TargetRNA: a tool for predicting targets of small RNA action in bacteria

OpenAIRE

Tjaden, Brian

2008-01-01

Many small RNA (sRNA) genes in bacteria act as posttranscriptional regulators of target messenger RNAs. Here, we present TargetRNA, a web tool for predicting mRNA targets of sRNA action in bacteria. TargetRNA takes as input a genomic sequence that may correspond to an sRNA gene. TargetRNA then uses a dynamic programming algorithm to search each annotated message in a specified genome for mRNAs that evince basepair-binding potential to the input sRNA sequence. Based on the calculated basepair-...

Processivity and coupling in messenger RNA transcription.

Directory of Open Access Journals (Sweden)

Stuart Aitken

2010-01-01

Full Text Available The complexity of messenger RNA processing is now being uncovered by experimental techniques that are capable of detecting individual copies of mRNA in cells, and by quantitative real-time observations that reveal the kinetics. This processing is commonly modelled by permitting mRNA to be transcribed only when the promoter is in the on state. In this simple on/off model, the many processes involved in active transcription are represented by a single reaction. These processes include elongation, which has a minimum time for completion and processing that is not captured in the model.In this paper, we explore the impact on the mRNA distribution of representing the elongation process in more detail. Consideration of the mechanisms of elongation leads to two alternative models of the coupling between the elongating polymerase and the state of the promoter: Processivity allows polymerases to complete elongation irrespective of the promoter state, whereas coupling requires the promoter to be active to produce a full-length transcript. We demonstrate that these alternatives have a significant impact on the predicted distributions. Models are simulated by the Gillespie algorithm, and the third and fourth moments of the resulting distribution are computed in order to characterise the length of the tail, and sharpness of the peak. By this methodology, we show that the moments provide a concise summary of the distribution, showing statistically-significant differences across much of the feasible parameter range.We conclude that processivity is not fully consistent with the on/off model unless the probability of successfully completing elongation is low--as has been observed. The results also suggest that some form of coupling between the promoter and a rate-limiting step in transcription may explain the cell's inability to maintain high mRNA levels at low noise--a prediction of the on/off model that has no supporting evidence.

Expression of μ, κ, and δ opioid receptor messenger RNA in the human CNS: a 33P in situ hybridization study

International Nuclear Information System (INIS)

Peckys, D.; Landwehrmeyer, G.B.

1999-01-01

The existence of at least three opioid receptor types, referred to as μ, κ, and δ, is well established. Complementary DNAs corresponding to the pharmacologically defined μ, κ, and δ opioid receptors have been isolated in various species including man. The expression patterns of opioid receptor transcripts in human brain has not been established with a cellular resolution, in part because of the low apparent abundance of opioid receptor messenger RNAs in human brain. To visualize opioid receptor messenger RNAs we developed a sensitive in situ hybridization histochemistry method using 33 P-labelled RNA probes. In the present study we report the regional and cellular expression of μ, κ, and δ opioid receptor messenger RNAs in selected areas of the human brain. Hybridization of the different opioid receptor probes resulted in distinct labelling patterns. For the μ and κ opioid receptor probes, the most intense regional signals were observed in striatum, thalamus, hypothalamus, cerebral cortex, cerebellum and certain brainstem areas as well as the spinal cord. The most intense signals for the δ opioid receptor probe were found in cerebral cortex. Expression of opioid receptor transcripts was restricted to subpopulations of neurons within most regions studied demonstrating differences in the cellular expression patterns of μ, κ, and δ opioid receptor messenger RNAs in numerous brain regions. The messenger RNA distribution patterns for each opioid receptor corresponded in general to the distribution of opioid receptor binding sites as visualized by receptor autoradiography. However, some mismatches, for instance between μ opioid receptor receptor binding and μ opioid receptor messenger RNA expression in the anterior striatum, were observed. A comparison of the distribution patterns of opioid receptor messenger RNAs in the human brain and that reported for the rat suggests a homologous expression pattern in many regions. However, in the human brain, κ

Altered expression of estrogen receptor-α variant messenger RNAs between adjacent normal breast and breast tumor tissues

International Nuclear Information System (INIS)

Leygue, Etienne; Dotzlaw, Helmut; Watson, Peter H; Murphy, Leigh C

2000-01-01

Using semiquantitative reverse transcription-polymerase chain reaction assays, we investigated the expression of variant messenger RNAs relative to wild-type estrogen receptor (ER)-α messenger RNA in normal breast tissues and their adjacent matched breast tumor tissues. Higher ER variant truncated after sequences encoding exon 2 of the wild-type ER-α (ERC4) messenger RNA and a lower exon 3 deleted ER-α variant (ERD3) messenger RNA relative expression in the tumor compartment were observed in the ER-positive/PR-positive and the ER-positive subsets, respectively. A significantly higher relative expression of exon 5 deleted ER-α varient (ERD5) messenger RNA was observed in tumor components overall. These data demonstrate that changes in the relative expression of ER-α variant messenger RNAs occur between adjacent normal and neoplastic breast tissues. We suggest that these changes might be involved in the mechanisms that underlie breast tumorigenesis. Estrogen receptor (ER)-α and ER-β are believed to mediate the action of estradiol in target tissues. Several ER-α and ER-β variant messenger RNAs have been identified in both normal and neoplastic human tissues. Most of these variants contain a deletion of one or more exons of the wild-type (WT) ER messenger RNAs. The putative proteins that are encoded by these variant messenger RNAs would therefore be missing some functional domains of the WT receptors, and might interfere with WT-ER signaling pathways. The detection of ER-α variants in both normal and neoplastic human breast tissues raised the question of their possible role in breast tumorigenesis. We have previously reported an increased relative expression of exon 5 deleted ER-α variant (ERD5) messenger RNA and of another ER-α variant truncated of all sequences following the exon 2 of the WT ER-α (ERC4) messenger RNA in breast tumor samples versus independent normal breast tissues. In contrast, a decreased relative expression of exon 3 deleted ER

The synthesis of polyadenylated messenger RNA in herpes simplex type I virus infected BHK cells.

Science.gov (United States)

Harris, T J; Wildy, P

1975-09-01

The pattern of polyadenylated messenger RNA (mRNA) synthesis in BHK cell monolayers, infected under defined conditions with herpes simplex type I virus has been investigated by polyacrylamide gel electrophoresis or pulse-labelled RNA isolated by oligo dT-cellulose chromatography. Two classes of mRNA molecules were synthesized in infected cells; these were not detected in uninfected cells. The rate of synthesis of the larger, 18 to 30S RNA class reached a maximum soon after injection and then declined, whereas the rate of synthesis of the 7 to 11 S RNA class did not reach a maximum until much later and did not decline. In the presence of cytosine arabinoside, the rate of mRNA synthesis in infected cells was reduced but the electrophoretic pattern remained the same.

antaRNA: ant colony-based RNA sequence design.

Science.gov (United States)

Kleinkauf, Robert; Mann, Martin; Backofen, Rolf

2015-10-01

RNA sequence design is studied at least as long as the classical folding problem. Although for the latter the functional fold of an RNA molecule is to be found ,: inverse folding tries to identify RNA sequences that fold into a function-specific target structure. In combination with RNA-based biotechnology and synthetic biology ,: reliable RNA sequence design becomes a crucial step to generate novel biochemical components. In this article ,: the computational tool antaRNA is presented. It is capable of compiling RNA sequences for a given structure that comply in addition with an adjustable full range objective GC-content distribution ,: specific sequence constraints and additional fuzzy structure constraints. antaRNA applies ant colony optimization meta-heuristics and its superior performance is shown on a biological datasets. http://www.bioinf.uni-freiburg.de/Software/antaRNA CONTACT: backofen@informatik.uni-freiburg.de Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

Early changes of placenta-derived messenger RNA in maternal plasma – potential value for preeclampsia prediction?

Directory of Open Access Journals (Sweden)

Surugiu Sebastian

2015-12-01

Full Text Available Objective: the pourpose of the study was to determine if there are any differences between placenta derived plasmatic levels of messenger RNA in normal and future preeclamptic pregnancies and if these placental transcripts can predict preeclampsia long before clinical onset

Design of a synthetic luminescent probe from a biomolecule binding domain: selective detection of AU-rich mRNA sequences.

Science.gov (United States)

Raibaut, Laurent; Vasseur, William; Shimberg, Geoffrey D; Saint-Pierre, Christine; Ravanat, Jean-Luc; Michel, Sarah L J; Sénèque, Olivier

2017-02-01

We report the design of a luminescent sensor based upon the zinc finger (ZF) protein TIS11d, that allows for the selective time-resolved detection of the UUAUUUAUU sequence of the 3'-untranslated region of messenger RNA. This sensor is composed of the tandem ZF RNA binding domain of TIS11d functionalized with a luminescent Tb 3+ complex on one of the ZFs and a sensitizing antenna on the other. This work provides the proof of principle that an RNA binding protein can be re-engineered as an RNA sensor and, more generally, that tunable synthetic luminescent probes for biomolecules can be obtained by modifying biomolecule-binding domains.

Characterization of long noncoding RNA and messenger RNA signatures in melanoma tumorigenesis and metastasis.

Directory of Open Access Journals (Sweden)

Siqi Wang

Full Text Available The incidence of melanoma, the most aggressive and life-threatening form of skin cancer, has significantly risen over recent decades. Therefore, it is essential to identify the mechanisms that underlie melanoma tumorigenesis and metastasis and to explore novel and effective melanoma treatment strategies. Accumulating evidence s uggests that aberrantly expressed long noncoding RNAs (lncRNAs have vital functions in multiple cancers. However, lncRNA functions in melanoma tumorigenesis and metastasis remain unclear. In this study, we investigated lncRNA and messenger RNA (mRNA expression profiles in primary melanomas, metastatic melanomas and normal skin samples from the Gene Expression Omnibus database. We used GSE15605 as the training set (n = 74 and GSE7553 as the validation set (n = 58. In three comparisons (primary melanoma versus normal skin, metastatic melanoma versus normal skin, and metastatic melanoma versus primary melanoma, 178, 295 and 48 lncRNAs and 847, 1758, and 295 mRNAs were aberrantly expressed, respectively. We performed Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses to examine the differentially expressed mRNAs, and potential core lncRNAs were predicted by lncRNA-mRNA co-expression networks. Based on our results, 15 lncRNAs and 144 mRNAs were significantly associated with melanoma tumorigenesis and metastasis. A subsequent analysis suggested a critical role for a five-lncRNA signature during melanoma tumorigenesis and metastasis. Low expression of U47924.27 was significantly associated with decreased survival of patients with melanoma. To the best of our knowledge, this study is the first to explore the expression patterns of lncRNAs and mRNAs during melanoma tumorigenesis and metastasis by re-annotating microarray data from the Gene Expression Omnibus (GEO microarray dataset. These findings reveal potential roles for lncRNAs during melanoma tumorigenesis and metastasis and provide a rich candidate

Messenger RNA biomarker signatures for forensic body fluid identification revealed by targeted RNA sequencing.

Science.gov (United States)

Hanson, E; Ingold, S; Haas, C; Ballantyne, J

2018-05-01

The recovery of a DNA profile from the perpetrator or victim in criminal investigations can provide valuable 'source level' information for investigators. However, a DNA profile does not reveal the circumstances by which biological material was transferred. Some contextual information can be obtained by a determination of the tissue or fluid source of origin of the biological material as it is potentially indicative of some behavioral activity on behalf of the individual that resulted in its transfer from the body. Here, we sought to improve upon established RNA based methods for body fluid identification by developing a targeted multiplexed next generation mRNA sequencing assay comprising a panel of approximately equal sized gene amplicons. The multiplexed biomarker panel includes several highly specific gene targets with the necessary specificity to definitively identify most forensically relevant biological fluids and tissues (blood, semen, saliva, vaginal secretions, menstrual blood and skin). In developing the biomarker panel we evaluated 66 gene targets, with a progressive iteration of testing target combinations that exhibited optimal sensitivity and specificity using a training set of forensically relevant body fluid samples. The current assay comprises 33 targets: 6 blood, 6 semen, 6 saliva, 4 vaginal secretions, 5 menstrual blood and 6 skin markers. We demonstrate the sensitivity and specificity of the assay and the ability to identify body fluids in single source and admixed stains. A 16 sample blind test was carried out by one lab with samples provided by the other participating lab. The blinded lab correctly identified the body fluids present in 15 of the samples with the major component identified in the 16th. Various classification methods are being investigated to permit inference of the body fluid/tissue in dried physiological stains. These include the percentage of reads in a sample that are due to each of the 6 tissues/body fluids tested and

Expression of somatotropin receptor messenger ribonucleic acid in bovine tissues

International Nuclear Information System (INIS)

Lucy, M.C.; Boyd, C.K.; Koenigsfeld, A.T.; Okamura, C.S.

1998-01-01

The somatotropin receptor mRNA is controlled by at least two different gene promoters that generate 2 two variants with different exon 1 sequences (1A and 1B). The location of 1A and 1B somatotropin receptor mRNA within cattle tissues and, hence, the tissue specificity of the 1A and 1B promoters are unknown. In addition, the cDNA sequence of the 1B somatotropin receptor has not been determined. Our objective, therefore, was to sequence a cDNA for the 1B somatotropin receptor and to analyze bovine tissues for expression of 1A and 1B somatotropin receptor mRNA. Twenty adult tissues and six fetal tissues were collected at slaughter from each of four cows and two fetuses. Messenger RNA was analyzed using ribonuclease protection assays. The adult liver expressed both 1A and 1B mRNA. All other adult tissues expressed 1B mRNA but not 1A mRNA. The greatest amount of 1B mRNA was detected in liver and adipose (abdominal and subcutaneous) tissues. Other tissues had approximately one-half to one-tenth of the amount of 1B mRNA in the liver or adipose tissue. Fetal tissues (including fetal liver) expressed 1B mRNA and not 1A mRNA. Based on cDNA sequencing, the protein encoded by the 1A and 1B mRNA was nearly identical. We concluded that 1A somatotropin receptor mRNA is specific to adult bovine liver. Other adult and fetal bovine tissues expressed 1B somatotropin receptor mRNA with a predicted protein sequence that was similar to the 1A somatotropin receptor

Direct, rapid RNA sequence analysis

International Nuclear Information System (INIS)

Peattie, D.A.

1987-01-01

The original methods of RNA sequence analysis were based on enzymatic production and chromatographic separation of overlapping oligonucleotide fragments from within an RNA molecule followed by identification of the mononucleotides comprising the oligomer. Over the past decade the field of nucleic acid sequencing has changed dramatically, however, and RNA molecules now can be sequenced in a variety of more streamlined fashions. Most of the more recent advances in RNA sequencing have involved one-dimensional electrophoretic separation of 32 P-end-labeled oligoribonucleotides on polyacrylamide gels. In this chapter the author discusses two of these methods for determining the nucleotide sequences of RNA molecules rapidly: the chemical method and the enzymatic method. Both methods are direct and degradative, i.e., they rely on fragmatic and chemical approaches should be utilized. The single-strand-specific ribonucleases (A, T 1 , T 2 , and S 1 ) provide an efficient means to locate double-helical regions rapidly, and the chemical reactions provide a means to determine the RNA sequence within these regions. In addition, the chemical reactions allow one to assign interactions to specific atoms and to distinguish secondary interactions from tertiary ones. If the RNA molecule is small enough to be sequenced directly by the enzymatic or chemical method, the probing reactions can be done easily at the same time as sequencing reactions

The microRNA and messengerRNA profile of the RNA-induced silencing complex in human primary astrocyte and astrocytoma cells.

Science.gov (United States)

Moser, Joanna J; Fritzler, Marvin J

2010-10-18

GW/P bodies are cytoplasmic ribonucleoprotein-rich foci involved in microRNA (miRNA)-mediated messenger RNA (mRNA) silencing and degradation. The mRNA regulatory functions within GW/P bodies are mediated by GW182 and its binding partner hAgo2 that bind miRNA in the RNA-induced silencing complex (RISC). To date there are no published reports of the profile of miRNA and mRNA targeted to the RISC or a comparison of the RISC-specific miRNA/mRNA profile differences in malignant and non-malignant cells. RISC mRNA and miRNA components were profiled by microarray analysis of malignant human U-87 astrocytoma cells and its non-malignant counterpart, primary human astrocytes. Total cell RNA as well as RNA from immunoprecipitated RISC was analyzed. The novel findings were fourfold: (1) miRNAs were highly enriched in astrocyte RISC compared to U-87 astrocytoma RISC, (2) astrocytoma and primary astrocyte cells each contained unique RISC miRNA profiles as compared to their respective cellular miRNA profiles, (3) miR-195, 10b, 29b, 19b, 34a and 455-3p levels were increased and the miR-181b level was decreased in U-87 astrocytoma RISC as compared to astrocyte RISC, and (4) the RISC contained decreased levels of mRNAs in primary astrocyte and U-87 astrocytoma cells. The observation that miR-34a and miR-195 levels were increased in the RISC of U-87 astrocytoma cells suggests an oncogenic role for these miRNAs. Differential regulation of mRNAs by specific miRNAs is evidenced by the observation that three miR34a-targeted mRNAs and two miR-195-targeted mRNAs were downregulated while one miR-195-targeted mRNA was upregulated. Biological pathway analysis of RISC mRNA components suggests that the RISC plays a pivotal role in malignancy and other conditions. This study points to the importance of the RISC and ultimately GW/P body composition and function in miRNA and mRNA deregulation in astrocytoma cells and possibly in other malignancies.

The microRNA and messengerRNA profile of the RNA-induced silencing complex in human primary astrocyte and astrocytoma cells.

Directory of Open Access Journals (Sweden)

Joanna J Moser

2010-10-01

Full Text Available GW/P bodies are cytoplasmic ribonucleoprotein-rich foci involved in microRNA (miRNA-mediated messenger RNA (mRNA silencing and degradation. The mRNA regulatory functions within GW/P bodies are mediated by GW182 and its binding partner hAgo2 that bind miRNA in the RNA-induced silencing complex (RISC. To date there are no published reports of the profile of miRNA and mRNA targeted to the RISC or a comparison of the RISC-specific miRNA/mRNA profile differences in malignant and non-malignant cells.RISC mRNA and miRNA components were profiled by microarray analysis of malignant human U-87 astrocytoma cells and its non-malignant counterpart, primary human astrocytes. Total cell RNA as well as RNA from immunoprecipitated RISC was analyzed. The novel findings were fourfold: (1 miRNAs were highly enriched in astrocyte RISC compared to U-87 astrocytoma RISC, (2 astrocytoma and primary astrocyte cells each contained unique RISC miRNA profiles as compared to their respective cellular miRNA profiles, (3 miR-195, 10b, 29b, 19b, 34a and 455-3p levels were increased and the miR-181b level was decreased in U-87 astrocytoma RISC as compared to astrocyte RISC, and (4 the RISC contained decreased levels of mRNAs in primary astrocyte and U-87 astrocytoma cells.The observation that miR-34a and miR-195 levels were increased in the RISC of U-87 astrocytoma cells suggests an oncogenic role for these miRNAs. Differential regulation of mRNAs by specific miRNAs is evidenced by the observation that three miR34a-targeted mRNAs and two miR-195-targeted mRNAs were downregulated while one miR-195-targeted mRNA was upregulated. Biological pathway analysis of RISC mRNA components suggests that the RISC plays a pivotal role in malignancy and other conditions. This study points to the importance of the RISC and ultimately GW/P body composition and function in miRNA and mRNA deregulation in astrocytoma cells and possibly in other malignancies.

Translational Influence on Messenger Stability

DEFF Research Database (Denmark)

Eriksen, Mette

-termination to be a global phenomena in gene regulation. The influence of codon usage in the early coding region on messenger stability was examined, in order to establish how fast or slow the ribosome has to decode the sequence for it to protect the messenger from degradation. The experiments demonstrated that very fast...

PACCMIT/PACCMIT-CDS: identifying microRNA targets in 3' UTRs and coding sequences.

Science.gov (United States)

Šulc, Miroslav; Marín, Ray M; Robins, Harlan S; Vaníček, Jiří

2015-07-01

The purpose of the proposed web server, publicly available at http://paccmit.epfl.ch, is to provide a user-friendly interface to two algorithms for predicting messenger RNA (mRNA) molecules regulated by microRNAs: (i) PACCMIT (Prediction of ACcessible and/or Conserved MIcroRNA Targets), which identifies primarily mRNA transcripts targeted in their 3' untranslated regions (3' UTRs), and (ii) PACCMIT-CDS, designed to find mRNAs targeted within their coding sequences (CDSs). While PACCMIT belongs among the accurate algorithms for predicting conserved microRNA targets in the 3' UTRs, the main contribution of the web server is 2-fold: PACCMIT provides an accurate tool for predicting targets also of weakly conserved or non-conserved microRNAs, whereas PACCMIT-CDS addresses the lack of similar portals adapted specifically for targets in CDS. The web server asks the user for microRNAs and mRNAs to be analyzed, accesses the precomputed P-values for all microRNA-mRNA pairs from a database for all mRNAs and microRNAs in a given species, ranks the predicted microRNA-mRNA pairs, evaluates their significance according to the false discovery rate and finally displays the predictions in a tabular form. The results are also available for download in several standard formats. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Annotating RNA motifs in sequences and alignments.

Science.gov (United States)

Gardner, Paul P; Eldai, Hisham

2015-01-01

RNA performs a diverse array of important functions across all cellular life. These functions include important roles in translation, building translational machinery and maturing messenger RNA. More recent discoveries include the miRNAs and bacterial sRNAs that regulate gene expression, the thermosensors, riboswitches and other cis-regulatory elements that help prokaryotes sense their environment and eukaryotic piRNAs that suppress transposition. However, there can be a long period between the initial discovery of a RNA and determining its function. We present a bioinformatic approach to characterize RNA motifs, which are critical components of many RNA structure-function relationships. These motifs can, in some instances, provide researchers with functional hypotheses for uncharacterized RNAs. Moreover, we introduce a new profile-based database of RNA motifs--RMfam--and illustrate some applications for investigating the evolution and functional characterization of RNA. All the data and scripts associated with this work are available from: https://github.com/ppgardne/RMfam. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Fox-2 protein regulates the alternative splicing of scleroderma-associated lysyl hydroxylase 2 messenger RNA.

Science.gov (United States)

Seth, Puneet; Yeowell, Heather N

2010-04-01

Scleroderma (systemic sclerosis [SSc]) is a complex connective tissue disorder characterized by hardening and thickening of the skin. One hallmark of scleroderma is excessive accumulation of collagen accompanied by increased levels of pyridinoline collagen crosslinks derived from hydroxylysine residues in the collagen telopeptide domains. Lysyl hydroxylase 2 (LH2), an important alternatively spliced enzyme in collagen biosynthesis, acts as a collagen telopeptide hydroxylase. Changes in the pattern of LH2 alternative splicing, favoring increased inclusion of the alternatively spliced LH2 exon 13A, thereby increasing the levels of the long transcript of LH2 (LH2[long]), are linked to scleroderma disease. This study was undertaken to examine the role played by RNA binding protein Fox-2 in regulating exon 13A inclusion, which leads to the generation of scleroderma-associated LH2(long) messenger RNA (mRNA). Phylogenetic sequence analysis of introns flanking exon 13A was performed. A tetracycline-inducible system in T-Rex 293 cells was used to induce Fox-2 protein, and endogenous LH2(long) mRNA was determined by reverse transcriptase-polymerase chain reaction. An LH2 minigene was designed, validated, and used in Fox-2 overexpression and mutagenesis experiments. Knockdown of Fox-2 was performed in mouse embryonic fibroblasts and in fibroblasts from SSc patients. Overexpression of Fox-2 enhanced the inclusion of exon 13A and increased the generation of LH2(long) mRNA, whereas knockdown of Fox-2 decreased LH2(long) transcripts. Mutational analysis of an LH2 minigene demonstrated that 2 of the 4 Fox binding motifs flanking LH2 exon 13A are required for inclusion of exon 13A. In early passage fibroblasts derived from patients with scleroderma, the knockdown of Fox-2 protein significantly decreased the endogenous levels of LH2(long) mRNA. Our findings indicate that Fox-2 plays an integral role in the regulation of LH2 splicing. Knockdown of Fox-2 and other methods to decrease

The ribosome uses two active mechanisms to unwind messenger RNA during translation.

Science.gov (United States)

Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio

2011-07-06

The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved

Alterations in polyribosome and messenger ribonucleic acid metabolism and messenger ribonucleoprotein utilization in osmotically stressed plant seedlings

International Nuclear Information System (INIS)

Mason, H.S.

1986-01-01

Polyribosome aggregation state in growing tissues of barley and wheat leaf of stems of pea and squash was studied in relation to seedling growth and water status of the growing tissue in plants at various levels of osmotic stress. It was found to be highly correlated with water potential and osmotic potential of the growing tissue and with leaf of stem elongation rate. Stress rapidly reduced polyribosome content and water status in growing tissues of barley leaves; changes were slow and slight in the non-growing leaf blade. Membrane-bound and free polyribosomes were equally sensitive to stress-induced disaggregation. Incorporation of 32 PO 4 3- into ribosomal RNA was rapidly inhibited by stress, but stability of poly(A) + RNA relative to ribosomal RNA was similar in stressed and unstressed tissues, with a half-life of about 12 hours. Stress also caused progressive loss of poly(A) + RNA from these tissues. Quantitation of poly(A) and in vitro messenger template activity in polysome gradient fractions showed a shift of activity from the polysomal region to the region of 20-60 S in stressed plants. Messenger RNA in the 20-60 S region coded for the same peptides as mRNA found in the polysomal fraction. Nonpolysomal and polysome-derived messenger ribonucleoprotein complexes (mRNP) were isolated, and characteristic proteins were found associated with either fraction. Polysomal mRNP from stressed or unstressed plants were translated with similar efficiency in a wheat germ cell-free system. It was concluded that no translational inhibitory activity was associated with nonpolysomal mRNP from barley prepared as described

In vivo expression of ß-galactosidase by rat oviduct exposed to naked DNA or messenger RNA

Directory of Open Access Journals (Sweden)

MARIANA RIOS

2002-01-01

Full Text Available Intra-oviductal administration of RNA obtained from oviducts of estradiol-treated rats resulted in accelerated egg transport (Ríos et al., 1997. It is probable that estradiol-induced messenger RNA (mRNA entered oviductal cells and was translated into the proteins involved in accelerated egg transport. In order to test this interpretation we deposited in vivo 50 µg of pure ß-galactosidase (ß-gal mRNA, 50 µg of pure DNA from the reporter gene ß-gal under SV40 promoter or the vehicle (control oviducts into the oviductal lumen of rats. Twenty four hours later the ß-gal activity was assayed in oviductal tissue homogenates using o-nitrophenyl-ß-D-galactopyranoside as a substrate. The administration of ß-gal mRNA and pSVBgal plasmid increased ß-gal activity by 71% and 142%, respectively, over the control oviducts. These results indicate that naked DNA and mRNA coding for ß-gal can enter oviductal cells and be translated into an active enzyme. They are consistent with the interpretation that embryo transport acceleration caused by the injection of estradiol-induced RNA in the oviduct involves translation of the injected mRNA

Primary structure of the α-subunit of Na+, K+-ATPase. II. Isolation, reverse transcription, and cloning of messenger RNA

International Nuclear Information System (INIS)

Petrukhin, K.E.; Broude, N.E.; Arsenyan, S.G.; Grishin, A.V.; Dzhandzhugazyan, K.N.; Modyanov, N.N.

1986-01-01

The messenger RNA coding the α-subunit of Na + ,K + -ATPase has been isolated from the outer medullary layer of porcine kidneys. The mRNA gives a specific hybridization band in the 25S-26S region with three oligonucleotide probes synthesized on the basis of information on the structure of three peptides isolated from a tryptic hydrolyzate of the α-subunit of Na + ,K + -ATPase. The translation of the mRNA in Xenopus laevis oocytes followed by immunochemical identification of the products of synthesis confirmed the presence of the mRNA of the α-subunit of Na + ,K + -ATPase in an enriched fraction of poly(A + )-RNA. This preparation has been used for the synthesis of cloning of double-stranded cDNA

miRNA-target chimeras reveal miRNA 3'-end pairing as a major determinant of Argonaute target specificity

DEFF Research Database (Denmark)

Moore, Michael J; Scheel, Troels K H; Luna, Joseph M

2015-01-01

microRNAs (miRNAs) act as sequence-specific guides for Argonaute (AGO) proteins, which mediate posttranscriptional silencing of target messenger RNAs. Despite their importance in many biological processes, rules governing AGO-miRNA targeting are only partially understood. Here we report a modifie...

PACCMIT/PACCMIT-CDS: identifying microRNA targets in 3′ UTRs and coding sequences

Science.gov (United States)

Šulc, Miroslav; Marín, Ray M.; Robins, Harlan S.; Vaníček, Jiří

2015-01-01

The purpose of the proposed web server, publicly available at http://paccmit.epfl.ch, is to provide a user-friendly interface to two algorithms for predicting messenger RNA (mRNA) molecules regulated by microRNAs: (i) PACCMIT (Prediction of ACcessible and/or Conserved MIcroRNA Targets), which identifies primarily mRNA transcripts targeted in their 3′ untranslated regions (3′ UTRs), and (ii) PACCMIT-CDS, designed to find mRNAs targeted within their coding sequences (CDSs). While PACCMIT belongs among the accurate algorithms for predicting conserved microRNA targets in the 3′ UTRs, the main contribution of the web server is 2-fold: PACCMIT provides an accurate tool for predicting targets also of weakly conserved or non-conserved microRNAs, whereas PACCMIT-CDS addresses the lack of similar portals adapted specifically for targets in CDS. The web server asks the user for microRNAs and mRNAs to be analyzed, accesses the precomputed P-values for all microRNA–mRNA pairs from a database for all mRNAs and microRNAs in a given species, ranks the predicted microRNA–mRNA pairs, evaluates their significance according to the false discovery rate and finally displays the predictions in a tabular form. The results are also available for download in several standard formats. PMID:25948580

Antigen-presenting cells transfected with Hsp65 messenger RNA fail to treat experimental tuberculosis

Energy Technology Data Exchange (ETDEWEB)

Rocha, C.D.; Trombone, A.P.F.; Lorenzi, J.C.C.; Almeida, L.P.; Gembre, A.F.; Padilha, E. [Departamento de Bioquímica e Imunologia, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil); Ramos, S.G. [Departamento de Patologia, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil); Silva, C.L.; Coelho-Castelo, A.A.M. [Departamento de Bioquímica e Imunologia, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil)

2012-09-21

In the last several years, the use of dendritic cells has been studied as a therapeutic strategy against tumors. Dendritic cells can be pulsed with peptides or full-length protein, or they can be transfected with DNA or RNA. However, comparative studies suggest that transfecting dendritic cells with messenger RNA (mRNA) is superior to other antigen-loading techniques in generating immunocompetent dendritic cells. In the present study, we evaluated a new therapeutic strategy to fight tuberculosis using dendritic cells and macrophages transfected with Hsp65 mRNA. First, we demonstrated that antigen-presenting cells transfected with Hsp65 mRNA exhibit a higher level of expression of co-stimulatory molecules, suggesting that Hsp65 mRNA has immunostimulatory properties. We also demonstrated that spleen cells obtained from animals immunized with mock and Hsp65 mRNA-transfected dendritic cells were able to generate a mixed Th1/Th2 response with production not only of IFN-γ but also of IL-5 and IL-10. In contrast, cells recovered from mice immunized with Hsp65 mRNA-transfected macrophages were able to produce only IL-5. When mice were infected with Mycobacterium tuberculosis and treated with antigen-presenting cells transfected with Hsp65 mRNA (therapeutic immunization), we did not detect any decrease in the lung bacterial load or any preservation of the lung parenchyma, indicating the inability of transfected cells to confer curative effects against tuberculosis. In spite of the lack of therapeutic efficacy, this study reports for the first time the use of antigen-presenting cells transfected with mRNA in experimental tuberculosis.

DSAP: deep-sequencing small RNA analysis pipeline.

Science.gov (United States)

Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus

2010-07-01

DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (http://rfam.sanger.ac.uk/); and (iv) known miRNA matching: detection of known miRNAs in miRBase (http://www.mirbase.org/) based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at http://dsap.cgu.edu.tw.

tRNA--the golden standard in molecular biology.

Science.gov (United States)

Barciszewska, Mirosława Z; Perrigue, Patrick M; Barciszewski, Jan

2016-01-01

Transfer RNAs (tRNAs) represent a major class of RNA molecules. Their primary function is to help decode a messenger RNA (mRNA) sequence in order to synthesize protein and thus ensures the precise translation of genetic information that is imprinted in DNA. The discovery of tRNA in the late 1950's provided critical insight into a genetic machinery when little was known about the central dogma of molecular biology. In 1965, Robert Holley determined the first nucleotide sequence of alanine transfer RNA (tRNA(Ala)) which earned him the 1968 Nobel Prize in Physiology or Medicine. Today, tRNA is one of the best described and characterized biological molecules. Here we review some of the key historical events in tRNA research which led to breakthrough discoveries and new developments in molecular biology.

RNA decay by messenger RNA interferases

DEFF Research Database (Denmark)

Christensen-Dalsgaard, Mikkel; Overgaard, Martin; Winther, Kristoffer Skovbo

2008-01-01

Two abundant toxin-antitoxin (TA) gene families, relBE and mazEF, encode mRNA cleaving enzymes whose ectopic overexpression abruptly inhibits translation and thereby induces a bacteriostatic condition. Here we describe and discuss protocols for the overproduction, purification, and analysis of mR...... cleaving enzymes such as RelE of Escherichia coli and the corresponding antitoxin RelB. In particular, we describe a set of plasmid vectors useful for the detailed analysis of cleavage sites in model mRNAs.......Two abundant toxin-antitoxin (TA) gene families, relBE and mazEF, encode mRNA cleaving enzymes whose ectopic overexpression abruptly inhibits translation and thereby induces a bacteriostatic condition. Here we describe and discuss protocols for the overproduction, purification, and analysis of mRNA...

DNA Methylation of MMP9 Is Associated with High Levels of MMP-9 Messenger RNA in Periapical Inflammatory Lesions.

Science.gov (United States)

Campos, Kelma; Gomes, Carolina Cavalieri; Farias, Lucyana Conceição; Silva, Renato Menezes; Letra, Ariadne; Gomez, Ricardo Santiago

2016-01-01

Matrix metalloproteinases (MMPs) are the major class of enzymes responsible for degradation of extracellular matrix components and participate in the pathogenesis of periapical inflammatory lesions. MMP expression may be regulated by DNA methylation. The purpose of the present investigation was to analyze the expression of MMP2 and MMP9 in periapical granulomas and radicular cysts and to test the hypothesis that, in these lesions, their transcription may be modulated by DNA methylation. Methylation-specific polymerase chain reaction was used to evaluate the DNA methylation pattern of the MMP2 gene in 13 fresh periapical granuloma samples and 10 fresh radicular cyst samples. Restriction enzyme digestion was used to assess methylation of the MMP9 gene in 12 fresh periapical granuloma samples and 10 fresh radicular cyst samples. MMP2 and MMP9 messenger RNA transcript levels were measured by quantitative real-time polymerase chain reaction. All periapical lesions and healthy mucosa samples showed partial methylation of the MMP2 gene; however, periapical granulomas showed higher MMP2 mRNA expression levels than healthy mucosa (P = .014). A higher unmethylated profile of the MMP9 gene was found in periapical granulomas and radicular cysts compared with healthy mucosa. In addition, higher MMP9 mRNA expression was observed in the periapical lesions compared with healthy tissues. The present study suggests that the unmethylated status of the MMP9 gene in periapical lesions may explain the observed up-regulation of messenger RNA transcription in these lesions. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

Skeletal muscle microRNA and messenger RNA profiling in cofilin-2 deficient mice reveals cell cycle dysregulation hindering muscle regeneration.

Directory of Open Access Journals (Sweden)

Sarah U Morton

Full Text Available Congenital myopathies are rare skeletal muscle diseases presenting in early age with hypotonia and weakness often linked to a genetic defect. Mutations in the gene for cofilin-2 (CFL2 have been identified in several families as a cause of congenital myopathy with nemaline bodies and cores. Here we explore the global messenger and microRNA expression patterns in quadriceps muscle samples from cofillin-2-null mice and compare them with sibling-matched wild-type mice to determine the molecular pathways and mechanisms involved. Cell cycle processes are markedly dysregulated, with altered expression of genes involved in mitotic spindle formation, and evidence of loss of cell cycle checkpoint regulation. Importantly, alterations in cell cycle, apoptosis and proliferation pathways are present in both mRNA and miRNA expression patterns. Specifically, p21 transcript levels were increased, and the expression of p21 targets, such as cyclin D and cyclin E, was decreased. We therefore hypothesize that deficiency of cofilin-2 is associated with interruption of the cell cycle at several checkpoints, hindering muscle regeneration. Identification of these pathways is an important step towards developing appropriate therapies against various congenital myopathies.

siRNAs targeted to certain polyadenylation sites promote specific, RISC-independent degradation of messenger RNAs.

Science.gov (United States)

Vickers, Timothy A; Crooke, Stanley T

2012-07-01

While most siRNAs induce sequence-specific target mRNA cleavage and degradation in a process mediated by Ago2/RNA-induced silencing complex (RISC), certain siRNAs have also been demonstrated to direct target RNA reduction through deadenylation and subsequent degradation of target transcripts in a process which involves Ago1/RISC and P-bodies. In the current study, we present data suggesting that a third class of siRNA exist, which are capable of promoting target RNA reduction that is independent of both Ago and RISC. These siRNAs bind the target messenger RNA at the polyA signal and are capable of redirecting a small amount of polyadenylation to downstream polyA sites when present, however, the majority of the activity appears to be due to inhibition of polyadenylation or deadenylation of the transcript, followed by exosomal degradation of the immature mRNA.

RNA Editing in Plant Mitochondria

Science.gov (United States)

Hiesel, Rudolf; Wissinger, Bernd; Schuster, Wolfgang; Brennicke, Axel

1989-12-01

Comparative sequence analysis of genomic and complementary DNA clones from several mitochondrial genes in the higher plant Oenothera revealed nucleotide sequence divergences between the genomic and the messenger RNA-derived sequences. These sequence alterations could be most easily explained by specific post-transcriptional nucleotide modifications. Most of the nucleotide exchanges in coding regions lead to altered codons in the mRNA that specify amino acids better conserved in evolution than those encoded by the genomic DNA. Several instances show that the genomic arginine codon CGG is edited in the mRNA to the tryptophan codon TGG in amino acid positions that are highly conserved as tryptophan in the homologous proteins of other species. This editing suggests that the standard genetic code is used in plant mitochondria and resolves the frequent coincidence of CGG codons and tryptophan in different plant species. The apparently frequent and non-species-specific equivalency of CGG and TGG codons in particular suggests that RNA editing is a common feature of all higher plant mitochondria.

RNA-Pareto: interactive analysis of Pareto-optimal RNA sequence-structure alignments.

Science.gov (United States)

Schnattinger, Thomas; Schöning, Uwe; Marchfelder, Anita; Kestler, Hans A

2013-12-01

Incorporating secondary structure information into the alignment process improves the quality of RNA sequence alignments. Instead of using fixed weighting parameters, sequence and structure components can be treated as different objectives and optimized simultaneously. The result is not a single, but a Pareto-set of equally optimal solutions, which all represent different possible weighting parameters. We now provide the interactive graphical software tool RNA-Pareto, which allows a direct inspection of all feasible results to the pairwise RNA sequence-structure alignment problem and greatly facilitates the exploration of the optimal solution set.

Detailed mapping of serotonin 5-HT1B and 5-HT1D receptor messenger RNA and ligand binding sites in guinea-pig brain and trigeminal ganglion: clues for function

International Nuclear Information System (INIS)

Leysen, J.E.; Schotte, A.; Jurzak, M.; Luyten, W.H.M.L.; Voorn, P.; Bonaventure, P.

1997-01-01

The similar pharmacology of the 5-HT 1B and 5-HT 1D receptors, and the lack of selective compounds sufficiently distinguishing between the two receptor subtypes, have hampered functional studies on these receptors. In order to provide clues for differential functional roles of the two subtypes, we performed a parallel localization study throughout the guinea-pig brain and the trigeminal ganglia by means of quantitative in situ hybridization histochemistry (using [ 35 S]-labelled riboprobes probes for receptor messenger RNA) and receptor autoradiography (using a new radioligand [ 3 H]alniditan).The anatomical patterns of 5-HT 1B and 5-HT 1D receptor messenger RNA were quite different. While 5-HT 1B receptor messenger RNA was abundant throughout the brain (with highest levels in the striatum, nucleus accumbens, olfactory tubercle, cortex, hypothalamus, hippocampal formation, amygdala, thalamus, dorsal raphe and cerebellum), 5-HT 1D receptor messenger RNA exhibited a more restricted pattern; it was found mainly in the olfactory tubercle, entorhinal cortex, dorsal raphe, cerebellum, mesencephalic trigeminal nucleus and in the trigeminal ganglion. The density of 5-HT 1B/1D binding sites (combined) obtained with [ 3 H]alniditan autoradiography was high in the substantia nigra, superior colliculus and globus pallidus, whereas lower levels were detected in the caudate-putamen, hypothalamus, hippocampal formation, amygdala, thalamus and central gray. This distribution pattern was indistinguishable from specific 5-HT 1B receptor labelling in the presence of ketanserin under conditions to occlude 5-HT 1D receptor labelling; hence the latter were below detection level. Relationships between the regional distributions of the receptor messenger RNAs and binding sites and particular neuroanatomical pathways are discussed with respect to possible functional roles of the 5-HT 1B and 5-HT 1D receptors. (Copyright (c) 1997 Elsevier Science B.V., Amsterdam. All rights reserved.)

Genetic recombination in plant-infecting messenger-sense RNA viruses: overview and research perspectives.

Science.gov (United States)

Bujarski, Jozef J

2013-01-01

RNA recombination is one of the driving forces of genetic variability in (+)-strand RNA viruses. Various types of RNA-RNA crossovers were described including crosses between the same or different viral RNAs or between viral and cellular RNAs. Likewise, a variety of molecular mechanisms are known to support RNA recombination, such as replicative events (based on internal or end-to-end replicase switchings) along with non-replicative joining among RNA fragments of viral and/or cellular origin. Such mechanisms as RNA decay or RNA interference are responsible for RNA fragmentation and trans-esterification reactions which are likely accountable for ligation of RNA fragments. Numerous host factors were found to affect the profiles of viral RNA recombinants and significant differences in recombination frequency were observed among various RNA viruses. Comparative analyses of viral sequences allowed for the development of evolutionary models in order to explain adaptive phenotypic changes and co-evolving sites. Many questions remain to be answered by forthcoming RNA recombination research. (1) How various factors modulate the ability of viral replicase to switch templates, (2) What is the intracellular location of RNA-RNA template switchings, (3) Mechanisms and factors responsible for non-replicative RNA recombination, (4) Mechanisms of integration of RNA viral sequences with cellular genomic DNA, and (5) What is the role of RNA splicing and ribozyme activity. From an evolutionary stand point, it is not known how RNA viruses parasitize new host species via recombination, nor is it obvious what the contribution of RNA recombination is among other RNA modification pathways. We do not understand why the frequency of RNA recombination varies so much among RNA viruses and the status of RNA recombination as a form of sex is not well documented.

Genetic recombination in plant-infecting messenger-sense RNA viruses: overview and research perspectives

Directory of Open Access Journals (Sweden)

Jozef Julian Bujarski

2013-03-01

Full Text Available RNA recombination is one of the driving forces of genetic variability in (+-strand RNA viruses. Various types of RNA-RNA crossovers were described including crosses between the same or different viral RNAs or between viral and cellular RNAs. Likewise, a variety of molecular mechanisms are known to support RNA recombination, such as replicative events (based on internal or end-to-end replicase switchings along with nonreplicative joining among RNA fragments of viral and/or cellular origin. Such mechanisms as RNA decay or RNA interference are responsible for RNA fragmentation and trans-esterification reactions which are likely accountable for ligation of RNA fragments. Numerous host factors were found to affect the profiles of viral RNA recombinants and significant differences in recombination frequency were observed among various RNA viruses. Comparative analyses of viral sequences allowed for the development of evolutionary models in order to explain adaptive phenotypic changes and co-evolving sites. Many questions remain to be answered by forthcoming RNA recombination research. (i How various factors modulate the ability of viral replicase to switch templates, (ii What is the intracellular location of RNA-RNA template switchings, (iii Mechanisms and factors responsible for non-replicative RNA recombination, (iv Mechanisms of integration of RNA viral sequences with cellular genomic DNA, and (v What is the role of RNA splicing and ribozyme activity. From an evolutionary stand point, it is not known how RNA viruses parasitize new host species via recombination, nor is it obvious what the contribution of RNA recombination is among other RNA modification pathways. We do not understand why the frequency of RNA recombination varies so much among RNA viruses and the status of RNA recombination as a form of sex is not well documented.

Reprogramming human umbilical cord mesenchymal stromal cells to islet-like cells with the use of in vitro-synthesized pancreatic-duodenal homebox 1 messenger RNA.

Science.gov (United States)

Wang, Xiao Li; Hu, Pei; Guo, Xing Rong; Yan, Ding; Yuan, Yahong; Yan, Shi Rong; Li, Dong Sheng

2014-11-01

Human umbilical cord mesenchymal stromal cells (hUC-MSCs) hold great potential as a therapeutic candidate to treat diabetes, owing to their unlimited source and ready availability. In this study, we differentiated hUC-MSCs with in vitro-synthesized pancreatic-duodenal homebox 1 (PDX1) messenger (m)RNA into islet-like cell clusters. hUC-MSCs were confirmed by both biomarker detection and functional differentiation. In vitro-synthesized PDX1 messenger RNA can be transfected into hUC-MSCs efficiently. The upregulated expression of PDX1 protein can be detected 4 h after transfection and remains detectable for 36 h. The induction of islet-like structures was confirmed by means of morphology and dithizone staining. Reverse transcriptase-polymerase chain reaction results revealed the expression of some key pancreatic transcription factors, such as PDX1, NeuroD, NKX6.1, Glut-2 and insulin in islet-like cell clusters. Immunofluorescence analysis showed that differentiated cells express both insulin and C-peptide. Enzyme-linked immunosorbent assay analysis validated the insulin secretion of islet-like cell clusters in response to the glucose stimulation. Our results demonstrate the use of in vitro-synthesized PDX1 messenger RNA to differentiate hUC-MSCs into islet-like cells and pave the way toward the development of reprogramming and directed-differentiation methods for the expression of encoded proteins. Copyright © 2014 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

Electrochemical Branched-DNA Assay for Polymerase Chain Reaction-Free Detection and Quantification of Oncogenes in Messenger RNA

Energy Technology Data Exchange (ETDEWEB)

Lee, Ai Cheng; Dai, Ziyu; Chen, Baowei; Wu, Hong; Wang, Jun; Zhang, Aiguo; Zhang, Lurong; Lim, Tit-Meng; Lin, Yuehe

2008-12-01

We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcript in the population of messenger RNA (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify targets signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct detection of target transcript in as little as 4.6 ng mRNA without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcript in total mRNA population. The approach thus provides a simple, sensitive, accurate and quantitative tool alternate to the RQ-PCR for early disease diagnosis.

Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.

Science.gov (United States)

Tan, M K

1991-08-01

A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.

Relationship between mRNA secondary structure and sequence variability in Chloroplast genes: possible life history implications.

Science.gov (United States)

Krishnan, Neeraja M; Seligmann, Hervé; Rao, Basuthkar J

2008-01-28

Synonymous sites are freer to vary because of redundancy in genetic code. Messenger RNA secondary structure restricts this freedom, as revealed by previous findings in mitochondrial genes that mutations at third codon position nucleotides in helices are more selected against than those in loops. This motivated us to explore the constraints imposed by mRNA secondary structure on evolutionary variability at all codon positions in general, in chloroplast systems. We found that the evolutionary variability and intrinsic secondary structure stability of these sequences share an inverse relationship. Simulations of most likely single nucleotide evolution in Psilotum nudum and Nephroselmis olivacea mRNAs, indicate that helix-forming propensities of mutated mRNAs are greater than those of the natural mRNAs for short sequences and vice-versa for long sequences. Moreover, helix-forming propensity estimated by the percentage of total mRNA in helices increases gradually with mRNA length, saturating beyond 1000 nucleotides. Protection levels of functionally important sites vary across plants and proteins: r-strategists minimize mutation costs in large genes; K-strategists do the opposite. Mrna length presumably predisposes shorter mRNAs to evolve under different constraints than longer mRNAs. The positive correlation between secondary structure protection and functional importance of sites suggests that some sites might be conserved due to packing-protection constraints at the nucleic acid level in addition to protein level constraints. Consequently, nucleic acid secondary structure a priori biases mutations. The converse (exposure of conserved sites) apparently occurs in a smaller number of cases, indicating a different evolutionary adaptive strategy in these plants. The differences between the protection levels of functionally important sites for r- and K-strategists reflect their respective molecular adaptive strategies. These converge with increasing domestication levels of

Deep sequencing of cardiac microRNA-mRNA interactomes in clinical and experimental cardiomyopathy.

Science.gov (United States)

Matkovich, Scot J; Dorn, Gerald W

2015-01-01

MicroRNAs are a family of short (~21 nucleotide) noncoding RNAs that serve key roles in cellular growth and differentiation and the response of the heart to stress stimuli. As the sequence-specific recognition element of RNA-induced silencing complexes (RISCs), microRNAs bind mRNAs and prevent their translation via mechanisms that may include transcript degradation and/or prevention of ribosome binding. Short microRNA sequences and the ability of microRNAs to bind to mRNA sites having only partial/imperfect sequence complementarity complicate purely computational analyses of microRNA-mRNA interactomes. Furthermore, computational microRNA target prediction programs typically ignore biological context, and therefore the principal determinants of microRNA-mRNA binding: the presence and quantity of each. To address these deficiencies we describe an empirical method, developed via studies of stressed and failing hearts, to determine disease-induced changes in microRNAs, mRNAs, and the mRNAs targeted to the RISC, without cross-linking mRNAs to RISC proteins. Deep sequencing methods are used to determine RNA abundances, delivering unbiased, quantitative RNA data limited only by their annotation in the genome of interest. We describe the laboratory bench steps required to perform these experiments, experimental design strategies to achieve an appropriate number of sequencing reads per biological replicate, and computer-based processing tools and procedures to convert large raw sequencing data files into gene expression measures useful for differential expression analyses.

Primary structure of the. cap alpha. -subunit of Na/sup +/, K/sup +/-ATPase. II. Isolation, reverse transcription, and cloning of messenger RNA

Energy Technology Data Exchange (ETDEWEB)

Petrukhin, K.E.; Broude, N.E.; Arsenyan, S.G.; Grishin, A.V.; Dzhandzhugazyan, K.N.; Modyanov, N.N.

1986-10-01

The messenger RNA coding the ..cap alpha..-subunit of Na/sup +/,K/sup +/-ATPase has been isolated from the outer medullary layer of porcine kidneys. The mRNA gives a specific hybridization band in the 25S-26S region with three oligonucleotide probes synthesized on the basis of information on the structure of three peptides isolated from a tryptic hydrolyzate of the ..cap alpha..-subunit of Na/sup +/,K/sup +/-ATPase. The translation of the mRNA in Xenopus laevis oocytes followed by immunochemical identification of the products of synthesis confirmed the presence of the mRNA of the ..cap alpha..-subunit of Na/sup +/,K/sup +/-ATPase in an enriched fraction of poly(A/sup +/)-RNA. This preparation has been used for the synthesis of cloning of double-stranded cDNA.

Blockade of OX40/OX40 ligand to decrease cytokine messenger RNA expression in acute renal allograft rejection in vitro.

Science.gov (United States)

Wang, Y-L; Li, G; Fu, Y-X; Wang, H; Shen, Z-Y

2013-01-01

The aim of this study was to investigate cytokine messenger RNA (mRNA) expression by peripheral blood mononuclear cells (PBMCs) from renal recipients experiencing acute rejection by blocking OX40-OX40L interactions with recombinant human OX40-Fc fusion protein (rhOX40Fc) in vitro. PBMCs were isolated from 20 recipients experiencing acute rejection episodes (rejection group) and 20 recipients with stable graft function (stable group). Levels of Th1 (interferon [IFN]-γ) and Th2 (interleukin [IL]-4) mRNA expressions by PBMCs were measured using real-time reverse transcriptase-polymerase chain reactions. IFN-γ mRNA expression levels were significantly higher in the rejection than the stable group (P rejection group, rhOX40Fc reduced significantly the expression of IFN-γ and IL-4 mRNA by anti-CD3-monoclonal antibody stimulated PBMCs (P type cytokines. Copyright © 2013 Elsevier Inc. All rights reserved.

Diagnosis of chronic myeloid and acute lymphocytic leukemias by detection of leukemia-specific mRNA sequences amplified in vitro

International Nuclear Information System (INIS)

Kawasaki, E.S.; Clark, S.S.; Coyne, M.Y.; Smith, S.D.; Champlin, R.; Witte, O.N.; McCormick, F.P.

1988-01-01

The Philadelphia chromosome is present in more than 95% of chronic myeloid leukemia patients and 13% of acute lymphocytic leukemia patients. The Philadelphia translocation, t(9;22), fuses the BCR and ABL genes resulting in the expression of leukemia-specific, chimeric BCR-ABL messenger RNAs. To facilitate diagnosis of these leukemias, the authors have developed a method of amplifying and detecting only the unique mRNA sequences, using an extension of the polymerase chain reaction technique. Diagnosis of chronic myeloid and acute lymphocytic leukemias by this procedure is rapid, much more sensitive than existing protocols, and independent of the presence or absence of an identifiable Philadelphia chromosome

Semiautomated improvement of RNA alignments

DEFF Research Database (Denmark)

Andersen, Ebbe Sloth; Lind-Thomsen, Allan; Knudsen, Bjarne

2007-01-01

connects to external tools to provide a flexible semiautomatic editing environment. A new method, Pcluster, is introduced for dividing the sequences of an RNA alignment into subgroups with secondary structure differences. Pcluster was used to evaluate 574 seed alignments obtained from the Rfam database...... and we identified 71 alignments with significant prediction of inconsistent base pairs and 102 alignments with significant prediction of novel base pairs. Four RNA families were used to illustrate how SARSE can be used to manually or automatically correct the inconsistent base pairs detected by Pcluster......: the mir-399 RNA, vertebrate telomase RNA (vert-TR), bacterial transfer-messenger RNA (tmRNA), and the signal recognition particle (SRP) RNA. The general use of the method is illustrated by the ability to accommodate pseudoknots and handle even large and divergent RNA families. The open architecture...

Chimira: analysis of small RNA sequencing data and microRNA modifications.

Science.gov (United States)

Vitsios, Dimitrios M; Enright, Anton J

2015-10-15

Chimira is a web-based system for microRNA (miRNA) analysis from small RNA-Seq data. Sequences are automatically cleaned, trimmed, size selected and mapped directly to miRNA hairpin sequences. This generates count-based miRNA expression data for subsequent statistical analysis. Moreover, it is capable of identifying epi-transcriptomic modifications in the input sequences. Supported modification types include multiple types of 3'-modifications (e.g. uridylation, adenylation), 5'-modifications and also internal modifications or variation (ADAR editing or single nucleotide polymorphisms). Besides cleaning and mapping of input sequences to miRNAs, Chimira provides a simple and intuitive set of tools for the analysis and interpretation of the results (see also Supplementary Material). These allow the visual study of the differential expression between two specific samples or sets of samples, the identification of the most highly expressed miRNAs within sample pairs (or sets of samples) and also the projection of the modification profile for specific miRNAs across all samples. Other tools have already been published in the past for various types of small RNA-Seq analysis, such as UEA workbench, seqBuster, MAGI, OASIS and CAP-miRSeq, CPSS for modifications identification. A comprehensive comparison of Chimira with each of these tools is provided in the Supplementary Material. Chimira outperforms all of these tools in total execution speed and aims to facilitate simple, fast and reliable analysis of small RNA-Seq data allowing also, for the first time, identification of global microRNA modification profiles in a simple intuitive interface. Chimira has been developed as a web application and it is accessible here: http://www.ebi.ac.uk/research/enright/software/chimira. aje@ebi.ac.uk Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

Size, Shape, and Sequence-Dependent Immunogenicity of RNA Nanoparticles

Directory of Open Access Journals (Sweden)

Sijin Guo

2017-12-01

Full Text Available RNA molecules have emerged as promising therapeutics. Like all other drugs, the safety profile and immune response are important criteria for drug evaluation. However, the literature on RNA immunogenicity has been controversial. Here, we used the approach of RNA nanotechnology to demonstrate that the immune response of RNA nanoparticles is size, shape, and sequence dependent. RNA triangle, square, pentagon, and tetrahedron with same shape but different sizes, or same size but different shapes were used as models to investigate the immune response. The levels of pro-inflammatory cytokines induced by these RNA nanoarchitectures were assessed in macrophage-like cells and animals. It was found that RNA polygons without extension at the vertexes were immune inert. However, when single-stranded RNA with a specific sequence was extended from the vertexes of RNA polygons, strong immune responses were detected. These immunostimulations are sequence specific, because some other extended sequences induced little or no immune response. Additionally, larger-size RNA square induced stronger cytokine secretion. 3D RNA tetrahedron showed stronger immunostimulation than planar RNA triangle. These results suggest that the immunogenicity of RNA nanoparticles is tunable to produce either a minimal immune response that can serve as safe therapeutic vectors, or a strong immune response for cancer immunotherapy or vaccine adjuvants.

Evaluation of two main RNA-seq approaches for gene quantification in clinical RNA sequencing: polyA+ selection versus rRNA depletion.

Science.gov (United States)

Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David

2018-03-19

To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.

Rfam: annotating families of non-coding RNA sequences.

Science.gov (United States)

Daub, Jennifer; Eberhardt, Ruth Y; Tate, John G; Burge, Sarah W

2015-01-01

The primary task of the Rfam database is to collate experimentally validated noncoding RNA (ncRNA) sequences from the published literature and facilitate the prediction and annotation of new homologues in novel nucleotide sequences. We group homologous ncRNA sequences into "families" and related families are further grouped into "clans." We collate and manually curate data cross-references for these families from other databases and external resources. Our Web site offers researchers a simple interface to Rfam and provides tools with which to annotate their own sequences using our covariance models (CMs), through our tools for searching, browsing, and downloading information on Rfam families. In this chapter, we will work through examples of annotating a query sequence, collating family information, and searching for data.

miRBase: integrating microRNA annotation and deep-sequencing data.

Science.gov (United States)

Kozomara, Ana; Griffiths-Jones, Sam

2011-01-01

miRBase is the primary online repository for all microRNA sequences and annotation. The current release (miRBase 16) contains over 15,000 microRNA gene loci in over 140 species, and over 17,000 distinct mature microRNA sequences. Deep-sequencing technologies have delivered a sharp rise in the rate of novel microRNA discovery. We have mapped reads from short RNA deep-sequencing experiments to microRNAs in miRBase and developed web interfaces to view these mappings. The user can view all read data associated with a given microRNA annotation, filter reads by experiment and count, and search for microRNAs by tissue- and stage-specific expression. These data can be used as a proxy for relative expression levels of microRNA sequences, provide detailed evidence for microRNA annotations and alternative isoforms of mature microRNAs, and allow us to revisit previous annotations. miRBase is available online at: http://www.mirbase.org/.

Size, Shape, and Sequence-Dependent Immunogenicity of RNA Nanoparticles.

Science.gov (United States)

Guo, Sijin; Li, Hui; Ma, Mengshi; Fu, Jian; Dong, Yizhou; Guo, Peixuan

2017-12-15

RNA molecules have emerged as promising therapeutics. Like all other drugs, the safety profile and immune response are important criteria for drug evaluation. However, the literature on RNA immunogenicity has been controversial. Here, we used the approach of RNA nanotechnology to demonstrate that the immune response of RNA nanoparticles is size, shape, and sequence dependent. RNA triangle, square, pentagon, and tetrahedron with same shape but different sizes, or same size but different shapes were used as models to investigate the immune response. The levels of pro-inflammatory cytokines induced by these RNA nanoarchitectures were assessed in macrophage-like cells and animals. It was found that RNA polygons without extension at the vertexes were immune inert. However, when single-stranded RNA with a specific sequence was extended from the vertexes of RNA polygons, strong immune responses were detected. These immunostimulations are sequence specific, because some other extended sequences induced little or no immune response. Additionally, larger-size RNA square induced stronger cytokine secretion. 3D RNA tetrahedron showed stronger immunostimulation than planar RNA triangle. These results suggest that the immunogenicity of RNA nanoparticles is tunable to produce either a minimal immune response that can serve as safe therapeutic vectors, or a strong immune response for cancer immunotherapy or vaccine adjuvants. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Maternal provision of non-sex-specific transformer messenger RNA in sex determination of the wasp Asobara tabida.

Science.gov (United States)

Geuverink, E; Verhulst, E C; van Leussen, M; van de Zande, L; Beukeboom, L W

2018-02-01

In many insect species maternal provision of sex-specifically spliced messenger RNA (mRNA) of sex determination genes is an essential component of the sex determination mechanism. In haplodiploid Hymenoptera, maternal provision in combination with genomic imprinting has been shown for the parasitoid Nasonia vitripennis, known as maternal effect genomic imprinting sex determination (MEGISD). Here, we characterize the sex determination cascade of Asobara tabida, another hymenopteran parasitoid. We show the presence of the conserved sex determination genes doublesex (dsx), transformer (tra) and transformer-2 (tra2) orthologues in As. tabida. Of these, At-dsx and At-tra are sex-specifically spliced, indicating a conserved function in sex determination. At-tra and At-tra2 mRNA is maternally provided to embryos but, in contrast to most studied insects, As. tabida females transmit a non-sex-specific splice form of At-tra mRNA to the eggs. In this respect, As. tabida sex determination differs from the MEGISD mechanism. How the paternal genome can induce female development in the absence of maternal provision of sex-specifically spliced mRNA remains an open question. Our study reports a hitherto unknown variant of maternal effect sex determination and accentuates the diversity of insect sex determination mechanisms. © 2017 The Authors. Insect Molecular Biology published by John Wiley & Sons Ltd on behalf of Royal Entomological Society.

Integrated mRNA and microRNA transcriptome sequencing characterizes sequence variants and mRNA–microRNA regulatory network in nasopharyngeal carcinoma model systems

Directory of Open Access Journals (Sweden)

Carol Ying-Ying Szeto

2014-01-01

Full Text Available Nasopharyngeal carcinoma (NPC is a prevalent malignancy in Southeast Asia among the Chinese population. Aberrant regulation of transcripts has been implicated in many types of cancers including NPC. Herein, we characterized mRNA and miRNA transcriptomes by RNA sequencing (RNASeq of NPC model systems. Matched total mRNA and small RNA of undifferentiated Epstein–Barr virus (EBV-positive NPC xenograft X666 and its derived cell line C666, well-differentiated NPC cell line HK1, and the immortalized nasopharyngeal epithelial cell line NP460 were sequenced by Solexa technology. We found 2812 genes and 149 miRNAs (human and EBV to be differentially expressed in NP460, HK1, C666 and X666 with RNASeq; 533 miRNA–mRNA target pairs were inversely regulated in the three NPC cell lines compared to NP460. Integrated mRNA/miRNA expression profiling and pathway analysis show extracellular matrix organization, Beta-1 integrin cell surface interactions, and the PI3K/AKT, EGFR, ErbB, and Wnt pathways were potentially deregulated in NPC. Real-time quantitative PCR was performed on selected mRNA/miRNAs in order to validate their expression. Transcript sequence variants such as short insertions and deletions (INDEL, single nucleotide variant (SNV, and isomiRs were characterized in the NPC model systems. A novel TP53 transcript variant was identified in NP460, HK1, and C666. Detection of three previously reported novel EBV-encoded BART miRNAs and their isomiRs were also observed. Meta-analysis of a model system to a clinical system aids the choice of different cell lines in NPC studies. This comprehensive characterization of mRNA and miRNA transcriptomes in NPC cell lines and the xenograft provides insights on miRNA regulation of mRNA and valuable resources on transcript variation and regulation in NPC, which are potentially useful for mechanistic and preclinical studies.

Detailed mapping of serotonin 5-HT{sub 1B} and 5-HT{sub 1D} receptor messenger RNA and ligand binding sites in guinea-pig brain and trigeminal ganglion: clues for function

Energy Technology Data Exchange (ETDEWEB)

Leysen, J.E. [Graduate School Neurosciences, Amsterdam (Netherlands); Schotte, A.; Jurzak, M.; Luyten, W.H.M.L. [Department of Biochemical Pharmacology, Janssen Research Foundation, Beerse (Belgium); Voorn, P.; Bonaventure, P. [Graduate School Neurosciences, Amsterdam (Netherlands)

1997-10-17

The similar pharmacology of the 5-HT{sub 1B} and 5-HT{sub 1D} receptors, and the lack of selective compounds sufficiently distinguishing between the two receptor subtypes, have hampered functional studies on these receptors. In order to provide clues for differential functional roles of the two subtypes, we performed a parallel localization study throughout the guinea-pig brain and the trigeminal ganglia by means of quantitative in situ hybridization histochemistry (using [{sup 35}S]-labelled riboprobes probes for receptor messenger RNA) and receptor autoradiography (using a new radioligand [{sup 3}H]alniditan).The anatomical patterns of 5-HT{sub 1B} and 5-HT{sub 1D} receptor messenger RNA were quite different. While 5-HT{sub 1B} receptor messenger RNA was abundant throughout the brain (with highest levels in the striatum, nucleus accumbens, olfactory tubercle, cortex, hypothalamus, hippocampal formation, amygdala, thalamus, dorsal raphe and cerebellum), 5-HT{sub 1D} receptor messenger RNA exhibited a more restricted pattern; it was found mainly in the olfactory tubercle, entorhinal cortex, dorsal raphe, cerebellum, mesencephalic trigeminal nucleus and in the trigeminal ganglion. The density of 5-HT{sub 1B/1D} binding sites (combined) obtained with [{sup 3}H]alniditan autoradiography was high in the substantia nigra, superior colliculus and globus pallidus, whereas lower levels were detected in the caudate-putamen, hypothalamus, hippocampal formation, amygdala, thalamus and central gray. This distribution pattern was indistinguishable from specific 5-HT{sub 1B} receptor labelling in the presence of ketanserin under conditions to occlude 5-HT{sub 1D} receptor labelling; hence the latter were below detection level. Relationships between the regional distributions of the receptor messenger RNAs and binding sites and particular neuroanatomical pathways are discussed with respect to possible functional roles of the 5-HT{sub 1B} and 5-HT{sub 1D} receptors. (Copyright (c

Effect of Thymine Starvation on Messenger Ribonucleic Acid Synthesis in Escherichia coli

Science.gov (United States)

Luzzati, Denise

1966-01-01

Luzzati, Denise (Institut de Biologie Physico-Chimique, Paris, France). Effect of thymine starvation on messenger ribonucleic acid synthesis in Escherichia coli. J. Bacteriol. 92:1435–1446. 1966.—During the course of thymine starvation, the rate of synthesis of messenger ribonucleic acid (mRNA, the rapidly labeled fraction of the RNA which decays in the presence of dinitrophenol or which hybridizes with deoxyribonucleic acid) decreases exponentially, in parallel with the viability of the thymine-starved bacteria. The ability of cell-free extracts of starved bacteria to incorporate ribonucleoside triphosphates into RNA was determined; it was found to be inferior to that of extracts from control cells. The analysis of the properties of cell-free extracts of starved cells shows that their decreased RNA polymerase activity is the consequence of a modification of their deoxyribonucleic acid, the ability of which to serve as a template for RNA polymerase decreases during starvation. PMID:5332402

Deep-sequencing protocols influence the results obtained in small-RNA sequencing.

Directory of Open Access Journals (Sweden)

Joern Toedling

Full Text Available Second-generation sequencing is a powerful method for identifying and quantifying small-RNA components of cells. However, little attention has been paid to the effects of the choice of sequencing platform and library preparation protocol on the results obtained. We present a thorough comparison of small-RNA sequencing libraries generated from the same embryonic stem cell lines, using different sequencing platforms, which represent the three major second-generation sequencing technologies, and protocols. We have analysed and compared the expression of microRNAs, as well as populations of small RNAs derived from repetitive elements. Despite the fact that different libraries display a good correlation between sequencing platforms, qualitative and quantitative variations in the results were found, depending on the protocol used. Thus, when comparing libraries from different biological samples, it is strongly recommended to use the same sequencing platform and protocol in order to ensure the biological relevance of the comparisons.

Computational prediction of miRNA genes from small RNA sequencing data

Directory of Open Access Journals (Sweden)

Wenjing eKang

2015-01-01

Full Text Available Next-generation sequencing now for the first time allows researchers to gauge the depth and variation of entire transcriptomes. However, now as rare transcripts can be detected that are present in cells at single copies, more advanced computational tools are needed to accurately annotate and profile them. miRNAs are 22 nucleotide small RNAs (sRNAs that post-transcriptionally reduce the output of protein coding genes. They have established roles in numerous biological processes, including cancers and other diseases. During miRNA biogenesis, the sRNAs are sequentially cleaved from precursor molecules that have a characteristic hairpin RNA structure. The vast majority of new miRNA genes that are discovered are mined from small RNA sequencing (sRNA-seq, which can detect more than a billion RNAs in a single run. However, given that many of the detected RNAs are degradation products from all types of transcripts, the accurate identification of miRNAs remain a non-trivial computational problem. Here we review the tools available to predict animal miRNAs from sRNA sequencing data. We present tools for generalist and specialist use cases, including prediction from massively pooled data or in species without reference genome. We also present wet-lab methods used to validate predicted miRNAs, and approaches to computationally benchmark prediction accuracy. For each tool, we reference validation experiments and benchmarking efforts. Last, we discuss the future of the field.

RNA sequencing: current and prospective uses in metabolic research.

Science.gov (United States)

Vikman, Petter; Fadista, Joao; Oskolkov, Nikolay

2014-10-01

Previous global RNA analysis was restricted to known transcripts in species with a defined transcriptome. Next generation sequencing has transformed transcriptomics by making it possible to analyse expressed genes with an exon level resolution from any tissue in any species without any a priori knowledge of which genes that are being expressed, splice patterns or their nucleotide sequence. In addition, RNA sequencing is a more sensitive technique compared with microarrays with a larger dynamic range, and it also allows for investigation of imprinting and allele-specific expression. This can be done for a cost that is able to compete with that of a microarray, making RNA sequencing a technique available to most researchers. Therefore RNA sequencing has recently become the state of the art with regards to large-scale RNA investigations and has to a large extent replaced microarrays. The only drawback is the large data amounts produced, which together with the complexity of the data can make a researcher spend far more time on analysis than performing the actual experiment. © 2014 Society for Endocrinology.

Guardian of Genetic Messenger-RNA-Binding Proteins

Directory of Open Access Journals (Sweden)

Antje Anji

2016-01-01

Full Text Available RNA in cells is always associated with RNA-binding proteins that regulate all aspects of RNA metabolism including RNA splicing, export from the nucleus, RNA localization, mRNA turn-over as well as translation. Given their diverse functions, cells express a variety of RNA-binding proteins, which play important roles in the pathologies of a number of diseases. In this review we focus on the effect of alcohol on different RNA-binding proteins and their possible contribution to alcohol-related disorders, and discuss the role of these proteins in the development of neurological diseases and cancer. We further discuss the conventional methods and newer techniques that are employed to identify RNA-binding proteins.

Nucleotide sequence of a human tRNA gene heterocluster

International Nuclear Information System (INIS)

Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

1986-01-01

Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues

Novel Approach to Analyzing MFE of Noncoding RNA Sequences.

Science.gov (United States)

George, Tina P; Thomas, Tessamma

2016-01-01

Genomic studies have become noncoding RNA (ncRNA) centric after the study of different genomes provided enormous information on ncRNA over the past decades. The function of ncRNA is decided by its secondary structure, and across organisms, the secondary structure is more conserved than the sequence itself. In this study, the optimal secondary structure or the minimum free energy (MFE) structure of ncRNA was found based on the thermodynamic nearest neighbor model. MFE of over 2600 ncRNA sequences was analyzed in view of its signal properties. Mathematical models linking MFE to the signal properties were found for each of the four classes of ncRNA analyzed. MFE values computed with the proposed models were in concordance with those obtained with the standard web servers. A total of 95% of the sequences analyzed had deviation of MFE values within ±15% relative to those obtained from standard web servers.

Sequence analysis of RNase MRP RNA reveals its origination from eukaryotic RNase P RNA

Science.gov (United States)

Zhu, Yanglong; Stribinskis, Vilius; Ramos, Kenneth S.; Li, Yong

2006-01-01

RNase MRP is a eukaryote-specific endoribonuclease that generates RNA primers for mitochondrial DNA replication and processes precursor rRNA. RNase P is a ubiquitous endoribonuclease that cleaves precursor tRNA transcripts to produce their mature 5′ termini. We found extensive sequence homology of catalytic domains and specificity domains between their RNA subunits in many organisms. In Candida glabrata, the internal loop of helix P3 is 100% conserved between MRP and P RNAs. The helix P8 of MRP RNA from microsporidia Encephalitozoon cuniculi is identical to that of P RNA. Sequence homology can be widely spread over the whole molecule of MRP RNA and P RNA, such as those from Dictyostelium discoideum. These conserved nucleotides between the MRP and P RNAs strongly support the hypothesis that the MRP RNA is derived from the P RNA molecule in early eukaryote evolution. PMID:16540690

Nicotiana small RNA sequences support a host genome origin of cucumber mosaic virus satellite RNA.

Directory of Open Access Journals (Sweden)

Kiran Zahid

2015-01-01

Full Text Available Satellite RNAs (satRNAs are small noncoding subviral RNA pathogens in plants that depend on helper viruses for replication and spread. Despite many decades of research, the origin of satRNAs remains unknown. In this study we show that a β-glucuronidase (GUS transgene fused with a Cucumber mosaic virus (CMV Y satellite RNA (Y-Sat sequence (35S-GUS:Sat was transcriptionally repressed in N. tabacum in comparison to a 35S-GUS transgene that did not contain the Y-Sat sequence. This repression was not due to DNA methylation at the 35S promoter, but was associated with specific DNA methylation at the Y-Sat sequence. Both northern blot hybridization and small RNA deep sequencing detected 24-nt siRNAs in wild-type Nicotiana plants with sequence homology to Y-Sat, suggesting that the N. tabacum genome contains Y-Sat-like sequences that give rise to 24-nt sRNAs capable of guiding RNA-directed DNA methylation (RdDM to the Y-Sat sequence in the 35S-GUS:Sat transgene. Consistent with this, Southern blot hybridization detected multiple DNA bands in Nicotiana plants that had sequence homology to Y-Sat, suggesting that Y-Sat-like sequences exist in the Nicotiana genome as repetitive DNA, a DNA feature associated with 24-nt sRNAs. Our results point to a host genome origin for CMV satRNAs, and suggest novel approach of using small RNA sequences for finding the origin of other satRNAs.

Complementary DNA and derived amino acid sequence of the α subunit of human complement protein C8: evidence for the existence of a separate α subunit messenger RNA

International Nuclear Information System (INIS)

Rao, A.G.; Howard, O.M.Z.; Ng, S.C.; Whitehead, A.S.; Colten, H.R.; Sodetz, J.M.

1987-01-01

The entire amino acid sequence of the α subunit (M/sub r/ 64,000) of the eight component of complement (C8) was determined by characterizing cDNA clones isolated from a human liver cDNA library. Two clones with overlapping inserts of net length 2.44 kilobases (kb) were isolated and found to contain the entire α coding region [1659 base pairs (bp)]. The 5' end consists of an untranslated region and a leader sequence of 30 amino acids. This sequence contains an apparent initiation Met, signal peptide, and propeptide which ends with an arginine-rich sequence that is characteristic of proteolytic processing sites found in the pro form of protein precursors. The 3' untranslated region contains two polyadenylation signals and a poly(A)sequence. RNA blot analysis of total cellular RNA from the human hepatoma cell line HepG2 revealed a message size of ∼2.5 kb. Features of the 5' and 3' sequences and the message size suggest that a separate mRNA codes for α and argues against the occurrence of a single-chain precursor form of the disulfide-linked α-λ subunit found in mature C8. Analysis of the derived amino acid sequence revealed several membrane surface seeking domains and a possible transmembrane domain. Analysis of the carbohydrate composition indicates 1 or 2 asparagine-linked but no O-linked oligosaccharide chains, a result consistent with predictions from the amino acid sequence. Most significantly, it exhibits a striking overall homology to human C9, with values of 24% on the basis of identity and 46% when conserved substitutions are allowed. As described in an accompanying report this homology also extends to the β subunit of C8

mESAdb: microRNA expression and sequence analysis database.

Science.gov (United States)

Kaya, Koray D; Karakülah, Gökhan; Yakicier, Cengiz M; Acar, Aybar C; Konu, Ozlen

2011-01-01

microRNA expression and sequence analysis database (http://konulab.fen.bilkent.edu.tr/mirna/) (mESAdb) is a regularly updated database for the multivariate analysis of sequences and expression of microRNAs from multiple taxa. mESAdb is modular and has a user interface implemented in PHP and JavaScript and coupled with statistical analysis and visualization packages written for the R language. The database primarily comprises mature microRNA sequences and their target data, along with selected human, mouse and zebrafish expression data sets. mESAdb analysis modules allow (i) mining of microRNA expression data sets for subsets of microRNAs selected manually or by motif; (ii) pair-wise multivariate analysis of expression data sets within and between taxa; and (iii) association of microRNA subsets with annotation databases, HUGE Navigator, KEGG and GO. The use of existing and customized R packages facilitates future addition of data sets and analysis tools. Furthermore, the ability to upload and analyze user-specified data sets makes mESAdb an interactive and expandable analysis tool for microRNA sequence and expression data.

RISC RNA sequencing for context-specific identification of in vivo microRNA targets.

Science.gov (United States)

Matkovich, Scot J; Van Booven, Derek J; Eschenbacher, William H; Dorn, Gerald W

2011-01-07

MicroRNAs (miRs) are expanding our understanding of cardiac disease and have the potential to transform cardiovascular therapeutics. One miR can target hundreds of individual mRNAs, but existing methodologies are not sufficient to accurately and comprehensively identify these mRNA targets in vivo. To develop methods permitting identification of in vivo miR targets in an unbiased manner, using massively parallel sequencing of mouse cardiac transcriptomes in combination with sequencing of mRNA associated with mouse cardiac RNA-induced silencing complexes (RISCs). We optimized techniques for expression profiling small amounts of RNA without introducing amplification bias and applied this to anti-Argonaute 2 immunoprecipitated RISCs (RISC-Seq) from mouse hearts. By comparing RNA-sequencing results of cardiac RISC and transcriptome from the same individual hearts, we defined 1645 mRNAs consistently targeted to mouse cardiac RISCs. We used this approach in hearts overexpressing miRs from Myh6 promoter-driven precursors (programmed RISC-Seq) to identify 209 in vivo targets of miR-133a and 81 in vivo targets of miR-499. Consistent with the fact that miR-133a and miR-499 have widely differing "seed" sequences and belong to different miR families, only 6 targets were common to miR-133a- and miR-499-programmed hearts. RISC-sequencing is a highly sensitive method for general RISC profiling and individual miR target identification in biological context and is applicable to any tissue and any disease state.

International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

Science.gov (United States)

Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

2015-01-01

This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

Directory of Open Access Journals (Sweden)

Nathan D. Olson

2015-03-01

Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

Diagnostic accuracy of circulating thyrotropin receptor messenger RNA combined with neck ultrasonography in patients with Bethesda III-V thyroid cytology.

Science.gov (United States)

Aliyev, Altay; Patel, Jinesh; Brainard, Jennifer; Gupta, Manjula; Nasr, Christian; Hatipoglu, Betul; Siperstein, Allan; Berber, Eren

2016-01-01

The aim of this study was to analyze the usefulness of thyrotropin receptor messenger RNA (TSHR-mRNA) combined with neck ultrasonography (US) in the management of thyroid nodules with Bethesda III-V cytology. Cytology slides of patients with a preoperative fine needle aspiration (FNA) and TSHR-mRNA who underwent thyroidectomy between 2002 and 2011 were recategorized based on the Bethesda classification. Results of thyroid FNA, TSHR-mRNA, and US were compared with the final pathology. Sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) were calculated. There were 12 patients with Bethesda III, 112 with Bethesda IV, and 58 with Bethesda V cytology. The sensitivity of TSHR-mRNA in predicting cancer was 33%, 65%, and 79 %, and specificity was 67%, 66%, and 71%, for Bethesda III, IV, and V categories, respectively. For the same categories, the PPV of TSHR-mRNA was 25%, 33%, and 79%, respectively; whereas the NPV was 75%, 88%, and 71%, respectively. The addition of neck US to TSHR-mRNA increased the NPV to 100% for Bethesda III, and 86%, for Bethesda IV, and 82% for Bethesda V disease. This study documents the potential usefulness of TSHR-mRNA for thyroid nodules with Bethesda III-V FNA categories. TSHR-mRNA may be used to exclude Bethesda IV disease. A large sample analysis is needed to determine its accuracy for Bethesda category III nodules. Copyright © 2016 Elsevier Inc. All rights reserved.

BioVLAB-MMIA-NGS: microRNA-mRNA integrated analysis using high-throughput sequencing data.

Science.gov (United States)

Chae, Heejoon; Rhee, Sungmin; Nephew, Kenneth P; Kim, Sun

2015-01-15

It is now well established that microRNAs (miRNAs) play a critical role in regulating gene expression in a sequence-specific manner, and genome-wide efforts are underway to predict known and novel miRNA targets. However, the integrated miRNA-mRNA analysis remains a major computational challenge, requiring powerful informatics systems and bioinformatics expertise. The objective of this study was to modify our widely recognized Web server for the integrated mRNA-miRNA analysis (MMIA) and its subsequent deployment on the Amazon cloud (BioVLAB-MMIA) to be compatible with high-throughput platforms, including next-generation sequencing (NGS) data (e.g. RNA-seq). We developed a new version called the BioVLAB-MMIA-NGS, deployed on both Amazon cloud and on a high-performance publicly available server called MAHA. By using NGS data and integrating various bioinformatics tools and databases, BioVLAB-MMIA-NGS offers several advantages. First, sequencing data is more accurate than array-based methods for determining miRNA expression levels. Second, potential novel miRNAs can be detected by using various computational methods for characterizing miRNAs. Third, because miRNA-mediated gene regulation is due to hybridization of an miRNA to its target mRNA, sequencing data can be used to identify many-to-many relationship between miRNAs and target genes with high accuracy. http://epigenomics.snu.ac.kr/biovlab_mmia_ngs/. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Natural RNA circles function as efficient microRNA sponges

DEFF Research Database (Denmark)

Hansen, Thomas Birkballe; Jensen, Trine I; Clausen, Bettina Hjelm

2013-01-01

MicroRNAs (miRNAs) are important post-transcriptional regulators of gene expression that act by direct base pairing to target sites within untranslated regions of messenger RNAs. Recently, miRNA activity has been shown to be affected by the presence of miRNA sponge transcripts, the so-called comp......MicroRNAs (miRNAs) are important post-transcriptional regulators of gene expression that act by direct base pairing to target sites within untranslated regions of messenger RNAs. Recently, miRNA activity has been shown to be affected by the presence of miRNA sponge transcripts, the so......-called competing endogenous RNA in humans and target mimicry in plants. We previously identified a highly expressed circular RNA (circRNA) in human and mouse brain. Here we show that this circRNA acts as a miR-7 sponge; we term this circular transcript ciRS-7 (circular RNA sponge for miR-7). ciRS-7 contains more...... sponge, suggesting that miRNA sponge effects achieved by circRNA formation are a general phenomenon. This study serves as the first, to our knowledge, functional analysis of a naturally expressed circRNA....

Shielding the messenger (RNA): microRNA-based anticancer therapies

Science.gov (United States)

Sotillo, Elena; Thomas-Tikhonenko, Andrei

2011-01-01

It has been a decade since scientists realized that microRNAs (miRNAs) are not an oddity invented by worms to regulate gene expression at post-transcriptional levels. Rather, many of these 21–22-nucleotide-short RNAs exist in invertebrates and vertebrates alike and some of them are in fact highly conserved. miRNAs are now recognized as an important class of non-coding small RNAs that inhibit gene expression by targeting mRNA stability and translation. In the last ten years, our knowledge of the miRNAs world was expanding at vertiginous speed, propelled by the development of computational engines for miRNA identification and target prediction, biochemical tools and techniques to modulate miRNA activity, and last but not least, the emergence of miRNA-centric animal models. One important conclusion that has emerged from this effort is that many microRNAs and their cognate targets are strongly implicated in cancer, either as oncogenes or tumor and metastasis suppressors. In this review we will discuss the diverse role that miRNAs play in cancer initiation and progression and also the tools with which miRNA expression could be corrected in vivo. While the idea of targeting microRNAs towards therapeutic ends is getting considerable traction, basic, translational, and clinical research done in the next few years will tell whether this promise is well-founded. PMID:21514318

Reconstruction of ancestral RNA sequences under multiple structural constraints.

Science.gov (United States)

Tremblay-Savard, Olivier; Reinharz, Vladimir; Waldispühl, Jérôme

2016-11-11

Secondary structures form the scaffold of multiple sequence alignment of non-coding RNA (ncRNA) families. An accurate reconstruction of ancestral ncRNAs must use this structural signal. However, the inference of ancestors of a single ncRNA family with a single consensus structure may bias the results towards sequences with high affinity to this structure, which are far from the true ancestors. In this paper, we introduce achARNement, a maximum parsimony approach that, given two alignments of homologous ncRNA families with consensus secondary structures and a phylogenetic tree, simultaneously calculates ancestral RNA sequences for these two families. We test our methodology on simulated data sets, and show that achARNement outperforms classical maximum parsimony approaches in terms of accuracy, but also reduces by several orders of magnitude the number of candidate sequences. To conclude this study, we apply our algorithms on the Glm clan and the FinP-traJ clan from the Rfam database. Our results show that our methods reconstruct small sets of high-quality candidate ancestors with better agreement to the two target structures than with classical approaches. Our program is freely available at: http://csb.cs.mcgill.ca/acharnement .

Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.

Science.gov (United States)

Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu

2014-02-04

TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.

Programmable RNA recognition and cleavage by CRISPR/Cas9.

Science.gov (United States)

O'Connell, Mitchell R; Oakes, Benjamin L; Sternberg, Samuel H; East-Seletsky, Alexandra; Kaplan, Matias; Doudna, Jennifer A

2014-12-11

The CRISPR-associated protein Cas9 is an RNA-guided DNA endonuclease that uses RNA-DNA complementarity to identify target sites for sequence-specific double-stranded DNA (dsDNA) cleavage. In its native context, Cas9 acts on DNA substrates exclusively because both binding and catalysis require recognition of a short DNA sequence, known as the protospacer adjacent motif (PAM), next to and on the strand opposite the twenty-nucleotide target site in dsDNA. Cas9 has proven to be a versatile tool for genome engineering and gene regulation in a large range of prokaryotic and eukaryotic cell types, and in whole organisms, but it has been thought to be incapable of targeting RNA. Here we show that Cas9 binds with high affinity to single-stranded RNA (ssRNA) targets matching the Cas9-associated guide RNA sequence when the PAM is presented in trans as a separate DNA oligonucleotide. Furthermore, PAM-presenting oligonucleotides (PAMmers) stimulate site-specific endonucleolytic cleavage of ssRNA targets, similar to PAM-mediated stimulation of Cas9-catalysed DNA cleavage. Using specially designed PAMmers, Cas9 can be specifically directed to bind or cut RNA targets while avoiding corresponding DNA sequences, and we demonstrate that this strategy enables the isolation of a specific endogenous messenger RNA from cells. These results reveal a fundamental connection between PAM binding and substrate selection by Cas9, and highlight the utility of Cas9 for programmable transcript recognition without the need for tags.

Reconstruction of ancestral RNA sequences under multiple structural constraints

OpenAIRE

Tremblay-Savard, Olivier; Reinharz, Vladimir; Waldisp?hl, J?r?me

2016-01-01

Background Secondary structures form the scaffold of multiple sequence alignment of non-coding RNA (ncRNA) families. An accurate reconstruction of ancestral ncRNAs must use this structural signal. However, the inference of ancestors of a single ncRNA family with a single consensus structure may bias the results towards sequences with high affinity to this structure, which are far from the true ancestors. Methods In this paper, we introduce achARNement, a maximum parsimony approach that, given...

Next-generation sequencing library preparation method for identification of RNA viruses on the Ion Torrent Sequencing Platform.

Science.gov (United States)

Chen, Guiqian; Qiu, Yuan; Zhuang, Qingye; Wang, Suchun; Wang, Tong; Chen, Jiming; Wang, Kaicheng

2018-05-09

Next generation sequencing (NGS) is a powerful tool for the characterization, discovery, and molecular identification of RNA viruses. There were multiple NGS library preparation methods published for strand-specific RNA-seq, but some methods are not suitable for identifying and characterizing RNA viruses. In this study, we report a NGS library preparation method to identify RNA viruses using the Ion Torrent PGM platform. The NGS sequencing adapters were directly inserted into the sequencing library through reverse transcription and polymerase chain reaction, without fragmentation and ligation of nucleic acids. The results show that this method is simple to perform, able to identify multiple species of RNA viruses in clinical samples.

Sequence-structure relationships in RNA loops: establishing the basis for loop homology modeling.

Science.gov (United States)

Schudoma, Christian; May, Patrick; Nikiforova, Viktoria; Walther, Dirk

2010-01-01

The specific function of RNA molecules frequently resides in their seemingly unstructured loop regions. We performed a systematic analysis of RNA loops extracted from experimentally determined three-dimensional structures of RNA molecules. A comprehensive loop-structure data set was created and organized into distinct clusters based on structural and sequence similarity. We detected clear evidence of the hallmark of homology present in the sequence-structure relationships in loops. Loops differing by structures. Thus, our results support the application of homology modeling for RNA loop model building. We established a threshold that may guide the sequence divergence-based selection of template structures for RNA loop homology modeling. Of all possible sequences that are, under the assumption of isosteric relationships, theoretically compatible with actual sequences observed in RNA structures, only a small fraction is contained in the Rfam database of RNA sequences and classes implying that the actual RNA loop space may consist of a limited number of unique loop structures and conserved sequences. The loop-structure data sets are made available via an online database, RLooM. RLooM also offers functionalities for the modeling of RNA loop structures in support of RNA engineering and design efforts.

Mutation of miRNA target sequences during human evolution

DEFF Research Database (Denmark)

Gardner, Paul P; Vinther, Jeppe

2008-01-01

It has long-been hypothesized that changes in non-protein-coding genes and the regulatory sequences controlling expression could undergo positive selection. Here we identify 402 putative microRNA (miRNA) target sequences that have been mutated specifically in the human lineage and show that genes...... containing such deletions are more highly expressed than their mouse orthologs. Our findings indicate that some miRNA target mutations are fixed by positive selection and might have been involved in the evolution of human-specific traits....

Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

Science.gov (United States)

Szymanski, Maciej; Karlowski, Wojciech M

2016-01-01

In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

SimFuse: A Novel Fusion Simulator for RNA Sequencing (RNA-Seq Data

Directory of Open Access Journals (Sweden)

Yuxiang Tan

2015-01-01

Full Text Available The performance evaluation of fusion detection algorithms from high-throughput sequencing data crucially relies on the availability of data with known positive and negative cases of gene rearrangements. The use of simulated data circumvents some shortcomings of real data by generation of an unlimited number of true and false positive events, and the consequent robust estimation of accuracy measures, such as precision and recall. Although a few simulated fusion datasets from RNA Sequencing (RNA-Seq are available, they are of limited sample size. This makes it difficult to systematically evaluate the performance of RNA-Seq based fusion-detection algorithms. Here, we present SimFuse to address this problem. SimFuse utilizes real sequencing data as the fusions’ background to closely approximate the distribution of reads from a real sequencing library and uses a reference genome as the template from which to simulate fusions’ supporting reads. To assess the supporting read-specific performance, SimFuse generates multiple datasets with various numbers of fusion supporting reads. Compared to an extant simulated dataset, SimFuse gives users control over the supporting read features and the sample size of the simulated library, based on which the performance metrics needed for the validation and comparison of alternative fusion-detection algorithms can be rigorously estimated.

sRNAnalyzer-a flexible and customizable small RNA sequencing data analysis pipeline.

