WorldWideScience

Sample records for messenger rna sequences

  1. Messenger RNA biomarker signatures for forensic body fluid identification revealed by targeted RNA sequencing.

    Science.gov (United States)

    Hanson, E; Ingold, S; Haas, C; Ballantyne, J

    2018-05-01

    The recovery of a DNA profile from the perpetrator or victim in criminal investigations can provide valuable 'source level' information for investigators. However, a DNA profile does not reveal the circumstances by which biological material was transferred. Some contextual information can be obtained by a determination of the tissue or fluid source of origin of the biological material as it is potentially indicative of some behavioral activity on behalf of the individual that resulted in its transfer from the body. Here, we sought to improve upon established RNA based methods for body fluid identification by developing a targeted multiplexed next generation mRNA sequencing assay comprising a panel of approximately equal sized gene amplicons. The multiplexed biomarker panel includes several highly specific gene targets with the necessary specificity to definitively identify most forensically relevant biological fluids and tissues (blood, semen, saliva, vaginal secretions, menstrual blood and skin). In developing the biomarker panel we evaluated 66 gene targets, with a progressive iteration of testing target combinations that exhibited optimal sensitivity and specificity using a training set of forensically relevant body fluid samples. The current assay comprises 33 targets: 6 blood, 6 semen, 6 saliva, 4 vaginal secretions, 5 menstrual blood and 6 skin markers. We demonstrate the sensitivity and specificity of the assay and the ability to identify body fluids in single source and admixed stains. A 16 sample blind test was carried out by one lab with samples provided by the other participating lab. The blinded lab correctly identified the body fluids present in 15 of the samples with the major component identified in the 16th. Various classification methods are being investigated to permit inference of the body fluid/tissue in dried physiological stains. These include the percentage of reads in a sample that are due to each of the 6 tissues/body fluids tested and

  2. Appendix: a solution hybridization assay to detect radioactive globin messenger RNA nucleotide sequences

    Energy Technology Data Exchange (ETDEWEB)

    Ross, J

    1976-09-15

    In view of the sensitivity and specificity of the solution hybridization assay for unlabeled globin mRNA a similar technique has been devised to detect radioactive globin mRNA sequences with unlabeled globin cDNA. Several properties of the hybridization reaction are presented since RNA kinetic experiments reported recently depend on the validity of this assay. Data on hybridization analysis of (/sup 3/H)RNA from mouse fetal liver or erythroleukemia cell cytoplasm are presented. These data indicate that the excess cDNA solution assay for radioactive globin mRNA detection is specific for globin mRNA sequences. It can be performed rapidly and is highly reproducible from experiment. It is at least 500-fold less sensitive than the assay for unlabeled globin mRNA, due to the RNAase backgrounds of 0.05 to 0.15 %. However, this limitation has not affected kinetic experiments with non-dividing fetal liver erythroid cells, which synthesize relatively large quantities of globin mRNA.

  3. Nuclear Export of Messenger RNA

    Directory of Open Access Journals (Sweden)

    Jun Katahira

    2015-03-01

    Full Text Available Transport of messenger RNA (mRNA from the nucleus to the cytoplasm is an essential step of eukaryotic gene expression. In the cell nucleus, a precursor mRNA undergoes a series of processing steps, including capping at the 5' ends, splicing and cleavage/polyadenylation at the 3' ends. During this process, the mRNA associates with a wide variety of proteins, forming a messenger ribonucleoprotein (mRNP particle. Association with factors involved in nuclear export also occurs during transcription and processing, and thus nuclear export is fully integrated into mRNA maturation. The coupling between mRNA maturation and nuclear export is an important mechanism for providing only fully functional and competent mRNA to the cytoplasmic translational machinery, thereby ensuring accuracy and swiftness of gene expression. This review describes the molecular mechanism of nuclear mRNA export mediated by the principal transport factors, including Tap-p15 and the TREX complex.

  4. Nuclear Export of Messenger RNA

    Science.gov (United States)

    Katahira, Jun

    2015-01-01

    Transport of messenger RNA (mRNA) from the nucleus to the cytoplasm is an essential step of eukaryotic gene expression. In the cell nucleus, a precursor mRNA undergoes a series of processing steps, including capping at the 5' ends, splicing and cleavage/polyadenylation at the 3' ends. During this process, the mRNA associates with a wide variety of proteins, forming a messenger ribonucleoprotein (mRNP) particle. Association with factors involved in nuclear export also occurs during transcription and processing, and thus nuclear export is fully integrated into mRNA maturation. The coupling between mRNA maturation and nuclear export is an important mechanism for providing only fully functional and competent mRNA to the cytoplasmic translational machinery, thereby ensuring accuracy and swiftness of gene expression. This review describes the molecular mechanism of nuclear mRNA export mediated by the principal transport factors, including Tap-p15 and the TREX complex. PMID:25836925

  5. Radiation sensitivity of messenger RNA

    International Nuclear Information System (INIS)

    Ponta, H.; Pfennig-Yeh, M.L.; Herrlich, P.; Karlsruhe Univ.; Wagner, E.F.; Schweiger, M.

    1979-01-01

    Messenger RNA function is inactivated by irradiation with ultraviolet light. A unit length mRNA (in bases) is 2-3 times more sensitive than a unit length of DNA (in base pairs) with respect to the inactivation of template function. These data stem from four experimental systems all of which do not repair DNA: the translation of E. coli mRNA in rifampicin-treated cells, of T7 mRNA in infected E.coli, of f2 phage RNA in vivo, and of stable mRNA in chromosomeless minicells. The comparison of relative sensitivities to UV is relevant to the technique of UV mapping of transcription units which enjoys increasing popularity in pro- and eukaryotic genetic research. (orig.) [de

  6. Radiation sensitivity of messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Ponta, H; Pfennig-Yeh, M L; Herrlich, P [Kernforschungszentrum Karlsruhe G.m.b.H. (Germany, F.R.). Inst. fuer Genetik und Toxikologie von Spaltstoffen; Karlsruhe Univ. (TH) (Germany, F.R.). Inst. fuer Genetik); Wagner, E F; Schweiger, M [Innsbruck Univ. (Austria). Inst. fuer Biochemie

    1979-08-01

    Messenger RNA function is inactivated by irradiation with ultraviolet light. A unit length mRNA (in bases) is 2-3 times more sensitive than a unit length of DNA (in base pairs) with respect to the inactivation of template function. These data stem from four experimental systems all of which do not repair DNA: the translation of E. coli mRNA in rifampicin-treated cells, of T7 mRNA in infected E.coli, of f2 phage RNA in vivo, and of stable mRNA in chromosomeless minicells. The comparison of relative sensitivities to UV is relevant to the technique of UV mapping of transcription units which enjoys increasing popularity in pro- and eukaryotic genetic research.

  7. Messenger RNA 3' end formation in plants.

    Science.gov (United States)

    Hunt, A G

    2008-01-01

    Messenger RNA 3' end formation is an integral step in the process that gives rise to mature, translated messenger RNAs in eukaryotes. With this step, a pre-messenger RNA is processed and polyadenylated, giving rise to a mature mRNA bearing the characteristic poly(A) tract. The poly(A) tract is a fundamental feature of mRNAs, participating in the process of translation initiation and being the focus of control mechanisms that define the lifetime of mRNAs. Thus messenger RNA 3' end formation impacts two steps in mRNA biogenesis and function. Moreover, mRNA 3' end formation is something of a bridge that integrates numerous other steps in mRNA biogenesis and function. While the process is essential for the expression of most genes, it is also one that is subject to various forms of regulation, such that both quantitative and qualitative aspects of gene expression may be modulated via the polyadenylation complex. In this review, the current status of understanding of mRNA 3' end formation in plants is discussed. In particular, the nature of mRNA 3' ends in plants is reviewed, as are recent studies that are beginning to yield insight into the functioning and regulation of plant polyadenylation factor subunits.

  8. Messenger RNA surveillance: neutralizing natural nonsense

    DEFF Research Database (Denmark)

    Weischelfeldt, Joachim Lütken; Lykke-Andersen, Jens; Porse, Bo

    2005-01-01

    Messenger RNA transcripts that contain premature stop codons are degraded by a process termed nonsense-mediated mRNA decay (NMD). Although previously thought of as a pathway that rids the cell of non-functional mRNAs arising from mutations and processing errors, new research suggests a more general...

  9. RNA decay by messenger RNA interferases

    DEFF Research Database (Denmark)

    Christensen-Dalsgaard, Mikkel; Overgaard, Martin; Winther, Kristoffer Skovbo

    2008-01-01

    Two abundant toxin-antitoxin (TA) gene families, relBE and mazEF, encode mRNA cleaving enzymes whose ectopic overexpression abruptly inhibits translation and thereby induces a bacteriostatic condition. Here we describe and discuss protocols for the overproduction, purification, and analysis of mR...... cleaving enzymes such as RelE of Escherichia coli and the corresponding antitoxin RelB. In particular, we describe a set of plasmid vectors useful for the detailed analysis of cleavage sites in model mRNAs.......Two abundant toxin-antitoxin (TA) gene families, relBE and mazEF, encode mRNA cleaving enzymes whose ectopic overexpression abruptly inhibits translation and thereby induces a bacteriostatic condition. Here we describe and discuss protocols for the overproduction, purification, and analysis of mRNA...

  10. Processivity and coupling in messenger RNA transcription.

    Directory of Open Access Journals (Sweden)

    Stuart Aitken

    2010-01-01

    Full Text Available The complexity of messenger RNA processing is now being uncovered by experimental techniques that are capable of detecting individual copies of mRNA in cells, and by quantitative real-time observations that reveal the kinetics. This processing is commonly modelled by permitting mRNA to be transcribed only when the promoter is in the on state. In this simple on/off model, the many processes involved in active transcription are represented by a single reaction. These processes include elongation, which has a minimum time for completion and processing that is not captured in the model.In this paper, we explore the impact on the mRNA distribution of representing the elongation process in more detail. Consideration of the mechanisms of elongation leads to two alternative models of the coupling between the elongating polymerase and the state of the promoter: Processivity allows polymerases to complete elongation irrespective of the promoter state, whereas coupling requires the promoter to be active to produce a full-length transcript. We demonstrate that these alternatives have a significant impact on the predicted distributions. Models are simulated by the Gillespie algorithm, and the third and fourth moments of the resulting distribution are computed in order to characterise the length of the tail, and sharpness of the peak. By this methodology, we show that the moments provide a concise summary of the distribution, showing statistically-significant differences across much of the feasible parameter range.We conclude that processivity is not fully consistent with the on/off model unless the probability of successfully completing elongation is low--as has been observed. The results also suggest that some form of coupling between the promoter and a rate-limiting step in transcription may explain the cell's inability to maintain high mRNA levels at low noise--a prediction of the on/off model that has no supporting evidence.

  11. Complementary DNA and derived amino acid sequence of the α subunit of human complement protein C8: evidence for the existence of a separate α subunit messenger RNA

    International Nuclear Information System (INIS)

    Rao, A.G.; Howard, O.M.Z.; Ng, S.C.; Whitehead, A.S.; Colten, H.R.; Sodetz, J.M.

    1987-01-01

    The entire amino acid sequence of the α subunit (M/sub r/ 64,000) of the eight component of complement (C8) was determined by characterizing cDNA clones isolated from a human liver cDNA library. Two clones with overlapping inserts of net length 2.44 kilobases (kb) were isolated and found to contain the entire α coding region [1659 base pairs (bp)]. The 5' end consists of an untranslated region and a leader sequence of 30 amino acids. This sequence contains an apparent initiation Met, signal peptide, and propeptide which ends with an arginine-rich sequence that is characteristic of proteolytic processing sites found in the pro form of protein precursors. The 3' untranslated region contains two polyadenylation signals and a poly(A)sequence. RNA blot analysis of total cellular RNA from the human hepatoma cell line HepG2 revealed a message size of ∼2.5 kb. Features of the 5' and 3' sequences and the message size suggest that a separate mRNA codes for α and argues against the occurrence of a single-chain precursor form of the disulfide-linked α-λ subunit found in mature C8. Analysis of the derived amino acid sequence revealed several membrane surface seeking domains and a possible transmembrane domain. Analysis of the carbohydrate composition indicates 1 or 2 asparagine-linked but no O-linked oligosaccharide chains, a result consistent with predictions from the amino acid sequence. Most significantly, it exhibits a striking overall homology to human C9, with values of 24% on the basis of identity and 46% when conserved substitutions are allowed. As described in an accompanying report this homology also extends to the β subunit of C8

  12. Bifurcations in the interplay of messenger RNA, protein and nonprotein coding RNA

    International Nuclear Information System (INIS)

    Zhdanov, Vladimir P

    2008-01-01

    The interplay of messenger RNA (mRNA), protein, produced via translation of this RNA, and nonprotein coding RNA (ncRNA) may include regulation of the ncRNA production by protein and (i) ncRNA-protein association resulting in suppression of the protein regulatory activity or (ii) ncRNA-mRNA association resulting in degradation of the miRNA-mRNA complex. The kinetic models describing these two scenarios are found to predict bistability provided that protein suppresses the ncRNA formation

  13. Tissue distribution of human acetylcholinesterase and butyrylcholinesterase messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Jbilo, O.; Barteles, C.F.; Chatonnet, A.; Toutant, J.P.; Lockridge, O.

    1994-12-31

    Tissue distribution of human acetyicholinesterase and butyryicholinesterase messenger RNA. 1 Cholinesterase inhibitors occur naturally in the calabar bean (eserine), green potatoes (solanine), insect-resistant crab apples, the coca plant (cocaine) and snake venom (fasciculin). There are also synthetic cholinesterase inhibitors, for example man-made insecticides. These inhibitors inactivate acetyicholinesterase and butyrylcholinesterase as well as other targets. From a study of the tissue distribution of acetylcholinesterase and butyrylcholinesterase mRNA by Northern blot analysis, we have found the highest levels of butyrylcholinesterase mRNA in the liver and lungs, tissues known as the principal detoxication sites of the human body. These results indicate that butyrylcholinesterase may be a first line of defense against poisons that are eaten or inhaled.

  14. Shielding the messenger (RNA): microRNA-based anticancer therapies

    Science.gov (United States)

    Sotillo, Elena; Thomas-Tikhonenko, Andrei

    2011-01-01

    It has been a decade since scientists realized that microRNAs (miRNAs) are not an oddity invented by worms to regulate gene expression at post-transcriptional levels. Rather, many of these 21–22-nucleotide-short RNAs exist in invertebrates and vertebrates alike and some of them are in fact highly conserved. miRNAs are now recognized as an important class of non-coding small RNAs that inhibit gene expression by targeting mRNA stability and translation. In the last ten years, our knowledge of the miRNAs world was expanding at vertiginous speed, propelled by the development of computational engines for miRNA identification and target prediction, biochemical tools and techniques to modulate miRNA activity, and last but not least, the emergence of miRNA-centric animal models. One important conclusion that has emerged from this effort is that many microRNAs and their cognate targets are strongly implicated in cancer, either as oncogenes or tumor and metastasis suppressors. In this review we will discuss the diverse role that miRNAs play in cancer initiation and progression and also the tools with which miRNA expression could be corrected in vivo. While the idea of targeting microRNAs towards therapeutic ends is getting considerable traction, basic, translational, and clinical research done in the next few years will tell whether this promise is well-founded. PMID:21514318

  15. Alterations in messenger RNA and small nuclear RNA metabolism resulting from fluorouracil incorporation

    International Nuclear Information System (INIS)

    Armstrong, R.D.; Cadman, E.C.

    1985-01-01

    Studies were completed to examine the effect of 5-fluorouracil (FUra) incorporation on messenger RNA (mRNA) and small molecular weight nuclear RNA (SnRNA) metabolism. Studies of mRNA were completed using cDNA-mRNA hybridization methods to specifically examine dihydrofolate reductase (DHFR) mRNA. C 3 -L5178Y murine leukemia cells which are gene-amplified for DHFR, were exposed to FUra for 6, 12 or 24 hr, and the nuclear and cytoplasmic levels of DHFR-mRNA determined by hybridization with 32 P-DHFR-cDNA. FUra produced a dose-dependent increase in nuclear DHFR-mRNA levels, while total cytoplasmic DHFR-mRNA levels appeared to be unchanged. To examine only mRNA synthesized during FUra exposure, cells were also treated concurrently with [ 3 H] cytidine, and the [ 3 H]mRNA-cDNA hybrids measured following S 1 -nuclease treatment. FUra produced a concentration-dependent increase in nascent nuclear DHFR-mRNA levels, and a decrease in nascent cytoplasmic DHFR-mRNAs levels. These results suggest that FUra produces either an inhibition of mRNA processing, or an inhibition of nuclear-cytoplasmic transport. Preliminary experiments to examine ATP-dependent mRNA transport were completed with isolated nuclei from cells treated with FUra for 1 or 24 hr and then pulse-labeled for 1 hr with [ 3 H] cytidine. The results demonstrate a FUra-concentration and time-dependent inhibition of ATP-mediated mRNA efflux

  16. ESTRADIOL-INDUCED SYNTHESIS OF VITELLOGENIN .3. ISOLATION AND CHARACTERIZATION OF VITELLOGENIN MESSENGER-RNA FROM AVIAN LIVER

    NARCIS (Netherlands)

    AB, G.; Roskam, W. G.; Dijkstra, J.; Mulder, J.; Willems, M.; van der Ende, A.; Gruber, M.

    1976-01-01

    The messenger RNA of the hormone-induced protein vitellogenin was isolated from the liver of estrogen-treated roosters. Starting from total polysomal RNA, the vitellogenin messenger was purified 67-fold by oligo (dT)-cellulose chromatography and sizing on a sucrose gradient. The messenger was

  17. A Contemporary, Laboratory-Intensive Course on Messenger RNA Transcription and Processing

    Science.gov (United States)

    Carson, Sue; Miller, Heather

    2012-01-01

    Messenger ribonucleic acid (mRNA) plays a pivotal role in the central dogma of molecular biology. Importantly, molecular events occurring during and after mRNA synthesis have the potential to create multiple proteins from one gene, leading to some of the remarkable protein diversity that genomes hold. The North Carolina State University…

  18. Effects of ionizing radiation and partial hepatectomy on messenger RNA synthesis

    International Nuclear Information System (INIS)

    Abdel-Halim, M.N.

    1979-01-01

    Newly synthesized messenger RNA, as measured by a 40 min uptake of the radioactive precursor (6- 14 C) orotic acid, was studied in the regenerating livers of non-irradiated and gamma-irradiated (1800 rad) adrenal-intact and adrenalectomized rats 24 and 48 hours after partial hepatectomy. Two groups of rats, one with and one without adrenal glands were each divided into four subgroups: (1) control rats, (2) irradiated rats, (3) partially hepatectomized rats and (4) irradiated, partially hepatectomized rats. The radioactive profile of polyribosome formation and distribution was determined by sucrose density gradient centrifugation (10 to 40 per cent). The result of this study indicates that ionizing radiation decreases the synthesis of newly formed messenger RNA in regenerating livers of adrenal-intact rats. However, adrenalectomy largely abolished that inhibition. These data suggest that the decrease in messenger RNA synthesis may be explained by the disturbance of adrenal hormones induced by partial hepatectomy and ionizing radiation. (author)

  19. Guardian of Genetic Messenger-RNA-Binding Proteins

    Directory of Open Access Journals (Sweden)

    Antje Anji

    2016-01-01

    Full Text Available RNA in cells is always associated with RNA-binding proteins that regulate all aspects of RNA metabolism including RNA splicing, export from the nucleus, RNA localization, mRNA turn-over as well as translation. Given their diverse functions, cells express a variety of RNA-binding proteins, which play important roles in the pathologies of a number of diseases. In this review we focus on the effect of alcohol on different RNA-binding proteins and their possible contribution to alcohol-related disorders, and discuss the role of these proteins in the development of neurological diseases and cancer. We further discuss the conventional methods and newer techniques that are employed to identify RNA-binding proteins.

  20. Characterization of long noncoding RNA and messenger RNA signatures in melanoma tumorigenesis and metastasis.

    Directory of Open Access Journals (Sweden)

    Siqi Wang

    Full Text Available The incidence of melanoma, the most aggressive and life-threatening form of skin cancer, has significantly risen over recent decades. Therefore, it is essential to identify the mechanisms that underlie melanoma tumorigenesis and metastasis and to explore novel and effective melanoma treatment strategies. Accumulating evidence s uggests that aberrantly expressed long noncoding RNAs (lncRNAs have vital functions in multiple cancers. However, lncRNA functions in melanoma tumorigenesis and metastasis remain unclear. In this study, we investigated lncRNA and messenger RNA (mRNA expression profiles in primary melanomas, metastatic melanomas and normal skin samples from the Gene Expression Omnibus database. We used GSE15605 as the training set (n = 74 and GSE7553 as the validation set (n = 58. In three comparisons (primary melanoma versus normal skin, metastatic melanoma versus normal skin, and metastatic melanoma versus primary melanoma, 178, 295 and 48 lncRNAs and 847, 1758, and 295 mRNAs were aberrantly expressed, respectively. We performed Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses to examine the differentially expressed mRNAs, and potential core lncRNAs were predicted by lncRNA-mRNA co-expression networks. Based on our results, 15 lncRNAs and 144 mRNAs were significantly associated with melanoma tumorigenesis and metastasis. A subsequent analysis suggested a critical role for a five-lncRNA signature during melanoma tumorigenesis and metastasis. Low expression of U47924.27 was significantly associated with decreased survival of patients with melanoma. To the best of our knowledge, this study is the first to explore the expression patterns of lncRNAs and mRNAs during melanoma tumorigenesis and metastasis by re-annotating microarray data from the Gene Expression Omnibus (GEO microarray dataset. These findings reveal potential roles for lncRNAs during melanoma tumorigenesis and metastasis and provide a rich candidate

  1. Effects of insulin on messenger RNA activities in rat liver

    International Nuclear Information System (INIS)

    Hill, R.E.; Lee, K.L.; Kenney, F.T.

    1981-01-01

    Liver poly(A) RNA, isolated from adrenalectomized rats after insulin treatment, was translated in a nuclease-treated lysate of rabbit reticulocytes and quantitated for both total activity and the capacity to synthesize the insulin-inducible enzyme tyrosine amino-transferase. Analysis of the translated products from poly(A) RNA isolated 1 h after insulin treatment showed a 2.7-fold increase in activity of tyrosine aminotransferase mRNA. During the same interval, the capacity of poly(A) RNA to direct the synthesis of total protein in lysates also changed, showing a 30 to 40% increase in translational activity/unit of RNA. Increased translatability was apparent in all fractions of poly(A) RNA separated by centrifugation on sucrose gradients. Insulin thus appears to mediated a generalized changed in mRNAs leading to increased capacity for translation; induction of tyrosine aminotransferase may reflect unusual sensitivity to this effect of the hormone

  2. Localization of calcium-binding proteins and GABA transporter (GAT-1) messenger RNA in the human subthalamic nucleus

    International Nuclear Information System (INIS)

    Augood, S.J.; Waldvogel, H.J.; Muenkle, M.C.; Faull, R.L.M.; Emson, P.C.

    1999-01-01

    The distribution of messenger RNA encoding the human GAT-1 (a high-affinity GABA transporter) was investigated in the subthalamic nucleus of 10 neurologically normal human post mortem cases. Further, the distribution of messenger RNA and protein encoding the three neuronally expressed calcium-binding proteins (calbindin D28k, parvalbumin and calretinin) was similarly investigated using in situ hybridization and immunohistochemical techniques. Cellular sites of calbindin D28k, parvalbumin, calretinin and GAT-1 messenger RNA expression were localized using human-specific oligonucleotide probes radiolabelled with [ 35 S]dATP. Sites of protein localization were visualized using specific anti-calbindin D28k, anti-parvalbumin and anti-calretinin antisera. Examination of emulsion-coated tissue sections processed for in situ hybridization revealed an intense signal for GAT-1 messenger RNA within the human subthalamic nucleus, indeed the majority of Methylene Blue-counterstained cells were enriched in this transcript. Further, a marked heterogeneity was noted with regard to the expression of the messenger RNA's encoding the three calcium-binding proteins; this elliptical nucleus was highly enriched in parvalbumin messenger RNA-positive neurons and calretinin mRNA-positive cells but not calbindin messenger RNA-positive cells. Indeed, only an occasional calbindin messenger RNA-positive cell was detected within the mediolateral extent of the nucleus. In marked contrast, numerous parvalbumin messenger RNA-positive cells and calretinin messenger RNA-positive cells were detected and they were topographically distributed; parvalbumin messenger RNA-positive cells were highly enriched in the dorsal subthalamic nucleus extending mediolaterally; calretinin messenger RNA-positive cells were more enriched ventrally although some degree of overlap was apparent. Computer-assisted analysis of the average cross-sectional somatic area of parvalbumin, calretinin and GAT-1 messenger RNA

  3. Fox-2 protein regulates the alternative splicing of scleroderma-associated lysyl hydroxylase 2 messenger RNA.

    Science.gov (United States)

    Seth, Puneet; Yeowell, Heather N

    2010-04-01

    Scleroderma (systemic sclerosis [SSc]) is a complex connective tissue disorder characterized by hardening and thickening of the skin. One hallmark of scleroderma is excessive accumulation of collagen accompanied by increased levels of pyridinoline collagen crosslinks derived from hydroxylysine residues in the collagen telopeptide domains. Lysyl hydroxylase 2 (LH2), an important alternatively spliced enzyme in collagen biosynthesis, acts as a collagen telopeptide hydroxylase. Changes in the pattern of LH2 alternative splicing, favoring increased inclusion of the alternatively spliced LH2 exon 13A, thereby increasing the levels of the long transcript of LH2 (LH2[long]), are linked to scleroderma disease. This study was undertaken to examine the role played by RNA binding protein Fox-2 in regulating exon 13A inclusion, which leads to the generation of scleroderma-associated LH2(long) messenger RNA (mRNA). Phylogenetic sequence analysis of introns flanking exon 13A was performed. A tetracycline-inducible system in T-Rex 293 cells was used to induce Fox-2 protein, and endogenous LH2(long) mRNA was determined by reverse transcriptase-polymerase chain reaction. An LH2 minigene was designed, validated, and used in Fox-2 overexpression and mutagenesis experiments. Knockdown of Fox-2 was performed in mouse embryonic fibroblasts and in fibroblasts from SSc patients. Overexpression of Fox-2 enhanced the inclusion of exon 13A and increased the generation of LH2(long) mRNA, whereas knockdown of Fox-2 decreased LH2(long) transcripts. Mutational analysis of an LH2 minigene demonstrated that 2 of the 4 Fox binding motifs flanking LH2 exon 13A are required for inclusion of exon 13A. In early passage fibroblasts derived from patients with scleroderma, the knockdown of Fox-2 protein significantly decreased the endogenous levels of LH2(long) mRNA. Our findings indicate that Fox-2 plays an integral role in the regulation of LH2 splicing. Knockdown of Fox-2 and other methods to decrease

  4. The synthesis of polyadenylated messenger RNA in herpes simplex type I virus infected BHK cells.

    Science.gov (United States)

    Harris, T J; Wildy, P

    1975-09-01

    The pattern of polyadenylated messenger RNA (mRNA) synthesis in BHK cell monolayers, infected under defined conditions with herpes simplex type I virus has been investigated by polyacrylamide gel electrophoresis or pulse-labelled RNA isolated by oligo dT-cellulose chromatography. Two classes of mRNA molecules were synthesized in infected cells; these were not detected in uninfected cells. The rate of synthesis of the larger, 18 to 30S RNA class reached a maximum soon after injection and then declined, whereas the rate of synthesis of the 7 to 11 S RNA class did not reach a maximum until much later and did not decline. In the presence of cytosine arabinoside, the rate of mRNA synthesis in infected cells was reduced but the electrophoretic pattern remained the same.

  5. A thermostable messenger RNA based vaccine against rabies.

    Science.gov (United States)

    Stitz, Lothar; Vogel, Annette; Schnee, Margit; Voss, Daniel; Rauch, Susanne; Mutzke, Thorsten; Ketterer, Thomas; Kramps, Thomas; Petsch, Benjamin

    2017-12-01

    Although effective rabies virus vaccines have been existing for decades, each year, rabies virus infections still cause around 50.000 fatalities worldwide. Most of these cases occur in developing countries, where these vaccines are not available. The reasons for this are the prohibitive high costs of cell culture or egg grown rabies virus vaccines and the lack of a functional cold chain in many regions in which rabies virus is endemic. Here, we describe the excellent temperature resistance of a non-replicating mRNA based rabies virus vaccine encoding the rabies virus glycoprotein (RABV-G). Prolonged storage of the vaccine from -80°C to up to +70°C for several months did not impact the protective capacity of the mRNA vaccine. Efficacy after storage was demonstrated by the induction of rabies specific virus neutralizing antibodies and protection in mice against lethal rabies infection. Moreover, storing the vaccine at oscillating temperatures between +4° and +56°C for 20 cycles in order to simulate interruptions of the cold chain during vaccine transport, did not affect the vaccine's immunogenicity and protective characteristics, indicating that maintenance of a cold chain is not essential for this vaccine.

  6. Direct, rapid RNA sequence analysis

    International Nuclear Information System (INIS)

    Peattie, D.A.

    1987-01-01

    The original methods of RNA sequence analysis were based on enzymatic production and chromatographic separation of overlapping oligonucleotide fragments from within an RNA molecule followed by identification of the mononucleotides comprising the oligomer. Over the past decade the field of nucleic acid sequencing has changed dramatically, however, and RNA molecules now can be sequenced in a variety of more streamlined fashions. Most of the more recent advances in RNA sequencing have involved one-dimensional electrophoretic separation of 32 P-end-labeled oligoribonucleotides on polyacrylamide gels. In this chapter the author discusses two of these methods for determining the nucleotide sequences of RNA molecules rapidly: the chemical method and the enzymatic method. Both methods are direct and degradative, i.e., they rely on fragmatic and chemical approaches should be utilized. The single-strand-specific ribonucleases (A, T 1 , T 2 , and S 1 ) provide an efficient means to locate double-helical regions rapidly, and the chemical reactions provide a means to determine the RNA sequence within these regions. In addition, the chemical reactions allow one to assign interactions to specific atoms and to distinguish secondary interactions from tertiary ones. If the RNA molecule is small enough to be sequenced directly by the enzymatic or chemical method, the probing reactions can be done easily at the same time as sequencing reactions

  7. Postage for the messenger: Designating routes for Nuclear mRNA Export

    Science.gov (United States)

    Natalizio, Barbara J.; Wente, Susan R.

    2013-01-01

    Transcription of messenger(m) RNA occurs in the nucleus, making the translocation of mRNA across the nuclear envelope (NE) boundary a critical determinant of proper gene expression and cell survival. A major mRNA export route occurs via the NXF1-dependent pathway through the nuclear pore complexes (NPCs) embedded in the NE. However, recent findings have discovered new evidence supporting the existence of multiple mechanisms for crossing the NE, including both NPC-mediated and NE budding-mediated pathways. An analysis of the trans-acting factors and cis components that define these pathways reveals shared elements as well as mechanistic differences. We review here the current understanding of the mechanisms that characterize each pathway and highlight the determinants that influence mRNA transport fate. PMID:23583578

  8. Genetic recombination in plant-infecting messenger-sense RNA viruses: overview and research perspectives

    Directory of Open Access Journals (Sweden)

    Jozef Julian Bujarski

    2013-03-01

    Full Text Available RNA recombination is one of the driving forces of genetic variability in (+-strand RNA viruses. Various types of RNA-RNA crossovers were described including crosses between the same or different viral RNAs or between viral and cellular RNAs. Likewise, a variety of molecular mechanisms are known to support RNA recombination, such as replicative events (based on internal or end-to-end replicase switchings along with nonreplicative joining among RNA fragments of viral and/or cellular origin. Such mechanisms as RNA decay or RNA interference are responsible for RNA fragmentation and trans-esterification reactions which are likely accountable for ligation of RNA fragments. Numerous host factors were found to affect the profiles of viral RNA recombinants and significant differences in recombination frequency were observed among various RNA viruses. Comparative analyses of viral sequences allowed for the development of evolutionary models in order to explain adaptive phenotypic changes and co-evolving sites. Many questions remain to be answered by forthcoming RNA recombination research. (i How various factors modulate the ability of viral replicase to switch templates, (ii What is the intracellular location of RNA-RNA template switchings, (iii Mechanisms and factors responsible for non-replicative RNA recombination, (iv Mechanisms of integration of RNA viral sequences with cellular genomic DNA, and (v What is the role of RNA splicing and ribozyme activity. From an evolutionary stand point, it is not known how RNA viruses parasitize new host species via recombination, nor is it obvious what the contribution of RNA recombination is among other RNA modification pathways. We do not understand why the frequency of RNA recombination varies so much among RNA viruses and the status of RNA recombination as a form of sex is not well documented.

  9. Genetic recombination in plant-infecting messenger-sense RNA viruses: overview and research perspectives.

    Science.gov (United States)

    Bujarski, Jozef J

    2013-01-01

    RNA recombination is one of the driving forces of genetic variability in (+)-strand RNA viruses. Various types of RNA-RNA crossovers were described including crosses between the same or different viral RNAs or between viral and cellular RNAs. Likewise, a variety of molecular mechanisms are known to support RNA recombination, such as replicative events (based on internal or end-to-end replicase switchings) along with non-replicative joining among RNA fragments of viral and/or cellular origin. Such mechanisms as RNA decay or RNA interference are responsible for RNA fragmentation and trans-esterification reactions which are likely accountable for ligation of RNA fragments. Numerous host factors were found to affect the profiles of viral RNA recombinants and significant differences in recombination frequency were observed among various RNA viruses. Comparative analyses of viral sequences allowed for the development of evolutionary models in order to explain adaptive phenotypic changes and co-evolving sites. Many questions remain to be answered by forthcoming RNA recombination research. (1) How various factors modulate the ability of viral replicase to switch templates, (2) What is the intracellular location of RNA-RNA template switchings, (3) Mechanisms and factors responsible for non-replicative RNA recombination, (4) Mechanisms of integration of RNA viral sequences with cellular genomic DNA, and (5) What is the role of RNA splicing and ribozyme activity. From an evolutionary stand point, it is not known how RNA viruses parasitize new host species via recombination, nor is it obvious what the contribution of RNA recombination is among other RNA modification pathways. We do not understand why the frequency of RNA recombination varies so much among RNA viruses and the status of RNA recombination as a form of sex is not well documented.

  10. Covalent Strategies for Targeting Messenger and Non-Coding RNAs: An Updated Review on siRNA, miRNA and antimiR Conjugates

    Directory of Open Access Journals (Sweden)

    Santiago Grijalvo

    2018-02-01

    Full Text Available Oligonucleotide-based therapy has become an alternative to classical approaches in the search of novel therapeutics involving gene-related diseases. Several mechanisms have been described in which demonstrate the pivotal role of oligonucleotide for modulating gene expression. Antisense oligonucleotides (ASOs and more recently siRNAs and miRNAs have made important contributions either in reducing aberrant protein levels by sequence-specific targeting messenger RNAs (mRNAs or restoring the anomalous levels of non-coding RNAs (ncRNAs that are involved in a good number of diseases including cancer. In addition to formulation approaches which have contributed to accelerate the presence of ASOs, siRNAs and miRNAs in clinical trials; the covalent linkage between non-viral vectors and nucleic acids has also added value and opened new perspectives to the development of promising nucleic acid-based therapeutics. This review article is mainly focused on the strategies carried out for covalently modifying siRNA and miRNA molecules. Examples involving cell-penetrating peptides (CPPs, carbohydrates, polymers, lipids and aptamers are discussed for the synthesis of siRNA conjugates whereas in the case of miRNA-based drugs, this review article makes special emphasis in using antagomiRs, locked nucleic acids (LNAs, peptide nucleic acids (PNAs as well as nanoparticles. The biomedical applications of siRNA and miRNA conjugates are also discussed.

  11. Antigen-presenting cells transfected with Hsp65 messenger RNA fail to treat experimental tuberculosis

    Energy Technology Data Exchange (ETDEWEB)

    Rocha, C.D.; Trombone, A.P.F.; Lorenzi, J.C.C.; Almeida, L.P.; Gembre, A.F.; Padilha, E. [Departamento de Bioquímica e Imunologia, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil); Ramos, S.G. [Departamento de Patologia, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil); Silva, C.L.; Coelho-Castelo, A.A.M. [Departamento de Bioquímica e Imunologia, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil)

    2012-09-21

    In the last several years, the use of dendritic cells has been studied as a therapeutic strategy against tumors. Dendritic cells can be pulsed with peptides or full-length protein, or they can be transfected with DNA or RNA. However, comparative studies suggest that transfecting dendritic cells with messenger RNA (mRNA) is superior to other antigen-loading techniques in generating immunocompetent dendritic cells. In the present study, we evaluated a new therapeutic strategy to fight tuberculosis using dendritic cells and macrophages transfected with Hsp65 mRNA. First, we demonstrated that antigen-presenting cells transfected with Hsp65 mRNA exhibit a higher level of expression of co-stimulatory molecules, suggesting that Hsp65 mRNA has immunostimulatory properties. We also demonstrated that spleen cells obtained from animals immunized with mock and Hsp65 mRNA-transfected dendritic cells were able to generate a mixed Th1/Th2 response with production not only of IFN-γ but also of IL-5 and IL-10. In contrast, cells recovered from mice immunized with Hsp65 mRNA-transfected macrophages were able to produce only IL-5. When mice were infected with Mycobacterium tuberculosis and treated with antigen-presenting cells transfected with Hsp65 mRNA (therapeutic immunization), we did not detect any decrease in the lung bacterial load or any preservation of the lung parenchyma, indicating the inability of transfected cells to confer curative effects against tuberculosis. In spite of the lack of therapeutic efficacy, this study reports for the first time the use of antigen-presenting cells transfected with mRNA in experimental tuberculosis.

  12. The ribosome uses two active mechanisms to unwind messenger RNA during translation.

    Science.gov (United States)

    Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio

    2011-07-06

    The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved

  13. Phenotypic characterization of neurotensin messenger RNA-expressing cells in the neuroleptic-treated rat striatum: a detailed cellular co-expression study

    International Nuclear Information System (INIS)

    Emson, P.C.; Westmore, K.; Augood, S.J.

    1996-01-01

    The chemical phenotype of proneurotensin messenger RNA-expressing cells was determined in the acute haloperidol-treated rat striatum using a combination of [ 35 S]-labelled and alkaline phosphatase-labelled oligonucleotides. Cellular sites of proneurotensin messenger RNA expression were visualized simultaneously on tissue sections processed to reveal cellular sites of preproenkephalin A messenger RNA or the dopamine and adenylate cyclase phosphoprotein-32, messenger RNA. The cellular co-expression of preproenkepahlin A and preprotachykinin messenger RNA was also examined within forebrain structures. Cellular sites of preproenkephalin A and dopamine and adenylate cyclase phosphoprotein-32 messenger RNAs were visualized using alkaline phosphatase-labelled oligonucleotides whilst sites of preprotachykinin and proneurotensin messenger RNA expression were detected using [ 35 S]-labelled oligos. Cellular sites of enkephalin and dopamine and adenylate cyclase phosphoprotein-32 gene expression were identified microscopically by the concentration of purple alkaline phosphatase reaction product within the cell cytoplasm, whereas sites of substance P and proneurotensin gene expression were identified by the dense clustering of silver grains overlying cells.An intense hybridization signal was detected for all three neuropeptide messenger RNAs in the striatum, the nucleus accumbens and septum. Dopamine and adenylate cyclase phosphoprotein-32 messenger RNA was detected within the neostriatum but not within the septum. In all forebrain regions examined, with the exception of the islands of Cajella, the cellular expression of enkephalin messenger RNA and substance P messenger RNA was discordant; the two neuropeptide messenger RNAs were detected essentially in different cells, although in the striatum and nucleus accumbens occasional isolated cells were detected which contained both hybridization signals; dense clusters of silver grains overlay alkaline phosphatase-positive cells

  14. Phenotypic characterization of neurotensin messenger RNA-expressing cells in the neuroleptic-treated rat striatum: a detailed cellular co-expression study

    Energy Technology Data Exchange (ETDEWEB)

    Emson, P C; Westmore, K; Augood, S J [MRC Molecular Neuroscience Group, The Department of Neurobiology, The Babraham Institute, Babraham, Cambridge (United Kingdom)

    1996-12-11

    The chemical phenotype of proneurotensin messenger RNA-expressing cells was determined in the acute haloperidol-treated rat striatum using a combination of [{sup 35}S]-labelled and alkaline phosphatase-labelled oligonucleotides. Cellular sites of proneurotensin messenger RNA expression were visualized simultaneously on tissue sections processed to reveal cellular sites of preproenkephalin A messenger RNA or the dopamine and adenylate cyclase phosphoprotein-32, messenger RNA. The cellular co-expression of preproenkepahlin A and preprotachykinin messenger RNA was also examined within forebrain structures. Cellular sites of preproenkephalin A and dopamine and adenylate cyclase phosphoprotein-32 messenger RNAs were visualized using alkaline phosphatase-labelled oligonucleotides whilst sites of preprotachykinin and proneurotensin messenger RNA expression were detected using [{sup 35}S]-labelled oligos. Cellular sites of enkephalin and dopamine and adenylate cyclase phosphoprotein-32 gene expression were identified microscopically by the concentration of purple alkaline phosphatase reaction product within the cell cytoplasm, whereas sites of substance P and proneurotensin gene expression were identified by the dense clustering of silver grains overlying cells.An intense hybridization signal was detected for all three neuropeptide messenger RNAs in the striatum, the nucleus accumbens and septum. Dopamine and adenylate cyclase phosphoprotein-32 messenger RNA was detected within the neostriatum but not within the septum. In all forebrain regions examined, with the exception of the islands of Cajella, the cellular expression of enkephalin messenger RNA and substance P messenger RNA was discordant; the two neuropeptide messenger RNAs were detected essentially in different cells, although in the striatum and nucleus accumbens occasional isolated cells were detected which contained both hybridization signals; dense clusters of silver grains overlay alkaline phosphatase

  15. Early changes of placenta-derived messenger RNA in maternal plasma – potential value for preeclampsia prediction?

    Directory of Open Access Journals (Sweden)

    Surugiu Sebastian

    2015-12-01

    Full Text Available Objective: the pourpose of the study was to determine if there are any differences between placenta derived plasmatic levels of messenger RNA in normal and future preeclamptic pregnancies and if these placental transcripts can predict preeclampsia long before clinical onset

  16. The microRNA and messengerRNA profile of the RNA-induced silencing complex in human primary astrocyte and astrocytoma cells.

    Science.gov (United States)

    Moser, Joanna J; Fritzler, Marvin J

    2010-10-18

    GW/P bodies are cytoplasmic ribonucleoprotein-rich foci involved in microRNA (miRNA)-mediated messenger RNA (mRNA) silencing and degradation. The mRNA regulatory functions within GW/P bodies are mediated by GW182 and its binding partner hAgo2 that bind miRNA in the RNA-induced silencing complex (RISC). To date there are no published reports of the profile of miRNA and mRNA targeted to the RISC or a comparison of the RISC-specific miRNA/mRNA profile differences in malignant and non-malignant cells. RISC mRNA and miRNA components were profiled by microarray analysis of malignant human U-87 astrocytoma cells and its non-malignant counterpart, primary human astrocytes. Total cell RNA as well as RNA from immunoprecipitated RISC was analyzed. The novel findings were fourfold: (1) miRNAs were highly enriched in astrocyte RISC compared to U-87 astrocytoma RISC, (2) astrocytoma and primary astrocyte cells each contained unique RISC miRNA profiles as compared to their respective cellular miRNA profiles, (3) miR-195, 10b, 29b, 19b, 34a and 455-3p levels were increased and the miR-181b level was decreased in U-87 astrocytoma RISC as compared to astrocyte RISC, and (4) the RISC contained decreased levels of mRNAs in primary astrocyte and U-87 astrocytoma cells. The observation that miR-34a and miR-195 levels were increased in the RISC of U-87 astrocytoma cells suggests an oncogenic role for these miRNAs. Differential regulation of mRNAs by specific miRNAs is evidenced by the observation that three miR34a-targeted mRNAs and two miR-195-targeted mRNAs were downregulated while one miR-195-targeted mRNA was upregulated. Biological pathway analysis of RISC mRNA components suggests that the RISC plays a pivotal role in malignancy and other conditions. This study points to the importance of the RISC and ultimately GW/P body composition and function in miRNA and mRNA deregulation in astrocytoma cells and possibly in other malignancies.

  17. The microRNA and messengerRNA profile of the RNA-induced silencing complex in human primary astrocyte and astrocytoma cells.

    Directory of Open Access Journals (Sweden)

    Joanna J Moser

    2010-10-01

    Full Text Available GW/P bodies are cytoplasmic ribonucleoprotein-rich foci involved in microRNA (miRNA-mediated messenger RNA (mRNA silencing and degradation. The mRNA regulatory functions within GW/P bodies are mediated by GW182 and its binding partner hAgo2 that bind miRNA in the RNA-induced silencing complex (RISC. To date there are no published reports of the profile of miRNA and mRNA targeted to the RISC or a comparison of the RISC-specific miRNA/mRNA profile differences in malignant and non-malignant cells.RISC mRNA and miRNA components were profiled by microarray analysis of malignant human U-87 astrocytoma cells and its non-malignant counterpart, primary human astrocytes. Total cell RNA as well as RNA from immunoprecipitated RISC was analyzed. The novel findings were fourfold: (1 miRNAs were highly enriched in astrocyte RISC compared to U-87 astrocytoma RISC, (2 astrocytoma and primary astrocyte cells each contained unique RISC miRNA profiles as compared to their respective cellular miRNA profiles, (3 miR-195, 10b, 29b, 19b, 34a and 455-3p levels were increased and the miR-181b level was decreased in U-87 astrocytoma RISC as compared to astrocyte RISC, and (4 the RISC contained decreased levels of mRNAs in primary astrocyte and U-87 astrocytoma cells.The observation that miR-34a and miR-195 levels were increased in the RISC of U-87 astrocytoma cells suggests an oncogenic role for these miRNAs. Differential regulation of mRNAs by specific miRNAs is evidenced by the observation that three miR34a-targeted mRNAs and two miR-195-targeted mRNAs were downregulated while one miR-195-targeted mRNA was upregulated. Biological pathway analysis of RISC mRNA components suggests that the RISC plays a pivotal role in malignancy and other conditions. This study points to the importance of the RISC and ultimately GW/P body composition and function in miRNA and mRNA deregulation in astrocytoma cells and possibly in other malignancies.

  18. Identification of messenger RNA of fetoplacental source in maternal plasma of women with normal pregnancies and pregnancies with intrauterine growth restriction.

    Science.gov (United States)

    Ayala Ramírez, Paola; García Robles, Reggie; Rojas, Juan Diego; Bermúdez, Martha; Bernal, Jaime

    2012-07-01

    to quantify placenta-specific RNA in plasma of women carrying foetuses with intrauterine growth restriction and pregnant women with normal pregnancies. 8 pregnant women with foetuses with intrauterine growth restriction were studied as well as 18 women with uncomplicated pregnancies in the third pregnancy trimester. Total free RNA was quantified in maternal plasma by spectrophotometry and the gene expression of hPL (Human Placental Lactogen) at the messenger RNA level through technical Real Time-Chain Reaction Polymerase. plasma RNA of fetoplacental origin was successfully detected in 100% of pregnant women. There were no statistically significant differences between the values of total RNA extracted from plasma (p= 0.5975) nor in the messenger RNA expression of hPL gene (p= 0.5785) between cases and controls. messenger RNA of fetoplacental origin can be detected in maternal plasma during pregnancy.

  19. Annotating RNA motifs in sequences and alignments.

    Science.gov (United States)

    Gardner, Paul P; Eldai, Hisham

    2015-01-01

    RNA performs a diverse array of important functions across all cellular life. These functions include important roles in translation, building translational machinery and maturing messenger RNA. More recent discoveries include the miRNAs and bacterial sRNAs that regulate gene expression, the thermosensors, riboswitches and other cis-regulatory elements that help prokaryotes sense their environment and eukaryotic piRNAs that suppress transposition. However, there can be a long period between the initial discovery of a RNA and determining its function. We present a bioinformatic approach to characterize RNA motifs, which are critical components of many RNA structure-function relationships. These motifs can, in some instances, provide researchers with functional hypotheses for uncharacterized RNAs. Moreover, we introduce a new profile-based database of RNA motifs--RMfam--and illustrate some applications for investigating the evolution and functional characterization of RNA. All the data and scripts associated with this work are available from: https://github.com/ppgardne/RMfam. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. antaRNA: ant colony-based RNA sequence design.

    Science.gov (United States)

    Kleinkauf, Robert; Mann, Martin; Backofen, Rolf

    2015-10-01

    RNA sequence design is studied at least as long as the classical folding problem. Although for the latter the functional fold of an RNA molecule is to be found ,: inverse folding tries to identify RNA sequences that fold into a function-specific target structure. In combination with RNA-based biotechnology and synthetic biology ,: reliable RNA sequence design becomes a crucial step to generate novel biochemical components. In this article ,: the computational tool antaRNA is presented. It is capable of compiling RNA sequences for a given structure that comply in addition with an adjustable full range objective GC-content distribution ,: specific sequence constraints and additional fuzzy structure constraints. antaRNA applies ant colony optimization meta-heuristics and its superior performance is shown on a biological datasets. http://www.bioinf.uni-freiburg.de/Software/antaRNA CONTACT: backofen@informatik.uni-freiburg.de Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

  1. In vivo expression of ß-galactosidase by rat oviduct exposed to naked DNA or messenger RNA

    Directory of Open Access Journals (Sweden)

    MARIANA RIOS

    2002-01-01

    Full Text Available Intra-oviductal administration of RNA obtained from oviducts of estradiol-treated rats resulted in accelerated egg transport (Ríos et al., 1997. It is probable that estradiol-induced messenger RNA (mRNA entered oviductal cells and was translated into the proteins involved in accelerated egg transport. In order to test this interpretation we deposited in vivo 50 µg of pure ß-galactosidase (ß-gal mRNA, 50 µg of pure DNA from the reporter gene ß-gal under SV40 promoter or the vehicle (control oviducts into the oviductal lumen of rats. Twenty four hours later the ß-gal activity was assayed in oviductal tissue homogenates using o-nitrophenyl-ß-D-galactopyranoside as a substrate. The administration of ß-gal mRNA and pSVBgal plasmid increased ß-gal activity by 71% and 142%, respectively, over the control oviducts. These results indicate that naked DNA and mRNA coding for ß-gal can enter oviductal cells and be translated into an active enzyme. They are consistent with the interpretation that embryo transport acceleration caused by the injection of estradiol-induced RNA in the oviduct involves translation of the injected mRNA

  2. Quantitative correlation between promoter methylation and messenger RNA levels of the reduced folate carrier

    Directory of Open Access Journals (Sweden)

    Kheradpour Albert

    2008-05-01

    Full Text Available Abstract Background Methotrexate (MTX uptake is mediated by the reduced folate carrier (RFC. Defective drug uptake in association with decreased RFC expression is a common mechanism of MTX resistance in many tumor types. Heavy promoter methylation was previously identified as a basis for the complete silencing of RFC in MDA-MB-231 breast cancer cells, its role and prevalence in RFC transcription regulation are, however, not widely studied. Methods In the current study, RFC promoter methylation was assessed using methylation specific PCR in a panel of malignant cell lines (n = 8, including MDA-MB-231, and M805, a MTX resistant cell line directly established from the specimen of a patient with malignant fibrohistocytoma, whom received multiple doses of MTX. A quantitative approach of real-time PCR for measuring the extent of RFC promoter methylation was developed, and was validated by direct bisulfite genomic sequencing. RFC mRNA levels were determined by quantitative real-time RT-PCR and were related to the extent of promoter methylation in these cell lines. Results A partial promoter methylation and RFC mRNA down-regulation were observed in M805. Using the quantitative approach, a reverse correlation (correlation coefficient = -0.59, p Conclusion This study further suggests that promoter methylation is a potential basis for MTX resistance. The quantitative correlation identified in this study implies that promoter methylation is possibly a mechanism involved in the fine regulation of RFC transcription.

  3. Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.

    Science.gov (United States)

    Tan, M K

    1991-08-01

    A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.

  4. Translation affects YoeB and MazF messenger RNA interferase activities by different mechanisms

    DEFF Research Database (Denmark)

    Christensen-Dalsgaard, Mikkel; Gerdes, Kenn

    2008-01-01

    Prokaryotic toxin-antitoxin loci encode mRNA cleaving enzymes that inhibit translation. Two types are known: those that cleave mRNA codons at the ribosomal A site and those that cleave any RNA site specifically. RelE of Escherichia coli cleaves mRNA at the ribosomal A site in vivo and in vitro bu...

  5. DNA Methylation of MMP9 Is Associated with High Levels of MMP-9 Messenger RNA in Periapical Inflammatory Lesions.

    Science.gov (United States)

    Campos, Kelma; Gomes, Carolina Cavalieri; Farias, Lucyana Conceição; Silva, Renato Menezes; Letra, Ariadne; Gomez, Ricardo Santiago

    2016-01-01

    Matrix metalloproteinases (MMPs) are the major class of enzymes responsible for degradation of extracellular matrix components and participate in the pathogenesis of periapical inflammatory lesions. MMP expression may be regulated by DNA methylation. The purpose of the present investigation was to analyze the expression of MMP2 and MMP9 in periapical granulomas and radicular cysts and to test the hypothesis that, in these lesions, their transcription may be modulated by DNA methylation. Methylation-specific polymerase chain reaction was used to evaluate the DNA methylation pattern of the MMP2 gene in 13 fresh periapical granuloma samples and 10 fresh radicular cyst samples. Restriction enzyme digestion was used to assess methylation of the MMP9 gene in 12 fresh periapical granuloma samples and 10 fresh radicular cyst samples. MMP2 and MMP9 messenger RNA transcript levels were measured by quantitative real-time polymerase chain reaction. All periapical lesions and healthy mucosa samples showed partial methylation of the MMP2 gene; however, periapical granulomas showed higher MMP2 mRNA expression levels than healthy mucosa (P = .014). A higher unmethylated profile of the MMP9 gene was found in periapical granulomas and radicular cysts compared with healthy mucosa. In addition, higher MMP9 mRNA expression was observed in the periapical lesions compared with healthy tissues. The present study suggests that the unmethylated status of the MMP9 gene in periapical lesions may explain the observed up-regulation of messenger RNA transcription in these lesions. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  6. Blockade of OX40/OX40 ligand to decrease cytokine messenger RNA expression in acute renal allograft rejection in vitro.

    Science.gov (United States)

    Wang, Y-L; Li, G; Fu, Y-X; Wang, H; Shen, Z-Y

    2013-01-01

    The aim of this study was to investigate cytokine messenger RNA (mRNA) expression by peripheral blood mononuclear cells (PBMCs) from renal recipients experiencing acute rejection by blocking OX40-OX40L interactions with recombinant human OX40-Fc fusion protein (rhOX40Fc) in vitro. PBMCs were isolated from 20 recipients experiencing acute rejection episodes (rejection group) and 20 recipients with stable graft function (stable group). Levels of Th1 (interferon [IFN]-γ) and Th2 (interleukin [IL]-4) mRNA expressions by PBMCs were measured using real-time reverse transcriptase-polymerase chain reactions. IFN-γ mRNA expression levels were significantly higher in the rejection than the stable group (P rejection group, rhOX40Fc reduced significantly the expression of IFN-γ and IL-4 mRNA by anti-CD3-monoclonal antibody stimulated PBMCs (P type cytokines. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Maternal provision of non-sex-specific transformer messenger RNA in sex determination of the wasp Asobara tabida.

    Science.gov (United States)

    Geuverink, E; Verhulst, E C; van Leussen, M; van de Zande, L; Beukeboom, L W

    2018-02-01

    In many insect species maternal provision of sex-specifically spliced messenger RNA (mRNA) of sex determination genes is an essential component of the sex determination mechanism. In haplodiploid Hymenoptera, maternal provision in combination with genomic imprinting has been shown for the parasitoid Nasonia vitripennis, known as maternal effect genomic imprinting sex determination (MEGISD). Here, we characterize the sex determination cascade of Asobara tabida, another hymenopteran parasitoid. We show the presence of the conserved sex determination genes doublesex (dsx), transformer (tra) and transformer-2 (tra2) orthologues in As. tabida. Of these, At-dsx and At-tra are sex-specifically spliced, indicating a conserved function in sex determination. At-tra and At-tra2 mRNA is maternally provided to embryos but, in contrast to most studied insects, As. tabida females transmit a non-sex-specific splice form of At-tra mRNA to the eggs. In this respect, As. tabida sex determination differs from the MEGISD mechanism. How the paternal genome can induce female development in the absence of maternal provision of sex-specifically spliced mRNA remains an open question. Our study reports a hitherto unknown variant of maternal effect sex determination and accentuates the diversity of insect sex determination mechanisms. © 2017 The Authors. Insect Molecular Biology published by John Wiley & Sons Ltd on behalf of Royal Entomological Society.

  8. Electrochemical Branched-DNA Assay for Polymerase Chain Reaction-Free Detection and Quantification of Oncogenes in Messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ai Cheng; Dai, Ziyu; Chen, Baowei; Wu, Hong; Wang, Jun; Zhang, Aiguo; Zhang, Lurong; Lim, Tit-Meng; Lin, Yuehe

    2008-12-01

    We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcript in the population of messenger RNA (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify targets signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct detection of target transcript in as little as 4.6 ng mRNA without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcript in total mRNA population. The approach thus provides a simple, sensitive, accurate and quantitative tool alternate to the RQ-PCR for early disease diagnosis.

  9. Efficient ex vivo delivery of chemically modified messenger RNA using lipofection and magnetofection.

    Science.gov (United States)

    Badieyan, Zohreh Sadat; Pasewald, Tamara; Mykhaylyk, Olga; Rudolph, Carsten; Plank, Christian

    2017-01-22

    Recently, chemically modified mRNA (cmRNA) therapeutics have been the subject of extensive application-oriented research in both academia and industry as a safer alternative for gene and recombinant protein therapies. However, the lack of an efficient delivery system hinders widespread application. Here we used ∼100-nm lipoplexes and magnetic lipoplexes that can protect cmRNA from RNases and efficiently deliver it into muscle and fat tissues as well as to the endothelium of the carotid artery. Establishing magnetofection for ex vivo cmRNA delivery for the first time, we suggest this method for potential enhanced and targeted delivery of cmRNA. This study introduces optimal cmRNA complexes with high ex vivo efficiency as good candidates for further in vivo cmRNA delivery. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Physical change in cytoplasmic messenger ribonucleoproteins in cells treated with inhibitors of mRNA transcription

    International Nuclear Information System (INIS)

    Dreyfuss, G.; Adam, S.A.; Choi, Y.D.

    1984-01-01

    Exposure of intact cells to UV light brings about cross-linking of polyadenylated mRNA to a set of cytoplasmic proteins which are in direct contact with the mRNA in vivo. Substantial amounts of an additional protein of molecular weight 38,000 become cross-linked to the mRNA when cells are treated with inhibitors of mRNA synthesis (actinomycin D, camptothecin, and 5,6-dichloro-1-beta-D-ribofuranosyl benzimidazole) or after infection with vesicular stomatitis virus. Cordycepin, which inhibits polyadenylation but not mRNA synthesis, has no such effect. Inhibitors of protein synthesis and of rRNA synthesis are also without effect on 38K cross-linking to mRNA. The onset of the effect of inhibitors of mRNA synthesis on the UV cross-linkable interaction between mRNA and 38K is rapid and reaches a maximal level in less than 60 min, and it is completely and rapidly reversible. In cells treated with actinomycin D, the amount of 38K which becomes cross-linked to mRNA is proportional to the extent of inhibition of mRNA synthesis. The association of 38K with mRNA during transcriptional arrest does not require protein synthesis because simultaneous treatment with the protein synthesis inhibitor emetine does not interfere with it. The effectors which promote the interaction of 38K with mRNA do not affect the proteins which are in contact with polyadenylated heterogeneous nuclear RNA and do not markedly affect protein synthesis in the cell. The 38K protein can be isolated with the polyribosomal polyadenylated fraction from which it was purified, and monoclonal antibodies against it were prepared

  11. Organism-specific rRNA capture system for application in next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Sai-Kam Li

    Full Text Available RNA-sequencing is a powerful tool in studying RNomics. However, the highly abundance of ribosomal RNAs (rRNA and transfer RNA (tRNA have predominated in the sequencing reads, thereby hindering the study of lowly expressed genes. Therefore, rRNA depletion prior to sequencing is often performed in order to preserve the subtle alteration in gene expression especially those at relatively low expression levels. One of the commercially available methods is to use DNA or RNA probes to hybridize to the target RNAs. However, there is always a concern with the non-specific binding and unintended removal of messenger RNA (mRNA when the same set of probes is applied to different organisms. The degree of such unintended mRNA removal varies among organisms due to organism-specific genomic variation. We developed a computer-based method to design probes to deplete rRNA in an organism-specific manner. Based on the computation results, biotinylated-RNA-probes were produced by in vitro transcription and were used to perform rRNA depletion with subtractive hybridization. We demonstrated that the designed probes of 16S rRNAs and 23S rRNAs can efficiently remove rRNAs from Mycobacterium smegmatis. In comparison with a commercial subtractive hybridization-based rRNA removal kit, using organism-specific probes is better in preserving the RNA integrity and abundance. We believe the computer-based design approach can be used as a generic method in preparing RNA of any organisms for next-generation sequencing, particularly for the transcriptome analysis of microbes.

  12. Transfer-messenger RNA controls the translation of cell-cycle and stress proteins in Streptomyces

    DEFF Research Database (Denmark)

    Barends, Sharief; Zehl, Martin; Bialek, Sylwia

    2010-01-01

    coelicolor, trans-translation has a specialized role in stress management. Analysis of proteins that were carboxy-terminally His(8)-tagged by a recombinant tmRNA identified only 10 targets, including the stress proteins: DnaK heat-shock protein 70, thiostrepton-induced protein A, universal stress protein A...... functionality for tmRNA, promoting the translation of the same mRNA it targets, at the expense of sacrificing the first nascent protein. In streptomycetes, tmRNA has evolved into a dedicated task force that ensures the instantaneous response to the exposure to stress....

  13. Illuminating Messengers: An Update and Outlook on RNA Visualization in Bacteria

    Directory of Open Access Journals (Sweden)

    Lieke A. van Gijtenbeek

    2017-06-01

    Full Text Available To be able to visualize the abundance and spatiotemporal features of RNAs in bacterial cells would permit obtaining a pivotal understanding of many mechanisms underlying bacterial cell biology. The first methods that allowed observing single mRNA molecules in individual cells were introduced by Bertrand et al. (1998 and Femino et al. (1998. Since then, a plethora of techniques to image RNA molecules with the aid of fluorescence microscopy has emerged. Many of these approaches are useful for the large eukaryotic cells but their adaptation to study RNA, specifically mRNA molecules, in bacterial cells progressed relatively slow. Here, an overview will be given of fluorescent techniques that can be used to reveal specific RNA molecules inside fixed and living single bacterial cells. It includes a critical evaluation of their caveats as well as potential solutions.

  14. Increased efficiency of exogenous messenger RNA translation in a Krebs ascites cell lysate.

    Science.gov (United States)

    Metafora, S; Terada, M; Dow, L W; Marks, P A; Bank, A

    1972-05-01

    Addition of a 0.5 M KCl wash fraction from rabbit reticulocyte ribosomes causes a 3- to 10-fold increase in the extent of translation of natural mRNAs by Krebs-cell lysates. In the presence of the wash fraction, 1 pmol of rabbit or mouse 10S RNA directs the incorporation of 80 pmol of leucine into rabbit globin. The addition of human 10S RNA results in the synthesis of equal amounts of human alpha and beta chains, identified by column chromatography. The stimulation by the wash fraction is almost completely dependent on added mammalian tRNA. In contrast to the wash fraction from rabbit reticulocytes, the wash fraction isolated from Krebs-cell ribosomes is inhibitory to both endogenous and exogenous mRNA translation. The stimulation by the wash fraction from rabbit ribosomes is not specific for globin mRNAs, but also increases endogenous, phage Qbeta, and viral RNA-directed protein synthesis.

