Pokemon promotes the invasiveness of hepatocellular carcinoma by enhancing MEF2D transcription.
Kong, Jing; Liu, Xiaoping; Li, Xiangqian; Wu, Jinsheng; Wu, Ning; Chen, Jun; Fang, Fang
2016-05-01
Pokemon, a master oncogene crucial for the tumorigenicity and progression of a variety of cancers, has been demonstrated to enhance the proliferation and survival of hepatocellular carcinoma (HCC). However, the contribution of Pokemon to the invasiveness of HCC has not yet been studied. In this study, we employed HCC cells to investigate the role of Pokemon in the invasion of HCC with multidisciplinary approaches. Pokemon overexpression was found to be closely associated with invasion and intrahepatic metastasis of HCC in clinical specimens. Suppression of Pokemon attenuated the invasion of HCC cells by in vitro transwell and wound-healing assays. Myocyte enhancer factor 2D (MEF2D), an oncogene that can promote the invasiveness of HCC, was found to be underexpressed during Pokemon silencing in HCC cells. Restoration of MEF2D abolished the effect of Pokemon downregulation on the migration of HCC cells. Further experiments verified that Pokemon binds two putative recognition sites located within the upstream region of the MEF2D promoter and enhances its transcription. The association between Pokemon and MEF2D was further confirmed in HCC specimens. Animal experiments further confirmed that Pokemon downregulation attenuated the metastasis of HCC cells in mice. Collectively, Pokemon was found to enhance the migration and invasion of HCC by increasing MEF2D expression. Thus, targeting Pokemon and MEF2D may be an effective strategy to suppress the metastasis of HCC.
The transcription factor MEF2C mediates cardiomyocyte hypertrophy induced by IGF-1 signaling
Energy Technology Data Exchange (ETDEWEB)
Munoz, Juan Pablo; Collao, Andres; Chiong, Mario; Maldonado, Carola; Adasme, Tatiana; Carrasco, Loreto; Ocaranza, Paula; Bravo, Roberto; Gonzalez, Leticia; Diaz-Araya, Guillermo [Centro FONDAP Estudios Moleculares de la Celula, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Facultad de Ciencias Quimicas y Farmaceuticas, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Hidalgo, Cecilia [Centro FONDAP Estudios Moleculares de la Celula, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Instituto de Ciencias Biomedicas, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Lavandero, Sergio, E-mail: slavander@uchile.cl [Centro FONDAP Estudios Moleculares de la Celula, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Facultad de Ciencias Quimicas y Farmaceuticas, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Instituto de Ciencias Biomedicas, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile)
2009-10-09
Myocyte enhancer factor 2C (MEF2C) plays an important role in cardiovascular development and is a key transcription factor for cardiac hypertrophy. Here, we describe MEF2C regulation by insulin-like growth factor-1 (IGF-1) and its role in IGF-1-induced cardiac hypertrophy. We found that IGF-1 addition to cultured rat cardiomyocytes activated MEF2C, as evidenced by its increased nuclear localization and DNA binding activity. IGF-1 stimulated MEF2 dependent-gene transcription in a time-dependent manner, as indicated by increased MEF2 promoter-driven reporter gene activity; IGF-1 also induced p38-MAPK phosphorylation, while an inhibitor of p38-MAPK decreased both effects. Additionally, inhibitors of phosphatidylinositol 3-kinase and calcineurin prevented IGF-1-induced MEF2 transcriptional activity. Via MEF2C-dependent signaling, IGF-1 also stimulated transcription of atrial natriuretic factor and skeletal {alpha}-actin but not of fos-lux reporter genes. These novel data suggest that MEF2C activation by IGF-1 mediates the pro-hypertrophic effects of IGF-1 on cardiac gene expression.
The transcription factor MEF2C mediates cardiomyocyte hypertrophy induced by IGF-1 signaling
International Nuclear Information System (INIS)
Munoz, Juan Pablo; Collao, Andres; Chiong, Mario; Maldonado, Carola; Adasme, Tatiana; Carrasco, Loreto; Ocaranza, Paula; Bravo, Roberto; Gonzalez, Leticia; Diaz-Araya, Guillermo; Hidalgo, Cecilia; Lavandero, Sergio
2009-01-01
Myocyte enhancer factor 2C (MEF2C) plays an important role in cardiovascular development and is a key transcription factor for cardiac hypertrophy. Here, we describe MEF2C regulation by insulin-like growth factor-1 (IGF-1) and its role in IGF-1-induced cardiac hypertrophy. We found that IGF-1 addition to cultured rat cardiomyocytes activated MEF2C, as evidenced by its increased nuclear localization and DNA binding activity. IGF-1 stimulated MEF2 dependent-gene transcription in a time-dependent manner, as indicated by increased MEF2 promoter-driven reporter gene activity; IGF-1 also induced p38-MAPK phosphorylation, while an inhibitor of p38-MAPK decreased both effects. Additionally, inhibitors of phosphatidylinositol 3-kinase and calcineurin prevented IGF-1-induced MEF2 transcriptional activity. Via MEF2C-dependent signaling, IGF-1 also stimulated transcription of atrial natriuretic factor and skeletal α-actin but not of fos-lux reporter genes. These novel data suggest that MEF2C activation by IGF-1 mediates the pro-hypertrophic effects of IGF-1 on cardiac gene expression.
Adachi, Megumi; Lin, Pei-Yi; Pranav, Heena; Monteggia, Lisa M
2016-07-15
Myocyte enhancer factor 2 (MEF2) transcription factors play critical roles in diverse cellular processes during central nervous system development. Studies attempting to address the role of MEF2 in brain have largely relied on overexpression of a constitutive MEF2 construct that impairs memory formation or knockdown of MEF2 function that increases spine numbers and enhances memory formation. Genetic deletion of individual MEF2 isoforms in brain during embryogenesis demonstrated that Mef2c loss negatively regulates spine numbers resulting in learning and memory deficits, possibly as a result of its essential role in development. To investigate MEF2C function in brain further, we genetically deleted Mef2c during postnatal development in mice. We characterized these conditional Mef2c knockout mice in an array of behavioral paradigms and examined the impact of postnatal loss of Mef2c on long-term potentiation. We observed increased spine numbers in hippocampus of the conditional Mef2c knockout mice. However, the postnatal loss of Mef2c did not impact learning and memory, long-term potentiation, or social and repetitive behaviors. Our findings demonstrate a critical role for MEF2C in the regulation of spine numbers with a dissociation of learning and memory, synaptic plasticity, and measures of autism-related behaviors in postnatal brain. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.
Pokemon and MEF2D co-operationally promote invasion of hepatocellular carcinoma.
Hong, Xin; Hong, Xing-Yu; Li, Tao; He, Cheng-Yan
2015-12-01
Hepatocellular carcinoma (HCC) is one of the most deadly human malignancy, and frequent invasion and metastasis is closely associated with its poor prognosis. However, the molecular mechanism underlying HCC invasion is still not completely elucidated. Pokemon is a well-established oncogene for HCC growth, but its contribution to HCC invasion has not been studied yet. In this paper, Pokemon was found to be overexpressed in MHCC-97H HCC cell line, which possesses higher invasiveness. Downregulation of Pokemon abolished the invasion of MHCC-97H HCC cell lines. Pokemon overexpression was able to enhance the invasion of MHCC-97L cells with lower invasiveness. MEF2D, an oncogene promoting the invasion of HCC cells, was further detected to be upregulated and downregulated when Pokemon was overexpressed and silenced, respectively. Online database analysis indicated that one Pokemon recognition site was located within the promoter of MEF2D. Chromatin co-precipitation, luciferase, and qPCR assays all proved that Pokemon can promote the expression of MEF2D in HCC cells. Restoration of MEF2D expression can prevent the impaired invasion of HCC cells with Pokemon silencing, while suppression of MEF2D abolished the effect of Pokemon overexpression on HCC invasion. More interestingly, MEF2D was also found to increase the transcription of Pokemon by binding myocyte enhancer factor 2 (MEF2) sites within its promoter region, implying an auto-regulatory circuit consisting of these two oncogenes that can promote HCC invasion. Our findings can contribute to the understanding of molecular mechanism underlying HCC invasion, and provided evidence that targeting this molecular loop may be a promising strategy for anti-invasion therapy.
Paciorkowski, Alex R.; Traylor, Ryan N.; Rosenfeld, Jill A.; Hoover, Jacqueline M.; Harris, Catharine J.; Winter, Susan; Lacassie, Yves; Bialer, Martin; Lamb, Allen N.; Schultz, Roger A.; Berry-Kravis, Elizabeth; Porter, Brenda E.; Falk, Marni; Venkat, Anu; Vanzo, Rena J.; Cohen, Julie S.; Fatemi, Ali; Dobyns, William B.; Shaffer, Lisa G.; Ballif, Blake C.; Marsh, Eric D.
2013-01-01
MEF2C haploinsufficiency syndrome is an emerging neurodevelopmental disorder associated with intellectual disability, autistic features, epilepsy, and abnormal movements. We report 16 new patients with MEF2C haploinsufficiency, including the oldest reported patient with MEF2C deletion at 5q14.3. We detail the neurobehavioral phenotype, epilepsy, and abnormal movements, and compare our subjects with those previously reported in the literature. We also investigate Mef2c expression in the developing mouse forebrain. A spectrum of neurofunctional deficits emerges, with hyperkinesis a consistent finding. Epilepsy varied from absent to severe, and included intractable myoclonic seizures and infantile spasms. Subjects with partial MEF2C deletion were statistically less likely to have epilepsy. Finally, we confirm that Mef2c is present both in dorsal primary neuroblasts and ventral gamma-aminobutyric acid(GABA)ergic interneurons in the forebrain of the developing mouse. Given interactions with several key neurodevelopmental genes such as ARX, FMR1, MECP2, and TBR1, it appears that MEF2C plays a role in several developmental stages of both dorsal and ventral neuronal cell types. PMID:23389741
Chancey, Scott T; Bai, Xianhe; Kumar, Nikhil; Drabek, Elliott F; Daugherty, Sean C; Colon, Thomas; Ott, Sandra; Sengamalay, Naomi; Sadzewicz, Lisa; Tallon, Luke J; Fraser, Claire M; Tettelin, Hervé; Stephens, David S
2015-01-01
Macrolide resistance, emerging in Streptococcus pneumoniae and other Gram-positive bacteria, is increasingly due to efflux pumps encoded by mef/mel(msr) operons found on discrete mobile genetic elements. The regulation of mef/mel(msr) in these elements is not well understood. We identified the mef(E)/mel transcriptional start, localized the mef(E)/mel promoter, and demonstrated attenuation of transcription as a mechanism of regulation of macrolide-inducible mef-mediated macrolide resistance in S. pneumoniae. The mef(E)/mel transcriptional start site was a guanine 327 bp upstream of mef(E). Consensus pneumococcal promoter -10 (5'-TATACT-3') and -35 (5'-TTGAAC-3') boxes separated by 17 bp were identified 7 bp upstream of the start site. Analysis of the predicted secondary structure of the 327 5' region identified four pairs of inverted repeats R1-R8 predicted to fold into stem-loops, a small leader peptide [MTASMRLR, (Mef(E)L)] required for macrolide induction and a Rho-independent transcription terminator. RNA-seq analyses provided confirmation of transcriptional attenuation. In addition, expression of mef(E)L was also influenced by mef(E)L-dependent mRNA stability. The regulatory region 5' of mef(E) was highly conserved in other mef/mel(msr)-containing elements including Tn1207.1 and the 5612IQ complex in pneumococci and Tn1207.3 in Group A streptococci, indicating a regulatory mechanism common to a wide variety of Gram-positive bacteria containing mef/mel(msr) elements.
Aoto, Kazushi; Sandell, Lisa L; Butler Tjaden, Naomi E; Yuen, Kobe C; Watt, Kristin E Noack; Black, Brian L; Durnin, Michael; Trainor, Paul A
2015-06-01
Neural crest cells (NCC) comprise a multipotent, migratory stem cell and progenitor population that gives rise to numerous cell and tissue types within a developing embryo, including craniofacial bone and cartilage, neurons and glia of the peripheral nervous system, and melanocytes within the skin. Here we describe two novel stable transgenic mouse lines suitable for lineage tracing and analysis of gene function in NCC. Firstly, using the F10N enhancer of the Mef2c gene (Mef2c-F10N) linked to LacZ, we generated transgenic mice (Mef2c-F10N-LacZ) that express LacZ in the majority, if not all migrating NCC that delaminate from the neural tube. Mef2c-F10N-LacZ then continues to be expressed primarily in neurogenic, gliogenic and melanocytic NCC and their derivatives, but not in ectomesenchymal derivatives. Secondly, we used the same Mef2c-F10N enhancer together with Cre recombinase to generate transgenic mice (Mef2c-F10N-Cre) that can be used to indelibly label, or alter gene function in, migrating NCC and their derivatives. At early stages of development, Mef2c-F10N-LacZ and Mef2c-F10N-Cre label NCC in a pattern similar to Wnt1-Cre mice, with the exception that Mef2c-F10N-LacZ and Mef2c-F10N-Cre specifically label NCC that have delaminated from the neural plate, while premigratory NCC are not labeled. Thus, our Mef2c-F10N-LacZ and Mef2c-F10N-Cre transgenic mice provide new resources for tracing migratory NCC and analyzing gene function in migrating and differentiating NCC independently of NCC formation. Copyright © 2015 Elsevier Inc. All rights reserved.
Analysis list: MEF2A [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available MEF2A Blood,Neural + hg19 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/MEF2A.1.tsv http:...//dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/MEF2A.5.tsv http://dbarchive.biosciencedbc....jp/kyushu-u/hg19/target/MEF2A.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/MEF2A.Blood.tsv,http:...//dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/MEF2A.Neural.tsv http://dbarch...ive.biosciencedbc.jp/kyushu-u/hg19/colo/Blood.gml,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/Neural.gml ...
Directory of Open Access Journals (Sweden)
Myriam P. Hoyeck
2017-11-01
Full Text Available The wood frog (Rana sylvatica can endure freezing of up to 65% of total body water during winter. When frozen, wood frogs enter a dormant state characterized by a cessation of vital functions (i.e., no heartbeat, blood circulation, breathing, brain activity, or movement. Wood frogs utilize various behavioural and biochemical adaptations to survive extreme freezing and component anoxia and dehydration stresses, including a global suppression of metabolic functions and gene expression. The stress-responsive myocyte enhancer factor-2 (MEF2 transcription factor family regulates the selective expression of genes involved in glucose transport, protein quality control, and phosphagen homeostasis. This study examined the role of MEF2A and MEF2C proteins as well as select downstream targets (glucose transporter-4, calreticulin, and muscle and brain creatine kinase isozymes in 40% dehydration and 24 h anoxia exposure at the transcriptional, translational, and post-translational levels using qRT-PCR, immunoblotting, and subcellular localization. Mef2a/c transcript levels remained constant during dehydration and anoxia. Total, cytoplasmic, and nuclear MEF2A/C and phospho-MEF2A/C protein levels remained constant during dehydration, whereas a decrease in total MEF2C levels was observed during rehydration. Total and phospho-MEF2A levels remained constant during anoxia, whereas total MEF2C levels decreased during 24 h anoxia and P-MEF2C levels increased during 4 h anoxia. In contrast, cytoplasmic MEF2A levels and nuclear phospho-MEF2A/C levels were upregulated during anoxia. MEF2 downstream targets remained constant during dehydration and anoxia, with the exception of glut4 which was upregulated during anoxia. These results suggest that the upregulated MEF2 response reported in wood frogs during freezing may in part stem from their cellular responses to surviving prolonged anoxia, rather than dehydration, leading to an increase in GLUT4 expression which may
Lack of MEF2A mutations in coronary artery disease
Energy Technology Data Exchange (ETDEWEB)
Weng, Li; Kavaslar, Nihan; Ustaszewska, Anna; Doelle, Heather; Schackwitz, Wendy; Hebert, Sybil; Cohen, Jonathan; McPherson, Ruth; Pennacchio, Len A.
2004-12-01
Mutations in MEF2A have been implicated in an autosomal dominant form of coronary artery disease (adCAD1). In this study we sought to determine whether severe mutations in MEF2A might also explain sporadic cases of coronary artery disease (CAD). To do this, we resequenced the coding sequence and splice sites of MEF2A in {approx}300 patients with premature CAD and failed to find causative mutations in the CAD cohort. However, we did identify the 21 base pair (bp) MEF2A coding sequence deletion originally implicated in adCAD1 in one of 300 elderly control subjects without CAD. Further screening of an additional {approx}1,500 non-CAD patients revealed two more subjects with the MEF2A 21 bp deletion. Genotyping of 19 family members of the three probands with the 21 bp deletion in MEF2A revealed that the mutation did not co-segregate with early CAD. These studies demonstrate that MEF2A mutations are not a common cause of CAD and cast serious doubt on the role of the MEF2A 21 bp deletion in adCAD1.
Directory of Open Access Journals (Sweden)
Sylvie Callegari
Full Text Available Mitochondrial translation, essential for synthesis of the electron transport chain complexes in the mitochondria, is governed by nuclear encoded genes. Polymorphisms within these genes are increasingly being implicated in disease and may also trigger adverse drug reactions. Statins, a class of HMG-CoA reductase inhibitors used to treat hypercholesterolemia, are among the most widely prescribed drugs in the world. However, a significant proportion of users suffer side effects of varying severity that commonly affect skeletal muscle. The mitochondria are one of the molecular targets of statins, and these drugs have been known to uncover otherwise silent mitochondrial mutations. Based on yeast genetic studies, we identify the mitochondrial translation factor MEF2 as a mediator of atorvastatin toxicity. The human ortholog of MEF2 is the Elongation Factor Gene (EF-G 2, which has previously been shown to play a specific role in mitochondrial ribosome recycling. Using small interfering RNA (siRNA silencing of expression in human cell lines, we demonstrate that the EF-G2mt gene is required for cell growth on galactose medium, signifying an essential role for this gene in aerobic respiration. Furthermore, EF-G2mt silenced cell lines have increased susceptibility to cell death in the presence of atorvastatin. Using yeast as a model, conserved amino acid variants, which arise from non-synonymous single nucleotide polymorphisms (SNPs in the EF-G2mt gene, were generated in the yeast MEF2 gene. Although these mutations do not produce an obvious growth phenotype, three mutations reveal an atorvastatin-sensitive phenotype and further analysis uncovers a decreased respiratory capacity. These findings constitute the first reported phenotype associated with SNPs in the EF-G2mt gene and implicate the human EF-G2mt gene as a pharmacogenetic candidate gene for statin toxicity in humans.
ES / MEF cell culture and electroporation of targeting construct
sprotocols
2014-01-01
Author: Gary Brown ### Day 0 One frozen vial of Murine Embryonic Fibroblasts (MEFs) is thawed quickly in a 37oC water bath. When the last bit of ice is melted, spray the vial with 70% ethanol and transfer the contents of the vial into one 75 cm2 flask (T-75) containing 20 ml of MEF media. Place the MEFs in a 37oC, 5% CO2, 86% humidity incubator. Every frozen MEF preparation thaws a little differently. If on Day 1, the MEFs are only 50% cconfluent, thaw another vial into your ongoing T...
Evolutionary genetic analyses of MEF2C gene: implications for learning and memory in Homo sapiens.
Kalmady, Sunil V; Venkatasubramanian, Ganesan; Arasappa, Rashmi; Rao, Naren P
2013-02-01
MEF2C facilitates context-dependent fear conditioning (CFC) which is a salient aspect of hippocampus-dependent learning and memory. CFC might have played a crucial role in human evolution because of its advantageous influence on survival of species. In this study, we analyzed 23 orthologous mammalian gene sequences of MEF2C gene to examine the evidence for positive selection on this gene in Homo sapiens using Phylogenetic Analysis by Maximum Likelihood (PAML) and HyPhy software. Both PAML Bayes Empirical Bayes (BEB) and HyPhy Fixed Effects Likelihood (FEL) analyses supported significant positive selection on 4 codon sites in H. sapiens. Also, haplotter analysis revealed significant ongoing positive selection on this gene in Central European population. The study findings suggest that adaptive selective pressure on this gene might have influenced human evolution. Further research on this gene might unravel the potential role of this gene in learning and memory as well as its pathogenetic effect in certain hippocampal disorders with evolutionary basis like schizophrenia. Copyright © 2012 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Sabine M.J. Welten
2017-06-01
Full Text Available Improving the efficacy of neovascularization is a promising strategy to restore perfusion of ischemic tissues in patients with peripheral arterial disease. The 14q32 microRNA cluster is highly involved in neovascularization. The Mef2a transcription factor has been shown to induce transcription of the microRNAs within this cluster. We inhibited expression of Mef2a using gene-silencing oligonucleotides (GSOs in an in vivo hind limb ischemia model. Treatment with GSO-Mef2a clearly improved blood flow recovery within 3 days (44% recovery versus 25% recovery in control and persisted until 14 days after ischemia induction (80% recovery versus 60% recovery in control. Animals treated with GSO-Mef2a showed increased arteriogenesis and angiogenesis in the relevant muscle tissues. Inhibition of Mef2a decreased expression of 14q32 microRNAs miR-329 (p = 0.026 and miR-494 (trend, p = 0.06, but not of other 14q32 microRNAs, nor of 14q32 microRNA precursors. Because Mef2a did not influence 14q32 microRNA transcription, we hypothesized it functions as an RNA-binding protein that influences processing of 14q32 microRNA miR-329 and miR-494. Mef2A immunoprecipitation followed by RNA isolation and rt/qPCR confirmed direct binding of MEF2A to pri-miR-494, supporting this hypothesis. Our study demonstrates a novel function for Mef2a in post-ischemic neovascularization via post-transcriptional regulation of 14q32 microRNAs miR-329 and miR-494.
Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites
Energy Technology Data Exchange (ETDEWEB)
Anderson, Courtney M. [Univ. of California, San Francisco, CA (United States). Cardiovascular Research Inst.; Hu, Jianxin [Univ. of California, San Francisco, CA (United States). Cardiovascular Research Inst.; Thomas, Reuben [Univ. of California, San Francisco, CA (United States). Gladstone Inst.; Gainous, T. Blair [Univ. of California, San Francisco, CA (United States). Cardiovascular Research Inst.; Celona, Barbara [Univ. of California, San Francisco, CA (United States). Cardiovascular Research Inst.; Sinha, Tanvi [Univ. of California, San Francisco, CA (United States). Cardiovascular Research Inst.; Dickel, Diane E. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Genomics Division; Heidt, Analeah B. [Univ. of California, San Francisco, CA (United States). Cardiovascular Research Inst.; Xu, Shan-Mei [Univ. of California, San Francisco, CA (United States). Cardiovascular Research Inst.; Bruneau, Benoit G. [Univ. of California, San Francisco, CA (United States). Cardiovascular Research Inst.; Univ. of California, San Francisco, CA (United States). Gladstone Inst.; Pollard, Katherine S. [Univ. of California, San Francisco, CA (United States). Gladstone Inst.; Pennacchio, Len A. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Genomics Division; Black, Brian L. [Univ. of California, San Francisco, CA (United States). Cardiovascular Research Inst.; Univ. of California, San Francisco, CA (United States). Dept. of
2017-03-28
Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by the SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.
Energy Technology Data Exchange (ETDEWEB)
Yuasa, Katsutoshi; Aoki, Natsumi; Hijikata, Takao, E-mail: hijikata@musashino-u.ac.jp
2015-08-15
Single-nucleotide polymorphisms associated with type 2 diabetes (T2D) have been identified in Jazf1, which is also involved in the oncogenesis of endometrial stromal tumors. To understand how Jazf1 variants confer a risk of tumorigenesis and T2D, we explored the functional roles of JAZF1 and searched for JAZF1 target genes in myogenic C2C12 cells. Consistent with an increase of Jazf1 transcripts during myoblast proliferation and their decrease during myogenic differentiation in regenerating skeletal muscle, JAZF1 overexpression promoted cell proliferation, whereas it retarded myogenic differentiation. Examination of myogenic genes revealed that JAZF1 overexpression transcriptionally repressed MEF2C and MRF4 and their downstream genes. AMP deaminase1 (AMPD1) was identified as a candidate for JAZF1 target by gene array analysis. However, promoter assays of Ampd1 demonstrated that mutation of the putative binding site for the TR4/JAZF1 complex did not alleviate the repressive effects of JAZF1 on promoter activity. Instead, JAZF1-mediated repression of Ampd1 occurred through the MEF2-binding site and E-box within the Ampd1 proximal regulatory elements. Consistently, MEF2C and MRF4 expression enhanced Ampd1 promoter activity. AMPD1 overexpression and JAZF1 downregulation impaired AMPK phosphorylation, while JAZF1 overexpression also reduced it. Collectively, these results suggest that aberrant JAZF1 expression contributes to the oncogenesis and T2D pathogenesis. - Highlights: • JAZF1 promotes cell cycle progression and proliferation of myoblasts. • JAZF1 retards myogenic differentiation and hypertrophy of myotubes. • JAZF1 transcriptionally represses Mef2C and Mrf4 expression. • JAZF1 has an impact on the phosphorylation of AMPK.
Avaliação molecular e fenotípica da superexpressão e do silenciamento de MEF2C em miócitos cardíacos
Ana Helena Macedo Pereira
2013-01-01
Resumo: Os fatores MEF2 (Myocyte Enhancer Factor 2) pertencem à família MADS Box (MCM1-Agamous-Deficiens-Serum response factor) e foram descritos pela primeira vez como fatores de transcrição que se ligam a sequencias de DNA ricas em A/T nos promotores de vários genes músculo específicos. Existem 4 genes da família MEF2 que foram identificados em vertebrados: MEF2A, B, C e D que são expressos de forma distinta durante a embriogênese e nos tecidos adultos. Estudos anteriores do nosso laboratór...
ATM-Dependent Phosphorylation of MEF2D Promotes Neuronal Survival after DNA Damage
Chan, Shing Fai; Sances, Sam; Brill, Laurence M.; Okamoto, Shu-ichi; Zaidi, Rameez; McKercher, Scott R.; Akhtar, Mohd W.; Nakanishi, Nobuki
2014-01-01
Mutations in the ataxia telangiectasia mutated (ATM) gene, which encodes a kinase critical for the normal DNA damage response, cause the neurodegenerative disorder ataxia-telangiectasia (AT). The substrates of ATM in the brain are poorly understood. Here we demonstrate that ATM phosphorylates and activates the transcription factor myocyte enhancer factor 2D (MEF2D), which plays a critical role in promoting survival of cerebellar granule cells. ATM associates with MEF2D after DNA damage and phosphorylates the transcription factor at four ATM consensus sites. Knockdown of endogenous MEF2D with a short-hairpin RNA (shRNA) increases sensitivity to etoposide-induced DNA damage and neuronal cell death. Interestingly, substitution of endogenous MEF2D with an shRNA-resistant phosphomimetic MEF2D mutant protects cerebellar granule cells from cell death after DNA damage, whereas an shRNA-resistant nonphosphorylatable MEF2D mutant does not. In vivo, cerebella in Mef2d knock-out mice manifest increased susceptibility to DNA damage. Together, our results show that MEF2D is a substrate for phosphorylation by ATM, thus promoting survival in response to DNA damage. Moreover, dysregulation of the ATM–MEF2D pathway may contribute to neurodegeneration in AT. PMID:24672010
Joseph, Jitcy S; Ayeleso, Ademola O; Mukwevho, Emmanuel
2017-04-22
Exercise brings changes on the chromatin ensuing the upregulation of many genes that confer protection from type 2 diabetes. In type-2 diabetes, critical genes are down-regulated such as those involved in glucose transport (GLUT4, MEF2A) and also oxidative phosphorylation (NRF-1 and its target genes). Recent reports have shown that NRF-1 not only regulate mitochondrial oxidative genes but also controls MEF2A, the main transcription factor for glucose transporter, GLUT4. Such dual control of the two pathways by NRF-1 place it as critical gene in the design of therapeutic modalities much needed to cure or better manage type 2 diabetes. Although it is known that NRF-1 controls these dual pathways (glucose transport and oxidative phosphorylation), the actual molecular mechanisms involved surrounding this regulation remains elusive. NRF-1 itself is regulated through posttranslational modifications (acetylation, methylation and phosphorylation) resulting in enhanced binding to its target genes. This study is therefore aimed at assessing whether CaMKII, a kinase activated by exercise brings about hyper-acetylation of histones in the vicinity of NRF-1 target gene, Mef2a. Five to six weeks old male Wistar rats were used in this study. Chromatin immunoprecipitation (ChIP) assay was used to investigate the extent through which NRF-1 is bound to the Mef2a gene and if this was associated with hyper-acetylation of histones in the region of NRF-1 binding site of the Mef2a gene. Quantitative real time PCR (qPCR) was used to determine the gene expression of MEF2A and NRF-1. Results from this study indicated that exercise-induced CaMKII activation increased hyper-acetylation of histones in the region of NRF-1 binding site on vicinity of Mef2a gene and this was associated with the increased binding of NRF-1 to Mef2a gene. Exercise also increased the expression of NRF-1 and MEF2A genes. Administration of CaMKII inhibitor (KN93) prior to exercise attenuated the observed exercise
Research Article Identification of novel MEF2A transcripts Novel ...
Indian Academy of Sciences (India)
Accdon
transcription factors have different and overlapped expression patterns in developing embryos and adult animal tissues (McKinsey et al. 2002). MEF2A promotes the regeneration of adult rat skeletal muscle by regulating the. microRNA (miRNA)-mediated Wnt signaling pathway (Snyder et al. 2013). MEF2A-knockout mice ...
Directory of Open Access Journals (Sweden)
Zhenguo Dong
2015-01-01
Full Text Available Our previous study reported that muscle cell enhancement factor 2C (MEF2C was fully activated after inhibition of the phosphorylation activity of integrin-linked kinase (ILK in the skeletal muscle cells of goats. It enhanced the binding of promoter or enhancer of transcription factor related to proliferation of muscle cells and then regulated the expression of these genes. In the present investigation, we explored whether ILK activation depended on PI3K to regulate the phosphorylation and transcriptional activity of MEF2C during C2C12 cell proliferation. We inhibited PI3K activity in C2C12 with LY294002 and then found that ILK phosphorylation levels and MEF2C phosphorylation were decreased and that MCK mRNA expression was suppressed significantly. After inhibiting ILK phosphorylation activity with Cpd22 and ILK-shRNA, we found MEF2C phosphorylation activity and MCK mRNA expression were increased extremely significantly. In the presence of Cpd22, PI3K activity inhibition increased MEF2C phosphorylation and MCK mRNA expression indistinctively. We conclude that ILK negatively and independently of PI3K regulated MEF2C phosphorylation activity and MCK mRNA expression in C2C12 cells. The results provide new ideas for the study of classical signaling pathway of PI3K-ILK-related proteins and transcription factors.
Sibony, Michal; Abdullah, Majd; Greenfield, Laura; Raju, Deepa; Wu, Ted; Rodrigues, David M; Galindo-Mata, Esther; Mascarenhas, Heidi; Philpott, Dana J; Silverberg, Mark S; Jones, Nicola L
2015-12-01
Autophagy is implicated in Crohn's disease (CD) pathogenesis. Recent evidence suggests autophagy regulates the microRNA (miRNA)-induced silencing complex (miRISC). Therefore, autophagy may play a novel role in CD by regulating expression of miRISC, thereby altering miRNA silencing. As microbes associated with CD can alter autophagy, we hypothesized that microbial disruption of autophagy affects the critical miRISC component AGO2. AGO2 expression was assessed in epithelial and immune cells, and intestinal organoids with disrupted autophagy. Microarray technology was used to determine the expression of downstream miRNAs in cells with defective autophagy. Increased AGO2 was detected in autophagy-deficient ATG5-/- and ATG16-/- mouse embryonic fibroblast cells (MEFs) in comparison with wild-type MEFs. Chemical agents and VacA toxin, which disrupt autophagy, increased AGO2 expression in MEFs, epithelial cells lines, and human monocytes, respectively. Increased AGO2 was also detected in ATG7-/- intestinal organoids, in comparison with wild-type organoids. Five miRNAs were differentially expressed in autophagy-deficient MEFs. Pathway enrichment analysis of the differentially expressed miRNAs implicated signaling pathways previously associated with CD. Taken together, our results suggest that autophagy is involved in the regulation of the critical miRISC component AGO2 in epithelial and immune cells and primary intestinal epithelial cells. We propose a mechanism by which autophagy alters miRNA expression, which likely impacts the regulation of CD-associated pathways. Furthermore, as enteric microbial products can manipulate autophagy and AGO2, our findings suggest a novel mechanism by which enteric microbes could influence miRNA to promote disease.
Mef2d is essential for the maturation and integrity of retinal photoreceptor and bipolar cells.
Omori, Yoshihiro; Kitamura, Tamiki; Yoshida, Satoyo; Kuwahara, Ryusuke; Chaya, Taro; Irie, Shoichi; Furukawa, Takahisa
2015-05-01
Mef2 transcription factors play a crucial role in cardiac and skeletal muscle differentiation. We found that Mef2d is highly expressed in the mouse retina and its loss causes photoreceptor degeneration similar to that observed in human retinitis pigmentosa patients. Electroretinograms (ERGs) were severely impaired in Mef2d-/- mice. Immunohistochemistry showed that photoreceptor and bipolar cell synapse protein levels severely decreased in the Mef2d-/- retina. Expression profiling by microarray analysis showed that Mef2d is required for the expression of various genes in photoreceptor and bipolar cells, including cone arrestin, Guca1b, Pde6h and Cacna1s, which encode outer segment and synapse proteins. We also observed that Mef2d synergistically activates the cone arrestin (Arr3) promoter with Crx, suggesting that functional cooperation between Mef2d and Crx is important for photoreceptor cell gene regulation. Taken together, our results show that Mef2d is essential for photoreceptor and bipolar cell gene expression, either independently or cooperatively with Crx. © 2015 Institution for Protein Research. Genes to Cells published by Wiley Publishing Asia Pty Ltd and the Molecular Biology Society of Japan.
Directory of Open Access Journals (Sweden)
Shing Fai Chan
2015-03-01
Full Text Available The myocyte enhancer factor 2 (MEF2 family of transcription factors is highly expressed in the brain and constitutes a key determinant of neuronal survival, differentiation, and synaptic plasticity. However, genome-wide transcriptional profiling of MEF2-regulated genes has not yet been fully elucidated, particularly at the neural stem cell stage. Here we report the results of microarray analysis comparing mRNAs isolated from human neural progenitor/stem cells (hNPCs derived from embryonic stem cells expressing a control vector versus progenitors expressing a constitutively-active form of MEF2 (MEF2CA, which increases MEF2 activity. Microarray experiments were performed using the Illumina Human HT-12 V4.0 expression beadchip (GEO#: GSE57184. By comparing vector-control cells to MEF2CA cells, microarray analysis identified 1880 unique genes that were differentially expressed. Among these genes, 1121 genes were up-regulated and 759 genes were down-regulated. Our results provide a valuable resource for identifying transcriptional targets of MEF2 in hNPCs.
The Role of CREB, SRF, and MEF2 in Activity-Dependent Neuronal Plasticity in the Visual Cortex.
Pulimood, Nisha S; Rodrigues, Wandilson Dos Santos; Atkinson, Devon A; Mooney, Sandra M; Medina, Alexandre E
2017-07-12
The transcription factors CREB (cAMP response element binding factor), SRF (serum response factor), and MEF2 (myocyte enhancer factor 2) play critical roles in the mechanisms underlying neuronal plasticity. However, the role of the activation of these transcription factors in the different components of plasticity in vivo is not well known. In this study, we tested the role of CREB, SRF, and MEF2 in ocular dominance plasticity (ODP), a paradigm of activity-dependent neuronal plasticity in the visual cortex. These three proteins bind to the synaptic activity response element (SARE), an enhancer sequence found upstream of many plasticity-related genes (Kawashima et al., 2009; Rodríguez-Tornos et al., 2013), and can act cooperatively to express Arc , a gene required for ODP (McCurry et al., 2010). We used viral-mediated gene transfer to block the transcription function of CREB, SRF, and MEF2 in the visual cortex, and measured visually evoked potentials in awake male and female mice before and after a 7 d monocular deprivation, which allowed us to examine both the depression component (Dc-ODP) and potentiation component (Pc-ODP) of plasticity independently. We found that CREB, SRF, and MEF2 are all required for ODP, but have differential effects on Dc-ODP and Pc-ODP. CREB is necessary for both Dc-ODP and Pc-ODP, whereas SRF and MEF2 are only needed for Dc-ODP. This finding supports previous reports implicating SRF and MEF2 in long-term depression (required for Dc-ODP), and CREB in long-term potentiation (required for Pc-ODP). SIGNIFICANCE STATEMENT Activity-dependent neuronal plasticity is the cellular basis for learning and memory, and it is crucial for the refinement of neuronal circuits during development. Identifying the mechanisms of activity-dependent neuronal plasticity is crucial to finding therapeutic interventions in the myriad of disorders where it is disrupted, such as Fragile X syndrome, Rett syndrome, epilepsy, major depressive disorder, and autism
Highly sensitive C-reactive protein (CRP) assay using metal-enhanced fluorescence (MEF)
International Nuclear Information System (INIS)
Zhang, Yi; Keegan, Gemma L.; Stranik, Ondrej; Brennan-Fournet, Margaret E.; McDonagh, Colette
2015-01-01
Fluorescence has been extensively employed in the area of diagnostic immunoassays. A significant enhancement of fluorescence can be achieved when noble metal nanoparticles are placed in close proximity to fluorophores. This effect, referred to as metal-enhanced fluorescence (MEF), has the potential to produce immunoassays with a high sensitivity and a low limit of detection (LOD). In this study, we investigate the fluorescence enhancement effect of two different nanoparticle systems, large spherical silver nanoparticles (AgNPs) and gold edge-coated triangular silver nanoplates, and both systems were evaluated for MEF. The extinction properties and electric field enhancement of both systems were modeled, and the optimum system, spherical AgNPs, was used in a sandwich immunoassay for human C-reactive protein with a red fluorescent dye label. A significant enhancement in the fluorescence was observed, which corresponded to an LOD improvement of ∼19-fold compared to a control assay without AgNPs
Highly sensitive C-reactive protein (CRP) assay using metal-enhanced fluorescence (MEF)
Energy Technology Data Exchange (ETDEWEB)
Zhang, Yi; Keegan, Gemma L., E-mail: gemmakeegan@gmail.com [Dublin City University, School of Physical Sciences, Biomedical Diagnostics Institute (Ireland); Stranik, Ondrej [Leibniz Institute of Photonic Technology, Department of NanoBiophotonics (Germany); Brennan-Fournet, Margaret E. [CMP-EMSE, MOC, Department of Bioelectronics, Ecole Nationale Superieure des Mines (France); McDonagh, Colette [Dublin City University, School of Physical Sciences, Biomedical Diagnostics Institute (Ireland)
2015-07-15
Fluorescence has been extensively employed in the area of diagnostic immunoassays. A significant enhancement of fluorescence can be achieved when noble metal nanoparticles are placed in close proximity to fluorophores. This effect, referred to as metal-enhanced fluorescence (MEF), has the potential to produce immunoassays with a high sensitivity and a low limit of detection (LOD). In this study, we investigate the fluorescence enhancement effect of two different nanoparticle systems, large spherical silver nanoparticles (AgNPs) and gold edge-coated triangular silver nanoplates, and both systems were evaluated for MEF. The extinction properties and electric field enhancement of both systems were modeled, and the optimum system, spherical AgNPs, was used in a sandwich immunoassay for human C-reactive protein with a red fluorescent dye label. A significant enhancement in the fluorescence was observed, which corresponded to an LOD improvement of ∼19-fold compared to a control assay without AgNPs.
miR-30a suppresses osteosarcoma proliferation and metastasis by downregulating MEF2D expression
Directory of Open Access Journals (Sweden)
Du L
2018-04-01
Full Text Available Liuxue Du,* Tianpei Chen,* Kai Zhao,* Dong Yang Department of Orthopedics, the First Affiliated Hospital of Nanchang University, Nanchang, People’s Republic of China *These authors contributed equally to this work Abstract: Many studies have revealed that microRNAs (miRNAs play crucial roles in cancer development and progression. miRNA-30a (miR-30a, as a member of the miR-30 family, has been implicated in various cancers. However, the role of miR-30a in osteosarcoma remains unclear. In the current study, we found that miR-30a was significantly downregulated in osteosarcoma tissues and cell lines by using quantitative real-time polymerase chain reaction (qRT-PCR. In addition, miR-30a could inhibit cancer cell growth, migration, and invasion in vitro. Furthermore, bioinformatics of miRNA target prediction and luciferase reporter assay indicated that MEF2D is a direct target of miR-30a. miR-30a was able to reduce the mRNA and protein expression of MEF2D as assessed using RT-PCR and Western blotting assay. Interestingly, overexpression of MEF2D partially reversed the miR-30a-reduced cell proliferation, migration, and invasion of osteosarcoma cell, indicating that miR-30a suppresses osteosarcoma cell proliferation and metastasis partially mediated by inhibition of MEF2D. Overall, our study demonstrated that miR-30a functions as a tumor suppressor by targeting MEF2D in osteosarcoma, providing a promising prognostic biomarker and a therapeutic strategy for osteosarcoma. Keywords: miR-30a, MEF2D, osteosarcoma, proliferation, invasion, migration
Directory of Open Access Journals (Sweden)
Rafael Estrada-Avilés
Full Text Available Calsequestrin-2 (CASQ2 is the main Ca2+-binding protein inside the sarcoplasmic reticulum of cardiomyocytes. Previously, we demonstrated that MEF-2 and SRF binding sites within the human CASQ2 gene (hCASQ2 promoter region are functional in neonatal cardiomyocytes. In this work, we investigated if the calcineurin/NFAT pathway regulates hCASQ2 expression in neonatal cardiomyocytes. The inhibition of NFAT dephosphorylation with CsA or INCA-6, reduced both the luciferase activity of hCASQ2 promoter constructs (-3102/+176 bp and -288/+176 bp and the CASQ2 mRNA levels in neonatal rat cardiomyocytes. Additionally, NFATc1 and NFATc3 over-expressing neonatal cardiomyocytes showed a 2-3-fold increase in luciferase activity of both hCASQ2 promoter constructs, which was prevented by CsA treatment. Site-directed mutagenesis of the -133 bp MEF-2 binding site prevented trans-activation of hCASQ2 promoter constructs induced by NFAT overexpression. Chromatin Immunoprecipitation (ChIP assays revealed NFAT and MEF-2 enrichment within the -288 bp to +76 bp of the hCASQ2 gene promoter. Besides, a direct interaction between NFAT and MEF-2 proteins was demonstrated by protein co-immunoprecipitation experiments. Taken together, these data demonstrate that NFAT interacts with MEF-2 bound to the -133 bp binding site at the hCASQ2 gene promoter. In conclusion, in this work, we demonstrate that the Ca2+-calcineurin/NFAT pathway modulates the transcription of the hCASQ2 gene in neonatal cardiomyocytes.
Buhrow, Leann M; Clark, Shawn M; Loewen, Michele C
2016-01-01
Virus-induced gene silencing (VIGS) has become an emerging technology for the rapid, efficient functional genomic screening of monocot and dicot species. The barley stripe mosaic virus (BSMV) has been described as an effective VIGS vehicle for the evaluation of genes involved in wheat and barley phytopathogenesis; however, these studies have been obscured by BSMV-induced phenotypes and defense responses. The utility of BSMV VIGS may be improved using a BSMV genetic background which is more tolerable to the host plant especially upon secondary infection of highly aggressive, necrotrophic pathogens such as Fusarium graminearum. BSMV-induced VIGS in Triticum aestivum (bread wheat) cv. 'Fielder' was assessed for the study of wheat genes putatively related to Fusarium Head Blight (FHB), the necrotrophism of wheat and other cereals by F. graminearum. Due to the lack of 'Fielder' spike viability and increased accumulation of Fusarium-derived deoxynivalenol contamination upon co-infection of BSMV and FHB, an attenuated BSMV construct was generated by the addition of a glycine-rich, C-terminal peptide to the BSMV γ b protein. This attenuated BSMV effectively silenced target wheat genes while limiting disease severity, deoxynivalenol contamination, and yield loss upon Fusarium co-infection compared to the original BSMV construct. The attenuated BSMV-infected tissue exhibited reduced abscisic, jasmonic, and salicylic acid defense phytohormone accumulation upon secondary Fusarium infection. Finally, the attenuated BSMV was used to investigate the role of the salicylic acid-responsive pathogenesis-related 1 in response to FHB. The use of an attenuated BSMV may be advantageous in characterizing wheat genes involved in phytopathogenesis, including Fusarium necrotrophism, where minimal viral background effects on defense are required. Additionally, the attenuated BSMV elicits reduced defense hormone accumulation, suggesting that this genotype may have applications for the
Cao, Yongmei; Jiang, Zhen; Zeng, Zhen; Liu, Yujing; Gu, Yuchun; Ji, Yingying; Zhao, Yupeng; Li, Yingchuan
2016-01-01
Pulmonary arterial hypertension (PAH) is a life-threatening disorder that ultimately causes heart failure. While the underlying causes of this condition are not well understood, previous studies suggest that the anti-apoptotic nature of pulmonary microvascular endothelial cells (PMVECs) in hypoxic environments contributes to PAH pathogenesis. In this study, we focus on the contribution of Bcl-2 and hypoxia response element (HRE) to apoptosis-resistant endothelial cells and investigate the mechanism. PMVECs obtained from either normal rats or apoptosis-resistant PMVECs obtained from PAH rats were transduced with recombinant lentiviral vectors carrying either Bcl-2-shRNA or HRE combined Bcl-2-shRNA, and then cultured these cells for 24 h under hypoxic (5% O2) or normoxic (21% O2) conditions. In normal PMVECs, Bcl-2-shRNA or HRE combined with Bcl-2-shRNA transduction successfully decreased Bcl-2 expression, while increasing apoptosis as well as caspase-3 and P53 expression in a normoxic environment. In a hypoxic environment, the effects of Bcl-2-shRNA treatment on cell apoptosis, and on Bcl-2, caspase-3, P53 expression were significantly suppressed. Conversely, HRE activation combined with Bcl-2-shRNA transduction markedly enhanced cell apoptosis and upregulated caspase-3 and P53 expression, while decreasing Bcl-2 expression. Furthermore, in apoptosis-resistant PMVECs, HRE-mediated Bcl-2 silencing effectively enhanced cell apoptosis and caspase-3 activity. The apoptosis rate was significantly depressed when Lv-HRE-Bcl-2-shRNA was combined with Lv-P53-shRNA or Lv-caspase3-shRNA transduction in a hypoxic environment. These results suggest that HRE-mediated Bcl-2 inhibition can effectively attenuate hypoxia-induced apoptosis resistance in PMVECs by downregulating Bcl-2 expression and upregulating caspase-3 and P53 expression. This study therefore reveals critical insight into potential therapeutic targets for treating PAH.
Ultrasonic attenuation in niobium II: measurements near Bsub(c2)
International Nuclear Information System (INIS)
Forgan, E.M.; Gough, C.E.
1978-01-01
The attenuation of 10 to 90 MHz longitudinal sound waves has been measured from 1.2 K upwards in the superconducting mixed state of niobium near Bsub(c2). The attenuation was determined as a function of the directly measured average induction, B, within single crystal specimens which had resistance ratios ranging from 83 to 3380. The specimens tended to the 'clean' limit (electron mean free path, 1 much greater than xi 0 , the superconducting coherence length) in which there is a strong purity dependence of the relative attenuation. For the purest crystals close to Bsub(C2), the results are in reasonable agreement with the purity and field dependence predicted by microscopic theories, and agree over a much wider field range with a phenomenological modification of these theories. Measurements of attenuation and other transport properties in clean type II superconductors by other authors are discussed and it is shown that many of the evident discrepancies can be attributed to neglect of the effects of magnetic irreversibility and crystalline anisotropy. (author)
Directory of Open Access Journals (Sweden)
M Fathi
2016-11-01
Full Text Available Introduction: Myocyte Enhancer Factor 2 (mef2 gene relates with multiple myogenic transcriptional factors that induces activation Muscle-specific genes. MEF2 contributes in muscular cells development and differentiation as well as in fibers transition in response to stimulants. Therefore, the aim of this study was to evaluate the effect of one bout of resistance exercise (RE on mef2 gene expression in fast and slow skeletal muscles of Wistar male rats. Methods: For this experimental study, 15 rats from Pasteur Institute were prepared and housed under natural conditions (temperature, light/dark (12:12 cycle, with ad libitum access to food and water and then randomly divided assigned to RE (n=10 and control groups (n=5; the RE group performed one RE session. 3 and 6 hours following, the rats were anaesthetized and sacrificed, then the soleus and Extensor digitorum longus (EDL muscles were removed. determine mef2 gene expression rate, the Quantitative Real time RT-PCR was used. Data were analyzed by one sample and independent samples t test. Results: In EDL muscle, in response to one RE session, the mef2 gene expression increased non significantly at 3 hour (p=0/093 and increased significantly (p=/008 at 6 hour after exercise, but in soleus muscle, the mef2 gene expression decreased significantly at 3 hour (p=0/01, and at 6 hour after RE session there was no observed significant change (p=0.247. Conclusion: Mef2 expression gene is differently changes in muscle fibers, which are likely associated with changes in fiber type in response to resistance exercise.
Effect of sex differences on human MEF2 regulation during endurance exercise
DEFF Research Database (Denmark)
Vissing, Kristian; McGee, Sean L; Roepstorff, Carsten
2008-01-01
. The primary purpose of this study, therefore, was to investigate the protein signaling of MEF2 regulatory pathway components at rest and during 90 min of bicycling exercise at 60% Vo(2peak) in healthy, moderately trained men (n = 8) and women (n = 9) to elucidate the potential role of these proteins...
Callegari, Sylvie; McKinnon, Ross A; Andrews, Stuart; de Barros Lopes, Miguel A
2011-04-20
The Saccharomyces cerevisiae MEF2 gene is a mitochondrial protein translation factor. Formerly believed to catalyze peptide elongation, evidence now suggests its involvement in ribosome recycling. This study confirms the role of the MEF2 gene for cell respiration and further uncovers a slow growth phenotype and reduced chronological lifespan. Furthermore, in comparison with cytoplasmic ρ(0) strains, mef2Δ strains have a marked reduction of the inner mitochondrial membrane potential and mitochondria show a tendency to aggregate, suggesting an additional role for the MEF2 gene in maintenance of mitochondrial health, a role that may also be shared by other mitochondrial protein synthesis factors. Copyright © 2011 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Paulo M F Cunha
2010-07-01
Full Text Available Understanding how complex patterns of temporal and spatial expression are regulated is central to deciphering genetic programs that drive development. Gene expression is initiated through the action of transcription factors and their cofactors converging on enhancer elements leading to a defined activity. Specific constellations of combinatorial occupancy are therefore often conceptualized as rigid binding codes that give rise to a common output of spatio-temporal expression. Here, we assessed this assumption using the regulatory input of two essential transcription factors within the Drosophila myogenic network. Mutations in either Myocyte enhancing factor 2 (Mef2 or the zinc-finger transcription factor lame duck (lmd lead to very similar defects in myoblast fusion, yet the underlying molecular mechanism for this shared phenotype is not understood. Using a combination of ChIP-on-chip analysis and expression profiling of loss-of-function mutants, we obtained a global view of the regulatory input of both factors during development. The majority of Lmd-bound enhancers are co-bound by Mef2, representing a subset of Mef2's transcriptional input during these stages of development. Systematic analyses of the regulatory contribution of both factors demonstrate diverse regulatory roles, despite their co-occupancy of shared enhancer elements. These results indicate that Lmd is a tissue-specific modulator of Mef2 activity, acting as both a transcriptional activator and repressor, which has important implications for myogenesis. More generally, this study demonstrates considerable flexibility in the regulatory output of two factors, leading to additive, cooperative, and repressive modes of co-regulation.