Science.gov (United States)

Wu, Xiaogang; Kim, Taek-Kyun; Baxter, David; Scherler, Kelsey; Gordon, Aaron; Fong, Olivia; Etheridge, Alton; Galas, David J; Wang, Kai

2017-12-01

Although many tools have been developed to analyze small RNA sequencing (sRNA-Seq) data, it remains challenging to accurately analyze the small RNA population, mainly due to multiple sequence ID assignment caused by short read length. Additional issues in small RNA analysis include low consistency of microRNA (miRNA) measurement results across different platforms, miRNA mapping associated with miRNA sequence variation (isomiR) and RNA editing, and the origin of those unmapped reads after screening against all endogenous reference sequence databases. To address these issues, we built a comprehensive and customizable sRNA-Seq data analysis pipeline-sRNAnalyzer, which enables: (i) comprehensive miRNA profiling strategies to better handle isomiRs and summarization based on each nucleotide position to detect potential SNPs in miRNAs, (ii) different sequence mapping result assignment approaches to simulate results from microarray/qRT-PCR platforms and a local probabilistic model to assign mapping results to the most-likely IDs, (iii) comprehensive ribosomal RNA filtering for accurate mapping of exogenous RNAs and summarization based on taxonomy annotation. We evaluated our pipeline on both artificial samples (including synthetic miRNA and Escherichia coli cultures) and biological samples (human tissue and plasma). sRNAnalyzer is implemented in Perl and available at: http://srnanalyzer.systemsbiology.net/. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

sRNAnalyzer—a flexible and customizable small RNA sequencing data analysis pipeline

Science.gov (United States)

Kim, Taek-Kyun; Baxter, David; Scherler, Kelsey; Gordon, Aaron; Fong, Olivia; Etheridge, Alton; Galas, David J.

2017-01-01

Abstract Although many tools have been developed to analyze small RNA sequencing (sRNA-Seq) data, it remains challenging to accurately analyze the small RNA population, mainly due to multiple sequence ID assignment caused by short read length. Additional issues in small RNA analysis include low consistency of microRNA (miRNA) measurement results across different platforms, miRNA mapping associated with miRNA sequence variation (isomiR) and RNA editing, and the origin of those unmapped reads after screening against all endogenous reference sequence databases. To address these issues, we built a comprehensive and customizable sRNA-Seq data analysis pipeline—sRNAnalyzer, which enables: (i) comprehensive miRNA profiling strategies to better handle isomiRs and summarization based on each nucleotide position to detect potential SNPs in miRNAs, (ii) different sequence mapping result assignment approaches to simulate results from microarray/qRT-PCR platforms and a local probabilistic model to assign mapping results to the most-likely IDs, (iii) comprehensive ribosomal RNA filtering for accurate mapping of exogenous RNAs and summarization based on taxonomy annotation. We evaluated our pipeline on both artificial samples (including synthetic miRNA and Escherichia coli cultures) and biological samples (human tissue and plasma). sRNAnalyzer is implemented in Perl and available at: http://srnanalyzer.systemsbiology.net/. PMID:29069500

Reconstruction of ancestral RNA sequences under multiple structural constraints

Directory of Open Access Journals (Sweden)

Olivier Tremblay-Savard

2016-11-01

Full Text Available Abstract Background Secondary structures form the scaffold of multiple sequence alignment of non-coding RNA (ncRNA families. An accurate reconstruction of ancestral ncRNAs must use this structural signal. However, the inference of ancestors of a single ncRNA family with a single consensus structure may bias the results towards sequences with high affinity to this structure, which are far from the true ancestors. Methods In this paper, we introduce achARNement, a maximum parsimony approach that, given two alignments of homologous ncRNA families with consensus secondary structures and a phylogenetic tree, simultaneously calculates ancestral RNA sequences for these two families. Results We test our methodology on simulated data sets, and show that achARNement outperforms classical maximum parsimony approaches in terms of accuracy, but also reduces by several orders of magnitude the number of candidate sequences. To conclude this study, we apply our algorithms on the Glm clan and the FinP-traJ clan from the Rfam database. Conclusions Our results show that our methods reconstruct small sets of high-quality candidate ancestors with better agreement to the two target structures than with classical approaches. Our program is freely available at: http://csb.cs.mcgill.ca/acharnement .

Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

Directory of Open Access Journals (Sweden)

Jennifer A Mitchell

Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

eRNA: a graphic user interface-based tool optimized for large data analysis from high-throughput RNA sequencing.

Science.gov (United States)

Yuan, Tiezheng; Huang, Xiaoyi; Dittmar, Rachel L; Du, Meijun; Kohli, Manish; Boardman, Lisa; Thibodeau, Stephen N; Wang, Liang

2014-03-05

RNA sequencing (RNA-seq) is emerging as a critical approach in biological research. However, its high-throughput advantage is significantly limited by the capacity of bioinformatics tools. The research community urgently needs user-friendly tools to efficiently analyze the complicated data generated by high throughput sequencers. We developed a standalone tool with graphic user interface (GUI)-based analytic modules, known as eRNA. The capacity of performing parallel processing and sample management facilitates large data analyses by maximizing hardware usage and freeing users from tediously handling sequencing data. The module miRNA identification" includes GUIs for raw data reading, adapter removal, sequence alignment, and read counting. The module "mRNA identification" includes GUIs for reference sequences, genome mapping, transcript assembling, and differential expression. The module "Target screening" provides expression profiling analyses and graphic visualization. The module "Self-testing" offers the directory setups, sample management, and a check for third-party package dependency. Integration of other GUIs including Bowtie, miRDeep2, and miRspring extend the program's functionality. eRNA focuses on the common tools required for the mapping and quantification analysis of miRNA-seq and mRNA-seq data. The software package provides an additional choice for scientists who require a user-friendly computing environment and high-throughput capacity for large data analysis. eRNA is available for free download at https://sourceforge.net/projects/erna/?source=directory.

Computational tools for genome-wide miRNA prediction and study

KAUST Repository

Malas, T.B.

2012-11-02

MicroRNAs (miRNAs) are single-stranded non-coding RNA susually of 22 nucleotidesin length that play an important post-transcriptional regulation role in many organisms. MicroRNAs bind a seed sequence to the 3-untranslated region (UTR) region of the target messenger RNA (mRNA), inducing degradation or inhibition of translation and resulting in a reduction in the protein level. This regulatory mechanism is central to many biological processes and perturbation could lead to diseases such as cancer. Given the biological importance, of miRNAs, there is a great need to identify and study their targets and functions. However, miRNAs are very difficult to clone in the lab and this has hindered the identification of novel miRNAs. Next-generation sequencing coupled with new computational tools has recently evolved to help researchers efficiently identify large numbers of novel miRNAs. In this review, we describe recent miRNA prediction tools and discuss their priorities, advantages and disadvantages. Malas and Ravasi.

Computational tools for genome-wide miRNA prediction and study

KAUST Repository

Malas, T.B.; Ravasi, Timothy

2012-01-01

MicroRNAs (miRNAs) are single-stranded non-coding RNA susually of 22 nucleotidesin length that play an important post-transcriptional regulation role in many organisms. MicroRNAs bind a seed sequence to the 3-untranslated region (UTR) region of the target messenger RNA (mRNA), inducing degradation or inhibition of translation and resulting in a reduction in the protein level. This regulatory mechanism is central to many biological processes and perturbation could lead to diseases such as cancer. Given the biological importance, of miRNAs, there is a great need to identify and study their targets and functions. However, miRNAs are very difficult to clone in the lab and this has hindered the identification of novel miRNAs. Next-generation sequencing coupled with new computational tools has recently evolved to help researchers efficiently identify large numbers of novel miRNAs. In this review, we describe recent miRNA prediction tools and discuss their priorities, advantages and disadvantages. Malas and Ravasi.

A tale of two sequences: microRNA-target chimeric reads.

Science.gov (United States)

Broughton, James P; Pasquinelli, Amy E

2016-04-04

In animals, a functional interaction between a microRNA (miRNA) and its target RNA requires only partial base pairing. The limited number of base pair interactions required for miRNA targeting provides miRNAs with broad regulatory potential and also makes target prediction challenging. Computational approaches to target prediction have focused on identifying miRNA target sites based on known sequence features that are important for canonical targeting and may miss non-canonical targets. Current state-of-the-art experimental approaches, such as CLIP-seq (cross-linking immunoprecipitation with sequencing), PAR-CLIP (photoactivatable-ribonucleoside-enhanced CLIP), and iCLIP (individual-nucleotide resolution CLIP), require inference of which miRNA is bound at each site. Recently, the development of methods to ligate miRNAs to their target RNAs during the preparation of sequencing libraries has provided a new tool for the identification of miRNA target sites. The chimeric, or hybrid, miRNA-target reads that are produced by these methods unambiguously identify the miRNA bound at a specific target site. The information provided by these chimeric reads has revealed extensive non-canonical interactions between miRNAs and their target mRNAs, and identified many novel interactions between miRNAs and noncoding RNAs.

RStrucFam: a web server to associate structure and cognate RNA for RNA-binding proteins from sequence information.

Science.gov (United States)

Ghosh, Pritha; Mathew, Oommen K; Sowdhamini, Ramanathan

2016-10-07

RNA-binding proteins (RBPs) interact with their cognate RNA(s) to form large biomolecular assemblies. They are versatile in their functionality and are involved in a myriad of processes inside the cell. RBPs with similar structural features and common biological functions are grouped together into families and superfamilies. It will be useful to obtain an early understanding and association of RNA-binding property of sequences of gene products. Here, we report a web server, RStrucFam, to predict the structure, type of cognate RNA(s) and function(s) of proteins, where possible, from mere sequence information. The web server employs Hidden Markov Model scan (hmmscan) to enable association to a back-end database of structural and sequence families. The database (HMMRBP) comprises of 437 HMMs of RBP families of known structure that have been generated using structure-based sequence alignments and 746 sequence-centric RBP family HMMs. The input protein sequence is associated with structural or sequence domain families, if structure or sequence signatures exist. In case of association of the protein with a family of known structures, output features like, multiple structure-based sequence alignment (MSSA) of the query with all others members of that family is provided. Further, cognate RNA partner(s) for that protein, Gene Ontology (GO) annotations, if any and a homology model of the protein can be obtained. The users can also browse through the database for details pertaining to each family, protein or RNA and their related information based on keyword search or RNA motif search. RStrucFam is a web server that exploits structurally conserved features of RBPs, derived from known family members and imprinted in mathematical profiles, to predict putative RBPs from sequence information. Proteins that fail to associate with such structure-centric families are further queried against the sequence-centric RBP family HMMs in the HMMRBP database. Further, all other essential

Defining reference sequences for Nocardia species by similarity and clustering analyses of 16S rRNA gene sequence data.

Directory of Open Access Journals (Sweden)

Manal Helal

Full Text Available BACKGROUND: The intra- and inter-species genetic diversity of bacteria and the absence of 'reference', or the most representative, sequences of individual species present a significant challenge for sequence-based identification. The aims of this study were to determine the utility, and compare the performance of several clustering and classification algorithms to identify the species of 364 sequences of 16S rRNA gene with a defined species in GenBank, and 110 sequences of 16S rRNA gene with no defined species, all within the genus Nocardia. METHODS: A total of 364 16S rRNA gene sequences of Nocardia species were studied. In addition, 110 16S rRNA gene sequences assigned only to the Nocardia genus level at the time of submission to GenBank were used for machine learning classification experiments. Different clustering algorithms were compared with a novel algorithm or the linear mapping (LM of the distance matrix. Principal Components Analysis was used for the dimensionality reduction and visualization. RESULTS: The LM algorithm achieved the highest performance and classified the set of 364 16S rRNA sequences into 80 clusters, the majority of which (83.52% corresponded with the original species. The most representative 16S rRNA sequences for individual Nocardia species have been identified as 'centroids' in respective clusters from which the distances to all other sequences were minimized; 110 16S rRNA gene sequences with identifications recorded only at the genus level were classified using machine learning methods. Simple kNN machine learning demonstrated the highest performance and classified Nocardia species sequences with an accuracy of 92.7% and a mean frequency of 0.578. CONCLUSION: The identification of centroids of 16S rRNA gene sequence clusters using novel distance matrix clustering enables the identification of the most representative sequences for each individual species of Nocardia and allows the quantitation of inter- and intra

Full-length mRNA sequencing uncovers a widespread coupling between transcription initiation and mRNA processing.

Science.gov (United States)

Anvar, Seyed Yahya; Allard, Guy; Tseng, Elizabeth; Sheynkman, Gloria M; de Klerk, Eleonora; Vermaat, Martijn; Yin, Raymund H; Johansson, Hans E; Ariyurek, Yavuz; den Dunnen, Johan T; Turner, Stephen W; 't Hoen, Peter A C

2018-03-29

The multifaceted control of gene expression requires tight coordination of regulatory mechanisms at transcriptional and post-transcriptional level. Here, we studied the interdependence of transcription initiation, splicing and polyadenylation events on single mRNA molecules by full-length mRNA sequencing. In MCF-7 breast cancer cells, we find 2700 genes with interdependent alternative transcription initiation, splicing and polyadenylation events, both in proximal and distant parts of mRNA molecules, including examples of coupling between transcription start sites and polyadenylation sites. The analysis of three human primary tissues (brain, heart and liver) reveals similar patterns of interdependency between transcription initiation and mRNA processing events. We predict thousands of novel open reading frames from full-length mRNA sequences and obtained evidence for their translation by shotgun proteomics. The mapping database rescues 358 previously unassigned peptides and improves the assignment of others. By recognizing sample-specific amino-acid changes and novel splicing patterns, full-length mRNA sequencing improves proteogenomics analysis of MCF-7 cells. Our findings demonstrate that our understanding of transcriptome complexity is far from complete and provides a basis to reveal largely unresolved mechanisms that coordinate transcription initiation and mRNA processing.

"Transcriptomics": molecular diagnosis of inborn errors of metabolism via RNA-sequencing.

Science.gov (United States)

Kremer, Laura S; Wortmann, Saskia B; Prokisch, Holger

2018-01-25

Exome wide sequencing techniques have revolutionized molecular diagnostics in patients with suspected inborn errors of metabolism or neuromuscular disorders. However, the diagnostic yield of 25-60% still leaves a large fraction of individuals without a diagnosis. This indicates a causative role for non-exonic regulatory variants not covered by whole exome sequencing. Here we review how systematic RNA-sequencing analysis (RNA-seq, "transcriptomics") lead to a molecular diagnosis in 10-35% of patients in whom whole exome sequencing failed to do so. Importantly, RNA-sequencing based discoveries cannot only guide molecular diagnosis but might also unravel therapeutic intervention points such as antisense oligonucleotide treatment for splicing defects as recently reported for spinal muscular atrophy.

Natural selection and algorithmic design of mRNA.

Science.gov (United States)

Cohen, Barry; Skiena, Steven

2003-01-01

Messenger RNA (mRNA) sequences serve as templates for proteins according to the triplet code, in which each of the 4(3) = 64 different codons (sequences of three consecutive nucleotide bases) in RNA either terminate transcription or map to one of the 20 different amino acids (or residues) which build up proteins. Because there are more codons than residues, there is inherent redundancy in the coding. Certain residues (e.g., tryptophan) have only a single corresponding codon, while other residues (e.g., arginine) have as many as six corresponding codons. This freedom implies that the number of possible RNA sequences coding for a given protein grows exponentially in the length of the protein. Thus nature has wide latitude to select among mRNA sequences which are informationally equivalent, but structurally and energetically divergent. In this paper, we explore how nature takes advantage of this freedom and how to algorithmically design structures more energetically favorable than have been built through natural selection. In particular: (1) Natural Selection--we perform the first large-scale computational experiment comparing the stability of mRNA sequences from a variety of organisms to random synonymous sequences which respect the codon preferences of the organism. This experiment was conducted on over 27,000 sequences from 34 microbial species with 36 genomic structures. We provide evidence that in all genomic structures highly stable sequences are disproportionately abundant, and in 19 of 36 cases highly unstable sequences are disproportionately abundant. This suggests that the stability of mRNA sequences is subject to natural selection. (2) Artificial Selection--motivated by these biological results, we examine the algorithmic problem of designing the most stable and unstable mRNA sequences which code for a target protein. We give a polynomial-time dynamic programming solution to the most stable sequence problem (MSSP), which is asymptotically no more complex

Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes.

Directory of Open Access Journals (Sweden)

Thomas Birkballe Hansen

Full Text Available BACKGROUND: miRNAs are key players in gene expression regulation. To fully understand the complex nature of cellular differentiation or initiation and progression of disease, it is important to assess the expression patterns of as many miRNAs as possible. Thereby, identifying novel miRNAs is an essential prerequisite to make possible a comprehensive and coherent understanding of cellular biology. METHODOLOGY/PRINCIPAL FINDINGS: Based on two extensive, but previously published, small RNA sequence datasets from human embryonic stem cells and human embroid bodies, respectively [1], we identified 112 novel miRNA-like structures and were able to validate miRNA processing in 12 out of 17 investigated cases. Several miRNA candidates were furthermore substantiated by including additional available small RNA datasets, thereby demonstrating the power of combining datasets to identify miRNAs that otherwise may be assigned as experimental noise. CONCLUSIONS/SIGNIFICANCE: Our analysis highlights that existing datasets are not yet exhaustedly studied and continuous re-analysis of the available data is important to uncover all features of small RNA sequencing.

MicroRNA sequence motifs reveal asymmetry between the stem arms

DEFF Research Database (Denmark)

Gorodkin, Jan; Havgaard, Jakob Hull; Ensterö, M.

2006-01-01

The processing of micro RNAs (miRNAs) from their stemloop precursor have revealed asymmetry in the processing of the mature and its star sequence. Furthermore, the miRNA processing system between organism differ. To assess this at the sequence level we have investigated mature miRNAs in their gen......The processing of micro RNAs (miRNAs) from their stemloop precursor have revealed asymmetry in the processing of the mature and its star sequence. Furthermore, the miRNA processing system between organism differ. To assess this at the sequence level we have investigated mature mi...

DNApi: A De Novo Adapter Prediction Algorithm for Small RNA Sequencing Data.

Science.gov (United States)

Tsuji, Junko; Weng, Zhiping

2016-01-01

With the rapid accumulation of publicly available small RNA sequencing datasets, third-party meta-analysis across many datasets is becoming increasingly powerful. Although removing the 3´ adapter is an essential step for small RNA sequencing analysis, the adapter sequence information is not always available in the metadata. The information can be also erroneous even when it is available. In this study, we developed DNApi, a lightweight Python software package that predicts the 3´ adapter sequence de novo and provides the user with cleansed small RNA sequences ready for down stream analysis. Tested on 539 publicly available small RNA libraries accompanied with 3´ adapter sequences in their metadata, DNApi shows near-perfect accuracy (98.5%) with fast runtime (~2.85 seconds per library) and efficient memory usage (~43 MB on average). In addition to 3´ adapter prediction, it is also important to classify whether the input small RNA libraries were already processed, i.e. the 3´ adapters were removed. DNApi perfectly judged that given another batch of datasets, 192 publicly available processed libraries were "ready-to-map" small RNA sequence. DNApi is compatible with Python 2 and 3, and is available at https://github.com/jnktsj/DNApi. The 731 small RNA libraries used for DNApi evaluation were from human tissues and were carefully and manually collected. This study also provides readers with the curated datasets that can be integrated into their studies.

Ultra-sensitive DNA assay based on single-molecule detection coupled with fluorescent quantum dot-labeling and its application to determination of messenger RNA

International Nuclear Information System (INIS)

Li Li; Li Xincang; Li Lu; Wang Jinxing; Jin Wenrui

2011-01-01

An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10 -14 mol L -1 . Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.

Hybridization-based reconstruction of small non-coding RNA transcripts from deep sequencing data.

Science.gov (United States)

Ragan, Chikako; Mowry, Bryan J; Bauer, Denis C

2012-09-01

Recent advances in RNA sequencing technology (RNA-Seq) enables comprehensive profiling of RNAs by producing millions of short sequence reads from size-fractionated RNA libraries. Although conventional tools for detecting and distinguishing non-coding RNAs (ncRNAs) from reference-genome data can be applied to sequence data, ncRNA detection can be improved by harnessing the full information content provided by this new technology. Here we present NorahDesk, the first unbiased and universally applicable method for small ncRNAs detection from RNA-Seq data. NorahDesk utilizes the coverage-distribution of small RNA sequence data as well as thermodynamic assessments of secondary structure to reliably predict and annotate ncRNA classes. Using publicly available mouse sequence data from brain, skeletal muscle, testis and ovary, we evaluated our method with an emphasis on the performance for microRNAs (miRNAs) and piwi-interacting small RNA (piRNA). We compared our method with Dario and mirDeep2 and found that NorahDesk produces longer transcripts with higher read coverage. This feature makes it the first method particularly suitable for the prediction of both known and novel piRNAs.

Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

Science.gov (United States)

Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

1987-06-01

The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

Study design requirements for RNA sequencing-based breast cancer diagnostics.

Science.gov (United States)

Mer, Arvind Singh; Klevebring, Daniel; Grönberg, Henrik; Rantalainen, Mattias

2016-02-01

Sequencing-based molecular characterization of tumors provides information required for individualized cancer treatment. There are well-defined molecular subtypes of breast cancer that provide improved prognostication compared to routine biomarkers. However, molecular subtyping is not yet implemented in routine breast cancer care. Clinical translation is dependent on subtype prediction models providing high sensitivity and specificity. In this study we evaluate sample size and RNA-sequencing read requirements for breast cancer subtyping to facilitate rational design of translational studies. We applied subsampling to ascertain the effect of training sample size and the number of RNA sequencing reads on classification accuracy of molecular subtype and routine biomarker prediction models (unsupervised and supervised). Subtype classification accuracy improved with increasing sample size up to N = 750 (accuracy = 0.93), although with a modest improvement beyond N = 350 (accuracy = 0.92). Prediction of routine biomarkers achieved accuracy of 0.94 (ER) and 0.92 (Her2) at N = 200. Subtype classification improved with RNA-sequencing library size up to 5 million reads. Development of molecular subtyping models for cancer diagnostics requires well-designed studies. Sample size and the number of RNA sequencing reads directly influence accuracy of molecular subtyping. Results in this study provide key information for rational design of translational studies aiming to bring sequencing-based diagnostics to the clinic.

Mechanisms controlling mRNA processing and translation : decoding the regulatory layers defining gene expression through RNA sequencing

NARCIS (Netherlands)

Klerk, Eleonora de

2015-01-01

The work described in this thesis focuses on the mechanisms that give rise to alternative mRNAs and their alternative translation into proteins. Each of the described studies has been based on a specific set of high-throughput RNA sequencing technologies. An overview of the available RNA sequencing

High throughput 16S rRNA gene amplicon sequencing

DEFF Research Database (Denmark)

Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup

S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r......RNA gene amplicon sequencing can be used to reveal factors of importance for the operation of full-scale nutrient removal plants related to settling problems and floc properties. Using optimized DNA extraction protocols, indexed primers and our in-house Illumina platform, we prepared multiple samples...... be correlated to the presence of the species that are regarded as “strong” and “weak” floc formers. In conclusion, 16S rRNA gene amplicon sequencing provides a high throughput approach for a rapid and cheap community profiling of activated sludge that in combination with multivariate statistics can be used...

Phylogenetic relationships of Salmonella based on rRNA sequences

DEFF Research Database (Denmark)

Christensen, H.; Nordentoft, Steen; Olsen, J.E.

1998-01-01

separated by 16S rRNA analysis and found to be closely related to the Escherichia coli and Shigella complex by both 16S and 23S rRNA analyses. The diphasic serotypes S. enterica subspp. I and VI were separated from the monophasic serotypes subspp. IIIa and IV, including S. bongori, by 23S rRNA sequence...

Cyanobacteria contain a structural homologue of the Hfq protein with altered RNA binding properties

DEFF Research Database (Denmark)

Bøggild, Andreas; Overgaard, Martin; Valentin-Hansen, Poul

2009-01-01

Hfq proteins are common in many species of enterobacteria, where they participate in RNA folding and translational regulation through pairing of small RNAs and messenger RNAs. Hfq proteins share the distinctive Sm fold, and form ring-shaped structures similar to those of the Sm/Lsm proteins...... proteins from the cyanobacteria Synechocystis sp. PCC 6803 and Anabaena PCC 7120 at 1.3 and 2.3 A resolution, respectively, and show that they retain the classic Sm fold despite low sequence conservation. In addition, the intersubunit contacts and RNA-binding site are divergent, and we show biochemically...

Cyanobacteria contain a structural homologue of the Hfq protein with altered RNA-binding properties

DEFF Research Database (Denmark)

Bøggild, Andreas; Overgaard, Martin; Valentin-Hansen, Poul

2009-01-01

Hfq proteins are common in many species of enterobacteria, where they participate in RNA folding and translational regulation through pairing of small RNAs and messenger RNAs. Hfq proteins share the distinctive Sm fold, and form ring-shaped structures similar to those of the Sm/Lsm proteins...... proteins from the cyanobacteria Synechocystis sp. PCC 6803 and Anabaena PCC 7120 at 1.3 and 2.3 A resolution, respectively, and show that they retain the classic Sm fold despite low sequence conservation. In addition, the intersubunit contacts and RNA-binding site are divergent, and we show biochemically...

Ultra-sensitive DNA assay based on single-molecule detection coupled with fluorescent quantum dot-labeling and its application to determination of messenger RNA

Energy Technology Data Exchange (ETDEWEB)

Li Li [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Li Xincang [School of Life Sciences, Shandong University, Jinan 250100 (China); Li Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

2011-01-24

An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10{sup -14} mol L{sup -1}. Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.

Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin

Science.gov (United States)

Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

2015-10-01

Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecue, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G•U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G•U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

MicroRNA-encoding long non-coding RNAs

Directory of Open Access Journals (Sweden)

Zhu Xiaopeng

2008-05-01

Full Text Available Abstract Background Recent analysis of the mouse transcriptional data has revealed the existence of ~34,000 messenger-like non-coding RNAs (ml-ncRNAs. Whereas the functional properties of these ml-ncRNAs are beginning to be unravelled, no functional information is available for the large majority of these transcripts. Results A few ml-ncRNA have been shown to have genomic loci that overlap with microRNA loci, leading us to suspect that a fraction of ml-ncRNA may encode microRNAs. We therefore developed an algorithm (PriMir for specifically detecting potential microRNA-encoding transcripts in the entire set of 34,030 mouse full-length ml-ncRNAs. In combination with mouse-rat sequence conservation, this algorithm detected 97 (80 of them were novel strong miRNA-encoding candidates, and for 52 of these we obtained experimental evidence for the existence of their corresponding mature microRNA by microarray and stem-loop RT-PCR. Sequence analysis of the microRNA-encoding RNAs revealed an internal motif, whose presence correlates strongly (R2 = 0.9, P-value = 2.2 × 10-16 with the occurrence of stem-loops with characteristics of known pre-miRNAs, indicating the presence of a larger number microRNA-encoding RNAs (from 300 up to 800 in the ml-ncRNAs population. Conclusion Our work highlights a unique group of ml-ncRNAs and offers clues to their functions.

Complete Genome Sequence of a Double-Stranded RNA Virus from Avocado

OpenAIRE

Villanueva, Francisco; Sabanadzovic, Sead; Valverde, Rodrigo A.; Navas-Castillo, Jesús

2012-01-01

A number of avocado (Persea americana) cultivars are known to contain high-molecular-weight double-stranded RNA (dsRNA) molecules for which a viral nature has been suggested, although sequence data are not available. Here we report the cloning and complete sequencing of a 13.5-kbp dsRNA virus isolated from avocado and show that it corresponds to the genome of a new species of the genus Endornavirus (family Endornaviridae), tentatively named Persea americana endornavirus (PaEV).

Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

Science.gov (United States)

Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

1989-10-11

The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

TurboFold: Iterative probabilistic estimation of secondary structures for multiple RNA sequences

Directory of Open Access Journals (Sweden)

Sharma Gaurav

2011-04-01

Full Text Available Abstract Background The prediction of secondary structure, i.e. the set of canonical base pairs between nucleotides, is a first step in developing an understanding of the function of an RNA sequence. The most accurate computational methods predict conserved structures for a set of homologous RNA sequences. These methods usually suffer from high computational complexity. In this paper, TurboFold, a novel and efficient method for secondary structure prediction for multiple RNA sequences, is presented. Results TurboFold takes, as input, a set of homologous RNA sequences and outputs estimates of the base pairing probabilities for each sequence. The base pairing probabilities for a sequence are estimated by combining intrinsic information, derived from the sequence itself via the nearest neighbor thermodynamic model, with extrinsic information, derived from the other sequences in the input set. For a given sequence, the extrinsic information is computed by using pairwise-sequence-alignment-based probabilities for co-incidence with each of the other sequences, along with estimated base pairing probabilities, from the previous iteration, for the other sequences. The extrinsic information is introduced as free energy modifications for base pairing in a partition function computation based on the nearest neighbor thermodynamic model. This process yields updated estimates of base pairing probability. The updated base pairing probabilities in turn are used to recompute extrinsic information, resulting in the overall iterative estimation procedure that defines TurboFold. TurboFold is benchmarked on a number of ncRNA datasets and compared against alternative secondary structure prediction methods. The iterative procedure in TurboFold is shown to improve estimates of base pairing probability with each iteration, though only small gains are obtained beyond three iterations. Secondary structures composed of base pairs with estimated probabilities higher than a

Regulation of gene expression in neuronal tissue by RNA interference and editing

DEFF Research Database (Denmark)

Venø, Morten Trillingsgaard

No tissue in the mammalian organism is more complex than the brain. This complexity is in part the result of precise timing and interplay of a large number mechanisms modulating gene expression post-transcriptionally. Fine-tuning mechanisms such as A-to-I editing of RNA transcripts and regulation...... mediated by microRNAs are crucial for the correct function of the mammalian brain. We are addressing A-to-I editing and regulation by microRNAs with spatio-temporal resolution in the embryonic porcine brain by Solexa sequencing of microRNAs and 454 sequencing of edited neuronal messenger RNAs, resulting...... in detailed data of both of these fine-tuning mechanisms in the embryonic development of the pig. Editing levels of transcripts examined are generally seen to increase through development, in agreement with editing of specific microRNA also examined in the Solexa sequencing study. Three studies examining...

Complete Genome Sequence of a Double-Stranded RNA Virus from Avocado

Science.gov (United States)

Villanueva, Francisco; Sabanadzovic, Sead; Valverde, Rodrigo A.

2012-01-01

A number of avocado (Persea americana) cultivars are known to contain high-molecular-weight double-stranded RNA (dsRNA) molecules for which a viral nature has been suggested, although sequence data are not available. Here we report the cloning and complete sequencing of a 13.5-kbp dsRNA virus isolated from avocado and show that it corresponds to the genome of a new species of the genus Endornavirus (family Endornaviridae), tentatively named Persea americana endornavirus (PaEV). PMID:22205720

RNA-ID, a Powerful Tool for Identifying and Characterizing Regulatory Sequences.

Science.gov (United States)

Brule, C E; Dean, K M; Grayhack, E J

2016-01-01

The identification and analysis of sequences that regulate gene expression is critical because regulated gene expression underlies biology. RNA-ID is an efficient and sensitive method to discover and investigate regulatory sequences in the yeast Saccharomyces cerevisiae, using fluorescence-based assays to detect green fluorescent protein (GFP) relative to a red fluorescent protein (RFP) control in individual cells. Putative regulatory sequences can be inserted either in-frame or upstream of a superfolder GFP fusion protein whose expression, like that of RFP, is driven by the bidirectional GAL1,10 promoter. In this chapter, we describe the methodology to identify and study cis-regulatory sequences in the RNA-ID system, explaining features and variations of the RNA-ID reporter, as well as some applications of this system. We describe in detail the methods to analyze a single regulatory sequence, from construction of a single GFP variant to assay of variants by flow cytometry, as well as modifications required to screen libraries of different strains simultaneously. We also describe subsequent analyses of regulatory sequences. © 2016 Elsevier Inc. All rights reserved.

Quantitative miRNA expression analysis: comparing microarrays with next-generation sequencing

DEFF Research Database (Denmark)

Willenbrock, Hanni; Salomon, Jesper; Søkilde, Rolf

2009-01-01

Recently, next-generation sequencing has been introduced as a promising, new platform for assessing the copy number of transcripts, while the existing microarray technology is considered less reliable for absolute, quantitative expression measurements. Nonetheless, so far, results from the two...... technologies have only been compared based on biological data, leading to the conclusion that, although they are somewhat correlated, expression values differ significantly. Here, we use synthetic RNA samples, resembling human microRNA samples, to find that microarray expression measures actually correlate...... better with sample RNA content than expression measures obtained from sequencing data. In addition, microarrays appear highly sensitive and perform equivalently to next-generation sequencing in terms of reproducibility and relative ratio quantification....

Identification of Bacterial Small RNAs by RNA Sequencing

DEFF Research Database (Denmark)

Gómez Lozano, María; Marvig, Rasmus Lykke; Molin, Søren

2014-01-01

sequencing (RNA-seq) is described that involves the preparation and analysis of three different sequencing libraries. As a signifi cant number of unique sRNAs are identifi ed in each library, the libraries can be used either alone or in combination to increase the number of sRNAs identifi ed. The approach......Small regulatory RNAs (sRNAs) in bacteria are known to modulate gene expression and control a variety of processes including metabolic reactions, stress responses, and pathogenesis in response to environmental signals. A method to identify bacterial sRNAs on a genome-wide scale based on RNA...... may be applied to identify sRNAs in any bacterium under different growth and stress conditions....

SINA: accurate high-throughput multiple sequence alignment of ribosomal RNA genes.

Science.gov (United States)

Pruesse, Elmar; Peplies, Jörg; Glöckner, Frank Oliver

2012-07-15

In the analysis of homologous sequences, computation of multiple sequence alignments (MSAs) has become a bottleneck. This is especially troublesome for marker genes like the ribosomal RNA (rRNA) where already millions of sequences are publicly available and individual studies can easily produce hundreds of thousands of new sequences. Methods have been developed to cope with such numbers, but further improvements are needed to meet accuracy requirements. In this study, we present the SILVA Incremental Aligner (SINA) used to align the rRNA gene databases provided by the SILVA ribosomal RNA project. SINA uses a combination of k-mer searching and partial order alignment (POA) to maintain very high alignment accuracy while satisfying high throughput performance demands. SINA was evaluated in comparison with the commonly used high throughput MSA programs PyNAST and mothur. The three BRAliBase III benchmark MSAs could be reproduced with 99.3, 97.6 and 96.1 accuracy. A larger benchmark MSA comprising 38 772 sequences could be reproduced with 98.9 and 99.3% accuracy using reference MSAs comprising 1000 and 5000 sequences. SINA was able to achieve higher accuracy than PyNAST and mothur in all performed benchmarks. Alignment of up to 500 sequences using the latest SILVA SSU/LSU Ref datasets as reference MSA is offered at http://www.arb-silva.de/aligner. This page also links to Linux binaries, user manual and tutorial. SINA is made available under a personal use license.

Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex.

Science.gov (United States)

Xie, Ping

2015-10-09

Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by "hungry" codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.

The chemical structure of DNA sequence signals for RNA transcription

Science.gov (United States)

George, D. G.; Dayhoff, M. O.

1982-01-01

The proposed recognition sites for RNA transcription for E. coli NRA polymerase, bacteriophage T7 RNA polymerase, and eukaryotic RNA polymerase Pol II are evaluated in the light of the requirements for efficient recognition. It is shown that although there is good experimental evidence that specific nucleic acid sequence patterns are involved in transcriptional regulation in bacteria and bacterial viruses, among the sequences now available, only in the case of the promoters recognized by bacteriophage T7 polymerase does it seem likely that the pattern is sufficient. It is concluded that the eukaryotic pattern that is investigated is not restrictive enough to serve as a recognition site.

3' terminal diversity of MRP RNA and other human noncoding RNAs revealed by deep sequencing.

Science.gov (United States)

Goldfarb, Katherine C; Cech, Thomas R

2013-09-21

Post-transcriptional 3' end processing is a key component of RNA regulation. The abundant and essential RNA subunit of RNase MRP has been proposed to function in three distinct cellular compartments and therefore may utilize this mode of regulation. Here we employ 3' RACE coupled with high-throughput sequencing to characterize the 3' terminal sequences of human MRP RNA and other noncoding RNAs that form RNP complexes. The 3' terminal sequence of MRP RNA from HEK293T cells has a distinctive distribution of genomically encoded termini (including an assortment of U residues) with a portion of these selectively tagged by oligo(A) tails. This profile contrasts with the relatively homogenous 3' terminus of an in vitro transcribed MRP RNA control and the differing 3' terminal profiles of U3 snoRNA, RNase P RNA, and telomerase RNA (hTR). 3' RACE coupled with deep sequencing provides a valuable framework for the functional characterization of 3' terminal sequences of noncoding RNAs.

Accurate RNA consensus sequencing for high-fidelity detection of transcriptional mutagenesis-induced epimutations.

Science.gov (United States)

Reid-Bayliss, Kate S; Loeb, Lawrence A

2017-08-29

Transcriptional mutagenesis (TM) due to misincorporation during RNA transcription can result in mutant RNAs, or epimutations, that generate proteins with altered properties. TM has long been hypothesized to play a role in aging, cancer, and viral and bacterial evolution. However, inadequate methodologies have limited progress in elucidating a causal association. We present a high-throughput, highly accurate RNA sequencing method to measure epimutations with single-molecule sensitivity. Accurate RNA consensus sequencing (ARC-seq) uniquely combines RNA barcoding and generation of multiple cDNA copies per RNA molecule to eliminate errors introduced during cDNA synthesis, PCR, and sequencing. The stringency of ARC-seq can be scaled to accommodate the quality of input RNAs. We apply ARC-seq to directly assess transcriptome-wide epimutations resulting from RNA polymerase mutants and oxidative stress.

Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

Science.gov (United States)

Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

1976-01-01

Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

Small molecule alteration of RNA sequence in cells and animals.

Science.gov (United States)

Guan, Lirui; Luo, Yiling; Ja, William W; Disney, Matthew D

2017-10-18

RNA regulation and maintenance are critical for proper cell function. Small molecules that specifically alter RNA sequence would be exceptionally useful as probes of RNA structure and function or as potential therapeutics. Here, we demonstrate a photochemical approach for altering the trinucleotide expanded repeat causative of myotonic muscular dystrophy type 1 (DM1), r(CUG) exp . The small molecule, 2H-4-Ru, binds to r(CUG) exp and converts guanosine residues to 8-oxo-7,8-dihydroguanosine upon photochemical irradiation. We demonstrate targeted modification upon irradiation in cell culture and in Drosophila larvae provided a diet containing 2H-4-Ru. Our results highlight a general chemical biology approach for altering RNA sequence in vivo by using small molecules and photochemistry. Furthermore, these studies show that addition of 8-oxo-G lesions into RNA 3' untranslated regions does not affect its steady state levels. Copyright © 2017 Elsevier Ltd. All rights reserved.

Common 5S rRNA variants are likely to be accepted in many sequence contexts

Science.gov (United States)

Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

2003-01-01

Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

Translation of a nonpolyadenylated viral RNA is enhanced by binding of viral coat protein or polyadenylation of the RNA.

Science.gov (United States)

Neeleman, L; Olsthoorn, R C; Linthorst, H J; Bol, J F

2001-12-04

On entering a host cell, positive-strand RNA virus genomes have to serve as messenger for the translation of viral proteins. Efficient translation of cellular messengers requires interactions between initiation factors bound to the 5'-cap structure and the poly(A) binding protein bound to the 3'-poly(A) tail. Initiation of infection with the tripartite RNA genomes of alfalfa mosaic virus (AMV) and viruses from the genus Ilarvirus requires binding of a few molecules of coat protein (CP) to the 3' end of the nonpolyadenylated viral RNAs. Moreover, infection with the genomic RNAs can be initiated by addition of the subgenomic messenger for CP, RNA 4. We report here that extension of the AMV RNAs with a poly(A) tail of 40 to 80 A-residues permitted initiation of infection independently of CP or RNA 4 in the inoculum. Specifically, polyadenylation of RNA 1 relieved an apparent bottleneck in the translation of the viral RNAs. Translation of RNA 4 in plant protoplasts was autocatalytically stimulated by its encoded CP. Mutations that interfered with CP binding to the 3' end of viral RNAs reduced translation of RNA 4 to undetectable levels. Possibly, CP of AMV and ilarviruses stimulates translation of viral RNAs by acting as a functional analogue of poly(A) binding protein or other cellular proteins.

Finding the most significant common sequence and structure motifs in a set of RNA sequences

DEFF Research Database (Denmark)

Gorodkin, Jan; Heyer, L.J.; Stormo, G.D.

1997-01-01

We present a computational scheme to locally align a collection of RNA sequences using sequence and structure constraints, In addition, the method searches for the resulting alignments with the most significant common motifs, among all possible collections, The first part utilizes a simplified...

Evaluating Methods for Isolating Total RNA and Predicting the Success of Sequencing Phylogenetically Diverse Plant Transcriptomes

Science.gov (United States)

Bruskiewich, Richard; Burris, Jason N.; Carrigan, Charlotte T.; Chase, Mark W.; Clarke, Neil D.; Covshoff, Sarah; dePamphilis, Claude W.; Edger, Patrick P.; Goh, Falicia; Graham, Sean; Greiner, Stephan; Hibberd, Julian M.; Jordon-Thaden, Ingrid; Kutchan, Toni M.; Leebens-Mack, James; Melkonian, Michael; Miles, Nicholas; Myburg, Henrietta; Patterson, Jordan; Pires, J. Chris; Ralph, Paula; Rolf, Megan; Sage, Rowan F.; Soltis, Douglas; Soltis, Pamela; Stevenson, Dennis; Stewart, C. Neal; Surek, Barbara; Thomsen, Christina J. M.; Villarreal, Juan Carlos; Wu, Xiaolei; Zhang, Yong; Deyholos, Michael K.; Wong, Gane Ka-Shu

2012-01-01

Next-generation sequencing plays a central role in the characterization and quantification of transcriptomes. Although numerous metrics are purported to quantify the quality of RNA, there have been no large-scale empirical evaluations of the major determinants of sequencing success. We used a combination of existing and newly developed methods to isolate total RNA from 1115 samples from 695 plant species in 324 families, which represents >900 million years of phylogenetic diversity from green algae through flowering plants, including many plants of economic importance. We then sequenced 629 of these samples on Illumina GAIIx and HiSeq platforms and performed a large comparative analysis to identify predictors of RNA quality and the diversity of putative genes (scaffolds) expressed within samples. Tissue types (e.g., leaf vs. flower) varied in RNA quality, sequencing depth and the number of scaffolds. Tissue age also influenced RNA quality but not the number of scaffolds ≥1000 bp. Overall, 36% of the variation in the number of scaffolds was explained by metrics of RNA integrity (RIN score), RNA purity (OD 260/230), sequencing platform (GAIIx vs HiSeq) and the amount of total RNA used for sequencing. However, our results show that the most commonly used measures of RNA quality (e.g., RIN) are weak predictors of the number of scaffolds because Illumina sequencing is robust to variation in RNA quality. These results provide novel insight into the methods that are most important in isolating high quality RNA for sequencing and assembling plant transcriptomes. The methods and recommendations provided here could increase the efficiency and decrease the cost of RNA sequencing for individual labs and genome centers. PMID:23185583

MESSENGER at Mercury: Early Orbital Operations

Science.gov (United States)

McNutt, Ralph L., Jr; Solomon, Sean C.; Bedini, Peter D.; Anderson, Brian J.; Blewett, David T.; Evans, Larry G.; Gold, Robert E.; Krimigis, Stamatios M.; Murchie, Scott L.; Nittler, Larry R.;

CodonLogo: a sequence logo-based viewer for codon patterns.

Science.gov (United States)

Sharma, Virag; Murphy, David P; Provan, Gregory; Baranov, Pavel V

2012-07-15

Conserved patterns across a multiple sequence alignment can be visualized by generating sequence logos. Sequence logos show each column in the alignment as stacks of symbol(s) where the height of a stack is proportional to its informational content, whereas the height of each symbol within the stack is proportional to its frequency in the column. Sequence logos use symbols of either nucleotide or amino acid alphabets. However, certain regulatory signals in messenger RNA (mRNA) act as combinations of codons. Yet no tool is available for visualization of conserved codon patterns. We present the first application which allows visualization of conserved regions in a multiple sequence alignment in the context of codons. CodonLogo is based on WebLogo3 and uses the same heuristics but treats codons as inseparable units of a 64-letter alphabet. CodonLogo can discriminate patterns of codon conservation from patterns of nucleotide conservation that appear indistinguishable in standard sequence logos. The CodonLogo source code and its implementation (in a local version of the Galaxy Browser) are available at http://recode.ucc.ie/CodonLogo and through the Galaxy Tool Shed at http://toolshed.g2.bx.psu.edu/.

Nucleotide sequence of tomato ringspot virus RNA-2.

Science.gov (United States)

Rott, M E; Tremaine, J H; Rochon, D M

1991-07-01

The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

Exosomes as divine messengers: are they the Hermes of modern molecular oncology?

Science.gov (United States)

Braicu, C; Tomuleasa, C; Monroig, P; Cucuianu, A; Berindan-Neagoe, I; Calin, G A

2015-01-01

Exosomes are cell-derived vesicles that convey key elements with the potential to modulate intercellular communication. They are known to be secreted from all types of cells, and are crucial messengers that can regulate cellular processes by ‘trafficking' molecules from cells of one tissue to another. The exosomal content has been shown to be broad, composed of different types of cytokines, growth factors, proteins, or nucleic acids. Besides messenger RNA (mRNA) they can also contain noncoding transcripts such as microRNAs (miRNAs), which are small endogenous cellular regulators of protein expression. In diseases such as cancer, exosomes can facilitate tumor progression by altering their vesicular content and supplying the tumor niche with molecules that favor the progression of oncogenic processes such as proliferation, invasion and metastasis, or even drug resistance. The packaging of their molecular content is known to be tissue specific, a fact that makes them interesting tools in clinical diagnostics and ideal candidates for biomarkers. In the current report, we describe the main properties of exosomes and explain their involvement in processes such as cell differentiation and cell death. Furthermore, we emphasize the need of developing patient-targeted treatments by applying the conceptualization of exosomal-derived miRNA-based therapeutics. PMID:25236394

CPSS: a computational platform for the analysis of small RNA deep sequencing data.