  15. The RNA world, automatic sequences and oncogenetics

    Energy Technology Data Exchange (ETDEWEB)

    Tahir Shah, K

    1993-04-01

    We construct a model of the RNA world in terms of naturally evolving nucleotide sequences assuming only Crick-Watson base pairing and self-cleaving/splicing capability. These sequences have the following properties. (1) They are recognizable by an automation (or automata). That is, to each k-sequence, there exist a k-automation which accepts, recognizes or generates the k-sequence. These are known as automatic sequences. Fibonacci and Morse-Thue sequences are the most natural outcome of pre-biotic chemical conditions. (2) Infinite (resp. large) sequences are self-similar (resp. nearly self-similar) under certain rewrite rules and consequently give rise to fractal (resp.fractal-like) structures. Computationally, such sequences can also be generated by their corresponding deterministic parallel re-write system, known as a DOL system. The self-similar sequences are fixed points of their respective rewrite rules. Some of these automatic sequences have the capability that they can read or ``accept`` other sequences while others can detect errors and trigger error-correcting mechanisms. They can be enlarged and have block and/or palindrome structure. Linear recurring sequences such as Fibonacci sequence are simply Feed-back Shift Registers, a well know model of information processing machines. We show that a mutation of any rewrite rule can cause a combinatorial explosion of error and relates this to oncogenetical behavior. On the other hand, a mutation of sequences that are not rewrite rules, leads to normal evolutionary change. Known experimental results support our hypothesis. (author). Refs.

  16. The RNA world, automatic sequences and oncogenetics

    International Nuclear Information System (INIS)

    Tahir Shah, K.

    1993-04-01

    We construct a model of the RNA world in terms of naturally evolving nucleotide sequences assuming only Crick-Watson base pairing and self-cleaving/splicing capability. These sequences have the following properties. 1) They are recognizable by an automation (or automata). That is, to each k-sequence, there exist a k-automation which accepts, recognizes or generates the k-sequence. These are known as automatic sequences. Fibonacci and Morse-Thue sequences are the most natural outcome of pre-biotic chemical conditions. 2) Infinite (resp. large) sequences are self-similar (resp. nearly self-similar) under certain rewrite rules and consequently give rise to fractal (resp.fractal-like) structures. Computationally, such sequences can also be generated by their corresponding deterministic parallel re-write system, known as a DOL system. The self-similar sequences are fixed points of their respective rewrite rules. Some of these automatic sequences have the capability that they can read or 'accept' other sequences while others can detect errors and trigger error-correcting mechanisms. They can be enlarged and have block and/or palindrome structure. Linear recurring sequences such as Fibonacci sequence are simply Feed-back Shift Registers, a well know model of information processing machines. We show that a mutation of any rewrite rule can cause a combinatorial explosion of error and relates this to oncogenetical behavior. On the other hand, a mutation of sequences that are not rewrite rules, leads to normal evolutionary change. Known experimental results support our hypothesis. (author). Refs

  17. Labeling of eukaryotic messenger RNA 5' terminus with phosphorus -32: use of tobacco acid pyrophosphatase for removal of cap structures

    International Nuclear Information System (INIS)

    Lockard, R.E.; Rieser, L.; Vournakis, J.N.

    1981-01-01

    In recent years, there has been a growing appreciation of the potential applications of 5'- 32 P-end-labeled mRNA, not only for screening recombinant clones and mapping gene structure, but also for revealing possible nucleotide sequence and structural signals within mRNA molecules themselves, which may be important for eukaryotic mRNA processing and turnover and for controlling differential rates of translational initiation. Three major problems, however, have retarded progress in this area, lack of methods for efficient and reproducible removal of m7G5ppp5'-cap structures, which maintain the integrity of an RNA molecule; inability to generate a sufficient amount of labeled mRNA, owing to the limited availability of most pure mRNA species; and the frequent problem of RNA degradation during in vitro end-labeling owing to RNAse contamination. The procedures presented here permit one to decap and label minute quantities of mRNA, effectively. Tobacco acid pyrophosphatase is relatively efficient in removing cap structures from even nanogram quantities of available mRNA, and enough radioactivity can be easily generated from minute amounts ofintact mRNA with very high-specific-activity [gamma- 32 P]ATP and the inhibition of ribonuclease contamination with diethylpyrocarbonate. These procedures can be modified and applied to almost any other type of RNA molecule as well. In Section III of this volume, we explore in detail how effectively 5'-end-labeled mRNA can be used not only for nucleotide sequence analysis, but also for mapping mRNA secondary structure

  18. Expression of μ, κ, and δ opioid receptor messenger RNA in the human CNS: a 33P in situ hybridization study

    International Nuclear Information System (INIS)

    Peckys, D.; Landwehrmeyer, G.B.

    1999-01-01

    The existence of at least three opioid receptor types, referred to as μ, κ, and δ, is well established. Complementary DNAs corresponding to the pharmacologically defined μ, κ, and δ opioid receptors have been isolated in various species including man. The expression patterns of opioid receptor transcripts in human brain has not been established with a cellular resolution, in part because of the low apparent abundance of opioid receptor messenger RNAs in human brain. To visualize opioid receptor messenger RNAs we developed a sensitive in situ hybridization histochemistry method using 33 P-labelled RNA probes. In the present study we report the regional and cellular expression of μ, κ, and δ opioid receptor messenger RNAs in selected areas of the human brain. Hybridization of the different opioid receptor probes resulted in distinct labelling patterns. For the μ and κ opioid receptor probes, the most intense regional signals were observed in striatum, thalamus, hypothalamus, cerebral cortex, cerebellum and certain brainstem areas as well as the spinal cord. The most intense signals for the δ opioid receptor probe were found in cerebral cortex. Expression of opioid receptor transcripts was restricted to subpopulations of neurons within most regions studied demonstrating differences in the cellular expression patterns of μ, κ, and δ opioid receptor messenger RNAs in numerous brain regions. The messenger RNA distribution patterns for each opioid receptor corresponded in general to the distribution of opioid receptor binding sites as visualized by receptor autoradiography. However, some mismatches, for instance between μ opioid receptor receptor binding and μ opioid receptor messenger RNA expression in the anterior striatum, were observed. A comparison of the distribution patterns of opioid receptor messenger RNAs in the human brain and that reported for the rat suggests a homologous expression pattern in many regions. However, in the human brain, κ

  19. Photoreversible UV-inactivation of messenger RNA in an insect embryo (Smittia spec., chironomidae, diptera)

    International Nuclear Information System (INIS)

    Jaeckle, H.; Kalthoff, K.

    1980-01-01

    Smittia embryos were UV-irradiated during intravitelline cleavage while nuclei are heavily shielded by yolk-rich cytoplasm and do not synthesize detectable amounts of RNA. Irradiation at 265, 285 and 295 nm wavelength caused biological inactivation, and pyrimidine dimer formation in maternal RNA. Marked effects on protein synthesis were also observed: (1) the overall rate of 35 S-methionine incorporation in vivo was reduced to less than half of the normal rate, (2) two dimensional gel electrophoresis revealed quantitative variations in the synthetic rate of some polypeptides and the appearance of new ones in UV-irradiated embryos, (3) translation of polyadenylated RNA from Smittia embryos in a cell-free system was inhibited by UV-irradiation in vivo, (4) the apparent degradation during early embryogenesis, of maternal polyadenylated RNA was retarded in UV-irradiated embryos. Exposure to light (400 nm) after UV caused partial photoreversal of all UV effects observed. This is the first data showing that animal mRNA, after UV-irradiation, can be photoreactivated in vivo. The results also strongly suggest that the photorepairable lesions consist of pyrimidine dimers generated in a photosensitized reaction. (author)

  20. Transforming growth factor-beta messenger RNA and protein in murine colitis

    DEFF Research Database (Denmark)

    Whiting, C V; Williams, A M; Claesson, Mogens Helweg

    2001-01-01

    Using a CD4+ T-cell-transplanted SCID mouse model of colitis, we have analyzed TGF-beta transcription and translation in advanced disease. By in situ hybridization, the epithelium of both control and inflamed tissues transcribed TGF-beta1 and TGF-beta3 mRNAs, but both were expressed significantly...... farther along the crypt axis in disease. Control lamina propria cells transcribed little TGF-beta1 or TGF-beta3 mRNA, but in inflamed tissues many cells expressed mRNA for both isoforms. No TGF-beta2 message was detected in either control or inflamed tissues. Immunohistochemistry for latent and active TGF...

  1. INDUCTION OF INTERLEUKIN-1-BETA MESSENGER-RNA AFTER FOCAL CEREBRAL-ISCHEMIA IN THE RAT

    NARCIS (Netherlands)

    BUTTINI, M; SAUTER, A; BODDEKE, HWGM

    The expression of interleukin-1beta (IL-1beta) mRNA in the brain in response to cerebral ischaemia in rats was examined using in situ hybridization histochemistry. Focal cerebral ischaemia was induced in spontaneously hypertensive rats by permanent occlusion of the left middle cerebral artery

  2. Rational design of avian metapneumovirus live attenuated vaccines by inhibiting viral messenger RNA cap methyltransferase

    Science.gov (United States)

    Avian metapneumovirus (aMPV), also known as avian pneumovirus or turkey rhinotracheitis, is a non-segmented negative-sense RNA virus belonging to the family of Paramyxoviridae, the subfamily Pneumovirinae, and the genus Metapneumovirus. aMPV is the causative agent of respiratory tract infection and ...

  3. Fetuin and fetuin messenger RNA in granulosa cells of the rat ovary

    DEFF Research Database (Denmark)

    Høyer, Poul Erik; Terkelsen, O B; Grete Byskov, A

    2001-01-01

    during maturation of the oocyte. We demonstrated fetuin mRNA in the rat ovary by reverse transcriptase-polymerase chain reaction and localized it by in situ hybridization. Fetuin mRNA was present in all granulosa cells of growing and large follicles. Immunohistochemical analysis revealed that the fetuin...... protein was only present in some of the small, growing follicles. In large, healthy follicles, fetuin protein was confined to cumulus cells and granulosa cells bordering the antrum. Fetuin was present in atretic follicles, but the staining pattern differed from that of healthy follicles. The follicular...... antrum contained a substantial amount of fetuin, but whether granulosa cells secreted it or it originated in the ovarian blood supply could not be confirmed. We concluded that at least a portion of the fetuin is produced by granulosa cells of growing and large follicles, suggesting that fetuin may...

  4. Tissue-specific splicing pattern of fibronectin messenger RNA precursor during development and aging in rat

    OpenAIRE

    1991-01-01

    Fibronectin isoforms are generated by the alternative splicing of a primary transcript derived from a single gene. In rat at least three regions of the molecule are involved: EIIIA, EIIIB, and V. This study investigated the splicing patterns of these regions during development and aging, by means of ribonuclease protection analysis. Between fetal and adult rat, the extent of inclusion of the EIIIA and/or EIIIB region in fibronectin mRNA varied according to the type of tissue analyzed; but the...

  5. MCT-1 protein interacts with the cap complex and modulates messenger RNA translational profiles

    DEFF Research Database (Denmark)

    Reinert, Line; Shi, B; Nandi, S

    2006-01-01

    MCT-1 is an oncogene that was initially identified in a human T cell lymphoma and has been shown to induce cell proliferation as well as activate survival-related pathways. MCT-1 contains the PUA domain, a recently described RNA-binding domain that is found in several tRNA and rRNA modification...... enzymes. Here, we established that MCT-1 protein interacts with the cap complex through its PUA domain and recruits the density-regulated protein (DENR/DRP), containing the SUI1 translation initiation domain. Through the use of microarray analysis on polysome-associated mRNAs, we showed that up......-regulation of MCT-1 was able to modulate the translation profiles of BCL2L2, TFDP1, MRE11A, cyclin D1, and E2F1 mRNAs, despite equivalent levels of mRNAs in the cytoplasm. Our data establish a role for MCT-1 in translational regulation, and support a linkage between translational control and oncogenesis....

  6. Expression of preprotachykinin-A and neuropeptide-Y messenger RNA in the thymus.

    Science.gov (United States)

    Ericsson, A; Geenen, V; Robert, F; Legros, J J; Vrindts-Gevaert, Y; Franchimont, P; Brene, S; Persson, H

    1990-08-01

    The preprotachykinin-A gene, the common gene of mRNAs encoding both substance-P (SP) and neurokinin-A (NKA), was shown to be expressed in Sprague-Dawley rat thymus by detection of specific mRNA in gel-blot analyses. In situ hybridization revealed dispersed PPT-A-labeled cells in sections from rat thymus, with a concentration of grains over a subpopulation of cells in the thymic medulla. Also, neuropeptide-Y mRNA-expressing cells were found in the rat thymus, primarily in the thymic medulla. Rat thymic extracts contained SP-like immunoreactivity (SP-LI), and the major part of the immunoreactivity coeluted with authentic SP and SP sulfoxide standards. SP-LI was also detected in human thymus, which contained between 0.09-0.88 ng SP-LI/g wet wt. Evidence for translation of preprotachykinin-A mRNA in the rat thymus was obtained from the demonstration of NKA-LI in thymic cells with an epithelial-like cell morphology. Combined with previous observations on the immunoregulatory roles of tachykinin peptides and the existence of specific receptors on immunocompetent cells, the demonstration of intrathymic synthesis of NKA suggests a role for NKA-LI peptides in T-cell differentiation in the thymus.

  7. Skeletal muscle microRNA and messenger RNA profiling in cofilin-2 deficient mice reveals cell cycle dysregulation hindering muscle regeneration.

    Directory of Open Access Journals (Sweden)

    Sarah U Morton

    Full Text Available Congenital myopathies are rare skeletal muscle diseases presenting in early age with hypotonia and weakness often linked to a genetic defect. Mutations in the gene for cofilin-2 (CFL2 have been identified in several families as a cause of congenital myopathy with nemaline bodies and cores. Here we explore the global messenger and microRNA expression patterns in quadriceps muscle samples from cofillin-2-null mice and compare them with sibling-matched wild-type mice to determine the molecular pathways and mechanisms involved. Cell cycle processes are markedly dysregulated, with altered expression of genes involved in mitotic spindle formation, and evidence of loss of cell cycle checkpoint regulation. Importantly, alterations in cell cycle, apoptosis and proliferation pathways are present in both mRNA and miRNA expression patterns. Specifically, p21 transcript levels were increased, and the expression of p21 targets, such as cyclin D and cyclin E, was decreased. We therefore hypothesize that deficiency of cofilin-2 is associated with interruption of the cell cycle at several checkpoints, hindering muscle regeneration. Identification of these pathways is an important step towards developing appropriate therapies against various congenital myopathies.

  8. Insulin-like growth factor II messenger RNA-binding protein-3 is an independent prognostic factor in uterine leiomyosarcoma.

    Science.gov (United States)

    Yasutake, Nobuko; Ohishi, Yoshihiro; Taguchi, Kenichi; Hiraki, Yuka; Oya, Masafumi; Oshiro, Yumi; Mine, Mari; Iwasaki, Takeshi; Yamamoto, Hidetaka; Kohashi, Kenichi; Sonoda, Kenzo; Kato, Kiyoko; Oda, Yoshinao

    2018-04-01

    The aim of this study was to identify the prognostic factors of uterine leiomyosarcoma (ULMS). We reviewed 60 cases of surgically resected ULMSs and investigated conventional clinicopathological factors, together with the expression of insulin-like growth factor II messenger RNA-binding protein-3 (IMP3), hormone receptors and cell cycle regulatory markers by immunohistochemistry. Mediator complex subunit 12 (MED12) mutation analysis was also performed. Univariate analyses revealed that advanced stage (P < 0.0001), older age (P = 0.0244) and IMP3 expression (P = 0.0011) were significant predictors of a poor outcome. Multivariate analysis revealed advanced stage (P < 0.0001) and IMP3 (P = 0.0373) as independent predictors of a poor prognosis. Expressions of cell cycle markers and hormone receptors, and MED12 mutations (12% in ULMSs) were not identified as prognostic markers in this study. IMP3 expression in ULMS could be a marker of a poor prognosis. © 2017 John Wiley & Sons Ltd.

  9. Characterization of human endothelial cell urokinase-type plasminogen activator receptor protein and messenger RNA

    DEFF Research Database (Denmark)

    Barnathan, E S; Kuo, A; Karikó, K

    1990-01-01

    Human umbilical vein endothelial cells in culture (HUVEC) express receptors for urokinase-type plasminogen activators (u-PA). The immunochemical nature of this receptor and its relationship to u-PA receptors expressed by other cell types is unknown. Cross-linking active site-blocked u-PA to HUVEC...... an endothelial cell cDNA library using the polymerase chain reaction (PCR) and oligonucleotide primers corresponding to the DNA sequence of the receptor cloned from transformed human fibroblasts (Roldan et al, EMBO J 9:467, 1990). The size of the cDNA (approximately 1,054 base pairs, bp) and the presence...

  10. PACCMIT/PACCMIT-CDS: identifying microRNA targets in 3' UTRs and coding sequences.

    Science.gov (United States)

    Šulc, Miroslav; Marín, Ray M; Robins, Harlan S; Vaníček, Jiří

    2015-07-01

    The purpose of the proposed web server, publicly available at http://paccmit.epfl.ch, is to provide a user-friendly interface to two algorithms for predicting messenger RNA (mRNA) molecules regulated by microRNAs: (i) PACCMIT (Prediction of ACcessible and/or Conserved MIcroRNA Targets), which identifies primarily mRNA transcripts targeted in their 3' untranslated regions (3' UTRs), and (ii) PACCMIT-CDS, designed to find mRNAs targeted within their coding sequences (CDSs). While PACCMIT belongs among the accurate algorithms for predicting conserved microRNA targets in the 3' UTRs, the main contribution of the web server is 2-fold: PACCMIT provides an accurate tool for predicting targets also of weakly conserved or non-conserved microRNAs, whereas PACCMIT-CDS addresses the lack of similar portals adapted specifically for targets in CDS. The web server asks the user for microRNAs and mRNAs to be analyzed, accesses the precomputed P-values for all microRNA-mRNA pairs from a database for all mRNAs and microRNAs in a given species, ranks the predicted microRNA-mRNA pairs, evaluates their significance according to the false discovery rate and finally displays the predictions in a tabular form. The results are also available for download in several standard formats. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Differential effects of common variants in SCN2A on general cognitive ability, brain physiology, and messenger RNA expression in schizophrenia cases and control individuals.

    Science.gov (United States)

    Dickinson, Dwight; Straub, Richard E; Trampush, Joey W; Gao, Yuan; Feng, Ningping; Xie, Bin; Shin, Joo Heon; Lim, Hun Ki; Ursini, Gianluca; Bigos, Kristin L; Kolachana, Bhaskar; Hashimoto, Ryota; Takeda, Masatoshi; Baum, Graham L; Rujescu, Dan; Callicott, Joseph H; Hyde, Thomas M; Berman, Karen F; Kleinman, Joel E; Weinberger, Daniel R

    2014-06-01

    One approach to understanding the genetic complexity of schizophrenia is to study associated behavioral and biological phenotypes that may be more directly linked to genetic variation. To identify single-nucleotide polymorphisms associated with general cognitive ability (g) in people with schizophrenia and control individuals. Genomewide association study, followed by analyses in unaffected siblings and independent schizophrenia samples, functional magnetic resonance imaging studies of brain physiology in vivo, and RNA sequencing in postmortem brain samples. The discovery cohort and unaffected siblings were participants in the National Institute of Mental Health Clinical Brain Disorders Branch schizophrenia genetics studies. Additional schizophrenia cohorts were from psychiatric treatment settings in the United States, Japan, and Germany. The discovery cohort comprised 339 with schizophrenia and 363 community control participants. Follow-up analyses studied 147 unaffected siblings of the schizophrenia cases and independent schizophrenia samples including a total of an additional 668 participants. Imaging analyses included 87 schizophrenia cases and 397 control individuals. Brain tissue samples were available for 64 cases and 61 control individuals. We studied genomewide association with g, by group, in the discovery cohort. We used selected genotypes to test specific associations in unaffected siblings and independent schizophrenia samples. Imaging analyses focused on activation in the prefrontal cortex during working memory. Brain tissue studies yielded messenger RNA expression levels for RefSeq transcripts. The schizophrenia discovery cohort showed genomewide-significant association of g with polymorphisms in sodium channel gene SCN2A, accounting for 10.4% of g variance (rs10174400, P = 9.27 × 10(-10)). Control individuals showed a trend for g/genotype association with reversed allelic directionality. The genotype-by-group interaction was also genomewide

  12. Culture temperature affects human chondrocyte messenger RNA expression in monolayer and pellet culture systems.

    Directory of Open Access Journals (Sweden)

    Akira Ito

    Full Text Available Cell-based therapy has been explored for articular cartilage regeneration. Autologous chondrocyte implantation is a promising cell-based technique for repairing articular cartilage defects. However, there are several issues such as chondrocyte de-differentiation. While numerous studies have been designed to overcome some of these issues, only a few have focused on the thermal environment that can affect chondrocyte metabolism and phenotype. In this study, the effects of different culture temperatures on human chondrocyte metabolism- and phenotype-related gene expression were investigated in 2D and 3D environments. Human chondrocytes were cultured in a monolayer or in a pellet culture system at three different culture temperatures (32°C, 37°C, and 41°C for 3 days. The results showed that the total RNA level, normalized to the threshold cycle value of internal reference genes, was higher at lower temperatures in both culture systems. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH and citrate synthase (CS, which are involved in glycolysis and the citric acid cycle, respectively, were expressed at similar levels at 32°C and 37°C in pellet cultures, but the levels were significantly lower at 41°C. Expression of the chondrogenic markers, collagen type IIA1 (COL2A1 and aggrecan (ACAN, was higher at 37°C than at 32°C and 41°C in both culture systems. However, this phenomenon did not coincide with SRY (sex-determining region Y-box 9 (SOX9, which is a fundamental transcription factor for chondrogenesis, indicating that a SOX9-independent pathway might be involved in this phenomenon. In conclusion, the expression of chondrocyte metabolism-related genes at 32°C was maintained or enhanced compared to that at 37°C. However, chondrogenesis-related genes were further induced at 37°C in both culture systems. Therefore, manipulating the culture temperature may be an advantageous approach for regulating human chondrocyte metabolic activity and

  13. Culture temperature affects human chondrocyte messenger RNA expression in monolayer and pellet culture systems.

    Science.gov (United States)

    Ito, Akira; Nagai, Momoko; Tajino, Junichi; Yamaguchi, Shoki; Iijima, Hirotaka; Zhang, Xiangkai; Aoyama, Tomoki; Kuroki, Hiroshi

    2015-01-01

    Cell-based therapy has been explored for articular cartilage regeneration. Autologous chondrocyte implantation is a promising cell-based technique for repairing articular cartilage defects. However, there are several issues such as chondrocyte de-differentiation. While numerous studies have been designed to overcome some of these issues, only a few have focused on the thermal environment that can affect chondrocyte metabolism and phenotype. In this study, the effects of different culture temperatures on human chondrocyte metabolism- and phenotype-related gene expression were investigated in 2D and 3D environments. Human chondrocytes were cultured in a monolayer or in a pellet culture system at three different culture temperatures (32°C, 37°C, and 41°C) for 3 days. The results showed that the total RNA level, normalized to the threshold cycle value of internal reference genes, was higher at lower temperatures in both culture systems. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and citrate synthase (CS), which are involved in glycolysis and the citric acid cycle, respectively, were expressed at similar levels at 32°C and 37°C in pellet cultures, but the levels were significantly lower at 41°C. Expression of the chondrogenic markers, collagen type IIA1 (COL2A1) and aggrecan (ACAN), was higher at 37°C than at 32°C and 41°C in both culture systems. However, this phenomenon did not coincide with SRY (sex-determining region Y)-box 9 (SOX9), which is a fundamental transcription factor for chondrogenesis, indicating that a SOX9-independent pathway might be involved in this phenomenon. In conclusion, the expression of chondrocyte metabolism-related genes at 32°C was maintained or enhanced compared to that at 37°C. However, chondrogenesis-related genes were further induced at 37°C in both culture systems. Therefore, manipulating the culture temperature may be an advantageous approach for regulating human chondrocyte metabolic activity and chondrogenesis.

  14. Primary structure of the α-subunit of Na+, K+-ATPase. II. Isolation, reverse transcription, and cloning of messenger RNA

    International Nuclear Information System (INIS)

    Petrukhin, K.E.; Broude, N.E.; Arsenyan, S.G.; Grishin, A.V.; Dzhandzhugazyan, K.N.; Modyanov, N.N.

    1986-01-01

    The messenger RNA coding the α-subunit of Na + ,K + -ATPase has been isolated from the outer medullary layer of porcine kidneys. The mRNA gives a specific hybridization band in the 25S-26S region with three oligonucleotide probes synthesized on the basis of information on the structure of three peptides isolated from a tryptic hydrolyzate of the α-subunit of Na + ,K + -ATPase. The translation of the mRNA in Xenopus laevis oocytes followed by immunochemical identification of the products of synthesis confirmed the presence of the mRNA of the α-subunit of Na + ,K + -ATPase in an enriched fraction of poly(A + )-RNA. This preparation has been used for the synthesis of cloning of double-stranded cDNA

  15. Primary structure of the. cap alpha. -subunit of Na/sup +/, K/sup +/-ATPase. II. Isolation, reverse transcription, and cloning of messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Petrukhin, K.E.; Broude, N.E.; Arsenyan, S.G.; Grishin, A.V.; Dzhandzhugazyan, K.N.; Modyanov, N.N.

    1986-10-01

    The messenger RNA coding the ..cap alpha..-subunit of Na/sup +/,K/sup +/-ATPase has been isolated from the outer medullary layer of porcine kidneys. The mRNA gives a specific hybridization band in the 25S-26S region with three oligonucleotide probes synthesized on the basis of information on the structure of three peptides isolated from a tryptic hydrolyzate of the ..cap alpha..-subunit of Na/sup +/,K/sup +/-ATPase. The translation of the mRNA in Xenopus laevis oocytes followed by immunochemical identification of the products of synthesis confirmed the presence of the mRNA of the ..cap alpha..-subunit of Na/sup +/,K/sup +/-ATPase in an enriched fraction of poly(A/sup +/)-RNA. This preparation has been used for the synthesis of cloning of double-stranded cDNA.

  16. PACCMIT/PACCMIT-CDS: identifying microRNA targets in 3′ UTRs and coding sequences

    Science.gov (United States)

    Šulc, Miroslav; Marín, Ray M.; Robins, Harlan S.; Vaníček, Jiří

    2015-01-01

    The purpose of the proposed web server, publicly available at http://paccmit.epfl.ch, is to provide a user-friendly interface to two algorithms for predicting messenger RNA (mRNA) molecules regulated by microRNAs: (i) PACCMIT (Prediction of ACcessible and/or Conserved MIcroRNA Targets), which identifies primarily mRNA transcripts targeted in their 3′ untranslated regions (3′ UTRs), and (ii) PACCMIT-CDS, designed to find mRNAs targeted within their coding sequences (CDSs). While PACCMIT belongs among the accurate algorithms for predicting conserved microRNA targets in the 3′ UTRs, the main contribution of the web server is 2-fold: PACCMIT provides an accurate tool for predicting targets also of weakly conserved or non-conserved microRNAs, whereas PACCMIT-CDS addresses the lack of similar portals adapted specifically for targets in CDS. The web server asks the user for microRNAs and mRNAs to be analyzed, accesses the precomputed P-values for all microRNA–mRNA pairs from a database for all mRNAs and microRNAs in a given species, ranks the predicted microRNA–mRNA pairs, evaluates their significance according to the false discovery rate and finally displays the predictions in a tabular form. The results are also available for download in several standard formats. PMID:25948580

  17. Diagnostic accuracy of circulating thyrotropin receptor messenger RNA combined with neck ultrasonography in patients with Bethesda III-V thyroid cytology.

    Science.gov (United States)

    Aliyev, Altay; Patel, Jinesh; Brainard, Jennifer; Gupta, Manjula; Nasr, Christian; Hatipoglu, Betul; Siperstein, Allan; Berber, Eren

    2016-01-01

    The aim of this study was to analyze the usefulness of thyrotropin receptor messenger RNA (TSHR-mRNA) combined with neck ultrasonography (US) in the management of thyroid nodules with Bethesda III-V cytology. Cytology slides of patients with a preoperative fine needle aspiration (FNA) and TSHR-mRNA who underwent thyroidectomy between 2002 and 2011 were recategorized based on the Bethesda classification. Results of thyroid FNA, TSHR-mRNA, and US were compared with the final pathology. Sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) were calculated. There were 12 patients with Bethesda III, 112 with Bethesda IV, and 58 with Bethesda V cytology. The sensitivity of TSHR-mRNA in predicting cancer was 33%, 65%, and 79 %, and specificity was 67%, 66%, and 71%, for Bethesda III, IV, and V categories, respectively. For the same categories, the PPV of TSHR-mRNA was 25%, 33%, and 79%, respectively; whereas the NPV was 75%, 88%, and 71%, respectively. The addition of neck US to TSHR-mRNA increased the NPV to 100% for Bethesda III, and 86%, for Bethesda IV, and 82% for Bethesda V disease. This study documents the potential usefulness of TSHR-mRNA for thyroid nodules with Bethesda III-V FNA categories. TSHR-mRNA may be used to exclude Bethesda IV disease. A large sample analysis is needed to determine its accuracy for Bethesda category III nodules. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Size, Shape, and Sequence-Dependent Immunogenicity of RNA Nanoparticles.

    Science.gov (United States)

    Guo, Sijin; Li, Hui; Ma, Mengshi; Fu, Jian; Dong, Yizhou; Guo, Peixuan

    2017-12-15

    RNA molecules have emerged as promising therapeutics. Like all other drugs, the safety profile and immune response are important criteria for drug evaluation. However, the literature on RNA immunogenicity has been controversial. Here, we used the approach of RNA nanotechnology to demonstrate that the immune response of RNA nanoparticles is size, shape, and sequence dependent. RNA triangle, square, pentagon, and tetrahedron with same shape but different sizes, or same size but different shapes were used as models to investigate the immune response. The levels of pro-inflammatory cytokines induced by these RNA nanoarchitectures were assessed in macrophage-like cells and animals. It was found that RNA polygons without extension at the vertexes were immune inert. However, when single-stranded RNA with a specific sequence was extended from the vertexes of RNA polygons, strong immune responses were detected. These immunostimulations are sequence specific, because some other extended sequences induced little or no immune response. Additionally, larger-size RNA square induced stronger cytokine secretion. 3D RNA tetrahedron showed stronger immunostimulation than planar RNA triangle. These results suggest that the immunogenicity of RNA nanoparticles is tunable to produce either a minimal immune response that can serve as safe therapeutic vectors, or a strong immune response for cancer immunotherapy or vaccine adjuvants. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Size, Shape, and Sequence-Dependent Immunogenicity of RNA Nanoparticles

    Directory of Open Access Journals (Sweden)

    Sijin Guo

    2017-12-01

    Full Text Available RNA molecules have emerged as promising therapeutics. Like all other drugs, the safety profile and immune response are important criteria for drug evaluation. However, the literature on RNA immunogenicity has been controversial. Here, we used the approach of RNA nanotechnology to demonstrate that the immune response of RNA nanoparticles is size, shape, and sequence dependent. RNA triangle, square, pentagon, and tetrahedron with same shape but different sizes, or same size but different shapes were used as models to investigate the immune response. The levels of pro-inflammatory cytokines induced by these RNA nanoarchitectures were assessed in macrophage-like cells and animals. It was found that RNA polygons without extension at the vertexes were immune inert. However, when single-stranded RNA with a specific sequence was extended from the vertexes of RNA polygons, strong immune responses were detected. These immunostimulations are sequence specific, because some other extended sequences induced little or no immune response. Additionally, larger-size RNA square induced stronger cytokine secretion. 3D RNA tetrahedron showed stronger immunostimulation than planar RNA triangle. These results suggest that the immunogenicity of RNA nanoparticles is tunable to produce either a minimal immune response that can serve as safe therapeutic vectors, or a strong immune response for cancer immunotherapy or vaccine adjuvants.

  20. Ultra-sensitive DNA assay based on single-molecule detection coupled with fluorescent quantum dot-labeling and its application to determination of messenger RNA

    International Nuclear Information System (INIS)

    Li Li; Li Xincang; Li Lu; Wang Jinxing; Jin Wenrui

    2011-01-01

    An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10 -14 mol L -1 . Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.

  1. Ultra-sensitive DNA assay based on single-molecule detection coupled with fluorescent quantum dot-labeling and its application to determination of messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Li Li [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Li Xincang [School of Life Sciences, Shandong University, Jinan 250100 (China); Li Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

    2011-01-24

    An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10{sup -14} mol L{sup -1}. Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.

  2. Reprogramming human umbilical cord mesenchymal stromal cells to islet-like cells with the use of in vitro-synthesized pancreatic-duodenal homebox 1 messenger RNA.

    Science.gov (United States)

    Wang, Xiao Li; Hu, Pei; Guo, Xing Rong; Yan, Ding; Yuan, Yahong; Yan, Shi Rong; Li, Dong Sheng

    2014-11-01

    Human umbilical cord mesenchymal stromal cells (hUC-MSCs) hold great potential as a therapeutic candidate to treat diabetes, owing to their unlimited source and ready availability. In this study, we differentiated hUC-MSCs with in vitro-synthesized pancreatic-duodenal homebox 1 (PDX1) messenger (m)RNA into islet-like cell clusters. hUC-MSCs were confirmed by both biomarker detection and functional differentiation. In vitro-synthesized PDX1 messenger RNA can be transfected into hUC-MSCs efficiently. The upregulated expression of PDX1 protein can be detected 4 h after transfection and remains detectable for 36 h. The induction of islet-like structures was confirmed by means of morphology and dithizone staining. Reverse transcriptase-polymerase chain reaction results revealed the expression of some key pancreatic transcription factors, such as PDX1, NeuroD, NKX6.1, Glut-2 and insulin in islet-like cell clusters. Immunofluorescence analysis showed that differentiated cells express both insulin and C-peptide. Enzyme-linked immunosorbent assay analysis validated the insulin secretion of islet-like cell clusters in response to the glucose stimulation. Our results demonstrate the use of in vitro-synthesized PDX1 messenger RNA to differentiate hUC-MSCs into islet-like cells and pave the way toward the development of reprogramming and directed-differentiation methods for the expression of encoded proteins. Copyright © 2014 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  3. Isolation and characterization of the messenger RNA and the gene coding for a proline-rich zein from corn endosperm

    International Nuclear Information System (INIS)

    Wang, S.Z.

    1985-01-01

    Gamma-zein, a proline-rich protein from corn endosperm, was investigated at the molecular level. Immunological and electrophoretic data indicated that gamma-zein was deposited into protein bodies in corn endosperm. Both isolated polysomes and poly(A) + mRNA were found to direct into vitro synthesis of gamma-zein in a wheat germ system. In vitro synthesized gamma-zein was immunoprecipitated from the total in vitro translation products. A cDNA expression library was constructed by reverse transcription of total poly(A) + mRNA using pUC8 plasmid as vector and E. coli strain DH1 as host. The library was screened for the expression of gamma-zein and alpha-zein by specific antibodies. The library was also screened with 32 P-labeled gamma-zein and alpha-zein cDNA probes. The results indicated that gamma-zein and its fragments were readily expressed in E. coli while alpha-zein was not. Seven independently selected clones, six of which were selected by antibody and one by a cDNA probe, were sequenced. A comparison of sequence information from seven clones revealed that their overlapping regions were identical. This suggests that gamma-zein is encoded by a single gene. This finding is in conflict with what was expected on the basis of extensive charge heterogeneity of gamma-zein in isoelectric focusing. Individual bands cut from an IEF gel were rerun and shown to give several bands suggesting that the charge heterogeneity of gamma-zein may be an artifact. Sequence information of gamma-zein indicated that the gene encodes a mature protein whose primary structure includes 204 amino acids and has a molecular weight of 21,824 daltons

  4. Translational Influence on Messenger Stability

    DEFF Research Database (Denmark)

    Eriksen, Mette

    -termination to be a global phenomena in gene regulation. The influence of codon usage in the early coding region on messenger stability was examined, in order to establish how fast or slow the ribosome has to decode the sequence for it to protect the messenger from degradation. The experiments demonstrated that very fast...

  5. Design of a synthetic luminescent probe from a biomolecule binding domain: selective detection of AU-rich mRNA sequences.

    Science.gov (United States)

    Raibaut, Laurent; Vasseur, William; Shimberg, Geoffrey D; Saint-Pierre, Christine; Ravanat, Jean-Luc; Michel, Sarah L J; Sénèque, Olivier

    2017-02-01

    We report the design of a luminescent sensor based upon the zinc finger (ZF) protein TIS11d, that allows for the selective time-resolved detection of the UUAUUUAUU sequence of the 3'-untranslated region of messenger RNA. This sensor is composed of the tandem ZF RNA binding domain of TIS11d functionalized with a luminescent Tb 3+ complex on one of the ZFs and a sensitizing antenna on the other. This work provides the proof of principle that an RNA binding protein can be re-engineered as an RNA sensor and, more generally, that tunable synthetic luminescent probes for biomolecules can be obtained by modifying biomolecule-binding domains.

  6. Changes in growth hormone (GH) messenger RNA (GH mRNA) expression in the rat anterior pituitary after single interferon (IFN) alpha administration

    International Nuclear Information System (INIS)

    Romanowski, W.; Braczkowski, R.; Nowakowska-Zajdel, E.; Muc-Wierzgon, M.; Zubelewicz-Szkodzinska, B.; Kosiewicz, J.; Korzonek, I.

    2006-01-01

    Introduction: Interferon a (IFN-a) is a cytokine with pleiotropic effects which, via different pathways, influences the secretion of certain cytokines and hormones. Growth hormone (GH) secreted from the pituitary has physiological effects on various target tissues. The question is how IFN-a administered in various types of disease influences GH secretion. This study investigated the acute effect of IFN-a on GH mRNA expression in the rat anterior pituitary. Objective: The aim of the study was to measure the cellular expression of GH mRNA by in situ hybridisation in the anterior pituitary after a single administration of IFN-a. Material and methods: Rats were administered an intraperitoneal injection of IFN-a or saline. The rat pituitaries were taken 2 and 4 hours after IFN/saline administration and kept frozen until in situ hybridisation histochemistry. A 31 - base 35S -labelled oligonucleotide probe complementary to part of the exonic mRNA sequence coding for GH mRNA was used. All control and experimental sections were hybridised in the same hybridisation reaction. Results: Acute administration of interferon a increased GH mRNA expression in the anterior pituitary in the 4-hour group in comparison with the control group, and there was no difference between the control group and the 2-hour rats. Conclusion: A single IFN-a administration was found to exert an influence on anterior pituitary GH mRNA expression. These observations may pave the way for presenting a possible new action of IFN-a. (author) GH mRNA, anterior pituitary, interferon

  7. Phylogenetic relationships of Salmonella based on rRNA sequences

    DEFF Research Database (Denmark)

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    separated by 16S rRNA analysis and found to be closely related to the Escherichia coli and Shigella complex by both 16S and 23S rRNA analyses. The diphasic serotypes S. enterica subspp. I and VI were separated from the monophasic serotypes subspp. IIIa and IV, including S. bongori, by 23S rRNA sequence...

  8. Novel Approach to Analyzing MFE of Noncoding RNA Sequences.

    Science.gov (United States)

    George, Tina P; Thomas, Tessamma

    2016-01-01

    Genomic studies have become noncoding RNA (ncRNA) centric after the study of different genomes provided enormous information on ncRNA over the past decades. The function of ncRNA is decided by its secondary structure, and across organisms, the secondary structure is more conserved than the sequence itself. In this study, the optimal secondary structure or the minimum free energy (MFE) structure of ncRNA was found based on the thermodynamic nearest neighbor model. MFE of over 2600 ncRNA sequences was analyzed in view of its signal properties. Mathematical models linking MFE to the signal properties were found for each of the four classes of ncRNA analyzed. MFE values computed with the proposed models were in concordance with those obtained with the standard web servers. A total of 95% of the sequences analyzed had deviation of MFE values within ±15% relative to those obtained from standard web servers.

  9. Reconstruction of ancestral RNA sequences under multiple structural constraints

    OpenAIRE

    Tremblay-Savard, Olivier; Reinharz, Vladimir; Waldisp?hl, J?r?me

    2016-01-01

    Background Secondary structures form the scaffold of multiple sequence alignment of non-coding RNA (ncRNA) families. An accurate reconstruction of ancestral ncRNAs must use this structural signal. However, the inference of ancestors of a single ncRNA family with a single consensus structure may bias the results towards sequences with high affinity to this structure, which are far from the true ancestors. Methods In this paper, we introduce achARNement, a maximum parsimony approach that, given...

  10. Sequence analysis of RNase MRP RNA reveals its origination from eukaryotic RNase P RNA

    Science.gov (United States)

    Zhu, Yanglong; Stribinskis, Vilius; Ramos, Kenneth S.; Li, Yong

    2006-01-01

    RNase MRP is a eukaryote-specific endoribonuclease that generates RNA primers for mitochondrial DNA replication and processes precursor rRNA. RNase P is a ubiquitous endoribonuclease that cleaves precursor tRNA transcripts to produce their mature 5′ termini. We found extensive sequence homology of catalytic domains and specificity domains between their RNA subunits in many organisms. In Candida glabrata, the internal loop of helix P3 is 100% conserved between MRP and P RNAs. The helix P8 of MRP RNA from microsporidia Encephalitozoon cuniculi is identical to that of P RNA. Sequence homology can be widely spread over the whole molecule of MRP RNA and P RNA, such as those from Dictyostelium discoideum. These conserved nucleotides between the MRP and P RNAs strongly support the hypothesis that the MRP RNA is derived from the P RNA molecule in early eukaryote evolution. PMID:16540690

  11. DSAP: deep-sequencing small RNA analysis pipeline.

    Science.gov (United States)

    Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus

    2010-07-01

    DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (http://rfam.sanger.ac.uk/); and (iv) known miRNA matching: detection of known miRNAs in miRBase (http://www.mirbase.org/) based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at http://dsap.cgu.edu.tw.

  12. Mercury's Messenger

    Science.gov (United States)

    Chapman, Clark R.

    2004-01-01

    Forty years after Mariner 2, planetary exploration has still only just begun, and many more missions are on drawing boards, nearing the launch pad, or even en route across interplanetary space to their targets. One of the most challenging missions that will be conducted this decade is sending the MESSENGER spacecraft to orbit the planet Mercury.…

  13. Nucleotide sequence of a human tRNA gene heterocluster

    International Nuclear Information System (INIS)

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

    1986-01-01

    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues

  14. Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.

    Science.gov (United States)

    Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu

    2014-02-04

    TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.

  15. Rfam: annotating families of non-coding RNA sequences.

    Science.gov (United States)

    Daub, Jennifer; Eberhardt, Ruth Y; Tate, John G; Burge, Sarah W

    2015-01-01

    The primary task of the Rfam database is to collate experimentally validated noncoding RNA (ncRNA) sequences from the published literature and facilitate the prediction and annotation of new homologues in novel nucleotide sequences. We group homologous ncRNA sequences into "families" and related families are further grouped into "clans." We collate and manually curate data cross-references for these families from other databases and external resources. Our Web site offers researchers a simple interface to Rfam and provides tools with which to annotate their own sequences using our covariance models (CMs), through our tools for searching, browsing, and downloading information on Rfam families. In this chapter, we will work through examples of annotating a query sequence, collating family information, and searching for data.

  16. Growth differentiation factor 3 is induced by bone morphogenetic protein 6 (BMP-6) and BMP-7 and increases luteinizing hormone receptor messenger RNA expression in human granulosa cells.

    Science.gov (United States)

    Shi, Jia; Yoshino, Osamu; Osuga, Yutaka; Akiyama, Ikumi; Harada, Miyuki; Koga, Kaori; Fujimoto, Akihisa; Yano, Tetsu; Taketani, Yuji

    2012-04-01

    To examine the relevance of growth differentiation factor 3 (GDF-3) and bone morphogenetic protein (BMP) cytokines in human ovary. Molecular studies. Research laboratory. Eight women undergoing salpingo-oophorectomy and 30 women undergoing ovarian stimulation for in vitro fertilization. Localizing GDF-3 protein in human ovaries; granulosa cells (GC) cultured with GDF-3, BMP-6, or BMP-7 followed by RNA extraction. The localization of GDF-3 protein in normal human ovaries via immunohistochemical analysis, GDF-3 messenger RNA (mRNA) expression evaluation via quantitative real-time reverse transcription and polymerase chain reaction (RT-PCR), and evaluation of the effect of GDF-3 on leuteinizing hormone (LH) receptor mRNA expression via quantitative real-time RT-PCR. In the ovary, BMP cytokines, of the transforming growth factor beta (TGF-β) superfamily, are known as a luteinization inhibitor by suppressing LH receptor expression in GC. Growth differentiation factor 3, a TGF-β superfamily cytokine, is recognized as an inhibitor of BMP cytokines in other cells. Immunohistochemical analysis showed that GDF-3 was strongly detected in the GC of antral follicles. An in vitro assay revealed that BMP-6 or BMP-7 induced GDF-3 mRNA in GC. Also, GDF-3 increased LH receptor mRNA expression and inhibited the effect of BMP-7, which suppressed the LH receptor mRNA expression in GC. GDF-3, induced with BMP-6 and BMP-7, might play a role in folliculogenesis by inhibiting the effect of BMP cytokines. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  17. Lower glutamic acid decarboxylase 65-kDa isoform messenger RNA and protein levels in the prefrontal cortex in schizoaffective disorder but not schizophrenia.

    Science.gov (United States)

    Glausier, Jill R; Kimoto, Sohei; Fish, Kenneth N; Lewis, David A

    2015-01-15

    Altered gamma-aminobutyric acid (GABA) signaling in the prefrontal cortex (PFC) has been associated with cognitive dysfunction in patients with schizophrenia and schizoaffective disorder. Levels of the GABA-synthesizing enzyme glutamic acid decarboxylase 67-kDa isoform (GAD67) in the PFC have been consistently reported to be lower in patients with these disorders, but the status of the second GABA-synthesizing enzyme, glutamic acid decarboxylase 65-kDa isoform (GAD65), remains unclear. GAD65 messenger RNA (mRNA) levels were quantified in PFC area 9 by quantitative polymerase chain reaction from 62 subjects with schizophrenia or schizoaffective disorder and 62 matched healthy comparison subjects. In a subset of subject pairs, GAD65 relative protein levels were quantified by confocal immunofluorescence microscopy. Mean GAD65 mRNA levels were 13.6% lower in subjects with schizoaffective disorder but did not differ in subjects with schizophrenia relative to their matched healthy comparison subjects. In the subjects with schizoaffective disorder, mean GAD65 protein levels were 19.4% lower and were correlated with GAD65 mRNA levels. Lower GAD65 mRNA and protein levels within subjects with schizoaffective disorder were not attributable to factors commonly comorbid with the diagnosis. In concert with previous studies, these findings suggest that schizoaffective disorder is associated with lower levels of both GAD65 and GAD67 mRNA and protein in the PFC, whereas subjects with schizophrenia have lower mean levels of only GAD67 mRNA and protein. Because cognitive function is generally better preserved in patients with schizoaffective disorder relative to patients with schizophrenia, these findings may support an interpretation that GAD65 downregulation provides a homeostatic response complementary to GAD67 downregulation that serves to reduce inhibition in the face of lower PFC network activity. Copyright © 2015 Society of Biological Psychiatry. Published by Elsevier Inc

  18. Mutation of miRNA target sequences during human evolution

    DEFF Research Database (Denmark)

    Gardner, Paul P; Vinther, Jeppe

    2008-01-01

    It has long-been hypothesized that changes in non-protein-coding genes and the regulatory sequences controlling expression could undergo positive selection. Here we identify 402 putative microRNA (miRNA) target sequences that have been mutated specifically in the human lineage and show that genes...... containing such deletions are more highly expressed than their mouse orthologs. Our findings indicate that some miRNA target mutations are fixed by positive selection and might have been involved in the evolution of human-specific traits....

  19. The chemical structure of DNA sequence signals for RNA transcription

    Science.gov (United States)

    George, D. G.; Dayhoff, M. O.

    1982-01-01

    The proposed recognition sites for RNA transcription for E. coli NRA polymerase, bacteriophage T7 RNA polymerase, and eukaryotic RNA polymerase Pol II are evaluated in the light of the requirements for efficient recognition. It is shown that although there is good experimental evidence that specific nucleic acid sequence patterns are involved in transcriptional regulation in bacteria and bacterial viruses, among the sequences now available, only in the case of the promoters recognized by bacteriophage T7 polymerase does it seem likely that the pattern is sufficient. It is concluded that the eukaryotic pattern that is investigated is not restrictive enough to serve as a recognition site.

  20. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Directory of Open Access Journals (Sweden)

    Jennifer A Mitchell

    Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  1. Small molecule alteration of RNA sequence in cells and animals.

    Science.gov (United States)

    Guan, Lirui; Luo, Yiling; Ja, William W; Disney, Matthew D

    2017-10-18

    RNA regulation and maintenance are critical for proper cell function. Small molecules that specifically alter RNA sequence would be exceptionally useful as probes of RNA structure and function or as potential therapeutics. Here, we demonstrate a photochemical approach for altering the trinucleotide expanded repeat causative of myotonic muscular dystrophy type 1 (DM1), r(CUG) exp . The small molecule, 2H-4-Ru, binds to r(CUG) exp and converts guanosine residues to 8-oxo-7,8-dihydroguanosine upon photochemical irradiation. We demonstrate targeted modification upon irradiation in cell culture and in Drosophila larvae provided a diet containing 2H-4-Ru. Our results highlight a general chemical biology approach for altering RNA sequence in vivo by using small molecules and photochemistry. Furthermore, these studies show that addition of 8-oxo-G lesions into RNA 3' untranslated regions does not affect its steady state levels. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. RNA-Pareto: interactive analysis of Pareto-optimal RNA sequence-structure alignments.

    Science.gov (United States)

    Schnattinger, Thomas; Schöning, Uwe; Marchfelder, Anita; Kestler, Hans A

    2013-12-01

    Incorporating secondary structure information into the alignment process improves the quality of RNA sequence alignments. Instead of using fixed weighting parameters, sequence and structure components can be treated as different objectives and optimized simultaneously. The result is not a single, but a Pareto-set of equally optimal solutions, which all represent different possible weighting parameters. We now provide the interactive graphical software tool RNA-Pareto, which allows a direct inspection of all feasible results to the pairwise RNA sequence-structure alignment problem and greatly facilitates the exploration of the optimal solution set.

  3. Complex degradation processes lead to non-exponential decay patterns and age-dependent decay rates of messenger RNA.

    Directory of Open Access Journals (Sweden)

    Carlus Deneke

    Full Text Available Experimental studies on mRNA stability have established several, qualitatively distinct decay patterns for the amount of mRNA within the living cell. Furthermore, a variety of different and complex biochemical pathways for mRNA degradation have been identified. The central aim of this paper is to bring together both the experimental evidence about the decay patterns and the biochemical knowledge about the multi-step nature of mRNA degradation in a coherent mathematical theory. We first introduce a mathematical relationship between the mRNA decay pattern and the lifetime distribution of individual mRNA molecules. This relationship reveals that the mRNA decay patterns at steady state expression level must obey a general convexity condition, which applies to any degradation mechanism. Next, we develop a theory, formulated as a Markov chain model, that recapitulates some aspects of the multi-step nature of mRNA degradation. We apply our theory to experimental data for yeast and explicitly derive the lifetime distribution of the corresponding mRNAs. Thereby, we show how to extract single-molecule properties of an mRNA, such as the age-dependent decay rate and the residual lifetime. Finally, we analyze the decay patterns of the whole translatome of yeast cells and show that yeast mRNAs can be grouped into three broad classes that exhibit three distinct decay patterns. This paper provides both a method to accurately analyze non-exponential mRNA decay patterns and a tool to validate different models of degradation using decay data.

  4. RNA sequencing: current and prospective uses in metabolic research.

    Science.gov (United States)

    Vikman, Petter; Fadista, Joao; Oskolkov, Nikolay

    2014-10-01

    Previous global RNA analysis was restricted to known transcripts in species with a defined transcriptome. Next generation sequencing has transformed transcriptomics by making it possible to analyse expressed genes with an exon level resolution from any tissue in any species without any a priori knowledge of which genes that are being expressed, splice patterns or their nucleotide sequence. In addition, RNA sequencing is a more sensitive technique compared with microarrays with a larger dynamic range, and it also allows for investigation of imprinting and allele-specific expression. This can be done for a cost that is able to compete with that of a microarray, making RNA sequencing a technique available to most researchers. Therefore RNA sequencing has recently become the state of the art with regards to large-scale RNA investigations and has to a large extent replaced microarrays. The only drawback is the large data amounts produced, which together with the complexity of the data can make a researcher spend far more time on analysis than performing the actual experiment. © 2014 Society for Endocrinology.

  5. Deep sequencing of cardiac microRNA-mRNA interactomes in clinical and experimental cardiomyopathy.

    Science.gov (United States)

    Matkovich, Scot J; Dorn, Gerald W

    2015-01-01

    MicroRNAs are a family of short (~21 nucleotide) noncoding RNAs that serve key roles in cellular growth and differentiation and the response of the heart to stress stimuli. As the sequence-specific recognition element of RNA-induced silencing complexes (RISCs), microRNAs bind mRNAs and prevent their translation via mechanisms that may include transcript degradation and/or prevention of ribosome binding. Short microRNA sequences and the ability of microRNAs to bind to mRNA sites having only partial/imperfect sequence complementarity complicate purely computational analyses of microRNA-mRNA interactomes. Furthermore, computational microRNA target prediction programs typically ignore biological context, and therefore the principal determinants of microRNA-mRNA binding: the presence and quantity of each. To address these deficiencies we describe an empirical method, developed via studies of stressed and failing hearts, to determine disease-induced changes in microRNAs, mRNAs, and the mRNAs targeted to the RISC, without cross-linking mRNAs to RISC proteins. Deep sequencing methods are used to determine RNA abundances, delivering unbiased, quantitative RNA data limited only by their annotation in the genome of interest. We describe the laboratory bench steps required to perform these experiments, experimental design strategies to achieve an appropriate number of sequencing reads per biological replicate, and computer-based processing tools and procedures to convert large raw sequencing data files into gene expression measures useful for differential expression analyses.

  6. High throughput 16S rRNA gene amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r......RNA gene amplicon sequencing can be used to reveal factors of importance for the operation of full-scale nutrient removal plants related to settling problems and floc properties. Using optimized DNA extraction protocols, indexed primers and our in-house Illumina platform, we prepared multiple samples...... be correlated to the presence of the species that are regarded as “strong” and “weak” floc formers. In conclusion, 16S rRNA gene amplicon sequencing provides a high throughput approach for a rapid and cheap community profiling of activated sludge that in combination with multivariate statistics can be used...

  7. Reconstruction of ancestral RNA sequences under multiple structural constraints

    Directory of Open Access Journals (Sweden)

    Olivier Tremblay-Savard

    2016-11-01

    Full Text Available Abstract Background Secondary structures form the scaffold of multiple sequence alignment of non-coding RNA (ncRNA families. An accurate reconstruction of ancestral ncRNAs must use this structural signal. However, the inference of ancestors of a single ncRNA family with a single consensus structure may bias the results towards sequences with high affinity to this structure, which are far from the true ancestors. Methods In this paper, we introduce achARNement, a maximum parsimony approach that, given two alignments of homologous ncRNA families with consensus secondary structures and a phylogenetic tree, simultaneously calculates ancestral RNA sequences for these two families. Results We test our methodology on simulated data sets, and show that achARNement outperforms classical maximum parsimony approaches in terms of accuracy, but also reduces by several orders of magnitude the number of candidate sequences. To conclude this study, we apply our algorithms on the Glm clan and the FinP-traJ clan from the Rfam database. Conclusions Our results show that our methods reconstruct small sets of high-quality candidate ancestors with better agreement to the two target structures than with classical approaches. Our program is freely available at: http://csb.cs.mcgill.ca/acharnement .

  8. Reconstruction of ancestral RNA sequences under multiple structural constraints.

    Science.gov (United States)

    Tremblay-Savard, Olivier; Reinharz, Vladimir; Waldispühl, Jérôme

    2016-11-11

    Secondary structures form the scaffold of multiple sequence alignment of non-coding RNA (ncRNA) families. An accurate reconstruction of ancestral ncRNAs must use this structural signal. However, the inference of ancestors of a single ncRNA family with a single consensus structure may bias the results towards sequences with high affinity to this structure, which are far from the true ancestors. In this paper, we introduce achARNement, a maximum parsimony approach that, given two alignments of homologous ncRNA families with consensus secondary structures and a phylogenetic tree, simultaneously calculates ancestral RNA sequences for these two families. We test our methodology on simulated data sets, and show that achARNement outperforms classical maximum parsimony approaches in terms of accuracy, but also reduces by several orders of magnitude the number of candidate sequences. To conclude this study, we apply our algorithms on the Glm clan and the FinP-traJ clan from the Rfam database. Our results show that our methods reconstruct small sets of high-quality candidate ancestors with better agreement to the two target structures than with classical approaches. Our program is freely available at: http://csb.cs.mcgill.ca/acharnement .

  9. High-Throughput Sequencing Based Methods of RNA Structure Investigation

    DEFF Research Database (Denmark)

    Kielpinski, Lukasz Jan

    In this thesis we describe the development of four related methods for RNA structure probing that utilize massive parallel sequencing. Using them, we were able to gather structural data for multiple, long molecules simultaneously. First, we have established an easy to follow experimental...... and computational protocol for detecting the reverse transcription termination sites (RTTS-Seq). This protocol was subsequently applied to hydroxyl radical footprinting of three dimensional RNA structures to give a probing signal that correlates well with the RNA backbone solvent accessibility. Moreover, we applied...

  10. Deep-sequencing protocols influence the results obtained in small-RNA sequencing.

    Directory of Open Access Journals (Sweden)

    Joern Toedling

    Full Text Available Second-generation sequencing is a powerful method for identifying and quantifying small-RNA components of cells. However, little attention has been paid to the effects of the choice of sequencing platform and library preparation protocol on the results obtained. We present a thorough comparison of small-RNA sequencing libraries generated from the same embryonic stem cell lines, using different sequencing platforms, which represent the three major second-generation sequencing technologies, and protocols. We have analysed and compared the expression of microRNAs, as well as populations of small RNAs derived from repetitive elements. Despite the fact that different libraries display a good correlation between sequencing platforms, qualitative and quantitative variations in the results were found, depending on the protocol used. Thus, when comparing libraries from different biological samples, it is strongly recommended to use the same sequencing platform and protocol in order to ensure the biological relevance of the comparisons.

  11. Association of Cocaine- and Amphetamine-Regulated Transcript (CART) Messenger RNA Level, Food Intake, and Growth in Channel Catfish

    Science.gov (United States)

    Cocaine-and Amphetamine-Regulated Transcript (CART) is a potent hypothalamic anorectic peptide in mammals and fish. We hypothesized that increased food intake is associated with changes in expression of CART mRNA within the brain of channel catfish. Objectives were to clone the CART gene, examine ...

  12. P-body loss is concomitant with formation of a messenger RNA storage domain in mouse oocytes

    Czech Academy of Sciences Publication Activity Database

    Flemr, Matyáš; Ma, J.; Schultz, R. M.; Svoboda, Petr

    2010-01-01

    Roč. 82, č. 5 (2010), s. 1008-1017 ISSN 0006-3363 R&D Project s: GA MŠk ME09039 Grant - others:EMBO SDIG(DE) project 1483 Institutional research plan: CEZ:AV0Z50520514 Keywords : oocyte * mRNA * cortex Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.870, year: 2010

  13. SIMULTANEOUS EXPRESSION AND REGULATION OF G-CSF AND IL-6 MESSENGER-RNA IN ADHERENT HUMAN MONOCYTES AND FIBROBLASTS

    NARCIS (Netherlands)

    VELLENGA, E; VANDERVINNE, B; DEWOLF, JTM; HALIE, MR

    The regulation of granulocyte-colony stimulating factor (G-CSF) and interleukin-6 (IL-6) mRNA was studied in human adherent monocytes in response to the protein kinase C activator, oleolyl-acetylglycerol (OAG), the calcium-ionophore A23187 and the cyclic AMP elevating agents, dibutyryl c-AMP

  14. Nicotiana small RNA sequences support a host genome origin of cucumber mosaic virus satellite RNA.

    Directory of Open Access Journals (Sweden)

    Kiran Zahid

    2015-01-01

    Full Text Available Satellite RNAs (satRNAs are small noncoding subviral RNA pathogens in plants that depend on helper viruses for replication and spread. Despite many decades of research, the origin of satRNAs remains unknown. In this study we show that a β-glucuronidase (GUS transgene fused with a Cucumber mosaic virus (CMV Y satellite RNA (Y-Sat sequence (35S-GUS:Sat was transcriptionally repressed in N. tabacum in comparison to a 35S-GUS transgene that did not contain the Y-Sat sequence. This repression was not due to DNA methylation at the 35S promoter, but was associated with specific DNA methylation at the Y-Sat sequence. Both northern blot hybridization and small RNA deep sequencing detected 24-nt siRNAs in wild-type Nicotiana plants with sequence homology to Y-Sat, suggesting that the N. tabacum genome contains Y-Sat-like sequences that give rise to 24-nt sRNAs capable of guiding RNA-directed DNA methylation (RdDM to the Y-Sat sequence in the 35S-GUS:Sat transgene. Consistent with this, Southern blot hybridization detected multiple DNA bands in Nicotiana plants that had sequence homology to Y-Sat, suggesting that Y-Sat-like sequences exist in the Nicotiana genome as repetitive DNA, a DNA feature associated with 24-nt sRNAs. Our results point to a host genome origin for CMV satRNAs, and suggest novel approach of using small RNA sequences for finding the origin of other satRNAs.

  15. Detailed mapping of serotonin 5-HT1B and 5-HT1D receptor messenger RNA and ligand binding sites in guinea-pig brain and trigeminal ganglion: clues for function

    International Nuclear Information System (INIS)

    Leysen, J.E.; Schotte, A.; Jurzak, M.; Luyten, W.H.M.L.; Voorn, P.; Bonaventure, P.

    1997-01-01

    The similar pharmacology of the 5-HT 1B and 5-HT 1D receptors, and the lack of selective compounds sufficiently distinguishing between the two receptor subtypes, have hampered functional studies on these receptors. In order to provide clues for differential functional roles of the two subtypes, we performed a parallel localization study throughout the guinea-pig brain and the trigeminal ganglia by means of quantitative in situ hybridization histochemistry (using [ 35 S]-labelled riboprobes probes for receptor messenger RNA) and receptor autoradiography (using a new radioligand [ 3 H]alniditan).The anatomical patterns of 5-HT 1B and 5-HT 1D receptor messenger RNA were quite different. While 5-HT 1B receptor messenger RNA was abundant throughout the brain (with highest levels in the striatum, nucleus accumbens, olfactory tubercle, cortex, hypothalamus, hippocampal formation, amygdala, thalamus, dorsal raphe and cerebellum), 5-HT 1D receptor messenger RNA exhibited a more restricted pattern; it was found mainly in the olfactory tubercle, entorhinal cortex, dorsal raphe, cerebellum, mesencephalic trigeminal nucleus and in the trigeminal ganglion. The density of 5-HT 1B/1D binding sites (combined) obtained with [ 3 H]alniditan autoradiography was high in the substantia nigra, superior colliculus and globus pallidus, whereas lower levels were detected in the caudate-putamen, hypothalamus, hippocampal formation, amygdala, thalamus and central gray. This distribution pattern was indistinguishable from specific 5-HT 1B receptor labelling in the presence of ketanserin under conditions to occlude 5-HT 1D receptor labelling; hence the latter were below detection level. Relationships between the regional distributions of the receptor messenger RNAs and binding sites and particular neuroanatomical pathways are discussed with respect to possible functional roles of the 5-HT 1B and 5-HT 1D receptors. (Copyright (c) 1997 Elsevier Science B.V., Amsterdam. All rights reserved.)

  16. Sequence analysis of L RNA of Lassa virus

    International Nuclear Information System (INIS)

    Vieth, Simon; Torda, Andrew E.; Asper, Marcel; Schmitz, Herbert; Guenther, Stephan

    2004-01-01

    The L RNA of three Lassa virus strains originating from Nigeria, Ghana/Ivory Coast, and Sierra Leone was sequenced and the data subjected to structure predictions and phylogenetic analyses. The L gene products had 2218-2221 residues, diverged by 18% at the amino acid level, and contained several conserved regions. Only one region of 504 residues (positions 1043-1546) could be assigned a function, namely that of an RNA polymerase. Secondary structure predictions suggest that this domain is very similar to RNA-dependent RNA polymerases of known structure encoded by plus-strand RNA viruses, permitting a model to be built. Outside the polymerase region, there is little structural data, except for regions of strong alpha-helical content and probably a coiled-coil domain at the N terminus. No evidence for reassortment or recombination during Lassa virus evolution was found. The secondary structure-assisted alignment of the RNA polymerase region permitted a reliable reconstruction of the phylogeny of all negative-strand RNA viruses, indicating that Arenaviridae are most closely related to Nairoviruses. In conclusion, the data provide a basis for structural and functional characterization of the Lassa virus L protein and reveal new insights into the phylogeny of negative-strand RNA viruses

  17. RNA-DNA sequence differences spell genetic code ambiguities

    DEFF Research Database (Denmark)

    Bentin, Thomas; Nielsen, Michael L

    2013-01-01

    A recent paper in Science by Li et al. 2011(1) reports widespread sequence differences in the human transcriptome between RNAs and their encoding genes termed RNA-DNA differences (RDDs). The findings could add a new layer of complexity to gene expression but the study has been criticized. ...