LENUS (Irish Health Repository)
Horan, Paul G
2006-01-01
BACKGROUND: Ischaemic heart disease (IHD) is a complex disease due to the combination of environmental and genetic factors. Mutations in the MEF2A gene have recently been reported in patients with IHD. In particular, a 21 base pair deletion (Delta7aa) in the MEF2A gene was identified in a family with an autosomal dominant pattern of inheritance of IHD. We investigated this region of the MEF2A gene using an Irish family-based study, where affected individuals had early-onset IHD. METHODS: A total of 1494 individuals from 580 families were included (800 discordant sib-pairs and 64 parent-child trios). The Delta7aa region of the MEF2A gene was investigated based on amplicon size. RESULTS: The Delta7aa mutation was not detected in any individual. Variation in the number of CAG (glutamate) and CCG (proline) residues was detected in a nearby region. However, this was not found to be associated with IHD. CONCLUSION: The Delta7aa mutation was not detected in any individual within the study population and is unlikely to play a significant role in the development of IHD in Ireland. Using family-based tests of association the number of tri-nucleotide repeats in a nearby region of the MEF2A gene was not associated with IHD in our study group.
Guo, Baojian; Hu, Shengquan; Zheng, Chengyou; Wang, Hongyu; Luo, Fangcheng; Li, Haitao; Cui, Wei; Yang, Xifei; Cui, Guozhen; Mak, Shinghung; Choi, Tony Chung-Lit; Ma, Edmond Dik-Lung; Wang, Yuqiang; Lee, Simon Ming Yuen; Zhang, Zaijun; Han, Yifan
2017-11-01
We have previously demonstrated the unexpected neuroprotection of the anti-cancer agent SU4312 in cellular models associated with Parkinson's disease (PD). However, the precise mechanisms underlying its neuroprotection are still unknown, and the effects of SU4312 on rodent models of PD have not been characterized. In the current study, we found that the protection of SU4312 against 1-methyl-4-phenylpyridinium ion (MPP + )-induced neurotoxicity in PC12 cells was achieved through the activation of transcription factor myocyte enhancer factor 2D (MEF2D), as evidenced by the fact that SU4312 stimulated myocyte enhancer factor 2 (MEF2) transcriptional activity and prevented the inhibition of MEF2D protein expression caused by MPP + , and that short hairpin RNA (ShRNA)-mediated knockdown of MEF2D significantly abolished the neuroprotection of SU4312. Additionally, Western blotting analysis revealed that SU4312 potentiated pro-survival PI3-K/Akt pathway to down-regulate MEF2D inhibitor glycogen synthase kinase-3beta (GSK3β). Furthermore, using the in vivo PD model of C57BL/6 mice insulted with 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP), we found that intragastrical administration of SU4312 (0.2 and 1 mg/kg) greatly ameliorated Parkinsonian motor defects, and restored protein levels of MEF2D, phosphorylated-Ser473-Akt and phosphorylated-Ser9-GSK3β. Meanwhile, SU4312 effectively reversed the decrease in protein expression of tyrosine hydroxylase in substantia nigra pars compacta dopaminergic neurons, inhibited oxidative stress, maintained mitochondrial biogenesis and partially prevented the depletion of dopamine and its metabolites. Very encouragingly, SU4312 was able to selectively inhibit monoamine oxidase-B (MAO-B) activity both in vitro and in vivo, with an IC 50 value of 0.2 μM. These findings suggest that SU4312 provides therapeutic benefits in cellular and animal models of PD, possibly through multiple mechanisms including enhancement of MEF2D
Zeng, Kaixuan; Chen, Xiaoxiang; Hu, Xiuxiu; Liu, Xiangxiang; Xu, Tao; Sun, Huiling; Pan, Yuqin; He, Bangshun; Wang, Shukui
2018-06-13
Colorectal cancer (CRC) is one of the most common aggressive malignancies. Like other solid tumors, inactivation of tumor suppressor genes and activation of oncogenes occur during CRC development and progression. Recently, a novel tumor suppressor, LACTB, was proposed to inhibit tumor progression, but the functional and clinical significance of this tumor suppressor in CRC remains unexplored. Herein, we found LACTB was significantly downregulated in CRC due to promoter methylation and histone deacetylation, which was associated with metastasis and advanced clinical stage. CRC patients with low LACTB expression had poorer overall survival and LACTB also determined to be an independent prognostic factor for poorer outcome. Ectopic expression of LACTB suppressed CRC cells proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT) in vitro and inhibited CRC growth and metastasis in vivo, while knockout of LACTB by CRISPR/Cas9 gene editing technique resulted in an opposite phenotype. Interestingly, LACTB could exert antitumorigenic effect only in HCT116 and HCT8 cells harboring wild-type TP53, but not in HT29 and SW480 cells harboring mutant TP53 or HCT116 p53 -/- cells. Mechanistic studies demonstrated that LACTB could directly bind to the C terminus of p53 to inhibit p53 degradation by preventing MDM2 from interacting with p53. Moreover, ablation of p53 attenuated the antitumorigenic effects of LACTB overexpression in CRC. Collectively, our findings successfully demonstrate for the first time that LACTB is a novel epigenetic silenced tumor suppressor through modulating the stability of p53, supporting the pursuit of LACTB as a potential therapeutic target for CRC.
Optical silencing of C. elegans cells with arch proton pump.
Directory of Open Access Journals (Sweden)
Ayako Okazaki
Full Text Available BACKGROUND: Optogenetic techniques using light-driven ion channels or ion pumps for controlling excitable cells have greatly facilitated the investigation of nervous systems in vivo. A model organism, C. elegans, with its small transparent body and well-characterized neural circuits, is especially suitable for optogenetic analyses. METHODOLOGY/PRINCIPAL FINDINGS: We describe the application of archaerhodopsin-3 (Arch, a recently reported optical neuronal silencer, to C. elegans. Arch::GFP expressed either in all neurons or body wall muscles of the entire body by means of transgenes were localized, at least partially, to the cell membrane without adverse effects, and caused locomotory paralysis of worms when illuminated by green light (550 nm. Pan-neuronal expression of Arch endowed worms with quick and sustained responsiveness to such light. Worms reliably responded to repeated periods of illumination and non-illumination, and remained paralyzed under continuous illumination for 30 seconds. Worms expressing Arch in different subsets of motor neurons exhibited distinct defects in the locomotory behavior under green light: selective silencing of A-type motor neurons affected backward movement while silencing of B-type motor neurons affected forward movement more severely. Our experiments using a heat-shock-mediated induction system also indicate that Arch becomes fully functional only 12 hours after induction and remains functional for more than 24 hour. CONCLUSIONS/SGNIFICANCE: Arch can be used for silencing neurons and muscles, and may be a useful alternative to currently widely used halorhodopsin (NpHR in optogenetic studies of C. elegans.
Zhong, Xueting; Wang, Zhan Qi; Xiao, Ruyuan; Cao, Linge; Wang, Yaqin; Xie, Yan; Zhou, Xueping
2017-08-15
Phosphorylation of the βC1 protein encoded by the betasatellite of tomato yellow leaf curl China virus (TYLCCNB-βC1) by SNF1-related protein kinase 1 (SnRK1) plays a critical role in defense of host plants against geminivirus infection in Nicotiana benthamiana However, how phosphorylation of TYLCCNB-βC1 impacts its pathogenic functions during viral infection remains elusive. In this study, we identified two additional tyrosine residues in TYLCCNB-βC1 that are phosphorylated by SnRK1. The effects of TYLCCNB-βC1 phosphorylation on its functions as a viral suppressor of RNA silencing (VSR) and a symptom determinant were investigated via phosphorylation mimic mutants in N. benthamiana plants. Mutations that mimic phosphorylation of TYLCCNB-βC1 at tyrosine 5 and tyrosine 110 attenuated disease symptoms during viral infection. The phosphorylation mimics weakened the ability of TYLCCNB-βC1 to reverse transcriptional gene silencing and to suppress posttranscriptional gene silencing and abolished its interaction with N. benthamiana ASYMMETRIC LEAVES 1 in N. benthamiana leaves. The mimic phosphorylation of TYLCCNB-βC1 had no impact on its protein stability, subcellular localization, or self-association. Our data establish an inhibitory effect of phosphorylation of TYLCCNB-βC1 on its pathogenic functions as a VSR and a symptom determinant and provide a mechanistic explanation of how SnRK1 functions as a host defense factor. IMPORTANCE Tomato yellow leaf curl China virus (TYLCCNV), which causes a severe yellow leaf curl disease in China, is a monopartite geminivirus associated with the betasatellite (TYLCCNB). TYLCCNB encodes a single pathogenicity protein, βC1 (TYLCCNB-βC1), which functions as both a viral suppressor of RNA silencing (VSR) and a symptom determinant. Here, we show that mimicking phosphorylation of TYLCCNB-βC1 weakens its ability to reverse transcriptional gene silencing, to suppress posttranscriptional gene silencing, and to interact with N
IRE1α links Nck1 deficiency to attenuated PTP1B expression in HepG2 cells.
Li, Hui; Li, Bing; Larose, Louise
2017-08-01
PTP1B, a prototype of the non-receptor subfamily of the protein tyrosine phosphatase superfamily, plays a key role in regulating intracellular signaling from various receptor and non-receptor protein tyrosine kinases. Previously, we reported that silencing Nck1 in human hepatocellular carcinoma HepG2 cells enhances basal and growth factor-induced activation of the PI3K-Akt pathway through attenuating PTP1B expression. However, the underlying mechanism by which Nck1 depletion represses PTP1B expression remains unclear. In this study, we found that silencing Nck1 attenuates PTP1B expression in HepG2 cells through down-regulation of IRE1α. Indeed, we show that silencing Nck1 in HepG2 cells leads to decreased IRE1α expression and signaling. Accordingly, IRE1α depletion using siRNA in HepG2 cells enhances PI3K-dependent basal and growth factor-induced Akt activation, reproducing the effects of silencing Nck1 on activation of this pathway. In addition, depletion of IRE1α also leads to reduced PTP1B expression, which was rescued by ectopic expression of IRE1α in Nck1-depleted cells. Mechanistically, we found that silencing either Nck1 or IRE1α in HepG2 cells decreases PTP1B mRNA levels and stability. However, despite miR-122 levels, a miRNA targeting PTP1B 3' UTR and inducing PTP1B mRNA degradation in HepG2 cells, are increased in both Nck1- and IRE1α-depleted HepG2 cells, a miR-122 antagomir did not rescue PTP1B expression in these cells. Overall, this study highlights an important role for Nck1 in fine-tuning IRE1α expression and signaling that regulate PTP1B expression and subsequent activation of the PI3K-Akt pathway in HepG2 cells. Copyright © 2017 Elsevier Inc. All rights reserved.
Epigenetic silencing of serine protease HTRA1 drives polyploidy
International Nuclear Information System (INIS)
Schmidt, Nina; Irle, Inga; Ripkens, Kamilla; Lux, Vanda; Nelles, Jasmin; Johannes, Christian; Parry, Lee; Greenow, Kirsty; Amir, Sarah; Campioni, Mara; Baldi, Alfonso; Oka, Chio; Kawaichi, Masashi; Clarke, Alan R.; Ehrmann, Michael
2016-01-01
Increased numbers and improperly positioned centrosomes, aneuploidy or polyploidy, and chromosomal instability are frequently observed characteristics of cancer cells. While some aspects of these events and the checkpoint mechanisms are well studied, not all players have yet been identified. As the role of proteases other than the proteasome in tumorigenesis is an insufficiently addressed question, we investigated the epigenetic control of the widely conserved protease HTRA1 and the phenotypes of deregulation. Mouse embryonal fibroblasts and HCT116 and SW480 cells were used to study the mechanism of epigenetic silencing of HTRA1. In addition, using cell biological and genetic methods, the phenotypes of downregulation of HTRA1 expression were investigated. HTRA1 is epigenetically silenced in HCT116 colon carcinoma cells via the epigenetic adaptor protein MBD2. On the cellular level, HTRA1 depletion causes multiple phenotypes including acceleration of cell growth, centrosome amplification and polyploidy in SW480 colon adenocarcinoma cells as well as in primary mouse embryonic fibroblasts (MEFs). Downregulation of HTRA1 causes a number of phenotypes that are hallmarks of cancer cells suggesting that the methylation state of the HtrA1 promoter may be used as a biomarker for tumour cells or cells at risk of transformation. The online version of this article (doi:10.1186/s12885-016-2425-8) contains supplementary material, which is available to authorized users
Gas turbine exhaust system silencing design
International Nuclear Information System (INIS)
Ozgur, D.
1991-01-01
Gas turbines are the preferred prime mover in many applications because of their high efficiency, fuel flexibility, and low environmental impact. A typical mid-size machine might have a power rating of 80 MW, a flow of about 1000 kg/hr, and an exhaust temperature of over 500C. The most powerful single source of noise is generally the exhaust, which may generate over a kilowatt of acoustic energy. This paper reports that there are two important ways in which exhaust systems can radiate noise. The first is through the discharge of the exhaust duct, with the exhaust gas. Because of the large quantity of hot gas, the duct exit is always oriented vertically; it may be fairly high in the air in order to promote dispersion of the exhaust plume. This source is almost always attenuated by means of a silencer located somewhere in the ductwork. The second source of noise is often called breakout; it is the radiation of exhaust noise through the walls of the ducting. Breakout is most important for those sections of the exhaust duct which lie upstream of the silencer, where sound levels inside the ducting are highest. Both exhaust duct exit noise and breakout noise can be calculated from the sound power level of the gas turbine exhaust and the sound transmission loss (TL) of the silencer and ducting
Directory of Open Access Journals (Sweden)
Shiu-Ming Kuo
Full Text Available Vitamin C has been shown to delay the cellular senescence and was considered a candidate for chemoprevention and cancer therapy. To understand the reported contrasting roles of vitamin C: growth-promoting in the primary cells and growth-inhibiting in cancer cells, primary mouse embryonic fibroblasts (MEF and their isogenic spontaneously immortalized fibroblasts with unlimited cell division potential were used as the model pair. We used microarray gene expression profiling to show that the immortalized MEF possess human cancer gene expression fingerprints including a pattern of up-regulation of inflammatory response-related genes. Using the MEF model, we found that a physiological treatment level of vitamin C (10(-5 M, but not other unrelated antioxidants, enhanced cell growth. The growth-promoting effect was associated with a pattern of enhanced expression of cell cycle- and cell division-related genes in both primary and immortalized cells. In the immortalized MEF, physiological treatment levels of vitamin C also enhanced the expression of immortalization-associated genes including a down-regulation of genes in the extracellular matrix functional category. In contrast, confocal immunofluorescence imaging of the primary MEF suggested an increase in collagen IV protein upon vitamin C treatment. Similar to the cancer cells, the growth-inhibitory effect of the redox-active form of vitamin C was preferentially observed in immortalized MEF. All effects of vitamin C required its intracellular presence since the transporter-deficient SVCT2-/- MEF did not respond to vitamin C. SVCT2-/- MEF divided and became immortalized readily indicating little dependence on vitamin C for the cell division. Immortalized SVCT2-/- MEF required higher concentration of vitamin C for the growth inhibition compared to the immortalized wildtype MEF suggesting an intracellular vitamin C toxicity. The relevance of our observation in aging and human cancer prevention was
Two classes of silencing RNAs move between C. elegans tissues
Jose, Antony M; Garcia, Giancarlo A; Hunter, Craig P
2011-01-01
Summary Organism-wide RNA interference (RNAi) is due to the transport of mobile silencing RNA throughout the organism but the identities of these mobile RNA species in animals are unknown. Here we present genetic evidence that both the initial double-stranded RNA (dsRNA), which triggers RNAi, and at least one dsRNA intermediate produced during RNAi can act as or generate mobile silencing RNA in Caenorhabditis elegans. This dsRNA intermediate requires the long dsRNA-binding protein RDE-4, the endonuclease DCR-1, which cleaves long dsRNA into double-stranded short-interfering RNA (ds-siRNA), and the putative nucleotidyltransferase MUT-2 (RDE-3). However, single-stranded siRNA and downstream secondary siRNA produced upon amplification by the RNA-dependent RNA Polymerase RRF-1 do not generate mobile silencing RNA. Restricting inter-tissue transport to long dsRNA and directly processed siRNA intermediates rather than amplified siRNA may serve to modulate the extent of systemic silencing in proportion to available dsRNA. PMID:21984186
Hao, Shoujin; Hao, Mary; Ferreri, Nicholas R
2018-06-01
We tested the hypothesis that TNF (tumor necrosis factor)-α produced within the kidney and acting on the renal tubular system is part of a regulatory mechanism that attenuates increases in blood pressure in response to high salt intake. Intrarenal administration of a lentivirus construct, which specifically silenced TNF in the kidney, did not affect baseline blood pressure. However, blood pressure increased significantly 1 day after mice with intrarenal silencing of TNF ingested 1% NaCl in the drinking water. The increase in blood pressure, which was continuously observed for 11 days, promptly returned to baseline levels when mice were switched from 1% NaCl to tap water. Silencing of renal TNF also increased NKCC2 (Na + -K + -2Cl - cotransporter) phosphorylation and induced a selective increase in NKCC2A (NKCC2 isoform A) mRNA accumulation in both the cortical and medullary thick ascending limb of Henle loop that was neither associated with a compensatory decrease of NKCC2F in the medulla nor NKCC2B in the cortex. The NaCl-mediated increases in blood pressure were completely absent when NKCC2A, using a lentivirus construct that did not alter expression of NKCC2F or NKCC2B, and TNF were concomitantly silenced in the kidney. Moreover, the decrease in urine volume and NaCl excretion induced by renal TNF silencing was abolished when NKCC2A was concurrently silenced, suggesting that this isoform contributes to the transition from a salt-resistant to salt-sensitive phenotype. Collectively, the data are the first to demonstrate a role for TNF produced by the kidney in the modulation of sodium homeostasis and blood pressure regulation. © 2018 American Heart Association, Inc.
Liu, Qian; Wang, Junguo; Miki, Daisuke; Xia, Ran; Yu, Wenxiang; He, Junna; Zheng, Zhimin; Zhu, Jian-Kang; Gonga, Zhizhong
2010-01-01
Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.
Liu, Qian
2010-07-01
Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.
Energy Technology Data Exchange (ETDEWEB)
Malek-Adamian, Elise; Guenther, Dale C.; Matsuda, Shigeo; Martínez-Montero, Saúl; Zlatev, Ivan; Harp, Joel; Patrascu, Mihai Burai; Foster, Donald J.; Fakhoury, Johans; Perkins, Lydia; Moitessier, Nicolas; Manoharan, Rajar M.; Taneja, Nate; Bisbe, Anna; Charisse, Klaus; Maier, Martin; Rajeev, Kallanthottathil G.; Egli, Martin; Manoharan, Muthiah; Damha, Masad J. (McGill); (Alnylam Pharm.); (Vanderbilt)
2017-10-06
We designed novel 4'-modified 2'-deoxy-2'-fluorouridine (2'-F U) analogues with the aim to improve nuclease resistance and potency of therapeutic siRNAs by introducing 4'-C-methoxy (4'-OMe) as the alpha (C4'α) or beta (C4'β) epimers. The C4'α epimer was synthesized by a stereoselective route in six steps; however, both α and β epimers could be obtained by a nonstereoselective approach starting from 2'-F U. 1H NMR analysis and computational investigation of the α-epimer revealed that the 4'-OMe imparts a conformational bias toward the North-East sugar pucker, due to intramolecular hydrogen bonding and hyperconjugation effects. The α-epimer generally conceded similar thermal stability as unmodified nucleotides, whereas the β-epimer led to significant destabilization. Both 4'-OMe epimers conferred increased nuclease resistance, which can be explained by the close proximity between 4'-OMe substituent and the vicinal 5'- and 3'-phosphate group, as seen in the X-ray crystal structure of modified RNA. siRNAs containing several C4'α-epimer monomers in the sense or antisense strands triggered RNAi-mediated gene silencing with efficiencies comparable to that of 2'-F U.
Seth, Meetu; Shirayama, Masaki; Gu, Weifeng; Ishidate, Takao; Conte, Darryl; Mello, Craig C
2013-12-23
Organisms can develop adaptive sequence-specific immunity by reexpressing pathogen-specific small RNAs that guide gene silencing. For example, the C. elegans PIWI-Argonaute/piwi-interacting RNA (piRNA) pathway recruits RNA-dependent RNA polymerase (RdRP) to foreign sequences to amplify a transgenerational small-RNA-induced epigenetic silencing signal (termed RNAe). Here, we provide evidence that, in addition to an adaptive memory of silenced sequences, C. elegans can also develop an opposing adaptive memory of expressed/self-mRNAs. We refer to this mechanism, which can prevent or reverse RNAe, as RNA-induced epigenetic gene activation (RNAa). We show that CSR-1, which engages RdRP-amplified small RNAs complementary to germline-expressed mRNAs, is required for RNAa. We show that a transgene with RNAa activity also exhibits accumulation of cognate CSR-1 small RNAs. Our findings suggest that C. elegans adaptively acquires and maintains a transgenerational CSR-1 memory that recognizes and protects self-mRNAs, allowing piRNAs to recognize foreign sequences innately, without the need for prior exposure
Energy Technology Data Exchange (ETDEWEB)
Das, Amitabh, E-mail: amitabhdas.kn@gmail.com [Department of Bionanotechnology, Hanyang University, Seoul 133-791 (Korea, Republic of); Chai, Jin Choul, E-mail: jincchai@gmail.com [Department of Molecular and Life Science, Hanyang University, 1271 Sa 3-dong, Ansan 426-791, Gyeonggi-do (Korea, Republic of); Jung, Kyoung Hwa, E-mail: khjung2@gmail.com [Department of Molecular and Life Science, Hanyang University, 1271 Sa 3-dong, Ansan 426-791, Gyeonggi-do (Korea, Republic of); Das, Nando Dulal, E-mail: nando.hu@gmail.com [Clinical Research Centre, Inha University School of Medicine, Incheon 400-711 (Korea, Republic of); Kang, Sung Chul, E-mail: gujiju11@gmail.com [Department of Molecular and Life Science, Hanyang University, 1271 Sa 3-dong, Ansan 426-791, Gyeonggi-do (Korea, Republic of); Lee, Young Seek, E-mail: yslee@hanyang.ac.kr [Department of Molecular and Life Science, Hanyang University, 1271 Sa 3-dong, Ansan 426-791, Gyeonggi-do (Korea, Republic of); Seo, Hyemyung, E-mail: hseo@hanyang.ac.kr [Department of Molecular and Life Science, Hanyang University, 1271 Sa 3-dong, Ansan 426-791, Gyeonggi-do (Korea, Republic of); Chai, Young Gyu, E-mail: ygchai@hanyang.ac.kr [Department of Bionanotechnology, Hanyang University, Seoul 133-791 (Korea, Republic of); Department of Molecular and Life Science, Hanyang University, 1271 Sa 3-dong, Ansan 426-791, Gyeonggi-do (Korea, Republic of)
2014-11-01
JMJD2A is a lysine trimethyl-specific histone demethylase that is highly expressed in a variety of tumours. The role of JMJD2A in tumour progression remains unclear. The objectives of this study were to identify JMJD2A-regulated genes and understand the function of JMJD2A in p53-null neuroectodermal stem cells (p53{sup −/−} NE-4Cs). We determined the effect of LPS as a model of inflammation in p53{sup −/−} NE-4Cs and investigated whether the epigenetic modifier JMJD2A alter the expression of tumourigenic inflammatory genes. Global gene expression was measured in JMJD2A knockdown (kd) p53{sup −/−} NE-4Cs and in LPS-stimulated JMJD2A-kd p53{sup −/−} NE-4C cells. JMJD2A attenuation significantly down-regulated genes were Cdca2, Ccnd2, Ccnd1, Crebbp, IL6rα, and Stat3 related with cell cycle, proliferation, and inflammatory-disease responses. Importantly, some tumour-suppressor genes including Dapk3, Timp2 and TFPI were significantly up-regulated but were not affected by silencing of the JMJD2B. Furthermore, we confirmed the attenuation of JMJD2A also down-regulated Cdca2, Ccnd2, Crebbp, and Rest in primary NSCs isolated from the forebrains of E15 embryos of C57/BL6J mice with effective p53 inhibitor pifithrin-α (PFT-α). Transcription factor (TF) motif analysis revealed known binding patterns for CDC5, MYC, and CREB, as well as three novel motifs in JMJD2A-regulated genes. IPA established molecular networks. The molecular network signatures and functional gene-expression profiling data from this study warrants further investigation as an effective therapeutic target, and studies to elucidate the molecular mechanism of JMJD2A-kd-dependent effects in neuroectodermal stem cells should be performed. - Highlights: • Significant up-regulation of epigenetic modifier JMJD2A mRNA upon LPS treatment. • Inhibition of JMJD2A attenuated key inflammatory and tumourigenic genes. • Establishing IPA based functional genomics in JMJD2A-attenuated p53{sup
DICER-LIKE2 plays a primary role in transitive silencing of transgenes in Arabidopsis.
Directory of Open Access Journals (Sweden)
Sizolwenkosi Mlotshwa
2008-03-01
Full Text Available Dicer-like (DCL enzymes play a pivotal role in RNA silencing in plants, processing the long double-stranded RNA (dsRNA that triggers silencing into the primary short interfering RNAs (siRNAs that mediate it. The siRNA population can be augmented and silencing amplified via transitivity, an RNA-dependent RNA polymerase (RDR-dependent pathway that uses the target RNA as substrate to generate secondary siRNAs. Here we report that Arabidopsis DCL2-but not DCL4-is required for transitivity in cell-autonomous, post-transcriptional silencing of transgenes. An insertion mutation in DCL2 blocked sense transgene-induced silencing and eliminated accumulation of the associated RDR-dependent siRNAs. In hairpin transgene-induced silencing, the dcl2 mutation likewise eliminated accumulation of secondary siRNAs and blocked transitive silencing, but did not block silencing mediated by primary siRNAs. Strikingly, in all cases, the dcl2 mutation eliminated accumulation of all secondary siRNAs, including those generated by other DCL enzymes. In contrast, mutations in DCL4 promoted a dramatic shift to transitive silencing in the case of the hairpin transgene and enhanced silencing induced by the sense transgene. Suppression of hairpin and sense transgene silencing by the P1/HC-Pro and P38 viral suppressors was associated with elimination of secondary siRNA accumulation, but the suppressors did not block processing of the stem of the hairpin transcript into primary siRNAs. Thus, these viral suppressors resemble the dcl2 mutation in their effects on siRNA biogenesis. We conclude that DCL2 plays an essential, as opposed to redundant, role in transitive silencing of transgenes and may play a more important role in silencing of viruses than currently thought.
Marie Nimier, au cœur du silence
Directory of Open Access Journals (Sweden)
Joëlle Papillon
2012-01-01
Full Text Available Dans La Reine du silence, Marie Nimier se confronte à la figure de son père, l’écrivain Roger Nimier, mort lorsqu’elle avait cinq ans. Elle y montre le poids qui pèse sur l’enfant d’écrivain, mais aussi celui de l’héritage du secret familial et de l’injonction au silence. La difficulté de l’élaboration de son récit de filiation se révèle dans les constants recommencements et reformulations, qui constituent la marque de la tension angoissante entre l’obligation de dire et celle de taire. In La Reine du silence, Marie Nimier confronts her father’s memory – the writer Roger Nimier, who died when she was five years old. The novel describes the burden of being a writer’s child, along with that of inheriting family secrets and submitting to a code of silence. The difficulty of recounting her relationship with her late father is evidenced by the narrator’s numerous “false starts” and her constant rewritings. The hesitant nature of the narration captures an anguish born of two irreconcilable obligations : the need to put things into words and the pressure to remain silent.
Yamanaka, Yuki; Winardhi, Ricksen S; Yamauchi, Erika; Nishiyama, So-Ichiro; Sowa, Yoshiyuki; Yan, Jie; Kawagishi, Ikuro; Ishihama, Akira; Yamamoto, Kaneyoshi
2018-06-15
The bacterial nucleoid-associated protein H-NS is a DNA-binding protein, playing a major role in gene regulation. To regulate transcription, H-NS silences genes, including horizontally acquired foreign genes. Escherichia coli H-NS is 137 residues long and consists of two discrete and independent structural domains: an N-terminal oligomerization domain and a C-terminal DNA-binding domain, joined by a flexible linker. The N-terminal oligomerization domain is composed of two dimerization sites, dimerization sites 1 and 2, which are both required for H-NS oligomerization, but the exact role of dimerization site 2 in gene silencing is unclear. To this end, we constructed a whole set of single amino acid substitution variants spanning residues 2 to 137. Using a well-characterized H-NS target, the slp promoter of the glutamic acid-dependent acid resistance (GAD) cluster promoters, we screened for any variants defective in gene silencing. Focusing on the function of dimerization site 2, we analyzed four variants, I70C/I70A and L75C/L75A, which all could actively bind DNA but are defective in gene silencing. Atomic force microscopy analysis of DNA-H-NS complexes revealed that all of these four variants formed condensed complexes on DNA, whereas WT H-NS formed rigid and extended nucleoprotein filaments, a conformation required for gene silencing. Single-molecule stretching experiments confirmed that the four variants had lost the ability to form stiffened filaments. We conclude that dimerization site 2 of H-NS plays a key role in the formation of rigid H-NS nucleoprotein filament structures required for gene silencing. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Silencing, positive selection and parallel evolution: busy history of primate cytochromes C.
Pierron, Denis; Opazo, Juan C; Heiske, Margit; Papper, Zack; Uddin, Monica; Chand, Gopi; Wildman, Derek E; Romero, Roberto; Goodman, Morris; Grossman, Lawrence I
2011-01-01
Cytochrome c (cyt c) participates in two crucial cellular processes, energy production and apoptosis, and unsurprisingly is a highly conserved protein. However, previous studies have reported for the primate lineage (i) loss of the paralogous testis isoform, (ii) an acceleration and then a deceleration of the amino acid replacement rate of the cyt c somatic isoform, and (iii) atypical biochemical behavior of human cyt c. To gain insight into the cause of these major evolutionary events, we have retraced the history of cyt c loci among primates. For testis cyt c, all primate sequences examined carry the same nonsense mutation, which suggests that silencing occurred before the primates diversified. For somatic cyt c, maximum parsimony, maximum likelihood, and Bayesian phylogenetic analyses yielded the same tree topology. The evolutionary analyses show that a fast accumulation of non-synonymous mutations (suggesting positive selection) occurred specifically on the anthropoid lineage root and then continued in parallel on the early catarrhini and platyrrhini stems. Analysis of evolutionary changes using the 3D structure suggests they are focused on the respiratory chain rather than on apoptosis or other cyt c functions. In agreement with previous biochemical studies, our results suggest that silencing of the cyt c testis isoform could be linked with the decrease of primate reproduction rate. Finally, the evolution of cyt c in the two sister anthropoid groups leads us to propose that somatic cyt c evolution may be related both to COX evolution and to the convergent brain and body mass enlargement in these two anthropoid clades.
Silencing, positive selection and parallel evolution: busy history of primate cytochromes C.
Directory of Open Access Journals (Sweden)
Denis Pierron
Full Text Available Cytochrome c (cyt c participates in two crucial cellular processes, energy production and apoptosis, and unsurprisingly is a highly conserved protein. However, previous studies have reported for the primate lineage (i loss of the paralogous testis isoform, (ii an acceleration and then a deceleration of the amino acid replacement rate of the cyt c somatic isoform, and (iii atypical biochemical behavior of human cyt c. To gain insight into the cause of these major evolutionary events, we have retraced the history of cyt c loci among primates. For testis cyt c, all primate sequences examined carry the same nonsense mutation, which suggests that silencing occurred before the primates diversified. For somatic cyt c, maximum parsimony, maximum likelihood, and Bayesian phylogenetic analyses yielded the same tree topology. The evolutionary analyses show that a fast accumulation of non-synonymous mutations (suggesting positive selection occurred specifically on the anthropoid lineage root and then continued in parallel on the early catarrhini and platyrrhini stems. Analysis of evolutionary changes using the 3D structure suggests they are focused on the respiratory chain rather than on apoptosis or other cyt c functions. In agreement with previous biochemical studies, our results suggest that silencing of the cyt c testis isoform could be linked with the decrease of primate reproduction rate. Finally, the evolution of cyt c in the two sister anthropoid groups leads us to propose that somatic cyt c evolution may be related both to COX evolution and to the convergent brain and body mass enlargement in these two anthropoid clades.
Silence in the Communication or Communicating through Silence: Silence in Psychoanalysis
Directory of Open Access Journals (Sweden)
Rita Marta
2014-10-01
Full Text Available This paper is a reflection upon the meaning and importance of silence in the psychoanalytical relationship. Beginning with the silence in the “normal” relationship between people, we show how silence can be experienced as confortable or unconfortable, and how it can be used to achieve a bigger proximity or distance in the relationship with others. We show these same aspects in the psychoanalytical relationship, and the evolution of the regard towards silence along the development of psychoanalysis. We end, presenting the Nacht’s thinking about silence, who emphasizes its integrative and fundamental role in the psychoanalytical relationship. Thus, only through silence certain affects can be born, and silence allows the patient to internalize the analyst.
Regulation of the activity of the promoter of RNA-induced silencing, C3PO.
Sahu, Shriya; Williams, Leo; Perez, Alberto; Philip, Finly; Caso, Giuseppe; Zurawsky, Walter; Scarlata, Suzanne
2017-09-01
RNA-induced silencing is a process which allows cells to regulate the synthesis of specific proteins. RNA silencing is promoted by the protein C3PO (component 3 of RISC). We have previously found that phospholipase Cβ, which increases intracellular calcium levels in response to specific G protein signals, inhibits C3PO activity towards certain genes. Understanding the parameters that control C3PO activity and which genes are impacted by G protein activation would help predict which genes are more vulnerable to downregulation. Here, using a library of 10 18 oligonucleotides, we show that C3PO binds oligonucleotides with structural specificity but little sequence specificity. Alternately, C3PO hydrolyzes oligonucleotides with a rate that is sensitive to substrate stability. Importantly, we find that oligonucleotides with higher Tm values are inhibited by bound PLCβ. This finding is supported by microarray analysis in cells over-expressing PLCβ1. Taken together, this study allows predictions of the genes whose post-transcriptional regulation is responsive to the G protein/phospholipase Cβ/calcium signaling pathway. © 2017 The Protein Society.
Rizzo, Milena; Evangelista, Monica; Simili, Marcella; Mariani, Laura; Pitto, Letizia; Rainaldi, Giuseppe
2011-07-01
The life span (Hayflick limit) of primary mouse embryo fibroblasts (MEF) in culture is variable but it is still unclear if the escape of the Hayflick limit is also variable. To address this point MEF were expanded every fifteen days (6T15) instead of every three days (6T3) until they became immortal. With this protocol MEF lifespan was extended and immortalization accordingly delayed. By testing a panel of genes (p19ARF, p16, p21) and miRNAs (miR-20a, miR-21, miR-28, miR-290) related to primary MEF senescence, a switch of p21 from up to down regulation, the down regulation of specific miRNAs as well as a massive shift from diploidy to hyperdiploidy were observed in coincidence with the resumption of cell proliferation. Collectively, these data indicate that the inactivation of genes and miRNAs, important in controlling cell proliferation, might be determinant for the escape from the Hayflick limit. In support of this hypothesis was the finding that some of the down regulated miRNAs transfected in immortalized MEF inhibited cell proliferation thus displaying a tumor suppressor-like activity.
Directory of Open Access Journals (Sweden)
A. Corso
2009-03-01
Full Text Available During the period 1993-2001, a total of 1,499 pneumococci isolates were recovered through the Argentinean surveillance of Streptococcus pneumoniae causing invasive disease in children under 6 years of age, 3.5% of which were erythromycin resistant. Among the 50 erythromycin-resistant strains available, 58% (n=29 harbored mefA/E genes (15 mefA, 30%; and 14 mefE, 28%, 34% (n=17 ermB, and 6% (n=3 both mefA/E plus ermB genes, while one isolate was negative for all the acquired genes studied. The England14-9 (42%, Poland6B-20 (20% and Spain9v-3 (16% clones were responsible for the emergence of pneumococcal macrolide resistance in pediatric population from Argentina.En el marco del programa de vigilancia regional SIREVA, se analizaron 1499 aislamientos de Streptococcus pneumoniae causantes de enfermedad invasiva en menores de 6 años, recuperados entre 1993 y 2001. Se detectó un 3,5% de resistencia a eritromicina. De los 50 aislamientos resistentes a eritromicina que pudieron ser estudiados, el 58% (n=29 tenían los genes mefA/E (15 mefA, 30% y 14 mefE, 28%, el 34% (n=17 el gen ermB y el 6% (n=3 la combinación de genes mefA/E y ermB. Sólo un aislamiento fue negativo para todos los genes analizados. Los clones internacionales England14-9, Poland6B-20 y Spain9v-3 representaron el 78% del total de aislamientos resistentes (42, 20 y 16%, respectivamente y se consideraron los responsables de la emergencia de la resistencia a macrólidos entre los neumococos que afectan a la población pediátrica de Argentina.
Directory of Open Access Journals (Sweden)
Bin Shan
Full Text Available Heterogeneous surface expression of Thy-1 in fibroblasts modulates inflammation and may thereby modulate injury and repair. As a paradigm, patients with idiopathic pulmonary fibrosis, a disease with pathologic features of chronic inflammation, demonstrate an absence of Thy-1 immunoreactivity within areas of fibrotic activity (fibroblast foci in contrast to the predominant Thy-1 expressing fibroblasts in the normal lung. Likewise, Thy-1 deficient mice display more severe lung fibrosis in response to an inflammatory injury than wildtype littermates. We investigated the role of Thy-1 in the response of fibroblasts to the pro-inflammatory cytokine TNF-alpha. Our study demonstrates distinct profiles of TNF-alpha-activated gene expression in Thy-1 positive (Thy-1+ and negative (Thy-1- subsets of mouse embryonic fibroblasts (MEF. TNF-alpha induced a robust activation of MMP-9, ICAM-1, and the IL-8 promoter driven reporter in Thy-1- MEFs, in contrast to only a modest increase in Thy-1+ counterparts. Consistently, ectopic expression of Thy-1 in Thy-1- MEFs significantly attenuated TNF-alpha-activated gene expression. Mechanistically, TNF-alpha activated Src family kinase (SFK only in Thy-1- MEFs. Blockade of SFK activation abrogated TNF-alpha-activated gene expression in Thy-1- MEFs, whereas restoration of SFK activation rescued the TNF-alpha response in Thy-1+ MEFs. Our findings suggest that Thy-1 down-regulates TNF-alpha-activated gene expression via interfering with SFK- and NF-kappaB-mediated transactivation. The current study provides a novel mechanistic insight to the distinct roles of fibroblast Thy-1 subsets in inflammation.
The rde-1 gene, RNA interference, and transposon silencing in C. elegans.
Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C
1999-10-15
Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.
Directory of Open Access Journals (Sweden)
Luciano Marcondes Godoy
1999-01-01
Full Text Available Muitas são as vivências que se expressarão em SILÊNCIOS. Muitos são os silêncios. No Bloco A, o silêncio denuncia a retirada para um outro mundo, a queda num abismo. No bloco B, o silêncio é controlador, exigindo a fala do analista, um jogo em que o que é falado não tem a menor importância. Surge ainda como expressão da necessidade de discriminar-se do analista e, na sua evolução, como um enfrentamento a um estado sem sentido. No Bloco C, o silêncio é agressivo, e a sobrevivência do analisando e analista ao mesmo criará um espaço que propiciará sonhos que surgirão no Bloco D. Esses momentos de silêncio-sonho são situações em que não há discriminação eu-não eu.Many are the experiences which are expressed through silences. Many are the silences. In Block A, silence denounces a pretreatment to another world, a fall into an abysm. In Block B, silence is a controlling factor, demanding the words of the analyst, a game where what is said does not have any importance what so ever. It emerges also as an expression of the analyst's necessity to discriminate himself, and within his evolution the revision of a senseless state. In Block C, the silence is aggressive. As a response, the survival of the patient and of the analyst will create a place in which dreams will come up. Block D analyses these moments of dream-silence situations, where there aren't any forms of self-non self discrimination.
NF-κB mediates the transcription of mouse calsarcin-1 gene, but not calsarcin-2, in C2C12 cells
Directory of Open Access Journals (Sweden)
Mu Yulian
2007-03-01
Full Text Available Abstract Background The calsarcins comprise a novel family of muscle-specific calcineurin-interaction proteins that play an important role in modulating both the function and substrate specificity of calcineurin in muscle cells. The expression of calsarcin-1 (CS-1 is restricted to slow-twitch skeletal muscle fibres, whereas that of both calsarcin-2 (CS-2 and calsarcin-3 (CS-3 is enriched in fast-twitch fibres. However, the transcriptional control of this selective expression has not been previously elucidated. Results Our real-time RT-PCR analyses suggest that the expression of CS-1 and CS-2 is increased during the myogenic differentiation of mouse C2C12 cells. Promoter deletion analysis further suggests that an NF-κB binding site within the CS-1 promoter is responsible for the up-regulation of CS-1 transcription, but no similar mechanism was evident for CS-2. These findings are further supported by the results of EMSA analysis, as well as by overexpression and inhibition experiments in which NF-κB function was blocked by treatment with its inhibitor, PDTC. In addition, the overexpression of NFATc4 induces both the CS-1 and CS-2 promoters, whereas MEF2C only activates CS-1. Conclusion Our present data suggest that NF-κB is required for the transcription of mouse CS-1 but not CS-2, and that the regulation of the calsarcins is mediated also by the NFAT and MEF2 transcription factors. These results provide new insights into the molecular mechanisms governing transcription in specific muscle fibre cells. The calsarcins may also serve as a valuable mechanistic tool to better understand the regulation of calcineurin signalling during muscle differentiation.
Fuentes-Santamaría, V; Alvarado, J C; Rodríguez-de la Rosa, L; Murillo-Cuesta, S; Contreras, J; Juiz, J M; Varela-Nieto, I
2016-03-01
Insulin-like growth factor 1 (IGF-1) is a neurotrophic protein that plays a crucial role in modulating neuronal function and synaptic plasticity in the adult brain. Mice lacking the Igf1 gene exhibit profound deafness and multiple anomalies in the inner ear and spiral ganglion. An issue that remains unknown is whether, in addition to these peripheral abnormalities, IGF-1 deficiency also results in structural changes along the central auditory pathway that may contribute to an imbalance between excitation and inhibition, which might be reflected in abnormal auditory brainstem responses (ABR). To assess such a possibility, we evaluated the morphological and physiological alterations in the cochlear nucleus complex of the adult mouse. The expression and distribution of the vesicular glutamate transporter 1 (VGluT1) and the vesicular inhibitory transporter (VGAT), which were used as specific markers for labeling excitatory and inhibitory terminals, and the involvement of the activity-dependent myocyte enhancer factor 2 (MEF2) transcription factors in regulating excitatory synapses were assessed in a 4-month-old mouse model of IGF-1 deficiency and neurosensorial deafness (Igf1 (-/-) homozygous null mice). The results demonstrate decreases in the cochlear nucleus area and cell size along with cell loss in the cochlear nuclei of the deficient mouse. Additionally, our results demonstrate that there is upregulation of VGluT1, but not VGAT, immunostaining and downregulation of MEF2 transcription factors together with increased wave II amplitude in the ABR recording. Our observations provide evidence of an abnormal neuronal cytoarchitecture in the cochlear nuclei of Igf1 (-/-) null mice and suggest that the increased efficacy of glutamatergic synapses might be mediated by MEF2 transcription factors.
Nicotinamide clearance by Pnc1 directly regulates Sir2-mediated silencing and longevity.
Gallo, Christopher M; Smith, Daniel L; Smith, Jeffrey S
2004-02-01
The Saccharomyces cerevisiae Sir2 protein is an NAD(+)-dependent histone deacetylase (HDAC) that functions in transcriptional silencing and longevity. The NAD(+) salvage pathway protein, Npt1, regulates Sir2-mediated processes by maintaining a sufficiently high intracellular NAD(+) concentration. However, another NAD(+) salvage pathway component, Pnc1, modulates silencing independently of the NAD(+) concentration. Nicotinamide (NAM) is a by-product of the Sir2 deacetylase reaction and is a natural Sir2 inhibitor. Pnc1 is a nicotinamidase that converts NAM to nicotinic acid. Here we show that recombinant Pnc1 stimulates Sir2 HDAC activity in vitro by preventing the accumulation of NAM produced by Sir2. In vivo, telomeric, rDNA, and HM silencing are differentially sensitive to inhibition by NAM. Furthermore, PNC1 overexpression suppresses the inhibitory effect of exogenously added NAM on silencing, life span, and Hst1-mediated transcriptional repression. Finally, we show that stress suppresses the inhibitory effect of NAM through the induction of PNC1 expression. Pnc1, therefore, positively regulates Sir2-mediated silencing and longevity by preventing the accumulation of intracellular NAM during times of stress.
Yang, Wookyeom; Park, In-Ja; Yun, Hee; Im, Dong-Uk; Ock, Sangmi; Kim, Jaetaek; Seo, Seon-Mi; Shin, Ha-Yeon; Viollet, Benoit; Kang, Insug; Choe, Wonchae; Kim, Sung-Soo; Ha, Joohun
2014-02-21
Doxorubicin is one of the most widely used anti-cancer drugs, but its clinical application is compromised by severe adverse effects in different organs including cardiotoxicity. In the present study we explored mechanisms of doxorubicin-induced cytotoxicity by revealing a novel role for the AMP-activated protein kinase α2 (AMPKα2) in mouse embryonic fibroblasts (MEFs). Doxorubicin robustly induced the expression of AMPKα2 in MEFs but slightly reduced AMPKα1 expression. Our data support the previous notion that AMPKα1 harbors survival properties under doxorubicin treatment. In contrast, analyses of Ampkα2(-/-) MEFs, gene knockdown of AMPKα2 by shRNA, and inhibition of AMPKα2 activity with an AMPK inhibitor indicated that AMPKα2 functions as a pro-apoptotic molecule under doxorubicin treatment. Doxorubicin induced AMPKα2 at the transcription level via E2F1, a transcription factor that regulates apoptosis in response to DNA damage. E2F1 directly transactivated the Ampkα2 gene promoter. In turn, AMPKα2 significantly contributed to stabilization and activation of E2F1 by doxorubicin, forming a positive signal amplification loop. AMPKα2 directly interacted with and phosphorylated E2F1. This signal loop was also detected in H9c2, C2C12, and ECV (human epithelial cells) cells as well as mouse liver under doxorubicin treatment. Resveratrol, which has been suggested to attenuate doxorubicin-induced cytotoxicity, significantly blocked induction of AMPKα2 and E2F1 by doxorubicin, leading to protection of these cells. This signal loop appears to be non-carcinoma-specific because AMPKα2 was not induced by doxorubicin in five different tested cancer cell lines. These results suggest that AMPKα2 may serve as a novel target for alleviating the cytotoxicity of doxorubicin.
DEFF Research Database (Denmark)
Saeed, Hamid; Taipaleenmäki, Hanna; Aldahmash, Abdullah M
2012-01-01
Mouse embryonic fibroblasts have been utilized as a surrogate stem cell model for the postnatal bone marrow-derived stromal stem cells (BMSC) to study mesoderm-type cell differentiation e.g. osteoblasts, adipocytes and chondrocytes. However, no formal characterization of MEF phenotype has been...... by real-time PCR analysis. Compared to BMSC, MEF exhibited a more enhanced differentiation into adipocyte and chondrocyte lineages. Interestingly, both MEF and BMSC formed the same amount of heterotopic bone and bone marrow elements upon in vivo subcutaneous implantation with hydroxyapatite...... and differentiation to osteoblasts, adipocytes and chondrocytes....
International Nuclear Information System (INIS)
Melo, Ana Cristina Bezerra Azedo de
2004-12-01
The fluid dynamic behavior of a riser in a cold type FCC model was investigated by means of catalyst concentration distribution measured with gamma attenuation and simulated with a mathematical model. In the riser of the cold model, MEF, 0,032 m in diameter, 2,30 m in length the fluidized bed, whose components are air and FCC catalyst, circulates. The MEF is operated by automatic control and instruments for measuring fluid dynamic variables. An axial catalyst concentration distribution was measured using an Am-241 gamma source and a NaI detector coupled to a multichannel provided with a software for data acquisition and evaluation. The MEF was adapted for a fluid dynamic model validation which describes the flow in the riser, for example, by introducing an injector for controlling the solid flow in circulation. Mathematical models were selected from literature, analyzed and tested to simulate the fluid dynamic of the riser. A methodology for validating fluid dynamic models was studied and implemented. The stages of the work were developed according to the validation methodology, such as data planning experiments, study of the equations which describe the fluidodynamic, computational solvers application and comparison with experimental data. Operational sequences were carried out keeping the MEF conditions for measuring catalyst concentration and simultaneously measuring the fluid dynamic variables, velocity of the components and pressure drop in the riser. Following this, simulated and experimental values were compared and statistical data treatment done, aiming at the required precision to validate the fluid dynamic model. The comparison tests between experimental and simulated data were carried out under validation criteria. The fluid dynamic behavior of the riser was analyzed and the results and the agreement with literature were discussed. The adopt model was validated under the MEF operational conditions, for a 3 to 6 m/s gas velocity in the riser and a slip
Synergistic inhibition of the APC/C by the removal of APC15 in HCT116 cells lacking UBE2C.