Science.gov (United States)

Zhang, Yuanwei; Xu, Bo; Yang, Yifan; Ban, Rongjun; Zhang, Huan; Jiang, Xiaohua; Cooke, Howard J; Xue, Yu; Shi, Qinghua

2012-07-15

Next generation sequencing (NGS) techniques have been widely used to document the small ribonucleic acids (RNAs) implicated in a variety of biological, physiological and pathological processes. An integrated computational tool is needed for handling and analysing the enormous datasets from small RNA deep sequencing approach. Herein, we present a novel web server, CPSS (a computational platform for the analysis of small RNA deep sequencing data), designed to completely annotate and functionally analyse microRNAs (miRNAs) from NGS data on one platform with a single data submission. Small RNA NGS data can be submitted to this server with analysis results being returned in two parts: (i) annotation analysis, which provides the most comprehensive analysis for small RNA transcriptome, including length distribution and genome mapping of sequencing reads, small RNA quantification, prediction of novel miRNAs, identification of differentially expressed miRNAs, piwi-interacting RNAs and other non-coding small RNAs between paired samples and detection of miRNA editing and modifications and (ii) functional analysis, including prediction of miRNA targeted genes by multiple tools, enrichment of gene ontology terms, signalling pathway involvement and protein-protein interaction analysis for the predicted genes. CPSS, a ready-to-use web server that integrates most functions of currently available bioinformatics tools, provides all the information wanted by the majority of users from small RNA deep sequencing datasets. CPSS is implemented in PHP/PERL+MySQL+R and can be freely accessed at http://mcg.ustc.edu.cn/db/cpss/index.html or http://mcg.ustc.edu.cn/sdap1/cpss/index.html.

Unusual loop-sequence flexibility of the proximal RNA replication element in EMCV.

Directory of Open Access Journals (Sweden)

Jan Zoll

Full Text Available Picornaviruses contain stable RNA structures at the 5' and 3' ends of the RNA genome, OriL and OriR involved in viral RNA replication. The OriL RNA element found at the 5' end of the enterovirus genome folds into a cloverleaf-like configuration. In vivo SELEX experiments revealed that functioning of the poliovirus cloverleaf depends on a specific structure in this RNA element. Little is known about the OriL of cardioviruses. Here, we investigated structural aspects and requirements of the apical loop of proximal stem-loop SL-A of mengovirus, a strain of EMCV. Using NMR spectroscopy, we showed that the mengovirus SL-A apical loop consists of an octaloop. In vivo SELEX experiments demonstrated that a large number of random sequences are tolerated in the apical octaloop that support virus replication. Mutants in which the SL-A loop size and the length of the upper part of the stem were varied showed that both stem-length and stability of the octaloop are important determinants for viral RNA replication and virus reproduction. Together, these data show that stem-loop A plays an important role in virus replication. The high degree of sequence flexibility and the lack of selective pressure on the octaloop argue against a role in sequence specific RNA-protein or RNA-RNA interactions in which octaloop nucleotides are involved.

microRNA-independent recruitment of Argonaute 1 to nanos mRNA through the Smaug RNA-binding protein.

Science.gov (United States)

Pinder, Benjamin D; Smibert, Craig A

2013-01-01

Argonaute (Ago) proteins are typically recruited to target messenger RNAs via an associated small RNA such as a microRNA (miRNA). Here, we describe a new mechanism of Ago recruitment through the Drosophila Smaug RNA-binding protein. We show that Smaug interacts with the Ago1 protein, and that Ago1 interacts with and is required for the translational repression of the Smaug target, nanos mRNA. The Ago1/nanos mRNA interaction does not require a miRNA, but it does require Smaug. Taken together, our data suggest a model whereby Smaug directly recruits Ago1 to nanos mRNA in a miRNA-independent manner, thereby repressing translation.

Effect of escitalopram versus placebo on GRα messenger RNA expression in peripheral blood cells of healthy individuals with a family history of depression - a secondary outcome analysis from the randomized AGENDA trial

DEFF Research Database (Denmark)

Knorr, Ulla; Koefoed, Pernille; Gluud, Christian

2016-01-01

Background Selective serotonin reuptake inhibitors (SSRIs) are widely prescribed as first-line drugs for the treatment of depression. However, the mechanisms of action for SSRIs are unclear and besides neurotransmitter modulation may depend on modulation of the hypothalamic-pituitary-adrenal (HPA......) system. The glucocorticoid receptor (GR) isoform α plays an important role in the negative feedback regulation of the HPA axis and reduced GRα messenger RNA (mRNA) expression has been shown in mood disorder patients and first-degree relatives compared to healthy individuals with no family history...

Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer

Science.gov (United States)

2017-09-01

AWARD NUMBER: W81XWH-14-1-0080 TITLE: Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer . PRINCIPAL INVESTIGATOR...TITLE AND SUBTITLE Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer . 5a. CONTRACT NUMBER 5b. GRANT NUMBER GRANT11489...institutional, NIH-funded study of genetic and epigenetic alterations of pre-invasive DCIS that did or did not progress to invasive breast cancer , with an

Complete sequence of RNA1 of grapevine Anatolian ringspot virus.

Science.gov (United States)

Digiaro, Michele; Nahdi, Sabrine; Elbeaino, Toufic

2012-10-01

The nucleotide sequence of RNA1 of grapevine Anatolian ringspot virus (GARSV), a nepovirus of subgroup B, was determined from cDNA clones. It is 7,288 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame (ORF), extending from nucleotides 272 to 7001, encoding a polypeptide of 2,243 amino acids with a predicted molecular mass of 250 kDa. The primary structure of the polyprotein, compared with that of other viral polyproteins, revealed the presence of all the characteristic domains of members of the order Picornavirales, i.e., the NTP-binding protein (1B(Hel)), the viral genome-linked protein (1C(VPg)), the proteinase (1D(Prot)), the RNA-dependent RNA polymerase (1E(Pol)), and of the protease cofactor (1A(Pro-cof)) shared by members of the subfamily Comovirinae within the family Secoviridae. The cleavage sites predicted within the polyprotein were found to be in agreement with those previously reported for nepoviruses of subgroup B, processing from 1A to 1E proteins of 67, 64, 3, 23 and 92 kDa, respectively. The RNA1-encoded polyprotein (p1) shared the highest amino acid sequence identity (66 %) with tomato black ring virus (TBRV) and beet ringspot virus (BRSV). The 5'- and 3'-noncoding regions (NCRs) of GARSV-RNA1 shared 89 % and 95 % nucleotide sequence identity respectively with the corresponding regions in RNA2. Phylogenetic analysis confirmed the close relationship of GARSV to members of subgroup B of the genus Nepovirus.

Insulin-like growth factor II messenger RNA-binding protein-3 is an independent prognostic factor in uterine leiomyosarcoma.

Science.gov (United States)

Yasutake, Nobuko; Ohishi, Yoshihiro; Taguchi, Kenichi; Hiraki, Yuka; Oya, Masafumi; Oshiro, Yumi; Mine, Mari; Iwasaki, Takeshi; Yamamoto, Hidetaka; Kohashi, Kenichi; Sonoda, Kenzo; Kato, Kiyoko; Oda, Yoshinao

2018-04-01

The aim of this study was to identify the prognostic factors of uterine leiomyosarcoma (ULMS). We reviewed 60 cases of surgically resected ULMSs and investigated conventional clinicopathological factors, together with the expression of insulin-like growth factor II messenger RNA-binding protein-3 (IMP3), hormone receptors and cell cycle regulatory markers by immunohistochemistry. Mediator complex subunit 12 (MED12) mutation analysis was also performed. Univariate analyses revealed that advanced stage (P < 0.0001), older age (P = 0.0244) and IMP3 expression (P = 0.0011) were significant predictors of a poor outcome. Multivariate analysis revealed advanced stage (P < 0.0001) and IMP3 (P = 0.0373) as independent predictors of a poor prognosis. Expressions of cell cycle markers and hormone receptors, and MED12 mutations (12% in ULMSs) were not identified as prognostic markers in this study. IMP3 expression in ULMS could be a marker of a poor prognosis. © 2017 John Wiley & Sons Ltd.

High-Throughput Mapping of Single-Neuron Projections by Sequencing of Barcoded RNA.

Science.gov (United States)

Kebschull, Justus M; Garcia da Silva, Pedro; Reid, Ashlan P; Peikon, Ian D; Albeanu, Dinu F; Zador, Anthony M

2016-09-07

Neurons transmit information to distant brain regions via long-range axonal projections. In the mouse, area-to-area connections have only been systematically mapped using bulk labeling techniques, which obscure the diverse projections of intermingled single neurons. Here we describe MAPseq (Multiplexed Analysis of Projections by Sequencing), a technique that can map the projections of thousands or even millions of single neurons by labeling large sets of neurons with random RNA sequences ("barcodes"). Axons are filled with barcode mRNA, each putative projection area is dissected, and the barcode mRNA is extracted and sequenced. Applying MAPseq to the locus coeruleus (LC), we find that individual LC neurons have preferred cortical targets. By recasting neuroanatomy, which is traditionally viewed as a problem of microscopy, as a problem of sequencing, MAPseq harnesses advances in sequencing technology to permit high-throughput interrogation of brain circuits. Copyright © 2016 Elsevier Inc. All rights reserved.

Labeling of eukaryotic messenger RNA 5' terminus with phosphorus -32: use of tobacco acid pyrophosphatase for removal of cap structures

International Nuclear Information System (INIS)

Lockard, R.E.; Rieser, L.; Vournakis, J.N.

1981-01-01

In recent years, there has been a growing appreciation of the potential applications of 5'- 32 P-end-labeled mRNA, not only for screening recombinant clones and mapping gene structure, but also for revealing possible nucleotide sequence and structural signals within mRNA molecules themselves, which may be important for eukaryotic mRNA processing and turnover and for controlling differential rates of translational initiation. Three major problems, however, have retarded progress in this area, lack of methods for efficient and reproducible removal of m7G5ppp5'-cap structures, which maintain the integrity of an RNA molecule; inability to generate a sufficient amount of labeled mRNA, owing to the limited availability of most pure mRNA species; and the frequent problem of RNA degradation during in vitro end-labeling owing to RNAse contamination. The procedures presented here permit one to decap and label minute quantities of mRNA, effectively. Tobacco acid pyrophosphatase is relatively efficient in removing cap structures from even nanogram quantities of available mRNA, and enough radioactivity can be easily generated from minute amounts ofintact mRNA with very high-specific-activity [gamma- 32 P]ATP and the inhibition of ribonuclease contamination with diethylpyrocarbonate. These procedures can be modified and applied to almost any other type of RNA molecule as well. In Section III of this volume, we explore in detail how effectively 5'-end-labeled mRNA can be used not only for nucleotide sequence analysis, but also for mapping mRNA secondary structure

Analysis of RNA metabolism in fission yeast

DEFF Research Database (Denmark)

Wise, Jo Ann; Nielsen, Olaf

2017-01-01

Here we focus on the biogenesis and function of messenger RNA (mRNA) in fission yeast cells. Following a general introduction that also briefly touches on other classes of RNA, we provide an overview of methods used to analyze mRNAs throughout their life cycles....

High-Throughput Sequencing Based Methods of RNA Structure Investigation

DEFF Research Database (Denmark)

Kielpinski, Lukasz Jan

In this thesis we describe the development of four related methods for RNA structure probing that utilize massive parallel sequencing. Using them, we were able to gather structural data for multiple, long molecules simultaneously. First, we have established an easy to follow experimental...... and computational protocol for detecting the reverse transcription termination sites (RTTS-Seq). This protocol was subsequently applied to hydroxyl radical footprinting of three dimensional RNA structures to give a probing signal that correlates well with the RNA backbone solvent accessibility. Moreover, we applied...

Sequencing of 16S rRNA gene for id ntification of Sta h lococcus ...

African Journals Online (AJOL)

Asdmin

2014-01-15

Jan 15, 2014 ... as the type strains of a species of genus Trichoderma based on phylogenetic tree analysis together with the 18S rRNA gene sequence search in Ribosomal Database Project, small subunit rRNA and large subunit rRNA databases. The sequence was deposited in GenBank with the accession numbers.

Dynamical Messengers for Gauge Mediation

Energy Technology Data Exchange (ETDEWEB)

Hook, Anson; Torroba, Gonzalo; /SLAC /Stanford U., Phys. Dept.

2011-08-17

We construct models of indirect gauge mediation where the dynamics responsible for breaking supersymmetry simultaneously generates a weakly coupled subsector of messengers. This provides a microscopic realization of messenger gauge mediation where the messenger and hidden sector fields are unified into a single sector. The UV theory is SQCD with massless and massive quarks plus singlets, and at low energies it flows to a weakly coupled quiver gauge theory. One node provides the primary source of supersymmetry breaking, which is then transmitted to the node giving rise to the messenger fields. These models break R-symmetry spontaneously, produce realistic gaugino and sfermion masses, and give a heavy gravitino.

Modeling bias and variation in the stochastic processes of small RNA sequencing.

Science.gov (United States)

Argyropoulos, Christos; Etheridge, Alton; Sakhanenko, Nikita; Galas, David

2017-06-20

The use of RNA-seq as the preferred method for the discovery and validation of small RNA biomarkers has been hindered by high quantitative variability and biased sequence counts. In this paper we develop a statistical model for sequence counts that accounts for ligase bias and stochastic variation in sequence counts. This model implies a linear quadratic relation between the mean and variance of sequence counts. Using a large number of sequencing datasets, we demonstrate how one can use the generalized additive models for location, scale and shape (GAMLSS) distributional regression framework to calculate and apply empirical correction factors for ligase bias. Bias correction could remove more than 40% of the bias for miRNAs. Empirical bias correction factors appear to be nearly constant over at least one and up to four orders of magnitude of total RNA input and independent of sample composition. Using synthetic mixes of known composition, we show that the GAMLSS approach can analyze differential expression with greater accuracy, higher sensitivity and specificity than six existing algorithms (DESeq2, edgeR, EBSeq, limma, DSS, voom) for the analysis of small RNA-seq data. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

RNA2 of grapevine fanleaf virus: sequence analysis and coat protein cistron location.

Science.gov (United States)

Serghini, M A; Fuchs, M; Pinck, M; Reinbolt, J; Walter, B; Pinck, L

1990-07-01

The nucleotide sequence of the genomic RNA2 (3774 nucleotides) of grapevine fanleaf virus strain F13 was determined from overlapping cDNA clones and its genetic organization was deduced. Two rapid and efficient methods were used for cDNA cloning of the 5' region of RNA2. The complete sequence contained only one long open reading frame of 3555 nucleotides (1184 codons, 131K product). The analysis of the N-terminal sequence of purified coat protein (CP) and identification of its C-terminal residue have allowed the CP cistron to be precisely positioned within the polyprotein. The CP produced by proteolytic cleavage at the Arg/Gly site between residues 680 and 681 contains 504 amino acids (Mr 56019) and has hydrophobic properties. The Arg/Gly cleavage site deduced by N-terminal amino acid sequence analysis is the first for a nepovirus coat protein and for plant viruses expressing their genomic RNAs by polyprotein synthesis. Comparison of GFLV RNA2 with M RNA of cowpea mosaic comovirus and with RNA2 of two closely related nepoviruses, tomato black ring virus and Hungarian grapevine chrome mosaic virus, showed strong similarities among the 3' non-coding regions but less similarity among the 5' end non-coding sequences than reported among other nepovirus RNAs.

Differential effects of common variants in SCN2A on general cognitive ability, brain physiology, and messenger RNA expression in schizophrenia cases and control individuals.

Science.gov (United States)

Dickinson, Dwight; Straub, Richard E; Trampush, Joey W; Gao, Yuan; Feng, Ningping; Xie, Bin; Shin, Joo Heon; Lim, Hun Ki; Ursini, Gianluca; Bigos, Kristin L; Kolachana, Bhaskar; Hashimoto, Ryota; Takeda, Masatoshi; Baum, Graham L; Rujescu, Dan; Callicott, Joseph H; Hyde, Thomas M; Berman, Karen F; Kleinman, Joel E; Weinberger, Daniel R

2014-06-01

One approach to understanding the genetic complexity of schizophrenia is to study associated behavioral and biological phenotypes that may be more directly linked to genetic variation. To identify single-nucleotide polymorphisms associated with general cognitive ability (g) in people with schizophrenia and control individuals. Genomewide association study, followed by analyses in unaffected siblings and independent schizophrenia samples, functional magnetic resonance imaging studies of brain physiology in vivo, and RNA sequencing in postmortem brain samples. The discovery cohort and unaffected siblings were participants in the National Institute of Mental Health Clinical Brain Disorders Branch schizophrenia genetics studies. Additional schizophrenia cohorts were from psychiatric treatment settings in the United States, Japan, and Germany. The discovery cohort comprised 339 with schizophrenia and 363 community control participants. Follow-up analyses studied 147 unaffected siblings of the schizophrenia cases and independent schizophrenia samples including a total of an additional 668 participants. Imaging analyses included 87 schizophrenia cases and 397 control individuals. Brain tissue samples were available for 64 cases and 61 control individuals. We studied genomewide association with g, by group, in the discovery cohort. We used selected genotypes to test specific associations in unaffected siblings and independent schizophrenia samples. Imaging analyses focused on activation in the prefrontal cortex during working memory. Brain tissue studies yielded messenger RNA expression levels for RefSeq transcripts. The schizophrenia discovery cohort showed genomewide-significant association of g with polymorphisms in sodium channel gene SCN2A, accounting for 10.4% of g variance (rs10174400, P = 9.27 × 10(-10)). Control individuals showed a trend for g/genotype association with reversed allelic directionality. The genotype-by-group interaction was also genomewide

Analysis of 16S rRNA amplicon sequencing options on the Roche/454 next-generation titanium sequencing platform.

Directory of Open Access Journals (Sweden)

Hideyuki Tamaki

Full Text Available BACKGROUND: 16S rRNA gene pyrosequencing approach has revolutionized studies in microbial ecology. While primer selection and short read length can affect the resulting microbial community profile, little is known about the influence of pyrosequencing methods on the sequencing throughput and the outcome of microbial community analyses. The aim of this study is to compare differences in output, ease, and cost among three different amplicon pyrosequencing methods for the Roche/454 Titanium platform METHODOLOGY/PRINCIPAL FINDINGS: The following three pyrosequencing methods for 16S rRNA genes were selected in this study: Method-1 (standard method is the recommended method for bi-directional sequencing using the LIB-A kit; Method-2 is a new option designed in this study for unidirectional sequencing with the LIB-A kit; and Method-3 uses the LIB-L kit for unidirectional sequencing. In our comparison among these three methods using 10 different environmental samples, Method-2 and Method-3 produced 1.5-1.6 times more useable reads than the standard method (Method-1, after quality-based trimming, and did not compromise the outcome of microbial community analyses. Specifically, Method-3 is the most cost-effective unidirectional amplicon sequencing method as it provided the most reads and required the least effort in consumables management. CONCLUSIONS: Our findings clearly demonstrated that alternative pyrosequencing methods for 16S rRNA genes could drastically affect sequencing output (e.g. number of reads before and after trimming but have little effect on the outcomes of microbial community analysis. This finding is important for both researchers and sequencing facilities utilizing 16S rRNA gene pyrosequencing for microbial ecological studies.

3′ terminal diversity of MRP RNA and other human noncoding RNAs revealed by deep sequencing

Science.gov (United States)

2013-01-01

Background Post-transcriptional 3′ end processing is a key component of RNA regulation. The abundant and essential RNA subunit of RNase MRP has been proposed to function in three distinct cellular compartments and therefore may utilize this mode of regulation. Here we employ 3′ RACE coupled with high-throughput sequencing to characterize the 3′ terminal sequences of human MRP RNA and other noncoding RNAs that form RNP complexes. Results The 3′ terminal sequence of MRP RNA from HEK293T cells has a distinctive distribution of genomically encoded termini (including an assortment of U residues) with a portion of these selectively tagged by oligo(A) tails. This profile contrasts with the relatively homogenous 3′ terminus of an in vitro transcribed MRP RNA control and the differing 3′ terminal profiles of U3 snoRNA, RNase P RNA, and telomerase RNA (hTR). Conclusions 3′ RACE coupled with deep sequencing provides a valuable framework for the functional characterization of 3′ terminal sequences of noncoding RNAs. PMID:24053768

ISVASE: identification of sequence variant associated with splicing event using RNA-seq data.

Science.gov (United States)

Aljohi, Hasan Awad; Liu, Wanfei; Lin, Qiang; Yu, Jun; Hu, Songnian

2017-06-28

Exon recognition and splicing precisely and efficiently by spliceosome is the key to generate mature mRNAs. About one third or a half of disease-related mutations affect RNA splicing. Software PVAAS has been developed to identify variants associated with aberrant splicing by directly using RNA-seq data. However, it bases on the assumption that annotated splicing site is normal splicing, which is not true in fact. We develop the ISVASE, a tool for specifically identifying sequence variants associated with splicing events (SVASE) by using RNA-seq data. Comparing with PVAAS, our tool has several advantages, such as multi-pass stringent rule-dependent filters and statistical filters, only using split-reads, independent sequence variant identification in each part of splicing (junction), sequence variant detection for both of known and novel splicing event, additional exon-exon junction shift event detection if known splicing events provided, splicing signal evaluation, known DNA mutation and/or RNA editing data supported, higher precision and consistency, and short running time. Using a realistic RNA-seq dataset, we performed a case study to illustrate the functionality and effectiveness of our method. Moreover, the output of SVASEs can be used for downstream analysis such as splicing regulatory element study and sequence variant functional analysis. ISVASE is useful for researchers interested in sequence variants (DNA mutation and/or RNA editing) associated with splicing events. The package is freely available at https://sourceforge.net/projects/isvase/ .

Mesoporous silica nanorods toward efficient loading and intracellular delivery of siRNA

Science.gov (United States)

Chen, Lijue; She, Xiaodong; Wang, Tao; Shigdar, Sarah; Duan, Wei; Kong, Lingxue

2018-02-01

The technology of RNA interference (RNAi) that uses small interfering RNA (siRNA) to silence the gene expression with complementary messenger RNA (mRNA) sequence has great potential for the treatment of cancer in which certain genes were usually found overexpressed. However, the carry and delivery of siRNA to the target site in the human body can be challenging for this technology to be used clinically to silence the cancer-related gene expression. In this work, rod shaped mesoporous silica nanoparticles (MSNs) were developed as siRNA delivery system for specific intracellular delivery. The rod MSNs with an aspect ratio of 1.5 had a high surface area of 934.28 m2/g and achieved a siRNA loading of more than 80 mg/g. With the epidermal growth factor (EGF) grafted on the surface of the MSNs, siRNA can be delivered to the epidermal growth factor receptor (EGFR) overexpressed colorectal cancer cells with high intracellular concentration compared to MSNs without EGF and lead to survivin gene knocking down to less than 30%.

The RNA world, automatic sequences and oncogenetics

Energy Technology Data Exchange (ETDEWEB)

Tahir Shah, K

1993-04-01

We construct a model of the RNA world in terms of naturally evolving nucleotide sequences assuming only Crick-Watson base pairing and self-cleaving/splicing capability. These sequences have the following properties. (1) They are recognizable by an automation (or automata). That is, to each k-sequence, there exist a k-automation which accepts, recognizes or generates the k-sequence. These are known as automatic sequences. Fibonacci and Morse-Thue sequences are the most natural outcome of pre-biotic chemical conditions. (2) Infinite (resp. large) sequences are self-similar (resp. nearly self-similar) under certain rewrite rules and consequently give rise to fractal (resp.fractal-like) structures. Computationally, such sequences can also be generated by their corresponding deterministic parallel re-write system, known as a DOL system. The self-similar sequences are fixed points of their respective rewrite rules. Some of these automatic sequences have the capability that they can read or ``accept`` other sequences while others can detect errors and trigger error-correcting mechanisms. They can be enlarged and have block and/or palindrome structure. Linear recurring sequences such as Fibonacci sequence are simply Feed-back Shift Registers, a well know model of information processing machines. We show that a mutation of any rewrite rule can cause a combinatorial explosion of error and relates this to oncogenetical behavior. On the other hand, a mutation of sequences that are not rewrite rules, leads to normal evolutionary change. Known experimental results support our hypothesis. (author). Refs.

The RNA world, automatic sequences and oncogenetics

International Nuclear Information System (INIS)

Tahir Shah, K.

1993-04-01

We construct a model of the RNA world in terms of naturally evolving nucleotide sequences assuming only Crick-Watson base pairing and self-cleaving/splicing capability. These sequences have the following properties. 1) They are recognizable by an automation (or automata). That is, to each k-sequence, there exist a k-automation which accepts, recognizes or generates the k-sequence. These are known as automatic sequences. Fibonacci and Morse-Thue sequences are the most natural outcome of pre-biotic chemical conditions. 2) Infinite (resp. large) sequences are self-similar (resp. nearly self-similar) under certain rewrite rules and consequently give rise to fractal (resp.fractal-like) structures. Computationally, such sequences can also be generated by their corresponding deterministic parallel re-write system, known as a DOL system. The self-similar sequences are fixed points of their respective rewrite rules. Some of these automatic sequences have the capability that they can read or 'accept' other sequences while others can detect errors and trigger error-correcting mechanisms. They can be enlarged and have block and/or palindrome structure. Linear recurring sequences such as Fibonacci sequence are simply Feed-back Shift Registers, a well know model of information processing machines. We show that a mutation of any rewrite rule can cause a combinatorial explosion of error and relates this to oncogenetical behavior. On the other hand, a mutation of sequences that are not rewrite rules, leads to normal evolutionary change. Known experimental results support our hypothesis. (author). Refs

Small RNA Deep Sequencing and the Effects of microRNA408 on Root Gravitropic Bending in Arabidopsis

Science.gov (United States)

Li, Huasheng; Lu, Jinying; Sun, Qiao; Chen, Yu; He, Dacheng; Liu, Min

2015-11-01

MicroRNA (miRNA) is a non-coding small RNA composed of 20 to 24 nucleotides that influences plant root development. This study analyzed the miRNA expression in Arabidopsis root tip cells using Illumina sequencing and real-time PCR before (sample 0) and 15 min after (sample 15) a 3-D clinostat rotational treatment was administered. After stimulation was performed, the expression levels of seven miRNA genes, including Arabidopsis miR160, miR161, miR394, miR402, miR403, miR408, and miR823, were significantly upregulated. Illumina sequencing results also revealed two novel miRNAsthat have not been previously reported, The target genes of these miRNAs included pentatricopeptide repeat-containing protein and diadenosine tetraphosphate hydrolase. An overexpression vector of Arabidopsis miR408 was constructed and transferred to Arabidopsis plant. The roots of plants over expressing miR408 exhibited a slower reorientation upon gravistimulation in comparison with those of wild-type. This result indicate that miR408 could play a role in root gravitropic response.

Development of Anti-Human Mesothelin-Targeted Chimeric Antigen Receptor Messenger RNA-transfected Peripheral Blood Lymphocytes for Ovarian Cancer Therapy.

Science.gov (United States)

Hung, Chien-Fu; Xu, Xuequn; Li, Linhong; Ma, Ying; Jin, Qiu; Viley, Angelia; Allen, Cornell; Natarajan, Pachai; Shivakumar, Rama; Peshwa, Madhusudan V; Emens, Leisha A

2018-04-02

CD19-targeted chimeric antigen receptor (CAR) engineered T/natural killer (NK)-cell therapies can result in durable clinical responses in B-cell malignancies. However, CAR-based immunotherapies have been much less successful in solid cancers, in part due to "on-target off-tumor" toxicity related to expression of target tumor antigens on normal tissue. Based on preliminary observations of safety and clinical activity in proof-of-concept clinical trials, tumor antigen-specific messenger RNA (mRNA) CAR transfection into selected, activated, and expanded T/NK cells may permit prospective control of "on-target off-tumor" toxicity. To develop a commercial product for solid tumors, mesothelin was selected as an antigen target based on its association with poor prognosis and overexpression in multiple solid cancers. It was hypothesized that selecting, activating, and expanding cells ex vivo prior to mRNA CAR transfection would not be necessary, thus simplifying the complexity and cost of manufacturing. Now, the development of anti-human mesothelin mRNA CAR transfected peripheral blood lymphocytes (CARMA-hMeso) is reported, demonstrating the manufacture and cryopreservation of multiple cell aliquots for repeat administrations from a single human leukapheresis. A rapid, automated, closed system for cGMP-compliant transfection of mRNA CAR in up to 20 × 10 9 peripheral blood lymphocytes was developed. Here we show that CARMA-hMeso cells recognize and lyse tumor cells in a mesothelin-specific manner. Expression of CAR was detectable over approximately 7 days in vitro, with a progressive decline of CAR expression that appears to correlate with in vitro cell expansion. In a murine ovarian cancer model, a single intraperitoneal injection of CARMA-hMeso resulted in the dose-dependent inhibition of tumor growth and improved survival of mice. Furthermore, repeat weekly intraperitoneal administrations of the optimal CARMA-hMeso dose further prolonged disease control and survival

Sequence analysis of L RNA of Lassa virus

International Nuclear Information System (INIS)

Vieth, Simon; Torda, Andrew E.; Asper, Marcel; Schmitz, Herbert; Guenther, Stephan

2004-01-01

The L RNA of three Lassa virus strains originating from Nigeria, Ghana/Ivory Coast, and Sierra Leone was sequenced and the data subjected to structure predictions and phylogenetic analyses. The L gene products had 2218-2221 residues, diverged by 18% at the amino acid level, and contained several conserved regions. Only one region of 504 residues (positions 1043-1546) could be assigned a function, namely that of an RNA polymerase. Secondary structure predictions suggest that this domain is very similar to RNA-dependent RNA polymerases of known structure encoded by plus-strand RNA viruses, permitting a model to be built. Outside the polymerase region, there is little structural data, except for regions of strong alpha-helical content and probably a coiled-coil domain at the N terminus. No evidence for reassortment or recombination during Lassa virus evolution was found. The secondary structure-assisted alignment of the RNA polymerase region permitted a reliable reconstruction of the phylogeny of all negative-strand RNA viruses, indicating that Arenaviridae are most closely related to Nairoviruses. In conclusion, the data provide a basis for structural and functional characterization of the Lassa virus L protein and reveal new insights into the phylogeny of negative-strand RNA viruses

Combined DECS Analysis and Next-Generation Sequencing Enable Efficient Detection of Novel Plant RNA Viruses

Directory of Open Access Journals (Sweden)

Hironobu Yanagisawa

2016-03-01

Full Text Available The presence of high molecular weight double-stranded RNA (dsRNA within plant cells is an indicator of infection with RNA viruses as these possess genomic or replicative dsRNA. DECS (dsRNA isolation, exhaustive amplification, cloning, and sequencing analysis has been shown to be capable of detecting unknown viruses. We postulated that a combination of DECS analysis and next-generation sequencing (NGS would improve detection efficiency and usability of the technique. Here, we describe a model case in which we efficiently detected the presumed genome sequence of Blueberry shoestring virus (BSSV, a member of the genus Sobemovirus, which has not so far been reported. dsRNAs were isolated from BSSV-infected blueberry plants using the dsRNA-binding protein, reverse-transcribed, amplified, and sequenced using NGS. A contig of 4,020 nucleotides (nt that shared similarities with sequences from other Sobemovirus species was obtained as a candidate of the BSSV genomic sequence. Reverse transcription (RT-PCR primer sets based on sequences from this contig enabled the detection of BSSV in all BSSV-infected plants tested but not in healthy controls. A recombinant protein encoded by the putative coat protein gene was bound by the BSSV-antibody, indicating that the candidate sequence was that of BSSV itself. Our results suggest that a combination of DECS analysis and NGS, designated here as “DECS-C,” is a powerful method for detecting novel plant viruses.

Robust Sub-nanomolar Library Preparation for High Throughput Next Generation Sequencing.

Science.gov (United States)

Wu, Wells W; Phue, Je-Nie; Lee, Chun-Ting; Lin, Changyi; Xu, Lai; Wang, Rong; Zhang, Yaqin; Shen, Rong-Fong

2018-05-04

Current library preparation protocols for Illumina HiSeq and MiSeq DNA sequencers require ≥2 nM initial library for subsequent loading of denatured cDNA onto flow cells. Such amounts are not always attainable from samples having a relatively low DNA or RNA input; or those for which a limited number of PCR amplification cycles is preferred (less PCR bias and/or more even coverage). A well-tested sub-nanomolar library preparation protocol for Illumina sequencers has however not been reported. The aim of this study is to provide a much needed working protocol for sub-nanomolar libraries to achieve outcomes as informative as those obtained with the higher library input (≥ 2 nM) recommended by Illumina's protocols. Extensive studies were conducted to validate a robust sub-nanomolar (initial library of 100 pM) protocol using PhiX DNA (as a control), genomic DNA (Bordetella bronchiseptica and microbial mock community B for 16S rRNA gene sequencing), messenger RNA, microRNA, and other small noncoding RNA samples. The utility of our protocol was further explored for PhiX library concentrations as low as 25 pM, which generated only slightly fewer than 50% of the reads achieved under the standard Illumina protocol starting with > 2 nM. A sub-nanomolar library preparation protocol (100 pM) could generate next generation sequencing (NGS) results as robust as the standard Illumina protocol. Following the sub-nanomolar protocol, libraries with initial concentrations as low as 25 pM could also be sequenced to yield satisfactory and reproducible sequencing results.

Deep sequencing of small RNA libraries from human prostate epithelial and stromal cells reveal distinct pattern of microRNAs primarily predicted to target growth factors.

Science.gov (United States)

Singh, Savita; Zheng, Yun; Jagadeeswaran, Guru; Ebron, Jey Sabith; Sikand, Kavleen; Gupta, Sanjay; Sunker, Ramanjulu; Shukla, Girish C

2016-02-28

Complex epithelial and stromal cell interactions are required during the development and progression of prostate cancer. Regulatory small non-coding microRNAs (miRNAs) participate in the spatiotemporal regulation of messenger RNA (mRNA) and regulation of translation affecting a large number of genes involved in prostate carcinogenesis. In this study, through deep-sequencing of size fractionated small RNA libraries we profiled the miRNAs of prostate epithelial (PrEC) and stromal (PrSC) cells. Over 50 million reads were obtained for PrEC in which 860,468 were unique sequences. Similarly, nearly 76 million reads for PrSC were obtained in which over 1 million were unique reads. Expression of many miRNAs of broadly conserved and poorly conserved miRNA families were identified. Sixteen highly expressed miRNAs with significant change in expression in PrSC than PrEC were further analyzed in silico. ConsensusPathDB showed the target genes of these miRNAs were significantly involved in adherence junction, cell adhesion, EGRF, TGF-β and androgen signaling. Let-7 family of tumor-suppressor miRNAs expression was highly pervasive in both, PrEC and PrSC cells. In addition, we have also identified several miRNAs that are unique to PrEC or PrSC cells and their predicted putative targets are a group of transcription factors. This study provides perspective on the miRNA expression in PrEC and PrSC, and reveals a global trend in miRNA interactome. We conclude that the most abundant miRNAs are potential regulators of development and differentiation of the prostate gland by targeting a set of growth factors. Additionally, high level expression of the most members of let-7 family miRNAs suggests their role in the fine tuning of the growth and proliferation of prostate epithelial and stromal cells. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Regulatory RNAs derived from transfer RNA?

Science.gov (United States)

Pederson, Thoru

2010-10-01

Four recent studies suggest that cleavages of transfer RNAs generate products with microRNA-like features, with some evidence of function. If their regulatory functions were to be confirmed, these newly revealed RNAs would add to the expanding repertoire of small noncoding RNAs and would also provide new perspectives on the coevolution of transfer RNA and messenger RNA.

Interactions between the HIV-1 Unspliced mRNA and Host mRNA Decay Machineries

Directory of Open Access Journals (Sweden)

Daniela Toro-Ascuy

2016-11-01

Full Text Available The human immunodeficiency virus type-1 (HIV-1 unspliced transcript is used both as mRNA for the synthesis of structural proteins and as the packaged genome. Given the presence of retained introns and instability AU-rich sequences, this viral transcript is normally retained and degraded in the nucleus of host cells unless the viral protein REV is present. As such, the stability of the HIV-1 unspliced mRNA must be particularly controlled in the nucleus and the cytoplasm in order to ensure proper levels of this viral mRNA for translation and viral particle formation. During its journey, the HIV-1 unspliced mRNA assembles into highly specific messenger ribonucleoproteins (mRNPs containing many different host proteins, amongst which are well-known regulators of cytoplasmic mRNA decay pathways such as up-frameshift suppressor 1 homolog (UPF1, Staufen double-stranded RNA binding protein 1/2 (STAU1/2, or components of miRNA-induced silencing complex (miRISC and processing bodies (PBs. More recently, the HIV-1 unspliced mRNA was shown to contain N6-methyladenosine (m6A, allowing the recruitment of YTH N6-methyladenosine RNA binding protein 2 (YTHDF2, an m6A reader host protein involved in mRNA decay. Interestingly, these host proteins involved in mRNA decay were shown to play positive roles in viral gene expression and viral particle assembly, suggesting that HIV-1 interacts with mRNA decay components to successfully accomplish viral replication. This review summarizes the state of the art in terms of the interactions between HIV-1 unspliced mRNA and components of different host mRNA decay machineries.

Preparation of highly multiplexed small RNA sequencing libraries.

Science.gov (United States)

Persson, Helena; Søkilde, Rolf; Pirona, Anna Chiara; Rovira, Carlos

2017-08-01

MicroRNAs (miRNAs) are ~22-nucleotide-long small non-coding RNAs that regulate the expression of protein-coding genes by base pairing to partially complementary target sites, preferentially located in the 3´ untranslated region (UTR) of target mRNAs. The expression and function of miRNAs have been extensively studied in human disease, as well as the possibility of using these molecules as biomarkers for prognostication and treatment guidance. To identify and validate miRNAs as biomarkers, their expression must be screened in large collections of patient samples. Here, we develop a scalable protocol for the rapid and economical preparation of a large number of small RNA sequencing libraries using dual indexing for multiplexing. Combined with the use of off-the-shelf reagents, more samples can be sequenced simultaneously on large-scale sequencing platforms at a considerably lower cost per sample. Sample preparation is simplified by pooling libraries prior to gel purification, which allows for the selection of a narrow size range while minimizing sample variation. A comparison with publicly available data from benchmarking of miRNA analysis platforms showed that this method captures absolute and differential expression as effectively as commercially available alternatives.

Deep sequencing of foot-and-mouth disease virus reveals RNA sequences involved in genome packaging.

Science.gov (United States)

Logan, Grace; Newman, Joseph; Wright, Caroline F; Lasecka-Dykes, Lidia; Haydon, Daniel T; Cottam, Eleanor M; Tuthill, Tobias J

2017-10-18

Non-enveloped viruses protect their genomes by packaging them into an outer shell or capsid of virus-encoded proteins. Packaging and capsid assembly in RNA viruses can involve interactions between capsid proteins and secondary structures in the viral genome as exemplified by the RNA bacteriophage MS2 and as proposed for other RNA viruses of plants, animals and human. In the picornavirus family of non-enveloped RNA viruses, the requirements for genome packaging remain poorly understood. Here we show a novel and simple approach to identify predicted RNA secondary structures involved in genome packaging in the picornavirus foot-and-mouth disease virus (FMDV). By interrogating deep sequencing data generated from both packaged and unpackaged populations of RNA we have determined multiple regions of the genome with constrained variation in the packaged population. Predicted secondary structures of these regions revealed stem loops with conservation of structure and a common motif at the loop. Disruption of these features resulted in attenuation of virus growth in cell culture due to a reduction in assembly of mature virions. This study provides evidence for the involvement of predicted RNA structures in picornavirus packaging and offers a readily transferable methodology for identifying packaging requirements in many other viruses. Importance In order to transmit their genetic material to a new host, non-enveloped viruses must protect their genomes by packaging them into an outer shell or capsid of virus-encoded proteins. For many non-enveloped RNA viruses the requirements for this critical part of the viral life cycle remain poorly understood. We have identified RNA sequences involved in genome packaging of the picornavirus foot-and-mouth disease virus. This virus causes an economically devastating disease of livestock affecting both the developed and developing world. The experimental methods developed to carry out this work are novel, simple and transferable to the

Accurate identification of RNA editing sites from primitive sequence with deep neural networks.

Science.gov (United States)

Ouyang, Zhangyi; Liu, Feng; Zhao, Chenghui; Ren, Chao; An, Gaole; Mei, Chuan; Bo, Xiaochen; Shu, Wenjie

2018-04-16

RNA editing is a post-transcriptional RNA sequence alteration. Current methods have identified editing sites and facilitated research but require sufficient genomic annotations and prior-knowledge-based filtering steps, resulting in a cumbersome, time-consuming identification process. Moreover, these methods have limited generalizability and applicability in species with insufficient genomic annotations or in conditions of limited prior knowledge. We developed DeepRed, a deep learning-based method that identifies RNA editing from primitive RNA sequences without prior-knowledge-based filtering steps or genomic annotations. DeepRed achieved 98.1% and 97.9% area under the curve (AUC) in training and test sets, respectively. We further validated DeepRed using experimentally verified U87 cell RNA-seq data, achieving 97.9% positive predictive value (PPV). We demonstrated that DeepRed offers better prediction accuracy and computational efficiency than current methods with large-scale, mass RNA-seq data. We used DeepRed to assess the impact of multiple factors on editing identification with RNA-seq data from the Association of Biomolecular Resource Facilities and Sequencing Quality Control projects. We explored developmental RNA editing pattern changes during human early embryogenesis and evolutionary patterns in Drosophila species and the primate lineage using DeepRed. Our work illustrates DeepRed's state-of-the-art performance; it may decipher the hidden principles behind RNA editing, making editing detection convenient and effective.

The Messenger Mission to Mercury

CERN Document Server

Domingue, D. L

2007-01-01

NASA’s MESSENGER mission, launched on 3 August, 2004 is the seventh mission in the Discovery series. MESSENGER encounters the planet Mercury four times, culminating with an insertion into orbit on 18 March 2011. It carries a comprehensive package of geophysical, geological, geochemical, and space environment experiments to complete the complex investigations of this solar-system end member, which begun with Mariner 10. The articles in this book, written by the experts in each area of the MESSENGER mission, describe the mission, spacecraft, scientific objectives, and payload. The book is of interest to all potential users of the data returned by the MESSENGER mission, to those studying the nature of the planet Mercury, and by all those interested in the design and implementation of planetary exploration missions.

Single-Cell RNA Sequencing of Glioblastoma Cells.

Science.gov (United States)

Sen, Rajeev; Dolgalev, Igor; Bayin, N Sumru; Heguy, Adriana; Tsirigos, Aris; Placantonakis, Dimitris G

2018-01-01

Single-cell RNA sequencing (sc-RNASeq) is a recently developed technique used to evaluate the transcriptome of individual cells. As opposed to conventional RNASeq in which entire populations are sequenced in bulk, sc-RNASeq can be beneficial when trying to better understand gene expression patterns in markedly heterogeneous populations of cells or when trying to identify transcriptional signatures of rare cells that may be underrepresented when using conventional bulk RNASeq. In this method, we describe the generation and analysis of cDNA libraries from single patient-derived glioblastoma cells using the C1 Fluidigm system. The protocol details the use of the C1 integrated fluidics circuit (IFC) for capturing, imaging and lysing cells; performing reverse transcription; and generating cDNA libraries that are ready for sequencing and analysis.

Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.

Science.gov (United States)

Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli

2012-01-01

RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.

Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.

Directory of Open Access Journals (Sweden)

Sara Kangaspeska

Full Text Available RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60% of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.

Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

Directory of Open Access Journals (Sweden)

Jeffrey R Johansen

Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

Cloning and sequencing of full-length cDNAs of RNA1 and RNA2 of a Tomato black ring virus isolate from Poland.

Science.gov (United States)

Jończyk, M; Le Gall, O; Pałucha, A; Borodynko, N; Pospieszny, H

2004-04-01

Full-length cDNA clones corresponding to the RNA1 and RNA2 of the Polish isolate MJ of Tomato black ring virus (TBRV, genus Nepovirus) were obtained using a direct recombination strategy in yeast, and their complete nucleotide sequences were established. RNA1 is 7358 nucleotides and RNA2 is 4633 nucleotides in length, excluding the poly(A) tails. Both RNAs contain a single open reading frame encoding polyproteins of 254 kDa and 149 kDa for RNA1 and RNA2 respectively. Putative cleavage sites were identified, and the relationships between TBRV and related nepoviruses were studied by sequence comparison.

Lower glutamic acid decarboxylase 65-kDa isoform messenger RNA and protein levels in the prefrontal cortex in schizoaffective disorder but not schizophrenia.

Science.gov (United States)

Glausier, Jill R; Kimoto, Sohei; Fish, Kenneth N; Lewis, David A

2015-01-15

Altered gamma-aminobutyric acid (GABA) signaling in the prefrontal cortex (PFC) has been associated with cognitive dysfunction in patients with schizophrenia and schizoaffective disorder. Levels of the GABA-synthesizing enzyme glutamic acid decarboxylase 67-kDa isoform (GAD67) in the PFC have been consistently reported to be lower in patients with these disorders, but the status of the second GABA-synthesizing enzyme, glutamic acid decarboxylase 65-kDa isoform (GAD65), remains unclear. GAD65 messenger RNA (mRNA) levels were quantified in PFC area 9 by quantitative polymerase chain reaction from 62 subjects with schizophrenia or schizoaffective disorder and 62 matched healthy comparison subjects. In a subset of subject pairs, GAD65 relative protein levels were quantified by confocal immunofluorescence microscopy. Mean GAD65 mRNA levels were 13.6% lower in subjects with schizoaffective disorder but did not differ in subjects with schizophrenia relative to their matched healthy comparison subjects. In the subjects with schizoaffective disorder, mean GAD65 protein levels were 19.4% lower and were correlated with GAD65 mRNA levels. Lower GAD65 mRNA and protein levels within subjects with schizoaffective disorder were not attributable to factors commonly comorbid with the diagnosis. In concert with previous studies, these findings suggest that schizoaffective disorder is associated with lower levels of both GAD65 and GAD67 mRNA and protein in the PFC, whereas subjects with schizophrenia have lower mean levels of only GAD67 mRNA and protein. Because cognitive function is generally better preserved in patients with schizoaffective disorder relative to patients with schizophrenia, these findings may support an interpretation that GAD65 downregulation provides a homeostatic response complementary to GAD67 downregulation that serves to reduce inhibition in the face of lower PFC network activity. Copyright © 2015 Society of Biological Psychiatry. Published by Elsevier Inc

incaRNAfbinv: a web server for the fragment-based design of RNA sequences

Science.gov (United States)

Drory Retwitzer, Matan; Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme; Barash, Danny

2016-01-01

Abstract In recent years, new methods for computational RNA design have been developed and applied to various problems in synthetic biology and nanotechnology. Lately, there is considerable interest in incorporating essential biological information when solving the inverse RNA folding problem. Correspondingly, RNAfbinv aims at including biologically meaningful constraints and is the only program to-date that performs a fragment-based design of RNA sequences. In doing so it allows the design of sequences that do not necessarily exactly fold into the target, as long as the overall coarse-grained tree graph shape is preserved. Augmented by the weighted sampling algorithm of incaRNAtion, our web server called incaRNAfbinv implements the method devised in RNAfbinv and offers an interactive environment for the inverse folding of RNA using a fragment-based design approach. It takes as input: a target RNA secondary structure; optional sequence and motif constraints; optional target minimum free energy, neutrality and GC content. In addition to the design of synthetic regulatory sequences, it can be used as a pre-processing step for the detection of novel natural occurring RNAs. The two complementary methodologies RNAfbinv and incaRNAtion are merged together and fully implemented in our web server incaRNAfbinv, available at http://www.cs.bgu.ac.il/incaRNAfbinv. PMID:27185893

Deep RNA Sequencing of the Skeletal Muscle Transcriptome in Swimming Fish

NARCIS (Netherlands)

Palstra, A.P.; Beltran, S.; Burgerhout, E.; Brittijn, S.A.; Magnoni, L.J.; Henkel, C.V.; Jansen, A.; Thillart, G.E.E.J.M.; Spaink, H.P.; Planas, J.V.