  18. Finding the most significant common sequence and structure motifs in a set of RNA sequences

    DEFF Research Database (Denmark)

    Gorodkin, Jan; Heyer, L.J.; Stormo, G.D.

    1997-01-01

    We present a computational scheme to locally align a collection of RNA sequences using sequence and structure constraints, In addition, the method searches for the resulting alignments with the most significant common motifs, among all possible collections, The first part utilizes a simplified...

  19. Distribution of precursor amyloid-β-protein messenger RNA in human cerebral cortex: relationship to neurofibrillary tangles and neuritic plaques

    International Nuclear Information System (INIS)

    Lewis, D.A.; Higgins, G.A.; Young, W.G.; Goldgaber, D.; Gajdusek, D.C.; Wilson, M.C.; Morrison, J.H.

    1988-01-01

    Neurofibrillary tangles (NFT) and neuritic plaques (NP), two neuropathological markers of Alzheimer disease, may both contain peptide fragments derived from the human amyloid β protein. However, the nature of the relationship between NFT and NP and the source of the amyloid β proteins found in each have remained unclear. The authors used in situ hybridization techniques to map the anatomical distribution of precursor amyloid-β-protein mRNA in the neocortex of brains from three subjects with no known neurologic disease and from five patients with Alzheimer disease. In brains from control subjects, positively hybridizing neurons were present in cortical regions and layers that contain a high density of neuropathological markers in Alzheimer disease, as well as in those loci that contain NP but few NFT. Quantitative analyses of in situ hybridization patterns within layers III and V of the superior frontal cortex revealed that the presence of high numbers of NFT in Alzheimer-diseased brains was associated with a decrease in the number of positively hybridizing neurons compared to controls and Alzheimer-diseased brains with few NFT. These findings suggest that the expression of precursor amyloid-β-protein mRNA may be a necessary but is clearly not a sufficient prerequisite for NFT formation. In addition, these results may indicate that the amyloid β protein, present in NP in a given region or layer of cortex, is not derived from the resident neuronal cell bodies that express the mRNA for the precursor protein

  20. Translational recognition of the 5'-terminal 7-methylguanosine of globin messenger RNA as a function of ionic strength.

    Science.gov (United States)

    Chu, L Y; Rhoads, R E

    1978-06-13

    The translation of rabbit globin mRNA in cell-free systems derived from either wheat germ or rabbit reticulocyte was studied in the presence of various analogues of the methylated 5' terminus (cap) as a function of ionic strength. Inhibition by these analogues was strongly enhanced by increasing concentrations of KCl, K(OAc), Na(OAc), or NH4(OAc). At appropriate concentrations of K(OAc), both cell-free systems were equally sensitive to inhibition by m7GTP. At 50 mM K(OAc), the reticulocyte system was not sensitive to m7GMP or m7GTP, but at higher concentrations up to 200 mM K(OAc), both nucleotides caused strong inhibition. The compound in m7G5'ppp5'Am was inhibitory at all concentrations of K(OAc) ranging from 50 to 200 mM, although more strongly so at the higher concentrations. Over the same range of nucleotide concentrations, the compounds GMP, GTP, and G5'ppp5'Am were not inhibitors. The mobility on sodium dodecyl sulfate-polyacrylamide electrophoresis of the translation product was that of globin at all K(OAc) concentrations in the presence of m7GTP. Globin mRNA from which the terminal m7GTP group had been removed by chemical treatment (periodate-cyclohexylamine-alkaline phosphatase) or enzymatic treatment (tobacco acid pyrophosphatase-alkaline phosphatase) was translated less efficiently than untreated globin mRNA at higher K(OAc) concentrations, but retained appreciable activity at low K(OAc) concentrations.

  1. Development of Anti-Human Mesothelin-Targeted Chimeric Antigen Receptor Messenger RNA-transfected Peripheral Blood Lymphocytes for Ovarian Cancer Therapy.

    Science.gov (United States)

    Hung, Chien-Fu; Xu, Xuequn; Li, Linhong; Ma, Ying; Jin, Qiu; Viley, Angelia; Allen, Cornell; Natarajan, Pachai; Shivakumar, Rama; Peshwa, Madhusudan V; Emens, Leisha A

    2018-04-02

    CD19-targeted chimeric antigen receptor (CAR) engineered T/natural killer (NK)-cell therapies can result in durable clinical responses in B-cell malignancies. However, CAR-based immunotherapies have been much less successful in solid cancers, in part due to "on-target off-tumor" toxicity related to expression of target tumor antigens on normal tissue. Based on preliminary observations of safety and clinical activity in proof-of-concept clinical trials, tumor antigen-specific messenger RNA (mRNA) CAR transfection into selected, activated, and expanded T/NK cells may permit prospective control of "on-target off-tumor" toxicity. To develop a commercial product for solid tumors, mesothelin was selected as an antigen target based on its association with poor prognosis and overexpression in multiple solid cancers. It was hypothesized that selecting, activating, and expanding cells ex vivo prior to mRNA CAR transfection would not be necessary, thus simplifying the complexity and cost of manufacturing. Now, the development of anti-human mesothelin mRNA CAR transfected peripheral blood lymphocytes (CARMA-hMeso) is reported, demonstrating the manufacture and cryopreservation of multiple cell aliquots for repeat administrations from a single human leukapheresis. A rapid, automated, closed system for cGMP-compliant transfection of mRNA CAR in up to 20 × 10 9 peripheral blood lymphocytes was developed. Here we show that CARMA-hMeso cells recognize and lyse tumor cells in a mesothelin-specific manner. Expression of CAR was detectable over approximately 7 days in vitro, with a progressive decline of CAR expression that appears to correlate with in vitro cell expansion. In a murine ovarian cancer model, a single intraperitoneal injection of CARMA-hMeso resulted in the dose-dependent inhibition of tumor growth and improved survival of mice. Furthermore, repeat weekly intraperitoneal administrations of the optimal CARMA-hMeso dose further prolonged disease control and survival

  2. Chimira: analysis of small RNA sequencing data and microRNA modifications.

    Science.gov (United States)

    Vitsios, Dimitrios M; Enright, Anton J

    2015-10-15

    Chimira is a web-based system for microRNA (miRNA) analysis from small RNA-Seq data. Sequences are automatically cleaned, trimmed, size selected and mapped directly to miRNA hairpin sequences. This generates count-based miRNA expression data for subsequent statistical analysis. Moreover, it is capable of identifying epi-transcriptomic modifications in the input sequences. Supported modification types include multiple types of 3'-modifications (e.g. uridylation, adenylation), 5'-modifications and also internal modifications or variation (ADAR editing or single nucleotide polymorphisms). Besides cleaning and mapping of input sequences to miRNAs, Chimira provides a simple and intuitive set of tools for the analysis and interpretation of the results (see also Supplementary Material). These allow the visual study of the differential expression between two specific samples or sets of samples, the identification of the most highly expressed miRNAs within sample pairs (or sets of samples) and also the projection of the modification profile for specific miRNAs across all samples. Other tools have already been published in the past for various types of small RNA-Seq analysis, such as UEA workbench, seqBuster, MAGI, OASIS and CAP-miRSeq, CPSS for modifications identification. A comprehensive comparison of Chimira with each of these tools is provided in the Supplementary Material. Chimira outperforms all of these tools in total execution speed and aims to facilitate simple, fast and reliable analysis of small RNA-Seq data allowing also, for the first time, identification of global microRNA modification profiles in a simple intuitive interface. Chimira has been developed as a web application and it is accessible here: http://www.ebi.ac.uk/research/enright/software/chimira. aje@ebi.ac.uk Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

  3. Immunohistochemical identification of messenger RNA-related proteins in basophilic inclusions of adult-onset atypical motor neuron disease.

    Science.gov (United States)

    Fujita, Kengo; Ito, Hidefumi; Nakano, Satoshi; Kinoshita, Yoshimi; Wate, Reika; Kusaka, Hirofumi

    2008-10-01

    This report concerns an immunohistochemical investigation on RNA-related proteins in the basophilic inclusions (BIs) from patients with adult-onset atypical motor neuron disease. Formalin-fixed, paraffin-embedded sections of the motor cortex and the lumbar spinal cord were examined. The BIs appeared blue in color with H&E and Nissl stain, and pink with methylgreen-pyronin stain. Ribonuclease pretreatment abolished the methylgreen-pyronin staining, suggesting that the BIs contained RNA. Immunohistochemically, the BIs were distinctly labeled with the antibodies against poly(A)-binding protein 1, T cell intracellular antigen 1, and ribosomal protein S6. These proteins are essential constituents of stress granules. In contrast, the BIs were not immunoreactive for ribosomal protein L28 and decapping enzyme 1, which are core components of transport ribonucleoprotein particles and processing bodies, respectively. Moreover, the BIs were not immunopositive for TDP-43. Our results imply that translation attenuation could be involved in the processes of BI formation in this disorder.

  4. Complete sequence of RNA1 of grapevine Anatolian ringspot virus.

    Science.gov (United States)

    Digiaro, Michele; Nahdi, Sabrine; Elbeaino, Toufic

    2012-10-01

    The nucleotide sequence of RNA1 of grapevine Anatolian ringspot virus (GARSV), a nepovirus of subgroup B, was determined from cDNA clones. It is 7,288 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame (ORF), extending from nucleotides 272 to 7001, encoding a polypeptide of 2,243 amino acids with a predicted molecular mass of 250 kDa. The primary structure of the polyprotein, compared with that of other viral polyproteins, revealed the presence of all the characteristic domains of members of the order Picornavirales, i.e., the NTP-binding protein (1B(Hel)), the viral genome-linked protein (1C(VPg)), the proteinase (1D(Prot)), the RNA-dependent RNA polymerase (1E(Pol)), and of the protease cofactor (1A(Pro-cof)) shared by members of the subfamily Comovirinae within the family Secoviridae. The cleavage sites predicted within the polyprotein were found to be in agreement with those previously reported for nepoviruses of subgroup B, processing from 1A to 1E proteins of 67, 64, 3, 23 and 92 kDa, respectively. The RNA1-encoded polyprotein (p1) shared the highest amino acid sequence identity (66 %) with tomato black ring virus (TBRV) and beet ringspot virus (BRSV). The 5'- and 3'-noncoding regions (NCRs) of GARSV-RNA1 shared 89 % and 95 % nucleotide sequence identity respectively with the corresponding regions in RNA2. Phylogenetic analysis confirmed the close relationship of GARSV to members of subgroup B of the genus Nepovirus.

  5. Computational prediction of miRNA genes from small RNA sequencing data

    Directory of Open Access Journals (Sweden)

    Wenjing eKang

    2015-01-01

    Full Text Available Next-generation sequencing now for the first time allows researchers to gauge the depth and variation of entire transcriptomes. However, now as rare transcripts can be detected that are present in cells at single copies, more advanced computational tools are needed to accurately annotate and profile them. miRNAs are 22 nucleotide small RNAs (sRNAs that post-transcriptionally reduce the output of protein coding genes. They have established roles in numerous biological processes, including cancers and other diseases. During miRNA biogenesis, the sRNAs are sequentially cleaved from precursor molecules that have a characteristic hairpin RNA structure. The vast majority of new miRNA genes that are discovered are mined from small RNA sequencing (sRNA-seq, which can detect more than a billion RNAs in a single run. However, given that many of the detected RNAs are degradation products from all types of transcripts, the accurate identification of miRNAs remain a non-trivial computational problem. Here we review the tools available to predict animal miRNAs from sRNA sequencing data. We present tools for generalist and specialist use cases, including prediction from massively pooled data or in species without reference genome. We also present wet-lab methods used to validate predicted miRNAs, and approaches to computationally benchmark prediction accuracy. For each tool, we reference validation experiments and benchmarking efforts. Last, we discuss the future of the field.

  6. Common acute lymphoblastic leukemia antigen: partial characterization by in vivo labeling and isolation of its messenger RNA

    International Nuclear Information System (INIS)

    Heinsohn, S.; Kabisch, H.

    1987-01-01

    Common acute lymphoblastic leukemia (ALL) antigen (CALLA)-like proteins were detected by in vivo labeling experiments carried out with human lymphoblastoid cell line KM3 and also in cell-free translation, directed by CALLA-specific mRNA prepared from immunoadsorbed KM3 polysomes. The CALLA-like structure found in both systems shows an Mr of 95kDa. Additional CALLA-like proteins could be identified in the in vivo experiments with calculated Mrs of 40kDa in the cells and 85 and 38kDa in the culture medium. In the cell-free translation system, an additional product of Mr 80kDa could be detected

  7. Stability of Reference Genes for Messenger RNA Quantification by Real-Time PCR in Mouse Dextran Sodium Sulfate Experimental Colitis.

    Directory of Open Access Journals (Sweden)

    Nour Eissa

    Full Text Available Many animal models have been developed to characterize the complexity of colonic inflammation. In dextran sodium sulfate (DSS experimental colitis in mice the choice of reference genes is critical for accurate quantification of target genes using quantitative real time PCR (RT-qPCR. No studies have addressed the performance of reference genes in mice DSS-experimental colitis. This study aimed to determine the stability of reference genes expression (RGE in DSS-experimental murine colitis.Colitis was induced in male C57BL/6 mice using DSS5% for 5 days, control group received water. RNA was extracted from inflamed and non-inflamed colon. Using RT-qPCR, comparative analysis of 13 RGE was performed according to predefined criteria and relative colonic TNF-α and IL-1β gene expression was determined by calculating the difference in the threshold cycle.Colitis significantly altered the stability of mucosal RGE. Commonly used glyceraldehyde-3-phosphate dehydrogenase (Gapdh, β-actin (Actb, or β2-microglobulin (β2m showed the highest variability within the inflamed and control groups. Conversely, TATA-box-binding protein (Tbp and eukaryotic translation elongation factor 2 (Eef2 were not affected by inflammation and were the most stable genes. Normalization of colonic TNF-α and IL-1β mRNA levels was dependent on the reference gene used. Depending on the genes used to normalize the data, statistical significance varied from significant when TBP / Eef2 were used to non-significant when Gapdh, Actb or β2m were used.This study highlights the appropriate choice of RGE to ensure adequate normalization of RT-qPCR data when using this model. Suboptimal RGE may explain controversial results from published studies. We recommend using Tbp and Eef2 instead of Gapdh, Actb or β2m as reference genes.

  8. Host apolipoprotein B messenger RNA-editing enzyme catalytic polypeptide-like 3G is an innate defensive factor and drug target against hepatitis C virus.

    Science.gov (United States)

    Peng, Zong-Gen; Zhao, Zhi-Yun; Li, Yan-Ping; Wang, Yu-Ping; Hao, Lan-Hu; Fan, Bo; Li, Yu-Huan; Wang, Yue-Ming; Shan, Yong-Qiang; Han, Yan-Xing; Zhu, Yan-Ping; Li, Jian-Rui; You, Xue-Fu; Li, Zhuo-Rong; Jiang, Jian-Dong

    2011-04-01

    Host cellular factor apolipoprotein B messenger RNA (mRNA)-editing enzyme catalytic polypeptide-like 3G (hA3G) is a cytidine deaminase that inhibits a group of viruses including human immunodeficiency virus-1 (HIV-1). In the continuation of our research on hA3G, we found that hA3G stabilizing compounds significantly inhibited hepatitis C virus (HCV) replication. Therefore, this study investigated the role of hA3G in HCV replication. Introduction of external hA3G into HCV-infected Huh7.5 human hepatocytes inhibited HCV replication; knockdown of endogenous hA3G enhanced HCV replication. Exogenous HIV-1 virion infectivity factor (Vif) decreased intracellular hA3G and therefore enhanced HCV proliferation, suggesting that the presence of Vif might be an explanation for the HIV-1/HCV coinfection often observed in HIV-1(+) individuals. Treatment of the HCV-infected Huh7.5 cells with RN-5 or IMB-26, two known hA3G stabilizing compounds, increased intracellular hA3G and accordingly inhibited HCV replication. The compounds inhibit HCV through increasing the level of hA3G incorporated into HCV particles, but not through inhibiting HCV enzymes. However, G/A hypermutation in the HCV genome were not detected, suggesting a new antiviral mechanism of hA3G in HCV, different from that in HIV-1. Stabilization of hA3G by RN-5 was safe in vivo. hA3G appears to be a cellular restrict factor against HCV and could be a potential target for drug discovery. 2011 American Association for the Study of Liver Diseases.

  9. Altered expression of estrogen receptor-α variant messenger RNAs between adjacent normal breast and breast tumor tissues

    International Nuclear Information System (INIS)

    Leygue, Etienne; Dotzlaw, Helmut; Watson, Peter H; Murphy, Leigh C

    2000-01-01

    Using semiquantitative reverse transcription-polymerase chain reaction assays, we investigated the expression of variant messenger RNAs relative to wild-type estrogen receptor (ER)-α messenger RNA in normal breast tissues and their adjacent matched breast tumor tissues. Higher ER variant truncated after sequences encoding exon 2 of the wild-type ER-α (ERC4) messenger RNA and a lower exon 3 deleted ER-α variant (ERD3) messenger RNA relative expression in the tumor compartment were observed in the ER-positive/PR-positive and the ER-positive subsets, respectively. A significantly higher relative expression of exon 5 deleted ER-α varient (ERD5) messenger RNA was observed in tumor components overall. These data demonstrate that changes in the relative expression of ER-α variant messenger RNAs occur between adjacent normal and neoplastic breast tissues. We suggest that these changes might be involved in the mechanisms that underlie breast tumorigenesis. Estrogen receptor (ER)-α and ER-β are believed to mediate the action of estradiol in target tissues. Several ER-α and ER-β variant messenger RNAs have been identified in both normal and neoplastic human tissues. Most of these variants contain a deletion of one or more exons of the wild-type (WT) ER messenger RNAs. The putative proteins that are encoded by these variant messenger RNAs would therefore be missing some functional domains of the WT receptors, and might interfere with WT-ER signaling pathways. The detection of ER-α variants in both normal and neoplastic human breast tissues raised the question of their possible role in breast tumorigenesis. We have previously reported an increased relative expression of exon 5 deleted ER-α variant (ERD5) messenger RNA and of another ER-α variant truncated of all sequences following the exon 2 of the WT ER-α (ERC4) messenger RNA in breast tumor samples versus independent normal breast tissues. In contrast, a decreased relative expression of exon 3 deleted ER

  10. Expression of somatotropin receptor messenger ribonucleic acid in bovine tissues

    International Nuclear Information System (INIS)

    Lucy, M.C.; Boyd, C.K.; Koenigsfeld, A.T.; Okamura, C.S.

    1998-01-01

    The somatotropin receptor mRNA is controlled by at least two different gene promoters that generate 2 two variants with different exon 1 sequences (1A and 1B). The location of 1A and 1B somatotropin receptor mRNA within cattle tissues and, hence, the tissue specificity of the 1A and 1B promoters are unknown. In addition, the cDNA sequence of the 1B somatotropin receptor has not been determined. Our objective, therefore, was to sequence a cDNA for the 1B somatotropin receptor and to analyze bovine tissues for expression of 1A and 1B somatotropin receptor mRNA. Twenty adult tissues and six fetal tissues were collected at slaughter from each of four cows and two fetuses. Messenger RNA was analyzed using ribonuclease protection assays. The adult liver expressed both 1A and 1B mRNA. All other adult tissues expressed 1B mRNA but not 1A mRNA. The greatest amount of 1B mRNA was detected in liver and adipose (abdominal and subcutaneous) tissues. Other tissues had approximately one-half to one-tenth of the amount of 1B mRNA in the liver or adipose tissue. Fetal tissues (including fetal liver) expressed 1B mRNA and not 1A mRNA. Based on cDNA sequencing, the protein encoded by the 1A and 1B mRNA was nearly identical. We concluded that 1A somatotropin receptor mRNA is specific to adult bovine liver. Other adult and fetal bovine tissues expressed 1B somatotropin receptor mRNA with a predicted protein sequence that was similar to the 1A somatotropin receptor

  11. Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

    Science.gov (United States)

    Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

    1984-01-11

    We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to an automated (Apple II) procedure for searching and evaluating possible promoters in DNA sequence files.

  12. Messenger RNA for membrane-type 2 matrix metalloproteinase, MT2-MMP, is expressed in human placenta of first trimester.

    Science.gov (United States)

    Bjørn, S F; Hastrup, N; Larsen, J F; Lund, L R; Pyke, C

    2000-01-01

    An intimately regulated cell surface activation of matrix metalloproteinases (MMPs) is believed to be of critical importance for the control of trophoblast invasion. A histological investigation of the expression and localization of three different MMPs, the membrane-type matrix metalloproteinases 1 and 2 (MT1-MMP, MT2-MMP) and matrix metalloproteinase 2 (MMP-2/gelatinase A) was performed by in situ hybridization on consecutive sections from human placentae of first trimester pregnancies. Cytokeratin immunostaining identified trophoblast cells. Both normal and tubal implantation sites were studied. We observed a high degree of coexpression of MT2-MMP, MT1-MMP and MMP-2 mRNAs in single extravillous cytotrophoblasts that had invaded the endometrium and tubal wall. Furthermore, mRNAs for all three genes were also seen in cytotrophoblasts of cell islands. In contrast to this coexpression pattern, MT2-MMP expression was absent from cell columns and decidual cells, in which signals for MT1-MMP and MMP-2 mRNAs were seen. The present data on the cellular expression of MT2-MMP mRNA in placenta extend our knowledge of the proteolytic events that take place during early pregnancy. The data suggest that MT2-MMP, capable of activating MMP-2 in vitro, is involved in the invasion of extravillous cytotrophoblast, possibly related to the physiological activation of MMP-2. Copyright 2000 Harcourt Publishers Ltd.

  13. Identification of Bacterial Small RNAs by RNA Sequencing

    DEFF Research Database (Denmark)

    Gómez Lozano, María; Marvig, Rasmus Lykke; Molin, Søren

    2014-01-01

    sequencing (RNA-seq) is described that involves the preparation and analysis of three different sequencing libraries. As a signifi cant number of unique sRNAs are identifi ed in each library, the libraries can be used either alone or in combination to increase the number of sRNAs identifi ed. The approach......Small regulatory RNAs (sRNAs) in bacteria are known to modulate gene expression and control a variety of processes including metabolic reactions, stress responses, and pathogenesis in response to environmental signals. A method to identify bacterial sRNAs on a genome-wide scale based on RNA...... may be applied to identify sRNAs in any bacterium under different growth and stress conditions....

  14. Nucleotide sequence of tomato ringspot virus RNA-2.

    Science.gov (United States)

    Rott, M E; Tremaine, J H; Rochon, D M

    1991-07-01

    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  15. Using small RNA (sRNA) deep sequencing to understand global virus distribution in plants

    Science.gov (United States)

    Small RNAs (sRNAs), a class of regulatory RNAs, have been used to serve as the specificity determinants of suppressing gene expression in plants and animals. Next generation sequencing (NGS) uncovered the sRNA landscape in most organisms including their associated microbes. In the current study, w...

  16. Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes.

    Directory of Open Access Journals (Sweden)

    Thomas Birkballe Hansen

    Full Text Available BACKGROUND: miRNAs are key players in gene expression regulation. To fully understand the complex nature of cellular differentiation or initiation and progression of disease, it is important to assess the expression patterns of as many miRNAs as possible. Thereby, identifying novel miRNAs is an essential prerequisite to make possible a comprehensive and coherent understanding of cellular biology. METHODOLOGY/PRINCIPAL FINDINGS: Based on two extensive, but previously published, small RNA sequence datasets from human embryonic stem cells and human embroid bodies, respectively [1], we identified 112 novel miRNA-like structures and were able to validate miRNA processing in 12 out of 17 investigated cases. Several miRNA candidates were furthermore substantiated by including additional available small RNA datasets, thereby demonstrating the power of combining datasets to identify miRNAs that otherwise may be assigned as experimental noise. CONCLUSIONS/SIGNIFICANCE: Our analysis highlights that existing datasets are not yet exhaustedly studied and continuous re-analysis of the available data is important to uncover all features of small RNA sequencing.

  17. RISC RNA sequencing for context-specific identification of in vivo microRNA targets.

    Science.gov (United States)

    Matkovich, Scot J; Van Booven, Derek J; Eschenbacher, William H; Dorn, Gerald W

    2011-01-07

    MicroRNAs (miRs) are expanding our understanding of cardiac disease and have the potential to transform cardiovascular therapeutics. One miR can target hundreds of individual mRNAs, but existing methodologies are not sufficient to accurately and comprehensively identify these mRNA targets in vivo. To develop methods permitting identification of in vivo miR targets in an unbiased manner, using massively parallel sequencing of mouse cardiac transcriptomes in combination with sequencing of mRNA associated with mouse cardiac RNA-induced silencing complexes (RISCs). We optimized techniques for expression profiling small amounts of RNA without introducing amplification bias and applied this to anti-Argonaute 2 immunoprecipitated RISCs (RISC-Seq) from mouse hearts. By comparing RNA-sequencing results of cardiac RISC and transcriptome from the same individual hearts, we defined 1645 mRNAs consistently targeted to mouse cardiac RISCs. We used this approach in hearts overexpressing miRs from Myh6 promoter-driven precursors (programmed RISC-Seq) to identify 209 in vivo targets of miR-133a and 81 in vivo targets of miR-499. Consistent with the fact that miR-133a and miR-499 have widely differing "seed" sequences and belong to different miR families, only 6 targets were common to miR-133a- and miR-499-programmed hearts. RISC-sequencing is a highly sensitive method for general RISC profiling and individual miR target identification in biological context and is applicable to any tissue and any disease state.

  18. Adenylylation of small RNA sequencing adapters using the TS2126 RNA ligase I.

    Science.gov (United States)

    Lama, Lodoe; Ryan, Kevin

    2016-01-01

    Many high-throughput small RNA next-generation sequencing protocols use 5' preadenylylated DNA oligonucleotide adapters during cDNA library preparation. Preadenylylation of the DNA adapter's 5' end frees from ATP-dependence the ligation of the adapter to RNA collections, thereby avoiding ATP-dependent side reactions. However, preadenylylation of the DNA adapters can be costly and difficult. The currently available method for chemical adenylylation of DNA adapters is inefficient and uses techniques not typically practiced in laboratories profiling cellular RNA expression. An alternative enzymatic method using a commercial RNA ligase was recently introduced, but this enzyme works best as a stoichiometric adenylylating reagent rather than a catalyst and can therefore prove costly when several variant adapters are needed or during scale-up or high-throughput adenylylation procedures. Here, we describe a simple, scalable, and highly efficient method for the 5' adenylylation of DNA oligonucleotides using the thermostable RNA ligase 1 from bacteriophage TS2126. Adapters with 3' blocking groups are adenylylated at >95% yield at catalytic enzyme-to-adapter ratios and need not be gel purified before ligation to RNA acceptors. Experimental conditions are also reported that enable DNA adapters with free 3' ends to be 5' adenylylated at >90% efficiency. © 2015 Lama and Ryan; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  19. Single-Cell RNA Sequencing of Glioblastoma Cells.

    Science.gov (United States)

    Sen, Rajeev; Dolgalev, Igor; Bayin, N Sumru; Heguy, Adriana; Tsirigos, Aris; Placantonakis, Dimitris G

    2018-01-01

    Single-cell RNA sequencing (sc-RNASeq) is a recently developed technique used to evaluate the transcriptome of individual cells. As opposed to conventional RNASeq in which entire populations are sequenced in bulk, sc-RNASeq can be beneficial when trying to better understand gene expression patterns in markedly heterogeneous populations of cells or when trying to identify transcriptional signatures of rare cells that may be underrepresented when using conventional bulk RNASeq. In this method, we describe the generation and analysis of cDNA libraries from single patient-derived glioblastoma cells using the C1 Fluidigm system. The protocol details the use of the C1 integrated fluidics circuit (IFC) for capturing, imaging and lysing cells; performing reverse transcription; and generating cDNA libraries that are ready for sequencing and analysis.

  20. Effect of escitalopram versus placebo on GRα messenger RNA expression in peripheral blood cells of healthy individuals with a family history of depression - a secondary outcome analysis from the randomized AGENDA trial

    DEFF Research Database (Denmark)

    Knorr, Ulla; Koefoed, Pernille; Gluud, Christian

    2016-01-01

    Background Selective serotonin reuptake inhibitors (SSRIs) are widely prescribed as first-line drugs for the treatment of depression. However, the mechanisms of action for SSRIs are unclear and besides neurotransmitter modulation may depend on modulation of the hypothalamic-pituitary-adrenal (HPA......) system. The glucocorticoid receptor (GR) isoform α plays an important role in the negative feedback regulation of the HPA axis and reduced GRα messenger RNA (mRNA) expression has been shown in mood disorder patients and first-degree relatives compared to healthy individuals with no family history...

  1. TargetRNA: a tool for predicting targets of small RNA action in bacteria

    OpenAIRE

    Tjaden, Brian

    2008-01-01

    Many small RNA (sRNA) genes in bacteria act as posttranscriptional regulators of target messenger RNAs. Here, we present TargetRNA, a web tool for predicting mRNA targets of sRNA action in bacteria. TargetRNA takes as input a genomic sequence that may correspond to an sRNA gene. TargetRNA then uses a dynamic programming algorithm to search each annotated message in a specified genome for mRNAs that evince basepair-binding potential to the input sRNA sequence. Based on the calculated basepair-...

  2. Unifying cancer and normal RNA sequencing data from different sources

    Science.gov (United States)

    Wang, Qingguo; Armenia, Joshua; Zhang, Chao; Penson, Alexander V.; Reznik, Ed; Zhang, Liguo; Minet, Thais; Ochoa, Angelica; Gross, Benjamin E.; Iacobuzio-Donahue, Christine A.; Betel, Doron; Taylor, Barry S.; Gao, Jianjiong; Schultz, Nikolaus

    2018-01-01

    Driven by the recent advances of next generation sequencing (NGS) technologies and an urgent need to decode complex human diseases, a multitude of large-scale studies were conducted recently that have resulted in an unprecedented volume of whole transcriptome sequencing (RNA-seq) data, such as the Genotype Tissue Expression project (GTEx) and The Cancer Genome Atlas (TCGA). While these data offer new opportunities to identify the mechanisms underlying disease, the comparison of data from different sources remains challenging, due to differences in sample and data processing. Here, we developed a pipeline that processes and unifies RNA-seq data from different studies, which includes uniform realignment, gene expression quantification, and batch effect removal. We find that uniform alignment and quantification is not sufficient when combining RNA-seq data from different sources and that the removal of other batch effects is essential to facilitate data comparison. We have processed data from GTEx and TCGA and successfully corrected for study-specific biases, enabling comparative analysis between TCGA and GTEx. The normalized datasets are available for download on figshare. PMID:29664468

  3. Integrated mRNA and microRNA transcriptome sequencing characterizes sequence variants and mRNA–microRNA regulatory network in nasopharyngeal carcinoma model systems

    Directory of Open Access Journals (Sweden)

    Carol Ying-Ying Szeto

    2014-01-01

    Full Text Available Nasopharyngeal carcinoma (NPC is a prevalent malignancy in Southeast Asia among the Chinese population. Aberrant regulation of transcripts has been implicated in many types of cancers including NPC. Herein, we characterized mRNA and miRNA transcriptomes by RNA sequencing (RNASeq of NPC model systems. Matched total mRNA and small RNA of undifferentiated Epstein–Barr virus (EBV-positive NPC xenograft X666 and its derived cell line C666, well-differentiated NPC cell line HK1, and the immortalized nasopharyngeal epithelial cell line NP460 were sequenced by Solexa technology. We found 2812 genes and 149 miRNAs (human and EBV to be differentially expressed in NP460, HK1, C666 and X666 with RNASeq; 533 miRNA–mRNA target pairs were inversely regulated in the three NPC cell lines compared to NP460. Integrated mRNA/miRNA expression profiling and pathway analysis show extracellular matrix organization, Beta-1 integrin cell surface interactions, and the PI3K/AKT, EGFR, ErbB, and Wnt pathways were potentially deregulated in NPC. Real-time quantitative PCR was performed on selected mRNA/miRNAs in order to validate their expression. Transcript sequence variants such as short insertions and deletions (INDEL, single nucleotide variant (SNV, and isomiRs were characterized in the NPC model systems. A novel TP53 transcript variant was identified in NP460, HK1, and C666. Detection of three previously reported novel EBV-encoded BART miRNAs and their isomiRs were also observed. Meta-analysis of a model system to a clinical system aids the choice of different cell lines in NPC studies. This comprehensive characterization of mRNA and miRNA transcriptomes in NPC cell lines and the xenograft provides insights on miRNA regulation of mRNA and valuable resources on transcript variation and regulation in NPC, which are potentially useful for mechanistic and preclinical studies.

  4. SimFuse: A Novel Fusion Simulator for RNA Sequencing (RNA-Seq Data

    Directory of Open Access Journals (Sweden)

    Yuxiang Tan

    2015-01-01

    Full Text Available The performance evaluation of fusion detection algorithms from high-throughput sequencing data crucially relies on the availability of data with known positive and negative cases of gene rearrangements. The use of simulated data circumvents some shortcomings of real data by generation of an unlimited number of true and false positive events, and the consequent robust estimation of accuracy measures, such as precision and recall. Although a few simulated fusion datasets from RNA Sequencing (RNA-Seq are available, they are of limited sample size. This makes it difficult to systematically evaluate the performance of RNA-Seq based fusion-detection algorithms. Here, we present SimFuse to address this problem. SimFuse utilizes real sequencing data as the fusions’ background to closely approximate the distribution of reads from a real sequencing library and uses a reference genome as the template from which to simulate fusions’ supporting reads. To assess the supporting read-specific performance, SimFuse generates multiple datasets with various numbers of fusion supporting reads. Compared to an extant simulated dataset, SimFuse gives users control over the supporting read features and the sample size of the simulated library, based on which the performance metrics needed for the validation and comparison of alternative fusion-detection algorithms can be rigorously estimated.

  5. Diagnosis of chronic myeloid and acute lymphocytic leukemias by detection of leukemia-specific mRNA sequences amplified in vitro

    International Nuclear Information System (INIS)

    Kawasaki, E.S.; Clark, S.S.; Coyne, M.Y.; Smith, S.D.; Champlin, R.; Witte, O.N.; McCormick, F.P.

    1988-01-01

    The Philadelphia chromosome is present in more than 95% of chronic myeloid leukemia patients and 13% of acute lymphocytic leukemia patients. The Philadelphia translocation, t(9;22), fuses the BCR and ABL genes resulting in the expression of leukemia-specific, chimeric BCR-ABL messenger RNAs. To facilitate diagnosis of these leukemias, the authors have developed a method of amplifying and detecting only the unique mRNA sequences, using an extension of the polymerase chain reaction technique. Diagnosis of chronic myeloid and acute lymphocytic leukemias by this procedure is rapid, much more sensitive than existing protocols, and independent of the presence or absence of an identifiable Philadelphia chromosome

  6. Preparation of highly multiplexed small RNA sequencing libraries.

    Science.gov (United States)

    Persson, Helena; Søkilde, Rolf; Pirona, Anna Chiara; Rovira, Carlos

    2017-08-01

    MicroRNAs (miRNAs) are ~22-nucleotide-long small non-coding RNAs that regulate the expression of protein-coding genes by base pairing to partially complementary target sites, preferentially located in the 3´ untranslated region (UTR) of target mRNAs. The expression and function of miRNAs have been extensively studied in human disease, as well as the possibility of using these molecules as biomarkers for prognostication and treatment guidance. To identify and validate miRNAs as biomarkers, their expression must be screened in large collections of patient samples. Here, we develop a scalable protocol for the rapid and economical preparation of a large number of small RNA sequencing libraries using dual indexing for multiplexing. Combined with the use of off-the-shelf reagents, more samples can be sequenced simultaneously on large-scale sequencing platforms at a considerably lower cost per sample. Sample preparation is simplified by pooling libraries prior to gel purification, which allows for the selection of a narrow size range while minimizing sample variation. A comparison with publicly available data from benchmarking of miRNA analysis platforms showed that this method captures absolute and differential expression as effectively as commercially available alternatives.

  7. Utility of RNA Sequencing for Analysis of Maize Reproductive Transcriptomes

    Directory of Open Access Journals (Sweden)

    Rebecca M. Davidson

    2011-11-01

    Full Text Available Transcriptome sequencing is a powerful method for studying global expression patterns in large, complex genomes. Evaluation of sequence-based expression profiles during reproductive development would provide functional annotation to genes underlying agronomic traits. We generated transcriptome profiles for 12 diverse maize ( L. reproductive tissues representing male, female, developing seed, and leaf tissues using high throughput transcriptome sequencing. Overall, ∼80% of annotated genes were expressed. Comparative analysis between sequence and hybridization-based methods demonstrated the utility of ribonucleic acid sequencing (RNA-seq for expression determination and differentiation of paralagous genes (∼85% of maize genes. Analysis of 4975 gene families across reproductive tissues revealed expression divergence is proportional to family size. In all pairwise comparisons between tissues, 7 (pre- vs. postemergence cobs to 48% (pollen vs. ovule of genes were differentially expressed. Genes with expression restricted to a single tissue within this study were identified with the highest numbers observed in leaves, endosperm, and pollen. Coexpression network analysis identified 17 gene modules with complex and shared expression patterns containing many previously described maize genes. The data and analyses in this study provide valuable tools through improved gene annotation, gene family characterization, and a core set of candidate genes to further characterize maize reproductive development and improve grain yield potential.

  8. Detailed mapping of serotonin 5-HT{sub 1B} and 5-HT{sub 1D} receptor messenger RNA and ligand binding sites in guinea-pig brain and trigeminal ganglion: clues for function

    Energy Technology Data Exchange (ETDEWEB)

    Leysen, J.E. [Graduate School Neurosciences, Amsterdam (Netherlands); Schotte, A.; Jurzak, M.; Luyten, W.H.M.L. [Department of Biochemical Pharmacology, Janssen Research Foundation, Beerse (Belgium); Voorn, P.; Bonaventure, P. [Graduate School Neurosciences, Amsterdam (Netherlands)

    1997-10-17

    The similar pharmacology of the 5-HT{sub 1B} and 5-HT{sub 1D} receptors, and the lack of selective compounds sufficiently distinguishing between the two receptor subtypes, have hampered functional studies on these receptors. In order to provide clues for differential functional roles of the two subtypes, we performed a parallel localization study throughout the guinea-pig brain and the trigeminal ganglia by means of quantitative in situ hybridization histochemistry (using [{sup 35}S]-labelled riboprobes probes for receptor messenger RNA) and receptor autoradiography (using a new radioligand [{sup 3}H]alniditan).The anatomical patterns of 5-HT{sub 1B} and 5-HT{sub 1D} receptor messenger RNA were quite different. While 5-HT{sub 1B} receptor messenger RNA was abundant throughout the brain (with highest levels in the striatum, nucleus accumbens, olfactory tubercle, cortex, hypothalamus, hippocampal formation, amygdala, thalamus, dorsal raphe and cerebellum), 5-HT{sub 1D} receptor messenger RNA exhibited a more restricted pattern; it was found mainly in the olfactory tubercle, entorhinal cortex, dorsal raphe, cerebellum, mesencephalic trigeminal nucleus and in the trigeminal ganglion. The density of 5-HT{sub 1B/1D} binding sites (combined) obtained with [{sup 3}H]alniditan autoradiography was high in the substantia nigra, superior colliculus and globus pallidus, whereas lower levels were detected in the caudate-putamen, hypothalamus, hippocampal formation, amygdala, thalamus and central gray. This distribution pattern was indistinguishable from specific 5-HT{sub 1B} receptor labelling in the presence of ketanserin under conditions to occlude 5-HT{sub 1D} receptor labelling; hence the latter were below detection level. Relationships between the regional distributions of the receptor messenger RNAs and binding sites and particular neuroanatomical pathways are discussed with respect to possible functional roles of the 5-HT{sub 1B} and 5-HT{sub 1D} receptors. (Copyright (c

  9. Next-generation sequencing library preparation method for identification of RNA viruses on the Ion Torrent Sequencing Platform.

    Science.gov (United States)

    Chen, Guiqian; Qiu, Yuan; Zhuang, Qingye; Wang, Suchun; Wang, Tong; Chen, Jiming; Wang, Kaicheng

    2018-05-09

    Next generation sequencing (NGS) is a powerful tool for the characterization, discovery, and molecular identification of RNA viruses. There were multiple NGS library preparation methods published for strand-specific RNA-seq, but some methods are not suitable for identifying and characterizing RNA viruses. In this study, we report a NGS library preparation method to identify RNA viruses using the Ion Torrent PGM platform. The NGS sequencing adapters were directly inserted into the sequencing library through reverse transcription and polymerase chain reaction, without fragmentation and ligation of nucleic acids. The results show that this method is simple to perform, able to identify multiple species of RNA viruses in clinical samples.

  10. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    OpenAIRE

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-01-01

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

  11. Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

    OpenAIRE

    Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

    1984-01-01

    We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to ...

  12. Deep sequencing of foot-and-mouth disease virus reveals RNA sequences involved in genome packaging.

    Science.gov (United States)

    Logan, Grace; Newman, Joseph; Wright, Caroline F; Lasecka-Dykes, Lidia; Haydon, Daniel T; Cottam, Eleanor M; Tuthill, Tobias J

    2017-10-18

    Non-enveloped viruses protect their genomes by packaging them into an outer shell or capsid of virus-encoded proteins. Packaging and capsid assembly in RNA viruses can involve interactions between capsid proteins and secondary structures in the viral genome as exemplified by the RNA bacteriophage MS2 and as proposed for other RNA viruses of plants, animals and human. In the picornavirus family of non-enveloped RNA viruses, the requirements for genome packaging remain poorly understood. Here we show a novel and simple approach to identify predicted RNA secondary structures involved in genome packaging in the picornavirus foot-and-mouth disease virus (FMDV). By interrogating deep sequencing data generated from both packaged and unpackaged populations of RNA we have determined multiple regions of the genome with constrained variation in the packaged population. Predicted secondary structures of these regions revealed stem loops with conservation of structure and a common motif at the loop. Disruption of these features resulted in attenuation of virus growth in cell culture due to a reduction in assembly of mature virions. This study provides evidence for the involvement of predicted RNA structures in picornavirus packaging and offers a readily transferable methodology for identifying packaging requirements in many other viruses. Importance In order to transmit their genetic material to a new host, non-enveloped viruses must protect their genomes by packaging them into an outer shell or capsid of virus-encoded proteins. For many non-enveloped RNA viruses the requirements for this critical part of the viral life cycle remain poorly understood. We have identified RNA sequences involved in genome packaging of the picornavirus foot-and-mouth disease virus. This virus causes an economically devastating disease of livestock affecting both the developed and developing world. The experimental methods developed to carry out this work are novel, simple and transferable to the

  13. Relationship between mRNA secondary structure and sequence variability in Chloroplast genes: possible life history implications.

    Science.gov (United States)

    Krishnan, Neeraja M; Seligmann, Hervé; Rao, Basuthkar J

    2008-01-28

    Synonymous sites are freer to vary because of redundancy in genetic code. Messenger RNA secondary structure restricts this freedom, as revealed by previous findings in mitochondrial genes that mutations at third codon position nucleotides in helices are more selected against than those in loops. This motivated us to explore the constraints imposed by mRNA secondary structure on evolutionary variability at all codon positions in general, in chloroplast systems. We found that the evolutionary variability and intrinsic secondary structure stability of these sequences share an inverse relationship. Simulations of most likely single nucleotide evolution in Psilotum nudum and Nephroselmis olivacea mRNAs, indicate that helix-forming propensities of mutated mRNAs are greater than those of the natural mRNAs for short sequences and vice-versa for long sequences. Moreover, helix-forming propensity estimated by the percentage of total mRNA in helices increases gradually with mRNA length, saturating beyond 1000 nucleotides. Protection levels of functionally important sites vary across plants and proteins: r-strategists minimize mutation costs in large genes; K-strategists do the opposite. Mrna length presumably predisposes shorter mRNAs to evolve under different constraints than longer mRNAs. The positive correlation between secondary structure protection and functional importance of sites suggests that some sites might be conserved due to packing-protection constraints at the nucleic acid level in addition to protein level constraints. Consequently, nucleic acid secondary structure a priori biases mutations. The converse (exposure of conserved sites) apparently occurs in a smaller number of cases, indicating a different evolutionary adaptive strategy in these plants. The differences between the protection levels of functionally important sites for r- and K-strategists reflect their respective molecular adaptive strategies. These converge with increasing domestication levels of

  14. Mechanisms controlling mRNA processing and translation : decoding the regulatory layers defining gene expression through RNA sequencing

    NARCIS (Netherlands)

    Klerk, Eleonora de

    2015-01-01

    The work described in this thesis focuses on the mechanisms that give rise to alternative mRNAs and their alternative translation into proteins. Each of the described studies has been based on a specific set of high-throughput RNA sequencing technologies. An overview of the available RNA sequencing

  15. Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

    Science.gov (United States)

    Szymanski, Maciej; Karlowski, Wojciech M

    2016-01-01

    In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

  16. Evaluation of two main RNA-seq approaches for gene quantification in clinical RNA sequencing: polyA+ selection versus rRNA depletion.

    Science.gov (United States)

    Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David

    2018-03-19

    To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.

  17. Sequencing of 16S rRNA gene for id ntification of Sta h lococcus ...

    African Journals Online (AJOL)

    Asdmin

    2014-01-15

    Jan 15, 2014 ... as the type strains of a species of genus Trichoderma based on phylogenetic tree analysis together with the 18S rRNA gene sequence search in Ribosomal Database Project, small subunit rRNA and large subunit rRNA databases. The sequence was deposited in GenBank with the accession numbers.

  18. Pairwise local structural alignment of RNA sequences with sequence similarity less than 40%

    DEFF Research Database (Denmark)

    Havgaard, Jakob Hull; Lyngsø, Rune B.; Stormo, Gary D.

    2005-01-01

    detect two genes with low sequence similarity, where the genes are part of a larger genomic region. Results: Here we present such an approach for pairwise local alignment which is based on FILDALIGN and the Sankoff algorithm for simultaneous structural alignment of multiple sequences. We include...... the ability to conduct mutual scans of two sequences of arbitrary length while searching for common local structural motifs of some maximum length. This drastically reduces the complexity of the algorithm. The scoring scheme includes structural parameters corresponding to those available for free energy....... The structure prediction performance for a family is typically around 0.7 using Matthews correlation coefficient. In case (2), the algorithm is successful at locating RNA families with an average sensitivity of 0.8 and a positive predictive value of 0.9 using a BLAST-like hit selection scheme. Availability...

  19. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-10-11

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

  20. Modulations of RNA sequences by cytokinin in pumpkin cotyledons

    International Nuclear Information System (INIS)

    Chang, C.; Ertl, J.; Chen, C.

    1987-01-01

    Polyadenylated mRNAs from excised pumpkin cotyledons treated with or without 10 -4 M benzyladenine (BA) for various time periods in suspension culture were assayed by in vitro translation in the presence of [ 35 S] methionine. The radioactive polypeptides were analyzed by one- and two-dimensional polyacrylamide gel electrophoresis. Specific sequences of mRNAs were enhanced, reduced, induced, or suppressed by the hormone within 60 min of the application of BA to the cotyledons. Four independent cDNA clones of cytokinin-modulated mRNAs have been selected and characterized. RNA blot hybridization using the four cDNA probes also indicates that the levels of specific mRNAs are modulated upward or downward by the hormone

  1. Interference by clustered regularly interspaced short palindromic repeat (CRISPR) RNA is governed by a seed sequence

    NARCIS (Netherlands)

    Semenova, E.V.; Jore, M.M.; Westra, E.R.; Oost, van der J.; Brouns, S.J.J.

    2011-01-01

    Prokaryotic clustered regularly interspaced short palindromic repeat (CRISPR)/Cas (CRISPR-associated sequences) systems provide adaptive immunity against viruses when a spacer sequence of small CRISPR RNA (crRNA) matches a protospacer sequence in the viral genome. Viruses that escape CRISPR/Cas

  2. Polyadenylation of RNA transcribed from mammalian SINEs by RNA polymerase III: Complex requirements for nucleotide sequences.

    Science.gov (United States)

    Borodulina, Olga R; Golubchikova, Julia S; Ustyantsev, Ilia G; Kramerov, Dmitri A

    2016-02-01

    It is generally accepted that only transcripts synthesized by RNA polymerase II (e.g., mRNA) were subject to AAUAAA-dependent polyadenylation. However, we previously showed that RNA transcribed by RNA polymerase III (pol III) from mouse B2 SINE could be polyadenylated in an AAUAAA-dependent manner. Many species of mammalian SINEs end with the pol III transcriptional terminator (TTTTT) and contain hexamers AATAAA in their A-rich tail. Such SINEs were united into Class T(+), whereas SINEs lacking the terminator and AATAAA sequences were classified as T(-). Here we studied the structural features of SINE pol III transcripts that are necessary for their polyadenylation. Eight and six SINE families from classes T(+) and T(-), respectively, were analyzed. The replacement of AATAAA with AACAAA in T(+) SINEs abolished the RNA polyadenylation. Interestingly, insertion of the polyadenylation signal (AATAAA) and pol III transcription terminator in T(-) SINEs did not result in polyadenylation. The detailed analysis of three T(+) SINEs (B2, DIP, and VES) revealed areas important for the polyadenylation of their pol III transcripts: the polyadenylation signal and terminator in A-rich tail, β region positioned immediately downstream of the box B of pol III promoter, and τ region located upstream of the tail. In DIP and VES (but not in B2), the τ region is a polypyrimidine motif which is also characteristic of many other T(+) SINEs. Most likely, SINEs of different mammals acquired these structural features independently as a result of parallel evolution. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Transcriptome sequencing of the Microarray Quality Control (MAQC RNA reference samples using next generation sequencing

    Directory of Open Access Journals (Sweden)

    Thierry-Mieg Danielle

    2009-06-01

    Full Text Available Abstract Background Transcriptome sequencing using next-generation sequencing platforms will soon be competing with DNA microarray technologies for global gene expression analysis. As a preliminary evaluation of these promising technologies, we performed deep sequencing of cDNA synthesized from the Microarray Quality Control (MAQC reference RNA samples using Roche's 454 Genome Sequencer FLX. Results We generated more that 3.6 million sequence reads of average length 250 bp for the MAQC A and B samples and introduced a data analysis pipeline for translating cDNA read counts into gene expression levels. Using BLAST, 90% of the reads mapped to the human genome and 64% of the reads mapped to the RefSeq database of well annotated genes with e-values ≤ 10-20. We measured gene expression levels in the A and B samples by counting the numbers of reads that mapped to individual RefSeq genes in multiple sequencing runs to evaluate the MAQC quality metrics for reproducibility, sensitivity, specificity, and accuracy and compared the results with DNA microarrays and Quantitative RT-PCR (QRTPCR from the MAQC studies. In addition, 88% of the reads were successfully aligned directly to the human genome using the AceView alignment programs with an average 90% sequence similarity to identify 137,899 unique exon junctions, including 22,193 new exon junctions not yet contained in the RefSeq database. Conclusion Using the MAQC metrics for evaluating the performance of gene expression platforms, the ExpressSeq results for gene expression levels showed excellent reproducibility, sensitivity, and specificity that improved systematically with increasing shotgun sequencing depth, and quantitative accuracy that was comparable to DNA microarrays and QRTPCR. In addition, a careful mapping of the reads to the genome using the AceView alignment programs shed new light on the complexity of the human transcriptome including the discovery of thousands of new splice variants.

  4. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Science.gov (United States)

    Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

    2015-01-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  5. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Directory of Open Access Journals (Sweden)

    Nathan D. Olson

    2015-03-01

    Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  6. sRNAnalyzer-a flexible and customizable small RNA sequencing data analysis pipeline.

    Science.gov (United States)

    Wu, Xiaogang; Kim, Taek-Kyun; Baxter, David; Scherler, Kelsey; Gordon, Aaron; Fong, Olivia; Etheridge, Alton; Galas, David J; Wang, Kai

    2017-12-01

    Although many tools have been developed to analyze small RNA sequencing (sRNA-Seq) data, it remains challenging to accurately analyze the small RNA population, mainly due to multiple sequence ID assignment caused by short read length. Additional issues in small RNA analysis include low consistency of microRNA (miRNA) measurement results across different platforms, miRNA mapping associated with miRNA sequence variation (isomiR) and RNA editing, and the origin of those unmapped reads after screening against all endogenous reference sequence databases. To address these issues, we built a comprehensive and customizable sRNA-Seq data analysis pipeline-sRNAnalyzer, which enables: (i) comprehensive miRNA profiling strategies to better handle isomiRs and summarization based on each nucleotide position to detect potential SNPs in miRNAs, (ii) different sequence mapping result assignment approaches to simulate results from microarray/qRT-PCR platforms and a local probabilistic model to assign mapping results to the most-likely IDs, (iii) comprehensive ribosomal RNA filtering for accurate mapping of exogenous RNAs and summarization based on taxonomy annotation. We evaluated our pipeline on both artificial samples (including synthetic miRNA and Escherichia coli cultures) and biological samples (human tissue and plasma). sRNAnalyzer is implemented in Perl and available at: http://srnanalyzer.systemsbiology.net/. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. sRNAnalyzer—a flexible and customizable small RNA sequencing data analysis pipeline

    Science.gov (United States)

    Kim, Taek-Kyun; Baxter, David; Scherler, Kelsey; Gordon, Aaron; Fong, Olivia; Etheridge, Alton; Galas, David J.

    2017-01-01

    Abstract Although many tools have been developed to analyze small RNA sequencing (sRNA-Seq) data, it remains challenging to accurately analyze the small RNA population, mainly due to multiple sequence ID assignment caused by short read length. Additional issues in small RNA analysis include low consistency of microRNA (miRNA) measurement results across different platforms, miRNA mapping associated with miRNA sequence variation (isomiR) and RNA editing, and the origin of those unmapped reads after screening against all endogenous reference sequence databases. To address these issues, we built a comprehensive and customizable sRNA-Seq data analysis pipeline—sRNAnalyzer, which enables: (i) comprehensive miRNA profiling strategies to better handle isomiRs and summarization based on each nucleotide position to detect potential SNPs in miRNAs, (ii) different sequence mapping result assignment approaches to simulate results from microarray/qRT-PCR platforms and a local probabilistic model to assign mapping results to the most-likely IDs, (iii) comprehensive ribosomal RNA filtering for accurate mapping of exogenous RNAs and summarization based on taxonomy annotation. We evaluated our pipeline on both artificial samples (including synthetic miRNA and Escherichia coli cultures) and biological samples (human tissue and plasma). sRNAnalyzer is implemented in Perl and available at: http://srnanalyzer.systemsbiology.net/. PMID:29069500

  8. Sequence-structure relationships in RNA loops: establishing the basis for loop homology modeling.

    Science.gov (United States)

    Schudoma, Christian; May, Patrick; Nikiforova, Viktoria; Walther, Dirk

    2010-01-01

    The specific function of RNA molecules frequently resides in their seemingly unstructured loop regions. We performed a systematic analysis of RNA loops extracted from experimentally determined three-dimensional structures of RNA molecules. A comprehensive loop-structure data set was created and organized into distinct clusters based on structural and sequence similarity. We detected clear evidence of the hallmark of homology present in the sequence-structure relationships in loops. Loops differing by structures. Thus, our results support the application of homology modeling for RNA loop model building. We established a threshold that may guide the sequence divergence-based selection of template structures for RNA loop homology modeling. Of all possible sequences that are, under the assumption of isosteric relationships, theoretically compatible with actual sequences observed in RNA structures, only a small fraction is contained in the Rfam database of RNA sequences and classes implying that the actual RNA loop space may consist of a limited number of unique loop structures and conserved sequences. The loop-structure data sets are made available via an online database, RLooM. RLooM also offers functionalities for the modeling of RNA loop structures in support of RNA engineering and design efforts.

  9. Evaluating Methods for Isolating Total RNA and Predicting the Success of Sequencing Phylogenetically Diverse Plant Transcriptomes

    Science.gov (United States)

    Bruskiewich, Richard; Burris, Jason N.; Carrigan, Charlotte T.; Chase, Mark W.; Clarke, Neil D.; Covshoff, Sarah; dePamphilis, Claude W.; Edger, Patrick P.; Goh, Falicia; Graham, Sean; Greiner, Stephan; Hibberd, Julian M.; Jordon-Thaden, Ingrid; Kutchan, Toni M.; Leebens-Mack, James; Melkonian, Michael; Miles, Nicholas; Myburg, Henrietta; Patterson, Jordan; Pires, J. Chris; Ralph, Paula; Rolf, Megan; Sage, Rowan F.; Soltis, Douglas; Soltis, Pamela; Stevenson, Dennis; Stewart, C. Neal; Surek, Barbara; Thomsen, Christina J. M.; Villarreal, Juan Carlos; Wu, Xiaolei; Zhang, Yong; Deyholos, Michael K.; Wong, Gane Ka-Shu

    2012-01-01

    Next-generation sequencing plays a central role in the characterization and quantification of transcriptomes. Although numerous metrics are purported to quantify the quality of RNA, there have been no large-scale empirical evaluations of the major determinants of sequencing success. We used a combination of existing and newly developed methods to isolate total RNA from 1115 samples from 695 plant species in 324 families, which represents >900 million years of phylogenetic diversity from green algae through flowering plants, including many plants of economic importance. We then sequenced 629 of these samples on Illumina GAIIx and HiSeq platforms and performed a large comparative analysis to identify predictors of RNA quality and the diversity of putative genes (scaffolds) expressed within samples. Tissue types (e.g., leaf vs. flower) varied in RNA quality, sequencing depth and the number of scaffolds. Tissue age also influenced RNA quality but not the number of scaffolds ≥1000 bp. Overall, 36% of the variation in the number of scaffolds was explained by metrics of RNA integrity (RIN score), RNA purity (OD 260/230), sequencing platform (GAIIx vs HiSeq) and the amount of total RNA used for sequencing. However, our results show that the most commonly used measures of RNA quality (e.g., RIN) are weak predictors of the number of scaffolds because Illumina sequencing is robust to variation in RNA quality. These results provide novel insight into the methods that are most important in isolating high quality RNA for sequencing and assembling plant transcriptomes. The methods and recommendations provided here could increase the efficiency and decrease the cost of RNA sequencing for individual labs and genome centers. PMID:23185583

  10. Evaluating Quality of Aged Archival Formalin-Fixed Paraffin-Embedded Samples for RNA-Sequencing

    Science.gov (United States)

    Archival formalin-fixed paraffin-embedded (FFPE) samples offer a vast, untapped source of genomic data for biomarker discovery. However, the quality of FFPE samples is often highly variable, and conventional methods to assess RNA quality for RNA-sequencing (RNA-seq) are not infor...

  11. BioVLAB-MMIA-NGS: microRNA-mRNA integrated analysis using high-throughput sequencing data.

    Science.gov (United States)

    Chae, Heejoon; Rhee, Sungmin; Nephew, Kenneth P; Kim, Sun

    2015-01-15

    It is now well established that microRNAs (miRNAs) play a critical role in regulating gene expression in a sequence-specific manner, and genome-wide efforts are underway to predict known and novel miRNA targets. However, the integrated miRNA-mRNA analysis remains a major computational challenge, requiring powerful informatics systems and bioinformatics expertise. The objective of this study was to modify our widely recognized Web server for the integrated mRNA-miRNA analysis (MMIA) and its subsequent deployment on the Amazon cloud (BioVLAB-MMIA) to be compatible with high-throughput platforms, including next-generation sequencing (NGS) data (e.g. RNA-seq). We developed a new version called the BioVLAB-MMIA-NGS, deployed on both Amazon cloud and on a high-performance publicly available server called MAHA. By using NGS data and integrating various bioinformatics tools and databases, BioVLAB-MMIA-NGS offers several advantages. First, sequencing data is more accurate than array-based methods for determining miRNA expression levels. Second, potential novel miRNAs can be detected by using various computational methods for characterizing miRNAs. Third, because miRNA-mediated gene regulation is due to hybridization of an miRNA to its target mRNA, sequencing data can be used to identify many-to-many relationship between miRNAs and target genes with high accuracy. http://epigenomics.snu.ac.kr/biovlab_mmia_ngs/. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  12. RNA sequencing of the exercise transcriptome in equine athletes.

    Directory of Open Access Journals (Sweden)

    Stefano Capomaccio

    Full Text Available The horse is an optimal model organism for studying the genomic response to exercise-induced stress, due to its natural aptitude for athletic performance and the relative homogeneity of its genetic and environmental backgrounds. Here, we applied RNA-sequencing analysis through the use of SOLiD technology in an experimental framework centered on exercise-induced stress during endurance races in equine athletes. We monitored the transcriptional landscape by comparing gene expression levels between animals at rest and after competition. Overall, we observed a shift from coding to non-coding regions, suggesting that the stress response involves the differential expression of not annotated regions. Notably, we observed significant post-race increases of reads that correspond to repeats, especially the intergenic and intronic L1 and L2 transposable elements. We also observed increased expression of the antisense strands compared to the sense strands in intronic and regulatory regions (1 kb up- and downstream of the genes, suggesting that antisense transcription could be one of the main mechanisms for transposon regulation in the horse under stress conditions. We identified a large number of transcripts corresponding to intergenic and intronic regions putatively associated with new transcriptional elements. Gene expression and pathway analysis allowed us to identify several biological processes and molecular functions that may be involved with exercise-induced stress. Ontology clustering reflected mechanisms that are already known to be stress activated (e.g., chemokine-type cytokines, Toll-like receptors, and kinases, as well as "nucleic acid binding" and "signal transduction activity" functions. There was also a general and transient decrease in the global rates of protein synthesis, which would be expected after strenuous global stress. In sum, our network analysis points toward the involvement of specific gene clusters in equine exercise

  13. Defining reference sequences for Nocardia species by similarity and clustering analyses of 16S rRNA gene sequence data.

    Directory of Open Access Journals (Sweden)

    Manal Helal

    Full Text Available BACKGROUND: The intra- and inter-species genetic diversity of bacteria and the absence of 'reference', or the most representative, sequences of individual species present a significant challenge for sequence-based identification. The aims of this study were to determine the utility, and compare the performance of several clustering and classification algorithms to identify the species of 364 sequences of 16S rRNA gene with a defined species in GenBank, and 110 sequences of 16S rRNA gene with no defined species, all within the genus Nocardia. METHODS: A total of 364 16S rRNA gene sequences of Nocardia species were studied. In addition, 110 16S rRNA gene sequences assigned only to the Nocardia genus level at the time of submission to GenBank were used for machine learning classification experiments. Different clustering algorithms were compared with a novel algorithm or the linear mapping (LM of the distance matrix. Principal Components Analysis was used for the dimensionality reduction and visualization. RESULTS: The LM algorithm achieved the highest performance and classified the set of 364 16S rRNA sequences into 80 clusters, the majority of which (83.52% corresponded with the original species. The most representative 16S rRNA sequences for individual Nocardia species have been identified as 'centroids' in respective clusters from which the distances to all other sequences were minimized; 110 16S rRNA gene sequences with identifications recorded only at the genus level were classified using machine learning methods. Simple kNN machine learning demonstrated the highest performance and classified Nocardia species sequences with an accuracy of 92.7% and a mean frequency of 0.578. CONCLUSION: The identification of centroids of 16S rRNA gene sequence clusters using novel distance matrix clustering enables the identification of the most representative sequences for each individual species of Nocardia and allows the quantitation of inter- and intra

  14. Full-length mRNA sequencing uncovers a widespread coupling between transcription initiation and mRNA processing.

    Science.gov (United States)

    Anvar, Seyed Yahya; Allard, Guy; Tseng, Elizabeth; Sheynkman, Gloria M; de Klerk, Eleonora; Vermaat, Martijn; Yin, Raymund H; Johansson, Hans E; Ariyurek, Yavuz; den Dunnen, Johan T; Turner, Stephen W; 't Hoen, Peter A C

    2018-03-29

    The multifaceted control of gene expression requires tight coordination of regulatory mechanisms at transcriptional and post-transcriptional level. Here, we studied the interdependence of transcription initiation, splicing and polyadenylation events on single mRNA molecules by full-length mRNA sequencing. In MCF-7 breast cancer cells, we find 2700 genes with interdependent alternative transcription initiation, splicing and polyadenylation events, both in proximal and distant parts of mRNA molecules, including examples of coupling between transcription start sites and polyadenylation sites. The analysis of three human primary tissues (brain, heart and liver) reveals similar patterns of interdependency between transcription initiation and mRNA processing events. We predict thousands of novel open reading frames from full-length mRNA sequences and obtained evidence for their translation by shotgun proteomics. The mapping database rescues 358 previously unassigned peptides and improves the assignment of others. By recognizing sample-specific amino-acid changes and novel splicing patterns, full-length mRNA sequencing improves proteogenomics analysis of MCF-7 cells. Our findings demonstrate that our understanding of transcriptome complexity is far from complete and provides a basis to reveal largely unresolved mechanisms that coordinate transcription initiation and mRNA processing.