Garvanska, Dimitriya H; Larsen, Marie Sofie Yoo; Nilsson, Jakob
2016-10-15
The spindle assembly checkpoint (SAC) inhibits the anaphase-promoting complex/cyclosome (APC/C) in response to unattached kinetochores by generating a diffusible inhibitor termed the mitotic checkpoint complex (MCC). At metaphase, rapid activation of the APC/C requires removal of the MCC, a process that has been shown to depend on the APC/C E2 enzymes, UBE2C and UBE2S. Here we investigate the in vivo role of the APC/C E2 enzymes in SAC silencing using CRISPR/Cas9 genetically engineered HCT116 UBE2C or UBE2S null cell lines. Using live cell assays, we show that UBE2C and UBE2S make a minor contribution to SAC silencing in HCT116 cells. Strikingly, in cells specifically lacking UBE2C, we observe a strong synergistic inhibition of mitotic progression when we stabilize the MCC on the APC/C by depleting APC15, potentially reflecting increased competition between the MCC and the remaining initiating E2 enzyme UBE2D. In conclusion, we provide in vivo insight into the APC/C E2 module and its interplay with SAC silencing components. © 2016. Published by The Company of Biologists Ltd.
Directory of Open Access Journals (Sweden)
Elena A Goncharova
Full Text Available TSC1 and TSC2 mutations cause neoplasms in rare disease pulmonary LAM and neuronal pathfinding in hamartoma syndrome TSC. The specific roles of TSC1 and TSC2 in actin remodeling and the modulation of cell motility, however, are not well understood. Previously, we demonstrated that TSC1 and TSC2 regulate the activity of small GTPases RhoA and Rac1, stress fiber formation and cell adhesion in a reciprocal manner. Here, we show that Tsc1(-/- MEFs have decreased migration compared to littermate-derived Tsc1(+/+ MEFs. Migration of Tsc1(-/- MEFs with re-expressed TSC1 was comparable to Tsc1(+/+ MEF migration. In contrast, Tsc2(-/- MEFs showed an increased migration compared to Tsc2(+/+ MEFs that were abrogated by TSC2 re-expression. Depletion of TSC1 and TSC2 using specific siRNAs in wild type MEFs and NIH 3T3 fibroblasts also showed that TSC1 loss attenuates cell migration while TSC2 loss promotes cell migration. Morphological and immunochemical analysis demonstrated that Tsc1(-/- MEFs have a thin protracted shape with a few stress fibers; in contrast, Tsc2(-/- MEFs showed a rounded morphology and abundant stress fibers. Expression of TSC1 in either Tsc1(-/- or Tsc2(-/- MEFs promoted stress fiber formation, while TSC2 re-expression induced stress fiber disassembly and the formation of cortical actin. To assess the mechanism(s by which TSC2 loss promotes actin re-arrangement and cell migration, we explored the role of known downstream effectors of TSC2, mTORC1 and mTORC2. Increased migration of Tsc2(-/- MEFs is inhibited by siRNA mTOR and siRNA Rictor, but not siRNA Raptor. siRNA mTOR or siRNA Rictor promoted stress fiber disassembly in TSC2-null cells, while siRNA Raptor had little effect. Overexpression of kinase-dead mTOR induced actin stress fiber disassembly and suppressed TSC2-deficient cell migration. Our data demonstrate that TSC1 and TSC2 differentially regulate actin stress fiber formation and cell migration, and that only TSC2 loss promotes
Sumoylation of Sir2 differentially regulates transcriptional silencing in yeast.
Hannan, Abdul; Abraham, Neethu Maria; Goyal, Siddharth; Jamir, Imlitoshi; Priyakumar, U Deva; Mishra, Krishnaveni
2015-12-02
Silent information regulator 2 (Sir2), the founding member of the conserved sirtuin family of NAD(+)-dependent histone deacetylase, regulates several physiological processes including genome stability, gene silencing, metabolism and life span in yeast. Within the nucleus, Sir2 is associated with telomere clusters in the nuclear periphery and rDNA in the nucleolus and regulates gene silencing at these genomic sites. How distribution of Sir2 between telomere and rDNA is regulated is not known. Here we show that Sir2 is sumoylated and this modification modulates the intra-nuclear distribution of Sir2. We identify Siz2 as the key SUMO ligase and show that multiple lysines in Sir2 are subject to this sumoylation activity. Mutating K215 alone counteracts the inhibitory effect of Siz2 on telomeric silencing. SUMO modification of Sir2 impairs interaction with Sir4 but not Net1 and, furthermore, SUMO modified Sir2 shows predominant nucleolar localization. Our findings demonstrate that sumoylation of Sir2 modulates distribution between telomeres and rDNA and this is likely to have implications for Sir2 function in other loci as well. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Synergistic inhibition of the APC/C by the removal of APC15 in HCT116 cells lacking UBE2C
DEFF Research Database (Denmark)
Garvanska, Dimitriya H; Larsen, Marie Sofie Yoo; Nilsson, Jakob
2016-01-01
that has been shown to depend on the APC/C E2 enzymes, UBE2C and UBE2S. Here we investigate the in vivo role of the APC/C E2 enzymes in SAC silencing using CRISPR/Cas9 genetically engineered HCT116 UBE2C or UBE2S null cell lines. Using live cell assays, we show that UBE2C and UBE2S make a minor...... contribution to SAC silencing in HCT116 cells. Strikingly in cells specifically lacking UBE2C, we observe a strong synergistic inhibition of mitotic progression when we stabilize the MCC on the APC/C by depleting APC15, potentially reflecting increased competition between the MCC and the remaining initiating E...
Cernilogar, Filippo M.
2013-06-13
Background:Beyond their role in post-transcriptional gene silencing, Dicer and Argonaute, two components of the RNA interference (RNAi) machinery, were shown to be involved in epigenetic regulation of centromeric heterochromatin and transcriptional gene silencing. In particular, RNAi mechanisms appear to play a role in repeat induced silencing and some aspects of Polycomb-mediated gene silencing. However, the functional interplay of RNAi mechanisms and Polycomb group (PcG) pathways at endogenous loci remains to be elucidated.Principal Findings:Here we show that the endogenous Dicer-2/Argonaute-2 RNAi pathway is dispensable for the PcG mediated silencing of the homeotic Bithorax Complex (BX-C). Although Dicer-2 depletion triggers mild transcriptional activation at Polycomb Response Elements (PREs), this does not induce transcriptional changes at PcG-repressed genes. Moreover, Dicer-2 is not needed to maintain global levels of methylation of lysine 27 of histone H3 and does not affect PRE-mediated higher order chromatin structures within the BX-C. Finally bioinformatic analysis, comparing published data sets of PcG targets with Argonaute-2-bound small RNAs reveals no enrichment of these small RNAs at promoter regions associated with PcG proteins.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.
Liver lipid molecules induce PEPCK-C gene transcription and attenuate insulin action
International Nuclear Information System (INIS)
Chen Guoxun
2007-01-01
Cytosolic phosphoenolpyruvate carboxykinase (PEPCK-C) plays key roles in gluconeogenesis, glyceroneogenesis, and cataplerosis. Experiments were designed to examine the effects of endogenous lipid molecules from rat livers on the expression of PEPCK-C gene in primary rat hepatocytes. The lipid extracts prepared from livers of Zucker fatty, lean, and Wistar rats induced the expression levels of PEPCK-C transcripts. Insulin-mediated reduction of PEPCK-C gene expression was attenuated by the same treatment. The lipid extracts induced the relative luciferase activity of reporter gene constructs that contain a 2.2-kb 5' promoter fragment of PEPCK-C gene, but not the construct that contains only the 3' untranslated region (UTR) of its mRNA. The estimated half life of PEPCK-C transcripts in the presence of the lipid extract is the same as that in the absence of it. My results demonstrate for the first time that endogenous lipid molecules induce PEPCK-C gene transcription and attenuate insulin action in liver
Presenilin dependence of phospholipase C and protein kinase C signaling
DEFF Research Database (Denmark)
Dehvari, Nodi; Cedazo-Minguez, Angel; Isacsson, Ola
2007-01-01
-stimulated phospholipase C (PLC) activity which was gamma-secretase dependent. To further evaluate the dependence of PLC on PSs we measured PLC activity and the activation of variant protein kinase C (PKC) isoforms in mouse embryonic fibroblasts (MEFs) lacking either PS1, PS2, or both. PLC activity and PKCalpha...
Tagalakis, Aristides D; Munye, Mustafa M; Ivanova, Rositsa; Chen, Hanpeng; Smith, Claire M; Aldossary, Ahmad M; Rosa, Luca Z; Moulding, Dale; Barnes, Josephine L; Kafetzis, Konstantinos N; Jones, Stuart A; Baines, Deborah L; Moss, Guy W J; O'Callaghan, Christopher; McAnulty, Robin J; Hart, Stephen L
2018-05-10
Loss of the cystic fibrosis transmembrane conductance regulator in cystic fibrosis (CF) leads to hyperabsorption of sodium and fluid from the airway due to upregulation of the epithelial sodium channel (ENaC). Thickened mucus and depleted airway surface liquid (ASL) then lead to impaired mucociliary clearance. ENaC regulation is thus a promising target for CF therapy. Our aim was to develop siRNA nanocomplexes that mediate effective silencing of airway epithelial ENaC in vitro and in vivo with functional correction of epithelial ion and fluid transport. We investigated translocation of nanocomplexes through mucus and their transfection efficiency in primary CF epithelial cells grown at air-liquid interface (ALI).Short interfering RNA (SiRNA)-mediated silencing was examined by quantitative RT-PCR and western analysis of ENaC. Transepithelial potential (V t ), short circuit current (I sc ), ASL depth and ciliary beat frequency (CBF) were measured for functional analysis. Inflammation was analysed by histological analysis of normal mouse lung tissue sections. Nanocomplexes translocated more rapidly than siRNA alone through mucus. Transfections of primary CF epithelial cells with nanocomplexes targeting αENaC siRNA, reduced αENaC and βENaC mRNA by 30%. Transfections reduced V t , the amiloride-sensitive I sc and mucus protein concentration while increasing ASL depth and CBF to normal levels. A single dose of siRNA in mouse lung silenced ENaC by approximately 30%, which persisted for at least 7 days. Three doses of siRNA increased silencing to approximately 50%. Nanoparticle-mediated delivery of ENaCsiRNA to ALI cultures corrected aspects of the mucociliary defect in human CF cells and offers effective delivery and silencing in vivo. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Lin, Chan-Chan; Zhou, Jing-Ping; Liu, Yun-Peng; Liu, Jing-Jing; Yang, Xiao-Ning; Jazag, Amarsanaa; Zhang, Zhi-Ping; Guleng, Bayasi; Ren, Jian-Lin
2012-01-01
Pokemon (POK erythroid myeloid ontogenic factor), which belongs to the POK protein family, is also called LRF, OCZF and FBI-1. As a transcriptional repressor, Pokemon assumes a critical function in cellular differentiation and oncogenesis. Our study identified an oncogenic role for Pokemon in human hepatocellular carcinoma (HCC). We successfully established human HepG2 and Huh-7 cell lines in which Pokemon was stably knocked down. We demonstrated that Pokemon silencing inhibited cell proliferation and migration. Pokemon knockdown inhibited the PI3K/Akt and c-Raf/MEK/ERK pathways and modulated the expression of various cell cycle regulators in HepG2 and Huh-7 cells. Therefore, Pokemon may also be involved in cell cycle progression in these cells. We confirmed that Pokemon silencing suppresses hepatocellular carcinoma growth in tumor xenograft mice. These results suggest that Pokemon promotes cell proliferation and migration in hepatocellular carcinoma and accelerates tumor development in an Akt- and ERK-signaling-dependent manner.
Directory of Open Access Journals (Sweden)
Chan-Chan Lin
Full Text Available Pokemon (POK erythroid myeloid ontogenic factor, which belongs to the POK protein family, is also called LRF, OCZF and FBI-1. As a transcriptional repressor, Pokemon assumes a critical function in cellular differentiation and oncogenesis. Our study identified an oncogenic role for Pokemon in human hepatocellular carcinoma (HCC. We successfully established human HepG2 and Huh-7 cell lines in which Pokemon was stably knocked down. We demonstrated that Pokemon silencing inhibited cell proliferation and migration. Pokemon knockdown inhibited the PI3K/Akt and c-Raf/MEK/ERK pathways and modulated the expression of various cell cycle regulators in HepG2 and Huh-7 cells. Therefore, Pokemon may also be involved in cell cycle progression in these cells. We confirmed that Pokemon silencing suppresses hepatocellular carcinoma growth in tumor xenograft mice. These results suggest that Pokemon promotes cell proliferation and migration in hepatocellular carcinoma and accelerates tumor development in an Akt- and ERK-signaling-dependent manner.
Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.
2013-11-01
Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.
Cummings, A.; Chang, I.-J.
1988-11-01
Internal mean flow within the pores of a bulk-reacting porous acoustic absorbent, driven by mean static pressure gradients, is shown here to be an important feature of the acoustics of dissipative silencers in flow ducts, particularly in the case of internal combustion engine exhaust silencers. Theoretical treatments are presented here, both to describe the effect of internal flow on the bulk acoustic perties of the porous medium and to find the effect of the absorbent in situ, in the form of the sound transmission loss of the silencer. The measured transmission loss of an experimental silencer is compared to predicted data and good agreement between the two is obtained. The effects of mean fluid flow in the central passage and internal flow in the absorbent are separately demonstrated.
Huang, Chung-Hao; Hsiao, Weng-Rong; Huang, Ching-Wen; Chen, Kuan-Chun; Lin, Shih-Shun; Chen, Tsung-Chi; Raja, Joseph A J; Wu, Hui-Wen; Yeh, Shyi-Dong
2015-01-01
The NSs protein of Watermelon silver mottle virus (WSMoV) is the RNA silencing suppressor and pathogenicity determinant. In this study, serial deletion and point-mutation mutagenesis of conserved regions (CR) of NSs protein were performed, and the silencing suppression function was analyzed through agroinfiltration in Nicotiana benthamiana plants. We found two amino acid (aa) residues, H113 and Y398, are novel functional residues for RNA silencing suppression. Our further analyses demonstrated that H113 at the common epitope (CE) ((109)KFTMHNQ(117)), which is highly conserved in Asia type tospoviruses, and the benzene ring of Y398 at the C-terminal β-sheet motif ((397)IYFL(400)) affect NSs mRNA stability and protein stability, respectively, and are thus critical for NSs RNA silencing suppression. Additionally, protein expression of other six deleted (ΔCR1-ΔCR6) and five point-mutated (Y15A, Y27A, G180A, R181A and R212A) mutants were hampered and their silencing suppression ability was abolished. The accumulation of the mutant mRNAs and proteins, except Y398A, could be rescued or enhanced by co-infiltration with potyviral suppressor HC-Pro. When assayed with the attenuated Zucchini yellow mosaic virus vector in squash plants, the recombinants carrying individual seven point-mutated NSs proteins displayed symptoms much milder than the recombinant carrying the wild type NSs protein, suggesting that these aa residues also affect viral pathogenicity by suppressing the host silencing mechanism.
Potential Impact of Fulfilment of Minimum Essential Force (MEF to The Regional Welfare
Directory of Open Access Journals (Sweden)
Joko Tri Haryanto
2017-05-01
Full Text Available As with other aspects, the element of meeting the needs of national defence and security becomes very crucial aspect. These elements are not only coming from the domestic, but also related to the system of inter-state relations. To ensure the creation of the defence system and optimal security, policy will require minimum essential forces (MEF, which will outline the major components of the minimum requirements of national defence should be prepared to face any threats. The fulfilment of MEF must also provide welfare impacts for the region. For this reason this study was conducted with the purpose of calculating the impact of compliance with the MEF on the welfare of the region, especially in West Java province. IRIO using spatial approach, it can be concluded that the domestic defence industry is projected to have a role that is quite high, especially for the regional economy. To the West Java region, industrial goods of metal, in which there is the defence industry, encourage the creation of outputs and increase the income of workers. Although most of the economy and its impact enjoyed by workers in the territory, region or other provinces also continue to enjoy the effects of the increase in output and labour income.
Liao, Ping; Sun, Guibo; Zhang, Chan; Wang, Min; Sun, Yao; Zhou, Yuehan; Sun, Xiaobo; Jian, Jie
2016-11-04
This study aimed to determine the effects of Bauhinia championii flavone (BCF) on hypoxia-reoxygenation (H/R) induced apoptosis in H9c2 cardiomyocytes and to explore potential mechanisms. The H/R model in H9c2 cardiomyocytes was established by 6 h of hypoxia and 12 h of reoxygenation. Cell viability was detected by CCK-8 assay. Apoptotic rate was measured by Annexin V/PI staining. Levels of mitochondria-associated ROS, mitochondrial transmembrane potential (∆Ψm) and mitochondrial permeability transition pores (MPTP) opening were assessed by fluorescent probes. ATP production was measured by ATP assay kit. The release of cytochrome c, translocation of Bax, and related proteins were measured by western blotting. Our results showed that pretreatment with BCF significantly improved cell viability and attenuated the cardiomyocyte apoptosis caused by H/R. Furthermore, BCF increased ATP production and inhibited ROS-generating mitochondria, depolarization of ΔΨm, and MPTP opening. Moreover, BCF pretreatment decreased Bax mitochondrial translocation, cytochrome c release, and activation of caspase-3, as well as increased the expression of p-PI3K, p-Akt, and the ratio of Bcl-2 to Bax. Interestingly, a specific inhibitor of phosphatidylinositol 3-kinase, LY294002, partly reversed the anti-apoptotic effect of BCF. These observations indicated that BCF pretreatment attenuates H/R-induced myocardial apoptosis strength by improving mitochondrial dysfunction via PI3K/Akt signaling pathway.
2017-10-01
AWARD NUMBER: W81XWH-15-2-0064 TITLE: Interventional Vitamin C -A Strategy for Attenuation of Coagulopathy and Inflammation in Hemorrhagic...COVERED 30 Sep 2016 - 29 Sep 2017 4. TITLE AND SUBTITLE Interventional Vitamin C -A Strategy for Attenuation of Coagulopathy and Inflammation in...high dose parenteral vitamin C (VitC) in a swine model of combined hemorrhagic shock and tissue trauma that simulates the course of a combat casualty
Masroori, Nasser; Merindol, Natacha; Berthoux, Lionel
2016-03-22
The promyelocytic leukemia (PML) protein, a type I interferon (IFN-I)-induced gene product and a member of the tripartite motif (TRIM) family, modulates the transcriptional activity of viruses belonging to various families. Whether PML has an impact on the replication of HIV-1 has not been fully addressed, but recent studies point to its possible involvement in the restriction of HIV-1 in human cells and in the maintenance of transcriptional latency in human cell lines in which HIV-1 is constitutively repressed. We investigated further the restriction of HIV-1 and a related lentivirus, SIVmac, by PML in murine cells and in a lymphocytic human cell line. In particular, we studied the relevance of PML to IFN-I-mediated inhibition and the role of individual human isoforms. We demonstrate that both human PML (hPML) and murine PML (mPML) inhibit the early post-entry stages of the replication of HIV-1 and a related lentivirus, SIVmac. In addition, HIV-1 was transcriptionally silenced by mPML and by hPML isoforms I, II, IV and VI in MEFs. This PML-mediated transcriptional repression was attenuated in presence of the histone deacetylase inhibitor SAHA. In contrast, depletion of PML had no effect on HIV-1 gene expression in a human T cell line. PML was found to contribute to the inhibition of HIV-1 by IFN-I. Specifically, IFN-α and IFN-β treatments of MEFs enhanced the PML-dependent inhibition of HIV-1 early replication stages. We show that PML can inhibit HIV-1 and other lentiviruses as part of the IFN-I-mediated response. The restriction takes place at two distinct steps, i.e. reverse transcription and transcription, and in an isoform-specific, cellular context-specific fashion. Our results support a model in which PML activates innate immune antilentiviral effectors. These data are relevant to the development of latency reversal-inducing pharmacological agents, since PML was previously proposed as a pharmacological target for such inhibitors. This study also has
Silencing MR-1 attenuates inflammatory damage in mice heart induced by AngII
International Nuclear Information System (INIS)
Dai, Wenjian; Chen, Haiyang; Jiang, Jiandong; Kong, Weijia; Wang, Yiguang
2010-01-01
Myofibrillogenesis regulator-1(MR-1) can aggravate cardiac hypertrophy induced by angiotensin(Ang) II in mice through activation of NF-κB signaling pathway, and nuclear transcription factor (NF)-κB and activator protein-1(AP-1) regulate inflammatory and immune responses by increasing the expression of specific inflammatory genes in various tissues including heart. Whether inhibition of MR-1 expression will attenuate AngII-induced inflammatory injury in mice heart has not been explored. Herein, we monitored the activation of NF-κB and AP-1, together with expression of pro-inflammatory of interleukin(IL)-6, tumor necrosis factor(TNF)-α, vascular-cell adhesion molecule (VCAM)-1, platelet endothelial cell adhesion molecule (PECAM), and inflammatory cell infiltration in heart of mice which are induced firstly by AngII (PBS),then received MR-1-siRNA or control-siRNA injecting. We found that the activation of NF-κB and AP-1 was inhibited significantly, together with the decreased expression of IL-6, TNF-α, VCAM-1, and PECAM in AngII-induced mice myocardium in MR-1-siRNA injection groups compared with control-siRNA injecting groups. However, the expression level of MR-1 was not an apparent change in PBS-infused groups than in unoperation groups, and MR-1-siRNA do not affect the expression of MR-1 in PBS-infused mice. Our findings suggest that silencing MR-1 protected mice myocardium against inflammatory injury induced by AngII by suppression of pro-inflammatory transcription factors NF-κB and AP-1 signaling pathway.
Directory of Open Access Journals (Sweden)
Yixiang Han
Full Text Available RNA-binding protein Musashi-2 (Msi2 is known to play a critical role in leukemogenesis and contributes to poor clinical prognosis in acute myeloid leukemia (AML. However, the effect of Msi2 silencing on treatment for AML still remains poorly understood. In this study, we used lentivirus-mediated RNA interference targeting Msi2 to investigate the resulting changes in cellular processes and the underlying mechanisms in AML cell lines as well as primary AML cells isolated from AML patients. We found that Msi2 was highly expressed in AML cells, and its depletion inhibited Ki-67 expression and resulted in decreased in vitro and in vivo proliferation. Msi2 silencing induced cell cycle arrest in G0/G1 phase, with decreased Cyclin D1 and increased p21 expression. Msi2 silencing induced apoptosis through down-regulation of Bcl-2 expression and up-regulation of Bax expression. Suppression of Akt, Erk1/2 and p38 phosphorylation also contributed to apoptosis mediated by Msi2 silencing. Finally, Msi2 silencing in AML cells also enhanced their chemosensitivity to daunorubicin. Conclusively, our data suggest that Msi2 is a promising target for gene therapy to optimize conventional chemotherapeutics in AML treatment.
Stress Wave attenuation in SiC3D/Al Composite
International Nuclear Information System (INIS)
Yuan Chunyuan; Wang Yangwei; Li Guoju; Zhang Xu; Gao Jubin
2013-01-01
SiC 3D /Al composite is a kind of special composite with interpenetrating network microstructure. The attenuation properties of stress wave propagation along the SiC 3D /Al composite are studied by a Split Hopkinson Pressure Bar system and FEM simulations, and the attenuation mechanism is discussed in this paper. Results show that the attenuation rate of the stress wave in the composite is up to 1.73MPa·mm −1 . The reduction of the amplitude of waves is caused by that plenty of interfaces between SiC and Al within the composite acting with stress waves. When the incident plane wave reaches the SiC 3D /Al interface, reflection wave and transmission wave propagates in different directions along the irregular interface between SiC phase and aluminium phase due to the impedance mismatch of them, which leads to the divergence of stress wave. At the same time, some stress micro-focuses occurs in the aluminium phase for the complex wave superimposition, and some plastic deformation may take place within such micro-regions, which results in the consumption of stress wave energy. In conclusion, the stress wave attenuation is derived from divergence and consumption of stress wave.
Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong
2016-05-01
Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
DEFF Research Database (Denmark)
Søndergaard, Katia Dupret
The article highlights the importance of silences in the processes of innovation in organizations, and the claim is that silence and the absence of talk distribute authority, responsibility and decisions. The act of silencing is conceptualised as a central “configurating actor”. Using an Actor......-Network Theoretical approach to organization studies silence is conceptualised as both a means and an effect of innovative efforts. It is a way of ordering practices. Thus silencing is thought of as a central potential change agent both in composing a kind of specific organizational collectivity and in composing new...... working practices more generally. In line with the approach to destabilise the mundane, invisible and taken-for-granted aspects of innovative efforts in organisations (crucial for ANT and foucauldian post-structuralism more broadly), this article suggests to non-silence the silence and make...
Directory of Open Access Journals (Sweden)
Thibaut Josse
2007-09-01
Full Text Available The study of P-element repression in Drosophila melanogaster led to the discovery of the telomeric Trans-Silencing Effect (TSE, a repression mechanism by which a transposon or a transgene inserted in subtelomeric heterochromatin (Telomeric Associated Sequence or TAS has the capacity to repress in trans in the female germline, a homologous transposon, or transgene located in euchromatin. TSE shows variegation among egg chambers in ovaries when silencing is incomplete. Here, we report that TSE displays an epigenetic transmission through meiosis, which involves an extrachromosomal maternally transmitted factor. We show that this silencing is highly sensitive to mutations affecting both heterochromatin formation (Su(var205 encoding Heterochromatin Protein 1 and Su(var3-7 and the repeat-associated small interfering RNA (or rasiRNA silencing pathway (aubergine, homeless, armitage, and piwi. In contrast, TSE is not sensitive to mutations affecting r2d2, which is involved in the small interfering RNA (or siRNA silencing pathway, nor is it sensitive to a mutation in loquacious, which is involved in the micro RNA (or miRNA silencing pathway. These results, taken together with the recent discovery of TAS homologous small RNAs associated to PIWI proteins, support the proposition that TSE involves a repeat-associated small interfering RNA pathway linked to heterochromatin formation, which was co-opted by the P element to establish repression of its own transposition after its recent invasion of the D. melanogaster genome. Therefore, the study of TSE provides insight into the genetic properties of a germline-specific small RNA silencing pathway.
International Nuclear Information System (INIS)
Si, Lina; Shi, Jin; Gao, Wenqun; Zheng, Min; Liu, Lingjuan; Zhu, Jing; Tian, Jie
2014-01-01
Highlights: • BMP2 can upregulated cardiac related gene GATA4, Nkx2.5, MEF2c and Tbx5. • Inhibition of Smad4 decreased BMP2-induced hyperacetylation of histone H3. • Inhibition of Smad4 diminished BMP2-induced overexpression of GATA4 and Nkx2.5. • Inhibition of Smad4 decreased hyperacetylated H3 in the promoter of GATA4 and Nkx2.5. • Smad4 is essential for BMP2 induced hyperacetylated histone H3. - Abstract: BMP2 signaling pathway plays critical roles during heart development, Smad4 encodes the only common Smad protein in mammals, which is a pivotal nuclear mediator. Our previous studies showed that BMP2 enhanced the expression of cardiac transcription factors in part by increasing histone H3 acetylation. In the present study, we tested the hypothesis that Smad4 mediated BMP2 signaling pathway is essential for the expression of cardiac core transcription factors by affecting the histone H3 acetylation. We successfully constructed a lentivirus-mediated short hairpin RNA interference vector targeting Smad4 (Lv-Smad4) in rat H9c2 embryonic cardiac myocytes (H9c2 cells) and demonstrated that it suppressed the expression of the Smad4 gene. Cultured H9c2 cells were transfected with recombinant adenoviruses expressing human BMP2 (AdBMP2) with or without Lv-Smad4. Quantitative real-time RT-PCR analysis showed that knocking down of Smad4 substantially inhibited both AdBMP2-induced and basal expression levels of cardiac transcription factors GATA4 and Nkx2.5, but not MEF2c and Tbx5. Similarly, chromatin immunoprecipitation (ChIP) analysis showed that knocking down of Smad4 inhibited both AdBMP2-induced and basal histone H3 acetylation levels in the promoter regions of GATA4 and Nkx2.5, but not of Tbx5 and MEF2c. In addition, Lv-Smad4 selectively suppressed AdBMP2-induced expression of HAT p300, but not of HAT GCN5 in H9c2 cells. The data indicated that inhibition of Smad4 diminished both AdBMP2 induced and basal histone acetylation levels in the promoter regions of
Energy Technology Data Exchange (ETDEWEB)
Si, Lina; Shi, Jin; Gao, Wenqun [Heart Centre, Children’s Hospital of Chongqing Medical University, 136 Zhongshan 2nd Road, Yu Zhong District, Chongqing 400014 (China); Ministry of Education Key Laboratory of Child Development and Disorders, Key Laboratory of Pediatrics in Chongqing, Chongqing International Science and Technology Cooperation Center for Child Development and Disorders, 136 Zhongshan 2nd Road, Yu Zhong District, Chongqing 400014 (China); Zheng, Min [Heart Centre, Children’s Hospital of Chongqing Medical University, 136 Zhongshan 2nd Road, Yu Zhong District, Chongqing 400014 (China); Liu, Lingjuan; Zhu, Jing [Ministry of Education Key Laboratory of Child Development and Disorders, Key Laboratory of Pediatrics in Chongqing, Chongqing International Science and Technology Cooperation Center for Child Development and Disorders, 136 Zhongshan 2nd Road, Yu Zhong District, Chongqing 400014 (China); Tian, Jie, E-mail: jietian@cqmu.edu.cn [Heart Centre, Children’s Hospital of Chongqing Medical University, 136 Zhongshan 2nd Road, Yu Zhong District, Chongqing 400014 (China)
2014-07-18
Highlights: • BMP2 can upregulated cardiac related gene GATA4, Nkx2.5, MEF2c and Tbx5. • Inhibition of Smad4 decreased BMP2-induced hyperacetylation of histone H3. • Inhibition of Smad4 diminished BMP2-induced overexpression of GATA4 and Nkx2.5. • Inhibition of Smad4 decreased hyperacetylated H3 in the promoter of GATA4 and Nkx2.5. • Smad4 is essential for BMP2 induced hyperacetylated histone H3. - Abstract: BMP2 signaling pathway plays critical roles during heart development, Smad4 encodes the only common Smad protein in mammals, which is a pivotal nuclear mediator. Our previous studies showed that BMP2 enhanced the expression of cardiac transcription factors in part by increasing histone H3 acetylation. In the present study, we tested the hypothesis that Smad4 mediated BMP2 signaling pathway is essential for the expression of cardiac core transcription factors by affecting the histone H3 acetylation. We successfully constructed a lentivirus-mediated short hairpin RNA interference vector targeting Smad4 (Lv-Smad4) in rat H9c2 embryonic cardiac myocytes (H9c2 cells) and demonstrated that it suppressed the expression of the Smad4 gene. Cultured H9c2 cells were transfected with recombinant adenoviruses expressing human BMP2 (AdBMP2) with or without Lv-Smad4. Quantitative real-time RT-PCR analysis showed that knocking down of Smad4 substantially inhibited both AdBMP2-induced and basal expression levels of cardiac transcription factors GATA4 and Nkx2.5, but not MEF2c and Tbx5. Similarly, chromatin immunoprecipitation (ChIP) analysis showed that knocking down of Smad4 inhibited both AdBMP2-induced and basal histone H3 acetylation levels in the promoter regions of GATA4 and Nkx2.5, but not of Tbx5 and MEF2c. In addition, Lv-Smad4 selectively suppressed AdBMP2-induced expression of HAT p300, but not of HAT GCN5 in H9c2 cells. The data indicated that inhibition of Smad4 diminished both AdBMP2 induced and basal histone acetylation levels in the promoter regions of
International Nuclear Information System (INIS)
Pronkin, A.A.
1978-01-01
The influence of Ba, Sr, Ca, Mg cations on transfer numbers of fluorine in glasses of Ba(PO 3 ) 2 - MeF 2 pseudobinary systems is studied. Transfer numbers are essentially different in one and the same fluorine ion concentration in glasses, containing various alkali-earth cations: increase of the cation field force brings about decrease of the transfer numbers of fluorine, and the glass-formation region in the Ba-Sr-Ca-Mg series rises. The dependence of transfer numbers of fluorine on the fluorine concentration logarithm is presented. It is established, that alkali-earth metals influence the transfer numbers of fluorine on account of selective interaction with the phosphate constituent of glass structure
Optical silencing of C. elegans cells with light-driven proton pumps.
Okazaki, Ayako; Takahashi, Megumi; Toyoda, Naoya; Takagi, Shin
2014-08-01
Recent development of optogenetic techniques, which utilize light-driven ion channels or ion pumps for controlling the activity of excitable cells, has greatly facilitated the investigation of nervous systems in vivo. A new generation of optical silencers includes outward-directed proton pumps, such as Arch, which have several advantages over currently widely used halorhodopsin (NpHR). These advantages include the resistance to inactivation during prolonged illumination and the ability to generate a larger optical current from low intensity light. C. elegans, with its small transparent body and well-characterized neural circuits, is especially suitable for optogenetic analyses. In this article, we will outline the practical aspects of using of Arch and other proton pumps as optogenetic tools in C. elegans. Copyright © 2014 Elsevier Inc. All rights reserved.
Calcium signalling silencing in atrial fibrillation.
Greiser, Maura
2017-06-15
Subcellular calcium signalling silencing is a novel and distinct cellular and molecular adaptive response to rapid cardiac activation. Calcium signalling silencing develops during short-term sustained rapid atrial activation as seen clinically during paroxysmal atrial fibrillation (AF). It is the first 'anti-arrhythmic' adaptive response in the setting of AF and appears to counteract the maladaptive changes that lead to intracellular Ca 2+ signalling instability and Ca 2+ -based arrhythmogenicity. Calcium signalling silencing results in a failed propagation of the [Ca 2+ ] i signal to the myocyte centre both in patients with AF and in a rabbit model. This adaptive mechanism leads to a substantial reduction in the expression levels of calcium release channels (ryanodine receptors, RyR2) in the sarcoplasmic reticulum, and the frequency of Ca 2+ sparks and arrhythmogenic Ca 2+ waves remains low. Less Ca 2+ release per [Ca 2+ ] i transient, increased fast Ca 2+ buffering strength, shortened action potentials and reduced L-type Ca 2+ current contribute to a substantial reduction of intracellular [Na + ]. These features of Ca 2+ signalling silencing are distinct and in contrast to the changes attributed to Ca 2+ -based arrhythmogenicity. Some features of Ca 2+ signalling silencing prevail in human AF suggesting that the Ca 2+ signalling 'phenotype' in AF is a sum of Ca 2+ stabilizing (Ca 2+ signalling silencing) and Ca 2+ destabilizing (arrhythmogenic unstable Ca 2+ signalling) factors. Calcium signalling silencing is a part of the mechanisms that contribute to the natural progression of AF and may limit the role of Ca 2+ -based arrhythmogenicity after the onset of AF. © 2017 The Authors. The Journal of Physiology © 2017 The Physiological Society.
Wang, Junjian; Wang, Haibin; Wang, Ling-Yu; Cai, Demin; Duan, Zhijian; Zhang, Yanhong; Chen, Peng; Zou, June X; Xu, Jianzhen; Chen, Xinbin; Kung, Hsing-Jien; Chen, Hong-Wu
2016-11-01
Recombinant TRAIL and agonistic antibodies to death receptors (DRs) have been in clinical trial but displayed limited anti-cancer efficacy. Lack of functional DR expression in tumors is a major limiting factor. We report here that chromatin regulator KDM4A/JMJD2A, not KDM4B, has a pivotal role in silencing tumor cell expression of both TRAIL and its receptor DR5. In TRAIL-sensitive and -resistant cancer cells of lung, breast and prostate, KDM4A small-molecule inhibitor compound-4 (C-4) or gene silencing strongly induces TRAIL and DR5 expression, and causes TRAIL-dependent apoptotic cell death. KDM4A inhibition also strongly sensitizes cells to TRAIL. C-4 alone potently inhibits tumor growth with marked induction of TRAIL and DR5 expression in the treated tumors and effectively sensitizes them to the newly developed TRAIL-inducer ONC201. Mechanistically, C-4 does not appear to act through the Akt-ERK-FOXO3a pathway. Instead, it switches histone modifying enzyme complexes at promoters of TRAIL and DR5 transcriptional activator CHOP gene by dissociating KDM4A and nuclear receptor corepressor (NCoR)-HDAC complex and inducing the recruitment of histone acetylase CBP. Thus, our results reveal KDM4A as a key epigenetic silencer of TRAIL and DR5 in tumors and establish inhibitors of KDM4A as a novel strategy for effectively sensitizing tumors to TRAIL pathway-based therapeutics.
DEFF Research Database (Denmark)
Nielsen, Troels T; Nielsen, Jørgen E
2013-01-01
Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...
Sandwich type plasmonic platform for MEF using silver fractals
DEFF Research Database (Denmark)
Raut, Sangram L.; Rich, Ryan; Shtoyko, Tanya
2015-01-01
was studied with the N-methyl-azadioxatriangulenium chloride salt (Me-ADOTA·Cl) in PVA films made from 0.2% PVA (w/v) solution spin-coated on a clean glass coverslip. The Plasmonic Platforms (PP) were assembled by pressing together silver fractals on one glass slide and a separate glass coverslip spin-coated...... with a uniform Me-ADOTA·Cl in PVA film. In addition, we also tested ADOTA labeled human serum albumin (HSA) deposited on a glass slide for potential PP bioassay applications. Using the new PP, we could achieve more than a 20-fold fluorescence enhancement (bright spots) accompanied by a decrease...... of PP can be a convenient approach for constructing assays utilizing metal enhanced fluorescence (MEF) without the need for depositing the material directly on metal structures platforms....
Germline stem cell gene PIWIL2 mediates DNA repair through relaxation of chromatin.
Directory of Open Access Journals (Sweden)
De-Tao Yin
Full Text Available DNA damage response (DDR is an intrinsic barrier of cell to tumorigenesis initiated by genotoxic agents. However, the mechanisms underlying the DDR are not completely understood despite of extensive investigation. Recently, we have reported that ectopic expression of germline stem cell gene PIWIL2 is associated with tumor stem cell development, although the underlying mechanisms are largely unknown. Here we show that PIWIL2 is required for the repair of DNA-damage induced by various types of genotoxic agents. Upon ultraviolet (UV irradiation, silenced PIWIL2 gene in normal human fibroblasts was transiently activated after treatment with UV light. This activation was associated with DNA repair, because Piwil2-deficienct mouse embryonic fibroblasts (mili(-/- MEFs were defective in cyclobutane pyrimidine dimers (CPD repair after UV treatment. As a result, the UV-treated mili(-/- MEFs were more susceptible to apoptosis, as characterized by increased levels of DNA damage-associated apoptotic proteins, such as active caspase-3, cleaved Poly (ADP-ribose polymerase (PARP and Bik. The impaired DNA repair in the mili(-/- MEFs was associated with the reductions of histone H3 acetylation and chromatin relaxation, although the DDR pathway downstream chromatin relaxation appeared not to be directly affected by Piwil2. Moreover, guanine-guanine (Pt-[GG] and double strand break (DSB repair were also defective in the mili(-/- MEFs treated by genotoxic chemicals Cisplatin and ionizing radiation (IR, respectively. The results indicate that Piwil2 can mediate DNA repair through an axis of Piwil2 → histone acetylation → chromatin relaxation upstream DDR pathways. The findings reveal a new role for Piwil2 in DNA repair and suggest that Piwil2 may act as a gatekeeper against DNA damage-mediated tumorigenesis.
Zuurbier, Linda; Gutierrez, Alejandro; Mullighan, Charles G.; Canté-Barrett, Kirsten; Gevaert, A. Olivier; de Rooi, Johan; Li, Yunlei; Smits, Willem K.; Buijs-Gladdines, Jessica G.C.A.M.; Sonneveld, Edwin; Look, A. Thomas; Horstmann, Martin; Pieters, Rob; Meijerink, Jules P.P.
2014-01-01
Three distinct immature T-cell acute lymphoblastic leukemia entities have been described including cases that express an early T-cell precursor immunophenotype or expression profile, immature MEF2C-dysregulated T-cell acute lymphoblastic leukemia cluster cases based on gene expression analysis (immature cluster) and cases that retain non-rearranged TRG@ loci. Early T-cell precursor acute lymphoblastic leukemia cases exclusively overlap with immature cluster samples based on the expression of early T-cell precursor acute lymphoblastic leukemia signature genes, indicating that both are featuring a single disease entity. Patients lacking TRG@ rearrangements represent only 40% of immature cluster cases, but no further evidence was found to suggest that cases with absence of bi-allelic TRG@ deletions reflect a distinct and even more immature disease entity. Immature cluster/early T-cell precursor acute lymphoblastic leukemia cases are strongly enriched for genes expressed in hematopoietic stem cells as well as genes expressed in normal early thymocyte progenitor or double negative-2A T-cell subsets. Identification of early T-cell precursor acute lymphoblastic leukemia cases solely by defined immunophenotypic criteria strongly underestimates the number of cases that have a corresponding gene signature. However, early T-cell precursor acute lymphoblastic leukemia samples correlate best with a CD1 negative, CD4 and CD8 double negative immunophenotype with expression of CD34 and/or myeloid markers CD13 or CD33. Unlike various other studies, immature cluster/early T-cell precursor acute lymphoblastic leukemia patients treated on the COALL-97 protocol did not have an overall inferior outcome, and demonstrated equal sensitivity levels to most conventional therapeutic drugs compared to other pediatric T-cell acute lymphoblastic leukemia patients. PMID:23975177
Tyč, Dimitrij; Nocarová, Eva; Sikorová, Lenka; Fischer, Lukáš
2017-08-01
Transient 5-azacytidine treatment of leaf explants from potato plants with transcriptionally silenced transgenes allows de novo regeneration of plants with restored transgene expression at the whole plant level. Transgenes introduced into plant genomes frequently become silenced either at the transcriptional or the posttranscriptional level. Transcriptional silencing is usually associated with DNA methylation in the promoter region. Treatments with inhibitors of maintenance DNA methylation were previously shown to allow reactivation of transcriptionally silenced transgenes in single cells or tissues, but not at the whole plant level. Here we analyzed the effect of DNA methylation inhibitor 5-azacytidine (AzaC) on the expression of two silenced reporter genes encoding green fluorescent protein (GFP) and neomycin phosphotransferase (NPTII) in potato plants. Whereas no obvious reactivation was observed in AzaC-treated stem cuttings, transient treatment of leaf segments with 10 μM AzaC and subsequent de novo regeneration of shoots on the selective medium with kanamycin resulted in the production of whole plants with clearly reactivated expression of previously silenced transgenes. Reactivation of nptII expression was accompanied by a decrease in cytosine methylation in the promoter region of the gene. Using the plants with reactivated GFP expression, we found that re-silencing of this transgene can be accidentally triggered by de novo regeneration. Thus, testing the incidence of transgene silencing during de novo regeneration could be a suitable procedure for negative selection of transgenic lines (insertion events) which have an inclination to be silenced. Based on our analysis of non-specific inhibitory effects of AzaC on growth of potato shoots in vitro, we estimated that AzaC half-life in the culture media is approximately 2 days.
Directory of Open Access Journals (Sweden)
. Alimuddin
2007-01-01
Full Text Available Highly unsaturated fatty acids (HUFA, especially eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA have long been recognized for its beneficial effect for human health and development. The D6 fatty acid desaturase is generally considered to be the rate-limiting factor in HUFA biosynthesis. Here, as the first step of study, we conducted experiment to select an appropriate construct that allows higher expression levels of masu salmon (Oncorhynchus masou D6-desaturase gene in zebrafish (Danio rerio in order to increase its activity for synthesizing EPA/DHA. Salmon D6-desaturase cDNA (sD6 was separately ligated with human cytomegalovirus (hCMV, medaka elongation factor 1a (mEF1a and medaka b-actin (mAct promoters. The resulted construct was designated as hCMV-sD6, mEF1a-sD6 and mAct-sD6, respectively. Each of the constructs in circular DNA form was microinjected into 1-cell stage embryos at a concentration of 30mg/ml. Transgenic individuals were identified by polymerase chain reaction (PCR and their expression levels were analyzed by reverse transcription PCR. The first (F1 and second (F2 generation was produced by crossing the transgenic founder F0 and F1, respectively, with wild-type fish. The results showed that the highest transient gene expression level was obtained from the mAct-D6 construct, followed respectively by EF1a-D6 and hCMV-D6 construct. The transmission rate of transgene into F1 generation was 4.2%-44.1%, and into F2 was followed the Mendellian segregation pattern. Expression of transgene in F2 generation was varied between strains regarding as the mosaics of F0 fish. Now, a transgenic system to study the modification of fatty acid biosynthesis pathways in fish was established. Further investigations are to produce fish containing higher levels of EPA and DHA. Keywords: desaturase, nutraceutical fatty acid, transgenic, zebrafish, masu salmon Abstrak Promoter merupakan regulator yang menentukan
Silencing of a Germin-Like Gene in Nicotiana attenuata Improves Performance of Native Herbivores1[W
Lou, Yonggen; Baldwin, Ian T.
2006-01-01
Germins and germin-like proteins (GLPs) are known to function in pathogen resistance, but their involvement in defense against insect herbivores is poorly understood. In the native tobacco Nicotiana attenuata, attack from the specialist herbivore Manduca sexta or elicitation by adding larval oral secretions (OS) to wounds up-regulates transcripts of a GLP. To understand the function of this gene, which occurs as a single copy, we cloned the full-length NaGLP and silenced its expression in N. attenuata by expressing a 250-bp fragment in an antisense orientation with an Agrobacterium-based transformation system and by virus-induced gene silencing (VIGS). Homozygous lines harboring a single insert and VIGS plants had significantly reduced constitutive (measured in roots) and elicited NaGLP transcript levels (in leaves). Silencing NaGLP improved M. sexta larval performance and Tupiocoris notatus preference, two native herbivores of N. attenuata. Silencing NaGLP also attenuated the OS-induced hydrogen peroxide (H2O2), diterpene glycosides, and trypsin proteinase inhibitor responses, which may explain the observed susceptibility of antisense or VIGS plants to herbivore attack and increased nicotine contents, but did not influence the OS-elicited jasmonate and salicylate bursts, or the release of the volatile organic compounds (limonene, cis-α-bergamotene, and germacrene-A) that function as an indirect defense. This suggests that NaGLP is involved in H2O2 production and might also be related to ethylene production and/or perception, which in turn influences the defense responses of N. attenuata via H2O2 and ethylene-signaling pathways. PMID:16461381
Anomalous ultrasonic attenuation and velocity change in LaAl2
International Nuclear Information System (INIS)
Federle, G.; Dransfeld, K.; Boemmel, H.E.; Roedhammer, P.
1980-01-01
The attenuation and velocity of longitudinal waves has been measured in superconducting and normal LaAl 2 in the frequency range from 15 to 225 MHz. Both in the superconducting and in the normal state an unusually large damping has been found superimposed on the relatively small attenuation due to the well known electron-phonon interaction. On cooling into the superconducting state the attenuation starts to drop only at temperatures well below Tsub(c) and - as in insulating glasses - it rises again below 0.8K. It is suggested that this indicates that two-level systems similar to the ones found in amorphous superconductors may be present in the crystalline LaAl 2 sample and are responsible for the observed acoustic anomalies. (author)
Madiraju, Padma; Hossain, Ekhtear; Anand-Srivastava, Madhu B
2018-02-07
We showed previously that natriuretic peptide receptor-C (NPR-C) agonist, C-ANP 4-23 , attenuated the enhanced expression of Giα proteins in vascular smooth muscle cells (VSMC) from spontaneously hypertensive rats (SHR) through the inhibition of enhanced oxidative stress. Since the enhanced levels of endogenous angiotensin II (Ang II) contribute to the overexpression of Giα proteins and augmented oxidative stress in VSMC from SHR, the present study was undertaken to investigate if C-ANP 4-23 could also attenuate angiotensin II (Ang II)-induced oxidative stress and associated signaling. Ang II treatment of aortic VSMC augmented the levels of superoxide anion (O 2 - ), NADPH oxidase activity, and the expression of NADPH oxidase subunits and C-ANP 4-23 treatment attenuated all these to control levels. In addition, Ang II-induced enhanced levels of thiobarbituric acid-reactive substances (TBARS) and protein carbonyl content were also attenuated toward control levels by C-ANP 4-23 treatment. On the other hand, Ang II inhibited the levels of nitric oxide (NO) and augmented the levels of peroxynitrite (OONO - ) in VSMC which were restored to control levels by C-ANP 4-23 treatment. Furthermore, C-ANP 4-23 treatment attenuated Ang II-induced enhanced expression of Giα proteins, phosphorylation of p38, JNK, and ERK 1,2 as well as hyperproliferation of VSMC as determined by DNA synthesis, and metabolic activity. These results indicate that C-ANP 4-23 , via the activation of NPR-C, attenuates Ang II-induced enhanced nitroxidative stress, overexpression of Giα proteins, increased activation of the p38/JNK/ERK 1,2 signaling pathways, and hyperproliferation of VSMC. It may be suggested that C-ANP 4-23 could be used as a therapeutic agent in the treatment of vascular remodeling associated with hypertension and atherosclerosis.
International Nuclear Information System (INIS)
Higgins, Larry G.; Cavin, Christophe; Itoh, Ken; Yamamoto, Masayuki; Hayes, John D.
2008-01-01
Mice fed diets containing 3% or 6% coffee for 5 days had increased levels of mRNA for NAD(P)H:quinone oxidoreductase 1 (NQO1) and glutathione S-transferase class Alpha 1 (GSTA1) of between 4- and 20-fold in the liver and small intestine. Mice fed 6% coffee also had increased amounts of mRNA for UDP-glucuronosyl transferase 1A6 (UGT1A6) and the glutamate cysteine ligase catalytic (GCLC) subunit of between 3- and 10-fold in the small intestine. Up-regulation of these mRNAs was significantly greater in mice possessing Nrf2 (NF-E2 p45 subunit-related factor 2) than those lacking the transcription factor. Basal levels of mRNAs for NQO1, GSTA1, UGT1A6 and GCLC were lower in tissues from nrf2 -/- mice than from nrf2 +/+ mice, but modest induction occurred in the mutant animals. Treatment of mouse embryonic fibroblasts (MEFs) from nrf2 +/+ mice with either coffee or the coffee-specific diterpenes cafestol and kahweol (C + K) increased NQO1 mRNA up to 9-fold. MEFs from nrf2 -/- mice expressed less NQO1 mRNA than did wild-type MEFs, but NQO1 was induced modestly by coffee or C + K in the mutant fibroblasts. Transfection of MEFs with nqo1-luciferase reporter constructs showed that induction by C + K was mediated primarily by Nrf2 and required the presence of an antioxidant response element in the 5'-upstream region of the gene. Luciferase reporter activity did not increase following treatment of MEFs with 100 μmol/l furan, suggesting that this ring structure within C + K is insufficient for gene induction. Priming of nrf2 +/+ MEFs, but not nrf2 -/- MEFs, with C + K conferred 2-fold resistance towards acrolein
Systemic RNAi-mediated Gene Silencing in Nonhuman Primate and Rodent Myeloid Cells
Directory of Open Access Journals (Sweden)
Tatiana I Novobrantseva
2012-01-01
Full Text Available Leukocytes are central regulators of inflammation and the target cells of therapies for key diseases, including autoimmune, cardiovascular, and malignant disorders. Efficient in vivo delivery of small interfering RNA (siRNA to immune cells could thus enable novel treatment strategies with broad applicability. In this report, we develop systemic delivery methods of siRNA encapsulated in lipid nanoparticles (LNP for durable and potent in vivo RNA interference (RNAi-mediated silencing in myeloid cells. This work provides the first demonstration of siRNA-mediated silencing in myeloid cell types of nonhuman primates (NHPs and establishes the feasibility of targeting multiple gene targets in rodent myeloid cells. The therapeutic potential of these formulations was demonstrated using siRNA targeting tumor necrosis factor-α (TNFα which induced substantial attenuation of disease progression comparable to a potent antibody treatment in a mouse model of rheumatoid arthritis (RA. In summary, we demonstrate a broadly applicable and therapeutically relevant platform for silencing disease genes in immune cells.