2013-01-01

Deep RNA sequencing (RNA-seq) was performed to provide an in-depth view of the transcriptome of red and white skeletal muscle of exercised and non-exercised rainbow trout (Oncorhynchus mykiss) with the specific objective to identify expressed genes and quantify the transcriptomic effects of

Thousands of primer-free, high-quality, full-length SSU rRNA sequences from all domains of life

DEFF Research Database (Denmark)

Karst, Soeren M; Dueholm, Morten S; McIlroy, Simon J

2016-01-01

Ribosomal RNA (rRNA) genes are the consensus marker for determination of microbial diversity on the planet, invaluable in studies of evolution and, for the past decade, high-throughput sequencing of variable regions of ribosomal RNA genes has become the backbone of most microbial ecology studies...... (SSU) rRNA genes and synthetic long read sequencing by molecular tagging, to generate primer-free, full-length SSU rRNA gene sequences from all domains of life, with a median raw error rate of 0.17%. We generated thousands of full-length SSU rRNA sequences from five well-studied ecosystems (soil, human...... gut, fresh water, anaerobic digestion, and activated sludge) and obtained sequences covering all domains of life and the majority of all described phyla. Interestingly, 30% of all bacterial operational taxonomic units were novel, compared to the SILVA database (less than 97% similarity...

Changes in growth hormone (GH) messenger RNA (GH mRNA) expression in the rat anterior pituitary after single interferon (IFN) alpha administration

International Nuclear Information System (INIS)

Romanowski, W.; Braczkowski, R.; Nowakowska-Zajdel, E.; Muc-Wierzgon, M.; Zubelewicz-Szkodzinska, B.; Kosiewicz, J.; Korzonek, I.

2006-01-01

Introduction: Interferon a (IFN-a) is a cytokine with pleiotropic effects which, via different pathways, influences the secretion of certain cytokines and hormones. Growth hormone (GH) secreted from the pituitary has physiological effects on various target tissues. The question is how IFN-a administered in various types of disease influences GH secretion. This study investigated the acute effect of IFN-a on GH mRNA expression in the rat anterior pituitary. Objective: The aim of the study was to measure the cellular expression of GH mRNA by in situ hybridisation in the anterior pituitary after a single administration of IFN-a. Material and methods: Rats were administered an intraperitoneal injection of IFN-a or saline. The rat pituitaries were taken 2 and 4 hours after IFN/saline administration and kept frozen until in situ hybridisation histochemistry. A 31 - base 35S -labelled oligonucleotide probe complementary to part of the exonic mRNA sequence coding for GH mRNA was used. All control and experimental sections were hybridised in the same hybridisation reaction. Results: Acute administration of interferon a increased GH mRNA expression in the anterior pituitary in the 4-hour group in comparison with the control group, and there was no difference between the control group and the 2-hour rats. Conclusion: A single IFN-a administration was found to exert an influence on anterior pituitary GH mRNA expression. These observations may pave the way for presenting a possible new action of IFN-a. (author) GH mRNA, anterior pituitary, interferon

RNA-DNA sequence differences spell genetic code ambiguities

DEFF Research Database (Denmark)

Bentin, Thomas; Nielsen, Michael L

2013-01-01

A recent paper in Science by Li et al. 2011(1) reports widespread sequence differences in the human transcriptome between RNAs and their encoding genes termed RNA-DNA differences (RDDs). The findings could add a new layer of complexity to gene expression but the study has been criticized. ...

Adenylylation of small RNA sequencing adapters using the TS2126 RNA ligase I.

Science.gov (United States)

Lama, Lodoe; Ryan, Kevin

2016-01-01

Many high-throughput small RNA next-generation sequencing protocols use 5' preadenylylated DNA oligonucleotide adapters during cDNA library preparation. Preadenylylation of the DNA adapter's 5' end frees from ATP-dependence the ligation of the adapter to RNA collections, thereby avoiding ATP-dependent side reactions. However, preadenylylation of the DNA adapters can be costly and difficult. The currently available method for chemical adenylylation of DNA adapters is inefficient and uses techniques not typically practiced in laboratories profiling cellular RNA expression. An alternative enzymatic method using a commercial RNA ligase was recently introduced, but this enzyme works best as a stoichiometric adenylylating reagent rather than a catalyst and can therefore prove costly when several variant adapters are needed or during scale-up or high-throughput adenylylation procedures. Here, we describe a simple, scalable, and highly efficient method for the 5' adenylylation of DNA oligonucleotides using the thermostable RNA ligase 1 from bacteriophage TS2126. Adapters with 3' blocking groups are adenylylated at >95% yield at catalytic enzyme-to-adapter ratios and need not be gel purified before ligation to RNA acceptors. Experimental conditions are also reported that enable DNA adapters with free 3' ends to be 5' adenylylated at >90% efficiency. © 2015 Lama and Ryan; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Interference by clustered regularly interspaced short palindromic repeat (CRISPR) RNA is governed by a seed sequence

NARCIS (Netherlands)

Semenova, E.V.; Jore, M.M.; Westra, E.R.; Oost, van der J.; Brouns, S.J.J.

2011-01-01

Prokaryotic clustered regularly interspaced short palindromic repeat (CRISPR)/Cas (CRISPR-associated sequences) systems provide adaptive immunity against viruses when a spacer sequence of small CRISPR RNA (crRNA) matches a protospacer sequence in the viral genome. Viruses that escape CRISPR/Cas

High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases

Science.gov (United States)

Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.

2016-01-01

Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030

MicroRNA of the fifth-instar posterior silk gland of silkworm identified by Solexa sequencing

Directory of Open Access Journals (Sweden)

Jisheng Li

2014-12-01

Full Text Available No special studies have been focused on the microRNA (miRNA in the fifth-instar posterior silk gland of Bombyx mori. Here, using next-generation sequencing, we acquired 93.2 million processed reads from 10 small RNA libraries. In this paper, we tried to thoroughly describe how our dataset generated from deep sequencing which was recently published in BMC genomics. Results showed that our findings are largely enriched silkworm miRNA depository and may benefit us to reveal the miRNA functions in the process of silk production.

Evaluating Quality of Aged Archival Formalin-Fixed Paraffin-Embedded Samples for RNA-Sequencing

Science.gov (United States)

Archival formalin-fixed paraffin-embedded (FFPE) samples offer a vast, untapped source of genomic data for biomarker discovery. However, the quality of FFPE samples is often highly variable, and conventional methods to assess RNA quality for RNA-sequencing (RNA-seq) are not infor...

Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

Science.gov (United States)

Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-11-28

Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

Effects of insulin on messenger RNA activities in rat liver

International Nuclear Information System (INIS)

Hill, R.E.; Lee, K.L.; Kenney, F.T.

1981-01-01

Liver poly(A) RNA, isolated from adrenalectomized rats after insulin treatment, was translated in a nuclease-treated lysate of rabbit reticulocytes and quantitated for both total activity and the capacity to synthesize the insulin-inducible enzyme tyrosine amino-transferase. Analysis of the translated products from poly(A) RNA isolated 1 h after insulin treatment showed a 2.7-fold increase in activity of tyrosine aminotransferase mRNA. During the same interval, the capacity of poly(A) RNA to direct the synthesis of total protein in lysates also changed, showing a 30 to 40% increase in translational activity/unit of RNA. Increased translatability was apparent in all fractions of poly(A) RNA separated by centrifugation on sucrose gradients. Insulin thus appears to mediated a generalized changed in mRNAs leading to increased capacity for translation; induction of tyrosine aminotransferase may reflect unusual sensitivity to this effect of the hormone

16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs.

Science.gov (United States)

Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S

1990-01-01

16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

Small RNA sequencing reveals metastasis-related microRNAs in lung adenocarcinoma

DEFF Research Database (Denmark)

Daugaard, Iben; Venø, Morten T.; Yan, Yan

2017-01-01

The majority of lung cancer deaths are caused by metastatic disease. MicroRNAs (miRNAs) are posttranscriptional regulators of gene expression and miRNA dysregulation can contribute to metastatic progression. Here, small RNA sequencing was used to profile the miRNA and piwi-interacting RNA (piRNA......) transcriptomes in relation to lung cancer metastasis. RNA-seq was performed using RNA extracted from formalin-fixed paraffin embedded (FFPE) lung adenocarcinomas (LAC) and brain metastases from 8 patients, and LACs from 8 patients without detectable metastatic disease. Impact on miRNA and piRNA transcriptomes...... was subtle with 9 miRNAs and 8 piRNAs demonstrating differential expression between metastasizing and non-metastasizing LACs. For piRNAs, decreased expression of piR-57125 was the most significantly associated with distant metastasis. Validation by RT-qPCR in a LAC cohort comprising 52 patients confirmed...

Efficient construction of an inverted minimal H1 promoter driven siRNA expression cassette: facilitation of promoter and siRNA sequence exchange.

Directory of Open Access Journals (Sweden)

Hoorig Nassanian

2007-08-01

Full Text Available RNA interference (RNAi, mediated by small interfering RNA (siRNA, is an effective method used to silence gene expression at the post-transcriptional level. Upon introduction into target cells, siRNAs incorporate into the RNA-induced silencing complex (RISC. The antisense strand of the siRNA duplex then "guides" the RISC to the homologous mRNA, leading to target degradation and gene silencing. In recent years, various vector-based siRNA expression systems have been developed which utilize opposing polymerase III promoters to independently drive expression of the sense and antisense strands of the siRNA duplex from the same template.We show here the use of a ligase chain reaction (LCR to develop a new vector system called pInv-H1 in which a DNA sequence encoding a specific siRNA is placed between two inverted minimal human H1 promoters (approximately 100 bp each. Expression of functional siRNAs from this construct has led to efficient silencing of both reporter and endogenous genes. Furthermore, the inverted H1 promoter-siRNA expression cassette was used to generate a retrovirus vector capable of transducing and silencing expression of the targeted protein by>80% in target cells.The unique design of this construct allows for the efficient exchange of siRNA sequences by the directional cloning of short oligonucleotides via asymmetric restriction sites. This provides a convenient way to test the functionality of different siRNA sequences. Delivery of the siRNA cassette by retroviral transduction suggests that a single copy of the siRNA expression cassette efficiently knocks down gene expression at the protein level. We note that this vector system can potentially be used to generate a random siRNA library. The flexibility of the ligase chain reaction suggests that additional control elements can easily be introduced into this siRNA expression cassette.

Using small RNA (sRNA) deep sequencing to understand global virus distribution in plants

Science.gov (United States)

Small RNAs (sRNAs), a class of regulatory RNAs, have been used to serve as the specificity determinants of suppressing gene expression in plants and animals. Next generation sequencing (NGS) uncovered the sRNA landscape in most organisms including their associated microbes. In the current study, w...

On the optimal trimming of high-throughput mRNA sequence data

Directory of Open Access Journals (Sweden)

Matthew D MacManes

2014-01-01

Full Text Available The widespread and rapid adoption of high-throughput sequencing technologies has afforded researchers the opportunity to gain a deep understanding of genome level processes that underlie evolutionary change, and perhaps more importantly, the links between genotype and phenotype. In particular, researchers interested in functional biology and adaptation have used these technologies to sequence mRNA transcriptomes of specific tissues, which in turn are often compared to other tissues, or other individuals with different phenotypes. While these techniques are extremely powerful, careful attention to data quality is required. In particular, because high-throughput sequencing is more error-prone than traditional Sanger sequencing, quality trimming of sequence reads should be an important step in all data processing pipelines. While several software packages for quality trimming exist, no general guidelines for the specifics of trimming have been developed. Here, using empirically derived sequence data, I provide general recommendations regarding the optimal strength of trimming, specifically in mRNA-Seq studies. Although very aggressive quality trimming is common, this study suggests that a more gentle trimming, specifically of those nucleotides whose Phred score < 2 or < 5, is optimal for most studies across a wide variety of metrics.

A DNA sequence obtained by replacement of the dopamine RNA aptamer bases is not an aptamer.

Science.gov (United States)

Álvarez-Martos, Isabel; Ferapontova, Elena E

2017-08-05

A unique specificity of the aptamer-ligand biorecognition and binding facilitates bioanalysis and biosensor development, contributing to discrimination of structurally related molecules, such as dopamine and other catecholamine neurotransmitters. The aptamer sequence capable of specific binding of dopamine is a 57 nucleotides long RNA sequence reported in 1997 (Biochemistry, 1997, 36, 9726). Later, it was suggested that the DNA homologue of the RNA aptamer retains the specificity of dopamine binding (Biochem. Biophys. Res. Commun., 2009, 388, 732). Here, we show that the DNA sequence obtained by the replacement of the RNA aptamer bases for their DNA analogues is not able of specific biorecognition of dopamine, in contrast to the original RNA aptamer sequence. This DNA sequence binds dopamine and structurally related catecholamine neurotransmitters non-specifically, as any DNA sequence, and, thus, is not an aptamer and cannot be used neither for in vivo nor in situ analysis of dopamine in the presence of structurally related neurotransmitters. Copyright © 2017 Elsevier Inc. All rights reserved.

Improved annotation of 3' untranslated regions and complex loci by combination of strand-specific direct RNA sequencing, RNA-Seq and ESTs.

Directory of Open Access Journals (Sweden)

Nicholas J Schurch

Full Text Available The reference annotations made for a genome sequence provide the framework for all subsequent analyses of the genome. Correct and complete annotation in addition to the underlying genomic sequence is particularly important when interpreting the results of RNA-seq experiments where short sequence reads are mapped against the genome and assigned to genes according to the annotation. Inconsistencies in annotations between the reference and the experimental system can lead to incorrect interpretation of the effect on RNA expression of an experimental treatment or mutation in the system under study. Until recently, the genome-wide annotation of 3' untranslated regions received less attention than coding regions and the delineation of intron/exon boundaries. In this paper, data produced for samples in Human, Chicken and A. thaliana by the novel single-molecule, strand-specific, Direct RNA Sequencing technology from Helicos Biosciences which locates 3' polyadenylation sites to within +/- 2 nt, were combined with archival EST and RNA-Seq data. Nine examples are illustrated where this combination of data allowed: (1 gene and 3' UTR re-annotation (including extension of one 3' UTR by 5.9 kb; (2 disentangling of gene expression in complex regions; (3 clearer interpretation of small RNA expression and (4 identification of novel genes. While the specific examples displayed here may become obsolete as genome sequences and their annotations are refined, the principles laid out in this paper will be of general use both to those annotating genomes and those seeking to interpret existing publically available annotations in the context of their own experimental data.

Translation of Angiotensin-Converting Enzyme 2 upon Liver- and Lung-Targeted Delivery of Optimized Chemically Modified mRNA

Directory of Open Access Journals (Sweden)

Eva Schrom

2017-06-01

Full Text Available Changes in lifestyle and environmental conditions give rise to an increasing prevalence of liver and lung fibrosis, and both have a poor prognosis. Promising results have been reported for recombinant angiotensin-converting enzyme 2 (ACE2 protein administration in experimental liver and lung fibrosis. However, the full potential of ACE2 may be achieved by localized translation of a membrane-anchored form. For this purpose, we advanced the latest RNA technology for liver- and lung-targeted ACE2 translation. We demonstrated in vitro that transfection with ACE2 chemically modified messenger RNA (cmRNA leads to robust translation of fully matured, membrane-anchored ACE2 protein. In a second step, we designed eight modified ACE2 cmRNA sequences and identified a lead sequence for in vivo application. Finally, formulation of this ACE2 cmRNA in tailor-made lipidoid nanoparticles and in lipid nanoparticles led to liver- and lung-targeted translation of significant amounts of ACE2 protein, respectively. In summary, we provide evidence that RNA transcript therapy (RTT is a promising approach for ACE2-based treatment of liver and lung fibrosis to be tested in fibrotic disease models.

Genetic selection and DNA sequences of 4.5S RNA homologs

DEFF Research Database (Denmark)

Brown, S; Thon, G; Tolentino, E

1989-01-01

A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

Integrated analysis of RNA-binding protein complexes using in vitro selection and high-throughput sequencing and sequence specificity landscapes (SEQRS).

Science.gov (United States)

Lou, Tzu-Fang; Weidmann, Chase A; Killingsworth, Jordan; Tanaka Hall, Traci M; Goldstrohm, Aaron C; Campbell, Zachary T

2017-04-15

RNA-binding proteins (RBPs) collaborate to control virtually every aspect of RNA function. Tremendous progress has been made in the area of global assessment of RBP specificity using next-generation sequencing approaches both in vivo and in vitro. Understanding how protein-protein interactions enable precise combinatorial regulation of RNA remains a significant problem. Addressing this challenge requires tools that can quantitatively determine the specificities of both individual proteins and multimeric complexes in an unbiased and comprehensive way. One approach utilizes in vitro selection, high-throughput sequencing, and sequence-specificity landscapes (SEQRS). We outline a SEQRS experiment focused on obtaining the specificity of a multi-protein complex between Drosophila RBPs Pumilio (Pum) and Nanos (Nos). We discuss the necessary controls in this type of experiment and examine how the resulting data can be complemented with structural and cell-based reporter assays. Additionally, SEQRS data can be integrated with functional genomics data to uncover biological function. Finally, we propose extensions of the technique that will enhance our understanding of multi-protein regulatory complexes assembled onto RNA. Copyright © 2016 Elsevier Inc. All rights reserved.

Informatics for RNA Sequencing: A Web Resource for Analysis on the Cloud.

Directory of Open Access Journals (Sweden)

Malachi Griffith

2015-08-01

Full Text Available Massively parallel RNA sequencing (RNA-seq has rapidly become the assay of choice for interrogating RNA transcript abundance and diversity. This article provides a detailed introduction to fundamental RNA-seq molecular biology and informatics concepts. We make available open-access RNA-seq tutorials that cover cloud computing, tool installation, relevant file formats, reference genomes, transcriptome annotations, quality-control strategies, expression, differential expression, and alternative splicing analysis methods. These tutorials and additional training resources are accompanied by complete analysis pipelines and test datasets made available without encumbrance at www.rnaseq.wiki.

The role of upstream sequences in selecting the reading frame on tmRNA

Directory of Open Access Journals (Sweden)

Dewey Jonathan D

2008-06-01

Full Text Available Abstract Background tmRNA acts first as a tRNA and then as an mRNA to rescue stalled ribosomes in eubacteria. Two unanswered questions about tmRNA function remain: how does tmRNA, lacking an anticodon, bypass the decoding machinery and enter the ribosome? Secondly, how does the ribosome choose the proper codon to resume translation on tmRNA? According to the -1 triplet hypothesis, the answer to both questions lies in the unique properties of the three nucleotides upstream of the first tmRNA codon. These nucleotides assume an A-form conformation that mimics the codon-anticodon interaction, leading to recognition by the decoding center and choice of the reading frame. The -1 triplet hypothesis is important because it is the most credible model in which direct binding and recognition by the ribosome sets the reading frame on tmRNA. Results Conformational analysis predicts that 18 triplets cannot form the correct structure to function as the -1 triplet of tmRNA. We tested the tmRNA activity of all possible -1 triplet mutants using a genetic assay in Escherichia coli. While many mutants displayed reduced activity, our findings do not match the predictions of this model. Additional mutagenesis identified sequences further upstream that are required for tmRNA function. An immunoblot assay for translation of the tmRNA tag revealed that certain mutations in U85, A86, and the -1 triplet sequence result in improper selection of the first codon and translation in the wrong frame (-1 or +1 in vivo. Conclusion Our findings disprove the -1 triplet hypothesis. The -1 triplet is not required for accommodation of tmRNA into the ribosome, although it plays a minor role in frame selection. Our results strongly disfavor direct ribosomal recognition of the upstream sequence, instead supporting a model in which the binding of a separate ligand to A86 is primarily responsible for frame selection.

StarScan: a web server for scanning small RNA targets from degradome sequencing data.

Science.gov (United States)

Liu, Shun; Li, Jun-Hao; Wu, Jie; Zhou, Ke-Ren; Zhou, Hui; Yang, Jian-Hua; Qu, Liang-Hu

2015-07-01

Endogenous small non-coding RNAs (sRNAs), including microRNAs, PIWI-interacting RNAs and small interfering RNAs, play important gene regulatory roles in animals and plants by pairing to the protein-coding and non-coding transcripts. However, computationally assigning these various sRNAs to their regulatory target genes remains technically challenging. Recently, a high-throughput degradome sequencing method was applied to identify biologically relevant sRNA cleavage sites. In this study, an integrated web-based tool, StarScan (sRNA target Scan), was developed for scanning sRNA targets using degradome sequencing data from 20 species. Given a sRNA sequence from plants or animals, our web server performs an ultrafast and exhaustive search for potential sRNA-target interactions in annotated and unannotated genomic regions. The interactions between small RNAs and target transcripts were further evaluated using a novel tool, alignScore. A novel tool, degradomeBinomTest, was developed to quantify the abundance of degradome fragments located at the 9-11th nucleotide from the sRNA 5' end. This is the first web server for discovering potential sRNA-mediated RNA cleavage events in plants and animals, which affords mechanistic insights into the regulatory roles of sRNAs. The StarScan web server is available at http://mirlab.sysu.edu.cn/starscan/. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

Science.gov (United States)

Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

1989-04-01

The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

Single-cell mRNA cytometry via sequence-specific nanoparticle clustering and trapping

Science.gov (United States)

Labib, Mahmoud; Mohamadi, Reza M.; Poudineh, Mahla; Ahmed, Sharif U.; Ivanov, Ivaylo; Huang, Ching-Lung; Moosavi, Maral; Sargent, Edward H.; Kelley, Shana O.

2018-05-01

Cell-to-cell variation in gene expression creates a need for techniques that can characterize expression at the level of individual cells. This is particularly true for rare circulating tumour cells, in which subtyping and drug resistance are of intense interest. Here we describe a method for cell analysis—single-cell mRNA cytometry—that enables the isolation of rare cells from whole blood as a function of target mRNA sequences. This approach uses two classes of magnetic particles that are labelled to selectively hybridize with different regions of the target mRNA. Hybridization leads to the formation of large magnetic clusters that remain localized within the cells of interest, thereby enabling the cells to be magnetically separated. Targeting specific intracellular mRNAs enablescirculating tumour cells to be distinguished from normal haematopoietic cells. No polymerase chain reaction amplification is required to determine RNA expression levels and genotype at the single-cell level, and minimal cell manipulation is required. To demonstrate this approach we use single-cell mRNA cytometry to detect clinically important sequences in prostate cancer specimens.

Tau mRNA 3'UTR-to-CDS ratio is increased in Alzheimer disease.

Science.gov (United States)

García-Escudero, Vega; Gargini, Ricardo; Martín-Maestro, Patricia; García, Esther; García-Escudero, Ramón; Avila, Jesús

2017-08-10

Neurons frequently show an imbalance in expression of the 3' untranslated region (3'UTR) relative to the coding DNA sequence (CDS) region of mature messenger RNAs (mRNA). The ratio varies among different cells or parts of the brain. The Map2 protein levels per cell depend on the 3'UTR-to-CDS ratio rather than the total mRNA amount, which suggests powerful regulation of protein expression by 3'UTR sequences. Here we found that MAPT (the microtubule-associated protein tau gene) 3'UTR levels are particularly high with respect to other genes; indeed, the 3'UTR-to-CDS ratio of MAPT is balanced in healthy brain in mouse and human. The tau protein accumulates in Alzheimer diseased brain. We nonetheless observed that the levels of RNA encoding MAPT/tau were diminished in these patients' brains. To explain this apparently contradictory result, we studied MAPT mRNA stoichiometry in coding and non-coding regions, and found that the 3'UTR-to-CDS ratio was higher in the hippocampus of Alzheimer disease patients, with higher tau protein but lower total mRNA levels. Our data indicate that changes in the 3'UTR-to-CDS ratio have a regulatory role in the disease. Future research should thus consider not only mRNA levels, but also the ratios between coding and non-coding regions. Copyright © 2017 Elsevier B.V. All rights reserved.

MESSENGER'S First Flyby of Mercury

Science.gov (United States)

Slavin, James A.

2008-01-01

The MESSENGER mission to Mercury offers our first opportunity to explore this planet's miniature magnetosphere since Mariner 10's brief fly-bys in 1974-5. The magnetosphere of Mercury is the smallest in the solar system with its magnetic field typically standing off the solar wind only - 1000 to 2000 km above the surface. An overview of the MESSENGER mission and its January 14th close flyby of Mercury will be provided. Primary science objectives and the science instrumentation will be described. Initial results from MESSENGER'S first flyby on January 14th, 2008 will be discussed with an emphasis on the magnetic field and charged particle measurements.

Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing

OpenAIRE

Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li

2010-01-01

Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resoluti...

Unifying cancer and normal RNA sequencing data from different sources

Science.gov (United States)

Wang, Qingguo; Armenia, Joshua; Zhang, Chao; Penson, Alexander V.; Reznik, Ed; Zhang, Liguo; Minet, Thais; Ochoa, Angelica; Gross, Benjamin E.; Iacobuzio-Donahue, Christine A.; Betel, Doron; Taylor, Barry S.; Gao, Jianjiong; Schultz, Nikolaus

2018-01-01

Driven by the recent advances of next generation sequencing (NGS) technologies and an urgent need to decode complex human diseases, a multitude of large-scale studies were conducted recently that have resulted in an unprecedented volume of whole transcriptome sequencing (RNA-seq) data, such as the Genotype Tissue Expression project (GTEx) and The Cancer Genome Atlas (TCGA). While these data offer new opportunities to identify the mechanisms underlying disease, the comparison of data from different sources remains challenging, due to differences in sample and data processing. Here, we developed a pipeline that processes and unifies RNA-seq data from different studies, which includes uniform realignment, gene expression quantification, and batch effect removal. We find that uniform alignment and quantification is not sufficient when combining RNA-seq data from different sources and that the removal of other batch effects is essential to facilitate data comparison. We have processed data from GTEx and TCGA and successfully corrected for study-specific biases, enabling comparative analysis between TCGA and GTEx. The normalized datasets are available for download on figshare. PMID:29664468

Computational sequence analysis of predicted long dsRNA transcriptomes of major crops reveals sequence complementarity with human genes.

Science.gov (United States)

Jensen, Peter D; Zhang, Yuanji; Wiggins, B Elizabeth; Petrick, Jay S; Zhu, Jin; Kerstetter, Randall A; Heck, Gregory R; Ivashuta, Sergey I

2013-01-01

Long double-stranded RNAs (long dsRNAs) are precursors for the effector molecules of sequence-specific RNA-based gene silencing in eukaryotes. Plant cells can contain numerous endogenous long dsRNAs. This study demonstrates that such endogenous long dsRNAs in plants have sequence complementarity to human genes. Many of these complementary long dsRNAs have perfect sequence complementarity of at least 21 nucleotides to human genes; enough complementarity to potentially trigger gene silencing in targeted human cells if delivered in functional form. However, the number and diversity of long dsRNA molecules in plant tissue from crops such as lettuce, tomato, corn, soy and rice with complementarity to human genes that have a long history of safe consumption supports a conclusion that long dsRNAs do not present a significant dietary risk.

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

Science.gov (United States)

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

Screening for sequence-specific RNA-BPs by comprehensive UV crosslinking

Directory of Open Access Journals (Sweden)

Le Meuth-Metzinger Valerie

2002-06-01

Full Text Available Abstract Background Specific cis-elements and the associated trans-acting factors have been implicated in the post-transcriptional regulation of gene expression. In the era of genome wide analyses identifying novel trans-acting factors and cis-regulatory elements is a step towards understanding coordinated gene expression. UV-crosslink analysis is a standard method used to identify RNA-binding proteins. Uridine is traditionally used to radiolabel substrate RNAs, however, proteins binding to cis-elments particularly uridine poor will be weakly or not detected. We evaluate here the possibility of using UV-crosslinking with RNA substrates radiolabeled with each of the four ribonucleotides as an approach for screening for novel sequence specific RNA-binding proteins. Results The radiolabeled RNA substrates were derived from the 3'UTRs of the cloned Eg and c-mos Xenopus laevis maternal mRNAs. Specific, but not identical, uv-crosslinking signals were obtained, some of which corresponded to already identified proteins. A signal for a novel 90 kDa protein was observed with the c-mos 3'UTR radiolabeled with both CTP and GTP but not with UTP. The binding site of the 90 kDa RNA-binding protein was localised to a 59-nucleotide portion of the c-mos 3'UTR. Conclusion That the 90 kDa signal was detected with RNAs radiolabeled with CTP or GTP but not UTP illustrates the advantage of radiolabeling all four nucleotides in a UV-crosslink based screen. This method can be used for both long and short RNAs and does not require knowledge of the cis-acting sequence. It should be amenable to high throughput screening for RNA binding proteins.

Mapping RNA Structure In Vitro with SHAPE Chemistry and Next-Generation Sequencing (SHAPE-Seq).

Science.gov (United States)

Watters, Kyle E; Lucks, Julius B

2016-01-01

Mapping RNA structure with selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistry has proven to be a versatile method for characterizing RNA structure in a variety of contexts. SHAPE reagents covalently modify RNAs in a structure-dependent manner to create adducts at the 2'-OH group of the ribose backbone at nucleotides that are structurally flexible. The positions of these adducts are detected using reverse transcriptase (RT) primer extension, which stops one nucleotide before the modification, to create a pool of cDNAs whose lengths reflect the location of SHAPE modification. Quantification of the cDNA pools is used to estimate the "reactivity" of each nucleotide in an RNA molecule to the SHAPE reagent. High reactivities indicate nucleotides that are structurally flexible, while low reactivities indicate nucleotides that are inflexible. These SHAPE reactivities can then be used to infer RNA structures by restraining RNA structure prediction algorithms. Here, we provide a state-of-the-art protocol describing how to perform in vitro RNA structure probing with SHAPE chemistry using next-generation sequencing to quantify cDNA pools and estimate reactivities (SHAPE-Seq). The use of next-generation sequencing allows for higher throughput, more consistent data analysis, and multiplexing capabilities. The technique described herein, SHAPE-Seq v2.0, uses a universal reverse transcription priming site that is ligated to the RNA after SHAPE modification. The introduced priming site allows for the structural analysis of an RNA independent of its sequence.

Sequence-specific inhibition of Dicer measured with a force-based microarray for RNA ligands.

Science.gov (United States)

Limmer, Katja; Aschenbrenner, Daniela; Gaub, Hermann E

2013-04-01

Malfunction of protein translation causes many severe diseases, and suitable correction strategies may become the basis of effective therapies. One major regulatory element of protein translation is the nuclease Dicer that cuts double-stranded RNA independently of the sequence into pieces of 19-22 base pairs starting the RNA interference pathway and activating miRNAs. Inhibiting Dicer is not desirable owing to its multifunctional influence on the cell's gene regulation. Blocking specific RNA sequences by small-molecule binding, however, is a promising approach to affect the cell's condition in a controlled manner. A label-free assay for the screening of site-specific interference of small molecules with Dicer activity is thus needed. We used the Molecular Force Assay (MFA), recently developed in our lab, to measure the activity of Dicer. As a model system, we used an RNA sequence that forms an aptamer-binding site for paromomycin, a 615-dalton aminoglycoside. We show that Dicer activity is modulated as a function of concentration and incubation time: the addition of paromomycin leads to a decrease of Dicer activity according to the amount of ligand. The measured dissociation constant of paromomycin to its aptamer was found to agree well with literature values. The parallel format of the MFA allows a large-scale search and analysis for ligands for any RNA sequence.

Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.

Science.gov (United States)

Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V

2003-01-01

Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).

mRNA Traffic Control Reviewed: N6-Methyladenosine (m6 A) Takes the Driver's Seat.

Science.gov (United States)

Visvanathan, Abhirami; Somasundaram, Kumaravel

2018-01-01

Messenger RNA is a flexible tool box that plays a key role in the dynamic regulation of gene expression. RNA modifications variegate the message conveyed by the mRNA. Similar to DNA and histone modifications, mRNA modifications are reversible and play a key role in the regulation of molecular events. Our understanding about the landscape of RNA modifications is still rudimentary in contrast to DNA and histone modifications. The major obstacle has been the lack of sensitive detection methods since they are non-editing events. However, with the advent of next-generation sequencing techniques, RNA modifications are being identified precisely at single nucleotide resolution. In recent years, methylation at the N6 position of adenine (m 6 A) has gained the attention of RNA biologists. The m 6 A modification has a set of writers (methylases), erasers (demethylases), and readers. Here, we provide a summary of interesting facts, conflicting findings, and recent advances in the technical and functional aspects of the m 6 A epitranscriptome. © 2017 WILEY Periodicals, Inc.

Protein functional features are reflected in the patterns of mRNA translation speed.

Science.gov (United States)

López, Daniel; Pazos, Florencio

2015-07-09

The degeneracy of the genetic code makes it possible for the same amino acid string to be coded by different messenger RNA (mRNA) sequences. These "synonymous mRNAs" may differ largely in a number of aspects related to their overall translational efficiency, such as secondary structure content and availability of the encoded transfer RNAs (tRNAs). Consequently, they may render different yields of the translated polypeptides. These mRNA features related to translation efficiency are also playing a role locally, resulting in a non-uniform translation speed along the mRNA, which has been previously related to some protein structural features and also used to explain some dramatic effects of "silent" single-nucleotide-polymorphisms (SNPs). In this work we perform the first large scale analysis of the relationship between three experimental proxies of mRNA local translation efficiency and the local features of the corresponding encoded proteins. We found that a number of protein functional and structural features are reflected in the patterns of ribosome occupancy, secondary structure and tRNA availability along the mRNA. One or more of these proxies of translation speed have distinctive patterns around the mRNA regions coding for certain protein local features. In some cases the three patterns follow a similar trend. We also show specific examples where these patterns of translation speed point to the protein's important structural and functional features. This support the idea that the genome not only codes the protein functional features as sequences of amino acids, but also as subtle patterns of mRNA properties which, probably through local effects on the translation speed, have some consequence on the final polypeptide. These results open the possibility of predicting a protein's functional regions based on a single genomic sequence, and have implications for heterologous protein expression and fine-tuning protein function.

Accuracy of taxonomy prediction for 16S rRNA and fungal ITS sequences

Directory of Open Access Journals (Sweden)

Robert C. Edgar

2018-04-01

Full Text Available Prediction of taxonomy for marker gene sequences such as 16S ribosomal RNA (rRNA is a fundamental task in microbiology. Most experimentally observed sequences are diverged from reference sequences of authoritatively named organisms, creating a challenge for prediction methods. I assessed the accuracy of several algorithms using cross-validation by identity, a new benchmark strategy which explicitly models the variation in distances between query sequences and the closest entry in a reference database. When the accuracy of genus predictions was averaged over a representative range of identities with the reference database (100%, 99%, 97%, 95% and 90%, all tested methods had ≤50% accuracy on the currently-popular V4 region of 16S rRNA. Accuracy was found to fall rapidly with identity; for example, better methods were found to have V4 genus prediction accuracy of ∼100% at 100% identity but ∼50% at 97% identity. The relationship between identity and taxonomy was quantified as the probability that a rank is the lowest shared by a pair of sequences with a given pair-wise identity. With the V4 region, 95% identity was found to be a twilight zone where taxonomy is highly ambiguous because the probabilities that the lowest shared rank between pairs of sequences is genus, family, order or class are approximately equal.

A novel RNA sequencing data analysis method for cell line authentication.

Directory of Open Access Journals (Sweden)

Erik Fasterius

Full Text Available We have developed a novel analysis method that can interrogate the authenticity of biological samples used for generation of transcriptome profiles in public data repositories. The method uses RNA sequencing information to reveal mutations in expressed transcripts and subsequently confirms the identity of analysed cells by comparison with publicly available cell-specific mutational profiles. Cell lines constitute key model systems widely used within cancer research, but their identity needs to be confirmed in order to minimise the influence of cell contaminations and genetic drift on the analysis. Using both public and novel data, we demonstrate the use of RNA-sequencing data analysis for cell line authentication by examining the validity of COLO205, DLD1, HCT15, HCT116, HKE3, HT29 and RKO colorectal cancer cell lines. We successfully authenticate the studied cell lines and validate previous reports indicating that DLD1 and HCT15 are synonymous. We also show that the analysed HKE3 cells harbour an unexpected KRAS-G13D mutation and confirm that this cell line is a genuine KRAS dosage mutant, rather than a true isogenic derivative of HCT116 expressing only the wild type KRAS. This authentication method could be used to revisit the numerous cell line based RNA sequencing experiments available in public data repositories, analyse new experiments where whole genome sequencing is not available, as well as facilitate comparisons of data from different experiments, platforms and laboratories.

Higgs mass from neutrino-messenger mixing

International Nuclear Information System (INIS)

Byakti, Pritibhajan; Khosa, Charanjit K.; Mummidi, V.S.; Vempati, Sudhir K.

2017-01-01

The discovery of the Higgs particle at 125 GeV has put strong constraints on minimal messenger models of gauge mediation, pushing the stop masses into the multi-TeV regime. Extensions of these models with matter-messenger mixing terms have been proposed to generate a large trilinear parameter, A t , relaxing these constraints. The detailed survey of these models (DOI: 10.1007/JHEP05(2013)055; 10.1007/JHEP08(2013)093 ) so far considered messenger mixings with only MSSM superfields. In the present work, we extend the survey to MSSM with inverse-seesaw mechanism. The neutrino-sneutrino corrections to the Higgs mass in the inverse seesaw model are not significant in the minimal gauge mediation model, unless one considers messenger-matter interaction terms. We classify all possible models with messenger-matter interactions and perform thorough numerical analysis to find out the promising models. We found that out of the 17 possible models 9 of them can lead to Higgs mass within the observed value without raising the sfermion masses significantly. The successful models have stop masses ∼1.5 TeV with small or negligible mixing and yet a light CP even Higgs at 125 GeV.

Pairwise local structural alignment of RNA sequences with sequence similarity less than 40%

DEFF Research Database (Denmark)

Havgaard, Jakob Hull; Lyngsø, Rune B.; Stormo, Gary D.

2005-01-01

detect two genes with low sequence similarity, where the genes are part of a larger genomic region. Results: Here we present such an approach for pairwise local alignment which is based on FILDALIGN and the Sankoff algorithm for simultaneous structural alignment of multiple sequences. We include...... the ability to conduct mutual scans of two sequences of arbitrary length while searching for common local structural motifs of some maximum length. This drastically reduces the complexity of the algorithm. The scoring scheme includes structural parameters corresponding to those available for free energy....... The structure prediction performance for a family is typically around 0.7 using Matthews correlation coefficient. In case (2), the algorithm is successful at locating RNA families with an average sensitivity of 0.8 and a positive predictive value of 0.9 using a BLAST-like hit selection scheme. Availability...

Martini Coarse-Grained Force Field : Extension to RNA

NARCIS (Netherlands)

Uusitalo, Jaakko J.; Ingolfsson, Helgi I.; Marrink, Siewert J.; Faustino, Ignacio

2017-01-01

RNA has an important role not only as the messenger of genetic information but also as a regulator of gene expression. Given its central role in cell biology, there is significant interest in studying the structural and dynamic behavior of RNA in relation to other biomolecules. Coarse-grain

Statistical Use of Argonaute Expression and RISC Assembly in microRNA Target Identification

Science.gov (United States)

Stanhope, Stephen A.; Sengupta, Srikumar; den Boon, Johan; Ahlquist, Paul; Newton, Michael A.

2009-01-01

MicroRNAs (miRNAs) posttranscriptionally regulate targeted messenger RNAs (mRNAs) by inducing cleavage or otherwise repressing their translation. We address the problem of detecting m/miRNA targeting relationships in homo sapiens from microarray data by developing statistical models that are motivated by the biological mechanisms used by miRNAs. The focus of our modeling is the construction, activity, and mediation of RNA-induced silencing complexes (RISCs) competent for targeted mRNA cleavage. We demonstrate that regression models accommodating RISC abundance and controlling for other mediating factors fit the expression profiles of known target pairs substantially better than models based on m/miRNA expressions alone, and lead to verifications of computational target pair predictions that are more sensitive than those based on marginal expression levels. Because our models are fully independent of exogenous results from sequence-based computational methods, they are appropriate for use as either a primary or secondary source of information regarding m/miRNA target pair relationships, especially in conjunction with high-throughput expression studies. PMID:19779550

cDNA cloning and mRNA expression of cat and dog Cdkal1

Directory of Open Access Journals (Sweden)

Sako T

2012-08-01

Full Text Available Ichiro Yamamoto, Shingo Ishikawa, Li Gebin, Hiroshi Takemitsu, Megumi Fujiwara, Nobuko Mori, Yutaka Hatano, Tomoko Suzuki, Akihiro Mori, Nobuhiro Nakao, Koh Kawasumi, Toshinori Sako, Toshiro AraiLaboratory of Veterinary Biochemistry, Nippon Veterinary and Life Science University, Tokyo, JapanAbstract: The cyclin-dependent kinase 5 regulatory subunit–associated protein 1–like 1 (CDKAL1 gene encodes methylthiotransferase, and the gene contains risk variants for type 2 diabetes in humans. In this study, we performed complementary DNA cloning for Cdkal1 in the cat and dog and characterized the tissue expression profiles of its messenger RNA. Cat and dog Cdkal1 complementary DNA encoded 576 and 578 amino acids, showing very high sequence homology to mammalian CDKAL1 (>88.4%. Real-time polymerase chain reaction analyses revealed that Cdkal1 messenger RNA is highly expressed in smooth muscle and that tissue distribution of Cdkal1 is similar in cats and dogs. Genotyping analysis of single-nucleotide polymorphism for cat Cdkal1 revealed that obese cats had different tendencies from normal cats. These findings suggest that the cat and dog Cdkal1 gene is highly conserved among mammals and that cat Cdkal1 may be a candidate marker for genetic diagnosis of obesity.Keywords: cat, dog, Cdkal1, obese, cDNA cloning, Q-PCR

Combined sequencing of mRNA and DNA from human embryonic stem cells

Directory of Open Access Journals (Sweden)

Florian Mertes

2016-06-01

Full Text Available Combined transcriptome and whole genome sequencing of the same ultra-low input sample down to single cells is a rapidly evolving approach for the analysis of rare cells. Besides stem cells, rare cells originating from tissues like tumor or biopsies, circulating tumor cells and cells from early embryonic development are under investigation. Herein we describe a universal method applicable for the analysis of minute amounts of sample material (150 to 200 cells derived from sub-colony structures from human embryonic stem cells. The protocol comprises the combined isolation and separate amplification of poly(A mRNA and whole genome DNA followed by next generation sequencing. Here we present a detailed description of the method developed and an overview of the results obtained for RNA and whole genome sequencing of human embryonic stem cells, sequencing data is available in the Gene Expression Omnibus (GEO database under accession number GSE69471.

Messengers of the universe

International Nuclear Information System (INIS)

Becker, J.K.; Spurio, M.

2011-01-01

The observation of the solar neutrinos and of a neutrino burst from the supernova explosion 1987A opened a new observation field which in the next years could be complemented with the detection of astrophysical highenergy neutrinos. Neutrino astronomy is a young discipline derived from the fundamental necessity of extending conventional astronomy beyond the usual electro-magnetic messengers. This is a summary of recent results on those new 'messengers of the universe', based on the presentations in Branch IV of the Neutrino Oscillation Workshop 2010 (NOW2010).

RNAcontext: a new method for learning the sequence and structure binding preferences of RNA-binding proteins.

Directory of Open Access Journals (Sweden)

Hilal Kazan

2010-07-01

Full Text Available Metazoan genomes encode hundreds of RNA-binding proteins (RBPs. These proteins regulate post-transcriptional gene expression and have critical roles in numerous cellular processes including mRNA splicing, export, stability and translation. Despite their ubiquity and importance, the binding preferences for most RBPs are not well characterized. In vitro and in vivo studies, using affinity selection-based approaches, have successfully identified RNA sequence associated with specific RBPs; however, it is difficult to infer RBP sequence and structural preferences without specifically designed motif finding methods. In this study, we introduce a new motif-finding method, RNAcontext, designed to elucidate RBP-specific sequence and structural preferences with greater accuracy than existing approaches. We evaluated RNAcontext on recently published in vitro and in vivo RNA affinity selected data and demonstrate that RNAcontext identifies known binding preferences for several control proteins including HuR, PTB, and Vts1p and predicts new RNA structure preferences for SF2/ASF, RBM4, FUSIP1 and SLM2. The predicted preferences for SF2/ASF are consistent with its recently reported in vivo binding sites. RNAcontext is an accurate and efficient motif finding method ideally suited for using large-scale RNA-binding affinity datasets to determine the relative binding preferences of RBPs for a wide range of RNA sequences and structures.

Design of a synthetic luminescent probe from a biomolecule binding domain: selective detection of AU-rich mRNA sequences† †Electronic supplementary information (ESI) available: Details of synthetic procedures of LTISTb, recombinant expression of TTP-2D and spectroscopic characterization of LTISTb and its RNA-binding properties. See DOI: 10.1039/c6sc04086a Click here for additional data file.

Science.gov (United States)

Raibaut, Laurent; Vasseur, William; Shimberg, Geoffrey D.; Saint-Pierre, Christine; Ravanat, Jean-Luc

2017-01-01

We report the design of a luminescent sensor based upon the zinc finger (ZF) protein TIS11d, that allows for the selective time-resolved detection of the UUAUUUAUU sequence of the 3′-untranslated region of messenger RNA. This sensor is composed of the tandem ZF RNA binding domain of TIS11d functionalized with a luminescent Tb3+ complex on one of the ZFs and a sensitizing antenna on the other. This work provides the proof of principle that an RNA binding protein can be re-engineered as an RNA sensor and, more generally, that tunable synthetic luminescent probes for biomolecules can be obtained by modifying biomolecule-binding domains. PMID:28451295

miRanalyzer: a microRNA detection and analysis tool for next-generation sequencing experiments.

