performance of RPISeq was competitive with that of a published method that requires information regarding many different features (e.g., mRNA half-life, GO annotations of the putative RNA and protein partners. In addition, RPISeq classifiers trained using the PRIDB data correctly predicted the majority (57-99% of non-coding RNA-protein interactions in NPInter-derived networks from E. coli, S. cerevisiae, D. melanogaster, M. musculus, and H. sapiens. Conclusions Our experiments with RPISeq demonstrate that RNA-protein interactions can be

  13. P-body loss is concomitant with formation of a messenger RNA storage domain in mouse oocytes.

    Science.gov (United States)

    Flemr, Matyas; Ma, Jun; Schultz, Richard M; Svoboda, Petr

    2010-05-01

    In mammalian somatic cells, several pathways that converge on deadenylation, decapping, and 5'-3' degradation are found in cytoplasmic foci known as P-bodies. Because controlled mRNA stability is essential for oocyte-to-zygote transition, we examined the dynamics of P-body components in mouse oocytes. We report that oocyte growth is accompanied by loss of P-bodies and a subcortical accumulation of several RNA-binding proteins, including DDX6, CPEB, YBX2 (MSY2), and the exon junction complex. These proteins form transient RNA-containing aggregates in fully grown oocytes with a surrounded nucleolus chromatin configuration. These aggregates disperse during oocyte maturation, consistent with recruitment of maternal mRNAs that occurs during this time. In contrast, levels of DCP1A are low during oocyte growth, and DCP1A does not colocalize with DDX6 in the subcortical aggregates. The amount of DCP1A markedly increases during meiosis, which correlates with the first wave of destabilization of maternal mRNAs. We propose that the cortex of growing oocytes serves as an mRNA storage compartment, which contains a novel type of RNA granule related to P-bodies.

  14. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Science.gov (United States)

    Mitchell, Jennifer A; Clay, Ieuan; Umlauf, David; Chen, Chih-Yu; Moir, Catherine A; Eskiw, Christopher H; Schoenfelder, Stefan; Chakalova, Lyubomira; Nagano, Takashi; Fraser, Peter

    2012-01-01

    In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq) in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq) of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A)-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  15. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Directory of Open Access Journals (Sweden)

    Jennifer A Mitchell

    Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  16. Statistical design and analysis of RNA sequencing data.

    Science.gov (United States)

    Auer, Paul L; Doerge, R W

    2010-06-01

    Next-generation sequencing technologies are quickly becoming the preferred approach for characterizing and quantifying entire genomes. Even though data produced from these technologies are proving to be the most informative of any thus far, very little attention has been paid to fundamental design aspects of data collection and analysis, namely sampling, randomization, replication, and blocking. We discuss these concepts in an RNA sequencing framework. Using simulations we demonstrate the benefits of collecting replicated RNA sequencing data according to well known statistical designs that partition the sources of biological and technical variation. Examples of these designs and their corresponding models are presented with the goal of testing differential expression.

  17. Hypocalcemia increases and hypercalcemia decreases the steady-state level of parathyroid hormone messenger RNA in the rat.

    OpenAIRE

    Yamamoto, M.; Igarashi, T; Muramatsu, M; Fukagawa, M.; Motokura, T.; Ogata, E

    1989-01-01

    To examine the effects of serum calcium concentrations on PTH biosynthesis, rats were made hyper- (serum total calcium, approximately 3.5 mM) or hypocalcemic (approximately 1.25 mM) and steady-state levels of PTH mRNA in parathyroid cells were measured by the primer extension method using a 32P-labeled synthetic oligomer. PTH mRNA levels increased about twofold in the rats made slightly hypocalcemic by infusion of calcium-free solution and decreased slightly in those made hypercalcemic by CaC...

  18. P-Body Loss Is Concomitant with Formation of a Messenger RNA Storage Domain in Mouse Oocytes1

    OpenAIRE

    Flemr, Matyas; Ma, Jun; Schultz, Richard M.; Svoboda, Petr

    2010-01-01

    In mammalian somatic cells, several pathways that converge on deadenylation, decapping, and 5'-3' degradation are found in cytoplasmic foci known as P-bodies. Because controlled mRNA stability is essential for oocyte-to-zygote transition, we examined the dynamics of P-body components in mouse oocytes. We report that oocyte growth is accompanied by loss of P-bodies and a subcortical accumulation of several RNA-binding proteins, including DDX6, CPEB, YBX2 (MSY2), and the exon junction complex. ...

  19. Library preparation for highly accurate population sequencing of RNA viruses

    Science.gov (United States)

    Acevedo, Ashley; Andino, Raul

    2015-01-01

    Circular resequencing (CirSeq) is a novel technique for efficient and highly accurate next-generation sequencing (NGS) of RNA virus populations. The foundation of this approach is the circularization of fragmented viral RNAs, which are then redundantly encoded into tandem repeats by ‘rolling-circle’ reverse transcription. When sequenced, the redundant copies within each read are aligned to derive a consensus sequence of their initial RNA template. This process yields sequencing data with error rates far below the variant frequencies observed for RNA viruses, facilitating ultra-rare variant detection and accurate measurement of low-frequency variants. Although library preparation takes ~5 d, the high-quality data generated by CirSeq simplifies downstream data analysis, making this approach substantially more tractable for experimentalists. PMID:24967624

  20. RNA-Pareto: interactive analysis of Pareto-optimal RNA sequence-structure alignments.

    Science.gov (United States)

    Schnattinger, Thomas; Schöning, Uwe; Marchfelder, Anita; Kestler, Hans A

    2013-12-01

    Incorporating secondary structure information into the alignment process improves the quality of RNA sequence alignments. Instead of using fixed weighting parameters, sequence and structure components can be treated as different objectives and optimized simultaneously. The result is not a single, but a Pareto-set of equally optimal solutions, which all represent different possible weighting parameters. We now provide the interactive graphical software tool RNA-Pareto, which allows a direct inspection of all feasible results to the pairwise RNA sequence-structure alignment problem and greatly facilitates the exploration of the optimal solution set.

  1. Distribution of glutamic acid decarboxylase messenger RNA-containing nerve cell populations of the male rat brain.

    Science.gov (United States)

    Ferraguti, F; Zoli, M; Aronsson, M; Agnati, L F; Goldstein, M; Filer, D; Fuxe, K

    1990-01-01

    The distribution of glutamic acid decarboxylase (GAD) mRNA was investigated throughout the rat brain by means of in situ hybridization. Hybridization was carried out with a 35S-radiolabeled cRNA probe transcribed from a cDNA from cat occipital cortex and cloned in a SP6-T7 promoter-containing vector. Fixed tissue sections were hybridized with 35S GAD probe (0.6 kb length). Signal was detected by means of film or emulsion autoradiography. The autoradiograms were semiquantitatively evaluated by means of computer-assisted image analysis. The results obtained with this evaluation were correlated with the results of the semiquantitative analysis of GAD immunoreactivity performed by Mugnaini and Oertel. Specific labeling was only observed in neuronal cell bodies, whereas no labeling was found over neuropil, glial and endothelial cells. The highest labeling was found in the bulbus olfactorius (internal plexiform and granular layers) and in the caudal magnocellular nucleus of the hypothalamus. Strong labeling was observed in the Purkinje layer of the cerebellar cortex, the interpeduncular nucleus, the interstitial nucleus of Cajal, the nucleus of Darkschewitsch and the suprachiasmatic nucleus. Intermediate or low levels of GAD mRNA were present in various brain nuclei, where gamma-aminobutyric acid (GABA)-containing cell bodies had been observed with other techniques. Interestingly, a low level of GAD mRNA was found in the caudate-putamen and nucleus accumbens, where the vast majority of nerve cells is known to contain GAD immunoreactivity. Only a poor correlation was found between the present semiquantitative measurements of GAD mRNA content and previous analyses of the number of GAD-immunoreactive cell bodies. The present study demonstrates that there exists a differential regional expression of GAD mRNA. The comparison with cell counts performed by immunocytochemistry suggests that some brain areas, such as caudate-putamen and nucleus accumbens, contain a large number

  2. Dinoflagellate 17S rRNA sequence inferred from the gene sequence: Evolutionary implications

    Science.gov (United States)

    Herzog, Michel; Maroteaux, Luc

    1986-01-01

    We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage. PMID:16578795

  3. Spatial distribution of CYP2B1/2 messenger RNA within the rat liver acinus following exposure to the inducers phenobarbital and dieldrin.

    Science.gov (United States)

    Dail, Mary B; Burgess, Shane C; Meek, Edward C; Wagner, Jennifer; Baravik, Jeffrey; Chambers, Janice E

    2007-09-01

    Traditionally, the liver has been considered a homogeneous organ, but literature suggests that the cytochromes P450 are differentially distributed among the hepatocytes and that the pattern of this distribution is altered by various xenobiotics. In this study, the CYP2B1/2 messenger RNA (mRNA) in the hepatocytes was compared following treatment of rats with either of two inducers, phenobarbital (PB), or dieldrin. Adult male Sprague-Dawley-derived rats were treated with either ip PB in saline at 80 mg/kg/day for 5 days or dieldrin in corn oil by oral gavage at 2.5 mg/kg/day for 13 days. Control rats received ip saline or po corn oil for the same time. Laser capture microdissection (LCM) followed by duplex quantitative real-time reverse transcriptase PCR was used to measure the CYP2B1/2 mRNA produced in bands of hepatocytes isolated from three locations along the sinusoidal path. The amounts of mRNA present in whole liver subsamples were also analyzed. CYP2B1/2 enzyme activity was determined by assaying 16beta-hydroxytestosterone formation. Whole liver mRNA samples exhibited significant induction in CYP2B1/2 transcript levels: sixfold for PB and 2200-fold for dieldrin. All the LCM band samples also showed significant fold induction in CYP2B1/2 mRNA compared to controls. Dieldrin caused marked increases in CYP2B1/2 mRNA levels in the direction of blood flow through the acinus: periportal, 300-fold; midzonal, 600-fold; and centrilobular, 1700-fold. A different pattern of induction was observed in the PB-treated rats: periportal, 1800-fold; midzonal, 8800-fold; and centrilobular, 1600-fold. The present study indicates the differences in spatial responses that can be exhibited within the liver following exposure to various xenobiotics. It also indicates the importance of examining xenobiotic metabolism in the liver in light of its nonhomogeneous, zoned microenvironment.

  4. Nucleotide sequence of papaya mosaic virus RNA.

    Science.gov (United States)

    Sit, T L; Abouhaidar, M G; Holy, S

    1989-09-01

    The RNA genome of papaya mosaic virus is 6656 nucleotides long [excluding the poly(A) tail] with six open reading frames (ORFs) more than 200 nucleotides long. The four nearest the 5' end each overlap with adjacent ORFs and could code for proteins with Mr 176307, 26248, 11949 and 7224 (ORFs 1 to 4). The fifth ORF produces the capsid protein of Mr 23043 and the sixth ORF, located completely within ORF1, could code for a protein with Mr 14113. The translation products of ORFs 1 to 3 show strong similarity with those of other potexviruses but the ORF 4 protein has only limited similarity with the other potexvirus ORF 4 proteins of 7K to 11K.

  5. Correlation between PMP-22 messenger RNA expression and phenotype in hereditary neuropathy with liability to pressure palsies.

    Science.gov (United States)

    Schenone, A; Nobbio, L; Caponnetto, C; Abbruzzese, M; Mandich, P; Bellone, E; Ajmar, F; Gherardi, G; Windebank, A J; Mancardi, G

    1997-12-01

    Hereditary neuropathy with liability to pressure palsies (HNPP) is associated with a deletion in chromosome 17p11.2, which includes the gene for the peripheral myelin protein 22 (PMP-22). A "gene dosage" effect is probably the mechanism underlying HNPP, but the amount of PMP-22 mRNA in sural nerves of HNPP patients is highly variable and the role of PMP-22 underexpression in impairing myelination has yet to be clarified. We have studied 6 genetically proven HNPP patients, to evaluate the relationship between PMP-22 mRNA levels, and clinical, neurophysiological, and neuropathological findings. Underexpression of PMP-22 mRNA correlates with disease severity and with mean axon diameter and g ratio, but not with myelin thickness, number of "tomacula," or nerve conduction parameters. Our findings further confirm that underexpression of PMP-22 is the main pathogenetic mechanism underlying the severity of clinical symptoms and signs in HNPP. Smaller axons in sural nerves of HNPP patients with lower PMP-22 levels suggests that underexpression of PMP-22 may also affect axon development.

  6. High-Throughput Sequencing Based Methods of RNA Structure Investigation

    DEFF Research Database (Denmark)

    Kielpinski, Lukasz Jan

    In this thesis we describe the development of four related methods for RNA structure probing that utilize massive parallel sequencing. Using them, we were able to gather structural data for multiple, long molecules simultaneously. First, we have established an easy to follow experimental and comp......In this thesis we describe the development of four related methods for RNA structure probing that utilize massive parallel sequencing. Using them, we were able to gather structural data for multiple, long molecules simultaneously. First, we have established an easy to follow experimental...... and computational protocol for detecting the reverse transcription termination sites (RTTS-Seq). This protocol was subsequently applied to hydroxyl radical footprinting of three dimensional RNA structures to give a probing signal that correlates well with the RNA backbone solvent accessibility. Moreover, we applied...

  7. Cell-SELEX Identifies a "Sticky" RNA Aptamer Sequence.

    Science.gov (United States)

    Ray, Partha; White, Rebekah R

    2017-01-01

    Cell-SELEX is performed to select for cell binding aptamers. We employed an additional selection pressure by using RNAse to remove surface-binding aptamers and select for cell-internalizing aptamers. A common RNA sequence was identified from independent cell-SELEX procedures against two different pancreatic cancer cell lines, indicating a strong selection pressure towards this sequence from the large pool of other available sequences present in the aptamer library. The aptamer is not specific for the pancreatic cancer cell lines, and a similar sequence motif is present in previously published internalizing aptamers. The identified sequence forms a structural motif that binds to a surface protein, which either is highly abundant or has strong affinity for the selected aptamer sequence. Deselecting (removing) this sequence during cell-SELEX may increase the probability of identifying aptamers against cell type-specific targets on the cell surface.

  8. Pairwise local structural alignment of RNA sequences with sequence similarity less than 40%

    DEFF Research Database (Denmark)

    Havgaard, Jakob Hull; Lyngsø, Rune B.; Stormo, Gary D.

    2005-01-01

    Motivation: Searching for non-coding RNA (ncRNA) genes and structural RNA elements (eleRNA) are major challenges in gene finding todya as these often are conserved in structure rather than in sequence. Even though the number of available methods is growing, it is still of interest to pairwise....... The structure prediction performance for a family is typically around 0.7 using Matthews correlation coefficient. In case (2), the algorithm is successful at locating RNA families with an average sensitivity of 0.8 and a positive predictive value of 0.9 using a BLAST-like hit selection scheme. Availability...

  9. Transcriptome and small RNA deep sequencing reveals deregulation of miRNA biogenesis in human glioma.

    Science.gov (United States)

    Moore, Lynette M; Kivinen, Virpi; Liu, Yuexin; Annala, Matti; Cogdell, David; Liu, Xiuping; Liu, Chang-Gong; Sawaya, Raymond; Yli-Harja, Olli; Shmulevich, Ilya; Fuller, Gregory N; Zhang, Wei; Nykter, Matti

    2013-02-01

    Altered expression of oncogenic and tumour-suppressing microRNAs (miRNAs) is widely associated with tumourigenesis. However, the regulatory mechanisms underlying these alterations are poorly understood. We sought to shed light on the deregulation of miRNA biogenesis promoting the aberrant miRNA expression profiles identified in these tumours. Using sequencing technology to perform both whole-transcriptome and small RNA sequencing of glioma patient samples, we examined precursor and mature miRNAs to directly evaluate the miRNA maturation process, and examined expression profiles for genes involved in the major steps of miRNA biogenesis. We found that ratios of mature to precursor forms of a large number of miRNAs increased with the progression from normal brain to low-grade and then to high-grade gliomas. The expression levels of genes involved in each of the three major steps of miRNA biogenesis (nuclear processing, nucleo-cytoplasmic transport, and cytoplasmic processing) were systematically altered in glioma tissues. Survival analysis of an independent data set demonstrated that the alteration of genes involved in miRNA maturation correlates with survival in glioma patients. Direct quantification of miRNA maturation with deep sequencing demonstrated that deregulation of the miRNA biogenesis pathway is a hallmark for glioma genesis and progression.

  10. Mutational analysis of the SDD sequence motif of a PRRSV RNA-dependent RNA polymerase.

    Science.gov (United States)

    Zhou, Yan; Zheng, Haihong; Gao, Fei; Tian, Debin; Yuan, Shishan

    2011-09-01

    The subgenomic mRNA transcription and genomic replication of the porcine reproductive and respiratory syndrome virus (PRRSV) are directed by the viral replicase. The replicase is expressed in the form of two polyproteins and is subsequently processed into smaller nonstructural proteins (nsps). nsp9, containing the viral replicase, has characteristic sequence motifs conserved among the RNA-dependent RNA polymerases (RdRp) of positive-strand (PS) RNA viruses. To test whether the conserved SDD motif can tolerate other conserved motifs of RNA viruses and the influence of every residue on RdRp catalytic activity, many amino acids substitutions were introduced into it. Only one nsp9 substitution, of serine by glycine (S3050G), could rescue mutant viruses. The rescued virus was genetically stable. Alteration of either aspartate residue was not tolerated, destroyed the polymerase activity, and abolished virus transcription, but did not eliminate virus replication. We also found that the SDD motif was essentially invariant for the signature sequence of PRRSV RdRp. It could not accommodate other conserved motifs found in other RNA viral polymerases, except the GDD motif, which is conserved in all the other PS RNA viruses. These findings indicated that nidoviruses are evolutionarily related to other PS RNA viruses. Our studies support the idea that the two aspartate residues of the SDD motif are critical and essential for PRRSV transcription and represent a sequence variant of the GDD motif in PS RNA viruses.

  11. Is the expression of γ-glutamyl transpeptidase messenger RNA an indicator of biological behavior in recurrent hepatocellular carcinoma?

    Institute of Scientific and Technical Information of China (English)

    I-Shyan Sheen; Kuo-Shyang Jeng; Yi-Chun Tsai

    2003-01-01

    AIM: To investigate the correlation between gammaglutamyl transpeptidase (γ-GTP) expression in the primary HCC and post-resection recurrence and its biological behaviors.METHODS: Forty consecutive patients having curative resection for HCC were included in this study. The primers for reverse-transcription polymerase chain reaction (RTPCR) were corresponding to the 5'-noncoding human γ-GTP mRNA of fetal liver (type A), HepG2 cells (type B),and placenta (type C). Both the cancer and non-cancerous tissues of the resected liver were analyzed. The correlations between the expression of γ-GTP and the clinicopathological variables and outcomes (recurrence and survival) were studied.RESULTS: Those with type B γ-GTP mRNA in cancer had significant higher recurrence rate than those without it (63.6 % vs 14.3 %). Both those with type B in cancer and in non-cancer died significantly more than those without it (45.5 % vs 0 % and 53.6 % vs 0 %, respectively). By multivariate analysis, the significant predictors of recurrence included high serum AFP (P=0.0108), vascular permeation (P=0.0084), and type B γ-GTP mRNA in non-cancerous liver (P=0.0107). The significant predictors of postrecurrence death included high serum AFP (P=0.0141),vascular permeation (P=0.0130), and daughter nodules (P=0.0053). As to the manifestations (recurrent number ≥2, recurrent extent≥2 segments, extra-hepatic metastasis, and death) in recurrent patients, there were no statistical significant differences between those with type B in the primary tumor and those without it. The difference between those with type B in non-cancerous liver and those without it also was not significant.CONCLUSION: Patients of HCC with type B γ-GTP mRNA both in cancer and in non-cancerous tissue had a worse outcome, earlier recurrence, and more post-recurrence death.

  12. Probing dimensionality beyond the linear sequence of mRNA.

    Science.gov (United States)

    Del Campo, Cristian; Ignatova, Zoya

    2016-05-01

    mRNA is a nexus entity between DNA and translating ribosomes. Recent developments in deep sequencing technologies coupled with structural probing have revealed new insights beyond the classic role of mRNA and place it more centrally as a direct effector of a variety of processes, including translation, cellular localization, and mRNA degradation. Here, we highlight emerging approaches to probe mRNA secondary structure on a global transcriptome-wide level and compare their potential and resolution. Combined approaches deliver a richer and more complex picture. While our understanding on the effect of secondary structure for various cellular processes is quite advanced, the next challenge is to unravel more complex mRNA architectures and tertiary interactions.

  13. Contrasting Storage Protein Synthesis and Messenger RNA Accumulation during Development of Zygotic and Somatic Embryos of Alfalfa (Medicago sativa L.).

    Science.gov (United States)

    Krochko, J E; Pramanik, S K; Bewley, J D

    1992-05-01

    During development on hormone-free media, somatic embryos pass through distinct morphological stages that superficially resemble those of zygotic embryo development (globular, heart, torpedo, cotyledonary stages). Despite these similarities, they differ from zygotic embryos in the extent of cotyledonary development and the patterns of synthesis and quantitative expression of seed-specific storage proteins (7S, 11S, and 2S proteins). Alfin (7S) is the first storage protein synthesized in developing zygotic embryos (stage IV). The 11S (medicagin) and 2S (Low Molecular Weight, LMW) storage proteins are not detectable until the following stage of development (stage V), although all three are present before the completion of embryo enlargement. Likewise, the 7S storage protein is the first to be synthesized in developing somatic embryos (day 5). Medicagin is evident by day 7 and the LMW protein by day 10. In contrast to zygotic embryos, alfin remains the predominant storage protein in somatic embryos throughout development. Not only are the relative amounts of medicagin and the LMW protein reduced in somatic embryos but the LMW protein is accumulated much later than the other proteins. Quantification of the storage protein mRNAs (7S, 11S, and 2S) by northern blot analysis confirms that there are substantial differences in the patterns of message accumulation in zygotic and somatic embryos of alfalfa (Medicago sativa). In zygotic embryos, the 7S, 11S, and 2S storage protein mRNAs are abundant during maturation and, in particular, during the stages of maximum protein synthesis (alfin, stages VI and VII; medicagin, stage VII; LMW, stage VII). In somatic embryos, the predominance of the 7S storage protein is correlated with increased accumulation of its mRNA, whereas the limited synthesis of the 11S storage protein is associated with much lower steady-state levels of its message. The mRNA for the LMW protein is present already by 3 days after transfer to hormone-free media

  14. Deep-sequencing protocols influence the results obtained in small-RNA sequencing.

    Directory of Open Access Journals (Sweden)

    Joern Toedling

    Full Text Available Second-generation sequencing is a powerful method for identifying and quantifying small-RNA components of cells. However, little attention has been paid to the effects of the choice of sequencing platform and library preparation protocol on the results obtained. We present a thorough comparison of small-RNA sequencing libraries generated from the same embryonic stem cell lines, using different sequencing platforms, which represent the three major second-generation sequencing technologies, and protocols. We have analysed and compared the expression of microRNAs, as well as populations of small RNAs derived from repetitive elements. Despite the fact that different libraries display a good correlation between sequencing platforms, qualitative and quantitative variations in the results were found, depending on the protocol used. Thus, when comparing libraries from different biological samples, it is strongly recommended to use the same sequencing platform and protocol in order to ensure the biological relevance of the comparisons.

  15. Stability of Reference Genes for Messenger RNA Quantification by Real-Time PCR in Mouse Dextran Sodium Sulfate Experimental Colitis.

    Directory of Open Access Journals (Sweden)

    Nour Eissa

    Full Text Available Many animal models have been developed to characterize the complexity of colonic inflammation. In dextran sodium sulfate (DSS experimental colitis in mice the choice of reference genes is critical for accurate quantification of target genes using quantitative real time PCR (RT-qPCR. No studies have addressed the performance of reference genes in mice DSS-experimental colitis. This study aimed to determine the stability of reference genes expression (RGE in DSS-experimental murine colitis.Colitis was induced in male C57BL/6 mice using DSS5% for 5 days, control group received water. RNA was extracted from inflamed and non-inflamed colon. Using RT-qPCR, comparative analysis of 13 RGE was performed according to predefined criteria and relative colonic TNF-α and IL-1β gene expression was determined by calculating the difference in the threshold cycle.Colitis significantly altered the stability of mucosal RGE. Commonly used glyceraldehyde-3-phosphate dehydrogenase (Gapdh, β-actin (Actb, or β2-microglobulin (β2m showed the highest variability within the inflamed and control groups. Conversely, TATA-box-binding protein (Tbp and eukaryotic translation elongation factor 2 (Eef2 were not affected by inflammation and were the most stable genes. Normalization of colonic TNF-α and IL-1β mRNA levels was dependent on the reference gene used. Depending on the genes used to normalize the data, statistical significance varied from significant when TBP / Eef2 were used to non-significant when Gapdh, Actb or β2m were used.This study highlights the appropriate choice of RGE to ensure adequate normalization of RT-qPCR data when using this model. Suboptimal RGE may explain controversial results from published studies. We recommend using Tbp and Eef2 instead of Gapdh, Actb or β2m as reference genes.

  16. Unveiling Chloroplast RNA Editing Events Using Next Generation Small RNA Sequencing Data

    Directory of Open Access Journals (Sweden)

    Nureyev F. Rodrigues

    2017-09-01

    Full Text Available Organellar RNA editing involves the modification of nucleotide sequences to maintain conserved protein functions, mainly by reverting non-neutral codon mutations. The loss of plastid editing events, resulting from mutations in RNA editing factors or through stress interference, leads to developmental, physiological and photosynthetic alterations. Recently, next generation sequencing technology has generated the massive discovery of sRNA sequences and expanded the number of sRNA data. Here, we present a method to screen chloroplast RNA editing using public sRNA libraries from Arabidopsis, soybean and rice. We mapped the sRNAs against the nuclear, mitochondrial and plastid genomes to confirm predicted cytosine to uracil (C-to-U editing events and identify new editing sites in plastids. Among the predicted editing sites, 40.57, 34.78, and 25.31% were confirmed using sRNAs from Arabidopsis, soybean and rice, respectively. SNP analysis revealed 58.2, 43.9, and 37.5% new C-to-U changes in the respective species and identified known and new putative adenosine to inosine (A-to-I RNA editing in tRNAs. The present method and data reveal the potential of sRNA as a reliable source to identify new and confirm known editing sites.

  17. In situ changes in the relative abundance of human epidermal cytokine messenger RNA levels following exposure to the poison ivy/oak contact allergen urushiol.

    Science.gov (United States)

    Boehm, K D; Yun, J K; Strohl, K P; Trefzer, U; Häffner, A; Elmets, C A

    1996-06-01

    Abstract: Epidermal keratinocytes in culture have been shown to produce many cytokines, and their proteins have been identified in skin tissue samples. It has therefore been assumed that these cytokines are transcribed in vivo by the epidermis in response to contact allergens. In this report, in situ hybridization was used to detect the messenger RNAs for interleukin-1 alpha (IL-1 alpha), interleukin-1 beta (IL-1 beta) and tumour necrosis factor-alpha (TNF-alpha) in samples of human skin prior to and at various times after application of urushiol, the immunogenic component of poison ivy/oak. In sensitive subjects, IL-1 alpha and TNF-alpha mRNAs showed a progressive increase in transcript levels that paralleled the clinical and histological features of the inflammatory process. The time-course of the IL-1 beta response differed from that of IL-1 alpha and TNF-alpha, in that there was an early (by 6 h after urushiol administration) elevation in IL-1 beta mRNA that occurred before there was evidence of inflammation and had returned to background levels by 72 h when the reaction had reached its peak. In contrast to urushiol-sensitive subjects, urushiol-anergic individuals did not exhibit an increase in IL-1 alpha, IL-1 beta or TNF-alpha mRNA levels. The data provide evidence for an in vivo role for epidermal IL-1 alpha, IL-1 beta and TNF-alpha transcription in the regulation of IL-1 beta and TNF-alpha polypeptide levels in the epidermis in response to this common contact allergen.

  18. Nicotiana small RNA sequences support a host genome origin of cucumber mosaic virus satellite RNA.

    Science.gov (United States)

    Zahid, Kiran; Zhao, Jian-Hua; Smith, Neil A; Schumann, Ulrike; Fang, Yuan-Yuan; Dennis, Elizabeth S; Zhang, Ren; Guo, Hui-Shan; Wang, Ming-Bo

    2015-01-01

    Satellite RNAs (satRNAs) are small noncoding subviral RNA pathogens in plants that depend on helper viruses for replication and spread. Despite many decades of research, the origin of satRNAs remains unknown. In this study we show that a β-glucuronidase (GUS) transgene fused with a Cucumber mosaic virus (CMV) Y satellite RNA (Y-Sat) sequence (35S-GUS:Sat) was transcriptionally repressed in N. tabacum in comparison to a 35S-GUS transgene that did not contain the Y-Sat sequence. This repression was not due to DNA methylation at the 35S promoter, but was associated with specific DNA methylation at the Y-Sat sequence. Both northern blot hybridization and small RNA deep sequencing detected 24-nt siRNAs in wild-type Nicotiana plants with sequence homology to Y-Sat, suggesting that the N. tabacum genome contains Y-Sat-like sequences that give rise to 24-nt sRNAs capable of guiding RNA-directed DNA methylation (RdDM) to the Y-Sat sequence in the 35S-GUS:Sat transgene. Consistent with this, Southern blot hybridization detected multiple DNA bands in Nicotiana plants that had sequence homology to Y-Sat, suggesting that Y-Sat-like sequences exist in the Nicotiana genome as repetitive DNA, a DNA feature associated with 24-nt sRNAs. Our results point to a host genome origin for CMV satRNAs, and suggest novel approach of using small RNA sequences for finding the origin of other satRNAs.

  19. Nicotiana small RNA sequences support a host genome origin of cucumber mosaic virus satellite RNA.

    Directory of Open Access Journals (Sweden)

    Kiran Zahid

    2015-01-01

    Full Text Available Satellite RNAs (satRNAs are small noncoding subviral RNA pathogens in plants that depend on helper viruses for replication and spread. Despite many decades of research, the origin of satRNAs remains unknown. In this study we show that a β-glucuronidase (GUS transgene fused with a Cucumber mosaic virus (CMV Y satellite RNA (Y-Sat sequence (35S-GUS:Sat was transcriptionally repressed in N. tabacum in comparison to a 35S-GUS transgene that did not contain the Y-Sat sequence. This repression was not due to DNA methylation at the 35S promoter, but was associated with specific DNA methylation at the Y-Sat sequence. Both northern blot hybridization and small RNA deep sequencing detected 24-nt siRNAs in wild-type Nicotiana plants with sequence homology to Y-Sat, suggesting that the N. tabacum genome contains Y-Sat-like sequences that give rise to 24-nt sRNAs capable of guiding RNA-directed DNA methylation (RdDM to the Y-Sat sequence in the 35S-GUS:Sat transgene. Consistent with this, Southern blot hybridization detected multiple DNA bands in Nicotiana plants that had sequence homology to Y-Sat, suggesting that Y-Sat-like sequences exist in the Nicotiana genome as repetitive DNA, a DNA feature associated with 24-nt sRNAs. Our results point to a host genome origin for CMV satRNAs, and suggest novel approach of using small RNA sequences for finding the origin of other satRNAs.

  20. Messenger RNA encoding constitutively active Toll-like receptor 4 enhances effector functions of human T cells.

    Science.gov (United States)

    Pato, A; Eisenberg, G; Machlenkin, A; Margalit, A; Cafri, G; Frankenburg, S; Merims, S; Peretz, T; Lotem, M; Gross, G

    2015-11-01

    Adoptive T cell therapy of cancer employs a large number of ex-vivo-propagated T cells which recognize their targets either by virtue of their endogenous T cell receptor (TCR) or via genetic reprogramming. However, both cell-extrinsic and intrinsic mechanisms often diminish the in-vivo potency of these therapeutic T cells, limiting their clinical efficacy and broader use. Direct activation of human T cells by Toll-like receptor (TLR) ligands induces T cell survival and proliferation, boosts the production of proinflammatory cytokines and augments resistance to regulatory T cell (Treg) suppression. Removal of the TLR ligand-binding region results in constitutive signalling triggered by the remaining cytosolic Toll/interleukin-1 receptor (TIR) domain. The use of such TIR domains therefore offers an ideal means for equipping anti-tumour T cells with the arsenal of functional attributes required for improving current clinical protocols. Here we show that constitutively active (ca)TLR-4 can be expressed efficiently in human T cells using mRNA electroporation. The mere expression of caTLR-4 mRNA in polyclonal CD8 and CD4 T cells induced the production of interferon (IFN)-γ, triggered the surface expression of CD25, CD69 and 4-1BB and up-regulated a panel of cytokines and chemokines. In tumour-infiltrating lymphocytes prepared from melanoma patients, caTLR-4 induced robust IFN-γ secretion in all samples tested. Furthermore, caTLR-4 enhanced the anti-melanoma cytolytic activity of tumour-infiltrating lymphocytes and augmented the secretion of IFN-γ, tumour necrosis factor (TNF)-α and granulocyte-macrophage colony-stimulating factor (GM-CSF) for at least 4 days post-transfection. Our results demonstrate that caTLR-4 is capable of exerting multiple T cell-enhancing effects and can potentially be used as a genetic adjuvant in adoptive cell therapy. © 2015 British Society for Immunology.

  1. MicroRNA and messenger RNA analyses of mesenchymal stem cells derived from teeth and the Wharton jelly of umbilical cord.

    Science.gov (United States)

    Chen, Hua-Chien; Lee, Yun-Shien; Sieber, Martin; Lu, Huan-Ting; Wei, Pei-Cih; Wang, Chao-Nin; Peng, Hsiu-Huei; Chao, An-Shine; Cheng, Po-Jen; Chang, Shuenn-Dyh; Chen, Shu-Jen; Wang, Tzu-Hao

    2012-04-10

    Microarray analyses of transcriptomes have been used to characterize mesenchymal stem cells (MSCs) of various origins. MicroRNAs (miRNAs) are short, nonprotein-coding RNAs involved in post-transcriptional gene inhibition in a variety of tissues, including cancer cells and MSCs. This study has integrated the use of miRNA and mRNA expression profiles to analyze human MSCs derived from Wharton's jelly (WJ) of the umbilical cord, milk teeth (MT), and adult wisdom teeth (AT). Because both miRNA and mRNA expression in MT and AT MSCs were so similar, they were combined together as tooth MSCs for comparison with WJ MSCs. Twenty-five genes that were up-regulated in tooth MSCs and 41 genes that were up-regulated in WJ MSCs were identified by cross-correlating miRNA and mRNA profiles. Functional network analysis show that tooth MSCs signature genes, represented by SATB2 and TNFRSF11B, are involved in ossification, bone development, and actin cytoskeleton organization. In addition, 2 upregulated genes of tooth MSCs-NEDD4 and EMP1-have been shown to be involved in neuroectodermal differentiation. The signature genes of WJ MSCs, represented by KAL1 and PAPPA, are involved in tissue development, regulation of cell differentiation, and bone morphogenetic protein signaling pathways. In conclusion, the combined interrogation of miRNA and mRNA expression profiles in this study proved useful in extracting reliable results from a genome-wide comparison of multiple types of MSCs. Subsequent functional network analysis provided further functional insights about these MSCs.

  2. RNA-DNA sequence differences spell genetic code ambiguities

    DEFF Research Database (Denmark)

    Bentin, Thomas; Nielsen, Michael L

    2013-01-01

    A recent paper in Science by Li et al. 2011(1) reports widespread sequence differences in the human transcriptome between RNAs and their encoding genes termed RNA-DNA differences (RDDs). The findings could add a new layer of complexity to gene expression but the study has been criticized. ...

  3. Dynamics in Sequence Space for RNA Secondary Structure Design.

    Science.gov (United States)

    Matthies, Marco C; Bienert, Stefan; Torda, Andrew E

    2012-10-01

    We have implemented a method for the design of RNA sequences that should fold to arbitrary secondary structures. A popular energy model allows one to take the derivative with respect to composition, which can then be interpreted as a force and used for Newtonian dynamics in sequence space. Combined with a negative design term, one can rapidly sample sequences which are compatible with a desired secondary structure via simulated annealing. Results for 360 structures were compared with those from another nucleic acid design program using measures such as the probability of the target structure and an ensemble-weighted distance to the target structure.

  4. siRNA release from pri-miRNA scaffolds is controlled by the sequence and structure of RNA.

    Science.gov (United States)

    Galka-Marciniak, Paulina; Olejniczak, Marta; Starega-Roslan, Julia; Szczesniak, Michal W; Makalowska, Izabela; Krzyzosiak, Wlodzimierz J

    2016-04-01

    shmiRs are pri-miRNA-based RNA interference triggers from which exogenous siRNAs are expressed in cells to silence target genes. These reagents are very promising tools in RNAi in vivo applications due to their good activity profile and lower toxicity than observed for other vector-based reagents such as shRNAs. In this study, using high-resolution northern blotting and small RNA sequencing, we investigated the precision with which RNases Drosha and Dicer process shmiRs. The fidelity of siRNA release from the commonly used pri-miRNA shuttles was found to depend on both the siRNA insert and the pri-miR scaffold. Then, we searched for specific factors that may affect the precision of siRNA release and found that both the structural features of shmiR hairpins and the nucleotide sequence at Drosha and Dicer processing sites contribute to cleavage site selection and cleavage precision. An analysis of multiple shRNA intermediates generated from several reagents revealed the complexity of shmiR processing by Drosha and demonstrated that Dicer selects substrates for further processing. Aside from providing new basic knowledge regarding the specificity of nucleases involved in miRNA biogenesis, our results facilitate the rational design of more efficient genetic reagents for RNAi technology.

  5. Onapristone (ZK299) and mifepristone (RU486) regulate the messenger RNA and protein expression levels of the progesterone receptor isoforms A and B in the bovine endometrium.

    Science.gov (United States)

    Rekawiecki, Robert; Kowalik, Magdalena K; Kotwica, Jan

    2015-08-01

    The aim of this study was to examine whether progesterone (P(4)) and its antagonists, onapristone (ZK299) and mifepristone (RU486), affect the levels of PGRA and PGRB messenger RNA (mRNA) and protein in the cow uterus which may be important in understanding whether the final physiological effect evoked by an antagonist depends on PGR isoform bound to the antagonist. Endometrial slices on Days 6 to 10 and 17 to 20 of the estrous cycle were treated for 6 or 24 hours for mRNA and protein expression analysis, respectively, with P4, ZK299, or RU486 at a dose of 10(-4), 10(-5), or 10(-6) M. In the samples on Days 6 to 10 of the estrous cycle, PGRAB mRNA was stimulated by P(4) (10(-4) M; P < 0.01) and RU486 (10(-6); P < 0.001) and was decreased by ZK299 (10(-5); P < 0.05). In contrast, PGRB mRNA was decreased by the all P(4) (P < 0.01) and ZK299 (P < 0.001) doses and by two of the RU486 doses (10(-4) M; P < 0.01 and 10(-5) M; P < 0.01). In samples on Days 17 to 20 of the estrous cycle, PGRAB mRNA was stimulated by RU486 (10(-5) M; P < 0.001). PGRB mRNA was decreased by P(4) (10(-4) and 10(-5) M; P < 0.001), ZK299 (10(-4) and 10(-5) M; P < 0.001), and RU486 (10(-4) M; P < 0.01 and 10(-6) M; P < 0.001) and was increased by ZK299 (10(-6) M; P < 0.001) and RU486 (10(-5) M; P < 0.001). In samples on Days 6 to 10 of the estrous cycle, PGRB protein levels were decreased (P < 0.05) by all three ZK299 doses and by two of the RU486 doses (10(-4) M; P < 0.05 and 10(-5) M; P < 0.01). In contrast, in samples on Days 17 to 20, both PGRA and PGRB protein levels were decreased by ZK299 stimulation (10(-5) M; P < 0.05 and 10(-5) M; P < 0.01, respectively), whereas only PGRA protein levels were increased by RU486 (10(-5) M; P < 0.01). Both ZK299 and RU486 may exhibit both agonist and antagonist properties depending on which receptor isoform they affect. As a result, an increase or decrease in the expression of a particular PGR isoform will be observed.

  6. Quantitative assessment of RNA-protein interactions with high-throughput sequencing-RNA affinity profiling.

    Science.gov (United States)

    Ozer, Abdullah; Tome, Jacob M; Friedman, Robin C; Gheba, Dan; Schroth, Gary P; Lis, John T

    2015-08-01

    Because RNA-protein interactions have a central role in a wide array of biological processes, methods that enable a quantitative assessment of these interactions in a high-throughput manner are in great demand. Recently, we developed the high-throughput sequencing-RNA affinity profiling (HiTS-RAP) assay that couples sequencing on an Illumina GAIIx genome analyzer with the quantitative assessment of protein-RNA interactions. This assay is able to analyze interactions between one or possibly several proteins with millions of different RNAs in a single experiment. We have successfully used HiTS-RAP to analyze interactions of the EGFP and negative elongation factor subunit E (NELF-E) proteins with their corresponding canonical and mutant RNA aptamers. Here we provide a detailed protocol for HiTS-RAP that can be completed in about a month (8 d hands-on time). This includes the preparation and testing of recombinant proteins and DNA templates, clustering DNA templates on a flowcell, HiTS and protein binding with a GAIIx instrument, and finally data analysis. We also highlight aspects of HiTS-RAP that can be further improved and points of comparison between HiTS-RAP and two other recently developed methods, quantitative analysis of RNA on a massively parallel array (RNA-MaP) and RNA Bind-n-Seq (RBNS), for quantitative analysis of RNA-protein interactions.

  7. Maize Gene Atlas Developed by RNA Sequencing and Comparative Evaluation of Transcriptomes Based on RNA Sequencing and Microarrays

    Science.gov (United States)

    Sekhon, Rajandeep S.; Briskine, Roman; Hirsch, Candice N.; Myers, Chad L.; Springer, Nathan M.; Buell, C. Robin; de Leon, Natalia; Kaeppler, Shawn M.

    2013-01-01

    Transcriptome analysis is a valuable tool for identification and characterization of genes and pathways underlying plant growth and development. We previously published a microarray-based maize gene atlas from the analysis of 60 unique spatially and temporally separated tissues from 11 maize organs [1]. To enhance the coverage and resolution of the maize gene atlas, we have analyzed 18 selected tissues representing five organs using RNA sequencing (RNA-Seq). For a direct comparison of the two methodologies, the same RNA samples originally used for our microarray-based atlas were evaluated using RNA-Seq. Both technologies produced similar transcriptome profiles as evident from high Pearson's correlation statistics ranging from 0.70 to 0.83, and from nearly identical clustering of the tissues. RNA-Seq provided enhanced coverage of the transcriptome, with 82.1% of the filtered maize genes detected as expressed in at least one tissue by RNA-Seq compared to only 56.5% detected by microarrays. Further, from the set of 465 maize genes that have been historically well characterized by mutant analysis, 427 show significant expression in at least one tissue by RNA-Seq compared to 390 by microarray analysis. RNA-Seq provided higher resolution for identifying tissue-specific expression as well as for distinguishing the expression profiles of closely related paralogs as compared to microarray-derived profiles. Co-expression analysis derived from the microarray and RNA-Seq data revealed that broadly similar networks result from both platforms, and that co-expression estimates are stable even when constructed from mixed data including both RNA-Seq and microarray expression data. The RNA-Seq information provides a useful complement to the microarray-based maize gene atlas and helps to further understand the dynamics of transcription during maize development. PMID:23637782

  8. Exploring the miRNA-mRNA Regulatory Network in Clear Cell Renal Cell Carcinomas by Next-Generation Sequencing Expression Profiles

    Directory of Open Access Journals (Sweden)

    Sören Müller

    2014-01-01

    Full Text Available Altered microRNA (miRNA expression is a hallmark of many cancer types. The combined analysis of miRNA and messenger RNA (mRNA expression profiles is crucial to identifying links between deregulated miRNAs and oncogenic pathways. Therefore, we investigated the small non-coding (snc transcriptomes of nine clear cell renal cell carcinomas (ccRCCs and adjacent normal tissues for alterations in miRNA expression using a publicly available small RNA-Sequencing (sRNA-Seq raw-dataset. We constructed a network of deregulated miRNAs and a set of differentially expressed genes publicly available from an independent study to in silico determine miRNAs that contribute to clear cell renal cell carcinogenesis. From a total of 1,672 sncRNAs, 61 were differentially expressed across all ccRCC tissue samples. Several with known implications in ccRCC development, like the upregulated miR-21-5p, miR-142-5p, as well as the downregulated miR-106a-5p, miR-135a-5p, or miR-206. Additionally, novel promising candidates like miR-3065, which i.a. targets NRP2 and FLT1, were detected in this study. Interaction network analysis revealed pivotal roles for miR-106a-5p, whose loss might contribute to the upregulation of 49 target mRNAs, miR-135a-5p (32 targets, miR-206 (28 targets, miR-363-3p (22 targets, and miR-216b (13 targets. Among these targets are the angiogenesis, metastasis, and motility promoting oncogenes c-MET, VEGFA, NRP2, and FLT1, the latter two coding for VEGFA receptors.

  9. Identification of soybean seed developmental stage-specific and tissue-specific miRNA targets by degradome sequencing

    Directory of Open Access Journals (Sweden)

    Shamimuzzaman Md

    2012-07-01

    sequencing of the enriched fragments resulting from miRNA-guided cleavage of messenger RNAs. Nearly 50% of the miRNA targets were transcription factors in pathways that are likely important in setting or maintaining the developmental program leading to high quality soybean seeds that are one of the dominant sources of protein and oil in world markets.

  10. Normalization of RNA-sequencing data from samples with varying mRNA levels.

    Directory of Open Access Journals (Sweden)

    Håvard Aanes

    Full Text Available Methods for normalization of RNA-sequencing gene expression data commonly assume equal total expression between compared samples. In contrast, scenarios of global gene expression shifts are many and increasing. Here we compare the performance of three normalization methods when polyA(+ RNA content fluctuates significantly during zebrafish early developmental stages. As a benchmark we have used reverse transcription-quantitative PCR. The results show that reads per kilobase per million (RPKM and trimmed mean of M-values (TMM normalization systematically leads to biased gene expression estimates. Biological scaling normalization (BSN, designed to handle differences in total expression, showed improved accuracy compared to the two other methods in estimating transcript level dynamics. The results have implications for past and future studies using RNA-sequencing on samples with different levels of total or polyA(+ RNA.

  11. IVT-seq reveals extreme bias in RNA sequencing

    OpenAIRE

    Kavaklı, Halil; Lahens, Nicholas F.; Zhang, Ray; Hayer, Katharina; Black, Michael B.; Dueck, Hannah; Pizarro, Angel; Kim, Junhyong; Irizarry, Rafael; Thomas, Russell S.; Grant, Gregory R.; Hogenesch, John B.

    2014-01-01

    RESEARCH Open Access IVT-seq reveals extreme bias in RNA sequencing Nicholas F Lahens1, Ibrahim Halil Kavakli2,3, Ray Zhang1, Katharina Hayer4, Michael B Black5, Hannah Dueck6, Angel Pizarro7, Junhyong Kim6, Rafael Irizarry8, Russell S Thomas5, Gregory R Grant4,9 and John B Hogenesch1* Abstract Background: RNA-seq is a powerful technique for identifying and quantifying transcription and splicing events, both known and novel. However, given its recent development and the prol...

  12. 肿瘤基因信使RNA可变剪接及其应用%Alternative splicing of tumor associated genes messenger RNA and application

    Institute of Scientific and Technical Information of China (English)

    张鑫桐; 岳文涛

    2014-01-01

    可变剪接作为基因的一种修饰方式,是真核细胞表达调控过程的重要因素。它使同一蛋白质编码基因能够产生多种转录本,极大地扩展了遗传信息的应用。在人类肿瘤细胞中前体信使RN A的可变剪接扮演着重要角色,一些重要基因通过可变剪接产生不同于正常细胞中的剪接异构体。这些肿瘤特异性剪接异构体的存在导致了肿瘤的发生、发展。深入探索肿瘤相关基因的可变剪接对肿瘤的诊断、治疗具有重要意义。%As a way of gene modification,alternative splicing is an important factor of eukaryotic gene expression and regulation.It makes various transcripts from one protein-coding gene,and greatly extends the genetic information.Alternative splicing of pre-messenger RNA plays an important role in tumor cells.By alter-native splicing,some important genes can generate splicing variants different from those in normal cells.The existence of tumor-specific splicing variants leads to the occurrence and progression of tumor.Therefore,explo-ration on the alternative splicing of tumor-associated genes may be of great significance in tumor diagnosis and treatment.