International Nuclear Information System (INIS)
Lee, Cheol-Jung; Lee, Mee-Hyun; Lee, Ji-Young; Song, Ji Hong; Lee, Hye Suk; Cho, Yong-Yeon
2013-01-01
Highlights: •We demonstrated a novel function of RSK2 in stress tolerance. •RSK2 deficiency enhanced apoptosis by calcium stress. •RSK2-mediated GSK3β phosphorylation at serine 9 increased calcium-induced stress tolerance. •Calcium stress-induced apoptosis inhibited by adding back of RSK2 into RSK2 −/− MEFs. -- Abstract: Our previous studies demonstrated that RSK2 plays a key role in cell proliferation and transformation induced by tumor promoters such as epidermal growth factor (EGF) in mouse and human skin cells. However, no direct evidence has been found regarding the relationship of RSK2 and cell survival. In this study, we found that RSK2 interacted and phosphorylated GSK3β at Ser9. Notably, GSK3β phosphorylation at Ser9 was suppressed in RSK2 −/− MEFs compared with RSK2 +/+ MEFs by stimulation of EGF and calcium ionophore A23187, a cellular calcium stressor. In proliferation, we found that RSK2 deficiency suppressed cell proliferation compared with RSK2 +/+ MEFs. In contrast, GSK3β −/− MEFs induced the cell proliferation compared with GSK3β +/+ MEFs. Importantly, RSK2 −/− MEFs were induced severe cellular morphology change by A23187 and enhanced G1/G0 and sub-G1 accumulation of the cell cycle phase compared with RSK2 +/+ MEFs. The sub-G1 induction in RSK2 −/− MEFs by A23187 was correlated with increase of cytochrome c release, caspase-3 cleavage and apoptotic DNA fragmentation compared with RSK2 +/+ MEFs. Notably, return back of RSK2 into RSK2 −/− MEFs restored A23187-induced morphological change, and decreased apoptosis, apoptotic DNA fragmentation and caspase-3 induction compared with RSK2 −/− /mock MEFs. Taken together, our results demonstrated that RSK2 plays an important role in stress-tolerance and cell survival, resulting in cell proliferation and cancer development
Ma, Qingyu; Liu, Qiuming; Yuan, Ling; Zhuang, Yongliang
2018-03-28
A previous study has shown that tilapia fish skin gelatin hydrolysates inhibited photoaging in vivo, and that, Leu-Ser-Gly-Tyr-Gly-Pro (LSGYGP) identified in the hydrolysate had a high hydroxyl radical scavenging activity. In this study, activities of LSGYGP were further evaluated using ultraviolet B (UVB)-induced mouse embryonic fibroblasts (MEFs). UVB irradiation significantly increased the intercellular reactive oxygen species (ROS) production and matrix metalloproteinases (MMPs) activities and decreased the content of collagen in MEFs. LSGYGP reduced the intercellular ROS generation in UVB-induced MEFs. Meanwhile, the decrease of superoxide dismutase (SOD) activity and the increase of malondiaidehyde (MDA) content were inhibited by LSGYGP. LSGYGP reduced MMP-1 and MMP-9 activities in a dose-dependent manner. Molecular docking simulation indicated that LSGYGP inhibited MMPs activities by docking the active sites of MMP-1 and MMP-9. Furthermore, LSGYGP also affected the intercellular phosphorylation of UVB-induced the mitogen-activated protein kinase pathway. LSGYGP could protect collagen synthesis in MEFs under UVB irradiation by inhibiting oxidative stress and regulating MMPs activities.
Directory of Open Access Journals (Sweden)
Qingyu Ma
2018-03-01
Full Text Available A previous study has shown that tilapia fish skin gelatin hydrolysates inhibited photoaging in vivo, and that, Leu-Ser-Gly-Tyr-Gly-Pro (LSGYGP identified in the hydrolysate had a high hydroxyl radical scavenging activity. In this study, activities of LSGYGP were further evaluated using ultraviolet B (UVB-induced mouse embryonic fibroblasts (MEFs. UVB irradiation significantly increased the intercellular reactive oxygen species (ROS production and matrix metalloproteinases (MMPs activities and decreased the content of collagen in MEFs. LSGYGP reduced the intercellular ROS generation in UVB-induced MEFs. Meanwhile, the decrease of superoxide dismutase (SOD activity and the increase of malondiaidehyde (MDA content were inhibited by LSGYGP. LSGYGP reduced MMP-1 and MMP-9 activities in a dose-dependent manner. Molecular docking simulation indicated that LSGYGP inhibited MMPs activities by docking the active sites of MMP-1 and MMP-9. Furthermore, LSGYGP also affected the intercellular phosphorylation of UVB-induced the mitogen-activated protein kinase pathway. LSGYGP could protect collagen synthesis in MEFs under UVB irradiation by inhibiting oxidative stress and regulating MMPs activities.
Directory of Open Access Journals (Sweden)
Yujing YIN
2017-12-01
Full Text Available Background and objective It has been proven that circular RNAs (circRNAs play an important role on the process of many types cancer and circUBAP2 was a cancer-promoting circRNA, however, the role and mechanism in lung cancer was not clear. The aim of this study is to investigate the effects of circUBAP2 on cell proliferation and invasion of human lung cancer A549 cells. Methods CCK-8 assay was employed to detect the effect of circUBAP2 sliencing on cell proliferation of A549 cells. Fow cytometry was applied to detect the impact of circUBAP2 sliencing on cell cycle and cell anoikis, and Transwell invasion assay was applied to determine cell invasion of A549 cells. We also employed Western blot and Real-time PCR to determine the expressions of CDK6, cyclin D1, p27 and c-IAP1, Bcl-2, Survivin, Bax, FAK, Rac1 and MMP2, and the activities of JNK and ERK1/2, luciferase report gene assay was used to detect the targets. Results CCK-8 assay showed that the inhibition of cell proliferation in the circUBAP2-siRNA group compared to untreated group and siRNA control group. Results of cell cycle detected by flow cytometry showed that cell cycle arrestd at G0/G1 after circUBAP2 silencing, cell apoptosis rate increased also. We also found that after circUBAP2 silencing, cell invasion of A549 cells was significantly inhibited. Western blot and Real-time PCR results showed that expression of CDK6, cyclin D1, c-IAP1, Bcl-2, Survivin, FAK, Rac1 and MMP2 were down-regulated, and the expression of p27 and Bax were up-regulated. Moreover, the activities of JNK and ERK1/2 were inhibited because of circUBAP2 silencing, the target genes were miR-339-5p, miR-96-3p and miR-135b-3p. Conclusion CircUBAP2 plays an important role in the proliferation and invasion of human lung cancer. Silencing of circUBAP2 might be a novel target for molecular targeted therapy of patients with lung cancer.
Energy Technology Data Exchange (ETDEWEB)
Melo, Ana Cristina Bezerra Azedo de
2004-12-15
The fluid dynamic behavior of a riser in a cold type FCC model was investigated by means of catalyst concentration distribution measured with gamma attenuation and simulated with a mathematical model. In the riser of the cold model, MEF, 0,032 m in diameter, 2,30 m in length the fluidized bed, whose components are air and FCC catalyst, circulates. The MEF is operated by automatic control and instruments for measuring fluid dynamic variables. An axial catalyst concentration distribution was measured using an Am-241 gamma source and a NaI detector coupled to a multichannel provided with a software for data acquisition and evaluation. The MEF was adapted for a fluid dynamic model validation which describes the flow in the riser, for example, by introducing an injector for controlling the solid flow in circulation. Mathematical models were selected from literature, analyzed and tested to simulate the fluid dynamic of the riser. A methodology for validating fluid dynamic models was studied and implemented. The stages of the work were developed according to the validation methodology, such as data planning experiments, study of the equations which describe the fluidodynamic, computational solvers application and comparison with experimental data. Operational sequences were carried out keeping the MEF conditions for measuring catalyst concentration and simultaneously measuring the fluid dynamic variables, velocity of the components and pressure drop in the riser. Following this, simulated and experimental values were compared and statistical data treatment done, aiming at the required precision to validate the fluid dynamic model. The comparison tests between experimental and simulated data were carried out under validation criteria. The fluid dynamic behavior of the riser was analyzed and the results and the agreement with literature were discussed. The adopt model was validated under the MEF operational conditions, for a 3 to 6 m/s gas velocity in the riser and a slip
Directory of Open Access Journals (Sweden)
Yan Liang
2013-11-01
Full Text Available Drought is a major threat to agriculture production worldwide. Mitogen-activated protein kinases (MAPKs play a pivotal role in sensing and converting stress signals into appropriate responses so that plants can adapt and survive. To examine the function of MAPKs in the drought tolerance of tomato plants, we silenced the SpMPK1, SpMPK2, and SpMPK3 genes in wild-type plants using the virus-induced gene silencing (VIGS method. The results indicate that silencing the individual genes or co-silencing SpMPK1, SpMPK2, and SpMPK3 reduced the drought tolerance of tomato plants by varying degrees. Co-silencing SpMPK1 and SpMPK2 impaired abscisic acid (ABA-induced and hydrogen peroxide (H2O2-induced stomatal closure and enhanced ABA-induced H2O2 production. Similar results were observed when silencing SpMPK3 alone, but not when SpMPK1 and SpMPK2 were individually silenced. These data suggest that the functions of SpMPK1 and SpMPK2 are redundant, and they overlap with that of SpMPK3 in drought stress signaling pathways. In addition, we found that SpMPK3 may regulate H2O2 levels by mediating the expression of CAT1. Hence, SpMPK1, SpMPK2, and SpMPK3 may play crucial roles in enhancing tomato plants’ drought tolerance by influencing stomatal activity and H2O2 production via the ABA-H2O2 pathway.
MicroRNA-145 Aggravates Hypoxia-Induced Injury by Targeting Rac1 in H9c2 Cells.
Wang, Ximing; Zhang, Yanxia; Wang, Hongshan; Zhao, Genshang; Fa, Xianen
2017-01-01
Myocardial infarction (MI) is a leading cause of morbidity and mortality. Here, we sought to explore the potential role and underlying mechanism of miR-145 in MI. H9c2 cells were cultured under persistent hypoxia to simulate MI. The hypoxia-induced injury was assessed on the basis of cell viability, migration, invasion and apoptosis. The expression of miR-145 was evaluated by qRT-PCR and the influence of aberrantly expressed miR-145 on H9c2 cells under hypoxia was also estimated. Utilizing bioinformatics methods, the target genes of miR-145 were verified by luciferase reporter assay. Then, effects of abnormally expressed target gene on miR-145 silenced H9c2 cells were assessed. Finally, the phosphorylation levels of key kinases in the phosphatidylinositol-3-kinase (PI3K)/AKT and the mitogen-activated protein kinase (MAPK)/extracellular signal-regulated kinase (ERK) pathways were detected by Western blot analysis. Hypoxia remarkably lowered viability, migration and invasion but promoted cell apoptosis. Meantime, the miR-145 level was up-regulated in H9c2 cells under hypoxia. Following experiments suggested that hypoxia-induced injury was exacerbated by miR-145 overexpression while was alleviated by miR-145 silence. Rac1 was predicted and further validated to be a target gene of miR-145. The influence of miR-145 silencing on H9c2 cells under hypoxia could be reversed by down-regulation of Rac1. Additionally, the phosphorylation levels of PI3K, AKT, MAPK and ERK were all elevated in miR-145 silenced cells and these alterations were reversed by down-regulation of Rac1. miR-145 silencing could protect H9c2 cells against hypoxia-induced injury by targeting Rac1, in which PI3K/AKT and MAPK/ERK pathways might be involved. © 2017 The Author(s). Published by S. Karger AG, Basel.
Durability of timber silencers at Wairakei geothermal steam field
Energy Technology Data Exchange (ETDEWEB)
Hedley, M E
1979-02-01
After early failures of reinforced concrete silencers and because of high costs of concrete-lined steel structures, preliminary tests were undertaken to assess the suitability of timber for silencer construction. Tests indicated that radiata pine treated with pentachlorophenol/oil or untreated red beech had most potential for timber silencer fabrication. One prototype silencer of each material was constructed and both were installed on operational bores in 1965. The red beech silencer had a service life of 4 years. The radiata pine silencer operated for 12/sup 1///sub 2/ years, although replacement had been recommended 1 year before this time expired. The performance of this silencer encouraged the general use of timber for silencer construction and further units were built. Procurement of satisfactory grades of timber has proved difficult and has limited silencer fabrication. Ways of improving timber supply, which require modification of silencer design, are discussed.
E(y)2/Sus1 is required for blocking PRE silencing by the Wari insulator in Drosophila melanogaster.
Erokhin, Maksim; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya
2010-06-01
Chromatin insulators affect interactions between promoters and enhancers/silencers and function as barriers to the spread of repressive chromatin. Recently, we have found an insulator, named Wari, located on the 3' side of the white gene. Here, we show that the previously identified 368-bp core of this insulator is sufficient for blocking Polycomb response element-mediated silencing. Although Wari does not contain binding sites for known insulator proteins, the E(y)2 and CP190 proteins bind to Wari as well as to the Su(Hw)-containing insulators in vivo. It may well be that these proteins are recruited to the insulator by as yet unidentified DNA-binding protein. Partial inactivation of E(y)2 in a weak e(y)2 ( u1 ) mutation impairs only the anti-silencing but not the enhancer-blocking activity of the Wari insulator. Thus, the E(y)2 protein in different Drosophila insulators serves to protect gene expression from silencing.
Pawar, Snehalata A; Sarkar, Tapasree Roy; Balamurugan, Kuppusamy; Sharan, Shikha; Wang, Jun; Zhang, Youhong; Dowdy, Steven F; Huang, A-Mei; Sterneck, Esta
2010-05-18
The transcription factor CCAAT/enhancer binding protein delta (C/EBPdelta, CEBPD, NFIL-6beta) has tumor suppressor function; however, the molecular mechanism(s) by which C/EBPdelta exerts its effect are largely unknown. Here, we report that C/EBPdelta induces expression of the Cdc27 (APC3) subunit of the anaphase promoting complex/cyclosome (APC/C), which results in the polyubiquitination and degradation of the prooncogenic cell cycle regulator cyclin D1, and also down-regulates cyclin B1, Skp2, and Plk-1. In C/EBPdelta knockout mouse embryo fibroblasts (MEF) Cdc27 levels were reduced, whereas cyclin D1 levels were increased even in the presence of activated GSK-3beta. Silencing of C/EBPdelta, Cdc27, or the APC/C coactivator Cdh1 (FZR1) in MCF-10A breast epithelial cells increased cyclin D1 protein expression. Like C/EBPdelta, and in contrast to cyclin D1, Cdc27 was down-regulated in several breast cancer cell lines, suggesting that Cdc27 itself may be a tumor suppressor. Cyclin D1 is a known substrate of polyubiquitination complex SKP1/CUL1/F-box (SCF), and our studies show that Cdc27 directs cyclin D1 to alternative degradation by APC/C. These findings shed light on the role and regulation of APC/C, which is critical for most cellular processes.
International Nuclear Information System (INIS)
Rückert, Felix; Samm, Nicole; Lehner, Anne-Kathrin; Saeger, Hans-Detlev; Grützmann, Robert; Pilarsky, Christian
2010-01-01
Pancreatic ductal adenocarcinoma shows a distinct apoptosis resistance, which contributes significantly to the aggressive nature of this tumor and constrains the effectiveness of new therapeutic strategies. Apoptosis resistance is determined by the net balance of the cells pro-and anti-apoptotic 'control mechanisms'. Numerous dysregulated anti-apoptotic genes have been identified in pancreatic cancer and seem to contribute to the high anti-apoptotic buffering capacity. We aimed to compare the benefit of simultaneous gene silencing (SGS) of several candidate genes with conventional gene silencing of single genes. From literature search we identified the anti-apoptotic genes XIAP, Survivin and Bcl-2 as commonly upregulated in pancreatic cancer. We performed SGS and silencing of single candidate genes using siRNA molecules in two pancreatic cancer cell lines. Effectiveness of SGS was assessed by qRT-PCR and western blotting. Apoptosis induction was measured by flow cytometry and caspase activation. Simultaneous gene silencing reduced expression of the three target genes effectively. Compared to silencing of a single target or control, SGS of these genes resulted in a significant higher induction of apoptosis in pancreatic cancer cells. In the present study we performed a subliminal silencing of different anti-apoptotic target genes simultaneously. Compared to silencing of single target genes, SGS had a significant higher impact on apoptosis induction in pancreatic cancer cells. Thereby, we give further evidence for the concept of an anti-apoptotic buffering capacity of pancreatic cancer cells
Kim, Bong Cho; Ryu, Min Sook; Oh, S Paul; Lim, In Kyoung
2008-09-01
It has been known that 12-O-tetradecanoyl phorbol-13-acetate-inducible sequence 21 (TIS21), ortholog of human B-cell translocation gene 2, regulates expansions of stage-specific thymocytes and hematopoietic progenitors. In the present study, lineage-negative (Lin(-))/stem cell antigen-1-positive (Sca-1+)/c-Kit+ (LSK) cell content was significantly elevated in bone marrow (BM) of TIS21-knockout (TIS21(-/-)) female mice, suggesting 17beta-estradiol (E(2))-regulated progenitor expansion. E(2) induced DNA synthesis and cell proliferation of mouse embryonic fibroblasts (MEFs) isolated from TIS21(-/-) mice, but not wild type (WT). In contrast to WT, E(2) failed to activate protein kinase B (Akt) in the TIS21(-/-) MEFs, independent of extracellular signal-regulated kinase 1/2 (Erk1/2) activation. Despite attenuation of Akt activation, mammalian target of rapamycin (mTOR) was constitutively activated in the TIS21(-/-) MEFs. Furthermore, mitogen-activated protein kinase 1/2 inhibitor or knockdown of Erk1 could restore activation of Akt and downregulate mTOR. Immunoprecipitation showed Akt preferentially bound to phosphorylated Erk1/2 (p-Erk1/2) in TIS21(-/-) cells, but reconstitution of TIS21 inhibited their interaction. E(2)-injected TIS21(-/-) male mice also increased LSK cells in BM. Taken together, expansion of hematopoietic progenitors in TIS21(-/-) female mice might be through inhibition of Akt activation, and constitutive activation of mTOR via preferential binding of TIS21 to E(2)-induced p-Erk1/2, compared with that of Akt. Our results suggest that TIS21 plays a pivotal role in maintaining the hematopoietic stem cell compartment and hematopoiesis.
Directory of Open Access Journals (Sweden)
Praveen Guleria
Full Text Available Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi based Agrobacterium mediated transient gene silencing (AMTS approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1 genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins.RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3 content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes.SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route.
DEFF Research Database (Denmark)
Dupret, Katia
2018-01-01
static nor neutral. It has performative effects. Silencing as an act, rather than a noun, is conceptualised as a central ‘configurating actor’ of change. Through the description of minute details from a videotaped supervision session in the mental healthcare sector, it is shown how different performative...... configurations of silence makes people relate to each other in new ways and influence new work practices. In spite of its somewhat immaterial connotations, using an Actor-Network Theory approach to organization studies, silencing is conceptualised as both a means and an effect of change efforts, which are socio...
Protein kinase D2 regulates migration and invasion of U87MG glioblastoma cells in vitro
Energy Technology Data Exchange (ETDEWEB)
Bernhart, Eva; Damm, Sabine; Wintersperger, Andrea [Institute of Molecular Biology and Biochemistry, Medical University of Graz, Graz (Austria); DeVaney, Trevor [Institute of Biophysics, Medical University of Graz (Austria); Zimmer, Andreas [Institute of Pharmaceutical Sciences, Department of Pharmaceutical Technology, Karl-Franzens University, Graz (Austria); Raynham, Tony; Ireson, Christopher [Cancer Research Technology Ltd, London (United Kingdom); Sattler, Wolfgang, E-mail: wolfgang.sattler@medunigraz.at [Institute of Molecular Biology and Biochemistry, Medical University of Graz, Graz (Austria)
2013-08-01
Glioblastoma multiforme (GBM) is the most common malignant brain tumor, which, despite combined modality treatment, reoccurs and is invariably fatal for affected patients. Recently, a member of the serine/threonine protein kinase D (PRKD) family, PRKD2, was shown to be a potent mediator of glioblastoma growth. Here we studied the role of PRKD2 in U87MG glioblastoma cell migration and invasion in response to sphingosine-1-phosphate (S1P), an activator of PRKD2 and a GBM mitogen. Time-lapse microscopy demonstrated that random cell migration was significantly diminished in response to PRKD2 silencing. The pharmacological PRKD family inhibitor CRT0066101 decreased chemotactic migration and invasion across uncoated or matrigel-coated Transwell inserts. Silencing of PRKD2 attenuated migration and invasion of U87MG cells even more effectively. In terms of downstream signaling, CRT0066101 prevented PRKD2 autophosphorylation and inhibited p44/42 MAPK and to a smaller extent p54/46 JNK and p38 MAPK activation. PRKD2 silencing impaired activation of p44/42 MAPK and p54/46 JNK, downregulated nuclear c-Jun protein levels and decreased c-Jun{sup S73} phosphorylation without affecting the NFκB pathway. Finally, qPCR array analyses revealed that silencing of PRKD2 downregulates mRNA levels of integrin alpha-2 and -4 (ITGA2 and -4), plasminogen activator urokinase (PLAU), plasminogen activator urokinase receptor (PLAUR), and matrix metallopeptidase 1 (MMP1). Findings of the present study identify PRKD2 as a potential target to interfere with glioblastoma cell migration and invasion, two major determinants contributing to recurrence of glioblastoma after multimodality treatment. Highlights: • Sphingosine-1-phosphate induces glioma cell migration and invasion. • Part of the effects is mediated by protein kinase D2 (PRKD2) activation. • Inactivation of PRKD2 attenuates glioblastoma cell migration and invasion. • Both, RNAi and pharmacological inhibition of PRKD2 inhibits MAPK
Protein kinase D2 regulates migration and invasion of U87MG glioblastoma cells in vitro
International Nuclear Information System (INIS)
Bernhart, Eva; Damm, Sabine; Wintersperger, Andrea; DeVaney, Trevor; Zimmer, Andreas; Raynham, Tony; Ireson, Christopher; Sattler, Wolfgang
2013-01-01
Glioblastoma multiforme (GBM) is the most common malignant brain tumor, which, despite combined modality treatment, reoccurs and is invariably fatal for affected patients. Recently, a member of the serine/threonine protein kinase D (PRKD) family, PRKD2, was shown to be a potent mediator of glioblastoma growth. Here we studied the role of PRKD2 in U87MG glioblastoma cell migration and invasion in response to sphingosine-1-phosphate (S1P), an activator of PRKD2 and a GBM mitogen. Time-lapse microscopy demonstrated that random cell migration was significantly diminished in response to PRKD2 silencing. The pharmacological PRKD family inhibitor CRT0066101 decreased chemotactic migration and invasion across uncoated or matrigel-coated Transwell inserts. Silencing of PRKD2 attenuated migration and invasion of U87MG cells even more effectively. In terms of downstream signaling, CRT0066101 prevented PRKD2 autophosphorylation and inhibited p44/42 MAPK and to a smaller extent p54/46 JNK and p38 MAPK activation. PRKD2 silencing impaired activation of p44/42 MAPK and p54/46 JNK, downregulated nuclear c-Jun protein levels and decreased c-Jun S73 phosphorylation without affecting the NFκB pathway. Finally, qPCR array analyses revealed that silencing of PRKD2 downregulates mRNA levels of integrin alpha-2 and -4 (ITGA2 and -4), plasminogen activator urokinase (PLAU), plasminogen activator urokinase receptor (PLAUR), and matrix metallopeptidase 1 (MMP1). Findings of the present study identify PRKD2 as a potential target to interfere with glioblastoma cell migration and invasion, two major determinants contributing to recurrence of glioblastoma after multimodality treatment. Highlights: • Sphingosine-1-phosphate induces glioma cell migration and invasion. • Part of the effects is mediated by protein kinase D2 (PRKD2) activation. • Inactivation of PRKD2 attenuates glioblastoma cell migration and invasion. • Both, RNAi and pharmacological inhibition of PRKD2 inhibits MAPK
Zheng, Min; Mitra, Rajendra N; Filonov, Nazar A; Han, Zongchao
2016-03-01
Previously, we compared the efficacy of nanoparticle (NP)-mediated intron-containing rhodopsin (sgRho) vs. intronless cDNA in ameliorating retinal disease phenotypes in a rhodopsin knockout (RKO) mouse model of retinitis pigmentosa. We showed that NP-mediated sgRho delivery achieved long-term expression and phenotypic improvement in RKO mice, but not NP housing cDNA. However, the protein level of the NP-sgRho construct was only 5-10% of wild-type at 8 mo postinjection. To have a better understanding of the reduced levels of long-term expression of the vectors, in the present study, we evaluated the epigenetic changes of subretinal delivering NP-cDNA vs. NP-sgRho in the RKO mouse eyes. Following the administration, DNA methylation and histone status of specific regions (bacteria plasmid backbone, promoter, rhodopsin gene, and scaffold/matrix attachment region) of the vectors were evaluated at various time points. We documented that epigenetic transgene silencing occurred in vector-mediated gene transfer, which were caused by the plasmid backbone and the cDNA of the transgene, but not the intron-containing transgene. No toxicity or inflammation was found in the treated eyes. Our results suggest that cDNA of the rhodopsin transgene and bacteria backbone interfered with the host defense mechanism of DNA methylation-mediated transgene silencing through heterochromatin-associated modifications. © FASEB.
Laldinsangi, C; Senthilkumaran, B
2018-04-03
C-kit receptor is a member of a family of growth factor receptors that have tyrosine kinase activity, and are involved in the transduction of growth regulatory signals across plasma membrane by activation of its ligand, kitl/scf. The present study analysed mRNA and protein expression profiles of c-kit in the gonads of catfish, Clarias gariepinus, using real time PCR, in situ hybridization and immunohistochemistry. Tissue distribution analysis revealed higher expression mainly in the catfish gonads. Ontogeny studies showed minimal expression during early developmental stages and highest during 50-75 days post hatch, and the dimorphic expression in gonads decreased gradually till adulthood, which might suggest an important role for this gene around later stages of sex differentiation and gonadal development. Expression of C-kit was analysed at various phases of gonadal cycle in both male and female, which showed minimal expression during the resting phase, and higher expression in male compared to females during the pre-spawning phase. In vitro and in vivo induction using human chorionic gonadotropin elevated the expression of c-kit indicating the regulatory influence of hypothalamo-hypophyseal axis. In vivo transient gene silencing using c-kit-esiRNA in adult catfish during gonadal recrudescence showed a decrease in c-kit expression, which affected the expression level of germ cell meiotic marker sycp3, as well as several factors and steroidogenic enzyme genes involved in germ cell development. Decrease in the levels of serum 11-KT and T were also observed after esiRNA silencing. The findings of this study suggest that c-kit has an important role in the process of germ cell proliferation, development and maturation during gonadal development and recrudescence in catfish. Copyright © 2018. Published by Elsevier Inc.
Guleria, Praveen; Yadav, Sudesh Kumar
2013-01-01
Background Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi) based Agrobacterium mediated transient gene silencing (AMTS) approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1) genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins. Methodology/Principal Findings RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3) content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes. Conclusions SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route. PMID:24023961
Thermodynamic control of small RNA-mediated gene silencing
Directory of Open Access Journals (Sweden)
Kumiko eUi-Tei
2012-06-01
Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.
Alfisyahrin; Isranuri, I.
2018-02-01
Active Noise Control is a technique to overcome noisy with noise or sound countered with sound in scientific terminology i.e signal countered with signals. This technique can be used to dampen relevant noise in accordance with the wishes of the engineering task and reducing automotive muffler noise to a minimum. Objective of this study is to develop a Active Noise Control which should cancel the noise of automotive Exhaust (Silencer) through Signal Processing Simulation methods. Noise generator of Active Noise Control is to make the opponent signal amplitude and frequency of the automotive noise. The steps are: Firstly, the noise of automotive silencer was measured to characterize the automotive noise that its amplitude and frequency which intended to be expressed. The opposed sound which having similar character with the signal source should be generated by signal function. A comparison between the data which has been completed with simulation calculations Fourier transform field data is data that has been captured on the muffler (noise silencer) Toyota Kijang Capsule assembly 2009. MATLAB is used to simulate how the signal processing noise generated by exhaust (silencer) using FFT. This opponent is inverted phase signal from the signal source 180° conducted by Instruments of Signal Noise Generators. The process of noise cancelation examined through simulation using computer software simulation. The result is obtained that attenuation of sound (noise cancellation) has a difference of 33.7%. This value is obtained from the comparison of the value of the signal source and the signal value of the opponent. So it can be concluded that the noisy signal can be attenuated by 33.7%.
2D Coda Attenuation Analysis of Active Sources: The Rockall Basin
Sketsiou, P.; De Siena, L.; Asena, K.
2017-12-01
Passive seismic surveys are used for the evaluation of seismic attenuation parameters to characterise the Earth's lithosphere. Attenuation imaging is rarely applied to active datasets, attenuation being considered a hindrance than an efficient parameter when imaging reservoirs. In this study, we use one-component active source signals to study coda attenuation in the sub-basaltic North-Eastern Atlantic Margin, the Rockall Basin. Although this technique has been primarily used in volcanic and lithospheric environments, we apply it here to the oil and gas industrial setting. The Rockall Basin data consist of publicly available waveforms from the Oil and Gas Authority of the UK. The selected signals were band-passed filtered. A multiple scattering model was adopted, assuming dominant contributions from intrinsic absorption over scattering at large lapse times. The residual dependency of Q_c on the geometrical spreading factor was additionally investigated. The distribution of Q_c over a seismic line and its dependence on frequency were plotted, revealing high Q_c near a well in Rockall. The power law Q_c=Q_0(f/f_0)^\\gamma was used to express Q_c as a function of frequency.
International Nuclear Information System (INIS)
Smolenskij, G.A.; Kolpakova, N.N.; Sher, E.S.; Brzhezina, B.
1986-01-01
Moderation of soft mode attenuation in the incommensurate phase in Cd 2 Nb 2 O 7 , K 2 SeO 4 and Rb 2 ZnBr 4 is observed at temperature drop and anomalous jump-like decrease of integral intensity of the soft mode under transition to the low-temperature commensurate phase. Anomalous behaviour of the soft mode is explained by wave amplitudon contribution (q=0) in Raman spectrum of the first order and composite tone (wave amplitudon (q=0) +- wave phase (q=K i )) in Raman spectrum of the second order. Relative contribution of the phase wave (q=K i ) to soft mode attenuation can be estimated supposing that wave amplitudon attenuation is G A ∼ (T i -T) -1 . ΔG f max makes up approximately 6 cm -1 in Cd 2 Nb 2 O 7 and approximately 3 cm -1 in K 2 SeO 4 and Rb 2 ZnBr 4 at temperatures above T c . In the low-temperature phase the soft mode corresponds to the wave amplitudon (q=0) in the Raman spectrum of the first order at T c - 26 K) in Cd 2 Nb 2 O 7 , T c - 13 K) in K 2 SeO 4 and T c - 163 K) in Rb 2 ZnBr 4
A study on impulsive sound attenuation for a high-pressure blast flow field
International Nuclear Information System (INIS)
Kang, Kuk Jeong; Ko, Sung Ho; Lee, Dong Soo
2008-01-01
The present work addresses a numerical study on impulsive sound attenuation for a complex high-pressure blast flow field; these characteristics are generated by a supersonic propellant gas flow through a shock tube into an ambient environment. A numerical solver for analyzing the high pressure blast flow field is developed in this study. From numerical simulations, wave dynamic processes (which include a first precursor shock wave, a second main propellant shock wave, and interactions in the muzzle blasts) are simulated and discussed. The pressure variation of the blast flow field is analyzed to evaluate the effect of a silencer. A live firing test is also performed to evaluate four different silencers. The results of this study will be helpful in understanding blast wave and in designing silencers
A study on impulsive sound attenuation for a high-pressure blast flow field
Energy Technology Data Exchange (ETDEWEB)
Kang, Kuk Jeong [Agency for Defence Development, Daejeon (Korea, Republic of); Ko, Sung Ho; Lee, Dong Soo [Chungnam National University, Daejeon (Korea, Republic of)
2008-01-15
The present work addresses a numerical study on impulsive sound attenuation for a complex high-pressure blast flow field; these characteristics are generated by a supersonic propellant gas flow through a shock tube into an ambient environment. A numerical solver for analyzing the high pressure blast flow field is developed in this study. From numerical simulations, wave dynamic processes (which include a first precursor shock wave, a second main propellant shock wave, and interactions in the muzzle blasts) are simulated and discussed. The pressure variation of the blast flow field is analyzed to evaluate the effect of a silencer. A live firing test is also performed to evaluate four different silencers. The results of this study will be helpful in understanding blast wave and in designing silencers
Small RNA-Mediated Epigenetic Myostatin Silencing
Directory of Open Access Journals (Sweden)
Thomas C Roberts
2012-01-01
Full Text Available Myostatin (Mstn is a secreted growth factor that negatively regulates muscle mass and is therefore a potential pharmacological target for the treatment of muscle wasting disorders such as Duchenne muscular dystrophy. Here we describe a novel Mstn blockade approach in which small interfering RNAs (siRNAs complementary to a promoter-associated transcript induce transcriptional gene silencing (TGS in two differentiated mouse muscle cell lines. Silencing is sensitive to treatment with the histone deacetylase inhibitor trichostatin A, and the silent state chromatin mark H3K9me2 is enriched at the Mstn promoter following siRNA transfection, suggesting epigenetic remodeling underlies the silencing effect. These observations suggest that long-term epigenetic silencing may be feasible for Mstn and that TGS is a promising novel therapeutic strategy for the treatment of muscle wasting disorders.
Silencing glypican-3 expression induces apoptosis in human hepatocellular carcinoma cells
Energy Technology Data Exchange (ETDEWEB)
Liu, Shiyuan [The Second Hospital of Lanzhou University, Lanzhou 730030, Gansu (China); Key Laboratory of Digestive System Tumors of Gansu Province, Lanzhou 730030, Gansu (China); Li, Yumin, E-mail: liym@lzu.edu.cn [The Second Hospital of Lanzhou University, Lanzhou 730030, Gansu (China); Key Laboratory of Digestive System Tumors of Gansu Province, Lanzhou 730030, Gansu (China); Chen, Wei [Department of Biochemistry and Molecular Biology, School of Basic Medical Science, Lanzhou University, Lanzhou 730000, Gansu (China); Zheng, Pengfei [The Second Hospital of Lanzhou University, Lanzhou 730030, Gansu (China); Key Laboratory of Digestive System Tumors of Gansu Province, Lanzhou 730030, Gansu (China); Liu, Tao; He, Wenting; Zhang, Junqiang; Zeng, Xiangting [Key Laboratory of Digestive System Tumors of Gansu Province, Lanzhou 730030, Gansu (China)
2012-03-23
Highlights: Black-Right-Pointing-Pointer RNA interference GPC3 induces apoptosis in human hepatocellular carcinoma cell. Black-Right-Pointing-Pointer Silencing GPC3 resulted in the release of cytochrome c and activation of caspase-3. Black-Right-Pointing-Pointer GPC3 modulates the Bax/Bcl-2/cytochrome c/caspase-3 apoptotic signaling pathway. Black-Right-Pointing-Pointer Knockdown of GPC3 is a novel approach to HCC treatment. -- Abstract: Hepatocellular carcinoma (HCC) is one of the most common internal malignant tumors. Glypican-3 (GPC3) is involved in the biological and molecular events in the tumorigenesis of HCC. We used RNA interference to evaluate the molecular effects of GPC3 suppression at the translational level and demonstrated for the first time that GPC3 silencing results in a significant elevation of the Bax/Bcl-2 ratio, the release of cytochrome c from mitochondria and the activation of caspase-3. The results suggest that GPC3 regulates cell proliferation by enhancing the resistance to apoptosis through the dysfunction of the Bax/Bcl-2/cytochrome c/caspase-3 signaling pathway and therefore plays a critical role in the tumorigenesis of HCC. Thus, the knockdown of GPC3 should be further investigated as an attractive novel approach for the targeted gene therapy of HCC.
FHL2 silencing reduces Wnt signaling and osteosarcoma tumorigenesis in vitro and in vivo.
Directory of Open Access Journals (Sweden)
Julia Brun
Full Text Available BACKGROUND: The molecular mechanisms that are involved in the growth and invasiveness of osteosarcoma, an aggressive and invasive primary bone tumor, are not fully understood. The transcriptional co-factor FHL2 (four and a half LIM domains protein 2 acts as an oncoprotein or as a tumor suppressor depending on the tissue context. In this study, we investigated the role of FHL2 in tumorigenesis in osteosarcoma model. METHODOLOGY/PRINCIPAL FINDINGS: Western blot analyses showed that FHL2 is expressed above normal in most human and murine osteosarcoma cells. Tissue microarray analysis revealed that FHL2 protein expression is high in human osteosarcoma and correlates with osteosarcoma aggressiveness. In murine osteosarcoma cells, FHL2 silencing using shRNA decreased canonical Wnt/β-catenin signaling and reduced the expression of Wnt responsive genes as well as of the key Wnt molecules Wnt5a and Wnt10b. This effect resulted in inhibition of osteosarcoma cell proliferation, invasion and migration in vitro. Using xenograft experiments, we showed that FHL2 silencing markedly reduced tumor growth and lung metastasis occurence in mice. The anti-oncogenic effect of FHL2 silencing in vivo was associated with reduced cell proliferation and decreased Wnt signaling in the tumors. CONCLUSION/SIGNIFICANCE: Our findings demonstrate that FHL2 acts as an oncogene in osteosarcoma cells and contributes to tumorigenesis through Wnt signaling. More importantly, FHL2 depletion greatly reduces tumor cell growth and metastasis, which raises the potential therapeutic interest of targeting FHL2 to efficiently impact primary bone tumors.
Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing.
Hedil, Marcio; Sterken, Mark G; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard
2015-01-01
RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silencing has only been studied to a limited extent. Here, the NSs proteins of TSWV, groundnut ringspot virus (GRSV) and tomato yellow ring virus (TYRV), representatives for three distinct tospovirus species, have been studied on their ability and strength to suppress local and systemic silencing. A system has been developed to quantify suppression of GFP silencing in Nicotiana benthamiana 16C lines, to allow a comparison of relative RNA silencing suppressor strength. It is shown that NSs of all three tospoviruses are suppressors of local and systemic silencing. Unexpectedly, suppression of systemic RNA silencing by NSsTYRV was just as strong as those by NSsTSWV and NSsGRSV, even though NSsTYRV was expressed in lower amounts. Using the system established, a set of selected NSsTSWV gene constructs mutated in predicted RNA binding domains, as well as NSs from TSWV isolates 160 and 171 (resistance breakers of the Tsw resistance gene), were analyzed for their ability to suppress systemic GFP silencing. The results indicate another mode of RNA silencing suppression by NSs that acts further downstream the biogenesis of siRNAs and their sequestration. The findings are discussed in light of the affinity of NSs for small and long dsRNA, and recent mutant screen of NSsTSWV to map domains required for RSS activity and triggering of Tsw-governed resistance.
Organizational Silence in Universities as the Predictor of Organizational Culture
Directory of Open Access Journals (Sweden)
Erkan YAMAN
2014-04-01
Full Text Available The aim of this study is to determine the relationship between the sense of organizational silence and the organizational culture the instructors perceived. In this study, the scale for determining organizational culture developed by İpek (1999 and the scale for measuring organizational silence developed by Çakıcı (2007 and adapted by Soycan (2010 are used. No remarkable difference was found in the academic staff's sense of organizational silence degree according to their genders and educational backgrounds. It was seen that the instructors' sense of organizational silence had remarkable differences according to their age group, faculty, sense of administration type in their institutions, frequency of their face-to-face communication with their administrators and their thoughts of speaking clearly with their administrators. It was observed that research assistants had a significantly higher sense of organizational silence than the lecturers in the sense of ‘Lack of Experience'. It was seen that academicians who had 1-5 years of employment period had the highest sense of organizational silence while those who had 21 years or more employment period had the lowest sense of organizational silence in the sense of ‘Lack of Experience' of organizational silence. When the points that participant academicians got from organizational silence and organizational culture scales analyzed in the correlation table, it was found out that there was a remarkable relationship between the academicians' sense of organizational silence and sense of organizational culture. This relationship was a medium-level negative relationship between subdimensions of two scales. A medium-level negative relationship between the organizational silence (total and the organizational culture was also seen. Based on the findings, university administrators were proposed to create a participant culture in their institutions as well as to encourage instructors to speak clearly and
"Listening Silence" and Its Discursive Effects
Applebaum, Barbara
2016-01-01
While researchers have studied how white silence protects white innocence and white ignorance, in this essay Barbara Applebaum explores a form of white silence that she refers to as "listening silence" in which silence protects white innocence but does not necessarily promote resistance to learning. White listening silence can appear to…
Maniscalco, James W; Zheng, Huiyuan; Gordon, Patrick J; Rinaman, Linda
2015-07-29
Previous reports indicate that caloric restriction attenuates anxiety and other behavioral responses to acute stress, and blunts the ability of stress to increase anterior pituitary release of adrenocorticotropic hormone. Since hindbrain glucagon-like peptide-1 (GLP-1) neurons and noradrenergic prolactin-releasing peptide (PrRP) neurons participate in behavioral and endocrine stress responses, and are sensitive to the metabolic state, we examined whether overnight food deprivation blunts stress-induced recruitment of these neurons and their downstream hypothalamic and limbic forebrain targets. A single overnight fast reduced anxiety-like behavior assessed in the elevated-plus maze and acoustic startle test, including marked attenuation of light-enhanced startle. Acute stress [i.e., 30 min restraint (RES) or 5 min elevated platform exposure] robustly activated c-Fos in GLP-1 and PrRP neurons in fed rats, but not in fasted rats. Fasting also significantly blunted the ability of acute stress to activate c-Fos expression within the anterior ventrolateral bed nucleus of the stria terminalis (vlBST). Acute RES stress suppressed dark-onset food intake in rats that were fed ad libitum, whereas central infusion of a GLP-1 receptor antagonist blocked RES-induced hypophagia, and reduced the ability of RES to activate PrRP and anterior vlBST neurons in ad libitum-fed rats. Thus, an overnight fast "silences" GLP-1 and PrRP neurons, and reduces both anxiety-like and hypophagic responses to acute stress. The partial mimicking of these fasting-induced effects in ad libitum-fed rats after GLP-1 receptor antagonism suggests a potential mechanism by which short-term negative energy balance attenuates neuroendocrine and behavioral responses to acute stress. The results from this study reveal a potential central mechanism for the "metabolic tuning" of stress responsiveness. A single overnight fast, which markedly reduces anxiety-like behavior in rats, reduces or blocks the ability of
Zalewski, Wojciech; Orczyk, Wacław; Gasparis, Sebastian; Nadolska-Orczyk, Anna
2012-11-07
CKX genes encode cytokinin dehydrogenase enzymes (CKX), which metabolize cytokinins in plants and influence developmental processes. The genes are expressed in different tissues and organs during development; however, their exact role in barley is poorly understood. It has already been proven that RNA interference (RNAi)-based silencing of HvCKX1 decreased the CKX level, especially in those organs which showed the highest expression, i.e. developing kernels and roots, leading to higher plant productivity and higher mass of the roots [1]. The same type of RNAi construct was applied to silence HvCKX2 and analyze the function of the gene. Two cultivars of barley were transformed with the same silencing and selection cassettes by two different methods: biolistic and via Agrobacterium. The mean Agrobacterium-mediated transformation efficiency of Golden Promise was 3.47% (±2.82). The transcript level of HvCKX2 in segregating progeny of T(1) lines was decreased to 34%. The reduction of the transcript in Agrobacterium-derived plants resulted in decreased CKX activity in the developing and developed leaves as well as in 7 DAP (days after pollination) spikes. The final phenotypic effect was increased productivity of T(0) plants and T(1) lines. Higher productivity was the result of the higher number of seeds and higher grain yield. It was also correlated with the higher 1000 grain weight, increased (by 7.5%) height of the plants and higher (from 0.5 to 2) numbers of spikes. The transformation efficiency of Golden Promise after biolistic transformation was more than twice as low compared to Agrobacterium. The transcript level in segregating progeny of T(1) lines was decreased to 24%. Otherwise, the enzyme activity found in the leaves of the lines after biolistic transformation, especially in cv. Golden Promise, was very high, exceeding the relative level of the control lines. These unbalanced ratios of the transcript level and the activity of the CKX enzyme negatively
Different Erythromycin Resistance Mechanisms in Group C and Group G Streptococci
Kataja, Janne; Seppälä, Helena; Skurnik, Mikael; Sarkkinen, Hannu; Huovinen, Pentti
1998-01-01
Different mechanisms of erythromycin resistance predominate in group C and G streptococcus (GCS and GGS, respectively) isolates collected from 1992 to 1995 in Finland. Of the 21 erythromycin-resistant GCS and 32 erythromycin-resistant GGS isolates, 95% had the mefA or mefE drug efflux gene and 94% had the ermTR methylase gene, respectively.
Attenuation coefficient of the light in skin of BALB/c and C57BL/6 mice
Silva, C. R.; Camargo, C. F. M.; Aureliano, D. P.; De Pretto, L. R.; Freitas, A. Z.; Ribeiro, M. S.
2015-06-01
Optical properties of the biological tissue play an important role to a correct use of optical techniques for therapy and diagnosis. The mice skin presents morphological differences due to characteristics such as gender, body mass and age. Murine models are frequently used in pre-clinical trials in optical therapy and diagnosis. Therefore, the assessment of the skin tissue in animal models is needed for a proper understanding of how light interacts with skin. Noninvasive techniques such as optical coherence tomography (OCT) have been used to obtain optical information of the tissue, as the attenuation coefficient, with the advantage of obtaining sectional images in real time. In this study, eight female BALB/c albino mice (twenty-four weeks old) and eight male C57BL/6 black mice (eight weeks old) were used to measure the attenuation coefficient of the light in the skin, utilizing the OCT technique, aiming to check for influence of the aging process. Two moments were assessed twenty-two weeks apart from each other. Our data show that the aging process significantly affects the light attenuation coefficient in mice skin. Twenty-two weeks after, statistical significant differences were observed between groups within a same strain. We conclude that light attenuation coefficient of mice skin may be influenced by factors such as disorganization of the dermis. Morphological aspects of skin should be taken into account in studies that involve optical strategies in murine models.
Histone Methylation and Epigenetic Silencing in Breast Cancer
National Research Council Canada - National Science Library
Simon, Jeffrey A; Lange, Carol A
2008-01-01
.... EZH2 is a histone methyltransferase which modifies lysine-27 of histone H3 an epigenetic mark which is generally linked to gene silencing and is implicated in tumor suppressor silencing during breast cancer progression...
Igf2/H19 Imprinting Control Region (ICR: An Insulator or a Position-Dependent Silencer?
Directory of Open Access Journals (Sweden)
Subhasis Banerjee
2001-01-01
Full Text Available The imprinting control region (ICR located far upstream of the H19 gene, in conjunction with enhancers, modulates the transcription of Igf2 and H19 genes in an allele-specific manner. On paternal inheritance, the methylated ICR silences the H19 gene and indirectly facilitates transcription from the distant Igf2 promoter, whereas on the maternal chromosome the unmethylated ICR, together with enhancers, activates transcription of the H19 gene and thereby contributes to the repression of Igf2. This repression of maternal Igf2 has recently been postulated to be due to a chromatin boundary or insulator function of the unmethylated ICR. Central to the insulator model is the site-specific binding of a ubiquitous nuclear factor CTCF which exhibits remarkable flexibility in functioning as transcriptional activator or silencer. We suggest that the ICR positioned close to the enhancers in an episomal context might function as a transcriptional silencer by virtue of interaction of CTCF with its modifiers such as SIN3A and histone deacetylases. Furthermore, a localised folded chromatin structure resulting from juxtaposition of two disparate regulatory sequences (enhancer ICR could be the mechanistic basis of ICR-mediated position-dependent (ICR-promoter transcriptional repression in transgenic Drosophila.
Hayashi, Junsuke; Nishigaki, Misa; Ochi, Yosuke; Wada, Shun-Ichi; Wada, Fumito; Nakagawa, Osamu; Obika, Satoshi; Harada-Shiba, Mariko; Urata, Hidehito
2018-07-01
Small interfering RNAs (siRNAs) are an active agent to induce gene silencing and they have been studied for becoming a biological and therapeutic tool. Various 2'-O-modified RNAs have been extensively studied to improve the nuclease resistance. However, the 2'-O-modified siRNA activities were often decreased by modification, since the bulky 2'-O-modifications inhibit to form a RNA-induced silencing complex (RISC). We developed novel prodrug-type 2'-O-methyldithiomethyl (MDTM) siRNA, which is converted into natural siRNA in an intracellular reducing environment. Prodrug-type 2'-O-MDTM siRNAs modified at the 5'-end side including 5'-end nucleotide and the seed region of the antisense strand exhibited much stronger gene silencing effect than non-prodrug-type 2'-O-methyl (2'-O-Me) siRNAs. Furthermore, the resistances for nuclease digestion of siRNAs were actually enhanced by 2'-O-MDTM modifications. Our results indicate that 2'-O-MDTM modifications improve the stability of siRNA in serum and they are able to be introduced at any positions of siRNA. Copyright © 2018 Elsevier Ltd. All rights reserved.
Simultaneous Silencing of Xylanase Genes in Botrytis cinerea
Directory of Open Access Journals (Sweden)
Néstor García
2017-12-01
Full Text Available The endo-β-1,4-xylanase BcXyn11A is one of several plant cell-wall degrading enzymes that the phytopathogenic fungus Botrytis cinerea secretes during interaction with its hosts. In addition to its enzymatic activity, this protein also acts as an elicitor of the defense response in plants and has been identified as a virulence factor. In the present work, other four endoxylanase coding genes (Bcxyn11B, Bcxyn11C, Bcxyn10A, and Bcxyn10B were identified in the B. cinerea genome and the expression of all five genes was analyzed by Q-RT- PCR in vitro and in planta. A cross-regulation between xylanase genes was identified analyzing their expression pattern in the ΔBcxyn11A mutant strain and a putative BcXyn11A-dependt induction of Bcxyn10B gene was found. In addition, multiple knockdown strains were obtained for the five endoxylanase genes by transformation of B. cinerea with a chimeric DNA construct composed of 50-nt sequences from the target genes. The silencing of each xylanase gene was analyzed in axenic cultures and during infection and the results showed that the efficiency of the multiple silencing depends on the growth conditions and on the cross-regulation between them. Although the simultaneous silencing of the five genes was observed by Q-RT-PCR when the silenced strains were grown on medium supplemented with tomato extract, the endoxylanase activity measured in the supernatants was reduced only by 40%. Unexpectedly, the silenced strains overexpressed the Bcxyn11A and Bcxyn11C genes during the infection of tomato leaves, making difficult the analysis of the role of the endo-β-1,4-xylanases in the virulence of the fungus.