  15. High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases

    Science.gov (United States)

    Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.

    2016-01-01

    Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030

  16. RStrucFam: a web server to associate structure and cognate RNA for RNA-binding proteins from sequence information.

    Science.gov (United States)

    Ghosh, Pritha; Mathew, Oommen K; Sowdhamini, Ramanathan

    2016-10-07

    RNA-binding proteins (RBPs) interact with their cognate RNA(s) to form large biomolecular assemblies. They are versatile in their functionality and are involved in a myriad of processes inside the cell. RBPs with similar structural features and common biological functions are grouped together into families and superfamilies. It will be useful to obtain an early understanding and association of RNA-binding property of sequences of gene products. Here, we report a web server, RStrucFam, to predict the structure, type of cognate RNA(s) and function(s) of proteins, where possible, from mere sequence information. The web server employs Hidden Markov Model scan (hmmscan) to enable association to a back-end database of structural and sequence families. The database (HMMRBP) comprises of 437 HMMs of RBP families of known structure that have been generated using structure-based sequence alignments and 746 sequence-centric RBP family HMMs. The input protein sequence is associated with structural or sequence domain families, if structure or sequence signatures exist. In case of association of the protein with a family of known structures, output features like, multiple structure-based sequence alignment (MSSA) of the query with all others members of that family is provided. Further, cognate RNA partner(s) for that protein, Gene Ontology (GO) annotations, if any and a homology model of the protein can be obtained. The users can also browse through the database for details pertaining to each family, protein or RNA and their related information based on keyword search or RNA motif search. RStrucFam is a web server that exploits structurally conserved features of RBPs, derived from known family members and imprinted in mathematical profiles, to predict putative RBPs from sequence information. Proteins that fail to associate with such structure-centric families are further queried against the sequence-centric RBP family HMMs in the HMMRBP database. Further, all other essential

  17. Deep sequencing of RNA from ancient maize kernels

    DEFF Research Database (Denmark)

    Fordyce, Sarah Louise; Avila Arcos, Maria del Carmen; Rasmussen, Morten

    2013-01-01

    The characterization of biomolecules from ancient samples can shed otherwise unobtainable insights into the past. Despite the fundamental role of transcriptomal change in evolution, the potential of ancient RNA remains unexploited - perhaps due to dogma associated with the fragility of RNA. We hy...... maize kernels. The results suggest that ancient seed transcriptomics may offer a powerful new tool with which to study plant domestication....

  18. Accurate RNA consensus sequencing for high-fidelity detection of transcriptional mutagenesis-induced epimutations.

    Science.gov (United States)

    Reid-Bayliss, Kate S; Loeb, Lawrence A

    2017-08-29

    Transcriptional mutagenesis (TM) due to misincorporation during RNA transcription can result in mutant RNAs, or epimutations, that generate proteins with altered properties. TM has long been hypothesized to play a role in aging, cancer, and viral and bacterial evolution. However, inadequate methodologies have limited progress in elucidating a causal association. We present a high-throughput, highly accurate RNA sequencing method to measure epimutations with single-molecule sensitivity. Accurate RNA consensus sequencing (ARC-seq) uniquely combines RNA barcoding and generation of multiple cDNA copies per RNA molecule to eliminate errors introduced during cDNA synthesis, PCR, and sequencing. The stringency of ARC-seq can be scaled to accommodate the quality of input RNAs. We apply ARC-seq to directly assess transcriptome-wide epimutations resulting from RNA polymerase mutants and oxidative stress.

  19. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin

    Science.gov (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-01

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecue, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G•U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G•U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  20. Hybridization-based reconstruction of small non-coding RNA transcripts from deep sequencing data.

    Science.gov (United States)

    Ragan, Chikako; Mowry, Bryan J; Bauer, Denis C

    2012-09-01

    Recent advances in RNA sequencing technology (RNA-Seq) enables comprehensive profiling of RNAs by producing millions of short sequence reads from size-fractionated RNA libraries. Although conventional tools for detecting and distinguishing non-coding RNAs (ncRNAs) from reference-genome data can be applied to sequence data, ncRNA detection can be improved by harnessing the full information content provided by this new technology. Here we present NorahDesk, the first unbiased and universally applicable method for small ncRNAs detection from RNA-Seq data. NorahDesk utilizes the coverage-distribution of small RNA sequence data as well as thermodynamic assessments of secondary structure to reliably predict and annotate ncRNA classes. Using publicly available mouse sequence data from brain, skeletal muscle, testis and ovary, we evaluated our method with an emphasis on the performance for microRNAs (miRNAs) and piwi-interacting small RNA (piRNA). We compared our method with Dario and mirDeep2 and found that NorahDesk produces longer transcripts with higher read coverage. This feature makes it the first method particularly suitable for the prediction of both known and novel piRNAs.

  1. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    Science.gov (United States)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  2. Small RNA sequencing reveals metastasis-related microRNAs in lung adenocarcinoma

    DEFF Research Database (Denmark)

    Daugaard, Iben; Venø, Morten T.; Yan, Yan

    2017-01-01

    The majority of lung cancer deaths are caused by metastatic disease. MicroRNAs (miRNAs) are posttranscriptional regulators of gene expression and miRNA dysregulation can contribute to metastatic progression. Here, small RNA sequencing was used to profile the miRNA and piwi-interacting RNA (piRNA......) transcriptomes in relation to lung cancer metastasis. RNA-seq was performed using RNA extracted from formalin-fixed paraffin embedded (FFPE) lung adenocarcinomas (LAC) and brain metastases from 8 patients, and LACs from 8 patients without detectable metastatic disease. Impact on miRNA and piRNA transcriptomes...... was subtle with 9 miRNAs and 8 piRNAs demonstrating differential expression between metastasizing and non-metastasizing LACs. For piRNAs, decreased expression of piR-57125 was the most significantly associated with distant metastasis. Validation by RT-qPCR in a LAC cohort comprising 52 patients confirmed...

  3. Fragile X Mental Retardation Protein and Dendritic Local Translation of the Alpha Subunit of the Calcium/Calmodulin-Dependent Kinase II Messenger RNA Are Required for the Structural Plasticity Underlying Olfactory Learning.

    Science.gov (United States)

    Daroles, Laura; Gribaudo, Simona; Doulazmi, Mohamed; Scotto-Lomassese, Sophie; Dubacq, Caroline; Mandairon, Nathalie; Greer, Charles August; Didier, Anne; Trembleau, Alain; Caillé, Isabelle

    2016-07-15

    In the adult brain, structural plasticity allowing gain or loss of synapses remodels circuits to support learning. In fragile X syndrome, the absence of fragile X mental retardation protein (FMRP) leads to defects in plasticity and learning deficits. FMRP is a master regulator of local translation but its implication in learning-induced structural plasticity is unknown. Using an olfactory learning task requiring adult-born olfactory bulb neurons and cell-specific ablation of FMRP, we investigated whether learning shapes adult-born neuron morphology during their synaptic integration and its dependence on FMRP. We used alpha subunit of the calcium/calmodulin-dependent kinase II (αCaMKII) mutant mice with altered dendritic localization of αCaMKII messenger RNA, as well as a reporter of αCaMKII local translation to investigate the role of this FMRP messenger RNA target in learning-dependent structural plasticity. Learning induces profound changes in dendritic architecture and spine morphology of adult-born neurons that are prevented by ablation of FMRP in adult-born neurons and rescued by an metabotropic glutamate receptor 5 antagonist. Moreover, dendritically translated αCaMKII is necessary for learning and associated structural modifications and learning triggers an FMRP-dependent increase of αCaMKII dendritic translation in adult-born neurons. Our results strongly suggest that FMRP mediates structural plasticity of olfactory bulb adult-born neurons to support olfactory learning through αCaMKII local translation. This reveals a new role for FMRP-regulated dendritic local translation in learning-induced structural plasticity. This might be of clinical relevance for the understanding of critical periods disruption in autism spectrum disorder patients, among which fragile X syndrome is the primary monogenic cause. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  4. DNApi: A De Novo Adapter Prediction Algorithm for Small RNA Sequencing Data.

    Science.gov (United States)

    Tsuji, Junko; Weng, Zhiping

    2016-01-01

    With the rapid accumulation of publicly available small RNA sequencing datasets, third-party meta-analysis across many datasets is becoming increasingly powerful. Although removing the 3´ adapter is an essential step for small RNA sequencing analysis, the adapter sequence information is not always available in the metadata. The information can be also erroneous even when it is available. In this study, we developed DNApi, a lightweight Python software package that predicts the 3´ adapter sequence de novo and provides the user with cleansed small RNA sequences ready for down stream analysis. Tested on 539 publicly available small RNA libraries accompanied with 3´ adapter sequences in their metadata, DNApi shows near-perfect accuracy (98.5%) with fast runtime (~2.85 seconds per library) and efficient memory usage (~43 MB on average). In addition to 3´ adapter prediction, it is also important to classify whether the input small RNA libraries were already processed, i.e. the 3´ adapters were removed. DNApi perfectly judged that given another batch of datasets, 192 publicly available processed libraries were "ready-to-map" small RNA sequence. DNApi is compatible with Python 2 and 3, and is available at https://github.com/jnktsj/DNApi. The 731 small RNA libraries used for DNApi evaluation were from human tissues and were carefully and manually collected. This study also provides readers with the curated datasets that can be integrated into their studies.

  5. A short autocomplementary sequence plays an essential role in avian sarcoma-leukosis virus RNA dimerization.

    Science.gov (United States)

    Fossé, P; Motté, N; Roumier, A; Gabus, C; Muriaux, D; Darlix, J L; Paoletti, J

    1996-12-24

    Retroviral genomes consist of two identical RNA molecules joined noncovalently near their 5'-ends. Recently, two models have been proposed for RNA dimer formation on the basis of results obtained in vitro with human immunodeficiency virus type 1 RNA and Moloney murine leukemia virus RNA. It was first proposed that viral RNA dimerizes by forming an interstrand quadruple helix with purine tetrads. The second model postulates that RNA dimerization is initiated by a loop-loop interaction between the two RNA molecules. In order to better characterize the dimerization process of retroviral genomic RNA, we analyzed the in vitro dimerization of avian sarcoma-leukosis virus (ASLV) RNA using different transcripts. We determined the requirements for heterodimer formation, the thermal dissociation of RNA dimers, and the influence of antisense DNA oligonucleotides on dimer formation. Our results strongly suggest that purine tetrads are not involved in dimer formation. Data show that an autocomplementary sequence located upstream from the splice donor site and within a major packaging signal plays a crucial role in ASLV RNA dimer formation in vitro. This sequence is able to form a stem-loop structure, and phylogenetic analysis reveals that it is conserved in 28 different avian sarcoma and leukosis viruses. These results suggest that dimerization of ASLV RNA is initiated by a loop-loop interaction between two RNA molecules and provide an additional argument for the ubiquity of the dimerization process via loop-loop interaction.

  6. Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

    Science.gov (United States)

    Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

    1989-10-11

    The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

  7. Combined DECS Analysis and Next-Generation Sequencing Enable Efficient Detection of Novel Plant RNA Viruses

    Directory of Open Access Journals (Sweden)

    Hironobu Yanagisawa

    2016-03-01

    Full Text Available The presence of high molecular weight double-stranded RNA (dsRNA within plant cells is an indicator of infection with RNA viruses as these possess genomic or replicative dsRNA. DECS (dsRNA isolation, exhaustive amplification, cloning, and sequencing analysis has been shown to be capable of detecting unknown viruses. We postulated that a combination of DECS analysis and next-generation sequencing (NGS would improve detection efficiency and usability of the technique. Here, we describe a model case in which we efficiently detected the presumed genome sequence of Blueberry shoestring virus (BSSV, a member of the genus Sobemovirus, which has not so far been reported. dsRNAs were isolated from BSSV-infected blueberry plants using the dsRNA-binding protein, reverse-transcribed, amplified, and sequenced using NGS. A contig of 4,020 nucleotides (nt that shared similarities with sequences from other Sobemovirus species was obtained as a candidate of the BSSV genomic sequence. Reverse transcription (RT-PCR primer sets based on sequences from this contig enabled the detection of BSSV in all BSSV-infected plants tested but not in healthy controls. A recombinant protein encoded by the putative coat protein gene was bound by the BSSV-antibody, indicating that the candidate sequence was that of BSSV itself. Our results suggest that a combination of DECS analysis and NGS, designated here as “DECS-C,” is a powerful method for detecting novel plant viruses.

  8. 3' terminal diversity of MRP RNA and other human noncoding RNAs revealed by deep sequencing.

    Science.gov (United States)

    Goldfarb, Katherine C; Cech, Thomas R

    2013-09-21

    Post-transcriptional 3' end processing is a key component of RNA regulation. The abundant and essential RNA subunit of RNase MRP has been proposed to function in three distinct cellular compartments and therefore may utilize this mode of regulation. Here we employ 3' RACE coupled with high-throughput sequencing to characterize the 3' terminal sequences of human MRP RNA and other noncoding RNAs that form RNP complexes. The 3' terminal sequence of MRP RNA from HEK293T cells has a distinctive distribution of genomically encoded termini (including an assortment of U residues) with a portion of these selectively tagged by oligo(A) tails. This profile contrasts with the relatively homogenous 3' terminus of an in vitro transcribed MRP RNA control and the differing 3' terminal profiles of U3 snoRNA, RNase P RNA, and telomerase RNA (hTR). 3' RACE coupled with deep sequencing provides a valuable framework for the functional characterization of 3' terminal sequences of noncoding RNAs.

  9. 3′ terminal diversity of MRP RNA and other human noncoding RNAs revealed by deep sequencing

    Science.gov (United States)

    2013-01-01

    Background Post-transcriptional 3′ end processing is a key component of RNA regulation. The abundant and essential RNA subunit of RNase MRP has been proposed to function in three distinct cellular compartments and therefore may utilize this mode of regulation. Here we employ 3′ RACE coupled with high-throughput sequencing to characterize the 3′ terminal sequences of human MRP RNA and other noncoding RNAs that form RNP complexes. Results The 3′ terminal sequence of MRP RNA from HEK293T cells has a distinctive distribution of genomically encoded termini (including an assortment of U residues) with a portion of these selectively tagged by oligo(A) tails. This profile contrasts with the relatively homogenous 3′ terminus of an in vitro transcribed MRP RNA control and the differing 3′ terminal profiles of U3 snoRNA, RNase P RNA, and telomerase RNA (hTR). Conclusions 3′ RACE coupled with deep sequencing provides a valuable framework for the functional characterization of 3′ terminal sequences of noncoding RNAs. PMID:24053768

  10. miRBase: integrating microRNA annotation and deep-sequencing data.

    Science.gov (United States)

    Kozomara, Ana; Griffiths-Jones, Sam

    2011-01-01

    miRBase is the primary online repository for all microRNA sequences and annotation. The current release (miRBase 16) contains over 15,000 microRNA gene loci in over 140 species, and over 17,000 distinct mature microRNA sequences. Deep-sequencing technologies have delivered a sharp rise in the rate of novel microRNA discovery. We have mapped reads from short RNA deep-sequencing experiments to microRNAs in miRBase and developed web interfaces to view these mappings. The user can view all read data associated with a given microRNA annotation, filter reads by experiment and count, and search for microRNAs by tissue- and stage-specific expression. These data can be used as a proxy for relative expression levels of microRNA sequences, provide detailed evidence for microRNA annotations and alternative isoforms of mature microRNAs, and allow us to revisit previous annotations. miRBase is available online at: http://www.mirbase.org/.

  11. MicroRNA Expression Profile in Penile Cancer Revealed by Next-Generation Small RNA Sequencing.

    Directory of Open Access Journals (Sweden)

    Li Zhang

    Full Text Available Penile cancer (PeCa is a relatively rare tumor entity but possesses higher morbidity and mortality rates especially in developing countries. To date, the concrete pathogenic signaling pathways and core machineries involved in tumorigenesis and progression of PeCa remain to be elucidated. Several studies suggested miRNAs, which modulate gene expression at posttranscriptional level, were frequently mis-regulated and aberrantly expressed in human cancers. However, the miRNA profile in human PeCa has not been reported before. In this present study, the miRNA profile was obtained from 10 fresh penile cancerous tissues and matched adjacent non-cancerous tissues via next-generation sequencing. As a result, a total of 751 and 806 annotated miRNAs were identified in normal and cancerous penile tissues, respectively. Among which, 56 miRNAs with significantly different expression levels between paired tissues were identified. Subsequently, several annotated miRNAs were selected randomly and validated using quantitative real-time PCR. Compared with the previous publications regarding to the altered miRNAs expression in various cancers and especially genitourinary (prostate, bladder, kidney, testis cancers, the most majority of deregulated miRNAs showed the similar expression pattern in penile cancer. Moreover, the bioinformatics analyses suggested that the putative target genes of differentially expressed miRNAs between cancerous and matched normal penile tissues were tightly associated with cell junction, proliferation, growth as well as genomic instability and so on, by modulating Wnt, MAPK, p53, PI3K-Akt, Notch and TGF-β signaling pathways, which were all well-established to participate in cancer initiation and progression. Our work presents a global view of the differentially expressed miRNAs and potentially regulatory networks of their target genes for clarifying the pathogenic transformation of normal penis to PeCa, which research resource also

  12. Informatics for RNA Sequencing: A Web Resource for Analysis on the Cloud.

    Directory of Open Access Journals (Sweden)

    Malachi Griffith

    2015-08-01

    Full Text Available Massively parallel RNA sequencing (RNA-seq has rapidly become the assay of choice for interrogating RNA transcript abundance and diversity. This article provides a detailed introduction to fundamental RNA-seq molecular biology and informatics concepts. We make available open-access RNA-seq tutorials that cover cloud computing, tool installation, relevant file formats, reference genomes, transcriptome annotations, quality-control strategies, expression, differential expression, and alternative splicing analysis methods. These tutorials and additional training resources are accompanied by complete analysis pipelines and test datasets made available without encumbrance at www.rnaseq.wiki.

  13. RNA sequencing atopic dermatitis transcriptome profiling provides insights into novel disease mechanisms with potential therapeutic implications

    DEFF Research Database (Denmark)

    Suárez-Fariñas, Mayte; Ungar, Benjamin; Correa da Rosa, Joel

    2015-01-01

    . These limitations might be lessened with next-generation RNA sequencing (RNA-seq). Objective: We sought to define the lesional AD transcriptome using RNA-seq and compare it using microarrays performed on the same cohort. Methods: RNA-seq and microarrays were performed to identify differentially expressed genes...... RNA-seq showed somewhat better agreement with RT-PCR (intraclass correlation coefficient, 0.57 and 0.70 for microarrays and RNA-seq vs RT-PCR, respectively), bias was not eliminated. Among genes uniquely identified by using RNA-seq were triggering receptor expressed on myeloid cells 1 (TREM-1......) signaling (eg, CCL2, CCL3, and single immunoglobulin domain IL1R1 related [SIGIRR]) and IL-36 isoform genes. TREM-1 is a surface receptor implicated in innate and adaptive immunity that amplifies infection-related inflammation. Conclusions: This is the first report of a lesional AD phenotype using RNA...

  14. Regulation of human histone gene expression: transcriptional and posttranscriptional control in the coupling of histone messenger RNA stability with DNA replication

    International Nuclear Information System (INIS)

    Baumbach, L.L.; Stein, G.S.; Stein, J.L.

    1987-01-01

    The extent to which transcriptional and posttranscriptional regulation contributes to the coupling of histone gene expression and DNA replication was examined during the cell cycle in synchronized HeLa S3 cells. Rates of transcription were determined in vitro in isolated nuclei. A 3-5-fold increase in cell cycle dependent histone gene transcription was observed in early S phase, prior to the peak of DNA synthesis. This result is consistent with a previous determination of histone mRNA synthesis in intact cells. The transcription of these genes did not change appreciably after inhibition of DNA replication by hydroxyurea treatment, although Northern blot analysis indicated that cellular levels of histone mRNA decreased rapidly in the presence of the drug. Total cellular levels of histone mRNA closely parallel the rate of DNA synthesis as a function of cell cycle progression, reaching a maximal 20-fold increase as compared with non S phase levels. This DNA synthesis dependent accumulation of histone mRNA occurs predominantly in the cytoplasm and appears to be mediated primarily by control of histone mRNA stability. Changes in nuclear histone mRNA levels were less pronounced. These combined observations suggest that both transcriptional regulation and posttranscriptional regulation contribute toward control of the cell cycle dependent accumulation of histone mRNA during S phase, while the stability of histone mRNA throughout S phase and the selective turnover of histone mRNAs, either at the natural termination of S phase or following inhibition of DNA synthesis, are posttranscriptionally regulated

  15. MicroRNA sequence motifs reveal asymmetry between the stem arms

    DEFF Research Database (Denmark)

    Gorodkin, Jan; Havgaard, Jakob Hull; Ensterö, M.

    2006-01-01

    The processing of micro RNAs (miRNAs) from their stemloop precursor have revealed asymmetry in the processing of the mature and its star sequence. Furthermore, the miRNA processing system between organism differ. To assess this at the sequence level we have investigated mature miRNAs in their gen......The processing of micro RNAs (miRNAs) from their stemloop precursor have revealed asymmetry in the processing of the mature and its star sequence. Furthermore, the miRNA processing system between organism differ. To assess this at the sequence level we have investigated mature mi...

  16. Quantitation of O6-methylguanine-DNA methyltransferase gene messenger RNA in gliomas by means of real-time RT-PCR and clinical response to nitrosoureas.

    Science.gov (United States)

    Tanaka, Satoshi; Oka, Hidehiro; Fujii, Kiyotaka; Watanabe, Kaoru; Nagao, Kumi; Kakimoto, Atsushi

    2005-09-01

    1. O6-methylguanine-DNA methyltransferase (MGMT) mRNA was measured in 50 malignant gliomas that had received 1-(4-amino-2-methyl-5-pyrimidynyl) methyl-3-(2-chloroethyl)-3-nitrosourea hydrochloride (ACNU) after the resection of the tumor by real-time reverse transcription-polymerase chain reaction (RT-PCR) using TaqMan probe. 2. The mean absolute value of MGMTmRNA normalized to the level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for 50 tumors was 1.29 x 10(4)+/- 1.28 x 10(4) copy/microg RNA (mean +/- SD). The amount of MGMTmRNA less than 6 x 10(3) copy/microg RNA was the most significant factor in predicting the initial effect of treatment with ACNU by multi-variant regression analysis (p = 0.0157). 3. These results suggest that quantitation of MGMTmRNA is the excellent method for predicting for the effect of ACNU in glioma therapy.

  17. Molecular-Sized DNA or RNA Sequencing Machine | NCI Technology Transfer Center | TTC

    Science.gov (United States)

    The National Cancer Institute's Gene Regulation and Chromosome Biology Laboratory is seeking statements of capability or interest from parties interested in collaborative research to co-develop a molecular-sized DNA or RNA sequencing machine.

  18. Messengers of the universe

    International Nuclear Information System (INIS)

    Becker, J.K.; Spurio, M.

    2011-01-01

    The observation of the solar neutrinos and of a neutrino burst from the supernova explosion 1987A opened a new observation field which in the next years could be complemented with the detection of astrophysical highenergy neutrinos. Neutrino astronomy is a young discipline derived from the fundamental necessity of extending conventional astronomy beyond the usual electro-magnetic messengers. This is a summary of recent results on those new 'messengers of the universe', based on the presentations in Branch IV of the Neutrino Oscillation Workshop 2010 (NOW2010).

  19. Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer

    Science.gov (United States)

    2017-09-01

    AWARD NUMBER: W81XWH-14-1-0080 TITLE: Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer . PRINCIPAL INVESTIGATOR...TITLE AND SUBTITLE Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer . 5a. CONTRACT NUMBER 5b. GRANT NUMBER GRANT11489...institutional, NIH-funded study of genetic and epigenetic alterations of pre-invasive DCIS that did or did not progress to invasive breast cancer , with an

  20. Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing

    OpenAIRE

    Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li

    2010-01-01

    Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resoluti...

  1. Small RNA sequencing reveals a comprehensive miRNA signature of BRCA1-associated high-grade serous ovarian cancer

    NARCIS (Netherlands)

    Brouwer, Jan; Kluiver, Joost; de Almeida, Rodrigo C.; Modderman, Rutger; Terpstra, Martijn; Kok, Klaas; Withoff, Sebo; Hollema, Harry; Reitsma, Welmoed; de Bock, Geertruida H.; Mourits, Marian J. E.; van den Berg, Anke

    2016-01-01

    AimsBRCA1 mutation carriers are at increased risk of developing high-grade serous ovarian cancer (HGSOC), a malignancy that originates from fallopian tube epithelium. We aimed to identify differentially expressed known and novel miRNAs in BRCA1-associated HGSOC. Methods Small RNA sequencing was

  2. MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing

    DEFF Research Database (Denmark)

    Nielsen, M; Hansen, J H; Hedegaard, J

    2010-01-01

    levels of 212 annotated miRNA genes, thereby providing a thorough account of the miRNA transcriptome in porcine muscle tissue. The expression levels displayed a very large range, as reflected by the number of sequence reads, which varied from single counts for rare miRNAs to several million reads...

  3. Genetic selection and DNA sequences of 4.5S RNA homologs

    DEFF Research Database (Denmark)

    Brown, S; Thon, G; Tolentino, E

    1989-01-01

    A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

  4. Sex chromosomes and germline transcriptomics explored by single-cell sequencing and RNA-tomography

    NARCIS (Netherlands)

    Vértesy, Ábel

    2018-01-01

    In our study of germ cell differentiation, we applied two recently developed technologies on the germline of various model organisms: single-cell mRNA sequencing and RNA-tomography. For the first time we could look at gene expression with such a high resolution, and this led us to discover the

  5. Body fluid identification of blood, saliva and semen using second generation sequencing of micro-RNA

    DEFF Research Database (Denmark)

    Petersen, Christel H.; Hjort, Benjamin Benn; Tvedebrink, Torben

    2013-01-01

    We report a new second generation sequencing method for identification micro-RNA (miRNA) that can be used to identify body fluids and tissues. Principal component analysis of 10 miRNAs with high expression in 16 samples of blood, saliva and semen showed clear differences in the expression of mi...

  6. Deep RNA Sequencing of the Skeletal Muscle Transcriptome in Swimming Fish

    NARCIS (Netherlands)

    Palstra, A.P.; Beltran, S.; Burgerhout, E.; Brittijn, S.A.; Magnoni, L.J.; Henkel, C.V.; Jansen, A.; Thillart, G.E.E.J.M.; Spaink, H.P.; Planas, J.V.

    2013-01-01

    Deep RNA sequencing (RNA-seq) was performed to provide an in-depth view of the transcriptome of red and white skeletal muscle of exercised and non-exercised rainbow trout (Oncorhynchus mykiss) with the specific objective to identify expressed genes and quantify the transcriptomic effects of

  7. Oasis: online analysis of small RNA deep sequencing data.

    Science.gov (United States)

    Capece, Vincenzo; Garcia Vizcaino, Julio C; Vidal, Ramon; Rahman, Raza-Ur; Pena Centeno, Tonatiuh; Shomroni, Orr; Suberviola, Irantzu; Fischer, Andre; Bonn, Stefan

    2015-07-01

    Oasis is a web application that allows for the fast and flexible online analysis of small-RNA-seq (sRNA-seq) data. It was designed for the end user in the lab, providing an easy-to-use web frontend including video tutorials, demo data and best practice step-by-step guidelines on how to analyze sRNA-seq data. Oasis' exclusive selling points are a differential expression module that allows for the multivariate analysis of samples, a classification module for robust biomarker detection and an advanced programming interface that supports the batch submission of jobs. Both modules include the analysis of novel miRNAs, miRNA targets and functional analyses including GO and pathway enrichment. Oasis generates downloadable interactive web reports for easy visualization, exploration and analysis of data on a local system. Finally, Oasis' modular workflow enables for the rapid (re-) analysis of data. Oasis is implemented in Python, R, Java, PHP, C++ and JavaScript. It is freely available at http://oasis.dzne.de. stefan.bonn@dzne.de Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

  8. Accurate identification of RNA editing sites from primitive sequence with deep neural networks.

    Science.gov (United States)

    Ouyang, Zhangyi; Liu, Feng; Zhao, Chenghui; Ren, Chao; An, Gaole; Mei, Chuan; Bo, Xiaochen; Shu, Wenjie

    2018-04-16

    RNA editing is a post-transcriptional RNA sequence alteration. Current methods have identified editing sites and facilitated research but require sufficient genomic annotations and prior-knowledge-based filtering steps, resulting in a cumbersome, time-consuming identification process. Moreover, these methods have limited generalizability and applicability in species with insufficient genomic annotations or in conditions of limited prior knowledge. We developed DeepRed, a deep learning-based method that identifies RNA editing from primitive RNA sequences without prior-knowledge-based filtering steps or genomic annotations. DeepRed achieved 98.1% and 97.9% area under the curve (AUC) in training and test sets, respectively. We further validated DeepRed using experimentally verified U87 cell RNA-seq data, achieving 97.9% positive predictive value (PPV). We demonstrated that DeepRed offers better prediction accuracy and computational efficiency than current methods with large-scale, mass RNA-seq data. We used DeepRed to assess the impact of multiple factors on editing identification with RNA-seq data from the Association of Biomolecular Resource Facilities and Sequencing Quality Control projects. We explored developmental RNA editing pattern changes during human early embryogenesis and evolutionary patterns in Drosophila species and the primate lineage using DeepRed. Our work illustrates DeepRed's state-of-the-art performance; it may decipher the hidden principles behind RNA editing, making editing detection convenient and effective.

  9. A tale of two sequences: microRNA-target chimeric reads.

    Science.gov (United States)

    Broughton, James P; Pasquinelli, Amy E

    2016-04-04

    In animals, a functional interaction between a microRNA (miRNA) and its target RNA requires only partial base pairing. The limited number of base pair interactions required for miRNA targeting provides miRNAs with broad regulatory potential and also makes target prediction challenging. Computational approaches to target prediction have focused on identifying miRNA target sites based on known sequence features that are important for canonical targeting and may miss non-canonical targets. Current state-of-the-art experimental approaches, such as CLIP-seq (cross-linking immunoprecipitation with sequencing), PAR-CLIP (photoactivatable-ribonucleoside-enhanced CLIP), and iCLIP (individual-nucleotide resolution CLIP), require inference of which miRNA is bound at each site. Recently, the development of methods to ligate miRNAs to their target RNAs during the preparation of sequencing libraries has provided a new tool for the identification of miRNA target sites. The chimeric, or hybrid, miRNA-target reads that are produced by these methods unambiguously identify the miRNA bound at a specific target site. The information provided by these chimeric reads has revealed extensive non-canonical interactions between miRNAs and their target mRNAs, and identified many novel interactions between miRNAs and noncoding RNAs.

  10. Unusual loop-sequence flexibility of the proximal RNA replication element in EMCV.

    Directory of Open Access Journals (Sweden)

    Jan Zoll

    Full Text Available Picornaviruses contain stable RNA structures at the 5' and 3' ends of the RNA genome, OriL and OriR involved in viral RNA replication. The OriL RNA element found at the 5' end of the enterovirus genome folds into a cloverleaf-like configuration. In vivo SELEX experiments revealed that functioning of the poliovirus cloverleaf depends on a specific structure in this RNA element. Little is known about the OriL of cardioviruses. Here, we investigated structural aspects and requirements of the apical loop of proximal stem-loop SL-A of mengovirus, a strain of EMCV. Using NMR spectroscopy, we showed that the mengovirus SL-A apical loop consists of an octaloop. In vivo SELEX experiments demonstrated that a large number of random sequences are tolerated in the apical octaloop that support virus replication. Mutants in which the SL-A loop size and the length of the upper part of the stem were varied showed that both stem-length and stability of the octaloop are important determinants for viral RNA replication and virus reproduction. Together, these data show that stem-loop A plays an important role in virus replication. The high degree of sequence flexibility and the lack of selective pressure on the octaloop argue against a role in sequence specific RNA-protein or RNA-RNA interactions in which octaloop nucleotides are involved.

  11. "Transcriptomics": molecular diagnosis of inborn errors of metabolism via RNA-sequencing.

    Science.gov (United States)

    Kremer, Laura S; Wortmann, Saskia B; Prokisch, Holger

    2018-01-25

    Exome wide sequencing techniques have revolutionized molecular diagnostics in patients with suspected inborn errors of metabolism or neuromuscular disorders. However, the diagnostic yield of 25-60% still leaves a large fraction of individuals without a diagnosis. This indicates a causative role for non-exonic regulatory variants not covered by whole exome sequencing. Here we review how systematic RNA-sequencing analysis (RNA-seq, "transcriptomics") lead to a molecular diagnosis in 10-35% of patients in whom whole exome sequencing failed to do so. Importantly, RNA-sequencing based discoveries cannot only guide molecular diagnosis but might also unravel therapeutic intervention points such as antisense oligonucleotide treatment for splicing defects as recently reported for spinal muscular atrophy.

  12. High-Throughput Mapping of Single-Neuron Projections by Sequencing of Barcoded RNA.

    Science.gov (United States)

    Kebschull, Justus M; Garcia da Silva, Pedro; Reid, Ashlan P; Peikon, Ian D; Albeanu, Dinu F; Zador, Anthony M

    2016-09-07

    Neurons transmit information to distant brain regions via long-range axonal projections. In the mouse, area-to-area connections have only been systematically mapped using bulk labeling techniques, which obscure the diverse projections of intermingled single neurons. Here we describe MAPseq (Multiplexed Analysis of Projections by Sequencing), a technique that can map the projections of thousands or even millions of single neurons by labeling large sets of neurons with random RNA sequences ("barcodes"). Axons are filled with barcode mRNA, each putative projection area is dissected, and the barcode mRNA is extracted and sequenced. Applying MAPseq to the locus coeruleus (LC), we find that individual LC neurons have preferred cortical targets. By recasting neuroanatomy, which is traditionally viewed as a problem of microscopy, as a problem of sequencing, MAPseq harnesses advances in sequencing technology to permit high-throughput interrogation of brain circuits. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Sequence analysis of mitochondrial 16S ribosomal RNA gene ...

    Indian Academy of Sciences (India)

    Unknown

    For the understanding of their vectorial capacity, identification of disease carrying and refractory strains is essential. ... been widely used for phylogenetic studies and sequence differences in ... In order to fill up the internal gap, a new set.

  14. Interleukin 18 messenger RNA and proIL-18 protein expression in chorioamniotic membranes from pregnant women with preterm prelabor rupture of membranes.

    Science.gov (United States)

    Polettini, Jossimara; Vieira, Eliane Passarelli; Santos, Mariana Perlati dos; Peraçoli, José Carlos; Witkin, Steven S; da Silva, Márcia Guimarães

    2012-04-01

    To quantify the expression of IL-18 mRNA and protein in the chorioamniotic membranes of pregnant women with PPROM and correlate expression with histological chorioamnionitis. A case control study that included 42 pregnant women not in labor in the following groups: PPROM (n=28) and controls with intact membranes submitted to selective cesarean section at term (n=14). Expression of IL-18 mRNA in chorioamniotic membranes was determined by real-time polymerase chain reaction, and IL-18 protein expression was measured by western blot. Histopathological analyses and immunolocalization of IL-18 by immunohistochemistry were also performed. Analyses were performed using the Mann-Whitney or Fisher's exact tests and the group effect was considered significant if the adjusted p-values were <0.05 and the magnitude of change was greater than 2-fold for mRNA expression. IL-18 mRNA was present in 100% of samples and no difference in expression was observed between term vs. PPROM membranes (fold-change 0.12; p=0.88). In the PPROM group, no difference was observed in IL-18 mRNA regarding gestational age (fold-change 0.11; p=0.42) or the presence of histological chorioamnionitis (fold-change 0.26; p=0.15). ProIL-18 was present in all samples. IL-18 was immunolocalized to amnion, chorion and decidua cells, with intense immunohistochemical staining at the choriodecidual junction. Chorioamniotic membranes are sources of IL-18 mRNA and proIL-18, and their expression is unrelated to PPROM or histological chorioamnionitis. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  15. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Johansen

    Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

  16. Next Generation Sequencing Analysis of Human Platelet PolyA+ mRNAs and rRNA-Depleted Total RNA

    Science.gov (United States)

    Kissopoulou, Antheia; Jonasson, Jon; Lindahl, Tomas L.; Osman, Abdimajid

    2013-01-01

    Background Platelets are small anucleate cells circulating in the blood vessels where they play a key role in hemostasis and thrombosis. Here, we compared platelet RNA-Seq results obtained from polyA+ mRNA and rRNA-depleted total RNA. Materials and Methods We used purified, CD45 depleted, human blood platelets collected by apheresis from three male and one female healthy blood donors. The Illumina HiSeq 2000 platform was employed to sequence cDNA converted either from oligo(dT) isolated polyA+ RNA or from rRNA-depleted total RNA. The reads were aligned to the GRCh37 reference assembly with the TopHat/Cufflinks alignment package using Ensembl annotations. A de novo assembly of the platelet transcriptome using the Trinity software package and RSEM was also performed. The bioinformatic tools HTSeq and DESeq from Bioconductor were employed for further statistical analyses of read counts. Results Consistent with previous findings our data suggests that mitochondrially expressed genes comprise a substantial fraction of the platelet transcriptome. We also identified high transcript levels for protein coding genes related to the cytoskeleton function, chemokine signaling, cell adhesion, aggregation, as well as receptor interaction between cells. Certain transcripts were particularly abundant in platelets compared with other cell and tissue types represented by RNA-Seq data from the Illumina Human Body Map 2.0 project. Irrespective of the different library preparation and sequencing protocols, there was good agreement between samples from the 4 individuals. Eighteen differentially expressed genes were identified in the two sexes at 10% false discovery rate using DESeq. Conclusion The present data suggests that platelets may have a unique transcriptome profile characterized by a relative over-expression of mitochondrially encoded genes and also of genomic transcripts related to the cytoskeleton function, chemokine signaling and surface components compared with other cell and

  17. Complete Genome Sequence of a Double-Stranded RNA Virus from Avocado

    OpenAIRE

    Villanueva, Francisco; Sabanadzovic, Sead; Valverde, Rodrigo A.; Navas-Castillo, Jesús

    2012-01-01

    A number of avocado (Persea americana) cultivars are known to contain high-molecular-weight double-stranded RNA (dsRNA) molecules for which a viral nature has been suggested, although sequence data are not available. Here we report the cloning and complete sequencing of a 13.5-kbp dsRNA virus isolated from avocado and show that it corresponds to the genome of a new species of the genus Endornavirus (family Endornaviridae), tentatively named Persea americana endornavirus (PaEV).

  18. Complete Genome Sequence of a Double-Stranded RNA Virus from Avocado

    Science.gov (United States)

    Villanueva, Francisco; Sabanadzovic, Sead; Valverde, Rodrigo A.

    2012-01-01

    A number of avocado (Persea americana) cultivars are known to contain high-molecular-weight double-stranded RNA (dsRNA) molecules for which a viral nature has been suggested, although sequence data are not available. Here we report the cloning and complete sequencing of a 13.5-kbp dsRNA virus isolated from avocado and show that it corresponds to the genome of a new species of the genus Endornavirus (family Endornaviridae), tentatively named Persea americana endornavirus (PaEV). PMID:22205720

  19. siRNAs targeted to certain polyadenylation sites promote specific, RISC-independent degradation of messenger RNAs.

    Science.gov (United States)

    Vickers, Timothy A; Crooke, Stanley T

    2012-07-01

    While most siRNAs induce sequence-specific target mRNA cleavage and degradation in a process mediated by Ago2/RNA-induced silencing complex (RISC), certain siRNAs have also been demonstrated to direct target RNA reduction through deadenylation and subsequent degradation of target transcripts in a process which involves Ago1/RISC and P-bodies. In the current study, we present data suggesting that a third class of siRNA exist, which are capable of promoting target RNA reduction that is independent of both Ago and RISC. These siRNAs bind the target messenger RNA at the polyA signal and are capable of redirecting a small amount of polyadenylation to downstream polyA sites when present, however, the majority of the activity appears to be due to inhibition of polyadenylation or deadenylation of the transcript, followed by exosomal degradation of the immature mRNA.

  20. IL-2 induction of IL-1 beta mRNA expression in monocytes. Regulation by agents that block second messenger pathways

    DEFF Research Database (Denmark)

    Kovacs, E J; Brock, B; Varesio, L

    1989-01-01

    We have previously shown that in mixed cultures of PBL incubation with human rIL-2 induces the rapid expression of IL-1 alpha and IL-1 beta mRNA. Because studies have demonstrated that IL-2R can be expressed on the surface of human peripheral blood monocytes, we chose to investigate whether IL-1 ...

  1. Effects of dietary nitrogen concentration on messenger RNA expression and protein abundance of urea transporter-B and aquaporins in ruminal papillae from lactating Holstein cows

    DEFF Research Database (Denmark)

    Røjen, Betina Amdisen; Poulsen, Søren Brandt; Theil, Peter Kappel

    2011-01-01

    To test the hypothesis that dietary N concentrations affect gut epithelial urea transport by modifying the expression of urea transporter B (UT-B) and aquaporins (AQP), the mRNA expression and protein abundance of UT-B and AQP3, AQP7, AQP8, and AQP10 were investigated in ruminal papillae from 9...... lactating dairy cows. Ruminal papillae were harvested from cows fed low N (12.9% crude protein) and high N (17.1% crude protein) diets in a crossover design with 21-d periods. The mRNA expression was determined by real-time reverse transcription-PCR and protein abundance by immunoblotting. The m......RNA expression of UT-B was not affected by dietary treatment, whereas mRNA expression of AQP3, 7, and 10 were greater in the high N compared with the low N fed cows. Using peptide-derived rabbit antibodies to cow AQP3, 7, and 8, immunoblotting revealed bands of approximately 27, 27, and 24 kDa in ruminal...

  2. Analysis of 16S rRNA amplicon sequencing options on the Roche/454 next-generation titanium sequencing platform.

    Directory of Open Access Journals (Sweden)

    Hideyuki Tamaki

    Full Text Available BACKGROUND: 16S rRNA gene pyrosequencing approach has revolutionized studies in microbial ecology. While primer selection and short read length can affect the resulting microbial community profile, little is known about the influence of pyrosequencing methods on the sequencing throughput and the outcome of microbial community analyses. The aim of this study is to compare differences in output, ease, and cost among three different amplicon pyrosequencing methods for the Roche/454 Titanium platform METHODOLOGY/PRINCIPAL FINDINGS: The following three pyrosequencing methods for 16S rRNA genes were selected in this study: Method-1 (standard method is the recommended method for bi-directional sequencing using the LIB-A kit; Method-2 is a new option designed in this study for unidirectional sequencing with the LIB-A kit; and Method-3 uses the LIB-L kit for unidirectional sequencing. In our comparison among these three methods using 10 different environmental samples, Method-2 and Method-3 produced 1.5-1.6 times more useable reads than the standard method (Method-1, after quality-based trimming, and did not compromise the outcome of microbial community analyses. Specifically, Method-3 is the most cost-effective unidirectional amplicon sequencing method as it provided the most reads and required the least effort in consumables management. CONCLUSIONS: Our findings clearly demonstrated that alternative pyrosequencing methods for 16S rRNA genes could drastically affect sequencing output (e.g. number of reads before and after trimming but have little effect on the outcomes of microbial community analysis. This finding is important for both researchers and sequencing facilities utilizing 16S rRNA gene pyrosequencing for microbial ecological studies.

  3. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  4. ISVASE: identification of sequence variant associated with splicing event using RNA-seq data.

    Science.gov (United States)

    Aljohi, Hasan Awad; Liu, Wanfei; Lin, Qiang; Yu, Jun; Hu, Songnian

    2017-06-28

    Exon recognition and splicing precisely and efficiently by spliceosome is the key to generate mature mRNAs. About one third or a half of disease-related mutations affect RNA splicing. Software PVAAS has been developed to identify variants associated with aberrant splicing by directly using RNA-seq data. However, it bases on the assumption that annotated splicing site is normal splicing, which is not true in fact. We develop the ISVASE, a tool for specifically identifying sequence variants associated with splicing events (SVASE) by using RNA-seq data. Comparing with PVAAS, our tool has several advantages, such as multi-pass stringent rule-dependent filters and statistical filters, only using split-reads, independent sequence variant identification in each part of splicing (junction), sequence variant detection for both of known and novel splicing event, additional exon-exon junction shift event detection if known splicing events provided, splicing signal evaluation, known DNA mutation and/or RNA editing data supported, higher precision and consistency, and short running time. Using a realistic RNA-seq dataset, we performed a case study to illustrate the functionality and effectiveness of our method. Moreover, the output of SVASEs can be used for downstream analysis such as splicing regulatory element study and sequence variant functional analysis. ISVASE is useful for researchers interested in sequence variants (DNA mutation and/or RNA editing) associated with splicing events. The package is freely available at https://sourceforge.net/projects/isvase/ .

  5. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    Science.gov (United States)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  6. Small RNA Deep Sequencing and the Effects of microRNA408 on Root Gravitropic Bending in Arabidopsis

    Science.gov (United States)

    Li, Huasheng; Lu, Jinying; Sun, Qiao; Chen, Yu; He, Dacheng; Liu, Min

    2015-11-01

    MicroRNA (miRNA) is a non-coding small RNA composed of 20 to 24 nucleotides that influences plant root development. This study analyzed the miRNA expression in Arabidopsis root tip cells using Illumina sequencing and real-time PCR before (sample 0) and 15 min after (sample 15) a 3-D clinostat rotational treatment was administered. After stimulation was performed, the expression levels of seven miRNA genes, including Arabidopsis miR160, miR161, miR394, miR402, miR403, miR408, and miR823, were significantly upregulated. Illumina sequencing results also revealed two novel miRNAsthat have not been previously reported, The target genes of these miRNAs included pentatricopeptide repeat-containing protein and diadenosine tetraphosphate hydrolase. An overexpression vector of Arabidopsis miR408 was constructed and transferred to Arabidopsis plant. The roots of plants over expressing miR408 exhibited a slower reorientation upon gravistimulation in comparison with those of wild-type. This result indicate that miR408 could play a role in root gravitropic response.

  7. StarScan: a web server for scanning small RNA targets from degradome sequencing data.

    Science.gov (United States)

    Liu, Shun; Li, Jun-Hao; Wu, Jie; Zhou, Ke-Ren; Zhou, Hui; Yang, Jian-Hua; Qu, Liang-Hu

    2015-07-01

    Endogenous small non-coding RNAs (sRNAs), including microRNAs, PIWI-interacting RNAs and small interfering RNAs, play important gene regulatory roles in animals and plants by pairing to the protein-coding and non-coding transcripts. However, computationally assigning these various sRNAs to their regulatory target genes remains technically challenging. Recently, a high-throughput degradome sequencing method was applied to identify biologically relevant sRNA cleavage sites. In this study, an integrated web-based tool, StarScan (sRNA target Scan), was developed for scanning sRNA targets using degradome sequencing data from 20 species. Given a sRNA sequence from plants or animals, our web server performs an ultrafast and exhaustive search for potential sRNA-target interactions in annotated and unannotated genomic regions. The interactions between small RNAs and target transcripts were further evaluated using a novel tool, alignScore. A novel tool, degradomeBinomTest, was developed to quantify the abundance of degradome fragments located at the 9-11th nucleotide from the sRNA 5' end. This is the first web server for discovering potential sRNA-mediated RNA cleavage events in plants and animals, which affords mechanistic insights into the regulatory roles of sRNAs. The StarScan web server is available at http://mirlab.sysu.edu.cn/starscan/. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Mapping RNA Structure In Vitro with SHAPE Chemistry and Next-Generation Sequencing (SHAPE-Seq).

    Science.gov (United States)

    Watters, Kyle E; Lucks, Julius B

    2016-01-01

    Mapping RNA structure with selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistry has proven to be a versatile method for characterizing RNA structure in a variety of contexts. SHAPE reagents covalently modify RNAs in a structure-dependent manner to create adducts at the 2'-OH group of the ribose backbone at nucleotides that are structurally flexible. The positions of these adducts are detected using reverse transcriptase (RT) primer extension, which stops one nucleotide before the modification, to create a pool of cDNAs whose lengths reflect the location of SHAPE modification. Quantification of the cDNA pools is used to estimate the "reactivity" of each nucleotide in an RNA molecule to the SHAPE reagent. High reactivities indicate nucleotides that are structurally flexible, while low reactivities indicate nucleotides that are inflexible. These SHAPE reactivities can then be used to infer RNA structures by restraining RNA structure prediction algorithms. Here, we provide a state-of-the-art protocol describing how to perform in vitro RNA structure probing with SHAPE chemistry using next-generation sequencing to quantify cDNA pools and estimate reactivities (SHAPE-Seq). The use of next-generation sequencing allows for higher throughput, more consistent data analysis, and multiplexing capabilities. The technique described herein, SHAPE-Seq v2.0, uses a universal reverse transcription priming site that is ligated to the RNA after SHAPE modification. The introduced priming site allows for the structural analysis of an RNA independent of its sequence.

  9. The PETfold and PETcofold web servers for intra- and intermolecular structures of multiple RNA sequences

    DEFF Research Database (Denmark)

    Seemann, Ernst Stefan; Menzel, Karl Peter; Backofen, Rolf

    2011-01-01

    gene. We present web servers to analyze multiple RNA sequences for common RNA structure and for RNA interaction sites. The web servers are based on the recent PET (Probabilistic Evolutionary and Thermodynamic) models PETfold and PETcofold, but add user friendly features ranging from a graphical layer...... to interactive usage of the predictors. Additionally, the web servers provide direct access to annotated RNA alignments, such as the Rfam 10.0 database and multiple alignments of 16 vertebrate genomes with human. The web servers are freely available at: http://rth.dk/resources/petfold/...

  10. The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

    International Nuclear Information System (INIS)

    Nuc, K.; Nuc, P.; Pawelkiewicz, J.

    1993-01-01

    We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

  11. Systems genetics of complex diseases using RNA-sequencing methods

    DEFF Research Database (Denmark)

    Mazzoni, Gianluca; Kogelman, Lisette; Suravajhala, Prashanth

    2015-01-01

    Next generation sequencing technologies have enabled the generation of huge quantities of biological data, and nowadays extensive datasets at different ‘omics levels have been generated. Systems genetics is a powerful approach that allows to integrate different ‘omics level and understand the bio...

  12. Sequence analysis of mitochondrial 16S ribosomal RNA gene

    Indian Academy of Sciences (India)

    Mosquitoes are vectors for the transmission of many human pathogens that include viruses, nematodes and protozoa. For the understanding of their vectorial capacity, identification of disease carrying and refractory strains is essential. Recently, molecular taxonomic techniques have been utilized for this purpose. Sequence ...

  13. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

    Science.gov (United States)

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

    1987-06-01

    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  14. Cloning and sequencing of full-length cDNAs of RNA1 and RNA2 of a Tomato black ring virus isolate from Poland.

    Science.gov (United States)

    Jończyk, M; Le Gall, O; Pałucha, A; Borodynko, N; Pospieszny, H

    2004-04-01

    Full-length cDNA clones corresponding to the RNA1 and RNA2 of the Polish isolate MJ of Tomato black ring virus (TBRV, genus Nepovirus) were obtained using a direct recombination strategy in yeast, and their complete nucleotide sequences were established. RNA1 is 7358 nucleotides and RNA2 is 4633 nucleotides in length, excluding the poly(A) tails. Both RNAs contain a single open reading frame encoding polyproteins of 254 kDa and 149 kDa for RNA1 and RNA2 respectively. Putative cleavage sites were identified, and the relationships between TBRV and related nepoviruses were studied by sequence comparison.

  15. Computational sequence analysis of predicted long dsRNA transcriptomes of major crops reveals sequence complementarity with human genes.

    Science.gov (United States)

    Jensen, Peter D; Zhang, Yuanji; Wiggins, B Elizabeth; Petrick, Jay S; Zhu, Jin; Kerstetter, Randall A; Heck, Gregory R; Ivashuta, Sergey I

    2013-01-01

    Long double-stranded RNAs (long dsRNAs) are precursors for the effector molecules of sequence-specific RNA-based gene silencing in eukaryotes. Plant cells can contain numerous endogenous long dsRNAs. This study demonstrates that such endogenous long dsRNAs in plants have sequence complementarity to human genes. Many of these complementary long dsRNAs have perfect sequence complementarity of at least 21 nucleotides to human genes; enough complementarity to potentially trigger gene silencing in targeted human cells if delivered in functional form. However, the number and diversity of long dsRNA molecules in plant tissue from crops such as lettuce, tomato, corn, soy and rice with complementarity to human genes that have a long history of safe consumption supports a conclusion that long dsRNAs do not present a significant dietary risk.

  16. A high ratio of insulin-like growth factor II/insulin-like growth factor binding protein 2 messenger RNA as a marker for anaplasia in meningiomas.

    Science.gov (United States)

    Nordqvist, A C; Peyrard, M; Pettersson, H; Mathiesen, T; Collins, V P; Dumanski, J P; Schalling, M

    1997-07-01

    Insulin-like growth factors (IGFs) I and II have been implicated as autocrine or paracrine growth promoters. These growth factors bind to specific receptors, and the response is modulated by interaction with IGF-binding proteins (IGFBPs). We observed a strong correlation between anaplastic/atypical histopathology and a high IGF-II/IGFBP-2 mRNA ratio in a set of 68 sporadic meningiomas. A strong correlation was also found between clinical outcome and IGF-II/IGFBP-2 ratio, whereas previously used histochemical markers were less correlated to outcome. We suggest that a high IGF-II/IGFBP-2 mRNA ratio may be a sign of biologically aggressive behavior in meningiomas that can influence treatment strategies. We propose that low IGFBP-2 levels in combination with increased levels of IGF-II would result in more free IGF-II and consequently greater stimulation of proliferation.

  17. SINA: accurate high-throughput multiple sequence alignment of ribosomal RNA genes.

    Science.gov (United States)

    Pruesse, Elmar; Peplies, Jörg; Glöckner, Frank Oliver

    2012-07-15

    In the analysis of homologous sequences, computation of multiple sequence alignments (MSAs) has become a bottleneck. This is especially troublesome for marker genes like the ribosomal RNA (rRNA) where already millions of sequences are publicly available and individual studies can easily produce hundreds of thousands of new sequences. Methods have been developed to cope with such numbers, but further improvements are needed to meet accuracy requirements. In this study, we present the SILVA Incremental Aligner (SINA) used to align the rRNA gene databases provided by the SILVA ribosomal RNA project. SINA uses a combination of k-mer searching and partial order alignment (POA) to maintain very high alignment accuracy while satisfying high throughput performance demands. SINA was evaluated in comparison with the commonly used high throughput MSA programs PyNAST and mothur. The three BRAliBase III benchmark MSAs could be reproduced with 99.3, 97.6 and 96.1 accuracy. A larger benchmark MSA comprising 38 772 sequences could be reproduced with 98.9 and 99.3% accuracy using reference MSAs comprising 1000 and 5000 sequences. SINA was able to achieve higher accuracy than PyNAST and mothur in all performed benchmarks. Alignment of up to 500 sequences using the latest SILVA SSU/LSU Ref datasets as reference MSA is offered at http://www.arb-silva.de/aligner. This page also links to Linux binaries, user manual and tutorial. SINA is made available under a personal use license.

  18. Genetic diagnosis of Mendelian disorders via RNA sequencing.

    Science.gov (United States)

    Kremer, Laura S; Bader, Daniel M; Mertes, Christian; Kopajtich, Robert; Pichler, Garwin; Iuso, Arcangela; Haack, Tobias B; Graf, Elisabeth; Schwarzmayr, Thomas; Terrile, Caterina; Koňaříková, Eliška; Repp, Birgit; Kastenmüller, Gabi; Adamski, Jerzy; Lichtner, Peter; Leonhardt, Christoph; Funalot, Benoit; Donati, Alice; Tiranti, Valeria; Lombes, Anne; Jardel, Claude; Gläser, Dieter; Taylor, Robert W; Ghezzi, Daniele; Mayr, Johannes A; Rötig, Agnes; Freisinger, Peter; Distelmaier, Felix; Strom, Tim M; Meitinger, Thomas; Gagneur, Julien; Prokisch, Holger

    2017-06-12

    Across a variety of Mendelian disorders, ∼50-75% of patients do not receive a genetic diagnosis by exome sequencing indicating disease-causing variants in non-coding regions. Although genome sequencing in principle reveals all genetic variants, their sizeable number and poorer annotation make prioritization challenging. Here, we demonstrate the power of transcriptome sequencing to molecularly diagnose 10% (5 of 48) of mitochondriopathy patients and identify candidate genes for the remainder. We find a median of one aberrantly expressed gene, five aberrant splicing events and six mono-allelically expressed rare variants in patient-derived fibroblasts and establish disease-causing roles for each kind. Private exons often arise from cryptic splice sites providing an important clue for variant prioritization. One such event is found in the complex I assembly factor TIMMDC1 establishing a novel disease-associated gene. In conclusion, our study expands the diagnostic tools for detecting non-exonic variants and provides examples of intronic loss-of-function variants with pathological relevance.

  19. Customized workflow development and data modularization concepts for RNA-Sequencing and metatranscriptome experiments.

    Science.gov (United States)

    Lott, Steffen C; Wolfien, Markus; Riege, Konstantin; Bagnacani, Andrea; Wolkenhauer, Olaf; Hoffmann, Steve; Hess, Wolfgang R

    2017-11-10

    RNA-Sequencing (RNA-Seq) has become a widely used approach to study quantitative and qualitative aspects of transcriptome data. The variety of RNA-Seq protocols, experimental study designs and the characteristic properties of the organisms under investigation greatly affect downstream and comparative analyses. In this review, we aim to explain the impact of structured pre-selection, classification and integration of best-performing tools within modularized data analysis workflows and ready-to-use computing infrastructures towards experimental data analyses. We highlight examples for workflows and use cases that are presented for pro-, eukaryotic and mixed dual RNA-Seq (meta-transcriptomics) experiments. In addition, we are summarizing the expertise of the laboratories participating in the project consortium "Structured Analysis and Integration of RNA-Seq experiments" (de.STAIR) and its integration with the Galaxy-workbench of the RNA Bioinformatics Center (RBC). Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  20. CPSS: a computational platform for the analysis of small RNA deep sequencing data.

    Science.gov (United States)

    Zhang, Yuanwei; Xu, Bo; Yang, Yifan; Ban, Rongjun; Zhang, Huan; Jiang, Xiaohua; Cooke, Howard J; Xue, Yu; Shi, Qinghua

    2012-07-15

    Next generation sequencing (NGS) techniques have been widely used to document the small ribonucleic acids (RNAs) implicated in a variety of biological, physiological and pathological processes. An integrated computational tool is needed for handling and analysing the enormous datasets from small RNA deep sequencing approach. Herein, we present a novel web server, CPSS (a computational platform for the analysis of small RNA deep sequencing data), designed to completely annotate and functionally analyse microRNAs (miRNAs) from NGS data on one platform with a single data submission. Small RNA NGS data can be submitted to this server with analysis results being returned in two parts: (i) annotation analysis, which provides the most comprehensive analysis for small RNA transcriptome, including length distribution and genome mapping of sequencing reads, small RNA quantification, prediction of novel miRNAs, identification of differentially expressed miRNAs, piwi-interacting RNAs and other non-coding small RNAs between paired samples and detection of miRNA editing and modifications and (ii) functional analysis, including prediction of miRNA targeted genes by multiple tools, enrichment of gene ontology terms, signalling pathway involvement and protein-protein interaction analysis for the predicted genes. CPSS, a ready-to-use web server that integrates most functions of currently available bioinformatics tools, provides all the information wanted by the majority of users from small RNA deep sequencing datasets. CPSS is implemented in PHP/PERL+MySQL+R and can be freely accessed at http://mcg.ustc.edu.cn/db/cpss/index.html or http://mcg.ustc.edu.cn/sdap1/cpss/index.html.

  1. Semiautomated improvement of RNA alignments

    DEFF Research Database (Denmark)

    Andersen, Ebbe Sloth; Lind-Thomsen, Allan; Knudsen, Bjarne

    2007-01-01

    connects to external tools to provide a flexible semiautomatic editing environment. A new method, Pcluster, is introduced for dividing the sequences of an RNA alignment into subgroups with secondary structure differences. Pcluster was used to evaluate 574 seed alignments obtained from the Rfam database...... and we identified 71 alignments with significant prediction of inconsistent base pairs and 102 alignments with significant prediction of novel base pairs. Four RNA families were used to illustrate how SARSE can be used to manually or automatically correct the inconsistent base pairs detected by Pcluster......: the mir-399 RNA, vertebrate telomase RNA (vert-TR), bacterial transfer-messenger RNA (tmRNA), and the signal recognition particle (SRP) RNA. The general use of the method is illustrated by the ability to accommodate pseudoknots and handle even large and divergent RNA families. The open architecture...

  2. RNA2 of grapevine fanleaf virus: sequence analysis and coat protein cistron location.

    Science.gov (United States)

    Serghini, M A; Fuchs, M; Pinck, M; Reinbolt, J; Walter, B; Pinck, L

    1990-07-01

    The nucleotide sequence of the genomic RNA2 (3774 nucleotides) of grapevine fanleaf virus strain F13 was determined from overlapping cDNA clones and its genetic organization was deduced. Two rapid and efficient methods were used for cDNA cloning of the 5' region of RNA2. The complete sequence contained only one long open reading frame of 3555 nucleotides (1184 codons, 131K product). The analysis of the N-terminal sequence of purified coat protein (CP) and identification of its C-terminal residue have allowed the CP cistron to be precisely positioned within the polyprotein. The CP produced by proteolytic cleavage at the Arg/Gly site between residues 680 and 681 contains 504 amino acids (Mr 56019) and has hydrophobic properties. The Arg/Gly cleavage site deduced by N-terminal amino acid sequence analysis is the first for a nepovirus coat protein and for plant viruses expressing their genomic RNAs by polyprotein synthesis. Comparison of GFLV RNA2 with M RNA of cowpea mosaic comovirus and with RNA2 of two closely related nepoviruses, tomato black ring virus and Hungarian grapevine chrome mosaic virus, showed strong similarities among the 3' non-coding regions but less similarity among the 5' end non-coding sequences than reported among other nepovirus RNAs.

  3. Study design requirements for RNA sequencing-based breast cancer diagnostics.

    Science.gov (United States)

    Mer, Arvind Singh; Klevebring, Daniel; Grönberg, Henrik; Rantalainen, Mattias

    2016-02-01

    Sequencing-based molecular characterization of tumors provides information required for individualized cancer treatment. There are well-defined molecular subtypes of breast cancer that provide improved prognostication compared to routine biomarkers. However, molecular subtyping is not yet implemented in routine breast cancer care. Clinical translation is dependent on subtype prediction models providing high sensitivity and specificity. In this study we evaluate sample size and RNA-sequencing read requirements for breast cancer subtyping to facilitate rational design of translational studies. We applied subsampling to ascertain the effect of training sample size and the number of RNA sequencing reads on classification accuracy of molecular subtype and routine biomarker prediction models (unsupervised and supervised). Subtype classification accuracy improved with increasing sample size up to N = 750 (accuracy = 0.93), although with a modest improvement beyond N = 350 (accuracy = 0.92). Prediction of routine biomarkers achieved accuracy of 0.94 (ER) and 0.92 (Her2) at N = 200. Subtype classification improved with RNA-sequencing library size up to 5 million reads. Development of molecular subtyping models for cancer diagnostics requires well-designed studies. Sample size and the number of RNA sequencing reads directly influence accuracy of molecular subtyping. Results in this study provide key information for rational design of translational studies aiming to bring sequencing-based diagnostics to the clinic.