  13. Glutathione Regulates 1-Aminocyclopropane-1-Carboxylate Synthase Transcription via WRKY33 and 1-Aminocyclopropane-1-Carboxylate Oxidase by Modulating Messenger RNA Stability to Induce Ethylene Synthesis during Stress.

    Science.gov (United States)

    Datta, Riddhi; Kumar, Deepak; Sultana, Asma; Hazra, Saptarshi; Bhattacharyya, Dipto; Chattopadhyay, Sharmila

    2015-12-01

    Glutathione (GSH) plays a fundamental role in plant defense-signaling network. Recently, we have established the involvement of GSH with ethylene (ET) to combat environmental stress. However, the mechanism of GSH-ET interplay still remains unexplored. Here, we demonstrate that GSH induces ET biosynthesis by modulating the transcriptional and posttranscriptional regulations of its key enzymes, 1-aminocyclopropane-1-carboxylate synthase (ACS) and 1-aminocyclopropane-1-carboxylate oxidase (ACO). Transgenic Arabidopsis (Arabidopsis thaliana) plants with enhanced GSH content (AtECS) exhibited remarkable up-regulation of ACS2, ACS6, and ACO1 at transcript as well as protein levels, while they were down-regulated in the GSH-depleted phytoalexin deficient2-1 (pad2-1) mutant. We further observed that GSH induced ACS2 and ACS6 transcription in a WRKY33-dependent manner, while ACO1 transcription remained unaffected. On the other hand, the messenger RNA stability for ACO1 was found to be increased by GSH, which explains our above observations. In addition, we also identified the ACO1 protein to be a subject for S-glutathionylation, which is consistent with our in silico data. However, S-glutathionylation of ACS2 and ACS6 proteins was not detected. Further, the AtECS plants exhibited resistance to necrotrophic infection and salt stress, while the pad2-1 mutant was sensitive. Exogenously applied GSH could improve stress tolerance in wild-type plants but not in the ET-signaling mutant ethylene insensitive2-1, indicating that GSH-mediated resistance to these stresses occurs via an ET-mediated pathway. Together, our investigation reveals a dual-level regulation of ET biosynthesis by GSH during stress.

  14. Using Small RNA Deep Sequencing Data to Detect Human Viruses.

    Science.gov (United States)

    Wang, Fang; Sun, Yu; Ruan, Jishou; Chen, Rui; Chen, Xin; Chen, Chengjie; Kreuze, Jan F; Fei, ZhangJun; Zhu, Xiao; Gao, Shan

    2016-01-01

    Small RNA sequencing (sRNA-seq) can be used to detect viruses in infected hosts without the necessity to have any prior knowledge or specialized sample preparation. The sRNA-seq method was initially used for viral detection and identification in plants and then in invertebrates and fungi. However, it is still controversial to use sRNA-seq in the detection of mammalian or human viruses. In this study, we used 931 sRNA-seq runs of data from the NCBI SRA database to detect and identify viruses in human cells or tissues, particularly from some clinical samples. Six viruses including HPV-18, HBV, HCV, HIV-1, SMRV, and EBV were detected from 36 runs of data. Four viruses were consistent with the annotations from the previous studies. HIV-1 was found in clinical samples without the HIV-positive reports, and SMRV was found in Diffuse Large B-Cell Lymphoma cells for the first time. In conclusion, these results suggest the sRNA-seq can be used to detect viruses in mammals and humans.

  15. Using Small RNA Deep Sequencing Data to Detect Human Viruses

    Directory of Open Access Journals (Sweden)

    Fang Wang

    2016-01-01

    Full Text Available Small RNA sequencing (sRNA-seq can be used to detect viruses in infected hosts without the necessity to have any prior knowledge or specialized sample preparation. The sRNA-seq method was initially used for viral detection and identification in plants and then in invertebrates and fungi. However, it is still controversial to use sRNA-seq in the detection of mammalian or human viruses. In this study, we used 931 sRNA-seq runs of data from the NCBI SRA database to detect and identify viruses in human cells or tissues, particularly from some clinical samples. Six viruses including HPV-18, HBV, HCV, HIV-1, SMRV, and EBV were detected from 36 runs of data. Four viruses were consistent with the annotations from the previous studies. HIV-1 was found in clinical samples without the HIV-positive reports, and SMRV was found in Diffuse Large B-Cell Lymphoma cells for the first time. In conclusion, these results suggest the sRNA-seq can be used to detect viruses in mammals and humans.

  16. Regional age-related changes in neuronal nitric oxide synthase (nNOS, messenger RNA levels and activity in SAMP8 brain

    Directory of Open Access Journals (Sweden)

    Guidon Gérard

    2006-12-01

    Full Text Available Abstract Background Nitric oxide (NO is a multifunctional molecule synthesized by three isozymes of the NO synthase (NOSs acting as a messenger/modulator and/or a potential neurotoxin. In rodents, the role of NOSs in sleep processes and throughout aging is now well established. For example, sleep parameters are highly deteriorated in senescence accelerated-prone 8 (SAMP8 mice, a useful animal model to study aging or age-associated disorders, while the inducible form of NOS (iNOS is down-regulated within the cortex and the sleep-structures of the brainstem. Evidence is now increasing for a role of iNOS and resulting oxidative stress but not for the constitutive expressed isozyme (nNOS. To better understand the role of nNOS in the behavioural impairments observed in SAMP8 versus SAMR1 (control animals, we evaluated age-related variations occurring in the nNOS expression and activity and nitrites/nitrates (NOx- levels, in three brain areas (n = 7 animals in each group. Calibrated reverse transcriptase (RT and real-time polymerase chain reaction (PCR and biochemical procedures were used. Results We found that the levels of nNOS mRNA decreased in the cortex and the hippocampus of 8- vs 2-month-old animals followed by an increase in 12-vs 8-month-old animals in both strains. In the brainstem, levels of nNOS mRNA decreased in an age-dependent manner in SAMP8, but not in SAMR1. Regional age-related changes were also observed in nNOS activity. Moreover, nNOS activity in hippocampus was found lower in 8-month-old SAMP8 than in SAMR1, while in the cortex and the brainstem, nNOS activities increased at 8 months and afterward decreased with age in SAMP8 and SAMR1. NOx- levels showed profiles similar to nNOS activities in the cortex and the brainstem but were undetectable in the hippocampus of SAMP8 and SAMR1. Finally, NOx- levels were higher in the cortex of 8 month-old SAMP8 than in age-matched SAMR1. Conclusion Concomitant variations occurring in NO levels

  17. Expression and alteration of insulin-like growth factor Ⅱ-messenger RNA in hepatoma tissues and peripheral blood of patients with hepatocellular carcinoma

    Institute of Scientific and Technical Information of China (English)

    Zhi-Zhen Dong; Deng-Fu Yao; Deng-Bing Yao; Xin-Hua Wu; Wei Wu; Li-Wei Qiu; Dao-Rong Jiang; Jian-Hua Zhu; Xian-Yong Meng

    2005-01-01

    AIM: To investigate the clinical values of serum free insulin-like growth factor Ⅱ (IGF-Ⅱ) levels and IGF-Ⅱ mRNA in hepatocellular carcinoma (HCC) tissues and peripheral blood for diagnosis of HCC and monitoring of extrahepatic metastasis.METHODS: Total RNAs were extracted from HCC tissues or peripheral blood mononuclear cells from patients with HCC, liver diseases devoid of cancer, non-hepatic tumors,and healthy controls, respectively. IGF-Ⅱ cDNAs were synthesized through random primers and reversetranscriptase, amplified by polymerase chain reaction (PCR), and confirmed by DNA sequencing analysis. Serum free IGF-Ⅱ levels in patients with different liver diseases were analyzed by an enzyme-linked immunosorbent assay.RESULTS: The amplified fragments of IGF-Ⅱ mRNA by RT-PCR were identical to originally designed ones with a size of 170 bp and confirmed by sequencing analysis.The dilution experiments revealed that the lowest sensitivity of our system was 2 ng/L of total RNA. The positive frequencies of IGF-Ⅱ mRNA were 100% in HCC tissues,53.3% in para-cancerous tissues, and 0% in non-cancerous tissues, respectively. The serum free IGF-Ⅱ levels were significantly higher in HCC than those in chronic hepatitis or liver cirrhosis. The positive frequency of circulating IGF-Ⅱ mRNA was 34.2% in HCC, no amplified fragment was found in other liver diseases, extrahepatic tumors,and normal controls, respectively. The circulating IGF-Ⅱ mRNA correlated with the stage of HCC, and its positive rate was 100% in HCC with extrahepatic metastasis and 35.5% in HCC with AFP-negative. No significant correlation was found between tumor sizes and circulating IGF-Ⅱ mRNA fragment.CONCLUSION: The abnormal expressions of free IGF-Ⅱ and IGF-Ⅱ mRNA are useful tumor markers for HCC diagnosis, differentiation of extrahepatic metastasis and monitoring postoperative recurrence.

  18. The distribution of RNA motifs in natural sequences.

    Science.gov (United States)

    Bourdeau, V; Ferbeyre, G; Pageau, M; Paquin, B; Cedergren, R

    1999-11-15

    Functional analysis of genome sequences has largely ignored RNA genes and their structures. We introduce here the notion of 'ribonomics' to describe the search for the distribution of and eventually the determination of the physiological roles of these RNA structures found in the sequence databases. The utility of this approach is illustrated here by the identification in the GenBank database of RNA motifs having known binding or chemical activity. The frequency of these motifs indicates that most have originated from evolutionary drift and are selectively neutral. On the other hand, their distribution among species and their location within genes suggest that the destiny of these motifs may be more elaborate. For example, the hammerhead motif has a skewed organismal presence, is phylogenetically stable and recent work on a schistosome version confirms its in vivo biological activity. The under-representation of the valine-binding motif and the Rev-binding element in GenBank hints at a detrimental effect on cell growth or viability. Data on the presence and the location of these motifs may provide critical guidance in the design of experiments directed towards the understanding and the manipulation of RNA complexes and activities in vivo.

  19. Statistical mechanics of secondary structures formed by random RNA sequences.

    Science.gov (United States)

    Bundschuh, R; Hwa, T

    2002-03-01

    The formation of secondary structures by a random RNA sequence is studied as a model system for the sequence-structure problem omnipresent in biopolymers. Several toy energy models are introduced to allow detailed analytical and numerical studies. First, a two-replica calculation is performed. By mapping the two-replica problem to the denaturation of a single homogeneous RNA molecule in six-dimensional embedding space, we show that sequence disorder is perturbatively irrelevant, i.e., an RNA molecule with weak sequence disorder is in a molten phase where many secondary structures with comparable total energy coexist. A numerical study of various models at high temperature reproduces behaviors characteristic of the molten phase. On the other hand, a scaling argument based on the external statistics of rare regions can be constructed to show that the low-temperature phase is unstable to sequence disorder. We performed a detailed numerical study of the low-temperature phase using the droplet theory as a guide, and characterized the statistics of large-scale, low-energy excitations of the secondary structures from the ground state structure. We find the excitation energy to grow very slowly (i.e., logarithmically) with the length scale of the excitation, suggesting the existence of a marginal glass phase. The transition between the low-temperature glass phase and the high-temperature molten phase is also characterized numerically. It is revealed by a change in the coefficient of the logarithmic excitation energy, from being disorder dominated to being entropy dominated.

  20. Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes.

    Directory of Open Access Journals (Sweden)

    Thomas Birkballe Hansen

    Full Text Available BACKGROUND: miRNAs are key players in gene expression regulation. To fully understand the complex nature of cellular differentiation or initiation and progression of disease, it is important to assess the expression patterns of as many miRNAs as possible. Thereby, identifying novel miRNAs is an essential prerequisite to make possible a comprehensive and coherent understanding of cellular biology. METHODOLOGY/PRINCIPAL FINDINGS: Based on two extensive, but previously published, small RNA sequence datasets from human embryonic stem cells and human embroid bodies, respectively [1], we identified 112 novel miRNA-like structures and were able to validate miRNA processing in 12 out of 17 investigated cases. Several miRNA candidates were furthermore substantiated by including additional available small RNA datasets, thereby demonstrating the power of combining datasets to identify miRNAs that otherwise may be assigned as experimental noise. CONCLUSIONS/SIGNIFICANCE: Our analysis highlights that existing datasets are not yet exhaustedly studied and continuous re-analysis of the available data is important to uncover all features of small RNA sequencing.

  1. The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

    OpenAIRE

    Takaiwa, F; Kusuda, M; Saga, N; Sugiura, M

    1982-01-01

    The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

  2. Finding the most significant common sequence and structure motifs in a set of RNA sequences

    DEFF Research Database (Denmark)

    Gorodkin, Jan; Heyer, L.J.; Stormo, G.D.

    1997-01-01

    version of the Sankoff algorithm for simultaneous folding and alignment of RNA sequences, but maintains tractability by constructing multi-sequence alignments from pairwise comparisons, The algorithm finds the multiple alignments using a greedy approach and has similarities to both CLUSTAL and CONSENSUS......, but the core algorithm assures that the pairwise alignments are optimized for both sequence and structure conservation. The choice of scoring system and the method of progressively constructing the final solution are important considerations that are discussed, Example solutions, and comparisons with other...

  3. Finding noncoding RNA transcripts from low abundance expressed sequence tags

    Institute of Scientific and Technical Information of China (English)

    Chenghai Xue; Fei Li; Fei Li

    2008-01-01

    It has been proved that noncoding RNA (ncRNA) genes are much more numerous than expected.However,it remains a difficult task to identify ncRNAs with either computational algorithms or biological experiments.Recent reports have suggested that ncRNAs may also appear in the expressed sequence tags (EST's) database.Nevertheless,intergenic ESTs have received little attention and are poorly annotated owing to their low abundance.Here,we have developed a computational strategy for discovering ncRNA genes from human ESTs.We first collected ESTs that are located in the intergenic regions and do not have detailed annotations.The intergenic regions were divided into non-overlapping 50-nt windows and PhastCons scores obtained from the UCSC database were assigned to these windows.We kept conserved windows that had PhastCons scores of over 0.8 and that had at least three supporting ESTs to act as seeds.Each cluster of ESTs corresponding to the seeds was assembled into a long contig.We used two criteria to screen for ncRNA transcripts from these contigs:the first was that the longest predicted open reading frame was less than 300 nt and the second was that the likely Pol-Ⅱ promoters exist within 2 000 nt upstream or downstream of the contigs.As a result,118 novel ncRNA genes were identified from human low abundance ESTs.Of seven randomly selected candidates,six were transcribed in human 2BS cells as shown by RT-PCR.Our work proves that the EST is a 'hidden treasure' for detecting novel ncRNA genes.

  4. Integrated mRNA and microRNA transcriptome sequencing characterizes sequence variants and mRNA–microRNA regulatory network in nasopharyngeal carcinoma model systems

    Directory of Open Access Journals (Sweden)

    Carol Ying-Ying Szeto

    2014-01-01

    Full Text Available Nasopharyngeal carcinoma (NPC is a prevalent malignancy in Southeast Asia among the Chinese population. Aberrant regulation of transcripts has been implicated in many types of cancers including NPC. Herein, we characterized mRNA and miRNA transcriptomes by RNA sequencing (RNASeq of NPC model systems. Matched total mRNA and small RNA of undifferentiated Epstein–Barr virus (EBV-positive NPC xenograft X666 and its derived cell line C666, well-differentiated NPC cell line HK1, and the immortalized nasopharyngeal epithelial cell line NP460 were sequenced by Solexa technology. We found 2812 genes and 149 miRNAs (human and EBV to be differentially expressed in NP460, HK1, C666 and X666 with RNASeq; 533 miRNA–mRNA target pairs were inversely regulated in the three NPC cell lines compared to NP460. Integrated mRNA/miRNA expression profiling and pathway analysis show extracellular matrix organization, Beta-1 integrin cell surface interactions, and the PI3K/AKT, EGFR, ErbB, and Wnt pathways were potentially deregulated in NPC. Real-time quantitative PCR was performed on selected mRNA/miRNAs in order to validate their expression. Transcript sequence variants such as short insertions and deletions (INDEL, single nucleotide variant (SNV, and isomiRs were characterized in the NPC model systems. A novel TP53 transcript variant was identified in NP460, HK1, and C666. Detection of three previously reported novel EBV-encoded BART miRNAs and their isomiRs were also observed. Meta-analysis of a model system to a clinical system aids the choice of different cell lines in NPC studies. This comprehensive characterization of mRNA and miRNA transcriptomes in NPC cell lines and the xenograft provides insights on miRNA regulation of mRNA and valuable resources on transcript variation and regulation in NPC, which are potentially useful for mechanistic and preclinical studies.

  5. SimFuse: A Novel Fusion Simulator for RNA Sequencing (RNA-Seq Data

    Directory of Open Access Journals (Sweden)

    Yuxiang Tan

    2015-01-01

    Full Text Available The performance evaluation of fusion detection algorithms from high-throughput sequencing data crucially relies on the availability of data with known positive and negative cases of gene rearrangements. The use of simulated data circumvents some shortcomings of real data by generation of an unlimited number of true and false positive events, and the consequent robust estimation of accuracy measures, such as precision and recall. Although a few simulated fusion datasets from RNA Sequencing (RNA-Seq are available, they are of limited sample size. This makes it difficult to systematically evaluate the performance of RNA-Seq based fusion-detection algorithms. Here, we present SimFuse to address this problem. SimFuse utilizes real sequencing data as the fusions’ background to closely approximate the distribution of reads from a real sequencing library and uses a reference genome as the template from which to simulate fusions’ supporting reads. To assess the supporting read-specific performance, SimFuse generates multiple datasets with various numbers of fusion supporting reads. Compared to an extant simulated dataset, SimFuse gives users control over the supporting read features and the sample size of the simulated library, based on which the performance metrics needed for the validation and comparison of alternative fusion-detection algorithms can be rigorously estimated.

  6. Systems genetics of complex diseases using RNA-sequencing methods

    DEFF Research Database (Denmark)

    Mazzoni, Gianluca; Kogelman, Lisette; Suravajhala, Prashanth

    2015-01-01

    Next generation sequencing technologies have enabled the generation of huge quantities of biological data, and nowadays extensive datasets at different ‘omics levels have been generated. Systems genetics is a powerful approach that allows to integrate different ‘omics level and understand...... non-coding RNAs (ncRNAs). The integration of transcriptomics data with genomic data in a systems genetics context represents a valuable possibility to go deep into the causal and regulatory mechanisms that generate complex traits and diseases. However RNA-Seq data have to be treated carefully...... principally on merits and demerits of tools for post mapping quality control, normalization, differential expression analysis, gene network analysis, and integration of different omics data in order to generate a comprehensive guideline to systems genetics analysis using RNA-Seq data....

  7. Deep Sequencing the MicroRNA Transcriptome in Colorectal Cancer.

    Directory of Open Access Journals (Sweden)

    Kristina Schee

    Full Text Available Colorectal cancer (CRC is one of the leading causes of cancer related deaths and the search for prognostic biomarkers that might improve treatment decisions is warranted. MicroRNAs (miRNAs are short non-coding RNA molecules involved in regulating gene expression and have been proposed as possible biomarkers in CRC. In order to characterize the miRNA transcriptome, a large cohort including 88 CRC tumors with long-term follow-up was deep sequenced. 523 mature miRNAs were expressed in our cohort, and they exhibited largely uniform expression patterns across tumor samples. Few associations were found between clinical parameters and miRNA expression, among them, low expression of miR-592 and high expression of miR-10b-5p and miR-615-3p were associated with tumors located in the right colon relative to the left colon and rectum. High expression of miR-615-3p was also associated with poorly differentiated tumors. No prognostic biomarker candidates for overall and metastasis-free survival were identified by applying the LASSO method in a Cox proportional hazards model or univariate Cox. Examination of the five most abundantly expressed miRNAs in the cohort (miR-10a-5p, miR-21-5p, miR-22-3p, miR-143-3p and miR-192-5p revealed that their collective expression represented 54% of the detected miRNA sequences. Pathway analysis of the target genes regulated by the five most highly expressed miRNAs uncovered a significant number of genes involved in the CRC pathway, including APC, TGFβ and PI3K, thus suggesting that these miRNAs are relevant in CRC.

  8. High throughput 16S rRNA gene amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r...... to the presence of filamentous microorganisms was monitored weekly over 4 months. Microthrix was identified as a causative filament and suitable control measures were introduced. The level of Microthrix was reduced after 1-2 months but a number of other filamentous species were still present, with most of them...

  9. Tetramerization of an RNA oligonucleotide containing a GGGG sequence.

    Science.gov (United States)

    Kim, J; Cheong, C; Moore, P B

    1991-05-23

    Poly rG can form four-stranded helices. The Hoogsteen-paired quartets of G residues on which such structures depend are so stable that they will form in 5'-GMP solutions, provided that Na+ or K+ are present (see for example, refs 2-4). Telomeric DNA sequences, which are G-rich, adopt four-stranded antiparallel G-quartet conformations in vitro, and parallel tetramerization of G-rich sequences may be involved in meiosis. Here we show that RNAs containing short runs of Gs can also tetramerize. A 19-base oligonucleotide derived from the 5S RNA of Escherichia coli (strand III), 5'GCCGAUGGUAGUGUGGGGU3', forms a K(+)-stabilized tetrameric aggregate that depends on the G residues at its 3' end. This complex is so stable that it would be surprising if similar structures do not occur in nature.

  10. Cloning and characterization of mouse growth hormone-releasing hormone (GRH) complementary DNA: increased GRH messenger RNA levels in the growth hormone-deficient lit/lit mouse.

    Science.gov (United States)

    Frohman, M A; Downs, T R; Chomczynski, P; Frohman, L A

    1989-10-01

    We have isolated and cloned the full length cDNA for mouse GH-releasing hormone (mGRH) from mouse hypothalamus using a recently described strategy involving the polymerase chain reaction technique (PCR). Degenerate oligonucleotide primers were selected based on short (six amino acids) conserved regions in the human and rat GRH peptides that would recognize DNA sequences encoding similar amino acids regardless of codon usage. Primer-extended cDNA was amplified by PCR on cDNA templates prepared by reverse transcribing total mouse hypothalamic RNA. After cloning and sequencing the initial product, the 3' and 5' ends of mGRH were generated using a separate PCR strategy (RACE protocol). The mGRH cDNA encodes a 103-amino acid reading frame, structurally similar to the human and rat GRH genes, containing a signal sequence, a 42-residue GRH peptide, and a 31-residue C-terminal region. Although the structures of mouse and rat GRH are highly conserved in the signal peptide and C-terminal region, there is considerable diversity in the GRH region, which exhibits nearly comparable homology with the rat (68%) and human (62%) structures. Differences between mouse and rat GRH were also found in the amino acid cleavage sites at the 5' and 3' ends of the mature peptide and at the polyadenylation signal.(ABSTRACT TRUNCATED AT 250 WORDS)

  11. Small RNA sequencing for profiling microRNAs in long-term preserved formalin-fixed and paraffin-embedded non-small cell lung cancer tumor specimens.

    Directory of Open Access Journals (Sweden)

    Daniel H Buitrago

    Full Text Available The preservation of microRNAs in formalin-fixed and paraffin-embedded (FFPE tissue makes them particularly useful for biomarker studies. The utility of small RNA sequencing for microRNA expression profiling of FFPE samples has yet to be determined.Total RNA was extracted from de-paraffinized and proteinase K-treated FFPE specimens (15-20 years old of 8 human lung adenocarcinoma tumors by affinity chromatography on silica columns. MicroRNAs in the RNA preparations were quantified by the Illumina HiSeq 2000 sequencing platform with sequencing libraries prepared with the TruSeq Small RNA Sample Preparation Kit (version 2.0 to obtain unpaired reads of 50 b for small RNA fragments. MicroRNAs were also quantified using Agilent Human miRNA (release 16.0 microarrays that can detect 1,205 mature microRNAs and by quantitative reverse transcription (RT-PCR assays.Between 9.1-16.9 million reads were obtained by small RNA sequencing of extracted RNA samples. Of these, only 0.6-2.3% (mean = 1.5% represented microRNAs. The sequencing method detected 454-625 microRNAs/sample (mean = 550 compared with 200-349 (mean = 286 microRNAs detected by microarray. In Spearman correlation analyses, the average correlation coefficient for the 126 microRNAs detected in all samples by both methods was 0.37, and >0.5 for 63 microRNAs. In correlation analyses of the sequencing- and RT-PCR-based measurements, the coefficients were 0.19-0.95 (mean = 0.73 and >0.7, respectively, for 7 of 9 examined microRNAs. The average inter-replicate Spearman correlation coefficient for the sequencing method was 0.81.Small RNA sequencing can be used to obtain microRNA profiles of FFPE tissue specimens with performance characteristics similar to those of microarrays, in spite of the fragmentation of ribosomal and messenger RNAs that reduces the method's informative capacity. The accuracy of the method can conceivably be improved by increasing sequencing depth and/or depleting FFPE tissue RNAs of

  12. Long non-coding RNA and alternative splicing modulations in Parkinson's leukocytes identified by RNA sequencing.

    Directory of Open Access Journals (Sweden)

    Lilach Soreq

    2014-03-01

    Full Text Available The continuously prolonged human lifespan is accompanied by increase in neurodegenerative diseases incidence, calling for the development of inexpensive blood-based diagnostics. Analyzing blood cell transcripts by RNA-Seq is a robust means to identify novel biomarkers that rapidly becomes a commonplace. However, there is lack of tools to discover novel exons, junctions and splicing events and to precisely and sensitively assess differential splicing through RNA-Seq data analysis and across RNA-Seq platforms. Here, we present a new and comprehensive computational workflow for whole-transcriptome RNA-Seq analysis, using an updated version of the software AltAnalyze, to identify both known and novel high-confidence alternative splicing events, and to integrate them with both protein-domains and microRNA binding annotations. We applied the novel workflow on RNA-Seq data from Parkinson's disease (PD patients' leukocytes pre- and post- Deep Brain Stimulation (DBS treatment and compared to healthy controls. Disease-mediated changes included decreased usage of alternative promoters and N-termini, 5'-end variations and mutually-exclusive exons. The PD regulated FUS and HNRNP A/B included prion-like domains regulated regions. We also present here a workflow to identify and analyze long non-coding RNAs (lncRNAs via RNA-Seq data. We identified reduced lncRNA expression and selective PD-induced changes in 13 of over 6,000 detected leukocyte lncRNAs, four of which were inversely altered post-DBS. These included the U1 spliceosomal lncRNA and RP11-462G22.1, each entailing sequence complementarity to numerous microRNAs. Analysis of RNA-Seq from PD and unaffected controls brains revealed over 7,000 brain-expressed lncRNAs, of which 3,495 were co-expressed in the leukocytes including U1, which showed both leukocyte and brain increases. Furthermore, qRT-PCR validations confirmed these co-increases in PD leukocytes and two brain regions, the amygdala and substantia

  13. SEXCMD: Development and validation of sex marker sequences for whole-exome/genome and RNA sequencing.

    Science.gov (United States)

    Jeong, Seongmun; Kim, Jiwoong; Park, Won; Jeon, Hongmin; Kim, Namshin

    2017-01-01

    Over the last decade, a large number of nucleotide sequences have been generated by next-generation sequencing technologies and deposited to public databases. However, most of these datasets do not specify the sex of individuals sampled because researchers typically ignore or hide this information. Male and female genomes in many species have distinctive sex chromosomes, XX/XY and ZW/ZZ, and expression levels of many sex-related genes differ between the sexes. Herein, we describe how to develop sex marker sequences from syntenic regions of sex chromosomes and use them to quickly identify the sex of individuals being analyzed. Array-based technologies routinely use either known sex markers or the B-allele frequency of X or Z chromosomes to deduce the sex of an individual. The same strategy has been used with whole-exome/genome sequence data; however, all reads must be aligned onto a reference genome to determine the B-allele frequency of the X or Z chromosomes. SEXCMD is a pipeline that can extract sex marker sequences from reference sex chromosomes and rapidly identify the sex of individuals from whole-exome/genome and RNA sequencing after training with a known dataset through a simple machine learning approach. The pipeline counts total numbers of hits from sex-specific marker sequences and identifies the sex of the individuals sampled based on the fact that XX/ZZ samples do not have Y or W chromosome hits. We have successfully validated our pipeline with mammalian (Homo sapiens; XY) and avian (Gallus gallus; ZW) genomes. Typical calculation time when applying SEXCMD to human whole-exome or RNA sequencing datasets is a few minutes, and analyzing human whole-genome datasets takes about 10 minutes. Another important application of SEXCMD is as a quality control measure to avoid mixing samples before bioinformatics analysis. SEXCMD comprises simple Python and R scripts and is freely available at https://github.com/lovemun/SEXCMD.

  14. Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

    Science.gov (United States)

    Szymanski, Maciej; Karlowski, Wojciech M

    2016-01-01

    In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

  15. Increased messenger RNA levels of the antagonist thyroid hormone receptor erbA-alpha 2 and decreased levels of erbA-alpha 1 and erbA-beta 1 receptor messenger RNAs in neoplastic rodent cells.

    Science.gov (United States)

    Too, C K; Guernsey, D L

    1992-04-15

    Nothern blot analysis of total RNA from the mouse C3H/10T1/2 cell line indicated that the erbA alpha gene transcribed three mRNA species of similar sizes (2.6, 5.5, 6.6 kilobases) as found in rodents. The 2.6-kilobase mRNA (erbA-alpha 2) was approximately 7- to 8-fold more abundant than either the 5.5- (erbA-alpha 1) or 6.6-kilobase species. The expression of the erbA-alpha 2 transcript increased 3- to 30-fold when "normal" mouse or rat cells were growth arrested by concluence. Triiodothyronine, at a concentration of 1 nM, had no effect on the levels of the erbA-alpha mRNA species in confluent cells nor on the levels of erbA-alpha 2 in proliferative normal or transformed C3H/10T1/2 cells. In log-phase growing cells there was a 2.5- to 5-fold increase in the relative expression of erbA-alpha 2 mRNA in transformed mouse C3H/10T1/2 cells, transformed cloned rat embryo fibroblasts (CREF), transformed rat embryo fibroblasts (REF), and a transformed temperature-sensitive rat mutant cell line (ts7E) when compared with their non-transformed counterparts. In contrast to the elevation of erbA-alpha 2 in transformed cells, erbA-alpha 1 and erbA-beta 1 mRNAs decreased in transformed mouse and rat cell lines. In conclusion, it is suggested that the increased levels of the erbA-alpha 2 transcript and the decreased levels of erbA-alpha 1 and erbA-beta 1 in neoplastic cells may account for the loss of thyroid hormone regulation of inducible pathways and decreased nuclear triiodothyronine binding as previously reported.

  16. A method for clustering of miRNA sequences using fragmented programming

    Science.gov (United States)

    Ivashchenko, Anatoly; Pyrkova, Anna; Niyazova, Raigul

    2016-01-01

    Clustering of miRNA sequences is an important problem in molecular genetics associated cellular biology. Thousands of such sequences are known today through advancement in sophisticated molecular tools, sequencing techniques, computational resources and rule based mathematical models. Analysis of such large-scale miRNA sequences for inferring patterns towards deducing cellular function is a great challenge in modern molecular biology. Therefore, it is of interest to develop mathematical models specific for miRNA sequences. The process is to group (cluster) such miRNA sequences using well-defined known features. We describe a method for clustering of miRNA sequences using fragmented programming. Subsequently, we illustrated the utility of the model using a dendrogram (a tree diagram) for publically known A.thaliana miRNA nucleotide sequences towards the inference of observed conserved patterns PMID:27212839

  17. Improved definition of the mouse transcriptome via targeted RNA sequencing.

    Science.gov (United States)

    Bussotti, Giovanni; Leonardi, Tommaso; Clark, Michael B; Mercer, Tim R; Crawford, Joanna; Malquori, Lorenzo; Notredame, Cedric; Dinger, Marcel E; Mattick, John S; Enright, Anton J

    2016-05-01

    Targeted RNA sequencing (CaptureSeq) uses oligonucleotide probes to capture RNAs for sequencing, providing enriched read coverage, accurate measurement of gene expression, and quantitative expression data. We applied CaptureSeq to refine transcript annotations in the current murine GRCm38 assembly. More than 23,000 regions corresponding to putative or annotated long noncoding RNAs (lncRNAs) and 154,281 known splicing junction sites were selected for targeted sequencing across five mouse tissues and three brain subregions. The results illustrate that the mouse transcriptome is considerably more complex than previously thought. We assemble more complete transcript isoforms than GENCODE, expand transcript boundaries, and connect interspersed islands of mapped reads. We describe a novel filtering pipeline that identifies previously unannotated but high-quality transcript isoforms. In this set, 911 GENCODE neighboring genes are condensed into 400 expanded gene models. Additionally, 594 GENCODE lncRNAs acquire an open reading frame (ORF) when their structure is extended with CaptureSeq. Finally, we validate our observations using current FANTOM and Mouse ENCODE resources.

  18. Transcriptional profiling of bovine milk using RNA sequencing

    Directory of Open Access Journals (Sweden)

    Wickramasinghe Saumya

    2012-01-01

    Full Text Available Abstract Background Cow milk is a complex bioactive fluid consumed by humans beyond infancy. Even though the chemical and physical properties of cow milk are well characterized, very limited research has been done on characterizing the milk transcriptome. This study performs a comprehensive expression profiling of genes expressed in milk somatic cells of transition (day 15, peak (day 90 and late (day 250 lactation Holstein cows by RNA sequencing. Milk samples were collected from Holstein cows at 15, 90 and 250 days of lactation, and RNA was extracted from the pelleted milk cells. Gene expression analysis was conducted by Illumina RNA sequencing. Sequence reads were assembled and analyzed in CLC Genomics Workbench. Gene Ontology (GO and pathway analysis were performed using the Blast2GO program and GeneGo application of MetaCore program. Results A total of 16,892 genes were expressed in transition lactation, 19,094 genes were expressed in peak lactation and 18,070 genes were expressed in late lactation. Regardless of the lactation stage approximately 9,000 genes showed ubiquitous expression. Genes encoding caseins, whey proteins and enzymes in lactose synthesis pathway showed higher expression in early lactation. The majority of genes in the fat metabolism pathway had high expression in transition and peak lactation milk. Most of the genes encoding for endogenous proteases and enzymes in ubiquitin-proteasome pathway showed higher expression along the course of lactation. Conclusions This is the first study to describe the comprehensive bovine milk transcriptome in Holstein cows. The results revealed that 69% of NCBI Btau 4.0 annotated genes are expressed in bovine milk somatic cells. Most of the genes were ubiquitously expressed in all three stages of lactation. However, a fraction of the milk transcriptome has genes devoted to specific functions unique to the lactation stage. This indicates the ability of milk somatic cells to adapt to different

  19. RNA expression profile of calcified bicuspid, tricuspid, and normal human aortic valves by RNA sequencing.

    Science.gov (United States)

    Guauque-Olarte, Sandra; Droit, Arnaud; Tremblay-Marchand, Joël; Gaudreault, Nathalie; Kalavrouziotis, Dimitri; Dagenais, Francois; Seidman, Jonathan G; Body, Simon C; Pibarot, Philippe; Mathieu, Patrick; Bossé, Yohan

    2016-10-01

    The molecular mechanisms leading to premature development of aortic valve stenosis (AS) in individuals with a bicuspid aortic valve are unknown. The objective of this study was to identify genes differentially expressed between calcified bicuspid aortic valves (BAVc) and tricuspid valves with (TAVc) and without (TAVn) AS using RNA sequencing (RNA-Seq). We collected 10 human BAVc and nine TAVc from men who underwent primary aortic valve replacement. Eight TAVn were obtained from men who underwent heart transplantation. mRNA levels were measured by RNA-Seq and compared between valve groups. Two genes were upregulated, and none were downregulated in BAVc compared with TAVc, suggesting a similar gene expression response to AS in individuals with bicuspid and tricuspid valves. There were 462 genes upregulated and 282 downregulated in BAVc compared with TAVn. In TAVc compared with TAVn, 329 genes were up- and 170 were downregulated. A total of 273 upregulated and 147 downregulated genes were concordantly altered between BAVc vs. TAVn and TAVc vs. TAVn, which represent 56 and 84% of significant genes in the first and second comparisons, respectively. This indicates that extra genes and pathways were altered in BAVc. Shared pathways between calcified (BAVc and TAVc) and normal (TAVn) aortic valves were also more extensively altered in BAVc. The top pathway enriched for genes differentially expressed in calcified compared with normal valves was fibrosis, which support the remodeling process as a therapeutic target. These findings are relevant to understand the molecular basis of AS in patients with bicuspid and tricuspid valves.

  20. Annealing to sequences within the primer binding site loop promotes an HIV-1 RNA conformation favoring RNA dimerization and packaging.

    Science.gov (United States)

    Seif, Elias; Niu, Meijuan; Kleiman, Lawrence

    2013-10-01

    The 5' untranslated region (5' UTR) of HIV-1 genomic RNA (gRNA) includes structural elements that regulate reverse transcription, transcription, translation, tRNA(Lys3) annealing to the gRNA, and gRNA dimerization and packaging into viruses. It has been reported that gRNA dimerization and packaging are regulated by changes in the conformation of the 5'-UTR RNA. In this study, we show that annealing of tRNA(Lys3) or a DNA oligomer complementary to sequences within the primer binding site (PBS) loop of the 5' UTR enhances its dimerization in vitro. Structural analysis of the 5'-UTR RNA using selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) shows that the annealing promotes a conformational change of the 5' UTR that has been previously reported to favor gRNA dimerization and packaging into virus. The model predicted by SHAPE analysis is supported by antisense experiments designed to test which annealed sequences will promote or inhibit gRNA dimerization. Based on reports showing that the gRNA dimerization favors its incorporation into viruses, we tested the ability of a mutant gRNA unable to anneal to tRNA(Lys3) to be incorporated into virions. We found a ∼60% decrease in mutant gRNA packaging compared with wild-type gRNA. Together, these data further support a model for viral assembly in which the initial annealing of tRNA(Lys3) to gRNA is cytoplasmic, which in turn aids in the promotion of gRNA dimerization and its incorporation into virions.

  1. Transcriptome sequencing of the Microarray Quality Control (MAQC RNA reference samples using next generation sequencing

    Directory of Open Access Journals (Sweden)

    Thierry-Mieg Danielle

    2009-06-01

    Full Text Available Abstract Background Transcriptome sequencing using next-generation sequencing platforms will soon be competing with DNA microarray technologies for global gene expression analysis. As a preliminary evaluation of these promising technologies, we performed deep sequencing of cDNA synthesized from the Microarray Quality Control (MAQC reference RNA samples using Roche's 454 Genome Sequencer FLX. Results We generated more that 3.6 million sequence reads of average length 250 bp for the MAQC A and B samples and introduced a data analysis pipeline for translating cDNA read counts into gene expression levels. Using BLAST, 90% of the reads mapped to the human genome and 64% of the reads mapped to the RefSeq database of well annotated genes with e-values ≤ 10-20. We measured gene expression levels in the A and B samples by counting the numbers of reads that mapped to individual RefSeq genes in multiple sequencing runs to evaluate the MAQC quality metrics for reproducibility, sensitivity, specificity, and accuracy and compared the results with DNA microarrays and Quantitative RT-PCR (QRTPCR from the MAQC studies. In addition, 88% of the reads were successfully aligned directly to the human genome using the AceView alignment programs with an average 90% sequence similarity to identify 137,899 unique exon junctions, including 22,193 new exon junctions not yet contained in the RefSeq database. Conclusion Using the MAQC metrics for evaluating the performance of gene expression platforms, the ExpressSeq results for gene expression levels showed excellent reproducibility, sensitivity, and specificity that improved systematically with increasing shotgun sequencing depth, and quantitative accuracy that was comparable to DNA microarrays and QRTPCR. In addition, a careful mapping of the reads to the genome using the AceView alignment programs shed new light on the complexity of the human transcriptome including the discovery of thousands of new splice variants.

  2. Sequence of the 16S Ribosomal RNA from Halobacterium volcanii, an Archaebacterium.

    Science.gov (United States)

    Gupta, R; Lanter, J M; Woese, C R

    1983-08-12

    The sequence of the 16S ribosomal RNA (rRNA) from the archaebacterium Halobacterium volcanii has been determined by DNA sequencing methods. The archaebacterial rRNA is similar to its eubacterial counterpart in secondary structure. Although it is closer in sequence to the eubacterial 16S rRNA than to the eukaryotic 16S-like rRNA, the H. volcanii sequence also shows certain points of specific similarity to its eukaryotic counterpart. Since the H. volcanii sequence is closer to both the eubacterial and the eukaryotic sequences than these two are to one another, it follows that the archaebacterial sequence resembles their common ancestral sequence more closely than does either of the other two versions.

  3. FASTR: A novel data format for concomitant representation of RNA sequence and secondary structure information.

    Science.gov (United States)

    Bose, Tungadri; Dutta, Anirban; Mh, Mohammed; Gandhi, Hemang; Mande, Sharmila S

    2015-09-01

    Given the importance of RNA secondary structures in defining their biological role, it would be convenient for researchers seeking RNA data if both sequence and structural information pertaining to RNA molecules are made available together. Current nucleotide data repositories archive only RNA sequence data. Furthermore, storage formats which can frugally represent RNA sequence as well as structure data in a single file, are currently unavailable. This article proposes a novel storage format, 'FASTR', for concomitant representation of RNA sequence and structure. The storage efficiency of the proposed FASTR format has been evaluated using RNA data from various microorganisms. Results indicate that the size of FASTR formatted files (containing both RNA sequence as well as structure information) are equivalent to that of FASTA-format files, which contain only RNA sequence information. RNA secondary structure is typically represented using a combination of a string of nucleotide characters along with the corresponding dot-bracket notation indicating structural attributes. 'FASTR' - the novel storage format proposed in the present study enables a frugal representation of both RNA sequence and structural information in the form of a single string. In spite of having a relatively smaller storage footprint, the resultant 'fastr' string(s) retain all sequence as well as secondary structural information that could be stored using a dot-bracket notation. An implementation of the 'FASTR' methodology is available for download at http://metagenomics.atc.tcs.com/compression/fastr.

  4. FASTR: A novel data format for concomitant representation of RNA sequence and secondary structure information

    Indian Academy of Sciences (India)

    Tungadri Bose; Anirban Dutta; Mohammed Mh; Hemang Gandhi; Sharmila S Mande

    2015-09-01

    Given the importance of RNA secondary structures in defining their biological role, it would be convenient for researchers seeking RNA data if both sequence and structural information pertaining to RNA molecules are made available together. Current nucleotide data repositories archive only RNA sequence data. Furthermore, storage formats which can frugally represent RNA sequence as well as structure data in a single file, are currently unavailable. This article proposes a novel storage format, `FASTR’, for concomitant representation of RNA sequence and structure. The storage efficiency of the proposed FASTR format has been evaluated using RNA data from various microorganisms. Results indicate that the size of FASTR formatted files (containing both RNA sequence as well as structure information) are equivalent to that of FASTA-format files, which contain only RNA sequence information. RNA secondary structure is typically represented using a combination of a string of nucleotide characters along with the corresponding dot-bracket notation indicating structural attributes. `FASTR’ – the novel storage format proposed in the present study enables a frugal representation of both RNA sequence and structural information in the form of a single string. In spite of having a relatively smaller storage footprint, the resultant `fastr’ string(s) retain all sequence as well as secondary structural information that could be stored using a dot-bracket notation. An implementation of the `FASTR’ methodology is available for download at http://metagenomics.atc.tcs.com/compression/fastr.

  5. Polyadenylation of RNA transcribed from mammalian SINEs by RNA polymerase III: Complex requirements for nucleotide sequences.

    Science.gov (United States)

    Borodulina, Olga R; Golubchikova, Julia S; Ustyantsev, Ilia G; Kramerov, Dmitri A

    2016-02-01

    It is generally accepted that only transcripts synthesized by RNA polymerase II (e.g., mRNA) were subject to AAUAAA-dependent polyadenylation. However, we previously showed that RNA transcribed by RNA polymerase III (pol III) from mouse B2 SINE could be polyadenylated in an AAUAAA-dependent manner. Many species of mammalian SINEs end with the pol III transcriptional terminator (TTTTT) and contain hexamers AATAAA in their A-rich tail. Such SINEs were united into Class T(+), whereas SINEs lacking the terminator and AATAAA sequences were classified as T(-). Here we studied the structural features of SINE pol III transcripts that are necessary for their polyadenylation. Eight and six SINE families from classes T(+) and T(-), respectively, were analyzed. The replacement of AATAAA with AACAAA in T(+) SINEs abolished the RNA polyadenylation. Interestingly, insertion of the polyadenylation signal (AATAAA) and pol III transcription terminator in T(-) SINEs did not result in polyadenylation. The detailed analysis of three T(+) SINEs (B2, DIP, and VES) revealed areas important for the polyadenylation of their pol III transcripts: the polyadenylation signal and terminator in A-rich tail, β region positioned immediately downstream of the box B of pol III promoter, and τ region located upstream of the tail. In DIP and VES (but not in B2), the τ region is a polypyrimidine motif which is also characteristic of many other T(+) SINEs. Most likely, SINEs of different mammals acquired these structural features independently as a result of parallel evolution. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Transmembrane Signalling: Membrane messengers

    Science.gov (United States)

    Cockroft, Scott L.

    2017-05-01

    Life has evolved elaborate means of communicating essential chemical information across cell membranes. Inspired by biology, two new artificial mechanisms have now been developed that use synthetic messenger molecules to relay chemical signals into or across lipid membranes.

  7. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons.

    Science.gov (United States)

    Olson, Nathan D; Lund, Steven P; Zook, Justin M; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B

    2015-03-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing(®), or Ion Torrent PGM(®). The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  8. Pea enation mosaic virus genoma RNA contains no polyadenylate sequences and cannot be aminoacylated.

    Science.gov (United States)

    German, T L; De Zoeten, G A; Hall, T C

    1978-01-01

    An active synthetase enzyme preparation from peas (Pisum sativum L.) did not catalyze the aminoacylation of pea enation mosaic virus RNA. The viral RNA was shown not to contain polyadenylic acid sequences.

  9. Targeted RNA Sequencing Assay to Characterize Gene Expression and Genomic Alterations

    Science.gov (United States)

    Martin, Dorrelyn P.; Miya, Jharna; Reeser, Julie W.; Roychowdhury, Sameek

    2017-01-01

    RNA sequencing (RNAseq) is a versatile method that can be utilized to detect and characterize gene expression, mutations, gene fusions, and noncoding RNAs. Standard RNAseq requires 30 – 100 million sequencing reads and can include multiple RNA products such as mRNA and noncoding RNAs. We demonstrate how targeted RNAseq (capture) permits a focused study on selected RNA products using a desktop sequencer. RNAseq capture can characterize unannotated, low, or transiently expressed transcripts that may otherwise be missed using traditional RNAseq methods. Here we describe the extraction of RNA from cell lines, ribosomal RNA depletion, cDNA synthesis, preparation of barcoded libraries, hybridization and capture of targeted transcripts and multiplex sequencing on a desktop sequencer. We also outline the computational analysis pipeline, which includes quality control assessment, alignment, fusion detection, gene expression quantification and identification of single nucleotide variants. This assay allows for targeted transcript sequencing to characterize gene expression, gene fusions, and mutations. PMID:27585245

  10. Genome Sequence of Mycobacteriophage Momo.

    Science.gov (United States)

    Pope, Welkin H; Bina, Elizabeth A; Brahme, Indraneel S; Hill, Amy B; Himmelstein, Philip H; Hunsicker, Sara M; Ish, Amanda R; Le, Tinh S; Martin, Mary M; Moscinski, Catherine N; Shetty, Sameer A; Swierzewski, Tomasz; Iyengar, Varun B; Kim, Hannah; Schafer, Claire E; Grubb, Sarah R; Warner, Marcie H; Bowman, Charles A; Russell, Daniel A; Hatfull, Graham F

    2015-06-18

    Momo is a newly discovered phage of Mycobacterium smegmatis mc(2)155. Momo has a double-stranded DNA genome 154,553 bp in length, with 233 predicted protein-encoding genes, 34 tRNA genes, and one transfer-messenger RNA (tmRNA) gene. Momo has a myoviral morphology and shares extensive nucleotide sequence similarity with subcluster C1 mycobacteriophages. Copyright © 2015 Pope et al.

  11. Genome-wide analyses of Epstein-Barr virus reveal conserved RNA structures and a novel stable intronic sequence RNA

    OpenAIRE

    2013-01-01

    Background Epstein-Barr virus (EBV) is a human herpesvirus implicated in cancer and autoimmune disorders. Little is known concerning the roles of RNA structure in this important human pathogen. This study provides the first comprehensive genome-wide survey of RNA and RNA structure in EBV. Results Novel EBV RNAs and RNA structures were identified by computational modeling and RNA-Seq analyses of EBV. Scans of the genomic sequences of four EBV strains (EBV-1, EBV-2, GD1, and GD2) and of the clo...