Yang, Guang; Hinson, Maurice D.; Bordner, Jessica E.; Lin, Qing S.; Fernando, Amal P.; La, Ping; Wright, Clyde J.
2011-01-01
Postnatal lung development requires proliferation and differentiation of specific cell types at precise times to promote proper alveolar formation. Hyperoxic exposure can disrupt alveolarization by inhibiting cell growth; however, it is not fully understood how this is mediated. The transcription factor CCAAT/enhancer binding protein-α (C/EBPα) is highly expressed in the lung and plays a role in cell proliferation and differentiation in many tissues. After 72 h of hyperoxia, C/EBPα expression was significantly enhanced in the lungs of newborn mice. The increased C/EBPα protein was predominantly located in alveolar type II cells. Silencing of C/EBPα with a transpulmonary injection of C/EBPα small interfering RNA (siRNA) prior to hyperoxic exposure reduced expression of markers of type I cell and differentiation typically observed after hyperoxia but did not rescue the altered lung morphology at 72 h. Nevertheless, when C/EBPα hyperoxia-exposed siRNA-injected mice were allowed to recover for 2 wk in room air, lung epithelial cell proliferation was increased and lung morphology was restored compared with hyperoxia-exposed control siRNA-injected mice. These data suggest that C/EBPα is an important regulator of postnatal alveolar epithelial cell proliferation and differentiation during injury and repair. PMID:21571903
Complement C3 deficiency attenuates chronic hypoxia-induced pulmonary hypertension in mice.
Directory of Open Access Journals (Sweden)
Eileen M Bauer
Full Text Available Evidence suggests a role of both innate and adaptive immunity in the development of pulmonary arterial hypertension. The complement system is a key sentry of the innate immune system and bridges innate and adaptive immunity. To date there are no studies addressing a role for the complement system in pulmonary arterial hypertension.Immunofluorescent staining revealed significant C3d deposition in lung sections from IPAH patients and C57Bl6/J wild-type mice exposed to three weeks of chronic hypoxia to induce pulmonary hypertension. Right ventricular systolic pressure and right ventricular hypertrophy were increased in hypoxic vs. normoxic wild-type mice, which were attenuated in C3-/- hypoxic mice. Likewise, pulmonary vascular remodeling was attenuated in the C3-/- mice compared to wild-type mice as determined by the number of muscularized peripheral arterioles and morphometric analysis of vessel wall thickness. The loss of C3 attenuated the increase in interleukin-6 and intracellular adhesion molecule-1 expression in response to chronic hypoxia, but not endothelin-1 levels. In wild-type mice, but not C3-/- mice, chronic hypoxia led to platelet activation as assessed by bleeding time, and flow cytometry of platelets to determine cell surface P-selectin expression. In addition, tissue factor expression and fibrin deposition were increased in the lungs of WT mice in response to chronic hypoxia. These pro-thrombotic effects of hypoxia were abrogated in C3-/- mice.Herein, we provide compelling genetic evidence that the complement system plays a pathophysiologic role in the development of PAH in mice, promoting pulmonary vascular remodeling and a pro-thrombotic phenotype. In addition we demonstrate C3d deposition in IPAH patients suggesting that complement activation plays a role in the development of PAH in humans.
Titration and hysteresis in epigenetic chromatin silencing
International Nuclear Information System (INIS)
Dayarian, Adel; Sengupta, Anirvan M
2013-01-01
Epigenetic mechanisms of silencing via heritable chromatin modifications play a major role in gene regulation and cell fate specification. We consider a model of epigenetic chromatin silencing in budding yeast and study the bifurcation diagram and characterize the bistable and the monostable regimes. The main focus of this paper is to examine how the perturbations altering the activity of histone modifying enzymes affect the epigenetic states. We analyze the implications of having the total number of silencing proteins, given by the sum of proteins bound to the nucleosomes and the ones available in the ambient, to be constant. This constraint couples different regions of chromatin through the shared reservoir of ambient silencing proteins. We show that the response of the system to perturbations depends dramatically on the titration effect caused by the above constraint. In particular, for a certain range of overall abundance of silencing proteins, the hysteresis loop changes qualitatively with certain jump replaced by continuous merger of different states. In addition, we find a nonmonotonic dependence of gene expression on the rate of histone deacetylation activity of Sir2. We discuss how these qualitative predictions of our model could be compared with experimental studies of the yeast system under anti-silencing drugs. (paper)
Kamimura, Rantaro; Hossain, Mohammad Z; Unno, Shumpei; Ando, Hiroshi; Masuda, Yuji; Takahashi, Kojiro; Otake, Masanori; Saito, Isao; Kitagawa, Junichi
2018-03-24
Current therapeutics are not effective for orofacial neuropathic pain, and better options are needed. The present study used inferior orbital nerve (ION)-injured mice to investigate the effect of inhibiting monoacylglycerol lipase (MAGL), an enzyme that degrades the major endocannabinoid 2-arachydonoylgycerol (2-AG) in orofacial neuropathic pain. The head-withdrawal threshold to mechanical stimulation of the whisker pad was reduced on days 3, 5, and 7 after ION injury. Injection of JZL184, a selective inhibitor of MAGL, on day 7 after ION injury attenuated the reduction in head-withdrawal threshold at 2 h after administration. Moreover, the numbers of MAGL-immunoreactive neurons in the trigeminal subnucleus caudalis (Vc) and upper cervical spinal cord (C1-C2) were significantly greater in ION-injured mice than in sham-operated mice but were reduced after administration of JZL184. The increase in MAGL immunoreactivity suggests that increased 2-AG production is followed by rapid enzymatic degradation of 2-AG. JZL184 inhibited this degradation and thus increased 2-AG concentration in the brain, particularly in the Vc and C1-C2 regions, thus attenuating pain. Our findings suggest that inhibition of 2-AG degradation by MAGL inhibitors is a promising therapeutic option for treatment of orofacial neuropathic pain.
dKDM2 couples histone H2A ubiquitylation to histone H3 demethylation during Polycomb group silencing
A. Lagarou (Anna); A.B. Mohd Sarip; Y.M. Moshkin (Yuri); G.E. Chalkley (Gillian); K. Bezstarosti (Karel); J.A.A. Demmers (Jeroen); C.P. Verrijzer (Peter)
2008-01-01
textabstractTranscription regulation involves enzyme-mediated changes in chromatin structure. Here, we describe a novel mode of histone crosstalk during gene silencing, in which histone H2A monoubiquitylation is coupled to the removal of histone H3 Lys 36 dimethylation (H3K36me2). This pathway was
Attenuation of insulin resistance in rats by agmatine: role of SREBP-1c, mTOR and GLUT-2.
Sharawy, Maha H; El-Awady, Mohammed S; Megahed, Nirmeen; Gameil, Nariman M
2016-01-01
Insulin resistance is a serious health condition worldwide; however, its exact mechanisms are still unclear. This study investigates agmatine (AGM; an endogenous metabolite of L-arginine) effects on insulin resistance induced by high fructose diet (HFD) in rats and the possible involved mechanisms. Sprague Dawley rats were fed 60% HFD for 12 weeks, and AGM (10 mg/kg/day, orally) was given from week 9 to 12. AGM significantly reduced HFD-induced elevation in fasting insulin level, homeostasis model assessment of insulin resistance (HOMA-IR) index and liver glycogen content from 3.44-, 3.62- and 2.07- to 2.59-, 2.78- and 1.3-fold, respectively, compared to the control group, while it increased HFD-induced reduction in glucose tolerance. Additionally, AGM significantly decreased HFD-induced elevation in serum triglycerides, low density lipoprotein cholesterol and very low density lipoprotein cholesterol levels from 3.18-, 2.97- and 4.75- to 1.25-, 1.25- and 1.07-fold, respectively, compared to control group. Conversely, AGM had no significant effect on HFD-induced changes in fasting glucose, glycosylated hemoglobin, insulin tolerance and high density lipoprotein cholesterol. Furthermore, AGM significantly reduced HFD-induced elevation in mRNA expression of glucose transporter type-2 (GLUT-2), mammalian target of rapamycin (mTOR) and sterol regulatory element-binding protein-1c (SREBP-1c) without affecting that of peroxisome proliferator-activated receptor-alpha (PPAR-α) in the liver. Additionally, AGM enhanced ACh-induced aortic relaxation and attenuated liver steatosis induced by HFD. In conclusion, AGM may have a therapeutic potential in insulin resistance through suppressing SREBP-1c, mTOR and GLUT-2 in liver.
Voice and silence in organizations
Directory of Open Access Journals (Sweden)
Moaşa, H.
2011-01-01
Full Text Available Unlike previous research on voice and silence, this article breaksthe distance between the two and declines to treat them as opposites. Voice and silence are interrelated and intertwined strategic forms ofcommunication which presuppose each other in such a way that the absence of one would minimize completely the other’s presence. Social actors are not voice, or silence. Social actors can have voice or silence, they can do both because they operate at multiple levels and deal with multiple issues at different moments in time.
Radiofrequency attenuator and method
Warner, Benjamin P [Los Alamos, NM; McCleskey, T Mark [Los Alamos, NM; Burrell, Anthony K [Los Alamos, NM; Agrawal, Anoop [Tucson, AZ; Hall, Simon B [Palmerston North, NZ
2009-01-20
Radiofrequency attenuator and method. The attenuator includes a pair of transparent windows. A chamber between the windows is filled with molten salt. Preferred molten salts include quarternary ammonium cations and fluorine-containing anions such as tetrafluoroborate (BF.sub.4.sup.-), hexafluorophosphate (PF.sub.6.sup.-), hexafluoroarsenate (AsF.sub.6.sup.-), trifluoromethylsulfonate (CF.sub.3SO.sub.3.sup.-), bis(trifluoromethylsulfonyl)imide ((CF.sub.3SO.sub.2).sub.2N.sup.-), bis(perfluoroethylsulfonyl)imide ((CF.sub.3CF.sub.2SO.sub.2).sub.2N.sup.-) and tris(trifluoromethylsulfonyl)methide ((CF.sub.3SO.sub.2).sub.3C.sup.-). Radicals or radical cations may be added to or electrochemically generated in the molten salt to enhance the RF attenuation.
RNAi-mediated silencing of enolase confirms its biological importance in Clonorchis sinensis.
Wang, Xiaoyun; Chen, Wenjun; Tian, Yanli; Huang, Yan; Li, Xuerong; Yu, Xinbing
2014-04-01
Clonorchis sinensis (C. sinensis) infection is still a common public health problem in freshwater fish consumption areas in Asian countries. More molecular evidence are required to speed up the prevention strategies to control this kind of infectious disease. In the present study, to confirm the biological importance of Csenolase followed by our previous observations of the key metabolic enzyme, we explored the RNA silence effect of the Csenolase-derived RNA interference (RNAi) in C. sinensis. The extramembranous region aa105-226 was selected as the target sequence of RNA silence. Csenolase-derived double strand RNA (dsRNA-Csenolase, 366 bp) was synthetized and delivered into C. sinensis by soaking approach. The penetration of dsRNA into adult worms and metacercariae was tracked using fluorescently labeled RNA. Western blotting and qRT-PCR experiments were performed to determine dsRNA-Csenolase-silencing effect. Our results showed that, after incubating for 120 h, dsRNA-Csenolase could effectively target and downregulate the expression of Csenolase in both adult worms (P sinensis adult worms (P sinensis, allowing further applications in identifying functional genes in C. sinensis.
The SNF2-family member Fun30 promotes gene silencing in heterochromatic loci.
Directory of Open Access Journals (Sweden)
Ana Neves-Costa
2009-12-01
Full Text Available Chromatin regulates many key processes in the nucleus by controlling access to the underlying DNA. SNF2-like factors are ATP-driven enzymes that play key roles in the dynamics of chromatin by remodelling nucleosomes and other nucleoprotein complexes. Even simple eukaryotes such as yeast contain members of several subfamilies of SNF2-like factors. The FUN30/ETL1 subfamily of SNF2 remodellers is conserved from yeasts to humans, but is poorly characterized. We show that the deletion of FUN30 leads to sensitivity to the topoisomerase I poison camptothecin and to severe cell cycle progression defects when the Orc5 subunit is mutated. We demonstrate a role of FUN30 in promoting silencing in the heterochromatin-like mating type locus HMR, telomeres and the rDNA repeats. Chromatin immunoprecipitation experiments demonstrate that Fun30 binds at the boundary element of the silent HMR and within the silent HMR. Mapping of nucleosomes in vivo using micrococcal nuclease demonstrates that deletion of FUN30 leads to changes of the chromatin structure at the boundary element. A point mutation in the ATP-binding site abrogates the silencing function of Fun30 as well as its toxicity upon overexpression, indicating that the ATPase activity is essential for these roles of Fun30. We identify by amino acid sequence analysis a putative CUE motif as a feature of FUN30/ETL1 factors and show that this motif assists Fun30 activity. Our work suggests that Fun30 is directly involved in silencing by regulating the chromatin structure within or around silent loci.
Sun, Xiaowen; Wu, Hefang; Zhao, Genhai; Li, Zhemin; Wu, Xihua; Liu, Hui; Zheng, Zhiming
2018-04-02
The mycelial morphology of Aspergillus niger, a major filamentous fungus used for citric acid production, is important for citric acid synthesis during submerged fermentation. To investigate the involvement of the chitin synthase gene, chsC, in morphogenesis and citric acid production in A. niger, an RNAi system was constructed to silence chsC and the morphological mutants were screened after transformation. The compactness of the mycelial pellets was obviously reduced in the morphological mutants, with lower proportion of dispersed mycelia. These morphological changes have caused a decrease in viscosity and subsequent improvement in oxygen and mass transfer efficiency, which may be conducive for citric acid accumulation. All the transformants exhibited improvements in citric acid production; in particular, chsC-3 showed 42.6% higher production than the original strain in the shake flask. Moreover, the high-yield strain chsC-3 exhibited excellent citric acid production potential in the scale-up process.The citric acid yield and the conversion rate of glucose of chsC-3 were both improved by 3.6%, when compared with that of the original strain in the stirred tank bioreactor.
Zagani, Rachid; El-Assaad, Wissal; Gamache, Isabelle; Teodoro, Jose G
2015-09-29
The G0/G1 switch gene 2 (G0S2) is methylated and silenced in a wide range of human cancers. The protein encoded by G0S2 is an endogenous inhibitor of lipid catabolism that directly binds adipose triglyceride lipase (ATGL). ATGL is the rate-limiting step in triglyceride metabolism. Although the G0S2 gene is silenced in cancer, the impact of ATGL in the growth and survival of cancer cells has never been addressed. Here we show that ectopic expression of G0S2 in non-small cell lung carcinomas (NSCL) inhibits triglyceride catabolism and results in lower cell growth. Similarly, knockdown of ATGL increased triglyceride levels, attenuated cell growth and promoted apoptosis. Conversely, knockdown of endogenous G0S2 enhanced the growth and invasiveness of cancer cells. G0S2 is strongly induced in acute promyelocytic leukemia (APL) cells in response to all trans retinoic acid (ATRA) and we show that inhibition of ATGL in these cells by G0S2 is required for efficacy of ATRA treatment. Our data uncover a novel tumor suppressor mechanism by which G0S2 directly inhibits activity of a key intracellular lipase. Our results suggest that elevated ATGL activity may be a general property of many cancer types and potentially represents a novel target for chemotherapy.
C. elegans ADARs antagonize silencing of cellular dsRNAs by the antiviral RNAi pathway.
Reich, Daniel P; Tyc, Katarzyna M; Bass, Brenda L
2018-02-01
Cellular dsRNAs are edited by adenosine deaminases that act on RNA (ADARs). While editing can alter mRNA-coding potential, most editing occurs in noncoding sequences, the function of which is poorly understood. Using dsRNA immunoprecipitation (dsRIP) and RNA sequencing (RNA-seq), we identified 1523 regions of clustered A-to-I editing, termed editing-enriched regions (EERs), in four stages of Caenorhabditis elegans development, often with highest expression in embryos. Analyses of small RNA-seq data revealed 22- to 23-nucleotide (nt) siRNAs, reminiscent of viral siRNAs, that mapped to EERs and were abundant in adr-1;adr-2 mutant animals. Consistent with roles for these siRNAs in silencing, EER-associated genes (EAGs) were down-regulated in adr-1;adr-2 embryos, and this was dependent on associated EERs and the RNAi factor RDE-4. We observed that ADARs genetically interact with the 26G endogenous siRNA (endo-siRNA) pathway, which likely competes for RNAi components; deletion of factors required for this pathway ( rrf-3 or ergo-1 ) in adr-1;adr-2 mutant strains caused a synthetic phenotype that was rescued by deleting antiviral RNAi factors. Poly(A) + RNA-seq revealed EAG down-regulation and antiviral gene induction in adr-1;adr-2;rrf-3 embryos, and these expression changes were dependent on rde-1 and rde-4 Our data suggest that ADARs restrict antiviral silencing of cellular dsRNAs. © 2018 Reich et al.; Published by Cold Spring Harbor Laboratory Press.
International Nuclear Information System (INIS)
Lv, Peng; Xue, Peng; Dong, Jian; Peng, Hui; Clewell, Rebecca; Wang, Aiping; Wang, Yue; Peng, Shuangqing; Qu, Weidong; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo
2013-01-01
Interleukin-6 (IL6) is a multifunctional cytokine that regulates immune and inflammatory responses. Multiple transcription factors, including nuclear factor κB (NF-κB) and nuclear factor E2-related factor 2 (Nrf2), regulate IL6 transcription. Kelch-like ECH-associated protein 1 (Keap1) is a substrate adaptor protein for the Cullin 3-dependent E3 ubiquitin ligase complex, which regulates the degradation of many proteins, including Nrf2 and IκB kinase β (IKKβ). Here, we found that stable knockdown of Keap1 (Keap1-KD) in RAW 264.7 (RAW) mouse macrophages and human monocyte THP-1 cells significantly increased expression of Il6, and Nrf2-target genes, under basal and lipopolysaccharide (LPS, 0.001–0.1 μg/ml)-challenged conditions. However, Nrf2 activation alone, by tert-butylhydroquinone treatment of RAW cells, did not increase expression of Il6. Compared to cells transduced with scrambled non-target negative control shRNA, Keap1-KD RAW cells showed enhanced protein levels of IKKβ and increased expression and phosphorylation of NF-κB p65 under non-stressed and LPS-treated conditions. Because the expression of Il6 in Keap1-KD RAW cells was significantly attenuated by silencing of Ikkβ, but not Nrf2, it appears that stabilized IKKβ is responsible for the enhanced transactivation of Il6 in Keap1-KD cells. This study demonstrated that silencing of Keap1 in macrophages boosts LPS-induced transcription of Il6 via NF-κB activation. Given the importance of IL6 in the inflammatory response, the Keap1–IKKβ–NF-κB pathway may be a novel target for treatment and prevention of inflammation and associated disorders. - Highlights: • Knockdown of Keap1 increases expression of Il6 in macrophages. • Silencing of Keap1 results in protein accumulation of IKKβ and NF-κB p65. • Induction of Il6 resulting from Keap1 silencing is attributed to NF-κB activation
Energy Technology Data Exchange (ETDEWEB)
Lv, Peng [Institute of Materia Medica, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing (China); Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Xue, Peng; Dong, Jian [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Peng, Hui [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Evaluation and Research Center for Toxicology, Institute of Disease Control and Prevention, Academy of Military Medical Sciences (China); Clewell, Rebecca [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Wang, Aiping [Institute of Materia Medica, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing (China); Wang, Yue [Institute for Medical Device Standardization Administration, National Institutes for Food and Drug Control, Beijing (China); Peng, Shuangqing [Evaluation and Research Center for Toxicology, Institute of Disease Control and Prevention, Academy of Military Medical Sciences (China); Qu, Weidong [Key Laboratory of the Public Health Safety, Ministry of Education, School of Public Health, Fudan University, Shanghai (China); Zhang, Qiang; Andersen, Melvin E. [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Pi, Jingbo, E-mail: jpi@thehamner.org [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States)
2013-11-01
Interleukin-6 (IL6) is a multifunctional cytokine that regulates immune and inflammatory responses. Multiple transcription factors, including nuclear factor κB (NF-κB) and nuclear factor E2-related factor 2 (Nrf2), regulate IL6 transcription. Kelch-like ECH-associated protein 1 (Keap1) is a substrate adaptor protein for the Cullin 3-dependent E3 ubiquitin ligase complex, which regulates the degradation of many proteins, including Nrf2 and IκB kinase β (IKKβ). Here, we found that stable knockdown of Keap1 (Keap1-KD) in RAW 264.7 (RAW) mouse macrophages and human monocyte THP-1 cells significantly increased expression of Il6, and Nrf2-target genes, under basal and lipopolysaccharide (LPS, 0.001–0.1 μg/ml)-challenged conditions. However, Nrf2 activation alone, by tert-butylhydroquinone treatment of RAW cells, did not increase expression of Il6. Compared to cells transduced with scrambled non-target negative control shRNA, Keap1-KD RAW cells showed enhanced protein levels of IKKβ and increased expression and phosphorylation of NF-κB p65 under non-stressed and LPS-treated conditions. Because the expression of Il6 in Keap1-KD RAW cells was significantly attenuated by silencing of Ikkβ, but not Nrf2, it appears that stabilized IKKβ is responsible for the enhanced transactivation of Il6 in Keap1-KD cells. This study demonstrated that silencing of Keap1 in macrophages boosts LPS-induced transcription of Il6 via NF-κB activation. Given the importance of IL6 in the inflammatory response, the Keap1–IKKβ–NF-κB pathway may be a novel target for treatment and prevention of inflammation and associated disorders. - Highlights: • Knockdown of Keap1 increases expression of Il6 in macrophages. • Silencing of Keap1 results in protein accumulation of IKKβ and NF-κB p65. • Induction of Il6 resulting from Keap1 silencing is attributed to NF-κB activation.
Directory of Open Access Journals (Sweden)
Mehdi Aghamohammadi
2017-04-01
Full Text Available One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not a mere theory, but rather a phenomenon from which we can get practical benefits. I believe silence is an eye, eye of knowledge. We can broaden our knowledge of the world through silence. To convey the idea that silence is an eye, I have concocted the word slence, where has replaced the letter i and stands for the eye. This means knowledge can enable us to see, thereby acquiring knowledge of, what used to be invisible, and accordingly unknowable. In other words, through silence, we can achieve a certain type of literacy. I substantiate this claim by exploring the Horus myth, Ojo de Dios, John Cage’s 4' 33", the nature of Expressionist paintings, Hinduism, thoughts of Hermes Trismegistus and Ibn al-Arabi, and practices of Mohammad, the prophet of Islam.
Loss of the Greatwall Kinase Weakens the Spindle Assembly Checkpoint.
Directory of Open Access Journals (Sweden)
M Kasim Diril
2016-09-01
Full Text Available The Greatwall kinase/Mastl is an essential gene that indirectly inhibits the phosphatase activity toward mitotic Cdk1 substrates. Here we show that although Mastl knockout (MastlNULL MEFs enter mitosis, they progress through mitosis without completing cytokinesis despite the presence of misaligned chromosomes, which causes chromosome segregation defects. Furthermore, we uncover the requirement of Mastl for robust spindle assembly checkpoint (SAC maintenance since the duration of mitotic arrest caused by microtubule poisons in MastlNULL MEFs is shortened, which correlates with premature disappearance of the essential SAC protein Mad1 at the kinetochores. Notably, MastlNULL MEFs display reduced phosphorylation of a number of proteins in mitosis, which include the essential SAC kinase MPS1. We further demonstrate that Mastl is required for multi-site phosphorylation of MPS1 as well as robust MPS1 kinase activity in mitosis. In contrast, treatment of MastlNULL cells with the phosphatase inhibitor okadaic acid (OKA rescues the defects in MPS1 kinase activity, mislocalization of phospho-MPS1 as well as Mad1 at the kinetochore, and premature SAC silencing. Moreover, using in vitro dephosphorylation assays, we demonstrate that Mastl promotes persistent MPS1 phosphorylation by inhibiting PP2A/B55-mediated MPS1 dephosphorylation rather than affecting Cdk1 kinase activity. Our findings establish a key regulatory function of the Greatwall kinase/Mastl->PP2A/B55 pathway in preventing premature SAC silencing.
Loss of the Greatwall Kinase Weakens the Spindle Assembly Checkpoint.
Diril, M Kasim; Bisteau, Xavier; Kitagawa, Mayumi; Caldez, Matias J; Wee, Sheena; Gunaratne, Jayantha; Lee, Sang Hyun; Kaldis, Philipp
2016-09-01
The Greatwall kinase/Mastl is an essential gene that indirectly inhibits the phosphatase activity toward mitotic Cdk1 substrates. Here we show that although Mastl knockout (MastlNULL) MEFs enter mitosis, they progress through mitosis without completing cytokinesis despite the presence of misaligned chromosomes, which causes chromosome segregation defects. Furthermore, we uncover the requirement of Mastl for robust spindle assembly checkpoint (SAC) maintenance since the duration of mitotic arrest caused by microtubule poisons in MastlNULL MEFs is shortened, which correlates with premature disappearance of the essential SAC protein Mad1 at the kinetochores. Notably, MastlNULL MEFs display reduced phosphorylation of a number of proteins in mitosis, which include the essential SAC kinase MPS1. We further demonstrate that Mastl is required for multi-site phosphorylation of MPS1 as well as robust MPS1 kinase activity in mitosis. In contrast, treatment of MastlNULL cells with the phosphatase inhibitor okadaic acid (OKA) rescues the defects in MPS1 kinase activity, mislocalization of phospho-MPS1 as well as Mad1 at the kinetochore, and premature SAC silencing. Moreover, using in vitro dephosphorylation assays, we demonstrate that Mastl promotes persistent MPS1 phosphorylation by inhibiting PP2A/B55-mediated MPS1 dephosphorylation rather than affecting Cdk1 kinase activity. Our findings establish a key regulatory function of the Greatwall kinase/Mastl->PP2A/B55 pathway in preventing premature SAC silencing.
MeCP2 silencing of LncRNA H19 controls hepatic stellate cell proliferation by targeting IGF1R
International Nuclear Information System (INIS)
Yang, Jing-Jing; Liu, Li-Ping; Tao, Hui; Hu, Wei; Shi, Peng; Deng, Zi-Yu; Li, Jun
2016-01-01
Highlights: • H19 plays a key role in HSCs proliferation and fibrosis. • MeCP2/H19 axis involvement in HSCs activation and fibrosis. • MeCP2 negative controls H19 expression in activated HSCs. • Identification of IGF1R as new target of H19 in HSC. - Abstract: Methyl-CpG-binding protein 2 (MeCP2) plays a key role in liver fibrosis. However, the potential mechanism of MeCP2 in liver fibrosis remains unclear. Early reports suggest that LncRNA H19 is important epigenetic regulator with critical roles in cell proliferation, but its role in hepatic fibrosis remains elusive. Sprague-Dawley rats liver fibrosis was generated by 12-weeks treatment with CCl 4 intraperitoneal injection. HSC-T6 cells were used in vitro study. The expression levels of MeCP2, H19, IGF1R, α-SMA, and Col1A1 were estimated by Western blotting, qRT-PCR and Immunohistochemistry. HSC-T6 cells were transfected with MeCP2-siRNA, pEGF-C1-MeCP2, pEX-3-H19, and H19-siRNA. Finally, cell proliferation ability was assessed by the MTT assay. Here, we found that H19 was significantly down-regulated in HSCs and fibrosis tissues, and an opposite pattern is observed for MeCP2 and IGF1R. Silencing of MeCP2 blocked HSCs proliferation. Knockdown of MeCP2 elevated H19 expression in activated HSCs, and over-expression of MeCP2 inhibited H19 expression in activated HSCs. Moreover, we investigated the effect of H19 on IGF1R expression. Overexpression of H19 in HSCs repressed the expression of IGF1R, and an opposite pattern is observed for H19 silenced. In addition, we reported that overexpression of H19 inhibited the TGF-β1-induced proliferation of HSCs. Furthermore, MeCP2 negative regulation of H19 by targeting the protein IGF1R. Taken together, these results demonstrated that MeCP2 silencing of H19 can alter the IGF1R overexpression, thus contributing to HSCs proliferation. These data could suggest the development of combination therapies that target the MeCP2.
Ombuds’ corner: Employee silence
Vincent Vuillemin
2013-01-01
Although around a hundred cases a year are reported to the Ombuds, several issues may still not be disclosed due to employee silence*. The deliberate withholding of concerns, escalating misunderstandings or genuine conflicts can impede the global process of learning and development of a better respectful organizational workplace environment, and prevent the detection and correction of acts violating the CERN Code of Conduct. For the employee him/herself, such silence can lead to feelings of anger, resentment, helplessness and humiliation. These feelings will inevitably contaminate personal and interpersonal relations, and poison creativity and effectiveness. Employee silence can be explained by many factors; sometimes it is connected to organizational forces. In their published paper*, authors Michael Knoll and Rolf van Dick found four forms of employee silence. People may stay silent if they feel that their opinion is neither welcomed nor valued by their management. They have gi...
Meng, Wenbo; Li, Xun; Bai, Zhongtian; Li, Yan; Yuan, Jinqiu; Liu, Tao; Yan, Jun; Zhou, Wence; Zhu, Kexiang; Zhang, Hui; Li, Yumin
2014-01-01
Alpha-fetoprotein not only serves as a diagnostic marker for liver cancer, but also posses a variety of biological functions. However, the role of Alpha-fetoprotein on tumor angiogenesis and cell invasion remains incompletely understood. In this study, we aimed to evaluate if Alpha-fetoprotein can regulate the major angiogenic factors and matrix metalloproteinases in human liver cancer cells. Alpha-fetoprotein silencing was achieved by Stealth RNAi. Expression of Alpha-fetoprotein was examined by a full-automatic electrochemistry luminescence immunity analyzer. Expression of VEGF, VEGFR-2, MMP-9, and MMP-2 was examined by Western blot and immunocytochemistry. Apoptosis was detected by TUNEL assay. Angiogenesis was detected by in vitro angiogenesis assay kit. Silencing of Alpha-fetoprotein led to an increased apoptosis, which was associated with a decreased expression of vascular endothelial growth factor, vascular endothelial growth factor receptor 2, matrix metalloproteinases-2/9. These results suggest that Alpha-fetoprotein may play a regulatory role on angiogenesis and cell invasion during liver cancer development.
Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira
2016-10-13
PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.
Drosophila PAF1 Modulates PIWI/piRNA Silencing Capacity.
Clark, Josef P; Rahman, Reazur; Yang, Nachen; Yang, Linda H; Lau, Nelson C
2017-09-11
To test the directness of factors in initiating PIWI-directed gene silencing, we employed a Piwi-interacting RNA (piRNA)-targeted reporter assay in Drosophila ovary somatic sheet (OSS) cells [1]. This assay confirmed direct silencing roles for piRNA biogenesis factors and PIWI-associated factors [2-12] but suggested that chromatin-modifying proteins may act downstream of the initial silencing event. Our data also revealed that RNA-polymerase-II-associated proteins like PAF1 and RTF1 antagonize PIWI-directed silencing. PAF1 knockdown enhances PIWI silencing of reporters when piRNAs target the transcript region proximal to the promoter. Loss of PAF1 suppresses endogenous transposable element (TE) transcript maturation, whereas a subset of gene transcripts and long-non-coding RNAs adjacent to TE insertions are affected by PAF1 knockdown in a similar fashion to piRNA-targeted reporters. Additionally, transcription activation at specific TEs and TE-adjacent loci during PIWI knockdown is suppressed when PIWI and PAF1 levels are both reduced. Our study suggests a mechanistic conservation between fission yeast PAF1 repressing AGO1/small interfering RNA (siRNA)-directed silencing [13, 14] and Drosophila PAF1 opposing PIWI/piRNA-directed silencing. Copyright © 2017 Elsevier Ltd. All rights reserved.
PPAR-γ Silencing Inhibits the Apoptosis of A549 Cells by Upregulating Bcl-2
Directory of Open Access Journals (Sweden)
Jingyu YANG
2013-03-01
Full Text Available Background and objective Drug resistance is the one of primary causes of death in patients with lung cancer, PPAR-γ could induce the apoptosis and reverse drug resistance. The aim of this study is to investigate the expression of PPAR-γ on cisplatin sensitivity and apoptosis response of human lung cancer cell line A549. Methods Reconstruction of PPAR-γ silencing A549 cells (A549/PPAR-γ(- by siRNA. MTT assay was employed to determine the effect of cisplatin on the proliferation of A549/PPAR-γ(-, flow cytometry to determine the effect of cisplatin on the cell apoptosis, Western blot to determine the change of phosphorylation of Akt, caspase-3 and expression of bcl-2/bax. Finally, RT-PCR was employed to determine the transcriptional level of bcl-2. Results Two PPAR-γ silencing A549 cell clones were established successfully, and the expression of PPAR-γ was downregulated significantly as confirmed by RT-PCR and Western blot. After PPAR-γ silencing, the resistance of these two A549 clones to cisplatin was increased by 1.29-fold and 1.60-fold respectively. Flow cytometry showed that the apoptosis rate was decreased, and Western Blot showed that the phosphorylation of Akt and expression of bcl-2/bax were upregulated, caspase-3 was downregulated. Finally, RT-PCR showed that the transcriptional level of bcl-2 was upregulated as well. Conclusion Downregulation of PPAR-γ in A549 cells led to increase of cisplatin resistance. One of the mechanisms was upregulatin of phosphorylation of Akt and expression of bcl-2, which inhibited the apoptosis of cells. The downregulation of PPAR-γ is a possible mechanism that leads to the clinical drug resistance of cancer.
Directory of Open Access Journals (Sweden)
Alison E Ringel
Full Text Available Sir2 is an NAD(+-dependent histone deacetylase required to mediate transcriptional silencing and suppress rDNA recombination in budding yeast. We previously identified Tdh3, a glyceraldehyde 3-phosphate dehydrogenase (GAPDH, as a high expression suppressor of the lethality caused by Sir2 overexpression in yeast cells. Here we show that Tdh3 interacts with Sir2, localizes to silent chromatin in a Sir2-dependent manner, and promotes normal silencing at the telomere and rDNA. Characterization of specific TDH3 alleles suggests that Tdh3's influence on silencing requires nuclear localization but does not correlate with its catalytic activity. Interestingly, a genetic assay suggests that Tdh3, an NAD(+-binding protein, influences nuclear NAD(+ levels; we speculate that Tdh3 links nuclear Sir2 with NAD(+ from the cytoplasm.
Bae, S I; Cheriyath, V; Jacobs, B S; Reu, F J; Borden, E C
2008-01-17
Human melanoma cell lines, SK-MEL-3 and SK-MEL-28, despite induction of the proapoptotic cytokine, Apo2L/TRAIL, did not undergo apoptosis in response to interferons (IFN-alpha2b or IFN-beta). Postulating that genes important for apoptosis induction by IFNs might be silenced by methylation, the DNA demethylating agent 5-aza-2'-deoxycytidine (5-AZAdC) was assessed. DR4 (TRAIL-R1) was identified as one of the genes reactivated by 5-AZAdC with a >3-fold increase in 8 of 10 melanoma cell lines. Pretreatment with 5-AZAdC sensitized SK-MEL-3 and SK-MEL-28 cells to apoptosis induced by IFN-alpha2b and IFN-beta; methylation-specific PCR and bisulfite sequencing confirmed demethylation of 5'CpG islands of DR4 and flow cytometry showed an increase in DR4 protein on the cell surface. In cells with reactivated DR4, neutralizing mAB to TRAIL reduced apoptosis in response to IFN-beta or Apo2L/TRAIL. To further confirm the role of DR4, it was expressed by retroviral vector in SK-MEL-3 and SK-MEL-28 cells with reversal of resistance to IFN-beta and Apo2L/TRAIL. Thus, reexpressing DR4 by 5-AZAdC or retroviral transfection in melanoma cell in which promoter methylation had suppressed its expression, potentiated apoptosis by IFN-alpha2b, IFN-beta and Apo2L/TRAIL. Reactivation of silenced proapoptotic genes by inhibitors of DNA methylation may enhance clinical response to IFNs or Apo2L/TRAIL.
Millenson, Michael L
2003-01-01
Despite several well-crafted Institute of Medicine (IOM) reports, there remains within health care a persistent refusal to confront providers' responsibility for severe quality problems. There is a silence of deed--failing to take corrective actions--and of word--failing to discuss openly the true consequences of that inertia. These silences distort public policy, delay change, and, by leading (albeit inadvertently) to thousands of patient deaths, undermine professionalism. The IOM quality committee, to retain its moral authority, should forgo issuing more reports and instead lead an emergency corrective-action campaign comparable to Flexner's crusade against charlatan medical schools.
Mobile gene silencing in Arabidopsis is regulated by hydrogen peroxide
Directory of Open Access Journals (Sweden)
Dacheng Liang
2014-12-01
Full Text Available In plants and nematodes, RNAi can spread from cells from which it is initiated to other cells in the organism. The underlying mechanism controlling the mobility of RNAi signals is not known, especially in the case of plants. A genetic screen designed to recover plants impaired in the movement but not the production or effectiveness of the RNAi signal identified RCI3, which encodes a hydrogen peroxide (H2O2-producing type III peroxidase, as a key regulator of silencing mobility in Arabidopsis thaliana. Silencing initiated in the roots of rci3 plants failed to spread into leaf tissue or floral tissue. Application of exogenous H2O2 reinstated the spread in rci3 plants and accelerated it in wild-type plants. The addition of catalase or MnO2, which breaks down H2O2, slowed the spread of silencing in wild-type plants. We propose that endogenous H2O2, under the control of peroxidases, regulates the spread of gene silencing by altering plasmodesmata permeability through remodelling of local cell wall structure, and may play a role in regulating systemic viral defence.
Phenotyping of VIGS-mediated gene silencing in rice using a vector derived from a DNA virus.
Kant, Ravi; Dasgupta, Indranil
2017-07-01
Target genes in rice can be optimally silenced if inserted in antisense or hairpin orientation in the RTBV-derived VIGS vector and plants grown at 28 °C and 80% humidity after inoculation. Virus induced gene silencing (VIGS) is a method used to transiently silence genes in dicot as well as monocot plants. For the important monocot species rice, the Rice tungro bacilliform virus (RTBV)-derived VIGS system (RTBV-VIGS), which uses agroinoculation to initiate silencing, has not been standardized for optimal use. Here, using RTBV-VIGS, three sets of conditions were tested to achieve optimal silencing of the rice marker gene phytoene desaturase (pds). The effect of orientation of the insert in the RTBV-VIGS plasmid (sense, antisense and hairpin) on the silencing of the target gene was then evaluated using rice magnesium chelatase subunit H (chlH). Finally, the rice Xa21 gene, conferring resistance against bacterial leaf blight disease (BLB) was silenced using RTBV-VIGS system. In each case, real-time PCR-based assessment indicated approximately 40-80% fall in the accumulation levels of the transcripts of pds, chlH and Xa21. In the case of pds, the appearance of white streaks in the emerging leaves, and for chlH, chlorophyll levels and F v /F m ratio were assessed as phenotypes for silencing. For Xa21, the resistance levels to BLB were assessed by measuring the lesion length and the percent diseased areas of leaves, following challenge inoculation with Xanthomonas oryzae. In each case, the RTBV-MVIGS system gave rise to a discernible phenotype indicating the silencing of the respective target gene using condition III (temperature 28 °C, humidity 80% and 1 mM MES and 20 µM acetosyringone in secondary agrobacterium culture), which revealed the robustness of this gene silencing system for rice.
[Identification of C(2)M interacting proteins by yeast two-hybrid screening].
Yue, Shan-shan; Xia, Lai-xin
2015-11-01
The synaptonemal complex (SC) is a huge structure which assembles between the homologous chromosomes during meiotic prophase I. Drosophila germ cell-specific nucleoprotein C(2)M clustering at chromosomes can induce SC formation. To further study the molecular function and mechanism of C(2)M in meiosis, we constructed a bait vector for C(2)M and used the yeast two-hybrid system to identify C(2)M interacting proteins. Forty interacting proteins were obtained, including many DNA and histone binding proteins, ATP synthases and transcription factors. Gene silencing assays in Drosophila showed that two genes, wech and Psf1, may delay the disappearance of SC. These results indicate that Wech and Psf1 may form a complex with C(2)M to participate in the formation or stabilization of the SC complex.
Ikeda, Keigo; Satoh, Minoru; Pauley, Kaleb M; Fritzler, Marvin J; Reeves, Westley H; Chan, Edward K L
2006-12-20
MicroRNAs (miRNAs) are short RNA molecules responsible for post-transcriptional gene silencing by the degradation or translational inhibition of their target messenger RNAs (mRNAs). This process of gene silencing, known as RNA interference (RNAi), is mediated by highly conserved Argonaute (Ago) proteins which are the key components of the RNA induced silencing complex (RISC). In humans, Ago2 is responsible for the endonuclease cleavage of targeted mRNA and it interacts with the mRNA-binding protein GW182, which is a marker for cytoplasmic foci referred to as GW bodies (GWBs). We demonstrated that the anti-Ago2 monoclonal antibody 4F9 recognized GWBs in a cell cycle dependent manner and was capable of capturing miRNAs associated with Ago2. Since Ago2 protein is the effector protein of RNAi, anti-Ago2 monoclonal antibody may be useful in capturing functional miRNAs.
Energy Technology Data Exchange (ETDEWEB)
Akram, Muhammad [College of Pharmacy Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan (Korea, Republic of); Shin, Iljin [College of Pharmacy and Research Institute of Pharmaceutical Science and Technology (RIPST), Ajou University, Suwon (Korea, Republic of); Kim, Kyeong-A; Noh, Dabi [College of Pharmacy Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan (Korea, Republic of); Baek, Seung-Hoon; Chang, Sun-Young [College of Pharmacy and Research Institute of Pharmaceutical Science and Technology (RIPST), Ajou University, Suwon (Korea, Republic of); Kim, Hyoungsu, E-mail: hkimajou@ajou.ac.kr [College of Pharmacy and Research Institute of Pharmaceutical Science and Technology (RIPST), Ajou University, Suwon (Korea, Republic of); Bae, Ok-Nam, E-mail: onbae@hanyang.ac.kr [College of Pharmacy Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan (Korea, Republic of)
2016-09-15
Impaired immune responses in skin play a pivotal role in the development and progression of chemical-associated inflammatory skin disorders. In this study, we synthesized new flavonoid derivatives from macakurzin C, and identified in vitro and in vivo efficacy of a potent anti-inflammatory flavonoid, Compound 14 (CPD 14), with its underlying mechanisms. In lipopolysaccharide (LPS)-stimulated murine macrophages and IFN-γ/TNF-α-stimulated human keratinocytes, CPD 14 significantly inhibited the release of inflammatory mediators including nitric oxide (NO), prostaglandins, and cytokines (IC{sub 50} for NO inhibition in macrophages: 4.61 μM). Attenuated NF-κB signaling and activated Nrf2/HO-1 pathway were responsible for the anti-inflammatory effects of CPD 14. The in vivo relevance was examined in phorbol 12-myristate 13-acetate (TPA)-induced acute skin inflammation and oxazolone-induced atopic dermatitis models. Topically applied CPD 14 significantly protected both irritation- and sensitization-associated skin inflammation by suppressing the expression of inflammatory mediators. In summary, we demonstrated that a newly synthesized flavonoid, CPD 14, has potent inhibitory effects on skin inflammation, suggesting it is a potential therapeutic candidate to treat skin disorders associated with excessive inflammation. - Highlights: • An anti-inflammatory flavonoid CPD 14 was newly synthesized from macakurzin C. • CPD 14 potently inhibited inflammatory reaction in keratinocytes and macrophages. • Dermal toxicity by irritation or sensitization in rats was protected by CPD 14. • Attenuated NF-κB and activated Nrf2/HO-1 were main mechanisms of CPD 14 action.
An MEF-Based Localization Algorithm against Outliers in Wireless Sensor Networks.
Wang, Dandan; Wan, Jiangwen; Wang, Meimei; Zhang, Qiang
2016-07-07
Precise localization has attracted considerable interest in Wireless Sensor Networks (WSNs) localization systems. Due to the internal or external disturbance, the existence of the outliers, including both the distance outliers and the anchor outliers, severely decreases the localization accuracy. In order to eliminate both kinds of outliers simultaneously, an outlier detection method is proposed based on the maximum entropy principle and fuzzy set theory. Since not all the outliers can be detected in the detection process, the Maximum Entropy Function (MEF) method is utilized to tolerate the errors and calculate the optimal estimated locations of unknown nodes. Simulation results demonstrate that the proposed localization method remains stable while the outliers vary. Moreover, the localization accuracy is highly improved by wisely rejecting outliers.
International Nuclear Information System (INIS)
Downs, R.M.; Hughes, M.A.; Kinsey, S.T.; Johnson, M.C.; Baumgarner, B.L.
2016-01-01
Caffeine is a widely consumed stimulant that has previously been shown to promote cytotoxic stress and even cell death in numerous mammalian cell lines. Thus far there is little information available regarding the toxicity of caffeine in skeletal muscle cells. Our preliminary data revealed that treating C2C12 myotubes with 5 mM caffeine for 6 h increased nuclear fragmentation and reduced basal and maximal oxygen consumption rate (OCR) in skeletal myotubes. The purpose of this study was to further elucidate the pathways by which caffeine increased cell death and reduced mitochondrial respiration. We specifically examined the role of c-Jun N-terminal kinase (JNK), which has previously been shown to simultaneously increase caspase-dependent cell death and reduce mitochondrial respiration in other mammalian cell lines. We found that caffeine promoted a dose-dependent increase in cell death in multinucleated myotubes but did not in mononucleated myoblasts. The addition of 10 μM Z-DEVD-FMK, a specific inhibitor of executioner caspases, completely inhibited caffeine-dependent cell death. Further, the addition of 400 μM dantrolene, a specific ryanodine receptor (RYR) inhibitor, prevented the caffeine-dependent increase in cell death and the reduction in basal and maximal OCR. We also discovered that caffeine treatment significantly increased the phosphorylation of JNK and that the addition of 30 μM SP600125 (JNKi), a specific JNK inhibitor, partially attenuated caffeine-induced cell death without preventing the caffeine-dependent reduction in basal and maximal OCR. Our results suggest that JNK partially mediates the increase in caspase-dependent cell death but does not contribute to reduced mitochondrial respiration in caffeine-treated skeletal muscle cells. We conclude that caffeine increased cell death and reduced mitochondrial respiration in a calcium-dependent manner by activating the RYR and promoting reticular calcium release. - Highlights: • Caffeine
How Silent is the Right to Silence?
Directory of Open Access Journals (Sweden)
Katherine Biber
2012-11-01
Full Text Available A long-held and fundamental principle of our criminal justice system is that people accused of crimes have a right to silence, arising from the presumption of innocence. Rules of evidence try to protect this ‘right’ during trial, by ensuring that juries understand that adverse inferences cannot be drawn from the silence of the accused. Silence, in court, can mean nothing, and we are not to speculate about what might motivate an accused person to remain silent, or what they might have said had they spoken. However, an examination of the jurisprudence in this area shows that the law is often not dealing with actual silence; sometimes when the law refers to the ‘right to silence’, it seems to mean a ‘refusal to hear’. In other instances, there is actual silence, and yet the law refuses to subject that silence to any critical interpretation, insisting that we cannot infer anything from it. While we have learned, from theatre, music, linguistics, religion and psychology, to develop sophisticated means for interpreting silence, the law demands that we set aside these interpretive tools, hearing silence that isn’t there, and inferring nothing about something.
Mottola, Giorgio; Chatterjee, Anuran; Wu, Bian; Chen, Mian; Conte, Michael S
2017-01-01
Resolvin D1 (RvD1) is a specialized pro-resolving lipid mediator that has been previously shown to attenuate vascular smooth muscle cell (VSMC) migration, a key process in the development of intimal hyperplasia. We sought to investigate the role of the cAMP/PKA pathway in mediating the effects of the aspirin-triggered epimer 17R-RvD1 (AT-RvD1) on VSMC migration. VSMCs were harvested from human saphenous veins. VSMCs were analyzed for intracellular cAMP levels and PKA activity after exposure to AT-RvD1. Platelet-derived growth factor (PDGF)-induced migration and cytoskeletal changes in VSMCs were observed through scratch, Transwell, and cell shape assays in the presence or absence of a PKA inhibitor (Rp-8-Br-cAMP). Further investigation of the pathways involved in AT-RvD1 signaling was performed by measuring Rac1 activity, vasodilator stimulated phosphoprotein (VASP) phosphorylation and paxillin translocation. Finally, we examined the role of RvD1 receptors (GPR32 and ALX/FPR2) in AT-RvD1 induced effects on VSMC migration and PKA activity. Treatment with AT-RvD1 induced a significant increase in cAMP levels and PKA activity in VSMCs at 5 minutes and 30 minutes, respectively. AT-RvD1 attenuated PDGF-induced VSMC migration and cytoskeletal rearrangements. These effects were attenuated by the PKA inhibitor Rp-8-Br-cAMP, suggesting cAMP/PKA involvement. Treatment of VSMC with AT-RvD1 inhibited PDGF-stimulated Rac1 activity, increased VASP phosphorylation, and attenuated paxillin localization to focal adhesions; these effects were negated by the addition of Rp-8-Br-cAMP. The effects of AT-RvD1 on VSMC migration and PKA activity were attenuated by blocking ALX/FPR2, suggesting an important role of this G-protein coupled receptor. Our results suggest that AT-RvD1 attenuates PDGF-induced VSMC migration via ALX/FPR2 and cAMP/PKA. Interference with Rac1, VASP and paxillin function appear to mediate the downstream effects of AT-RvD1 on VSMC migration.
Attenuation Measurements in Solutions of Some Carbohydrates
International Nuclear Information System (INIS)
Gagandeep; Singh, Kulwant; Lark, B.S.; Sahota, H.S.