Science.gov (United States)

Hackenberg, Michael; Sturm, Martin; Langenberger, David; Falcón-Pérez, Juan Manuel; Aransay, Ana M

2009-07-01

Next-generation sequencing allows now the sequencing of small RNA molecules and the estimation of their expression levels. Consequently, there will be a high demand of bioinformatics tools to cope with the several gigabytes of sequence data generated in each single deep-sequencing experiment. Given this scene, we developed miRanalyzer, a web server tool for the analysis of deep-sequencing experiments for small RNAs. The web server tool requires a simple input file containing a list of unique reads and its copy numbers (expression levels). Using these data, miRanalyzer (i) detects all known microRNA sequences annotated in miRBase, (ii) finds all perfect matches against other libraries of transcribed sequences and (iii) predicts new microRNAs. The prediction of new microRNAs is an especially important point as there are many species with very few known microRNAs. Therefore, we implemented a highly accurate machine learning algorithm for the prediction of new microRNAs that reaches AUC values of 97.9% and recall values of up to 75% on unseen data. The web tool summarizes all the described steps in a single output page, which provides a comprehensive overview of the analysis, adding links to more detailed output pages for each analysis module. miRanalyzer is available at http://web.bioinformatics.cicbiogune.es/microRNA/.

Growth differentiation factor 3 is induced by bone morphogenetic protein 6 (BMP-6) and BMP-7 and increases luteinizing hormone receptor messenger RNA expression in human granulosa cells.

Science.gov (United States)

Shi, Jia; Yoshino, Osamu; Osuga, Yutaka; Akiyama, Ikumi; Harada, Miyuki; Koga, Kaori; Fujimoto, Akihisa; Yano, Tetsu; Taketani, Yuji

2012-04-01

To examine the relevance of growth differentiation factor 3 (GDF-3) and bone morphogenetic protein (BMP) cytokines in human ovary. Molecular studies. Research laboratory. Eight women undergoing salpingo-oophorectomy and 30 women undergoing ovarian stimulation for in vitro fertilization. Localizing GDF-3 protein in human ovaries; granulosa cells (GC) cultured with GDF-3, BMP-6, or BMP-7 followed by RNA extraction. The localization of GDF-3 protein in normal human ovaries via immunohistochemical analysis, GDF-3 messenger RNA (mRNA) expression evaluation via quantitative real-time reverse transcription and polymerase chain reaction (RT-PCR), and evaluation of the effect of GDF-3 on leuteinizing hormone (LH) receptor mRNA expression via quantitative real-time RT-PCR. In the ovary, BMP cytokines, of the transforming growth factor beta (TGF-β) superfamily, are known as a luteinization inhibitor by suppressing LH receptor expression in GC. Growth differentiation factor 3, a TGF-β superfamily cytokine, is recognized as an inhibitor of BMP cytokines in other cells. Immunohistochemical analysis showed that GDF-3 was strongly detected in the GC of antral follicles. An in vitro assay revealed that BMP-6 or BMP-7 induced GDF-3 mRNA in GC. Also, GDF-3 increased LH receptor mRNA expression and inhibited the effect of BMP-7, which suppressed the LH receptor mRNA expression in GC. GDF-3, induced with BMP-6 and BMP-7, might play a role in folliculogenesis by inhibiting the effect of BMP cytokines. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

How to Tackle the Challenge of siRNA Delivery with Sequence-Defined Oligoamino Amides.

Science.gov (United States)

Reinhard, Sören; Wagner, Ernst

2017-01-01

RNA interference (RNAi) as a mechanism of gene regulation provides exciting opportunities for medical applications. Synthetic small interfering RNA (siRNA) triggers the knockdown of complementary mRNA sequences in a catalytic fashion and has to be delivered into the cytosol of the targeted cells. The design of adequate carrier systems to overcome multiple extracellular and intracellular roadblocks within the delivery process has utmost importance. Cationic polymers form polyplexes through electrostatic interaction with negatively charged nucleic acids and present a promising class of carriers. Issues of polycations regarding toxicity, heterogeneity, and polydispersity can be overcome by solid-phase-assisted synthesis of sequence-defined cationic oligomers. These medium-sized highly versatile nucleic acid carriers display low cytotoxicity and can be modified and tailored in multiple ways to meet specific requirements of nucleic acid binding, polyplex size, shielding, targeting, and intracellular release of the cargo. In this way, sequence-defined cationic oligomers can mimic the dynamic and bioresponsive behavior of viruses. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Higgs mass from neutrino-messenger mixing

Energy Technology Data Exchange (ETDEWEB)

Byakti, Pritibhajan [Center for High Energy Physics, Indian Institute of Science,C.V. Raman Ave, Bangalore 560012 (India); Department of Theoretical Physics, Indian Association for the Cultivation of Science,2A & 2B Raja S.C. Mullick Road, Kolkata 700 032 (India); Khosa, Charanjit K. [Center for High Energy Physics, Indian Institute of Science,C.V. Raman Ave, Bangalore 560012 (India); Mummidi, V.S. [Harish-Chandra Research Institute,Chhatnag Road, Jhusi, Allahabad 211019 (India); Vempati, Sudhir K. [Center for High Energy Physics, Indian Institute of Science,C.V. Raman Ave, Bangalore 560012 (India)

2017-03-06

The discovery of the Higgs particle at 125 GeV has put strong constraints on minimal messenger models of gauge mediation, pushing the stop masses into the multi-TeV regime. Extensions of these models with matter-messenger mixing terms have been proposed to generate a large trilinear parameter, A{sub t}, relaxing these constraints. The detailed survey of these models (DOI: 10.1007/JHEP05(2013)055; 10.1007/JHEP08(2013)093 ) so far considered messenger mixings with only MSSM superfields. In the present work, we extend the survey to MSSM with inverse-seesaw mechanism. The neutrino-sneutrino corrections to the Higgs mass in the inverse seesaw model are not significant in the minimal gauge mediation model, unless one considers messenger-matter interaction terms. We classify all possible models with messenger-matter interactions and perform thorough numerical analysis to find out the promising models. We found that out of the 17 possible models 9 of them can lead to Higgs mass within the observed value without raising the sfermion masses significantly. The successful models have stop masses ∼1.5 TeV with small or negligible mixing and yet a light CP even Higgs at 125 GeV.

Deep RNA sequencing of the skeletal muscle transcriptome in swimming fish.

Directory of Open Access Journals (Sweden)

Arjan P Palstra

Full Text Available Deep RNA sequencing (RNA-seq was performed to provide an in-depth view of the transcriptome of red and white skeletal muscle of exercised and non-exercised rainbow trout (Oncorhynchus mykiss with the specific objective to identify expressed genes and quantify the transcriptomic effects of swimming-induced exercise. Pubertal autumn-spawning seawater-raised female rainbow trout were rested (n = 10 or swum (n = 10 for 1176 km at 0.75 body-lengths per second in a 6,000-L swim-flume under reproductive conditions for 40 days. Red and white muscle RNA of exercised and non-exercised fish (4 lanes was sequenced and resulted in 15-17 million reads per lane that, after de novo assembly, yielded 149,159 red and 118,572 white muscle contigs. Most contigs were annotated using an iterative homology search strategy against salmonid ESTs, the zebrafish Danio rerio genome and general Metazoan genes. When selecting for large contigs (>500 nucleotides, a number of novel rainbow trout gene sequences were identified in this study: 1,085 and 1,228 novel gene sequences for red and white muscle, respectively, which included a number of important molecules for skeletal muscle function. Transcriptomic analysis revealed that sustained swimming increased transcriptional activity in skeletal muscle and specifically an up-regulation of genes involved in muscle growth and developmental processes in white muscle. The unique collection of transcripts will contribute to our understanding of red and white muscle physiology, specifically during the long-term reproductive migration of salmonids.

Partial nucleotide sequence analysis of 18S ribosomal RNA gene of the four genotypes of Trypanosoma congolense

International Nuclear Information System (INIS)

Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.

2006-01-01

Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)

Fast selection of miRNA candidates based on large-scale pre-computed MFE sets of randomized sequences.

Science.gov (United States)

Warris, Sven; Boymans, Sander; Muiser, Iwe; Noback, Michiel; Krijnen, Wim; Nap, Jan-Peter

2014-01-13

Small RNAs are important regulators of genome function, yet their prediction in genomes is still a major computational challenge. Statistical analyses of pre-miRNA sequences indicated that their 2D structure tends to have a minimal free energy (MFE) significantly lower than MFE values of equivalently randomized sequences with the same nucleotide composition, in contrast to other classes of non-coding RNA. The computation of many MFEs is, however, too intensive to allow for genome-wide screenings. Using a local grid infrastructure, MFE distributions of random sequences were pre-calculated on a large scale. These distributions follow a normal distribution and can be used to determine the MFE distribution for any given sequence composition by interpolation. It allows on-the-fly calculation of the normal distribution for any candidate sequence composition. The speedup achieved makes genome-wide screening with this characteristic of a pre-miRNA sequence practical. Although this particular property alone will not be able to distinguish miRNAs from other sequences sufficiently discriminative, the MFE-based P-value should be added to the parameters of choice to be included in the selection of potential miRNA candidates for experimental verification.

Exploratory Bioinformatics Study of lncRNAs in Alzheimer’s Disease mRNA Sequences with Application to Drug Development

Directory of Open Access Journals (Sweden)

T. Holden

2013-01-01

Full Text Available Long noncoding RNA (lncRNA within mRNA sequences of Alzheimer’s disease genes, namely, APP, APOE, PSEN1, and PSEN2, has been analyzed using fractal dimension (FD computation and correlation analysis. We examined lncRNA by comparing mRNA FD to corresponding coding DNA sequences (CDSs FD. APP, APOE, and PSEN1 CDSs select slightly higher FDs compared to the mRNA, while PSEN2 CDSs FDs are lower. The correlation coefficient for these sequences is 0.969. A comparative study of differentially expressed MAPK signaling pathway lncRNAs in pancreatic cancer cells shows a correlation of 0.771. Selection of higher FD CDSs could indicate interaction of Alzheimer’s gene products APP, APOE, and PSEN1. Including hypocretin sequences (where all CDSs have higher fractal dimensions than mRNA in the APP, APOE, and PSEN1 sequence analyses improves correlation, but the inclusion of erythropoietin (where all CDSs have higher FD than mRNA would suppress correlation, suggesting that HCRT, a hypothalamus neurotransmitter related to the wake/sleep cycle, might be better when compared to EPO, a glycoprotein hormone, for targeting Alzheimer’s disease drug development. Fractal dimension and entropy correlation have provided supporting evidence, consistent with evolutionary studies, for using a zebrafish model together with a mouse model, in HCRT drug development.

RNAPattMatch: a web server for RNA sequence/structure motif detection based on pattern matching with flexible gaps

Science.gov (United States)

Drory Retwitzer, Matan; Polishchuk, Maya; Churkin, Elena; Kifer, Ilona; Yakhini, Zohar; Barash, Danny

2015-01-01

Searching for RNA sequence-structure patterns is becoming an essential tool for RNA practitioners. Novel discoveries of regulatory non-coding RNAs in targeted organisms and the motivation to find them across a wide range of organisms have prompted the use of computational RNA pattern matching as an enhancement to sequence similarity. State-of-the-art programs differ by the flexibility of patterns allowed as queries and by their simplicity of use. In particular—no existing method is available as a user-friendly web server. A general program that searches for RNA sequence-structure patterns is RNA Structator. However, it is not available as a web server and does not provide the option to allow flexible gap pattern representation with an upper bound of the gap length being specified at any position in the sequence. Here, we introduce RNAPattMatch, a web-based application that is user friendly and makes sequence/structure RNA queries accessible to practitioners of various background and proficiency. It also extends RNA Structator and allows a more flexible variable gaps representation, in addition to analysis of results using energy minimization methods. RNAPattMatch service is available at http://www.cs.bgu.ac.il/rnapattmatch. A standalone version of the search tool is also available to download at the site. PMID:25940619

Novel sequence variations in LAMA2 and SGCG genes modulating cis-acting regulatory elements and RNA secondary structure

Directory of Open Access Journals (Sweden)

Olfa Siala

2010-01-01

Full Text Available In this study, we detected new sequence variations in LAMA2 and SGCG genes in 5 ethnic populations, and analysed their effect on enhancer composition and mRNA structure. PCR amplification and DNA sequencing were performed and followed by bioinformatics analyses using ESEfinder as well as MFOLD software. We found 3 novel sequence variations in the LAMA2 (c.3174+22_23insAT and c.6085 +12delA and SGCG (c.*102A/C genes. These variations were present in 210 tested healthy controls from Tunisian, Moroccan, Algerian, Lebanese and French populations suggesting that they represent novel polymorphisms within LAMA2 and SGCG genes sequences. ESEfinder showed that the c.*102A/C substitution created a new exon splicing enhancer in the 3'UTR of SGCG genes, whereas the c.6085 +12delA deletion was situated in the base pairing region between LAMA2 mRNA and the U1snRNA spliceosomal components. The RNA structure analyses showed that both variations modulated RNA secondary structure. Our results are suggestive of correlations between mRNA folding and the recruitment of spliceosomal components mediating splicing, including SR proteins. The contribution of common sequence variations to mRNA structural and functional diversity will contribute to a better study of gene expression.

Next Generation Sequencing Analysis of Human Platelet PolyA+ mRNAs and rRNA-Depleted Total RNA

Science.gov (United States)

Kissopoulou, Antheia; Jonasson, Jon; Lindahl, Tomas L.; Osman, Abdimajid

2013-01-01

Background Platelets are small anucleate cells circulating in the blood vessels where they play a key role in hemostasis and thrombosis. Here, we compared platelet RNA-Seq results obtained from polyA+ mRNA and rRNA-depleted total RNA. Materials and Methods We used purified, CD45 depleted, human blood platelets collected by apheresis from three male and one female healthy blood donors. The Illumina HiSeq 2000 platform was employed to sequence cDNA converted either from oligo(dT) isolated polyA+ RNA or from rRNA-depleted total RNA. The reads were aligned to the GRCh37 reference assembly with the TopHat/Cufflinks alignment package using Ensembl annotations. A de novo assembly of the platelet transcriptome using the Trinity software package and RSEM was also performed. The bioinformatic tools HTSeq and DESeq from Bioconductor were employed for further statistical analyses of read counts. Results Consistent with previous findings our data suggests that mitochondrially expressed genes comprise a substantial fraction of the platelet transcriptome. We also identified high transcript levels for protein coding genes related to the cytoskeleton function, chemokine signaling, cell adhesion, aggregation, as well as receptor interaction between cells. Certain transcripts were particularly abundant in platelets compared with other cell and tissue types represented by RNA-Seq data from the Illumina Human Body Map 2.0 project. Irrespective of the different library preparation and sequencing protocols, there was good agreement between samples from the 4 individuals. Eighteen differentially expressed genes were identified in the two sexes at 10% false discovery rate using DESeq. Conclusion The present data suggests that platelets may have a unique transcriptome profile characterized by a relative over-expression of mitochondrially encoded genes and also of genomic transcripts related to the cytoskeleton function, chemokine signaling and surface components compared with other cell and

Next generation sequencing analysis of human platelet PolyA+ mRNAs and rRNA-depleted total RNA.

Directory of Open Access Journals (Sweden)

Antheia Kissopoulou

Full Text Available BACKGROUND: Platelets are small anucleate cells circulating in the blood vessels where they play a key role in hemostasis and thrombosis. Here, we compared platelet RNA-Seq results obtained from polyA+ mRNA and rRNA-depleted total RNA. MATERIALS AND METHODS: We used purified, CD45 depleted, human blood platelets collected by apheresis from three male and one female healthy blood donors. The Illumina HiSeq 2000 platform was employed to sequence cDNA converted either from oligo(dT isolated polyA+ RNA or from rRNA-depleted total RNA. The reads were aligned to the GRCh37 reference assembly with the TopHat/Cufflinks alignment package using Ensembl annotations. A de novo assembly of the platelet transcriptome using the Trinity software package and RSEM was also performed. The bioinformatic tools HTSeq and DESeq from Bioconductor were employed for further statistical analyses of read counts. RESULTS: Consistent with previous findings our data suggests that mitochondrially expressed genes comprise a substantial fraction of the platelet transcriptome. We also identified high transcript levels for protein coding genes related to the cytoskeleton function, chemokine signaling, cell adhesion, aggregation, as well as receptor interaction between cells. Certain transcripts were particularly abundant in platelets compared with other cell and tissue types represented by RNA-Seq data from the Illumina Human Body Map 2.0 project. Irrespective of the different library preparation and sequencing protocols, there was good agreement between samples from the 4 individuals. Eighteen differentially expressed genes were identified in the two sexes at 10% false discovery rate using DESeq. CONCLUSION: The present data suggests that platelets may have a unique transcriptome profile characterized by a relative over-expression of mitochondrially encoded genes and also of genomic transcripts related to the cytoskeleton function, chemokine signaling and surface components

Alternative RNA splicing and cancer

Science.gov (United States)

Liu, Sali; Cheng, Chonghui

2015-01-01

Alternative splicing of pre-messenger RNA (mRNA) is a fundamental mechanism by which a gene can give rise to multiple distinct mRNA transcripts, yielding protein isoforms with different, even opposing, functions. With the recognition that alternative splicing occurs in nearly all human genes, its relationship with cancer-associated pathways has emerged as a rapidly growing field. In this review, we summarize recent findings that have implicated the critical role of alternative splicing in cancer and discuss current understandings of the mechanisms underlying dysregulated alternative splicing in cancer cells. PMID:23765697

Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

Science.gov (United States)

Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

2017-04-01

5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Spontaneous reverse movement of mRNA-bound tRNA through the ribosome.

Science.gov (United States)

Konevega, Andrey L; Fischer, Niels; Semenkov, Yuri P; Stark, Holger; Wintermeyer, Wolfgang; Rodnina, Marina V

2007-04-01

During the translocation step of protein synthesis, a complex of two transfer RNAs bound to messenger RNA (tRNA-mRNA) moves through the ribosome. The reaction is promoted by an elongation factor, called EF-G in bacteria, which, powered by GTP hydrolysis, induces an open, unlocked conformation of the ribosome that allows for spontaneous tRNA-mRNA movement. Here we show that, in the absence of EF-G, there is spontaneous backward movement, or retrotranslocation, of two tRNAs bound to mRNA. Retrotranslocation is driven by the gain in affinity when a cognate E-site tRNA moves into the P site, which compensates the affinity loss accompanying the movement of peptidyl-tRNA from the P to the A site. These results lend support to the diffusion model of tRNA movement during translocation. In the cell, tRNA movement is biased in the forward direction by EF-G, which acts as a Brownian ratchet and prevents backward movement.

Sweet Spot Supersymmetry and Composite Messengers

International Nuclear Information System (INIS)

Ibe, Masahiro; Kitano, Ryuichiro

2007-01-01

Sweet spot supersymmetry is a phenomenologically and cosmologically perfect framework to realize a supersymmetric world at short distance. We discuss a class of dynamical models of supersymmetry breaking and its mediation whose low-energy effective description falls into this framework. Hadron fields in the dynamical models play a role of the messengers of the supersymmetry breaking. As is always true in the models of the sweet spot supersymmetry, the messenger scale is predicted to be 10 5 GeV ∼ mess ∼ 10 GeV. Various values of the effective number of messenger fields N mess are possible depending on the choice of the gauge group

Deep sequencing analysis of the developing mouse brain reveals a novel microRNA

Directory of Open Access Journals (Sweden)

Piltz Sandra

2011-04-01

Full Text Available Abstract Background MicroRNAs (miRNAs are small non-coding RNAs that can exert multilevel inhibition/repression at a post-transcriptional or protein synthesis level during disease or development. Characterisation of miRNAs in adult mammalian brains by deep sequencing has been reported previously. However, to date, no small RNA profiling of the developing brain has been undertaken using this method. We have performed deep sequencing and small RNA analysis of a developing (E15.5 mouse brain. Results We identified the expression of 294 known miRNAs in the E15.5 developing mouse brain, which were mostly represented by let-7 family and other brain-specific miRNAs such as miR-9 and miR-124. We also discovered 4 putative 22-23 nt miRNAs: mm_br_e15_1181, mm_br_e15_279920, mm_br_e15_96719 and mm_br_e15_294354 each with a 70-76 nt predicted pre-miRNA. We validated the 4 putative miRNAs and further characterised one of them, mm_br_e15_1181, throughout embryogenesis. Mm_br_e15_1181 biogenesis was Dicer1-dependent and was expressed in E3.5 blastocysts and E7 whole embryos. Embryo-wide expression patterns were observed at E9.5 and E11.5 followed by a near complete loss of expression by E13.5, with expression restricted to a specialised layer of cells within the developing and early postnatal brain. Mm_br_e15_1181 was upregulated during neurodifferentiation of P19 teratocarcinoma cells. This novel miRNA has been identified as miR-3099. Conclusions We have generated and analysed the first deep sequencing dataset of small RNA sequences of the developing mouse brain. The analysis revealed a novel miRNA, miR-3099, with potential regulatory effects on early embryogenesis, and involvement in neuronal cell differentiation/function in the brain during late embryonic and early neonatal development.

Detection of small interfering RNA (siRNA) by mass spectrometry procedures in doping controls.

Science.gov (United States)

Thomas, Andreas; Walpurgis, Katja; Delahaut, Philippe; Kohler, Maxie; Schänzer, Wilhelm; Thevis, Mario

2013-01-01

Uncovering manipulation of athletic performance via small interfering (si)RNA is an emerging field in sports drug testing. Due to the potential to principally knock down every target gene in the organism by means of the RNA interference pathway, this facet of gene doping has become a realistic scenario. In the present study, two distinct model siRNAs comprising 21 nucleotides were designed as double strands which were perfect counterparts to a sequence of the respective messenger RNA coding the muscle regulator myostatin of Rattus norvegicus. Several modified nucleotides were introduced in both the sense and the antisense strand comprising phosphothioates, 2'-O-methylation, 2'-fluoro-nucleotides, locked nucleic acids and a cholesterol tag at the 3'-end. The model siRNAs were applied to rats at 1 mg/kg (i.v.) and blood as well as urine samples were collected. After isolation of the RNA by means of a RNA purification kit, the target analytes were detected by liquid chromatography - high resolution/high accuracy mass spectrometry (LC-HRMS). Analytes were detected as modified nucleotides after alkaline hydrolysis, as intact oligonucleotide strands (top-down) and by means of denaturing SDS-PAGE analysis. The gel-separated siRNA was further subjected to in-gel hydrolysis with different RNases and subsequent identification of the fragments by untargeted LC-HRMS analysis (bottom-up, 'experimental RNomics'). Combining the results of all approaches, the identification of several 3'-truncated urinary metabolites was accomplished and target analytes were detected up to 24 h after a single administration. Simultaneously collected blood samples yielded no promising results. The methods were validated and found fit-for-purpose for doping controls. Copyright © 2013 John Wiley & Sons, Ltd.

MicroRNA Expression Profiling by Bead Array Technology in Human Tumor Cell Lines Treated with Interferon-Alpha-2a

Directory of Open Access Journals (Sweden)

Siegrist Fredy

2009-01-01

Full Text Available Abstract MicroRNAs are positive and negative regulators of eukaryotic gene expression that modulate transcript abundance by specific binding to sequence motifs located prevalently in the 3' untranslated regions of target messenger RNAs (mRNA. Interferon-alpha-2a (IFNα induces a large set of protein coding genes mediating antiproliferative and antiviral responses. Here we use a global microarray-based microRNA detection platform to identify genes that are induced by IFNα in hepatoma- or melanoma-derived human tumor cell lines. Despite the enormous differences in expression levels between these models, we were able to identify microRNAs that are upregulated by IFNα in both lines suggesting the possibility that interferon-regulated microRNAs are involved in the transcriptional repression of mRNA relevant to cytokine responses.

Mercury's Reference Frames After the MESSENGER Mission

Science.gov (United States)

Stark, A.; Oberst, J.; Preusker, F.; Burmeister, S.; Steinbrügge, G.; Hussmann, H.

2018-05-01

We provide an overview of Mercury's reference frames based on MESSENGER observations. We discuss the dynamical, the principal-axes, the ellipsoid, as well as the cartographic frame, which was adopted for MESSENGER data products.

Illuminating Messengers: An Update and Outlook on RNA Visualization in Bacteria

Directory of Open Access Journals (Sweden)

Lieke A. van Gijtenbeek

2017-06-01

Full Text Available To be able to visualize the abundance and spatiotemporal features of RNAs in bacterial cells would permit obtaining a pivotal understanding of many mechanisms underlying bacterial cell biology. The first methods that allowed observing single mRNA molecules in individual cells were introduced by Bertrand et al. (1998 and Femino et al. (1998. Since then, a plethora of techniques to image RNA molecules with the aid of fluorescence microscopy has emerged. Many of these approaches are useful for the large eukaryotic cells but their adaptation to study RNA, specifically mRNA molecules, in bacterial cells progressed relatively slow. Here, an overview will be given of fluorescent techniques that can be used to reveal specific RNA molecules inside fixed and living single bacterial cells. It includes a critical evaluation of their caveats as well as potential solutions.

Comprehensive processing of high-throughput small RNA sequencing data including quality checking, normalization, and differential expression analysis using the UEA sRNA Workbench.

Science.gov (United States)

Beckers, Matthew; Mohorianu, Irina; Stocks, Matthew; Applegate, Christopher; Dalmay, Tamas; Moulton, Vincent

2017-06-01

Recently, high-throughput sequencing (HTS) has revealed compelling details about the small RNA (sRNA) population in eukaryotes. These 20 to 25 nt noncoding RNAs can influence gene expression by acting as guides for the sequence-specific regulatory mechanism known as RNA silencing. The increase in sequencing depth and number of samples per project enables a better understanding of the role sRNAs play by facilitating the study of expression patterns. However, the intricacy of the biological hypotheses coupled with a lack of appropriate tools often leads to inadequate mining of the available data and thus, an incomplete description of the biological mechanisms involved. To enable a comprehensive study of differential expression in sRNA data sets, we present a new interactive pipeline that guides researchers through the various stages of data preprocessing and analysis. This includes various tools, some of which we specifically developed for sRNA analysis, for quality checking and normalization of sRNA samples as well as tools for the detection of differentially expressed sRNAs and identification of the resulting expression patterns. The pipeline is available within the UEA sRNA Workbench, a user-friendly software package for the processing of sRNA data sets. We demonstrate the use of the pipeline on a H. sapiens data set; additional examples on a B. terrestris data set and on an A. thaliana data set are described in the Supplemental Information A comparison with existing approaches is also included, which exemplifies some of the issues that need to be addressed for sRNA analysis and how the new pipeline may be used to do this. © 2017 Beckers et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

[Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence

Science.gov (United States)

Ortega, Maya

2010-01-01

My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

miRDis: a Web tool for endogenous and exogenous microRNA discovery based on deep-sequencing data analysis.

Science.gov (United States)

Zhang, Hanyuan; Vieira Resende E Silva, Bruno; Cui, Juan

2018-05-01

Small RNA sequencing is the most widely used tool for microRNA (miRNA) discovery, and shows great potential for the efficient study of miRNA cross-species transport, i.e., by detecting the presence of exogenous miRNA sequences in the host species. Because of the increased appreciation of dietary miRNAs and their far-reaching implication in human health, research interests are currently growing with regard to exogenous miRNAs bioavailability, mechanisms of cross-species transport and miRNA function in cellular biological processes. In this article, we present microRNA Discovery (miRDis), a new small RNA sequencing data analysis pipeline for both endogenous and exogenous miRNA detection. Specifically, we developed and deployed a Web service that supports the annotation and expression profiling data of known host miRNAs and the detection of novel miRNAs, other noncoding RNAs, and the exogenous miRNAs from dietary species. As a proof-of-concept, we analyzed a set of human plasma sequencing data from a milk-feeding study where 225 human miRNAs were detected in the plasma samples and 44 show elevated expression after milk intake. By examining the bovine-specific sequences, data indicate that three bovine miRNAs (bta-miR-378, -181* and -150) are present in human plasma possibly because of the dietary uptake. Further evaluation based on different sets of public data demonstrates that miRDis outperforms other state-of-the-art tools in both detection and quantification of miRNA from either animal or plant sources. The miRDis Web server is available at: http://sbbi.unl.edu/miRDis/index.php.

JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

Science.gov (United States)

Shi, Jieming; Li, Xi; Dong, Min; Graham, Mitchell; Yadav, Nehul; Liang, Chun

2017-01-01

Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures

Science.gov (United States)

Dong, Min; Graham, Mitchell; Yadav, Nehul

2017-01-01

Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416

JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

Directory of Open Access Journals (Sweden)

Jieming Shi

Full Text Available Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

Extensive 16S rRNA gene sequence diversity in Campylobacter hyointestinalis strains: taxonomic and applied implications

DEFF Research Database (Denmark)

Harrington, C.S.; On, Stephen L.W.

1999-01-01

Phylogenetic relationships of Campylobacter hyointestinalis subspecies were examined by means of 16S rRNA gene sequencing. Sequence similarities among C. hyointestinalis subsp. lawsonii strains exceeded 99.0 %, but values among C. hyointestinalis subsp. hyointestinalis strains ranged from 96...... of the genus Campylobacter, emphasizing the need for multiple strain analysis when using 16S rRNA gene sequence comparisons for taxonomic investigations........4 to 100 %. Sequence similarites between strains representing the two different subspecies ranged from 95.7 to 99.0 %. An intervening sequence was identified in certain of the C. hyointestinalis subsp. lawsonii strains. C. hyointestinalis strains occupied two distinct branches in a phylogenetic analysis...

CoLIde: A bioinformatics tool for CO-expression based small RNA Loci Identification using high-throughput sequencing data

OpenAIRE

Mohorianu, Irina; Stocks, Matthew Benedict; Wood, John; Dalmay, Tamas; Moulton, Vincent

2013-01-01

Small RNAs (sRNAs) are 20–25 nt non-coding RNAs that act as guides for the highly sequence-specific regulatory mechanism known as RNA silencing. Due to the recent increase in sequencing depth, a highly complex and diverse population of sRNAs in both plants and animals has been revealed. However, the exponential increase in sequencing data has also made the identification of individual sRNA transcripts corresponding to biological units (sRNA loci) more challenging when based exclusively on the...

MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing

DEFF Research Database (Denmark)

Nielsen, M; Hansen, J H; Hedegaard, J

2010-01-01

levels of 212 annotated miRNA genes, thereby providing a thorough account of the miRNA transcriptome in porcine muscle tissue. The expression levels displayed a very large range, as reflected by the number of sequence reads, which varied from single counts for rare miRNAs to several million reads...

Sex chromosomes and germline transcriptomics explored by single-cell sequencing and RNA-tomography

NARCIS (Netherlands)

Vértesy, Ábel

2018-01-01

In our study of germ cell differentiation, we applied two recently developed technologies on the germline of various model organisms: single-cell mRNA sequencing and RNA-tomography. For the first time we could look at gene expression with such a high resolution, and this led us to discover the

Characterization of novel precursor miRNAs using next generation sequencing and prediction of miRNA targets in Atlantic halibut.

Directory of Open Access Journals (Sweden)

Teshome Tilahun Bizuayehu

Full Text Available BACKGROUND: microRNAs (miRNAs are implicated in regulation of many cellular processes. miRNAs are processed to their mature functional form in a step-wise manner by multiple proteins and cofactors in the nucleus and cytoplasm. Many miRNAs are conserved across vertebrates. Mature miRNAs have recently been characterized in Atlantic halibut (Hippoglossus hippoglossus L.. The aim of this study was to identify and characterize precursor miRNA (pre-miRNAs and miRNA targets in this non-model flatfish. Discovery of miRNA precursor forms and targets in non-model organisms is difficult because of limited source information available. Therefore, we have developed a methodology to overcome this limitation. METHODS: Genomic DNA and small transcriptome of Atlantic halibut were sequenced using Roche 454 pyrosequencing and SOLiD next generation sequencing (NGS, respectively. Identified pre- miRNAs were further validated with reverse-transcription PCR. miRNA targets were identified using miRanda and RNAhybrid target prediction tools using sequences from public databases. Some of miRNA targets were also identified using RACE-PCR. miRNA binding sites were validated with luciferase assay using the RTS34st cell line. RESULTS: We obtained more than 1.3 M and 92 M sequence reads from 454 genomic DNA sequencing and SOLiD small RNA sequencing, respectively. We identified 34 known and 9 novel pre-miRNAs. We predicted a number of miRNA target genes involved in various biological pathways. miR-24 binding to kisspeptin 1 receptor-2 (kiss1-r2 was confirmed using luciferase assay. CONCLUSION: This study demonstrates that identification of conserved and novel pre-miRNAs in a non-model vertebrate lacking substantial genomic resources can be performed by combining different next generation sequencing technologies. Our results indicate a wide conservation of miRNA precursors and involvement of miRNA in multiple regulatory pathways, and provide resources for further research on miRNA

Mapping a nucleolar targeting sequence of an RNA binding nucleolar protein, Nop25

International Nuclear Information System (INIS)

Fujiwara, Takashi; Suzuki, Shunji; Kanno, Motoko; Sugiyama, Hironobu; Takahashi, Hisaaki; Tanaka, Junya

2006-01-01

Nop25 is a putative RNA binding nucleolar protein associated with rRNA transcription. The present study was undertaken to determine the mechanism of Nop25 localization in the nucleolus. Deletion experiments of Nop25 amino acid sequence showed Nop25 to contain a nuclear targeting sequence in the N-terminal and a nucleolar targeting sequence in the C-terminal. By expressing derivative peptides from the C-terminal as GFP-fusion proteins in the cells, a lysine and arginine residue-enriched peptide (KRKHPRRAQDSTKKPPSATRTSKTQRRRR) allowed a GFP-fusion protein to be transported and fully retained in the nucleolus. When the peptide was fused with cMyc epitope and expressed in the cells, a cMyc epitope was then detected in the nucleolus. Nop25 did not localize in the nucleolus by deletion of the peptide from Nop25. Furthermore, deletion of a subdomain (KRKHPRRAQ) in the peptide or amino acid substitution of lysine and arginine residues in the subdomain resulted in the loss of Nop25 nucleolar localization. These results suggest that the lysine and arginine residue-enriched peptide is the most prominent nucleolar targeting sequence of Nop25 and that the long stretch of basic residues might play an important role in the nucleolar localization of Nop25. Although Nop25 contained putative SUMOylation, phosphorylation and glycosylation sites, the amino acid substitution in these sites had no effect on the nucleolar localization, thus suggesting that these post-translational modifications did not contribute to the localization of Nop25 in the nucleolus. The treatment of the cells, which expressed a GFP-fusion protein with a nucleolar targeting sequence of Nop25, with RNase A resulted in a complete dislocation of the protein from the nucleolus. These data suggested that the nucleolar targeting sequence might therefore play an important role in the binding of Nop25 to RNA molecules and that the RNA binding of Nop25 might be essential for the nucleolar localization of Nop25

Identification and analysis of pig chimeric mRNAs using RNA sequencing data

Science.gov (United States)

2012-01-01

Background Gene fusion is ubiquitous over the course of evolution. It is expected to increase the diversity and complexity of transcriptomes and proteomes through chimeric sequence segments or altered regulation. However, chimeric mRNAs in pigs remain unclear. Here we identified some chimeric mRNAs in pigs and analyzed the expression of them across individuals and breeds using RNA-sequencing data. Results The present study identified 669 putative chimeric mRNAs in pigs, of which 251 chimeric candidates were detected in a set of RNA-sequencing data. The 618 candidates had clear trans-splicing sites, 537 of which obeyed the canonical GU-AG splice rule. Only two putative pig chimera variants whose fusion junction was overlapped with that of a known human chimeric mRNA were found. A set of unique chimeric events were considered middle variances in the expression across individuals and breeds, and revealed non-significant variance between sexes. Furthermore, the genomic region of the 5′ partner gene shares a similar DNA sequence with that of the 3′ partner gene for 458 putative chimeric mRNAs. The 81 of those shared DNA sequences significantly matched the known DNA-binding motifs in the JASPAR CORE database. Four DNA motifs shared in parental genomic regions had significant similarity with known human CTCF binding sites. Conclusions The present study provided detailed information on some pig chimeric mRNAs. We proposed a model that trans-acting factors, such as CTCF, induced the spatial organisation of parental genes to the same transcriptional factory so that parental genes were coordinatively transcribed to give birth to chimeric mRNAs. PMID:22925561

Identification and analysis of pig chimeric mRNAs using RNA sequencing data

Directory of Open Access Journals (Sweden)

Ma Lei

2012-08-01

Full Text Available Abstract Background Gene fusion is ubiquitous over the course of evolution. It is expected to increase the diversity and complexity of transcriptomes and proteomes through chimeric sequence segments or altered regulation. However, chimeric mRNAs in pigs remain unclear. Here we identified some chimeric mRNAs in pigs and analyzed the expression of them across individuals and breeds using RNA-sequencing data. Results The present study identified 669 putative chimeric mRNAs in pigs, of which 251 chimeric candidates were detected in a set of RNA-sequencing data. The 618 candidates had clear trans-splicing sites, 537 of which obeyed the canonical GU-AG splice rule. Only two putative pig chimera variants whose fusion junction was overlapped with that of a known human chimeric mRNA were found. A set of unique chimeric events were considered middle variances in the expression across individuals and breeds, and revealed non-significant variance between sexes. Furthermore, the genomic region of the 5′ partner gene shares a similar DNA sequence with that of the 3′ partner gene for 458 putative chimeric mRNAs. The 81 of those shared DNA sequences significantly matched the known DNA-binding motifs in the JASPAR CORE database. Four DNA motifs shared in parental genomic regions had significant similarity with known human CTCF binding sites. Conclusions The present study provided detailed information on some pig chimeric mRNAs. We proposed a model that trans-acting factors, such as CTCF, induced the spatial organisation of parental genes to the same transcriptional factory so that parental genes were coordinatively transcribed to give birth to chimeric mRNAs.

Sequences within the 5' untranslated region regulate the levels of a kinetoplast DNA topoisomerase mRNA during the cell cycle.

Science.gov (United States)

Pasion, S G; Hines, J C; Ou, X; Mahmood, R; Ray, D S

1996-12-01

Gene expression in trypanosomatids appears to be regulated largely at the posttranscriptional level and involves maturation of mRNA precursors by trans splicing of a 39-nucleotide miniexon sequence to the 5' end of the mRNA and cleavage and polyadenylation at the 3' end of the mRNA. To initiate the identification of sequences involved in the periodic expression of DNA replication genes in trypanosomatids, we have mapped splice acceptor sites in the 5' flanking region of the TOP2 gene, which encodes the kinetoplast DNA topoisomerase, and have carried out deletion analysis of this region on a plasmid-encoded TOP2 gene. Block deletions within the 5' untranslated region (UTR) identified two regions (-608 to -388 and -387 to -186) responsible for periodic accumulation of the mRNA. Deletion of one or the other of these sequences had no effect on periodic expression of the mRNA, while deletion of both regions resulted in constitutive expression of the mRNA throughout the cell cycle. Subcloning of these sequences into the 5' UTR of a construct lacking both regions of the TOP2 5' UTR has shown that an octamer consensus sequence present in the 5' UTR of the TOP2, RPA1, and DHFR-TS mRNAs is required for normal cycling of the TOP2 mRNA. Mutation of the consensus octamer sequence in the TOP2 5' UTR in a plasmid construct containing only a single consensus octamer and that shows normal cycling of the plasmid-encoded TOP2 mRNA resulted in substantial reduction of the cycling of the mRNA level. These results imply a negative regulation of TOP2 mRNA during the cell cycle by a mechanism involving redundant elements containing one or more copies of a conserved octamer sequence within the 5' UTR of TOP2 mRNA.

RNA shotgun metagenomic sequencing of northern California (USA mosquitoes uncovers viruses, bacteria, and fungi

Directory of Open Access Journals (Sweden)

James Angus eChandler

2015-03-01

Full Text Available Mosquitoes, most often recognized for the microbial agents of disease they may carry, harbor diverse microbial communities that include viruses, bacteria, and fungi, collectively called the microbiota. The composition of the microbiota can directly and indirectly affect disease transmission through microbial interactions that could be revealed by its characterization in natural populations of mosquitoes. Furthermore, the use of shotgun metagenomic sequencing (SMS approaches could allow the discovery of unknown members of the microbiota. In this study, we use RNA SMS to characterize the microbiota of seven individual mosquitoes (species include Culex pipiens, Culiseta incidens, and Ochlerotatus sierrensis collected from a variety of habitats in California, USA. Sequencing was performed on the Illumina HiSeq platform and the resulting sequences were quality-checked and assembled into contigs using the A5 pipeline. Sequences related to single stranded RNA viruses of the Bunyaviridae and Rhabdoviridae were uncovered, along with an unclassified genus of double-stranded RNA viruses. Phylogenetic analysis finds that in all three cases, the closest relatives of the identified viral sequences are other mosquito-associated viruses, suggesting widespread host-group specificity among disparate viral taxa. Interestingly, we identified a Narnavirus of fungi, also reported elsewhere in mosquitoes, that potentially demonstrates a nested host-parasite association between virus, fungi, and mosquito. Sequences related to 8 bacterial families and 13 fungal families were found across the seven samples. Bacillus and Escherichia/Shigella were identified in all samples and Wolbachia was identified in all Cx. pipiens samples, while no single fungal genus was found in more than two samples. This study exemplifies the utility of RNA SMS in the characterization of the natural microbiota of mosquitoes and, in particular, the value of identifying all microbes associated with

AllelicImbalance: An R/ bioconductor package for detecting, managing, and visualizing allele expression imbalance data from RNA sequencing

DEFF Research Database (Denmark)

Gådin, Jesper R.; van't Hooft, Ferdinand M.; Eriksson, Per

2015-01-01

the possible biases. Results: We present AllelicImblance, a software program that is designed to detect, manage, and visualize allelic imbalances comprehensively. The purpose of this software is to allow users to pose genetic questions in any RNA sequencing experiment quickly, enhancing the general utility...... of RNA sequencing. The visualization features can reveal notable, non-trivial allelic imbalance behavior over specific regions, such as exons. Conclusions: The software provides a complete framework to perform allelic imbalance analyses of aligned RNA sequencing data, from detection to visualization...

An Efficient Method for Identifying Gene Fusions by Targeted RNA Sequencing from Fresh Frozen and FFPE Samples.

Directory of Open Access Journals (Sweden)

Jonathan A Scolnick

Full Text Available Fusion genes are known to be key drivers of tumor growth in several types of cancer. Traditionally, detecting fusion genes has been a difficult task based on fluorescent in situ hybridization to detect chromosomal abnormalities. More recently, RNA sequencing has enabled an increased pace of fusion gene identification. However, RNA-Seq is inefficient for the identification of fusion genes due to the high number of sequencing reads needed to detect the small number of fusion transcripts present in cells of interest. Here we describe a method, Single Primer Enrichment Technology (SPET, for targeted RNA sequencing that is customizable to any target genes, is simple to use, and efficiently detects gene fusions. Using SPET to target 5701 exons of 401 known cancer fusion genes for sequencing, we were able to identify known and previously unreported gene fusions from both fresh-frozen and formalin-fixed paraffin-embedded (FFPE tissue RNA in both normal tissue and cancer cells.

Correlation between sequence conservation and structural thermodynamics of microRNA precursors from human, mouse, and chicken genomes

Directory of Open Access Journals (Sweden)

Wang Shengqi

2010-10-01

Full Text Available Abstract Background Previous studies have shown that microRNA precursors (pre-miRNAs have considerably more stable secondary structures than other native RNAs (tRNA, rRNA, and mRNA and artificial RNA sequences. However, pre-miRNAs with ultra stable secondary structures have not been investigated. It is not known if there is a tendency in pre-miRNA sequences towards or against ultra stable structures? Furthermore, the relationship between the structural thermodynamic stability of pre-miRNA and their evolution remains unclear. Results We investigated the correlation between pre-miRNA sequence conservation and structural stability as measured by adjusted minimum folding free energies in pre-miRNAs isolated from human, mouse, and chicken. The analysis revealed that conserved and non-conserved pre-miRNA sequences had structures with similar average stabilities. However, the relatively ultra stable and unstable pre-miRNAs were more likely to be non-conserved than pre-miRNAs with moderate stability. Non-conserved pre-miRNAs had more G+C than A+U nucleotides, while conserved pre-miRNAs contained more A+U nucleotides. Notably, the U content of conserved pre-miRNAs was especially higher than that of non-conserved pre-miRNAs. Further investigations showed that conserved and non-conserved pre-miRNAs exhibited different structural element features, even though they had comparable levels of stability. Conclusions We proposed that there is a correlation between structural thermodynamic stability and sequence conservation for pre-miRNAs from human, mouse, and chicken genomes. Our analyses suggested that pre-miRNAs with relatively ultra stable or unstable structures were less favoured by natural selection than those with moderately stable structures. Comparison of nucleotide compositions between non-conserved and conserved pre-miRNAs indicated the importance of U nucleotides in the pre-miRNA evolutionary process. Several characteristic structural elements were

High-throughput sequencing of RNA silencing-associated small RNAs in olive (Olea europaea L..

Directory of Open Access Journals (Sweden)

Livia Donaire

Full Text Available Small RNAs (sRNAs of 20 to 25 nucleotides (nt in length maintain genome integrity and control gene expression in a multitude of developmental and physiological processes. Despite RNA silencing has been primarily studied in model plants, the advent of high-throughput sequencing technologies has enabled profiling of the sRNA component of more than 40 plant species. Here, we used deep sequencing and molecular methods to report the first inventory of sRNAs in olive (Olea europaea L.. sRNA libraries prepared from juvenile and adult shoots revealed that the 24-nt class dominates the sRNA transcriptome and atypically accumulates to levels never seen in other plant species, suggesting an active role of heterochromatin silencing in the maintenance and integrity of its large genome. A total of 18 known miRNA families were identified in the libraries. Also, 5 other sRNAs derived from potential hairpin-like precursors remain as plausible miRNA candidates. RNA blots confirmed miRNA expression and suggested tissue- and/or developmental-specific expression patterns. Target mRNAs of conserved miRNAs were computationally predicted among the olive cDNA collection and experimentally validated through endonucleolytic cleavage assays. Finally, we use expression data to uncover genetic components of the miR156, miR172 and miR390/TAS3-derived trans-acting small interfering RNA (tasiRNA regulatory nodes, suggesting that these interactive networks controlling developmental transitions are fully operational in olive.

RCK: accurate and efficient inference of sequence- and structure-based protein-RNA binding models from RNAcompete data.