  12. RNA reprogramming of alpha-mannosidase mRNA sequences in vitro by myxomycete group IC1 and IE ribozymes.

    Science.gov (United States)

    Fiskaa, Tonje; Lundblad, Eirik W; Henriksen, Jørn R; Johansen, Steinar D; Einvik, Christer

    2006-06-01

    Trans-splicing group I ribozymes have been introduced in order to mediate RNA reprogramming (including RNA repair) of therapeutically relevant RNA transcripts. Efficient RNA reprogramming depends on the appropriate efficiency of the reaction, and several attempts, including optimization of target recognition and ribozyme catalysis, have been performed. In most studies, the Tetrahymena group IC1 ribozyme has been applied. Here we investigate the potential of group IC1 and group IE intron ribozymes, derived from the myxomycetes Didymium and Fuligo, in addition to the Tetrahymena ribozyme, for RNA reprogramming of a mutated alpha-mannosidase mRNA sequence. Randomized internal guide sequences were introduced for all four ribozymes and used to select accessible sites within isolated mutant alpha-mannosidase mRNA from mammalian COS-7 cells. Two accessible sites common to all the group I ribozymes were identified and further investigated in RNA reprogramming by trans-splicing analyses. All the myxomycete ribozymes performed the trans-splicing reaction with high fidelity, resulting in the conversion of mutated alpha-mannosidase RNA into wild-type sequence. RNA protection analysis revealed that the myxomycete ribozymes perform trans-splicing at approximately similar efficiencies as the Tetrahymena ribozyme. Interestingly, the relative efficiency among the ribozymes tested correlates with structural features of the P4-P6-folding domain, consistent with the fact that efficient folding is essential for group I intron trans-splicing.

  13. High-fat diet-induced reduction of peroxisome proliferator-activated receptor-γ coactivator-1α messenger RNA levels and oxidative capacity in the soleus muscle of rats with metabolic syndrome.

    Science.gov (United States)

    Nagatomo, Fumiko; Fujino, Hidemi; Kondo, Hiroyo; Takeda, Isao; Tsuda, Kinsuke; Ishihara, Akihiko

    2012-02-01

    Animal models of type 2 diabetes exhibit reduced peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α) messenger RNA (mRNA) levels, which are associated with decreased oxidative capacity, in skeletal muscles. In contrast, animal models with metabolic syndrome show normal PGC-1α mRNA levels. We hypothesized that a high-fat diet decreases PGC-1α mRNA levels in skeletal muscles of rats with metabolic syndrome, reducing muscle oxidative capacity and accelerating metabolic syndrome or inducing type 2 diabetes. We examined mRNA levels and fiber profiles in the soleus muscles of rats with metabolic syndrome (SHR/NDmcr-cp [cp/cp]; CP) fed a high-fat diet. Five-week-old CP rats were assigned to a sedentary group (CP-N) that was fed a standard diet (15.1 kJ/g, 23.6% protein, 5.3% fat, and 54.4% carbohydrates) or a sedentary group (CP-H) that was fed a high-fat diet (21.6 kJ/g, 23.6% protein, 34.9% fat, and 25.9% carbohydrates) and were housed for 10 weeks. Body weight, energy intake, and systolic blood pressure were higher in the CP-H group than in the CP-N group. Nonfasting glucose, triglyceride, total cholesterol, and leptin levels were higher in the CP-H group than in the CP-N group. There was no difference in insulin levels between the CP-N and CP-H groups. Muscle PGC-1α mRNA levels and succinate dehydrogenase activity were lower in the CP-H group than in the CP-N group. We concluded that a high-fat diet reduces PGC-1α mRNA levels and oxidative capacity in skeletal muscles and accelerates metabolic syndrome.

  14. Deletion analysis of the 5' untranslated leader sequence of tobacco mosaic virus RNA.

    OpenAIRE

    Takamatsu, N; Watanabe, Y.; Iwasaki, T.; Shiba, T.; Meshi, T; Okada, Y.

    1991-01-01

    To determine the sequences essential for viral multiplication in the 5' untranslated leader sequence of tobacco mosaic virus RNA, mutant TMV-L (a tomato strain) RNAs which carry several deletions in this 71-nucleotide sequence were constructed by an in vitro transcription system and their multiplication was analyzed by introducing mutant RNA into tobacco protoplasts by electroporation. Large deletions of the sequence from nucleotides 9 to 47 or 25 to 71 abolished viral multiplication; when ab...

  15. Equally parsimonious pathways through an RNA sequence space are not equally likely

    Science.gov (United States)

    Lee, Y. H.; DSouza, L. M.; Fox, G. E.

    1997-01-01

    An experimental system for determining the potential ability of sequences resembling 5S ribosomal RNA (rRNA) to perform as functional 5S rRNAs in vivo in the Escherichia coli cellular environment was devised previously. Presumably, the only 5S rRNA sequences that would have been fixed by ancestral populations are ones that were functionally valid, and hence the actual historical paths taken through RNA sequence space during 5S rRNA evolution would have most likely utilized valid sequences. Herein, we examine the potential validity of all sequence intermediates along alternative equally parsimonious trajectories through RNA sequence space which connect two pairs of sequences that had previously been shown to behave as valid 5S rRNAs in E. coli. The first trajectory requires a total of four changes. The 14 sequence intermediates provide 24 apparently equally parsimonious paths by which the transition could occur. The second trajectory involves three changes, six intermediate sequences, and six potentially equally parsimonious paths. In total, only eight of the 20 sequence intermediates were found to be clearly invalid. As a consequence of the position of these invalid intermediates in the sequence space, seven of the 30 possible paths consisted of exclusively valid sequences. In several cases, the apparent validity/invalidity of the intermediate sequences could not be anticipated on the basis of current knowledge of the 5S rRNA structure. This suggests that the interdependencies in RNA sequence space may be more complex than currently appreciated. If ancestral sequences predicted by parsimony are to be regarded as actual historical sequences, then the present results would suggest that they should also satisfy a validity requirement and that, in at least limited cases, this conjecture can be tested experimentally.

  16. Maternal Plasma DNA and RNA Sequencing for Prenatal Testing.

    Science.gov (United States)

    Tamminga, Saskia; van Maarle, Merel; Henneman, Lidewij; Oudejans, Cees B M; Cornel, Martina C; Sistermans, Erik A

    2016-01-01

    Cell-free DNA (cfDNA) testing has recently become indispensable in diagnostic testing and screening. In the prenatal setting, this type of testing is often called noninvasive prenatal testing (NIPT). With a number of techniques, using either next-generation sequencing or single nucleotide polymorphism-based approaches, fetal cfDNA in maternal plasma can be analyzed to screen for rhesus D genotype, common chromosomal aneuploidies, and increasingly for testing other conditions, including monogenic disorders. With regard to screening for common aneuploidies, challenges arise when implementing NIPT in current prenatal settings. Depending on the method used (targeted or nontargeted), chromosomal anomalies other than trisomy 21, 18, or 13 can be detected, either of fetal or maternal origin, also referred to as unsolicited or incidental findings. For various biological reasons, there is a small chance of having either a false-positive or false-negative NIPT result, or no result, also referred to as a "no-call." Both pre- and posttest counseling for NIPT should include discussing potential discrepancies. Since NIPT remains a screening test, a positive NIPT result should be confirmed by invasive diagnostic testing (either by chorionic villus biopsy or by amniocentesis). As the scope of NIPT is widening, professional guidelines need to discuss the ethics of what to offer and how to offer. In this review, we discuss the current biochemical, clinical, and ethical challenges of cfDNA testing in the prenatal setting and its future perspectives including novel applications that target RNA instead of DNA.

  17. A cross-sectional study of a prototype carcinogenic human papillomavirus E6/E7 messenger RNA assay for detection of cervical precancer and cancer.

    Science.gov (United States)

    Castle, Philip E; Dockter, Janel; Giachetti, Cristina; Garcia, Francisco A R; McCormick, Mary Kay; Mitchell, Amy L; Holladay, E Blair; Kolk, Daniel P

    2007-05-01

    To evaluate carcinogenic human papillomavirus (HPV) mRNA for E6 and E7 mRNA detection on clinical specimens to identify women with cervical precancer and cancer. We evaluated a prototype assay that collectively detects oncogenes E6/E7 mRNA for 14 carcinogenic HPV genotypes on a sample of liquid cytology specimens (n=531), masked to clinical data and to the presence of HPV genotypes detected by PGMY09/11 L1 consensus primer PCR assay. We found an increasing likelihood of testing positive for carcinogenic HPV E6/E7 mRNA with increasing severity of cytology (P(Trend) E6/E7 mRNA. Overall, fewer specimens tested positive for carcinogenic HPV E6/E7 mRNA than for carcinogenic HPV DNA (PE6/E7 mRNA improved the association of positive test results with cervical precancer and cancer by reducing the number of test positives in women without precancer without reducing clinical sensitivity for cervical precancer and cancer compared with detection of carcinogenic HPV E6/E7 mRNA using a lower positive cutpoint by the same assay and with detection of carcinogenic HPV DNA. We found that carcinogenic HPV E6/E7 mRNA is a potentially useful biomarker for detection of cervical precancer and cancer and warrants further evaluation.

  18. Evaluating methods for isolating total RNA and predicting the success of sequencing phylogenetically diverse plant transcriptomes.

    Science.gov (United States)

    Johnson, Marc T J; Carpenter, Eric J; Tian, Zhijian; Bruskiewich, Richard; Burris, Jason N; Carrigan, Charlotte T; Chase, Mark W; Clarke, Neil D; Covshoff, Sarah; Depamphilis, Claude W; Edger, Patrick P; Goh, Falicia; Graham, Sean; Greiner, Stephan; Hibberd, Julian M; Jordon-Thaden, Ingrid; Kutchan, Toni M; Leebens-Mack, James; Melkonian, Michael; Miles, Nicholas; Myburg, Henrietta; Patterson, Jordan; Pires, J Chris; Ralph, Paula; Rolf, Megan; Sage, Rowan F; Soltis, Douglas; Soltis, Pamela; Stevenson, Dennis; Stewart, C Neal; Surek, Barbara; Thomsen, Christina J M; Villarreal, Juan Carlos; Wu, Xiaolei; Zhang, Yong; Deyholos, Michael K; Wong, Gane Ka-Shu

    2012-01-01

    Next-generation sequencing plays a central role in the characterization and quantification of transcriptomes. Although numerous metrics are purported to quantify the quality of RNA, there have been no large-scale empirical evaluations of the major determinants of sequencing success. We used a combination of existing and newly developed methods to isolate total RNA from 1115 samples from 695 plant species in 324 families, which represents >900 million years of phylogenetic diversity from green algae through flowering plants, including many plants of economic importance. We then sequenced 629 of these samples on Illumina GAIIx and HiSeq platforms and performed a large comparative analysis to identify predictors of RNA quality and the diversity of putative genes (scaffolds) expressed within samples. Tissue types (e.g., leaf vs. flower) varied in RNA quality, sequencing depth and the number of scaffolds. Tissue age also influenced RNA quality but not the number of scaffolds ≥ 1000 bp. Overall, 36% of the variation in the number of scaffolds was explained by metrics of RNA integrity (RIN score), RNA purity (OD 260/230), sequencing platform (GAIIx vs HiSeq) and the amount of total RNA used for sequencing. However, our results show that the most commonly used measures of RNA quality (e.g., RIN) are weak predictors of the number of scaffolds because Illumina sequencing is robust to variation in RNA quality. These results provide novel insight into the methods that are most important in isolating high quality RNA for sequencing and assembling plant transcriptomes. The methods and recommendations provided here could increase the efficiency and decrease the cost of RNA sequencing for individual labs and genome centers.

  19. Evaluating methods for isolating total RNA and predicting the success of sequencing phylogenetically diverse plant transcriptomes.

    Directory of Open Access Journals (Sweden)

    Marc T J Johnson

    Full Text Available Next-generation sequencing plays a central role in the characterization and quantification of transcriptomes. Although numerous metrics are purported to quantify the quality of RNA, there have been no large-scale empirical evaluations of the major determinants of sequencing success. We used a combination of existing and newly developed methods to isolate total RNA from 1115 samples from 695 plant species in 324 families, which represents >900 million years of phylogenetic diversity from green algae through flowering plants, including many plants of economic importance. We then sequenced 629 of these samples on Illumina GAIIx and HiSeq platforms and performed a large comparative analysis to identify predictors of RNA quality and the diversity of putative genes (scaffolds expressed within samples. Tissue types (e.g., leaf vs. flower varied in RNA quality, sequencing depth and the number of scaffolds. Tissue age also influenced RNA quality but not the number of scaffolds ≥ 1000 bp. Overall, 36% of the variation in the number of scaffolds was explained by metrics of RNA integrity (RIN score, RNA purity (OD 260/230, sequencing platform (GAIIx vs HiSeq and the amount of total RNA used for sequencing. However, our results show that the most commonly used measures of RNA quality (e.g., RIN are weak predictors of the number of scaffolds because Illumina sequencing is robust to variation in RNA quality. These results provide novel insight into the methods that are most important in isolating high quality RNA for sequencing and assembling plant transcriptomes. The methods and recommendations provided here could increase the efficiency and decrease the cost of RNA sequencing for individual labs and genome centers.

  20. Thousands of corresponding human and mouse genomic regions unalignable in primary sequence contain common RNA structure

    DEFF Research Database (Denmark)

    Torarinsson, Elfar; Sawera, Milena; Havgaard, Jakob Hull

    2006-01-01

    been investigated. Owing to the limitations in computational methods, comparative genomics has been lacking the ability to compare such nonconserved sequence regions for conserved structural RNA elements. We have investigated the presence of structural RNA elements by conducting a local structural...... alignment, using FOLDALIGN, on a subset of these 100,000 corresponding regions and estimate that 1800 contain common RNA structures. Comparing our results with the recent mapping of transcribed fragments (transfrags) in human, we find that high-scoring candidates are twice as likely to be found in regions...... expressed non-coding RNA sequences not alignable in primary sequence....

  1. Evaluating Quality of Aged Archival Formalin-Fixed Paraffin-Embedded Samples for RNA-Sequencing

    Science.gov (United States)

    Archival formalin-fixed paraffin-embedded (FFPE) samples offer a vast, untapped source of genomic data for biomarker discovery. However, the quality of FFPE samples is often highly variable, and conventional methods to assess RNA quality for RNA-sequencing (RNA-seq) are not infor...

  2. Evaluating Quality of Aged Archival Formalin-Fixed Paraffin-Embedded Samples for RNA-Sequencing

    Science.gov (United States)

    Archival formalin-fixed paraffin-embedded (FFPE) samples offer a vast, untapped source of genomic data for biomarker discovery. However, the quality of FFPE samples is often highly variable, and conventional methods to assess RNA quality for RNA-sequencing (RNA-seq) are not infor...

  3. Rapid Amplification of cDNA Ends for RNA Transcript Sequencing in Staphylococcus.

    Science.gov (United States)

    Miller, Eric

    2016-01-01

    Rapid amplification of cDNA ends (RACE) is a technique that was developed to swiftly and efficiently amplify full-length RNA molecules in which the terminal ends have not been characterized. Current usage of this procedure has been more focused on sequencing and characterizing RNA 5' and 3' untranslated regions. Herein is described an adapted RACE protocol to amplify bacterial RNA transcripts.

  4. PTB and TIAR binding to insulin mRNA 3′- and 5′UTRs; implications for insulin biosynthesis and messenger stability

    Directory of Open Access Journals (Sweden)

    Rikard G. Fred

    2016-09-01

    Conclusions: These experiments indicate that alterations in insulin mRNA stability and translation correlate with differential RBP binding. We propose that the balance between PTB on one hand and TIAR on the other participates in the control of insulin mRNA stability and utilization for insulin biosynthesis.

  5. Defining reference sequences for Nocardia species by similarity and clustering analyses of 16S rRNA gene sequence data.

    Directory of Open Access Journals (Sweden)

    Manal Helal

    Full Text Available BACKGROUND: The intra- and inter-species genetic diversity of bacteria and the absence of 'reference', or the most representative, sequences of individual species present a significant challenge for sequence-based identification. The aims of this study were to determine the utility, and compare the performance of several clustering and classification algorithms to identify the species of 364 sequences of 16S rRNA gene with a defined species in GenBank, and 110 sequences of 16S rRNA gene with no defined species, all within the genus Nocardia. METHODS: A total of 364 16S rRNA gene sequences of Nocardia species were studied. In addition, 110 16S rRNA gene sequences assigned only to the Nocardia genus level at the time of submission to GenBank were used for machine learning classification experiments. Different clustering algorithms were compared with a novel algorithm or the linear mapping (LM of the distance matrix. Principal Components Analysis was used for the dimensionality reduction and visualization. RESULTS: The LM algorithm achieved the highest performance and classified the set of 364 16S rRNA sequences into 80 clusters, the majority of which (83.52% corresponded with the original species. The most representative 16S rRNA sequences for individual Nocardia species have been identified as 'centroids' in respective clusters from which the distances to all other sequences were minimized; 110 16S rRNA gene sequences with identifications recorded only at the genus level were classified using machine learning methods. Simple kNN machine learning demonstrated the highest performance and classified Nocardia species sequences with an accuracy of 92.7% and a mean frequency of 0.578. CONCLUSION: The identification of centroids of 16S rRNA gene sequence clusters using novel distance matrix clustering enables the identification of the most representative sequences for each individual species of Nocardia and allows the quantitation of inter- and intra

  6. Expression of alpha-fetoprotein messenger RNA in BEL-7404 human hepatoma cells and effect of L-4-oxalysine on the expression

    Institute of Scientific and Technical Information of China (English)

    1998-01-01

    AIM To investigate alpha-fetoprotein (AFP) mRNA expression in BEL-7404 human hepatoma cells and the effect of L-4-oxalysine (OXL) on the expression.METHODS BEl-7404 human hepatoma cells were maintained in RPMI 1640 media. Human AFP cDNA probe was labelled with digoxigenin-11-dUTP by the random primer labelling method. The expression of AFP mRNA in Bel-7404 cells was determined by an in situ hybridization technique with digoxigenin-labelled human AFP cDNA probe. The positive intensities of AFP mRNA in cells were analyzed by microspectrophotometer and expressed as absorbance at 470nm. For the experiment with OXL, cells were incubated with various concentrations of the agent for 72h.RESULTS Essentially all the hepatoma cells contained AFP mRNA in the cytoplasm, although in various amounts. The specificity of the hybridization reaction was confirmed by control experiments in which the use of RNase-treated BEL-7404 cells, non-AFP-producing cells (HL-60 human leukemia cells) or a nonspecific cDNA probe resulted in negative hybridization. When the cells were treated with OXL (25, 50mg/L), the content of AFP mRNA in the cytoplasm was decreased with the inhibition percentages of 34.3% and 70.1%, respectively (P<0.05).CONCLUSION AFP mRNA was expressed in BEL-7404 human hepatoma cells and OXL suppressed AFP mRNA expression in the cells.

  7. Changes in messenger RNA of pancreatic enzymes and intestinal cholecystokinin after a 7-day bile-pancreatic juice diversion from the proximal small intestine in rats.

    Science.gov (United States)

    Hara, H; Ochi, Y; Kasai, T

    1997-06-01

    We have previously demonstrated the bile-pancreatic juice (BPJ)-independent stimulation of pancreatic enzyme secretion in chronic BPJ-diverted rats. Pancreatic and intestinal adaptation to 7-day BPJ diversion was next examined. Pancreatic enzyme mRNA and cholecystokinin mRNA in the jejunal mucosa were measured in rats with BPJ diverted into the ileum (PBD rats) in comparison with the figures for rats with BPJ returned to the duodenum (normal rats) or laparotomized (Intact) rats under well-nourished conditions. Amylase mRNA in the pancreas was lower and trypsinogen plus chymotrypsinogen mRNA was higher in the PBD rats than in the intact rats. The change in pancreatic mRNA was similar to that in the specific activities of the enzymes after a chronic BPJ diversion. This finding suggests that these pancreatic enzymes were regulated by the mRNA level. The portal concentration of cholecystokinin in the postabsorptive period (exogenously non-stimulated status) was 4-fold higher in the PBD group than in the normal and intact groups. Cholecystokinin mRNA in the jejunal mucosa of PBD rats was somewhat higher than that of intact rats. These results suggest that intestinal cholecystokinin was predominantly increased at the translational or later stage by chronic BPJ diversion.

  8. RNA2DNAlign: nucleotide resolution allele asymmetries through quantitative assessment of RNA and DNA paired sequencing data.

    Science.gov (United States)

    Movassagh, Mercedeh; Alomran, Nawaf; Mudvari, Prakriti; Dede, Merve; Dede, Cem; Kowsari, Kamran; Restrepo, Paula; Cauley, Edmund; Bahl, Sonali; Li, Muzi; Waterhouse, Wesley; Tsaneva-Atanasova, Krasimira; Edwards, Nathan; Horvath, Anelia

    2016-12-15

    We introduce RNA2DNAlign, a computational framework for quantitative assessment of allele counts across paired RNA and DNA sequencing datasets. RNA2DNAlign is based on quantitation of the relative abundance of variant and reference read counts, followed by binomial tests for genotype and allelic status at SNV positions between compatible sequences. RNA2DNAlign detects positions with differential allele distribution, suggesting asymmetries due to regulatory/structural events. Based on the type of asymmetry, RNA2DNAlign outlines positions likely to be implicated in RNA editing, allele-specific expression or loss, somatic mutagenesis or loss-of-heterozygosity (the first three also in a tumor-specific setting). We applied RNA2DNAlign on 360 matching normal and tumor exomes and transcriptomes from 90 breast cancer patients from TCGA. Under high-confidence settings, RNA2DNAlign identified 2038 distinct SNV sites associated with one of the aforementioned asymetries, the majority of which have not been linked to functionality before. The performance assessment shows very high specificity and sensitivity, due to the corroboration of signals across multiple matching datasets. RNA2DNAlign is freely available from http://github.com/HorvathLab/NGS as a self-contained binary package for 64-bit Linux systems.

  9. Construction and characterization of recombinant Japanese encephalitis virus carrying brainspecific miRNA target sequences

    Directory of Open Access Journals (Sweden)

    Wen-yuan CAO

    2014-08-01

    Full Text Available Objective To construct the recombinant Japanese encephalitis virus ( JEV carrying brain-specific miRNA targeting sequences. Methods The target sequences of brain-specific miR-124 and miR-125 were introduced into the infectious cDNA clone of JEV to generate recombinant plasmids based on reverse genetics technology. The recombinant plasmids were linearized with Xho Ⅰ and served as templates of transcription with SP6 RNA polymerase to generate infectious viral RNA. The RNA transcripts were then transfected into BHK-21 cells, and the supernatant was obtained after incubated at 37℃, 5% CO2 for 3 days. The cytopathic changes of BHK-21 cells inoculated with the supernatant were observed after one passage. The rescued viruses carrying miRNA target sequences were validated by RT-PCR, standard plaque forming test on BHK-21 cells and growth curves analysis. Results Two recombinant viruses carrying miR-124 or miR-125 target sequence were rescued, respectively. The insertion of miRNA target sequences was confirmed by DNA sequencing. The rescued viruses yielded similar plaque morphology and replication efficiency compared with wild type JEV. Conclusion The recombinant JEV containing brain-specific miRNA target sequences can be obtained by reverse genetics technique, which could be used in further studies of miRNA-mediated tissue-specific attenuation mechanism of JEV. DOI: 10.11855/j.issn.0577-7402.2014.06.01

  10. Messengers of new physics

    Energy Technology Data Exchange (ETDEWEB)

    Rodejohann, W. [Max-Planck-Institut fuer Kernphysik, Postfach 103980, D-69029 Heidelberg (Germany); Shiozawa, M. [Kamioka Observatory, Institute for Cosmic Ray Research, University of Tokyo, Higashi-Mozumi, Kamioka-cho, Hida-shi, Gifu 506-1205 (Japan)

    2011-08-15

    The talks of the parallel session 'Messengers of new physics' of the NOW2010 workshop are summarized. Topics under discussion included models of neutrino mass and mixing, charged lepton flavor violation and neutrinos, neutrinos and the LHC, future large-volume detectors, neutrinos and dark matter, neutrino properties and interactions beyond the Standard Model, leptogenesis, etc.

  11. Translation complex profile sequencing to study the in vivo dynamics of mRNA-ribosome interactions during translation initiation, elongation and termination.

    Science.gov (United States)

    Shirokikh, Nikolay E; Archer, Stuart K; Beilharz, Traude H; Powell, David; Preiss, Thomas

    2017-04-01

    Messenger RNA (mRNA) translation is a tightly controlled process that is integral to gene expression. It features intricate and dynamic interactions of the small and large subunits of the ribosome with mRNAs, aided by multiple auxiliary factors during distinct initiation, elongation and termination phases. The recently developed ribosome profiling method can generate transcriptome-wide surveys of translation and its regulation. Ribosome profiling records the footprints of fully assembled ribosomes along mRNAs and thus primarily interrogates the elongation phase of translation. Importantly, it does not monitor multiple substeps of initiation and termination that involve complexes between the small ribosomal subunit (SSU) and mRNA. Here we describe a related method, termed 'translation complex profile sequencing' (TCP-seq), that is uniquely capable of recording positions of any type of ribosome-mRNA complex transcriptome-wide. It uses fast covalent fixation of translation complexes in live cells, followed by RNase footprinting of translation intermediates and their separation into complexes involving either the full ribosome or the SSU. The footprints derived from each type of complex are then deep-sequenced separately, generating native distribution profiles during the elongation, as well as the initiation and termination stages of translation. We provide the full TCP-seq protocol for Saccharomyces cerevisiae liquid suspension culture, including a data analysis pipeline. The protocol takes ∼3 weeks to complete by a researcher who is well acquainted with standard molecular biology techniques and who has some experience in ultracentrifugation and the preparation of RNA sequencing (RNA-seq) libraries. Basic Bash and UNIX/Linux command skills are required to use the bioinformatics tools provided.

  12. Regulation of corticotropin releasing hormone receptor type 1 messenger RNA level in Y-79 retinoblastoma cells: potential implications for human stress response and immune/inflammatory reaction

    Directory of Open Access Journals (Sweden)

    N. C. Vamvakopoulos

    1996-01-01

    Full Text Available We report the regulation of type 1 receptor mRNA in Y-79 human retinoblastoma cells, grown in the absence or presence of pharmacological levels of phorbol esters, forskolin, glucocorticoids and their combinations. To control for inducibility and for assessing the sensitivity of the Y-79 system to glucocorticoids, corticotropin releasing hormone mRNA levels were measured in parallel. All treatments stimulated corticotropin releasing hormone receptor type 1 gene expression relative to baseline. A weak suppression of corticotropin releasing hormone mRNA level was observed during dexamethasone treatment. The cell line expressed ten-fold excess of receptor to ligand mRNA under basal conditions. The findings predict the presence of functional phorbol ester, cyclic AMP and glucocorticoid response elements in the promoter region of corticotropin releasing hormone receptor type 1 gene and support a potential role for its product during chronic stress and immune/inflammatory reaction.

  13. Regulation of corticotropin releasing hormone receptor type 1 messenger RNA level in Y-79 retinoblastoma cells: potential implications for human stress response and immune/inflammatory reaction

    OpenAIRE

    Vamvakopoulos, N C; Sioutopoulou, T. O.; Mamuris, Z.; Marcoulatos, P.; Avgerinos, P. C.

    1996-01-01

    We report the regulation of type 1 receptor mRNA in Y-79 human retinoblastoma cells, grown in the absence or presence of pharmacological levels of phorbol esters, forskolin, glucocorticoids and their combinations. To control for inducibility and for assessing the sensitivity of the Y-79 system to glucocorticoids, corticotropin releasing hormone mRNA levels were measured in parallel. All treatments stimulated corticotropin releasing hormone receptor type 1 gene expression relative to baseline....

  14. Role of dopamine in the plasticity of glutamic acid decarboxylase messenger RNA in the rat frontal cortex and the nucleus accumbens.

    Science.gov (United States)

    Rétaux, S; Trovero, F; Besson, M J

    1994-12-01

    The modulatory role of dopamine (DA) on the expression of mRNA encoding the large isoform of glutamic acid decarboxylase (GAD67), the biosynthesis enzyme of gamma aminobutyric acid (GABA), was examined in GABA neurons of two structures innervated by DA neurons originating from the ventral tegmental area (VTA): the medial frontal cortex (MFC) and the nucleus accumbens (NAcc). A bilateral electrolytic lesion of VTA was performed in rats to produce a DA denervation of both the MFC and NAcc. The efficacy of VTA lesions was verified by measurement of locomotor activity and by immunohistochemical detection of tyrosine hydroxylase in the mesencephalon. GAD67 mRNA was detected by in situ hybridization histochemistry using a 35S-labelled cDNA probe. Densitometric analysis of GAD67 mRNA hybridization signals revealed in VTA-lesioned rats a significant decrease (-24%) in GAD67 mRNA levels in the prelimbic area of the MFC and no significant effect in the anterior cingulate area or the frontoparietal cortex. Single cell analyses by computer-assisted grain counting showed that the decrease in GAD67 mRNA levels in prelimbic MFC was due to a change in GAD67 mRNA expression in a subpopulation of GABA interneurons located in the deep cortical layers (V-VI). By contrast, in the NAcc of VTA-lesioned rats, GAD67 mRNA levels were significantly increased in the anterior part and in the core but were unchanged in the shell part. These results suggest that in two target structures of VTA DA neurons, GAD67 mRNA expression is, in normal conditions, under a tonic stimulatory and a tonic inhibitory DA control in the MFC and the NAcc respectively. A schematic diagram is proposed for functional interactions between these structures.

  15. Autocatalytic cyclization of an excised intervening sequence RNA is a cleavage-ligation reaction.

    Science.gov (United States)

    Zaug, A J; Grabowski, P J; Cech, T R

    The intervening sequence (IVS) of the Tetrahymena ribosomal RNA precursor is excised as a linear RNA molecule which subsequently cyclizes itself in a protein-independent reaction. Cyclization involves cleavage of the linear IVS RNA 15 nucleotides from its 5' end and formation of a phosphodiester bond between the new 5' phosphate and the original 3'-hydroxyl terminus of the IVS. This recombination mechanism is analogous to that by which splicing of the precursor RNA is achieved. The circular molecules appear to have no direct function in RNA splicing, and we propose the cyclization serves to prevent unwanted RNA from driving the splicing reactions backwards.

  16. Deep sequencing of RNA from ancient maize kernels

    DEFF Research Database (Denmark)

    Fordyce, Sarah Louise; Avila Arcos, Maria del Carmen; Rasmussen, Morten

    2013-01-01

    The characterization of biomolecules from ancient samples can shed otherwise unobtainable insights into the past. Despite the fundamental role of transcriptomal change in evolution, the potential of ancient RNA remains unexploited - perhaps due to dogma associated with the fragility of RNA. We hy...

  17. Deep sequencing of RNA from ancient maize kernels

    DEFF Research Database (Denmark)

    Fordyce, Sarah Louise; Avila Arcos, Maria del Carmen; Rasmussen, Morten;

    2013-01-01

    The characterization of biomolecules from ancient samples can shed otherwise unobtainable insights into the past. Despite the fundamental role of transcriptomal change in evolution, the potential of ancient RNA remains unexploited - perhaps due to dogma associated with the fragility of RNA. We...... maize kernels. The results suggest that ancient seed transcriptomics may offer a powerful new tool with which to study plant domestication....

  18. Sequencing 16S rRNA gene fragments using the PacBio SMRT DNA sequencing system.

    Science.gov (United States)

    Schloss, Patrick D; Jenior, Matthew L; Koumpouras, Charles C; Westcott, Sarah L; Highlander, Sarah K

    2016-01-01

    Over the past 10 years, microbial ecologists have largely abandoned sequencing 16S rRNA genes by the Sanger sequencing method and have instead adopted highly parallelized sequencing platforms. These new platforms, such as 454 and Illumina's MiSeq, have allowed researchers to obtain millions of high quality but short sequences. The result of the added sequencing depth has been significant improvements in experimental design. The tradeoff has been the decline in the number of full-length reference sequences that are deposited into databases. To overcome this problem, we tested the ability of the PacBio Single Molecule, Real-Time (SMRT) DNA sequencing platform to generate sequence reads from the 16S rRNA gene. We generated sequencing data from the V4, V3-V5, V1-V3, V1-V5, V1-V6, and V1-V9 variable regions from within the 16S rRNA gene using DNA from a synthetic mock community and natural samples collected from human feces, mouse feces, and soil. The mock community allowed us to assess the actual sequencing error rate and how that error rate changed when different curation methods were applied. We developed a simple method based on sequence characteristics and quality scores to reduce the observed error rate for the V1-V9 region from 0.69 to 0.027%. This error rate is comparable to what has been observed for the shorter reads generated by 454 and Illumina's MiSeq sequencing platforms. Although the per base sequencing cost is still significantly more than that of MiSeq, the prospect of supplementing reference databases with full-length sequences from organisms below the limit of detection from the Sanger approach is exciting.

  19. Sequencing 16S rRNA gene fragments using the PacBio SMRT DNA sequencing system

    Directory of Open Access Journals (Sweden)

    Patrick D. Schloss

    2016-03-01

    Full Text Available Over the past 10 years, microbial ecologists have largely abandoned sequencing 16S rRNA genes by the Sanger sequencing method and have instead adopted highly parallelized sequencing platforms. These new platforms, such as 454 and Illumina’s MiSeq, have allowed researchers to obtain millions of high quality but short sequences. The result of the added sequencing depth has been significant improvements in experimental design. The tradeoff has been the decline in the number of full-length reference sequences that are deposited into databases. To overcome this problem, we tested the ability of the PacBio Single Molecule, Real-Time (SMRT DNA sequencing platform to generate sequence reads from the 16S rRNA gene. We generated sequencing data from the V4, V3–V5, V1–V3, V1–V5, V1–V6, and V1–V9 variable regions from within the 16S rRNA gene using DNA from a synthetic mock community and natural samples collected from human feces, mouse feces, and soil. The mock community allowed us to assess the actual sequencing error rate and how that error rate changed when different curation methods were applied. We developed a simple method based on sequence characteristics and quality scores to reduce the observed error rate for the V1–V9 region from 0.69 to 0.027%. This error rate is comparable to what has been observed for the shorter reads generated by 454 and Illumina’s MiSeq sequencing platforms. Although the per base sequencing cost is still significantly more than that of MiSeq, the prospect of supplementing reference databases with full-length sequences from organisms below the limit of detection from the Sanger approach is exciting.

  20. 核糖核酸干扰%The RNA interference

    Institute of Scientific and Technical Information of China (English)

    孔祥平; LiXing W.Reneker

    2004-01-01

    The phenomenon of RNA interference (RNAi) is highly conserved mechanism in the organism evolution. As a immune system ,RNAi is a ubiquitous mechanism against invading microorganism in plant and animal cells. Recently, it has been found that RNAi is the process by which double-strand RNA(dsRNA) directs sequence-specific degradation of messenger RNA and the mediations of sequence specific messenger RNA degradation are 21-and 23-nucleotide small interfering RNAs that generate by ribonuclease from endogenous longer dsRNA or by transfectious technics from heterologous dsRNA. Over the past few years, the way in which cells respond to dsRNA by silencing homologous genes has revealed a new regulating paradigm in biology.

  1. Deep Sequencing of RNA from Ancient Maize Kernels

    Science.gov (United States)

    Rasmussen, Morten; Cappellini, Enrico; Romero-Navarro, J. Alberto; Wales, Nathan; Alquezar-Planas, David E.; Penfield, Steven; Brown, Terence A.; Vielle-Calzada, Jean-Philippe; Montiel, Rafael; Jørgensen, Tina; Odegaard, Nancy; Jacobs, Michael; Arriaza, Bernardo; Higham, Thomas F. G.; Ramsey, Christopher Bronk; Willerslev, Eske; Gilbert, M. Thomas P.

    2013-01-01

    The characterization of biomolecules from ancient samples can shed otherwise unobtainable insights into the past. Despite the fundamental role of transcriptomal change in evolution, the potential of ancient RNA remains unexploited – perhaps due to dogma associated with the fragility of RNA. We hypothesize that seeds offer a plausible refuge for long-term RNA survival, due to the fundamental role of RNA during seed germination. Using RNA-Seq on cDNA synthesized from nucleic acid extracts, we validate this hypothesis through demonstration of partial transcriptomal recovery from two sources of ancient maize kernels. The results suggest that ancient seed transcriptomics may offer a powerful new tool with which to study plant domestication. PMID:23326310

  2. Deep sequencing of RNA from ancient maize kernels.

    Directory of Open Access Journals (Sweden)

    Sarah L Fordyce

    Full Text Available The characterization of biomolecules from ancient samples can shed otherwise unobtainable insights into the past. Despite the fundamental role of transcriptomal change in evolution, the potential of ancient RNA remains unexploited - perhaps due to dogma associated with the fragility of RNA. We hypothesize that seeds offer a plausible refuge for long-term RNA survival, due to the fundamental role of RNA during seed germination. Using RNA-Seq on cDNA synthesized from nucleic acid extracts, we validate this hypothesis through demonstration of partial transcriptomal recovery from two sources of ancient maize kernels. The results suggest that ancient seed transcriptomics may offer a powerful new tool with which to study plant domestication.

  3. New perspectives on the diversification of the RNA interference system: insights from comparative genomics and small RNA sequencing.

    Science.gov (United States)

    Burroughs, Alexander Maxwell; Ando, Yoshinari; Aravind, L

    2014-01-01

    Our understanding of the pervasive involvement of small RNAs in regulating diverse biological processes has been greatly augmented by recent application of deep-sequencing technologies to small RNA across diverse eukaryotes. We review the currently known small RNA classes and place them in context of the reconstructed evolutionary history of the RNA interference (RNAi) protein machinery. This synthesis indicates that the earliest versions of eukaryotic RNAi systems likely utilized small RNA processed from three types of precursors: (1) sense-antisense transcriptional products, (2) genome-encoded, imperfectly complementary hairpin sequences, and (3) larger noncoding RNA precursor sequences. Structural dissection of PIWI proteins along with recent discovery of novel families (including Med13 of the Mediator complex) suggest that emergence of a distinct architecture with the N-terminal domains (also occurring separately fused to endoDNases in prokaryotes) formed via duplication of an ancestral unit was key to their recruitment as primary RNAi effectors and use of small RNAs of certain preferred lengths. Prokaryotic PIWI proteins are typically components of several RNA-directed DNA restriction or CRISPR/Cas systems. However, eukaryotic versions appear to have emerged from a subset that evolved RNA-directed RNAi. They were recruited alongside RNaseIII domains and RNA-dependent RNA polymerase (RdRP) domains, also from prokaryotic systems, to form the core eukaryotic RNAi system. Like certain regulatory systems, RNAi diversified into two distinct but linked arms concomitant with eukaryotic nucleocytoplasmic compartmentalization. Subsequent elaboration of RNAi proceeded via diversification of the core protein machinery through lineage-specific expansions and recruitment of new components from prokaryotes (nucleases and small RNA-modifying enzymes), allowing for diversification of associating small RNAs. © 2013 John Wiley & Sons, Ltd.

  4. Messenger RNA levels of estrogen receptors alpha and beta and progesterone receptors in the cyclic and inseminated/early pregnant sow uterus.

    Science.gov (United States)

    Sukjumlong, S; Persson, E; Dalin, A-M; Janson, V; Sahlin, L

    2009-06-01

    The aim of the present study was to investigate differences in the expression of mRNAs for ERalpha, ERbeta and PR in the sow uterus at different stages of the estrous cycle as well as in inseminated sows at estrus and during early pregnancy by use of solution hybridization and in relation to plasma levels of estradiol and progesterone. Uterine samples were collected at different stages of the estrous cycle and after insemination/early pregnancy. In the endometrium, the expression of ERalpha mRNA and PR mRNA was similar for cyclic and early pregnant groups. Both were highest at early diestrus/70 h after ovulation and ERalpha mRNA was lowest at late diestrus/d 19 while PR mRNA was lowest at diestrus and late diestrus/d 11 and d 19. The expression of endometrial ERbeta was constantly low during the estrous cycle but higher expression was found in inseminated/early pregnant sows at estrus and 70 h after ovulation. In the myometrium, high expression of ERalpha mRNA and PR mRNA was observed at proestrus and estrus in cyclic sows and at estrus in newly inseminated sows. Higher expression of myometrial ERbeta mRNA was found in inseminated/early pregnant sows compared with cyclic sows, although significant only at estrus. In conclusion, the expression of mRNAs for ERalpha, ERbeta and PR in the sow uterus differed between endometrium and myometrium as well as with stages of the estrous cycle and early pregnancy. In addition to plasma steroid levels, the differences between cyclic and inseminated/early pregnant sows suggest that other factors, e.g. insemination and/or the presence of embryos, influence the expression of these steroid receptor mRNAs in the sow uterus.

  5. MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing

    DEFF Research Database (Denmark)

    Nielsen, M; Hansen, J H; Hedegaard, J;

    2010-01-01

    MicroRNAs (miRNA) are short single-stranded RNA molecules that regulate gene expression post-transcriptionally by binding to complementary sequences in the 3' untranslated region (3' UTR) of target mRNAs. MiRNAs participate in the regulation of myogenesis, and identification of the complete set...... of miRNAs expressed in muscles is likely to significantly increase our understanding of muscle growth and development. To determine the identity and abundance of miRNA in porcine skeletal muscle, we applied a deep sequencing approach. This allowed us to identify the sequences and relative expression...... levels of 212 annotated miRNA genes, thereby providing a thorough account of the miRNA transcriptome in porcine muscle tissue. The expression levels displayed a very large range, as reflected by the number of sequence reads, which varied from single counts for rare miRNAs to several million reads...

  6. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    Science.gov (United States)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  7. An Exact Mathematical Programming Approach to Multiple RNA Sequence-Structure Alignment

    NARCIS (Netherlands)

    Bauer, M.; Klau, G.W.; Reinert, K.

    2008-01-01

    One of the main tasks in computational biology is the computation of alignments of genomic sequences to reveal their commonalities. In case of DNA or protein sequences, sequence information alone is usually sufficient to compute reliable alignments. RNA molecules, however, build spatial confor

  8. Identification of messenger RNA of fetoplacental source in maternal plasma of women with normal pregnancies and pregnancies with intrauterine growth restriction

    Directory of Open Access Journals (Sweden)

    Paola Andrea Ayala Ramírez

    2012-09-01

    Full Text Available Normal 0 21 false false false ES-CO X-NONE X-NONE Objetivo: cuantificar RNA (ácido ribonucleico específico de placenta en el plasma de mujeres con embarazos con fetos con Restricción de Crecimiento Intrauterino (RCIU y gestantes con embarazos normales.    Materiales y métodos: se estudiaron 8 mujeres con embarazos con fetos con RCIU y 18 mujeres con embarazos sin complicaciones, en el tercer trimestre de embarazo. Se cuantificó el RNA total libre en plasma materno por espectrofotometría y la expresión del gen Lactógeno Placentario Humano (hPL a nivel de RNA mensajero (RNAm por medio de la técnica Reacción en Cadena de la Polimerasa en Tiempo Real (qPCR-RT.   Resultados: se logró detectar RNA en plasma de origen fetoplacentario en el 100% de las gestantes. No se encontraron diferencias estadísticamente significativas entre los valores de RNA total extraído de plasma (p=0,5975 ni en la expresión del RNAm del gen hPL (p=0,5785 entre casos y controles.   Conclusión: es posible detectar RNAm de origen fetoplacentario en plasma materno durante el embarazo.  

  9. Detection of Borrelia-specific 16S rRNA sequence in total RNA extracted from Ixodes ricinus ticks

    Directory of Open Access Journals (Sweden)

    Ž. Radulović

    2010-08-01

    Full Text Available A reverse transcriptase - polymerase chain reaction based assay for Borrelia species detection in ticks was developed. The method was based on amplification of 552 nucleotide bases long sequence of 16S rRNA, targeted by Borrelia specific primers. In the present study, total RNA extracted from Ixodes ricinus ticks was used as template. The results showed higher sensitivity for Borrelia detection as compared to standard dark-field microscopy. Method specificity was confirmed by cloning and sequencing of obtained 552 base pairs long amplicons. Phylogenetic analysis of obtained sequences showed that they belong to B. lusitaniae and B. afzelii genospecies. RT-PCR based method presented in this paper could be very useful as a screening test for detecting pathogen presence, especially when in investigations is required extraction of total RNA from ticks.

  10. Predicting RNA secondary structures from sequence and probing data.

    Science.gov (United States)

    Lorenz, Ronny; Wolfinger, Michael T; Tanzer, Andrea; Hofacker, Ivo L

    2016-07-01

    RNA secondary structures have proven essential for understanding the regulatory functions performed by RNA such as microRNAs, bacterial small RNAs, or riboswitches. This success is in part due to the availability of efficient computational methods for predicting RNA secondary structures. Recent advances focus on dealing with the inherent uncertainty of prediction by considering the ensemble of possible structures rather than the single most stable one. Moreover, the advent of high-throughput structural probing has spurred the development of computational methods that incorporate such experimental data as auxiliary information.

  11. a Simple Symmetric Algorithm Using a Likeness with Introns Behavior in RNA Sequences

    Science.gov (United States)

    Regoli, Massimo

    2009-02-01

    The RNA-Crypto System (shortly RCS) is a symmetric key algorithm to cipher data. The idea for this new algorithm starts from the observation of nature. In particular from the observation of RNA behavior and some of its properties. The RNA sequences has some sections called Introns. Introns, derived from the term "intragenic regions", are non-coding sections of precursor mRNA (pre-mRNA) or other RNAs, that are removed (spliced out of the RNA) before the mature RNA is formed. Once the introns have been spliced out of a pre-mRNA, the resulting mRNA sequence is ready to be translated into a protein. The corresponding parts of a gene are known as introns as well. The nature and the role of Introns in the pre-mRNA is not clear and it is under ponderous researches by Biologists but, in our case, we will use the presence of Introns in the RNA-Crypto System output as a strong method to add chaotic non coding information and an unnecessary behaviour in the access to the secret key to code the messages. In the RNA-Crypto System algoritnm the introns are sections of the ciphered message with non-coding information as well as in the precursor mRNA.

  12. Effects of RNA sequence specificity in the electrostatic stabilization of viruses

    CERN Document Server

    Erdemci-Tandogan, Gonca; van der Schoot, Paul; Podgornik, Rudolf; Zandi, Roya

    2016-01-01

    Many single-stranded (ss) RNA viruses self assemble from capsid protein subunits and the nucleic acid to form an infectious virion. It is believed that the electrostatic interactions between the negatively charged RNA and the positively charged viral capsid proteins drive the encapsidation, although there is growing evidence that the sequence of the viral RNA also plays a role in packaging. In particular the sequence will determine the possible secondary structures that the ssRNA will take in solution. In this work, we use a mean field theory to investigate how the secondary structure of the RNA combined with electrostatic interactions affects the efficiency of assembly and stability of the assembled virions. We show that the secondary structure of RNA may result in negative osmotic pressures while a linear polymer causes positive osmotic pressures for the same conditions. This may suggest that the branched structure makes the RNA more effectively packaged and the virion more stable.

  13. Nucleotide sequences of three tRNA(Ser) from Drosophila melanogaster reading the six serine codons.

    Science.gov (United States)

    Cribbs, D L; Gillam, I C; Tener, G M

    1987-10-05

    The nucleotide sequences of three serine tRNAs from Drosophila melanogaster, together capable of decoding the six serine codons, were determined. tRNA(Ser)2b has the anticodon GCU, tRNA(Ser)4 has CGA and tRNA(Ser)7 has IGA. tRNA(Ser)2b differs from the last two by about 25%. However, tRNA(Ser)4 and tRNA(Ser)7 are 96% homologous, differing only at the first position of the anticodon and two other sites. This unusual sequence relationship suggests, together with similar pairs in the yeasts Schizosaccharomyces pombe and Saccharomyces cerevisiae, that eukaryotic tRNA(Ser)UCN may be undergoing concerted evolution.