2000-01-01
The linear attenuation coefficients in aqueous solutions of three carbohydrates, glucose (C 6 H 12 O 6 ), maltose monohydrate (C 12 H 22 O 11 .H 2 O), and sucrose (C 12 H 22 O 11 ), were determined at 81, 356, 511, 662, 1173, and 1332 keV by the gamma-ray transmission method in a good geometry setup. From the precisely measured densities of these solutions, mass attenuation coefficients were then obtained that varied systematically with the corresponding changes in the concentrations (g/cm 3 ) of these solutions. The experimental results were used in terms of effective atomic numbers and electron densities. A comparison between experimental and theoretical values of attenuation coefficients has proven that the study has a potential application for the determination of attenuation coefficients of solid solutes from their solutions without obtaining them in pure crystalline form
Energy Technology Data Exchange (ETDEWEB)
Ishino, Ruri; Minami, Kaori; Tanaka, Satowa [Laboratory of Hematology, Division of Medical Biophysics, Kobe University Graduate School of Health Sciences, 7-10-2 Tomogaoka, Suma-ku, Kobe 654-0142 (Japan); Nagai, Mami [Consolidated Research Institute for Advanced Science and Medical Care, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 159-8555 (Japan); Matsui, Keiji; Hasegawa, Natsumi [Laboratory of Hematology, Division of Medical Biophysics, Kobe University Graduate School of Health Sciences, 7-10-2 Tomogaoka, Suma-ku, Kobe 654-0142 (Japan); Roeder, Robert G. [Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10065 (United States); Asano, Shigetaka [Consolidated Research Institute for Advanced Science and Medical Care, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 159-8555 (Japan); Ito, Mitsuhiro, E-mail: itomi@med.kobe-u.ac.jp [Laboratory of Hematology, Division of Medical Biophysics, Kobe University Graduate School of Health Sciences, 7-10-2 Tomogaoka, Suma-ku, Kobe 654-0142 (Japan); Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10065 (United States); Consolidated Research Institute for Advanced Science and Medical Care, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 159-8555 (Japan); Department of Family and Community Medicine, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 654-0142 (Japan)
2013-10-11
Highlights: •FGF7 is downregulated in MED1-deficient mesenchymal cells. •FGF7 produced by mesenchymal stromal cells is a novel hematopoietic niche molecule. •FGF7 supports hematopoietic progenitor cells and niche-dependent leukemia cells. •FGF7 activates FGFR2IIIb of bone marrow stromal cells in an autocrine manner. •FGF7 indirectly acts on hematopoietic cells lacking FGFR2IIIb via stromal cells. -- Abstract: FGF1 and FGF2 support hematopoietic stem and progenitor cells (HSPCs) under stress conditions. In this study, we show that fibroblast growth factor (FGF7) may be a novel niche factor for HSPC support and leukemic growth. FGF7 expression was attenuated in mouse embryonic fibroblasts (MEFs) deficient for the MED1 subunit of the Mediator transcriptional coregulator complex. When normal mouse bone marrow (BM) cells were cocultured with Med1{sup +/+} MEFs or BM stromal cells in the presence of anti-FGF7 antibody, the growth of BM cells and the number of long-time culture-initiating cells (LTC-ICs) decreased significantly. Anti-FGF7 antibody also attenuated the proliferation and cobblestone formation of MB1 stromal cell-dependent myeloblastoma cells. The addition of recombinant FGF7 to the coculture of BM cells and Med1{sup −/−} MEFs increased BM cells and LTC-ICs. FGF7 and its cognate receptor, FGFR2IIIb, were undetectable in BM cells, but MEFs and BM stromal cells expressed both. FGF7 activated downstream targets of FGFR2IIIb in Med1{sup +/+} and Med1{sup −/−} MEFs and BM stromal cells. Taken together, we propose that FGF7 supports HSPCs and leukemia-initiating cells indirectly via FGFR2IIIb expressed on stromal cells.
International Nuclear Information System (INIS)
Ishino, Ruri; Minami, Kaori; Tanaka, Satowa; Nagai, Mami; Matsui, Keiji; Hasegawa, Natsumi; Roeder, Robert G.; Asano, Shigetaka; Ito, Mitsuhiro
2013-01-01
Highlights: •FGF7 is downregulated in MED1-deficient mesenchymal cells. •FGF7 produced by mesenchymal stromal cells is a novel hematopoietic niche molecule. •FGF7 supports hematopoietic progenitor cells and niche-dependent leukemia cells. •FGF7 activates FGFR2IIIb of bone marrow stromal cells in an autocrine manner. •FGF7 indirectly acts on hematopoietic cells lacking FGFR2IIIb via stromal cells. -- Abstract: FGF1 and FGF2 support hematopoietic stem and progenitor cells (HSPCs) under stress conditions. In this study, we show that fibroblast growth factor (FGF7) may be a novel niche factor for HSPC support and leukemic growth. FGF7 expression was attenuated in mouse embryonic fibroblasts (MEFs) deficient for the MED1 subunit of the Mediator transcriptional coregulator complex. When normal mouse bone marrow (BM) cells were cocultured with Med1 +/+ MEFs or BM stromal cells in the presence of anti-FGF7 antibody, the growth of BM cells and the number of long-time culture-initiating cells (LTC-ICs) decreased significantly. Anti-FGF7 antibody also attenuated the proliferation and cobblestone formation of MB1 stromal cell-dependent myeloblastoma cells. The addition of recombinant FGF7 to the coculture of BM cells and Med1 −/− MEFs increased BM cells and LTC-ICs. FGF7 and its cognate receptor, FGFR2IIIb, were undetectable in BM cells, but MEFs and BM stromal cells expressed both. FGF7 activated downstream targets of FGFR2IIIb in Med1 +/+ and Med1 −/− MEFs and BM stromal cells. Taken together, we propose that FGF7 supports HSPCs and leukemia-initiating cells indirectly via FGFR2IIIb expressed on stromal cells
Directory of Open Access Journals (Sweden)
Kae Harada-Hada
Full Text Available Autophagy is an intrinsic host defense system that recognizes and eliminates invading bacterial pathogens. We have identified microtubule-associated protein 1 light chain 3 (LC3, a hallmark of autophagy, as a binding partner of phospholipase C-related catalytically inactive protein (PRIP that was originally identified as an inositol trisphosphate-binding protein. Here, we investigated the involvement of PRIP in the autophagic elimination of Staphylococcus aureus in infected mouse embryonic fibroblasts (MEFs. We observed significantly more LC3-positive autophagosome-like vacuoles enclosing an increased number of S. aureus cells in PRIP-deficient MEFs than control MEFs, 3 h and 4.5 h post infection, suggesting that S. aureus proliferates in LC3-positive autophagosome-like vacuoles in PRIP-deficient MEFs. We performed autophagic flux analysis using an mRFP-GFP-tagged LC3 plasmid and found that autophagosome maturation is significantly inhibited in PRIP-deficient MEFs. Furthermore, acidification of autophagosomes was significantly inhibited in PRIP-deficient MEFs compared to the wild-type MEFs, as determined by LysoTracker staining and time-lapse image analysis performed using mRFP-GFP-tagged LC3. Taken together, our data show that PRIP is required for the fusion of S. aureus-containing autophagosome-like vacuoles with lysosomes, indicating that PRIP is a novel modulator in the regulation of the innate immune system in non-professional phagocytic host cells.
Judicial review of administrative silence
Directory of Open Access Journals (Sweden)
Radošević Ratko S.
2015-01-01
Full Text Available Administrative silence is a situation in which the competent authority, within the statutory deadline, has not issued an administrative act at the request of the party. In the case of administrative silence, given the fact that the citizens are unable to protect their rights and legal interests without an administrative act, they are provided with legal protection. In this case, the same legal relationship is created, directly on the basis of the statute, as in the situation in which the party's request is rejected. This means that the party may, under the conditions prescribed by the statute, initiate the procedure of judicial review of administrative silence. In the paper, the author explains the conditions under which the judicial review of administrative silence can be initiated and the role of the court in this judicial procedure.
Preparation, characterization and X-ray attenuation property of Gd2O3-based nanocomposites
Jayakumar, Sangeetha; Saravanan, T.; Philip, John
2017-11-01
In an attempt to develop an alternate to lead-based X-ray shielding material, we describe the X-ray attenuation property of nanocomposites containing Gd2O3 as nanofiller and silicone resin as matrix, prepared by a simple solution-casting technique. Gd2O3 nanoparticles of size 30 and 56 nm are used at concentrations of 25 and 2.5 wt%. The nanoparticles and the nanocomposites are characterized using X-ray diffraction (XRD) studies, small angle X-ray spectroscopy (SAXS), thermogravimetric analysis (TGA), differential scanning calorimetry (DSC) and atomic force microscopy (AFM). The X-ray attenuation property of nanocomposites, studied using an industrial X-ray unit, shows that nanocomposites containing nanoparticles of size 56 nm (G2) exhibit better attenuation than nanocomposites containing nanoparticles of size 30 nm (G1), which is attributed to the greater interfacial interaction between the G2 nanofillers and silicone matrix. In the case of nanocomposites containing G1 nanoparticles, the interfacial interaction between the nanofiller and the matrix is so weak that it results in pulling out of nanofillers, causing voids in the matrix, which act as X-ray transparent region, thereby reducing the overall X-ray attenuation property of G1 nanocomposites. This is further corroborated from the AFM images of the nanocomposites. The weight loss and heat flow curves of pure silicone matrix and the nanocomposites containing Gd2O3 nanoparticles of size 30 and 56 nm show the degradation of silicone resin, due to chain scission, between 403 and 622 °C. The same onset temperature (403 °C) of degradation of matrix with and without nanoparticles shows that the addition of nanofillers to the matrix does not deteriorate the thermal stability of the matrix. This confirms the thermal stability of nanocomposites. Therefore, our study shows that nanocomposites containing G2 nanoparticles are potential candidates for the development of X-ray opaque fabric material.
MicroRNA-33 promotes the replicative senescence of mouse embryonic fibroblasts by suppressing CDK6
Energy Technology Data Exchange (ETDEWEB)
Xu, Shun; Huang, Haijiao; Li, Nanhong; Zhang, Bing; Jia, Yubin; Yang, Yukun; Yuan, Yuan; Xiong, Xing-dong; Wang, Dengchuan; Zheng, Hui-ling [Institute of Aging Research, Guangdong Medical University, Dongguan (China); Guangdong Provincial Key Laboratory of Medical Molecular Diagnostics, Dongguan (China); Institute of Biochemistry & Molecular Biology, Guangdong Medical University, Zhanjiang (China); Liu, Xinguang, E-mail: xgliu64@126.com [Institute of Aging Research, Guangdong Medical University, Dongguan (China); Guangdong Provincial Key Laboratory of Medical Molecular Diagnostics, Dongguan (China); Institute of Biochemistry & Molecular Biology, Guangdong Medical University, Zhanjiang (China)
2016-05-13
MicroRNAs are a large class of tiny noncoding RNAs, which have emerged as critical regulators of gene expression, and thus are involved in multiple cellular processes, including cellular senescence. MicroRNA-33 has previously been established to exert crucial effect on cell proliferation, lipid metabolism and cholesterol metabolism. Nonetheless, the association between microRNA-33 and cellular senescence and its underlying molecular mechanism are far to be elucidated. The present study has attempted to probe into the effect of microRNA-33 on MEFs senescence. Our data unveiled that microRNA-33 was dramatically down-regulated in senescent MEFs compared to the young MEFs, and ectopic expression of microRNA-33 promoted MEFs senescence, while knock-down of microRNA-33 exhibited a protective effect against senescence phenotype. Moreover, we verified CDK6 as a direct target of microRNA-33 in mouse. Silencing of CDK6 induced the premature senescence phenotype of MEFs similarly as microRNA-33, while enforced expression of CDK6 significantly reverse the senescence-induction effect of microRNA-33. Taken together, our results suggested that microRNA-33 enhanced the replicative senescence of MEFs potentially by suppressing CDK6 expression. -- Highlights: •MicroRNA-33 was dramatically down-regulated in senescent MEF cells. •Altered expression of microRNA-33 exerted a critical role in MEFs senescence. •MicroRNA-33 promoted the replicative senescence of MEFs via targeting of CDK6.
MicroRNA-33 promotes the replicative senescence of mouse embryonic fibroblasts by suppressing CDK6
International Nuclear Information System (INIS)
Xu, Shun; Huang, Haijiao; Li, Nanhong; Zhang, Bing; Jia, Yubin; Yang, Yukun; Yuan, Yuan; Xiong, Xing-dong; Wang, Dengchuan; Zheng, Hui-ling; Liu, Xinguang
2016-01-01
MicroRNAs are a large class of tiny noncoding RNAs, which have emerged as critical regulators of gene expression, and thus are involved in multiple cellular processes, including cellular senescence. MicroRNA-33 has previously been established to exert crucial effect on cell proliferation, lipid metabolism and cholesterol metabolism. Nonetheless, the association between microRNA-33 and cellular senescence and its underlying molecular mechanism are far to be elucidated. The present study has attempted to probe into the effect of microRNA-33 on MEFs senescence. Our data unveiled that microRNA-33 was dramatically down-regulated in senescent MEFs compared to the young MEFs, and ectopic expression of microRNA-33 promoted MEFs senescence, while knock-down of microRNA-33 exhibited a protective effect against senescence phenotype. Moreover, we verified CDK6 as a direct target of microRNA-33 in mouse. Silencing of CDK6 induced the premature senescence phenotype of MEFs similarly as microRNA-33, while enforced expression of CDK6 significantly reverse the senescence-induction effect of microRNA-33. Taken together, our results suggested that microRNA-33 enhanced the replicative senescence of MEFs potentially by suppressing CDK6 expression. -- Highlights: •MicroRNA-33 was dramatically down-regulated in senescent MEF cells. •Altered expression of microRNA-33 exerted a critical role in MEFs senescence. •MicroRNA-33 promoted the replicative senescence of MEFs via targeting of CDK6.
Hypoxia silences retrotrapezoid nucleus respiratory chemoreceptors via alkalosis.
Basting, Tyler M; Burke, Peter G R; Kanbar, Roy; Viar, Kenneth E; Stornetta, Daniel S; Stornetta, Ruth L; Guyenet, Patrice G
2015-01-14
In conscious mammals, hypoxia or hypercapnia stimulates breathing while theoretically exerting opposite effects on central respiratory chemoreceptors (CRCs). We tested this theory by examining how hypoxia and hypercapnia change the activity of the retrotrapezoid nucleus (RTN), a putative CRC and chemoreflex integrator. Archaerhodopsin-(Arch)-transduced RTN neurons were reversibly silenced by light in anesthetized rats. We bilaterally transduced RTN and nearby C1 neurons with Arch (PRSx8-ArchT-EYFP-LVV) and measured the cardiorespiratory consequences of Arch activation (10 s) in conscious rats during normoxia, hypoxia, or hyperoxia. RTN photoinhibition reduced breathing equally during non-REM sleep and quiet wake. Compared with normoxia, the breathing frequency reduction (Δf(R)) was larger in hyperoxia (65% FiO2), smaller in 15% FiO2, and absent in 12% FiO2. Tidal volume changes (ΔV(T)) followed the same trend. The effect of hypoxia on Δf(R) was not arousal-dependent but was reversed by reacidifying the blood (acetazolamide; 3% FiCO2). Δf(R) was highly correlated with arterial pH up to arterial pH (pHa) 7.5 with no frequency inhibition occurring above pHa 7.53. Blood pressure was minimally reduced suggesting that C1 neurons were very modestly inhibited. In conclusion, RTN neurons regulate eupneic breathing about equally during both sleep and wake. RTN neurons are the first putative CRCs demonstrably silenced by hypocapnic hypoxia in conscious mammals. RTN neurons are silent above pHa 7.5 and increasingly active below this value. During hyperoxia, RTN activation maintains breathing despite the inactivity of the carotid bodies. Finally, during hypocapnic hypoxia, carotid body stimulation increases breathing frequency via pathways that bypass RTN. Copyright © 2015 the authors 0270-6474/15/350527-17$15.00/0.
Bartels, Josef; Rodenbach, Rachel; Ciesinski, Katherine; Gramling, Robert; Fiscella, Kevin; Epstein, Ronald
2016-10-01
Silences in doctor-patient communication can be "connectional" and communicative, in contrast to silences that indicate awkwardness or distraction. Musical and lexical analyses can identify and characterize connectional silences in consultations between oncologists and patients. Two medical students and a professor of voice screened all 1211 silences over 2s in length from 124 oncology office visits. We developed a "strength of connection" taxonomy and examined ten connectional silences for lexical and musical features including pitch, volume, and speaker turn-taking rhythm. We identified connectional silences with good reliability. Typical dialog rhythms surrounding connectional silences are characterized by relatively equal turn lengths and frequent short vocalizations. We found no pattern of volume and pitch variability around these silences. Connectional silences occurred in a wide variety of lexical contexts. Particular patterns of dialog rhythm mark connectional silences. Exploring structures of connectional silence extends our understanding of the audio-linguistic conditions that mark patient-clinician connection. Communicating with an awareness of pitch, rhythm, and silence - in addition to lexical content - can facilitate shared understanding and emotional connection. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Attenuation measurements in solutions of some carbohydrates
International Nuclear Information System (INIS)
Gagandeep; Singh, K.; Lark, B.S.; Sahota, H.S.
2000-01-01
The linear attenuation coefficients in aqueous solutions of three carbohydrates, glucose (C 6 H 12 O 6 ), maltose monohydrate (C 12 H 22 O 11 ·H 2 O), and sucrose (C 12 H 22 O 11 ), were determined at 81, 356, 511, 662, 1,173, and 1,332 keV by the gamma-ray transmission method in a good geometry setup. From the precisely measured densities of these solutions, mass attenuation coefficients were then obtained that varied systematically with the corresponding changes in the concentrations (g/cm 3 ) of these solutions. The experimental results were used in terms of effective atomic numbers and electron densities. A comparison between experimental and theoretical values of attenuation coefficients has proven that the study has a potential application for the determination of attenuation coefficients of solid solutes from their solutions without obtaining them in pure crystalline form
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...
Directory of Open Access Journals (Sweden)
Rocco Piazza
2013-05-01
Full Text Available BIM is a proapoptotic member of the Bcl-2 family. Here, we investigated the epigenetic status of the BIM locus in NPM/ALK+ anaplastic large cell lymphoma (ALCL cell lines and in lymph node biopsies from NPM/ALK+ ALCL patients. We show that BIM is epigenetically silenced in cell lines and lymph node specimens and that treatment with the deacetylase inhibitor trichostatin A restores the histone acetylation, strongly upregulates BIM expression, and induces cell death. BIM silencing occurs through recruitment of MeCP2 and the SIN3a/histone deacetylase 1/2 (HDAC1/2 corepressor complex. This event requires BIM CpG methylation/demethylation with 5-azacytidine that leads to detachment of the MeCP2 corepressor complex and reacetylation of the histone tails. Treatment with the ALK inhibitor PF2341066 or with an inducible shRNA targeting NPM/ALK does not restore BIM locus reacetylation; however, enforced expression of NPM/ALK in an NPM/ALK-negative cell line significantly increases the methylation at the BIM locus. This study demonstrates that BIM is epigenetically silenced in NPM/ALK-positive cells through recruitment of the SIN3a/HDAC1/2 corepressor complex and that NPM/ALK is dispensable to maintain BIM epigenetic silencing but is able to act as an inducer of BIM methylation.
Lu, Yuhong; Wajapeyee, Narendra; Turker, Mitchell S.; Glazer, Peter M.
2014-01-01
SUMMARY Silencing of the MLH1 gene is frequently seen in sporadic cancers. We report that hypoxia causes decreased H3K4 methylation at the MLH1 promoter via the H3K4 demethylases, LSD1 and PLU-1, and promotes long-term silencing of the promoter in a pathway that requires LSD1. Knockdown of LSD1 or its co-repressor, CoREST, also prevents the re-silencing (and cytosine DNA methylation) of the endogenous MLH1 promoter in RKO colon cancer cells following transient reactivation by the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (5-aza-dC). The results demonstrate that hypoxia is a critical driving force for silencing of MLH1 through chromatin modification and indicate that the LSD1/CoREST complex is essential for MLH1 silencing. PMID:25043185
Wong, Siew Ying; Tan, Michelle G K; Banks, William A; Wong, W S Fred; Wong, Peter T-H; Lai, Mitchell K P
2016-02-09
Andrographolide is the major bioactive compound isolated from Andrographis paniculata, a native South Asian herb used medicinally for its anti-inflammatory properties. In this study, we aimed to assess andrographolide's potential utility as an anti-neuroinflammatory therapeutic. The effects of andrographolide on lipopolysaccharide (LPS)-induced chemokine up-regulation both in mouse cortex and in cultured primary astrocytes were measured, including cytokine profiling, gene expression, and, in cultured astrocytes, activation of putative signaling regulators. Orally administered andrographolide significantly attenuated mouse cortical chemokine levels from the C-C and C-X-C subfamilies. Similarly, andrographolide abrogated a range of LPS-induced chemokines as well as tumor necrosis factor (TNF)-α in astrocytes. In astrocytes, the inhibitory actions of andrographolide on chemokine and TNF-α up-regulation appeared to be mediated by nuclear factor-κB (NF-κB) or c-Jun N-terminal kinase (JNK) activation. These results suggest that andrographolide may be useful as a therapeutic for neuroinflammatory diseases, especially those characterized by chemokine dysregulation.
[Construction and identification of eukaryotic plasmid pGC-silencer-U6/Neo/GFP/ABCG2].
Yu, Yanping; Zhang, Song; Kong, Weijia
2010-09-01
To construct three short hairpin RNA (shRNA) interference expression plasmid vectors of human ABCG2 gene, to assay the expression of ABCG2 in a human nasopharyngeal carcinoma (NPC) cell line, CEN-2 cell line, and to detect the RNAi effect of shRNA. Targeting ABCG2 gene sequence, three plasmid expression vectors coding for shRNA and a control vector containing random DNA fragment were constructed. The recombinant plasmids were amplified in Ecoli. DH5 and then identified by restriction digestion, PCR and sequencing. The recombinant plasmids were transfected into CEN-2 cells. ABCG2 expression was assayed by real-time quantitative PCR and Western blot. The construction of pGC-silencer-U6/Neo/GFP/ABCG2 was succeed. The shRNA plasmids significantly down-regulated the ABCG2 expression in CEN-2 cells, at both mRNA level and protein level. Recombinant plasmid 1 had the strongest effect compared with plasmids 2 and 3 (P < 0.05), with an inhibition ratio of 75% at the mRNA level and 68% at the protein level. pGC-silencer-U6/Neo/GFP/ABCG2 has been successfully constructed and it can down-regulate ABCG2 expression after transfected into CEN-2 cells, which could help further studies of ABCG2 functions CEN-2 cell line and contribute to the NPC gene therapy.
Xiong, Qin; Ye, Wenwu; Choi, Duseok; Wong, James; Qiao, Yongli; Tao, Kai; Wang, Yuanchao; Ma, Wenbo
2014-12-01
The genus Phytophthora consists of notorious and emerging pathogens of economically important crops. Each Phytophthora genome encodes several hundreds of cytoplasmic effectors, which are believed to manipulate plant immune response inside the host cells. However, the majority of Phytophthora effectors remain functionally uncharacterized. We recently discovered two effectors from the soybean stem and root rot pathogen Phytophthora sojae with the activity to suppress RNA silencing in plants. These effectors are designated Phytophthora suppressor of RNA silencing (PSRs). Here, we report that the P. sojae PSR2 (PsPSR2) belongs to a conserved and widespread effector family in Phytophthora. A PsPSR2-like effector produced by P. infestans (PiPSR2) can also suppress RNA silencing in plants and promote Phytophthora infection, suggesting that the PSR2 family effectors have conserved functions in plant hosts. Using Agrobacterium rhizogenes-mediated hairy roots induction, we demonstrated that the expression of PsPSR2 rendered hypersusceptibility of soybean to P. sojae. Enhanced susceptibility was also observed in PsPSR2-expressing Arabidopsis thaliana plants during Phytophthora but not bacterial infection. These experiments provide strong evidence that PSR2 is a conserved Phytophthora effector family that performs important virulence functions specifically during Phytophthora infection of various plant hosts.
Activated protein C attenuates acute ischaemia reperfusion injury in skeletal muscle.
LENUS (Irish Health Repository)
Dillon, J P
2012-02-03
Activated protein C (APC) is an endogenous anti-coagulant with anti-inflammatory properties. The purpose of the present study was to evaluate the effects of activated protein C in the setting of skeletal muscle ischaemia reperfusion injury (IRI). IRI was induced in rats by applying rubber bands above the levels of the greater trochanters bilaterally for a period of 2h followed by 12h reperfusion. Treatment groups received either equal volumes of normal saline or activated protein C prior to tourniquet release. Following 12h reperfusion, muscle function was assessed electrophysiologically by electrical field stimulation. The animals were then sacrificed and skeletal muscle harvested for evaluation. Activated protein C significantly attenuated skeletal muscle reperfusion injury as shown by reduced myeloperoxidase content, wet to dry ratio and electrical properties of skeletal muscle. Further in vitro work was carried out on neutrophils isolated from healthy volunteers to determine the direct effect of APC on neutrophil function. The effects of APC on TNF-alpha stimulated neutrophils were examined by measuring CD18 expression as well as reactive oxygen species generation. The in vitro work demonstrated a reduction in CD18 expression and reactive oxygen species generation. We conclude that activated protein C may have a protective role in the setting of skeletal muscle ischaemia reperfusion injury and that this is in part mediated by a direct inhibitory effect on neutrophil activation.
Breaching cultural silence: enhancing resilience among Ugandan ...
African Journals Online (AJOL)
Cultural silence is frequently the outcome of deep-seated taboos regarding adults talking to children about sex and death. This paper examines the impact of cultural silence on the resilience of children orphaned by AIDS in Uganda. Cultural silence is often linked with denial. This article explores the complexities of cultural ...
DEFF Research Database (Denmark)
Bjerling, Pernilla; Ekwall, Karl; Egel, Richard
2004-01-01
The mating-type region of the fission yeast Schizosaccharomyces pombe comprises three loci: mat1, mat2-P and mat3-M. mat1 is expressed and determines the mating type of the cell. mat2-P and mat3-M are two storage cassettes located in a 17 kb heterochromatic region with features identical to those...... of mammalian heterochromatin. Mutations in the swi6+, clr1+, clr2+, clr3+, clr4+ and clr6+ genes were obtained in screens for factors necessary for silencing the mat2-P-mat3-M region. swi6+ encodes a chromodomain protein, clr3+ and clr6+ histone deacetylases, and clr4+ a histone methyltransferase. Here, we...
Ding, Xin Shun; Schneider, William L; Chaluvadi, Srinivasa Rao; Mian, M A Rouf; Nelson, Richard S
2006-11-01
Virus-induced gene silencing (VIGS) is used to analyze gene function in dicotyledonous plants but less so in monocotyledonous plants (particularly rice and corn), partially due to the limited number of virus expression vectors available. Here, we report the cloning and modification for VIGS of a virus from Festuca arundinacea Schreb. (tall fescue) that caused systemic mosaic symptoms on barley, rice, and a specific cultivar of maize (Va35) under greenhouse conditions. Through sequencing, the virus was determined to be a strain of Brome mosaic virus (BMV). The virus was named F-BMV (F for Festuca), and genetic determinants that controlled the systemic infection of rice were mapped to RNAs 1 and 2 of the tripartite genome. cDNA from RNA 3 of the Russian strain of BMV (R-BMV) was modified to accept inserts from foreign genes. Coinoculation of RNAs 1 and 2 from F-BMV and RNA 3 from R-BMV expressing a portion of a plant gene to leaves of barley, rice, and maize plants resulted in visual silencing-like phenotypes. The visual phenotypes were correlated with decreased target host transcript levels in the corresponding leaves. The VIGS visual phenotype varied from maintained during silencing of actin 1 transcript expression to transient with incomplete penetration through affected tissue during silencing of phytoene desaturase expression. F-BMV RNA 3 was modified to allow greater accumulation of virus while minimizing virus pathogenicity. The modified vector C-BMV(A/G) (C for chimeric) was shown to be useful for VIGS. These BMV vectors will be useful for analysis of gene function in rice and maize for which no VIGS system is reported.
Organizational Silence in Sports Employees
Bastug, Gulsum; Pala, Adem; Yilmaz, Taner; Duyan, Mehdi; Gunel, Ilker
2016-01-01
Organizational silence can be defined as a way of behaviour belonging to men and women employees in the organization exhibited without reflecting their feelings, ideas, concerns and suggestions related with their workplaces, works for which they are responsible or other activities of the organization. In the period of organizational silence,…
Aghamohammadi, Mehdi
2017-01-01
One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not…
AGO/RISC-mediated antiviral RNA silencing in a plant in vitro system.
Schuck, Jana; Gursinsky, Torsten; Pantaleo, Vitantonio; Burgyán, Jozsef; Behrens, Sven-Erik
2013-05-01
AGO/RISC-mediated antiviral RNA silencing, an important component of the plant's immune response against RNA virus infections, was recapitulated in vitro. Cytoplasmic extracts of tobacco protoplasts were applied that supported Tombusvirus RNA replication, as well as the formation of RNA-induced silencing complexes (RISC) that could be functionally reconstituted with various plant ARGONAUTE (AGO) proteins. For example, when RISC containing AGO1, 2, 3 or 5 were programmed with exogenous siRNAs that specifically targeted the viral RNA, endonucleolytic cleavages occurred and viral replication was inhibited. Antiviral RNA silencing was disabled by the viral silencing suppressor p19 when this was present early during RISC formation. Notably, with replicating viral RNA, only (+)RNA molecules were accessible to RISC, whereas (-)RNA replication intermediates were not. The vulnerability of viral RNAs to RISC activity also depended on the RNA structure of the target sequence. This was most evident when we characterized viral siRNAs (vsiRNAs) that were particularly effective in silencing with AGO1- or AGO2/RISC. These vsiRNAs targeted similar sites, suggesting that accessible parts of the viral (+)RNA may be collectively attacked by different AGO/RISC. The in vitro system was, hence, established as a valuable tool to define and characterize individual molecular determinants of antiviral RNA silencing.
Directory of Open Access Journals (Sweden)
Barik Sailen
2001-12-01
Full Text Available Abstract Background Post-transcriptional gene silencing (PTGS by short interfering RNA has opened up new directions in the phenotypic mutation of cellular genes. However, its efficacy on non-nuclear genes and its effect on the interferon pathway remain unexplored. Since directed mutation of RNA genomes is not possible through conventional mutagenesis, we have tested sequence-specific 21-nucleotide long double-stranded RNAs (dsRNAs for their ability to silence cytoplasmic RNA genomes. Results Short dsRNAs were generated against specific mRNAs of respiratory syncytial virus, a nonsegmented negative-stranded RNA virus with a cytoplasmic life cycle. At nanomolar concentrations, the dsRNAs specifically abrogated expression of the corresponding viral proteins, and produced the expected mutant phenotype ex vivo. The dsRNAs did not induce an interferon response, and did not inhibit cellular gene expression. The ablation of the viral proteins correlated with the loss of the specific mRNAs. In contrast, viral genomic and antigenomic RNA, which are encapsidated, were not directly affected. Conclusions Synthetic inhibitory dsRNAs are effective in specific silencing of RNA genomes that are exclusively cytoplasmic and transcribed by RNA-dependent RNA polymerases. RNA-directed RNA gene silencing does not require cloning, expression, and mutagenesis of viral cDNA, and thus, will allow the generation of phenotypic null mutants of specific RNA viral genes under normal infection conditions and at any point in the infection cycle. This will, for the first time, permit functional genomic studies, attenuated infections, reverse genetic analysis, and studies of host-virus signaling pathways using a wild type RNA virus, unencumbered by any superinfecting virus.
International Nuclear Information System (INIS)
Fusaro, Adriana F.; Correa, Regis L.; Nakasugi, Kenlee; Jackson, Craig; Kawchuk, Lawrence; Vaslin, Maite F.S.; Waterhouse, Peter M.
2012-01-01
The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0 PE , in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0 PE has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0 PE destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.
Energy Technology Data Exchange (ETDEWEB)
Fusaro, Adriana F. [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Correa, Regis L. [CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Nakasugi, Kenlee; Jackson, Craig [University of Sydney, NSW 2006 (Australia); Kawchuk, Lawrence [Research Centre, Agriculture and Agri-Food Canada, Lethbridge, AB T1J4B1 (Canada); Vaslin, Maite F.S. [Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Waterhouse, Peter M., E-mail: peter.waterhouse@sydney.edu.au [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia)
2012-05-10
The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0{sup PE}, in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0{sup PE} has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0{sup PE} destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.
Liu, Ying; Tan, Huiling; Tian, Hui; Liang, Chunyang; Chen, She; Liu, Qinghua
2011-11-04
The effector of RNA interference (RNAi) is the RNA-induced silencing complex (RISC). C3PO promotes the activation of RISC by degrading the Argonaute2 (Ago2)-nicked passenger strand of duplex siRNA. Active RISC is a multiple-turnover enzyme that uses the guide strand of siRNA to direct the Ago2-mediated sequence-specific cleavage of complementary mRNA. How this effector step of RNAi is regulated is currently unknown. Here, we used the human Ago2 minimal RISC system to purify Sjögren's syndrome antigen B (SSB)/autoantigen La as an activator of the RISC-mediated mRNA cleavage activity. Our reconstitution studies showed that La could promote multiple-turnover RISC catalysis by facilitating the release of cleaved mRNA from RISC. Moreover, we demonstrated that La was required for efficient RNAi, antiviral defense, and transposon silencing in vivo. Taken together, the findings of C3PO and La reveal a general concept that regulatory factors are required to remove Ago2-cleaved products to assemble or restore active RISC. Copyright © 2011 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Kim, Jaewoo; Lee, Byung-Chul; Uhm, Young Rang; Miller, William H.
2014-01-01
Highlights: • Preparation of B 4 C and BN nanopowders using a simple ball milling process. • Homogeneous dispersion and strong adhesion of nano-B 4 C and -BN with polymer matrix. • Enhancement of mechanical properties of the nanocomposites compared to their micro counterparts. • Enhancement of thermal neutron attenuation of the nanocomposites. - Abstract: Nano-sized boron carbide (B 4 C) and boron nitride (BN) powder were prepared using ball milling. Micro- and milled nano-powders were melt blended with high density polyethylene (HDPE) using a polymer mixer followed by hot pressing to fabricate sheet composites. The tensile and flexural strengths of HDPE nanocomposites were ∼20% higher than their micro counterparts, while those for latter decreased compared to neat HDPE. Thermal neutrons attenuation of the prepared HDPE nanocomposites was evaluated using a monochromatic ∼0.025 eV neutron beam. Thermal neutron attenuation of the HDPE nanocomposites was greatly enhanced compared to their micro counterparts at the same B-10 areal densities. Monte Carlo n-Particles (MCNP) simulations based on the lattice structure modeling also shows the similar filler size dependent thermal neutron absorption
Liu, Ling; Huang, Zile; Chen, Jingjing; Wang, Jiangang; Wang, Shuying
2018-04-25
Protein phosphatase 2A (PP2A) is an important enzyme within various signal transduction pathways. The present study was investigated PP2A mediates JS-K-induced apoptosis by affecting Bcl-2 family protein. JS-K showed diverse inhibitory effects in five HCC cell lines, especially HepG2 cells. JS-K caused a dose- and time-dependent reduction in cell viability and increased in levels of LDH release. Meanwhile, JS-K- induced apoptosis was characterized by mitochondrial membrane potential reduction, Hoechst 33342 + /PI + dual staining, release of cytochrome c (Cyt c), and activation of cleaved caspase-9/3. Moreover, JS-K-treatment could lead to the activation of protein phosphatase 2A-C (PP2A-C), decrease of anti-apoptotic Bcl-2 family-protein expression including p-Bcl-2 (Ser70), Bcl-2, Bcl-xL, and Mcl-1 as well as the increase of pro-apoptosis Bcl-2 family-protein including Bim, Bad, Bax, and Bak. Furthermore, JS-K caused a marked increase of intracellular NO levels while pre-treatment with Carboxy-PTIO (a NO scavenger) reduced the cytotoxicity effects and the apoptosis rate. Meanwhile, pre-treatment with Carboxy-PTIO attenuated the JS-K-induced up-regulation of PP2A, Cyt c, and cleaved-caspase-9/3 activation. The silencing PP2A-C by siRNA could abolish the activation of PP2A-C, down-regulation of anti-apoptotic Bcl-2 family-protein (p-Bcl-2, Bcl-2, Bcl-xL, and Mcl-1), increase of pro-apoptosis Bcl-2 family-protein (Bim, Bad, Bax, and Bak) and apoptotic-related protein (Cyt c, cleaved caspase-9/3) that were caused by JS-K in HepG2 cells. In addition, pre-treatment with OA (a PP2A inhibitor) also attenuated the above effects induced by JS-K. In summary, NO release from JS-K induces apoptosis through PP2A activation, which contributed to the regulation of Bcl-2 family proteins. © 2018 Wiley Periodicals, Inc.
Priego, Neibla; Arechederra, María; Sequera, Celia; Bragado, Paloma; Vázquez-Carballo, Ana; Gutiérrez-Uzquiza, Álvaro; Martín-Granado, Víctor; Ventura, Juan José; Kazanietz, Marcelo G.; Guerrero, Carmen; Porras, Almudena
2016-01-01
C3G, a Guanine nucleotide Exchange Factor (GEF) for Rap1 and R-Ras, has been shown to play important roles in development and cancer. Previous studies determined that C3G regulates cell death through down-regulation of p38α MAPK activity. Here, we found that C3G knock-down in MEFs and HCT116 cells promotes migration and invasion through Rap1-mediated p38α hyper-activation. These effects of C3G were inhibited by Rap1 knock-down or inactivation. The enhanced migration observed in C3G depleted HCT116 cells was associated with reduction in E-cadherin expression, internalization of ZO-1, actin cytoskeleton reorganization and decreased adhesion. We also found that matrix metalloproteases MMP2 and MMP9 are involved in the pro-invasive effect of C3G down-regulation. Additionally, our studies revealed that both C3G and p38α collaborate to promote growth of HCT116 cells in vitro and in vivo, possibly by enhancing cell survival. In fact, knocking-down C3G or p38α individually or together promoted cell death in vitro, although only the double C3G-p38α silencing was able to increase cell death within tumors. Notably, we found that the pro-tumorigenic function of C3G does not depend on p38α or Rap1 activation. Altogether, our studies uncover novel mechanisms by which C3G controls key aspects of tumorigenesis. PMID:27286263
Energy Technology Data Exchange (ETDEWEB)
Xu, Wei; Wang, Ting [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China); Xu, Shaoxin [School of physics and materials science, Anhui University, Hefei, Anhui, 230601 (China); Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China); Bian, Po, E-mail: bianpo@ipp.ac.cn [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China)
2016-08-15
Highlights: • Transcriptional gene silencing (TGS) in plants can be epigenetically alleviated by volatile signals from UV-C- irradiated neighboring plants. • Alleviation of TGS can be induced by UV-C irradiation through plant–plant–plant communication. • JA and SA signals take part in interplant communication for alleviation of TGS. - Abstract: Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant–plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant–plant and plant–plant–plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant–plant and plant–plant–plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant–plant–plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA.
International Nuclear Information System (INIS)
Xu, Wei; Wang, Ting; Xu, Shaoxin; Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin; Bian, Po
2016-01-01
Highlights: • Transcriptional gene silencing (TGS) in plants can be epigenetically alleviated by volatile signals from UV-C- irradiated neighboring plants. • Alleviation of TGS can be induced by UV-C irradiation through plant–plant–plant communication. • JA and SA signals take part in interplant communication for alleviation of TGS. - Abstract: Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant–plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant–plant and plant–plant–plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant–plant and plant–plant–plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant–plant–plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA.
Rouze, Ned C; Deng, Yufeng; Palmeri, Mark L; Nightingale, Kathryn R
2017-10-01
Recent measurements of shear wave propagation in viscoelastic materials have been analyzed by constructing the 2-D Fourier transform (2DFT) of the shear wave signal and measuring the phase velocity c(ω) and attenuation α(ω) from the peak location and full width at half-maximum (FWHM) of the 2DFT signal at discrete frequencies. However, when the shear wave is observed over a finite spatial range, the 2DFT signal is a convolution of the true signal and the observation window, and measurements using the FWHM can yield biased results. In this study, we describe a method to account for the size of the spatial observation window using a model of the 2DFT signal and a non-linear, least-squares fitting procedure to determine c(ω) and α(ω). Results from the analysis of finite-element simulation data agree with c(ω) and α(ω) calculated from the material parameters used in the simulation. Results obtained in a viscoelastic phantom indicate that the measured attenuation is independent of the observation window and agree with measurements of c(ω) and α(ω) obtained using the previously described progressive phase and exponential decay analysis. Copyright © 2017 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Curry, Merril C.; Peters, Amelia A. [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia); Kenny, Paraic A. [Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Roberts-Thomson, Sarah J. [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia); Monteith, Gregory R., E-mail: gregm@uq.edu.au [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia)
2013-05-10
Highlights: •Some clinical breast cancers are associated with MCU overexpression. •MCU silencing did not alter cell death initiated with the Bcl-2 inhibitor ABT-263. •MCU silencing potentiated caspase-independent cell death initiated by ionomycin. •MCU silencing promoted ionomycin-mediated cell death without changes in bulk Ca{sup 2+}. -- Abstract: The mitochondrial calcium uniporter (MCU) transports free ionic Ca{sup 2+} into the mitochondrial matrix. We assessed MCU expression in clinical breast cancer samples using microarray analysis and the consequences of MCU silencing in a breast cancer cell line. Our results indicate that estrogen receptor negative and basal-like breast cancers are characterized by elevated levels of MCU. Silencing of MCU expression in the basal-like MDA-MB-231 breast cancer cell line produced no change in proliferation or cell viability. However, distinct consequences of MCU silencing were seen on cell death pathways. Caspase-dependent cell death initiated by the Bcl-2 inhibitor ABT-263 was not altered by MCU silencing; whereas caspase-independent cell death induced by the calcium ionophore ionomycin was potentiated by MCU silencing. Measurement of cytosolic Ca{sup 2+} levels showed that the promotion of ionomycin-induced cell death by MCU silencing occurs independently of changes in bulk cytosolic Ca{sup 2+} levels. This study demonstrates that MCU overexpression is a feature of some breast cancers and that MCU overexpression may offer a survival advantage against some cell death pathways. MCU inhibitors may be a strategy to increase the effectiveness of therapies that act through the induction of caspase-independent cell death pathways in estrogen receptor negative and basal-like breast cancers.
Directory of Open Access Journals (Sweden)
Yan eQi
2015-10-01
Full Text Available Amyotrophic lateral sclerosis (ALS is a lethal neurodegenerative disease causing death of motor neurons. This study investigated the roles of energy metabolism in the pathogenesis of ALS in the SOD1(G93A transgenic mouse model. Control and SOD1(G93A mice were administered with shcontrol or shPGC-1α in combination with PBS or TZD for 8 weeks. Gene expression was analyzed by quantitative real-time PCR and western blot. ROS and fibrosis were assessed with a colorimetric kit and Sirius staining respectively. Inflammatory cytokines were measured using ELISA kits. The levels of tissue ROS and serum inflammatory cytokines were significantly higher in SOD1(G93A mice compared to control mice, and knocking down PGC-1α drastically increased cytokine levels in both control and SOD1(G93A mice. Muscle fibrosis was much severer in SOD1(G93A mice, and worsened by silencing PGC-1α and attenuate d by TZD. The expression levels of PGC-1α, SOD1, UCP2, and cytochrome C were substantially reduced by shPGC-1α and increased by TZD in muscle of both control and SOD1(G93A mice whereas the level of NF-B was significantly elevated in SOD1(G93A mice, which was further increased by PGC-1α silencing. These data indicated that disruption of energy homeostasis would exacerbate the pathological changes caused by SOD1 mutations to promote the pathogenesis of ALS.
Gu, Keyu; Tian, Dongsheng; Mao, Huizhu; Wu, Lifang; Yin, Zhongchao
2015-10-08
Jatropha curcas L. is a potential biofuel plant and its seed oil is suitable for biodiesel production. Despite this promising application, jatropha seeds contain two major toxic components, namely phorbol esters and curcins. These compounds would reduce commercial value of seed cake and raise safety and environment concerns on jatropha plantation and processing. Curcins are Type I ribosome inactivating proteins. Several curcin genes have been identified in the jatropha genome. Among which, the Curcin 1 (C1) gene is identified to be specifically expressed in endosperm, whereas the Curcin 2A (C2A) is mainly expressed in young leaves. A marker-free RNAi construct carrying a β-estradiol-regulated Cre/loxP system and a C1 promoter-driven RNAi cassette for C1 gene was made and used to generate marker-free transgenic RNAi plants to specifically silence the C1 gene in the endosperm of J. curcas. Plants of transgenic line L1, derived from T0-1, carry two copies of marker-free RNAi cassette, whereas plants of L35, derived from T0-35, harbored one copy of marker-free RNAi cassette and three copies of closely linked and yet truncated Hpt genes. The C1 protein content in endosperm of L1 and L35 seeds was greatly reduced or undetectable, while the C2A proteins in young leaves of T0-1 and T0-35 plants were unaffected. In addition, the C1 mRNA transcripts were undetectable in the endosperm of T3 seeds of L1 and L35. The results demonstrated that the expression of the C1 gene was specifically down-regulated or silenced by the double-stranded RNA-mediated RNA interference generated from the RNAi cassette. The C1 promoter-driven RNAi cassette for the C1 gene in transgenic plants was functional and heritable. Both C1 transcripts and C1 proteins were greatly down-regulated or silenced in the endosperm of transgenic J. curcas. The marker-free transgenic plants and curcin-deficient seeds developed in this study provided a solution for the toxicity of curcins in jatropha seeds and
Chinanteco children’s silences in different classroom situations
Directory of Open Access Journals (Sweden)
Valeria Rebolledo Angulo
2016-01-01
Full Text Available This article analyzes, from an ethnographic perspective and a sociocultural framework, the construction of silences in the interaction between students and teachers in a multilingual classroom situation in an indigenous community in méxico. the analysis reveals how the silence of the chinanteco speaking children when asked to answer certain questions in class is not always due to their failure to understand spoken and written spanish that is used in class. their silences are responses taking different meanings in specific situations. the silence of the children can be a way of resisting, a way of hiding, and, sometimes, their voices are silenced.
Cernilogar, Filippo M.; Burroughs, A. Maxwell; Lanzuolo, Chiara; Breiling, Achim; Imhof, Axel; Orlando, Valerio
2013-01-01
.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.
Identification of Novel Fibrosis Modifiers by In Vivo siRNA Silencing
Directory of Open Access Journals (Sweden)
Elisabeth H. Vollmann
2017-06-01
Full Text Available Fibrotic diseases contribute to 45% of deaths in the industrialized world, and therefore a better understanding of the pathophysiological mechanisms underlying tissue fibrosis is sorely needed. We aimed to identify novel modifiers of tissue fibrosis expressed by myofibroblasts and their progenitors in their disease microenvironment through RNA silencing in vivo. We leveraged novel biology, targeting genes upregulated during liver and kidney fibrosis in this cell lineage, and employed small interfering RNA (siRNA-formulated lipid nanoparticles technology to silence these genes in carbon-tetrachloride-induced liver fibrosis in mice. We identified five genes, Egr2, Atp1a2, Fkbp10, Fstl1, and Has2, which modified fibrogenesis based on their silencing, resulting in reduced Col1a1 mRNA levels and collagen accumulation in the liver. These genes fell into different groups based on the effects of their silencing on a transcriptional mini-array and histological outcomes. Silencing of Egr2 had the broadest effects in vivo and also reduced fibrogenic gene expression in a human fibroblast cell line. Prior to our study, Egr2, Atp1a2, and Fkbp10 had not been functionally validated in fibrosis in vivo. Thus, our results provide a major advance over the existing knowledge of fibrogenic pathways. Our study is the first example of a targeted siRNA assay to identify novel fibrosis modifiers in vivo.
International Nuclear Information System (INIS)
Oh, Sae Wook; Park, Young Chul; Park, Soo Young; Kim, Deug Jin; Hue, Sun Chul
1996-01-01
This study verified the relationship between fracture mechanics parameters and X-ray parameters for normalized SS41 steel with homogeneous crystal structure and M.E.F. dual phase steel(martensite encapsulated islands of ferrite). The fatigue crack propagation test were carried out and X-ray diffraction technique was applied to fatigue fractured surface. The change in X-ray parameters(residual stress, half-value breadth) according to the depth of fatigue fractured surface were investigated. The depth of maximum plastic zone, W y , were determined on the basis of the distribution of the half-value breadth for normalized SS41 steel and that of the residual stress for M.E.F. dual phase steel. K max could be estimated by the measurement of W y
Directory of Open Access Journals (Sweden)
Ruilin Wang
Full Text Available Cucumber mosaic virus (CMV is a model virus for plant-virus protein interaction and mechanism research because of its wide distribution, high-level of replication and simple genome structure. The 2b protein is a multifunctional protein encoded by CMV that suppresses RNA silencing-based antiviral defense and contributes to CMV virulence in host plants. In this report, 12 host proteins were identified as CMV LS2b binding partners using the yeast two-hybrid screen system from the Arabidopsis thaliana cDNA library. Among the host proteins, 30S ribosomal subunit protein S11 (RPS11 was selected for further studies. The interaction between LS2b and full-length RPS11 was confirmed using the yeast two-hybrid system. Bimolecular fluorescence complementation (BIFC assays observed by confocal laser microscopy and Glutathione S-transferase (GST pull-down assays were used to verify the interaction between endogenous NbRPS11 and viral CMVLS2b both in vivo and in vitro. TRV-based gene silencing vector was used to knockdown NbRPS11 transcription, and immunoblot analysis revealed a decline in infectious viral RNA replication and a decrease in CMV infection in RPS11 down-regulated Nicotiana benthamiana plants. Thus, the knockdown of RPS11 likely inhibited CMV replication and accumulation. The gene silencing suppressor activity of CMV2b protein was reduced by the RPS11 knockdown. This study demonstrated that the function of viral LS2b protein was remarkably affected by the interaction with host RPS11 protein.
Visceral adipose tissue macrophage-targeted TACE silencing to treat obesity-induced type 2 diabetes.
Yong, Seok-Beom; Song, Yoonsung; Kim, Yong-Hee
2017-12-01
Obesity is an increasingly prevalent global health problem. Due to its close relations with metabolic diseases and cancer, new therapeutic approaches for treating obesity and obesity-induced metabolic diseases are required. Visceral white adipose tissue (WAT) has been closely associated with obesity-induced inflammation and adipose tissue macrophages (ATMs) are responsible for obesity-induced inflammation by releasing inflammatory cytokines such as tumor necrosis factor-α (TNF-α) and interleukin-6. TNF-α converting enzyme (TACE) is a transmembrane enzyme that induces the enzymatic cleavage and release of inflammatory cytokines. In this study, we developed a nonviral gene delivery system consisting of an oligopeptide (ATS-9R) that can selectively target visceral ATMs. In here we shows visceral adipose tissue-dominant inflammatory gene over-expressions in obese mouse and our strategy enabled the preferential delivery of therapeutic genes to visceral ATMs and successfully achieved ATM-targeted gene silencing. Finally, ATS-9R-mediated TACE gene silencing in visceral ATMs alleviated visceral fat inflammation and improved type 2 diabetes by reducing whole body inflammation. Copyright © 2017 Elsevier Ltd. All rights reserved.