Science.gov (United States)

Orenstein, Yaron; Wang, Yuhao; Berger, Bonnie

2016-06-15

Protein-RNA interactions, which play vital roles in many processes, are mediated through both RNA sequence and structure. CLIP-based methods, which measure protein-RNA binding in vivo, suffer from experimental noise and systematic biases, whereas in vitro experiments capture a clearer signal of protein RNA-binding. Among them, RNAcompete provides binding affinities of a specific protein to more than 240 000 unstructured RNA probes in one experiment. The computational challenge is to infer RNA structure- and sequence-based binding models from these data. The state-of-the-art in sequence models, Deepbind, does not model structural preferences. RNAcontext models both sequence and structure preferences, but is outperformed by GraphProt. Unfortunately, GraphProt cannot detect structural preferences from RNAcompete data due to the unstructured nature of the data, as noted by its developers, nor can it be tractably run on the full RNACompete dataset. We develop RCK, an efficient, scalable algorithm that infers both sequence and structure preferences based on a new k-mer based model. Remarkably, even though RNAcompete data is designed to be unstructured, RCK can still learn structural preferences from it. RCK significantly outperforms both RNAcontext and Deepbind in in vitro binding prediction for 244 RNAcompete experiments. Moreover, RCK is also faster and uses less memory, which enables scalability. While currently on par with existing methods in in vivo binding prediction on a small scale test, we demonstrate that RCK will increasingly benefit from experimentally measured RNA structure profiles as compared to computationally predicted ones. By running RCK on the entire RNAcompete dataset, we generate and provide as a resource a set of protein-RNA structure-based models on an unprecedented scale. Software and models are freely available at http://rck.csail.mit.edu/ bab@mit.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by

Strategies for Protein Overproduction in Escherichia coli.

Science.gov (United States)

Mott, John E.

1984-01-01

Examines heterologous expression in Escherichia coli and the role of regulatory sequences which control gene expression at transcription resulting in abundant production of messenger RNA and regulatory sequences in mRNA which promote efficient translation. Also examines the role of E. coli cells in stabilizing mRNA and protein that is…

The nucleotide sequence of RNA1 of Lettuce big-vein virus, genus Varicosavirus, reveals its relation to nonsegmented negative-strand RNA viruses.

Science.gov (United States)

Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki

2002-06-05

The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.

An RNA Phage Lab: MS2 in Walter Fiers' laboratory of molecular biology in Ghent, from genetic code to gene and genome, 1963-1976.

Science.gov (United States)

Pierrel, Jérôme

2012-01-01

The importance of viruses as model organisms is well-established in molecular biology and Max Delbrück's phage group set standards in the DNA phage field. In this paper, I argue that RNA phages, discovered in the 1960s, were also instrumental in the making of molecular biology. As part of experimental systems, RNA phages stood for messenger RNA (mRNA), genes and genome. RNA was thought to mediate information transfers between DNA and proteins. Furthermore, RNA was more manageable at the bench than DNA due to the availability of specific RNases, enzymes used as chemical tools to analyse RNA. Finally, RNA phages provided scientists with a pure source of mRNA to investigate the genetic code, genes and even a genome sequence. This paper focuses on Walter Fiers' laboratory at Ghent University (Belgium) and their work on the RNA phage MS2. When setting up his Laboratory of Molecular Biology, Fiers planned a comprehensive study of the virus with a strong emphasis on the issue of structure. In his lab, RNA sequencing, now a little-known technique, evolved gradually from a means to solve the genetic code, to a tool for completing the first genome sequence. Thus, I follow the research pathway of Fiers and his 'RNA phage lab' with their evolving experimental system from 1960 to the late 1970s. This study illuminates two decisive shifts in post-war biology: the emergence of molecular biology as a discipline in the 1960s in Europe and of genomics in the 1990s.

Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera.

Science.gov (United States)

Chen, X; Yu, X; Cai, Y; Zheng, H; Yu, D; Liu, G; Zhou, Q; Hu, S; Hu, F

2010-12-01

MicroRNAs (miRNAs) are key regulators in various physiological and pathological processes via post-transcriptional regulation of gene expression. The honey bee (Apis mellifera) is a key model for highly social species, and its complex social behaviour can be interpreted theoretically as changes in gene regulation, in which miRNAs are thought to be involved. We used the SOLiD sequencing system to identify the repertoire of miRNAs in the honey bee by sequencing a mixed small RNA library from different developmental stages. We obtained a total of 36,796,459 raw sequences; of which 5,491,100 short sequences were fragments of mRNA and other noncoding RNAs (ncRNA), and 1,759,346 reads mapped to the known miRNAs. We predicted 267 novel honey bee miRNAs representing 380,182 short reads, including eight miRNAs of other insects in 14,107,583 genome-mapped sequences. We verified 50 of them using stem-loop reverse-transcription PCR (RT-PCR), in which 35 yielded PCR products. Cross-species analyses showed 81 novel miRNAs with homologues in other insects, suggesting that they were authentic miRNAs and have similar functions. The results of this study provide a basis for studies of the miRNA-modulating networks in development and some intriguing phenomena such as caste differentiation in A. mellifera. © 2010 The Authors. Insect Molecular Biology © 2010 The Royal Entomological Society.

A short autocomplementary sequence plays an essential role in avian sarcoma-leukosis virus RNA dimerization.

Science.gov (United States)

Fossé, P; Motté, N; Roumier, A; Gabus, C; Muriaux, D; Darlix, J L; Paoletti, J

1996-12-24

Retroviral genomes consist of two identical RNA molecules joined noncovalently near their 5'-ends. Recently, two models have been proposed for RNA dimer formation on the basis of results obtained in vitro with human immunodeficiency virus type 1 RNA and Moloney murine leukemia virus RNA. It was first proposed that viral RNA dimerizes by forming an interstrand quadruple helix with purine tetrads. The second model postulates that RNA dimerization is initiated by a loop-loop interaction between the two RNA molecules. In order to better characterize the dimerization process of retroviral genomic RNA, we analyzed the in vitro dimerization of avian sarcoma-leukosis virus (ASLV) RNA using different transcripts. We determined the requirements for heterodimer formation, the thermal dissociation of RNA dimers, and the influence of antisense DNA oligonucleotides on dimer formation. Our results strongly suggest that purine tetrads are not involved in dimer formation. Data show that an autocomplementary sequence located upstream from the splice donor site and within a major packaging signal plays a crucial role in ASLV RNA dimer formation in vitro. This sequence is able to form a stem-loop structure, and phylogenetic analysis reveals that it is conserved in 28 different avian sarcoma and leukosis viruses. These results suggest that dimerization of ASLV RNA is initiated by a loop-loop interaction between two RNA molecules and provide an additional argument for the ubiquity of the dimerization process via loop-loop interaction.

Application of RNA interference in treating human diseases

Indian Academy of Sciences (India)

ference than either strand individually. After injection into ... antisense strand to messenger RNAs (mRNAs) that bear ... processing of longer dsRNA and stem loop precursors (Nov- ... RNAi has several applications in biomedical research,.

Mercury's Messenger

Science.gov (United States)

Chapman, Clark R.

2004-01-01

Forty years after Mariner 2, planetary exploration has still only just begun, and many more missions are on drawing boards, nearing the launch pad, or even en route across interplanetary space to their targets. One of the most challenging missions that will be conducted this decade is sending the MESSENGER spacecraft to orbit the planet Mercury.…

Identification of microRNA-Like RNAs in the filamentous fungus Trichoderma reesei by solexa sequencing.

Directory of Open Access Journals (Sweden)

Kang Kang

Full Text Available microRNAs (miRNAs are non-coding small RNAs (sRNAs capable of negatively regulating gene expression. Recently, microRNA-like small RNAs (milRNAs were discovered in several filamentous fungi but not yet in Trichoderma reesei, an industrial filamentous fungus that can secrete abundant hydrolases. To explore the presence of milRNA in T. reesei and evaluate their expression under induction of cellulose, two T. reesei sRNA libraries of cellulose induction (IN and non-induction (CON were generated and sequenced using Solexa sequencing technology. A total of 726 and 631 sRNAs were obtained from the IN and CON samples, respectively. Global expression analysis showed an extensively differential expression of sRNAs in T. reesei under the two conditions. Thirteen predicted milRNAs were identified in T. reesei based on the short hairpin structure analysis. The milRNA profiles obtained in deep sequencing were further validated by RT-qPCR assay. Computational analysis predicted a number of potential targets relating to many processes including regulation of enzyme expression. The presence and differential expression of T. reesei milRNAs imply that milRNA might play a role in T. reesei growth and cellulase induction. This work lays foundation for further functional study of fungal milRNAs and their industrial application.

Discovery and validation of Barrett's esophagus microRNA transcriptome by next generation sequencing.

Directory of Open Access Journals (Sweden)

Ajay Bansal

Full Text Available Barrett's esophagus (BE is transition from squamous to columnar mucosa as a result of gastroesophageal reflux disease (GERD. The role of microRNA during this transition has not been systematically studied.For initial screening, total RNA from 5 GERD and 6 BE patients was size fractionated. RNA <70 nucleotides was subjected to SOLiD 3 library preparation and next generation sequencing (NGS. Bioinformatics analysis was performed using R package "DEseq". A p value<0.05 adjusted for a false discovery rate of 5% was considered significant. NGS-identified miRNA were validated using qRT-PCR in an independent group of 40 GERD and 27 BE patients. MicroRNA expression of human BE tissues was also compared with three BE cell lines.NGS detected 19.6 million raw reads per sample. 53.1% of filtered reads mapped to miRBase version 18. NGS analysis followed by qRT-PCR validation found 10 differentially expressed miRNA; several are novel (-708-5p, -944, -224-5p and -3065-5p. Up- or down- regulation predicted by NGS was matched by qRT-PCR in every case. Human BE tissues and BE cell lines showed a high degree of concordance (70-80% in miRNA expression. Prediction analysis identified targets that mapped to developmental signaling pathways such as TGFβ and Notch and inflammatory pathways such as toll-like receptor signaling and TGFβ. Cluster analysis found similarly regulated (up or down miRNA to share common targets suggesting coordination between miRNA.Using highly sensitive next-generation sequencing, we have performed a comprehensive genome wide analysis of microRNA in BE and GERD patients. Differentially expressed miRNA between BE and GERD have been further validated. Expression of miRNA between BE human tissues and BE cell lines are highly correlated. These miRNA should be studied in biological models to further understand BE development.

Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

Science.gov (United States)

Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

2014-04-01

Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

Determining RNA quality for NextGen sequencing: some exceptions to the gold standard rule of 23S to 16S rRNA ratio

Science.gov (United States)

Using next-generation-sequencing technology to assess entire transcriptomes requires high quality starting RNA. Currently, RNA quality is routinely judged using automated microfluidic gel electrophoresis platforms and associated algorithms. Here we report that such automated methods generate false-n...

Sequence-engineered mRNA Without Chemical Nucleoside Modifications Enables an Effective Protein Therapy in Large Animals

Science.gov (United States)

Thess, Andreas; Grund, Stefanie; Mui, Barbara L; Hope, Michael J; Baumhof, Patrick; Fotin-Mleczek, Mariola; Schlake, Thomas

2015-01-01

Being a transient carrier of genetic information, mRNA could be a versatile, flexible, and safe means for protein therapies. While recent findings highlight the enormous therapeutic potential of mRNA, evidence that mRNA-based protein therapies are feasible beyond small animals such as mice is still lacking. Previous studies imply that mRNA therapeutics require chemical nucleoside modifications to obtain sufficient protein expression and avoid activation of the innate immune system. Here we show that chemically unmodified mRNA can achieve those goals as well by applying sequence-engineered molecules. Using erythropoietin (EPO) driven production of red blood cells as the biological model, engineered Epo mRNA elicited meaningful physiological responses from mice to nonhuman primates. Even in pigs of about 20 kg in weight, a single adequate dose of engineered mRNA encapsulated in lipid nanoparticles (LNPs) induced high systemic Epo levels and strong physiological effects. Our results demonstrate that sequence-engineered mRNA has the potential to revolutionize human protein therapies. PMID:26050989

A thermostable messenger RNA based vaccine against rabies.

Science.gov (United States)

Stitz, Lothar; Vogel, Annette; Schnee, Margit; Voss, Daniel; Rauch, Susanne; Mutzke, Thorsten; Ketterer, Thomas; Kramps, Thomas; Petsch, Benjamin

2017-12-01

Although effective rabies virus vaccines have been existing for decades, each year, rabies virus infections still cause around 50.000 fatalities worldwide. Most of these cases occur in developing countries, where these vaccines are not available. The reasons for this are the prohibitive high costs of cell culture or egg grown rabies virus vaccines and the lack of a functional cold chain in many regions in which rabies virus is endemic. Here, we describe the excellent temperature resistance of a non-replicating mRNA based rabies virus vaccine encoding the rabies virus glycoprotein (RABV-G). Prolonged storage of the vaccine from -80°C to up to +70°C for several months did not impact the protective capacity of the mRNA vaccine. Efficacy after storage was demonstrated by the induction of rabies specific virus neutralizing antibodies and protection in mice against lethal rabies infection. Moreover, storing the vaccine at oscillating temperatures between +4° and +56°C for 20 cycles in order to simulate interruptions of the cold chain during vaccine transport, did not affect the vaccine's immunogenicity and protective characteristics, indicating that maintenance of a cold chain is not essential for this vaccine.

Mobile MSN Messenger: Still a Complement?

Directory of Open Access Journals (Sweden)

Marcus Nyberg

2008-10-01

Full Text Available In order to understand how mobile instant messaging services can fit into the users’ current communication behavior, Ericsson Research performed a qualitative user study in Sweden in May 2007. The results showed that the respondents were positive towards (free of charge mobile MSN Messenger and perceived it as an ex¬tension of the computer-based version that could be used anywhere. However, although MSN Messenger on the com¬puter definitely was considered as a ‘must-have’ application, the mobile version was only perceived as a ‘nice-to-have’ application and a complement to text mes¬saging (SMS. Almost one year later, in April 2008, Ericsson Research performed a short qualita¬tive follow-up study with the same set of respondents to un¬derstand if and how the mobile MSN Messenger usage had changed. The results actually revealed that none of the re¬spondents used mobile MSN Messenger anymore as the application no longer was free of charge. On a general level, the study highlights important considera¬tions when intro¬ducing computer-based concepts and Internet services in a mo¬bile environment.

Rapid RNase L-driven arrest of protein synthesis in the dsRNA response without degradation of translation machinery.

Science.gov (United States)

Donovan, Jesse; Rath, Sneha; Kolet-Mandrikov, David; Korennykh, Alexei

2017-11-01

Mammalian cells respond to double-stranded RNA (dsRNA) by activating a translation-inhibiting endoribonuclease, RNase L. Consensus in the field indicates that RNase L arrests protein synthesis by degrading ribosomal RNAs (rRNAs) and messenger RNAs (mRNAs). However, here we provide evidence for a different and far more efficient mechanism. By sequencing abundant RNA fragments generated by RNase L in human cells, we identify site-specific cleavage of two groups of noncoding RNAs: Y-RNAs, whose function is poorly understood, and cytosolic tRNAs, which are essential for translation. Quantitative analysis of human RNA cleavage versus nascent protein synthesis in lung carcinoma cells shows that RNase L stops global translation when tRNAs, as well as rRNAs and mRNAs, are still intact. Therefore, RNase L does not have to degrade the translation machinery to stop protein synthesis. Our data point to a rapid mechanism that transforms a subtle RNA cleavage into a cell-wide translation arrest. © 2017 Donovan et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure.

Directory of Open Access Journals (Sweden)

Masfique Mehedi

Full Text Available Ebolavirus (EBOV, the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure.

Science.gov (United States)

Mehedi, Masfique; Hoenen, Thomas; Robertson, Shelly; Ricklefs, Stacy; Dolan, Michael A; Taylor, Travis; Falzarano, Darryl; Ebihara, Hideki; Porcella, Stephen F; Feldmann, Heinz

2013-01-01

Ebolavirus (EBOV), the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

Genome-Wide Analysis of Gene and microRNA Expression in Diploid and Autotetraploid Paulownia fortunei (Seem Hemsl. under Drought Stress by Transcriptome, microRNA, and Degradome Sequencing

Directory of Open Access Journals (Sweden)

Zhenli Zhao

2018-02-01

Full Text Available Drought is a common and recurring climatic condition in many parts of the world, and it can have disastrous impacts on plant growth and development. Many genes involved in the drought response of plants have been identified. Transcriptome, microRNA (miRNA, and degradome analyses are rapid ways of identifying drought-responsive genes. The reference genome sequence of Paulownia fortunei (Seem Hemsl. is now available, which makes it easier to explore gene expression, transcriptional regulation, and post-transcriptional in this species. In this study, four transcriptome, small RNA, and degradome libraries were sequenced by Illumina sequencing, respectively. A total of 258 genes and 11 miRNAs were identified for drought-responsive genes and miRNAs in P. fortunei. Degradome sequencing detected 28 miRNA target genes that were cleaved by members of nine conserved miRNA families and 12 novel miRNAs. The results here will contribute toward enriching our understanding of the response of Paulownia fortunei trees to drought stress and may provide new direction for further experimental studies related the development of molecular markers, the genetic map construction, and other genomic research projects in Paulownia.

CoverageAnalyzer (CAn: A Tool for Inspection of Modification Signatures in RNA Sequencing Profiles

Directory of Open Access Journals (Sweden)

Ralf Hauenschild

2016-11-01

Full Text Available Combination of reverse transcription (RT and deep sequencing has emerged as a powerful instrument for the detection of RNA modifications, a field that has seen a recent surge in activity because of its importance in gene regulation. Recent studies yielded high-resolution RT signatures of modified ribonucleotides relying on both sequence-dependent mismatch patterns and reverse transcription arrests. Common alignment viewers lack specialized functionality, such as filtering, tailored visualization, image export and differential analysis. Consequently, the community will profit from a platform seamlessly connecting detailed visual inspection of RT signatures and automated screening for modification candidates. CoverageAnalyzer (CAn was developed in response to the demand for a powerful inspection tool. It is freely available for all three main operating systems. With SAM file format as standard input, CAn is an intuitive and user-friendly tool that is generally applicable to the large community of biomedical users, starting from simple visualization of RNA sequencing (RNA-Seq data, up to sophisticated modification analysis with significance-based modification candidate calling.

Selective amplification and sequencing of cyclic phosphate-containing RNAs by the cP-RNA-seq method.

Science.gov (United States)

Honda, Shozo; Morichika, Keisuke; Kirino, Yohei

2016-03-01

RNA digestions catalyzed by many ribonucleases generate RNA fragments that contain a 2',3'-cyclic phosphate (cP) at their 3' termini. However, standard RNA-seq methods are unable to accurately capture cP-containing RNAs because the cP inhibits the adapter ligation reaction. We recently developed a method named cP-RNA-seq that is able to selectively amplify and sequence cP-containing RNAs. Here we describe the cP-RNA-seq protocol in which the 3' termini of all RNAs, except those containing a cP, are cleaved through a periodate treatment after phosphatase treatment; hence, subsequent adapter ligation and cDNA amplification steps are exclusively applied to cP-containing RNAs. cP-RNA-seq takes ∼6 d, excluding the time required for sequencing and bioinformatics analyses, which are not covered in detail in this protocol. Biochemical validation of the existence of cP in the identified RNAs takes ∼3 d. Even though the cP-RNA-seq method was developed to identify angiogenin-generating 5'-tRNA halves as a proof of principle, the method should be applicable to global identification of cP-containing RNA repertoires in various transcriptomes.

Full Genome Sequence and sfRNA Interferon Antagonist Activity of Zika Virus from Recife, Brazil.

Directory of Open Access Journals (Sweden)

Claire L Donald

2016-10-01

Full Text Available The outbreak of Zika virus (ZIKV in the Americas has transformed a previously obscure mosquito-transmitted arbovirus of the Flaviviridae family into a major public health concern. Little is currently known about the evolution and biology of ZIKV and the factors that contribute to the associated pathogenesis. Determining genomic sequences of clinical viral isolates and characterization of elements within these are an important prerequisite to advance our understanding of viral replicative processes and virus-host interactions.We obtained a ZIKV isolate from a patient who presented with classical ZIKV-associated symptoms, and used high throughput sequencing and other molecular biology approaches to determine its full genome sequence, including non-coding regions. Genome regions were characterized and compared to the sequences of other isolates where available. Furthermore, we identified a subgenomic flavivirus RNA (sfRNA in ZIKV-infected cells that has antagonist activity against RIG-I induced type I interferon induction, with a lesser effect on MDA-5 mediated action.The full-length genome sequence including non-coding regions of a South American ZIKV isolate from a patient with classical symptoms will support efforts to develop genetic tools for this virus. Detection of sfRNA that counteracts interferon responses is likely to be important for further understanding of pathogenesis and virus-host interactions.

Accurate microRNA target prediction correlates with protein repression levels

Directory of Open Access Journals (Sweden)

Simossis Victor A

2009-09-01

Full Text Available Abstract Background MicroRNAs are small endogenously expressed non-coding RNA molecules that regulate target gene expression through translation repression or messenger RNA degradation. MicroRNA regulation is performed through pairing of the microRNA to sites in the messenger RNA of protein coding genes. Since experimental identification of miRNA target genes poses difficulties, computational microRNA target prediction is one of the key means in deciphering the role of microRNAs in development and disease. Results DIANA-microT 3.0 is an algorithm for microRNA target prediction which is based on several parameters calculated individually for each microRNA and combines conserved and non-conserved microRNA recognition elements into a final prediction score, which correlates with protein production fold change. Specifically, for each predicted interaction the program reports a signal to noise ratio and a precision score which can be used as an indication of the false positive rate of the prediction. Conclusion Recently, several computational target prediction programs were benchmarked based on a set of microRNA target genes identified by the pSILAC method. In this assessment DIANA-microT 3.0 was found to achieve the highest precision among the most widely used microRNA target prediction programs reaching approximately 66%. The DIANA-microT 3.0 prediction results are available online in a user friendly web server at http://www.microrna.gr/microT

Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

Science.gov (United States)

Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

1984-01-11

We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to an automated (Apple II) procedure for searching and evaluating possible promoters in DNA sequence files.

Molecular-Sized DNA or RNA Sequencing Machine | NCI Technology Transfer Center | TTC

Science.gov (United States)

The National Cancer Institute's Gene Regulation and Chromosome Biology Laboratory is seeking statements of capability or interest from parties interested in collaborative research to co-develop a molecular-sized DNA or RNA sequencing machine.

Peroxisome proliferator-activated receptors, estrogenic responses and biotransformation system in the liver of salmon exposed to tributyltin and second messenger activator

Energy Technology Data Exchange (ETDEWEB)

Pavlikova, Nela [Department of Biology, Norwegian University of Science and Technology (NTNU), Hogskoleringen 5, 7491 Trondheim (Norway); RECETOX Research Centre for Environmental Chemistry and Ecotoxicology, Masaryk University, Kamenice 3, CZ62500 Brno (Czech Republic); Kortner, Trond M. [Department of Biology, Norwegian University of Science and Technology (NTNU), Hogskoleringen 5, 7491 Trondheim (Norway); Arukwe, Augustine, E-mail: arukwe@bio.ntnu.no [Department of Biology, Norwegian University of Science and Technology (NTNU), Hogskoleringen 5, 7491 Trondheim (Norway)

2010-08-15

The mechanisms by which organotin compounds produce modulations of the endocrine systems and other biological responses are not fully understood. In this study, juvenile salmon were force-fed diet containing TBT (0: solvent control, 0.1, 1 and 10 mg/kg fish) for 72 h. Subsequently, fish exposed to solvent control and 10 mg TBT were exposed to waterborne concentration (200 {mu}g/l) of the adenylate cyclase (AC) stimulator, forskolin for 2 and 4 h. The overall aim of the study was to explore whether TBT endocrine disruptive effects involve second messenger activation. Liver was sampled from individual fish (n = 8) at the end of the exposures. The transcription patterns of peroxisome proliferator-activated receptor (PPAR) isotype and acyl-coenzyme A oxidase 1 (ACOX1), aromatase isoform, estrogen receptor-{alpha} (ER{alpha}), pregnane X receptor (PXR), CYP3A and glutathione S-transferase (GST) genes were measured by quantitative polymerase chain reaction (qPCR). Our data showed a consistent increase in PPAR{alpha}, PPAR{beta} and PPAR{gamma} mRNA and protein expression after TBT exposure that were inversely correlated with ACOX1 mRNA levels. Forskolin produced PPAR isotype-specific mRNA and protein effects that were modulated by TBT. ACOX1 expression was decreased (at 2 h) and increased (at 4 h) by forskolin and the presence of TBT potentiated these effects. TBT apparently increased mRNA and protein levels of cyp19a, compared to the solvent control, whereas cyp19b mRNA levels were unaffected by TBT treatment. Combined TBT and forskolin exposure produced respective decrease and increase of mRNA levels of cyp19a and cyp19b, compared with control. TBT decreased ER{alpha} mRNA at low dose (1 mg/kg) and forskolin exposure alone produced a consistent decrease of ER{alpha} mRNA levels that were not affected by the presence of TBT. Interestingly, PXR and CYP3A mRNA levels were differentially affected, either decreased or increased, after exposure to TBT and forskolin, singly

Peroxisome proliferator-activated receptors, estrogenic responses and biotransformation system in the liver of salmon exposed to tributyltin and second messenger activator

International Nuclear Information System (INIS)

Pavlikova, Nela; Kortner, Trond M.; Arukwe, Augustine

2010-01-01

The mechanisms by which organotin compounds produce modulations of the endocrine systems and other biological responses are not fully understood. In this study, juvenile salmon were force-fed diet containing TBT (0: solvent control, 0.1, 1 and 10 mg/kg fish) for 72 h. Subsequently, fish exposed to solvent control and 10 mg TBT were exposed to waterborne concentration (200 μg/l) of the adenylate cyclase (AC) stimulator, forskolin for 2 and 4 h. The overall aim of the study was to explore whether TBT endocrine disruptive effects involve second messenger activation. Liver was sampled from individual fish (n = 8) at the end of the exposures. The transcription patterns of peroxisome proliferator-activated receptor (PPAR) isotype and acyl-coenzyme A oxidase 1 (ACOX1), aromatase isoform, estrogen receptor-α (ERα), pregnane X receptor (PXR), CYP3A and glutathione S-transferase (GST) genes were measured by quantitative polymerase chain reaction (qPCR). Our data showed a consistent increase in PPARα, PPARβ and PPARγ mRNA and protein expression after TBT exposure that were inversely correlated with ACOX1 mRNA levels. Forskolin produced PPAR isotype-specific mRNA and protein effects that were modulated by TBT. ACOX1 expression was decreased (at 2 h) and increased (at 4 h) by forskolin and the presence of TBT potentiated these effects. TBT apparently increased mRNA and protein levels of cyp19a, compared to the solvent control, whereas cyp19b mRNA levels were unaffected by TBT treatment. Combined TBT and forskolin exposure produced respective decrease and increase of mRNA levels of cyp19a and cyp19b, compared with control. TBT decreased ERα mRNA at low dose (1 mg/kg) and forskolin exposure alone produced a consistent decrease of ERα mRNA levels that were not affected by the presence of TBT. Interestingly, PXR and CYP3A mRNA levels were differentially affected, either decreased or increased, after exposure to TBT and forskolin, singly and also in combination. GST mRNA was

Avian reovirus L2 genome segment sequences and predicted structure/function of the encoded RNA-dependent RNA polymerase protein

Directory of Open Access Journals (Sweden)

Xu Wanhong

2008-12-01

Full Text Available Abstract Background The orthoreoviruses are infectious agents that possess a genome comprised of 10 double-stranded RNA segments encased in two concentric protein capsids. Like virtually all RNA viruses, an RNA-dependent RNA polymerase (RdRp enzyme is required for viral propagation. RdRp sequences have been determined for the prototype mammalian orthoreoviruses and for several other closely-related reoviruses, including aquareoviruses, but have not yet been reported for any avian orthoreoviruses. Results We determined the L2 genome segment nucleotide sequences, which encode the RdRp proteins, of two different avian reoviruses, strains ARV138 and ARV176 in order to define conserved and variable regions within reovirus RdRp proteins and to better delineate structure/function of this important enzyme. The ARV138 L2 genome segment was 3829 base pairs long, whereas the ARV176 L2 segment was 3830 nucleotides long. Both segments were predicted to encode λB RdRp proteins 1259 amino acids in length. Alignments of these newly-determined ARV genome segments, and their corresponding proteins, were performed with all currently available homologous mammalian reovirus (MRV and aquareovirus (AqRV genome segment and protein sequences. There was ~55% amino acid identity between ARV λB and MRV λ3 proteins, making the RdRp protein the most highly conserved of currently known orthoreovirus proteins, and there was ~28% identity between ARV λB and homologous MRV and AqRV RdRp proteins. Predictive structure/function mapping of identical and conserved residues within the known MRV λ3 atomic structure indicated most identical amino acids and conservative substitutions were located near and within predicted catalytic domains and lining RdRp channels, whereas non-identical amino acids were generally located on the molecule's surfaces. Conclusion The ARV λB and MRV λ3 proteins showed the highest ARV:MRV identity values (~55% amongst all currently known ARV and MRV

RNA Localization in Astrocytes

DEFF Research Database (Denmark)

Thomsen, Rune

2012-01-01

, regulation of the blood brain barrier and glial scar tissue formation. Despite the involvement in various CNS functions only a limited number of studies have addressed mRNA localization in astrocytes. This PhD project was initially focused on developing and implementing methods that could be used to asses mRNA......Messenger RNA (mRNA) localization is a mechanism by which polarized cells can regulate protein synthesis to specific subcellular compartments in a spatial and temporal manner, and plays a pivotal role in multiple physiological processes from embryonic development to cell differentiation...... localization in astrocyte protrusions, and following look into the subcellular localization pattern of specific mRNA species of both primary astrocytes isolated from cortical hemispheres of newborn mice, and the mouse astrocyte cell line, C8S. The Boyden chamber cell fractionation assay was optimized, in a way...

Geodesy at Mercury with MESSENGER

Science.gov (United States)

Smith, David E.; Zuber, Maria t.; Peale, Stanley J.; Phillips, Roger J.; Solomon, Sean C.

2006-01-01

In 2011 the MESSENGER (MErcury Surface, Space ENvironment, GEochemistry, and Ranging) spacecraft will enter Mercury orbit and begin the mapping phase of the mission. As part of its science objectives the MESSENGER mission will determine the shape and gravity field of Mercury. These observations will enable the topography and the crustal thickness to be derived for the planet and will determine the small libration of the planet about its axis, the latter critical to constraining the state of the core. These measurements require very precise positioning of the MESSENGER spacecraft in its eccentric orbit, which has a periapsis altitude as low as 200 km, an apoapsis altitude near 15,000 km, and a closest approach to the surface varying from latitude 60 to about 70 N. The X-band tracking of MESSENGER and the laser altimetry are the primary data that will be used to measure the planetary shape and gravity field. The laser altimeter, which has an expected range of 1000 to 1200 km, is expected to provide significant data only over the northern hemisphere because of MESSENGER's eccentric orbit. For the southern hemisphere, radio occultation measurements obtained as the spacecraft passes behind the planet as seen from Earth and images obtained with the imaging system will be used to provide the long-wavelength shape of the planet. Gravity, derived from the tracking data, will also have greater resolution in the northern hemisphere, but full global models for both topography and gravity will be obtained at low harmonic order and degree. The limiting factor for both gravity and topography is expected to be knowledge of the spacecraft location. Present estimations are that in a combined tracking, altimetry, and occultation solution the spacecraft position uncertainty is likely to be of order 10 m. This accuracy should be adequate for establishing an initial geodetic coordinate system for Mercury that will enable positioning of imaged features on the surface, determination of

Determining mutant spectra of three RNA viral samples using ultra-deep sequencing

Energy Technology Data Exchange (ETDEWEB)

Chen, H

2012-06-06

RNA viruses have extremely high mutation rates that enable the virus to adapt to new host environments and even jump from one species to another. As part of a viral transmission study, three viral samples collected from naturally infected animals were sequenced using Illumina paired-end technology at ultra-deep coverage. In order to determine the mutant spectra within the viral quasispecies, it is critical to understand the sequencing error rates and control for false positive calls of viral variants (point mutantations). I will estimate the sequencing error rate from two control sequences and characterize the mutant spectra in the natural samples with this error rate.

MESSENGER'S First and Second Flybys of Mercury

Science.gov (United States)

Slavin, James A.

2009-01-01

The MESSENGER mission to Mercury offers our first opportunity to explore this planet's miniature magnetosphere since Mariner 10's brief fly-bys in 1974-5. The magnetosphere of Mercury is the smallest in the solar system with its magnetic field typically standing off the solar wind only approximately 1000 km above the surface. An overview of the MESSENGER mission and its January 14th and October 6th, 2008 close flybys of Mercury will be provided. Primary science objectives and the science instrumentation will be described. Initial results from MESSENGER will be discussed with an emphasis on the magnetic field and charged particle measurements.

Sequence-based heuristics for faster annotation of non-coding RNA families.

Science.gov (United States)

Weinberg, Zasha; Ruzzo, Walter L

2006-01-01

Non-coding RNAs (ncRNAs) are functional RNA molecules that do not code for proteins. Covariance Models (CMs) are a useful statistical tool to find new members of an ncRNA gene family in a large genome database, using both sequence and, importantly, RNA secondary structure information. Unfortunately, CM searches are extremely slow. Previously, we created rigorous filters, which provably sacrifice none of a CM's accuracy, while making searches significantly faster for virtually all ncRNA families. However, these rigorous filters make searches slower than heuristics could be. In this paper we introduce profile HMM-based heuristic filters. We show that their accuracy is usually superior to heuristics based on BLAST. Moreover, we compared our heuristics with those used in tRNAscan-SE, whose heuristics incorporate a significant amount of work specific to tRNAs, where our heuristics are generic to any ncRNA. Performance was roughly comparable, so we expect that our heuristics provide a high-quality solution that--unlike family-specific solutions--can scale to hundreds of ncRNA families. The source code is available under GNU Public License at the supplementary web site.

Structure, dynamics and RNA binding of the multi-domain splicing factor TIA-1

Science.gov (United States)

Wang, Iren; Hennig, Janosch; Jagtap, Pravin Kumar Ankush; Sonntag, Miriam; Valcárcel, Juan; Sattler, Michael

2014-01-01

Alternative pre-messenger ribonucleic acid (pre-mRNA) splicing is an essential process in eukaryotic gene regulation. The T-cell intracellular antigen-1 (TIA-1) is an apoptosis-promoting factor that modulates alternative splicing of transcripts, including the pre-mRNA encoding the membrane receptor Fas. TIA-1 is a multi-domain ribonucleic acid (RNA) binding protein that recognizes poly-uridine tract RNA sequences to facilitate 5′ splice site recognition by the U1 small nuclear ribonucleoprotein (snRNP). Here, we characterize the RNA interaction and conformational dynamics of TIA-1 by nuclear magnetic resonance (NMR), isothermal titration calorimetry (ITC) and small angle X-ray scattering (SAXS). Our NMR-derived solution structure of TIA-1 RRM2–RRM3 (RRM2,3) reveals that RRM2 adopts a canonical RNA recognition motif (RRM) fold, while RRM3 is preceded by an non-canonical helix α0. NMR and SAXS data show that all three RRMs are largely independent structural modules in the absence of RNA, while RNA binding induces a compact arrangement. RRM2,3 binds to pyrimidine-rich FAS pre-mRNA or poly-uridine (U9) RNA with nanomolar affinities. RRM1 has little intrinsic RNA binding affinity and does not strongly contribute to RNA binding in the context of RRM1,2,3. Our data unravel the role of binding avidity and the contributions of the TIA-1 RRMs for recognition of pyrimidine-rich RNAs. PMID:24682828

Identification of human microRNA-like sequences embedded within the protein-encoding genes of the human immunodeficiency virus.

Directory of Open Access Journals (Sweden)

Bryan Holland

Full Text Available BACKGROUND: MicroRNAs (miRNAs are highly conserved, short (18-22 nts, non-coding RNA molecules that regulate gene expression by binding to the 3' untranslated regions (3'UTRs of mRNAs. While numerous cellular microRNAs have been associated with the progression of various diseases including cancer, miRNAs associated with retroviruses have not been well characterized. Herein we report identification of microRNA-like sequences in coding regions of several HIV-1 genomes. RESULTS: Based on our earlier proteomics and bioinformatics studies, we have identified 8 cellular miRNAs that are predicted to bind to the mRNAs of multiple proteins that are dysregulated during HIV-infection of CD4+ T-cells in vitro. In silico analysis of the full length and mature sequences of these 8 miRNAs and comparisons with all the genomic and subgenomic sequences of HIV-1 strains in global databases revealed that the first 18/18 sequences of the mature hsa-miR-195 sequence (including the short seed sequence, matched perfectly (100%, or with one nucleotide mismatch, within the envelope (env genes of five HIV-1 genomes from Africa. In addition, we have identified 4 other miRNA-like sequences (hsa-miR-30d, hsa-miR-30e, hsa-miR-374a and hsa-miR-424 within the env and the gag-pol encoding regions of several HIV-1 strains, albeit with reduced homology. Mapping of the miRNA-homologues of env within HIV-1 genomes localized these sequence to the functionally significant variable regions of the env glycoprotein gp120 designated V1, V2, V4 and V5. CONCLUSIONS: We conclude that microRNA-like sequences are embedded within the protein-encoding regions of several HIV-1 genomes. Given that the V1 to V5 regions of HIV-1 envelopes contain specific, well-characterized domains that are critical for immune responses, virus neutralization and disease progression, we propose that the newly discovered miRNA-like sequences within the HIV-1 genomes may have evolved to self-regulate survival of the

Quantifying alternative splicing from paired-end RNA-sequencing data

OpenAIRE

Rossell, David; Stephan-Otto Attolini, Camille; Kroiss, Manuel; Stöcker, Almond

2014-01-01

RNA-sequencing has revolutionized biomedical research and, in particular, our ability to study gene alternative splicing. The problem has important implications for human health, as alternative splicing may be involved in malfunctions at the cellular level and multiple diseases. However, the high-dimensional nature of the data and the existence of experimental biases pose serious data analysis challenges. We find that the standard data summaries used to study alternative splicing are severely...

Transfecting Human Monocytes with RNA.

Science.gov (United States)

Dannull, Jens; Nair, Smita K

2016-01-01

Targeting monocytes as a delivery system for drugs or nucleic acids, and thereby harnessing their natural tissue-infiltrating capacity, has become an area of intense investigation in both basic and clinical research. Herein we describe an efficient method to deliver mRNA (messenger RNA) or siRNA (small interfering RNA) into human monocytes by electroporation. This method can be applied in the laboratory to monocytes isolated via magnetic bead-based techniques, or in a clinical setting using monocytes that were collected via counterflow centrifugation elutriation using the Elutra(®) Cell Separation System. We further demonstrate that electroporation of monocytes with RNA represents a robust and highly relevant approach to modify monocytes for cell-based therapies. Last, the procedure described can readily be adapted to monocytes from different species, hence facilitating research in animal models.

RNA-Based Vaccines in Cancer Immunotherapy

Directory of Open Access Journals (Sweden)

Megan A. McNamara

2015-01-01

Full Text Available RNA vaccines traditionally consist of messenger RNA synthesized by in vitro transcription using a bacteriophage RNA polymerase and template DNA that encodes the antigen(s of interest. Once administered and internalized by host cells, the mRNA transcripts are translated directly in the cytoplasm and then the resulting antigens are presented to antigen presenting cells to stimulate an immune response. Alternatively, dendritic cells can be loaded with either tumor associated antigen mRNA or total tumor RNA and delivered to the host to elicit a specific immune response. In this review, we will explain why RNA vaccines represent an attractive platform for cancer immunotherapy, discuss modifications to RNA structure that have been developed to optimize mRNA vaccine stability and translational efficiency, and describe strategies for nonviral delivery of mRNA vaccines, highlighting key preclinical and clinical data related to cancer immunotherapy.

Cytoplasmic Control of Sense-Antisense mRNA Pairs

Directory of Open Access Journals (Sweden)

Flore Sinturel

2015-09-01

Full Text Available Transcriptome analyses have revealed that convergent gene transcription can produce many 3′-overlapping mRNAs in diverse organisms. Few studies have examined the fate of 3′-complementary mRNAs in double-stranded RNA-dependent nuclear phenomena, and nothing is known about the cytoplasmic destiny of 3′-overlapping messengers or their impact on gene expression. Here, we demonstrate that the complementary tails of 3′-overlapping mRNAs can interact in the cytoplasm and promote post-transcriptional regulatory events including no-go decay (NGD in Saccharomyces cerevisiae. Genome-wide experiments confirm that these messenger-interacting mRNAs (mimRNAs form RNA duplexes in wild-type cells and thus have potential roles in modulating the mRNA levels of their convergent gene pattern under different growth conditions. We show that the post-transcriptional fate of hundreds of mimRNAs is controlled by Xrn1, revealing the extent to which this conserved 5′-3′ cytoplasmic exoribonuclease plays an unexpected but key role in the post-transcriptional control of convergent gene expression.

Cytoplasmic Control of Sense-Antisense mRNA Pairs.

Science.gov (United States)

Sinturel, Flore; Navickas, Albertas; Wery, Maxime; Descrimes, Marc; Morillon, Antonin; Torchet, Claire; Benard, Lionel

2015-09-22

Transcriptome analyses have revealed that convergent gene transcription can produce many 3'-overlapping mRNAs in diverse organisms. Few studies have examined the fate of 3'-complementary mRNAs in double-stranded RNA-dependent nuclear phenomena, and nothing is known about the cytoplasmic destiny of 3'-overlapping messengers or their impact on gene expression. Here, we demonstrate that the complementary tails of 3'-overlapping mRNAs can interact in the cytoplasm and promote post-transcriptional regulatory events including no-go decay (NGD) in Saccharomyces cerevisiae. Genome-wide experiments confirm that these messenger-interacting mRNAs (mimRNAs) form RNA duplexes in wild-type cells and thus have potential roles in modulating the mRNA levels of their convergent gene pattern under different growth conditions. We show that the post-transcriptional fate of hundreds of mimRNAs is controlled by Xrn1, revealing the extent to which this conserved 5'-3' cytoplasmic exoribonuclease plays an unexpected but key role in the post-transcriptional control of convergent gene expression. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Unusually effective microRNA targeting within repeat-rich coding regions of mammalian mRNAs

Science.gov (United States)

Schnall-Levin, Michael; Rissland, Olivia S.; Johnston, Wendy K.; Perrimon, Norbert; Bartel, David P.; Berger, Bonnie

2011-01-01

MicroRNAs (miRNAs) regulate numerous biological processes by base-pairing with target messenger RNAs (mRNAs), primarily through sites in 3′ untranslated regions (UTRs), to direct the repression of these targets. Although miRNAs have sometimes been observed to target genes through sites in open reading frames (ORFs), large-scale studies have shown such targeting to be generally less effective than 3′ UTR targeting. Here, we show that several miRNAs each target significant groups of genes through multiple sites within their coding regions. This ORF targeting, which mediates both predictable and effective repression, arises from highly repeated sequences containing miRNA target sites. We show that such sequence repeats largely arise through evolutionary duplications and occur particularly frequently within families of paralogous C2H2 zinc-finger genes, suggesting the potential for their coordinated regulation. Examples of ORFs targeted by miR-181 include both the well-known tumor suppressor RB1 and RBAK, encoding a C2H2 zinc-finger protein and transcriptional binding partner of RB1. Our results indicate a function for repeat-rich coding sequences in mediating post-transcriptional regulation and reveal circumstances in which miRNA-mediated repression through ORF sites can be reliably predicted. PMID:21685129

Guide totheNomenclatureofKinetoplastidRNA Editing: AProposal

Czech Academy of Sciences Publication Activity Database

Simpson, L.; Aphasizhev, R.; Lukeš, Julius; Cruz-Reyes, J.

2010-01-01

Roč. 161, č. 1 (2010), s. 2-6 ISSN 1434-4610 Institutional research plan: CEZ:AV0Z60220518 Keywords : TRYPANOSOMA-BRUCEI MITOCHONDRIA * BINDING COMPLEX * EDITOSOME INTEGRITY * MESSENGER-RNA * U-DELETION * LEISHMANIA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.329, year: 2010

Small RNA sequencing reveals a comprehensive miRNA signature of BRCA1-associated high-grade serous ovarian cancer

NARCIS (Netherlands)

Brouwer, Jan; Kluiver, Joost; de Almeida, Rodrigo C.; Modderman, Rutger; Terpstra, Martijn; Kok, Klaas; Withoff, Sebo; Hollema, Harry; Reitsma, Welmoed; de Bock, Geertruida H.; Mourits, Marian J. E.; van den Berg, Anke

2016-01-01

AimsBRCA1 mutation carriers are at increased risk of developing high-grade serous ovarian cancer (HGSOC), a malignancy that originates from fallopian tube epithelium. We aimed to identify differentially expressed known and novel miRNAs in BRCA1-associated HGSOC. Methods Small RNA sequencing was

Calling genotypes from public RNA-sequencing data enables identification of genetic variants that affect gene-expression levels

NARCIS (Netherlands)

Deelen, Patrick; Zhernakova, Daria V.; de Haan, Mark; van der Sijde, Marijke; Bonder, Marc Jan; Karjalainen, Juha; van der Velde, K. Joeri; Abbott, Kristin M.; Fu, Jingyuan; Wijmenga, Cisca; Sinke, Richard J.; Swertz, Morris A.; Franke, Lude

2015-01-01

Background: RNA-sequencing (RNA-seq) is a powerful technique for the identification of genetic variants that affect gene-expression levels, either through expression quantitative trait locus (eQTL) mapping or through allele-specific expression (ASE) analysis. Given increasing numbers of RNA-seq

Phylogenetic analysis of Fusobacterium prausnitzii based upon the 16S rRNA gene sequence and PCR confirmation.

Science.gov (United States)

Wang, R F; Cao, W W; Cerniglia, C E

1996-01-01

In order to develop a PCR method to detect Fusobacterium prausnitzii in human feces and to clarify the phylogenetic position of this species, its 16S rRNA gene sequence was determined. The sequence described in this paper is different from the 16S rRNA gene sequence is specific for F. prausnitzii, and the results of this assay confirmed that F. prausnitzii is the most common species in human feces. However, a PCR assay based on the original GenBank sequence was negative when it was performed with two strains of F. prausnitzii obtained from the American Type Culture Collection. A phylogenetic tree based on the new 16S rRNA gene sequence was constructed. On this tree F. prausnitzii was not a member of the Fusobacterium group but was closer to some Eubacterium spp. and located between Clostridium "clusters III and IV" (M.D. Collins, P.A. Lawson, A. Willems, J.J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J.A.E. Farrow, Int. J. Syst. Bacteriol. 44:812-826, 1994).

Molecular characterizations of somatic hybrids developed between Pleurotus florida and Lentinus squarrosulus through inter-simple sequence repeat markers and sequencing of ribosomal RNA-ITS gene.