  14. Combined DECS Analysis and Next-Generation Sequencing Enable Efficient Detection of Novel Plant RNA Viruses.

    Science.gov (United States)

    Yanagisawa, Hironobu; Tomita, Reiko; Katsu, Koji; Uehara, Takuya; Atsumi, Go; Tateda, Chika; Kobayashi, Kappei; Sekine, Ken-Taro

    2016-03-07

    The presence of high molecular weight double-stranded RNA (dsRNA) within plant cells is an indicator of infection with RNA viruses as these possess genomic or replicative dsRNA. DECS (dsRNA isolation, exhaustive amplification, cloning, and sequencing) analysis has been shown to be capable of detecting unknown viruses. We postulated that a combination of DECS analysis and next-generation sequencing (NGS) would improve detection efficiency and usability of the technique. Here, we describe a model case in which we efficiently detected the presumed genome sequence of Blueberry shoestring virus (BSSV), a member of the genus Sobemovirus, which has not so far been reported. dsRNAs were isolated from BSSV-infected blueberry plants using the dsRNA-binding protein, reverse-transcribed, amplified, and sequenced using NGS. A contig of 4,020 nucleotides (nt) that shared similarities with sequences from other Sobemovirus species was obtained as a candidate of the BSSV genomic sequence. Reverse transcription (RT)-PCR primer sets based on sequences from this contig enabled the detection of BSSV in all BSSV-infected plants tested but not in healthy controls. A recombinant protein encoded by the putative coat protein gene was bound by the BSSV-antibody, indicating that the candidate sequence was that of BSSV itself. Our results suggest that a combination of DECS analysis and NGS, designated here as "DECS-C," is a powerful method for detecting novel plant viruses.

  15. Global Annotation of Small RNA and MicroRNA Mature Sequences from Developing Ovules of Gossypium hirsutum L.

    Institute of Scientific and Technical Information of China (English)

    ABDURAKHMONOV Ibrokhim Y; DEVOR Eric J; HUANG Ling-yan; BURIEV Zabardast T; MAKAMOV Abdusalom; SHERMATOV Shukhrat E; ABDUKARIMOV Abdusattor

    2008-01-01

    @@ The involvement of small RNAs in cotton fiber development is under explored.The objective of this work was to directly clone,annotate,and analyze small RNAs of developing ovules to reveal the candidate small interfering RNA/microRNAs (siRNAs/miRNAs) involved in cotton ovule and fiber development.We cloned small RNA sequences from 0~10 days post anthesis (DPA) developing ovules of Gossypium hirsutum var.

  16. The Adh-related gene of Drosophila melanogaster is expressed as a functional dicistronic messenger RNA: multigenic transcription in higher organisms.

    Science.gov (United States)

    Brogna, S; Ashburner, M

    1997-01-01

    Essentially all eukaryotic cellular mRNAs are monocistronic, and are usually transcribed individually. Two tandemly arranged Drosophila genes, alcohol dehydrogenase (Adh) and Adh-related (Adhr), are transcribed as a dicistronic transcript. From transcripts initiated from the Adh promoter, two classes of mRNA are accumulated, one is monocistronic and encodes Adh alone, the other is dicistronic and includes the open reading frames of both Adh and Adhr. The dicistronic transcript is found in polysomes and the Adhr protein product is detected by antibody staining. We present evidence that the accumulation of the dicistronic mRNA is controlled at the level of the 3' end processing. PMID:9155028

  17. Mapping the miRNA interactome by cross-linking ligation and sequencing of hybrids (CLASH).

    Science.gov (United States)

    Helwak, Aleksandra; Tollervey, David

    2014-03-01

    RNA-RNA interactions have critical roles in many cellular processes, but studying them is difficult and laborious. Here we describe an experimental procedure, termed cross-linking ligation and sequencing of hybrids (CLASH), which allows high-throughput identification of sites of RNA-RNA interaction. During CLASH, a tagged bait protein is UV-cross-linked in cell cultures to stabilize RNA interactions, and it is purified under denaturing conditions. RNAs associated with the bait protein are partially truncated, and the ends of RNA duplexes are ligated together. After linker addition, cDNA library preparation and high-throughput sequencing, the ligated duplexes give rise to chimeric cDNAs, which unambiguously identify RNA-RNA interaction sites independent of bioinformatic predictions. This protocol is optimized for studying miRNA targets bound by Argonaute (AGO) proteins, but it should be easily adapted for other RNA-binding proteins and classes of RNA. The protocol requires ∼5 d to complete, excluding the time required for high-throughput sequencing and bioinformatic analyses.

  18. Bias in ligation-based small RNA sequencing library construction is determined by adaptor and RNA structure.

    Directory of Open Access Journals (Sweden)

    Ryan T Fuchs

    Full Text Available High-throughput sequencing (HTS has become a powerful tool for the detection of and sequence characterization of microRNAs (miRNA and other small RNAs (sRNA. Unfortunately, the use of HTS data to determine the relative quantity of different miRNAs in a sample has been shown to be inconsistent with quantitative PCR and Northern Blot results. Several recent studies have concluded that the major contributor to this inconsistency is bias introduced during the construction of sRNA libraries for HTS and that the bias is primarily derived from the adaptor ligation steps, specifically where single stranded adaptors are sequentially ligated to the 3' and 5'-end of sRNAs using T4 RNA ligases. In this study we investigated the effects of ligation bias by using a pool of randomized ligation substrates, defined mixtures of miRNA sequences and several combinations of adaptors in HTS library construction. We show that like the 3' adaptor ligation step, the 5' adaptor ligation is also biased, not because of primary sequence, but instead due to secondary structures of the two ligation substrates. We find that multiple secondary structural factors influence final representation in HTS results. Our results provide insight about the nature of ligation bias and allowed us to design adaptors that reduce ligation bias and produce HTS results that more accurately reflect the actual concentrations of miRNAs in the defined starting material.

  19. Small RNA Library Cloning Procedure for Deep Sequencing of Specific Endogenous siRNA Classes in Caenorhabditis elegans

    Science.gov (United States)

    Ow, Maria C.; Lau, Nelson C.; Hall, Sarah E.

    2017-01-01

    In recent years, distinct classes of small RNAs ranging in size from ~21 to 26 nucleotides have been discovered and shown to play important roles in a wide array of cellular functions. Because of the abundance of these small RNAs, library preparation from an RNA sample followed by deep sequencing provides the identity and quantity of a particular class of small RNAs. In this chapter we describe a detailed protocol for preparing small RNA libraries for deep sequencing on the Illumina platform from the nematode C. elegans. PMID:24920360

  20. Effects of dietary nitrogen concentration on messenger RNA expression and protein abundance of urea transporter-B and aquaporins in ruminal papillae from lactating Holstein cows

    DEFF Research Database (Denmark)

    Røjen, Betina Amdisen; Poulsen, Søren Brandt; Theil, Peter Kappel

    2011-01-01

    To test the hypothesis that dietary N concentrations affect gut epithelial urea transport by modifying the expression of urea transporter B (UT-B) and aquaporins (AQP), the mRNA expression and protein abundance of UT-B and AQP3, AQP7, AQP8, and AQP10 were investigated in ruminal papillae from 9...... lactating dairy cows. Ruminal papillae were harvested from cows fed low N (12.9% crude protein) and high N (17.1% crude protein) diets in a crossover design with 21-d periods. The mRNA expression was determined by real-time reverse transcription-PCR and protein abundance by immunoblotting. The mRNA...... expression of UT-B was not affected by dietary treatment, whereas mRNA expression of AQP3, 7, and 10 were greater in the high N compared with the low N fed cows. Using peptide-derived rabbit antibodies to cow AQP3, 7, and 8, immunoblotting revealed bands of approximately 27, 27, and 24 kDa in ruminal...

  1. INTERLEUKIN-4 PREVENTS THE INDUCTION OF G-CSF MESSENGER-RNA IN HUMAN ADHERENT MONOCYTES IN RESPONSE TO ENDOTOXIN AND IL-1 STIMULATION

    NARCIS (Netherlands)

    VELLENGA, E; DOKTER, W; DEWOLF, JTM; VANDEVINNE, B; ESSELINK, MT; HALIE, MR

    Human recombinant interleukin-4 (IL-4) was studied for its effects on the expression of granulocyte-colony stimulating factor (G-CSF) mRNA in human adherent monocytes in the absence and presence of endotoxin and interleukin 1 (IL-1). IL-4 (15 ng/ml) did not induce G-CSF transcripts in monocytes but

  2. Messenger RNA electroporation of human monocytes, followed by rapid in vitro differentiation, leads to highly stimulatory antigen-loaded mature dendritic cells.

    Science.gov (United States)

    Ponsaerts, Peter; Van den Bosch, Glenn; Cools, Nathalie; Van Driessche, Ann; Nijs, Griet; Lenjou, Marc; Lardon, Filip; Van Broeckhoven, Christine; Van Bockstaele, Dirk R; Berneman, Zwi N; Van Tendeloo, Viggo F I

    2002-08-15

    Dendritic cells (DC) are professional Ag-capturing and -presenting cells of the immune system. Because of their exceptional capability of activating tumor-specific T cells, cancer vaccination research is now shifting toward the formulation of a clinical human DC vaccine. We developed a short term and serum-free culture protocol for rapid generation of fully mature, viable, and highly stimulatory CD83(+) DC. Human monocytes were cultured for 24 h in serum-free AIM-V medium, followed by 24-h maturation by polyriboinosinic polyribocytidylic acid (polyI:C). Short term cultured, polyI:C-maturated DC, far more than immature DC, showed typical mature DC markers and high allogeneic stimulatory capacity and had high autologous stimulatory capacity in an influenza model system using peptide-pulsed DC. Electroporation of mRNA as an Ag-loading strategy in these cells was optimized using mRNA encoding the enhanced green fluorescent protein (EGFP). Monocytes electroporated with EGFP mRNA, followed by short term, serum-free differentiation to mature DC, had a phenotype of DC, and all showed positive EGFP fluorescence. Influenza matrix protein mRNA-electroporated monocytes cultured serum-free and maturated with polyI:C showed high stimulatory capacity in autologous T cell activation experiments. In conclusion, the present short term and serum-free ex vivo DC culture protocol in combination with mRNA electroporation at the monocyte stage imply an important reduction in time and consumables for preparation of Ag-loaded mature DC compared with classical DC culture protocols and might find application in clinical immunotherapy settings.

  3. The Changes of TGF-α, TGF-β1 and Basic FGF Messenger RNA Expression in Rabbit Cornea after Photorefractive Keratectomy

    Institute of Scientific and Technical Information of China (English)

    Yisheng Zhong; Yingrning Zhou; Jingcai Lian; Wen Ye; Kangsun Wang; Feng Cheng

    2000-01-01

    Objective: To study the mechanism of haze formation and investigate the expression changes of transforming growth factor-αα(TGF-αα), transforming growth factor-β1 (TGF-β1)and basic fibroblast growth factor (bFGF) mRNA in corneal epithelium and stroma after photorefractive keratectomy (PRK).Methods: Sixteen white rabbits were randomly divided into 4 groups, and PRK was performed on each eye of 12 rabbits. The haze formation was examined under a slit-lamp microscope at the 1st, 2na and 3ra month after PRK, and the expressions of TGF-αα , TGF-βi and bFGF mRNA were detected with in situ hybridization.Results: The corneal haze formed at the 1st month after PRK. The most prominent haze formation was observed at the 2nd month, and declined gradually at the 3ra month after ablation. TGF-αα mRNA expression was presented on the normal corneal epithelium and not on the corneal stroma. TGF-βl and bGFG mRNA were expressed by both corneal epitheliurn and stroma. The capacities for cornea tissue expression of three growth factors mRNA increased after PRK, and the peaks appeared on the 1s, 2na month. The extent for expressions of three growth factors related proportionally to the haze formation.Conclusion: Three growth factors took part in promoting corneal wound healing after PRK, and might contribute to corneal haze formation and development.

  4. RNA sequencing of Sleeping Beauty transposon-induced tumors detects transposon-RNA fusions in forward genetic cancer screens

    Science.gov (United States)

    Temiz, Nuri A.; Moriarity, Branden S.; Wolf, Natalie K.; Riordan, Jesse D.; Dupuy, Adam J.; Largaespada, David A.; Sarver, Aaron L.

    2016-01-01

    Forward genetic screens using Sleeping Beauty (SB)-mobilized T2/Onc transposons have been used to identify common insertion sites (CISs) associated with tumor formation. Recurrent sites of transposon insertion are commonly identified using ligation-mediated PCR (LM-PCR). Here, we use RNA sequencing (RNA-seq) data to directly identify transcriptional events mediated by T2/Onc. Surprisingly, the majority (∼80%) of LM-PCR identified junction fragments do not lead to observable changes in RNA transcripts. However, in CIS regions, direct transcriptional effects of transposon insertions are observed. We developed an automated method to systematically identify T2/Onc-genome RNA fusion sequences in RNA-seq data. RNA fusion-based CISs were identified corresponding to both DNA-based CISs (Cdkn2a, Mycl1, Nf2, Pten, Sema6d, and Rere) and additional regions strongly associated with cancer that were not observed by LM-PCR (Myc, Akt1, Pth, Csf1r, Fgfr2, Wisp1, Map3k5, and Map4k3). In addition to calculating recurrent CISs, we also present complementary methods to identify potential driver events via determination of strongly supported fusions and fusions with large transcript level changes in the absence of multitumor recurrence. These methods independently identify CIS regions and also point to cancer-associated genes like Braf. We anticipate RNA-seq analyses of tumors from forward genetic screens will become an efficient tool to identify causal events. PMID:26553456

  5. RNA sequencing of Sleeping Beauty transposon-induced tumors detects transposon-RNA fusions in forward genetic cancer screens.

    Science.gov (United States)

    Temiz, Nuri A; Moriarity, Branden S; Wolf, Natalie K; Riordan, Jesse D; Dupuy, Adam J; Largaespada, David A; Sarver, Aaron L

    2016-01-01

    Forward genetic screens using Sleeping Beauty (SB)-mobilized T2/Onc transposons have been used to identify common insertion sites (CISs) associated with tumor formation. Recurrent sites of transposon insertion are commonly identified using ligation-mediated PCR (LM-PCR). Here, we use RNA sequencing (RNA-seq) data to directly identify transcriptional events mediated by T2/Onc. Surprisingly, the majority (∼80%) of LM-PCR identified junction fragments do not lead to observable changes in RNA transcripts. However, in CIS regions, direct transcriptional effects of transposon insertions are observed. We developed an automated method to systematically identify T2/Onc-genome RNA fusion sequences in RNA-seq data. RNA fusion-based CISs were identified corresponding to both DNA-based CISs (Cdkn2a, Mycl1, Nf2, Pten, Sema6d, and Rere) and additional regions strongly associated with cancer that were not observed by LM-PCR (Myc, Akt1, Pth, Csf1r, Fgfr2, Wisp1, Map3k5, and Map4k3). In addition to calculating recurrent CISs, we also present complementary methods to identify potential driver events via determination of strongly supported fusions and fusions with large transcript level changes in the absence of multitumor recurrence. These methods independently identify CIS regions and also point to cancer-associated genes like Braf. We anticipate RNA-seq analyses of tumors from forward genetic screens will become an efficient tool to identify causal events.

  6. Predicting sequence and structural specificities of RNA binding regions recognized by splicing factor SRSF1

    Directory of Open Access Journals (Sweden)

    Wang Xin

    2011-12-01

    Full Text Available Abstract Background RNA-binding proteins (RBPs play diverse roles in eukaryotic RNA processing. Despite their pervasive functions in coding and noncoding RNA biogenesis and regulation, elucidating the sequence specificities that define protein-RNA interactions remains a major challenge. Recently, CLIP-seq (Cross-linking immunoprecipitation followed by high-throughput sequencing has been successfully implemented to study the transcriptome-wide binding patterns of SRSF1, PTBP1, NOVA and fox2 proteins. These studies either adopted traditional methods like Multiple EM for Motif Elicitation (MEME to discover the sequence consensus of RBP's binding sites or used Z-score statistics to search for the overrepresented nucleotides of a certain size. We argue that most of these methods are not well-suited for RNA motif identification, as they are unable to incorporate the RNA structural context of protein-RNA interactions, which may affect to binding specificity. Here, we describe a novel model-based approach--RNAMotifModeler to identify the consensus of protein-RNA binding regions by integrating sequence features and RNA secondary structures. Results As an example, we implemented RNAMotifModeler on SRSF1 (SF2/ASF CLIP-seq data. The sequence-structural consensus we identified is a purine-rich octamer 'AGAAGAAG' in a highly single-stranded RNA context. The unpaired probabilities, the probabilities of not forming pairs, are significantly higher than negative controls and the flanking sequence surrounding the binding site, indicating that SRSF1 proteins tend to bind on single-stranded RNA. Further statistical evaluations revealed that the second and fifth bases of SRSF1octamer motif have much stronger sequence specificities, but weaker single-strandedness, while the third, fourth, sixth and seventh bases are far more likely to be single-stranded, but have more degenerate sequence specificities. Therefore, we hypothesize that nucleotide specificity and

  7. Sequence variation between 462 human individuals fine-tunes functional sites of RNA processing

    Science.gov (United States)

    Ferreira, Pedro G.; Oti, Martin; Barann, Matthias; Wieland, Thomas; Ezquina, Suzana; Friedländer, Marc R.; Rivas, Manuel A.; Esteve-Codina, Anna; Estivill, Xavier; Guigó, Roderic; Dermitzakis, Emmanouil; Antonarakis, Stylianos; Meitinger, Thomas; Strom, Tim M.; Palotie, Aarno; François Deleuze, Jean; Sudbrak, Ralf; Lerach, Hans; Gut, Ivo; Syvänen, Ann-Christine; Gyllensten, Ulf; Schreiber, Stefan; Rosenstiel, Philip; Brunner, Han; Veltman, Joris; Hoen, Peter A. C. T.; Jan van Ommen, Gert; Carracedo, Angel; Brazma, Alvis; Flicek, Paul; Cambon-Thomsen, Anne; Mangion, Jonathan; Bentley, David; Hamosh, Ada; Rosenstiel, Philip; Strom, Tim M.; Lappalainen, Tuuli; Guigó, Roderic; Sammeth, Michael

    2016-09-01

    Recent advances in the cost-efficiency of sequencing technologies enabled the combined DNA- and RNA-sequencing of human individuals at the population-scale, making genome-wide investigations of the inter-individual genetic impact on gene expression viable. Employing mRNA-sequencing data from the Geuvadis Project and genome sequencing data from the 1000 Genomes Project we show that the computational analysis of DNA sequences around splice sites and poly-A signals is able to explain several observations in the phenotype data. In contrast to widespread assessments of statistically significant associations between DNA polymorphisms and quantitative traits, we developed a computational tool to pinpoint the molecular mechanisms by which genetic markers drive variation in RNA-processing, cataloguing and classifying alleles that change the affinity of core RNA elements to their recognizing factors. The in silico models we employ further suggest RNA editing can moonlight as a splicing-modulator, albeit less frequently than genomic sequence diversity. Beyond existing annotations, we demonstrate that the ultra-high resolution of RNA-Seq combined from 462 individuals also provides evidence for thousands of bona fide novel elements of RNA processing—alternative splice sites, introns, and cleavage sites—which are often rare and lowly expressed but in other characteristics similar to their annotated counterparts.

  8. Sequence variation between 462 human individuals fine-tunes functional sites of RNA processing

    Science.gov (United States)

    Ferreira, Pedro G.; Oti, Martin; Barann, Matthias; Wieland, Thomas; Ezquina, Suzana; Friedländer, Marc R.; Rivas, Manuel A.; Esteve-Codina, Anna; Estivill, Xavier; Guigó, Roderic; Dermitzakis, Emmanouil; Antonarakis, Stylianos; Meitinger, Thomas; Strom, Tim M; Palotie, Aarno; François Deleuze, Jean; Sudbrak, Ralf; Lerach, Hans; Gut, Ivo; Syvänen, Ann-Christine; Gyllensten, Ulf; Schreiber, Stefan; Rosenstiel, Philip; Brunner, Han; Veltman, Joris; Hoen, Peter A.C.T; Jan van Ommen, Gert; Carracedo, Angel; Brazma, Alvis; Flicek, Paul; Cambon-Thomsen, Anne; Mangion, Jonathan; Bentley, David; Hamosh, Ada; Rosenstiel, Philip; Strom, Tim M; Lappalainen, Tuuli; Guigó, Roderic; Sammeth, Michael

    2016-01-01

    Recent advances in the cost-efficiency of sequencing technologies enabled the combined DNA- and RNA-sequencing of human individuals at the population-scale, making genome-wide investigations of the inter-individual genetic impact on gene expression viable. Employing mRNA-sequencing data from the Geuvadis Project and genome sequencing data from the 1000 Genomes Project we show that the computational analysis of DNA sequences around splice sites and poly-A signals is able to explain several observations in the phenotype data. In contrast to widespread assessments of statistically significant associations between DNA polymorphisms and quantitative traits, we developed a computational tool to pinpoint the molecular mechanisms by which genetic markers drive variation in RNA-processing, cataloguing and classifying alleles that change the affinity of core RNA elements to their recognizing factors. The in silico models we employ further suggest RNA editing can moonlight as a splicing-modulator, albeit less frequently than genomic sequence diversity. Beyond existing annotations, we demonstrate that the ultra-high resolution of RNA-Seq combined from 462 individuals also provides evidence for thousands of bona fide novel elements of RNA processing—alternative splice sites, introns, and cleavage sites—which are often rare and lowly expressed but in other characteristics similar to their annotated counterparts. PMID:27617755

  9. Sequence-non-specific effects generated by various types of RNA interference triggers.

    Science.gov (United States)

    Olejniczak, Marta; Urbanek, Martyna O; Jaworska, Edyta; Witucki, Lukasz; Szczesniak, Michal W; Makalowska, Izabela; Krzyzosiak, Wlodzimierz J

    2016-02-01

    RNA interference triggers such as short interfering RNA (siRNA) or genetically encoded short hairpin RNA (shRNA) and artificial miRNA (sh-miR) are widely used to silence the expression of specific genes. In addition to silencing selected targets, RNAi reagents may induce various side effects, including immune responses. To determine the molecular markers of immune response activation when using RNAi reagents, we analyzed the results of experiments gathered in the RNAimmuno (v 2.0) and GEO Profiles databases. To better characterize and compare cellular responses to various RNAi reagents in one experimental system, we designed a reagent series in corresponding siRNA, D-siRNA, shRNA and sh-miR forms. To exclude sequence-specific effects the reagents targeted 3 different transcripts (Luc, ATXN3 and HTT). We demonstrate that RNAi reagents induce a broad variety of sequence-non-specific effects, including the deregulation of cellular miRNA levels. Typical siRNAs are weak stimulators of interferon response but may saturate the miRNA biogenesis pathway, leading to the downregulation of highly expressed miRNAs, whereas plasmid-based reagents induce known markers of immune response and may alter miRNA levels and their isomiR composition.

  10. MicroRNA Expression Profile in Penile Cancer Revealed by Next-Generation Small RNA Sequencing.

    Directory of Open Access Journals (Sweden)

    Li Zhang

    Full Text Available Penile cancer (PeCa is a relatively rare tumor entity but possesses higher morbidity and mortality rates especially in developing countries. To date, the concrete pathogenic signaling pathways and core machineries involved in tumorigenesis and progression of PeCa remain to be elucidated. Several studies suggested miRNAs, which modulate gene expression at posttranscriptional level, were frequently mis-regulated and aberrantly expressed in human cancers. However, the miRNA profile in human PeCa has not been reported before. In this present study, the miRNA profile was obtained from 10 fresh penile cancerous tissues and matched adjacent non-cancerous tissues via next-generation sequencing. As a result, a total of 751 and 806 annotated miRNAs were identified in normal and cancerous penile tissues, respectively. Among which, 56 miRNAs with significantly different expression levels between paired tissues were identified. Subsequently, several annotated miRNAs were selected randomly and validated using quantitative real-time PCR. Compared with the previous publications regarding to the altered miRNAs expression in various cancers and especially genitourinary (prostate, bladder, kidney, testis cancers, the most majority of deregulated miRNAs showed the similar expression pattern in penile cancer. Moreover, the bioinformatics analyses suggested that the putative target genes of differentially expressed miRNAs between cancerous and matched normal penile tissues were tightly associated with cell junction, proliferation, growth as well as genomic instability and so on, by modulating Wnt, MAPK, p53, PI3K-Akt, Notch and TGF-β signaling pathways, which were all well-established to participate in cancer initiation and progression. Our work presents a global view of the differentially expressed miRNAs and potentially regulatory networks of their target genes for clarifying the pathogenic transformation of normal penis to PeCa, which research resource also

  11. Informatics for RNA Sequencing: A Web Resource for Analysis on the Cloud.

    Science.gov (United States)

    Griffith, Malachi; Walker, Jason R; Spies, Nicholas C; Ainscough, Benjamin J; Griffith, Obi L

    2015-08-01

    Massively parallel RNA sequencing (RNA-seq) has rapidly become the assay of choice for interrogating RNA transcript abundance and diversity. This article provides a detailed introduction to fundamental RNA-seq molecular biology and informatics concepts. We make available open-access RNA-seq tutorials that cover cloud computing, tool installation, relevant file formats, reference genomes, transcriptome annotations, quality-control strategies, expression, differential expression, and alternative splicing analysis methods. These tutorials and additional training resources are accompanied by complete analysis pipelines and test datasets made available without encumbrance at www.rnaseq.wiki.

  12. Informatics for RNA Sequencing: A Web Resource for Analysis on the Cloud.

    Directory of Open Access Journals (Sweden)

    Malachi Griffith

    2015-08-01

    Full Text Available Massively parallel RNA sequencing (RNA-seq has rapidly become the assay of choice for interrogating RNA transcript abundance and diversity. This article provides a detailed introduction to fundamental RNA-seq molecular biology and informatics concepts. We make available open-access RNA-seq tutorials that cover cloud computing, tool installation, relevant file formats, reference genomes, transcriptome annotations, quality-control strategies, expression, differential expression, and alternative splicing analysis methods. These tutorials and additional training resources are accompanied by complete analysis pipelines and test datasets made available without encumbrance at www.rnaseq.wiki.

  13. RNA sequencing atopic dermatitis transcriptome profiling provides insights into novel disease mechanisms with potential therapeutic implications

    DEFF Research Database (Denmark)

    Suárez-Fariñas, Mayte; Ungar, Benjamin; Correa da Rosa, Joel

    2015-01-01

    . These limitations might be lessened with next-generation RNA sequencing (RNA-seq). Objective: We sought to define the lesional AD transcriptome using RNA-seq and compare it using microarrays performed on the same cohort. Methods: RNA-seq and microarrays were performed to identify differentially expressed genes...... RNA-seq showed somewhat better agreement with RT-PCR (intraclass correlation coefficient, 0.57 and 0.70 for microarrays and RNA-seq vs RT-PCR, respectively), bias was not eliminated. Among genes uniquely identified by using RNA-seq were triggering receptor expressed on myeloid cells 1 (TREM-1......) signaling (eg, CCL2, CCL3, and single immunoglobulin domain IL1R1 related [SIGIRR]) and IL-36 isoform genes. TREM-1 is a surface receptor implicated in innate and adaptive immunity that amplifies infection-related inflammation. Conclusions: This is the first report of a lesional AD phenotype using RNA-seq...

  14. Detection of Messenger RNA for Gonadotropin-Releasing Hormone (GnRH) but not for GnRH Receptors in Rat Pancreas

    Institute of Scientific and Technical Information of China (English)

    王雷; 谢莉萍; 黄威权; 张荣庆

    2001-01-01

    Although gonadotropin-releasing hormone (GnRH), GnRH-like molecule, and GnRH receptor (GnRH-R) have been reported to exist in several tissues other than brain or anterior pituitary, there are no reports concerning GnRH or GnRH-R gene expression in a normal pancreatic gland. In order to define the production of GnRH as well as GnRH-R in the pancreatic gland, we examined their gene expression in various developmental stages of rat pancreas using the reverse transcriptase-polymerase chain reaction (RT-PCR).GnRH mRNA transcripts were found in pancreas of male and female rats at different ages, expressing at about the same level, whereas GnRH-R mRNA transcripts could not be detected in any rat pancreatic gland samples. These results suggest a possible biological role of GnRH in rodent pancreas.

  15. Influences of Sex, Incubation Temperature, and Environmental Quality on Gonadal Estrogen and Androgen Receptor Messenger RNA Expression in Juvenile American Alligators (Alligator mississippiensis)1

    Science.gov (United States)

    Moore, Brandon C.; Milnes, Matthew R.; Kohno, Satomi; Katsu, Yoshinao; Iguchi, Taisen; Guillette, Louis J.

    2009-01-01

    Gonadal steroid hormone receptors play a vital role in transforming ligand signals into gene expression. We have shown previously that gonads from wild-caught juvenile alligators express greater levels of estrogen receptor 1 (ESR1) than estrogen receptor 2 (ESR2). Furthermore, sexually dimorphic ESR2 mRNA expression (female > male) observed in animals from the reference site (Lake Woodruff, FL, USA) was lost in alligators from the contaminated Lake Apopka (FL, USA). We postulated that environmental contaminant exposure could influence gonadal steroid hormone receptor expression. Here, we address questions regarding gonadal estrogen and androgen receptor (AR) mRNA expression in 1-yr-old, laboratory-raised alligators. What are relative expression levels within gonads? Do these levels vary between sexes or incubation temperatures? Can contaminant exposure change these levels? We observed a similar pattern of expression (ESR1 > AR > ESR2) in ovary and testis. However, both incubation temperature and environment modulated expression. Males incubated at 33.5°C expressed greater AR levels than females incubated at 30°C; dimorphic expression was not observed in animals incubated at 32°C. Compared to Lake Woodruff alligators, Lake Apopka animals of both sexes showed lesser ESR2 mRNA expression levels. Employing cluster analyses, we integrated these receptor expression patterns with those of steroidogenic factors. Elevated ESR2 and CYP19A1 expressions were diagnostic of alligator ovary, whereas elevated HSD3B1, CYP11A1, and CYP17A1 expressions were indicative of testis. In contrast, AR, ESR1, and NR5A1 showed variable expressions that were not entirely associated with sex. These findings demonstrate that the mRNA expression of receptors required for steroid hormone signaling are modified by exposure to environmental factors, including temperature and contaminants. PMID:19759368

  16. Appropriateness of reference genes for normalizing messenger RNA in mouse 2,4-dinitrobenzene sulfonic acid (DNBS)-induced colitis using quantitative real time PCR

    Science.gov (United States)

    Eissa, Nour; Kermarrec, Laëtitia; Hussein, Hayam; Bernstein, Charles N.; Ghia, Jean-Eric

    2017-01-01

    2,4-Dinitrobenzene sulfonic acid (DNBS)-induced colitis is an experimental model that mimics Crohn’s disease. Appropriateness of reference genes is crucial for RT-qPCR. This is the first study to determine the stability of reference gene expression (RGE) in mice treated with DNBS. DNBS experimental Colitis was induced in male C57BL/6 mice. RNA was extracted from colon tissue and comprehensive analysis of 13 RGE was performed according to predefined criteria. Relative colonic TNF-α and IL-1β mRNA levels were calculated. Colitis significantly altered the stability of mucosal RGE. Commonly used glyceraldehyde-3-phosphate dehydrogenase (Gapdh), β-actin (Actb), or β2-microglobulin (β2m) showed the highest fluctuation within the inflamed and control groups. Conversely, ribosomal protein large P0 (Rplp0), non-POU domain containing (Nono), TATA-box-binding protein (Tbp) and eukaryotic translation elongation factor 2 (Eef2) were not affected by inflammation and were the most stable genes. TNF-α and IL-1β mRNA levels was dependent on the reference gene used and varied from significant when the most stable genes were used to non-significant when the least stable genes were used. The appropriate choice of RGE is critical to guarantee satisfactory normalization of RT-qPCR data when using DNBS-Model. We recommend using Rplp0, Nono, Tbp, Hprt and Eef2 instead of common reference genes. PMID:28186172

  17. Predicting RNA secondary structure by the comparative approach: how to select the homologous sequences

    Directory of Open Access Journals (Sweden)

    Tahi Fariza

    2007-11-01

    Full Text Available Abstract Background The secondary structure of an RNA must be known before the relationship between its structure and function can be determined. One way to predict the secondary structure of an RNA is to identify covarying residues that maintain the pairings (Watson-Crick, Wobble and non-canonical pairings. This "comparative approach" consists of identifying mutations from homologous sequence alignments. The sequences must covary enough for compensatory mutations to be revealed, but comparison is difficult if they are too different. Thus the choice of homologous sequences is critical. While many possible combinations of homologous sequences may be used for prediction, only a few will give good structure predictions. This can be due to poor quality alignment in stems or to the variability of certain sequences. This problem of sequence selection is currently unsolved. Results This paper describes an algorithm, SSCA, which measures the suitability of sequences for the comparative approach. It is based on evolutionary models with structure constraints, particularly those on sequence variations and stem alignment. We propose three models, based on different constraints on sequence alignments. We show the results of the SSCA algorithm for predicting the secondary structure of several RNAs. SSCA enabled us to choose sets of homologous sequences that gave better predictions than arbitrarily chosen sets of homologous sequences. Conclusion SSCA is an algorithm for selecting combinations of RNA homologous sequences suitable for secondary structure predictions with the comparative approach.

  18. Nucleotide sequence of the SrRNA gene and phylogenetic analysis of Trichomonas tenax.

    Science.gov (United States)

    Fukura, K; Yamamoto, A; Hashimoto, T; Goto, N

    1996-01-01

    The small subunit ribosomal RNA (SrRNA) gene of Trichomonas tenax ATCC30207 was amplified by PCR and the 1.55-kb product was cloned into plasmid vector pUC18. Four clones were isolated and sequenced. The insert DNAs were 1,552 bp long and their G+C contents were 48.1%; three of them had exactly the same DNA sequences and one had only one nucleotide change. A representative SrRNA sequence was analyzed and a phylogenetic tree was estimated by the neighbor-joining (NJ) method. Among the protists examined, T. tenax was placed as the closest relative of Tritrichomonas foetus, as expected from the traditional taxonomy. The total homology between the two SrRNA sequences was 89.2%.

  19. Non-invasive analysis of intestinal development in preterm and term infants using RNA-Sequencing

    National Research Council Canada - National Science Library

    Knight, Jason M; Davidson, Laurie A; Herman, Damir; Martin, Camilia R; Goldsby, Jennifer S; Ivanov, Ivan V; Donovan, Sharon M; Chapkin, Robert S

    2014-01-01

    ... in the healthy newborn intestine. To that end, we have developed a novel, noninvasive, molecular approach that utilizes next generation RNA sequencing on stool samples containing intact epithelial cells for the purpose of quantifying...

  20. Species identification and profiling of complex microbial communities using shotgun Illumina sequencing of 16S rRNA amplicon sequences.

    Directory of Open Access Journals (Sweden)

    Swee Hoe Ong

    Full Text Available The high throughput and cost-effectiveness afforded by short-read sequencing technologies, in principle, enable researchers to perform 16S rRNA profiling of complex microbial communities at unprecedented depth and resolution. Existing Illumina sequencing protocols are, however, limited by the fraction of the 16S rRNA gene that is interrogated and therefore limit the resolution and quality of the profiling. To address this, we present the design of a novel protocol for shotgun Illumina sequencing of the bacterial 16S rRNA gene, optimized to amplify more than 90% of sequences in the Greengenes database and with the ability to distinguish nearly twice as many species-level OTUs compared to existing protocols. Using several in silico and experimental datasets, we demonstrate that despite the presence of multiple variable and conserved regions, the resulting shotgun sequences can be used to accurately quantify the constituents of complex microbial communities. The reconstruction of a significant fraction of the 16S rRNA gene also enabled high precision (>90% in species-level identification thereby opening up potential application of this approach for clinical microbial characterization.

  1. Barcoding bias in high-throughput multiplex sequencing of miRNA.

    Science.gov (United States)

    Alon, Shahar; Vigneault, Francois; Eminaga, Seda; Christodoulou, Danos C; Seidman, Jonathan G; Church, George M; Eisenberg, Eli

    2011-09-01

    Second-generation sequencing is gradually becoming the method of choice for miRNA detection and expression profiling. Given the relatively small number of miRNAs and improvements in DNA sequencing technology, studying miRNA expression profiles of multiple samples in a single flow cell lane becomes feasible. Multiplexing strategies require marking each miRNA library with a DNA barcode. Here we report that barcodes introduced through adapter ligation confer significant bias on miRNA expression profiles. This bias is much higher than the expected Poisson noise and masks significant expression differences between miRNA libraries. This bias can be eliminated by adding barcodes during PCR amplification of libraries. The accuracy of miRNA expression measurement in multiplexed experiments becomes a function of sample number.

  2. Small RNA sequencing reveals a comprehensive miRNA signature of BRCA1-associated high-grade serous ovarian cancer

    NARCIS (Netherlands)

    Brouwer, Jan; Kluiver, Joost; de Almeida, Rodrigo C; Modderman, Rutger; Terpstra, Miente Martijn; Kok, Klaas; Withoff, Sebo; Hollema, Harry; Reitsma, Welmoed; de Bock, Geertruida H; Mourits, Marian J E; van den Berg, Anke

    2016-01-01

    AIMS: BRCA1 mutation carriers are at increased risk of developing high-grade serous ovarian cancer (HGSOC), a malignancy that originates from fallopian tube epithelium. We aimed to identify differentially expressed known and novel miRNAs in BRCA1-associated HGSOC. METHODS: Small RNA sequencing was p

  3. Small RNA sequencing reveals a comprehensive miRNA signature of BRCA1-associated high-grade serous ovarian cancer

    NARCIS (Netherlands)

    Brouwer, Jan; Kluiver, Joost; de Almeida, Rodrigo C.; Modderman, Rutger; Terpstra, Miente Martijn; Kok, Klaas; Withoff, Sebo; Hollema, Harry; Reitsma, Welmoed; de Bock, Geertruida H.; Mourits, Marian J. E.; van den Berg, Anke

    2016-01-01

    AimsBRCA1 mutation carriers are at increased risk of developing high-grade serous ovarian cancer (HGSOC), a malignancy that originates from fallopian tube epithelium. We aimed to identify differentially expressed known and novel miRNAs in BRCA1-associated HGSOC. Methods Small RNA sequencing was perf

  4. Identification of Bacterial Small RNAs by RNA Sequencing

    DEFF Research Database (Denmark)

    Gómez Lozano, María; Marvig, Rasmus Lykke; Molin, Søren;

    2014-01-01

    Small regulatory RNAs (sRNAs) in bacteria are known to modulate gene expression and control a variety of processes including metabolic reactions, stress responses, and pathogenesis in response to environmental signals. A method to identify bacterial sRNAs on a genome-wide scale based on RNA seque...

  5. Effect of chronic uremia on the transcriptional profile of the calcified aorta analyzed by RNA sequencing

    OpenAIRE

    Rukov, Jakob L.; Gravesen, Eva; Mace, Maria L.; Hofman-Bang, Jacob; Vinther, Jeppe; Andersen, Claus B.; Lewin, Ewa; Olgaard, Klaus

    2016-01-01

    The development of vascular calcification (VC) in chronic uremia (CU) is a tightly regulated process controlled by factors promoting and inhibiting mineralization. Next-generation high-throughput RNA sequencing (RNA-seq) is a powerful and sensitive tool for quantitative gene expression profiling and the detection of differentially expressed genes. In the present study, we, for the first time, used RNA-seq to examine rat aorta transcriptomes from CU rats compared with control rats. Severe VC w...

  6. Genetic selection and DNA sequences of 4.5S RNA homologs

    DEFF Research Database (Denmark)

    Brown, S; Thon, G; Tolentino, E

    1989-01-01

    A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

  7. Body fluid identification of blood, saliva and semen using second generation sequencing of micro-RNA

    DEFF Research Database (Denmark)

    Petersen, Christel H.; Hjort, Benjamin Benn; Tvedebrink, Torben;

    2013-01-01

    We report a new second generation sequencing method for identification micro-RNA (miRNA) that can be used to identify body fluids and tissues. Principal component analysis of 10 miRNAs with high expression in 16 samples of blood, saliva and semen showed clear differences in the expression of mi...

  8. Body fluid identification of blood, saliva and semen using second generation sequencing of micro-RNA

    DEFF Research Database (Denmark)

    Petersen, Christel Hougård; Hjort, Benjamin Benn; Tvedebrink, Torben;

    2013-01-01

    We report a new second generation sequencing method for identification micro-RNA (miRNA) that can be used to identify body fluids and tissues. Principal component analysis of 10 miRNAs with high expression in 16 samples of blood, saliva and semen showed clear differences in the expression of miRN...

  9. Deep RNA Sequencing of the Skeletal Muscle Transcriptome in Swimming Fish

    NARCIS (Netherlands)

    Palstra, A.P.; Beltran, S.; Burgerhout, E.; Brittijn, S.A.; Magnoni, L.J.; Henkel, C.V.; Jansen, A.; Thillart, G.E.E.J.M.; Spaink, H.P.; Planas, J.V.

    2013-01-01

    Deep RNA sequencing (RNA-seq) was performed to provide an in-depth view of the transcriptome of red and white skeletal muscle of exercised and non-exercised rainbow trout (Oncorhynchus mykiss) with the specific objective to identify expressed genes and quantify the transcriptomic effects of swimming

  10. High-Throughput Mapping of Single-Neuron Projections by Sequencing of Barcoded RNA.

    Science.gov (United States)

    Kebschull, Justus M; Garcia da Silva, Pedro; Reid, Ashlan P; Peikon, Ian D; Albeanu, Dinu F; Zador, Anthony M

    2016-09-01

    Neurons transmit information to distant brain regions via long-range axonal projections. In the mouse, area-to-area connections have only been systematically mapped using bulk labeling techniques, which obscure the diverse projections of intermingled single neurons. Here we describe MAPseq (Multiplexed Analysis of Projections by Sequencing), a technique that can map the projections of thousands or even millions of single neurons by labeling large sets of neurons with random RNA sequences ("barcodes"). Axons are filled with barcode mRNA, each putative projection area is dissected, and the barcode mRNA is extracted and sequenced. Applying MAPseq to the locus coeruleus (LC), we find that individual LC neurons have preferred cortical targets. By recasting neuroanatomy, which is traditionally viewed as a problem of microscopy, as a problem of sequencing, MAPseq harnesses advances in sequencing technology to permit high-throughput interrogation of brain circuits.

  11. Unusual loop-sequence flexibility of the proximal RNA replication element in EMCV.

    Directory of Open Access Journals (Sweden)

    Jan Zoll

    Full Text Available Picornaviruses contain stable RNA structures at the 5' and 3' ends of the RNA genome, OriL and OriR involved in viral RNA replication. The OriL RNA element found at the 5' end of the enterovirus genome folds into a cloverleaf-like configuration. In vivo SELEX experiments revealed that functioning of the poliovirus cloverleaf depends on a specific structure in this RNA element. Little is known about the OriL of cardioviruses. Here, we investigated structural aspects and requirements of the apical loop of proximal stem-loop SL-A of mengovirus, a strain of EMCV. Using NMR spectroscopy, we showed that the mengovirus SL-A apical loop consists of an octaloop. In vivo SELEX experiments demonstrated that a large number of random sequences are tolerated in the apical octaloop that support virus replication. Mutants in which the SL-A loop size and the length of the upper part of the stem were varied showed that both stem-length and stability of the octaloop are important determinants for viral RNA replication and virus reproduction. Together, these data show that stem-loop A plays an important role in virus replication. The high degree of sequence flexibility and the lack of selective pressure on the octaloop argue against a role in sequence specific RNA-protein or RNA-RNA interactions in which octaloop nucleotides are involved.

  12. Differential expression in glioblastoma multiforme and cerebral hemangioblastoma of cytoplasmic proteins that bind two different domains within the 3'-untranslated region of the human glucose transporter 1 (GLUT1) messenger RNA.

    Science.gov (United States)

    Tsukamoto, H; Boado, R J; Pardridge, W M

    1996-01-01

    The glucose transporter 1 (GLUT1) protein is underexpressed in human glioblastoma multiforme and is overexpressed in human cerebral hemangioblastoma. To gain in-sight into possible posttranscriptional mechanisms regulating the expression of the GLUT1 protein in human brain tumors, cytosolic proteins were prepared from these two tumors and used in RNase T1 protection assays that employed [32P]human GLUT1 synthetic RNA prepared from transcription plasmids. Gel shift mobility assays and ultra-violet light cross-linking studies demonstrated the formation of specific RNA/protein complexes that migrated with a mol mass of 120, 44, and 41 kD. RNase T1 mapping and oligodeoxynucleotide competition studies showed that the 120 kD complex was comprised of an RNA fragment that localized to nucleotides 2186-2203 of the GLUT1 mRNA. The 44 kD complex contained an adenosine-uridine-rich RNA fragment that localized to nucleotides 1885-1906 of the human GLUT1 mRNA, and the formation of this complex was inhibited by synthetic RNA enriched in adenosine-uridine sequences. The 44 kD complex was selectively downregulated in hemangioblastoma as compared to glioblastoma multiforme. These studies demonstrate that human brain tumors have differential regulation of cytosolic proteins that specifically interact with two different domains in the 3'-untranslated region of the GLUT1 mRNA, which may serve to mediate the posttranscriptional regulation of GLUT1 gene expression in these tumors. PMID:8675694

  13. A carvacrol-thymol blend decreased intestinal oxidative stress and influenced selected microbes without changing the messenger RNA levels of tight junction proteins in jejunal mucosa of weaning piglets.

    Science.gov (United States)

    Wei, H-K; Xue, H-X; Zhou, Z X; Peng, J

    2017-02-01

    Recent studies indicate that intestinal oxidative stress and microbiota imbalance is involved in weaning-induced intestinal dysfunction in piglets. We have investigated the effect of feeding a carvacrol-thymol blend supplemented diet on intestinal redox status, selected microbial populations and the intestinal barrier in weaning piglets. The piglets (weaned at 21 days of age) were randomly allocated to two groups with six pens per treatment and 10 piglets per pen. At weaning day (21 days of age), six piglets were sacrificed before weaning to serve as the preweaning group. The weaned group was fed with a basal diet, while the weaned-CB group was fed with the basal diet supplemented with 100 mg/kg carvacrol-thymol (1 : 1) blend for 14 days. On day 7 post-weaning, six piglets from each group were sacrificed to determine intestinal redox status, selected microbial populations, messenger RNA (mRNA) transcript levels of proinflammatory cytokines and biomarkers of intestinal barrier function. Weaning resulted in intestinal oxidative stress, indicated by the increased concentration of reactive oxygen species and thiobarbituric acid-reactive substances present in the intestine. Weaning also reduced the population of Lactobacillus genus and increased the populations of Enterococcus genus and Escherichia coli in the jejunum, and increased mRNA levels of tumor necrosis factor α (TNF-α), interleukin 1β and interleukin 6 (IL-6). In addition, decreased mRNA levels of zonula occludens and occludin in the jejunal mucosa and increased plasma diamine oxidase concentrations indicated that weaning induced dysfunction of the intestinal barrier. On day 7 post-weaning, supplementation with the carvacrol-thymol blend restored weaning-induced intestinal oxidative stress. Compared with the weaned group, the weaned-CB group had an increased population of Lactobacillus genus but reduced populations of Enterococcus genus and E. coli in the jejunum and decreased mRNA levels of TNF-α. The

  14. Analysis of 16S rRNA amplicon sequencing options on the Roche/454 next-generation titanium sequencing platform.

    Directory of Open Access Journals (Sweden)

    Hideyuki Tamaki

    Full Text Available BACKGROUND: 16S rRNA gene pyrosequencing approach has revolutionized studies in microbial ecology. While primer selection and short read length can affect the resulting microbial community profile, little is known about the influence of pyrosequencing methods on the sequencing throughput and the outcome of microbial community analyses. The aim of this study is to compare differences in output, ease, and cost among three different amplicon pyrosequencing methods for the Roche/454 Titanium platform METHODOLOGY/PRINCIPAL FINDINGS: The following three pyrosequencing methods for 16S rRNA genes were selected in this study: Method-1 (standard method is the recommended method for bi-directional sequencing using the LIB-A kit; Method-2 is a new option designed in this study for unidirectional sequencing with the LIB-A kit; and Method-3 uses the LIB-L kit for unidirectional sequencing. In our comparison among these three methods using 10 different environmental samples, Method-2 and Method-3 produced 1.5-1.6 times more useable reads than the standard method (Method-1, after quality-based trimming, and did not compromise the outcome of microbial community analyses. Specifically, Method-3 is the most cost-effective unidirectional amplicon sequencing method as it provided the most reads and required the least effort in consumables management. CONCLUSIONS: Our findings clearly demonstrated that alternative pyrosequencing methods for 16S rRNA genes could drastically affect sequencing output (e.g. number of reads before and after trimming but have little effect on the outcomes of microbial community analysis. This finding is important for both researchers and sequencing facilities utilizing 16S rRNA gene pyrosequencing for microbial ecological studies.