Role of DNA methylation in miR-200c/141 cluster silencing in invasive breast cancer cells
Directory of Open Access Journals (Sweden)
Wernet Peter
2010-08-01
Full Text Available Abstract Background The miR-200c/141 cluster has recently been implicated in the epithelial to mesenchymal transition (EMT process. The expression of these two miRNAs is inversely correlated with tumorigenicity and invasiveness in several human cancers. The role of these miRNAs in cancer progression is based in part on their capacity to target the EMT activators ZEB1 and ZEB2, two transcription factors, which in turn repress expression of E-cadherin. Little is known about the regulation of the mir200c/141 cluster, whose targeting has been proposed as a promising new therapy for the most aggressive tumors. Findings We show that the miR-200c/141 cluster is repressed by DNA methylation of a CpG island located in the promoter region of these miRNAs. Whereas in vitro methylation of the miR-200c/141 promoter led to shutdown of promoter activity, treatment with a demethylating agent caused transcriptional reactivation in breast cancer cells formerly lacking expression of miR-200c and miR-141. More importantly, we observed that DNA methylation of the identified miR-200c/141 promoter was tightly correlated with phenotype and the invasive capacity in a panel of 8 human breast cancer cell lines. In line with this, in vitro induction of EMT by ectopic expression of the EMT transcription factor Twist in human immortalized mammary epithelial cells (HMLE was accompanied by increased DNA methylation and concomitant repression of the miR-200c/141 locus. Conclusions The present study demonstrates that expression of the miR-200c/141 cluster is regulated by DNA methylation, suggesting epigenetic regulation of this miRNA locus in aggressive breast cancer cell lines as well as untransformed mammary epithelial cells. This epigenetic silencing mechanism might represent a novel component of the regulatory circuit for the maintenance of EMT programs in cancer and normal cells.
Role of DNA methylation in miR-200c/141 cluster silencing in invasive breast cancer cells.
Neves, Rui; Scheel, Christina; Weinhold, Sandra; Honisch, Ellen; Iwaniuk, Katharina M; Trompeter, Hans-Ingo; Niederacher, Dieter; Wernet, Peter; Santourlidis, Simeon; Uhrberg, Markus
2010-08-03
The miR-200c/141 cluster has recently been implicated in the epithelial to mesenchymal transition (EMT) process. The expression of these two miRNAs is inversely correlated with tumorigenicity and invasiveness in several human cancers. The role of these miRNAs in cancer progression is based in part on their capacity to target the EMT activators ZEB1 and ZEB2, two transcription factors, which in turn repress expression of E-cadherin. Little is known about the regulation of the mir200c/141 cluster, whose targeting has been proposed as a promising new therapy for the most aggressive tumors. We show that the miR-200c/141 cluster is repressed by DNA methylation of a CpG island located in the promoter region of these miRNAs. Whereas in vitro methylation of the miR-200c/141 promoter led to shutdown of promoter activity, treatment with a demethylating agent caused transcriptional reactivation in breast cancer cells formerly lacking expression of miR-200c and miR-141. More importantly, we observed that DNA methylation of the identified miR-200c/141 promoter was tightly correlated with phenotype and the invasive capacity in a panel of 8 human breast cancer cell lines. In line with this, in vitro induction of EMT by ectopic expression of the EMT transcription factor Twist in human immortalized mammary epithelial cells (HMLE) was accompanied by increased DNA methylation and concomitant repression of the miR-200c/141 locus. The present study demonstrates that expression of the miR-200c/141 cluster is regulated by DNA methylation, suggesting epigenetic regulation of this miRNA locus in aggressive breast cancer cell lines as well as untransformed mammary epithelial cells. This epigenetic silencing mechanism might represent a novel component of the regulatory circuit for the maintenance of EMT programs in cancer and normal cells.
Hu, Yudong; Yu, Kaikai; Wang, Gang; Zhang, Depeng; Shi, Chaoji; Ding, Yunhe; Hong, Duo; Zhang, Dan; He, Huiqiong; Sun, Lei; Zheng, Jun-Nian; Sun, Shuyang; Qian, Feng
2018-04-01
Gastric cancer is the third common cause of cancer mortality in the world with poor prognosis and high recurrence due to lack of effective medicines. Our studies revealed that lanatoside C, a FDA-approved cardiac glycoside, had an anti-proliferation effect on different human cancer cell lines (MKN-45; SGC-7901; HN4; MCF-7; HepG2) and gastric cell lines MKN-45 and SGC-7901 were the most sensitive cell lines to lanatoside C. MKN-45 cells treated with lanatoside C showed cell cycle arrest at G2/M phase and inhibition of cell migration. Meanwhile, upregulation of cleaved caspase-9 and cleaved PARP and downregulation of Bcl-xl were accompanied with the loss of mitochondrial membrane potential (MMP) and induction of intracellular reactive oxygen species (ROS). Lanatoside C inhibited Wnt/β-catenin signaling with downregulation of c-Myc, while overexpression of c-Myc reversed the anti-tumor effect of lanatoside C, confirming that c-Myc is a key drug target of lanatoside C. Furthermore, we discovered that lanatoside C prompted c-Myc degradation in proteasome-ubiquitin pathway with attenuating the binding of USP28 to c-Myc. These findings indicate that lanatoside C targeted c-Myc ubiquitination to inhibit MKN-45 proliferation and support the potential value of lanatoside C as a chemotherapeutic candidate. Copyright © 2018 Elsevier Inc. All rights reserved.
Sidorenko, Lyudmila; Dorweiler, Jane E; Cigan, A Mark; Arteaga-Vazquez, Mario; Vyas, Meenal; Kermicle, Jerry; Jurcin, Diane; Brzeski, Jan; Cai, Yu; Chandler, Vicki L
2009-11-01
Paramutation involves homologous sequence communication that leads to meiotically heritable transcriptional silencing. We demonstrate that mop2 (mediator of paramutation2), which alters paramutation at multiple loci, encodes a gene similar to Arabidopsis NRPD2/E2, the second-largest subunit of plant-specific RNA polymerases IV and V. In Arabidopsis, Pol-IV and Pol-V play major roles in RNA-mediated silencing and a single second-largest subunit is shared between Pol-IV and Pol-V. Maize encodes three second-largest subunit genes: all three genes potentially encode full length proteins with highly conserved polymerase domains, and each are expressed in multiple overlapping tissues. The isolation of a recessive paramutation mutation in mop2 from a forward genetic screen suggests limited or no functional redundancy of these three genes. Potential alternative Pol-IV/Pol-V-like complexes could provide maize with a greater diversification of RNA-mediated transcriptional silencing machinery relative to Arabidopsis. Mop2-1 disrupts paramutation at multiple loci when heterozygous, whereas previously silenced alleles are only up-regulated when Mop2-1 is homozygous. The dramatic reduction in b1 tandem repeat siRNAs, but no disruption of silencing in Mop2-1 heterozygotes, suggests the major role for tandem repeat siRNAs is not to maintain silencing. Instead, we hypothesize the tandem repeat siRNAs mediate the establishment of the heritable silent state-a process fully disrupted in Mop2-1 heterozygotes. The dominant Mop2-1 mutation, which has a single nucleotide change in a domain highly conserved among all polymerases (E. coli to eukaryotes), disrupts both siRNA biogenesis (Pol-IV-like) and potentially processes downstream (Pol-V-like). These results suggest either the wild-type protein is a subunit in both complexes or the dominant mutant protein disrupts both complexes. Dominant mutations in the same domain in E. coli RNA polymerase suggest a model for Mop2-1 dominance
Virus-induced gene silencing (VIGS) is a widely used tool for gene function studies in many plant species, though its use in monocots has been limited. Using a Brome mosaic virus (BMV) vector designed to silence the maize phytoene desaturase gene, a genetically diverse set of maize inbred lines was ...
Directory of Open Access Journals (Sweden)
Guillaume Jannot
2016-12-01
Full Text Available MicroRNAs and Argonaute form the microRNA induced silencing complex or miRISC that recruits GW182, causing mRNA degradation and/or translational repression. Despite the clear conservation and molecular significance, it is unknown if miRISC-GW182 interaction is essential for gene silencing during animal development. Using Caenorhabditis elegans to explore this question, we examined the relationship and effect on gene silencing between the GW182 orthologs, AIN-1 and AIN-2, and the microRNA-specific Argonaute, ALG-1. Homology modeling based on human Argonaute structures indicated that ALG-1 possesses conserved Tryptophan-binding Pockets required for GW182 binding. We show in vitro and in vivo that their mutations severely altered the association with AIN-1 and AIN-2. ALG-1 tryptophan-binding pockets mutant animals retained microRNA-binding and processing ability, but were deficient in reporter silencing activity. Interestingly, the ALG-1 tryptophan-binding pockets mutant phenocopied the loss of alg-1 in worms during larval stages, yet was sufficient to rescue embryonic lethality, indicating the dispensability of AINs association with the miRISC at this developmental stage. The dispensability of AINs in miRNA regulation is further demonstrated by the capacity of ALG-1 tryptophan-binding pockets mutant to regulate a target of the embryonic mir-35 microRNA family. Thus, our results demonstrate that the microRNA pathway can act independently of GW182 proteins during C. elegans embryogenesis.
Galambos, A; Zok, A; Kuczmog, A; Oláh, R; Putnoky, P; Ream, W; Szegedi, E
2013-11-01
Grapevine rootstock transformed with an Agrobacterium oncogene-silencing transgene was resistant to certain Agrobacterium strains but sensitive to others. Thus, genetic diversity of Agrobacterium oncogenes may limit engineering crown gall resistance. Crown gall disease of grapevine induced by Agrobacterium vitis or Agrobacterium tumefaciens causes serious economic losses in viticulture. To establish crown gall-resistant lines, somatic proembryos of Vitis berlandieri × V. rupestris cv. 'Richter 110' rootstock were transformed with an oncogene-silencing transgene based on iaaM and ipt oncogene sequences from octopine-type, tumor-inducing (Ti) plasmid pTiA6. Twenty-one transgenic lines were selected, and their transgenic nature was confirmed by polymerase chain reaction (PCR). These lines were inoculated with two A. tumefaciens and three A. vitis strains. Eight lines showed resistance to octopine-type A. tumefaciens A348. Resistance correlated with the expression of the silencing genes. However, oncogene silencing was mostly sequence specific because these lines did not abolish tumorigenesis by A. vitis strains or nopaline-type A. tumefaciens C58.
International Nuclear Information System (INIS)
Patel, Divya; Chaudhary, Jaideep
2012-01-01
Highlights: ► E2A, considered as a tumor suppressor is highly expressed in prostate cancer. ► Silencing of E2A attenuates cell proliferation and promotes apoptosis. ► E2A regulates c-myc, Id1, Id3 and CDKN1A expression. ► Loss of E2A promotes doxorubicin dependent apoptosis in prostate cancer cells. ► Results suggest that E2A acts as a tumor promoter at least in prostate cancer. -- Abstract: E2A (TCF3) is a multifunctional basic helix loop helix (bHLH), transcription factor. E2A regulates transcription of target genes by homo- or heterodimerization with cell specific bHLH proteins. In general, E2A promotes cell differentiation, acts as a negative regulator of cell proliferation in normal cells and cancer cell lines and is required for normal B-cell development. Given the diverse biological pathways regulated/influenced by E2A little is known about its expression in cancer. In this study we investigated the expression of E2A in prostate cancer. Unexpectedly, E2A immuno-histochemistry demonstrated increased E2A expression in prostate cancer as compared to normal prostate. Silencing of E2A in prostate cancer cells DU145 and PC3 led to a significant reduction in proliferation due to G1 arrest that was in part mediated by increased CDKN1A(p21) and decreased Id1, Id3 and c-myc. E2A silencing in prostate cancer cell lines also resulted in increased apoptosis due to increased mitochondrial permeability and caspase 3/7 activation. Moreover, silencing of E2A increased sensitivity to doxorubicin induced apoptosis. Based on our results, we propose that E2A could be an upstream regulator of Id1 and c-Myc which are highly expressed in prostate cancer. These results for the first time demonstrate that E2A could in fact acts as a tumor promoter at least in prostate cancer.
Lin, Chan-Chan; Zhou, Jing-Ping; Liu, Yun-Peng; Liu, Jing-Jing; Yang, Xiao-Ning; Jazag, Amarsanaa; Zhang, Zhi-Ping; Guleng, Bayasi; Ren, Jian-Lin
2012-01-01
Pokemon (POK erythroid myeloid ontogenic factor), which belongs to the POK protein family, is also called LRF, OCZF and FBI-1. As a transcriptional repressor, Pokemon assumes a critical function in cellular differentiation and oncogenesis. Our study identified an oncogenic role for Pokemon in human hepatocellular carcinoma (HCC). We successfully established human HepG2 and Huh-7 cell lines in which Pokemon was stably knocked down. We demonstrated that Pokemon silencing inhibited cell prolifer...
Liu, Yanling; Zhang, Yujuan; Zheng, Xiufen; Zhang, Xusheng; Wang, Hongmei; Li, Qin; Yuan, Keng; Zhou, Nanjing; Yu, Yanrong; Song, Na; Fu, Jiamin; Min, Weiping
2016-05-31
Indoleamine 2,3-dioxygenase 2 (IDO2) is a newly discovered enzyme that catalyzes the initial and rate-limiting step in the degradation of tryptophan. As a homologous protein of IDO1, IDO2 plays an inhibitory role in T cell proliferation, and it is essential for regulatory T cell (Treg) generation in healthy conditions. Little is known about the immune-independent functions of IDO2 relevant to its specific contributions to physiology and pathophysiology in cancer cells. The purpose of this study was to assess the impact of IDO2 gene silencing as a way to inhibit B16-BL6 cancer cells in a murine model. Here, for the first time, we show that knockdown of IDO2 using small interfering RNA (siRNA) inhibits cancer cell proliferation, arrests cell cycle in G1, induces greater cell apoptosis, and reduces cell migration in vitro. Knockdown of IDO2 decreased the generation of nicotinamide adenine dinucleotide (NAD+) while increasing the generation of reactive oxygen species (ROS). We further demonstrate that cell apoptosis, induced by IDO2 downregulation, can be weakened by addition of exogenous NAD+, suggesting a novel mechanism by which IDO2 promotes tumor growth through its metabolite product NAD+. In addition to in vitro findings, we also demonstrate that IDO2 silencing in tumor cells using short hairpin RNA (shRNA) delayed tumor formation and arrested tumor growth in vivo. In conclusion, this study demonstrates a new non-immune-associated mechanism of IDO2 in vitro and IDO2 expression in B16-BL6 cells contributes to cancer development and progression. Our research provides evidence of a novel target for gene silencing that has the potential to enhance cancer therapy.
Choosing Silence for Equality in and through Schooling
Lees, Helen E.
2016-01-01
This article considers silences and equality as combined from a theoretical perspective. Equality in and through chosen, deliberate and regular silence experience is seen as an equaliser: if no one is speaking no one can dominate. The article uses a bifurcated concept of silence: weak, negative forms and strong, positive forms. Only the strong…
Onyilo, Francis; Tusiime, Geoffrey; Tripathi, Jaindra N; Chen, Li-Hung; Falk, Bryce; Stergiopoulos, Ioannis; Tushemereirwe, Wilberforce; Kubiriba, Jerome; Tripathi, Leena
2018-01-01
Pseudocercospora fijiensis , causal agent of the black Sigatoka disease (BSD) of Musa spp., has spread globally since its discovery in Fiji 1963 to all the banana and plantain growing areas across the globe. It is becoming the most damaging and economically important disease of this crop. The identification and characterization of genes that regulate infection processes and pathogenicity in P. fijiensis will provide important knowledge for the development of disease-resistant cultivars. In many fungal plant pathogens, the Fus3 and Slt2 are reported to be essential for pathogenicity. Fus3 regulates filamentous-invasion pathways including the formation of infection structures, sporulation, virulence, and invasive and filamentous growth, whereas Slt2 is involved in the cell-wall integrity pathway, virulence, invasive growth, and colonization in host tissues. Here, we used RNAi-mediated gene silencing to investigate the role of the Slt2 and Fus3 homologs in P. fijiensis in pathogen invasiveness, growth and pathogenicity. The PfSlt2 and PfFus3 silenced P. fijiensis transformants showed significantly lower gene expression and reduced virulence, invasive growth, and lower biomass in infected leaf tissues of East African Highland Banana (EAHB). This study suggests that Slt2 and Fus3 MAPK signaling pathways play important roles in plant infection and pathogenic growth of fungal pathogens. The silencing of these vital fungal genes through host-induced gene silencing (HIG) could be an alternative strategy for developing transgenic banana and plantain resistant to BSD.
Directory of Open Access Journals (Sweden)
Francis Onyilo
2018-03-01
Full Text Available Pseudocercospora fijiensis, causal agent of the black Sigatoka disease (BSD of Musa spp., has spread globally since its discovery in Fiji 1963 to all the banana and plantain growing areas across the globe. It is becoming the most damaging and economically important disease of this crop. The identification and characterization of genes that regulate infection processes and pathogenicity in P. fijiensis will provide important knowledge for the development of disease-resistant cultivars. In many fungal plant pathogens, the Fus3 and Slt2 are reported to be essential for pathogenicity. Fus3 regulates filamentous-invasion pathways including the formation of infection structures, sporulation, virulence, and invasive and filamentous growth, whereas Slt2 is involved in the cell-wall integrity pathway, virulence, invasive growth, and colonization in host tissues. Here, we used RNAi-mediated gene silencing to investigate the role of the Slt2 and Fus3 homologs in P. fijiensis in pathogen invasiveness, growth and pathogenicity. The PfSlt2 and PfFus3 silenced P. fijiensis transformants showed significantly lower gene expression and reduced virulence, invasive growth, and lower biomass in infected leaf tissues of East African Highland Banana (EAHB. This study suggests that Slt2 and Fus3 MAPK signaling pathways play important roles in plant infection and pathogenic growth of fungal pathogens. The silencing of these vital fungal genes through host-induced gene silencing (HIG could be an alternative strategy for developing transgenic banana and plantain resistant to BSD.
siRNA-mediated Erc gene silencing suppresses tumor growth in Tsc2 mutant renal carcinoma model.
Imamura, Osamu; Okada, Hiroaki; Takashima, Yuuki; Zhang, Danqing; Kobayashi, Toshiyuki; Hino, Okio
2008-09-18
Silencing of gene expression by small interfering RNAs (siRNAs) is rapidly becoming a powerful tool for genetic analysis and represents a potential strategy for therapeutic product development. However, there are no reports of systemic delivery of siRNAs for stable treatment except short hairpin RNAs (shRNAs). On the other hand, there are many reports of systemic delivery of siRNAs for transient treatment using liposome carriers and others. With regard to shRNAs, a report showed fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Therefore, we decided to use original siRNA microspheres instead of shRNA for stable treatment of disease. In this study, we designed rat-specific siRNA sequences for Erc/mesothelin, which is a tumor-specific gene expressed in the Eker (Tsc2 mutant) rat model of hereditary renal cancer and confirmed the efficacy of gene silencing in vitro. Then, by using siRNA microspheres, we found that the suppression of Erc/mesothelin caused growth inhibition of Tsc2 mutant renal carcinoma cells in tumor implantation experiments in mice.
Energy Technology Data Exchange (ETDEWEB)
Kim, Jaewoo, E-mail: kimj@kaeri.re.kr [Nuclear Materials Research Division, Korea Atomic Energy Research Institute, 111-989 Daeduck-daero, Yuseong-gu, Daejeon-si 305-353 (Korea, Republic of); WCI Quantum Beam based Radiation Research Center, Korea Atomic Energy Research Institute, 111-989 Daeduck-daero, Yuseong-gu, Daejeon-si 305-353 (Korea, Republic of); Missouri University Research Reactor, University of Missouri-Columbia, Columbia, MO 65211 (United States); Lee, Byung-Chul [Nuclear Reactor Core Design Division, Korea Atomic Energy Research Institute, 111-989 Daeduck-daero, Yuseong-gu, Daejeon-si 305-353 (Korea, Republic of); Uhm, Young Rang [Radioisotopes Research Division, Korea Atomic Energy Research Institute, 111-989 Daeduck-daero, Yuseong-gu, Daejeon-si 305-353 (Korea, Republic of); Miller, William H. [Missouri University Research Reactor, University of Missouri-Columbia, Columbia, MO 65211 (United States)
2014-10-15
Highlights: • Preparation of B{sub 4}C and BN nanopowders using a simple ball milling process. • Homogeneous dispersion and strong adhesion of nano-B{sub 4}C and -BN with polymer matrix. • Enhancement of mechanical properties of the nanocomposites compared to their micro counterparts. • Enhancement of thermal neutron attenuation of the nanocomposites. - Abstract: Nano-sized boron carbide (B{sub 4}C) and boron nitride (BN) powder were prepared using ball milling. Micro- and milled nano-powders were melt blended with high density polyethylene (HDPE) using a polymer mixer followed by hot pressing to fabricate sheet composites. The tensile and flexural strengths of HDPE nanocomposites were ∼20% higher than their micro counterparts, while those for latter decreased compared to neat HDPE. Thermal neutrons attenuation of the prepared HDPE nanocomposites was evaluated using a monochromatic ∼0.025 eV neutron beam. Thermal neutron attenuation of the HDPE nanocomposites was greatly enhanced compared to their micro counterparts at the same B-10 areal densities. Monte Carlo n-Particles (MCNP) simulations based on the lattice structure modeling also shows the similar filler size dependent thermal neutron absorption.
Methylation and silencing of the retinoic acid receptor-β2 gene in cervical cancer
International Nuclear Information System (INIS)
Ivanova, Tatyana; Petrenko, Anatolii; Gritsko, Tatyana; Vinokourova, Svetlana; Eshilev, Ernest; Kobzeva, Vera; Kisseljov, Fjodor; Kisseljova, Natalia
2002-01-01
Expression of the retinoic acid receptor β2 (RAR-β2), a putative tumor suppressor gene, is reduced in various human cancers, including squamous cell carcinomas (SCC) of the uterine cervix. The mechanism of the inhibition of RAR-β2 expression remains obscure. We examined whether methylation of RAR-β2 gene could be responsible for this silencing in cervical SCC. Expression of RAR-β2 mRNA and methylation status of the 5' region of RAR-β2 gene were examined in 20 matched specimens from patients with cervical SCC and in three cervical cancer cell lines by Northern blot analysis and methylation-specific PCR (MSP) assay or Southern blot analysis respectively. In 8 out 20 cervical SCC (40%) the levels of RAR-β2 mRNA were decreased or undetectable in comparison with non-neoplastic cervix tissues. All 8 tumors with reduced levels of RAR-β2 mRNA expression showed methylation of the promoter and the first exon expressed in the RAR-β2 transcript. The RAR-β2 gene from non-neoplastic cervical tissues was mostly unmethylated and expressed, but methylated alleles of the gene were found in three samples of the morphologically normal tissues adjacent to the tumors. Three cervical cancer cell lines with extremely low level of RAR-β2 mRNA expression, SiHA, HeLA and CaSki, also showed methylation of this region of the RAR-β2 gene. These findings suggest that methylation of the 5' region of RAR-β2 gene may contribute to gene silencing and that methylation of this region may be an important and early event in cervical carcinogenesis. These findings may be useful to make retinoids more effective as preventive and therapeutic agents in combination with inhibitors of DNA methylation
DEFF Research Database (Denmark)
Hammer, Karin; Jensen, Kaj Frank; Poulsen, Peter
1987-01-01
Escherichia coli mutants simultaneously resistant to rifampin and to the lethal effects of bacteriophage lambda cII protein were isolated. The sck mutant strains carry alterations in rpoB that allow them to survive cII killing (thus the name sck), but that do not impair either the expression of c......II or the activation by cII of the lambda promoters pE and pI. The sck-1, sck-2, and sck-3 mutations modify transcription termination. The growth of lambda, but not of the N-independent lambda variant, lambda nin-5, is hindered by these mutations, which act either alone or in concert with the bacterial nusA1 mutation....... In contrast to their effect on lambda growth, the three mutations reduce transcription termination in bacterial operons. The E. coli pyrE gene, which is normally regulated by attenuation, is expressed constitutively in the mutant strains. The sck mutations appear to prevent pyrE attenuation by slowing...
Directory of Open Access Journals (Sweden)
Yuyang Du
2018-04-01
Full Text Available Araloside C (AsC is a cardioprotective triterpenoid compound that is mainly isolated from Aralia elata. This study aims to determine the effects of AsC on hypoxia-reoxygenation (H/R-induced apoptosis in H9c2 cardiomyocytes and its underlying mechanisms. Results demonstrated that pretreatment with AsC (12.5 μM for 12 h significantly suppressed the H/R injury in H9c2 cardiomyocytes, including improving cell viability, attenuating the LDH leakage and preventing cardiomyocyte apoptosis. AsC also inhibited H/R-induced ER stress by reducing the activation of ER stress pathways (PERK/eIF2α and ATF6, and decreasing the expression of ER stress-related apoptotic proteins (CHOP and caspase-12. Moreover, AsC greatly improved the expression level of HSP90 compared with that in the H/R group. The use of HSP90 inhibitor 17-AAG and HSP90 siRNA blocked the above suppression effect of AsC on ER stress-related apoptosis caused by H/R. Taken together, AsC could reduce H/R-induced apoptosis possibly because it attenuates ER stress-dependent apoptotic pathways by increasing HSP90 expression.
Delfosse, Verónica C; Agrofoglio, Yamila C; Casse, María F; Kresic, Iván Bonacic; Hopp, H Esteban; Ziegler-Graff, Véronique; Distéfano, Ana J
2014-02-13
Plants employ RNA silencing as a natural defense mechanism against viruses. As a counter-defense, viruses encode silencing suppressor proteins (SSPs) that suppress RNA silencing. Most, but not all, the P0 proteins encoded by poleroviruses have been identified as SSP. In this study, we demonstrated that cotton leafroll dwarf virus (CLRDV, genus Polerovirus) P0 protein suppressed local silencing that was induced by sense or inverted repeat transgenes in Agrobacterium co-infiltration assay in Nicotiana benthamiana plants. A CLRDV full-length infectious cDNA clone that is able to infect N. benthamiana through Agrobacterium-mediated inoculation also inhibited local silencing in co-infiltration assays, suggesting that the P0 protein exhibits similar RNA silencing suppression activity when expressed from the full-length viral genome. On the other hand, the P0 protein did not efficiently inhibit the spread of systemic silencing signals. Moreover, Northern blotting indicated that the P0 protein inhibits the generation of secondary but not primary small interfering RNAs. The study of CLRDV P0 suppression activity may contribute to understanding the molecular mechanisms involved in the induction of cotton blue disease by CLRDV infection. Copyright © 2013 Elsevier B.V. All rights reserved.
[E. M. Jellinek's silenced and silencing transgenerational story].
Kelemen, Gábor; Márk, Mónika
2013-01-01
Jellinek is a kind of archetypal character for future generations in the field of addiction studies. His implosion in the arena of alcoholism around the age of 50 was an unexpected challenge to medical science. We know very little about his own role models giving an intellectual and moral compass to his pragmatic creativity. More than 30 years has passed since Jellinek's death when an American sociologist Ron Roizen started unearthing his silent story. Roizen discerned that there are a lot of unsaid and muted issues in his personal Hungarian past. Our paper, based on the authors' research in Hungarian archives and other sources reveals that not just Jellinek's personal but his transgenerational narrative has been not-yet-said. This silenced and silencing history appears an unfinished business of acculturation of the family, which started prior to four generations. Authors have been concluding that the issue of religious conversion is a critical point in the process of acculturation. They examine the counter move of loyalty to family values and driving force of assimilation making their story unspeakable.
Directory of Open Access Journals (Sweden)
Đerić Gordana
2007-01-01
Full Text Available Wars of the last decade of the 20th century in former Yugoslavia have brought the whole region into the center of media attention and, accordingly, have aroused interest of the western academic theory. Since the latest ′discovery of the Balkans′ was brought into being precisely due to wars, one shouldn’t be surprised to find that many academic approaches to questions of Yugoslavia dismemberment are biased, superficial or exotic. On the other hand, Serbian academic auditorium was far from being active in elaborating questions of its own contemporality and closest past - for various reasons, but mostly because of its detachment from systematic explorations. Thus, acknowledgement and presentations of mentioned issues were left to be the job of media publicists, others outside of academic community or were left to be treated in the time to come. Domestic scholars were rarely intrigued to deal with these matters, despite the fact that images of recent wars were often built on stereotypes and propaganda and that the formed knowledge of the entire subject suffered from severe simplification. The themes of great violence were particularly avoided which left some of the crucial war events out of the academic focus - the reason being, very probably, the estimation that what made Serbia and the region worldwide known is best to be forgotten. Contemporary academic silence on recent wars, in retrospection, could easily be placed within the continuum of silence during the socialist period and war which preceded it. Having all mentioned in mind, this paper not only investigates reasons for avoiding the issues of the nearest past and influences of silence in socialism on what came afterwards, but also highlights the importance of exploring semantics and functions of silence and silencing in recent wars, as well as the relationship between silence and social memory constructions.
Directory of Open Access Journals (Sweden)
Peter V Usatyuk
Full Text Available Coronins are a highly conserved family of actin binding proteins that regulate actin-dependent processes such as cell motility and endocytosis. We found that treatment of human pulmonary artery endothelial cells (HPAECs with the bioactive lipid, sphingosine-1-phosphate (S1P rapidly stimulates coronin 1B translocation to lamellipodia at the cell leading edge, which is required for S1P-induced chemotaxis. Further, S1P-induced chemotaxis of HPAECs was attenuated by pretreatment with small interfering RNA (siRNA targeting coronin 1B (∼36%, PLD2 (∼45% or Rac1 (∼50% compared to scrambled siRNA controls. Down regulation PLD2 expression by siRNA also attenuated S1P-induced coronin 1B translocation to the leading edge of the cell periphery while PLD1 silencing had no effect. Also, S1P-induced coronin 1B redistribution to cell periphery and chemotaxis was attenuated by inhibition of Rac1 and over-expression of dominant negative PKC δ, ε and ζ isoforms in HPAECs. These results demonstrate that S1P activation of PLD2, PKC and Rac1 is part of the signaling cascade that regulates coronin 1B translocation to the cell periphery and the ensuing cell chemotaxis.
Jiang, Guangming; Wan, Xiaoju; Wang, Ming; Zhou, Jianhua; Pan, Jian; Wang, Baolong
2016-08-01
Mouse embryonic fibroblasts (MEFs) are widely used to prepare feeder layers for culturing embryonic stem cells (ESCs) or induced pluripotent stem cells (iPSCs) in vitro. Transportation lesions and exorbitant prices make the commercially obtained MEFs unsuitable for long term research. The aim of present study is to establish a method, which enables researchers to gain MEFs from mice and establish feeder layers by themselves in ordinary laboratories. MEFs were isolated from ICR mouse embryos at 12.5-17.5 day post-coitum (DPC) and cultured in vitro. At P2-P7, the cells were inactivated with mitomycin C or by X-ray irradiation. Then they were used to prepare feeder layers. The key factors of the whole protocol were analyzed to determine the optimal conditions for the method. The results revealed MEFs isolated at 12.5-13.5 DPC, and cultured to P3 were the best choice for feeder preparation, those P2 and P4-P5 MEFs were also suitable for the purpose. The P3-P5 MEFs treated with 10 μg/ml of mitomycin C for 3 h, or irradiated with X-ray at 1.5 Gy/min for 25 Gy were the most suitable feeder cells. Treating MEFs with 10 μg/ml of mitomycin C for 2.5 h, 15 μg/ml for 2.0 h, or irradiating the cells with 20 Gy of X-ray at 2.0 Gy/min could all serve as alternative methods for P3-P4 cells. Our study provides a reliable and economical way to obtain large amount of qualified MEFs for long term research of ESCs or iPSCs.
Transcriptional Silencing of Retroviral Vectors
DEFF Research Database (Denmark)
Lund, Anders Henrik; Duch, M.; Pedersen, F.S.
1996-01-01
. Extinction of long-term vector expression has been observed after implantation of transduced hematopoietic cells as well as fibroblasts, myoblasts and hepatocytes. Here we review the influence of vector structure, integration site and cell type on transcriptional silencing. While down-regulation of proviral...... transcription is known from a number of cellular and animal models, major insight has been gained from studies in the germ line and embryonal cells of the mouse. Key elements for the transfer and expression of retroviral vectors, such as the viral transcriptional enhancer and the binding site for the t......RNA primer for reverse transcription may have a major influence on transcriptional silencing. Alterations of these elements of the vector backbone as well as the use of internal promoter elements from housekeeping genes may contribute to reduce transcriptional silencing. The use of cell culture and animal...
Genome-wide methylation analysis identifies genes silenced in non-seminoma cell lines.
Noor, Dzul Azri Mohamed; Jeyapalan, Jennie N; Alhazmi, Safiah; Carr, Matthew; Squibb, Benjamin; Wallace, Claire; Tan, Christopher; Cusack, Martin; Hughes, Jaime; Reader, Tom; Shipley, Janet; Sheer, Denise; Scotting, Paul J
2016-01-01
Silencing of genes by DNA methylation is a common phenomenon in many types of cancer. However, the genome-wide effect of DNA methylation on gene expression has been analysed in relatively few cancers. Germ cell tumours (GCTs) are a complex group of malignancies. They are unique in developing from a pluripotent progenitor cell. Previous analyses have suggested that non-seminomas exhibit much higher levels of DNA methylation than seminomas. The genomic targets that are methylated, the extent to which this results in gene silencing and the identity of the silenced genes most likely to play a role in the tumours' biology have not yet been established. In this study, genome-wide methylation and expression analysis of GCT cell lines was combined with gene expression data from primary tumours to address this question. Genome methylation was analysed using the Illumina infinium HumanMethylome450 bead chip system and gene expression was analysed using Affymetrix GeneChip Human Genome U133 Plus 2.0 arrays. Regulation by methylation was confirmed by demethylation using 5-aza-2-deoxycytidine and reverse transcription-quantitative PCR. Large differences in the level of methylation of the CpG islands of individual genes between tumour cell lines correlated well with differential gene expression. Treatment of non-seminoma cells with 5-aza-2-deoxycytidine verified that methylation of all genes tested played a role in their silencing in yolk sac tumour cells and many of these genes were also differentially expressed in primary tumours. Genes silenced by methylation in the various GCT cell lines were identified. Several pluripotency-associated genes were identified as a major functional group of silenced genes.
Listen and the question of silence
DEFF Research Database (Denmark)
Doubinsky, Sebastien
2018-01-01
Listen is a film about words, but around words. The words become useless and are surrounded by silence. And the whole film is constructed on this silence, which builds up like an unbreakable wall. The question is thus: what are we listening to? What should we listen to? And maybe, even more crucial...
Energy Technology Data Exchange (ETDEWEB)
Hsu, Ya-Yun [Department of Pharmacology, School of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Tseng, Yu-Ting [Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Lo, Yi-Ching, E-mail: yichlo@kmu.edu.tw [Department of Pharmacology, School of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China)
2013-11-01
Reactive oxygen intermediates production and apoptotic damage induced by high glucose are major causes of neuronal damage in diabetic neuropathy. Berberine (BBR), a natural antidiabetes drug with PI3K-activating activity, holds promise for diabetes because of its dual antioxidant and anti-apoptotic activities. We have previously reported that BBR attenuated H{sub 2}O{sub 2} neurotoxicity via activating the PI3K/Akt/Nrf2-dependent pathway. In this study, we further explored the novel protective mechanism of BBR on high glucose-induced apoptotic death and neurite damage of SH-SY5Y cells. Results indicated BBR (0.1–10 nM) significantly attenuated reactive oxygen species (ROS) production, nucleus condensation, and apoptotic death in high glucose-treated cells. However, AG1024, an inhibitor of insulin growth factor-1 (IGF-1) receptor, significantly abolished BBR protection against high glucose-induced neuronal death. BBR also increased Bcl-2 expression and decreased cytochrome c release. High glucose down-regulated IGF-1 receptor and phosphorylation of Akt and GSK-3β, the effects of which were attenuated by BBR treatment. BBR also activated nuclear erythroid 2-related factor 2 (Nrf2), the key antioxidative transcription factor, which is accompanied with up-regulation of hemeoxygenase-1 (HO-1). Furthermore, BBR markedly enhanced nerve growth factor (NGF) expression and promoted neurite outgrowth in high glucose-treated cells. To further determine the role of the Nrf2 in BBR neuroprotection, RNA interference directed against Nrf2 was used. Results indicated Nrf2 siRNA abolished BBR-induced HO-1, NGF, neurite outgrowth and ROS decrease. In conclusion, BBR attenuated high glucose-induced neurotoxicity, and we are the first to reveal this novel mechanism of BBR as an Nrf2 activator against glucose neurotoxicity, providing another potential therapeutic use of BBR on the treatment of diabetic complications. - Highlights: • BBR attenuates high glucose-induced ROS
International Nuclear Information System (INIS)
Hsu, Ya-Yun; Tseng, Yu-Ting; Lo, Yi-Ching
2013-01-01
Reactive oxygen intermediates production and apoptotic damage induced by high glucose are major causes of neuronal damage in diabetic neuropathy. Berberine (BBR), a natural antidiabetes drug with PI3K-activating activity, holds promise for diabetes because of its dual antioxidant and anti-apoptotic activities. We have previously reported that BBR attenuated H 2 O 2 neurotoxicity via activating the PI3K/Akt/Nrf2-dependent pathway. In this study, we further explored the novel protective mechanism of BBR on high glucose-induced apoptotic death and neurite damage of SH-SY5Y cells. Results indicated BBR (0.1–10 nM) significantly attenuated reactive oxygen species (ROS) production, nucleus condensation, and apoptotic death in high glucose-treated cells. However, AG1024, an inhibitor of insulin growth factor-1 (IGF-1) receptor, significantly abolished BBR protection against high glucose-induced neuronal death. BBR also increased Bcl-2 expression and decreased cytochrome c release. High glucose down-regulated IGF-1 receptor and phosphorylation of Akt and GSK-3β, the effects of which were attenuated by BBR treatment. BBR also activated nuclear erythroid 2-related factor 2 (Nrf2), the key antioxidative transcription factor, which is accompanied with up-regulation of hemeoxygenase-1 (HO-1). Furthermore, BBR markedly enhanced nerve growth factor (NGF) expression and promoted neurite outgrowth in high glucose-treated cells. To further determine the role of the Nrf2 in BBR neuroprotection, RNA interference directed against Nrf2 was used. Results indicated Nrf2 siRNA abolished BBR-induced HO-1, NGF, neurite outgrowth and ROS decrease. In conclusion, BBR attenuated high glucose-induced neurotoxicity, and we are the first to reveal this novel mechanism of BBR as an Nrf2 activator against glucose neurotoxicity, providing another potential therapeutic use of BBR on the treatment of diabetic complications. - Highlights: • BBR attenuates high glucose-induced ROS production and
Directory of Open Access Journals (Sweden)
Tatsuya eKon
2014-11-01
Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.
The ethics of silence: Does conflict of interest explain employee silence?
Anderson, James
2018-03-01
Employee silence constitutes a significant threat to organizational success. This article argues that silence is a by-product of a structural Conflict of Interest (COI) between employees and their employers. This argument turns on the claim, also defended here, that employees are in a privileged position vis-à-vis knowledge of their work and that leaders-whether they recognize it or not-are dependent on their employees for reliable information about the work they are doing. Employee voice, therefore, is an organizational necessity. It is also a moral achievement as it involves risking one's personal interests for the sake of the organization. Leaders must take steps to mitigate COI and encourage employee voice; this article provides several strategies for doing exactly that.
Silence as a Response to Everyday Violence
DEFF Research Database (Denmark)
Gammeltoft, Tine
2016-01-01
Across the world, existing research indicates that many women respond with silence to marital abuse. This article offers an ethnographic investigation of the social and psychic forces behind Vietnamese women’s silencing of violence and a theoretical exploration of how the psychoanalytic concept...... of fantasy—understood as unconscious or subconscious mental processes—may contribute to the analysis of everyday violence and psychic distress. Distinguishing between what I term deliberate and subconscious silence, I explore the role that fantasy plays when Vietnamese women silently endure intimate partner...
MicroRNA-Mediated Myostatin Silencing in Caprine Fetal Fibroblasts
Zhong, Bushuai; Zhang, Yanli; Yan, Yibo; Wang, Ziyu; Ying, Shijia; Huang, Mingrui; Wang, Feng
2014-01-01
Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi) mediated by microRNAs (miRNAs) is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF) was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN) response genes, such as interferon beta (IFN-β) and 2′-5′-oligoadenylate synthetase 2 (OAS2), were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats. PMID:25244645
MicroRNA-mediated myostatin silencing in caprine fetal fibroblasts.
Directory of Open Access Journals (Sweden)
Bushuai Zhong
Full Text Available Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi mediated by microRNAs (miRNAs is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN response genes, such as interferon beta (IFN-β and 2'-5'-oligoadenylate synthetase 2 (OAS2, were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats.
Silencing effect of shRNA expression vectors with stem length of 21 ...
African Journals Online (AJOL)
AJL
2011-02-14
Feb 14, 2011 ... construct itself or its delivery vehicle (Rao et al., 2009). Through choosing ... Cell culture, transfection and intramuscular injection. MEFs were isolated ..... A system for stable expression of ... Adv. Drug Deliv. Rev. 61: 746-759.
Down-Regulation of Gene Expression by RNA-Induced Gene Silencing
Travella, Silvia; Keller, Beat
Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.
The LIM-only protein FHL2 attenuates lung inflammation during bleomycin-induced fibrosis.
Directory of Open Access Journals (Sweden)
Abdulaleem Alnajar
Full Text Available Fibrogenesis is usually initiated when regenerative processes have failed and/or chronic inflammation occurs. It is characterised by the activation of tissue fibroblasts and dysregulated synthesis of extracellular matrix proteins. FHL2 (four-and-a-half LIM domain protein 2 is a scaffolding protein that interacts with numerous cellular proteins, regulating signalling cascades and gene transcription. It is involved in tissue remodelling and tumour progression. Recent data suggest that FHL2 might support fibrogenesis by maintaining the transcriptional expression of alpha smooth muscle actin and the excessive synthesis and assembly of matrix proteins in activated fibroblasts. Here, we present evidence that FHL2 does not promote bleomycin-induced lung fibrosis, but rather suppresses this process by attenuating lung inflammation. Loss of FHL2 results in increased expression of the pro-inflammatory matrix protein tenascin C and downregulation of the macrophage activating C-type lectin receptor DC-SIGN. Consequently, FHL2 knockout mice developed a severe and long-lasting lung pathology following bleomycin administration due to enhanced expression of tenascin C and impaired activation of inflammation-resolving macrophages.
Galectin-3 mediates cross-talk between K-Ras and Let-7c tumor suppressor microRNA.
Directory of Open Access Journals (Sweden)
Ran Levy
Full Text Available BACKGROUND: Galectin-3 (Gal-3 and active (GTP-bound K-Ras contribute to the malignant phenotype of many human tumors by increasing the rate of cell proliferation, survival, and migration. These Gal-3-mediated effects result from a selective binding to K-Ras.GTP, causing increased nanoclustering in the cell membrane and leading to robust Ras signaling. Regulation of the interactions between Gal-3 and active K-Ras is not fully understood. METHODS AND FINDINGS: To gain a better understanding of what regulates the critical interactions between these two proteins, we examined the role of Gal-3 in the regulation of K-Ras by using Gal-3-knockout mouse embryonic-fibroblasts (Gal-3-/- MEFs and/or Gal-3/Gal-1 double-knockout MEFs. We found that knockout of Gal-3 induced strong downregulation (∼60% of K-Ras and K-Ras.GTP. The downregulation was somewhat more marked in the double-knockout MEFs, in which we also detected robust inhibition(∼50% of ERK and Akt activation. These additional effects are probably attributable to inhibition of the weak interactions of K-Ras.GTP with Gal-1. Re-expression of Gal-3 reversed the phenotype of the Gal-3-/- MEFs and dramatically reduced the disappearance of K-Ras in the presence of cycloheximide to the levels seen in wild-type MEFs. Furthermore, phosphorylation of Gal-3 by casein kinase-1 (CK-1 induced translocation of Gal-3 from the nucleus to the cytoplasm and the plasma membrane, leading to K-Ras stabilization accompanied by downregulation of the tumor suppressor miRNA let-7c, known to negatively control K-Ras transcription. CONCLUSIONS: Our results suggest a novel cross-talk between Gal-3-mediated downregulation of let 7c microRNA (which in turn negatively regulates K-Ras transcription and elucidates the association among Gal-3 let-7c and K-Ras transcription/translation, cellular compartmentalization and activity.
Energy Technology Data Exchange (ETDEWEB)
Yamshchikov, Vladimir, E-mail: yaximik@gmail.com; Manuvakhova, Marina; Rodriguez, Efrain
2016-01-15
Direct attenuation of West Nile (WN) virus strain NY99 for the purpose of vaccine development is not feasible due to its high virulence and pathogenicity. Instead, we created highly attenuated chimeric virus W1806 with the serological identity of NY99. To further attenuate W1806, we investigated effects of mutations found in Japanese encephalitis virus vaccine SA14-14-2. WN viruses carrying all attenuating mutations lost infectivity in mammalian, but not in mosquito cells. No single reversion restored infectivity in mammalian cells, although increased infectivity in mosquito cells was observed. To identify a subset of mutations suitable for further attenuation of W1806, we analyzed effects of E{sub 138}K and K{sub 279}M changes on virulence, growth properties, and immunogenicity of derivatized W956, from which chimeric W1806 inherited its biological properties and attenuation profile. Despite strong dominant attenuating effect, introduction of only two mutations was not sufficient for attenuating W1806 to the safety level acceptable for human use. - Highlights: • Further attenuation of a WN vaccine precursor is outlined. • Effect of SA14-14-2 attenuating mutations is tested. • Mechanism of attenuation is proposed and illustrated. • The need for additional attenuating mutations is justified.
Reactivation of CDX2 in Gastric Cancer as Mark for Gene Silencing Memory
International Nuclear Information System (INIS)
Kameoka, Yuri; Kitazawa, Riko; Ariasu, Kanazu; Tachibana, Ryosuke; Mizuno, Yosuke; Haraguchi, Ryuma; Kitazawa, Sohei
2015-01-01
To explore the epigenetic mechanism that reactivates CDX2 (a homeobox transcription factor that serves as a tumor-suppressor gene) in intestinal-type gastric cancer during cancer progression, we examined the methylation status of the CDX2 gene promoter and the expression pattern of methyl-CpG binding protein-2 (MeCP2). From archives of the pathology records of surgically excised advanced stomach cancer cases in the Department of Molecular Pathology, Ehime University in a past decate (n=265), 10 cases of intestinal-type tubular adenocarcinoma, well-differentiated type (wel) with minor poorly-differentiated adenocarcinoma (por) components were selected. The expression pattern of CDX2, MUC2 and MeCP2 in these 10 cases was analyzed by immunohistochemistry. The cancerous and non-cancerous areas were selectively obtained by microdissection, and the methylation status of the CDX2 promoter of each area was assessed by methylation-specific polymerase chain reaction (MSP). In all 10 cases, CDX2 expression was clearly observed in the nucleus of the non-cancerous background of the intestinal metaplasic area, where the unmethylation pattern of the CDX2 gene promoter prevailed with reduced MeCP2 expression. In this metaplastic area, CDX2 expression was co-localized with its target gene, MUC2. CDX2 expression then disappeared from the deep invasive wel area. Reflecting the reduced CDX2 expression, microdissected samples from all the wel areas showed hypermethylation of the CDX2 gene promoter by MSP, with prominent MeCP2 expression. Interestingly, while hypermethylation of the CDX2 gene promoter was maintained in the por area in 8 of the 10 cases, CDX2 expression was restored in por areas where MeCP2 expression was markedly and selectively reduced. The other two cases, however, showed a constant MeCP2 expression level comparable to the surrounding deep invasive wel area with negative CDX2 expression. Therefore, gene silencing by hypermethylation may be overcome by the reduction of
Untereiner, Ashley A; Oláh, Gabor; Módis, Katalin; Hellmich, Mark R; Szabo, Csaba
2017-07-15
Cystathionine-β-synthase (CBS) is upregulated and hydrogen sulfide (H 2 S) production is increased in colon cancer cells. The functional consequence of this response is stimulation of cellular bioenergetics and tumor growth and proliferation. Lactate dehydrogenase A (LDHA) is also upregulated in various colon cancer cells and has been previously implicated in tumor cell bioenergetics and proliferation. In the present study, we sought to determine the potential interaction between the H 2 S pathway and LDH activity in the control of bioenergetics and proliferation of colon cancer, using the colon cancer line HCT116. Low concentrations of GYY4137 (a slow-releasing H 2 S donor) enhanced mitochondrial function (oxygen consumption, ATP production, and spare respiratory capacity) and glycolysis in HCT116 cells. SiRNA-mediated transient silencing of LDHA attenuated the GYY4137-induced stimulation of mitochondrial respiration, but not of glycolysis. H 2 S induced the S-sulfhydration of Cys163 in recombinant LDHA, and stimulated LDHA activity. The H 2 S-induced stimulation of LDHA activity was absent in C163A LDHA. As shown in HCT116 cell whole extracts, in addition to LDHA activation, GYY4137 also stimulated LDHB activity, although to a smaller extent. Total cellular lactate and pyruvate measurements showed that in HCT116 cells LDHA catalyzes the conversion of pyruvate to lactate. Total cellular lactate levels were increased by GYY4137 in wild-type cells (but not in cells with LDHA silencing). LDHA silencing sensitized HCT116 cells to glucose oxidase (GOx)-induced oxidative stress; this was further exacerbated with GYY4137 treatment. Treatment with low concentrations of GYY4137 (0.3mM) or GOx (0.01U/ml) significantly increased the proliferation rate of HCT116 cells; the effect of GOx, but not the effect of GYY4137 was attenuated by LDHA silencing. The current report points to the involvement of LDHA in the stimulatory effect of H 2 S on mitochondrial respiration in colon
Mutuality, Self-Silencing, and Disordered Eating in College Women
Wechsler, Lisa S.; Riggs, Shelley A.; Stabb, Sally D.; Marshall, David M.