  4. A DNA sequence obtained by replacement of the dopamine RNA aptamer bases is not an aptamer.

    Science.gov (United States)

    Álvarez-Martos, Isabel; Ferapontova, Elena E

    2017-08-05

    A unique specificity of the aptamer-ligand biorecognition and binding facilitates bioanalysis and biosensor development, contributing to discrimination of structurally related molecules, such as dopamine and other catecholamine neurotransmitters. The aptamer sequence capable of specific binding of dopamine is a 57 nucleotides long RNA sequence reported in 1997 (Biochemistry, 1997, 36, 9726). Later, it was suggested that the DNA homologue of the RNA aptamer retains the specificity of dopamine binding (Biochem. Biophys. Res. Commun., 2009, 388, 732). Here, we show that the DNA sequence obtained by the replacement of the RNA aptamer bases for their DNA analogues is not able of specific biorecognition of dopamine, in contrast to the original RNA aptamer sequence. This DNA sequence binds dopamine and structurally related catecholamine neurotransmitters non-specifically, as any DNA sequence, and, thus, is not an aptamer and cannot be used neither for in vivo nor in situ analysis of dopamine in the presence of structurally related neurotransmitters. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. RNA Sequencing and Bioinformatics Analysis Implicate the Regulatory Role of a Long Noncoding RNA-mRNA Network in Hepatic Stellate Cell Activation.

    Science.gov (United States)

    Guo, Can-Jie; Xiao, Xiao; Sheng, Li; Chen, Lili; Zhong, Wei; Li, Hai; Hua, Jing; Ma, Xiong

    2017-01-01

    To analyze the long noncoding (lncRNA)-mRNA expression network and potential roles in rat hepatic stellate cells (HSCs) during activation. LncRNA expression was analyzed in quiescent and culture-activated HSCs by RNA sequencing, and differentially expressed lncRNAs verified by quantitative reverse transcription polymerase chain reaction (qRT-PCR) were subjected to bioinformatics analysis. In vivo analyses of differential lncRNA-mRNA expression were performed on a rat model of liver fibrosis. We identified upregulation of 12 lncRNAs and 155 mRNAs and downregulation of 12 lncRNAs and 374 mRNAs in activated HSCs. Additionally, we identified the differential expression of upregulated lncRNAs (NONRATT012636.2, NONRATT016788.2, and NONRATT021402.2) and downregulated lncRNAs (NONRATT007863.2, NONRATT019720.2, and NONRATT024061.2) in activated HSCs relative to levels observed in quiescent HSCs, and Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses showed that changes in lncRNAs associated with HSC activation revealed 11 significantly enriched pathways according to their predicted targets. Moreover, based on the predicted co-expression network, the relative dynamic levels of NONRATT013819.2 and lysyl oxidase (Lox) were compared during HSC activation both in vitro and in vivo. Our results confirmed the upregulation of lncRNA NONRATT013819.2 and Lox mRNA associated with the extracellular matrix (ECM)-related signaling pathway in HSCs and fibrotic livers. Our results detailing a dysregulated lncRNA-mRNA network might provide new treatment strategies for hepatic fibrosis based on findings indicating potentially critical roles for NONRATT013819.2 and Lox in ECM remodeling during HSC activation. © 2017 The Author(s). Published by S. Karger AG, Basel.

  6. Short communication: Acute but transient increase in serum insulin reduces messenger RNA expression of hepatic enzymes associated with progesterone catabolism in dairy cows.

    Science.gov (United States)

    Vieira, F V R; Cooke, R F; Aboin, A C; Lima, P; Vasconcelos, J L M

    2013-02-01

    The objective of this experiment was to evaluate the effects of glucose infusion on serum concentrations of glucose, insulin, and progesterone (P4), as well as mRNA expression of hepatic CYP2C19 and CYP3A4 in nonlactating, ovariectomized cows in adequate nutritional status. Eight Gir × Holstein cows were maintained on a low-quality Brachiaria brizantha pasture with reduced forage availability, but they individually received, on average, 3 kg/cow daily (as fed) of a corn-based concentrate from d -28 to 0 of the experiment. All cows had an intravaginal P4-releasing device inserted on d -14, which remained in cows until the end of the experiment (d 1). On d 0, cows were randomly assigned to receive, in a crossover design containing 2 periods of 24h each (d 0 and 1), (1) an intravenous glucose infusion (GLUC; 0.5 g of glucose/kg of BW, over a 3-h period) or (2) an intravenous saline infusion (SAL; 0.9%, over a 3-h period). Cows were fasted for 12h before infusions, and they remained fasted during infusion and sample collections. Blood samples were collected at 0, 3, and 6h relative to the beginning of infusions. Liver biopsies were performed concurrently with blood collections at 0 and 3h. After the last blood collection of period 1, cows received concentrate and returned to pasture. Cows gained BW (16.5 ± 3.6 kg) and BCS (0.08 ± 0.06) from d -28 to 0. Cows receiving GLUC had greater serum glucose and insulin concentrations at 3h compared with SAL cohorts. No treatment effects were detected for serum P4 concentrations, although mRNA expression of CYP2C19 and CYP3A4 after the infusion period was reduced for cows in the GLUC treatment compared with their cohorts in the SAL treatment. In conclusion, hepatic CYP3A4 and CYP2C19 mRNA expression can be promptly modulated by glucose infusion followed by acute increases in circulating insulin, which provides novel insight into the physiological mechanisms associating nutrition and reproductive function in dairy cows

  7. Quantitative miRNA expression analysis: comparing microarrays with next-generation sequencing

    DEFF Research Database (Denmark)

    Willenbrock, Hanni; Salomon, Jesper; Søkilde, Rolf

    2009-01-01

    Recently, next-generation sequencing has been introduced as a promising, new platform for assessing the copy number of transcripts, while the existing microarray technology is considered less reliable for absolute, quantitative expression measurements. Nonetheless, so far, results from the two...... technologies have only been compared based on biological data, leading to the conclusion that, although they are somewhat correlated, expression values differ significantly. Here, we use synthetic RNA samples, resembling human microRNA samples, to find that microarray expression measures actually correlate...... better with sample RNA content than expression measures obtained from sequencing data. In addition, microarrays appear highly sensitive and perform equivalently to next-generation sequencing in terms of reproducibility and relative ratio quantification....

  8. The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

    Science.gov (United States)

    Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

    1989-04-01

    The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

  9. Efficient RNA extraction protocol for the wood mangrove species Laguncularia racemosa suited for next-generation RNA sequencing

    International Nuclear Information System (INIS)

    Wilwerth, M. W.; Rossetto, P.

    2016-01-01

    Mangrove flora and habitat have immeasurable importance in marine and coastal ecology as well as in the economy. Despite their importance, they are constantly threatened by oil spill accidents and environmental contamination; therefore, it is crucial to understand the changes in gene expression to better predict toxicity in these plants. Among the species of Atlantic coast mangrove (Americas and Africa), Laguncularia racemosa, or white mangrove, is a conspicuous species. The wide distribution of L. racemosa in areas where marine oil exploration is rapidly increasing make it a candidate mangrove species model to uncover the impact of oil spills at the molecular level with the use of massive transcriptome sequencing. However, for this purpose, the RNA extraction protocol should ensure low levels of contaminants and structure integrity. In this study, eight RNA extraction methods were tested and analysed using downstream applications. The InviTrap Spin Plant RNA Mini Kit performed best with regard to purity and integrity. Moreover, the obtained RNA was submitted to cDNA synthesis and RT-PCR, successfully generating amplification products of the expected size. These Results show the applicability of the RNA obtained here for downstream methodologies, such as the construction of cDNA libraries for the Illumina Hi-seq platform. (author)

  10. Effect of N-Feruloylserotonin and Methotrexate on Severity of Experimental Arthritis and on Messenger RNA Expression of Key Proinflammatory Markers in Liver

    Directory of Open Access Journals (Sweden)

    Ľudmila Pašková

    2016-01-01

    Full Text Available Rheumatoid arthritis (RA is a chronic inflammatory disease, leading to progressive destruction of joints and extra-articular tissues, including organs such as liver and spleen. The purpose of this study was to compare the effects of a potential immunomodulator, natural polyphenol N-feruloylserotonin (N-f-5HT, with methotrexate (MTX, the standard in RA therapy, in the chronic phase of adjuvant-induced arthritis (AA in male Lewis rats. The experiment included healthy controls (CO, arthritic animals (AA, AA given N-f-5HT (AA-N-f-5HT, and AA given MTX (AA-MTX. N-f-5HT did not affect the body weight change and clinical parameters until the 14th experimental day. Its positive effect was rising during the 28-day experiment, indicating a delayed onset of N-f-5HT action. Administration of either N-f-5HT or MTX caused reduction of inflammation measured as the level of CRP in plasma and the activity of LOX in the liver. mRNA transcription of TNF-α and iNOS in the liver was significantly attenuated in both MTX and N-f-5HT treated groups of arthritic rats. Interestingly, in contrast to MTX, N-f-5HT significantly lowered the level of IL-1β in plasma and IL-1β mRNA expression in the liver and spleen of arthritic rats. This speaks for future investigations of N-f-5HT as an agent in the treatment of RA in combination therapy with MTX.

  11. Determining mutant spectra of three RNA viral samples using ultra-deep sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Chen, H

    2012-06-06

    RNA viruses have extremely high mutation rates that enable the virus to adapt to new host environments and even jump from one species to another. As part of a viral transmission study, three viral samples collected from naturally infected animals were sequenced using Illumina paired-end technology at ultra-deep coverage. In order to determine the mutant spectra within the viral quasispecies, it is critical to understand the sequencing error rates and control for false positive calls of viral variants (point mutantations). I will estimate the sequencing error rate from two control sequences and characterize the mutant spectra in the natural samples with this error rate.

  12. Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure.

    Directory of Open Access Journals (Sweden)

    Masfique Mehedi

    Full Text Available Ebolavirus (EBOV, the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

  13. Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure.

    Science.gov (United States)

    Mehedi, Masfique; Hoenen, Thomas; Robertson, Shelly; Ricklefs, Stacy; Dolan, Michael A; Taylor, Travis; Falzarano, Darryl; Ebihara, Hideki; Porcella, Stephen F; Feldmann, Heinz

    2013-01-01

    Ebolavirus (EBOV), the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

  14. mESAdb: microRNA expression and sequence analysis database.

    Science.gov (United States)

    Kaya, Koray D; Karakülah, Gökhan; Yakicier, Cengiz M; Acar, Aybar C; Konu, Ozlen

    2011-01-01

    microRNA expression and sequence analysis database (http://konulab.fen.bilkent.edu.tr/mirna/) (mESAdb) is a regularly updated database for the multivariate analysis of sequences and expression of microRNAs from multiple taxa. mESAdb is modular and has a user interface implemented in PHP and JavaScript and coupled with statistical analysis and visualization packages written for the R language. The database primarily comprises mature microRNA sequences and their target data, along with selected human, mouse and zebrafish expression data sets. mESAdb analysis modules allow (i) mining of microRNA expression data sets for subsets of microRNAs selected manually or by motif; (ii) pair-wise multivariate analysis of expression data sets within and between taxa; and (iii) association of microRNA subsets with annotation databases, HUGE Navigator, KEGG and GO. The use of existing and customized R packages facilitates future addition of data sets and analysis tools. Furthermore, the ability to upload and analyze user-specified data sets makes mESAdb an interactive and expandable analysis tool for microRNA sequence and expression data.

  15. incaRNAfbinv: a web server for the fragment-based design of RNA sequences

    Science.gov (United States)

    Drory Retwitzer, Matan; Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme; Barash, Danny

    2016-01-01

    Abstract In recent years, new methods for computational RNA design have been developed and applied to various problems in synthetic biology and nanotechnology. Lately, there is considerable interest in incorporating essential biological information when solving the inverse RNA folding problem. Correspondingly, RNAfbinv aims at including biologically meaningful constraints and is the only program to-date that performs a fragment-based design of RNA sequences. In doing so it allows the design of sequences that do not necessarily exactly fold into the target, as long as the overall coarse-grained tree graph shape is preserved. Augmented by the weighted sampling algorithm of incaRNAtion, our web server called incaRNAfbinv implements the method devised in RNAfbinv and offers an interactive environment for the inverse folding of RNA using a fragment-based design approach. It takes as input: a target RNA secondary structure; optional sequence and motif constraints; optional target minimum free energy, neutrality and GC content. In addition to the design of synthetic regulatory sequences, it can be used as a pre-processing step for the detection of novel natural occurring RNAs. The two complementary methodologies RNAfbinv and incaRNAtion are merged together and fully implemented in our web server incaRNAfbinv, available at http://www.cs.bgu.ac.il/incaRNAfbinv. PMID:27185893

  16. Sequence-specific inhibition of Dicer measured with a force-based microarray for RNA ligands.

    Science.gov (United States)

    Limmer, Katja; Aschenbrenner, Daniela; Gaub, Hermann E

    2013-04-01

    Malfunction of protein translation causes many severe diseases, and suitable correction strategies may become the basis of effective therapies. One major regulatory element of protein translation is the nuclease Dicer that cuts double-stranded RNA independently of the sequence into pieces of 19-22 base pairs starting the RNA interference pathway and activating miRNAs. Inhibiting Dicer is not desirable owing to its multifunctional influence on the cell's gene regulation. Blocking specific RNA sequences by small-molecule binding, however, is a promising approach to affect the cell's condition in a controlled manner. A label-free assay for the screening of site-specific interference of small molecules with Dicer activity is thus needed. We used the Molecular Force Assay (MFA), recently developed in our lab, to measure the activity of Dicer. As a model system, we used an RNA sequence that forms an aptamer-binding site for paromomycin, a 615-dalton aminoglycoside. We show that Dicer activity is modulated as a function of concentration and incubation time: the addition of paromomycin leads to a decrease of Dicer activity according to the amount of ligand. The measured dissociation constant of paromomycin to its aptamer was found to agree well with literature values. The parallel format of the MFA allows a large-scale search and analysis for ligands for any RNA sequence.

  17. Next generation sequencing analysis of human platelet PolyA+ mRNAs and rRNA-depleted total RNA.

    Directory of Open Access Journals (Sweden)

    Antheia Kissopoulou

    Full Text Available BACKGROUND: Platelets are small anucleate cells circulating in the blood vessels where they play a key role in hemostasis and thrombosis. Here, we compared platelet RNA-Seq results obtained from polyA+ mRNA and rRNA-depleted total RNA. MATERIALS AND METHODS: We used purified, CD45 depleted, human blood platelets collected by apheresis from three male and one female healthy blood donors. The Illumina HiSeq 2000 platform was employed to sequence cDNA converted either from oligo(dT isolated polyA+ RNA or from rRNA-depleted total RNA. The reads were aligned to the GRCh37 reference assembly with the TopHat/Cufflinks alignment package using Ensembl annotations. A de novo assembly of the platelet transcriptome using the Trinity software package and RSEM was also performed. The bioinformatic tools HTSeq and DESeq from Bioconductor were employed for further statistical analyses of read counts. RESULTS: Consistent with previous findings our data suggests that mitochondrially expressed genes comprise a substantial fraction of the platelet transcriptome. We also identified high transcript levels for protein coding genes related to the cytoskeleton function, chemokine signaling, cell adhesion, aggregation, as well as receptor interaction between cells. Certain transcripts were particularly abundant in platelets compared with other cell and tissue types represented by RNA-Seq data from the Illumina Human Body Map 2.0 project. Irrespective of the different library preparation and sequencing protocols, there was good agreement between samples from the 4 individuals. Eighteen differentially expressed genes were identified in the two sexes at 10% false discovery rate using DESeq. CONCLUSION: The present data suggests that platelets may have a unique transcriptome profile characterized by a relative over-expression of mitochondrially encoded genes and also of genomic transcripts related to the cytoskeleton function, chemokine signaling and surface components

  18. Ribosomal RNA gene sequences confirm that protistan endoparasite of larval cod Gadus morhua is Ichthyodinium sp

    DEFF Research Database (Denmark)

    Skovgaard, Alf; Meyer, Stefan; Overton, Julia Lynne

    2010-01-01

    An enigmatic protistan endoparasite found in eggs and larvae of cod Gadus morhua and turbot Psetta maxima was isolated from Baltic cod larvae, and DNA was extracted for sequencing of the parasite's small Subunit ribosomal RNA (SSU rRNA) gene. The endoparasite has previously been suggested...... to be related to Ichthyodinium chabelardi, a dinoflagellate-like protist that parasitizes yolk sacs of embryos and larvae of a variety of fish species. Comparison of a 1535 bp long fragment of the SSU rRNA gene of the cod endoparasite showed absolute identify with I. chabelardi, demonstrating that the 2...

  19. 3' end labelling of RNA with /sup 32/P suitable for rapid gel sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Winter, G; Brownlee, G G [Medical Research Council, Cambridge (UK)

    1978-09-01

    A new general method of labelling the 2', 3'-diol end of RNA with /sup 32/P has been devised suitable for gel sequencing. Poly(A) polymerase (E.coli) is incubated with the RNA and limiting amounts of ..cap alpha..-/sup 32/P-ATP. The mono-addition product is then cleaved with periodate and ..beta..-eliminated with aniline, leaving the RNA terminally labelled with 3'/sup 32/P-phosphate. When applied to a model compound, tRNAsup(Phe) from E. coli, over 28 residues could be read from the 3' end.

  20. RNA-Sequencing of Primary Retinoblastoma Tumors Provides New Insights and Challenges Into Tumor Development

    Directory of Open Access Journals (Sweden)

    Sailaja V. Elchuri

    2018-05-01

    Full Text Available Retinoblastoma is rare tumor of the retina caused by the homozygous loss of the Retinoblastoma 1 tumor suppressor gene (RB1. Loss of the RB1 protein, pRB, results in de-regulated activity of the E2F transcription factors, chromatin changes and developmental defects leading to tumor development. Extensive microarray profiles of these tumors have enabled the identification of genes sensitive to pRB disruption, however, this technology has a number of limitations in the RNA profiles that they generate. The advent of RNA-sequencing has enabled the global profiling of all of the RNA within the cell including both coding and non-coding features and the detection of aberrant RNA processing events. In this perspective, we focus on discussing how RNA-sequencing of rare Retinoblastoma tumors will build on existing data and open up new area’s to improve our understanding of the biology of these tumors. In particular, we discuss how the RB-research field may be to use this data to determine how RB1 loss results in the expression of; non-coding RNAs, causes aberrant RNA processing events and how a deeper analysis of metabolic RNA changes can be utilized to model tumor specific shifts in metabolism. Each section discusses new opportunities and challenges associated with these types of analyses and aims to provide an honest assessment of how understanding these different processes may contribute to the treatment of Retinoblastoma.

  1. Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.

    Science.gov (United States)

    Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V

    2003-01-01

    Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).

  2. Modeling bias and variation in the stochastic processes of small RNA sequencing.

    Science.gov (United States)

    Argyropoulos, Christos; Etheridge, Alton; Sakhanenko, Nikita; Galas, David

    2017-06-20

    The use of RNA-seq as the preferred method for the discovery and validation of small RNA biomarkers has been hindered by high quantitative variability and biased sequence counts. In this paper we develop a statistical model for sequence counts that accounts for ligase bias and stochastic variation in sequence counts. This model implies a linear quadratic relation between the mean and variance of sequence counts. Using a large number of sequencing datasets, we demonstrate how one can use the generalized additive models for location, scale and shape (GAMLSS) distributional regression framework to calculate and apply empirical correction factors for ligase bias. Bias correction could remove more than 40% of the bias for miRNAs. Empirical bias correction factors appear to be nearly constant over at least one and up to four orders of magnitude of total RNA input and independent of sample composition. Using synthetic mixes of known composition, we show that the GAMLSS approach can analyze differential expression with greater accuracy, higher sensitivity and specificity than six existing algorithms (DESeq2, edgeR, EBSeq, limma, DSS, voom) for the analysis of small RNA-seq data. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Reduction in PSA messenger-RNA expression and clinical recurrence in patients with prostatic cancer undergoing neoadjuvant therapy before radical prostatectomy

    Directory of Open Access Journals (Sweden)

    Baruffi Marco

    2004-04-01

    Full Text Available Abstract Background We assessed the incidence of micro-metastases at surgical margins (SM and pelvic lymph nodes (LN in patients submitted to radical retropubic prostatectomy (RP after neoadjuvant therapy (NT or to RP alone. We compared traditional staging to molecular detection of PSA using Taqman-based quantitative real-time PCR (qrt-PCR never used before for this purpose. Methods 29 patients were assigned to NT plus RP (arm A or RP alone (arm B. Pelvic LN were dissected for qrt-PCR analysis, together with right and left lateral SM. Results 64,3% patients of arm B and 26.6% of arm A had evidence of PSA mRNA expression in LN and/or SM. 17,2% patients, all of arm B, had biochemical recurrence. Conclusions Qrt-PCR may be more sensitive, compared to conventional histology, in identifying presence of viable prostate carcinoma cells in SM and LN. Gene expression of PSA in surgical periprostatic samples might be considered as a novel and reliable indicator of minimal residual disease after NT.

  4. Reduction in PSA messenger-RNA expression and clinical recurrence in patients with prostatic cancer undergoing neoadjuvant therapy before radical prostatectomy

    Science.gov (United States)

    Grasso, Marco; Lania, Caterina; Blanco, Salvatore; Baruffi, Marco; Mocellin, Simone

    2004-01-01

    Background We assessed the incidence of micro-metastases at surgical margins (SM) and pelvic lymph nodes (LN) in patients submitted to radical retropubic prostatectomy (RP) after neoadjuvant therapy (NT) or to RP alone. We compared traditional staging to molecular detection of PSA using Taqman-based quantitative real-time PCR (qrt-PCR) never used before for this purpose. Methods 29 patients were assigned to NT plus RP (arm A) or RP alone (arm B). Pelvic LN were dissected for qrt-PCR analysis, together with right and left lateral SM. Results 64,3% patients of arm B and 26.6% of arm A had evidence of PSA mRNA expression in LN and/or SM. 17,2% patients, all of arm B, had biochemical recurrence. Conclusions Qrt-PCR may be more sensitive, compared to conventional histology, in identifying presence of viable prostate carcinoma cells in SM and LN. Gene expression of PSA in surgical periprostatic samples might be considered as a novel and reliable indicator of minimal residual disease after NT. PMID:15104791

  5. High-throughput sequencing of RNA silencing-associated small RNAs in olive (Olea europaea L..

    Directory of Open Access Journals (Sweden)

    Livia Donaire

    Full Text Available Small RNAs (sRNAs of 20 to 25 nucleotides (nt in length maintain genome integrity and control gene expression in a multitude of developmental and physiological processes. Despite RNA silencing has been primarily studied in model plants, the advent of high-throughput sequencing technologies has enabled profiling of the sRNA component of more than 40 plant species. Here, we used deep sequencing and molecular methods to report the first inventory of sRNAs in olive (Olea europaea L.. sRNA libraries prepared from juvenile and adult shoots revealed that the 24-nt class dominates the sRNA transcriptome and atypically accumulates to levels never seen in other plant species, suggesting an active role of heterochromatin silencing in the maintenance and integrity of its large genome. A total of 18 known miRNA families were identified in the libraries. Also, 5 other sRNAs derived from potential hairpin-like precursors remain as plausible miRNA candidates. RNA blots confirmed miRNA expression and suggested tissue- and/or developmental-specific expression patterns. Target mRNAs of conserved miRNAs were computationally predicted among the olive cDNA collection and experimentally validated through endonucleolytic cleavage assays. Finally, we use expression data to uncover genetic components of the miR156, miR172 and miR390/TAS3-derived trans-acting small interfering RNA (tasiRNA regulatory nodes, suggesting that these interactive networks controlling developmental transitions are fully operational in olive.

  6. TurboFold: Iterative probabilistic estimation of secondary structures for multiple RNA sequences

    Directory of Open Access Journals (Sweden)

    Sharma Gaurav

    2011-04-01

    Full Text Available Abstract Background The prediction of secondary structure, i.e. the set of canonical base pairs between nucleotides, is a first step in developing an understanding of the function of an RNA sequence. The most accurate computational methods predict conserved structures for a set of homologous RNA sequences. These methods usually suffer from high computational complexity. In this paper, TurboFold, a novel and efficient method for secondary structure prediction for multiple RNA sequences, is presented. Results TurboFold takes, as input, a set of homologous RNA sequences and outputs estimates of the base pairing probabilities for each sequence. The base pairing probabilities for a sequence are estimated by combining intrinsic information, derived from the sequence itself via the nearest neighbor thermodynamic model, with extrinsic information, derived from the other sequences in the input set. For a given sequence, the extrinsic information is computed by using pairwise-sequence-alignment-based probabilities for co-incidence with each of the other sequences, along with estimated base pairing probabilities, from the previous iteration, for the other sequences. The extrinsic information is introduced as free energy modifications for base pairing in a partition function computation based on the nearest neighbor thermodynamic model. This process yields updated estimates of base pairing probability. The updated base pairing probabilities in turn are used to recompute extrinsic information, resulting in the overall iterative estimation procedure that defines TurboFold. TurboFold is benchmarked on a number of ncRNA datasets and compared against alternative secondary structure prediction methods. The iterative procedure in TurboFold is shown to improve estimates of base pairing probability with each iteration, though only small gains are obtained beyond three iterations. Secondary structures composed of base pairs with estimated probabilities higher than a

  7. Combined sequencing of mRNA and DNA from human embryonic stem cells

    Directory of Open Access Journals (Sweden)

    Florian Mertes

    2016-06-01

    Full Text Available Combined transcriptome and whole genome sequencing of the same ultra-low input sample down to single cells is a rapidly evolving approach for the analysis of rare cells. Besides stem cells, rare cells originating from tissues like tumor or biopsies, circulating tumor cells and cells from early embryonic development are under investigation. Herein we describe a universal method applicable for the analysis of minute amounts of sample material (150 to 200 cells derived from sub-colony structures from human embryonic stem cells. The protocol comprises the combined isolation and separate amplification of poly(A mRNA and whole genome DNA followed by next generation sequencing. Here we present a detailed description of the method developed and an overview of the results obtained for RNA and whole genome sequencing of human embryonic stem cells, sequencing data is available in the Gene Expression Omnibus (GEO database under accession number GSE69471.

  8. The role of upstream sequences in selecting the reading frame on tmRNA

    Directory of Open Access Journals (Sweden)

    Dewey Jonathan D

    2008-06-01

    Full Text Available Abstract Background tmRNA acts first as a tRNA and then as an mRNA to rescue stalled ribosomes in eubacteria. Two unanswered questions about tmRNA function remain: how does tmRNA, lacking an anticodon, bypass the decoding machinery and enter the ribosome? Secondly, how does the ribosome choose the proper codon to resume translation on tmRNA? According to the -1 triplet hypothesis, the answer to both questions lies in the unique properties of the three nucleotides upstream of the first tmRNA codon. These nucleotides assume an A-form conformation that mimics the codon-anticodon interaction, leading to recognition by the decoding center and choice of the reading frame. The -1 triplet hypothesis is important because it is the most credible model in which direct binding and recognition by the ribosome sets the reading frame on tmRNA. Results Conformational analysis predicts that 18 triplets cannot form the correct structure to function as the -1 triplet of tmRNA. We tested the tmRNA activity of all possible -1 triplet mutants using a genetic assay in Escherichia coli. While many mutants displayed reduced activity, our findings do not match the predictions of this model. Additional mutagenesis identified sequences further upstream that are required for tmRNA function. An immunoblot assay for translation of the tmRNA tag revealed that certain mutations in U85, A86, and the -1 triplet sequence result in improper selection of the first codon and translation in the wrong frame (-1 or +1 in vivo. Conclusion Our findings disprove the -1 triplet hypothesis. The -1 triplet is not required for accommodation of tmRNA into the ribosome, although it plays a minor role in frame selection. Our results strongly disfavor direct ribosomal recognition of the upstream sequence, instead supporting a model in which the binding of a separate ligand to A86 is primarily responsible for frame selection.

  9. RNA deep sequencing reveals differential microRNA expression during development of sea urchin and sea star.

    Directory of Open Access Journals (Sweden)

    Sabah Kadri

    Full Text Available microRNAs (miRNAs are small (20-23 nt, non-coding single stranded RNA molecules that act as post-transcriptional regulators of mRNA gene expression. They have been implicated in regulation of developmental processes in diverse organisms. The echinoderms, Strongylocentrotus purpuratus (sea urchin and Patiria miniata (sea star are excellent model organisms for studying development with well-characterized transcriptional networks. However, to date, nothing is known about the role of miRNAs during development in these organisms, except that the genes that are involved in the miRNA biogenesis pathway are expressed during their developmental stages. In this paper, we used Illumina Genome Analyzer (Illumina, Inc. to sequence small RNA libraries in mixed stage population of embryos from one to three days after fertilization of sea urchin and sea star (total of 22,670,000 reads. Analysis of these data revealed the miRNA populations in these two species. We found that 47 and 38 known miRNAs are expressed in sea urchin and sea star, respectively, during early development (32 in common. We also found 13 potentially novel miRNAs in the sea urchin embryonic library. miRNA expression is generally conserved between the two species during development, but 7 miRNAs are highly expressed in only one species. We expect that our two datasets will be a valuable resource for everyone working in the field of developmental biology and the regulatory networks that affect it. The computational pipeline to analyze Illumina reads is available at http://www.benoslab.pitt.edu/services.html.

  10. RNA Deep Sequencing Reveals Differential MicroRNA Expression during Development of Sea Urchin and Sea Star

    Science.gov (United States)

    Kadri, Sabah; Hinman, Veronica F.; Benos, Panayiotis V.

    2011-01-01

    microRNAs (miRNAs) are small (20–23 nt), non-coding single stranded RNA molecules that act as post-transcriptional regulators of mRNA gene expression. They have been implicated in regulation of developmental processes in diverse organisms. The echinoderms, Strongylocentrotus purpuratus (sea urchin) and Patiria miniata (sea star) are excellent model organisms for studying development with well-characterized transcriptional networks. However, to date, nothing is known about the role of miRNAs during development in these organisms, except that the genes that are involved in the miRNA biogenesis pathway are expressed during their developmental stages. In this paper, we used Illumina Genome Analyzer (Illumina, Inc.) to sequence small RNA libraries in mixed stage population of embryos from one to three days after fertilization of sea urchin and sea star (total of 22,670,000 reads). Analysis of these data revealed the miRNA populations in these two species. We found that 47 and 38 known miRNAs are expressed in sea urchin and sea star, respectively, during early development (32 in common). We also found 13 potentially novel miRNAs in the sea urchin embryonic library. miRNA expression is generally conserved between the two species during development, but 7 miRNAs are highly expressed in only one species. We expect that our two datasets will be a valuable resource for everyone working in the field of developmental biology and the regulatory networks that affect it. The computational pipeline to analyze Illumina reads is available at http://www.benoslab.pitt.edu/services.html. PMID:22216218

  11. Accuracy of taxonomy prediction for 16S rRNA and fungal ITS sequences

    Directory of Open Access Journals (Sweden)

    Robert C. Edgar

    2018-04-01

    Full Text Available Prediction of taxonomy for marker gene sequences such as 16S ribosomal RNA (rRNA is a fundamental task in microbiology. Most experimentally observed sequences are diverged from reference sequences of authoritatively named organisms, creating a challenge for prediction methods. I assessed the accuracy of several algorithms using cross-validation by identity, a new benchmark strategy which explicitly models the variation in distances between query sequences and the closest entry in a reference database. When the accuracy of genus predictions was averaged over a representative range of identities with the reference database (100%, 99%, 97%, 95% and 90%, all tested methods had ≤50% accuracy on the currently-popular V4 region of 16S rRNA. Accuracy was found to fall rapidly with identity; for example, better methods were found to have V4 genus prediction accuracy of ∼100% at 100% identity but ∼50% at 97% identity. The relationship between identity and taxonomy was quantified as the probability that a rank is the lowest shared by a pair of sequences with a given pair-wise identity. With the V4 region, 95% identity was found to be a twilight zone where taxonomy is highly ambiguous because the probabilities that the lowest shared rank between pairs of sequences is genus, family, order or class are approximately equal.

  12. RNA-ID, a Powerful Tool for Identifying and Characterizing Regulatory Sequences.

    Science.gov (United States)

    Brule, C E; Dean, K M; Grayhack, E J

    2016-01-01

    The identification and analysis of sequences that regulate gene expression is critical because regulated gene expression underlies biology. RNA-ID is an efficient and sensitive method to discover and investigate regulatory sequences in the yeast Saccharomyces cerevisiae, using fluorescence-based assays to detect green fluorescent protein (GFP) relative to a red fluorescent protein (RFP) control in individual cells. Putative regulatory sequences can be inserted either in-frame or upstream of a superfolder GFP fusion protein whose expression, like that of RFP, is driven by the bidirectional GAL1,10 promoter. In this chapter, we describe the methodology to identify and study cis-regulatory sequences in the RNA-ID system, explaining features and variations of the RNA-ID reporter, as well as some applications of this system. We describe in detail the methods to analyze a single regulatory sequence, from construction of a single GFP variant to assay of variants by flow cytometry, as well as modifications required to screen libraries of different strains simultaneously. We also describe subsequent analyses of regulatory sequences. © 2016 Elsevier Inc. All rights reserved.

  13. [Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence

    Science.gov (United States)

    Ortega, Maya

    2010-01-01

    My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

  14. Sequence-specific bias correction for RNA-seq data using recurrent neural networks.

    Science.gov (United States)

    Zhang, Yao-Zhong; Yamaguchi, Rui; Imoto, Seiya; Miyano, Satoru

    2017-01-25

    The recent success of deep learning techniques in machine learning and artificial intelligence has stimulated a great deal of interest among bioinformaticians, who now wish to bring the power of deep learning to bare on a host of bioinformatical problems. Deep learning is ideally suited for biological problems that require automatic or hierarchical feature representation for biological data when prior knowledge is limited. In this work, we address the sequence-specific bias correction problem for RNA-seq data redusing Recurrent Neural Networks (RNNs) to model nucleotide sequences without pre-determining sequence structures. The sequence-specific bias of a read is then calculated based on the sequence probabilities estimated by RNNs, and used in the estimation of gene abundance. We explore the application of two popular RNN recurrent units for this task and demonstrate that RNN-based approaches provide a flexible way to model nucleotide sequences without knowledge of predetermined sequence structures. Our experiments show that training a RNN-based nucleotide sequence model is efficient and RNN-based bias correction methods compare well with the-state-of-the-art sequence-specific bias correction method on the commonly used MAQC-III data set. RNNs provides an alternative and flexible way to calculate sequence-specific bias without explicitly pre-determining sequence structures.

  15. Dynamical Messengers for Gauge Mediation

    Energy Technology Data Exchange (ETDEWEB)

    Hook, Anson; Torroba, Gonzalo; /SLAC /Stanford U., Phys. Dept.

    2011-08-17

    We construct models of indirect gauge mediation where the dynamics responsible for breaking supersymmetry simultaneously generates a weakly coupled subsector of messengers. This provides a microscopic realization of messenger gauge mediation where the messenger and hidden sector fields are unified into a single sector. The UV theory is SQCD with massless and massive quarks plus singlets, and at low energies it flows to a weakly coupled quiver gauge theory. One node provides the primary source of supersymmetry breaking, which is then transmitted to the node giving rise to the messenger fields. These models break R-symmetry spontaneously, produce realistic gaugino and sfermion masses, and give a heavy gravitino.

  16. Identification of microRNA-Like RNAs in the filamentous fungus Trichoderma reesei by solexa sequencing.

    Directory of Open Access Journals (Sweden)

    Kang Kang

    Full Text Available microRNAs (miRNAs are non-coding small RNAs (sRNAs capable of negatively regulating gene expression. Recently, microRNA-like small RNAs (milRNAs were discovered in several filamentous fungi but not yet in Trichoderma reesei, an industrial filamentous fungus that can secrete abundant hydrolases. To explore the presence of milRNA in T. reesei and evaluate their expression under induction of cellulose, two T. reesei sRNA libraries of cellulose induction (IN and non-induction (CON were generated and sequenced using Solexa sequencing technology. A total of 726 and 631 sRNAs were obtained from the IN and CON samples, respectively. Global expression analysis showed an extensively differential expression of sRNAs in T. reesei under the two conditions. Thirteen predicted milRNAs were identified in T. reesei based on the short hairpin structure analysis. The milRNA profiles obtained in deep sequencing were further validated by RT-qPCR assay. Computational analysis predicted a number of potential targets relating to many processes including regulation of enzyme expression. The presence and differential expression of T. reesei milRNAs imply that milRNA might play a role in T. reesei growth and cellulase induction. This work lays foundation for further functional study of fungal milRNAs and their industrial application.

  17. MESSENGER: Exploring Mercury's Magnetosphere

    Science.gov (United States)

    Slavin, James A.

    2008-01-01

    The MESSENGER mission to Mercury offers our first opportunity to explore this planet's miniature magnetosphere since Mariner 10's brief fly-bys in 1974-5. Mercury's magnetosphere is unique in many respects. The magnetosphere of Mercury is the smallest in the solar system with its magnetic field typically standing off the solar wind only - 1000 to 2000 km above the surface. For this reason there are no closed dri-fi paths for energetic particles and, hence, no radiation belts; the characteristic time scales for wave propagation and convective transport are short possibly coupling kinetic and fluid modes; magnetic reconnection at the dayside magnetopause may erode the subsolar magnetosphere allowing solar wind ions to directly impact the dayside regolith; inductive currents in Mercury's interior should act to modify the solar In addition, Mercury's magnetosphere is the only one with its defining magnetic flux tubes rooted in a planetary regolith as opposed to an atmosphere with a conductive ionosphere. This lack of an ionosphere is thought to be the underlying reason for the brevity of the very intense, but short lived, approx. 1-2 min, substorm-like energetic particle events observed by Mariner 10 in Mercury's magnetic tail. In this seminar, we review what we think we know about Mercury's magnetosphere and describe the MESSENGER science team's strategy for obtaining answers to the outstanding science questions surrounding the interaction of the solar wind with Mercury and its small, but dynamic magnetosphere.

  18. 16S rRNA gene sequence and phylogenetic tree of lactobacillus ...

    African Journals Online (AJOL)

    ... processed by denaturing gradient gel electrophoresis (DGGE). Phylogenetic tree was constructed with the sequences of the V2-V3 region of 16S rRNA gene. Results show two distinct divisions among the Lactobacillus species. The study presents a new understanding of the nature of the Lactobacillus vaginal microbiota ...

  19. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing

    OpenAIRE

    B Dhawan; S Sebastian; R Malhotra; A Kapil; D Gautam

    2016-01-01

    We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  20. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing

    Directory of Open Access Journals (Sweden)

    B Dhawan

    2016-01-01

    Full Text Available We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  1. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Science.gov (United States)

    Shi, Jieming; Li, Xi; Dong, Min; Graham, Mitchell; Yadav, Nehul; Liang, Chun

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

  2. JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures

    Science.gov (United States)

    Dong, Min; Graham, Mitchell; Yadav, Nehul

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416

  3. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Directory of Open Access Journals (Sweden)

    Jieming Shi

    Full Text Available Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

  4. eRNA: a graphic user interface-based tool optimized for large data analysis from high-throughput RNA sequencing.

    Science.gov (United States)

    Yuan, Tiezheng; Huang, Xiaoyi; Dittmar, Rachel L; Du, Meijun; Kohli, Manish; Boardman, Lisa; Thibodeau, Stephen N; Wang, Liang

    2014-03-05

    RNA sequencing (RNA-seq) is emerging as a critical approach in biological research. However, its high-throughput advantage is significantly limited by the capacity of bioinformatics tools. The research community urgently needs user-friendly tools to efficiently analyze the complicated data generated by high throughput sequencers. We developed a standalone tool with graphic user interface (GUI)-based analytic modules, known as eRNA. The capacity of performing parallel processing and sample management facilitates large data analyses by maximizing hardware usage and freeing users from tediously handling sequencing data. The module miRNA identification" includes GUIs for raw data reading, adapter removal, sequence alignment, and read counting. The module "mRNA identification" includes GUIs for reference sequences, genome mapping, transcript assembling, and differential expression. The module "Target screening" provides expression profiling analyses and graphic visualization. The module "Self-testing" offers the directory setups, sample management, and a check for third-party package dependency. Integration of other GUIs including Bowtie, miRDeep2, and miRspring extend the program's functionality. eRNA focuses on the common tools required for the mapping and quantification analysis of miRNA-seq and mRNA-seq data. The software package provides an additional choice for scientists who require a user-friendly computing environment and high-throughput capacity for large data analysis. eRNA is available for free download at https://sourceforge.net/projects/erna/?source=directory.

  5. miRNA-target chimeras reveal miRNA 3'-end pairing as a major determinant of Argonaute target specificity

    DEFF Research Database (Denmark)

    Moore, Michael J; Scheel, Troels K H; Luna, Joseph M

    2015-01-01

    microRNAs (miRNAs) act as sequence-specific guides for Argonaute (AGO) proteins, which mediate posttranscriptional silencing of target messenger RNAs. Despite their importance in many biological processes, rules governing AGO-miRNA targeting are only partially understood. Here we report a modifie...

  6. Discovery and validation of Barrett's esophagus microRNA transcriptome by next generation sequencing.

    Directory of Open Access Journals (Sweden)

    Ajay Bansal

    Full Text Available Barrett's esophagus (BE is transition from squamous to columnar mucosa as a result of gastroesophageal reflux disease (GERD. The role of microRNA during this transition has not been systematically studied.For initial screening, total RNA from 5 GERD and 6 BE patients was size fractionated. RNA <70 nucleotides was subjected to SOLiD 3 library preparation and next generation sequencing (NGS. Bioinformatics analysis was performed using R package "DEseq". A p value<0.05 adjusted for a false discovery rate of 5% was considered significant. NGS-identified miRNA were validated using qRT-PCR in an independent group of 40 GERD and 27 BE patients. MicroRNA expression of human BE tissues was also compared with three BE cell lines.NGS detected 19.6 million raw reads per sample. 53.1% of filtered reads mapped to miRBase version 18. NGS analysis followed by qRT-PCR validation found 10 differentially expressed miRNA; several are novel (-708-5p, -944, -224-5p and -3065-5p. Up- or down- regulation predicted by NGS was matched by qRT-PCR in every case. Human BE tissues and BE cell lines showed a high degree of concordance (70-80% in miRNA expression. Prediction analysis identified targets that mapped to developmental signaling pathways such as TGFβ and Notch and inflammatory pathways such as toll-like receptor signaling and TGFβ. Cluster analysis found similarly regulated (up or down miRNA to share common targets suggesting coordination between miRNA.Using highly sensitive next-generation sequencing, we have performed a comprehensive genome wide analysis of microRNA in BE and GERD patients. Differentially expressed miRNA between BE and GERD have been further validated. Expression of miRNA between BE human tissues and BE cell lines are highly correlated. These miRNA should be studied in biological models to further understand BE development.

  7. 16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs.

    Science.gov (United States)

    Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S

    1990-01-01

    16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

  8. Efficient construction of an inverted minimal H1 promoter driven siRNA expression cassette: facilitation of promoter and siRNA sequence exchange.

    Directory of Open Access Journals (Sweden)

    Hoorig Nassanian

    2007-08-01

    Full Text Available RNA interference (RNAi, mediated by small interfering RNA (siRNA, is an effective method used to silence gene expression at the post-transcriptional level. Upon introduction into target cells, siRNAs incorporate into the RNA-induced silencing complex (RISC. The antisense strand of the siRNA duplex then "guides" the RISC to the homologous mRNA, leading to target degradation and gene silencing. In recent years, various vector-based siRNA expression systems have been developed which utilize opposing polymerase III promoters to independently drive expression of the sense and antisense strands of the siRNA duplex from the same template.We show here the use of a ligase chain reaction (LCR to develop a new vector system called pInv-H1 in which a DNA sequence encoding a specific siRNA is placed between two inverted minimal human H1 promoters (approximately 100 bp each. Expression of functional siRNAs from this construct has led to efficient silencing of both reporter and endogenous genes. Furthermore, the inverted H1 promoter-siRNA expression cassette was used to generate a retrovirus vector capable of transducing and silencing expression of the targeted protein by>80% in target cells.The unique design of this construct allows for the efficient exchange of siRNA sequences by the directional cloning of short oligonucleotides via asymmetric restriction sites. This provides a convenient way to test the functionality of different siRNA sequences. Delivery of the siRNA cassette by retroviral transduction suggests that a single copy of the siRNA expression cassette efficiently knocks down gene expression at the protein level. We note that this vector system can potentially be used to generate a random siRNA library. The flexibility of the ligase chain reaction suggests that additional control elements can easily be introduced into this siRNA expression cassette.

  9. Full Genome Sequence and sfRNA Interferon Antagonist Activity of Zika Virus from Recife, Brazil.

    Directory of Open Access Journals (Sweden)

    Claire L Donald

    2016-10-01

    Full Text Available The outbreak of Zika virus (ZIKV in the Americas has transformed a previously obscure mosquito-transmitted arbovirus of the Flaviviridae family into a major public health concern. Little is currently known about the evolution and biology of ZIKV and the factors that contribute to the associated pathogenesis. Determining genomic sequences of clinical viral isolates and characterization of elements within these are an important prerequisite to advance our understanding of viral replicative processes and virus-host interactions.We obtained a ZIKV isolate from a patient who presented with classical ZIKV-associated symptoms, and used high throughput sequencing and other molecular biology approaches to determine its full genome sequence, including non-coding regions. Genome regions were characterized and compared to the sequences of other isolates where available. Furthermore, we identified a subgenomic flavivirus RNA (sfRNA in ZIKV-infected cells that has antagonist activity against RIG-I induced type I interferon induction, with a lesser effect on MDA-5 mediated action.The full-length genome sequence including non-coding regions of a South American ZIKV isolate from a patient with classical symptoms will support efforts to develop genetic tools for this virus. Detection of sfRNA that counteracts interferon responses is likely to be important for further understanding of pathogenesis and virus-host interactions.

  10. Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.

    Science.gov (United States)

    Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli

    2012-01-01

    RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.

  11. Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.

    Directory of Open Access Journals (Sweden)

    Sara Kangaspeska

    Full Text Available RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60% of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.

  12. RNA shotgun metagenomic sequencing of northern California (USA mosquitoes uncovers viruses, bacteria, and fungi

    Directory of Open Access Journals (Sweden)

    James Angus eChandler

    2015-03-01

    Full Text Available Mosquitoes, most often recognized for the microbial agents of disease they may carry, harbor diverse microbial communities that include viruses, bacteria, and fungi, collectively called the microbiota. The composition of the microbiota can directly and indirectly affect disease transmission through microbial interactions that could be revealed by its characterization in natural populations of mosquitoes. Furthermore, the use of shotgun metagenomic sequencing (SMS approaches could allow the discovery of unknown members of the microbiota. In this study, we use RNA SMS to characterize the microbiota of seven individual mosquitoes (species include Culex pipiens, Culiseta incidens, and Ochlerotatus sierrensis collected from a variety of habitats in California, USA. Sequencing was performed on the Illumina HiSeq platform and the resulting sequences were quality-checked and assembled into contigs using the A5 pipeline. Sequences related to single stranded RNA viruses of the Bunyaviridae and Rhabdoviridae were uncovered, along with an unclassified genus of double-stranded RNA viruses. Phylogenetic analysis finds that in all three cases, the closest relatives of the identified viral sequences are other mosquito-associated viruses, suggesting widespread host-group specificity among disparate viral taxa. Interestingly, we identified a Narnavirus of fungi, also reported elsewhere in mosquitoes, that potentially demonstrates a nested host-parasite association between virus, fungi, and mosquito. Sequences related to 8 bacterial families and 13 fungal families were found across the seven samples. Bacillus and Escherichia/Shigella were identified in all samples and Wolbachia was identified in all Cx. pipiens samples, while no single fungal genus was found in more than two samples. This study exemplifies the utility of RNA SMS in the characterization of the natural microbiota of mosquitoes and, in particular, the value of identifying all microbes associated with

  13. Novel approaches for bioinformatic analysis of salivary RNA sequencing data for development.

    Science.gov (United States)

    Kaczor-Urbanowicz, Karolina Elzbieta; Kim, Yong; Li, Feng; Galeev, Timur; Kitchen, Rob R; Gerstein, Mark; Koyano, Kikuye; Jeong, Sung-Hee; Wang, Xiaoyan; Elashoff, David; Kang, So Young; Kim, Su Mi; Kim, Kyoung; Kim, Sung; Chia, David; Xiao, Xinshu; Rozowsky, Joel; Wong, David T W

    2018-01-01

    Analysis of RNA sequencing (RNA-Seq) data in human saliva is challenging. Lack of standardization and unification of the bioinformatic procedures undermines saliva's diagnostic potential. Thus, it motivated us to perform this study. We applied principal pipelines for bioinformatic analysis of small RNA-Seq data of saliva of 98 healthy Korean volunteers including either direct or indirect mapping of the reads to the human genome using Bowtie1. Analysis of alignments to exogenous genomes by another pipeline revealed that almost all of the reads map to bacterial genomes. Thus, salivary exRNA has fundamental properties that warrant the design of unique additional steps while performing the bioinformatic analysis. Our pipelines can serve as potential guidelines for processing of RNA-Seq data of human saliva. Processing and analysis results of the experimental data generated by the exceRpt (v4.6.3) small RNA-seq pipeline (github.gersteinlab.org/exceRpt) are available from exRNA atlas (exrna-atlas.org). Alignment to exogenous genomes and their quantification results were used in this paper for the analyses of small RNAs of exogenous origin. dtww@ucla.edu. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  14. Accounting for technical noise in differential expression analysis of single-cell RNA sequencing data.

    Science.gov (United States)

    Jia, Cheng; Hu, Yu; Kelly, Derek; Kim, Junhyong; Li, Mingyao; Zhang, Nancy R

    2017-11-02

    Recent technological breakthroughs have made it possible to measure RNA expression at the single-cell level, thus paving the way for exploring expression heterogeneity among individual cells. Current single-cell RNA sequencing (scRNA-seq) protocols are complex and introduce technical biases that vary across cells, which can bias downstream analysis without proper adjustment. To account for cell-to-cell technical differences, we propose a statistical framework, TASC (Toolkit for Analysis of Single Cell RNA-seq), an empirical Bayes approach to reliably model the cell-specific dropout rates and amplification bias by use of external RNA spike-ins. TASC incorporates the technical parameters, which reflect cell-to-cell batch effects, into a hierarchical mixture model to estimate the biological variance of a gene and detect differentially expressed genes. More importantly, TASC is able to adjust for covariates to further eliminate confounding that may originate from cell size and cell cycle differences. In simulation and real scRNA-seq data, TASC achieves accurate Type I error control and displays competitive sensitivity and improved robustness to batch effects in differential expression analysis, compared to existing methods. TASC is programmed to be computationally efficient, taking advantage of multi-threaded parallelization. We believe that TASC will provide a robust platform for researchers to leverage the power of scRNA-seq. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Deep Sequence Analysis of AgoshRNA Processing Reveals 3' A Addition and Trimming.

    Science.gov (United States)

    Harwig, Alex; Herrera-Carrillo, Elena; Jongejan, Aldo; van Kampen, Antonius Hubertus; Berkhout, Ben

    2015-07-14

    The RNA interference (RNAi) pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA), was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2) slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA) molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp). This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3' strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3' tail of 1-3 A-nucleotides (nt) and we present evidence that this product is subsequently trimmed by the poly(A)-specific ribonuclease (PARN).

  16. Deep sequencing of small RNA libraries from human prostate epithelial and stromal cells reveal distinct pattern of microRNAs primarily predicted to target growth factors.

    Science.gov (United States)

    Singh, Savita; Zheng, Yun; Jagadeeswaran, Guru; Ebron, Jey Sabith; Sikand, Kavleen; Gupta, Sanjay; Sunker, Ramanjulu; Shukla, Girish C

    2016-02-28

    Complex epithelial and stromal cell interactions are required during the development and progression of prostate cancer. Regulatory small non-coding microRNAs (miRNAs) participate in the spatiotemporal regulation of messenger RNA (mRNA) and regulation of translation affecting a large number of genes involved in prostate carcinogenesis. In this study, through deep-sequencing of size fractionated small RNA libraries we profiled the miRNAs of prostate epithelial (PrEC) and stromal (PrSC) cells. Over 50 million reads were obtained for PrEC in which 860,468 were unique sequences. Similarly, nearly 76 million reads for PrSC were obtained in which over 1 million were unique reads. Expression of many miRNAs of broadly conserved and poorly conserved miRNA families were identified. Sixteen highly expressed miRNAs with significant change in expression in PrSC than PrEC were further analyzed in silico. ConsensusPathDB showed the target genes of these miRNAs were significantly involved in adherence junction, cell adhesion, EGRF, TGF-β and androgen signaling. Let-7 family of tumor-suppressor miRNAs expression was highly pervasive in both, PrEC and PrSC cells. In addition, we have also identified several miRNAs that are unique to PrEC or PrSC cells and their predicted putative targets are a group of transcription factors. This study provides perspective on the miRNA expression in PrEC and PrSC, and reveals a global trend in miRNA interactome. We conclude that the most abundant miRNAs are potential regulators of development and differentiation of the prostate gland by targeting a set of growth factors. Additionally, high level expression of the most members of let-7 family miRNAs suggests their role in the fine tuning of the growth and proliferation of prostate epithelial and stromal cells. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  17. Segundos mensajeros Second messengers

    Directory of Open Access Journals (Sweden)

    Diana Patricia Díaz Hernández

    1989-01-01

    Full Text Available

    En esta revisión se describen, de manera esquemática, los mecanismos de acción empleados por los SEGUNDOS MENSAJEROS comenzando por el estimulo del receptor y continuando con las reacciones en cadena que conducen finalmente a una respuesta celular.

    This review schematically describes the different mechanisms of action that Second Messengers employ to stimulate receptors and then Initiate a chain of reactions that finally lead to appropriate cellular responses.

  18. How to Tackle the Challenge of siRNA Delivery with Sequence-Defined Oligoamino Amides.

    Science.gov (United States)

    Reinhard, Sören; Wagner, Ernst

    2017-01-01

    RNA interference (RNAi) as a mechanism of gene regulation provides exciting opportunities for medical applications. Synthetic small interfering RNA (siRNA) triggers the knockdown of complementary mRNA sequences in a catalytic fashion and has to be delivered into the cytosol of the targeted cells. The design of adequate carrier systems to overcome multiple extracellular and intracellular roadblocks within the delivery process has utmost importance. Cationic polymers form polyplexes through electrostatic interaction with negatively charged nucleic acids and present a promising class of carriers. Issues of polycations regarding toxicity, heterogeneity, and polydispersity can be overcome by solid-phase-assisted synthesis of sequence-defined cationic oligomers. These medium-sized highly versatile nucleic acid carriers display low cytotoxicity and can be modified and tailored in multiple ways to meet specific requirements of nucleic acid binding, polyplex size, shielding, targeting, and intracellular release of the cargo. In this way, sequence-defined cationic oligomers can mimic the dynamic and bioresponsive behavior of viruses. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Calling genotypes from public RNA-sequencing data enables identification of genetic variants that affect gene-expression levels

    NARCIS (Netherlands)

    Deelen, Patrick; Zhernakova, Daria V.; de Haan, Mark; van der Sijde, Marijke; Bonder, Marc Jan; Karjalainen, Juha; van der Velde, K. Joeri; Abbott, Kristin M.; Fu, Jingyuan; Wijmenga, Cisca; Sinke, Richard J.; Swertz, Morris A.; Franke, Lude

    2015-01-01

    Background: RNA-sequencing (RNA-seq) is a powerful technique for the identification of genetic variants that affect gene-expression levels, either through expression quantitative trait locus (eQTL) mapping or through allele-specific expression (ASE) analysis. Given increasing numbers of RNA-seq

  20. Single-cell mRNA cytometry via sequence-specific nanoparticle clustering and trapping

    Science.gov (United States)

    Labib, Mahmoud; Mohamadi, Reza M.; Poudineh, Mahla; Ahmed, Sharif U.; Ivanov, Ivaylo; Huang, Ching-Lung; Moosavi, Maral; Sargent, Edward H.; Kelley, Shana O.

    2018-05-01

    Cell-to-cell variation in gene expression creates a need for techniques that can characterize expression at the level of individual cells. This is particularly true for rare circulating tumour cells, in which subtyping and drug resistance are of intense interest. Here we describe a method for cell analysis—single-cell mRNA cytometry—that enables the isolation of rare cells from whole blood as a function of target mRNA sequences. This approach uses two classes of magnetic particles that are labelled to selectively hybridize with different regions of the target mRNA. Hybridization leads to the formation of large magnetic clusters that remain localized within the cells of interest, thereby enabling the cells to be magnetically separated. Targeting specific intracellular mRNAs enablescirculating tumour cells to be distinguished from normal haematopoietic cells. No polymerase chain reaction amplification is required to determine RNA expression levels and genotype at the single-cell level, and minimal cell manipulation is required. To demonstrate this approach we use single-cell mRNA cytometry to detect clinically important sequences in prostate cancer specimens.

  1. GLASSgo – Automated and Reliable Detection of sRNA Homologs From a Single Input Sequence

    Directory of Open Access Journals (Sweden)

    Steffen C. Lott

    2018-04-01

    Full Text Available Bacterial small RNAs (sRNAs are important post-transcriptional regulators of gene expression. The functional and evolutionary characterization of sRNAs requires the identification of homologs, which is frequently challenging due to their heterogeneity, short length and partly, little sequence conservation. We developed the GLobal Automatic Small RNA Search go (GLASSgo algorithm to identify sRNA homologs in complex genomic databases starting from a single sequence. GLASSgo combines an iterative BLAST strategy with pairwise identity filtering and a graph-based clustering method that utilizes RNA secondary structure information. We tested the specificity, sensitivity and runtime of GLASSgo, BLAST and the combination RNAlien/cmsearch in a typical use case scenario on 40 bacterial sRNA families. The sensitivity of the tested methods was similar, while the specificity of GLASSgo and RNAlien/cmsearch was significantly higher than that of BLAST. GLASSgo was on average ∼87 times faster than RNAlien/cmsearch, and only ∼7.5 times slower than BLAST, which shows that GLASSgo optimizes the trade-off between speed and accuracy in the task of finding sRNA homologs. GLASSgo is fully automated, whereas BLAST often recovers only parts of homologs and RNAlien/cmsearch requires extensive additional bioinformatic work to get a comprehensive set of homologs. GLASSgo is available as an easy-to-use web server to find homologous sRNAs in large databases.

  2. MicroRNA of the fifth-instar posterior silk gland of silkworm identified by Solexa sequencing

    Directory of Open Access Journals (Sweden)

    Jisheng Li

    2014-12-01

    Full Text Available No special studies have been focused on the microRNA (miRNA in the fifth-instar posterior silk gland of Bombyx mori. Here, using next-generation sequencing, we acquired 93.2 million processed reads from 10 small RNA libraries. In this paper, we tried to thoroughly describe how our dataset generated from deep sequencing which was recently published in BMC genomics. Results showed that our findings are largely enriched silkworm miRNA depository and may benefit us to reveal the miRNA functions in the process of silk production.

  3. Non-codingRNA sequence variations in human chronic lymphocytic leukemia and colorectal cancer.

    Science.gov (United States)

    Wojcik, Sylwia E; Rossi, Simona; Shimizu, Masayoshi; Nicoloso, Milena S; Cimmino, Amelia; Alder, Hansjuerg; Herlea, Vlad; Rassenti, Laura Z; Rai, Kanti R; Kipps, Thomas J; Keating, Michael J; Croce, Carlo M; Calin, George A

    2010-02-01

    Cancer is a genetic disease in which the interplay between alterations in protein-coding genes and non-coding RNAs (ncRNAs) plays a fundamental role. In recent years, the full coding component of the human genome was sequenced in various cancers, whereas such attempts related to ncRNAs are still fragmentary. We screened genomic DNAs for sequence variations in 148 microRNAs (miRNAs) and ultraconserved regions (UCRs) loci in patients with chronic lymphocytic leukemia (CLL) or colorectal cancer (CRC) by Sanger technique and further tried to elucidate the functional consequences of some of these variations. We found sequence variations in miRNAs in both sporadic and familial CLL cases, mutations of UCRs in CLLs and CRCs and, in certain instances, detected functional effects of these variations. Furthermore, by integrating our data with previously published data on miRNA sequence variations, we have created a catalog of DNA sequence variations in miRNAs/ultraconserved genes in human cancers. These findings argue that ncRNAs are targeted by both germ line and somatic mutations as well as by single-nucleotide polymorphisms with functional significance for human tumorigenesis. Sequence variations in ncRNA loci are frequent and some have functional and biological significance. Such information can be exploited to further investigate on a genome-wide scale the frequency of genetic variations in ncRNAs and their functional meaning, as well as for the development of new diagnostic and prognostic markers for leukemias and carcinomas.

  4. On the optimal trimming of high-throughput mRNA sequence data

    Directory of Open Access Journals (Sweden)

    Matthew D MacManes

    2014-01-01

    Full Text Available The widespread and rapid adoption of high-throughput sequencing technologies has afforded researchers the opportunity to gain a deep understanding of genome level processes that underlie evolutionary change, and perhaps more importantly, the links between genotype and phenotype. In particular, researchers interested in functional biology and adaptation have used these technologies to sequence mRNA transcriptomes of specific tissues, which in turn are often compared to other tissues, or other individuals with different phenotypes. While these techniques are extremely powerful, careful attention to data quality is required. In particular, because high-throughput sequencing is more error-prone than traditional Sanger sequencing, quality trimming of sequence reads should be an important step in all data processing pipelines. While several software packages for quality trimming exist, no general guidelines for the specifics of trimming have been developed. Here, using empirically derived sequence data, I provide general recommendations regarding the optimal strength of trimming, specifically in mRNA-Seq studies. Although very aggressive quality trimming is common, this study suggests that a more gentle trimming, specifically of those nucleotides whose Phred score < 2 or < 5, is optimal for most studies across a wide variety of metrics.

  5. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    Science.gov (United States)

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  6. Enhancing potency of siRNA targeting fusion genes by optimization outside of target sequence.

    Science.gov (United States)

    Gavrilov, Kseniya; Seo, Young-Eun; Tietjen, Gregory T; Cui, Jiajia; Cheng, Christopher J; Saltzman, W Mark

    2015-12-01

    Canonical siRNA design algorithms have become remarkably effective at predicting favorable binding regions within a target mRNA, but in some cases (e.g., a fusion junction site) region choice is restricted. In these instances, alternative approaches are necessary to obtain a highly potent silencing molecule. Here we focus on strategies for rational optimization of two siRNAs that target the junction sites of fusion oncogenes BCR-ABL and TMPRSS2-ERG. We demonstrate that modifying the termini of these siRNAs with a terminal G-U wobble pair or a carefully selected pair of terminal asymmetry-enhancing mismatches can result in an increase in potency at low doses. Importantly, we observed that improvements in silencing at the mRNA level do not necessarily translate to reductions in protein level and/or cell death. Decline in protein level is also heavily influenced by targeted protein half-life, and delivery vehicle toxicity can confound measures of cell death due to silencing. Therefore, for BCR-ABL, which has a long protein half-life that is difficult to overcome using siRNA, we also developed a nontoxic transfection vector: poly(lactic-coglycolic acid) nanoparticles that release siRNA over many days. We show that this system can achieve effective killing of leukemic cells. These findings provide insights into the implications of siRNA sequence for potency and suggest strategies for the design of more effective therapeutic siRNA molecules. Furthermore, this work points to the importance of integrating studies of siRNA design and delivery, while heeding and addressing potential limitations such as restricted targetable mRNA regions, long protein half-lives, and nonspecific toxicities.

  7. A novel RNA sequencing data analysis method for cell line authentication.

    Directory of Open Access Journals (Sweden)

    Erik Fasterius

    Full Text Available We have developed a novel analysis method that can interrogate the authenticity of biological samples used for generation of transcriptome profiles in public data repositories. The method uses RNA sequencing information to reveal mutations in expressed transcripts and subsequently confirms the identity of analysed cells by comparison with publicly available cell-specific mutational profiles. Cell lines constitute key model systems widely used within cancer research, but their identity needs to be confirmed in order to minimise the influence of cell contaminations and genetic drift on the analysis. Using both public and novel data, we demonstrate the use of RNA-sequencing data analysis for cell line authentication by examining the validity of COLO205, DLD1, HCT15, HCT116, HKE3, HT29 and RKO colorectal cancer cell lines. We successfully authenticate the studied cell lines and validate previous reports indicating that DLD1 and HCT15 are synonymous. We also show that the analysed HKE3 cells harbour an unexpected KRAS-G13D mutation and confirm that this cell line is a genuine KRAS dosage mutant, rather than a true isogenic derivative of HCT116 expressing only the wild type KRAS. This authentication method could be used to revisit the numerous cell line based RNA sequencing experiments available in public data repositories, analyse new experiments where whole genome sequencing is not available, as well as facilitate comparisons of data from different experiments, platforms and laboratories.

  8. Effect of chronic uremia on the transcriptional profile of the calcified aorta analyzed by RNA sequencing

    DEFF Research Database (Denmark)

    Rukov, Jakob Lewin; Gravesen, Eva; Mace, Maria L.