  15. Next generation sequencing analysis of human platelet PolyA+ mRNAs and rRNA-depleted total RNA.

    Science.gov (United States)

    Kissopoulou, Antheia; Jonasson, Jon; Lindahl, Tomas L; Osman, Abdimajid

    2013-01-01

    Platelets are small anucleate cells circulating in the blood vessels where they play a key role in hemostasis and thrombosis. Here, we compared platelet RNA-Seq results obtained from polyA+ mRNA and rRNA-depleted total RNA. We used purified, CD45 depleted, human blood platelets collected by apheresis from three male and one female healthy blood donors. The Illumina HiSeq 2000 platform was employed to sequence cDNA converted either from oligo(dT) isolated polyA+ RNA or from rRNA-depleted total RNA. The reads were aligned to the GRCh37 reference assembly with the TopHat/Cufflinks alignment package using Ensembl annotations. A de novo assembly of the platelet transcriptome using the Trinity software package and RSEM was also performed. The bioinformatic tools HTSeq and DESeq from Bioconductor were employed for further statistical analyses of read counts. Consistent with previous findings our data suggests that mitochondrially expressed genes comprise a substantial fraction of the platelet transcriptome. We also identified high transcript levels for protein coding genes related to the cytoskeleton function, chemokine signaling, cell adhesion, aggregation, as well as receptor interaction between cells. Certain transcripts were particularly abundant in platelets compared with other cell and tissue types represented by RNA-Seq data from the Illumina Human Body Map 2.0 project. Irrespective of the different library preparation and sequencing protocols, there was good agreement between samples from the 4 individuals. Eighteen differentially expressed genes were identified in the two sexes at 10% false discovery rate using DESeq. The present data suggests that platelets may have a unique transcriptome profile characterized by a relative over-expression of mitochondrially encoded genes and also of genomic transcripts related to the cytoskeleton function, chemokine signaling and surface components compared with other cell and tissue types. The in vivo functional significance

  16. An energy-rich diet enhances expression of Na(+)/H(+) exchanger isoform 1 and 3 messenger RNA in rumen epithelium of goat.

    Science.gov (United States)

    Yang, W; Shen, Z; Martens, H

    2012-01-01

    Rumen epithelial Na(+)/H(+) exchanger (NHE) catalyzes the exchange of extracellular Na(+) for intracellular H(+). Thus, it is of importance in the maintenance of Na and pH homeostasis of rumen epithelial cells. We have tested the hypothesis that an increase in energy and protein intake induces alterations of NHE isoform 1, 2, and 3 (NHE1, NHE1, and NHE3, respectively) mRNA abundance in the rumen epithelium of goats. Goats (n = 26) were randomly allocated to 2 experiments (n = 16 in Exp. 1, and n = 10 in Exp. 2) and fed either peanut straw ad libitum [PNS, n = 8 in Exp. 1, and n = 5 in Exp. 2; 600 kJ of ME/(kg(0.75)·d)] or PNS + concentrate [CF, n = 8 in Exp. 1, and n = 5 in Exp. 2; 1,000 kJ of ME/(kg(0.75)·d)] for 42 d. Concentrate (400 g/d) was given daily (0800 to 1700 h) in 4 equal portions at 3-h intervals. In Exp. 1, the goats were euthanized 2 h after the last portion of concentrate was fed, and in Exp. 2, the goats were euthanized after a fasting period of 16 h. In Exp. 1, goats in the CF treatment exhibited a greater ruminal short-chain fatty acid (SCFA) concentration (140.6 ± 1.30 mM) compared with those in the PNS treatment (114.3 ± 3.11 mM; P goats in the CF treatment than for those in the PNS treatment. However, in Exp. 2, 16 h of fasting abolished differences in ruminal SCFA concentration, pH, and NHE mRNA expression between goats in the CF and PNS treatments. In both Exp. 1 and 2, a positive correlation was observed between ruminal SCFA concentration and expression of mRNA in NHE1 and NHE3, whereas expression was negatively correlated with ruminal pH. In in vitro studies with isolated rumen epithelial cells from goats fed dried grass, exposure to pH of 6.8 or to 20 mM SCFA increased (P diet-dependent rumen epithelial NHE1 and NHE3 expression is probably related to ruminal SCFA concentration and pH, but that is not the case with NHE2.

  17. Complete Genome Sequence of a Double-Stranded RNA Virus from Avocado

    Science.gov (United States)

    Villanueva, Francisco; Sabanadzovic, Sead; Valverde, Rodrigo A.

    2012-01-01

    A number of avocado (Persea americana) cultivars are known to contain high-molecular-weight double-stranded RNA (dsRNA) molecules for which a viral nature has been suggested, although sequence data are not available. Here we report the cloning and complete sequencing of a 13.5-kbp dsRNA virus isolated from avocado and show that it corresponds to the genome of a new species of the genus Endornavirus (family Endornaviridae), tentatively named Persea americana endornavirus (PaEV). PMID:22205720

  18. 4SALE – A tool for synchronous RNA sequence and secondary structure alignment and editing

    Directory of Open Access Journals (Sweden)

    Schultz Jörg

    2006-11-01

    Full Text Available Abstract Background In sequence analysis the multiple alignment builds the fundament of all proceeding analyses. Errors in an alignment could strongly influence all succeeding analyses and therefore could lead to wrong predictions. Hand-crafted and hand-improved alignments are necessary and meanwhile good common practice. For RNA sequences often the primary sequence as well as a secondary structure consensus is well known, e.g., the cloverleaf structure of the t-RNA. Recently, some alignment editors are proposed that are able to include and model both kinds of information. However, with the advent of a large amount of reliable RNA sequences together with their solved secondary structures (available from e.g. the ITS2 Database, we are faced with the problem to handle sequences and their associated secondary structures synchronously. Results 4SALE fills this gap. The application allows a fast sequence and synchronous secondary structure alignment for large data sets and for the first time synchronous manual editing of aligned sequences and their secondary structures. This study describes an algorithm for the synchronous alignment of sequences and their associated secondary structures as well as the main features of 4SALE used for further analyses and editing. 4SALE builds an optimal and unique starting point for every RNA sequence and structure analysis. Conclusion 4SALE, which provides an user-friendly and intuitive interface, is a comprehensive toolbox for RNA analysis based on sequence and secondary structure information. The program connects sequence and structure databases like the ITS2 Database to phylogeny programs as for example the CBCAnalyzer. 4SALE is written in JAVA and therefore platform independent. The software is freely available and distributed from the website at http://4sale.bioapps.biozentrum.uni-wuerzburg.de

  19. Functional microRNA screening using a comprehensive lentiviral human microRNA expression library

    NARCIS (Netherlands)

    Poell, J.B.; van Haastert, R.J.; Cerisoli, F.; Bolijn, A.S.; Timmer, L.M.; Diosdado-Calvo, B.; Meijer, G.A.; van Puijenbroek, A.A.; Berezikov, E.; Schaapveld, R.Q.; Cuppen, E.

    2011-01-01

    ABSTRACT: BACKGROUND: MicroRNAs (miRNAs) are a class of small regulatory RNAs that target sequences in messenger RNAs (mRNAs) to inhibit their protein output. Dissecting the complexities of miRNA function continues to prove challenging as miRNAs are predicted to have thousands of targets, and mRNAs

  20. Effect of N-Feruloylserotonin and Methotrexate on Severity of Experimental Arthritis and on Messenger RNA Expression of Key Proinflammatory Markers in Liver

    Directory of Open Access Journals (Sweden)

    Ľudmila Pašková

    2016-01-01

    Full Text Available Rheumatoid arthritis (RA is a chronic inflammatory disease, leading to progressive destruction of joints and extra-articular tissues, including organs such as liver and spleen. The purpose of this study was to compare the effects of a potential immunomodulator, natural polyphenol N-feruloylserotonin (N-f-5HT, with methotrexate (MTX, the standard in RA therapy, in the chronic phase of adjuvant-induced arthritis (AA in male Lewis rats. The experiment included healthy controls (CO, arthritic animals (AA, AA given N-f-5HT (AA-N-f-5HT, and AA given MTX (AA-MTX. N-f-5HT did not affect the body weight change and clinical parameters until the 14th experimental day. Its positive effect was rising during the 28-day experiment, indicating a delayed onset of N-f-5HT action. Administration of either N-f-5HT or MTX caused reduction of inflammation measured as the level of CRP in plasma and the activity of LOX in the liver. mRNA transcription of TNF-α and iNOS in the liver was significantly attenuated in both MTX and N-f-5HT treated groups of arthritic rats. Interestingly, in contrast to MTX, N-f-5HT significantly lowered the level of IL-1β in plasma and IL-1β mRNA expression in the liver and spleen of arthritic rats. This speaks for future investigations of N-f-5HT as an agent in the treatment of RA in combination therapy with MTX.

  1. miRNA Nomenclature : A View Incorporating Genetic Origins, Biosynthetic Pathways, and Sequence Variants

    NARCIS (Netherlands)

    Desvignes, T.; Batzel, P.; Berezikov, E.; Eilbeck, K.; Eppig, J. T.; McAndrews, M. S.; Singer, A.; Postlethwait, J. H.

    2015-01-01

    High-throughput sequencing of miRNAs has revealed the diversity and variability of mature and functional short noncoding RNAs, including their genomic origins, biogenesis pathways, sequence variability, and newly identified products such as miRNA-offset RNAs (moRs). Here we review known cases of alt

  2. miRNA Nomenclature : A View Incorporating Genetic Origins, Biosynthetic Pathways, and Sequence Variants

    NARCIS (Netherlands)

    Desvignes, T.; Batzel, P.; Berezikov, E.; Eilbeck, K.; Eppig, J. T.; McAndrews, M. S.; Singer, A.; Postlethwait, J. H.

    2015-01-01

    High-throughput sequencing of miRNAs has revealed the diversity and variability of mature and functional short noncoding RNAs, including their genomic origins, biogenesis pathways, sequence variability, and newly identified products such as miRNA-offset RNAs (moRs). Here we review known cases of

  3. Sequence, structure, and stacking: specifics of tRNA anchoring to the T box riboswitch.

    Science.gov (United States)

    Grigg, Jason C; Ke, Ailong

    2013-12-01

    The term riboswitch usually refers to small molecule sensing regulatory modules in the 5' untranslated regions of a mRNA. They are typically comprised of separate ligand binding and regulatory domains. The T box riboswitch is unique from other identified riboswitches because its effector is an essential macromolecule, tRNA. It senses the aminoacylation state of tRNA to regulate genes involved in a variety of functions relating to amino acid metabolism and tRNA aminoacylation. T box riboswitches performs an intuitively simple process using a complex structured RNA element and, until recently, the underlying mechanisms were poorly understood. Only two sequence-specific contacts had been previously identified: (1) between the specifier sequence (codon) and the tRNA anticodon and (2) between an anti-terminator stem loop and the tRNA acceptor arm CCA tail. tRNA aminoacylation blocks the latter interaction and therefore serves as the switch between termination and anti-termination. Outside of these two contacts, the structure and functions of T box riboswitches have come to light in some recent studies. We recently described the X-ray crystal structure of the highly conserved T box riboswitch distal Stem I region and demonstrated that this region interacts with the tRNA elbow to anchor it to the riboswitch. Independently, Lehmann et al. used sequence homology search to arrive at a similar model for Stem I-tRNA interactions. The model was further supported by two recent structures of the Stem I-tRNA complex, determined independently by our group and by Zhang and Ferré-D'Amaré. This article highlights some of these contributions to synthesize an updated model for tRNA recognition by the T box riboswitch.

  4. Sequencing bias: comparison of different protocols of MicroRNA library construction

    Directory of Open Access Journals (Sweden)

    Tian Geng

    2010-09-01

    Full Text Available Abstract Background MicroRNAs(miRNAs are 18-25 nt small RNAs playing critical roles in many biological processes. The majority of known miRNAs were discovered by conventional cloning and a Sanger sequencing approach. The next-generation sequencing (NGS technologies enable in-depth characterization of the global repertoire of miRNAs, and different protocols for miRNA library construction have been developed. However, the possible bias between the relative expression levels and sequences introduced by different protocols of library preparation have rarely been explored. Results We assessed three different miRNA library preparation protocols, SOLiD, Illumina versions 1 and 1.5, using cloning or SBS sequencing of total RNA samples extracted from skeletal muscles from Hu sheep and Dorper sheep, and then validated 9 miRNAs by qRT-PCR. Our results show that SBS sequencing data highly correlate with Illumina cloning data. The SOLiD data, when compared to Illumina's, indicate more dispersed distribution of length, higher frequency variation for nucleotides near the 3'- and 5'-ends, higher frequency occurrence for reads containing end secondary structure (ESS, and higher frequency for reads that do not map to known miRNAs. qRT-PCR results showed the best correlation with SOLiD cloning data. Fold difference of Hu sheep and Dorper sheep between qRT-PCR result and SBS sequencing data correlated well (r = 0.937, and fold difference of miR-1 and miR-206 among SOLiD cloning data, qRT-PCR and SBS sequencing data was similar. Conclusions The sequencing depth can influence the quantitative measurement of miRNA abundance, but the discrepancy caused by it was not statistically significant as high correlation was observed between Illumina cloning and SBS sequencing data. Bias of length distribution, sequence variation, and ESS was observed between data obtained with the different protocols. SOLiD cloning data differ from Illumina cloning data mainly because of

  5. Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

    Science.gov (United States)

    Schnare, M N; Gray, M W

    1982-01-01

    In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176

  6. A conditional random fields method for RNA sequence-structure relationship modeling and conformation sampling.

    Science.gov (United States)

    Wang, Zhiyong; Xu, Jinbo

    2011-07-01

    Accurate tertiary structures are very important for the functional study of non-coding RNA molecules. However, predicting RNA tertiary structures is extremely challenging, because of a large conformation space to be explored and lack of an accurate scoring function differentiating the native structure from decoys. The fragment-based conformation sampling method (e.g. FARNA) bears shortcomings that the limited size of a fragment library makes it infeasible to represent all possible conformations well. A recent dynamic Bayesian network method, BARNACLE, overcomes the issue of fragment assembly. In addition, neither of these methods makes use of sequence information in sampling conformations. Here, we present a new probabilistic graphical model, conditional random fields (CRFs), to model RNA sequence-structure relationship, which enables us to accurately estimate the probability of an RNA conformation from sequence. Coupled with a novel tree-guided sampling scheme, our CRF model is then applied to RNA conformation sampling. Experimental results show that our CRF method can model RNA sequence-structure relationship well and sequence information is important for conformation sampling. Our method, named as TreeFolder, generates a much higher percentage of native-like decoys than FARNA and BARNACLE, although we use the same simple energy function as BARNACLE. zywang@ttic.edu; j3xu@ttic.edu Supplementary data are available at Bioinformatics online.

  7. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    Science.gov (United States)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  8. Identification of differentially expressed genes during development of the zebrafish pineal complex using RNA sequencing.

    Science.gov (United States)

    Khuansuwan, Sataree; Gamse, Joshua T

    2014-11-01

    We describe a method for isolating RNA suitable for high-throughput RNA sequencing (RNA-seq) from small numbers of fluorescently labeled cells isolated from live zebrafish (Danio rerio) embryos without using costly, commercially available columns. This method ensures high cell viability after dissociation and suspension of cells and gives a very high yield of intact RNA. We demonstrate the utility of our new protocol by isolating RNA from fluorescence activated cell sorted (FAC sorted) pineal complex neurons in wild-type and tbx2b knockdown embryos at 24 hours post-fertilization. Tbx2b is a transcription factor required for pineal complex formation. We describe a bioinformatics pipeline used to analyze differential expression following high-throughput sequencing and demonstrate the validity of our results using in situ hybridization of differentially expressed transcripts. This protocol brings modern transcriptome analysis to the study of small cell populations in zebrafish.

  9. End Sequence Analysis Toolkit (ESAT) expands the extractable information from single-cell RNA-seq data

    OpenAIRE

    Derr, Alan; Yang, Chaoxing; Žilionis, Rapolas; Sergushichev, Alexey; Blodgett, David M.; Redick, Sambra; Bortell, Rita; Luban, Jeremy; Harlan, David M.; Kadener, Sebastian; Greiner, Dale L.; Klein, Allon; Artyomov, Maxim N.; Garber, Manuel

    2016-01-01

    RNA-seq protocols that focus on transcript termini are well suited for applications in which template quantity is limiting. Here we show that, when applied to end-sequencing data, analytical methods designed for global RNA-seq produce computational artifacts. To remedy this, we created the End Sequence Analysis Toolkit (ESAT). As a test, we first compared end-sequencing and bulk RNA-seq using RNA from dendritic cells stimulated with lipopolysaccharide (LPS). As predicted by the telescripting ...

  10. Small RNA transcriptome investigation based on next-generation sequencing technology

    Institute of Scientific and Technical Information of China (English)

    Linglin Zhou; Xueying Li; Qi Liu; Fangqing Zhao; Jinyu Wu

    2011-01-01

    Over the past decade,there has been a growing realization that studying the small RNA transcriptome is essential for understanding the complexity of transcriptional regulation.With an increased throughput and a reduced cost,next-generation sequencing technology has provided an unprecedented opportunity to measure the extent and complexity of small RNA transcriptome.Meanwhile,the large amount of obtained data and varied technology platforms have also posed multiple challenges for effective data analysis and mining.To provide some insight into the small RNA transcriptome investigation,this review describes the major small RNA classes,experimental methods to identify small RNAs,and available bioinformatics tools and databases.

  11. Recombinant human MDM2 oncoprotein shows sequence composition selectivity for binding to both RNA and DNA.

    Science.gov (United States)

    Challen, Christine; Anderson, John J; Chrzanowska-Lightowlers, Zofia M A; Lightowlers, Robert N; Lunec, John

    2012-03-01

    MDM2 is a 90 kDa nucleo-phosphoprotein that binds p53 and other proteins contributing to its oncogenic properties. Its structure includes an amino proximal p53 binding site, a central acidic domain and a carboxy region which incorporates Zinc and Ring Finger domains suggestive of nucleic acid binding or transcription factor function. It has previously been reported that a bacculovirus expressed MDM2 protein binds RNA in a sequence-specific manner through the Ring Finger domain, however, its ability to bind DNA has yet to be examined. We report here that a bacterially expressed human MDM2 protein binds both DNA as well as the previously defined RNA consensus sequence. DNA binding appears selective and involves the carboxy-terminal domain of the molecule. RNA binding is inhibited by an MDM2 specific antibody, which recognises an epitope within the carboxy region of the protein. Selection cloning and sequence analysis of MDM2 DNA binding sequences, unlike RNA binding sequences, revealed no obvious DNA binding consensus sequence, but preferential binding to oligopurine:pyrimidine-rich stretches. Our results suggest that the observed preferential DNA binding may occur through the Zinc Finger or in a charge-charge interaction through the Ring Finger, thereby implying potentially different mechanisms for DNA and RNA MDM2 binding.

  12. Dynamical Messengers for Gauge Mediation

    Energy Technology Data Exchange (ETDEWEB)

    Hook, Anson; Torroba, Gonzalo; /SLAC /Stanford U., Phys. Dept.

    2011-08-17

    We construct models of indirect gauge mediation where the dynamics responsible for breaking supersymmetry simultaneously generates a weakly coupled subsector of messengers. This provides a microscopic realization of messenger gauge mediation where the messenger and hidden sector fields are unified into a single sector. The UV theory is SQCD with massless and massive quarks plus singlets, and at low energies it flows to a weakly coupled quiver gauge theory. One node provides the primary source of supersymmetry breaking, which is then transmitted to the node giving rise to the messenger fields. These models break R-symmetry spontaneously, produce realistic gaugino and sfermion masses, and give a heavy gravitino.

  13. MESSENGER: Exploring Mercury's Magnetosphere

    Science.gov (United States)

    Slavin, James A.

    2008-01-01

    The MESSENGER mission to Mercury offers our first opportunity to explore this planet's miniature magnetosphere since Mariner 10's brief fly-bys in 1974-5. Mercury's magnetosphere is unique in many respects. The magnetosphere of Mercury is the smallest in the solar system with its magnetic field typically standing off the solar wind only - 1000 to 2000 km above the surface. For this reason there are no closed dri-fi paths for energetic particles and, hence, no radiation belts; the characteristic time scales for wave propagation and convective transport are short possibly coupling kinetic and fluid modes; magnetic reconnection at the dayside magnetopause may erode the subsolar magnetosphere allowing solar wind ions to directly impact the dayside regolith; inductive currents in Mercury's interior should act to modify the solar In addition, Mercury's magnetosphere is the only one with its defining magnetic flux tubes rooted in a planetary regolith as opposed to an atmosphere with a conductive ionosphere. This lack of an ionosphere is thought to be the underlying reason for the brevity of the very intense, but short lived, approx. 1-2 min, substorm-like energetic particle events observed by Mariner 10 in Mercury's magnetic tail. In this seminar, we review what we think we know about Mercury's magnetosphere and describe the MESSENGER science team's strategy for obtaining answers to the outstanding science questions surrounding the interaction of the solar wind with Mercury and its small, but dynamic magnetosphere.

  14. Transcription factor binding sites are highly enriched within microRNA precursor sequences

    Directory of Open Access Journals (Sweden)

    Piriyapongsa Jittima

    2011-12-01

    Full Text Available Abstract Background Transcription factors are thought to regulate the transcription of microRNA genes in a manner similar to that of protein-coding genes; that is, by binding to conventional transcription factor binding site DNA sequences located in or near promoter regions that lie upstream of the microRNA genes. However, in the course of analyzing the genomics of human microRNA genes, we noticed that annotated transcription factor binding sites commonly lie within 70- to 110-nt long microRNA small hairpin precursor sequences. Results We report that about 45% of all human small hairpin microRNA (pre-miR sequences contain at least one predicted transcription factor binding site motif that is conserved across human, mouse and rat, and this rises to over 75% if one excludes primate-specific pre-miRs. The association is robust and has extremely strong statistical significance; it affects both intergenic and intronic pre-miRs and both isolated and clustered microRNA genes. We also confirmed and extended this finding using a separate analysis that examined all human pre-miR sequences regardless of conservation across species. Conclusions The transcription factor binding sites localized within small hairpin microRNA precursor sequences may possibly regulate their transcription. Transcription factors may also possibly bind directly to nascent primary microRNA gene transcripts or small hairpin microRNA precursors and regulate their processing. Reviewers This article was reviewed by Guillaume Bourque (nominated by Jerzy Jurka, Dmitri Pervouchine (nominated by Mikhail Gelfand, and Yuriy Gusev.

  15. Tumor gene mutations and messenger RNA expression: correlation with clinical response to icotinib hydrochloride in non-small cell lung cancer

    Institute of Scientific and Technical Information of China (English)

    REN Guan-jun; ZHAO Yuan-yuan; ZHU Yu-jia; XIAO Yi; XU Jia-sen; SHAN Bin; ZHANG Li

    2011-01-01

    Background Molecular targeted drugs is now widely used in non-small cell lung cancer (NSCLC) clinical treatment.lcotinib hydrochloride is a new type of oral epidermal growth factor receptor (EGFR) tyresine kinase inhibitors (EGFR-TKIs). In this study, we examined the role of EGFR, K-RAS, B-RAF somatic mutations and EGFR mRNAexpression in tumor specimens from advanced NSCLC patients as predicators of the efficacy of icotinib hydrochlodde.Methods We analyzed tumor paraffin-embedded specimens, which were obtained from 14 of 40 patients with advanced NSCLC who enrolled in the stage Ⅰ clinical trial of icotinib hydrochloride. Somatic mutations were evaluated by mutant-enriched liquidchip (MEL) technology, and EGFR mRNA expression was measured by branched DNA liquidchip (MBL) technology.Results In the 14 specimens, seven patients showed EGFR mutations, exon 19 deletion (3/7) and exon 21 point mutation (4/7); and two patients showed K-RAS mutation. No mutations in EGFR exon 20. or B-RAF were detected. In patients with EGFR mutation, one patient developed progress disease (PD), three patients had stable disease (SD), two patients had partial responses (PR) and one patient had a complete response (CR). In patients with wild-type EGFR, four patients had PD, three patients acquired SD, and none had PR/CR (P=0.0407). EGFR mutations were associated with better progress-free survival (PFS) (141 days vs. 61 days) but without a statistically significant difference (P=0.8597), and median overall survival (OS) (≥449 days vs. 140 days). EGFR mRNA expression levels were evaluated (three high, eight moderate, one low, and two that can not be measured due to insufficient tumor tissue) and no statistically significant relationships was observed with response, PFS or OS.Conclusions The EGFR mutation rate was consistent with that reported in the Asian population, so the MEL technology is reliable for measuring EGFR mutation with high throughput and rapidity. EGFR exon 19 deletions and

  16. Sequences locating the 5' ends of the major simian virus 40 late mRNA forms.

    Science.gov (United States)

    Piatak, M; Ghosh, P K; Norkin, L C; Weissman, S M

    1983-01-01

    The 5' sequences of late mRNA specified by several constructed or naturally occurring deletion or duplication mutants of simian virus 40 were examined. The mutants included viruses with various small deletions centered about 25 nucleotides upstream from the major transcription initiation site, as well as viruses containing tandem duplications of a sequence of 50 nucleotides or less embedding the major transcription initiation site. The results show that the sequences 25 to 30 nucleotides upstream from the major initiation site in the position of the TATA box of other polymerase II promoters are not essential for the precise localization of the initiation site of late mRNA. Rather, we deduce that the major late mRNA start site is determined primarily by sequences located very close to the initiation site, and that the relative abundance of the 5' ends with this initiation site is modulated by nearby downstream sequences. Modification of six nucleotides adjacent upstream to the initiation site almost completely prevents the utilization of this site. Various deletions and substitutions of sequences 21 nucleotides or more downstream from the major initiation site causes upstream shifts in the localization of the most abundantly utilized 5' ends. The sequences immediately downstream from the major simian virus 40 initiation sites contain inverted symmetries that could give rise to secondary structures in either single-stranded DNA or RNA; the possibility that these inverted symmetries function in transcription initiation at the level of DNA structure rather than in RNA stabilization is discussed. Finally, we present additional evidence that precursor species with certain 5' termini are selectively spliced to form 19S RNA, whereas other 5' termini are preferred for forming the 16S RNA splice. We discuss the possibility that this is a consequence of the influence of leader structure on downstream splicing events. Images PMID:6194314

  17. Computational approaches for the analysis of ncRNA through Deep Sequencing techniques

    Directory of Open Access Journals (Sweden)

    Dario eVeneziano

    2015-06-01

    Full Text Available The majority of the human transcriptome is defined as non-coding RNA (ncRNA, since only a small fraction of human DNA encodes for proteins, as reported by the ENCODE project. Several distinct classes of ncRNAs, such as transfer RNA (tRNA, microRNA (miRNA, and long non-coding RNA (lncRNA, have been classified, each with its own three-dimensional folding and specific function. As ncRNAs are highly abundant in living organisms and have been discovered to play important roles in many biological processes, there has been an ever increasing need to investigate the entire ncRNAome in further unbiased detail.Recently, the advent of Next-Generation Sequencing (NGS technologies has substantially increased the throughput of transcriptome studies, allowing an unprecedented investigation of ncRNAs, as regulatory pathways and novel functions involving ncRNAs are now also emerging. The huge amount of transcript data produced by NGS has progressively required the development and implementation of suitable bioinformatics workflows, complemented by knowledge-based approaches, to identify, classify, and evaluate the expression of hundreds of ncRNAs in normal and pathological states, such as cancer.In this mini-review, we present and discuss current bioinformatics advances in the development of such computational approaches to analyze and classify the non-coding RNA component of human transcriptome sequence data obtained from NGS technologies.

  18. Integrative analyses of RNA editing, alternative splicing, and expression of young genes in human brain transcriptome by deep RNA sequencing.

    Science.gov (United States)

    Wu, Dong-Dong; Ye, Ling-Qun; Li, Yan; Sun, Yan-Bo; Shao, Yi; Chen, Chunyan; Zhu, Zhu; Zhong, Li; Wang, Lu; Irwin, David M; Zhang, Yong E; Zhang, Ya-Ping

    2015-08-01

    Next-generation RNA sequencing has been successfully used for identification of transcript assembly, evaluation of gene expression levels, and detection of post-transcriptional modifications. Despite these large-scale studies, additional comprehensive RNA-seq data from different subregions of the human brain are required to fully evaluate the evolutionary patterns experienced by the human brain transcriptome. Here, we provide a total of 6.5 billion RNA-seq reads from different subregions of the human brain. A significant correlation was observed between the levels of alternative splicing and RNA editing, which might be explained by a competition between the molecular machineries responsible for the splicing and editing of RNA. Young human protein-coding genes demonstrate biased expression to the neocortical and non-neocortical regions during evolution on the lineage leading to humans. We also found that a significantly greater number of young human protein-coding genes are expressed in the putamen, a tissue that was also observed to have the highest level of RNA-editing activity. The putamen, which previously received little attention, plays an important role in cognitive ability, and our data suggest a potential contribution of the putamen to human evolution. © The Author (2015). Published by Oxford University Press on behalf of Journal of Molecular Cell Biology, IBCB, SIBS, CAS. All rights reserved.

  19. Long-range genomic enrichment, sequencing, and assembly to determine unknown sequences flanking a known microRNA.

    Directory of Open Access Journals (Sweden)

    Zhaorong Ma

    Full Text Available Conserved plant microRNAs (miRNAs modulate important biological processes but little is known about conserved cis-regulatory elements (CREs surrounding MIRNA genes. We developed a solution-based targeted genomic enrichment methodology to capture, enrich, and sequence flanking genomic regions surrounding conserved MIRNA genes with a locked-nucleic acid (LNA-modified, biotinylated probe complementary to the mature miRNA sequence. Genomic DNA bound by the probe is captured by streptavidin-coated magnetic beads, amplified, sequenced and assembled de novo to obtain genomic DNA sequences flanking MIRNA locus of interest. We demonstrate the sensitivity and specificity of this enrichment methodology in Arabidopsis thaliana to enrich targeted regions spanning 10-20 kb surrounding known MIR166 and MIR165 loci. Assembly of the sequencing reads successfully recovered all targeted loci. While further optimization for larger, more complex genomes is needed, this method may enable determination of flanking genomic DNA sequence surrounding a known core (like a conserved mature miRNA from multiple species that currently don't have a full genome assembly available.

  20. LIN28 binds messenger RNAs at GGAGA motifs and regulates splicing factor abundance.

    Science.gov (United States)

    Wilbert, Melissa L; Huelga, Stephanie C; Kapeli, Katannya; Stark, Thomas J; Liang, Tiffany Y; Chen, Stella X; Yan, Bernice Y; Nathanson, Jason L; Hutt, Kasey R; Lovci, Michael T; Kazan, Hilal; Vu, Anthony Q; Massirer, Katlin B; Morris, Quaid; Hoon, Shawn; Yeo, Gene W

    2012-10-26

    LIN28 is a conserved RNA-binding protein implicated in pluripotency, reprogramming, and oncogenesis. It was previously shown to act primarily by blocking let-7 microRNA (miRNA) biogenesis, but here we elucidate distinct roles of LIN28 regulation via its direct messenger RNA (mRNA) targets. Through crosslinking and immunoprecipitation coupled with high-throughput sequencing (CLIP-seq) in human embryonic stem cells and somatic cells expressing exogenous LIN28, we have defined discrete LIN28-binding sites in a quarter of human transcripts. These sites revealed that LIN28 binds to GGAGA sequences enriched within loop structures in mRNAs, reminiscent of its interaction with let-7 miRNA precursors. Among LIN28 mRNA targets, we found evidence for LIN28 autoregulation and also direct but differing effects on the protein abundance of splicing regulators in somatic and pluripotent stem cells. Splicing-sensitive microarrays demonstrated that exogenous LIN28 expression causes widespread downstream alternative splicing changes. These findings identify important regulatory functions of LIN28 via direct mRNA interactions. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. Small RNA sequencing for secondary metabolite analysis in Persicaria minor

    Directory of Open Access Journals (Sweden)

    Abdul Fatah A. Samad

    2017-09-01

    Full Text Available Persicaria minor (kesum is an important medicinal plant and commonly found in southeast countries; Malaysia, Thailand, Indonesia, and Vietnam. This plant is enriched with a variety of secondary metabolites (SMs, and among these SMs, terpenoids are in high abundance. Terpenoids are comprised of many valuable biomolecules which have well-established role in agriculture and pharmaceutical industry. In P. minor, for the first time, we have generated small RNAs data sets, which can be used as tool in deciphering their roles in terpenoid biosynthesis pathways. Fungal pathogen, Fusarium oxysporum was used as elicitor to trigger SMs biosynthesis in P. minor. Raw reads and small RNA analysis data have already been deposited at GenBank under the accessions; SRX2645684 (Fusarium-treated, SRX2645685 (Fusarium-treated, SRX2645686 (mock-infected, and SRX2645687 (mock-infected.

  2. Complete nucleotide sequence of a new satellite RNA associated with cucumber mosaic virus inducing tomato necrosis

    Institute of Scientific and Technical Information of China (English)

    程宁辉; 方荣祥; 濮祖芹; 方中达

    1997-01-01

    A new strain (TN strain) of cucumber mosaic virus (CMV) was isolated from tomato plants with necrotic symptoms and proved to carry a necrogenic satellite RNA (TN-Sat RNA). Double-strand cDNA of the TN-Sat RNA was synthesized by reverse transcription and polymerase chain reaction using primers designed according to the conserved terminal sequences of known CMV satellite RNAs. Sequence analysis indicated that the TN-Sat RNA consisted of 390 nucleotides (nt). Comparison of the sequence of the TN-Sat RNA with those of other CMV satellite RNAs revealed four homologous regions ( I . 1-81 nt; II . 216-261 nt; III. 278-338 nt; IV . 349-390 nt) and one hypervarible domain in the region of 82-215 nt. Moreover, the TN-Sat RNA contained a characteristic necro-genic consensus sequence at the 3’ end (339-367 nt) as reported in the known necrosis-inducing CMV satellite RNAs.

  3. R3D-2-MSA: the RNA 3D structure-to-multiple sequence alignment server.

    Science.gov (United States)

    Cannone, Jamie J; Sweeney, Blake A; Petrov, Anton I; Gutell, Robin R; Zirbel, Craig L; Leontis, Neocles

    2015-07-01

    The RNA 3D Structure-to-Multiple Sequence Alignment Server (R3D-2-MSA) is a new web service that seamlessly links RNA three-dimensional (3D) structures to high-quality RNA multiple sequence alignments (MSAs) from diverse biological sources. In this first release, R3D-2-MSA provides manual and programmatic access to curated, representative ribosomal RNA sequence alignments from bacterial, archaeal, eukaryal and organellar ribosomes, using nucleotide numbers from representative atomic-resolution 3D structures. A web-based front end is available for manual entry and an Application Program Interface for programmatic access. Users can specify up to five ranges of nucleotides and 50 nucleotide positions per range. The R3D-2-MSA server maps these ranges to the appropriate columns of the corresponding MSA and returns the contents of the columns, either for display in a web browser or in JSON format for subsequent programmatic use. The browser output page provides a 3D interactive display of the query, a full list of sequence variants with taxonomic information and a statistical summary of distinct sequence variants found. The output can be filtered and sorted in the browser. Previous user queries can be viewed at any time by resubmitting the output URL, which encodes the search and re-generates the results. The service is freely available with no login requirement at http://rna.bgsu.edu/r3d-2-msa.

  4. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.

    Directory of Open Access Journals (Sweden)

    Marissa B Hirst

    Full Text Available Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of

  5. A DNA sequence obtained by replacement of the dopamine RNA aptamer bases is not an aptamer.

    Science.gov (United States)

    Álvarez-Martos, Isabel; Ferapontova, Elena E

    2017-08-05

    A unique specificity of the aptamer-ligand biorecognition and binding facilitates bioanalysis and biosensor development, contributing to discrimination of structurally related molecules, such as dopamine and other catecholamine neurotransmitters. The aptamer sequence capable of specific binding of dopamine is a 57 nucleotides long RNA sequence reported in 1997 (Biochemistry, 1997, 36, 9726). Later, it was suggested that the DNA homologue of the RNA aptamer retains the specificity of dopamine binding (Biochem. Biophys. Res. Commun., 2009, 388, 732). Here, we show that the DNA sequence obtained by the replacement of the RNA aptamer bases for their DNA analogues is not able of specific biorecognition of dopamine, in contrast to the original RNA aptamer sequence. This DNA sequence binds dopamine and structurally related catecholamine neurotransmitters non-specifically, as any DNA sequence, and, thus, is not an aptamer and cannot be used neither for in vivo nor in situ analysis of dopamine in the presence of structurally related neurotransmitters. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. High-quality RNA extraction from copepods for Next Generation Sequencing: A comparative study.

    Science.gov (United States)

    Asai, Sneha; Ianora, Adrianna; Lauritano, Chiara; Lindeque, Penelope K; Carotenuto, Ylenia

    2015-12-01

    Despite the ecological importance of copepods, few Next Generation Sequencing studies (NGS) have been performed on small crustaceans, and a standard method for RNA extraction is lacking. In this study, we compared three commonly-used methods: TRIzol®, Aurum Total RNA Mini Kit and Qiagen RNeasy Micro Kit, in combination with preservation reagents TRIzol® or RNAlater®, to obtain high-quality and quantity of RNA from copepods for NGS. Total RNA was extracted from the copepods Calanus helgolandicus, Centropages typicus and Temora stylifera and its quantity and quality were evaluated using NanoDrop, agarose gel electrophoresis and Agilent Bioanalyzer. Our results demonstrate that preservation of copepods in RNAlater® and extraction with Qiagen RNeasy Micro Kit were the optimal isolation method for high-quality and quantity of RNA for NGS studies of C. helgolandicus. Intriguingly, C. helgolandicus 28S rRNA is formed by two subunits that separate after heat-denaturation and migrate along with 18S rRNA. This unique property of protostome RNA has never been reported in copepods. Overall, our comparative study on RNA extraction protocols will help increase gene expression studies on copepods using high-throughput applications, such as RNA-Seq and microarrays. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Hierarchical folding of multiple sequence alignments for the prediction of structures and RNA-RNA interactions

    DEFF Research Database (Denmark)

    Seemann, Ernst Stefan; Richter, Andreas S.; Gorodkin, Jan;

    2010-01-01

    Background: Many regulatory non-coding RNAs (ncRNAs) function through complementary binding with mRNAs or other ncRNAs, e.g., microRNAs, snoRNAs and bacterial sRNAs. Predicting these RNA interactions is essential for functional studies of putative ncRNAs or for the design of artificial RNAs. Many...

  8. Determining mutant spectra of three RNA viral samples using ultra-deep sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Chen, H

    2012-06-06

    RNA viruses have extremely high mutation rates that enable the virus to adapt to new host environments and even jump from one species to another. As part of a viral transmission study, three viral samples collected from naturally infected animals were sequenced using Illumina paired-end technology at ultra-deep coverage. In order to determine the mutant spectra within the viral quasispecies, it is critical to understand the sequencing error rates and control for false positive calls of viral variants (point mutantations). I will estimate the sequencing error rate from two control sequences and characterize the mutant spectra in the natural samples with this error rate.

  9. RNA Sequencing and Bioinformatics Analysis Implicate the Regulatory Role of a Long Noncoding RNA-mRNA Network in Hepatic Stellate Cell Activation.

    Science.gov (United States)

    Guo, Can-Jie; Xiao, Xiao; Sheng, Li; Chen, Lili; Zhong, Wei; Li, Hai; Hua, Jing; Ma, Xiong

    2017-08-11

    To analyze the long noncoding (lncRNA)-mRNA expression network and potential roles in rat hepatic stellate cells (HSCs) during activation. LncRNA expression was analyzed in quiescent and culture-activated HSCs by RNA sequencing, and differentially expressed lncRNAs verified by quantitative reverse transcription polymerase chain reaction (qRT-PCR) were subjected to bioinformatics analysis. In vivo analyses of differential lncRNA-mRNA expression were performed on a rat model of liver fibrosis. We identified upregulation of 12 lncRNAs and 155 mRNAs and downregulation of 12 lncRNAs and 374 mRNAs in activated HSCs. Additionally, we identified the differential expression of upregulated lncRNAs (NONRATT012636.2, NONRATT016788.2, and NONRATT021402.2) and downregulated lncRNAs (NONRATT007863.2, NONRATT019720.2, and NONRATT024061.2) in activated HSCs relative to levels observed in quiescent HSCs, and Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses showed that changes in lncRNAs associated with HSC activation revealed 11 significantly enriched pathways according to their predicted targets. Moreover, based on the predicted co-expression network, the relative dynamic levels of NONRATT013819.2 and lysyl oxidase (Lox) were compared during HSC activation both in vitro and in vivo. Our results confirmed the upregulation of lncRNA NONRATT013819.2 and Lox mRNA associated with the extracellular matrix (ECM)-related signaling pathway in HSCs and fibrotic livers. Our results detailing a dysregulated lncRNA-mRNA network might provide new treatment strategies for hepatic fibrosis based on findings indicating potentially critical roles for NONRATT013819.2 and Lox in ECM remodeling during HSC activation. © 2017 The Author(s). Published by S. Karger AG, Basel.

  10. RNA Sequencing and Bioinformatics Analysis Implicate the Regulatory Role of a Long Noncoding RNA-mRNA Network in Hepatic Stellate Cell Activation

    Directory of Open Access Journals (Sweden)

    Can-Jie Guo

    2017-08-01

    Full Text Available Background/Aims: To analyze the long noncoding (lncRNA-mRNA expression network and potential roles in rat hepatic stellate cells (HSCs during activation. Methods: LncRNA expression was analyzed in quiescent and culture-activated HSCs by RNA sequencing, and differentially expressed lncRNAs verified by quantitative reverse transcription polymerase chain reaction (qRT-PCR were subjected to bioinformatics analysis. In vivo analyses of differential lncRNA-mRNA expression were performed on a rat model of liver fibrosis. Results: We identified upregulation of 12 lncRNAs and 155 mRNAs and downregulation of 12 lncRNAs and 374 mRNAs in activated HSCs. Additionally, we identified the differential expression of upregulated lncRNAs (NONRATT012636.2, NONRATT016788.2, and NONRATT021402.2 and downregulated lncRNAs (NONRATT007863.2, NONRATT019720.2, and NONRATT024061.2 in activated HSCs relative to levels observed in quiescent HSCs, and Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses showed that changes in lncRNAs associated with HSC activation revealed 11 significantly enriched pathways according to their predicted targets. Moreover, based on the predicted co-expression network, the relative dynamic levels of NONRATT013819.2 and lysyl oxidase (Lox were compared during HSC activation both in vitro and in vivo. Our results confirmed the upregulation of lncRNA NONRATT013819.2 and Lox mRNA associated with the extracellular matrix (ECM-related signaling pathway in HSCs and fibrotic livers. Conclusion: Our results detailing a dysregulated lncRNA-mRNA network might provide new treatment strategies for hepatic fibrosis based on findings indicating potentially critical roles for NONRATT013819.2 and Lox in ECM remodeling during HSC activation.

  11. Cell-SELEX Identifies a “Sticky” RNA Aptamer Sequence

    Science.gov (United States)

    2017-01-01

    Cell-SELEX is performed to select for cell binding aptamers. We employed an additional selection pressure by using RNAse to remove surface-binding aptamers and select for cell-internalizing aptamers. A common RNA sequence was identified from independent cell-SELEX procedures against two different pancreatic cancer cell lines, indicating a strong selection pressure towards this sequence from the large pool of other available sequences present in the aptamer library. The aptamer is not specific for the pancreatic cancer cell lines, and a similar sequence motif is present in previously published internalizing aptamers. The identified sequence forms a structural motif that binds to a surface protein, which either is highly abundant or has strong affinity for the selected aptamer sequence. Deselecting (removing) this sequence during cell-SELEX may increase the probability of identifying aptamers against cell type-specific targets on the cell surface. PMID:28194280

  12. Cell-SELEX Identifies a “Sticky” RNA Aptamer Sequence

    Directory of Open Access Journals (Sweden)

    Partha Ray

    2017-01-01

    Full Text Available Cell-SELEX is performed to select for cell binding aptamers. We employed an additional selection pressure by using RNAse to remove surface-binding aptamers and select for cell-internalizing aptamers. A common RNA sequence was identified from independent cell-SELEX procedures against two different pancreatic cancer cell lines, indicating a strong selection pressure towards this sequence from the large pool of other available sequences present in the aptamer library. The aptamer is not specific for the pancreatic cancer cell lines, and a similar sequence motif is present in previously published internalizing aptamers. The identified sequence forms a structural motif that binds to a surface protein, which either is highly abundant or has strong affinity for the selected aptamer sequence. Deselecting (removing this sequence during cell-SELEX may increase the probability of identifying aptamers against cell type-specific targets on the cell surface.

  13. Hierarchical folding of multiple sequence alignments for the prediction of structures and RNA-RNA interactions

    Directory of Open Access Journals (Sweden)

    Gorodkin Jan

    2010-05-01

    Full Text Available Abstract Background Many regulatory non-coding RNAs (ncRNAs function through complementary binding with mRNAs or other ncRNAs, e.g., microRNAs, snoRNAs and bacterial sRNAs. Predicting these RNA interactions is essential for functional studies of putative ncRNAs or for the design of artificial RNAs. Many ncRNAs show clear signs of undergoing compensating base changes over evolutionary time. Here, we postulate that a non-negligible part of the existing RNA-RNA interactions contain preserved but covarying patterns of interactions. Methods We present a novel method that takes compensating base changes across the binding sites into account. The algorithm works in two steps on two pre-generated multiple alignments. In the first step, individual base pairs with high reliability are found using the PETfold algorithm, which includes evolutionary and thermodynamic properties. In step two (where high reliability base pairs from step one are constrained as unpaired, the principle of cofolding is combined with hierarchical folding. The final prediction of intra- and inter-molecular base pairs consists of the reliabilities computed from the constrained expected accuracy scoring, which is an extended version of that used for individual multiple alignments. Results We derived a rather extensive algorithm. One of the advantages of our approach (in contrast to other RNA-RNA interaction prediction methods is the application of covariance detection and prediction of pseudoknots between intra- and inter-molecular base pairs. As a proof of concept, we show an example and discuss the strengths and weaknesses of the approach.

  14. A Model of Sequence Dependent Rna-Polymerase Diffusion Along Dna

    CERN Document Server

    Barbi, M; Popkov, V; Salerno, M; Barbi, Maria; Place, Christophe; Popkov, Vladislav; Salerno, Mario

    2001-01-01

    We introduce a probabilistic model for the RNA-polymerase sliding motion along DNA during the promoter search. The model accounts for possible effects due to sequence-dependent interactions between the nonspecific DNA and the enzyme. We focus on T7 RNA-polymerase and exploit the available information about its interaction at the promoter site in order to investigate the influence of bacteriophage T7 DNA sequence on the dynamics of the sliding process. Hydrogen bonds in the major groove are used as the main sequence-dependent interaction between the RNA-polymerase and the DNA. The resulting dynamical properties and the possibility of an experimental validation are discussed in details. We show that, while at large times the process reaches a pure diffusive regime, it initially displays a sub-diffusive behavior. The crossover from anomalous to normal diffusion may occur at times large enough to be of biological interest.

  15. Quantitative miRNA expression analysis: comparing microarrays with next-generation sequencing

    DEFF Research Database (Denmark)

    Willenbrock, Hanni; Salomon, Jesper; Søkilde, Rolf

    2009-01-01

    Recently, next-generation sequencing has been introduced as a promising, new platform for assessing the copy number of transcripts, while the existing microarray technology is considered less reliable for absolute, quantitative expression measurements. Nonetheless, so far, results from the two...... technologies have only been compared based on biological data, leading to the conclusion that, although they are somewhat correlated, expression values differ significantly. Here, we use synthetic RNA samples, resembling human microRNA samples, to find that microarray expression measures actually correlate...... better with sample RNA content than expression measures obtained from sequencing data. In addition, microarrays appear highly sensitive and perform equivalently to next-generation sequencing in terms of reproducibility and relative ratio quantification....

  16. Phylogenetic analysis of freshwater mussel corbicula regularis by 18s rRNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Magare V N

    2015-04-01

    Full Text Available Corbicula regularis is a freshwater mussel found in the Indian sub-continent. In the present study, phylogenetic characterization of this important bivalve was attempted using 18S ribosomal RNA gene markers. Genomic DNA was extracted and 18S rRNA gene was amplified by universal primers. The amplification product was sequenced and compared with the nucleotide databases available online to evaluate phylogenetic relationship of the animal under study. Results indicated that 18S rRNA gene sequences of C. regularis showed high degree of similarity to another freshwater mussel, C. fluminea. This work constitutes the first ever sequence deposition of the C. regularis in the nucleotide databases highlighting the usefulness of 18S ribosomal gene markers for phylogenetic analysis.