Science.gov (United States)

Mallick, Pijush; Chattaraj, Shruti; Sikdar, Samir Ranjan

2017-10-01

The 12 pfls somatic hybrids and 2 parents of Pleurotus florida and Lentinus s quarrosulus were characterized by ISSR and sequencing of rRNA-ITS genes. Five ISSR primers were used and amplified a total of 54 reproducible fragments with 98.14% polymorphism among all the pfls hybrid populations and parental strains. UPGMA-based cluster exhibited a dendrogram with three major groups between the parents and pfls hybrids. Parent P . florida and L . squarrosulus showed different degrees of genetic distance with all the hybrid lines and they showed closeness to hybrid pfls 1m and pfls 1h , respectively. ITS1(F) and ITS4(R) amplified the rRNA-ITS gene with 611-867 bp sequence length. The nucleotide polymorphisms were found in the ITS1, ITS2 and 5.8S rRNA region with different number of bases. Based on rRNA-ITS sequence, UPGMA cluster exhibited three distinct groups between L. squarrosulus and pfls 1p , pfls 1m and pfls 1s , and pfls 1e and P. florida .

RNA-Sequencing of Primary Retinoblastoma Tumors Provides New Insights and Challenges Into Tumor Development

Directory of Open Access Journals (Sweden)

Sailaja V. Elchuri

2018-05-01

Full Text Available Retinoblastoma is rare tumor of the retina caused by the homozygous loss of the Retinoblastoma 1 tumor suppressor gene (RB1. Loss of the RB1 protein, pRB, results in de-regulated activity of the E2F transcription factors, chromatin changes and developmental defects leading to tumor development. Extensive microarray profiles of these tumors have enabled the identification of genes sensitive to pRB disruption, however, this technology has a number of limitations in the RNA profiles that they generate. The advent of RNA-sequencing has enabled the global profiling of all of the RNA within the cell including both coding and non-coding features and the detection of aberrant RNA processing events. In this perspective, we focus on discussing how RNA-sequencing of rare Retinoblastoma tumors will build on existing data and open up new area’s to improve our understanding of the biology of these tumors. In particular, we discuss how the RB-research field may be to use this data to determine how RB1 loss results in the expression of; non-coding RNAs, causes aberrant RNA processing events and how a deeper analysis of metabolic RNA changes can be utilized to model tumor specific shifts in metabolism. Each section discusses new opportunities and challenges associated with these types of analyses and aims to provide an honest assessment of how understanding these different processes may contribute to the treatment of Retinoblastoma.

MicroRNA and Cancer: Tiny Molecules with Major Implications

OpenAIRE

VandenBoom II, Timothy G; Li, Yiwei; Philip, Philip A; Sarkar, Fazlul H

2008-01-01

Cancer is currently a major public health problem and, as such, emerging research is making significant progress in identifying major players in its biology. One recent topic of interest involves microRNAs (miRNAs) which are small, non-coding RNA molecules that inhibit gene expression post-transcriptionally. They accomplish this by binding to the 3? untranslated region (3?UTR) of target messengerRNA (mRNA), resulting in either their degradation or inhibition of translation, depending on the d...

The binding of TIA-1 to RNA C-rich sequences is driven by its C-terminal RRM domain.

Science.gov (United States)

Cruz-Gallardo, Isabel; Aroca, Ángeles; Gunzburg, Menachem J; Sivakumaran, Andrew; Yoon, Je-Hyun; Angulo, Jesús; Persson, Cecilia; Gorospe, Myriam; Karlsson, B Göran; Wilce, Jacqueline A; Díaz-Moreno, Irene

2014-01-01

T-cell intracellular antigen-1 (TIA-1) is a key DNA/RNA binding protein that regulates translation by sequestering target mRNAs in stress granules (SG) in response to stress conditions. TIA-1 possesses three RNA recognition motifs (RRM) along with a glutamine-rich domain, with the central domains (RRM2 and RRM3) acting as RNA binding platforms. While the RRM2 domain, which displays high affinity for U-rich RNA sequences, is primarily responsible for interaction with RNA, the contribution of RRM3 to bind RNA as well as the target RNA sequences that it binds preferentially are still unknown. Here we combined nuclear magnetic resonance (NMR) and surface plasmon resonance (SPR) techniques to elucidate the sequence specificity of TIA-1 RRM3. With a novel approach using saturation transfer difference NMR (STD-NMR) to quantify protein-nucleic acids interactions, we demonstrate that isolated RRM3 binds to both C- and U-rich stretches with micromolar affinity. In combination with RRM2 and in the context of full-length TIA-1, RRM3 significantly enhanced the binding to RNA, particularly to cytosine-rich RNA oligos, as assessed by biotinylated RNA pull-down analysis. Our findings provide new insight into the role of RRM3 in regulating TIA-1 binding to C-rich stretches, that are abundant at the 5' TOPs (5' terminal oligopyrimidine tracts) of mRNAs whose translation is repressed under stress situations.

16S rRNA gene sequence and phylogenetic tree of lactobacillus ...

African Journals Online (AJOL)

... processed by denaturing gradient gel electrophoresis (DGGE). Phylogenetic tree was constructed with the sequences of the V2-V3 region of 16S rRNA gene. Results show two distinct divisions among the Lactobacillus species. The study presents a new understanding of the nature of the Lactobacillus vaginal microbiota ...

Customized workflow development and data modularization concepts for RNA-Sequencing and metatranscriptome experiments.

Science.gov (United States)

Lott, Steffen C; Wolfien, Markus; Riege, Konstantin; Bagnacani, Andrea; Wolkenhauer, Olaf; Hoffmann, Steve; Hess, Wolfgang R

2017-11-10

RNA-Sequencing (RNA-Seq) has become a widely used approach to study quantitative and qualitative aspects of transcriptome data. The variety of RNA-Seq protocols, experimental study designs and the characteristic properties of the organisms under investigation greatly affect downstream and comparative analyses. In this review, we aim to explain the impact of structured pre-selection, classification and integration of best-performing tools within modularized data analysis workflows and ready-to-use computing infrastructures towards experimental data analyses. We highlight examples for workflows and use cases that are presented for pro-, eukaryotic and mixed dual RNA-Seq (meta-transcriptomics) experiments. In addition, we are summarizing the expertise of the laboratories participating in the project consortium "Structured Analysis and Integration of RNA-Seq experiments" (de.STAIR) and its integration with the Galaxy-workbench of the RNA Bioinformatics Center (RBC). Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

A multiplexed miRNA and transgene expression platform for simultaneous repression and expression of protein coding sequences.

Science.gov (United States)

Seyhan, Attila A

2016-01-01

Knockdown of single or multiple gene targets by RNA interference (RNAi) is necessary to overcome escape mutants or isoform redundancy. It is also necessary to use multiple RNAi reagents to knockdown multiple targets. It is also desirable to express a transgene or positive regulatory elements and inhibit a target gene in a coordinated fashion. This study reports a flexible multiplexed RNAi and transgene platform using endogenous intronic primary microRNAs (pri-miRNAs) as a scaffold located in the green fluorescent protein (GFP) as a model for any functional transgene. The multiplexed intronic miRNA - GFP transgene platform was designed to co-express multiple small RNAs within the polycistronic cluster from a Pol II promoter at more moderate levels to reduce potential vector toxicity. The native intronic miRNAs are co-transcribed with a precursor GFP mRNA as a single transcript and presumably cleaved out of the precursor-(pre) mRNA by the RNA splicing machinery, spliceosome. The spliced intron with miRNA hairpins will be further processed into mature miRNAs or small interfering RNAs (siRNAs) capable of triggering RNAi effects, while the ligated exons become a mature messenger RNA for the translation of the functional GFP protein. Data show that this approach led to robust RNAi-mediated silencing of multiple Renilla Luciferase (R-Luc)-tagged target genes and coordinated expression of functional GFP from a single transcript in transiently transfected HeLa cells. The results demonstrated that this design facilitates the coordinated expression of all mature miRNAs either as individual miRNAs or as multiple miRNAs and the associated protein. The data suggest that, it is possible to simultaneously deliver multiple negative (miRNA or shRNA) and positive (transgene) regulatory elements. Because many cellular processes require simultaneous repression and activation of downstream pathways, this approach offers a platform technology to achieve that dual manipulation efficiently

NSun2-Mediated Cytosine-5 Methylation of Vault Noncoding RNA Determines Its Processing into Regulatory Small RNAs

Directory of Open Access Journals (Sweden)

Shobbir Hussain

2013-07-01

Full Text Available Autosomal-recessive loss of the NSUN2 gene has been identified as a causative link to intellectual disability disorders in humans. NSun2 is an RNA methyltransferase modifying cytosine-5 in transfer RNAs (tRNAs, yet the identification of cytosine methylation in other RNA species has been hampered by the lack of sensitive and reliable molecular techniques. Here, we describe miCLIP as an additional approach for identifying RNA methylation sites in transcriptomes. miCLIP is a customized version of the individual-nucleotide-resolution crosslinking and immunoprecipitation (iCLIP method. We confirm site-specific methylation in tRNAs and additional messenger and noncoding RNAs (ncRNAs. Among these, vault ncRNAs contained six NSun2-methylated cytosines, three of which were confirmed by RNA bisulfite sequencing. Using patient cells lacking the NSun2 protein, we further show that loss of cytosine-5 methylation in vault RNAs causes aberrant processing into Argonaute-associated small RNA fragments that can function as microRNAs. Thus, impaired processing of vault ncRNA may contribute to the etiology of NSun2-deficiency human disorders.

DNA sequencing reveals limited heterogeneity in the 16S rRNA gene from the rrnB operon among five Mycoplasma hominis isolates

DEFF Research Database (Denmark)

Mygind, T; Birkelund, Svend; Christiansen, Gunna

1998-01-01

To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...... by PCR and the PCR products were sequenced. Three isolates had identical 16S rRNA sequences and two isolates had sequences that differed from the others by only one nucleotide....

Quantitative correlation between promoter methylation and messenger RNA levels of the reduced folate carrier

Directory of Open Access Journals (Sweden)

Kheradpour Albert

2008-05-01

Full Text Available Abstract Background Methotrexate (MTX uptake is mediated by the reduced folate carrier (RFC. Defective drug uptake in association with decreased RFC expression is a common mechanism of MTX resistance in many tumor types. Heavy promoter methylation was previously identified as a basis for the complete silencing of RFC in MDA-MB-231 breast cancer cells, its role and prevalence in RFC transcription regulation are, however, not widely studied. Methods In the current study, RFC promoter methylation was assessed using methylation specific PCR in a panel of malignant cell lines (n = 8, including MDA-MB-231, and M805, a MTX resistant cell line directly established from the specimen of a patient with malignant fibrohistocytoma, whom received multiple doses of MTX. A quantitative approach of real-time PCR for measuring the extent of RFC promoter methylation was developed, and was validated by direct bisulfite genomic sequencing. RFC mRNA levels were determined by quantitative real-time RT-PCR and were related to the extent of promoter methylation in these cell lines. Results A partial promoter methylation and RFC mRNA down-regulation were observed in M805. Using the quantitative approach, a reverse correlation (correlation coefficient = -0.59, p Conclusion This study further suggests that promoter methylation is a potential basis for MTX resistance. The quantitative correlation identified in this study implies that promoter methylation is possibly a mechanism involved in the fine regulation of RFC transcription.

Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing.

Science.gov (United States)

Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li

2010-08-01

Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resolution and sensitivity afforded by RNA-Seq, we were able to identify a substantial number of novel transcripts, new exons, untranslated regions, alternative upstream initiation codons and upstream open reading frames, which provide remarkable insight into the A. oryzae transcriptome. We were also able to assess the alternative mRNA isoforms in A. oryzae and found a large number of genes undergoing alternative splicing. Many genes and pathways that might be involved in higher levels of protein production in solid-state culture than in liquid culture were identified by comparing gene expression levels between different cultures. Our analysis indicated that the transcriptome of A. oryzae is much more complex than previously anticipated, and these results may provide a blueprint for further study of the A. oryzae transcriptome.

Mathematical and Biological Modelling of RNA Secondary Structure and Its Effects on Gene Expression

Directory of Open Access Journals (Sweden)

T. A. Hughes

2006-01-01

Full Text Available Secondary structures within the 5′ untranslated regions of messenger RNAs can have profound effects on the efficiency of translation of their messages and thereby on gene expression. Consequently they can act as important regulatory motifs in both physiological and pathological settings. Current approaches to predicting the secondary structure of these RNA sequences find the structure with the global-minimum free energy. However, since RNA folds progressively from the 5′ end when synthesised or released from the translational machinery, this may not be the most probable structure. We discuss secondary structure prediction based on local-minimisation of free energy with thermodynamic fluctuations as nucleotides are added to the 3′ end and show that these can result in different secondary structures. We also discuss approaches for studying the extent of the translational inhibition specified by structures within the 5′ untranslated region.

RNA Sequencing and Bioinformatics Analysis Implicate the Regulatory Role of a Long Noncoding RNA-mRNA Network in Hepatic Stellate Cell Activation.

Science.gov (United States)

Guo, Can-Jie; Xiao, Xiao; Sheng, Li; Chen, Lili; Zhong, Wei; Li, Hai; Hua, Jing; Ma, Xiong

2017-01-01

To analyze the long noncoding (lncRNA)-mRNA expression network and potential roles in rat hepatic stellate cells (HSCs) during activation. LncRNA expression was analyzed in quiescent and culture-activated HSCs by RNA sequencing, and differentially expressed lncRNAs verified by quantitative reverse transcription polymerase chain reaction (qRT-PCR) were subjected to bioinformatics analysis. In vivo analyses of differential lncRNA-mRNA expression were performed on a rat model of liver fibrosis. We identified upregulation of 12 lncRNAs and 155 mRNAs and downregulation of 12 lncRNAs and 374 mRNAs in activated HSCs. Additionally, we identified the differential expression of upregulated lncRNAs (NONRATT012636.2, NONRATT016788.2, and NONRATT021402.2) and downregulated lncRNAs (NONRATT007863.2, NONRATT019720.2, and NONRATT024061.2) in activated HSCs relative to levels observed in quiescent HSCs, and Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses showed that changes in lncRNAs associated with HSC activation revealed 11 significantly enriched pathways according to their predicted targets. Moreover, based on the predicted co-expression network, the relative dynamic levels of NONRATT013819.2 and lysyl oxidase (Lox) were compared during HSC activation both in vitro and in vivo. Our results confirmed the upregulation of lncRNA NONRATT013819.2 and Lox mRNA associated with the extracellular matrix (ECM)-related signaling pathway in HSCs and fibrotic livers. Our results detailing a dysregulated lncRNA-mRNA network might provide new treatment strategies for hepatic fibrosis based on findings indicating potentially critical roles for NONRATT013819.2 and Lox in ECM remodeling during HSC activation. © 2017 The Author(s). Published by S. Karger AG, Basel.

Capturing microRNA targets using an RNA-induced silencing complex (RISC)-trap approach.

Science.gov (United States)

Cambronne, Xiaolu A; Shen, Rongkun; Auer, Paul L; Goodman, Richard H

2012-12-11

Identifying targets is critical for understanding the biological effects of microRNA (miRNA) expression. The challenge lies in characterizing the cohort of targets for a specific miRNA, especially when targets are being actively down-regulated in miRNA- RNA-induced silencing complex (RISC)-messengerRNA (mRNA) complexes. We have developed a robust and versatile strategy called RISCtrap to stabilize and purify targets from this transient interaction. Its utility was demonstrated by determining specific high-confidence target datasets for miR-124, miR-132, and miR-181 that contained known and previously unknown transcripts. Two previously unknown miR-132 targets identified with RISCtrap, adaptor protein CT10 regulator of kinase 1 (CRK1) and tight junction-associated protein 1 (TJAP1), were shown to be endogenously regulated by miR-132 in adult mouse forebrain. The datasets, moreover, differed in the number of targets and in the types and frequency of microRNA recognition element (MRE) motifs, thus revealing a previously underappreciated level of specificity in the target sets regulated by individual miRNAs.

Quartz-Seq2: a high-throughput single-cell RNA-sequencing method that effectively uses limited sequence reads.

Science.gov (United States)

Sasagawa, Yohei; Danno, Hiroki; Takada, Hitomi; Ebisawa, Masashi; Tanaka, Kaori; Hayashi, Tetsutaro; Kurisaki, Akira; Nikaido, Itoshi

2018-03-09

High-throughput single-cell RNA-seq methods assign limited unique molecular identifier (UMI) counts as gene expression values to single cells from shallow sequence reads and detect limited gene counts. We thus developed a high-throughput single-cell RNA-seq method, Quartz-Seq2, to overcome these issues. Our improvements in the reaction steps make it possible to effectively convert initial reads to UMI counts, at a rate of 30-50%, and detect more genes. To demonstrate the power of Quartz-Seq2, we analyzed approximately 10,000 transcriptomes from in vitro embryonic stem cells and an in vivo stromal vascular fraction with a limited number of reads.

Simultaneous sequencing of coding and noncoding RNA reveals a human transcriptome dominated by a small number of highly expressed noncoding genes.

Science.gov (United States)

Boivin, Vincent; Deschamps-Francoeur, Gabrielle; Couture, Sonia; Nottingham, Ryan M; Bouchard-Bourelle, Philia; Lambowitz, Alan M; Scott, Michelle S; Abou-Elela, Sherif

2018-07-01

Comparing the abundance of one RNA molecule to another is crucial for understanding cellular functions but most sequencing techniques can target only specific subsets of RNA. In this study, we used a new fragmented ribodepleted TGIRT sequencing method that uses a thermostable group II intron reverse transcriptase (TGIRT) to generate a portrait of the human transcriptome depicting the quantitative relationship of all classes of nonribosomal RNA longer than 60 nt. Comparison between different sequencing methods indicated that FRT is more accurate in ranking both mRNA and noncoding RNA than viral reverse transcriptase-based sequencing methods, even those that specifically target these species. Measurements of RNA abundance in different cell lines using this method correlate with biochemical estimates, confirming tRNA as the most abundant nonribosomal RNA biotype. However, the single most abundant transcript is 7SL RNA, a component of the signal recognition particle. S tructured n on c oding RNAs (sncRNAs) associated with the same biological process are expressed at similar levels, with the exception of RNAs with multiple functions like U1 snRNA. In general, sncRNAs forming RNPs are hundreds to thousands of times more abundant than their mRNA counterparts. Surprisingly, only 50 sncRNA genes produce half of the non-rRNA transcripts detected in two different cell lines. Together the results indicate that the human transcriptome is dominated by a small number of highly expressed sncRNAs specializing in functions related to translation and splicing. © 2018 Boivin et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

SHARAKU: an algorithm for aligning and clustering read mapping profiles of deep sequencing in non-coding RNA processing.

Science.gov (United States)

Tsuchiya, Mariko; Amano, Kojiro; Abe, Masaya; Seki, Misato; Hase, Sumitaka; Sato, Kengo; Sakakibara, Yasubumi

2016-06-15

Deep sequencing of the transcripts of regulatory non-coding RNA generates footprints of post-transcriptional processes. After obtaining sequence reads, the short reads are mapped to a reference genome, and specific mapping patterns can be detected called read mapping profiles, which are distinct from random non-functional degradation patterns. These patterns reflect the maturation processes that lead to the production of shorter RNA sequences. Recent next-generation sequencing studies have revealed not only the typical maturation process of miRNAs but also the various processing mechanisms of small RNAs derived from tRNAs and snoRNAs. We developed an algorithm termed SHARAKU to align two read mapping profiles of next-generation sequencing outputs for non-coding RNAs. In contrast with previous work, SHARAKU incorporates the primary and secondary sequence structures into an alignment of read mapping profiles to allow for the detection of common processing patterns. Using a benchmark simulated dataset, SHARAKU exhibited superior performance to previous methods for correctly clustering the read mapping profiles with respect to 5'-end processing and 3'-end processing from degradation patterns and in detecting similar processing patterns in deriving the shorter RNAs. Further, using experimental data of small RNA sequencing for the common marmoset brain, SHARAKU succeeded in identifying the significant clusters of read mapping profiles for similar processing patterns of small derived RNA families expressed in the brain. The source code of our program SHARAKU is available at http://www.dna.bio.keio.ac.jp/sharaku/, and the simulated dataset used in this work is available at the same link. Accession code: The sequence data from the whole RNA transcripts in the hippocampus of the left brain used in this work is available from the DNA DataBank of Japan (DDBJ) Sequence Read Archive (DRA) under the accession number DRA004502. yasu@bio.keio.ac.jp Supplementary data are available

Rtools: a web server for various secondary structural analyses on single RNA sequences.

Science.gov (United States)

Hamada, Michiaki; Ono, Yukiteru; Kiryu, Hisanori; Sato, Kengo; Kato, Yuki; Fukunaga, Tsukasa; Mori, Ryota; Asai, Kiyoshi

2016-07-08

The secondary structures, as well as the nucleotide sequences, are the important features of RNA molecules to characterize their functions. According to the thermodynamic model, however, the probability of any secondary structure is very small. As a consequence, any tool to predict the secondary structures of RNAs has limited accuracy. On the other hand, there are a few tools to compensate the imperfect predictions by calculating and visualizing the secondary structural information from RNA sequences. It is desirable to obtain the rich information from those tools through a friendly interface. We implemented a web server of the tools to predict secondary structures and to calculate various structural features based on the energy models of secondary structures. By just giving an RNA sequence to the web server, the user can get the different types of solutions of the secondary structures, the marginal probabilities such as base-paring probabilities, loop probabilities and accessibilities of the local bases, the energy changes by arbitrary base mutations as well as the measures for validations of the predicted secondary structures. The web server is available at http://rtools.cbrc.jp, which integrates software tools, CentroidFold, CentroidHomfold, IPKnot, CapR, Raccess, Rchange and RintD. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Messenger Observations of Mercury's Bow Shock and Magnetopause

Science.gov (United States)

Slavin J. A.; Acuna, M. H.; Anderson, B. J.; Benna, M.; Gloeckler, G.; Krimigis, S. M.; Raines, M.; Schriver, D.; Travnicek, P.; Zurbuchen, T. H.

2008-01-01

The MESSENGER spacecraft made the first of three flybys of Mercury on January 14.2008 (1). New observations of solar wind interaction with Mercury were made with MESSENGER'S Magnetometer (MAG) (2.3) and Energetic Particle and Plasma Spectrometer (EPPS) - composed of the Energetic Particle Spectrometer (EPS) and Fast Imaging Plasma Spectrometer (FIPS) (3,4). These MESSENGER observations show that Mercury's magnetosphere has a large-scale structure that is distinctly Earth-like, but it is immersed in a comet-like cloud of planetary ions [5]. Fig. 1 provides a schematic view of the coupled solar wind - magnetosphere - neutral atmosphere - solid planet system at Mercury.

Gold nanoparticle-based beacon to detect STAT5b mRNA expression in living cells: a case optimized by bioinformatics screen.

Science.gov (United States)

Deng, Dawei; Li, Yang; Xue, Jianpeng; Wang, Jie; Ai, Guanhua; Li, Xin; Gu, Yueqing

2015-01-01

Messenger RNA (mRNA), a single-strand ribonucleic acid with functional gene information is usually abnormally expressed in cancer cells and has become a promising biomarker for the study of tumor progress. Hairpin DNA-coated gold nanoparticle (hDAuNP) beacon containing a bare gold nanoparticle (AuNP) as fluorescence quencher and thiol-terminated fluorescently labeled stem-loop-stem oligonucleotide sequences attached by Au-S bond is currently a new nanoscale biodiagnostic platform capable of mRNA detection, in which the design of the loop region sequence is crucial for hybridizing with the target mRNA. Hence, in this study, to improve the sensitivity and selectivity of hDAuNP beacon simultaneously, the loop region of hairpin DNA was screened by bioinformatics strategy. Here, signal transducer and activator of transcription 5b (STAT5b) mRNA was selected and used as a practical example. The results from the combined characterizations using optical techniques, flow cytometry assay, and cell microscopic imaging showed that after optimization, the as-prepared hDAuNP beacon had higher selectivity and sensitivity for the detection of STAT5b mRNA in living cells, as compared with our previous beacon. Thus, the bioinformatics method may be a promising new strategy for assisting in the designing of the hDAuNP beacon, extending its application in the detection of mRNA expression and the resultant mRNA-based biological processes and disease pathogenesis.

Deep sequencing of Salmonella RNA associated with heterologous Hfq proteins in vivo reveals small RNAs as a major target class and identifies RNA processing phenotypes.

Science.gov (United States)

Sittka, Alexandra; Sharma, Cynthia M; Rolle, Katarzyna; Vogel, Jörg

2009-01-01

The bacterial Sm-like protein, Hfq, is a key factor for the stability and function of small non-coding RNAs (sRNAs) in Escherichia coli. Homologues of this protein have been predicted in many distantly related organisms yet their functional conservation as sRNA-binding proteins has not entirely been clear. To address this, we expressed in Salmonella the Hfq proteins of two eubacteria (Neisseria meningitides, Aquifex aeolicus) and an archaeon (Methanocaldococcus jannaschii), and analyzed the associated RNA by deep sequencing. This in vivo approach identified endogenous Salmonella sRNAs as a major target of the foreign Hfq proteins. New Salmonella sRNA species were also identified, and some of these accumulated specifically in the presence of a foreign Hfq protein. In addition, we observed specific RNA processing defects, e.g., suppression of precursor processing of SraH sRNA by Methanocaldococcus Hfq, or aberrant accumulation of extracytoplasmic target mRNAs of the Salmonella GcvB, MicA or RybB sRNAs. Taken together, our study provides evidence of a conserved inherent sRNA-binding property of Hfq, which may facilitate the lateral transmission of regulatory sRNAs among distantly related species. It also suggests that the expression of heterologous RNA-binding proteins combined with deep sequencing analysis of RNA ligands can be used as a molecular tool to dissect individual steps of RNA metabolism in vivo.

Bacterial nucleotide-based second messengers.

Science.gov (United States)

Pesavento, Christina; Hengge, Regine

2009-04-01

In all domains of life nucleotide-based second messengers transduce signals originating from changes in the environment or in intracellular conditions into appropriate cellular responses. In prokaryotes cyclic di-GMP has emerged as an important and ubiquitous second messenger regulating bacterial life-style transitions relevant for biofilm formation, virulence, and many other bacterial functions. This review describes similarities and differences in the architecture of the cAMP, (p)ppGpp, and c-di-GMP signaling systems and their underlying signaling principles. Moreover, recent advances in c-di-GMP-mediated signaling will be presented and the integration of c-di-GMP signaling with other nucleotide-based signaling systems will be discussed.

The hormone response element mimic sequence of GAS5 lncRNA is sufficient to induce apoptosis in breast cancer cells

Science.gov (United States)

Pickard, Mark R.; Williams, Gwyn T.

2016-01-01

Growth arrest-specific 5 (GAS5) lncRNA promotes apoptosis, and its expression is down-regulated in breast cancer. GAS5 lncRNA is a decoy of glucocorticoid/related receptors; a stem-loop sequence constitutes the GAS5 hormone response element mimic (HREM), which is essential for the regulation of breast cancer cell apoptosis. This preclinical study aimed to determine if the GAS5 HREM sequence alone promotes the apoptosis of breast cancer cells. Nucleofection of hormone-sensitive and –insensitive breast cancer cell lines with a GAS5 HREM DNA oligonucleotide increased both basal and ultraviolet-C-induced apoptosis, and decreased culture viability and clonogenic growth, similar to GAS5 lncRNA. The HREM oligonucleotide demonstrated similar sequence specificity to the native HREM for its functional activity and had no effect on endogenous GAS5 lncRNA levels. Certain chemically modified HREM oligonucleotides, notably DNA and RNA phosphorothioates, retained pro-apoptotic. activity. Crucially the HREM oligonucleotide could overcome apoptosis resistance secondary to deficient endogenous GAS5 lncRNA levels. Thus, the GAS5 lncRNA HREM sequence alone is sufficient to induce apoptosis in breast cancer cells, including triple-negative breast cancer cells. These findings further suggest that emerging knowledge of structure/function relationships in the field of lncRNA biology can be exploited for the development of entirely novel, oligonucleotide mimic-based, cancer therapies. PMID:26862727

Efficient RNA extraction protocol for the wood mangrove species Laguncularia racemosa suited for next-generation RNA sequencing

International Nuclear Information System (INIS)

Wilwerth, M. W.; Rossetto, P.

2016-01-01

Mangrove flora and habitat have immeasurable importance in marine and coastal ecology as well as in the economy. Despite their importance, they are constantly threatened by oil spill accidents and environmental contamination; therefore, it is crucial to understand the changes in gene expression to better predict toxicity in these plants. Among the species of Atlantic coast mangrove (Americas and Africa), Laguncularia racemosa, or white mangrove, is a conspicuous species. The wide distribution of L. racemosa in areas where marine oil exploration is rapidly increasing make it a candidate mangrove species model to uncover the impact of oil spills at the molecular level with the use of massive transcriptome sequencing. However, for this purpose, the RNA extraction protocol should ensure low levels of contaminants and structure integrity. In this study, eight RNA extraction methods were tested and analysed using downstream applications. The InviTrap Spin Plant RNA Mini Kit performed best with regard to purity and integrity. Moreover, the obtained RNA was submitted to cDNA synthesis and RT-PCR, successfully generating amplification products of the expected size. These Results show the applicability of the RNA obtained here for downstream methodologies, such as the construction of cDNA libraries for the Illumina Hi-seq platform. (author)

The nucleotide sequence of the RNA-2 of an isolate of the English serotype of tomato black ring virus: RNA recombination in the history of nepoviruses.

Science.gov (United States)

Le Gall, O L; Lanneau, M; Candresse, T; Dunez, J

1995-05-01

The RNA-2 of a carrot isolate from the English serotype of tomato black ring nepovirus (TBRV-ED) has been sequenced. It is 4618 nucleotides long and contains one open reading frame encoding a polypeptide of 1344 amino acids. The 5' non-coding region contains three repetitions of a stem-loop structure also conserved in TBRV-Scottish and grapevine chrome mosaic nepovirus (GCMV). The coat protein domain was mapped to the carboxy-terminal one-third of the polyprotein. Sequence comparisons indicate that TBRV-ED RNA-2 probably arose by an RNA recombination event that resulted in the exchange of the putative movement protein gene between TBRV and GCMV.

Non-codingRNA sequence variations in human chronic lymphocytic leukemia and colorectal cancer.

Science.gov (United States)

Wojcik, Sylwia E; Rossi, Simona; Shimizu, Masayoshi; Nicoloso, Milena S; Cimmino, Amelia; Alder, Hansjuerg; Herlea, Vlad; Rassenti, Laura Z; Rai, Kanti R; Kipps, Thomas J; Keating, Michael J; Croce, Carlo M; Calin, George A

2010-02-01

Cancer is a genetic disease in which the interplay between alterations in protein-coding genes and non-coding RNAs (ncRNAs) plays a fundamental role. In recent years, the full coding component of the human genome was sequenced in various cancers, whereas such attempts related to ncRNAs are still fragmentary. We screened genomic DNAs for sequence variations in 148 microRNAs (miRNAs) and ultraconserved regions (UCRs) loci in patients with chronic lymphocytic leukemia (CLL) or colorectal cancer (CRC) by Sanger technique and further tried to elucidate the functional consequences of some of these variations. We found sequence variations in miRNAs in both sporadic and familial CLL cases, mutations of UCRs in CLLs and CRCs and, in certain instances, detected functional effects of these variations. Furthermore, by integrating our data with previously published data on miRNA sequence variations, we have created a catalog of DNA sequence variations in miRNAs/ultraconserved genes in human cancers. These findings argue that ncRNAs are targeted by both germ line and somatic mutations as well as by single-nucleotide polymorphisms with functional significance for human tumorigenesis. Sequence variations in ncRNA loci are frequent and some have functional and biological significance. Such information can be exploited to further investigate on a genome-wide scale the frequency of genetic variations in ncRNAs and their functional meaning, as well as for the development of new diagnostic and prognostic markers for leukemias and carcinomas.

A comprehensive evaluation of the sl1p pipeline for 16S rRNA gene sequencing analysis.

Science.gov (United States)

Whelan, Fiona J; Surette, Michael G

2017-08-14

Advances in next-generation sequencing technologies have allowed for detailed, molecular-based studies of microbial communities such as the human gut, soil, and ocean waters. Sequencing of the 16S rRNA gene, specific to prokaryotes, using universal PCR primers has become a common approach to studying the composition of these microbiota. However, the bioinformatic processing of the resulting millions of DNA sequences can be challenging, and a standardized protocol would aid in reproducible analyses. The short-read library 16S rRNA gene sequencing pipeline (sl1p, pronounced "slip") was designed with the purpose of mitigating this lack of reproducibility by combining pre-existing tools into a computational pipeline. This pipeline automates the processing of raw 16S rRNA gene sequencing data to create human-readable tables, graphs, and figures to make the collected data more readily accessible. Data generated from mock communities were compared using eight OTU clustering algorithms, two taxon assignment approaches, and three 16S rRNA gene reference databases. While all of these algorithms and options are available to sl1p users, through testing with human-associated mock communities, AbundantOTU+, the RDP Classifier, and the Greengenes 2011 reference database were chosen as sl1p's defaults based on their ability to best represent the known input communities. sl1p promotes reproducible research by providing a comprehensive log file, and reduces the computational knowledge needed by the user to process next-generation sequencing data. sl1p is freely available at https://bitbucket.org/fwhelan/sl1p .

RNA-Mediated Gene Duplication and Retroposons: Retrogenes, LINEs, SINEs, and Sequence Specificity

Science.gov (United States)

2013-01-01

A substantial number of “retrogenes” that are derived from the mRNA of various intron-containing genes have been reported. A class of mammalian retroposons, long interspersed element-1 (LINE1, L1), has been shown to be involved in the reverse transcription of retrogenes (or processed pseudogenes) and non-autonomous short interspersed elements (SINEs). The 3′-end sequences of various SINEs originated from a corresponding LINE. As the 3′-untranslated regions of several LINEs are essential for retroposition, these LINEs presumably require “stringent” recognition of the 3′-end sequence of the RNA template. However, the 3′-ends of mammalian L1s do not exhibit any similarity to SINEs, except for the presence of 3′-poly(A) repeats. Since the 3′-poly(A) repeats of L1 and Alu SINE are critical for their retroposition, L1 probably recognizes the poly(A) repeats, thereby mobilizing not only Alu SINE but also cytosolic mRNA. Many flowering plants only harbor L1-clade LINEs and a significant number of SINEs with poly(A) repeats, but no homology to the LINEs. Moreover, processed pseudogenes have also been found in flowering plants. I propose that the ancestral L1-clade LINE in the common ancestor of green plants may have recognized a specific RNA template, with stringent recognition then becoming relaxed during the course of plant evolution. PMID:23984183

Body fluid identification of blood, saliva and semen using second generation sequencing of micro-RNA

DEFF Research Database (Denmark)

Petersen, Christel H.; Hjort, Benjamin Benn; Tvedebrink, Torben

2013-01-01

We report a new second generation sequencing method for identification micro-RNA (miRNA) that can be used to identify body fluids and tissues. Principal component analysis of 10 miRNAs with high expression in 16 samples of blood, saliva and semen showed clear differences in the expression of mi...

RNA deep sequencing reveals differential microRNA expression during development of sea urchin and sea star.

Directory of Open Access Journals (Sweden)

Sabah Kadri

Full Text Available microRNAs (miRNAs are small (20-23 nt, non-coding single stranded RNA molecules that act as post-transcriptional regulators of mRNA gene expression. They have been implicated in regulation of developmental processes in diverse organisms. The echinoderms, Strongylocentrotus purpuratus (sea urchin and Patiria miniata (sea star are excellent model organisms for studying development with well-characterized transcriptional networks. However, to date, nothing is known about the role of miRNAs during development in these organisms, except that the genes that are involved in the miRNA biogenesis pathway are expressed during their developmental stages. In this paper, we used Illumina Genome Analyzer (Illumina, Inc. to sequence small RNA libraries in mixed stage population of embryos from one to three days after fertilization of sea urchin and sea star (total of 22,670,000 reads. Analysis of these data revealed the miRNA populations in these two species. We found that 47 and 38 known miRNAs are expressed in sea urchin and sea star, respectively, during early development (32 in common. We also found 13 potentially novel miRNAs in the sea urchin embryonic library. miRNA expression is generally conserved between the two species during development, but 7 miRNAs are highly expressed in only one species. We expect that our two datasets will be a valuable resource for everyone working in the field of developmental biology and the regulatory networks that affect it. The computational pipeline to analyze Illumina reads is available at http://www.benoslab.pitt.edu/services.html.

RNA Deep Sequencing Reveals Differential MicroRNA Expression during Development of Sea Urchin and Sea Star

Science.gov (United States)

Kadri, Sabah; Hinman, Veronica F.; Benos, Panayiotis V.

2011-01-01

microRNAs (miRNAs) are small (20–23 nt), non-coding single stranded RNA molecules that act as post-transcriptional regulators of mRNA gene expression. They have been implicated in regulation of developmental processes in diverse organisms. The echinoderms, Strongylocentrotus purpuratus (sea urchin) and Patiria miniata (sea star) are excellent model organisms for studying development with well-characterized transcriptional networks. However, to date, nothing is known about the role of miRNAs during development in these organisms, except that the genes that are involved in the miRNA biogenesis pathway are expressed during their developmental stages. In this paper, we used Illumina Genome Analyzer (Illumina, Inc.) to sequence small RNA libraries in mixed stage population of embryos from one to three days after fertilization of sea urchin and sea star (total of 22,670,000 reads). Analysis of these data revealed the miRNA populations in these two species. We found that 47 and 38 known miRNAs are expressed in sea urchin and sea star, respectively, during early development (32 in common). We also found 13 potentially novel miRNAs in the sea urchin embryonic library. miRNA expression is generally conserved between the two species during development, but 7 miRNAs are highly expressed in only one species. We expect that our two datasets will be a valuable resource for everyone working in the field of developmental biology and the regulatory networks that affect it. The computational pipeline to analyze Illumina reads is available at http://www.benoslab.pitt.edu/services.html. PMID:22216218

Cosmic Microwave Background Mapmaking with a Messenger Field

Science.gov (United States)

Huffenberger, Kevin M.; Næss, Sigurd K.

2018-01-01

We apply a messenger field method to solve the linear minimum-variance mapmaking equation in the context of Cosmic Microwave Background (CMB) observations. In simulations, the method produces sky maps that converge significantly faster than those from a conjugate gradient descent algorithm with a diagonal preconditioner, even though the computational cost per iteration is similar. The messenger method recovers large scales in the map better than conjugate gradient descent, and yields a lower overall χ2. In the single, pencil beam approximation, each iteration of the messenger mapmaking procedure produces an unbiased map, and the iterations become more optimal as they proceed. A variant of the method can handle differential data or perform deconvolution mapmaking. The messenger method requires no preconditioner, but a high-quality solution needs a cooling parameter to control the convergence. We study the convergence properties of this new method and discuss how the algorithm is feasible for the large data sets of current and future CMB experiments.

Analysis of microRNA profile of Anopheles sinensis by deep sequencing and bioinformatic approaches.

Science.gov (United States)

Feng, Xinyu; Zhou, Xiaojian; Zhou, Shuisen; Wang, Jingwen; Hu, Wei

2018-03-12

microRNAs (miRNAs) are small non-coding RNAs widely identified in many mosquitoes. They are reported to play important roles in development, differentiation and innate immunity. However, miRNAs in Anopheles sinensis, one of the Chinese malaria mosquitoes, remain largely unknown. We investigated the global miRNA expression profile of An. sinensis using Illumina Hiseq 2000 sequencing. Meanwhile, we applied a bioinformatic approach to identify potential miRNAs in An. sinensis. The identified miRNA profiles were compared and analyzed by two approaches. The selected miRNAs from the sequencing result and the bioinformatic approach were confirmed with qRT-PCR. Moreover, target prediction, GO annotation and pathway analysis were carried out to understand the role of miRNAs in An. sinensis. We identified 49 conserved miRNAs and 12 novel miRNAs by next-generation high-throughput sequencing technology. In contrast, 43 miRNAs were predicted by the bioinformatic approach, of which two were assigned as novel. Comparative analysis of miRNA profiles by two approaches showed that 21 miRNAs were shared between them. Twelve novel miRNAs did not match any known miRNAs of any organism, indicating that they are possibly species-specific. Forty miRNAs were found in many mosquito species, indicating that these miRNAs are evolutionally conserved and may have critical roles in the process of life. Both the selected known and novel miRNAs (asi-miR-281, asi-miR-184, asi-miR-14, asi-miR-nov5, asi-miR-nov4, asi-miR-9383, and asi-miR-2a) could be detected by quantitative real-time PCR (qRT-PCR) in the sequenced sample, and the expression patterns of these miRNAs measured by qRT-PCR were in concordance with the original miRNA sequencing data. The predicted targets for the known and the novel miRNAs covered many important biological roles and pathways indicating the diversity of miRNA functions. We also found 21 conserved miRNAs and eight counterparts of target immune pathway genes in An. sinensis

The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

International Nuclear Information System (INIS)

Nuc, K.; Nuc, P.; Pawelkiewicz, J.

1993-01-01

We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

The PETfold and PETcofold web servers for intra- and intermolecular structures of multiple RNA sequences

DEFF Research Database (Denmark)

Seemann, Ernst Stefan; Menzel, Karl Peter; Backofen, Rolf

2011-01-01

gene. We present web servers to analyze multiple RNA sequences for common RNA structure and for RNA interaction sites. The web servers are based on the recent PET (Probabilistic Evolutionary and Thermodynamic) models PETfold and PETcofold, but add user friendly features ranging from a graphical layer...... to interactive usage of the predictors. Additionally, the web servers provide direct access to annotated RNA alignments, such as the Rfam 10.0 database and multiple alignments of 16 vertebrate genomes with human. The web servers are freely available at: http://rth.dk/resources/petfold/...

Massively parallel sequencing, aCGH, and RNA-Seq technologies provide a comprehensive molecular diagnosis of Fanconi anemia.

Science.gov (United States)

Chandrasekharappa, Settara C; Lach, Francis P; Kimble, Danielle C; Kamat, Aparna; Teer, Jamie K; Donovan, Frank X; Flynn, Elizabeth; Sen, Shurjo K; Thongthip, Supawat; Sanborn, Erica; Smogorzewska, Agata; Auerbach, Arleen D; Ostrander, Elaine A

2013-05-30

Current methods for detecting mutations in Fanconi anemia (FA)-suspected patients are inefficient and often miss mutations. We have applied recent advances in DNA sequencing and genomic capture to the diagnosis of FA. Specifically, we used custom molecular inversion probes or TruSeq-enrichment oligos to capture and sequence FA and related genes, including introns, from 27 samples from the International Fanconi Anemia Registry at The Rockefeller University. DNA sequencing was complemented with custom array comparative genomic hybridization (aCGH) and RNA sequencing (RNA-seq) analysis. aCGH identified deletions/duplications in 4 different FA genes. RNA-seq analysis revealed lack of allele specific expression associated with a deletion and splicing defects caused by missense, synonymous, and deep-in-intron variants. The combination of TruSeq-targeted capture, aCGH, and RNA-seq enabled us to identify the complementation group and biallelic germline mutations in all 27 families: FANCA (7), FANCB (3), FANCC (3), FANCD1 (1), FANCD2 (3), FANCF (2), FANCG (2), FANCI (1), FANCJ (2), and FANCL (3). FANCC mutations are often the cause of FA in patients of Ashkenazi Jewish (AJ) ancestry, and we identified 2 novel FANCC mutations in 2 patients of AJ ancestry. We describe here a strategy for efficient molecular diagnosis of FA.

Fragile X Mental Retardation Protein and Dendritic Local Translation of the Alpha Subunit of the Calcium/Calmodulin-Dependent Kinase II Messenger RNA Are Required for the Structural Plasticity Underlying Olfactory Learning.

Science.gov (United States)

Daroles, Laura; Gribaudo, Simona; Doulazmi, Mohamed; Scotto-Lomassese, Sophie; Dubacq, Caroline; Mandairon, Nathalie; Greer, Charles August; Didier, Anne; Trembleau, Alain; Caillé, Isabelle

2016-07-15

In the adult brain, structural plasticity allowing gain or loss of synapses remodels circuits to support learning. In fragile X syndrome, the absence of fragile X mental retardation protein (FMRP) leads to defects in plasticity and learning deficits. FMRP is a master regulator of local translation but its implication in learning-induced structural plasticity is unknown. Using an olfactory learning task requiring adult-born olfactory bulb neurons and cell-specific ablation of FMRP, we investigated whether learning shapes adult-born neuron morphology during their synaptic integration and its dependence on FMRP. We used alpha subunit of the calcium/calmodulin-dependent kinase II (αCaMKII) mutant mice with altered dendritic localization of αCaMKII messenger RNA, as well as a reporter of αCaMKII local translation to investigate the role of this FMRP messenger RNA target in learning-dependent structural plasticity. Learning induces profound changes in dendritic architecture and spine morphology of adult-born neurons that are prevented by ablation of FMRP in adult-born neurons and rescued by an metabotropic glutamate receptor 5 antagonist. Moreover, dendritically translated αCaMKII is necessary for learning and associated structural modifications and learning triggers an FMRP-dependent increase of αCaMKII dendritic translation in adult-born neurons. Our results strongly suggest that FMRP mediates structural plasticity of olfactory bulb adult-born neurons to support olfactory learning through αCaMKII local translation. This reveals a new role for FMRP-regulated dendritic local translation in learning-induced structural plasticity. This might be of clinical relevance for the understanding of critical periods disruption in autism spectrum disorder patients, among which fragile X syndrome is the primary monogenic cause. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

A non-canonical landscape of the microRNA system

Directory of Open Access Journals (Sweden)

Gabriel Adelman Cipolla

2014-09-01

Full Text Available Microribonucleic acids, best known as microRNAs or miRNAs, are small, non-coding RNAs with important regulatory roles in eukaryotic cells. Here, I present a broad review about highly relevant but generally non-depicted features of miRNAs, among which stand out the non-conventional miRNA seed sites, the unusual messenger RNA (mRNA target regions, the non-canonical miRNA-guided mechanisms of gene expression regulation and the recently identified new class of miRNA ligands. Furthermore, I address the miRNA uncommon genomic location, transcription, and subcellular localization. Altogether, these unusual features and roles place the miRNA system as a very diverse, complex and intriguing biological mechanism.

Fluctuations in protein synthesis from a single RNA template: stochastic kinetics of ribosomes.

Science.gov (United States)

Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V

2009-01-01

Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them--namely, the dwell time distribution--has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.

3' end labelling of RNA with /sup 32/P suitable for rapid gel sequencing