    2016-01-01

    The development of vascular calcification (VC) in chronic uremia (CU) is a tightly regulated process controlled by factors promoting and inhibiting mineralization. Next-generation high-throughput RNA sequencing (RNA-seq) is a powerful and sensitive tool for quantitative gene expression profiling...... with an expression level of >1 reads/kilobase transcript/million mapped reads, 2,663 genes were differentially expressed with 47% upregulated genes and 53% downregulated genes in uremic rats. Significantly deregulated genes were enriched for ontologies related to the extracellular matrix, response to wounding...

  9. Vitellogenin messenger rna in rooster liver

    NARCIS (Netherlands)

    Bos, Ebo Sijbren

    1975-01-01

    The investigations described in this thesis were carried out as a part of the studies in our laboratory on the control of gene expression in animal cells. They represent an example of the hormonal regulation of protein synthesis, viz. the induction of vitellogenin synthesis in rooster liver by the

  10. Sequence-based heuristics for faster annotation of non-coding RNA families.

    Science.gov (United States)

    Weinberg, Zasha; Ruzzo, Walter L

    2006-01-01

    Non-coding RNAs (ncRNAs) are functional RNA molecules that do not code for proteins. Covariance Models (CMs) are a useful statistical tool to find new members of an ncRNA gene family in a large genome database, using both sequence and, importantly, RNA secondary structure information. Unfortunately, CM searches are extremely slow. Previously, we created rigorous filters, which provably sacrifice none of a CM's accuracy, while making searches significantly faster for virtually all ncRNA families. However, these rigorous filters make searches slower than heuristics could be. In this paper we introduce profile HMM-based heuristic filters. We show that their accuracy is usually superior to heuristics based on BLAST. Moreover, we compared our heuristics with those used in tRNAscan-SE, whose heuristics incorporate a significant amount of work specific to tRNAs, where our heuristics are generic to any ncRNA. Performance was roughly comparable, so we expect that our heuristics provide a high-quality solution that--unlike family-specific solutions--can scale to hundreds of ncRNA families. The source code is available under GNU Public License at the supplementary web site.

  11. visnormsc: A Graphical User Interface to Normalize Single-cell RNA Sequencing Data.

    Science.gov (United States)

    Tang, Lijun; Zhou, Nan

    2017-12-26

    Single-cell RNA sequencing (RNA-seq) allows the analysis of gene expression with high resolution. The intrinsic defects of this promising technology imports technical noise into the single-cell RNA-seq data, increasing the difficulty of accurate downstream inference. Normalization is a crucial step in single-cell RNA-seq data pre-processing. SCnorm is an accurate and efficient method that can be used for this purpose. An R implementation of this method is currently available. On one hand, the R package possesses many excellent features from R. On the other hand, R programming ability is required, which prevents the biologists who lack the skills from learning to use it quickly. To make this method more user-friendly, we developed a graphical user interface, visnormsc, for normalization of single-cell RNA-seq data. It is implemented in Python and is freely available at https://github.com/solo7773/visnormsc . Although visnormsc is based on the existing method, it contributes to this field by offering a user-friendly alternative. The out-of-the-box and cross-platform features make visnormsc easy to learn and to use. It is expected to serve biologists by simplifying single-cell RNA-seq normalization.

  12. Determining RNA quality for NextGen sequencing: some exceptions to the gold standard rule of 23S to 16S rRNA ratio

    Science.gov (United States)

    Using next-generation-sequencing technology to assess entire transcriptomes requires high quality starting RNA. Currently, RNA quality is routinely judged using automated microfluidic gel electrophoresis platforms and associated algorithms. Here we report that such automated methods generate false-n...

  13. The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

    Science.gov (United States)

    Hammond, R W; Crosslin, J M

    1995-04-01

    The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

  14. Inhibition of hepatitis B virus replication with linear DNA sequences expressing antiviral micro-RNA shuttles

    International Nuclear Information System (INIS)

    Chattopadhyay, Saket; Ely, Abdullah; Bloom, Kristie; Weinberg, Marc S.; Arbuthnot, Patrick

    2009-01-01

    RNA interference (RNAi) may be harnessed to inhibit viral gene expression and this approach is being developed to counter chronic infection with hepatitis B virus (HBV). Compared to synthetic RNAi activators, DNA expression cassettes that generate silencing sequences have advantages of sustained efficacy and ease of propagation in plasmid DNA (pDNA). However, the large size of pDNAs and inclusion of sequences conferring antibiotic resistance and immunostimulation limit delivery efficiency and safety. To develop use of alternative DNA templates that may be applied for therapeutic gene silencing, we assessed the usefulness of PCR-generated linear expression cassettes that produce anti-HBV micro-RNA (miR) shuttles. We found that silencing of HBV markers of replication was efficient (>75%) in cell culture and in vivo. miR shuttles were processed to form anti-HBV guide strands and there was no evidence of induction of the interferon response. Modification of terminal sequences to include flanking human adenoviral type-5 inverted terminal repeats was easily achieved and did not compromise silencing efficacy. These linear DNA sequences should have utility in the development of gene silencing applications where modifications of terminal elements with elimination of potentially harmful and non-essential sequences are required.

  15. Inhibition of hepatitis B virus replication with linear DNA sequences expressing antiviral micro-RNA shuttles

    Energy Technology Data Exchange (ETDEWEB)

    Chattopadhyay, Saket; Ely, Abdullah; Bloom, Kristie; Weinberg, Marc S. [Antiviral Gene Therapy Research Unit, University of the Witwatersrand (South Africa); Arbuthnot, Patrick, E-mail: Patrick.Arbuthnot@wits.ac.za [Antiviral Gene Therapy Research Unit, University of the Witwatersrand (South Africa)

    2009-11-20

    RNA interference (RNAi) may be harnessed to inhibit viral gene expression and this approach is being developed to counter chronic infection with hepatitis B virus (HBV). Compared to synthetic RNAi activators, DNA expression cassettes that generate silencing sequences have advantages of sustained efficacy and ease of propagation in plasmid DNA (pDNA). However, the large size of pDNAs and inclusion of sequences conferring antibiotic resistance and immunostimulation limit delivery efficiency and safety. To develop use of alternative DNA templates that may be applied for therapeutic gene silencing, we assessed the usefulness of PCR-generated linear expression cassettes that produce anti-HBV micro-RNA (miR) shuttles. We found that silencing of HBV markers of replication was efficient (>75%) in cell culture and in vivo. miR shuttles were processed to form anti-HBV guide strands and there was no evidence of induction of the interferon response. Modification of terminal sequences to include flanking human adenoviral type-5 inverted terminal repeats was easily achieved and did not compromise silencing efficacy. These linear DNA sequences should have utility in the development of gene silencing applications where modifications of terminal elements with elimination of potentially harmful and non-essential sequences are required.

  16. Single-cell RNA sequencing reveals metallothionein heterogeneity during hESC differentiation to definitive endoderm

    Directory of Open Access Journals (Sweden)

    Junjie Lu

    2018-04-01

    Full Text Available Differentiation of human pluripotent stem cells towards definitive endoderm (DE is the critical first step for generating cells comprising organs such as the gut, liver, pancreas and lung. This in-vitro differentiation process generates a heterogeneous population with a proportion of cells failing to differentiate properly and maintaining expression of pluripotency factors such as Oct4. RNA sequencing of single cells collected at four time points during a 4-day DE differentiation identified high expression of metallothionein genes in the residual Oct4-positive cells that failed to differentiate to DE. Using X-ray fluorescence microscopy and multi-isotope mass spectrometry, we discovered that high intracellular zinc level corresponds with persistent Oct4 expression and failure to differentiate. This study improves our understanding of the cellular heterogeneity during in-vitro directed differentiation and provides a valuable resource to improve DE differentiation efficiency. Keywords: hPSC, Differentiation, Definitive endoderm, Heterogeneity, Single cell, RNA sequencing

  17. MicroRNA Profiling in Aqueous Humor of Individual Human Eyes by Next-Generation Sequencing.

    Science.gov (United States)

    Wecker, Thomas; Hoffmeier, Klaus; Plötner, Anne; Grüning, Björn Andreas; Horres, Ralf; Backofen, Rolf; Reinhard, Thomas; Schlunck, Günther

    2016-04-01

    Extracellular microRNAs (miRNAs) in aqueous humor were suggested to have a role in transcellular signaling and may serve as disease biomarkers. The authors adopted next-generation sequencing (NGS) techniques to further characterize the miRNA profile in single samples of 60 to 80 μL human aqueous humor. Samples were obtained at the outset of cataract surgery in nine independent, otherwise healthy eyes. Four samples were used to extract RNA and generate sequencing libraries, followed by an adapter-driven amplification step, electrophoretic size selection, sequencing, and data analysis. Five samples were used for quantitative PCR (qPCR) validation of NGS results. Published NGS data on circulating miRNAs in blood were analyzed in comparison. One hundred fifty-eight miRNAs were consistently detected by NGS in all four samples; an additional 59 miRNAs were present in at least three samples. The aqueous humor miRNA profile shows some overlap with published NGS-derived inventories of circulating miRNAs in blood plasma with high prevalence of human miR-451a, -21, and -16. In contrast to blood, miR-184, -4448, -30a, -29a, -29c, -19a, -30d, -205, -24, -22, and -3074 were detected among the 20 most prevalent miRNAs in aqueous humor. Relative expression patterns of miR-451a, -202, and -144 suggested by NGS were confirmed by qPCR. Our data illustrate the feasibility of miRNA analysis by NGS in small individual aqueous humor samples. Intraocular cells as well as blood plasma contribute to the extracellular aqueous humor miRNome. The data suggest possible roles of miRNA in intraocular cell adhesion and signaling by TGF-β and Wnt, which are important in intraocular pressure regulation and glaucoma.

  18. Quantifying alternative splicing from paired-end RNA-sequencing data

    OpenAIRE

    Rossell, David; Stephan-Otto Attolini, Camille; Kroiss, Manuel; Stöcker, Almond

    2014-01-01

    RNA-sequencing has revolutionized biomedical research and, in particular, our ability to study gene alternative splicing. The problem has important implications for human health, as alternative splicing may be involved in malfunctions at the cellular level and multiple diseases. However, the high-dimensional nature of the data and the existence of experimental biases pose serious data analysis challenges. We find that the standard data summaries used to study alternative splicing are severely...

  19. Screening for sequence-specific RNA-BPs by comprehensive UV crosslinking

    Directory of Open Access Journals (Sweden)

    Le Meuth-Metzinger Valerie

    2002-06-01

    Full Text Available Abstract Background Specific cis-elements and the associated trans-acting factors have been implicated in the post-transcriptional regulation of gene expression. In the era of genome wide analyses identifying novel trans-acting factors and cis-regulatory elements is a step towards understanding coordinated gene expression. UV-crosslink analysis is a standard method used to identify RNA-binding proteins. Uridine is traditionally used to radiolabel substrate RNAs, however, proteins binding to cis-elments particularly uridine poor will be weakly or not detected. We evaluate here the possibility of using UV-crosslinking with RNA substrates radiolabeled with each of the four ribonucleotides as an approach for screening for novel sequence specific RNA-binding proteins. Results The radiolabeled RNA substrates were derived from the 3'UTRs of the cloned Eg and c-mos Xenopus laevis maternal mRNAs. Specific, but not identical, uv-crosslinking signals were obtained, some of which corresponded to already identified proteins. A signal for a novel 90 kDa protein was observed with the c-mos 3'UTR radiolabeled with both CTP and GTP but not with UTP. The binding site of the 90 kDa RNA-binding protein was localised to a 59-nucleotide portion of the c-mos 3'UTR. Conclusion That the 90 kDa signal was detected with RNAs radiolabeled with CTP or GTP but not UTP illustrates the advantage of radiolabeling all four nucleotides in a UV-crosslink based screen. This method can be used for both long and short RNAs and does not require knowledge of the cis-acting sequence. It should be amenable to high throughput screening for RNA binding proteins.

  20. RNA-Mediated Gene Duplication and Retroposons: Retrogenes, LINEs, SINEs, and Sequence Specificity

    Science.gov (United States)

    2013-01-01

    A substantial number of “retrogenes” that are derived from the mRNA of various intron-containing genes have been reported. A class of mammalian retroposons, long interspersed element-1 (LINE1, L1), has been shown to be involved in the reverse transcription of retrogenes (or processed pseudogenes) and non-autonomous short interspersed elements (SINEs). The 3′-end sequences of various SINEs originated from a corresponding LINE. As the 3′-untranslated regions of several LINEs are essential for retroposition, these LINEs presumably require “stringent” recognition of the 3′-end sequence of the RNA template. However, the 3′-ends of mammalian L1s do not exhibit any similarity to SINEs, except for the presence of 3′-poly(A) repeats. Since the 3′-poly(A) repeats of L1 and Alu SINE are critical for their retroposition, L1 probably recognizes the poly(A) repeats, thereby mobilizing not only Alu SINE but also cytosolic mRNA. Many flowering plants only harbor L1-clade LINEs and a significant number of SINEs with poly(A) repeats, but no homology to the LINEs. Moreover, processed pseudogenes have also been found in flowering plants. I propose that the ancestral L1-clade LINE in the common ancestor of green plants may have recognized a specific RNA template, with stringent recognition then becoming relaxed during the course of plant evolution. PMID:23984183

  1. Complete nucleotide sequence of the RNA-2 of grapevine deformation and Grapevine Anatolian ringspot viruses.

    Science.gov (United States)

    Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P

    2005-05-01

    The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.

  2. Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing.

    Science.gov (United States)

    Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li

    2010-08-01

    Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resolution and sensitivity afforded by RNA-Seq, we were able to identify a substantial number of novel transcripts, new exons, untranslated regions, alternative upstream initiation codons and upstream open reading frames, which provide remarkable insight into the A. oryzae transcriptome. We were also able to assess the alternative mRNA isoforms in A. oryzae and found a large number of genes undergoing alternative splicing. Many genes and pathways that might be involved in higher levels of protein production in solid-state culture than in liquid culture were identified by comparing gene expression levels between different cultures. Our analysis indicated that the transcriptome of A. oryzae is much more complex than previously anticipated, and these results may provide a blueprint for further study of the A. oryzae transcriptome.

  3. MESSENGER'S First Flyby of Mercury

    Science.gov (United States)

    Slavin, James A.

    2008-01-01

    The MESSENGER mission to Mercury offers our first opportunity to explore this planet's miniature magnetosphere since Mariner 10's brief fly-bys in 1974-5. The magnetosphere of Mercury is the smallest in the solar system with its magnetic field typically standing off the solar wind only - 1000 to 2000 km above the surface. An overview of the MESSENGER mission and its January 14th close flyby of Mercury will be provided. Primary science objectives and the science instrumentation will be described. Initial results from MESSENGER'S first flyby on January 14th, 2008 will be discussed with an emphasis on the magnetic field and charged particle measurements.

  4. MESSENGER at Mercury: Early Orbital Operations

    Science.gov (United States)

    McNutt, Ralph L., Jr; Solomon, Sean C.; Bedini, Peter D.; Anderson, Brian J.; Blewett, David T.; Evans, Larry G.; Gold, Robert E.; Krimigis, Stamatios M.; Murchie, Scott L.; Nittler, Larry R.; hide

    2013-01-01

    angles. Targeted areas have been selected for spectral coverage into the ultraviolet with the Ultraviolet and Visible Spectrometer (UVVS). MESSENGER's Mercury Laser Altimeter is acquiring topographic profiles when the slant range to Mercury's surface is less than 1800 km, encompassing latitudes from 20 deg. S to the north pole. Topography over the remainder of the southern hemisphere will be derived from stereo imaging, radio occultations, and limb profiles. MESSENGER's radio science experiment is determining Mercury's gravity field from Doppler signals acquired during frequent downlinks. MESSENGER's Magnetometer is measuring the vector magnetic field both within Mercury's magnetosphere and in Mercury's solar wind environment at an instrument sampling rate of up to 20 samples/s. The UVVS is determining the three-dimensional, time-dependent distribution of Mercury's exospheric neutral and ionic species via their emission lines. During each spacecraft orbit, the Energetic Particle Spectrometer measures energetic electrons and ions, and the Fast Imaging Plasma Spectrometer measures the energies and mass per charge of thermal plasma components, both within Mercury's magnetosphere and in Mercury's solar-wind environment. The primary mission observation sequence will continue for one Earth year, until March 2012. An extended mission, currently under discussion with NASA, would add a second year of orbital observations targeting a set of focused follow-on questions that build on observations to date and take advantage of the more active Sun expected during 2012-2013. MESSENGER's total primary mission cost, projected at $446 M in real-year dollars, is comparable to that of Mariner 10 after adjustment for inflation.

  5. Rtools: a web server for various secondary structural analyses on single RNA sequences.

    Science.gov (United States)

    Hamada, Michiaki; Ono, Yukiteru; Kiryu, Hisanori; Sato, Kengo; Kato, Yuki; Fukunaga, Tsukasa; Mori, Ryota; Asai, Kiyoshi

    2016-07-08

    The secondary structures, as well as the nucleotide sequences, are the important features of RNA molecules to characterize their functions. According to the thermodynamic model, however, the probability of any secondary structure is very small. As a consequence, any tool to predict the secondary structures of RNAs has limited accuracy. On the other hand, there are a few tools to compensate the imperfect predictions by calculating and visualizing the secondary structural information from RNA sequences. It is desirable to obtain the rich information from those tools through a friendly interface. We implemented a web server of the tools to predict secondary structures and to calculate various structural features based on the energy models of secondary structures. By just giving an RNA sequence to the web server, the user can get the different types of solutions of the secondary structures, the marginal probabilities such as base-paring probabilities, loop probabilities and accessibilities of the local bases, the energy changes by arbitrary base mutations as well as the measures for validations of the predicted secondary structures. The web server is available at http://rtools.cbrc.jp, which integrates software tools, CentroidFold, CentroidHomfold, IPKnot, CapR, Raccess, Rchange and RintD. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. CoverageAnalyzer (CAn: A Tool for Inspection of Modification Signatures in RNA Sequencing Profiles

    Directory of Open Access Journals (Sweden)

    Ralf Hauenschild

    2016-11-01

    Full Text Available Combination of reverse transcription (RT and deep sequencing has emerged as a powerful instrument for the detection of RNA modifications, a field that has seen a recent surge in activity because of its importance in gene regulation. Recent studies yielded high-resolution RT signatures of modified ribonucleotides relying on both sequence-dependent mismatch patterns and reverse transcription arrests. Common alignment viewers lack specialized functionality, such as filtering, tailored visualization, image export and differential analysis. Consequently, the community will profit from a platform seamlessly connecting detailed visual inspection of RT signatures and automated screening for modification candidates. CoverageAnalyzer (CAn was developed in response to the demand for a powerful inspection tool. It is freely available for all three main operating systems. With SAM file format as standard input, CAn is an intuitive and user-friendly tool that is generally applicable to the large community of biomedical users, starting from simple visualization of RNA sequencing (RNA-Seq data, up to sophisticated modification analysis with significance-based modification candidate calling.

  7. Extensive 16S rRNA gene sequence diversity in Campylobacter hyointestinalis strains: taxonomic and applied implications

    DEFF Research Database (Denmark)

    Harrington, C.S.; On, Stephen L.W.

    1999-01-01

    Phylogenetic relationships of Campylobacter hyointestinalis subspecies were examined by means of 16S rRNA gene sequencing. Sequence similarities among C. hyointestinalis subsp. lawsonii strains exceeded 99.0 %, but values among C. hyointestinalis subsp. hyointestinalis strains ranged from 96...... of the genus Campylobacter, emphasizing the need for multiple strain analysis when using 16S rRNA gene sequence comparisons for taxonomic investigations........4 to 100 %. Sequence similarites between strains representing the two different subspecies ranged from 95.7 to 99.0 %. An intervening sequence was identified in certain of the C. hyointestinalis subsp. lawsonii strains. C. hyointestinalis strains occupied two distinct branches in a phylogenetic analysis...

  8. Genetic divergence of Asiatic Bdellocephala (Turbellaria, Tricladida, Paludicola) as revealed by partial 18S rRNA gene sequence comparisons.

    Science.gov (United States)

    Kuznedelov, K D; Timoshkin, O A; Goldman, E

    1997-01-01

    Polymerase chain reaction (PCR) and direct sequencing of small ribosomal RNA genes were used for analysis of genetic differences among Asiatic species of freshwater triclad genus Bdellocephala. Representatives of four species and four subspecies of this genus were used to establish homology between nucleotides in the 5'-end portion of small ribosomal RNA gene sequences. Within 552 nucleotide sites of aligned sequences compared, six variable base positions were discovered, dividing Bdellocephala into five different genotypes. Sequence data allow to distinguish two groups of these genotypes. One of them unites species from Kamchatka and Japan, another one unites Baikalian taxa. Agreement between available morphological, cytological and sequence data is discussed.

  9. MicroRNA and piRNA profiles in normal human testis detected by next generation sequencing.

    Directory of Open Access Journals (Sweden)

    Qingling Yang

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are the class of small endogenous RNAs that play an important regulatory role in cells by negatively affecting gene expression at transcriptional and post-transcriptional levels. There have been extensive studies aiming to discover miRNAs and to analyze their functions in the cells from a variety of species. However, there are no published studies of miRNA profiles in human testis using next generation sequencing (NGS technology. RESULTS: We employed Solexa sequencing technology to profile miRNAs in normal human testis. Total 770 known and 5 novel human miRNAs, and 20121 piRNAs were detected, indicating that the human testis has a complex population of small RNAs. The expression of 15 known and 5 novel detected miRNAs was validated by qRT-PCR. We have also predicted the potential target genes of the abundant known and novel miRNAs, and subjected them to GO and pathway analysis, revealing the involvement of miRNAs in many important biological phenomenon including meiosis and p53-related pathways that are implicated in the regulation of spermatogenesis. CONCLUSIONS: This study reports the first genome-wide miRNA profiles in human testis using a NGS approach. The presence of large number of miRNAs and the nature of their target genes suggested that miRNAs play important roles in spermatogenesis. Here we provide a useful resource for further elucidation of the regulatory role of miRNAs and piRNAs in the spermatogenesis. It may also facilitate the development of prophylactic strategies for male infertility.

  10. Identification and analysis of pig chimeric mRNAs using RNA sequencing data

    Science.gov (United States)

    2012-01-01

    Background Gene fusion is ubiquitous over the course of evolution. It is expected to increase the diversity and complexity of transcriptomes and proteomes through chimeric sequence segments or altered regulation. However, chimeric mRNAs in pigs remain unclear. Here we identified some chimeric mRNAs in pigs and analyzed the expression of them across individuals and breeds using RNA-sequencing data. Results The present study identified 669 putative chimeric mRNAs in pigs, of which 251 chimeric candidates were detected in a set of RNA-sequencing data. The 618 candidates had clear trans-splicing sites, 537 of which obeyed the canonical GU-AG splice rule. Only two putative pig chimera variants whose fusion junction was overlapped with that of a known human chimeric mRNA were found. A set of unique chimeric events were considered middle variances in the expression across individuals and breeds, and revealed non-significant variance between sexes. Furthermore, the genomic region of the 5′ partner gene shares a similar DNA sequence with that of the 3′ partner gene for 458 putative chimeric mRNAs. The 81 of those shared DNA sequences significantly matched the known DNA-binding motifs in the JASPAR CORE database. Four DNA motifs shared in parental genomic regions had significant similarity with known human CTCF binding sites. Conclusions The present study provided detailed information on some pig chimeric mRNAs. We proposed a model that trans-acting factors, such as CTCF, induced the spatial organisation of parental genes to the same transcriptional factory so that parental genes were coordinatively transcribed to give birth to chimeric mRNAs. PMID:22925561

  11. Identification and analysis of pig chimeric mRNAs using RNA sequencing data

    Directory of Open Access Journals (Sweden)

    Ma Lei

    2012-08-01

    Full Text Available Abstract Background Gene fusion is ubiquitous over the course of evolution. It is expected to increase the diversity and complexity of transcriptomes and proteomes through chimeric sequence segments or altered regulation. However, chimeric mRNAs in pigs remain unclear. Here we identified some chimeric mRNAs in pigs and analyzed the expression of them across individuals and breeds using RNA-sequencing data. Results The present study identified 669 putative chimeric mRNAs in pigs, of which 251 chimeric candidates were detected in a set of RNA-sequencing data. The 618 candidates had clear trans-splicing sites, 537 of which obeyed the canonical GU-AG splice rule. Only two putative pig chimera variants whose fusion junction was overlapped with that of a known human chimeric mRNA were found. A set of unique chimeric events were considered middle variances in the expression across individuals and breeds, and revealed non-significant variance between sexes. Furthermore, the genomic region of the 5′ partner gene shares a similar DNA sequence with that of the 3′ partner gene for 458 putative chimeric mRNAs. The 81 of those shared DNA sequences significantly matched the known DNA-binding motifs in the JASPAR CORE database. Four DNA motifs shared in parental genomic regions had significant similarity with known human CTCF binding sites. Conclusions The present study provided detailed information on some pig chimeric mRNAs. We proposed a model that trans-acting factors, such as CTCF, induced the spatial organisation of parental genes to the same transcriptional factory so that parental genes were coordinatively transcribed to give birth to chimeric mRNAs.

  12. RNA Sequencing Reveals that Kaposi Sarcoma-Associated Herpesvirus Infection Mimics Hypoxia Gene Expression Signature

    Science.gov (United States)

    Viollet, Coralie; Davis, David A.; Tekeste, Shewit S.; Reczko, Martin; Pezzella, Francesco; Ragoussis, Jiannis

    2017-01-01

    Kaposi sarcoma-associated herpesvirus (KSHV) causes several tumors and hyperproliferative disorders. Hypoxia and hypoxia-inducible factors (HIFs) activate latent and lytic KSHV genes, and several KSHV proteins increase the cellular levels of HIF. Here, we used RNA sequencing, qRT-PCR, Taqman assays, and pathway analysis to explore the miRNA and mRNA response of uninfected and KSHV-infected cells to hypoxia, to compare this with the genetic changes seen in chronic latent KSHV infection, and to explore the degree to which hypoxia and KSHV infection interact in modulating mRNA and miRNA expression. We found that the gene expression signatures for KSHV infection and hypoxia have a 34% overlap. Moreover, there were considerable similarities between the genes up-regulated by hypoxia in uninfected (SLK) and in KSHV-infected (SLKK) cells. hsa-miR-210, a HIF-target known to have pro-angiogenic and anti-apoptotic properties, was significantly up-regulated by both KSHV infection and hypoxia using Taqman assays. Interestingly, expression of KSHV-encoded miRNAs was not affected by hypoxia. These results demonstrate that KSHV harnesses a part of the hypoxic cellular response and that a substantial portion of hypoxia-induced changes in cellular gene expression are induced by KSHV infection. Therefore, targeting hypoxic pathways may be a useful way to develop therapeutic strategies for KSHV-related diseases. PMID:28046107

  13. Deep sequencing analysis of the developing mouse brain reveals a novel microRNA

    Directory of Open Access Journals (Sweden)

    Piltz Sandra

    2011-04-01

    Full Text Available Abstract Background MicroRNAs (miRNAs are small non-coding RNAs that can exert multilevel inhibition/repression at a post-transcriptional or protein synthesis level during disease or development. Characterisation of miRNAs in adult mammalian brains by deep sequencing has been reported previously. However, to date, no small RNA profiling of the developing brain has been undertaken using this method. We have performed deep sequencing and small RNA analysis of a developing (E15.5 mouse brain. Results We identified the expression of 294 known miRNAs in the E15.5 developing mouse brain, which were mostly represented by let-7 family and other brain-specific miRNAs such as miR-9 and miR-124. We also discovered 4 putative 22-23 nt miRNAs: mm_br_e15_1181, mm_br_e15_279920, mm_br_e15_96719 and mm_br_e15_294354 each with a 70-76 nt predicted pre-miRNA. We validated the 4 putative miRNAs and further characterised one of them, mm_br_e15_1181, throughout embryogenesis. Mm_br_e15_1181 biogenesis was Dicer1-dependent and was expressed in E3.5 blastocysts and E7 whole embryos. Embryo-wide expression patterns were observed at E9.5 and E11.5 followed by a near complete loss of expression by E13.5, with expression restricted to a specialised layer of cells within the developing and early postnatal brain. Mm_br_e15_1181 was upregulated during neurodifferentiation of P19 teratocarcinoma cells. This novel miRNA has been identified as miR-3099. Conclusions We have generated and analysed the first deep sequencing dataset of small RNA sequences of the developing mouse brain. The analysis revealed a novel miRNA, miR-3099, with potential regulatory effects on early embryogenesis, and involvement in neuronal cell differentiation/function in the brain during late embryonic and early neonatal development.

  14. Application of small RNA sequencing to identify microRNAs in acute kidney injury and fibrosis

    Energy Technology Data Exchange (ETDEWEB)

    Pellegrini, Kathryn L. [Department of Medicine, Renal Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Gerlach, Cory V. [Department of Medicine, Renal Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Department of Environmental Health, Harvard T.H. Chan School of Public Health, Boston, MA (United States); Laboratory of Systems Pharmacology, Harvard Program in Therapeutic Sciences, Harvard Medical School, Boston, MA (United States); Craciun, Florin L.; Ramachandran, Krithika [Department of Medicine, Renal Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Bijol, Vanesa [Department of Pathology, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Kissick, Haydn T. [Department of Surgery, Urology Division, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA (United States); Vaidya, Vishal S., E-mail: vvaidya@bwh.harvard.edu [Department of Medicine, Renal Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Department of Environmental Health, Harvard T.H. Chan School of Public Health, Boston, MA (United States); Laboratory of Systems Pharmacology, Harvard Program in Therapeutic Sciences, Harvard Medical School, Boston, MA (United States)

    2016-12-01

    Establishing a microRNA (miRNA) expression profile in affected tissues provides an important foundation for the discovery of miRNAs involved in the development or progression of pathologic conditions. We conducted small RNA sequencing to generate a temporal profile of miRNA expression in the kidneys using a mouse model of folic acid-induced (250 mg/kg i.p.) kidney injury and fibrosis. From the 103 miRNAs that were differentially expressed over the time course (> 2-fold, p < 0.05), we chose to further investigate miR-18a-5p, which is expressed during the acute stage of the injury; miR-132-3p, which is upregulated during transition between acute and fibrotic injury; and miR-146b-5p, which is highly expressed at the peak of fibrosis. Using qRT-PCR, we confirmed the increased expression of these candidate miRNAs in the folic acid model as well as in other established mouse models of acute injury (ischemia/reperfusion injury) and fibrosis (unilateral ureteral obstruction). In situ hybridization confirmed high expression of miR-18a-5p, miR-132-3p and miR-146b-5p throughout the kidney cortex in mice and humans with severe kidney injury or fibrosis. When primary human proximal tubular epithelial cells were treated with model nephrotoxicants such as cadmium chloride (CdCl{sub 2}), arsenic trioxide, aristolochic acid (AA), potassium dichromate (K{sub 2}Cr{sub 2}O{sub 7}) and cisplatin, miRNA-132-3p was upregulated 4.3-fold after AA treatment and 1.5-fold after K{sub 2}Cr{sub 2}O{sub 7} and CdCl{sub 2} treatment. These results demonstrate the application of temporal small RNA sequencing to identify miR-18a, miR-132 and miR-146b as differentially expressed miRNAs during distinct phases of kidney injury and fibrosis progression. - Highlights: • We used small RNA sequencing to identify differentially expressed miRNAs in kidney. • Distinct patterns were found for acute injury and fibrotic stages in the kidney. • Upregulation of miR-18a, -132 and -146b was confirmed in mice

  15. Deep Sequence Analysis of AgoshRNA Processing Reveals 3’ A Addition and Trimming

    Directory of Open Access Journals (Sweden)

    Alex Harwig

    2015-01-01

    Full Text Available The RNA interference (RNAi pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA, was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2 slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp. This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3’ strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3’ tail of 1–3 A-nucleotides (nt and we present evidence that this product is subsequently trimmed by the poly(A-specific ribonuclease (PARN.

  16. The Messenger Mission to Mercury

    CERN Document Server

    Domingue, D. L

    2007-01-01

    NASA’s MESSENGER mission, launched on 3 August, 2004 is the seventh mission in the Discovery series. MESSENGER encounters the planet Mercury four times, culminating with an insertion into orbit on 18 March 2011. It carries a comprehensive package of geophysical, geological, geochemical, and space environment experiments to complete the complex investigations of this solar-system end member, which begun with Mariner 10. The articles in this book, written by the experts in each area of the MESSENGER mission, describe the mission, spacecraft, scientific objectives, and payload. The book is of interest to all potential users of the data returned by the MESSENGER mission, to those studying the nature of the planet Mercury, and by all those interested in the design and implementation of planetary exploration missions.

  17. Comparison of two approaches for the classification of 16S rRNA gene sequences.

    Science.gov (United States)

    Chatellier, Sonia; Mugnier, Nathalie; Allard, Françoise; Bonnaud, Bertrand; Collin, Valérie; van Belkum, Alex; Veyrieras, Jean-Baptiste; Emler, Stefan

    2014-10-01

    The use of 16S rRNA gene sequences for microbial identification in clinical microbiology is accepted widely, and requires databases and algorithms. We compared a new research database containing curated 16S rRNA gene sequences in combination with the lca (lowest common ancestor) algorithm (RDB-LCA) to a commercially available 16S rDNA Centroid approach. We used 1025 bacterial isolates characterized by biochemistry, matrix-assisted laser desorption/ionization time-of-flight MS and 16S rDNA sequencing. Nearly 80 % of isolates were identified unambiguously at the species level by both classification platforms used. The remaining isolates were mostly identified correctly at the genus level due to the limited resolution of 16S rDNA sequencing. Discrepancies between both 16S rDNA platforms were due to differences in database content and the algorithm used, and could amount to up to 10.5 %. Up to 1.4 % of the analyses were found to be inconclusive. It is important to realize that despite the overall good performance of the pipelines for analysis, some inconclusive results remain that require additional in-depth analysis performed using supplementary methods. © 2014 The Authors.

  18. AllelicImbalance: An R/ bioconductor package for detecting, managing, and visualizing allele expression imbalance data from RNA sequencing

    DEFF Research Database (Denmark)

    Gådin, Jesper R.; van't Hooft, Ferdinand M.; Eriksson, Per

    2015-01-01

    the possible biases. Results: We present AllelicImblance, a software program that is designed to detect, manage, and visualize allelic imbalances comprehensively. The purpose of this software is to allow users to pose genetic questions in any RNA sequencing experiment quickly, enhancing the general utility...... of RNA sequencing. The visualization features can reveal notable, non-trivial allelic imbalance behavior over specific regions, such as exons. Conclusions: The software provides a complete framework to perform allelic imbalance analyses of aligned RNA sequencing data, from detection to visualization...

  19. Mapping a nucleolar targeting sequence of an RNA binding nucleolar protein, Nop25

    International Nuclear Information System (INIS)

    Fujiwara, Takashi; Suzuki, Shunji; Kanno, Motoko; Sugiyama, Hironobu; Takahashi, Hisaaki; Tanaka, Junya

    2006-01-01

    Nop25 is a putative RNA binding nucleolar protein associated with rRNA transcription. The present study was undertaken to determine the mechanism of Nop25 localization in the nucleolus. Deletion experiments of Nop25 amino acid sequence showed Nop25 to contain a nuclear targeting sequence in the N-terminal and a nucleolar targeting sequence in the C-terminal. By expressing derivative peptides from the C-terminal as GFP-fusion proteins in the cells, a lysine and arginine residue-enriched peptide (KRKHPRRAQDSTKKPPSATRTSKTQRRRR) allowed a GFP-fusion protein to be transported and fully retained in the nucleolus. When the peptide was fused with cMyc epitope and expressed in the cells, a cMyc epitope was then detected in the nucleolus. Nop25 did not localize in the nucleolus by deletion of the peptide from Nop25. Furthermore, deletion of a subdomain (KRKHPRRAQ) in the peptide or amino acid substitution of lysine and arginine residues in the subdomain resulted in the loss of Nop25 nucleolar localization. These results suggest that the lysine and arginine residue-enriched peptide is the most prominent nucleolar targeting sequence of Nop25 and that the long stretch of basic residues might play an important role in the nucleolar localization of Nop25. Although Nop25 contained putative SUMOylation, phosphorylation and glycosylation sites, the amino acid substitution in these sites had no effect on the nucleolar localization, thus suggesting that these post-translational modifications did not contribute to the localization of Nop25 in the nucleolus. The treatment of the cells, which expressed a GFP-fusion protein with a nucleolar targeting sequence of Nop25, with RNase A resulted in a complete dislocation of the protein from the nucleolus. These data suggested that the nucleolar targeting sequence might therefore play an important role in the binding of Nop25 to RNA molecules and that the RNA binding of Nop25 might be essential for the nucleolar localization of Nop25

  20. An optimized protocol for generation and analysis of Ion Proton sequencing reads for RNA-Seq.

    Science.gov (United States)

    Yuan, Yongxian; Xu, Huaiqian; Leung, Ross Ka-Kit

    2016-05-26

    Previous studies compared running cost, time and other performance measures of popular sequencing platforms. However, comprehensive assessment of library construction and analysis protocols for Proton sequencing platform remains unexplored. Unlike Illumina sequencing platforms, Proton reads are heterogeneous in length and quality. When sequencing data from different platforms are combined, this can result in reads with various read length. Whether the performance of the commonly used software for handling such kind of data is satisfactory is unknown. By using universal human reference RNA as the initial material, RNaseIII and chemical fragmentation methods in library construction showed similar result in gene and junction discovery number and expression level estimated accuracy. In contrast, sequencing quality, read length and the choice of software affected mapping rate to a much larger extent. Unspliced aligner TMAP attained the highest mapping rate (97.27 % to genome, 86.46 % to transcriptome), though 47.83 % of mapped reads were clipped. Long reads could paradoxically reduce mapping in junctions. With reference annotation guide, the mapping rate of TopHat2 significantly increased from 75.79 to 92.09 %, especially for long (>150 bp) reads. Sailfish, a k-mer based gene expression quantifier attained highly consistent results with that of TaqMan array and highest sensitivity. We provided for the first time, the reference statistics of library preparation methods, gene detection and quantification and junction discovery for RNA-Seq by the Ion Proton platform. Chemical fragmentation performed equally well with the enzyme-based one. The optimal Ion Proton sequencing options and analysis software have been evaluated.

  1. Deep sequencing of Salmonella RNA associated with heterologous Hfq proteins in vivo reveals small RNAs as a major target class and identifies RNA processing phenotypes.

    Science.gov (United States)

    Sittka, Alexandra; Sharma, Cynthia M; Rolle, Katarzyna; Vogel, Jörg

    2009-01-01

    The bacterial Sm-like protein, Hfq, is a key factor for the stability and function of small non-coding RNAs (sRNAs) in Escherichia coli. Homologues of this protein have been predicted in many distantly related organisms yet their functional conservation as sRNA-binding proteins has not entirely been clear. To address this, we expressed in Salmonella the Hfq proteins of two eubacteria (Neisseria meningitides, Aquifex aeolicus) and an archaeon (Methanocaldococcus jannaschii), and analyzed the associated RNA by deep sequencing. This in vivo approach identified endogenous Salmonella sRNAs as a major target of the foreign Hfq proteins. New Salmonella sRNA species were also identified, and some of these accumulated specifically in the presence of a foreign Hfq protein. In addition, we observed specific RNA processing defects, e.g., suppression of precursor processing of SraH sRNA by Methanocaldococcus Hfq, or aberrant accumulation of extracytoplasmic target mRNAs of the Salmonella GcvB, MicA or RybB sRNAs. Taken together, our study provides evidence of a conserved inherent sRNA-binding property of Hfq, which may facilitate the lateral transmission of regulatory sRNAs among distantly related species. It also suggests that the expression of heterologous RNA-binding proteins combined with deep sequencing analysis of RNA ligands can be used as a molecular tool to dissect individual steps of RNA metabolism in vivo.

  2. Deep RNA sequencing of the skeletal muscle transcriptome in swimming fish.

    Directory of Open Access Journals (Sweden)

    Arjan P Palstra

    Full Text Available Deep RNA sequencing (RNA-seq was performed to provide an in-depth view of the transcriptome of red and white skeletal muscle of exercised and non-exercised rainbow trout (Oncorhynchus mykiss with the specific objective to identify expressed genes and quantify the transcriptomic effects of swimming-induced exercise. Pubertal autumn-spawning seawater-raised female rainbow trout were rested (n = 10 or swum (n = 10 for 1176 km at 0.75 body-lengths per second in a 6,000-L swim-flume under reproductive conditions for 40 days. Red and white muscle RNA of exercised and non-exercised fish (4 lanes was sequenced and resulted in 15-17 million reads per lane that, after de novo assembly, yielded 149,159 red and 118,572 white muscle contigs. Most contigs were annotated using an iterative homology search strategy against salmonid ESTs, the zebrafish Danio rerio genome and general Metazoan genes. When selecting for large contigs (>500 nucleotides, a number of novel rainbow trout gene sequences were identified in this study: 1,085 and 1,228 novel gene sequences for red and white muscle, respectively, which included a number of important molecules for skeletal muscle function. Transcriptomic analysis revealed that sustained swimming increased transcriptional activity in skeletal muscle and specifically an up-regulation of genes involved in muscle growth and developmental processes in white muscle. The unique collection of transcripts will contribute to our understanding of red and white muscle physiology, specifically during the long-term reproductive migration of salmonids.

  3. tRNA--the golden standard in molecular biology.

    Science.gov (United States)

    Barciszewska, Mirosława Z; Perrigue, Patrick M; Barciszewski, Jan

    2016-01-01

    Transfer RNAs (tRNAs) represent a major class of RNA molecules. Their primary function is to help decode a messenger RNA (mRNA) sequence in order to synthesize protein and thus ensures the precise translation of genetic information that is imprinted in DNA. The discovery of tRNA in the late 1950's provided critical insight into a genetic machinery when little was known about the central dogma of molecular biology. In 1965, Robert Holley determined the first nucleotide sequence of alanine transfer RNA (tRNA(Ala)) which earned him the 1968 Nobel Prize in Physiology or Medicine. Today, tRNA is one of the best described and characterized biological molecules. Here we review some of the key historical events in tRNA research which led to breakthrough discoveries and new developments in molecular biology.

  4. The Pseudomonas aeruginosa transcriptome in planktonic cultures and static biofilms using RNA sequencing.

    Directory of Open Access Journals (Sweden)

    Andreas Dötsch

    Full Text Available In this study, we evaluated how gene expression differs in mature Pseudomonas aeruginosa biofilms as opposed to planktonic cells by the use of RNA sequencing technology that gives rise to both quantitative and qualitative information on the transcriptome. Although a large proportion of genes were consistently regulated in both the stationary phase and biofilm cultures as opposed to the late exponential growth phase cultures, the global biofilm gene expression pattern was clearly distinct indicating that biofilms are not just surface attached cells in stationary phase. A large amount of the genes found to be biofilm specific were involved in adaptation to microaerophilic growth conditions, repression of type three secretion and production of extracellular matrix components. Additionally, we found many small RNAs to be differentially regulated most of them similarly in stationary phase cultures and biofilms. A qualitative analysis of the RNA-seq data revealed more than 3000 putative transcriptional start sites (TSS. By the use of rapid amplification of cDNA ends (5'-RACE we confirmed the presence of three different TSS associated with the pqsABCDE operon, two in the promoter of pqsA and one upstream of the second gene, pqsB. Taken together, this study reports the first transcriptome study on P. aeruginosa that employs RNA sequencing technology and provides insights into the quantitative and qualitative transcriptome including the expression of small RNAs in P. aeruginosa biofilms.

  5. Transcriptomic characterization of soybean (Glycine max) roots in response to rhizobium infection by RNA sequencing

    International Nuclear Information System (INIS)

    He, Q.; Li, Z.; Wang, S.; Huang, S.; Yang, H.

    2018-01-01

    Legumes interacting with rhizobium to convert N2 into ammonia for plant use has attracted worldwide interest. However, the plant basal nitrogen fixation mechanisms induced in response to Rhizobium, giving differential gene expression of plants, have not yet been fully realized. The differential expressed genes of soybean between inoculated and mock-inoculated were analyzed by a RNA-Seq. The results of the sequencing were aligned against the Williams 82 genome sequence, which contain 55787 transcripts; 280 and 316 transcripts were found to be up- and down-regulated, respectively, for inoculated and mock-inoculated soybean roots at stage V1. Gene ontology (GO) analyses detected 104, 182 and 178 genes associated with the cell component category, molecular function category and biological process category, respectively. Pathway analysis revealed that 98 differentially expressed genes (115 transcripts) were involved in 169 biological pathways. We selected 19 differentially expressed genes and analyzed their expressions in mock-inoculated, inoculated USDA110 and CCBAU45436 using qRT-PCR. The results were in accordance with those obtained from rhizobia infected RNA-Seq data. These showed that the results of RNA-Seq had reliability and universality. Additionally, this study showed some novel genes associated with the nitrogen fixation process in comparison to previously identified QTLs. (author)

  6. microRNA expression profiling in fetal single ventricle malformation identified by deep sequencing.

    Science.gov (United States)

    Yu, Zhang-Bin; Han, Shu-Ping; Bai, Yun-Fei; Zhu, Chun; Pan, Ya; Guo, Xi-Rong

    2012-01-01

    microRNAs (miRNAs) have emerged as key regulators in many biological processes, particularly cardiac growth and development, although the specific miRNA expression profile associated with this process remains to be elucidated. This study aimed to characterize the cellular microRNA profile involved in the development of congenital heart malformation, through the investigation of single ventricle (SV) defects. Comprehensive miRNA profiling in human fetal SV cardiac tissue was performed by deep sequencing. Differential expression of 48 miRNAs was revealed by sequencing by oligonucleotide ligation and detection (SOLiD) analysis. Of these, 38 were down-regulated and 10 were up-regulated in differentiated SV cardiac tissue, compared to control cardiac tissue. This was confirmed by real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis. Predicted target genes of the 48 differentially expressed miRNAs were analyzed by gene ontology and categorized according to cellular process, regulation of biological process and metabolic process. Pathway-Express analysis identified the WNT and mTOR signaling pathways as the most significant processes putatively affected by the differential expression of these miRNAs. The candidate genes involved in cardiac development were identified as potential targets for these differentially expressed microRNAs and the collaborative network of microRNAs and cardiac development related-mRNAs was constructed. These data provide the basis for future investigation of the mechanism of the occurrence and development of fetal SV malformations.

  7. The binding of TIA-1 to RNA C-rich sequences is driven by its C-terminal RRM domain.

    Science.gov (United States)

    Cruz-Gallardo, Isabel; Aroca, Ángeles; Gunzburg, Menachem J; Sivakumaran, Andrew; Yoon, Je-Hyun; Angulo, Jesús; Persson, Cecilia; Gorospe, Myriam; Karlsson, B Göran; Wilce, Jacqueline A; Díaz-Moreno, Irene

    2014-01-01

    T-cell intracellular antigen-1 (TIA-1) is a key DNA/RNA binding protein that regulates translation by sequestering target mRNAs in stress granules (SG) in response to stress conditions. TIA-1 possesses three RNA recognition motifs (RRM) along with a glutamine-rich domain, with the central domains (RRM2 and RRM3) acting as RNA binding platforms. While the RRM2 domain, which displays high affinity for U-rich RNA sequences, is primarily responsible for interaction with RNA, the contribution of RRM3 to bind RNA as well as the target RNA sequences that it binds preferentially are still unknown. Here we combined nuclear magnetic resonance (NMR) and surface plasmon resonance (SPR) techniques to elucidate the sequence specificity of TIA-1 RRM3. With a novel approach using saturation transfer difference NMR (STD-NMR) to quantify protein-nucleic acids interactions, we demonstrate that isolated RRM3 binds to both C- and U-rich stretches with micromolar affinity. In combination with RRM2 and in the context of full-length TIA-1, RRM3 significantly enhanced the binding to RNA, particularly to cytosine-rich RNA oligos, as assessed by biotinylated RNA pull-down analysis. Our findings provide new insight into the role of RRM3 in regulating TIA-1 binding to C-rich stretches, that are abundant at the 5' TOPs (5' terminal oligopyrimidine tracts) of mRNAs whose translation is repressed under stress situations.

  8. Goodness-of-fit tests and model diagnostics for negative binomial regression of RNA sequencing data.

    Science.gov (United States)

    Mi, Gu; Di, Yanming; Schafer, Daniel W

    2015-01-01

    This work is about assessing model adequacy for negative binomial (NB) regression, particularly (1) assessing the adequacy of the NB assumption, and (2) assessing the appropriateness of models for NB dispersion parameters. Tools for the first are appropriate for NB regression generally; those for the second are primarily intended for RNA sequencing (RNA-Seq) data analysis. The typically small number of biological samples and large number of genes in RNA-Seq analysis motivate us to address the trade-offs between robustness and statistical power using NB regression models. One widely-used power-saving strategy, for example, is to assume some commonalities of NB dispersion parameters across genes via simple models relating them to mean expression rates, and many such models have been proposed. As RNA-Seq analysis is becoming ever more popular, it is appropriate to make more thorough investigations into power and robustness of the resulting methods, and into practical tools for model assessment. In this article, we propose simulation-based statistical tests and diagnostic graphics to address model adequacy. We provide simulated and real data examples to illustrate that our proposed methods are effective for detecting the misspecification of the NB mean-variance relationship as well as judging the adequacy of fit of several NB dispersion models.

  9. A powerful and flexible approach to the analysis of RNA sequence count data.

    Science.gov (United States)

    Zhou, Yi-Hui; Xia, Kai; Wright, Fred A

    2011-10-01

    A number of penalization and shrinkage approaches have been proposed for the analysis of microarray gene expression data. Similar techniques are now routinely applied to RNA sequence transcriptional count data, although the value of such shrinkage has not been conclusively established. If penalization is desired, the explicit modeling of mean-variance relationships provides a flexible testing regimen that 'borrows' information across genes, while easily incorporating design effects and additional covariates. We describe BBSeq, which incorporates two approaches: (i) a simple beta-binomial generalized linear model, which has not been extensively tested for RNA-Seq data and (ii) an extension of an expression mean-variance modeling approach to RNA-Seq data, involving modeling of the overdispersion as a function of the mean. Our approaches are flexible, allowing for general handling of discrete experimental factors and continuous covariates. We report comparisons with other alternate methods to handle RNA-Seq data. Although penalized methods have advantages for very small sample sizes, the beta-binomial generalized linear model, combined with simple outlier detection and testing approaches, appears to have favorable characteristics in power and flexibility. An R package containing examples and sample datasets is available at http://www.bios.unc.edu/research/genomic_software/BBSeq yzhou@bios.unc.edu; fwright@bios.unc.edu Supplementary data are available at Bioinformatics online.

  10. An Efficient Method for Identifying Gene Fusions by Targeted RNA Sequencing from Fresh Frozen and FFPE Samples.

    Directory of Open Access Journals (Sweden)

    Jonathan A Scolnick

    Full Text Available Fusion genes are known to be key drivers of tumor growth in several types of cancer. Traditionally, detecting fusion genes has been a difficult task based on fluorescent in situ hybridization to detect chromosomal abnormalities. More recently, RNA sequencing has enabled an increased pace of fusion gene identification. However, RNA-Seq is inefficient for the identification of fusion genes due to the high number of sequencing reads needed to detect the small number of fusion transcripts present in cells of interest. Here we describe a method, Single Primer Enrichment Technology (SPET, for targeted RNA sequencing that is customizable to any target genes, is simple to use, and efficiently detects gene fusions. Using SPET to target 5701 exons of 401 known cancer fusion genes for sequencing, we were able to identify known and previously unreported gene fusions from both fresh-frozen and formalin-fixed paraffin-embedded (FFPE tissue RNA in both normal tissue and cancer cells.

  11. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Muhammad Naveed

    2014-09-01

    Full Text Available In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ. Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

  12. MicroRNA repertoire for functional genome research in tilapia identified by deep sequencing.

    Science.gov (United States)

    Yan, Biao; Wang, Zhen-Hua; Zhu, Chang-Dong; Guo, Jin-Tao; Zhao, Jin-Liang

    2014-08-01

    The Nile tilapia (Oreochromis niloticus; Cichlidae) is an economically important species in aquaculture and occupies a prominent position in the aquaculture industry. MicroRNAs (miRNAs) are a class of noncoding RNAs that post-transcriptionally regulate gene expression involved in diverse biological and metabolic processes. To increase the repertoire of miRNAs characterized in tilapia, we used the Illumina/Solexa sequencing technology to sequence a small RNA library using pooled RNA sample isolated from the different developmental stages of tilapia. Bioinformatic analyses suggest that 197 conserved and 27 novel miRNAs are expressed in tilapia. Sequence alignments indicate that all tested miRNAs and miRNAs* are highly conserved across many species. In addition, we characterized the tissue expression patterns of five miRNAs using real-time quantitative PCR. We found that miR-1/206, miR-7/9, and miR-122 is abundantly expressed in muscle, brain, and liver, respectively, implying a potential role in the regulation of tissue differentiation or the maintenance of tissue identity. Overall, our results expand the number of tilapia miRNAs, and the discovery of miRNAs in tilapia genome contributes to a better understanding the role of miRNAs in regulating diverse biological processes.

  13. Evolutionary relationships in the ilarviruses: nucleotide sequence of prunus necrotic ringspot virus RNA 3.

    Science.gov (United States)

    Sánchez-Navarro, J A; Pallás, V

    1997-01-01

    The complete nucleotide sequence of an isolate of prunus necrotic ringspot virus (PNRSV) RNA 3 has been determined. Elucidation of the amino acid sequence of the proteins encoded by the two large open reading frames (ORFs) allowed us to carry out comparative and phylogenetic studies on the movement (MP) and coat (CP) proteins in the ilarvirus group. Amino acid sequence comparison of the MP revealed a highly conserved basic sequence motif with an amphipathic alpha-helical structure preceding the conserved motif of the '30K superfamily' proposed by Mushegian and Koonin [26] for MP's. Within this '30K' motif a strictly conserved transmembrane domain is present in all ilarviruses sequenced so far. At the amino-terminal end, prune dwarf virus (PDV) has an extension not present in other ilarviruses but which is observed in all bromo- and cucumoviruses, suggesting a common ancestor or a recombinational event in the Bromoviridae family. Examination of the N-terminus of the CP's of all ilarviruses revealed a highly basic region, part of which resembles the Arg-rich motif that has been characterized in the RNA-binding protein family. This motif has also been found in the other members of the Bromoviridae family, suggesting its involvement in a structural function. Furthermore this region is required for infectivity in ilarviruses. The similarities found in this Arg-rich motif are discussed in terms of this process known as genome activation. Finally, phylogenetic analysis of both the MP and CP proteins revealed a higher relationship of A1MV to PNRSV, apple mosaic virus (ApMV) and PDV than any other member of the ilarvirus group. In that sense, A1MV should be considered as a true ilarvirus instead of forming a distinct group of viruses.

  14. Comprehensive processing of high-throughput small RNA sequencing data including quality checking, normalization, and differential expression analysis using the UEA sRNA Workbench.

    Science.gov (United States)

    Beckers, Matthew; Mohorianu, Irina; Stocks, Matthew; Applegate, Christopher; Dalmay, Tamas; Moulton, Vincent

    2017-06-01

    Recently, high-throughput sequencing (HTS) has revealed compelling details about the small RNA (sRNA) population in eukaryotes. These 20 to 25 nt noncoding RNAs can influence gene expression by acting as guides for the sequence-specific regulatory mechanism known as RNA silencing. The increase in sequencing depth and number of samples per project enables a better understanding of the role sRNAs play by facilitating the study of expression patterns. However, the intricacy of the biological hypotheses coupled with a lack of appropriate tools often leads to inadequate mining of the available data and thus, an incomplete description of the biological mechanisms involved. To enable a comprehensive study of differential expression in sRNA data sets, we present a new interactive pipeline that guides researchers through the various stages of data preprocessing and analysis. This includes various tools, some of which we specifically developed for sRNA analysis, for quality checking and normalization of sRNA samples as well as tools for the detection of differentially expressed sRNAs and identification of the resulting expression patterns. The pipeline is available within the UEA sRNA Workbench, a user-friendly software package for the processing of sRNA data sets. We demonstrate the use of the pipeline on a H. sapiens data set; additional examples on a B. terrestris data set and on an A. thaliana data set are described in the Supplemental Information A comparison with existing approaches is also included, which exemplifies some of the issues that need to be addressed for sRNA analysis and how the new pipeline may be used to do this. © 2017 Beckers et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  15. A multiplexed miRNA and transgene expression platform for simultaneous repression and expression of protein coding sequences.

    Science.gov (United States)

    Seyhan, Attila A

    2016-01-01

    Knockdown of single or multiple gene targets by RNA interference (RNAi) is necessary to overcome escape mutants or isoform redundancy. It is also necessary to use multiple RNAi reagents to knockdown multiple targets. It is also desirable to express a transgene or positive regulatory elements and inhibit a target gene in a coordinated fashion. This study reports a flexible multiplexed RNAi and transgene platform using endogenous intronic primary microRNAs (pri-miRNAs) as a scaffold located in the green fluorescent protein (GFP) as a model for any functional transgene. The multiplexed intronic miRNA - GFP transgene platform was designed to co-express multiple small RNAs within the polycistronic cluster from a Pol II promoter at more moderate levels to reduce potential vector toxicity. The native intronic miRNAs are co-transcribed with a precursor GFP mRNA as a single transcript and presumably cleaved out of the precursor-(pre) mRNA by the RNA splicing machinery, spliceosome. The spliced intron with miRNA hairpins will be further processed into mature miRNAs or small interfering RNAs (siRNAs) capable of triggering RNAi effects, while the ligated exons become a mature messenger RNA for the translation of the functional GFP protein. Data show that this approach led to robust RNAi-mediated silencing of multiple Renilla Luciferase (R-Luc)-tagged target genes and coordinated expression of functional GFP from a single transcript in transiently transfected HeLa cells. The results demonstrated that this design facilitates the coordinated expression of all mature miRNAs either as individual miRNAs or as multiple miRNAs and the associated protein. The data suggest that, it is possible to simultaneously deliver multiple negative (miRNA or shRNA) and positive (transgene) regulatory elements. Because many cellular processes require simultaneous repression and activation of downstream pathways, this approach offers a platform technology to achieve that dual manipulation efficiently

  16. Single-Cell RNA-Sequencing Reveals a Continuous Spectrum of Differentiation in Hematopoietic Cells

    Directory of Open Access Journals (Sweden)

    Iain C. Macaulay

    2016-02-01

    Full Text Available The transcriptional programs that govern hematopoiesis have been investigated primarily by population-level analysis of hematopoietic stem and progenitor cells, which cannot reveal the continuous nature of the differentiation process. Here we applied single-cell RNA-sequencing to a population of hematopoietic cells in zebrafish as they undergo thrombocyte lineage commitment. By reconstructing their developmental chronology computationally, we were able to place each cell along a continuum from stem cell to mature cell, refining the traditional lineage tree. The progression of cells along this continuum is characterized by a highly coordinated transcriptional program, displaying simultaneous suppression of genes involved in cell proliferation and ribosomal biogenesis as the expression of lineage specific genes increases. Within this program, there is substantial heterogeneity in the expression of the key lineage regulators. Overall, the total number of genes expressed, as well as the total mRNA content of the cell, decreases as the cells undergo lineage commitment.

  17. High throughput sequencing of small RNA component of leaves and inflorescence revealed conserved and novel miRNAs as well as phasiRNA loci in chickpea.

    Science.gov (United States)

    Srivastava, Sangeeta; Zheng, Yun; Kudapa, Himabindu; Jagadeeswaran, Guru; Hivrale, Vandana; Varshney, Rajeev K; Sunkar, Ramanjulu

    2015-06-01

    Among legumes, chickpea (Cicer arietinum L.) is the second most important crop after soybean. MicroRNAs (miRNAs) play important roles by regulating target gene expression important for plant development and tolerance to stress conditions. Additionally, recently discovered phased siRNAs (phasiRNAs), a new class of small RNAs, are abundantly produced in legumes. Nevertheless, little is known about these regulatory molecules in chickpea. The small RNA population was sequenced from leaves and flowers of chickpea to identify conserved and novel miRNAs as well as phasiRNAs/phasiRNA loci. Bioinformatics analysis revealed 157 miRNA loci for the 96 highly conserved and known miRNA homologs belonging to 38 miRNA families in chickpea. Furthermore, 20 novel miRNAs belonging to 17 miRNA families were identified. Sequence analysis revealed approximately 60 phasiRNA loci. Potential target genes likely to be regulated by these miRNAs were predicted and some were confirmed by modified 5' RACE assay. Predicted targets are mostly transcription factors that might be important for developmental processes, and others include superoxide dismutases, plantacyanin, laccases and F-box proteins that could participate in stress responses and protein degradation. Overall, this study provides an inventory of miRNA-target gene interactions for chickpea, useful for the comparative analysis of small RNAs among legumes. Copyright © 2015 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

  18. Novel sequence variations in LAMA2 and SGCG genes modulating cis-acting regulatory elements and RNA secondary structure

    Directory of Open Access Journals (Sweden)

    Olfa Siala

    2010-01-01

    Full Text Available In this study, we detected new sequence variations in LAMA2 and SGCG genes in 5 ethnic populations, and analysed their effect on enhancer composition and mRNA structure. PCR amplification and DNA sequencing were performed and followed by bioinformatics analyses using ESEfinder as well as MFOLD software. We found 3 novel sequence variations in the LAMA2 (c.3174+22_23insAT and c.6085 +12delA and SGCG (c.*102A/C genes. These variations were present in 210 tested healthy controls from Tunisian, Moroccan, Algerian, Lebanese and French populations suggesting that they represent novel polymorphisms within LAMA2 and SGCG genes sequences. ESEfinder showed that the c.*102A/C substitution created a new exon splicing enhancer in the 3'UTR of SGCG genes, whereas the c.6085 +12delA deletion was situated in the base pairing region between LAMA2 mRNA and the U1snRNA spliceosomal components. The RNA structure analyses showed that both variations modulated RNA secondary structure. Our results are suggestive of correlations between mRNA folding and the recruitment of spliceosomal components mediating splicing, including SR proteins. The contribution of common sequence variations to mRNA structural and functional diversity will contribute to a better study of gene expression.

  19. RNAPattMatch: a web server for RNA sequence/structure motif detection based on pattern matching with flexible gaps

    Science.gov (United States)

    Drory Retwitzer, Matan; Polishchuk, Maya; Churkin, Elena; Kifer, Ilona; Yakhini, Zohar; Barash, Danny

    2015-01-01

    Searching for RNA sequence-structure patterns is becoming an essential tool for RNA practitioners. Novel discoveries of regulatory non-coding RNAs in targeted organisms and the motivation to find them across a wide range of organisms have prompted the use of computational RNA pattern matching as an enhancement to sequence similarity. State-of-the-art programs differ by the flexibility of patterns allowed as queries and by their simplicity of use. In particular—no existing method is available as a user-friendly web server. A general program that searches for RNA sequence-structure patterns is RNA Structator. However, it is not available as a web server and does not provide the option to allow flexible gap pattern representation with an upper bound of the gap length being specified at any position in the sequence. Here, we introduce RNAPattMatch, a web-based application that is user friendly and makes sequence/structure RNA queries accessible to practitioners of various background and proficiency. It also extends RNA Structator and allows a more flexible variable gaps representation, in addition to analysis of results using energy minimization methods. RNAPattMatch service is available at http://www.cs.bgu.ac.il/rnapattmatch. A standalone version of the search tool is also available to download at the site. PMID:25940619

  20. Linking Maternal and Somatic 5S rRNA types with Different Sequence-Specific Non-LTR Retrotransposons

    NARCIS (Netherlands)

    Locati, M.D.; Pagano, J.F.B.; Ensink, W.A.; van Olst, M.; van Leeuwen, S.; Nehrdich, U.; Zhu, K.; Spaink, H.P.; Girard, G.; Rauwerda, H.; Jonker, M.J.; Dekker, R.J.; Breit, T.M.

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo and adult tissue,

  1. Transcriptomic analysis of Petunia hybrida in response to salt stress using high throughput RNA sequencing.

    Directory of Open Access Journals (Sweden)

    Gonzalo H Villarino

    Full Text Available Salinity and drought stress are the primary cause of crop losses worldwide. In sodic saline soils sodium chloride (NaCl disrupts normal plant growth and development. The complex interactions of plant systems with abiotic stress have made RNA sequencing a more holistic and appealing approach to study transcriptome level responses in a single cell and/or tissue. In this work, we determined the Petunia transcriptome response to NaCl stress by sequencing leaf samples and assembling 196 million Illumina reads with Trinity software. Using our reference transcriptome we identified more than 7,000 genes that were differentially expressed within 24 h of acute NaCl stress. The proposed transcriptome can also be used as an excellent tool for biological and bioinformatics in the absence of an available Petunia genome and it is available at the SOL Genomics Network (SGN http://solgenomics.net. Genes related to regulation of reactive oxygen species, transport, and signal transductions as well as novel and undescribed transcripts were among those differentially expressed in response to salt stress. The candidate genes identified in this study can be applied as markers for breeding or to genetically engineer plants to enhance salt tolerance. Gene Ontology analyses indicated that most of the NaCl damage happened at 24 h inducing genotoxicity, affecting transport and organelles due to the high concentration of Na+ ions. Finally, we report a modification to the library preparation protocol whereby cDNA samples were bar-coded with non-HPLC purified primers, without affecting the quality and quantity of the RNA-seq data. The methodological improvement presented here could substantially reduce the cost of sample preparation for future high-throughput RNA sequencing experiments.