  17. Telomerase RNA stem terminus element affects template boundary element function, telomere sequence, and shelterin binding.

    Science.gov (United States)

    Webb, Christopher J; Zakian, Virginia A

    2015-09-08

    The stem terminus element (STE), which was discovered 13 y ago in human telomerase RNA, is required for telomerase activity, yet its mode of action is unknown. We report that the Schizosaccharomyces pombe telomerase RNA, TER1 (telomerase RNA 1), also contains a STE, which is essential for telomere maintenance. Cells expressing a partial loss-of-function TER1 STE allele maintained short stable telomeres by a recombination-independent mechanism. Remarkably, the mutant telomere sequence was different from that of wild-type cells. Generation of the altered sequence is explained by reverse transcription into the template boundary element, demonstrating that the STE helps maintain template boundary element function. The altered telomeres bound less Pot1 (protection of telomeres 1) and Taz1 (telomere-associated in Schizosaccharomyces pombe 1) in vivo. Thus, the S. pombe STE, although distant from the template, ensures proper telomere sequence, which in turn promotes proper assembly of the shelterin complex.

  18. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    Science.gov (United States)

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method.

  19. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    Directory of Open Access Journals (Sweden)

    Huijing Hao

    Full Text Available API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method.

  20. Sequencing and characterisation of an extensive Atlantic salmon (Salmo salar L. microRNA repertoire.

    Directory of Open Access Journals (Sweden)

    Michaël Bekaert

    Full Text Available Atlantic salmon (Salmo salar L., a member of the family Salmonidae, is a totemic species of ecological and cultural significance that is also economically important in terms of both sports fisheries and aquaculture. These factors have promoted the continuous development of genomic resources for this species, furthering both fundamental and applied research. MicroRNAs (miRNA are small endogenous non-coding RNA molecules that control spatial and temporal expression of targeted genes through post-transcriptional regulation. While miRNA have been characterised in detail for many other species, this is not yet the case for Atlantic salmon. To identify miRNAs from Atlantic salmon, we constructed whole fish miRNA libraries for 18 individual juveniles (fry, four months post hatch and characterised them by Illumina high-throughput sequencing (total of 354,505,167 paired-ended reads. We report an extensive and partly novel repertoire of miRNA sequences, comprising 888 miRNA genes (547 unique mature miRNA sequences, quantify their expression levels in basal conditions, examine their homology to miRNAs from other species and identify their predicted target genes. We also identify the location and putative copy number of the miRNA genes in the draft Atlantic salmon reference genome sequence. The Atlantic salmon miRNAs experimentally identified in this study provide a robust large-scale resource for functional genome research in salmonids. There is an opportunity to explore the evolution of salmonid miRNAs following the relatively recent whole genome duplication event in salmonid species and to investigate the role of miRNAs in the regulation of gene expression in particular their contribution to variation in economically and ecologically important traits.

  1. Using RNase sequence specificity to refine the identification of RNA-protein binding regions

    OpenAIRE

    Wang Xinguo; Li Lang; Shen Changyu; Wang Guohua; Wang Xin; Mooney Sean D; Edenberg Howard J; Sanford Jeremy R; Liu Yunlong

    2008-01-01

    Abstract Massively parallel pyrosequencing is a high-throughput technology that can sequence hundreds of thousands of DNA/RNA fragments in a single experiment. Combining it with immunoprecipitation-based biochemical assays, such as cross-linking immunoprecipitation (CLIP), provides a genome-wide method to detect the sites at which proteins bind DNA or RNA. In a CLIP-pyrosequencing experiment, the resolutions of the detected protein binding regions are partially determined by the length of the...

  2. Molecular indexing enables quantitative targeted RNA sequencing and reveals poor efficiencies in standard library preparations.

    Science.gov (United States)

    Fu, Glenn K; Xu, Weihong; Wilhelmy, Julie; Mindrinos, Michael N; Davis, Ronald W; Xiao, Wenzhong; Fodor, Stephen P A

    2014-02-01

    We present a simple molecular indexing method for quantitative targeted RNA sequencing, in which mRNAs of interest are selectively captured from complex cDNA libraries and sequenced to determine their absolute concentrations. cDNA fragments are individually labeled so that each molecule can be tracked from the original sample through the library preparation and sequencing process. Multiple copies of cDNA fragments of identical sequence become distinct through labeling, and replicate clones created during PCR amplification steps can be identified and assigned to their distinct parent molecules. Selective capture enables efficient use of sequencing for deep sampling and for the absolute quantitation of rare or transient transcripts that would otherwise escape detection by standard sequencing methods. We have also constructed a set of synthetic barcoded RNA molecules, which can be introduced as controls into the sample preparation mix and used to monitor the efficiency of library construction. The quantitative targeted sequencing revealed extremely low efficiency in standard library preparations, which were further confirmed by using synthetic barcoded RNA molecules. This finding shows that standard library preparation methods result in the loss of rare transcripts and highlights the need for monitoring library efficiency and for developing more efficient sample preparation methods.

  3. Visitor, an informatic pipeline for analysis of viral siRNA sequencing datasets.

    Science.gov (United States)

    Antoniewski, Christophe

    2011-01-01

    High-throughput sequencing emerged as a powerful approach to characterize siRNA populations -generated by hosts in response to viral infections. Here we described an informatic pipeline visitor to analyze in-house large sequencing datasets generated from Illumina sequencing of Drosophila small RNA libraries. The visitor perl script is designed to treat fastq sequence datasets from the Illumina sequencing platform, using a computer running under a UNIX compliant operating system (MacOS X, Linux, etc.). visitor first generates a detailed report of the sequence quality of the Illumina run. Then, using the Novoalign software, the script removes reads that match with the D. melanogaster genome from the sequencing data set. The remaining reads are aligned to a viral reference library, which can contain one or several virus genomes. visitor provides a hit table of identified viral siRNAs as well as graphics eps files of viral siRNA profiles. Unmatched small RNAs are also available in a fast format for de novo assembly and new virus discovery.

  4. incaRNAfbinv: a web server for the fragment-based design of RNA sequences.

    Science.gov (United States)

    Drory Retwitzer, Matan; Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme; Barash, Danny

    2016-07-08

    In recent years, new methods for computational RNA design have been developed and applied to various problems in synthetic biology and nanotechnology. Lately, there is considerable interest in incorporating essential biological information when solving the inverse RNA folding problem. Correspondingly, RNAfbinv aims at including biologically meaningful constraints and is the only program to-date that performs a fragment-based design of RNA sequences. In doing so it allows the design of sequences that do not necessarily exactly fold into the target, as long as the overall coarse-grained tree graph shape is preserved. Augmented by the weighted sampling algorithm of incaRNAtion, our web server called incaRNAfbinv implements the method devised in RNAfbinv and offers an interactive environment for the inverse folding of RNA using a fragment-based design approach. It takes as input: a target RNA secondary structure; optional sequence and motif constraints; optional target minimum free energy, neutrality and GC content. In addition to the design of synthetic regulatory sequences, it can be used as a pre-processing step for the detection of novel natural occurring RNAs. The two complementary methodologies RNAfbinv and incaRNAtion are merged together and fully implemented in our web server incaRNAfbinv, available at http://www.cs.bgu.ac.il/incaRNAfbinv.

  5. Development of Transcriptomic Markers for Population Analysis Using Restriction Site Associated RNA Sequencing (RARseq.

    Directory of Open Access Journals (Sweden)

    Magdy S Alabady

    Full Text Available We describe restriction site associated RNA sequencing (RARseq, an RNAseq-based genotype by sequencing (GBS method. It includes the construction of RNAseq libraries from double stranded cDNA digested with selected restriction enzymes. To test this, we constructed six single- and six-dual-digested RARseq libraries from six F2 pitcher plant individuals and sequenced them on a half of a Miseq run. On average, the de novo approach of population genome analysis detected 544 and 570 RNA SNPs, whereas the reference transcriptome-based approach revealed an average of 1907 and 1876 RNA SNPs per individual, from single- and dual-digested RARseq data, respectively. The average numbers of RNA SNPs and alleles per loci are 1.89 and 2.17, respectively. Our results suggest that the RARseq protocol allows good depth of coverage per loci for detecting RNA SNPs and polymorphic loci for population genomics and mapping analyses. In non-model systems where complete genomes sequences are not always available, RARseq data can be analyzed in reference to the transcriptome. In addition to enriching for functional markers, this method may prove particularly useful in organisms where the genomes are not favorable for DNA GBS.

  6. Sequence and analysis of the gene for bacteriophage T3 RNA polymerase.

    Science.gov (United States)

    McGraw, N J; Bailey, J N; Cleaves, G R; Dembinski, D R; Gocke, C R; Joliffe, L K; MacWright, R S; McAllister, W T

    1985-01-01

    The RNA polymerases encoded by bacteriophages T3 and T7 have similar structures, but exhibit nearly exclusive template specificities. We have determined the nucleotide sequence of the region of T3 DNA that encodes the T3 RNA polymerase (the gene 1.0 region), and have compared this sequence with the corresponding region of T7 DNA. The predicted amino acid sequence of the T3 RNA polymerase exhibits very few changes when compared to the T7 enzyme (82% of the residues are identical). Significant differences appear to cluster in three distinct regions in the amino-terminal half of the protein. Analysis of the data from both enzymes suggests features that may be important for polymerase function. In particular, a region that differs between the T3 and T7 enzymes exhibits significant homology to the bi-helical domain that is common to many sequence-specific DNA binding proteins. The region that flanks the structural gene contains a number of regulatory elements including: a promoter for the E. coli RNA polymerase, a potential processing site for RNase III and a promoter for the T3 polymerase. The promoter for the T3 RNA polymerase is located only 12 base pairs distal to the stop codon for the structural gene. PMID:3903658

  7. Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure.

    Directory of Open Access Journals (Sweden)

    Masfique Mehedi

    Full Text Available Ebolavirus (EBOV, the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

  8. rRNA sequence comparison of Beauveria bassiana, Tolypocladium cylindrosporum, and Tolypocladium extinguens.

    Science.gov (United States)

    Rakotonirainy, M S; Dutertre, M; Brygoo, Y; Riba, G

    1991-01-01

    Five strains of Tolypocladium cylindrosporum, one strain of Tolypocladium extinguens, and nine strains of Beauveria bassiana were analyzed using a rapid rRNA sequencing technique. The sequences of two highly variable domains (D1 and D2) located at the 5' end of the 28S-like rRNA molecule were determined. The phylogenetic tree computed from the absolute number of nucleotide differences shows the separation between the genus Beauveria and the genus Tolypocladium and points out that T. cylindrosporum and T. extinguens probably do not belong to the same genus.

  9. Sequence determination and modeling of structural motifs for the smallest monomeric aminoacyl-tRNA synthetase.

    OpenAIRE

    Hou, Y M; Shiba, K; Mottes, C; Schimmel, P.

    1991-01-01

    Polypeptide chains of 19 previously studied Escherichia coli aminoacyl-tRNA synthetases are as large as 951 amino acids and, depending on the enzyme, have quaternary structures of alpha, alpha 2, alpha 2 beta 2, and alpha 4. These enzymes have been organized into two classes which are defined by sequence motifs that are associated with specific three-dimensional structures. We isolated, cloned, and sequenced the previously uncharacterized gene for E. coli cysteine-tRNA synthetase (EC 6.1.1.16...

  10. Phylogeny of protostome worms derived from 18S rRNA sequences.

    Science.gov (United States)

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1995-07-01

    The phylogenetic relationships of protostome worms were studied by comparing new complete 18S rRNA sequences of Vestimentifera, Pogonophora, Sipuncula, Echiura, Nemertea, and Annelida with existing 18S rRNA sequences of Mollusca, Arthropoda, Chordata, and Platyhelminthes. Phylogenetic trees were inferred via neighbor-joining and maximum parsimony analyses. These suggest that (1) Sipuncula and Echiura are not sister groups; (2) Nemertea are protostomes; (3) Vestimentifera and Pogonophora are protostomes that have a common ancestor with Echiura; and (4) Vestimentifera and Pogonophora are a monophyletic clade.

  11. Next generation sequencing analysis of human platelet PolyA+ mRNAs and rRNA-depleted total RNA.

    Directory of Open Access Journals (Sweden)

    Antheia Kissopoulou

    Full Text Available BACKGROUND: Platelets are small anucleate cells circulating in the blood vessels where they play a key role in hemostasis and thrombosis. Here, we compared platelet RNA-Seq results obtained from polyA+ mRNA and rRNA-depleted total RNA. MATERIALS AND METHODS: We used purified, CD45 depleted, human blood platelets collected by apheresis from three male and one female healthy blood donors. The Illumina HiSeq 2000 platform was employed to sequence cDNA converted either from oligo(dT isolated polyA+ RNA or from rRNA-depleted total RNA. The reads were aligned to the GRCh37 reference assembly with the TopHat/Cufflinks alignment package using Ensembl annotations. A de novo assembly of the platelet transcriptome using the Trinity software package and RSEM was also performed. The bioinformatic tools HTSeq and DESeq from Bioconductor were employed for further statistical analyses of read counts. RESULTS: Consistent with previous findings our data suggests that mitochondrially expressed genes comprise a substantial fraction of the platelet transcriptome. We also identified high transcript levels for protein coding genes related to the cytoskeleton function, chemokine signaling, cell adhesion, aggregation, as well as receptor interaction between cells. Certain transcripts were particularly abundant in platelets compared with other cell and tissue types represented by RNA-Seq data from the Illumina Human Body Map 2.0 project. Irrespective of the different library preparation and sequencing protocols, there was good agreement between samples from the 4 individuals. Eighteen differentially expressed genes were identified in the two sexes at 10% false discovery rate using DESeq. CONCLUSION: The present data suggests that platelets may have a unique transcriptome profile characterized by a relative over-expression of mitochondrially encoded genes and also of genomic transcripts related to the cytoskeleton function, chemokine signaling and surface components

  12. Sequence selective recognition of double-stranded RNA using triple helix-forming peptide nucleic acids.

    Science.gov (United States)

    Zengeya, Thomas; Gupta, Pankaj; Rozners, Eriks

    2014-01-01

    Noncoding RNAs are attractive targets for molecular recognition because of the central role they play in gene expression. Since most noncoding RNAs are in a double-helical conformation, recognition of such structures is a formidable problem. Herein, we describe a method for sequence-selective recognition of biologically relevant double-helical RNA (illustrated on ribosomal A-site RNA) using peptide nucleic acids (PNA) that form a triple helix in the major grove of RNA under physiologically relevant conditions. Protocols for PNA preparation and binding studies using isothermal titration calorimetry are described in detail.

  13. Revolution of nephrology research by deep sequencing: ChIP-seq and RNA-seq.

    Science.gov (United States)

    Mimura, Imari; Kanki, Yasuharu; Kodama, Tatsuhiko; Nangaku, Masaomi

    2014-01-01

    The recent and rapid advent of next-generation sequencing (NGS) has made this technology broadly available not only to researchers in various molecular and cellular biology fields but also to those in kidney disease. In this paper, we describe the usage of ChIP-seq (chromatin immunoprecipitation with sequencing) and RNA-seq for sample preparation and interpretation of raw data in the investigation of biological phenomenon in renal diseases. ChIP-seq identifies genome-wide transcriptional DNA-binding sites as well as histone modifications, which are known to regulate gene expression, in the intragenic as well as in the intergenic regions. With regard to RNA-seq, this process analyzes not only the expression level of mRNA but also splicing variants, non-coding RNA, and microRNA on a genome-wide scale. The combination of ChIP-seq and RNA-seq allows the clarification of novel transcriptional mechanisms, which have important roles in various kinds of diseases, including chronic kidney disease. The rapid development of these techniques requires an update on the latest information and methods of NGS. In this review, we highlight the merits and characteristics of ChIP-seq and RNA-seq and discuss the use of the genome-wide analysis in kidney disease.

  14. Combined sequencing of mRNA and DNA from human embryonic stem cells.

    Science.gov (United States)

    Mertes, Florian; Kuhl, Heiner; Wruck, Wasco; Lehrach, Hans; Adjaye, James

    2016-06-01

    Combined transcriptome and whole genome sequencing of the same ultra-low input sample down to single cells is a rapidly evolving approach for the analysis of rare cells. Besides stem cells, rare cells originating from tissues like tumor or biopsies, circulating tumor cells and cells from early embryonic development are under investigation. Herein we describe a universal method applicable for the analysis of minute amounts of sample material (150 to 200 cells) derived from sub-colony structures from human embryonic stem cells. The protocol comprises the combined isolation and separate amplification of poly(A) mRNA and whole genome DNA followed by next generation sequencing. Here we present a detailed description of the method developed and an overview of the results obtained for RNA and whole genome sequencing of human embryonic stem cells, sequencing data is available in the Gene Expression Omnibus (GEO) database under accession number GSE69471.

  15. Architecture of ribosomal RNA: Constraints on the sequence of tetra-loops

    Energy Technology Data Exchange (ETDEWEB)

    Woese, C.R. (Univ. of Illinois, Urbana (United States)); Winker, S. (Argonne National Lab., IL (United States)); Gutell, R.R. (Univ. of Illinois, Urbana (United States) Cangene Corp., Mississauga, Ontario (Canada))

    1990-11-01

    The four-base loops that cap many double-helical structures in rRNA (the so-called tetra-loops) exhibit highly invariant to highly variable sequences depending upon their location in the molecule. However, in the vast majority of these cases the sequence of a tetra-loop is independent of its location and conforms to one of three general motifs, GNRA, UNCG, and (more rarely) CUUG. For the most frequently varying of the 16S rRNA tetra-loops, that at position 83 (Escherichia coli numbering), the three sequences CUUG, UUCG, and GCAA account for almost all examples encountered, and each of them has independently arisen at least a dozen times. The closing base pair of tetra-loop hairpins reflects the loop sequence, tending to be C{center dot}G for CUUG loops.

  16. Counterselection of prokaryotic ribosomal RNA during reverse transcription using non-random hexameric oligonucleotides.

    Science.gov (United States)

    Gonzalez, J M; Robb, F T

    2007-12-01

    Ribosomal RNA (rRNA) is the major component in total RNA extracts, interfering with the synthesis of cDNA corresponding to messenger RNA (mRNA). In this study, we present a novel strategy for selectively discriminating against rRNA and favoring mRNA from prokaryotes during synthesis of cDNA by reverse transcriptase. Our technique is based on the fact that rRNA sequences, in many species, are G+C rich relative to the genome at large, and highly conserved among prokaryotes. The sequence TTTT is therefore rarely found in rRNA sequences. However, TTTT priming sites are found at a much higher frequency in protein-encoding gene sequences. We designed specific hexamers (HD/DHTTTT) to prime reverse transcription reactions resulting in a selective synthesis of cDNA corresponding to mRNA from prokaryotic total RNA extractions.

  17. Different organisms associated with heartwater as shown by analysis of 16S ribosomal RNA gene sequences.

    Science.gov (United States)

    Allsopp, M; Visser, E S; du Plessis, J L; Vogel, S W; Allsopp, B A

    1997-08-01

    Cowdria ruminantium is a rickettsial parasite which causes heartwater, a economically important disease of domestic and wild ruminants in tropical and subtropical Africa and parts of the Caribbean. Because existing diagnostic methods are unreliable, we investigated the small-subunit ribosomal RNA (srRNA) gene from heartwater-infected material to characterise the organisms present and to develop specific oligonucleotide probes for polymerase chain reaction (PCR) based diagnosis. DNA was obtained from ticks and ruminants from heartwater-free and heartwater-endemic areas from Cowdria in tissue culture. PCR was carried out using primers designed to amplify only rickettsial srRNA genes, the target region being the highly variable V1 loop. Amplicons were cloned and sequenced; 51% were C. ruminantium sequences corresponding to four genotypes, two of which were identical to previously reported C. ruminantium sequences while the other two were new. The four different Cowdria genotypes can be correlated with different phenotypes. Tissue-culture samples yielded only Cowdria genotype sequences, but an extraordinary heterogeneity of 16S sequences was obtained from field samples. In addition to Cowdria genotypes we found sequences from previously unknown Ehrlichia spp., sequences showing homology to other Rickettsiales and a variety of Pseudomonadaceae. One Ehrlichia sequence was phylogenetically closely related to Ehrlichia platys (Group II Ehrlichia) and one to Ehrlichia canis (Group III Ehrlichia). This latter sequence was from an isolate (Germishuys) made from a naturally infected sheep which, from brain smear examination and pathology, appeared to be suffering from heartwater; nevertheless no Cowdria genotype sequences were found in this isolate. In addition no Cowdria sequences were obtained from uninfected ticks. Complete 16S rRNA gene sequences were determined for two C. ruminantium genotypes and for two previously uncharacterised heartwater-associated Ehrlichia spp

  18. Prediction of viral microRNA precursors based on human microRNA precursor sequence and structural features.

    Science.gov (United States)

    Kumar, Shiva; Ansari, Faraz A; Scaria, Vinod

    2009-08-20

    MicroRNAs (small approximately 22 nucleotide long non-coding endogenous RNAs) have recently attracted immense attention as critical regulators of gene expression in multi-cellular eukaryotes, especially in humans. Recent studies have proved that viruses also express microRNAs, which are thought to contribute to the intricate mechanisms of host-pathogen interactions. Computational predictions have greatly accelerated the discovery of microRNAs. However, most of these widely used tools are dependent on structural features and sequence conservation which limits their use in discovering novel virus expressed microRNAs and non-conserved eukaryotic microRNAs. In this work an efficient prediction method is developed based on the hypothesis that sequence and structure features which discriminate between host microRNA precursor hairpins and pseudo microRNAs are shared by viral microRNA as they depend on host machinery for the processing of microRNA precursors. The proposed method has been found to be more efficient than recently reported ab-initio methods for predicting viral microRNAs and microRNAs expressed by mammals.

  19. Evaluating the impact of sequencing error correction for RNA-seq data with ERCC RNA spike-in controls.

    Science.gov (United States)

    Tong, Li; Yang, Cheng; Wu, Po-Yen; Wang, May D

    2016-02-01

    Sequencing errors are a major issue for several next-generation sequencing-based applications such as de novo assembly and single nucleotide polymorphism detection. Several error-correction methods have been developed to improve raw data quality. However, error-correction performance is hard to evaluate because of the lack of a ground truth. In this study, we propose a novel approach which using ERCC RNA spike-in controls as the ground truth to facilitate error-correction performance evaluation. After aligning raw and corrected RNA-seq data, we characterized the quality of reads by three metrics: mismatch patterns (i.e., the substitution rate of A to C) of reads aligned with one mismatch, mismatch patterns of reads aligned with two mismatches and the percentage increase of reads aligned to reference. We observed that the mismatch patterns for reads aligned with one mismatch are significantly correlated between ERCC spike-ins and real RNA samples. Based on such observations, we conclude that ERCC spike-ins can serve as ground truths for error correction beyond their previous applications for validation of dynamic range and fold-change response. Also, the mismatch patterns for ERCC reads aligned with one mismatch can serve as a novel and reliable metric to evaluate the performance of error-correction tools.

  20. Improved identification of Gordonia, Rhodococcus and Tsukamurella species by 5'-end 16S rRNA gene sequencing.

    Science.gov (United States)

    Wang, Tao; Kong, Fanrong; Chen, Sharon; Xiao, Meng; Sorrell, Tania; Wang, Xiaoyan; Wang, Shuo; Sintchenko, Vitali

    2011-01-01

    The identification of fastidious aerobic Actinomycetes such as Gordonia, Rhodococcus, and Tsukamurella has remained a challenge leading to clinically significant misclassifications. This study is intended to examine the feasibility of partial 5'-end 16S rRNA gene sequencing for the identification of Gordonia, Rhodococcus, and Tsukamurella, and defined potential reference sequences for species from each of these genera. The 16S rRNA gene sequence based identification algorithm for species identification was used and enhanced by aligning test sequences with reference sequences from the List of Prokaryotic Names with Standing in Nomenclature. Conventional PCR based 16S rRNA gene sequencing and the alignment of the isolate 16S rRNA gene sequence with reference sequences accurately identified 100% of clinical strains of aerobic Actinomycetes. While partial 16S rRNA gene sequences of reference type strains matched with the 16S rRNA gene sequences of 19 isolates in our data set, another 13 strains demonstrated a degree of polymorphism with a 1-4 bp difference in the regions of difference. 5'-end 606 bp 16S rRNA gene sequencing, coupled with the assignment of well defined reference sequences to clinically relevant species of bacteria, can be a useful strategy for improving the identification of clinically relevant aerobic Actinomycetes.

  1. Recombination analysis of Soybean mosaic virus sequences reveals evidence of RNA recombination between distinct pathotypes

    Directory of Open Access Journals (Sweden)

    Babu Mohan

    2008-11-01

    Full Text Available Abstract RNA recombination is one of the two major factors that create RNA genome variability. Assessing its incidence in plant RNA viruses helps understand the formation of new isolates and evaluate the effectiveness of crop protection strategies. To search for recombination in Soybean mosaic virus (SMV, the causal agent of a worldwide seed-borne, aphid-transmitted viral soybean disease, we obtained all full-length genome sequences of SMV as well as partial sequences encoding the N-terminal most (P1 protease and the C-terminal most (capsid protein; CP viral protein. The sequences were analyzed for possible recombination events using a variety of automatic and manual recombination detection and verification approaches. Automatic scanning identified 3, 10, and 17 recombination sites in the P1, CP, and full-length sequences, respectively. Manual analyses confirmed 10 recombination sites in three full-length SMV sequences. To our knowledge, this is the first report of recombination between distinct SMV pathotypes. These data imply that different SMV pathotypes can simultaneously infect a host cell and exchange genetic materials through recombination. The high incidence of SMV recombination suggests that recombination plays an important role in SMV evolution. Obtaining additional full-length sequences will help elucidate this role.

  2. Phylogenetic analysis of Mexican Babesia bovis isolates using msa and ssrRNA gene sequences.

    Science.gov (United States)

    Genis, Alma D; Mosqueda, Juan J; Borgonio, Verónica M; Falcón, Alfonso; Alvarez, Antonio; Camacho, Minerva; de Lourdes Muñoz, Maria; Figueroa, Julio V

    2008-12-01

    Variable merozoite surface antigens of Babesia bovis are exposed glycoproteins having a role in erythrocyte invasion. Members of this gene family include msa-1 and msa-2 (msa-2c, msa-2a(1), msa-2a(2), and msa-2b). Small subunit ribosomal (ssr)RNA gene is subject to evolutive pressure and has been used in phylogenetic studies. To determine the phylogenetic relationship among B. bovis Mexican isolates using different genetic markers, PCR amplicons, corresponding to msa-1, msa-2c, msa-2b, and ssrRNA genes, were cloned and plasmids carrying the corresponding inserts were sequenced. Comparative analysis of nucleotide and deduced amino acid sequences revealed distinct degrees of variability and identity among the coding gene sequences obtained from 12 geographically different B. bovis isolates and a reference strain. Overall sequence identities of 47.7%, 72.3%, 87.7%, and 94% were determined for msa-1, msa-2b, msa-2c, and ssrRNA, respectively. A robust phylogenetic tree was obtained with msa-2b sequences. The phylogenetic analysis suggests that Mexican B. bovis isolates group in clades not concordant with the Mexican geography. However, the Mexican isolates group together in an American clade separated from the Australian clade. Sequence heterogeneity in msa-1, msa-2b, and msa-2c coding regions of Mexican B. bovis isolates present in different geographical regions can be a result of either differential evolutive pressure or cattle movement from commercial trade.

  3. MESSENGER'S First Flyby of Mercury

    Science.gov (United States)

    Slavin, James A.

    2008-01-01

    The MESSENGER mission to Mercury offers our first opportunity to explore this planet's miniature magnetosphere since Mariner 10's brief fly-bys in 1974-5. The magnetosphere of Mercury is the smallest in the solar system with its magnetic field typically standing off the solar wind only - 1000 to 2000 km above the surface. An overview of the MESSENGER mission and its January 14th close flyby of Mercury will be provided. Primary science objectives and the science instrumentation will be described. Initial results from MESSENGER'S first flyby on January 14th, 2008 will be discussed with an emphasis on the magnetic field and charged particle measurements.

  4. Peptide primary messengers in plants

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The peptide primary messengers regulate embryonic development,cell growth and many other activities in animal cells. But recent evidence verified that peptide primary messengers are also involved in plant defense responses, the recognition between pollen and stigma and keep the balance between cell proliferation and differentiations in shoot apical meristems. Those results suggest that plants may actually make wide use of peptide primary messengers, both in embryonic development and late life when they rally their cells to defend against pathogens and insect pests. The recent advance in those aspects is reviewed.

  5. RNA deep sequencing reveals differential microRNA expression during development of sea urchin and sea star.

    Directory of Open Access Journals (Sweden)

    Sabah Kadri

    Full Text Available microRNAs (miRNAs are small (20-23 nt, non-coding single stranded RNA molecules that act as post-transcriptional regulators of mRNA gene expression. They have been implicated in regulation of developmental processes in diverse organisms. The echinoderms, Strongylocentrotus purpuratus (sea urchin and Patiria miniata (sea star are excellent model organisms for studying development with well-characterized transcriptional networks. However, to date, nothing is known about the role of miRNAs during development in these organisms, except that the genes that are involved in the miRNA biogenesis pathway are expressed during their developmental stages. In this paper, we used Illumina Genome Analyzer (Illumina, Inc. to sequence small RNA libraries in mixed stage population of embryos from one to three days after fertilization of sea urchin and sea star (total of 22,670,000 reads. Analysis of these data revealed the miRNA populations in these two species. We found that 47 and 38 known miRNAs are expressed in sea urchin and sea star, respectively, during early development (32 in common. We also found 13 potentially novel miRNAs in the sea urchin embryonic library. miRNA expression is generally conserved between the two species during development, but 7 miRNAs are highly expressed in only one species. We expect that our two datasets will be a valuable resource for everyone working in the field of developmental biology and the regulatory networks that affect it. The computational pipeline to analyze Illumina reads is available at http://www.benoslab.pitt.edu/services.html.

  6. [Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence

    Science.gov (United States)

    Ortega, Maya

    2010-01-01

    My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

  7. The MESSENGER Spacecraft

    Science.gov (United States)

    Leary, James C.; Conde, Richard F.; Dakermanji, George; Engelbrecht, Carl S.; Ercol, Carl J.; Fielhauer, Karl B.; Grant, David G.; Hartka, Theodore J.; Hill, Tracy A.; Jaskulek, Stephen E.; Mirantes, Mary A.; Mosher, Larry E.; Paul, Michael V.; Persons, David F.; Rodberg, Elliot H.; Srinivasan, Dipak K.; Vaughan, Robin M.; Wiley, Samuel R.

    2007-08-01

    The MErcury Surface, Space ENvironment, GEochemistry, and Ranging (MESSENGER) spacecraft was designed and constructed to withstand the harsh environments associated with achieving and operating in Mercury orbit. The system can be divided into eight subsystems: structures and mechanisms (e.g., the composite core structure, aluminum launch vehicle adapter, and deployables), propulsion (e.g., the state-of-the-art titanium fuel tanks, thruster modules, and associated plumbing), thermal (e.g., the ceramic-cloth sunshade, heaters, and radiators), power (e.g., solar arrays, battery, and controlling electronics), avionics (e.g., the processors, solid-state recorder, and data handling electronics), software (e.g., processor-supported code that performs commanding, data handling, and spacecraft control), guidance and control (e.g., attitude sensors including star cameras and Sun sensors integrated with controllers including reaction wheels), radio frequency telecommunications (e.g., the spacecraft antenna suites and supporting electronics), and payload (e.g., the science instruments and supporting processors). This system architecture went through an extensive (nearly four-year) development and testing effort that provided the team with confidence that all mission goals will be achieved.

  8. An Algorithm for Finding Conserved Secondary Structure Motifs in Unaligned RNA Sequences

    Institute of Scientific and Technical Information of China (English)

    Giulio Pavesi; Giancarlo Mauri; Graziano Pesole

    2004-01-01

    Several experiments and observations have revealed the fact that small local distinct structural features in RNA molecules are correlated with their biological function, for example, in post-transcriptional regulation of gene expression. Thus, finding similar structural features in a set of RNA sequences known to play the same biological function could provide substantial information concerning which parts of the sequences are responsible for the function itself. Unfortunately, finding common structural elements in RNA molecules is a very challenging task, even if limited to secondary structure. The main difficulty lies in the fact that in nearly all the cases the structure of the molecules is unknown, has to be somehow predicted, and that sequences with little or no similarity can fold into similar structures. Although they differ in some details, the approaches proposed so far are usually based on the preliminary alignment of the sequences and attempt to predict common structures (either local or global, or for some selected regions) for the aligned sequences. These methods give good results when sequence and structure similarity are very high, but function less well when similarity is limited to small and local elements, like single stem-loop motifs. Instead of aligning the sequences, the algorithm we present directly searches for regions of the sequences that can fold into similar structures, where the degree of similarity can be defined by the user. Any information concerning sequence similarity in the motifs can be used either as a search constraint, or a posteriori, by post-processing the output. The search for the regions sharing structural similarity is implemented with the affix tree, a novel text-indexing structure that significantly accelerates the search for patterns having a symmetric layout, such as those forming stem-loop structures. Tests based on experimentally known structures have shown that the algorithm is able to identify functional motifs in

  9. MESSENGER at Mercury: Early Orbital Operations

    Science.gov (United States)

    McNutt, Ralph L., Jr; Solomon, Sean C.; Bedini, Peter D.; Anderson, Brian J.; Blewett, David T.; Evans, Larry G.; Gold, Robert E.; Krimigis, Stamatios M.; Murchie, Scott L.; Nittler, Larry R.; Philips, Roger J.; Prockter, Louise M.; Slavin, James A.; Zuber, M. T.; Finnegan, Eric J.; Grant, David G.

    2013-01-01

    angles. Targeted areas have been selected for spectral coverage into the ultraviolet with the Ultraviolet and Visible Spectrometer (UVVS). MESSENGER's Mercury Laser Altimeter is acquiring topographic profiles when the slant range to Mercury's surface is less than 1800 km, encompassing latitudes from 20 deg. S to the north pole. Topography over the remainder of the southern hemisphere will be derived from stereo imaging, radio occultations, and limb profiles. MESSENGER's radio science experiment is determining Mercury's gravity field from Doppler signals acquired during frequent downlinks. MESSENGER's Magnetometer is measuring the vector magnetic field both within Mercury's magnetosphere and in Mercury's solar wind environment at an instrument sampling rate of up to 20 samples/s. The UVVS is determining the three-dimensional, time-dependent distribution of Mercury's exospheric neutral and ionic species via their emission lines. During each spacecraft orbit, the Energetic Particle Spectrometer measures energetic electrons and ions, and the Fast Imaging Plasma Spectrometer measures the energies and mass per charge of thermal plasma components, both within Mercury's magnetosphere and in Mercury's solar-wind environment. The primary mission observation sequence will continue for one Earth year, until March 2012. An extended mission, currently under discussion with NASA, would add a second year of orbital observations targeting a set of focused follow-on questions that build on observations to date and take advantage of the more active Sun expected during 2012-2013. MESSENGER's total primary mission cost, projected at $446 M in real-year dollars, is comparable to that of Mariner 10 after adjustment for inflation.

  10. MESSENGER at Mercury: Early orbital operations

    Science.gov (United States)

    McNutt, Ralph L.; Solomon, Sean C.; Bedini, Peter D.; Anderson, Brian J.; Blewett, David T.; Evans, Larry G.; Gold, Robert E.; Krimigis, Stamatios M.; Murchie, Scott L.; Nittler, Larry R.; Phillips, Roger J.; Prockter, Louise M.; Slavin, James A.; Zuber, Maria T.; Finnegan, Eric J.; Grant, David G.; MESSENGER Team

    2014-01-01

    angles. Targeted areas have been selected for spectral coverage into the ultraviolet with the Ultraviolet and Visible Spectrometer (UVVS). MESSENGER's Mercury Laser Altimeter is acquiring topographic profiles when the slant range to Mercury's surface is less than 1800 km, encompassing latitudes from 20°S to the north pole. Topography over the remainder of the southern hemisphere will be derived from stereo imaging, radio occultations, and limb profiles. MESSENGER's radio science experiment is determining Mercury's gravity field from Doppler signals acquired during frequent downlinks. MESSENGER's Magnetometer is measuring the vector magnetic field both within Mercury's magnetosphere and in Mercury's solar wind environment at an instrument sampling rate of up to 20 samples/s. The UVVS is determining the three-dimensional, time-dependent distribution of Mercury's exospheric neutral and ionic species via their emission lines. During each spacecraft orbit, the Energetic Particle Spectrometer measures energetic electrons and ions, and the Fast Imaging Plasma Spectrometer measures the energies and mass per charge of thermal plasma components, both within Mercury's magnetosphere and in Mercury's solar-wind environment. The primary mission observation sequence will continue for one Earth year, until March 2012. An extended mission, currently under discussion with NASA, would add a second year of orbital observations targeting a set of focused follow-on questions that build on observations to date and take advantage of the more active Sun expected during 2012-2013. MESSENGER's total primary mission cost, projected at $446 M in real-year dollars, is comparable to that of Mariner 10 after adjustment for inflation.

  11. The impact of CRISPR repeat sequence on structures of a Cas6 protein-RNA complex

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Ruiying; Zheng, Han; Preamplume, Gan; Shao, Yaming; Li, Hong [FSU

    2012-03-15

    The repeat-associated mysterious proteins (RAMPs) comprise the most abundant family of proteins involved in prokaryotic immunity against invading genetic elements conferred by the clustered regularly interspaced short palindromic repeat (CRISPR) system. Cas6 is one of the first characterized RAMP proteins and is a key enzyme required for CRISPR RNA maturation. Despite a strong structural homology with other RAMP proteins that bind hairpin RNA, Cas6 distinctly recognizes single-stranded RNA. Previous structural and biochemical studies show that Cas6 captures the 5' end while cleaving the 3' end of the CRISPR RNA. Here, we describe three structures and complementary biochemical analysis of a noncatalytic Cas6 homolog from Pyrococcus horikoshii bound to CRISPR repeat RNA of different sequences. Our study confirms the specificity of the Cas6 protein for single-stranded RNA and further reveals the importance of the bases at Positions 5-7 in Cas6-RNA interactions. Substitutions of these bases result in structural changes in the protein-RNA complex including its oligomerization state.

  12. YM500v3: a database for small RNA sequencing in human cancer research

    Science.gov (United States)

    Chung, I-Fang; Chang, Shing-Jyh; Chen, Chen-Yang; Liu, Shu-Hsuan; Li, Chia-Yang; Chan, Chia-Hao; Shih, Chuan-Chi; Cheng, Wei-Chung

    2017-01-01

    We previously presented the YM500 database, which contains >8000 small RNA sequencing (smRNA-seq) data sets and integrated analysis results for various cancer miRNome studies. In the updated YM500v3 database (http://ngs.ym.edu.tw/ym500/) presented herein, we not only focus on miRNAs but also on other functional small non-coding RNAs (sncRNAs), such as PIWI-interacting RNAs (piRNAs), tRNA-derived fragments (tRFs), small nuclear RNAs (snRNAs) and small nucleolar RNAs (snoRNAs). There is growing knowledge of the role of sncRNAs in gene regulation and tumorigenesis. We have also incorporated >10 000 cancer-related RNA-seq and >3000 more smRNA-seq data sets into the YM500v3 database. Furthermore, there are two main new sections, ‘Survival' and ‘Cancer', in this updated version. The ‘Survival’ section provides the survival analysis results in all cancer types or in a user-defined group of samples for a specific sncRNA. The ‘Cancer’ section provides the results of differential expression analyses, miRNA–gene interactions and cancer miRNA-related pathways. In the ‘Expression’ section, sncRNA expression profiles across cancer and sample types are newly provided. Cancer-related sncRNAs hold potential for both biotech applications and basic research. PMID:27899625

  13. Small RNA Sequencing Based Identification of MiRNAs in Daphnia magna.

    Science.gov (United States)

    Ünlü, Ercan Selçuk; Gordon, Donna M; Telli, Murat

    2015-01-01

    Small RNA molecules are short, non-coding RNAs identified for their crucial role in post-transcriptional regulation. A well-studied example includes miRNAs (microRNAs) which have been identified in several model organisms including the freshwater flea and planktonic crustacean Daphnia. A model for epigenetic-based studies with an available genome database, the identification of miRNAs and their potential role in regulating Daphnia gene expression has only recently garnered interest. Computational-based work using Daphnia pulex, has indicated the existence of 45 miRNAs, 14 of which have been experimentally verified. To extend this study, we took a sequencing approach towards identifying miRNAs present in a small RNA library isolated from Daphnia magna. Using Perl codes designed for comparative genomic analysis, 815,699 reads were obtained from 4 million raw reads and run against a database file of known miRNA sequences. Using this approach, we have identified 205 putative mature miRNA sequences belonging to 188 distinct miRNA families. Data from this study provides critical information necessary to begin an investigation into a role for these transcripts in the epigenetic regulation of Daphnia magna.

  14. Secondary Structure Predictions for Long RNA Sequences Based on Inversion Excursions and MapReduce.

    Science.gov (United States)

    Yehdego, Daniel T; Zhang, Boyu; Kodimala, Vikram K R; Johnson, Kyle L; Taufer, Michela; Leung, Ming-Ying

    2013-05-01

    Secondary structures of ribonucleic acid (RNA) molecules play important roles in many biological processes including gene expression and regulation. Experimental observations and computing limitations suggest that we can approach the secondary structure prediction problem for long RNA sequences by segmenting them into shorter chunks, predicting the secondary structures of each chunk individually using existing prediction programs, and then assembling the results to give the structure of the original sequence. The selection of cutting points is a crucial component of the segmenting step. Noting that stem-loops and pseudoknots always contain an inversion, i.e., a stretch of nucleotides followed closely by its inverse complementary sequence, we developed two cutting methods for segmenting long RNA sequences based on inversion excursions: the centered and optimized method. Each step of searching for inversions, chunking, and predictions can be performed in parallel. In this paper we use a MapReduce framework, i.e., Hadoop, to extensively explore meaningful inversion stem lengths and gap sizes for the segmentation and identify correlations between chunking methods and prediction accuracy. We show that for a set of long RNA sequences in the RFAM database, whose secondary structures are known to contain pseudoknots, our approach predicts secondary structures more accurately than methods that do not segment the sequence, when the latter predictions are possible computationally. We also show that, as sequences exceed certain lengths, some programs cannot computationally predict pseudoknots while our chunking methods can. Overall, our predicted structures still retain the accuracy level of the original prediction programs when compared with known experimental secondary structure.

  15. Maize (Zea mays L. genome diversity as revealed by RNA-sequencing.

    Directory of Open Access Journals (Sweden)

    Candice N Hansey

    Full Text Available Maize is rich in genetic and phenotypic diversity. Understanding the sequence, structural, and expression variation that contributes to phenotypic diversity would facilitate more efficient varietal improvement. RNA based sequencing (RNA-seq is a powerful approach for transcriptional analysis, assessing sequence variation, and identifying novel transcript sequences, particularly in large, complex, repetitive genomes such as maize. In this study, we sequenced RNA from whole seedlings of 21 maize inbred lines representing diverse North American and exotic germplasm. Single nucleotide polymorphism (SNP detection identified 351,710 polymorphic loci distributed throughout the genome covering 22,830 annotated genes. Tight clustering of two distinct heterotic groups and exotic lines was evident using these SNPs as genetic markers. Transcript abundance analysis revealed minimal variation in the total number of genes expressed across these 21 lines (57.1% to 66.0%. However, the transcribed gene set among the 21 lines varied, with 48.7% expressed in all of the lines, 27.9% expressed in one to 20 lines, and 23.4% expressed in none of the lines. De novo assembly of RNA-seq reads that did not map to the reference B73 genome sequence revealed 1,321 high confidence novel transcripts, of which, 564 loci were present in all 21 lines, including B73, and 757 loci were restricted to a subset of the lines. RT-PCR validation demonstrated 87.5% concordance with the computational prediction of these expressed novel transcripts. Intriguingly, 145 of the novel de novo assembled loci were present in lines from only one of the two heterotic groups consistent with the hypothesis that, in addition to sequence polymorphisms and transcript abundance, transcript presence/absence variation is present and, thereby, may be a mechanism contributing to the genetic basis of heterosis.

  16. A library screening approach identifies naturally occurring RNA sequences for a G-quadruplex binding ligand.

    Science.gov (United States)

    Mirihana Arachchilage, Gayan; Morris, Mark J; Basu, Soumitra

    2014-02-07

    An RNA G-quadruplex library was synthesised and screened against kanamycin A as the ligand. Naturally occurring G-quadruplex forming sequences that differentially bind to kanamycin A were identified and characterized. This provides a simple and effective strategy for identification of potential intracellular G-quadruplex targets for a ligand.

  17. RNA-guided complex from a bacterial immune system enhances target recognition through seed sequence interactions

    NARCIS (Netherlands)

    Wiedenheft, Blake; van Duijn, Esther; Bultema, Jelle; Waghmare, Sakharam; Zhou, Kaihong; Barendregt, Arjan; Westphal, Wiebke; Heck, Albert; Boekema, Egbert; Dickman, Mark; Doudna, Jennifer A.

    2011-01-01

    Prokaryotes have evolved multiple versions of an RNA-guided adaptive immune system that targets foreign nucleic acids. In each case, transcripts derived from clustered regularly interspaced short palindromic repeats (CRISPRs) are thought to selectively target invading phage and plasmids in a sequenc

  18. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing.

    Science.gov (United States)

    Dhawan, B; Sebastian, S; Malhotra, R; Kapil, A; Gautam, D

    2016-01-01

    We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  19. RNA-guided complex from a bacterial immune system enhances target recognition through seed sequence interactions

    NARCIS (Netherlands)

    Wiedenheft, Blake; van Duijn, Esther; Bultema, Jelle; Waghmare, Sakharam; Zhou, Kaihong; Barendregt, Arjan; Westphal, Wiebke; Heck, Albert; Boekema, Egbert; Dickman, Mark; Doudna, Jennifer A.

    2011-01-01

    Prokaryotes have evolved multiple versions of an RNA-guided adaptive immune system that targets foreign nucleic acids. In each case, transcripts derived from clustered regularly interspaced short palindromic repeats (CRISPRs) are thought to selectively target invading phage and plasmids in a sequenc

  20. Profiling of Ribose Methylations in RNA by High-Throughput Sequencing

    DEFF Research Database (Denmark)

    Birkedal, Ulf; Christensen-Dalsgaard, Mikkel; Krogh, Nicolai;

    2015-01-01

    Ribose methylations are the most abundant chemical modifications of ribosomal RNA and are critical for ribosome assembly and fidelity of translation. Many aspects of ribose methylations have been difficult to study due to lack of efficient mapping methods. Here, we present a sequencing-based method...

  1. RNA sequence and transcriptional properties of the 3' end of the Newcastle disease virus genome

    Energy Technology Data Exchange (ETDEWEB)

    Kurilla, M.G.; Stone, H.O.; Keene, J.D.

    1985-09-01

    The 3' end of the genomic RNA of Newcastle disease virus (NDV) has been sequenced and the leader RNA defined. Using hybridization to a 3'-end-labeled genome, leader RNA species from in vitro transcription reactions and from infected cell extracts were found to be 47 and 53 nucleotides long. In addition, the start site of the 3'-proximal mRNA was determined by sequence analysis of in vitro (beta-32P)GTP-labeled transcription products. The genomic sequence extending beyond the leader region demonstrated an open reading frame for at least 42 amino acids and probably represents the amino terminus of the nucleocapsid protein (NP). The terminal 8 nucleotides of the NDV genome were identical to those of measles virus and Sendai virus while the sequence of the distal half of the leader region was more similar to that of vesicular stomatitis virus. These data argue for strong evolutionary relatedness between the paramyxovirus and rhabdovirus groups.

  2. Ultra deep sequencing of Listeria monocytogenes sRNA transcriptome revealed new antisense RNAs.

    Directory of Open Access Journals (Sweden)

    Sebastian Behrens

    Full Text Available Listeria monocytogenes, a gram-positive pathogen, and causative agent of listeriosis, has become a widely used model organism for intracellular infections. Recent studies have identified small non-coding RNAs (sRNAs as important factors for regulating gene expression and pathogenicity of L. monocytogenes. Increased speed and reduced costs of high throughput sequencing (HTS techniques have made RNA sequencing (RNA-Seq the state-of-the-art method to study bacterial transcriptomes. We created a large transcriptome dataset of L. monocytogenes containing a total of 21 million reads, using the SOLiD sequencing technology. The dataset contained cDNA sequences generated from L. monocytogenes RNA collected under intracellular and extracellular condition and additionally was size fractioned into three different size ranges from 150 nt. We report here, the identification of nine new sRNAs candidates of L. monocytogenes and a reevaluation of known sRNAs of L. monocytogenes EGD-e. Automatic comparison to known sRNAs revealed a high recovery rate of 55%, which was increased to 90% by manual revision of the data. Moreover, thorough classification of known sRNAs shed further light on their possible biological functions. Interestingly among the newly identified sRNA candidates are antisense RNAs (asRNAs associated to the housekeeping genes purA, fumC and pgi and potentially their regulation, emphasizing the significance of sRNAs for metabolic adaptation in L. monocytogenes.

  3. Ultra Deep Sequencing of Listeria monocytogenes sRNA Transcriptome Revealed New Antisense RNAs

    Science.gov (United States)

    Behrens, Sebastian; Widder, Stefanie; Mannala, Gopala Krishna; Qing, Xiaoxing; Madhugiri, Ramakanth; Kefer, Nathalie; Mraheil, Mobarak Abu; Rattei, Thomas; Hain, Torsten

    2014-01-01

    Listeria monocytogenes, a gram-positive pathogen, and causative agent of listeriosis, has become a widely used model organism for intracellular infections. Recent studies have identified small non-coding RNAs (sRNAs) as important factors for regulating gene expression and pathogenicity of L. monocytogenes. Increased speed and reduced costs of high throughput sequencing (HTS) techniques have made RNA sequencing (RNA-Seq) the state-of-the-art method to study bacterial transcriptomes. We created a large transcriptome dataset of L. monocytogenes containing a total of 21 million reads, using the SOLiD sequencing technology. The dataset contained cDNA sequences generated from L. monocytogenes RNA collected under intracellular and extracellular condition and additionally was size fractioned into three different size ranges from 150 nt. We report here, the identification of nine new sRNAs candidates of L. monocytogenes and a reevaluation of known sRNAs of L. monocytogenes EGD-e. Automatic comparison to known sRNAs revealed a high recovery rate of 55%, which was increased to 90% by manual revision of the data. Moreover, thorough classification of known sRNAs shed further light on their possible biological functions. Interestingly among the newly identified sRNA candidates are antisense RNAs (asRNAs) associated to the housekeeping genes purA, fumC and pgi and potentially their regulation, emphasizing the significance of sRNAs for metabolic adaptation in L. monocytogenes. PMID:24498259

  4. microPIR: an integrated database of microRNA target sites within human promoter sequences.

    Directory of Open Access Journals (Sweden)

    Jittima Piriyapongsa

    Full Text Available BACKGROUND: microRNAs are generally understood to regulate gene expression through binding to target sequences within 3'-UTRs of mRNAs. Therefore, computational prediction of target sites is usually restricted to these gene regions. Recent experimental studies though have suggested that microRNAs may alternatively modulate gene expression by interacting with promoters. A database of potential microRNA target sites in promoters would stimulate research in this field leading to more understanding of complex microRNA regulatory mechanism. METHODOLOGY: We developed a database hosting predicted microRNA target sites located within human promoter sequences and their associated genomic features, called microPIR (microRNA-Promoter Interaction Resource. microRNA seed sequences were used to identify perfect complementary matching sequences in the human promoters and the potential target sites were predicted using the RNAhybrid program. >15 million target sites were identified which are located within 5000 bp upstream of all human genes, on both sense and antisense strands. The experimentally confirmed argonaute (AGO binding sites and EST expression data including the sequence conservation across vertebrate species of each predicted target are presented for researchers to appraise the quality of predicted target sites. The microPIR database integrates various annotated genomic sequence databases, e.g. repetitive elements, transcription factor binding sites, CpG islands, and SNPs, offering users the facility to extensively explore relationships among target sites and other genomic features. Furthermore, functional information of target genes including gene ontologies, KEGG pathways, and OMIM associations are provided. The built-in genome browser of microPIR provides a comprehensive view of multidimensional genomic data. Finally, microPIR incorporates a PCR primer design module to facilitate experimental validation. CONCLUSIONS: The proposed micro

  5. Exploring PTX3 expression in Sus scrofa cardiac tissue using RNA sequencing.

    Science.gov (United States)

    Cabiati, Manuela; Caselli, Chiara; Savelli, Sara; Prescimone, Tommaso; Lionetti, Vincenzo; Giannessi, Daniela; Del Ry, Silvia

    2012-02-10

    The prototypic long pentraxin PTX3 is a novel vascular inflammatory marker sharing similarities with the classic short pentraxin (C-reactive protein). PTX3 is rapidly produced and released by several cell types in response to local inflammation of the cardiovascular system. Plasma PTX3 levels are very low in normal conditions and increase in heart failure (HF) patients with advancing NYHA functional class, but its exact role during HF pathogenetic mechanisms is not yet established. No data about PTX3 cardiac expression in normal and pathological conditions are currently available, either in human or in large-size animals. Of the latter, the pig has a central role in "in vivo" clinical settings but its genome has not been completely sequenced and the PTX3 gene sequence is still lacking. The aim of this study was to sequence the PTX3 in Sus scrofa, whose sequence is not yet present in GenBank. Utilizing our knowledge of this sequence, PTX3 mRNA expression was evaluated in cardiac tissue of normal (n=6) and HF pigs (n=5), obtained from the four chambers. To sequence PTX3 gene in S. scrofa, the high homology between Homo sapiens and S. scrofa was exploited. Pig PTX3 mRNA was sequenced using polymerase chain reaction primers designed from human consensus sequences. The DNA, obtained from different RT-PCR reactions, was sequenced using the Sanger method. S. scrofa PTX3 mRNA, 1-336 bp, was submitted to GenBank (ID: GQ412351). The sequence obtained from pig cardiac tissue shared an 84% sequence identity with human homolog. The presence of PTX3 mRNA expression was detected in all the cardiac chambers sharing an increase after 3 weeks of pacing compared to controls (p=0.036 HF right atrium vs. N; p=0.022, HF left ventricle vs. N). Knowledge of the PTX3 sequence could be a useful starting point for future studies devoted to better understanding the specific role of this molecule in the pathogenesis of cardiovascular diseases.

  6. RNA sequencing uncovers antisense RNAs and novel small RNAs in Streptococcus pyogenes.

    Science.gov (United States)

    Le Rhun, Anaïs; Beer, Yan Yan; Reimegård, Johan; Chylinski, Krzysztof; Charpentier, Emmanuelle

    2016-01-01

    Streptococcus pyogenes is a human pathogen responsible for a wide spectrum of diseases ranging from mild to life-threatening infections. During the infectious process, the temporal and spatial expression of pathogenicity factors is tightly controlled by a complex network of protein and RNA regulators acting in response to various environmental signals. Here, we focus on the class of small RNA regulators (sRNAs) and present the first complete analysis of sRNA sequencing data in S. pyogenes. In the SF370 clinical isolate (M1 serotype), we identified 197 and 428 putative regulatory RNAs by visual inspection and bioinformatics screening of the sequencing data, respectively. Only 35 from the 197 candidates identified by visual screening were assigned a predicted function (T-boxes, ribosomal protein leaders, characterized riboswitches or sRNAs), indicating how little is known about sRNA regulation in S. pyogenes. By comparing our list of predicted sRNAs with previous S. pyogenes sRNA screens using bioinformatics or microarrays, 92 novel sRNAs were revealed, including antisense RNAs that are for the first time shown to be expressed in this pathogen. We experimentally validated the expression of 30 novel sRNAs and antisense RNAs. We show that the expression profile of 9 sRNAs including 2 predicted regulatory elements is affected by the endoribonucleases RNase III and/or RNase Y, highlighting the critical role of these enzymes in sRNA regulation.

  7. Improvement of sequence selectivity in triple helical recognition of RNA by phenylalanine-derived PNA.

    Science.gov (United States)

    Zengeya, Thomas; Gindin, Artem; Rozners, Eriks

    2013-01-01

    Modified peptide nucleic acids (PNA) containing one or two thymine PNA monomers derived from phenylalanine were synthesized. Triple helix formation by these modified PNAs with RNA and DNA hairpins having a variable base pair in the middle of the helix were studied using isothermal titration calorimetry and compared with triple helix formation by non-modified PNAs. While unmodified PNA had low sequence selectivity against mismatched hairpins, introduction of one or two phenylalanine-derived monomers significantly increased the mismatch discrimination and sequence selectivity of the modified PNA. Consistent with our previous observations, PNA formed more stable triple helices with RNA than with DNA. Interestingly, the phenylalanine modification further improved the preference of PNA for RNA over DNA hairpin.

  8. Ultrasensitive single-genome sequencing: accurate, targeted, next generation sequencing of HIV-1 RNA.

    Science.gov (United States)

    Boltz, Valerie F; Rausch, Jason; Shao, Wei; Hattori, Junko; Luke, Brian; Maldarelli, Frank; Mellors, John W; Kearney, Mary F; Coffin, John M

    2016-12-20

    Although next generation sequencing (NGS) offers the potential for studying virus populations in unprecedented depth, PCR error, amplification bias and recombination during library construction have limited its use to population sequencing and measurements of unlinked allele frequencies. Here we report a method, termed ultrasensitive Single-Genome Sequencing (uSGS), for NGS library construction and analysis that eliminates PCR errors and recombinants, and generates single-genome sequences of the same quality as the "gold-standard" of HIV-1 single-genome sequencing assay but with more than 100-fold greater depth. Primer ID tagged cDNA was synthesized from mixtures of cloned BH10 wild-type and mutant HIV-1 transcripts containing ten drug resistance mutations. First, the resultant cDNA was divided and NGS libraries were generated in parallel using two methods: uSGS and a method applying long PCR primers to attach the NGS adaptors (LP-PCR-1). Second, cDNA was divided and NGS libraries were generated in parallel comparing 3 methods: uSGS and 2 methods adapted from more recent reports using variations of the long PCR primers to attach the adaptors (LP-PCR-2 and LP-PCR-3). Consistently, the uSGS method amplified a greater proportion of cDNAs, averaging 30% compared to 13% for LP-PCR-1, 21% for LP-PCR-2 and 14% for LP-PCR-3. Most importantly, when the uSGS sequences were binned according to their primer IDs, 94% of the bins did not contain PCR recombinant sequences versus only 55, 75 and 65% for LP-PCR-1, 2 and 3, respectively. Finally, when uSGS was applied to plasma samples from HIV-1 infected donors, both frequent and rare variants were detected in each sample and neighbor-joining trees revealed clusters of genomes driven by the linkage of these mutations, showing the lack of PCR recombinants in the datasets. The uSGS assay can be used for accurate detection of rare variants and for identifying linkage of rare alleles associated with HIV-1 drug resistance. In addition

  9. The Messenger Mission to Mercury

    CERN Document Server

    Domingue, D. L

    2007-01-01

    NASA’s MESSENGER mission, launched on 3 August, 2004 is the seventh mission in the Discovery series. MESSENGER encounters the planet Mercury four times, culminating with an insertion into orbit on 18 March 2011. It carries a comprehensive package of geophysical, geological, geochemical, and space environment experiments to complete the complex investigations of this solar-system end member, which begun with Mariner 10. The articles in this book, written by the experts in each area of the MESSENGER mission, describe the mission, spacecraft, scientific objectives, and payload. The book is of interest to all potential users of the data returned by the MESSENGER mission, to those studying the nature of the planet Mercury, and by all those interested in the design and implementation of planetary exploration missions.

  10. Sequences more than 500 base pairs upstream of the human U3 small nuclear RNA gene stimulate the synthesis of U3 RNA in frog oocytes

    Energy Technology Data Exchange (ETDEWEB)

    Suh, D.; Reddy, R. (Baylor Coll. of Medicine, Houston, TX (United States)); Wright, D. (Texas Medical Center, Houston (United States))

    1991-06-04

    Small nuclear RNA (snRNA) genes contain strong promoters capable of initiating transcription once every 4 s. Studies on the human U1 snRNA gene, carried out in other laboratories, showed that sequences within 400 bp of the 5' flanking region are sufficient for maximal levels of transcription both in vivo and in frog oocytes (reviewed in Dahlberg and Lund (1988)). The authors studied the expression of a human U3 snRNA gene by injecting 5' deletion mutants into frog oocytes. The results show that sequences more than 500 bp upstream of the U3 snRNA gene have a 2-3-fold stimulatory effect on the U3 snRNA synthesis. These results indicate that the human U3 snRNA gene is different from human U1 snRNA gene in containing regulatory elements more than 500 bp upstream. The U3 snRNA gene upstream sequences contain an AluI homologous sequence in the {minus}1,200 region; these AluI sequences were transcribed in vitro and in frog oocytes but were not detectable in Hela cells.

  11. Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.

    Directory of Open Access Journals (Sweden)

    Sara Kangaspeska

    Full Text Available RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60% of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.

  12. Sequence analysis of mitochondrial 16S ribosomal RNA gene fragment from seven mosquito species

    Indian Academy of Sciences (India)

    Yogesh S Shouche; Milind S Patole

    2000-12-01

    Mosquitoes are vectors for the transmission of many human pathogens that include viruses, nematodes and protozoa. For the understanding of their vectorial capacity, identification of disease carrying and refractory strains is essential. Recently, molecular taxonomic techniques have been utilized for this purpose. Sequence analysis of the mitochondrial 16S rRNA gene has been used for molecular taxonomy in many insects. In this paper, we have analysed a 450 bp hypervariable region of the mitochondrial 16S rRNA gene in three major genera of mosquitoes, Aedes, Anopheles and Culex. The sequence was found to be unusually A + T rich and in substitutions the rate of transversions was higher than the transition rate. A phylogenetic tree was constructed with these sequences. An interesting feature of the sequences was a stretch of Ts that distinguished between Aedes and Culex on the one hand, and Anopheles on the other. This is the first report of mitochondrial rRNA sequences from these medically important genera of mosquitoes.

  13. Full Genome Sequence and sfRNA Interferon Antagonist Activity of Zika Virus from Recife, Brazil

    Science.gov (United States)

    Rezelj, Veronica V.; Clark, Jordan J.; Cordeiro, Marli T.; Freitas de Oliveira França, Rafael; Pena, Lindomar J.; Wilkie, Gavin S.; Da Silva Filipe, Ana; Davis, Christopher; Hughes, Joseph; Varjak, Margus; Selinger, Martin; Zuvanov, Luíza; Owsianka, Ania M.; Patel, Arvind H.; McLauchlan, John; Lindenbach, Brett D.; Fall, Gamou; Sall, Amadou A.; Biek, Roman; Rehwinkel, Jan; Schnettler, Esther; Kohl, Alain

    2016-01-01

    Background The outbreak of Zika virus (ZIKV) in the Americas has transformed a previously obscure mosquito-transmitted arbovirus of the Flaviviridae family into a major public health concern. Little is currently known about the evolution and biology of ZIKV and the factors that contribute to the associated pathogenesis. Determining genomic sequences of clinical viral isolates and characterization of elements within these are an important prerequisite to advance our understanding of viral replicative processes and virus-host interactions. Methodology/Principal findings We obtained a ZIKV isolate from a patient who presented with classical ZIKV-associated symptoms, and used high throughput sequencing and other molecular biology approaches to determine its full genome sequence, including non-coding regions. Genome regions were characterized and compared to the sequences of other isolates where available. Furthermore, we identified a subgenomic flavivirus RNA (sfRNA) in ZIKV-infected cells that has antagonist activity against RIG-I induced type I interferon induction, with a lesser effect on MDA-5 mediated action. Conclusions/Significance The full-length genome sequence including non-coding regions of a South American ZIKV isolate from a patient with classical symptoms will support efforts to develop genetic tools for this virus. Detection of sfRNA that counteracts interferon responses is likely to be important for further understanding of pathogenesis and virus-host interactions. PMID:27706161

  14. TAXONOMIC STATUS OF CAR BACILLUS BASED ON THE SMALL SUBUNIT RIBOSOMAL RNA SEQUENCES

    Institute of Scientific and Technical Information of China (English)

    魏强; TsujiM; TakahashiT; IshiharaC; ItohT

    1995-01-01

    In an attempt to identify the taxonomic relationship between CAR bacillus and other bacteria, the SSU rRNA gene sequences of two CAR bacillus strains, CBM and CBR isolated from mice and rats respectively were used in the present studies. The SSU rRNA gene sequences, approximately 1.5 kb in size amplified from genomic DNAs from both strains, were determined and 96. 8% homologies were found to exist be-tween them. Those sequences were aligned to most euhacteria with a computer search showing high homol-ogy with those of Flavobacter/Flexibacter species especially closed to Fx. sanai and Ft. ferrugineum. Phylogenetic analysts indicated that CAR bacillus belongs to a species close to Fx. sancti and Ft. ferrug-imum subdivision.

  15. Efficient experimental design and analysis strategies for the detection of differential expression using RNA-Sequencing

    Directory of Open Access Journals (Sweden)

    Robles José A

    2012-09-01

    Full Text Available Abstract Background RNA sequencing (RNA-Seq has emerged as a powerful approach for the detection of differential gene expression with both high-throughput and high resolution capabilities possible depending upon the experimental design chosen. Multiplex experimental designs are now readily available, these can be utilised to increase the numbers of samples or replicates profiled at the cost of decreased sequencing depth generated per sample. These strategies impact on the power of the approach to accurately identify differential expression. This study presents a detailed analysis of the power to detect differential expression in a range of scenarios including simulated null and differential expression distributions with varying numbers of biological or technical replicates, sequencing depths and analysis methods. Results Differential and non-differential expression datasets were simulated using a combination of negative binomial and exponential distributions derived from real RNA-Seq data. These datasets were used to evaluate the performance of three commonly used differential expression analysis algorithms and to quantify the changes in power with respect to true and false positive rates when simulating variations in sequencing depth, biological replication and multiplex experimental design choices. Conclusions This work quantitatively explores comparisons between contemporary analysis tools and experimental design choices for the detection of differential expression using RNA-Seq. We found that the DESeq algorithm performs more conservatively than edgeR and NBPSeq. With regard to testing of various experimental designs, this work strongly suggests that greater power is gained through the use of biological replicates relative to library (technical replicates and sequencing depth. Strikingly, sequencing depth could be reduced as low as 15% without substantial impacts on false positive or true positive rates.

  16. Sequence requirements for micro RNA processing and function in human cells

    Science.gov (United States)

    ZENG, YAN; CULLEN, BRYAN R.

    2003-01-01

    Most eukaryotes encode a substantial number of small noncoding RNAs termed micro RNAs (miRNAs). Previously, we have demonstrated that miR-30, a 22-nucleotide human miRNA, can be processed from a longer transcript bearing the proposed miR-30 stem-loop precursor and can translationally inhibit an mRNA-bearing artificial target sites. We also demonstrated that the miR-30 precursor stem can be substituted with a heterologous stem, which can be processed to yield novel miRNAs and can block the expression of endogenous mRNAs. Here, we show that a second human miRNA, termed miR-21, can also be effectively expressed when its precursor forms part of a longer mRNA. For both miR-30 and miR-21, mature miRNA production was highly dependent on the integrity of the precursor RNA stem, although the underlying sequence had little effect. In contrast, the sequence of the terminal loop affected miRNA production only moderately. Processing of the initial, miR-30-containing transcript led to the production of not only mature miR-30 but also to the largely nuclear excision of an ∼65-nucleotide RNA that is likely to represent an important intermediate in miR-30 processing. Consistent with this hypothesis, mutations that affected mature miR-30 production inhibited expression of this miR-30 pre-miRNA to an equivalent degree. Although point mutations could block the ability of both miR-30 and miR-21 to inhibit the translation of mRNAs bearing multiple artificial miRNA target sites, single point mutations only attenuated the miRNA-mediated inhibition of genes bearing single, fully complementary targets. These results suggest that miRNAs, and the closely similar small interfering RNAs, cannot totally discriminate between RNA targets differing by a single nucleotide. PMID:12554881

  17. Global transcriptional start site mapping using differential RNA sequencing reveals novel antisense RNAs in Escherichia coli.

    Science.gov (United States)

    Thomason, Maureen K; Bischler, Thorsten; Eisenbart, Sara K; Förstner, Konrad U; Zhang, Aixia; Herbig, Alexander; Nieselt, Kay; Sharma, Cynthia M; Storz, Gisela

    2015-01-01

    While the model organism Escherichia coli has been the subject of intense study for decades, the full complement of its RNAs is only now being examined. Here we describe a survey of the E. coli transcriptome carried out using a differential RNA sequencing (dRNA-seq) approach, which can distinguish between primary and processed transcripts, and an automated prediction algorithm for transcriptional start sites (TSS). With the criterion of expression under at least one of three growth conditions examined, we predicted 14,868 TSS candidates, including 5,574 internal to annotated genes (iTSS) and 5,495 TSS corresponding to potential antisense RNAs (asRNAs). We examined expression of 14 candidate asRNAs by Northern analysis using RNA from wild-type E. coli and from strains defective for RNases III and E, two RNases reported to be involved in asRNA processing. Interestingly, nine asRNAs detected as distinct bands by Northern analysis were differentially affected by the rnc and rne mutations. We also compared our asRNA candidates with previously published asRNA annotations from RNA-seq data and discuss the challenges associated with these cross-comparisons. Our global transcriptional start site map represents a valuable resource for identification of transcription start sites, promoters, and novel transcripts in E. coli and is easily accessible, together with the cDNA coverage plots, in an online genome browser.

  18. Comprehensive comparative analysis of RNA sequencing methods for degraded or low input samples

    Science.gov (United States)

    Adiconis, Xian; Borges-Rivera, Diego; Satija, Rahul; DeLuca, David S.; Busby, Michele A.; Berlin, Aaron M.; Sivachenko, Andrey; Thompson, Dawn Anne; Wysoker, Alec; Fennell, Timothy; Gnirke, Andreas; Pochet, Nathalie; Regev, Aviv; Levin, Joshua Z.

    2013-01-01

    RNA-Seq is an effective method to study the transcriptome, but can be difficult to apply to scarce or degraded RNA from fixed clinical samples, rare cell populations, or cadavers. Recent studies have proposed several methods for RNA-Seq of low quality and/or low quantity samples, but their relative merits have not been systematically analyzed. Here, we compare five such methods using metrics relevant to transcriptome annotation, transcript discovery, and gene expression. Using a single human RNA sample, we constructed and sequenced ten libraries with these methods and two control libraries. We find that the RNase H method performed best for low quality RNA, and confirmed this with actual degraded samples. RNase H can even effectively replace oligo (dT) based methods for standard RNA-Seq. SMART and NuGEN had distinct strengths for low quantity RNA. Our analysis allows biologists to select the most suitable methods and provides a benchmark for future method development. PMID:23685885

  19. Comparative analysis of RNA sequencing methods for degraded or low-input samples.

    Science.gov (United States)

    Adiconis, Xian; Borges-Rivera, Diego; Satija, Rahul; DeLuca, David S; Busby, Michele A; Berlin, Aaron M; Sivachenko, Andrey; Thompson, Dawn Anne; Wysoker, Alec; Fennell, Timothy; Gnirke, Andreas; Pochet, Nathalie; Regev, Aviv; Levin, Joshua Z

    2013-07-01

    RNA-seq is an effective method for studying the transcriptome, but it can be difficult to apply to scarce or degraded RNA from fixed clinical samples, rare cell populations or cadavers. Recent studies have proposed several methods for RNA-seq of low-quality and/or low-quantity samples, but the relative merits of these methods have not been systematically analyzed. Here we compare five such methods using metrics relevant to transcriptome annotation, transcript discovery and gene expression. Using a single human RNA sample, we constructed and sequenced ten libraries with these methods and compared them against two control libraries. We found that the RNase H method performed best for chemically fragmented, low-quality RNA, and we confirmed this through analysis of actual degraded samples. RNase H can even effectively replace oligo(dT)-based methods for standard RNA-seq. SMART and NuGEN had distinct strengths for measuring low-quantity RNA. Our analysis allows biologists to select the most suitable methods and provides a benchmark for future method development.

  20. SiRNA sequence model: redesign algorithm based on available genome-wide libraries.

    Science.gov (United States)

    Kozak, Karol

    2013-12-01

    The evolution of RNA interference (RNAi) and the development of technologies exploiting its biology have enabled scientists to rapidly examine the consequences of depleting a particular gene product in cells. Design tools have been developed based on experimental data to increase the knockdown efficiency of siRNAs. Not all siRNAs that are developed to a given target mRNA are equally effective. Currently available design algorithms take an accession, identify conserved regions among their transcript space, find accessible regions within the mRNA, design all possible siRNAs for these regions, filter them based on multi-scores thresholds, and then perform off-target filtration. These different criteria are used by commercial suppliers to produce siRNA genome-wide libraries for different organisms. In this article, we analyze existing siRNA design algorithms and evaluate weight of design parameters for libraries produced in the last decade. We proved that not all essential parameters are currently applied by siRNA vendors. Based on our evaluation results, we were able to suggest an siRNA sequence pattern. The findings in our study can be useful for commercial vendors improving the design of RNAi constructs, by addressing both the issue of potency and the issue of specificity.

  1. Strategy for microbiome analysis using 16S rRNA gene sequence analysis on the Illumina sequencing platform.

    Science.gov (United States)

    Ram, Jeffrey L; Karim, Aos S; Sendler, Edward D; Kato, Ikuko

    2011-06-01

    Understanding the identity and changes of organisms in the urogenital and other microbiomes of the human body may be key to discovering causes and new treatments of many ailments, such as vaginosis. High-throughput sequencing technologies have recently enabled discovery of the great diversity of the human microbiome. The cost per base of many of these sequencing platforms remains high (thousands of dollars per sample); however, the Illumina Genome Analyzer (IGA) is estimated to have a cost per base less than one-fifth of its nearest competitor. The main disadvantage of the IGA for sequencing PCR-amplified 16S rRNA genes is that the maximum read-length of the IGA is only 100 bases; whereas, at least 300 bases are needed to obtain phylogenetically informative data down to the genus and species level. In this paper we describe and conduct a pilot test of a multiplex sequencing strategy suitable for achieving total reads of > 300 bases per extracted DNA molecule on the IGA. Results show that all proposed primers produce products of the expected size and that correct sequences can be obtained, with all proposed forward primers. Various bioinformatic optimization of the Illumina Bustard analysis pipeline proved necessary to extract the correct sequence from IGA image data, and these modifications of the data files indicate that further optimization of the analysis pipeline may improve the quality rankings of the data and enable more sequence to be correctly analyzed. The successful application of this method could result in an unprecedentedly deep description (800,000 taxonomic identifications per sample) of the urogenital and other microbiomes in a large number of samples at a reasonable cost per sample.

  2. Sequence-specific binding of a hormonally regulated mRNA binding protein to cytidine-rich sequences in the lutropin receptor open reading frame.

    Science.gov (United States)

    Kash, J C; Menon, K M

    1999-12-21

    In previous studies, a lutropin receptor mRNA binding protein implicated in the hormonal regulation of lutropin receptor mRNA stability was identified. This protein, termed LRBP-1, was shown by RNA gel electrophoretic mobility shift assay to specifically interact with lutropin receptor RNA sequences. The present studies have examined the specificity of lutropin receptor mRNA recognition by LRBP-1 and mapped the contact site by RNA footprinting and by site-directed mutagenesis. LRBP-1 was partially purified by cation-exchange chromatography, and the mRNA binding properties of the partially purified LRBP-1 were examined by RNA gel electrophoretic mobility shift assay and hydroxyl-radical RNA footprinting. These data showed that the LRBP-1 binding site is located between nucleotides 203 and 220 of the receptor open reading frame, and consists of the bipartite polypyrimidine sequence 5'-UCUC-X(7)-UCUCCCU-3'. Competition RNA gel electrophoretic mobility shift assays demonstrated that homoribopolymers of poly(rC) were effective RNA binding competitors, while poly(rA), poly(rG), and poly(rU) showed no effect. Mutagenesis of the cytidine residues contained within the LRBP-1 binding site demonstrated that all the cytidines in the bipartite sequence contribute to LRBP-1 binding specificity. Additionally, RNA gel electrophoretic mobility supershift analysis showed that LRBP-1 was not recognized by antibodies against two well-characterized poly(rC) RNA binding proteins, alphaCP-1 and alphaCP-2, implicated in the regulation of RNA stability of alpha-globin and tyrosine hydroxylase mRNAs. In summary, we show that partially purified LRBP-1 binds to a polypyrimidine sequence within nucleotides 203 and 220 of lutropin receptor mRNA with a high degree of specificity which is indicative of its role in posttranscriptional control of lutropin receptor expression.

  3. On the optimal trimming of high-throughput mRNA sequence data

    Directory of Open Access Journals (Sweden)

    Matthew D MacManes

    2014-01-01

    Full Text Available The widespread and rapid adoption of high-throughput sequencing technologies has afforded researchers the opportunity to gain a deep understanding of genome level processes that underlie evolutionary change, and perhaps more importantly, the links between genotype and phenotype. In particular, researchers interested in functional biology and adaptation have used these technologies to sequence mRNA transcriptomes of specific tissues, which in turn are often compared to other tissues, or other individuals with different phenotypes. While these techniques are extremely powerful, careful attention to data quality is required. In particular, because high-throughput sequencing is more error-prone than traditional Sanger sequencing, quality trimming of sequence reads should be an important step in all data processing pipelines. While several software packages for quality trimming exist, no general guidelines for the specifics of trimming have been developed. Here, using empirically derived sequence data, I provide general recommendations regarding the optimal strength of trimming, specifically in mRNA-Seq studies. Although very aggressive quality trimming is common, this study suggests that a more gentle trimming, specifically of those nucleotides whose Phred score < 2 or < 5, is optimal for most studies across a wide variety of metrics.

  4. Prediction of effective RNA interference targets and pathway-related genes in lepidopteran insects by RNA sequencing analysis.

    Science.gov (United States)

    Guan, Ruo-Bing; Li, Hai-Chao; Miao, Xue-Xia

    2017-01-06

    When using RNAi to study gene functions in Lepidoptera insects, we discovered that some genes could not be suppressed, instead, their expression levels could be up-regulated by dsRNA. To predict which genes could be easily silenced, we treated the Asian corn borer (Ostrinia furnacalis) with dsGFP and dsMLP. A transcriptome sequence analysis was conducted using the cDNAs 6 h after treatment with dsRNA. The results indicated that 160 genes were up-regulated and 44 genes were down-regulated by the two dsRNAs. Then, 50 co-up-regulated, 25 co-down-regulated and 43 unaffected genes were selected to determine their RNAi responses. All the 25 down-regulated genes were knocked down by their corresponding dsRNA. However, several of the up-regulated and unaffected genes were up-regulated when treated with their corresponding dsRNAs instead of being knocked-down. The genes up-regulated by the dsGFP treatment may be involved in insect immune responses or the RNAi pathway. When the immune-related genes were excluded, only seven genes were induced by dsGFP, including ago-2 and dicer-2. These results not only provide a reference for efficient RNAi targets predication, but also provide some potential RNAi pathway-related genes for further study. This article is protected by copyright. All rights reserved.

  5. Spatially Enhanced Differential RNA Methylation Analysis from Affinity-Based Sequencing Data with Hidden Markov Model.

    Science.gov (United States)

    Zhang, Yu-Chen; Zhang, Shao-Wu; Liu, Lian; Liu, Hui; Zhang, Lin; Cui, Xiaodong; Huang, Yufei; Meng, Jia

    2015-01-01

    With the development of new sequencing technology, the entire N6-methyl-adenosine (m(6)A) RNA methylome can now be unbiased profiled with methylated RNA immune-precipitation sequencing technique (MeRIP-Seq), making it possible to detect differential methylation states of RNA between two conditions, for example, between normal and cancerous tissue. However, as an affinity-based method, MeRIP-Seq has yet provided base-pair resolution; that is, a single methylation site determined from MeRIP-Seq data can in practice contain multiple RNA methylation residuals, some of which can be regulated by different enzymes and thus differentially methylated between two conditions. Since existing peak-based methods could not effectively differentiate multiple methylation residuals located within a single methylation site, we propose a hidden Markov model (HMM) based approach to address this issue. Specifically, the detected RNA methylation site is further divided into multiple adjacent small bins and then scanned with higher resolution using a hidden Markov model to model the dependency between spatially adjacent bins for improved accuracy. We tested the proposed algorithm on both simulated data and real data. Result suggests that the proposed algorithm clearly outperforms existing peak-based approach on simulated systems and detects differential methylation regions with higher statistical significance on real dataset.

  6. A Guide RNA Sequence Design Platform for the CRISPR/Cas9 System for Model Organism Genomes

    Directory of Open Access Journals (Sweden)

    Ming Ma

    2013-01-01

    Full Text Available Cas9/CRISPR has been reported to efficiently induce targeted gene disruption and homologous recombination in both prokaryotic and eukaryotic cells. Thus, we developed a Guide RNA Sequence Design Platform for the Cas9/CRISPR silencing system for model organisms. The platform is easy to use for gRNA design with input query sequences. It finds potential targets by PAM and ranks them according to factors including uniqueness, SNP, RNA secondary structure, and AT content. The platform allows users to upload and share their experimental results. In addition, most guide RNA sequences from published papers have been put into our database.

  7. An evolutionary conserved pattern of 18S rRNA sequence complementarity to mRNA 5' UTRs and its implications for eukaryotic gene translation regulation.

    Science.gov (United States)

    Pánek, Josef; Kolár, Michal; Vohradský, Jirí; Shivaya Valásek, Leos

    2013-09-01

    There are several key mechanisms regulating eukaryotic gene expression at the level of protein synthesis. Interestingly, the least explored mechanisms of translational control are those that involve the translating ribosome per se, mediated for example via predicted interactions between the ribosomal RNAs (rRNAs) and mRNAs. Here, we took advantage of robustly growing large-scale data sets of mRNA sequences for numerous organisms, solved ribosomal structures and computational power to computationally explore the mRNA-rRNA complementarity that is statistically significant across the species. Our predictions reveal highly specific sequence complementarity of 18S rRNA sequences with mRNA 5' untranslated regions (UTRs) forming a well-defined 3D pattern on the rRNA sequence of the 40S subunit. Broader evolutionary conservation of this pattern may imply that 5' UTRs of eukaryotic mRNAs, which have already emerged from the mRNA-binding channel, may contact several complementary spots on 18S rRNA situated near the exit of the mRNA binding channel and on the middle-to-lower body of the solvent-exposed 40S ribosome including its left foot. We discuss physiological significance of this structurally conserved pattern and, in the context of previously published experimental results, propose that it modulates scanning of the 40S subunit through 5' UTRs of mRNAs.

  8. New Hosts of Simplicimonas similis and Trichomitus batrachorum Identified by 18S Ribosomal RNA Gene Sequences

    Directory of Open Access Journals (Sweden)

    Kris Genelyn B. Dimasuay

    2013-01-01

    Full Text Available Trichomonads are obligate anaerobes generally found in the digestive and genitourinary tract of domestic animals. In this study, four trichomonad isolates were obtained from carabao, dog, and pig hosts using rectal swab. Genomic DNA was extracted using Chelex method and the 18S rRNA gene was successfully amplified through novel sets of primers and undergone DNA sequencing. Aligned isolate sequences together with retrieved 18S rRNA gene sequences of known trichomonads were utilized to generate phylogenetic trees using maximum likelihood and neighbor-joining analyses. Two isolates from carabao were identified as Simplicimonas similis while each isolate from dog and pig was identified as Pentatrichomonas hominis and Trichomitus batrachorum, respectively. This is the first report of S. similis in carabao and the identification of T. batrachorum in pig using 18S rRNA gene sequence analysis. The generated phylogenetic tree yielded three distinct groups mostly with relatively moderate to high bootstrap support and in agreement with the most recent classification. Pathogenic potential of the trichomonads in these hosts still needs further investigation.

  9. Sequence analysis and location of capsid proteins within RNA 2 of strawberry latent ringspot virus.

    Science.gov (United States)

    Kreiah, S; Strunk, G; Cooper, J I

    1994-09-01

    The nucleotide sequence of the RNA 2 of a strawberry isolate (H) of strawberry latent ringspot virus (SLRSV) comprised 3824 nucleotides and contained one long open reading frame with a theoretical coding capacity of 890 amino acids equivalent to a protein of 98.8K. The N-terminal amino acid sequences of virion-derived proteins were determined by Edman degradation allowing the capsid coding regions to be located and serine/glycine cleavage sites to be identified within the polyprotein. The amino acid sequence in the capsid coding region of an isolate of SLRSV from flowering cherry in New Zealand was 97% identical to that of SLRSV-H. Except in the 3' and 5' terminal non-coding sequences, computer-based alignment and comparison algorithms did not reveal any substantial homologies between RNA 2 of SLRSV-H and the equivalent genomic segments in the nepoviruses arabis mosaic, cherry leaf roll, grapevine fanleaf, raspberry ringspot, grapevine hungarian chrome mosaic, tomato blackring, tomato ringspot, tobacco ringspot, or in the comoviruses cowpea mosaic and red clover mottle. Despite the similarities in overall genome organization, data from RNA 2 remain insufficient for unambiguous positioning of SLRSV in relation to species/genera in the Comoviridae.

  10. RNA-guided complex from a bacterial immune system enhances target recognition through seed sequence interactions

    Science.gov (United States)

    Wiedenheft, Blake; van Duijn, Esther; Bultema, Jelle B.; Waghmare, Sakharam P.; Zhou, Kaihong; Barendregt, Arjan; Westphal, Wiebke; Heck, Albert J. R.; Boekema, Egbert J.; Dickman, Mark J.; Doudna, Jennifer A.

    2011-01-01

    Prokaryotes have evolved multiple versions of an RNA-guided adaptive immune system that targets foreign nucleic acids. In each case, transcripts derived from clustered regularly interspaced short palindromic repeats (CRISPRs) are thought to selectively target invading phage and plasmids in a sequence-specific process involving a variable cassette of CRISPR-associated (cas) genes. The CRISPR locus in Pseudomonas aeruginosa (PA14) includes four cas genes that are unique to and conserved in microorganisms harboring the Csy-type (CRISPR system yersinia) immune system. Here we show that the Csy proteins (Csy1–4) assemble into a 350 kDa ribonucleoprotein complex that facilitates target recognition by enhancing sequence-specific hybridization between the CRISPR RNA and complementary target sequences. Target recognition is enthalpically driven and localized to a “seed sequence” at the 5′ end of the CRISPR RNA spacer. Structural analysis of the complex by small-angle X-ray scattering and single particle electron microscopy reveals a crescent-shaped particle that bears striking resemblance to the architecture of a large CRISPR-associated complex from Escherichia coli, termed Cascade. Although similarity between these two complexes is not evident at the sequence level, their unequal subunit stoichiometry and quaternary architecture reveal conserved structural features that may be common among diverse CRISPR-mediated defense systems. PMID:21536913

  11. MicroRNA of the fifth-instar posterior silk gland of silkworm identified by Solexa sequencing

    Directory of Open Access Journals (Sweden)

    Jisheng Li

    2014-12-01

    Full Text Available No special studies have been focused on the microRNA (miRNA in the fifth-instar posterior silk gland of Bombyx mori. Here, using next-generation sequencing, we acquired 93.2 million processed reads from 10 small RNA libraries. In this paper, we tried to thoroughly describe how our dataset generated from deep sequencing which was recently published in BMC genomics. Results showed that our findings are largely enriched silkworm miRNA depository and may benefit us to reveal the miRNA functions in the process of silk production.

  12. Characterization and Comparative Analysis of the Milk Transcriptome in Two Dairy Sheep Breeds using RNA Sequencing

    OpenAIRE

    Aroa Suárez-Vega; Beatriz Gutiérrez-Gil; Christophe Klopp; Christèle Robert-Granie; Gwenola Tosser-Klopp; Juan José Arranz

    2015-01-01

    This study presents a dynamic characterization of the sheep milk transcriptome aiming at achieving a better understanding of the sheep lactating mammary gland. Transcriptome sequencing (RNA-seq) was performed on total RNA extracted from milk somatic cells from ewes on days 10, 50, 120 and 150 after lambing. The experiment was performed in Spanish Churra and Assaf breeds, which differ in their milk production traits. Nearly 67% of the annotated genes in the reference genome (Oar_v3.1) were exp...

  13. MicroRNA transcriptome profiling of mice brains infected with Japanese encephalitis virus by RNA sequencing.

    Science.gov (United States)

    Li, Xin-Feng; Cao, Rui-Bing; Luo, Jun; Fan, Jian-Ming; Wang, Jing-Man; Zhang, Yuan-Peng; Gu, Jin-Yan; Feng, Xiu-Li; Zhou, Bin; Chen, Pu-Yan

    2016-04-01

    Japanese encephalitis (JE) is a mosquito borne viral disease, caused by Japanese encephalitis virus (JEV) infection producing severe neuroinflammation in the central nervous system (CNS) with the associated disruption of the blood brain barrier. MicroRNAs (miRNAs) are a family of 21-24 nt small non-coding RNAs that play important post-transcriptional regulatory roles in gene expression and have critical roles in virus pathogenesis. We examined the potential roles of miRNAs in JEV-infected suckling mice brains and found that JEV infection changed miRNA expression profiles when the suckling mice began showing nervous symptoms. A total of 1062 known and 71 novel miRNAs were detected in JEV-infected group, accompanied with 1088 known and 75 novel miRNAs in mock controls. Among these miRNAs, one novel and 25 known miRNAs were significantly differentially expressed, including 18 up-regulated and 8 down-regulated miRNAs which were further confirmed by real-time PCR. Gene ontology (GO) and signaling pathway analysis of the predicted target mRNAs of the modulated miRNAs showed that they are correlated with the regulation of apoptosis, neuron differentiation, antiviral immunity and infiltration of mouse brain, and the validated targets of 12 differentially expressed miRNAs were enriched for the regulation of cell programmed death, proliferation, transcription, muscle organ development, erythrocyte differentiation, gene expression, plasma membrane and protein domain specific binding. KEGG analysis further reveals that the validated target genes were involved in the Pathways in cancer, Neurotrophin signaling pathway, Toll like receptor signaling pathway, Endometrial cancer and Jak-STAT signaling pathway. We constructed the interaction networks of miRNAs and their target genes according to GO terms and KEGG pathways and the expression levels of several target genes were examined. Our data provides a valuable basis for further studies on the regulatory roles of miRNAs in JE

  14. tRNADB-CE: tRNA gene database well-timed in the era of big sequence data.

    Science.gov (United States)

    Abe, Takashi; Inokuchi, Hachiro; Yamada, Yuko; Muto, Akira; Iwasaki, Yuki; Ikemura, Toshimichi

    2014-01-01

    The tRNA gene data base curated by experts "tRNADB-CE" (http://trna.ie.niigata-u.ac.jp) was constructed by analyzing 1,966 complete and 5,272 draft genomes of prokaryotes, 171 viruses', 121 chloroplasts', and 12 eukaryotes' genomes plus fragment sequences obtained by metagenome studies of environmental samples. 595,115 tRNA genes in total, and thus two times of genes compiled previously, have been registered, for which sequence, clover-leaf structure, and results of sequence-similarity and oligonucleotide-pattern searches can be browsed. To provide collective knowledge with help from experts in tRNA researches, we added a column for enregistering comments to each tRNA. By grouping bacterial tRNAs with an identical sequence, we have found high phylogenetic preservation of tRNA sequences, especially at the phylum level. Since many species-unknown tRNAs from metagenomic sequences have sequences identical to those found in species-known prokaryotes, the identical sequence group (ISG) can provide phylogenetic markers to investigate the microbial community in an environmental ecosystem. This strategy can be applied to a huge amount of short sequences obtained from next-generation sequencers, as showing that tRNADB-CE is a well-timed database in the era of big sequence data. It is also discussed that batch-learning self-organizing-map with oligonucleotide composition is useful for efficient knowledge discovery from big sequence data.

  15. tRNADB-CE: tRNA gene database well-timed in the era of big sequence data

    Directory of Open Access Journals (Sweden)

    Takashi eAbe

    2014-05-01

    Full Text Available The tRNA Gene Data Base Curated by Experts tRNADB-CE (http://trna.ie.niigata-u.ac.jp was constructed by analyzing 1,966 complete and 5,272 draft genomes of prokaryotes, 171 viruses’, 121 chloroplasts’, and 12 eukaryotes’ genomes plus fragment sequences obtained by metagenome studies of environmental samples. 595,115 tRNA genes in total, and thus two times of genes compiled previously, have been registered, for which sequence, clover-leaf structure, and results of sequence-similarity and oligonucleotide-pattern searches can be browsed. To provide collective knowledge with help from experts in tRNA researches, we added a column for enregistering comments to each tRNA. By grouping bacterial tRNAs with an identical sequence, we have found high phylogenetic preservation of tRNA sequences, especially at the phylum level. Since many species-unknown tRNAs from metagenomic sequences have sequences identical to those found in species-known prokaryotes, the identical sequence group can provide phylogenetic markers to investigate the microbial community in an environmental ecosystem. This strategy can be applied to a huge amount of short sequences obtained from next-generation sequencers, as showing that tRNADB-CE is a well-timed database in the era of big sequence data. It is also discussed that BLSOM with oligonucleotide composition is useful for efficient knowledge discovery from big sequence data.

  16. Enhanced methods for unbiased deep sequencing of Lassa and Ebola RNA viruses from clinical and biological samples.

    Science.gov (United States)

    Matranga, Christian B; Andersen, Kristian G; Winnicki, Sarah; Busby, Michele; Gladden, Adrianne D; Tewhey, Ryan; Stremlau, Matthew; Berlin, Aaron; Gire, Stephen K; England, Eleina; Moses, Lina M; Mikkelsen, Tarjei S; Odia, Ikponmwonsa; Ehiane, Philomena E; Folarin, Onikepe; Goba, Augustine; Kahn, S Humarr; Grant, Donald S; Honko, Anna; Hensley, Lisa; Happi, Christian; Garry, Robert F; Malboeuf, Christine M; Birren, Bruce W; Gnirke, Andreas; Levin, Joshua Z; Sabeti, Pardis C

    2014-01-01

    We have developed a robust RNA sequencing method for generating complete de novo assemblies with intra-host variant calls of Lassa and Ebola virus genomes in clinical and biological samples. Our method uses targeted RNase H-based digestion to remove contaminating poly(rA) carrier and ribosomal RNA. This depletion step improves both the quality of data and quantity of informative reads in unbiased total RNA sequencing libraries. We have also developed a hybrid-selection protocol to further enrich the viral content of sequencing libraries. These protocols have enabled rapid deep sequencing of both Lassa and Ebola virus and are broadly applicable to other viral genomics studies.