  2. Transcriptomic analysis of Petunia hybrida in response to salt stress using high throughput RNA sequencing.

    Science.gov (United States)

    Villarino, Gonzalo H; Bombarely, Aureliano; Giovannoni, James J; Scanlon, Michael J; Mattson, Neil S

    2014-01-01

    Salinity and drought stress are the primary cause of crop losses worldwide. In sodic saline soils sodium chloride (NaCl) disrupts normal plant growth and development. The complex interactions of plant systems with abiotic stress have made RNA sequencing a more holistic and appealing approach to study transcriptome level responses in a single cell and/or tissue. In this work, we determined the Petunia transcriptome response to NaCl stress by sequencing leaf samples and assembling 196 million Illumina reads with Trinity software. Using our reference transcriptome we identified more than 7,000 genes that were differentially expressed within 24 h of acute NaCl stress. The proposed transcriptome can also be used as an excellent tool for biological and bioinformatics in the absence of an available Petunia genome and it is available at the SOL Genomics Network (SGN) http://solgenomics.net. Genes related to regulation of reactive oxygen species, transport, and signal transductions as well as novel and undescribed transcripts were among those differentially expressed in response to salt stress. The candidate genes identified in this study can be applied as markers for breeding or to genetically engineer plants to enhance salt tolerance. Gene Ontology analyses indicated that most of the NaCl damage happened at 24 h inducing genotoxicity, affecting transport and organelles due to the high concentration of Na+ ions. Finally, we report a modification to the library preparation protocol whereby cDNA samples were bar-coded with non-HPLC purified primers, without affecting the quality and quantity of the RNA-seq data. The methodological improvement presented here could substantially reduce the cost of sample preparation for future high-throughput RNA sequencing experiments.

  3. Globicatella sanguinis bacteraemia identified by partial 16S rRNA gene sequencing

    DEFF Research Database (Denmark)

    Abdul-Redha, Rawaa Jalil; Balslew, Ulla; Christensen, Jens Jørgen

    2007-01-01

    Globicatella sanguinis is a gram-positive coccus, resembling non-haemolytic streptococci. The organism has been isolated infrequently from normally sterile sites of humans. Three isolates obtained by blood culture could not be identified by Rapid 32 ID Strep, but partial sequencing of the 16S r......RNA gene revealed the identity of the isolated bacteria, and supplementary biochemical tests confirmed the species identification. The cases histories illustrate the dilemma of finding relevant, newly recognized, opportunistic pathogens and the identification achievement (s) that can be obtained by using...

  4. Global Perspectives on Activated Sludge Community Composition analyzed using 16S rRNA amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Saunders, Aaron Marc; Albertsen, Mads

    communities, and in this study activated sludge sampled from 32 Wastewater Treatment Plants (WWTPs) around the world was described and compared. The top abundant bacteria in the global activated sludge ecosystem were found and the core population shared by multiple samples was investigated. The results......Activated sludge is the most commonly applied bioprocess throughout the world for wastewater treatment. Microorganisms are key to the process, yet our knowledge of their identity and function is still limited. High-througput16S rRNA amplicon sequencing can reliably characterize microbial...

  5. MicroRNA discovery and analysis of pinewood nematode Bursaphelenchus xylophilus by deep sequencing.

    Directory of Open Access Journals (Sweden)

    Qi-Xing Huang

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are considered to be very important in regulating the growth, development, behavior and stress response in animals and plants in post-transcriptional gene regulation. Pinewood nematode, Bursaphelenchus xylophilus, is an important invasive plant parasitic nematode in Asia. To have a comprehensive knowledge about miRNAs of the nematode is necessary for further in-depth study on roles of miRNAs in the ecological adaptation of the invasive species. METHODS AND FINDINGS: Five small RNA libraries were constructed and sequenced by Illumina/Solexa deep-sequencing technology. A total of 810 miRNA candidates (49 conserved and 761 novel were predicted by a computational pipeline, of which 57 miRNAs (20 conserved and 37 novel encoded by 53 miRNA precursors were identified by experimental methods. Ten novel miRNAs were considered to be species-specific miRNAs of B. xylophilus. Comparison of expression profiles of miRNAs in the five small RNA libraries showed that many miRNAs exhibited obviously different expression levels in the third-stage dispersal juvenile and at a cold-stressed status. Most of the miRNAs exhibited obviously down-regulated expression in the dispersal stage. But differences among the three geographic libraries were not prominent. A total of 979 genes were predicted to be targets of these authentic miRNAs. Among them, seven heat shock protein genes were targeted by 14 miRNAs, and six FMRFamide-like neuropeptides genes were targeted by 17 miRNAs. A real-time quantitative polymerase chain reaction was used to quantify the mRNA expression levels of target genes. CONCLUSIONS: Basing on the fact that a negative correlation existed between the expression profiles of miRNAs and the mRNA expression profiles of their target genes (hsp, flp by comparing those of the nematodes at a cold stressed status and a normal status, we suggested that miRNAs might participate in ecological adaptation and behavior regulation of the

  6. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Science.gov (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  7. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  8. Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

    Science.gov (United States)

    Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

    2014-04-01

    Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

  9. Analysis of microRNA profile of Anopheles sinensis by deep sequencing and bioinformatic approaches.

    Science.gov (United States)

    Feng, Xinyu; Zhou, Xiaojian; Zhou, Shuisen; Wang, Jingwen; Hu, Wei

    2018-03-12

    microRNAs (miRNAs) are small non-coding RNAs widely identified in many mosquitoes. They are reported to play important roles in development, differentiation and innate immunity. However, miRNAs in Anopheles sinensis, one of the Chinese malaria mosquitoes, remain largely unknown. We investigated the global miRNA expression profile of An. sinensis using Illumina Hiseq 2000 sequencing. Meanwhile, we applied a bioinformatic approach to identify potential miRNAs in An. sinensis. The identified miRNA profiles were compared and analyzed by two approaches. The selected miRNAs from the sequencing result and the bioinformatic approach were confirmed with qRT-PCR. Moreover, target prediction, GO annotation and pathway analysis were carried out to understand the role of miRNAs in An. sinensis. We identified 49 conserved miRNAs and 12 novel miRNAs by next-generation high-throughput sequencing technology. In contrast, 43 miRNAs were predicted by the bioinformatic approach, of which two were assigned as novel. Comparative analysis of miRNA profiles by two approaches showed that 21 miRNAs were shared between them. Twelve novel miRNAs did not match any known miRNAs of any organism, indicating that they are possibly species-specific. Forty miRNAs were found in many mosquito species, indicating that these miRNAs are evolutionally conserved and may have critical roles in the process of life. Both the selected known and novel miRNAs (asi-miR-281, asi-miR-184, asi-miR-14, asi-miR-nov5, asi-miR-nov4, asi-miR-9383, and asi-miR-2a) could be detected by quantitative real-time PCR (qRT-PCR) in the sequenced sample, and the expression patterns of these miRNAs measured by qRT-PCR were in concordance with the original miRNA sequencing data. The predicted targets for the known and the novel miRNAs covered many important biological roles and pathways indicating the diversity of miRNA functions. We also found 21 conserved miRNAs and eight counterparts of target immune pathway genes in An. sinensis

  10. An efficient and high fidelity method for amplification, cloning and sequencing of complete tospovirus genomic RNA segments

    Science.gov (United States)

    Amplification and sequencing of the complete M- and S-RNA segments of Tomato spotted wilt virus and Impatiens necrotic spot virus as a single fragment is useful for whole genome sequencing of tospoviruses co-infecting a single host plant. It avoids issues associated with overlapping amplicon-based ...

  11. Improved taxonomic assignment of human intestinal 16S rRNA sequences by a dedicated reference database

    NARCIS (Netherlands)

    Ritari, Jarmo; Salojärvi, Jarkko; Lahti, Leo; Vos, de Willem M.

    2015-01-01

    Background: Current sequencing technology enables taxonomic profiling of microbial ecosystems at high resolution and depth by using the 16S rRNA gene as a phylogenetic marker. Taxonomic assignation of newly acquired data is based on sequence comparisons with comprehensive reference databases to

  12. 16S rRNA gene sequencing in routine identification of anaerobic bacteria isolated from blood cultures

    DEFF Research Database (Denmark)

    Justesen, Ulrik Stenz; Skov, Marianne Nielsine; Knudsen, Elisa

    2010-01-01

    A comparison between conventional identification and 16S rRNA gene sequencing of anaerobic bacteria isolated from blood cultures in a routine setting was performed (n = 127). With sequencing, 89% were identified to the species level, versus 52% with conventional identification. The times...

  13. RNAcontext: a new method for learning the sequence and structure binding preferences of RNA-binding proteins.

    Directory of Open Access Journals (Sweden)

    Hilal Kazan

    2010-07-01

    Full Text Available Metazoan genomes encode hundreds of RNA-binding proteins (RBPs. These proteins regulate post-transcriptional gene expression and have critical roles in numerous cellular processes including mRNA splicing, export, stability and translation. Despite their ubiquity and importance, the binding preferences for most RBPs are not well characterized. In vitro and in vivo studies, using affinity selection-based approaches, have successfully identified RNA sequence associated with specific RBPs; however, it is difficult to infer RBP sequence and structural preferences without specifically designed motif finding methods. In this study, we introduce a new motif-finding method, RNAcontext, designed to elucidate RBP-specific sequence and structural preferences with greater accuracy than existing approaches. We evaluated RNAcontext on recently published in vitro and in vivo RNA affinity selected data and demonstrate that RNAcontext identifies known binding preferences for several control proteins including HuR, PTB, and Vts1p and predicts new RNA structure preferences for SF2/ASF, RBM4, FUSIP1 and SLM2. The predicted preferences for SF2/ASF are consistent with its recently reported in vivo binding sites. RNAcontext is an accurate and efficient motif finding method ideally suited for using large-scale RNA-binding affinity datasets to determine the relative binding preferences of RBPs for a wide range of RNA sequences and structures.

  14. REMap: Operon map of M. tuberculosis based on RNA sequence data.

    Science.gov (United States)

    Pelly, Shaaretha; Winglee, Kathryn; Xia, Fang Fang; Stevens, Rick L; Bishai, William R; Lamichhane, Gyanu

    2016-07-01

    A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Selection of mRNA 5'-untranslated region sequence with high translation efficiency through ribosome display

    International Nuclear Information System (INIS)

    Mie, Masayasu; Shimizu, Shun; Takahashi, Fumio; Kobatake, Eiry

    2008-01-01

    The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, only mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library

  16. Transcriptome analysis of the model protozoan, Tetrahymena thermophila, using Deep RNA sequencing.

    Directory of Open Access Journals (Sweden)

    Jie Xiong

    Full Text Available BACKGROUND: The ciliated protozoan Tetrahymena thermophila is a well-studied single-celled eukaryote model organism for cellular and molecular biology. However, the lack of extensive T. thermophila cDNA libraries or a large expressed sequence tag (EST database limited the quality of the original genome annotation. METHODOLOGY/PRINCIPAL FINDINGS: This RNA-seq study describes the first deep sequencing analysis of the T. thermophila transcriptome during the three major stages of the life cycle: growth, starvation and conjugation. Uniquely mapped reads covered more than 96% of the 24,725 predicted gene models in the somatic genome. More than 1,000 new transcribed regions were identified. The great dynamic range of RNA-seq allowed detection of a nearly six order-of-magnitude range of measurable gene expression orchestrated by this cell. RNA-seq also allowed the first prediction of transcript untranslated regions (UTRs and an updated (larger size estimate of the T. thermophila transcriptome: 57 Mb, or about 55% of the somatic genome. Our study identified nearly 1,500 alternative splicing (AS events distributed over 5.2% of T. thermophila genes. This percentage represents a two order-of-magnitude increase over previous EST-based estimates in Tetrahymena. Evidence of stage-specific regulation of alternative splicing was also obtained. Finally, our study allowed us to completely confirm about 26.8% of the genes originally predicted by the gene finder, to correct coding sequence boundaries and intron-exon junctions for about a third, and to reassign microarray probes and correct earlier microarray data. CONCLUSIONS/SIGNIFICANCE: RNA-seq data significantly improve the genome annotation and provide a fully comprehensive view of the global transcriptome of T. thermophila. To our knowledge, 5.2% of T. thermophila genes with AS is the highest percentage of genes showing AS reported in a unicellular eukaryote. Tetrahymena thus becomes an excellent unicellular

  17. Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

    Science.gov (United States)

    Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

    2014-07-08

    We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

  18. Small RNA and transcriptome deep sequencing proffers insight into floral gene regulation in Rosa cultivars

    Directory of Open Access Journals (Sweden)

    Kim Jungeun

    2012-11-01

    Full Text Available Abstract Background Roses (Rosa sp., which belong to the family Rosaceae, are the most economically important ornamental plants—making up 30% of the floriculture market. However, given high demand for roses, rose breeding programs are limited in molecular resources which can greatly enhance and speed breeding efforts. A better understanding of important genes that contribute to important floral development and desired phenotypes will lead to improved rose cultivars. For this study, we analyzed rose miRNAs and the rose flower transcriptome in order to generate a database to expound upon current knowledge regarding regulation of important floral characteristics. A rose genetic database will enable comprehensive analysis of gene expression and regulation via miRNA among different Rosa cultivars. Results We produced more than 0.5 million reads from expressed sequences, totalling more than 110 million bp. From these, we generated 35,657, 31,434, 34,725, and 39,722 flower unigenes from Rosa hybrid: ‘Vital’, ‘Maroussia’, and ‘Sympathy’ and Rosa rugosa Thunb. , respectively. The unigenes were assigned functional annotations, domains, metabolic pathways, Gene Ontology (GO terms, Plant Ontology (PO terms, and MIPS Functional Catalogue (FunCat terms. Rose flower transcripts were compared with genes from whole genome sequences of Rosaceae members (apple, strawberry, and peach and grape. We also produced approximately 40 million small RNA reads from flower tissue for Rosa, representing 267 unique miRNA tags. Among identified miRNAs, 25 of them were novel and 242 of them were conserved miRNAs. Statistical analyses of miRNA profiles revealed both shared and species-specific miRNAs, which presumably effect flower development and phenotypes. Conclusions In this study, we constructed a Rose miRNA and transcriptome database, and we analyzed the miRNAs and transcriptome generated from the flower tissues of four Rosa cultivars. The database provides a

  19. Phylogenetic inference of Coxiella burnetii by 16S rRNA gene sequencing.

    Directory of Open Access Journals (Sweden)

    Heather P McLaughlin

    Full Text Available Coxiella burnetii is a human pathogen that causes the serious zoonotic disease Q fever. It is ubiquitous in the environment and due to its wide host range, long-range dispersal potential and classification as a bioterrorism agent, this microorganism is considered an HHS Select Agent. In the event of an outbreak or intentional release, laboratory strain typing methods can contribute to epidemiological investigations, law enforcement investigation and the public health response by providing critical information about the relatedness between C. burnetii isolates collected from different sources. Laboratory cultivation of C. burnetii is both time-consuming and challenging. Availability of strain collections is often limited and while several strain typing methods have been described over the years, a true gold-standard method is still elusive. Building upon epidemiological knowledge from limited, historical strain collections and typing data is essential to more accurately infer C. burnetii phylogeny. Harmonization of auspicious high-resolution laboratory typing techniques is critical to support epidemiological and law enforcement investigation. The single nucleotide polymorphism (SNP -based genotyping approach offers simplicity, rapidity and robustness. Herein, we demonstrate SNPs identified within 16S rRNA gene sequences can differentiate C. burnetii strains. Using this method, 55 isolates were assigned to six groups based on six polymorphisms. These 16S rRNA SNP-based genotyping results were largely congruent with those obtained by analyzing restriction-endonuclease (RE-digested DNA separated by SDS-PAGE and by the high-resolution approach based on SNPs within multispacer sequence typing (MST loci. The SNPs identified within the 16S rRNA gene can be used as targets for the development of additional SNP-based genotyping assays for C. burnetii.

  20. Molecular Mechanisms of Mild and Severe Pneumonia: Insights from RNA Sequencing.

    Science.gov (United States)

    Huang, Sai; Feng, Cong; Chen, Li; Huang, Zhi; Zhou, Xuan; Li, Bei; Wang, Li-Li; Chen, Wei; Lv, Fa-Qin; Li, Tan-Shi

    2017-04-06

    BACKGROUND This study aimed to uncover the molecular mechanisms underlying mild and severe pneumonia by use of mRNA sequencing (RNA-seq). MATERIAL AND METHODS RNA was extracted from the peripheral blood of patients with mild pneumonia, severe pneumonia, and healthy controls. Sequencing was performed on the HiSeq4000 platform. After filtering, clean reads were mapped to the human reference genome hg19. Differentially expressed genes (DEGs) were identified between the control group and the mild or severe group. A transcription factor-gene network was constructed for each group. Biological process (BP) terms enriched by DEGs in the network were analyzed and these genes were also mapped to the Connectivity map to search for small-molecule drugs. RESULTS A total of 199 and 560 DEGs were identified from the mild group and severe group, respectively. A transcription factor-gene network consisting of 215 nodes and another network consisting of 451 nodes were constructed in the mild group and severe group, respectively, and 54 DEGs (e.g., S100A9 and S100A12) were found to be common, with consistent differential expression changes in the 2 groups. Genes in the transcription factor-gene network for the mild group were mainly enriched in 13 BP terms, especially defense and inflammatory response (e.g., S100A8) and spermatogenesis, while the top BP terms enriched by genes in the severe group include response to oxidative stress (CCL5), wound healing, and regulation of cell differentiation (CCL5), and of the cellular protein metabolic process. CONCLUSIONS S100A9 and S100A12 may have a role in the pathogenesis of pneumonia: S100A9 and CXCL1 may contribute solely in mild pneumonia, and CCL5 and CXCL11 may contribute in severe pneumonia.

  1. Comprehensive microRNA profiling in B-cells of human centenarians by massively parallel sequencing

    Directory of Open Access Journals (Sweden)

    Gombar Saurabh

    2012-07-01

    Full Text Available Abstract Background MicroRNAs (miRNAs are small, non-coding RNAs that regulate gene expression and play a critical role in development, homeostasis, and disease. Despite their demonstrated roles in age-associated pathologies, little is known about the role of miRNAs in human aging and longevity. Results We employed massively parallel sequencing technology to identify miRNAs expressed in B-cells from Ashkenazi Jewish centenarians, i.e., those living to a hundred and a human model of exceptional longevity, and younger controls without a family history of longevity. With data from 26.7 million reads comprising 9.4 × 108 bp from 3 centenarian and 3 control individuals, we discovered a total of 276 known miRNAs and 8 unknown miRNAs ranging several orders of magnitude in expression levels, a typical characteristics of saturated miRNA-sequencing. A total of 22 miRNAs were found to be significantly upregulated, with only 2 miRNAs downregulated, in centenarians as compared to controls. Gene Ontology analysis of the predicted and validated targets of the 24 differentially expressed miRNAs indicated enrichment of functional pathways involved in cell metabolism, cell cycle, cell signaling, and cell differentiation. A cross sectional expression analysis of the differentially expressed miRNAs in B-cells from Ashkenazi Jewish individuals between the 50th and 100th years of age indicated that expression levels of miR-363* declined significantly with age. Centenarians, however, maintained the youthful expression level. This result suggests that miR-363* may be a candidate longevity-associated miRNA. Conclusion Our comprehensive miRNA data provide a resource for further studies to identify genetic pathways associated with aging and longevity in humans.

  2. Plastid, nuclear and reverse transcriptase sequences in the mitochondrial genome of Oenothera: is genetic information transferred between organelles via RNA?

    Science.gov (United States)

    Schuster, W; Brennicke, A

    1987-01-01

    We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433

  3. Selective amplification and sequencing of cyclic phosphate-containing RNAs by the cP-RNA-seq method.

    Science.gov (United States)

    Honda, Shozo; Morichika, Keisuke; Kirino, Yohei

    2016-03-01

    RNA digestions catalyzed by many ribonucleases generate RNA fragments that contain a 2',3'-cyclic phosphate (cP) at their 3' termini. However, standard RNA-seq methods are unable to accurately capture cP-containing RNAs because the cP inhibits the adapter ligation reaction. We recently developed a method named cP-RNA-seq that is able to selectively amplify and sequence cP-containing RNAs. Here we describe the cP-RNA-seq protocol in which the 3' termini of all RNAs, except those containing a cP, are cleaved through a periodate treatment after phosphatase treatment; hence, subsequent adapter ligation and cDNA amplification steps are exclusively applied to cP-containing RNAs. cP-RNA-seq takes ∼6 d, excluding the time required for sequencing and bioinformatics analyses, which are not covered in detail in this protocol. Biochemical validation of the existence of cP in the identified RNAs takes ∼3 d. Even though the cP-RNA-seq method was developed to identify angiogenin-generating 5'-tRNA halves as a proof of principle, the method should be applicable to global identification of cP-containing RNA repertoires in various transcriptomes.

  4. Elucidating the Small Regulatory RNA Repertoire of the Sea Anemone Anemonia viridis Based on Whole Genome and Small RNA Sequencing.

    Science.gov (United States)

    Urbarova, Ilona; Patel, Hardip; Forêt, Sylvain; Karlsen, Bård Ove; Jørgensen, Tor Erik; Hall-Spencer, Jason M; Johansen, Steinar D

    2018-02-01

    Cnidarians harbor a variety of small regulatory RNAs that include microRNAs (miRNAs) and PIWI-interacting RNAs (piRNAs), but detailed information is limited. Here, we report the identification and expression of novel miRNAs and putative piRNAs, as well as their genomic loci, in the symbiotic sea anemone Anemonia viridis. We generated a draft assembly of the A. viridis genome with putative size of 313 Mb that appeared to be composed of about 36% repeats, including known transposable elements. We detected approximately equal fractions of DNA transposons and retrotransposons. Deep sequencing of small RNA libraries constructed from A. viridis adults sampled at a natural CO2 gradient off Vulcano Island, Italy, identified 70 distinct miRNAs. Eight were homologous to previously reported miRNAs in cnidarians, whereas 62 appeared novel. Nine miRNAs were recognized as differentially expressed along the natural seawater pH gradient. We found a highly abundant and diverse population of piRNAs, with a substantial fraction showing ping-pong signatures. We identified nearly 22% putative piRNAs potentially targeting transposable elements within the A. viridis genome. The A. viridis genome appeared similar in size to that of other hexacorals with a very high divergence of transposable elements resembling that of the sea anemone genus Exaiptasia. The genome encodes and expresses a high number of small regulatory RNAs, which include novel miRNAs and piRNAs. Differentially expressed small RNAs along the seawater pH gradient indicated regulatory gene responses to environmental stressors. © The Author(s) 2018. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  5. Partial nucleotide sequence analysis of 18S ribosomal RNA gene of the four genotypes of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.

    2006-01-01

    Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)

  6. Fast selection of miRNA candidates based on large-scale pre-computed MFE sets of randomized sequences.

    Science.gov (United States)

    Warris, Sven; Boymans, Sander; Muiser, Iwe; Noback, Michiel; Krijnen, Wim; Nap, Jan-Peter

    2014-01-13

    Small RNAs are important regulators of genome function, yet their prediction in genomes is still a major computational challenge. Statistical analyses of pre-miRNA sequences indicated that their 2D structure tends to have a minimal free energy (MFE) significantly lower than MFE values of equivalently randomized sequences with the same nucleotide composition, in contrast to other classes of non-coding RNA. The computation of many MFEs is, however, too intensive to allow for genome-wide screenings. Using a local grid infrastructure, MFE distributions of random sequences were pre-calculated on a large scale. These distributions follow a normal distribution and can be used to determine the MFE distribution for any given sequence composition by interpolation. It allows on-the-fly calculation of the normal distribution for any candidate sequence composition. The speedup achieved makes genome-wide screening with this characteristic of a pre-miRNA sequence practical. Although this particular property alone will not be able to distinguish miRNAs from other sequences sufficiently discriminative, the MFE-based P-value should be added to the parameters of choice to be included in the selection of potential miRNA candidates for experimental verification.

  7. Phylogenetic Analysis of Pasteuria penetrans by 16S rRNA Gene Cloning and Sequencing.

    Science.gov (United States)

    Anderson, J M; Preston, J F; Dickson, D W; Hewlett, T E; Williams, N H; Maruniak, J E

    1999-09-01

    Pasteuria penetrans is an endospore-forming bacterial parasite of Meloidogyne spp. This organism is among the most promising agents for the biological control of root-knot nematodes. In order to establish the phylogenetic position of this species relative to other endospore-forming bacteria, the 16S ribosomal genes from two isolates of P. penetrans, P-20, which preferentially infects M. arenaria race 1, and P-100, which preferentially infects M. incognita and M. javanica, were PCR-amplified from a purified endospore extraction. Universal primers for the 16S rRNA gene were used to amplify DNA which was cloned, and a nucleotide sequence was obtained for 92% of the gene (1,390 base pairs) encoding the 16S rDNA from each isolate. Comparison of both isolates showed identical sequences that were compared to 16S rDNA sequences of 30 other endospore-forming bacteria obtained from GenBank. Parsimony analyses indicated that P. penetrans is a species within a clade that includes Alicyclobacillus acidocaldarius, A. cycloheptanicus, Sulfobacillus sp., Bacillus tusciae, B. schlegelii, and P. ramosa. Its closest neighbor is P. ramosa, a parasite of Daphnia spp. (water fleas). This study provided a genomic basis for the relationship of species assigned to the genus Pasteuria, and for comparison of species that are parasites of different phytopathogenic nematodes.

  8. The nucleotide sequence of the RNA-2 of an isolate of the English serotype of tomato black ring virus: RNA recombination in the history of nepoviruses.

    Science.gov (United States)

    Le Gall, O L; Lanneau, M; Candresse, T; Dunez, J

    1995-05-01

    The RNA-2 of a carrot isolate from the English serotype of tomato black ring nepovirus (TBRV-ED) has been sequenced. It is 4618 nucleotides long and contains one open reading frame encoding a polypeptide of 1344 amino acids. The 5' non-coding region contains three repetitions of a stem-loop structure also conserved in TBRV-Scottish and grapevine chrome mosaic nepovirus (GCMV). The coat protein domain was mapped to the carboxy-terminal one-third of the polyprotein. Sequence comparisons indicate that TBRV-ED RNA-2 probably arose by an RNA recombination event that resulted in the exchange of the putative movement protein gene between TBRV and GCMV.

  9. Mercury's Reference Frames After the MESSENGER Mission

    Science.gov (United States)

    Stark, A.; Oberst, J.; Preusker, F.; Burmeister, S.; Steinbrügge, G.; Hussmann, H.

    2018-05-01

    We provide an overview of Mercury's reference frames based on MESSENGER observations. We discuss the dynamical, the principal-axes, the ellipsoid, as well as the cartographic frame, which was adopted for MESSENGER data products.

  10. SHARAKU: an algorithm for aligning and clustering read mapping profiles of deep sequencing in non-coding RNA processing.

    Science.gov (United States)

    Tsuchiya, Mariko; Amano, Kojiro; Abe, Masaya; Seki, Misato; Hase, Sumitaka; Sato, Kengo; Sakakibara, Yasubumi

    2016-06-15

    Deep sequencing of the transcripts of regulatory non-coding RNA generates footprints of post-transcriptional processes. After obtaining sequence reads, the short reads are mapped to a reference genome, and specific mapping patterns can be detected called read mapping profiles, which are distinct from random non-functional degradation patterns. These patterns reflect the maturation processes that lead to the production of shorter RNA sequences. Recent next-generation sequencing studies have revealed not only the typical maturation process of miRNAs but also the various processing mechanisms of small RNAs derived from tRNAs and snoRNAs. We developed an algorithm termed SHARAKU to align two read mapping profiles of next-generation sequencing outputs for non-coding RNAs. In contrast with previous work, SHARAKU incorporates the primary and secondary sequence structures into an alignment of read mapping profiles to allow for the detection of common processing patterns. Using a benchmark simulated dataset, SHARAKU exhibited superior performance to previous methods for correctly clustering the read mapping profiles with respect to 5'-end processing and 3'-end processing from degradation patterns and in detecting similar processing patterns in deriving the shorter RNAs. Further, using experimental data of small RNA sequencing for the common marmoset brain, SHARAKU succeeded in identifying the significant clusters of read mapping profiles for similar processing patterns of small derived RNA families expressed in the brain. The source code of our program SHARAKU is available at http://www.dna.bio.keio.ac.jp/sharaku/, and the simulated dataset used in this work is available at the same link. Accession code: The sequence data from the whole RNA transcripts in the hippocampus of the left brain used in this work is available from the DNA DataBank of Japan (DDBJ) Sequence Read Archive (DRA) under the accession number DRA004502. yasu@bio.keio.ac.jp Supplementary data are available

  11. RCK: accurate and efficient inference of sequence- and structure-based protein-RNA binding models from RNAcompete data.

    Science.gov (United States)

    Orenstein, Yaron; Wang, Yuhao; Berger, Bonnie

    2016-06-15

    Protein-RNA interactions, which play vital roles in many processes, are mediated through both RNA sequence and structure. CLIP-based methods, which measure protein-RNA binding in vivo, suffer from experimental noise and systematic biases, whereas in vitro experiments capture a clearer signal of protein RNA-binding. Among them, RNAcompete provides binding affinities of a specific protein to more than 240 000 unstructured RNA probes in one experiment. The computational challenge is to infer RNA structure- and sequence-based binding models from these data. The state-of-the-art in sequence models, Deepbind, does not model structural preferences. RNAcontext models both sequence and structure preferences, but is outperformed by GraphProt. Unfortunately, GraphProt cannot detect structural preferences from RNAcompete data due to the unstructured nature of the data, as noted by its developers, nor can it be tractably run on the full RNACompete dataset. We develop RCK, an efficient, scalable algorithm that infers both sequence and structure preferences based on a new k-mer based model. Remarkably, even though RNAcompete data is designed to be unstructured, RCK can still learn structural preferences from it. RCK significantly outperforms both RNAcontext and Deepbind in in vitro binding prediction for 244 RNAcompete experiments. Moreover, RCK is also faster and uses less memory, which enables scalability. While currently on par with existing methods in in vivo binding prediction on a small scale test, we demonstrate that RCK will increasingly benefit from experimentally measured RNA structure profiles as compared to computationally predicted ones. By running RCK on the entire RNAcompete dataset, we generate and provide as a resource a set of protein-RNA structure-based models on an unprecedented scale. Software and models are freely available at http://rck.csail.mit.edu/ bab@mit.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by

  12. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

    Science.gov (United States)

    Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

    2017-04-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  13. Improved annotation of 3' untranslated regions and complex loci by combination of strand-specific direct RNA sequencing, RNA-Seq and ESTs.

    Directory of Open Access Journals (Sweden)

    Nicholas J Schurch

    Full Text Available The reference annotations made for a genome sequence provide the framework for all subsequent analyses of the genome. Correct and complete annotation in addition to the underlying genomic sequence is particularly important when interpreting the results of RNA-seq experiments where short sequence reads are mapped against the genome and assigned to genes according to the annotation. Inconsistencies in annotations between the reference and the experimental system can lead to incorrect interpretation of the effect on RNA expression of an experimental treatment or mutation in the system under study. Until recently, the genome-wide annotation of 3' untranslated regions received less attention than coding regions and the delineation of intron/exon boundaries. In this paper, data produced for samples in Human, Chicken and A. thaliana by the novel single-molecule, strand-specific, Direct RNA Sequencing technology from Helicos Biosciences which locates 3' polyadenylation sites to within +/- 2 nt, were combined with archival EST and RNA-Seq data. Nine examples are illustrated where this combination of data allowed: (1 gene and 3' UTR re-annotation (including extension of one 3' UTR by 5.9 kb; (2 disentangling of gene expression in complex regions; (3 clearer interpretation of small RNA expression and (4 identification of novel genes. While the specific examples displayed here may become obsolete as genome sequences and their annotations are refined, the principles laid out in this paper will be of general use both to those annotating genomes and those seeking to interpret existing publically available annotations in the context of their own experimental data.

  14. The interaction between the iron-responsive element binding protein and its cognate RNA is highly dependent upon both RNA sequence and structure.

    Science.gov (United States)

    Jaffrey, S R; Haile, D J; Klausner, R D; Harford, J B

    1993-09-25

    To assess the influence of RNA sequence/structure on the interaction RNAs with the iron-responsive element binding protein (IRE-BP), twenty eight altered RNAs were tested as competitors for an RNA corresponding to the ferritin H chain IRE. All changes in the loop of the predicted IRE hairpin and in the unpaired cytosine residue characteristically found in IRE stems significantly decreased the apparent affinity of the RNA for the IRE-BP. Similarly, alteration in the spacing and/or orientation of the loop and the unpaired cytosine of the stem by either increasing or decreasing the number of base pairs separating them significantly reduced efficacy as a competitor. It is inferred that the IRE-BP forms multiple contacts with its cognate RNA, and that these contacts, acting in concert, provide the basis for the high affinity of this interaction.

  15. Transcriptome Analysis of Ceriops tagal in Saline Environments Using RNA-Sequencing.

    Directory of Open Access Journals (Sweden)

    Xiaorong Xiao

    Full Text Available Identification of genes involved in mangrove species' adaptation to salt stress can provide valuable information for developing salt-tolerant crops and understanding the molecular evolution of salt tolerance in halophiles. Ceriops tagal is a salt-tolerant mangrove tree growing in mudflats and marshes in tropical and subtropical areas, without any prior genome information. In this study, we assessed the biochemical and transcriptional responses of C. tagal to high salt treatment (500 mmol/L NaCl by hydroponic experiments and RNA-seq. In C. tagal root tissues under salt stress, proline accumulated strongly from 3 to 12 h of treatment; meanwhile, malondialdehyde content progressively increased from 0 to 9 h, then dropped to lower than control levels by 24 h. These implied that C. tagal plants could survive salt stress through biochemical modification. Using the Illumina sequencing platform, approximately 27.39 million RNA-seq reads were obtained from three salt-treated and control (untreated root samples. These reads were assembled into 47,111 transcripts with an average length of 514 bp and an N50 of 632 bp. Approximately 78% of the transcripts were annotated, and a total of 437 genes were putative transcription factors. Digital gene expression analysis was conducted by comparing transcripts from the untreated control to the three salt treated samples, and 7,330 differentially expressed transcripts were identified. Using k-means clustering, these transcripts were divided into six clusters that differed in their expression patterns across four treatment time points. The genes identified as being up- or downregulated are involved in salt stress responses, signal transduction, and DNA repair. Our study shows the main adaptive pathway of C. tagal in saline environments, under short-term and long-term treatments of salt stress. This provides vital clues as to which genes may be candidates for breeding salt-tolerant crops and clarifying molecular

  16. Sequence-engineered mRNA Without Chemical Nucleoside Modifications Enables an Effective Protein Therapy in Large Animals

    Science.gov (United States)

    Thess, Andreas; Grund, Stefanie; Mui, Barbara L; Hope, Michael J; Baumhof, Patrick; Fotin-Mleczek, Mariola; Schlake, Thomas

    2015-01-01

    Being a transient carrier of genetic information, mRNA could be a versatile, flexible, and safe means for protein therapies. While recent findings highlight the enormous therapeutic potential of mRNA, evidence that mRNA-based protein therapies are feasible beyond small animals such as mice is still lacking. Previous studies imply that mRNA therapeutics require chemical nucleoside modifications to obtain sufficient protein expression and avoid activation of the innate immune system. Here we show that chemically unmodified mRNA can achieve those goals as well by applying sequence-engineered molecules. Using erythropoietin (EPO) driven production of red blood cells as the biological model, engineered Epo mRNA elicited meaningful physiological responses from mice to nonhuman primates. Even in pigs of about 20 kg in weight, a single adequate dose of engineered mRNA encapsulated in lipid nanoparticles (LNPs) induced high systemic Epo levels and strong physiological effects. Our results demonstrate that sequence-engineered mRNA has the potential to revolutionize human protein therapies. PMID:26050989

  17. Translation of the flavivirus kunjin NS3 gene in cis but not its RNA sequence or secondary structure is essential for efficient RNA packaging.

    Science.gov (United States)

    Pijlman, Gorben P; Kondratieva, Natasha; Khromykh, Alexander A

    2006-11-01

    Our previous studies using trans-complementation analysis of Kunjin virus (KUN) full-length cDNA clones harboring in-frame deletions in the NS3 gene demonstrated the inability of these defective complemented RNAs to be packaged into virus particles (W. J. Liu, P. L. Sedlak, N. Kondratieva, and A. A. Khromykh, J. Virol. 76:10766-10775). In this study we aimed to establish whether this requirement for NS3 in RNA packaging is determined by the secondary RNA structure of the NS3 gene or by the essential role of the translated NS3 gene product. Multiple silent mutations of three computer-predicted stable RNA structures in the NS3 coding region of KUN replicon RNA aimed at disrupting RNA secondary structure without affecting amino acid sequence did not affect RNA replication and packaging into virus-like particles in the packaging cell line, thus demonstrating that the predicted conserved RNA structures in the NS3 gene do not play a role in RNA replication and/or packaging. In contrast, double frameshift mutations in the NS3 coding region of full-length KUN RNA, producing scrambled NS3 protein but retaining secondary RNA structure, resulted in the loss of ability of these defective RNAs to be packaged into virus particles in complementation experiments in KUN replicon-expressing cells. Furthermore, the more robust complementation-packaging system based on established stable cell lines producing large amounts of complemented replicating NS3-deficient replicon RNAs and infection with KUN virus to provide structural proteins also failed to detect any secreted virus-like particles containing packaged NS3-deficient replicon RNAs. These results have now firmly established the requirement of KUN NS3 protein translated in cis for genome packaging into virus particles.

  18. Conserved properties of dentate gyrus neurogenesis across postnatal development revealed by single-cell RNA sequencing.

    Science.gov (United States)

    Hochgerner, Hannah; Zeisel, Amit; Lönnerberg, Peter; Linnarsson, Sten

    2018-02-01

    The dentate gyrus of the hippocampus is a brain region in which neurogenesis persists into adulthood; however, the relationship between developmental and adult dentate gyrus neurogenesis has not been examined in detail. Here we used single-cell RNA sequencing to reveal the molecular dynamics and diversity of dentate gyrus cell types in perinatal, juvenile, and adult mice. We found distinct quiescent and proliferating progenitor cell types, linked by transient intermediate states to neuroblast stages and fully mature granule cells. We observed shifts in the molecular identity of quiescent and proliferating radial glia and granule cells during the postnatal period that were then maintained through adult stages. In contrast, intermediate progenitor cells, neuroblasts, and immature granule cells were nearly indistinguishable at all ages. These findings demonstrate the fundamental similarity of postnatal and adult neurogenesis in the hippocampus and pinpoint the early postnatal transformation of radial glia from embryonic progenitors to adult quiescent stem cells.

  19. Sequence-specific antimicrobials using efficiently delivered RNA-guided nucleases.

    Science.gov (United States)

    Citorik, Robert J; Mimee, Mark; Lu, Timothy K

    2014-11-01

    Current antibiotics tend to be broad spectrum, leading to indiscriminate killing of commensal bacteria and accelerated evolution of drug resistance. Here, we use CRISPR-Cas technology to create antimicrobials whose spectrum of activity is chosen by design. RNA-guided nucleases (RGNs) targeting specific DNA sequences are delivered efficiently to microbial populations using bacteriophage or bacteria carrying plasmids transmissible by conjugation. The DNA targets of RGNs can be undesirable genes or polymorphisms, including antibiotic resistance and virulence determinants in carbapenem-resistant Enterobacteriaceae and enterohemorrhagic Escherichia coli. Delivery of RGNs significantly improves survival in a Galleria mellonella infection model. We also show that RGNs enable modulation of complex bacterial populations by selective knockdown of targeted strains based on genetic signatures. RGNs constitute a class of highly discriminatory, customizable antimicrobials that enact selective pressure at the DNA level to reduce the prevalence of undesired genes, minimize off-target effects and enable programmable remodeling of microbiota.

  20. Expression profiles of mRNA and long noncoding RNA in the ovaries of letrozole-induced polycystic ovary syndrome rat model through deep sequencing.

    Science.gov (United States)

    Fu, Lu-Lu; Xu, Ying; Li, Dan-Dan; Dai, Xiao-Wei; Xu, Xin; Zhang, Jing-Shun; Ming, Hao; Zhang, Xue-Ying; Zhang, Guo-Qing; Ma, Ya-Lan; Zheng, Lian-Wen

    2018-05-30

    Polycystic ovary syndrome (PCOS) is one of the most common endocrine disorders in reproductive-aged women. However, the exact pathophysiology of PCOS remains largely unclear. We performed deep sequencing to investigate the mRNA and long noncoding RNA (lncRNA) expression profiles in the ovarian tissues of letrozole-induced PCOS rat model and control rats. A total of 2147 mRNAs and 158 lncRNAs were differentially expressed between the PCOS models and control. Gene ontology analysis indicated that differentially expressed mRNAs were associated with biological adhesion, reproduction, and metabolic process. Pathway analysis results indicated that these aberrantly expressed mRNAs were related to several specific signaling pathways, including insulin resistance, steroid hormone biosynthesis, PPAR signaling pathway, cell adhesion molecules, autoimmune thyroid disease, and AMPK signaling pathway. The relative expression levels of mRNAs and lncRNAs were validated through qRT-PCR. LncRNA-miRNA-mRNA network was constructed to explore ceRNAs involved in the PCOS model and were also verified by qRTPCR experiment. These findings may provide insight into the pathogenesis of PCOS and clues to find key diagnostic and therapeutic roles of lncRNA in PCOS. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Physiological and Pathological Transcriptional Activation of Endogenous Retroelements Assessed by RNA-Sequencing of B Lymphocytes

    Directory of Open Access Journals (Sweden)

    Jan Attig

    2017-12-01

    Full Text Available In addition to evolutionarily-accrued sequence mutation or deletion, endogenous retroelements (EREs in eukaryotic genomes are subject to epigenetic silencing, preventing or reducing their transcription, particularly in the germplasm. Nevertheless, transcriptional activation of EREs, including endogenous retroviruses (ERVs and long interspersed nuclear elements (LINEs, is observed in somatic cells, variably upon cellular differentiation and frequently upon cellular transformation. ERE transcription is modulated during physiological and pathological immune cell activation, as well as in immune cell cancers. However, our understanding of the potential consequences of such modulation remains incomplete, partly due to the relative scarcity of information regarding genome-wide ERE transcriptional patterns in immune cells. Here, we describe a methodology that allows probing RNA-sequencing (RNA-seq data for genome-wide expression of EREs in murine and human cells. Our analysis of B cells reveals that their transcriptional response during immune activation is dominated by induction of gene transcription, and that EREs respond to a much lesser extent. The transcriptional activity of the majority of EREs is either unaffected or reduced by B cell activation both in mice and humans, albeit LINEs appear considerably more responsive in the latter host. Nevertheless, a small number of highly distinct ERVs are strongly and consistently induced during B cell activation. Importantly, this pattern contrasts starkly with B cell transformation, which exhibits widespread induction of EREs, including ERVs that minimally overlap with those responsive to immune stimulation. The distinctive patterns of ERE induction suggest different underlying mechanisms and will help separate physiological from pathological expression.

  2. Optimizing a massive parallel sequencing workflow for quantitative miRNA expression analysis.

    Directory of Open Access Journals (Sweden)

    Francesca Cordero

    Full Text Available BACKGROUND: Massive Parallel Sequencing methods (MPS can extend and improve the knowledge obtained by conventional microarray technology, both for mRNAs and short non-coding RNAs, e.g. miRNAs. The processing methods used to extract and interpret the information are an important aspect of dealing with the vast amounts of data generated from short read sequencing. Although the number of computational tools for MPS data analysis is constantly growing, their strengths and weaknesses as part of a complex analytical pipe-line have not yet been well investigated. PRIMARY FINDINGS: A benchmark MPS miRNA dataset, resembling a situation in which miRNAs are spiked in biological replication experiments was assembled by merging a publicly available MPS spike-in miRNAs data set with MPS data derived from healthy donor peripheral blood mononuclear cells. Using this data set we observed that short reads counts estimation is strongly under estimated in case of duplicates miRNAs, if whole genome is used as reference. Furthermore, the sensitivity of miRNAs detection is strongly dependent by the primary tool used in the analysis. Within the six aligners tested, specifically devoted to miRNA detection, SHRiMP and MicroRazerS show the highest sensitivity. Differential expression estimation is quite efficient. Within the five tools investigated, two of them (DESseq, baySeq show a very good specificity and sensitivity in the detection of differential expression. CONCLUSIONS: The results provided by our analysis allow the definition of a clear and simple analytical optimized workflow for miRNAs digital quantitative analysis.

  3. Optimizing a massive parallel sequencing workflow for quantitative miRNA expression analysis.

    Science.gov (United States)

    Cordero, Francesca; Beccuti, Marco; Arigoni, Maddalena; Donatelli, Susanna; Calogero, Raffaele A

    2012-01-01

    Massive Parallel Sequencing methods (MPS) can extend and improve the knowledge obtained by conventional microarray technology, both for mRNAs and short non-coding RNAs, e.g. miRNAs. The processing methods used to extract and interpret the information are an important aspect of dealing with the vast amounts of data generated from short read sequencing. Although the number of computational tools for MPS data analysis is constantly growing, their strengths and weaknesses as part of a complex analytical pipe-line have not yet been well investigated. A benchmark MPS miRNA dataset, resembling a situation in which miRNAs are spiked in biological replication experiments was assembled by merging a publicly available MPS spike-in miRNAs data set with MPS data derived from healthy donor peripheral blood mononuclear cells. Using this data set we observed that short reads counts estimation is strongly under estimated in case of duplicates miRNAs, if whole genome is used as reference. Furthermore, the sensitivity of miRNAs detection is strongly dependent by the primary tool used in the analysis. Within the six aligners tested, specifically devoted to miRNA detection, SHRiMP and MicroRazerS show the highest sensitivity. Differential expression estimation is quite efficient. Within the five tools investigated, two of them (DESseq, baySeq) show a very good specificity and sensitivity in the detection of differential expression. The results provided by our analysis allow the definition of a clear and simple analytical optimized workflow for miRNAs digital quantitative analysis.

  4. RNA.

    Science.gov (United States)

    Darnell, James E., Jr.

    1985-01-01

    Ribonucleic acid (RNA) converts genetic information into protein and usually must be processed to serve its function. RNA types, chemical structure, protein synthesis, translation, manufacture, and processing are discussed. Concludes that the first genes might have been spliced RNA and that humans might be closer than bacteria to primitive…

  5. High-throughput sequencing of plasma microRNA in chronic fatigue syndrome/myalgic encephalomyelitis.

    Directory of Open Access Journals (Sweden)

    Ekua W Brenu

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are known to regulate many biological processes and their dysregulation has been associated with a variety of diseases including Chronic Fatigue Syndrome/Myalgic Encephalomyelitis (CFS/ME. The recent discovery of stable and reproducible miRNA in plasma has raised the possibility that circulating miRNAs may serve as novel diagnostic markers. The objective of this study was to determine the role of plasma miRNA in CFS/ME. RESULTS: Using Illumina high-throughput sequencing we identified 19 miRNAs that were differentially expressed in the plasma of CFS/ME patients in comparison to non-fatigued controls. Following RT-qPCR analysis, we were able to confirm the significant up-regulation of three miRNAs (hsa-miR-127-3p, hsa-miR-142-5p and hsa-miR-143-3p in the CFS/ME patients. CONCLUSION: Our study is the first to identify circulating miRNAs from CFS/ME patients and also to confirm three differentially expressed circulating miRNAs in CFS/ME patients, providing a basis for further study to find useful CFS/ME biomarkers.

  6. High-Throughput Sequencing of Plasma MicroRNA in Chronic Fatigue Syndrome/Myalgic Encephalomyelitis

    Science.gov (United States)

    Brenu, Ekua W.; Ashton, Kevin J.; Batovska, Jana; Staines, Donald R.; Marshall-Gradisnik, Sonya M.

    2014-01-01

    Background MicroRNAs (miRNAs) are known to regulate many biological processes and their dysregulation has been associated with a variety of diseases including Chronic Fatigue Syndrome/Myalgic Encephalomyelitis (CFS/ME). The recent discovery of stable and reproducible miRNA in plasma has raised the possibility that circulating miRNAs may serve as novel diagnostic markers. The objective of this study was to determine the role of plasma miRNA in CFS/ME. Results Using Illumina high-throughput sequencing we identified 19 miRNAs that were differentially expressed in the plasma of CFS/ME patients in comparison to non-fatigued controls. Following RT-qPCR analysis, we were able to confirm the significant up-regulation of three miRNAs (hsa-miR-127-3p, hsa-miR-142-5p and hsa-miR-143-3p) in the CFS/ME patients. Conclusion Our study is the first to identify circulating miRNAs from CFS/ME patients and also to confirm three differentially expressed circulating miRNAs in CFS/ME patients, providing a basis for further study to find useful CFS/ME biomarkers. PMID:25238588

  7. Prokaryotic community profiling of local algae wastewaters using advanced 16S rRNA gene sequencing.

    Science.gov (United States)

    Limayem, Alya; Micciche, Andrew; Nayak, Bina; Mohapatra, Shyam

    2018-01-01

    Algae biomass-fed wastewaters are a promising source of lipid and bioenergy manufacture, revealing substantial end-product investment returns. However, wastewaters would contain lytic pathogens carrying drug resistance detrimental to algae yield and environmental safety. This study was conducted to simultaneously decipher through high-throughput advanced Illumina 16S ribosomal RNA (rRNA) gene sequencing, the cultivable and uncultivable bacterial community profile found in a single sample that was directly recovered from the local wastewater systems. Samples were collected from two previously documented sources including anaerobically digested (AD) municipal wastewater and swine wastewater with algae namely Chlorella spp. in addition to control samples, swine wastewater, and municipal wastewater without algae. Results indicated the presence of a significant level of Bacteria in all samples with an average of approximately 95.49% followed by Archaea 2.34%, in local wastewaters designed for algae cultivation. Taxonomic genus identification indicated the presence of Calothrix, Pseudomonas, and Clostridium as the most prevalent strains in both local municipal and swine wastewater samples containing algae with an average of 17.37, 12.19, and 7.84%, respectively. Interestingly, swine wastewater without algae displayed the lowest level of Pseudomonas strains algae indicates potential coexistence between these strains and algae microenvironment, suggesting further investigations. This finding was particularly relevant for the earlier documented adverse effects of some nosocomial Pseudomonas strains on algae growth and their multidrug resistance potential, requiring the development of targeted bioremediation with regard to the beneficial flora.

  8. Evolutionary patterns in the sequence and structure of transfer RNA: early origins of archaea and viruses.

    Directory of Open Access Journals (Sweden)

    Feng-Jie Sun

    2008-03-01

    Full Text Available Transfer RNAs (tRNAs are ancient molecules that are central to translation. Since they probably carry evolutionary signatures that were left behind when the living world diversified, we reconstructed phylogenies directly from the sequence and structure of tRNA using well-established phylogenetic methods. The trees placed tRNAs with long variable arms charging Sec, Tyr, Ser, and Leu consistently at the base of the rooted phylogenies, but failed to reveal groupings that would indicate clear evolutionary links to organismal origin or molecular functions. In order to uncover evolutionary patterns in the trees, we forced tRNAs into monophyletic groups using constraint analyses to generate timelines of organismal diversification and test competing evolutionary hypotheses. Remarkably, organismal timelines showed Archaea was the most ancestral superkingdom, followed by viruses, then superkingdoms Eukarya and Bacteria, in that order, supporting conclusions from recent phylogenomic studies of protein architecture. Strikingly, constraint analyses showed that the origin of viruses was not only ancient, but was linked to Archaea. Our findings have important implications. They support the notion that the archaeal lineage was very ancient, resulted in the first organismal divide, and predated diversification of tRNA function and specificity. Results are also consistent with the concept that viruses contributed to the development of the DNA replication machinery during the early diversification of the living world.

  9. Identification of Novel Equine (Equus caballus Tendon Markers Using RNA Sequencing

    Directory of Open Access Journals (Sweden)

    Jan M. Kuemmerle

    2016-11-01

    Full Text Available Although several tendon-selective genes exist, they are also expressed in other musculoskeletal tissues. As cell and tissue engineering is reliant on specific molecular markers to discriminate between cell types, tendon-specific genes need to be identified. In order to accomplish this, we have used RNA sequencing (RNA-seq to compare gene expression between tendon, bone, cartilage and ligament from horses. We identified several tendon-selective gene markers, and established eyes absent homolog 2 (EYA2 and a G-protein regulated inducer of neurite outgrowth 3 (GPRIN3 as specific tendon markers using RT-qPCR. Equine tendon cells cultured as three-dimensional spheroids expressed significantly greater levels of EYA2 than GPRIN3, and stained positively for EYA2 using immunohistochemistry. EYA2 was also found in fibroblast-like cells within the tendon tissue matrix and in cells localized to the vascular endothelium. In summary, we have identified EYA2 and GPRIN3 as specific molecular markers of equine tendon as compared to bone, cartilage and ligament, and provide evidence for the use of EYA2 as an additional marker for tendon cells in vitro.

  10. Viroids: from genotype to phenotype just relying on RNA sequence and structural motifs

    Directory of Open Access Journals (Sweden)

    Ricardo eFlores

    2012-06-01

    Full Text Available As a consequence of two unique physical properties, small size and circularity, viroid RNAs do not code for proteins and thus depend on RNA sequence/structural motifs for interacting with host proteins that mediate their invasion, replication, spread, and circumvention of defensive barriers. Viroid genomes fold up on themselves adopting collapsed secondary structures wherein stretches of nucleotides stabilized by Watson-Crick pairs are flanked by apparently unstructured loops. However, compelling data show that they are instead stabilized by alternative non-canonical pairs and that specific loops in the rod-like secondary structure, characteristic of Potato spindle tuber viroid and most other members of the family Pospiviroidae, are critical for replication and systemic trafficking. In contrast, rather than folding into a rod-like secondary structure, most members of the family Avsunvioidae adopt multibranched conformations occasionally stabilized by kissing loop interactions critical for viroid viability in vivo. Besides these most stable secondary structures, viroid RNAs alternatively adopt during replication transient metastable conformations containing elements of local higher-order structure, prominent among which are the hammerhead ribozymes catalyzing a key replicative step in the family Avsunvioidae, and certain conserved hairpins that also mediate replication steps in the family Pospiviroidae. Therefore, different RNA structures ⎯either global or local ⎯ determine different functions, thus highlighting the need for in-depth structural studies on viroid RNAs.

  11. LncRNA Expression Profile of Human Thoracic Aortic Dissection by High-Throughput Sequencing.

    Science.gov (United States)

    Sun, Jie; Chen, Guojun; Jing, Yuanwen; He, Xiang; Dong, Jianting; Zheng, Junmeng; Zou, Meisheng; Li, Hairui; Wang, Shifei; Sun, Yili; Liao, Wangjun; Liao, Yulin; Feng, Li; Bin, Jianping

    2018-01-01

    In this study, the long non-coding RNA (lncRNA) expression profile in human thoracic aortic dissection (TAD), a highly lethal cardiovascular disease, was investigated. Human TAD (n=3) and normal aortic tissues (NA) (n=3) were examined by high-throughput sequencing. Bioinformatics analyses were performed to predict the roles of aberrantly expressed lncRNAs. Quantitative real-time polymerase chain reaction (qRT-PCR) was applied to validate the results. A total of 269 lncRNAs (159 up-regulated and 110 down-regulated) and 2, 255 mRNAs (1 294 up-regulated and 961 down-regulated) were aberrantly expressed in human TAD (fold-change> 1.5, PTAD than in NA. The predicted binding motifs of three up-regulated lncRNAs (ENSG00000248508, ENSG00000226530, and EG00000259719) were correlated with up-regulated RUNX1 (R=0.982, PTAD. These findings suggest that lncRNAs are novel potential therapeutic targets for human TAD. © 2018 The Author(s). Published by S. Karger AG, Basel.

  12. Co-transcriptomic Analysis by RNA Sequencing to Simultaneously Measure Regulated Gene Expression in Host and Bacterial Pathogen

    KAUST Repository

    Ravasi, Timothy; Mavromatis, Charalampos Harris; Bokil, Nilesh J.; Schembri, Mark A.; Sweet, Matthew J.

    2016-01-01

    Intramacrophage pathogens subvert antimicrobial defence pathways using various mechanisms, including the targeting of host TLR-mediated transcriptional responses. Conversely, TLR-inducible host defence mechanisms subject intramacrophage pathogens to stress, thus altering pathogen gene expression programs. Important biological insights can thus be gained through the analysis of gene expression changes in both the host and the pathogen during an infection. Traditionally, research methods have involved the use of qPCR, microarrays and/or RNA sequencing to identify transcriptional changes in either the host or the pathogen. Here we describe the application of RNA sequencing using samples obtained from in vitro infection assays to simultaneously quantify both host and bacterial pathogen gene expression changes, as well as general approaches that can be undertaken to interpret the RNA sequencing data that is generated. These methods can be used to provide insights into host TLR-regulated transcriptional responses to microbial challenge, as well as pathogen subversion mechanisms against such responses.

  13. Co-transcriptomic Analysis by RNA Sequencing to Simultaneously Measure Regulated Gene Expression in Host and Bacterial Pathogen

    KAUST Repository

    Ravasi, Timothy

    2016-01-24

    Intramacrophage pathogens subvert antimicrobial defence pathways using various mechanisms, including the targeting of host TLR-mediated transcriptional responses. Conversely, TLR-inducible host defence mechanisms subject intramacrophage pathogens to stress, thus altering pathogen gene expression programs. Important biological insights can thus be gained through the analysis of gene expression changes in both the host and the pathogen during an infection. Traditionally, research methods have involved the use of qPCR, microarrays and/or RNA sequencing to identify transcriptional changes in either the host or the pathogen. Here we describe the application of RNA sequencing using samples obtained from in vitro infection assays to simultaneously quantify both host and bacterial pathogen gene expression changes, as well as general approaches that can be undertaken to interpret the RNA sequencing data that is generated. These methods can be used to provide insights into host TLR-regulated transcriptional responses to microbial challenge, as well as pathogen subversion mechanisms against such responses.

  14. Comparison of 16S ribosomal RNA gene sequence analysis and conventional culture in the environmental survey of a hospital

    OpenAIRE

    Manaka, Akihiro; Tokue, Yutaka; Murakami, Masami

    2017-01-01

    Background Nosocomial infection is one of the most common complications within health care facilities. Certain studies have reported outbreaks resulting from contaminated hospital environments. Although the identification of bacteria in the environment can readily be achieved using culturing methods, these methods detect live bacteria. Sequencing of the 16S ribosomal RNA (16S rRNA) gene is recognized to be effective for bacterial identification. In this study, we surveyed wards where drug-res...

  15. The nucleotide sequence of RNA1 of Lettuce big-vein virus, genus Varicosavirus, reveals its relation to nonsegmented negative-strand RNA viruses.

    Science.gov (United States)

    Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki

    2002-06-05

    The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.

  16. A framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates.

    Science.gov (United States)

    Helbling, Damian E; Johnson, David R; Lee, Tae Kwon; Scheidegger, Andreas; Fenner, Kathrin

    2015-03-01

    The rates at which wastewater treatment plant (WWTP) microbial communities biotransform specific substrates can differ by orders of magnitude among WWTP communities. Differences in taxonomic compositions among WWTP communities may predict differences in the rates of some types of biotransformations. In this work, we present a novel framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates. We selected ten WWTPs with substantial variation in their environmental and operational metrics and measured the in situ ammonia biotransformation rate constants in nine of them. We isolated total RNA from samples from each WWTP and analyzed 16S rRNA sequence reads. We then developed multivariate models between the measured abundances of specific bacterial 16S rRNA sequence reads and the ammonia biotransformation rate constants. We constructed model scenarios that systematically explored the effects of model regularization, model linearity and non-linearity, and aggregation of 16S rRNA sequences into operational taxonomic units (OTUs) as a function of sequence dissimilarity threshold (SDT). A large percentage (greater than 80%) of model scenarios resulted in well-performing and significant models at intermediate SDTs of 0.13-0.14 and 0.26. The 16S rRNA sequences consistently selected into the well-performing and significant models at those SDTs were classified as Nitrosomonas and Nitrospira groups. We then extend the framework by applying it to the biotransformation rate constants of ten micropollutants measured in batch reactors seeded with the ten WWTP communities. We identified phylogenetic groups that were robustly selected into all well-performing and significant models constructed with biotransformation rates of isoproturon, propachlor, ranitidine, and venlafaxine. These phylogenetic groups can be used as predictive biomarkers of WWTP microbial community activity towards these specific

  17. Transcriptional Responses in root and leaf of Prunus persica Under Drought Stress Using RNA Sequencing

    Directory of Open Access Journals (Sweden)

    Najla Ksouri

    2016-11-01

    Full Text Available Prunus persica L. Batch, or peach, is one of the most important crops and it is widely established in irrigated arid and semi-arid regions. However, due to variations in the climate and the increased aridity, drought has become a major constraint, causing crop losses worldwide. The use of drought-tolerant rootstocks in modern fruit production appears to be a useful method of alleviating water deficit problems. However, the transcriptomic variation and the major molecular mechanisms that underlie the adaptation of drought-tolerant rootstocks to water shortage remain unclear. Hence, in this study, high-throughput sequencing (RNA-seq was performed to assess the transcriptomic changes and the key genes involved in the response to drought in root tissues (GF677 rootstock and leaf tissues (graft, var. Catherina subjected to 16 days of drought stress. In total, 12 RNA libraries were constructed and sequenced. This generated a total of 315M raw reads from both tissues, which allowed the assembly of 22,079 and 17,854 genes associated with the root and leaf tissues, respectively. Subsets of 500 differentially expressed genes (DEGs in roots and 236 in leaves were identified and functionally annotated with 56 gene ontology (GO terms and 99 metabolic pathways, which were mostly associated with aminobenzoate degradation and phenylpropanoid biosynthesis. The GO analysis highlighted the biological functions that were exclusive to the root tissue, such as locomotion, hormone metabolic process, and detection of stimulus, indicating the stress-buffering role of the GF677 rootstock. Furthermore, the complex regulatory network involved in the drought response was revealed, involving proteins that are associated with signaling transduction, transcription and hormone regulation, redox homeostasis, and frontline barriers. We identified two poorly characterized genes in P. persica: growth-regulating factor 5 (GRF5, which may be involved in cellular expansion, and AtHB12

  18. miRanalyzer: a microRNA detection and analysis tool for next-generation sequencing experiments.

    Science.gov (United States)

    Hackenberg, Michael; Sturm, Martin; Langenberger, David; Falcón-Pérez, Juan Manuel; Aransay, Ana M

    2009-07-01

    Next-generation sequencing allows now the sequencing of small RNA molecules and the estimation of their expression levels. Consequently, there will be a high demand of bioinformatics tools to cope with the several gigabytes of sequence data generated in each single deep-sequencing experiment. Given this scene, we developed miRanalyzer, a web server tool for the analysis of deep-sequencing experiments for small RNAs. The web server tool requires a simple input file containing a list of unique reads and its copy numbers (expression levels). Using these data, miRanalyzer (i) detects all known microRNA sequences annotated in miRBase, (ii) finds all perfect matches against other libraries of transcribed sequences and (iii) predicts new microRNAs. The prediction of new microRNAs is an especially important point as there are many species with very few known microRNAs. Therefore, we implemented a highly accurate machine learning algorithm for the prediction of new microRNAs that reaches AUC values of 97.9% and recall values of up to 75% on unseen data. The web tool summarizes all the described steps in a single output page, which provides a comprehensive overview of the analysis, adding links to more detailed output pages for each analysis module. miRanalyzer is available at http://web.bioinformatics.cicbiogune.es/microRNA/.