  17. Temporal changes in glial fibrillary acidic protein messenger RNA and [{sup 3}H]PK11195 binding in relation to imidazoline-I{sub 2}-receptor and {alpha}{sub 2}-adrenoceptor binding in the hippocampus following transient global forebrain ischaemia in the rat

    Energy Technology Data Exchange (ETDEWEB)

    Craven, J.A.; Gundlach, A.L.; Conway, E.L. [The University of Melbourne, Clinical Pharmacology and Therapeutics Unit (Australia); Department of Medicine, Austin and Repatriation Medical Centre (Australia)

    1997-10-24

    Immunohistochemical studies have demonstrated that following global forebrain ischaemia the selective neuronal loss that occurs in the CA1 pyramidal cell layer of the hippocampus is accompanied by a reactive astrocytosis, characterized by increases in glial fibrillary acidic protein, and activation of microglia. In this study the spatial changes in glial fibrillary acidic protein messenger RNA levels in the hippocampus have been mapped four, eight, 12, 16 and 20 days following 10 min of global forebrain ischaemia in the rat and related to changes in [{sup 3}H]PK11195 binding to peripheral benzodiazepine receptors, a putative marker of activated microglia. Recent studies have suggested that the imidazoline-I{sub 2}-receptor, one of a class of non-adrenergic receptors related to, but structurally and functionally distinct from {alpha}{sub 2}-adrenoceptors, may have a functional role in controlling the expression of glial fibrillary acidic protein. To explore this possibility further we have also mapped changes in imidazoline-I{sub 2}-receptor and {alpha}{sub 2}-adrenoceptor binding sites. Following transient ischaemia there was a marked, biphasic increase in glial fibrillary acidic protein messenger RNA levels throughout the vulnerable CA1 region of the hippocampus, peaking four days after ischaemia and then increasing gradually during the remainder of the study period. There was also a sustained increase in [{sup 3}H]PK11195 binding, however, in contrast to the initial increase in glial fibrillary acidic protein messenger RNA levels that peaked four days after ischaemia the density of [{sup 3}H]PK11195 binding increased rapidly in all strata of the CA1 region over the first eight days and then increased more slowly throughout days 12 to 20. Despite the marked increase in glial fibrillary acidic protein messenger RNA levels there was no concomitant alteration in imidazoline-I{sub 2}-receptor binding sites detected using the specific radioligand, [{sup 3}H]2

  18. Multiple, non-allelic, intein-coding sequences in eukaryotic RNA polymerase genes

    Directory of Open Access Journals (Sweden)

    Butler Margaret I

    2006-10-01

    Full Text Available Abstract Background Inteins are self-splicing protein elements. They are translated as inserts within host proteins that excise themselves and ligate the flanking portions of the host protein (exteins with a peptide bond. They are encoded as in-frame insertions within the genes for the host proteins. Inteins are found in all three domains of life and in viruses, but have a very sporadic distribution. Only a small number of intein coding sequences have been identified in eukaryotic nuclear genes, and all of these are from ascomycete or basidiomycete fungi. Results We identified seven intein coding sequences within nuclear genes coding for the second largest subunits of RNA polymerase. These sequences were found in diverse eukaryotes: one is in the second largest subunit of RNA polymerase I (RPA2 from the ascomycete fungus Phaeosphaeria nodorum, one is in the RNA polymerase III (RPC2 of the slime mould Dictyostelium discoideum and four intein coding sequences are in RNA polymerase II genes (RPB2, one each from the green alga Chlamydomonas reinhardtii, the zygomycete fungus Spiromyces aspiralis and the chytrid fungi Batrachochytrium dendrobatidis and Coelomomyces stegomyiae. The remaining intein coding sequence is in a viral relic embedded within the genome of the oomycete Phytophthora ramorum. The Chlamydomonas and Dictyostelium inteins are the first nuclear-encoded inteins found outside of the fungi. These new inteins represent a unique dataset: they are found in homologous proteins that form a paralogous group. Although these paralogues diverged early in eukaryotic evolution, their sequences can be aligned over most of their length. The inteins are inserted at multiple distinct sites, each of which corresponds to a highly conserved region of RNA polymerase. This dataset supports earlier work suggesting that inteins preferentially occur in highly conserved regions of their host proteins. Conclusion The identification of these new inteins

  19. [Characterization of 5S rRNA gene sequence and secondary structure in gymnosperms].

    Science.gov (United States)

    Liu, Zhan-Lin; Zhang, Da-Ming; Wang, Xiao-Ru

    2003-01-01

    In higher plants the primary and the secondary structures of 5S ribosomal RNA gene are considered highly conservative. Little is known about the 5S rRNA gene structure, organization and variation in gyimnosperms. In this study we analyzed sequence and structure variation of 5S rRNA gene in Pinus through cloning and sequencing multiple copies of 5S rDNA repeats from individual trees of five pines, P. bungeana, P. tabulaeformis, P. yunnanensis, P. massoniana and P. densata. Pinus bungeana is from the subgenus Strobus while the other four are from the subgenus Pinus (diploxylon pines). Our results revealed variations in both primary and secondary structure among copies of 5S rDNA within individual genomes and between species. 5S rRNA gene in Pinus is 120 bp long in most of the 122 clones we sequenced except for one or two deletions in three clones. Among these clones 50 unique sequences were identified and they were shared by different pine species. Our sequences were compared to 13 sequences each representing a different gymnosperm species, and to six sequences representing both angiosperm monocots and dicots. Average sequence similarity was 97.1% among Pinus species and 94.3% between Pinus and other gymnosperms. Between gymnosperms and angiosperms the sequence similarity decreased to 88.1%. Similar to other molecular data, significant sequence divergence was found between the two Pinus subgenera. The 5S gene tree (neighbor-joining tree) grouped the four diploxylon pines together and separated them distinctly from P. bungeana. Comparison of sequence divergence within individuals and between species suggested that concerted evolution has been very weak especially after the divergence of the four diploxylon pines. The phylogenetic information contained in the 5S rRNA gene is limited due to its shorter length and the difficulties in identifying orthologous and paralogous copies of rDNA multigene family further complicate its phylogenetic application. Pinus densata is a

  20. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    Science.gov (United States)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  1. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    Science.gov (United States)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  2. Detecting sequence dependent transcriptional pauses from RNA and protein number time series

    Directory of Open Access Journals (Sweden)

    Emmert-Streib Frank

    2012-06-01

    Full Text Available Abstract Background Evidence suggests that in prokaryotes sequence-dependent transcriptional pauses affect the dynamics of transcription and translation, as well as of small genetic circuits. So far, a few pause-prone sequences have been identified from in vitro measurements of transcription elongation kinetics. Results Using a stochastic model of gene expression at the nucleotide and codon levels with realistic parameter values, we investigate three different but related questions and present statistical methods for their analysis. First, we show that information from in vivo RNA and protein temporal numbers is sufficient to discriminate between models with and without a pause site in their coding sequence. Second, we demonstrate that it is possible to separate a large variety of models from each other with pauses of various durations and locations in the template by means of a hierarchical clustering and a random forest classifier. Third, we introduce an approximate likelihood function that allows to estimate the location of a pause site. Conclusions This method can aid in detecting unknown pause-prone sequences from temporal measurements of RNA and protein numbers at a genome-wide scale and thus elucidate possible roles that these sequences play in the dynamics of genetic networks and phenotype.

  3. Detecting sequence dependent transcriptional pauses from RNA and protein number time series.

    Science.gov (United States)

    Emmert-Streib, Frank; Häkkinen, Antti; Ribeiro, Andre S

    2012-06-28

    Evidence suggests that in prokaryotes sequence-dependent transcriptional pauses affect the dynamics of transcription and translation, as well as of small genetic circuits. So far, a few pause-prone sequences have been identified from in vitro measurements of transcription elongation kinetics. Using a stochastic model of gene expression at the nucleotide and codon levels with realistic parameter values, we investigate three different but related questions and present statistical methods for their analysis. First, we show that information from in vivo RNA and protein temporal numbers is sufficient to discriminate between models with and without a pause site in their coding sequence. Second, we demonstrate that it is possible to separate a large variety of models from each other with pauses of various durations and locations in the template by means of a hierarchical clustering and a random forest classifier. Third, we introduce an approximate likelihood function that allows to estimate the location of a pause site. This method can aid in detecting unknown pause-prone sequences from temporal measurements of RNA and protein numbers at a genome-wide scale and thus elucidate possible roles that these sequences play in the dynamics of genetic networks and phenotype.

  4. Evolutionary evidence for alternative structure in RNA sequence co-variation.

    Directory of Open Access Journals (Sweden)

    Justin Ritz

    Full Text Available Sequence conservation and co-variation of base pairs are hallmarks of structured RNAs. For certain RNAs (e.g. riboswitches, a single sequence must adopt at least two alternative secondary structures to effectively regulate the message. If alternative secondary structures are important to the function of an RNA, we expect to observe evolutionary co-variation supporting multiple conformations. We set out to characterize the evolutionary co-variation supporting alternative conformations in riboswitches to determine the extent to which alternative secondary structures are conserved. We found strong co-variation support for the terminator, P1, and anti-terminator stems in the purine riboswitch by extending alignments to include terminator sequences. When we performed Boltzmann suboptimal sampling on purine riboswitch sequences with terminators we found that these sequences appear to have evolved to favor specific alternative conformations. We extended our analysis of co-variation to classic alignments of group I/II introns, tRNA, and other classes of riboswitches. In a majority of these RNAs, we found evolutionary evidence for alternative conformations that are compatible with the Boltzmann suboptimal ensemble. Our analyses suggest that alternative conformations are selected for and thus likely play functional roles in even the most structured of RNAs.

  5. GeneTack database: genes with frameshifts in prokaryotic genomes and eukaryotic mRNA sequences.

    Science.gov (United States)

    Antonov, Ivan; Baranov, Pavel; Borodovsky, Mark

    2013-01-01

    Database annotations of prokaryotic genomes and eukaryotic mRNA sequences pay relatively low attention to frame transitions that disrupt protein-coding genes. Frame transitions (frameshifts) could be caused by sequencing errors or indel mutations inside protein-coding regions. Other observed frameshifts are related to recoding events (that evolved to control expression of some genes). Earlier, we have developed an algorithm and software program GeneTack for ab initio frameshift finding in intronless genes. Here, we describe a database (freely available at http://topaz.gatech.edu/GeneTack/db.html) containing genes with frameshifts (fs-genes) predicted by GeneTack. The database includes 206 991 fs-genes from 1106 complete prokaryotic genomes and 45 295 frameshifts predicted in mRNA sequences from 100 eukaryotic genomes. The whole set of fs-genes was grouped into clusters based on sequence similarity between fs-proteins (conceptually translated fs-genes), conservation of the frameshift position and frameshift direction (-1, +1). The fs-genes can be retrieved by similarity search to a given query sequence via a web interface, by fs-gene cluster browsing, etc. Clusters of fs-genes are characterized with respect to their likely origin, such as pseudogenization, phase variation, etc. The largest clusters contain fs-genes with programed frameshifts (related to recoding events).

  6. Inhibition of hepatitis B virus replication with linear DNA sequences expressing antiviral micro-RNA shuttles

    Energy Technology Data Exchange (ETDEWEB)

    Chattopadhyay, Saket; Ely, Abdullah; Bloom, Kristie; Weinberg, Marc S. [Antiviral Gene Therapy Research Unit, University of the Witwatersrand (South Africa); Arbuthnot, Patrick, E-mail: Patrick.Arbuthnot@wits.ac.za [Antiviral Gene Therapy Research Unit, University of the Witwatersrand (South Africa)

    2009-11-20

    RNA interference (RNAi) may be harnessed to inhibit viral gene expression and this approach is being developed to counter chronic infection with hepatitis B virus (HBV). Compared to synthetic RNAi activators, DNA expression cassettes that generate silencing sequences have advantages of sustained efficacy and ease of propagation in plasmid DNA (pDNA). However, the large size of pDNAs and inclusion of sequences conferring antibiotic resistance and immunostimulation limit delivery efficiency and safety. To develop use of alternative DNA templates that may be applied for therapeutic gene silencing, we assessed the usefulness of PCR-generated linear expression cassettes that produce anti-HBV micro-RNA (miR) shuttles. We found that silencing of HBV markers of replication was efficient (>75%) in cell culture and in vivo. miR shuttles were processed to form anti-HBV guide strands and there was no evidence of induction of the interferon response. Modification of terminal sequences to include flanking human adenoviral type-5 inverted terminal repeats was easily achieved and did not compromise silencing efficacy. These linear DNA sequences should have utility in the development of gene silencing applications where modifications of terminal elements with elimination of potentially harmful and non-essential sequences are required.

  7. Reproducible analysis of sequencing-based RNA structure probing data with user-friendly tools

    DEFF Research Database (Denmark)

    Kielpinski, Lukasz Jan; Sidiropoulos, Nikos; Vinther, Jeppe

    2015-01-01

    coordinates and vice versa. The collection is implemented as functions in the R statistical environment and as tools in the Galaxy platform, making them easily accessible for the scientific community. We demonstrate the usefulness of the collection by applying it to the analysis of sequencing-based hydroxyl......, we have made a collection of tools, which allow raw sequencing reads to be converted to normalized probing values using different published strategies. In addition, we also provide tools for visualization of the probing data in the UCSC Genome Browser and for converting RNA coordinates to genomic...

  8. MicroRNA expression signatures of bladder cancer revealed by deep sequencing.

    Directory of Open Access Journals (Sweden)

    Yonghua Han

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are a class of small noncoding RNAs that regulate gene expression. They are aberrantly expressed in many types of cancers. In this study, we determined the genome-wide miRNA profiles in bladder urothelial carcinoma by deep sequencing. METHODOLOGY/PRINCIPAL FINDINGS: We detected 656 differentially expressed known human miRNAs and miRNA antisense sequences (miRNA*s in nine bladder urothelial carcinoma patients by deep sequencing. Many miRNAs and miRNA*s were significantly upregulated or downregulated in bladder urothelial carcinoma compared to matched histologically normal urothelium. hsa-miR-96 was the most significantly upregulated miRNA and hsa-miR-490-5p was the most significantly downregulated one. Upregulated miRNAs were more common than downregulated ones. The hsa-miR-183, hsa-miR-200b ∼ 429, hsa-miR-200c ∼ 141 and hsa-miR-17 ∼ 92 clusters were significantly upregulated. The hsa-miR-143 ∼ 145 cluster was significantly downregulated. hsa-miR-182, hsa-miR-183, hsa-miR-200a, hsa-miR-143 and hsa-miR-195 were evaluated by Real-Time qPCR in a total of fifty-one bladder urothelial carcinoma patients. They were aberrantly expressed in bladder urothelial carcinoma compared to matched histologically normal urothelium (p < 0.001 for each miRNA. CONCLUSIONS/SIGNIFICANCE: To date, this is the first study to determine genome-wide miRNA expression patterns in human bladder urothelial carcinoma by deep sequencing. We found that a collection of miRNAs were aberrantly expressed in bladder urothelial carcinoma compared to matched histologically normal urothelium, suggesting that they might play roles as oncogenes or tumor suppressors in the development and/or progression of this cancer. Our data provide novel insights into cancer biology.

  9. A tool kit for quantifying eukaryotic rRNA gene sequences from human microbiome samples.

    Science.gov (United States)

    Dollive, Serena; Peterfreund, Gregory L; Sherrill-Mix, Scott; Bittinger, Kyle; Sinha, Rohini; Hoffmann, Christian; Nabel, Christopher S; Hill, David A; Artis, David; Bachman, Michael A; Custers-Allen, Rebecca; Grunberg, Stephanie; Wu, Gary D; Lewis, James D; Bushman, Frederic D

    2012-07-03

    Eukaryotic microorganisms are important but understudied components of the human microbiome. Here we present a pipeline for analysis of deep sequencing data on single cell eukaryotes. We designed a new 18S rRNA gene-specific PCR primer set and compared a published rRNA gene internal transcribed spacer (ITS) gene primer set. Amplicons were tested against 24 specimens from defined eukaryotes and eight well-characterized human stool samples. A software pipeline https://sourceforge.net/projects/brocc/ was developed for taxonomic attribution, validated against simulated data, and tested on pyrosequence data. This study provides a well-characterized tool kit for sequence-based enumeration of eukaryotic organisms in human microbiome samples.

  10. Combined small RNA and degradome sequencing reveals complex microRNA regulation of catechin biosynthesis in tea (Camellia sinensis)

    Science.gov (United States)

    Sun, Ping; Cheng, Chunzhen; Lin, Yuling; Zhu, Qiufang; Lin, Jinke

    2017-01-01

    MicroRNAs are endogenous non-coding small RNAs playing crucial regulatory roles in plants. Tea, a globally popular non-alcoholic drink, is rich in health-enhancing catechins. In this study, 69 conserved and 47 novel miRNAs targeting 644 genes were identified by high-throughout sequencing. Predicted target genes of miRNAs were mainly involved in plant growth, signal transduction, morphogenesis and defense. To further identify targets of tea miRNAs, degradome sequencing and RNA ligase-mediated rapid amplification of 5’cDNA ends (RLM-RACE) were applied. Using degradome sequencing, 26 genes mainly involved in transcription factor, resistance protein and signal transduction protein synthesis were identified as potential miRNA targets, with 5 genes subsequently verified. Quantitative real-time PCR (qRT-PCR) revealed that the expression patterns of novel-miR1, novel-miR2, csn-miR160a, csn-miR162a, csn-miR394 and csn-miR396a were negatively correlated with catechin content. The expression of six miRNAs (csn-miRNA167a, csn-miR2593e, csn-miR4380a, csn-miR3444b, csn-miR5251 and csn-miR7777-5p.1) and their target genes involved in catechin biosynthesis were also analyzed by qRT-PCR. Negative and positive correlations were found between these miRNAs and catechin contents, while positive correlations were found between their target genes and catechin content. This result suggests that these miRNAs may negatively regulate catechin biosynthesis by down-regulating their biosynthesis-related target genes. Taken together, our results indicate that miRNAs are crucial regulators in tea, with the results of 5’-RLM-RACE and expression analyses revealing the important role of miRNAs in catechin anabolism. Our findings should facilitate future research to elucidate the function of miRNAs in catechin biosynthesis. PMID:28225779

  11. Analysis of RNA-Dependent RNA Polymerase Sequence of Infectious Flacherie Virus Isolated in China and Its Expression in BmN Cells

    Institute of Scientific and Technical Information of China (English)

    LI Ming-qian; LU Qi-neng; WU Xiao-Feng; MAN Nan-a; CHEN Xiao-xue; JIN Wei; LU Xing-meng

    2009-01-01

    Full gene sequence of RNA-dependent RNA polymerase (RdRp) from Bombyx mori infectious flacherie virus isolated in Zhejiang Province, China (Zhejiang01/CHN/2002) was cloned. The sequence was 1 920 nucleotides in length coding 639 amino acid residues. Sequences comparison of RdRp showed Zhejiang01/CHN/2002 was 99.7% nucleotide sequence and 99.1% amino acids sequence homology with Japanese strain. The RdRp sequence was aligned with 8 representative picorna(-like) viruses and 8 highly conserved regions were detected. The result indicated their relevance function. Phylogenetic tree of 14 picorna(-like) viruses which RdRp presumed protein sequences revealed that the viruses from Iflavirus genus formed an independent clade. The RdRp was successfully expressed in Bran cells using Bac-to-Bac expression system.

  12. Effect of chronic uremia on the transcriptional profile of the calcified aorta analyzed by RNA sequencing

    DEFF Research Database (Denmark)

    Rukov, Jakob Lewin; Gravesen, Eva; Mace, Maria L.

    2016-01-01

    The development of vascular calcification (VC) in chronic uremia (CU) is a tightly regulated process controlled by factors promoting and inhibiting mineralization. Next-generation high-throughput RNA sequencing (RNA-seq) is a powerful and sensitive tool for quantitative gene expression profiling...... and the detection of differentially expressed genes. In the present study, we, for the first time, used RNA-seq to examine rat aorta transcriptomes from CU rats compared with control rats. Severe VC was induced in CU rats, which lead to extensive changes in the transcriptional profile. Among the 10,153 genes...... with an expression level of >1 reads/kilobase transcript/million mapped reads, 2,663 genes were differentially expressed with 47% upregulated genes and 53% downregulated genes in uremic rats. Significantly deregulated genes were enriched for ontologies related to the extracellular matrix, response to wounding...

  13. Identification of selenocyst- eine insertion sequence (SECIS) element in eukaryotic selenoproteins by RNA Draw program

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The computer program RNA Draw was used to identify the secondary structures in the 3′ untranslated re- gions (3′UTRs) of the mRNAs from 46 eukaryotic seleno- proteins among 7 species. The program found one or two possible SECIS elements in these selenoproteins. The SECIS element consists of a stem-loop or hairpin structure with three conserved sequences of AUGA-(A)AA-GA. SECIS element was not found by the RNA Draw program in randomly selected non-selenoproteins. The results showed that SECIS element is the unique character of the genes of eukaryotic selenoproteins. Thus it is possible to use RNA Draw to search the SECIS elements in gene bank for poten- tial new selenoproteins.

  14. DARIO: a ncRNA detection and analysis tool for next-generation sequencing experiments

    Science.gov (United States)

    Fasold, Mario; Langenberger, David; Binder, Hans; Stadler, Peter F.; Hoffmann, Steve

    2011-01-01

    Small non-coding RNAs (ncRNAs) such as microRNAs, snoRNAs and tRNAs are a diverse collection of molecules with several important biological functions. Current methods for high-throughput sequencing for the first time offer the opportunity to investigate the entire ncRNAome in an essentially unbiased way. However, there is a substantial need for methods that allow a convenient analysis of these overwhelmingly large data sets. Here, we present DARIO, a free web service that allows to study short read data from small RNA-seq experiments. It provides a wide range of analysis features, including quality control, read normalization, ncRNA quantification and prediction of putative ncRNA candidates. The DARIO web site can be accessed at http://dario.bioinf.uni-leipzig.de/. PMID:21622957

  15. dsRNA provides sequence-dependent protection against infectious myonecrosis virus in Litopenaeus vannamei.

    Science.gov (United States)

    Loy, J Dustin; Mogler, Mark A; Loy, Duan S; Janke, Bruce; Kamrud, Kurt; Scura, Edward D; Harris, D L Hank; Bartholomay, Lyric C

    2012-04-01

    Viral diseases are significant impediments to the sustainability of shrimp aquaculture. In addition to endemic disease, new viral diseases continue to emerge and cause significant impact on the shrimp industry. Disease caused by infectious myonecrosis virus (IMNV) has caused tremendous losses in farmed Pacific white shrimp (Litopenaeus vannamei) since it emerged in Brazil and translocated to Indonesia. There are no existing antiviral interventions, outside of pathogen exclusion, to mitigate disease in commercial shrimp operations. Here, we describe an iterative process of panning the genome of IMNV to discover RNA interference trigger sequences that initiate a robust and long-lasting protective response against IMNV in L. vannamei. Using this process, a single, low dose (0.02 µg) of an 81 or 153 bp fragment, with sequence corresponding to putative cleavage protein 1 in ORF1, protected 100 % of animals from disease and mortality caused by IMNV. Furthermore, animals that were treated with highly efficacious dsRNA survived an initial infection and were resistant to subsequent infections over 50 days later with a 100-fold greater dose of virus. This protection is probably sequence dependent, because targeting the coding regions for the polymerase or structural genes of IMNV conferred lesser or no protection. Interestingly, non-sequence specific dsRNA did not provide any degree of protection to animals as had been described for other shrimp viruses. Our data indicate that the targeted region for dsRNA is a crucial factor in maximizing the degree of protection and lowering the dose required to induce a protective effect against IMNV infection in shrimp.

  16. Effect of photoperiod on the feline adipose transcriptome as assessed by RNA sequencing

    OpenAIRE

    Mori, Akihiro; Kappen, Kelly L; Dilger, Anna C; Swanson, Kelly S.

    2014-01-01

    Background Photoperiod is known to cause physiological changes in seasonal mammals, including changes in body weight, physical activity, reproductive status, and adipose tissue gene expression in several species. The objective of this study was to determine the effects of day length on the adipose transcriptome of cats as assessed by RNA sequencing. Ten healthy adult neutered male domestic shorthair cats were used in a randomized crossover design study. During two 12-wk periods, cats were exp...

  17. Improvement of sequence selectivity in triple helical recognition of RNA by phenylalanine-derived PNA

    OpenAIRE

    Zengeya, Thomas; Gindin, Artem; Rozners, Eriks

    2013-01-01

    Modified peptide nucleic acids (PNA) containing one or two thymine PNA monomers derived from phenylalanine were synthesized. Triple helix formation by these modified PNAs with RNA and DNA hairpins having a variable base pair in the middle of the helix were studied using isothermal titration calorimetry and compared with triple helix formation by non-modified PNAs. While unmodified PNA had low sequence selectivity against mismatched hairpins, introduction of one or two phenylalanine-derived mo...

  18. Next-generation sequencing of the porcine skeletal muscle transcriptome for computational prediction of microRNA gene targets.

    Directory of Open Access Journals (Sweden)

    Tara G McDaneld

    Full Text Available BACKGROUND: MicroRNA are a class of small RNAs that regulate gene expression by inhibiting translation of protein encoding transcripts through targeting of a microRNA-protein complex by base-pairing of the microRNA sequence to cognate recognition sequences in the 3' untranslated region (UTR of the mRNA. Target identification for a given microRNA sequence is generally accomplished by informatics analysis of predicted mRNA sequences present in the genome or in databases of transcript sequence for the tissue of interest. However, gene models for porcine skeletal muscle transcripts in current databases, specifically complete sequence of the 3' UTR, are inadequate for this exercise. METHODOLOGY/PRINCIPAL FINDINGS: To provide data necessary to identify gene targets for microRNA in porcine skeletal muscle, normalized cDNA libraries were sequenced using Roche 454 GS-FLX pyrosequencing and de novo assembly of transcripts enriched in the 3' UTR was performed using the MIRA sequence assembly program. Over 725 million bases of sequence were generated, which assembled into 18,202 contigs. Sequence reads were mapped to a 3' UTR database containing porcine sequences. The 3' UTR that mapped to the database were examined to predict targets for previously identified microRNA that had been separately sequenced from the same porcine muscle sample used to generate the cDNA libraries. For genes with microRNA-targeted 3' UTR, KEGG pathways were computationally determined in order to identify potential functional effects of these microRNA-targeted transcripts. CONCLUSIONS: Through next-generation sequencing of transcripts expressed in skeletal muscle, mapping reads to a 3' UTR database, and prediction of microRNA target sites in the 3' UTR, our results identified genes expressed in porcine skeletal muscle and predicted the microRNA that target these genes. Additionally, identification of pathways regulated by these microRNA-targeted genes provides us with a set of

  19. Long-range Transcriptome Sequencing Reveals Cancer Cell Growth Regulatory Chimeric mRNA

    Directory of Open Access Journals (Sweden)

    Roberto Plebani

    2012-11-01

    Full Text Available mRNA chimeras from chromosomal translocations often play a role as transforming oncogenes. However, cancer transcriptomes also contain mRNA chimeras that may play a role in tumor development, which arise as transcriptional or post-transcriptional events. To identify such chimeras, we developed a deterministic screening strategy for long-range sequence analysis. High-throughput, long-read sequencing was then performed on cDNA libraries from major tumor histotypes and corresponding normal tissues. These analyses led to the identification of 378 chimeras, with an unexpectedly high frequency of expression (≈2 x 10-5 of all mRNA. Functional assays in breast and ovarian cancer cell lines showed that a large fraction of mRNA chimeras regulates cell replication. Strikingly, chimeras were shown to include both positive and negative regulators of cell growth, which functioned as such in a cell-type-specific manner. Replication-controlling chimeras were found to be expressed by most cancers from breast, ovary, colon, uterus, kidney, lung, and stomach, suggesting a widespread role in tumor development.

  20. RNA-Mediated Gene Duplication and Retroposons: Retrogenes, LINEs, SINEs, and Sequence Specificity

    Science.gov (United States)

    2013-01-01

    A substantial number of “retrogenes” that are derived from the mRNA of various intron-containing genes have been reported. A class of mammalian retroposons, long interspersed element-1 (LINE1, L1), has been shown to be involved in the reverse transcription of retrogenes (or processed pseudogenes) and non-autonomous short interspersed elements (SINEs). The 3′-end sequences of various SINEs originated from a corresponding LINE. As the 3′-untranslated regions of several LINEs are essential for retroposition, these LINEs presumably require “stringent” recognition of the 3′-end sequence of the RNA template. However, the 3′-ends of mammalian L1s do not exhibit any similarity to SINEs, except for the presence of 3′-poly(A) repeats. Since the 3′-poly(A) repeats of L1 and Alu SINE are critical for their retroposition, L1 probably recognizes the poly(A) repeats, thereby mobilizing not only Alu SINE but also cytosolic mRNA. Many flowering plants only harbor L1-clade LINEs and a significant number of SINEs with poly(A) repeats, but no homology to the LINEs. Moreover, processed pseudogenes have also been found in flowering plants. I propose that the ancestral L1-clade LINE in the common ancestor of green plants may have recognized a specific RNA template, with stringent recognition then becoming relaxed during the course of plant evolution. PMID:23984183

  1. RNA-Mediated Gene Duplication and Retroposons: Retrogenes, LINEs, SINEs, and Sequence Specificity

    Directory of Open Access Journals (Sweden)

    Kazuhiko Ohshima

    2013-01-01

    Full Text Available A substantial number of “retrogenes” that are derived from the mRNA of various intron-containing genes have been reported. A class of mammalian retroposons, long interspersed element-1 (LINE1, L1, has been shown to be involved in the reverse transcription of retrogenes (or processed pseudogenes and non-autonomous short interspersed elements (SINEs. The -end sequences of various SINEs originated from a corresponding LINE. As the -untranslated regions of several LINEs are essential for retroposition, these LINEs presumably require “stringent” recognition of the -end sequence of the RNA template. However, the -ends of mammalian L1s do not exhibit any similarity to SINEs, except for the presence of -poly(A repeats. Since the -poly(A repeats of L1 and Alu SINE are critical for their retroposition, L1 probably recognizes the poly(A repeats, thereby mobilizing not only Alu SINE but also cytosolic mRNA. Many flowering plants only harbor L1-clade LINEs and a significant number of SINEs with poly(A repeats, but no homology to the LINEs. Moreover, processed pseudogenes have also been found in flowering plants. I propose that the ancestral L1-clade LINE in the common ancestor of green plants may have recognized a specific RNA template, with stringent recognition then becoming relaxed during the course of plant evolution.

  2. The four ingredients of single-sequence RNA secondary structure prediction. A unifying perspective.

    Science.gov (United States)

    Rivas, Elena

    2013-07-01

    Any method for RNA secondary structure prediction is determined by four ingredients. The architecture is the choice of features implemented by the model (such as stacked basepairs, loop length distributions, etc.). The architecture determines the number of parameters in the model. The scoring scheme is the nature of those parameters (whether thermodynamic, probabilistic, or weights). The parameterization stands for the specific values assigned to the parameters. These three ingredients are referred to as "the model." The fourth ingredient is the folding algorithms used to predict plausible secondary structures given the model and the sequence of a structural RNA. Here, I make several unifying observations drawn from looking at more than 40 years of methods for RNA secondary structure prediction in the light of this classification. As a final observation, there seems to be a performance ceiling that affects all methods with complex architectures, a ceiling that impacts all scoring schemes with remarkable similarity. This suggests that modeling RNA secondary structure by using intrinsic sequence-based plausible "foldability" will require the incorporation of other forms of information in order to constrain the folding space and to improve prediction accuracy. This could give an advantage to probabilistic scoring systems since a probabilistic framework is a natural platform to incorporate different sources of information into one single inference problem.

  3. Exploration of sequence space as the basis of viral RNA genome segmentation.

    Science.gov (United States)

    Moreno, Elena; Ojosnegros, Samuel; García-Arriaza, Juan; Escarmís, Cristina; Domingo, Esteban; Perales, Celia

    2014-05-06

    The mechanisms of viral RNA genome segmentation are unknown. On extensive passage of foot-and-mouth disease virus in baby hamster kidney-21 cells, the virus accumulated multiple point mutations and underwent a transition akin to genome segmentation. The standard single RNA genome molecule was replaced by genomes harboring internal in-frame deletions affecting the L- or capsid-coding region. These genomes were infectious and killed cells by complementation. Here we show that the point mutations in the nonstructural protein-coding region (P2, P3) that accumulated in the standard genome before segmentation increased the relative fitness of the segmented version relative to the standard genome. Fitness increase was documented by intracellular expression of virus-coded proteins and infectious progeny production by RNAs with the internal deletions placed in the sequence context of the parental and evolved genome. The complementation activity involved several viral proteins, one of them being the leader proteinase L. Thus, a history of genetic drift with accumulation of point mutations was needed to allow a major variation in the structure of a viral genome. Thus, exploration of sequence space by a viral genome (in this case an unsegmented RNA) can reach a point of the space in which a totally different genome structure (in this case, a segmented RNA) is favored over the form that performed the exploration.

  4. Deep sequencing reveals a global reprogramming of lncRNA transcriptome during EMT.

    Science.gov (United States)

    Liao, Jian-You; Wu, Jue; Wang, Yan-Jie; He, Jie-Hua; Deng, Wei-Xi; Hu, KaiShun; Zhang, Yu-Chan; Zhang, Yin; Yan, Haiyan; Wang, Dan-Lan; Liu, Qiang; Zeng, Mu-Sheng; Phillip Koeffler, H; Song, Erwei; Yin, Dong

    2017-10-01

    Several studies have shown that long non-coding RNAs (lncRNAs) may play an essential role in Epithelial-Mesenchymal Transition (EMT), which is an important step in tumor metastasis; however, little is known about the global change of lncRNA transcriptome during EMT. To investigate how lncRNA transcriptome alterations contribute to EMT progression regulation, we deep-sequenced the whole-transcriptome of MCF10A as the cells underwent TGF-β-induced EMT. Deep-sequencing results showed that the long RNA transcriptome of MCF10A had undergone global changes as early as 8h after treatment with TGF-β. The expression of 3403 known and novel lncRNAs, and 570 known and novel circRNAs were altered during EMT. To identify the key lncRNA-regulator, we constructed the co-expression network and found all junction nodes in the network are lncRNAs. One junction node, RP6-65G23.5, was further verified as a key regulator of EMT. Intriguingly, we identified 216 clusters containing lncRNAs which were located in "gene desert" regions. The expressions of all lncRNAs in these clusters changed concurrently during EMT, strongly suggesting that these clusters might play important roles in EMT. Our study reveals a global reprogramming of lncRNAs transcriptome during EMT and provides clues for the future study of the molecular mechanism of EMT. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Profiling single-guide RNA specificity reveals a mismatch sensitive core sequence

    Science.gov (United States)

    Zheng, Ting; Hou, Yingzi; Zhang, Pingjing; Zhang, Zhenxi; Xu, Ying; Zhang, Letian; Niu, Leilei; Yang, Yi; Liang, Da; Yi, Fan; Peng, Wei; Feng, Wenjian; Yang, Ying; Chen, Jianxin; Zhu, York Yuanyuan; Zhang, Li-He; Du, Quan

    2017-01-01

    Targeting specificity is an essential issue in the development of CRISPR-Cas technology. Using a luciferase activation assay, off-target cleavage activity of sgRNA was systematically investigated on single nucleotide-mismatched targets. In addition to confirming that PAM-proximal mismatches are less tolerated than PAM-distal mismatches, our study further identified a “core” sequence that is highly sensitive to target-mismatch. This sequence is of 4-nucleotide long, located at +4 to +7 position upstream of PAM, and positioned in a steric restriction region when assembled into Cas9 endonuclease. Our study also found that, single or multiple target mismatches at this region abolished off-target cleavage mediated by active sgRNAs, thus proposing a principle for gene-specific sgRNA design. Characterization of a mismatch sensitive “core” sequence not only enhances our understanding of how this elegant system functions, but also facilitates our efforts to improve targeting specificity of a sgRNA. PMID:28098181

  6. Beyond secondary structure: primary-sequence determinants license pri-miRNA hairpins for processing.

    Science.gov (United States)

    Auyeung, Vincent C; Ulitsky, Igor; McGeary, Sean E; Bartel, David P

    2013-02-14

    To use microRNAs to downregulate mRNA targets, cells must first process these ~22 nt RNAs from primary transcripts (pri-miRNAs). These transcripts form RNA hairpins important for processing, but additional determinants must distinguish pri-miRNAs from the many other hairpin-containing transcripts expressed in each cell. Illustrating the complexity of this recognition, we show that most Caenorhabditis elegans pri-miRNAs lack determinants required for processing in human cells. To find these determinants, we generated many variants of four human pri-miRNAs, sequenced millions that retained function, and compared them with the starting variants. Our results confirmed the importance of pairing in the stem and revealed three primary-sequence determinants, including an SRp20-binding motif (CNNC) found downstream of most pri-miRNA hairpins in bilaterian animals, but not in nematodes. Adding this and other determinants to C. elegans pri-miRNAs imparted efficient processing in human cells, thereby confirming the importance of primary-sequence determinants for distinguishing pri-miRNAs from other hairpin-containing transcripts.

  7. Direct RNA motif definition and identification from multiple sequence alignments using secondary structure profiles.

    Science.gov (United States)

    Gautheret, D; Lambert, A

    2001-11-09

    We present here a new approach to the problem of defining RNA signatures and finding their occurrences in sequence databases. The proposed method is based on "secondary structure profiles". An RNA sequence alignment with secondary structure information is used as an input. Two types of weight matrices/profiles are constructed from this alignment: single strands are represented by a classical lod-scores profile while helical regions are represented by an extended "helical profile" comprising 16 lod-scores per position, one for each of the 16 possible base-pairs. Database searches are then conducted using a simultaneous search for helical profiles and dynamic programming alignment of single strand profiles. The algorithm has been implemented into a new software, ERPIN, that performs both profile construction and database search. Applications are presented for several RNA motifs. The automated use of sequence information in both single-stranded and helical regions yields better sensitivity/specificity ratios than descriptor-based programs. Furthermore, since the translation of alignments into profiles is straightforward with ERPIN, iterative searches can easily be conducted to enrich collections of homologous RNAs. Copyright 2001 Academic Press.

  8. CoverageAnalyzer (CAn: A Tool for Inspection of Modification Signatures in RNA Sequencing Profiles

    Directory of Open Access Journals (Sweden)

    Ralf Hauenschild

    2016-11-01

    Full Text Available Combination of reverse transcription (RT and deep sequencing has emerged as a powerful instrument for the detection of RNA modifications, a field that has seen a recent surge in activity because of its importance in gene regulation. Recent studies yielded high-resolution RT signatures of modified ribonucleotides relying on both sequence-dependent mismatch patterns and reverse transcription arrests. Common alignment viewers lack specialized functionality, such as filtering, tailored visualization, image export and differential analysis. Consequently, the community will profit from a platform seamlessly connecting detailed visual inspection of RT signatures and automated screening for modification candidates. CoverageAnalyzer (CAn was developed in response to the demand for a powerful inspection tool. It is freely available for all three main operating systems. With SAM file format as standard input, CAn is an intuitive and user-friendly tool that is generally applicable to the large community of biomedical users, starting from simple visualization of RNA sequencing (RNA-Seq data, up to sophisticated modification analysis with significance-based modification candidate calling.

  9. The sweet side of RNA regulation: glyceraldehyde-3-phosphate dehydrogenase as a noncanonical RNA-binding protein.

    Science.gov (United States)

    White, Michael R; Garcin, Elsa D

    2016-01-01

    The glycolytic protein, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), has a vast array of extraglycolytic cellular functions, including interactions with nucleic acids. GAPDH has been implicated in the translocation of transfer RNA (tRNA), the regulation of cellular messenger RNA (mRNA) stability and translation, as well as the regulation of replication and gene expression of many single-stranded RNA viruses. A growing body of evidence supports GAPDH-RNA interactions serving as part of a larger coordination between intermediary metabolism and RNA biogenesis. Despite the established role of GAPDH in nucleic acid regulation, it is still unclear how and where GAPDH binds to its RNA targets, highlighted by the absence of any conserved RNA-binding sequences. This review will summarize our current understanding of GAPDH-mediated regulation of RNA function. WIREs RNA 2016, 7:53-70. doi: 10.1002/wrna.1315 For further resources related to this article, please visit the WIREs website.

  10. Systematic Analysis of Small RNAs Associated with Human Mitochondria by Deep Sequencing: Detailed Analysis of Mitochondrial Associated miRNA

    Science.gov (United States)

    Sripada, Lakshmi; Tomar, Dhanendra; Prajapati, Paresh; Singh, Rochika; Singh, Arun Kumar; Singh, Rajesh

    2012-01-01

    Mitochondria are one of the central regulators of many cellular processes beyond its well established role in energy metabolism. The inter-organellar crosstalk is critical for the optimal function of mitochondria. Many nuclear encoded proteins and RNA are imported to mitochondria. The translocation of small RNA (sRNA) including miRNA to mitochondria and other sub-cellular organelle is still not clear. We characterized here sRNA including miRNA associated with human mitochondria by cellular fractionation and deep sequencing approach. Mitochondria were purified from HEK293 and HeLa cells for RNA isolation. The sRNA library was generated and sequenced using Illumina system. The analysis showed the presence of unique population of sRNA associated with mitochondria including miRNA. Putative novel miRNAs were characterized from unannotated sRNA sequences. The study showed the association of 428 known, 196 putative novel miRNAs to mitochondria of HEK293 and 327 known, 13 putative novel miRNAs to mitochondria of HeLa cells. The alignment of sRNA to mitochondrial genome was also studied. The targets were analyzed using DAVID to classify them in unique networks using GO and KEGG tools. Analysis of identified targets showed that miRNA associated with mitochondria regulates critical cellular processes like RNA turnover, apoptosis, cell cycle and nucleotide metabolism. The six miRNAs (counts >1000) associated with mitochondria of both HEK293 and HeLa were validated by RT-qPCR. To our knowledge, this is the first systematic study demonstrating the associations of sRNA including miRNA with mitochondria that may regulate site-specific turnover of target mRNA important for mitochondrial related functions. PMID:22984580

  11. Multiplex analysis of polyA-linked sequences (MAPS): an RNA-seq strategy to profile poly(A+) RNA.

    Science.gov (United States)

    Zhou, Yu; Li, Hai-Ri; Huang, Jie; Jin, Ge; Fu, Xiang-Dong

    2014-01-01

    We summarize 12 experimental methods that have been developed for profiling gene expression by focusing on the 3'-end of poly(A+) mRNA, distilling both common and unique features. Of this family of methods, we provide detailed protocol for MAPS, a method we believe is the simplest and most cost-effective for profiling gene expression and quantifying alternative polyadenylation events by oligo-dT priming followed by random priming and deep sequencing. This method also enables library multiplexing by using a set of bar coding primers during PCR amplification. We also provide a general guideline for analysis of the data generated by MAPS by using the software package maps3end.

  12. Identification and analysis of pig chimeric mRNAs using RNA sequencing data

    Directory of Open Access Journals (Sweden)

    Ma Lei

    2012-08-01

    Full Text Available Abstract Background Gene fusion is ubiquitous over the course of evolution. It is expected to increase the diversity and complexity of transcriptomes and proteomes through chimeric sequence segments or altered regulation. However, chimeric mRNAs in pigs remain unclear. Here we identified some chimeric mRNAs in pigs and analyzed the expression of them across individuals and breeds using RNA-sequencing data. Results The present study identified 669 putative chimeric mRNAs in pigs, of which 251 chimeric candidates were detected in a set of RNA-sequencing data. The 618 candidates had clear trans-splicing sites, 537 of which obeyed the canonical GU-AG splice rule. Only two putative pig chimera variants whose fusion junction was overlapped with that of a known human chimeric mRNA were found. A set of unique chimeric events were considered middle variances in the expression across individuals and breeds, and revealed non-significant variance between sexes. Furthermore, the genomic region of the 5′ partner gene shares a similar DNA sequence with that of the 3′ partner gene for 458 putative chimeric mRNAs. The 81 of those shared DNA sequences significantly matched the known DNA-binding motifs in the JASPAR CORE database. Four DNA motifs shared in parental genomic regions had significant similarity with known human CTCF binding sites. Conclusions The present study provided detailed information on some pig chimeric mRNAs. We proposed a model that trans-acting factors, such as CTCF, induced the spatial organisation of parental genes to the same transcriptional factory so that parental genes were coordinatively transcribed to give birth to chimeric mRNAs.

  13. Dataset of the transcribed 45S ribosomal RNA sequence of the tree crop “yerba mate”

    Directory of Open Access Journals (Sweden)

    Patricia M. Aguilera

    2017-06-01

    Full Text Available This contribution contains data related to the research article entitled “The 18S-25S ribosomal RNA unit of yerba mate (Ilex paraguariensis A. St.-Hil.” (Aguilera et al., 2016 [1]. Through a bioinformatic approach involving NGS data, we provide information of the transcribed 45S ribosomal RNA (rRNA sequence of yerba mate, the first reference for the Ilex L. genus. This dataset (Supplementary file 1 comprises information regarding the assembly and annotation of this rRNA unit. The generated data is applicable for comparative analysis and evolutionary studies among Ilex and related taxa. The raw sequencing data used here is available at DDBJ/EMBL/GenBank (NCBI Resource Coordinators, 2016 [2] Sequence Read Archive (SRA under the accession SRP043293 and the consensus 45S ribosomal RNA sequence has been deposited there under the accession GFHV00000000.

  14. Close association between paralogous multiple isomiRs and paralogous/orthologues miRNA sequences implicates dominant sequence selection across various animal species.

    Science.gov (United States)

    Guo, Li; Zhao, Yang; Zhang, Hui; Yang, Sheng; Chen, Feng

    2013-09-25

    MicroRNAs (miRNAs) are crucial negative regulators of gene expression at the post-transcriptional level. Next-generation sequencing technologies have identified a series of miRNA variants (named isomiRs). In this study, paralogous isomiR assemblies (from the miRNA locus) were systematically analyzed based on data acquired from deep sequencing data sets. Evolutionary analysis of paralogous (members in miRNA gene family in a specific species) and orthologues (across different animal species) miRNAs was also performed. The sequence diversity of paralogous isomiRs was found to be similar to the diversity of paralogous and orthologues miRNAs. Additionally, both isomiRs and paralogous/orthologues miRNAs were implicated in 5' and 3' ends (especially 3' ends), nucleotide substitutions, and insertions and deletions. Generally, multiple isomiRs can be produced from a single miRNA locus, but most of them had lower enrichment levels, and only several dominant isomiR sequences were detected. These dominant isomiR groups were always stable, and one of them would be selected as the most abundant miRNA sequence in specific animal species. Some isomiRs might be consistent to miRNA sequences in some species but not the other. Homologous miRNAs were often detected in similar isomiR repertoires, and showed similar expression patterns, while dominant isomiRs showed complex evolutionary patterns from miRNA sequences across the animal kingdom. These results indicate that the phenomenon of multiple isomiRs is not a random event, but rather the result of evolutionary pressures. The existence of multiple isomiRs enables different species to express advantageous sequences in different environments. Thus, dominant sequences emerge in response to functional and evolutionary pressures, allowing an organism to adapt to complex intra- and extra-cellular events. © 2013.

  15. Differential microRNA expression between shoots and rhizomes in Oryza longistaminata using high-throughput RNA sequencing

    Institute of Scientific and Technical Information of China (English)

    Ying; Zong; Liyu; Huang; Ting; Zhang; Qiao; Qin; Wensheng; Wang; Xiuqin; Zhao; Fengyi; Hu; Binying; Fu; Zhikang; Li

    2014-01-01

    Plant microRNAs(miRNAs)play important roles in biological processes such as development and stress responses.Although the diverse functions of miRNAs in model organisms have been well studied,their function in wild rice is poorly understood.In this study,high-throughput small RNA sequencing was performed to characterize tissue-specific transcriptomes in Oryza longistaminata.A total of 603 miRNAs,380 known rice miRNAs,72 conserved plant miRNAs,and151 predicted novel miRNAs were identified as being expressed in aerial shoots and rhizomes.Additionally,99 and 79 miRNAs were expressed exclusively or differentially,respectively,in the two tissues,and 144 potential targets were predicted for the differentially expressed miRNAs in the rhizomes.Functional annotation of these targets suggested that transcription factors,including squamosa promoter binding proteins and auxin response factors,function in rhizome growth and development.The expression levels of several miRNAs and target genes in the rhizomes were quantified by RT-PCR,and the results indicated the existence of complex regulatory mechanisms between the miRNAs and their targets.Eight target cleavage sites were verified by RNA ligase-mediated rapid 5′end amplification.These results provide valuable information on the composition,expression and function of miRNAs in O.longistaminata,and will aid in understanding the molecular mechanisms of rhizome development.

  16. Deep sequencing analysis of the developing mouse brain reveals a novel microRNA

    Directory of Open Access Journals (Sweden)

    Piltz Sandra

    2011-04-01

    Full Text Available Abstract Background MicroRNAs (miRNAs are small non-coding RNAs that can exert multilevel inhibition/repression at a post-transcriptional or protein synthesis level during disease or development. Characterisation of miRNAs in adult mammalian brains by deep sequencing has been reported previously. However, to date, no small RNA profiling of the developing brain has been undertaken using this method. We have performed deep sequencing and small RNA analysis of a developing (E15.5 mouse brain. Results We identified the expression of 294 known miRNAs in the E15.5 developing mouse brain, which were mostly represented by let-7 family and other brain-specific miRNAs such as miR-9 and miR-124. We also discovered 4 putative 22-23 nt miRNAs: mm_br_e15_1181, mm_br_e15_279920, mm_br_e15_96719 and mm_br_e15_294354 each with a 70-76 nt predicted pre-miRNA. We validated the 4 putative miRNAs and further characterised one of them, mm_br_e15_1181, throughout embryogenesis. Mm_br_e15_1181 biogenesis was Dicer1-dependent and was expressed in E3.5 blastocysts and E7 whole embryos. Embryo-wide expression patterns were observed at E9.5 and E11.5 followed by a near complete loss of expression by E13.5, with expression restricted to a specialised layer of cells within the developing and early postnatal brain. Mm_br_e15_1181 was upregulated during neurodifferentiation of P19 teratocarcinoma cells. This novel miRNA has been identified as miR-3099. Conclusions We have generated and analysed the first deep sequencing dataset of small RNA sequences of the developing mouse brain. The analysis revealed a novel mi