  19. Identification by 16S rRNA Gene Sequencing of Lactobacillus salivarius Bacteremic Cholecystitis

    Science.gov (United States)

    Woo, Patrick C. Y.; Fung, Ami M. Y.; Lau, Susanna K. P.; Yuen, Kwok-Yung

    2002-01-01

    An anaerobic, nonsporulating, gram-positive bacterium was isolated from blood and bile pus cultures of a 70-year-old man with bacteremic acute cholecystitis. The API 20A system showed that it was 70% Actinomyces naeslundii and 30% Bifidobacterium species, whereas the Vitek ANI system and the ATB ID32A Expression system showed that it was “unidentified.” The 16S rRNA gene of the strain was amplified and sequenced. There were 3 base differences between the nucleotide sequence of the isolate and that of Lactobacillus salivarius subsp. salivarius or L. salivarius subsp. salicinius, indicating that the isolate was a strain of L. salivarius. The patient responded to cholecystectomy and a 2-week course of antibiotic treatment. Identification of the organism in the present study was important because the duration of antibiotic therapy would have been entirely different depending on the organism. If the bacterium had been identified as Actinomyces, penicillin for 6 months would have been the regimen of choice. However, it was Lactobacillus, and a 2-week course of antibiotic was sufficient. PMID:11773128

  20. Sequence organization and control of transcription in the bacteriophage T4 tRNA region.

    Science.gov (United States)

    Broida, J; Abelson, J

    1985-10-05

    Bacteriophage T4 contains genes for eight transfer RNAs and two stable RNAs of unknown function. These are found in two clusters at 70 X 10(3) base-pairs on the T4 genetic map. To understand the control of transcription in this region we have completed the sequencing of 5000 base-pairs in this region. The sequence contains a part of gene 3, gene 1, gene 57, internal protein I, the tRNA genes and five open reading frames which most likely code for heretofore unidentified proteins. We have used subclones of the region to investigate the kinetics of transcription in vivo. The results show that transcription in this region consists of overlapping early, middle and late transcripts. Transcription is directed from two early promoters, one or two middle promoters and perhaps two late promoters. This region contains all of the features that are seen in T4 transcription and as such is a good place to study the phenomenon in more detail.

  1. Identifying transposon insertions and their effects from RNA-sequencing data.

    Science.gov (United States)

    de Ruiter, Julian R; Kas, Sjors M; Schut, Eva; Adams, David J; Koudijs, Marco J; Wessels, Lodewyk F A; Jonkers, Jos

    2017-07-07

    Insertional mutagenesis using engineered transposons is a potent forward genetic screening technique used to identify cancer genes in mouse model systems. In the analysis of these screens, transposon insertion sites are typically identified by targeted DNA-sequencing and subsequently assigned to predicted target genes using heuristics. As such, these approaches provide no direct evidence that insertions actually affect their predicted targets or how transcripts of these genes are affected. To address this, we developed IM-Fusion, an approach that identifies insertion sites from gene-transposon fusions in standard single- and paired-end RNA-sequencing data. We demonstrate IM-Fusion on two separate transposon screens of 123 mammary tumors and 20 B-cell acute lymphoblastic leukemias, respectively. We show that IM-Fusion accurately identifies transposon insertions and their true target genes. Furthermore, by combining the identified insertion sites with expression quantification, we show that we can determine the effect of a transposon insertion on its target gene(s) and prioritize insertions that have a significant effect on expression. We expect that IM-Fusion will significantly enhance the accuracy of cancer gene discovery in forward genetic screens and provide initial insight into the biological effects of insertions on candidate cancer genes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. RNA Sequencing of Formalin-Fixed, Paraffin-Embedded Specimens for Gene Expression Quantification and Data Mining

    Directory of Open Access Journals (Sweden)

    Yan Guo

    2016-01-01

    Full Text Available Background. Proper rRNA depletion is crucial for the successful utilization of FFPE specimens when studying gene expression. We performed a study to evaluate two major rRNA depletion methods: Ribo-Zero and RNase H. RNAs extracted from 4 samples were treated with the two rRNA depletion methods in duplicate and sequenced (N=16. We evaluated their reducibility, ability to detect RNA, and ability to molecularly subtype these triple negative breast cancer specimens. Results. Both rRNA depletion methods produced consistent data between the technical replicates. We found that the RNase H method produced higher quality RNAseq data as compared to the Ribo-Zero method. In addition, we evaluated the RNAseq data generated from the FFPE tissue samples for noncoding RNA, including lncRNA, enhancer/super enhancer RNA, and single nucleotide variation (SNV. We found that the RNase H is more suitable for detecting high-quality, noncoding RNAs as compared to the Ribo-Zero and provided more consistent molecular subtype identification between replicates. Unfortunately, neither method produced reliable SNV data. Conclusions. In conclusion, for FFPE specimens, the RNase H rRNA depletion method performed better than the Ribo-Zero. Neither method generates data sufficient for SNV detection.

  3. Direct detection of RNA in vitro and in situ by target-primed RCA: The impact of E. coli RNase III on the detection efficiency of RNA sequences distanced far from the 3'-end.

    Science.gov (United States)

    Merkiene, Egle; Gaidamaviciute, Edita; Riauba, Laurynas; Janulaitis, Arvydas; Lagunavicius, Arunas

    2010-08-01

    We improved the target RNA-primed RCA technique for direct detection and analysis of RNA in vitro and in situ. Previously we showed that the 3' --> 5' single-stranded RNA exonucleolytic activity of Phi29 DNA polymerase converts the target RNA into a primer and uses it for RCA initiation. However, in some cases, the single-stranded RNA exoribonucleolytic activity of the polymerase is hindered by strong double-stranded structures at the 3'-end of target RNAs. We demonstrate that in such hampered cases, the double-stranded RNA-specific Escherichia coli RNase III efficiently assists Phi29 DNA polymerase in converting the target RNA into a primer. These observations extend the target RNA-primed RCA possibilities to test RNA sequences distanced far from the 3'-end and customize this technique for the inner RNA sequence analysis.

  4. Phenomenologies of Higgs messenger models

    Energy Technology Data Exchange (ETDEWEB)

    Zheng Sibo; Yu Yao; Wu Xinggang [Department of Physics, Chongqing University, Chongqing 401331 (China)

    2011-08-11

    In this Letter, we investigate the phenomenologies of models where the Higgs sector plays the role of messengers in gauge mediation. The minimal Higgs sector and its extension are considered respectively. We find that there exist viable models when an appropriate parity is imposed. Phenomenological features in these kind of models include three sum rules for scalar masses, light gluino as well as one-loop {mu} and two-loop B{mu} terms.

  5. Advantages and Limitations of Ribosomal RNA PCR and DNA Sequencing for Identification of Bacteria in Cardiac Valves of Danish Patients

    DEFF Research Database (Denmark)

    Kemp, Michael; Bangsborg, Jette; Kjerulf, Anne

    2013-01-01

    of direct molecular identification should also address weaknesses, their relevance in the given setting, and possible improvements. In this study cardiac valves from 56 Danish patients referred for surgery for infective endocarditis were analysed by microscopy and culture as well as by PCR targeting part...... of the bacterial 16S rRNA gene followed by DNA sequencing of the PCR product. PCR and DNA sequencing identified significant bacteria in 49 samples from 43 patients, including five out of 13 culture-negative cases. No rare, exotic, or intracellular bacteria were identified. There was a general agreement between...... bacterial identity obtained by ribosomal PCR and DNA sequencing from the valves and bacterial isolates from blood culture. However, DNA sequencing of the 16S rRNA gene did not discriminate well among non-haemolytic streptococci, especially within the Streptococcus mitis group. Ribosomal PCR with subsequent...

  6. Sequence walkers: a graphical method to display how binding proteins interact with DNA or RNA sequences | Center for Cancer Research

    Science.gov (United States)

    A graphical method is presented for displaying how binding proteins and other macromolecules interact with individual bases of nucleotide sequences. Characters representing the sequence are either oriented normally and placed above a line indicating favorable contact, or upside-down and placed below the line indicating unfavorable contact. The positive or negative height of each letter shows the contribution of that base to the average sequence conservation of the binding site, as represented by a sequence logo.

  7. Identification of human microRNA-like sequences embedded within the protein-encoding genes of the human immunodeficiency virus.

    Directory of Open Access Journals (Sweden)

    Bryan Holland

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are highly conserved, short (18-22 nts, non-coding RNA molecules that regulate gene expression by binding to the 3' untranslated regions (3'UTRs of mRNAs. While numerous cellular microRNAs have been associated with the progression of various diseases including cancer, miRNAs associated with retroviruses have not been well characterized. Herein we report identification of microRNA-like sequences in coding regions of several HIV-1 genomes. RESULTS: Based on our earlier proteomics and bioinformatics studies, we have identified 8 cellular miRNAs that are predicted to bind to the mRNAs of multiple proteins that are dysregulated during HIV-infection of CD4+ T-cells in vitro. In silico analysis of the full length and mature sequences of these 8 miRNAs and comparisons with all the genomic and subgenomic sequences of HIV-1 strains in global databases revealed that the first 18/18 sequences of the mature hsa-miR-195 sequence (including the short seed sequence, matched perfectly (100%, or with one nucleotide mismatch, within the envelope (env genes of five HIV-1 genomes from Africa. In addition, we have identified 4 other miRNA-like sequences (hsa-miR-30d, hsa-miR-30e, hsa-miR-374a and hsa-miR-424 within the env and the gag-pol encoding regions of several HIV-1 strains, albeit with reduced homology. Mapping of the miRNA-homologues of env within HIV-1 genomes localized these sequence to the functionally significant variable regions of the env glycoprotein gp120 designated V1, V2, V4 and V5. CONCLUSIONS: We conclude that microRNA-like sequences are embedded within the protein-encoding regions of several HIV-1 genomes. Given that the V1 to V5 regions of HIV-1 envelopes contain specific, well-characterized domains that are critical for immune responses, virus neutralization and disease progression, we propose that the newly discovered miRNA-like sequences within the HIV-1 genomes may have evolved to self-regulate survival of the

  8. Integrated analysis of RNA-binding protein complexes using in vitro selection and high-throughput sequencing and sequence specificity landscapes (SEQRS).

    Science.gov (United States)

    Lou, Tzu-Fang; Weidmann, Chase A; Killingsworth, Jordan; Tanaka Hall, Traci M; Goldstrohm, Aaron C; Campbell, Zachary T

    2017-04-15

    RNA-binding proteins (RBPs) collaborate to control virtually every aspect of RNA function. Tremendous progress has been made in the area of global assessment of RBP specificity using next-generation sequencing approaches both in vivo and in vitro. Understanding how protein-protein interactions enable precise combinatorial regulation of RNA remains a significant problem. Addressing this challenge requires tools that can quantitatively determine the specificities of both individual proteins and multimeric complexes in an unbiased and comprehensive way. One approach utilizes in vitro selection, high-throughput sequencing, and sequence-specificity landscapes (SEQRS). We outline a SEQRS experiment focused on obtaining the specificity of a multi-protein complex between Drosophila RBPs Pumilio (Pum) and Nanos (Nos). We discuss the necessary controls in this type of experiment and examine how the resulting data can be complemented with structural and cell-based reporter assays. Additionally, SEQRS data can be integrated with functional genomics data to uncover biological function. Finally, we propose extensions of the technique that will enhance our understanding of multi-protein regulatory complexes assembled onto RNA. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Molecular characterizations of somatic hybrids developed between Pleurotus florida and Lentinus squarrosulus through inter-simple sequence repeat markers and sequencing of ribosomal RNA-ITS gene.

    Science.gov (United States)

    Mallick, Pijush; Chattaraj, Shruti; Sikdar, Samir Ranjan

    2017-10-01

    The 12 pfls somatic hybrids and 2 parents of Pleurotus florida and Lentinus s quarrosulus were characterized by ISSR and sequencing of rRNA-ITS genes. Five ISSR primers were used and amplified a total of 54 reproducible fragments with 98.14% polymorphism among all the pfls hybrid populations and parental strains. UPGMA-based cluster exhibited a dendrogram with three major groups between the parents and pfls hybrids. Parent P . florida and L . squarrosulus showed different degrees of genetic distance with all the hybrid lines and they showed closeness to hybrid pfls 1m and pfls 1h , respectively. ITS1(F) and ITS4(R) amplified the rRNA-ITS gene with 611-867 bp sequence length. The nucleotide polymorphisms were found in the ITS1, ITS2 and 5.8S rRNA region with different number of bases. Based on rRNA-ITS sequence, UPGMA cluster exhibited three distinct groups between L. squarrosulus and pfls 1p , pfls 1m and pfls 1s , and pfls 1e and P. florida .

  10. Correlation between sequence conservation and structural thermodynamics of microRNA precursors from human, mouse, and chicken genomes

    Directory of Open Access Journals (Sweden)

    Wang Shengqi

    2010-10-01

    Full Text Available Abstract Background Previous studies have shown that microRNA precursors (pre-miRNAs have considerably more stable secondary structures than other native RNAs (tRNA, rRNA, and mRNA and artificial RNA sequences. However, pre-miRNAs with ultra stable secondary structures have not been investigated. It is not known if there is a tendency in pre-miRNA sequences towards or against ultra stable structures? Furthermore, the relationship between the structural thermodynamic stability of pre-miRNA and their evolution remains unclear. Results We investigated the correlation between pre-miRNA sequence conservation and structural stability as measured by adjusted minimum folding free energies in pre-miRNAs isolated from human, mouse, and chicken. The analysis revealed that conserved and non-conserved pre-miRNA sequences had structures with similar average stabilities. However, the relatively ultra stable and unstable pre-miRNAs were more likely to be non-conserved than pre-miRNAs with moderate stability. Non-conserved pre-miRNAs had more G+C than A+U nucleotides, while conserved pre-miRNAs contained more A+U nucleotides. Notably, the U content of conserved pre-miRNAs was especially higher than that of non-conserved pre-miRNAs. Further investigations showed that conserved and non-conserved pre-miRNAs exhibited different structural element features, even though they had comparable levels of stability. Conclusions We proposed that there is a correlation between structural thermodynamic stability and sequence conservation for pre-miRNAs from human, mouse, and chicken genomes. Our analyses suggested that pre-miRNAs with relatively ultra stable or unstable structures were less favoured by natural selection than those with moderately stable structures. Comparison of nucleotide compositions between non-conserved and conserved pre-miRNAs indicated the importance of U nucleotides in the pre-miRNA evolutionary process. Several characteristic structural elements were

  11. Geodesy at Mercury with MESSENGER

    Science.gov (United States)

    Smith, David E.; Zuber, Maria t.; Peale, Stanley J.; Phillips, Roger J.; Solomon, Sean C.

    2006-01-01

    In 2011 the MESSENGER (MErcury Surface, Space ENvironment, GEochemistry, and Ranging) spacecraft will enter Mercury orbit and begin the mapping phase of the mission. As part of its science objectives the MESSENGER mission will determine the shape and gravity field of Mercury. These observations will enable the topography and the crustal thickness to be derived for the planet and will determine the small libration of the planet about its axis, the latter critical to constraining the state of the core. These measurements require very precise positioning of the MESSENGER spacecraft in its eccentric orbit, which has a periapsis altitude as low as 200 km, an apoapsis altitude near 15,000 km, and a closest approach to the surface varying from latitude 60 to about 70 N. The X-band tracking of MESSENGER and the laser altimetry are the primary data that will be used to measure the planetary shape and gravity field. The laser altimeter, which has an expected range of 1000 to 1200 km, is expected to provide significant data only over the northern hemisphere because of MESSENGER's eccentric orbit. For the southern hemisphere, radio occultation measurements obtained as the spacecraft passes behind the planet as seen from Earth and images obtained with the imaging system will be used to provide the long-wavelength shape of the planet. Gravity, derived from the tracking data, will also have greater resolution in the northern hemisphere, but full global models for both topography and gravity will be obtained at low harmonic order and degree. The limiting factor for both gravity and topography is expected to be knowledge of the spacecraft location. Present estimations are that in a combined tracking, altimetry, and occultation solution the spacecraft position uncertainty is likely to be of order 10 m. This accuracy should be adequate for establishing an initial geodetic coordinate system for Mercury that will enable positioning of imaged features on the surface, determination of

  12. Molecular characterization and phylogenetic relationships among microsporidian isolates infecting silkworm, Bombyx mori using small subunit rRNA (SSU-rRNA) gene sequence analysis.

    Science.gov (United States)

    Nath, B Surendra; Gupta, S K; Bajpai, A K

    2012-12-01

    The life cycle, spore morphology, pathogenicity, tissue specificity, mode of transmission and small subunit rRNA (SSU-rRNA) gene sequence analysis of the five new microsporidian isolates viz., NIWB-11bp, NIWB-12n, NIWB-13md, NIWB-14b and NIWB-15mb identified from the silkworm, Bombyx mori have been studied along with type species, NIK-1s_mys. The life cycle of the microsporidians identified exhibited the sequential developmental cycles that are similar to the general developmental cycle of the genus, Nosema. The spores showed considerable variations in their shape, length and width. The pathogenicity observed was dose-dependent and differed from each of the microsporidian isolates; the NIWB-15mb was found to be more virulent than other isolates. All of the microsporidians were found to infect most of the tissues examined and showed gonadal infection and transovarial transmission in the infected silkworms. SSU-rRNA sequence based phylogenetic tree placed NIWB-14b, NIWB-12n and NIWB-11bp in a separate branch along with other Nosema species and Nosema bombycis; while NIWB-15mb and NIWB-13md together formed another cluster along with other Nosema species. NIK-1s_mys revealed a signature sequence similar to standard type species, N. bombycis, indicating that NIK-1s_mys is similar to N. bombycis. Based on phylogenetic relationships, branch length information based on genetic distance and nucleotide differences, we conclude that the microsporidian isolates identified are distinctly different from the other known species and belonging to the genus, Nosema. This SSU-rRNA gene sequence analysis method is found to be more useful approach in detecting different and closely related microsporidians of this economically important domestic insect.

  13. Sample size calculation while controlling false discovery rate for differential expression analysis with RNA-sequencing experiments.

    Science.gov (United States)

    Bi, Ran; Liu, Peng

    2016-03-31

    RNA-Sequencing (RNA-seq) experiments have been popularly applied to transcriptome studies in recent years. Such experiments are still relatively costly. As a result, RNA-seq experiments often employ a small number of replicates. Power analysis and sample size calculation are challenging in the context of differential expression analysis with RNA-seq data. One challenge is that there are no closed-form formulae to calculate power for the popularly applied tests for differential expression analysis. In addition, false discovery rate (FDR), instead of family-wise type I error rate, is controlled for the multiple testing error in RNA-seq data analysis. So far, there are very few proposals on sample size calculation for RNA-seq experiments. In this paper, we propose a procedure for sample size calculation while controlling FDR for RNA-seq experimental design. Our procedure is based on the weighted linear model analysis facilitated by the voom method which has been shown to have competitive performance in terms of power and FDR control for RNA-seq differential expression analysis. We derive a method that approximates the average power across the differentially expressed genes, and then calculate the sample size to achieve a desired average power while controlling FDR. Simulation results demonstrate that the actual power of several popularly applied tests for differential expression is achieved and is close to the desired power for RNA-seq data with sample size calculated based on our method. Our proposed method provides an efficient algorithm to calculate sample size while controlling FDR for RNA-seq experimental design. We also provide an R package ssizeRNA that implements our proposed method and can be downloaded from the Comprehensive R Archive Network ( http://cran.r-project.org ).

  14. Microbial Dark Matter: Unusual intervening sequences in 16S rRNA genes of candidate phyla from the deep subsurface

    Energy Technology Data Exchange (ETDEWEB)

    Jarett, Jessica; Stepanauskas, Ramunas; Kieft, Thomas; Onstott, Tullis; Woyke, Tanja

    2014-03-17

    The Microbial Dark Matter project has sequenced genomes from over 200 single cells from candidate phyla, greatly expanding our knowledge of the ecology, inferred metabolism, and evolution of these widely distributed, yet poorly understood lineages. The second phase of this project aims to sequence an additional 800 single cells from known as well as potentially novel candidate phyla derived from a variety of environments. In order to identify whole genome amplified single cells, screening based on phylogenetic placement of 16S rRNA gene sequences is being conducted. Briefly, derived 16S rRNA gene sequences are aligned to a custom version of the Greengenes reference database and added to a reference tree in ARB using parsimony. In multiple samples from deep subsurface habitats but not from other habitats, a large number of sequences proved difficult to align and therefore to place in the tree. Based on comparisons to reference sequences and structural alignments using SSU-ALIGN, many of these ?difficult? sequences appear to originate from candidate phyla, and contain intervening sequences (IVSs) within the 16S rRNA genes. These IVSs are short (39 - 79 nt) and do not appear to be self-splicing or to contain open reading frames. IVSs were found in the loop regions of stem-loop structures in several different taxonomic groups. Phylogenetic placement of sequences is strongly affected by IVSs; two out of three groups investigated were classified as different phyla after their removal. Based on data from samples screened in this project, IVSs appear to be more common in microbes occurring in deep subsurface habitats, although the reasons for this remain elusive.

  15. Thousands of primer-free, high-quality, full-length SSU rRNA sequences from all domains of life

    DEFF Research Database (Denmark)

    Karst, Soeren M; Dueholm, Morten S; McIlroy, Simon J

    2016-01-01

    Ribosomal RNA (rRNA) genes are the consensus marker for determination of microbial diversity on the planet, invaluable in studies of evolution and, for the past decade, high-throughput sequencing of variable regions of ribosomal RNA genes has become the backbone of most microbial ecology studies...... (SSU) rRNA genes and synthetic long read sequencing by molecular tagging, to generate primer-free, full-length SSU rRNA gene sequences from all domains of life, with a median raw error rate of 0.17%. We generated thousands of full-length SSU rRNA sequences from five well-studied ecosystems (soil, human...... gut, fresh water, anaerobic digestion, and activated sludge) and obtained sequences covering all domains of life and the majority of all described phyla. Interestingly, 30% of all bacterial operational taxonomic units were novel, compared to the SILVA database (less than 97% similarity...

  16. Gene expression profiling of liver cancer stem cells by RNA-sequencing.

    Directory of Open Access Journals (Sweden)

    David W Y Ho

    Full Text Available BACKGROUND: Accumulating evidence supports that tumor growth and cancer relapse are driven by cancer stem cells. Our previous work has demonstrated the existence of CD90(+ liver cancer stem cells (CSCs in hepatocellular carcinoma (HCC. Nevertheless, the characteristics of these cells are still poorly understood. In this study, we employed a more sensitive RNA-sequencing (RNA-Seq to compare the gene expression profiling of CD90(+ cells sorted from tumor (CD90(+CSCs with parallel non-tumorous liver tissues (CD90(+NTSCs and elucidate the roles of putative target genes in hepatocarcinogenesis. METHODOLOGY/PRINCIPAL FINDINGS: CD90(+ cells were sorted respectively from tumor and adjacent non-tumorous human liver tissues using fluorescence-activated cell sorting. The amplified RNAs of CD90(+ cells from 3 HCC patients were subjected to RNA-Seq analysis. A differential gene expression profile was established between CD90(+CSCs and CD90(+NTSCs, and validated by quantitative real-time PCR (qRT-PCR on the same set of amplified RNAs, and further confirmed in an independent cohort of 12 HCC patients. Five hundred genes were differentially expressed (119 up-regulated and 381 down-regulated genes between CD90(+CSCs and CD90(+NTSCs. Gene ontology analysis indicated that the over-expressed genes in CD90(+CSCs were associated with inflammation, drug resistance and lipid metabolism. Among the differentially expressed genes, glypican-3 (GPC3, a member of glypican family, was markedly elevated in CD90(+CSCs compared to CD90(+NTSCs. Immunohistochemistry demonstrated that GPC3 was highly expressed in forty-two human liver tumor tissues but absent in adjacent non-tumorous liver tissues. Flow cytometry indicated that GPC3 was highly expressed in liver CD90(+CSCs and mature cancer cells in liver cancer cell lines and human liver tumor tissues. Furthermore, GPC3 expression was positively correlated with the number of CD90(+CSCs in liver tumor tissues. CONCLUSIONS

  17. Gene Expression Profiling of Liver Cancer Stem Cells by RNA-Sequencing

    Science.gov (United States)

    Lam, Chi Tat; Ng, Michael N. P.; Yu, Wan Ching; Lau, Joyce; Wan, Timothy; Wang, Xiaoqi; Yan, Zhixiang; Liu, Hang; Fan, Sheung Tat

    2012-01-01

    Background Accumulating evidence supports that tumor growth and cancer relapse are driven by cancer stem cells. Our previous work has demonstrated the existence of CD90+ liver cancer stem cells (CSCs) in hepatocellular carcinoma (HCC). Nevertheless, the characteristics of these cells are still poorly understood. In this study, we employed a more sensitive RNA-sequencing (RNA-Seq) to compare the gene expression profiling of CD90+ cells sorted from tumor (CD90+CSCs) with parallel non-tumorous liver tissues (CD90+NTSCs) and elucidate the roles of putative target genes in hepatocarcinogenesis. Methodology/Principal Findings CD90+ cells were sorted respectively from tumor and adjacent non-tumorous human liver tissues using fluorescence-activated cell sorting. The amplified RNAs of CD90+ cells from 3 HCC patients were subjected to RNA-Seq analysis. A differential gene expression profile was established between CD90+CSCs and CD90+NTSCs, and validated by quantitative real-time PCR (qRT-PCR) on the same set of amplified RNAs, and further confirmed in an independent cohort of 12 HCC patients. Five hundred genes were differentially expressed (119 up-regulated and 381 down-regulated genes) between CD90+CSCs and CD90+NTSCs. Gene ontology analysis indicated that the over-expressed genes in CD90+CSCs were associated with inflammation, drug resistance and lipid metabolism. Among the differentially expressed genes, glypican-3 (GPC3), a member of glypican family, was markedly elevated in CD90+CSCs compared to CD90+NTSCs. Immunohistochemistry demonstrated that GPC3 was highly expressed in forty-two human liver tumor tissues but absent in adjacent non-tumorous liver tissues. Flow cytometry indicated that GPC3 was highly expressed in liver CD90+CSCs and mature cancer cells in liver cancer cell lines and human liver tumor tissues. Furthermore, GPC3 expression was positively correlated with the number of CD90+CSCs in liver tumor tissues. Conclusions/Significance The identified genes

  18. Ontogeny of hepatic energy metabolism genes in mice as revealed by RNA-sequencing.

    Directory of Open Access Journals (Sweden)

    Helen J Renaud

    Full Text Available The liver plays a central role in metabolic homeostasis by coordinating synthesis, storage, breakdown, and redistribution of nutrients. Hepatic energy metabolism is dynamically regulated throughout different life stages due to different demands for energy during growth and development. However, changes in gene expression patterns throughout ontogeny for factors important in hepatic energy metabolism are not well understood. We performed detailed transcript analysis of energy metabolism genes during various stages of liver development in mice. Livers from male C57BL/6J mice were collected at twelve ages, including perinatal and postnatal time points (n = 3/age. The mRNA was quantified by RNA-Sequencing, with transcript abundance estimated by Cufflinks. One thousand sixty energy metabolism genes were examined; 794 were above detection, of which 627 were significantly changed during at least one developmental age compared to adult liver. Two-way hierarchical clustering revealed three major clusters dependent on age: GD17.5-Day 5 (perinatal-enriched, Day 10-Day 20 (pre-weaning-enriched, and Day 25-Day 60 (adolescence/adulthood-enriched. Clustering analysis of cumulative mRNA expression values for individual pathways of energy metabolism revealed three patterns of enrichment: glycolysis, ketogenesis, and glycogenesis were all perinatally-enriched; glycogenolysis was the only pathway enriched during pre-weaning ages; whereas lipid droplet metabolism, cholesterol and bile acid metabolism, gluconeogenesis, and lipid metabolism were all enriched in adolescence/adulthood. This study reveals novel findings such as the divergent expression of the fatty acid β-oxidation enzymes Acyl-CoA oxidase 1 and Carnitine palmitoyltransferase 1a, indicating a switch from mitochondrial to peroxisomal β-oxidation after weaning; as well as the dynamic ontogeny of genes implicated in obesity such as Stearoyl-CoA desaturase 1 and Elongation of very long chain fatty

  19. Campylobacter jejuni, an uncommon cause of splenic abscess diagnosed by 16S rRNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Piseth Seng

    2014-12-01

    Full Text Available Splenic abscess is a rare disease that primarily occurs in patients with splenic trauma, endocarditis, sickle cell anemia, or other diseases that compromise the immune system. This report describes a culture-negative splenic abscess in an immunocompetent patient caused by Campylobacter jejuni, as determined by 16S rRNA gene sequencing.

  20. DeAnnIso: a tool for online detection and annotation of isomiRs from small RNA sequencing data.

    Science.gov (United States)

    Zhang, Yuanwei; Zang, Qiguang; Zhang, Huan; Ban, Rongjun; Yang, Yifan; Iqbal, Furhan; Li, Ao; Shi, Qinghua

    2016-07-08

    Small RNA (sRNA) Sequencing technology has revealed that microRNAs (miRNAs) are capable of exhibiting frequent variations from their canonical sequences, generating multiple variants: the isoforms of miRNAs (isomiRs). However, integrated tool to precisely detect and systematically annotate isomiRs from sRNA sequencing data is still in great demand. Here, we present an online tool, DeAnnIso (Detection and Annotation of IsomiRs from sRNA sequencing data). DeAnnIso can detect all the isomiRs in an uploaded sample, and can extract the differentially expressing isomiRs from paired or multiple samples. Once the isomiRs detection is accomplished, detailed annotation information, including isomiRs expression, isomiRs classification, SNPs in miRNAs and tissue specific isomiR expression are provided to users. Furthermore, DeAnnIso provides a comprehensive module of target analysis and enrichment analysis for the selected isomiRs. Taken together, DeAnnIso is convenient for users to screen for isomiRs of their interest and useful for further functional studies. The server is implemented in PHP + Perl + R and available to all users for free at: http://mcg.ustc.edu.cn/bsc/deanniso/ and http://mcg2.ustc.edu.cn/bsc/deanniso/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Massively parallel sequencing, aCGH, and RNA-Seq technologies provide a comprehensive molecular diagnosis of Fanconi anemia.

    Science.gov (United States)

    Chandrasekharappa, Settara C; Lach, Francis P; Kimble, Danielle C; Kamat, Aparna; Teer, Jamie K; Donovan, Frank X; Flynn, Elizabeth; Sen, Shurjo K; Thongthip, Supawat; Sanborn, Erica; Smogorzewska, Agata; Auerbach, Arleen D; Ostrander, Elaine A

    2013-05-30

    Current methods for detecting mutations in Fanconi anemia (FA)-suspected patients are inefficient and often miss mutations. We have applied recent advances in DNA sequencing and genomic capture to the diagnosis of FA. Specifically, we used custom molecular inversion probes or TruSeq-enrichment oligos to capture and sequence FA and related genes, including introns, from 27 samples from the International Fanconi Anemia Registry at The Rockefeller University. DNA sequencing was complemented with custom array comparative genomic hybridization (aCGH) and RNA sequencing (RNA-seq) analysis. aCGH identified deletions/duplications in 4 different FA genes. RNA-seq analysis revealed lack of allele specific expression associated with a deletion and splicing defects caused by missense, synonymous, and deep-in-intron variants. The combination of TruSeq-targeted capture, aCGH, and RNA-seq enabled us to identify the complementation group and biallelic germline mutations in all 27 families: FANCA (7), FANCB (3), FANCC (3), FANCD1 (1), FANCD2 (3), FANCF (2), FANCG (2), FANCI (1), FANCJ (2), and FANCL (3). FANCC mutations are often the cause of FA in patients of Ashkenazi Jewish (AJ) ancestry, and we identified 2 novel FANCC mutations in 2 patients of AJ ancestry. We describe here a strategy for efficient molecular diagnosis of FA.

  2. Direct 16S rRNA gene sequencing of polymicrobial culture-negative samples with analysis of mixed chromatograms

    DEFF Research Database (Denmark)

    Hartmeyer, Gitte N; Justesen, Ulrik S

    2010-01-01

    Two cases involving polymicrobial culture-negative samples were investigated by 16S rRNA gene sequencing, with analysis of mixed chromatograms. Fusobacterium necrophorum, Prevotella intermedia and Streptococcus constellatus were identified from pleural fluid in a patient with Lemierre's syndrome...

  3. A high-throughput method to detect RNA profiling by integration of RT-MLPA with next generation sequencing technology.

    Science.gov (United States)

    Wang, Jing; Yang, Xue; Chen, Haofeng; Wang, Xuewei; Wang, Xiangyu; Fang, Yi; Jia, Zhenyu; Gao, Jidong

    2017-07-11

    RNA in formalin-fixed and paraffin-embedded (FFPE) tissues provides large amount of information indicating disease stages, histological tumor types and grades, as well as clinical outcomes. However, Detection of RNA expression levels in formalin-fixed and paraffin-embedded samples is extremely difficult due to poor RNA quality. Here we developed a high-throughput method, Reverse Transcription-Multiple Ligation-dependent Probe Sequencing (RT-MLPSeq), to determine expression levels of multiple transcripts in FFPE samples. By combining Reverse Transcription-Multiple Ligation-dependent Amplification method and next generation sequencing technology, RT-MLPSeq overcomes the limit of probe length in multiplex ligation-dependent probe amplification assay and thus could detect expression levels of transcripts without quantitative limitations. We proved that different RT-MLPSeq probes targeting on the same transcripts have highly consistent results and the starting RNA/cDNA input could be as little as 1 ng. RT-MLPSeq also presented consistent relative RNA levels of selected 13 genes with reverse transcription quantitative PCR. Finally, we demonstrated the application of the new RT-MLPSeq method by measuring the mRNA expression levels of 21 genes which can be used for accurate calculation of the breast cancer recurrence score - an index that has been widely used for managing breast cancer patients.

  4. Systematic Analysis of Long Noncoding RNAs in the Senescence-accelerated Mouse Prone 8 Brain Using RNA Sequencing

    Directory of Open Access Journals (Sweden)

    Shuai Zhang

    2016-01-01

    Full Text Available Long noncoding RNAs (lncRNAs may play an important role in Alzheimer's disease (AD pathogenesis. However, despite considerable research in this area, the comprehensive and systematic understanding of lncRNAs in AD is still limited. The emergence of RNA sequencing provides a predictor and has incomparable advantage compared with other methods, including microarray. In this study, we identified lncRNAs in a 7-month-old mouse brain through deep RNA sequencing using the senescence-accelerated mouse prone 8 (SAMP8 and senescence-accelerated mouse resistant 1 (SAMR1 models. A total of 599,985,802 clean reads and 23,334 lncRNA transcripts were obtained. Then, we identified 97 significantly upregulated and 114 significantly downregulated lncRNA transcripts from all cases in SAMP8 mice relative to SAMR1 mice. Gene ontology (GO and Kyoto Encyclopedia of Genes and Genomes analyses revealed that these significantly dysregulated lncRNAs were involved in regulating the development of AD from various angles, such as nerve growth factor term (GO: 1990089, mitogen-activated protein kinase signaling pathway, and AD pathway. Furthermore, the most probable AD-associated lncRNAs were predicted and listed in detail. Our study provided the systematic dissection of lncRNA profiling in SAMP8 mouse brain and accelerated the development of lncRNA biomarkers in AD. These attracting biomarkers could provide significant insights into AD therapy in the future.

  5. Alterations in polyribosome and messenger ribonucleic acid metabolism and messenger ribonucleoprotein utilization in osmotically stressed plant seedlings

    International Nuclear Information System (INIS)

    Mason, H.S.

    1986-01-01

    Polyribosome aggregation state in growing tissues of barley and wheat leaf of stems of pea and squash was studied in relation to seedling growth and water status of the growing tissue in plants at various levels of osmotic stress. It was found to be highly correlated with water potential and osmotic potential of the growing tissue and with leaf of stem elongation rate. Stress rapidly reduced polyribosome content and water status in growing tissues of barley leaves; changes were slow and slight in the non-growing leaf blade. Membrane-bound and free polyribosomes were equally sensitive to stress-induced disaggregation. Incorporation of 32 PO 4 3- into ribosomal RNA was rapidly inhibited by stress, but stability of poly(A) + RNA relative to ribosomal RNA was similar in stressed and unstressed tissues, with a half-life of about 12 hours. Stress also caused progressive loss of poly(A) + RNA from these tissues. Quantitation of poly(A) and in vitro messenger template activity in polysome gradient fractions showed a shift of activity from the polysomal region to the region of 20-60 S in stressed plants. Messenger RNA in the 20-60 S region coded for the same peptides as mRNA found in the polysomal fraction. Nonpolysomal and polysome-derived messenger ribonucleoprotein complexes (mRNP) were isolated, and characteristic proteins were found associated with either fraction. Polysomal mRNP from stressed or unstressed plants were translated with similar efficiency in a wheat germ cell-free system. It was concluded that no translational inhibitory activity was associated with nonpolysomal mRNP from barley prepared as described

  6. Deep sequencing analysis of small noncoding RNA and mRNA targets of the global post-transcriptional regulator, Hfq

    DEFF Research Database (Denmark)

    Sittka, A; Lucchini, S; Papenfort, K

    2008-01-01

    would be rescued by overexpression of HilD and FlhDC, and we proved this to be correct. The combination of epitope-tagging and HTPS of immunoprecipitated RNA detected the expression of many intergenic chromosomal regions of Salmonella. Our approach overcomes the limited availability of high...

  7. Partial Sequencing of 16S rRNA Gene of Selected Staphylococcus aureus Isolates and its Antibiotic Resistance

    Directory of Open Access Journals (Sweden)

    Harsi Dewantari Kusumaningrum

    2016-08-01

    Full Text Available The choice of primer used in 16S rRNA sequencing for identification of Staphylococcus species found in food is important. This study aimed to characterize Staphylococcus aureus isolates by partial sequencing based on 16S rRNA gene employing primers 16sF, 63F or 1387R. The isolates were isolated from milk, egg dishes and chicken dishes and selected based on the presence of sea gene that responsible for formation of enterotoxin-A. Antibiotic susceptibility of the isolates towards six antibiotics was also tested. The use of 16sF resulted generally in higher identity percentage and query coverage compared to the sequencing by 63F or 1387R. BLAST results of all isolates, sequenced by 16sF, showed 99% homology to complete genome of four S. aureus strains, with different characteristics on enterotoxin production and antibiotic resistance. Considering that all isolates were carrying sea gene, indicated by the occurence of 120 bp amplicon after PCR amplification using primer SEA1/SEA2,  the isolates were most in agreeing to S. aureus subsp. aureus ST288. This study indicated that 4 out of 8 selected isolates were resistant towards streptomycin. The 16S rRNA gene sequencing using 16sF is useful for identification of S. aureus. However, additional analysis such as PCR employing specific gene target, should give a valuable supplementary information, when specific characteristic is expected.

  8. Phylogenetic analysis of Fusobacterium prausnitzii based upon the 16S rRNA gene sequence and PCR confirmation.

    Science.gov (United States)

    Wang, R F; Cao, W W; Cerniglia, C E

    1996-01-01

    In order to develop a PCR method to detect Fusobacterium prausnitzii in human feces and to clarify the phylogenetic position of this species, its 16S rRNA gene sequence was determined. The sequence described in this paper is different from the 16S rRNA gene sequence is specific for F. prausnitzii, and the results of this assay confirmed that F. prausnitzii is the most common species in human feces. However, a PCR assay based on the original GenBank sequence was negative when it was performed with two strains of F. prausnitzii obtained from the American Type Culture Collection. A phylogenetic tree based on the new 16S rRNA gene sequence was constructed. On this tree F. prausnitzii was not a member of the Fusobacterium group but was closer to some Eubacterium spp. and located between Clostridium "clusters III and IV" (M.D. Collins, P.A. Lawson, A. Willems, J.J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J.A.E. Farrow, Int. J. Syst. Bacteriol. 44:812-826, 1994).

  9. Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

    NARCIS (Netherlands)

    Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben

    2004-01-01

    Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

  10. Patterns of homoeologous gene expression shown by RNA sequencing in hexaploid bread wheat.

    KAUST Repository

    Leach, Lindsey J; Belfield, Eric J; Jiang, Caifu; Brown, Carly; Mithani, Aziz; Harberd, Nicholas P

    2014-01-01

    BACKGROUND: Bread wheat (Triticum aestivum) has a large, complex and hexaploid genome consisting of A, B and D homoeologous chromosome sets. Therefore each wheat gene potentially exists as a trio of A, B and D homoeoloci, each of which may contribute differentially to wheat phenotypes. We describe a novel approach combining wheat cytogenetic resources (chromosome substitution 'nullisomic-tetrasomic' lines) with next generation deep sequencing of gene transcripts (RNA-Seq), to directly and accurately identify homoeologue-specific single nucleotide variants and quantify the relative contribution of individual homoeoloci to gene expression. RESULTS: We discover, based on a sample comprising ~5-10% of the total wheat gene content, that at least 45% of wheat genes are expressed from all three distinct homoeoloci. Most of these genes show strikingly biased expression patterns in which expression is dominated by a single homoeolocus. The remaining ~55% of wheat genes are expressed from either one or two homoeoloci only, through a combination of extensive transcriptional silencing and homoeolocus loss. CONCLUSIONS: We conclude that wheat is tending towards functional diploidy, through a variety of mechanisms causing single homoeoloci to become the predominant source of gene transcripts. This discovery has profound consequences for wheat breeding and our understanding of wheat evolution.

  11. Transcriptome analysis of the Chinese giant salamander (Andrias davidianus using RNA-sequencing

    Directory of Open Access Journals (Sweden)

    Yong Huang

    2017-12-01

    Full Text Available The Chinese giant salamander (Andrias davidianus is an economically important animal on academic value. However, the genomic information of this species has been less studied. In our study, the transcripts of A. davidianus were obtained by RNA-seq to conduct a transcriptomic analysis. In total 132,912 unigenes were generated with an average length of 690 bp and N50 of 1263 bp by de novo assembly using Trinity software. Using a sequence similarity search against the nine public databases (CDD, KOG, NR, NT, PFAM, Swiss-prot, TrEMBL, GO and KEGG databases, a total of 24,049, 18,406, 36,711, 15,858, 20,500, 27,515, 36,705, 28,879 and 10,958 unigenes were annotated in databases, respectively. Of these, 6323 unigenes were annotated in all database and 39,672 unigenes were annotated in at least one database. Blasted with KEGG pathway, 10,958 unigenes were annotated, and it was divided into 343 categories according to different pathways. In addition, we also identified 29,790 SSRs. This study provided a valuable resource for understanding transcriptomic information of A. davidianus and laid a foundation for further research on functional gene cloning, genomics, genetic diversity analysis and molecular marker exploitation in A. davidianus.

  12. Patterns of homoeologous gene expression shown by RNA sequencing in hexaploid bread wheat.

    KAUST Repository

    Leach, Lindsey J

    2014-04-11

    BACKGROUND: Bread wheat (Triticum aestivum) has a large, complex and hexaploid genome consisting of A, B and D homoeologous chromosome sets. Therefore each wheat gene potentially exists as a trio of A, B and D homoeoloci, each of which may contribute differentially to wheat phenotypes. We describe a novel approach combining wheat cytogenetic resources (chromosome substitution \\'nullisomic-tetrasomic\\' lines) with next generation deep sequencing of gene transcripts (RNA-Seq), to directly and accurately identify homoeologue-specific single nucleotide variants and quantify the relative contribution of individual homoeoloci to gene expression. RESULTS: We discover, based on a sample comprising ~5-10% of the total wheat gene content, that at least 45% of wheat genes are expressed from all three distinct homoeoloci. Most of these genes show strikingly biased expression patterns in which expression is dominated by a single homoeolocus. The remaining ~55% of wheat genes are expressed from either one or two homoeoloci only, through a combination of extensive transcriptional silencing and homoeolocus loss. CONCLUSIONS: We conclude that wheat is tending towards functional diploidy, through a variety of mechanisms causing single homoeoloci to become the predominant source of gene transcripts. This discovery has profound consequences for wheat breeding and our understanding of wheat evolution.

  13. Evolution of green plants as deduced from 5S rRNA sequences.

    Science.gov (United States)

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other.

  14. The Cladophora complex (Chlorophyta): new views based on 18S rRNA gene sequences.

    Science.gov (United States)

    Bakker, F T; Olsen, J L; Stam, W T; van den Hoek, C

    1994-12-01

    Evolutionary relationships among species traditionally ascribed to the Siphonocladales/Cladophorales have remained unclear due to a lack of phylogenetically informative characters and extensive morphological plasticity resulting in morphological convergence. This study explores some of the diversity within the generic complex Cladophora and its siphonocladalaen allies. Twelve species of Cladophora representing 6 of the 11 morphological sections recognized by van den Hoek were analyzed along with 8 siphonocladalaen species using 18S rRNA gene sequences. The final alignment consisted of 1460 positions containing 92 phylogenetically informative substitutions. Weighting schemes (EOR weighting, combinatorial weighting) were applied in maximum parsimony analysis to correct for substitution bias. Stem characters were weighted 0.66 relative to single-stranded characters to correct for secondary structural constraints. Both weighting approaches resulted in greater phylogenetic resolution. Results confirm that there is no basis for the independent recognition of the Cladophorales and Siphonocladales. The Siphonocladales is polyphyletic, and Cladophora is paraphyletic. All analyses support two principal lineages, of which one contains predominantly tropical members including almost all siphonocladalean taxa, while the other lineage consists of mostly warm- to cold-temperate species of Cladophora.

  15. RNA sequencing provides exquisite insight into the manipulation of the alveolar macrophage by tubercle bacilli.

    Science.gov (United States)

    Nalpas, Nicolas C; Magee, David A; Conlon, Kevin M; Browne, John A; Healy, Claire; McLoughlin, Kirsten E; Rue-Albrecht, Kévin; McGettigan, Paul A; Killick, Kate E; Gormley, Eamonn; Gordon, Stephen V; MacHugh, David E

    2015-09-08

    Mycobacterium bovis, the agent of bovine tuberculosis, causes an estimated $3 billion annual losses to global agriculture due, in part, to the limitations of current diagnostics. Development of next-generation diagnostics requires a greater understanding of the interaction between the pathogen and the bovine host. Therefore, to explore the early response of the alveolar macrophage to infection, we report the first application of RNA-sequencing to define, in exquisite detail, the transcriptomes of M. bovis-infected and non-infected alveolar macrophages from ten calves at 2, 6, 24 and 48 hours post-infection. Differentially expressed sense genes were detected at these time points that revealed enrichment of innate immune signalling functions, and transcriptional suppression of host defence mechanisms (e.g., lysosome maturation). We also detected differentially expressed natural antisense transcripts, which may play a role in subverting innate immune mechanisms following infection. Furthermore, we report differential expression of novel bovine genes, some of which have immune-related functions based on orthology with human proteins. This is the first in-depth transcriptomics investigation of the alveolar macrophage response to the early stages of M. bovis infection and reveals complex patterns of gene expression and regulation that underlie the immunomodulatory mechanisms used by M. bovis to evade host defence mechanisms.

  16. [Phylogeny of protostome moulting animals (Ecdysozoa) inferred from 18 and 28S rRNA gene sequences].

    Science.gov (United States)

    Petrov, N B; Vladychenskaia, N S

    2005-01-01

    Reliability of reconstruction of phylogenetic relationships within a group of protostome moulting animals was evaluated by means of comparison of 18 and 28S rRNA gene sequences sets both taken separately and combined. Reliability of reconstructions was evaluated by values of the bootstrap support of major phylogenetic tree nodes and by degree of congruence of phylogenetic trees inferred by various methods. By both criteria, phylogenetic trees reconstructed from the combined 18 and 28S rRNA gene sequences were better than those inferred from 18 and 28S sequences taken separately. Results obtained are consistent with phylogenetic hypothesis separating protostome animals into two major clades, moulting Ecdysozoa (Priapulida + Kinorhyncha, Nematoda + Nematomorpha, Onychophora + Tardigrada, Myriapoda + Chelicerata, Crustacea + Hexapoda) and unmoulting Lophotrochozoa (Plathelminthes, Nemertini, Annelida, Mollusca, Echiura, Sipuncula). Clade Cephalorhyncha does not include nematomorphs (Nematomorpha). Conclusion was taken that it is necessary to use combined 18 and 28S data in phylogenetic studies.

  17. Herpesvirus telomerase RNA (vTR with a mutated template sequence abrogates herpesvirus-induced lymphomagenesis.

    Directory of Open Access Journals (Sweden)

    Benedikt B Kaufer

    2011-10-01

    Full Text Available Telomerase reverse transcriptase (TERT and telomerase RNA (TR represent the enzymatically active components of telomerase. In the complex, TR provides the template for the addition of telomeric repeats to telomeres, a protective structure at the end of linear chromosomes. Human TR with a mutation in the template region has been previously shown to inhibit proliferation of cancer cells in vitro. In this report, we examined the effects of a mutation in the template of a virus encoded TR (vTR on herpesvirus-induced tumorigenesis in vivo. For this purpose, we used the oncogenic avian herpesvirus Marek's disease virus (MDV as a natural virus-host model for lymphomagenesis. We generated recombinant MDV in which the vTR template sequence was mutated from AATCCCAATC to ATATATATAT (vAU5 by two-step Red-mediated mutagenesis. Recombinant viruses harboring the template mutation replicated with kinetics comparable to parental and revertant viruses in vitro. However, mutation of the vTR template sequence completely abrogated virus-induced tumor formation in vivo, although the virus was able to undergo low-level lytic replication. To confirm that the absence of tumors was dependent on the presence of mutant vTR in the telomerase complex, a second mutation was introduced in vAU5 that targeted the P6.1 stem loop, a conserved region essential for vTR-TERT interaction. Absence of vTR-AU5 from the telomerase complex restored virus-induced lymphoma formation. To test if the attenuated vAU5 could be used as an effective vaccine against MDV, we performed vaccination-challenge studies and determined that vaccination with vAU5 completely protected chickens from lethal challenge with highly virulent MDV. Taken together, our results demonstrate 1 that mutation of the vTR template sequence can completely abrogate virus-induced tumorigenesis, likely by the inhibition of cancer cell proliferation, and 2 that this strategy could be used to generate novel vaccine candidates

  18. microRNA Biomarker Discovery and High-Throughput DNA Sequencing Are Possible Using Long-term Archived Serum Samples.

    Science.gov (United States)

    Rounge, Trine B; Lauritzen, Marianne; Langseth, Hilde; Enerly, Espen; Lyle, Robert; Gislefoss, Randi E

    2015-09-01

    The impacts of long-term storage and varying preanalytical factors on the quality and quantity of DNA and miRNA from archived serum have not been fully assessed. Preanalytical and analytical variations and degradation may introduce bias in representation of DNA and miRNA and may result in loss or corruption of quantitative data. We have evaluated DNA and miRNA quantity, quality, and variability in samples stored up to 40 years using one of the oldest prospective serum collections in the world, the Janus Serumbank, a biorepository dedicated to cancer research. miRNAs are present and stable in archived serum samples frozen at -25°C for at least 40 years. Long-time storage did not reduce miRNA yields; however, varying preanalytical conditions had a significant effect and should be taken into consideration during project design. Of note, 500 μL serum yielded sufficient miRNA for qPCR and small RNA sequencing and on average 650 unique miRNAs were detected in samples from presumably healthy donors. Of note, 500 μL serum yielded sufficient DNA for whole-genome sequencing and subsequent SNP calling, giving a uniform representation of the genomes. DNA and miRNA are stable during long-term storage, making large prospectively collected serum repositories an invaluable source for miRNA and DNA biomarker discovery. Large-scale biomarker studies with long follow-up time are possible utilizing biorepositories with archived serum and state-of-the-art technology. ©2015 American Association for Cancer Research.

  19. Deep RNA sequencing reveals dynamic regulation of myocardial noncoding RNAs in failing human heart and remodeling with mechanical circulatory support.

    Science.gov (United States)

    Yang, Kai-Chien; Yamada, Kathryn A; Patel, Akshar Y; Topkara, Veli K; George, Isaac; Cheema, Faisal H; Ewald, Gregory A; Mann, Douglas L; Nerbonne, Jeanne M

    2014-03-04

    Microarrays have been used extensively to profile transcriptome remodeling in failing human heart, although the genomic coverage provided is limited and fails to provide a detailed picture of the myocardial transcriptome landscape. Here, we describe sequencing-based transcriptome profiling, providing comprehensive analysis of myocardial mRNA, microRNA (miRNA), and long noncoding RNA (lncRNA) expression in failing human heart before and after mechanical support with a left ventricular (LV) assist device (LVAD). Deep sequencing of RNA isolated from paired nonischemic (NICM; n=8) and ischemic (ICM; n=8) human failing LV samples collected before and after LVAD and from nonfailing human LV (n=8) was conducted. These analyses revealed high abundance of mRNA (37%) and lncRNA (71%) of mitochondrial origin. miRNASeq revealed 160 and 147 differentially expressed miRNAs in ICM and NICM, respectively, compared with nonfailing LV. Among these, only 2 (ICM) and 5 (NICM) miRNAs are normalized with LVAD. RNASeq detected 18 480, including 113 novel, lncRNAs in human LV. Among the 679 (ICM) and 570 (NICM) lncRNAs differentially expressed with heart failure, ≈10% are improved or normalized with LVAD. In addition, the expression signature of lncRNAs, but not miRNAs or mRNAs, distinguishes ICM from NICM. Further analysis suggests that cis-gene regulation represents a major mechanism of action of human cardiac lncRNAs. The myocardial transcriptome is dynamically regulated in advanced heart failure and after LVAD support. The expression profiles of lncRNAs, but not mRNAs or miRNAs, can discriminate failing hearts of different pathologies and are markedly altered in response to LVAD support. These results suggest an important role for lncRNAs in the pathogenesis of heart failure and in reverse remodeling observed with mechanical support.

  20. A comprehensive evaluation of the sl1p pipeline for 16S rRNA gene sequencing analysis.

    Science.gov (United States)

    Whelan, Fiona J; Surette, Michael G

    2017-08-14

    Advances in next-generation sequencing technologies have allowed for detailed, molecular-based studies of microbial communities such as the human gut, soil, and ocean waters. Sequencing of the 16S rRNA gene, specific to prokaryotes, using universal PCR primers has become a common approach to studying the composition of these microbiota. However, the bioinformatic processing of the resulting millions of DNA sequences can be challenging, and a standardized protocol would aid in reproducible analyses. The short-read library 16S rRNA gene sequencing pipeline (sl1p, pronounced "slip") was designed with the purpose of mitigating this lack of reproducibility by combining pre-existing tools into a computational pipeline. This pipeline automates the processing of raw 16S rRNA gene sequencing data to create human-readable tables, graphs, and figures to make the collected data more readily accessible. Data generated from mock communities were compared using eight OTU clustering algorithms, two taxon assignment approaches, and three 16S rRNA gene reference databases. While all of these algorithms and options are available to sl1p users, through testing with human-associated mock communities, AbundantOTU+, the RDP Classifier, and the Greengenes 2011 reference database were chosen as sl1p's defaults based on their ability to best represent the known input communities. sl1p promotes reproducible research by providing a comprehensive log file, and reduces the computational knowledge needed by the user to process next-generation sequencing data. sl1p is freely available at https://bitbucket.org/fwhelan/sl1p .

  1. pEVL: A Linear Plasmid for Generating mRNA IVT Templates With Extended Encoded Poly(A Sequences

    Directory of Open Access Journals (Sweden)

    Alexandra E Grier

    2016-01-01

    Full Text Available Increasing demand for large-scale synthesis of in vitro transcribed (IVT mRNA is being driven by the increasing use of mRNA for transient gene expression in cell engineering and therapeutic applications. An important determinant of IVT mRNA potency is the 3′ polyadenosine (poly(A tail, the length of which correlates with translational efficiency. However, present methods for generation of IVT mRNA rely on templates derived from circular plasmids or PCR products, in which homopolymeric tracts are unstable, thus limiting encoded poly(A tail lengths to ≃120 base pairs (bp. Here, we have developed a novel method for generation of extended poly(A tracts using a previously described linear plasmid system, pJazz. We find that linear plasmids can successfully propagate poly(A tracts up to ≃500 bp in length for IVT mRNA production. We then modified pJazz by removing extraneous restriction sites, adding a T7 promoter sequence upstream from an extended multiple cloning site, and adding a unique type-IIS restriction site downstream from the encoded poly(A tract to facilitate generation of IVT mRNA with precisely defined encoded poly(A tracts and 3′ termini. The resulting plasmid, designated pEVL, can be used to generate IVT mRNA with consistent defined lengths and terminal residue(s.

  2. Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

    International Nuclear Information System (INIS)

    Lee, K.M.; Marshall, A.G.

    1987-01-01

    Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

  3. StralSV: assessment of sequence variability within similar 3D structures and application to polio RNA-dependent RNA polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Zemla, A; Lang, D; Kostova, T; Andino, R; Zhou, C

    2010-11-29

    Most of the currently used methods for protein function prediction rely on sequence-based comparisons between a query protein and those for which a functional annotation is provided. A serious limitation of sequence similarity-based approaches for identifying residue conservation among proteins is the low confidence in assigning residue-residue correspondences among proteins when the level of sequence identity between the compared proteins is poor. Multiple sequence alignment methods are more satisfactory - still, they cannot provide reliable results at low levels of sequence identity. Our goal in the current work was to develop an algorithm that could overcome these difficulties and facilitate the identification of structurally (and possibly functionally) relevant residue-residue correspondences between compared protein structures. Here we present StralSV, a new algorithm for detecting closely related structure fragments and quantifying residue frequency from tight local structure alignments. We apply StralSV in a study of the RNA-dependent RNA polymerase of poliovirus and demonstrate that the algorithm can be used to determine regions of the protein that are relatively unique or that shared structural similarity with structures that are distantly related. By quantifying residue frequencies among many residue-residue pairs extracted from local alignments, one can infer potential structural or functional importance of specific residues that are determined to be highly conserved or that deviate from a consensus. We further demonstrate that considerable detailed structural and phylogenetic information can be derived from StralSV analyses. StralSV is a new structure-based algorithm for identifying and aligning structure fragments that have similarity to a reference protein. StralSV analysis can be used to quantify residue-residue correspondences and identify residues that may be of particular structural or functional importance, as well as unusual or unexpected

  4. Small RNA Sequencing Reveals Differential miRNA Expression in the Early Development of Broccoli (Brassica oleracea var. italica) Pollen.

    Science.gov (United States)

    Li, Hui; Wang, Yu; Wu, Mei; Li, Lihong; Jin, Chuan; Zhang, Qingli; Chen, Chengbin; Song, Wenqin; Wang, Chunguo

    2017-01-01

    Pollen development is an important and complex biological process in the sexual reproduction of flowering plants. Although the cytological characteristics of pollen development are well defined, the regulation of its early stages remains largely unknown. In the present study, miRNAs were explored in the early development of broccoli ( Brassica oleracea var. italica ) pollen. A total of 333 known miRNAs that originated from 235 miRNA families were detected. Fifty-five novel miRNA candidates were identified. Sixty of the 333 known miRNAs and 49 of the 55 predicted novel miRNAs exhibited significantly differential expression profiling in the three distinct developmental stages of broccoli pollen. Among these differentially expressed miRNAs, miRNAs that would be involved in the developmental phase transition from uninucleate microspores to binucleate pollen grains or from binucleate to trinucleate pollen grains were identified. miRNAs that showed significantly enriched expression in a specific early stage of broccoli pollen development were also observed. In addition, 552 targets for 127 known miRNAs and 69 targets for 40 predicted novel miRNAs were bioinformatically identified. Functional annotation and GO (Gene Ontology) analysis indicated that the putative miRNA targets showed significant enrichment in GO terms that were related to plant organ formation and morphogenesis. Some of enriched GO terms were detected for the targets directly involved in plant male reproduction development. These findings provided new insights into the functions of miRNA-mediated regulatory networks in broccoli pollen development.

  5. Molecular phylogenetic studies on an unnamed bovine Babesia sp. based on small subunit ribosomal RNA gene sequences.

    Science.gov (United States)

    Luo, Jianxun; Yin, Hong; Liu, Zhijie; Yang, Dongying; Guan, Guiquan; Liu, Aihong; Ma, Miling; Dang, Shengzhi; Lu, Bingyi; Sun, Caiqin; Bai, Qi; Lu, Wenshun; Chen, Puyan

    2005-10-10

    The 18S small subunit ribosomal RNA (18S rRNA) gene of an unnamed Babesia species (designated B. U sp.) was sequenced and analyzed in an attempt to distinguish it from other Babesia species in China. The target DNA segment was amplified by polymerase chain reaction (PCR). The PCR product was ligated to the pGEM-T Easy vector for sequencing. It was found that the length of the 18S rRNA gene of all B. U sp. Kashi 1 and B. U sp. Kashi 2 was 1699 bp and 1689 bp. Two phylogenetic trees were, respectively, inferred based on 18S rRNA sequence of the Chinese bovine Babesia isolates and all of Babesia species available in GenBank. The first tree showed that B. U sp. was situated in the branch between B. major Yili and B. bovis Shannxian, and the second tree revealed that B. U sp. was confined to the same group as B. caballi. The percent identity of B. U sp. with other Chinese Babesia species was between 74.2 and 91.8, while the percent identity between two B. U sp. isolates was 99.7. These results demonstrated that this B. U sp. is different from other Babesia species, but that two B. U sp. isolates obtained with nymphal and adultal Hyalomma anatolicum anatolicum tick belong to the same species.

  6. DNA sequencing reveals limited heterogeneity in the 16S rRNA gene from the rrnB operon among five Mycoplasma hominis isolates

    DEFF Research Database (Denmark)

    Mygind, T; Birkelund, Svend; Christiansen, Gunna

    1998-01-01

    To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...... by PCR and the PCR products were sequenced. Three isolates had identical 16S rRNA sequences and two isolates had sequences that differed from the others by only one nucleotide....

  7. Retrieval of a million high-quality, full-length microbial 16S and 18S rRNA gene sequences without primer bias

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Dueholm, Morten Simonsen; McIlroy, Simon Jon

    2018-01-01

    Small subunit ribosomal RNA (SSU rRNA) genes, 16S in bacteria and 18S in eukaryotes, have been the standard phylogenetic markers used to characterize microbial diversity and evolution for decades. However, the reference databases of full-length SSU rRNA gene sequences are skewed to well-studied e...

  8. RNA Editing in Plant Mitochondria

    Science.gov (United States)

    Hiesel, Rudolf; Wissinger, Bernd; Schuster, Wolfgang; Brennicke, Axel

    1989-12-01

    Comparative sequence analysis of genomic and complementary DNA clones from several mitochondrial genes in the higher plant Oenothera revealed nucleotide sequence divergences between the genomic and the messenger RNA-derived sequences. These sequence alterations could be most easily explained by specific post-transcriptional nucleotide modifications. Most of the nucleotide exchanges in coding regions lead to altered codons in the mRNA that specify amino acids better conserved in evolution than those encoded by the genomic DNA. Several instances show that the genomic arginine codon CGG is edited in the mRNA to the tryptophan codon TGG in amino acid positions that are highly conserved as tryptophan in the homologous proteins of other species. This editing suggests that the standard genetic code is used in plant mitochondria and resolves the frequent coincidence of CGG codons and tryptophan in different plant species. The apparently frequent and non-species-specific equivalency of CGG and TGG codons in particular suggests that RNA editing is a common feature of all higher plant mitochondria.

  9. Analysis and prediction of translation rate based on sequence and functional features of the mRNA.

    Directory of Open Access Journals (Sweden)

    Tao Huang

    Full Text Available Protein concentrations depend not only on the mRNA level, but also on the translation rate and the degradation rate. Prediction of mRNA's translation rate would provide valuable information for in-depth understanding of the translation mechanism and dynamic proteome. In this study, we developed a new computational model to predict the translation rate, featured by (1 integrating various sequence-derived and functional features, (2 applying the maximum relevance & minimum redundancy method and incremental feature selection to select features to optimize the prediction model, and (3 being able to predict the translation rate of RNA into high or low translation rate category. The prediction accuracies under rich and starvation condition were 68.8% and 70.0%, respectively, evaluated by jackknife cross-validation. It was found that the following features were correlated with translation rate: codon usage frequency, some gene ontology enrichment scores, number of RNA binding proteins known to bind its mRNA product, coding sequence length, protein abundance and 5'UTR free energy. These findings might provide useful information for understanding the mechanisms of translation and dynamic proteome. Our translation rate prediction model might become a high throughput tool for annotating the translation rate of mRNAs in large-scale.

  10. Nitric oxide: a physiologic messenger.

    Science.gov (United States)

    Lowenstein, C J; Dinerman, J L; Snyder, S H

    1994-02-01

    To review the physiologic role of nitric oxide, an unusual messenger molecule that mediates blood vessel relaxation, neurotransmission, and pathogen suppression. A MEDLINE search of articles published from 1987 to 1993 that addressed nitric oxide and the enzyme that synthesizes it, nitric oxide synthase. Animal and human studies were selected from 3044 articles to analyze the clinical importance of nitric oxide. Descriptions of the structure and function of nitric oxide synthase were selected to show how nitric oxide acts as a biological messenger molecule. Biochemical and physiologic studies were analyzed if the same results were found by three or more independent observers. Two major classes of nitric oxide synthase enzymes produce nitric oxide. The constitutive isoforms fo