2006-01-01
The current study examined patterns of association among mutuality, self-silencing, and disordered eating in an ethnically diverse sample of college women (N = 149). Partner mutuality and overall self-silencing were negatively correlated and together were associated with six disordered eating indices. All four self-silencing subscales were…
Niso-Santano, Mireia; González-Polo, Rosa A; Bravo-San Pedro, José M; Gómez-Sánchez, Rubén; Lastres-Becker, Isabel; Ortiz-Ortiz, Miguel A; Soler, Germán; Morán, José M; Cuadrado, Antonio; Fuentes, José M
2010-05-15
Although oxidative stress is fundamental to the etiopathology of Parkinson disease, the signaling molecules involved in transduction after oxidant exposure to cell death are ill-defined, thus making it difficult to identify molecular targets of therapeutic relevance. We have addressed this question in human dopaminergic neuroblastoma SH-SY5Y cells exposed to the parkinsonian toxin paraquat (PQ). This toxin elicited a dose-dependent increase in reactive oxygen species and cell death that correlated with activation of ASK1 and the stress kinases p38 and JNK. The relevance of these kinases in channeling PQ neurotoxicity was demonstrated with the use of interference RNA for ASK1 and two well-established pharmaceutical inhibitors for JNK and p38. The toxic effect of PQ was substantially attenuated by preincubation with vitamin E, blocking ASK1 pathways and preventing oxidative stress and cell death. In a search for a physiological pathway that might counterbalance PQ-induced ASK1 activation, we analyzed the role of the transcription factor Nrf2, master regulator of redox homeostasis, and its target thioredoxin (Trx), which binds and inhibits ASK1. Trx levels were undetectable in Nrf2-deficient mouse embryo fibroblasts (MEFs), whereas they were constitutively high in Keap1-deficient MEFs as well as in SH-SY5Y cells treated with sulforaphane (SFN). Consistent with these data, Nrf2-deficient MEFs were more sensitive and Keap1-deficient MEFs and SH-SY5Y cells incubated with SFN were more resistant to PQ-induced cell death. This study identifies ASK1/JNK and ASK1/p38 as two critical pathways involved in the activation of cell death under oxidative stress conditions and identifies the Nrf2/Trx axis as a new target to block these pathways and protect from oxidant exposure such as that found in Parkinson and other neurodegenerative diseases. Copyright 2010 Elsevier Inc. All rights reserved.
Precedents and consequences of prosocial behaviors of voice and silence
Directory of Open Access Journals (Sweden)
Alicia Omar
2015-09-01
Full Text Available Prosocial behavior is that which that encourages solidarity and harmony in interpersonal relationships, and produce personal or collective benefits. Although early research on job prosociality was focused on the study of conventional behaviors such as help, courtesy and sportsmanship, the identification and operationalization of new dimensions is rapidly expanding this nomological network. Such is the case of prosocial voice and prosocial silence, recently introduced in the scientific literature. The aim of this study is to explore possible relationships between employee’s voice and employee’s silence, and their personality structure; and examine the role of interpersonal justice perceptions on such relationships. We worked with a sample of 316 employees- aged 37 years and holding a 4.2-year signority working at public and private companies in southern and central Rosario (Argentina. The subjects completed Colquitt’ Justice Organizational Scale, Eysenck Personality Questionnaire, and Van Dyne’s Prosocial Voice and Prosocial Silence Scales. Extraversion and neuroticism emerged as the strongest predictors of prosocial voice and prosocial silence, respectively. Interpersonal justice perceptions emerged as moderators of the ‘natural’ tendency of extraverted workers to engage in prosocial voice, and emotionally controlled workers to engage in prosocial silence. Such findings would indicate that the promotion of high levels of interpersonal justice on job contexts could help workers to engage in more prosocial behavior with positive effects for the organization.
Reshma, P L; Lekshmi, V S; Sankar, Vandana; Raghu, K G
2015-06-01
Tribulus terrestris L. was evaluated for its cardioprotective property against myocardial ischemia in a cell line model. Initially, methanolic extract was prepared and subjected to sequential extraction with various solvents. The extract with high phenolic content (T. terrestris L. ethyl acetate extract-TTME) was further characterized for its chemical constituents and taken forward for evaluation against cardiac ischemia. HPLC analysis revealed the presence of phenolic compounds like caffeic acid (12.41 ± 0.22 mg g(-1)), chlorogenic acid (0.52 ± 0.06 mg g(-1)) and 4-hydroxybenzoic acid (0.60 ± 0.08 mg g(-1)). H9c2 cells were pretreated with TTME (10, 25, 50 and 100 µg/ml) for 24 h before the induction of ischemia. Then ischemia was induced by exposing cells to ischemia buffer, in a hypoxic chamber, maintained at 0.1% O2, 95% N2 and 5% CO2, for 1 h. A significant (p ≤ 0.05) increase in reactive oxygen species generation (56%), superoxide production (18%), loss of plasma membrane integrity, dissipation of transmembrane potential, permeability transition pore opening and apoptosis had been observed during ischemia. However, pretreatment with TTME was found to significantly (p ≤ 0.05) attenuate the alterations caused by ischemia. The overall results of this study partially reveal the scientific basis of the use of T. terrestris L. in the traditional system of medicine for heart diseases. Copyright © 2015 John Wiley & Sons, Ltd.
Buhrow, Leann M.; Clark, Shawn M.; Loewen, Michele C.
2016-01-01
Background Virus-induced gene silencing (VIGS) has become an emerging technology for the rapid, efficient functional genomic screening of monocot and dicot species. The barley stripe mosaic virus (BSMV) has been described as an effective VIGS vehicle for the evaluation of genes involved in wheat and barley phytopathogenesis; however, these studies have been obscured by BSMV-induced phenotypes and defense responses. The utility of BSMV VIGS may be improved using a BSMV genetic background which...
Insights on ornithine decarboxylase silencing as a potential strategy for targeting retinoblastoma.
Muthukumaran, Sivashanmugam; Bhuvanasundar, Renganathan; Umashankar, Vetrivel; Sulochana, K N
2018-02-01
Ornithine Decarboxylase (ODC) is a key enzyme involved in polyamine synthesis and is reported to be up regulated in several cancers. However, the effect of ODC gene silencing in retinoblastoma is to be understood for utilization in therapeutic applications. Hence, in this study, a novel siRNA (small interference RNA) targeting ODC was designed and validated in Human Y79 retinoblastoma cells for its effects on intracellular polyamine levels, Matrix Metalloproteinase 2 & 9 activity and Cell cycle. The designed siRNA showed efficient silencing of ODC mRNA expression and protein levels in Y79 cells. It also showed significant reduction of intracellular polyamine levels and altered levels of oncogenic LIN28b expression. By this study, a regulatory loop is proposed, wherein, ODC silencing in Y79 cells to result in decreased polyamine levels, thereby, leading to altered protein levels of Lin28b, MMP-2 and MMP-9, which falls in line with earlier studies in neuroblastoma. Thus, by this study, we propose ODC silencing as a prospective strategy for targeting retinoblastoma. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
After the Blackbird Whistles: Listening to Silence in Classrooms
Schultz, Katherine
2010-01-01
Background/Context: Students spend a large part of their time in schools in silence. However, teachers tend to spend most of their time attending to student talk. Anthropological and linguistic research has contributed to an understanding of silence in particular communities, offering explanations for students' silence in school. This research…
Directory of Open Access Journals (Sweden)
Sandra Patricia Arenas Grisales
2012-08-01
Full Text Available This article exposes the hypothesis that memory artifacts, created to commemorate the victims of armed conflict in Colombia, are an expression of the underground memories and a way of political action in the midst of war. We analyze three cases of creations of memory artifacts in Medellín, Colombia, as forms of suffering, perceiving and resisting the power of armed groups in Medellín. The silence, inherent in these objects, should not be treated as an absence of language, but as another form of expression of memory. Silence is a tactic used to overcome losses and reset everyday life in contexts of protracted violence.
TYLCV-Is movement in planta does not require V2 protein
Energy Technology Data Exchange (ETDEWEB)
Hak, Hagit [Institute of Plant Sciences, Agricultural Research Organization, The Volcani Center, Bet Dagan (Israel); Department of Biological Chemistry, The Alexander Silberman Institute of Life Sciences, The Hebrew University of Jerusalem (Israel); Levy, Yael; Chandran, Sam A.; Belausov, Eduard [Institute of Plant Sciences, Agricultural Research Organization, The Volcani Center, Bet Dagan (Israel); Loyter, Abraham [Department of Biological Chemistry, The Alexander Silberman Institute of Life Sciences, The Hebrew University of Jerusalem (Israel); Lapidot, Moshe [Institute of Plant Sciences, Agricultural Research Organization, The Volcani Center, Bet Dagan (Israel); Gafni, Yedidya, E-mail: ygafni@volcani.agri.gov.il [Institute of Plant Sciences, Agricultural Research Organization, The Volcani Center, Bet Dagan (Israel)
2015-03-15
Tomato yellow leaf curl virus (TYLCV), a major tomato pathogen causing extensive crop losses, is a whitefly-transmitted geminivirus. V2 mutants of TYLCV-Is and related viruses tend to induce symptomless infection with attenuated viral DNA levels, while accumulating close to wild-type DNA levels in protoplasts, suggesting V2 as a movement protein. The discovery of plant-silencing mechanisms and viral silencing suppressors, V2 included, led us to reconsider V2's involvement in viral movement. We studied two mutant versions of the virus, one impaired in V2 silencing-suppression activity, and another carrying a non-translatable V2. While both mutant viruses spread in the infected plant to newly emerged leaves at the same rate as the wild-type virus, their DNA-accumulation levels were tenfold lower than in the wild-type virus. Thus, we suggest that the setback in virus proliferation, previously ascribed to a movement impediment, is due to lack of silencing-suppression activity. - Highlights: • TYLCV-Is V2 protein is localized in distinct microbodies throughout the cell cytoplasm, around the nucleus and in association with cytoplasmic strands but is not associated with the plasmodesmata. • Disruption of RNA-silencing suppression activity of TYLCV-Is V2 protein causes low titer of the virus in the infected plants. • The movement of TYLCV-Is in planta does not require a functional V2 protein.
International Nuclear Information System (INIS)
Zhang, Wenting; Tingare, Asmita; Ng, David Chi-Heng; Johnson, Hong W.; Schell, Michael J.; Lord, Rebecca L.; Chawla, Sangeeta
2012-01-01
Highlights: ► cAMP-induced c-fos expression in hippocampal neurons requires a submembraneous Ca 2+ pool. ► The submembraneous Ca 2+ pool derives from intracellular ER stores. ► Expression of IP 3 -metabolizing enzymes inhibits cAMP-induced c-fos expression. ► SRE-mediated and CRE-mediated gene expression is sensitive to IP 3 -metabolizing enzymes. ► Intracellular Ca 2+ release is required for cAMP-induced nuclear translocation of TORC1. -- Abstract: Ca 2+ and cAMP are widely used in concert by neurons to relay signals from the synapse to the nucleus, where synaptic activity modulates gene expression required for synaptic plasticity. Neurons utilize different transcriptional regulators to integrate information encoded in the spatiotemporal dynamics and magnitude of Ca 2+ and cAMP signals, including some that are Ca 2+ -responsive, some that are cAMP-responsive and some that detect coincident Ca 2+ and cAMP signals. Because Ca 2+ and cAMP can influence each other’s amplitude and spatiotemporal characteristics, we investigated how cAMP acts to regulate gene expression when increases in intracellular Ca 2+ are buffered. We show here that cAMP-mobilizing stimuli are unable to induce expression of the immediate early gene c-fos in hippocampal neurons in the presence of the intracellular Ca 2+ buffer BAPTA-AM. Expression of enzymes that attenuate intracellular IP 3 levels also inhibited cAMP-dependent c-fos induction. Synaptic activity induces c-fos transcription through two cis regulatory DNA elements – the CRE and the SRE. We show here that in response to cAMP both CRE-mediated and SRE-mediated induction of a luciferase reporter gene is attenuated by IP 3 metabolizing enzymes. Furthermore, cAMP-induced nuclear translocation of the CREB coactivator TORC1 was inhibited by depletion of intracellular Ca 2+ stores. Our data indicate that Ca 2+ release from IP 3 -sensitive pools is required for cAMP-induced transcription in hippocampal neurons.
The molecular basis for stability of heterochromatin-mediated silencing in mammals.
Hiragami-Hamada, Kyoko; Xie, Sheila Q; Saveliev, Alexander; Uribe-Lewis, Santiago; Pombo, Ana; Festenstein, Richard
2009-11-04
The archetypal epigenetic phenomenon of position effect variegation (PEV) in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3), DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac) and lysine 4 di or tri methylation (H3K4me2/3) are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.
The molecular basis for stability of heterochromatin-mediated silencing in mammals
Directory of Open Access Journals (Sweden)
Hiragami-Hamada Kyoko
2009-11-01
Full Text Available Abstract The archetypal epigenetic phenomenon of position effect variegation (PEV in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3, DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac and lysine 4 di or tri methylation (H3K4me2/3 are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.
Tospovirus : induction and suppression of RNA silencing
Hedil, Marcio
2016-01-01
While infecting their hosts, viruses must deal with host immunity. In plants the antiviral RNA silencing pathway is an important part of plant innate immunity. Tospoviruses are segmented negative-stranded RNA viruses of plants. To counteract the antiviral RNA silencing response in plants,
Energy Technology Data Exchange (ETDEWEB)
Fernandes, Marco A.R., E-mail: marco@cetea.com.b, E-mail: marfernandes@fmb.unesp.b [Universidade Estadual Paulista Julio de Mesquita Filho (FMB/UNESP), Botucatu, SP (Brazil). Fac. de Medicina; Ribeiro, Victor A.B. [Universidade Estadual Paulista Julio de Mesquita Filho (IBB/UNESP), Botucatu, SP (Brazil). Inst. de Biociencias; Viana, Rodrigo S.S.; Coelho, Talita S. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)
2011-07-01
The paper illustrates the use of the Monte Carlo method, MCNP-5C code, to analyze the attenuation curve behavior of the 50 kVp radiation beam from superficial radiotherapy equipment as Dermopan2 model. The simulations seek to verify the MCNP-5C code performance to study the variation of the attenuation curve - percentage depth dose (PDD) curve - in function of the radiation field dimension used at radiotherapy of skin tumors with 50 kVp X-ray beams. The PDD curve was calculated for six different radiation field sizes with circular geometry of 1.0, 2.0, 3.0, 4.0, 5.0 and 6.0 cm in diameter. The radiation source was modeled considering a tungsten target with inclination 30 deg, focal point of 6.5 mm in diameter and energy beam of 50 kVp; the X-ray spectrum was calculated with the MCNP-5C code adopting total filtration (beryllium window of 1 mm and aluminum additional filter of 1 mm). The PDD showed decreasing behavior with the attenuation depth similar what is presented on the literature. There was not significant variation at the PDD values for the radiation field between 1.0 and 4.0 cm in diameter. The differences increased for fields of 5.0 and 6.0 cm and at attenuation depth higher than 1.0 cm. When it is compared the PDD values for fields of 3.0 and 6.0 cm in diameter, it verifies the greater difference (12.6 %) at depth of 5.7 cm, proving the scattered radiation effect. The MCNP-5C code showed as an appropriate procedure to analyze the attenuation curves of the superficial radiotherapy beams. (author)
Gender Differences in Self-Silencing and Psychological Distress in Informal Cancer Carers
Ussher, Jane M.; Perz, Janette
2010-01-01
This study examined gender differences in self-silencing, the relationship between self-silencing and psychological distress, and reasons for self-silencing in informal cancer carers (329 women, 155 men), using a mixed-method design. Men reported greater self-silencing than women on the Silencing the Self Scale; however, women reported higher…
Conifers have a unique small RNA silencing signature
Dolgosheina, Elena V.; Morin, Ryan D.; Aksay, Gozde; Sahinalp, S. Cenk; Magrini, Vincent; Mardis, Elaine R.; Mattsson, Jim; Unrau, Peter J.
2008-01-01
Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an u...
Locus-specific ribosomal RNA gene silencing in nucleolar dominance.
Directory of Open Access Journals (Sweden)
Michelle S Lewis
2007-08-01
Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.
The physics of chromatin silencing: Bi-stability and front propagation
Sedighi, Mohammad
A mean-field dynamical model of chromatin silencing in budding yeast is provided and the conditions giving rise to two states: one silenced and another un-silenced, is studied. Based on these conditions, the space of control parameters is divided into two distinct regions of mono-stable and bi-stable solutions (the bifurcation diagram). Then, considering both the discrete and continuous versions of the model, the formation of a stable boundary between the silenced and un-silenced areas on DNA is investigated. As a result, a richer phase diagram is provided. The dynamics of the boundary is also studied under different conditions. Consequently, assuming negative feedback due to possible depletion of silencing proteins, the model explains a paradoxical epigenetic behavior of yeast that happens under some mutation. A stochastic treatment of the model is also considered to verify the results of the mean-field approximation and also to understand the role of intrinsic noise at single cell level. This model could be used as a general guide to discuss chromatin silencing in many organisms.
Energy Technology Data Exchange (ETDEWEB)
Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Lee, Eun Ju [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Bovine Genome Resources Bank, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Choi, Inho, E-mail: inhochoi@ynu.ac.kr [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Bovine Genome Resources Bank, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of)
2014-08-08
Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.
The effects of sedative music, arousal music, and silence on electrocardiography signals.
Dousty, Mehdy; Daneshvar, Sabalan; Haghjoo, Majid
2011-01-01
Research indicates that music can affect heart rate, blood pressure, and skin conductance. Music can stimulate central emotions in the brain and release biochemical materials that change the physiologic state. We sought to compare changes in the electrical function of the heart in response to music. Subjects were asked to listen to 2 types of music, namely, sedative and arousal music, in conjunction with two 30-second periods of complete silence. The experiment was conducted in 4 segments: the first and third parts were silence, and the second and fourth parts were music. First, the response to each type of music was compared with that to the preceding period of silence. Next, the responses to both types of music were compared. Finally, the response to music regardless of the type was compared with that to silence. The amplitude of polarization and depolarization changed in response to different kinds of music. The electrical function of the heart in response to music, irrespective of the music type, differed from that in response to silence. The 2 types of music impacted the electrical function of the heart in different ways: the arousal music influenced T-wave maximum amplitude, whereas no such change was recorded in response to the sedative music. The bandwidth of the polarization and depolarization of the heart rate and R-wave amplitude increased in response to music by comparison with silence. In addition, the heart did not seem to try to synchronize with music. The mean R-wave amplitude in sedative music is higher than the arousal music, so our heart works differently when different types of music are heard. Copyright © 2011 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Cheng, Jung-Chien; Chang, Hsun-Ming; Qiu, Xin; Fang, Lanlan; Leung, Peter C.K., E-mail: peter.leung@ubc.ca
2014-01-10
Highlights: •Activin A stimulates cell proliferation in KGN human granulosa cell tumor-derived cell line. •Cyclin D2 mediates activin A-induced KGN cell proliferation. •FOXL2 induces follistatin expression in KGN cells. •FOXL2-induced follistatin attenuates activin A-stimulated KGN cell proliferation. -- Abstract: Human granulosa cell tumors (GCTs) are rare, and their etiology remains largely unknown. Recently, the FOXL2 402C > G (C134W) mutation was found to be specifically expressed in human adult-type GCTs; however, its function in the development of human GCTs is not fully understood. Activins are members of the transforming growth factor-beta superfamily, which has been shown to stimulate normal granulosa cell proliferation; however, little is known regarding the function of activins in human GCTs. In this study, we examined the effect of activin A on cell proliferation in the human GCT-derived cell line KGN. We show that activin A treatment stimulates KGN cell proliferation. Treatment with the activin type I receptor inhibitor SB431542 blocks activin A-stimulated cell proliferation. In addition, our results show that cyclin D2 is induced by treatment with activin A and is involved in activin A-stimulated cell proliferation. Moreover, the activation of Smad signaling is required for activin A-induced cyclin D2 expression. Finally, we show that the overexpression of the wild-type FOXL2 but not the C134W mutant FOXL2 induced follistatin production. Treatment with exogenous follistatin blocks activin A-stimulated cell proliferation, and the overexpression of wild-type FOXL2 attenuates activin A-stimulated cell proliferation. These results suggest that FOXL2 may act as a tumor suppressor in human adult-type GCTs by inducing follistatin expression, which subsequently inhibits activin-stimulated cell proliferation.
Inhibition of transcriptional activity of c-JUN by SIRT1
International Nuclear Information System (INIS)
Gao Zhanguo; Ye Jianping
2008-01-01
c-JUN is a major component of heterodimer transcription factor AP-1 (Activator Protein-1) that activates gene transcription in cell proliferation, inflammation and stress responses. SIRT1 (Sirtuin 1) is a histone deacetylase that controls gene transcription through modification of chromatin structure. However, it is not clear if SIRT1 regulates c-JUN activity in the control of gene transcription. Here, we show that SIRT1 associated with c-JUN in co-immunoprecipitation of whole cell lysate, and inhibited the transcriptional activity of c-JUN in the mammalian two hybridization system. SIRT1 was found in the AP-1 response element in the matrix metalloproteinase-9 (MMP9) promoter DNA leading to inhibition of histone 3 acetylation as shown in a ChIP assay. The SIRT1 signal was reduced by the AP-1 activator PMA, and induced by the SIRT1 activator Resveratrol in the promoter DNA. SIRT1-mediaetd inhibition of AP-1 was demonstrated in the MMP9 gene expression at the gene promoter, mRNA and protein levels. In mouse embryonic fibroblast (MEF) with SIRT1 deficiency (SIRT1 -/- ), mRNA and protein of MMP9 were increased in the basal condition, and the inhibitory activity of Resveratrol was significantly attenuated. Glucose-induced MMP9 expression was also inhibited by SIRT1 in response to Resveratrol. These data consistently suggest that SIRT1 directly inhibits the transcriptional activity of AP-1 by targeting c-JUN
International Nuclear Information System (INIS)
Han, Sung Gu; Eum, Sung Yong; Toborek, Michal; Smart, Eric; Hennig, Bernhard
2010-01-01
Exposure to environmental contaminants, such as polychlorinated biphenyls (PCBs), is a risk factor for the development of cardiovascular diseases such as atherosclerosis. Vascular cell adhesion molecule-1 (VCAM-1) is a critical mediator for adhesion and uptake of monocytes across the endothelium in the early stages of atherosclerosis development. The upregulation of VCAM-1 by PCBs may be dependent on functional membrane domains called caveolae. Caveolae are particularly abundant in endothelial cell membranes and involved in trafficking and signal transduction. The objective of this study was to investigate the role of caveolae in PCB-induced endothelial cell dysfunction. Primary mouse aortic endothelial cells (MAECs) isolated from caveolin-1-deficient mice and background C57BL/6 mice were treated with coplanar PCBs, such as PCB77 and PCB126. In addition, siRNA gene silencing technique was used to knockdown caveolin-1 in porcine vascular endothelial cells. In MAECs with functional caveolae, VCAM-1 protein levels were increased after exposure to both coplanar PCBs, whereas expression levels of VCAM-1 were not significantly altered in cells deficient of caveolin-1. Furthermore, PCB-induced monocyte adhesion was attenuated in caveolin-1-deficient MAECs. Similarly, siRNA silencing of caveolin-1 in porcine endothelial cells confirmed the caveolin-1-dependent VCAM-1 expression. Treatment of cells with PCB77 and PCB126 resulted in phosphorylation of extracellular signal-regulated kinase-1/2 (ERK1/2), and pharmacological inhibition of ERK1/2 diminished the observed PCB-induced increase in monocyte adhesion. These findings suggest that coplanar PCBs induce adhesion molecule expression, such as VCAM-1, in endothelial cells, and that this response is regulated by caveolin-1 and functional caveolae. Our data demonstrate a critical role of functional caveolae in the activation and dysfunction of endothelial cells by coplanar PCBs.
Cytoprotective Role of Nrf2 in Electrical Pulse Stimulated C2C12 Myotube.
Directory of Open Access Journals (Sweden)
Masaki Horie
Full Text Available Regular physical exercise is central to a healthy lifestyle. However, exercise-related muscle contraction can induce reactive oxygen species and reactive nitrogen species (ROS/RNS production in skeletal muscle. The nuclear factor-E2-related factor-2 (Nrf2 transcription factor is a cellular sensor for oxidative stress. Regulation of nuclear Nrf2 signaling regulates antioxidant responses and protects organ structure and function. However, the role of Nrf2 in exercise- or contraction-induced ROS/RNS production in skeletal muscle is not clear. In this study, using differentiated C2C12 cells and electrical pulse stimulation (EPS of muscle contraction, we explored whether Nrf2 plays a role in the skeletal muscle response to muscle contraction-induced ROS/RNS. We found that EPS (40 V, 1 Hz, 2 ms stimulated ROS/RNS accumulation and Nrf2 activation. We also showed that expression of NQO1, HO-1 and GCLM increased after EPS-induced muscle contraction and was remarkably suppressed in cells with Nrf2 knockdown. We also found that the antioxidant N-acetylcysteine (NAC significantly attenuated Nrf2 activation after EPS, whereas the nitric oxide synthetase inhibitor Nω-nitro-L-arginine methyl ester (L-NAME did not. Furthermore, Nrf2 knockdown after EPS markedly decreased ROS/RNS redox potential and cell viability and increased expression of the apoptosis marker Annexin V in C2C12 myotubes. These results indicate that Nrf2 activation and expression of Nrf2 regulated-genes protected muscle against the increased ROS caused by EPS-induced muscle contraction. Thus, our findings suggest that Nrf2 may be a key factor for preservation of muscle function during muscle contraction.
Control of thermoacoustic instability with a drum-like silencer
Zhang, Guangyu; Wang, Xiaoyu; Li, Lei; Jing, Xiaodong; Sun, Xiaofeng
2017-10-01
Theoretical investigation is carried out by a novel method of controlling thermoacoustic instability with a drum-like silencer. It is shown that by decreasing the frequency of thermoacoustic system, the instability can be suppressed with the help of drum-like silencer. The purely reactive silencer, which is composed of a flexible membrane and a backing cavity, is usually known as a noise control device that works effectively in low frequency bandwidth without any aerodynamic loss. In present research, the silencer is exploited in a Rijke tube, as a means of decreasing the natural frequency of the system, and consequently changing the resonance period of the system. The "transfer element method" (TEM) is used to consider the interactions between the acoustic waves and the flexible membranes of the silencer. The effects of all possible properties of the silencer on the growth rate and resonance frequency of the thermoacoustic system are explored. According to the calculation results, it is found that for some properties of the silencer, the resonance frequencies are greatly decreased and then the phase difference between the unsteady heat release and the pressure fluctuation is increased. Consequently, the instability is suppressed with some dissipation that can not be able to control its onset in the original system. Therefore, when the damping is low, but not zero, it is effective to control thermoacoustic instability with this technique.
Zhang, Xuefeng; Hagen, Jussara; Muniz, Viviane P.; Smith, Tarik; Coombs, Gary S.; Eischen, Christine M.; Mackie, Duncan I.; Roman, David L.; Van Rheeden, Richard; Darbro, Benjamin; Tompkins, Van S.; Quelle, Dawn E.
2013-01-01
RABL6A (RAB-like 6 isoform A) is a novel protein that was originally identified based on its association with the Alternative Reading Frame (ARF) tumor suppressor. ARF acts through multiple p53-dependent and p53-independent pathways to prevent cancer. How RABL6A functions, to what extent it depends on ARF and p53 activity, and its importance in normal cell biology are entirely unknown. We examined the biological consequences of RABL6A silencing in primary mouse embryo fibroblasts (MEFs) that express or lack ARF, p53 or both proteins. We found that RABL6A depletion caused centrosome amplification, aneuploidy and multinucleation in MEFs regardless of ARF and p53 status. The centrosome amplification in RABL6A depleted p53−/− MEFs resulted from centrosome reduplication via Cdk2-mediated hyperphosphorylation of nucleophosmin (NPM) at threonine-199. Thus, RABL6A prevents centrosome amplification through an ARF/p53-independent mechanism that restricts NPM-T199 phosphorylation. These findings demonstrate an essential role for RABL6A in centrosome regulation and maintenance of chromosome stability in non-transformed cells, key processes that ensure genomic integrity and prevent tumorigenesis. PMID:24282525
1987-10-13
after multiple passages in vivo and in vitro. J. Gen. Virol. 67, 1741- 1744. Sabin , A.B. (1985). Oral poliovirus vaccine : history of its development...IN (N NEW APPROACHES TO ATTENUATED HEPATITIS A VACCINE DEVELOPMENT: Q) CLONING AND SEQUENCING OF CELL-CULTURE ADAPTED VIRAL cDNA I ANNUAL REPORT...6ll02Bsl0 A 055 11. TITLE (Include Security Classification) New Approaches to Attenuated Hepatitis A Vaccine Development: Cloning and Sequencing of Cell
Directory of Open Access Journals (Sweden)
Ebrahim Parcham
2017-01-01
Full Text Available Introduction: Organizational Culture is one of the most important factors that can change the climate of silence. The main aim of this research was to investigate the influence of organizational culture on employees’ organizational silence in Shiraz University of Medical Sciences. Method: This research was a descriptive-correlation one. The target population was chosen from 1900 staff of the University of Medical sciences and Health Care headquarter in Shiraz. Thus 311 employees were selected using the Krejcie and Morgan sampling table. The instrument used in this research was Denison (2006 organizational culture questionnaire and Dimitris Buratas and Maria Vacula (2007 organizational culture. Cornbrash’s alpha method was used to calculate the reliability. The Item analysis and expert consensus were applied to calculate the validity of instruments. All gathered data analyzed with PLS software. Results: The results showed that the four dimensions of organizational culture include organizational involvement, organizational adaptability, organizational concistency and organizational mission was moderate and the mean scores obtained for each factor were 2.85, 2.82, 2.94 and 2.93 respectively. Structural equation model showed Organizational culture has a significant positive impact on organizational silence (β=0.68; P<.001. Conclusion: Based on the results and impact of organizational culture on organizational silence that is positive and significant; The organization further efforts to strengthen various aspects of organizational culture, especially the employees’ involvement in decision making; Employees can better express their opinions and thus reduced their organizational silence. In other words strengthening corporate culture is combined with the reduction of organizational silence. Medical organizations can establish appropriate reward system for creative ideas and suggestions to encourage people express their ideas As a result, reduced
Gonorazky, Gabriela; Guzzo, María Carla; Abd-El-Haliem, Ahmed M.; Joosten, Matthieu H.A.J.; Laxalt, Ana María
2016-01-01
The tomato [Solanum lycopersicum (Sl)] phosphatidylinositol-phospholipase C (PI-PLC) gene family is composed of six members, named SlPLC1 to SlPLC6, differentially regulated on pathogen attack. We have previously shown that the fungal elicitor xylanase induces a raise of SlPLC2 and SlPLC5
Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing
Hedil, M.; Sterken, M.G.; Ronde, de D.; Lohuis, D.; Kormelink, R.
2015-01-01
RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS.
No-Big-Silence teeb klubituuri / Urmas Hännile
Hännile, Urmas
2009-01-01
Rockansamblist No-Big-Silence ja dark-popansamblist Sinine, nende kontsertttuurist mööda Eestimaad, tutvustamisel bändide uued albumid (No-Big-Silence "Starstealer" ja Sinine "Butterflies"), Pärnus on kontsert 24. oktoobril klubis Sugar
Estimating marginal CO2 emissions rates for national electricity systems
International Nuclear Information System (INIS)
Hawkes, A.D.
2010-01-01
The carbon dioxide (CO 2 ) emissions reduction afforded by a demand-side intervention in the electricity system is typically assessed by means of an assumed grid emissions rate, which measures the CO 2 intensity of electricity not used as a result of the intervention. This emissions rate is called the 'marginal emissions factor' (MEF). Accurate estimation of MEFs is crucial for performance assessment because their application leads to decisions regarding the relative merits of CO 2 reduction strategies. This article contributes to formulating the principles by which MEFs are estimated, highlighting the strengths and weaknesses in existing approaches, and presenting an alternative based on the observed behaviour of power stations. The case of Great Britain is considered, demonstrating an MEF of 0.69 kgCO 2 /kW h for 2002-2009, with error bars at +/-10%. This value could reduce to 0.6 kgCO 2 /kW h over the next decade under planned changes to the underlying generation mix, and could further reduce to approximately 0.51 kgCO 2 /kW h before 2025 if all power stations commissioned pre-1970 are replaced by their modern counterparts. Given that these rates are higher than commonly applied system-average or assumed 'long term marginal' emissions rates, it is concluded that maintenance of an improved understanding of MEFs is valuable to better inform policy decisions.
DEFF Research Database (Denmark)
Konradsen, Hanne; Kirkevold, Marit; McCallin, Antoinette
2012-01-01
and individual interviews were analyzed using the grounded theory method. The findings revealed that the main concern of the patients was feeling isolated, which was resolved using a process of interactional integration. Interactional integration begins by breaking the silence to enable the progression from...
Toward a science of silence: The consequences of leaving a memory unsaid
DEFF Research Database (Denmark)
Stone, Charles; Coman, Alin; Brown, Adam
2012-01-01
of the silence—and listeners—those attending to the speaker. Although the topic of silence is widely discussed, it is rarely mentioned in the empirical literature on memory. Three factors are employed to classify silence into different types: whether a silence is accompanied by covert remembering, whether...... the silence is intentional or unintentional, and whether the silenced memory is related or unrelated to the memories emerging in a conversation. These factors appear to be critical when considering the mnemonic consequences. Moreover, the influence of silence on memory varies between speaker and listener...
A conversation analysis of the function of silence in writing conferences
Directory of Open Access Journals (Sweden)
Milad Mirzaee
2016-07-01
Full Text Available One of the recent issues in English as a Second/Foreign Language (ESL/EFL writing instruction has been the quest for a more effective way to give feedback to L2 learners’ writing drafts. Although teacher- learner writing conferences have been increasingly used for providing ample opportunity for negotiating revisions, relatively little attention has been given to actual teacher-learner conversation. Drawing on sociocultural theory, which holds that all cognitive developments are results of ‘social interactions’, and drawing on conversation analysis as an analytical tool, this study attempts to explore the different functions of ‘silence’ in writing conferences during teacher-learner conversation. The data comes from transcripts of six 1-hour writing conferences video-recorded in a graduate program with 7 candidates in Iran. During the writing conferences, learners’ drafts were discussed. Findings of the study demonstrated that teacher’s silence can play a key role in the management of turns in writing conferences, thereby providing the parties with various opportunities for accomplishing intersubjectivity: the teacher used silence to rethink the information provided during writing conferences, and the learner exploited silence to revise the writing draft. The current study, reporting a range of functions of silence in writing conferences, offers an extension to the existing literature and draws language teachers’, specifically writing instructors’, attention to different functions of silence in writing conferences.
Assessment of RNAi-induced silencing in banana (Musa spp.).
Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge
2014-09-18
In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target
Strategies for Improving siRNA-Induced Gene Silencing Efficiency.
Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad
2017-12-01
Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.
β‐Taxilin participates in differentiation of C2C12 myoblasts into myotubes
Energy Technology Data Exchange (ETDEWEB)
Sakane, Hiroshi; Makiyama, Tomohiko; Nogami, Satoru; Horii, Yukimi [Department of Molecular and Cell Biology, Graduate school of Medicine, Dokkyo Medical University, 880 Kitakobayashi, Mibu-town, Tochigi 321-0293 (Japan); Akasaki, Kenji [Faculty of Pharmacy and Pharmaceutical Sciences, Fukuyama University, Fukuyama, Hiroshima 729-0292 (Japan); Shirataki, Hiromichi, E-mail: hiro-sh@dokkyomed.ac.jp [Department of Molecular and Cell Biology, Graduate school of Medicine, Dokkyo Medical University, 880 Kitakobayashi, Mibu-town, Tochigi 321-0293 (Japan)
2016-07-15
Myogenesis is required for the development of skeletal muscle. Accumulating evidence indicates that the expression of several genes are upregulated during myogenesis and these genes play pivotal roles in myogenesis. However, the molecular mechanism underlying myogenesis is not fully understood. In this study, we found that β-taxilin, which is specifically expressed in the skeletal muscle and heart tissues, was progressively expressed during differentiation of C2C12 myoblasts into myotubes, prompting us to investigate the role of β-taxilin in myogenesis. In C2C12 cells, knockdown of β-taxilin impaired the fusion of myoblasts into myotubes, and decreased the diameter of myotubes. We also found that β-taxilin interacted with dysbindin, a coiled-coil-containing protein. Knockdown of dysbindin conversely promoted the fusion of myoblasts into myotubes and increased the diameter of myotubes in C2C12 cells. Furthermore, knockdown of dysbindin attenuated the inhibitory effect of β-taxilin depletion on myotube formation of C2C12 cells. These results demonstrate that β-taxilin participates in myogenesis through suppressing the function of dysbindin to inhibit the differentiation of C2C12 myoblasts into myotubes. - Highlights: • β‐Taxilin is progressively expressed during differentiation of C2C12 cell. • Knockdown of β-taxilin impaired C2C12 myotube formation. • β‐Taxilin interacted with dysbindin. • Knockdown of dysbindin promoted C2C12 myotube formation. • The function of β-taxilin in C2C12 myotube formation depends on dysbindin.
Epigenetic Silencing and Resistance to Imatinib Mesylate in CML
National Research Council Canada - National Science Library
Issa, Jean-Pierre
2004-01-01
...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...
Epigenetic Silencing and Resistance to Imatinib Mesylate in CML
National Research Council Canada - National Science Library
Issa, Jean-Pierre
2005-01-01
...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...
Epigenetic Silencing and Resistance to Imatinib Mesylate in CML
National Research Council Canada - National Science Library
Issa, Jean-Pierre
2006-01-01
...). In this project we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases and that reversal of silencing by decitabine...
Silencing of Atp2b1 increases blood pressure through vasoconstriction.
Shin, Young-Bin; Lim, Ji Eun; Ji, Su-Min; Lee, Hyeon-Ju; Park, So-Yon; Hong, Kyung-Won; Lim, Mihwa; McCarthy, Mark I; Lee, Young-Ho; Oh, Bermseok
2013-08-01
Recent genome-wide association studies (GWASs) have identified 30 genetic loci that regulate blood pressure, increasing our understanding of the cause of hypertension. However, it has been difficult to define the causative genes at these loci due to a lack of functional analyses. In this study, we aimed to validate the candidate gene ATP2B1 in 12q21, variants near which have the strongest association with blood pressure in Asians and Europeans. ATP2B1 functions as a calcium pump to fine-tune calcium concentrations - necessary for repolarization following muscular contractions. We silenced Atp2b1 using an siRNA complex, injected into mouse tail veins. In treated mice, blood pressure rose and the mesenteric arteries increased in wall : lumen ratio. Moreover, the arteries showed enhanced myogenic responses to pressure, and contractile responses to phenylephrine increased compared with the control, suggesting that blood pressure is regulated by ATP2B1 through the contraction and dilation of the vessel, likely by controlling calcium concentrations in the resting state. These results support that ATP2B1 is the causative gene in the blood pressure-associated 12q21 locus and demonstrate that ATP2B1 expression in the vessel influences blood pressure.
International Nuclear Information System (INIS)
Katgert, P.
1977-01-01
The 5C2 region, observed originally with the Cambridge One-Mile Telescope at 408 MHz, has been reobserved at l4l5 MHz. The resulting source list contains 238 sources with attenuated flux densities exceeding the catalogue limit of 6.25 m.f.u. Out of a total of 190 5C2 sources (i.e. all 5C2 sources within the 10 dB attenuation contour of the present survey), 128 were detected with flux densities above the catalogue limit. Another 22 5C2 sources were detected with flux densities below the catalogue limit. A discussion is given of the procedures used for determining source parameters. Special attention has been given to the determination of flux density and angular size as well as to the question of completeness of the source list as a function of flux density and angular size
Klotho gene silencing promotes pathology in the mdx mouse model of Duchenne muscular dystrophy
Wehling-Henricks, Michelle; Li, Zhenzhi; Lindsey, Catherine; Wang, Ying; Welc, Steven S.; Ramos, Julian N.; Khanlou, Négar; Kuro-o, Makoto; Tidball, James G.
2016-01-01
Duchenne muscular dystrophy (DMD) is a lethal muscle disease involving progressive loss of muscle regenerative capacity and increased fibrosis. We tested whether epigenetic silencing of the klotho gene occurs in the mdx mouse model of DMD and whether klotho silencing is an important feature of the disease. Our findings show that klotho undergoes muscle-specific silencing at the acute onset of mdx pathology. Klotho experiences increased methylation of CpG sites in its promoter region, which is associated with gene silencing, and increases in a repressive histone mark, H3K9me2. Expression of a klotho transgene in mdx mice restored their longevity, reduced muscle wasting, improved function and greatly increased the pool of muscle-resident stem cells required for regeneration. Reductions of fibrosis in late, progressive stages of the mdx pathology achieved by transgene expression were paralleled by reduced expression of Wnt target genes (axin-2), transforming growth factor-beta (TGF-β1) and collagens types 1 and 3, indicating that Klotho inhibition of the profibrotic Wnt/TGFβ axis underlies its anti-fibrotic effect in aging, dystrophic muscle. Thus, epigenetic silencing of klotho during muscular dystrophy contributes substantially to lost regenerative capacity and increased fibrosis of dystrophic muscle during late progressive stages of the disease. PMID:27154199
Smuggling gold nanoparticles across cell types - A new role for exosomes in gene silencing.
Roma-Rodrigues, Catarina; Pereira, Francisca; Alves de Matos, António P; Fernandes, Marta; Baptista, Pedro V; Fernandes, Alexandra R
2017-05-01
Once released to the extracellular space, exosomes enable the transfer of proteins, lipids and RNA between different cells, being able to modulate the recipient cells' phenotypes. Members of the Rab small GTP-binding protein family, such as RAB27A, are responsible for the coordination of several steps in vesicle trafficking, including budding, mobility, docking and fusion. The use of gold nanoparticles (AuNPs) for gene silencing is considered a cutting-edge technology. Here, AuNPs were functionalized with thiolated oligonucleotides anti-RAB27A (AuNP@PEG@anti-RAB27A) for selective silencing of the gene with a consequent decrease of exosomes´ release by MCF-7 and MDA-MB-453 cells. Furthermore, communication between tumor and normal cells was observed both in terms of alterations in c-Myc gene expression and transportation of the AuNPs, mediating gene silencing in secondary cells. Copyright © 2017 Elsevier Inc. All rights reserved.
Silencing of the SlNAP7 gene influences plastid development and lycopene accumulation in tomato
Fu, Da-Qi; Meng, Lan-Huan; Zhu, Ben-Zhong; Zhu, Hong-Liang; Yan, Hua-Xue; Luo, Yun-Bo
2016-12-01
Ripening is an important stage of fruit development. To screen the genes associated with pigment formation in tomato fruit, a suppression subtractive hybridization (SSH) cDNA library was constructed by using tomato fruit in the green ripe and break ripe stages, and 129 differential genes were obtained. Using redness as a screening marker, virus-induced gene silencing (VIGS) of the differential genes was performed with a sprout vacuum-infiltration system (SVI). The results showed that silencing the SlNAP7 gene affected the chloroplast development of tomato leaves, manifesting as a photo-bleaching phenotype, and silenced fruit significantly affected the accumulation of lycopene, manifested as a yellow phenotype. In our study, we found that silencing the SlNAP7 gene downregulates the expression of the POR and PORA genes and destroys the normal development of the chloroplast. The expression of related genes included in the lycopene biosynthesis pathway was not significantly changed, but lycopene accumulation was significantly reduced in tomato fruit. Perhaps it was caused by the destruction of the chromoplast, which leads to the oxidation of lycopene. The results show that the SlNAP7 gene influences chloroplast development and lycopene accumulation in tomato.
Morici, Eleonora; Simoni, Serena; Brenciani, Andrea; Giovanetti, Eleonora; Varaldo, Pietro E; Mingoia, Marina
2017-01-01
To investigate the genetic basis of catQ-mediated chloramphenicol resistance in Streptococcus agalactiae. Two clinical strains of catQ-positive chloramphenicol-resistant S. agalactiae (Sag236 and Sag403) were recently isolated, typed (MLST, PFGE pulsotypes, capsular types) and their antibiotic resistances investigated by phenotypic and genotypic approaches. Several molecular methods (PCR mapping, restriction assays, Southern blotting, sequencing and sequence analysis, conjugal transfer assays) were used to determine the genetic context of catQ and characterize a genetic element detected in the isolates. Sag236 and Sag403 shared the same ST (ST19), but exhibited a different capsular type (III and V, respectively) and pulsotype. Both harboured the macrolide resistance genes mef(I) and erm(TR) and the tetracycline resistance gene tet(M). Accordingly, they were resistant to chloramphenicol, erythromycin and tetracycline. catQ and mef(I) were associated in an IQ module that was indistinguishable in Sag236 and Sag403. In mating assays, chloramphenicol and erythromycin resistance proved transferable, at low frequency, only from Sag236. Transconjugants carried not only catQ and mef(I), but also erm(TR), suggesting a linkage of the three resistance genes in a mobile element, which, though seemingly non-mobile, was also detected in Sag403. The new element (designated ICESag236, ∼110 kb) results from recombination of two integrative and conjugative elements (ICEs) originally described in different streptococcal species: S. agalactiae ICESagTR7, carrying erm(TR); and Streptococcus pneumoniae ICESpn529IQ, carrying the prototype IQ module. These findings strengthen the notion that widespread streptococcal ICEs may form mosaics that enhance their diversity and spread, broaden their host range and carry new cargo genes. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions
Uudised : Rannap sai raha lõpuks kätte. No Big Silence esitleb uut heliplaati
2000-01-01
Pärnus toimunud lühima öö laulukonkursil võitis peaauhinna R. Rannap. Ans. No-Big-Silence on soojendusbändiks 2. juulil Tallinna Lauluväljakul toimuval Iron Maideni kontserdil. Ans. No-Big-Silence esitleb oma uut heliplaati "successful, bitch and beautiful"
Directory of Open Access Journals (Sweden)
Wuyang Zhu
Full Text Available Cell culture-adapted strains of Sindbis virus (SINV initially attach to cells by the ability to interact with heparan sulfate (HS through selective mutation for positively charged amino acid (aa scattered in E2 glycoprotein (W. B. Klimstra, K. D. Ryman, and R. E. Johnston, J. Virol. 72: 7357-7366, 1998. Here we have further confirmed that interaction of E2 protein with HS is crucial for cellular infection of SINV based on the reverse genetic system of XJ-160 virus, a Sindbis-like virus (SINLV. Both SINV YN87448 and SINLV XJ-160 displayed similar infectivity on BHK-21, Vero, or C6/36 cells, but XJ-160 failed to infect mouse embryonic fibroblast (MEF cells. The molecular mechanisms underlying the selective infectivity of XJ-160 were approached by substituting the E1, E2, or both genes of XJ-160 with that of YN87448, and the chimeric virus was denominated as XJ-160/E1, XJ-160/E2, or XJ-160/E1E2, respectively. In contrast to the parental XJ-160, all chimeric viruses became infectious to wild-type MEF cells (MEF-wt. While MEF-Ext(-/- cells, producing shortened HS chains, were resistant not only to XJ-160, but also to YN87448 as well as the chimeric viruses, indicating that the inability of XJ-160 to infect MEF-wt cells likely due to its incompetent discrimination of cellular HS. Treatment with heparin or HS-degrading enzyme resulted in a substantial decrease in plaque formation by YN87448, XJ-160/E2, and XJ-160/E1E2, but had marginal effect on XJ-160 and XJ-160/E1, suggesting that E2 glycoprotein from YN87448 plays a more important role than does E1 in mediating cellular HS-related cell infection. In addition, the peptide containing 145-150 aa from E2 gene of YN87448 specifically bound to heparin, while the corresponding peptide from the E2 gene of XJ-160 essentially showed no binding to heparin. As a new dataset, these results clearly confirm an essential role of E2 glycoprotein, especially the domain of 145-150 aa, in SINV cellular infection
Antiviral RNA silencing viral counter defense in plants
Bucher, E.C.
2006-01-01
The research described in this thesis centres around the mechanism of RNA silencing in relation to virus-host interaction, an area of increasing importance. It shows how this recently disclosed mechanism can be used to produce virus-resistant plants. Based on the activity of the RNA silencing
Anti-viral RNA silencing: do we look like plants ?
Directory of Open Access Journals (Sweden)
Lecellier Charles-Henri
2006-01-01
Full Text Available Abstract The anti-viral function of RNA silencing was first discovered in plants as a natural manifestation of the artificial 'co-suppression', which refers to the extinction of endogenous gene induced by homologous transgene. Because silencing components are conserved among most, if not all, eukaryotes, the question rapidly arose as to determine whether this process fulfils anti-viral functions in animals, such as insects and mammals. It appears that, whereas the anti-viral process seems to be similarly conserved from plants to insects, even in worms, RNA silencing does influence the replication of mammalian viruses but in a particular mode: micro(miRNAs, endogenous small RNAs naturally implicated in translational control, rather than virus-derived small interfering (siRNAs like in other organisms, are involved. In fact, these recent studies even suggest that RNA silencing may be beneficial for viral replication. Accordingly, several large DNA mammalian viruses have been shown to encode their own miRNAs. Here, we summarize the seminal studies that have implicated RNA silencing in viral infection and compare the different eukaryotic responses.
Directory of Open Access Journals (Sweden)
Xiao-Bing Ji
2015-07-01
Full Text Available Background: Uncoupling protein 2 (UCP2 is critical in regulating energy metabolism. Due to the significant change in energy metabolism of myocardium upon pressure overload, we hypothesize that UCP2 could contribute to the etiology of cardiac hypertrophy. Methods: Adult male C57BL/6J mice were subjected to pressure overload by using transverse aortic constriction (TAC, and then received genipin (a UCP2 selective inhibitor; 25 mg/kg/d, ip or vehicle for three weeks prior to histologic assessment of myocardial hypertrophy. ATP concentration, ROS level, and myocardial apoptosis were also examined. A parallel set of experiments was also conducted in UCP2-/- mice. Results: TAC induced left ventricular hypertrophy, as reflected by increased ventricular weight/thickness and increased size of myocardial cell (vs. sham controls. ATP concentration was decreased; ROS level was increased. Apoptosis and fibrosis markers were increased. TAC increased mitochondrial UCP2 expression in the myocardium at both mRNA and protein levels. Genipin treatment attenuated cardiac hypertrophy and the histologic/biochemical changes described above. Hypertrophy and associated changes induced by TAC in UCP2-/- mice were much less pronounced than in WT mice. Conclusions: Blocking UCP2 expression attenuates cardiac hypertrophy induced by pressure overload.
Polydatin Attenuates H2O2-Induced Oxidative Stress via PKC Pathway
Directory of Open Access Journals (Sweden)
Huilian Qiao
2016-01-01
Full Text Available Oxidative stress plays an important role in the pathogenesis of endothelial dysfunction, which is found to precede the development of diverse cardiovascular diseases (CVDs. The aim of this study was to observe the protective effects of PD against H2O2-induced oxidative stress injury (OSI in human umbilical vein endothelial cells (HUVECs and the possible mechanism of PD in OSI treatment. HUVECs were subjected to H2O2 in the absence or presence of PD. It turned out that PD improved cell viability and adhesive and migratory abilities, inhibited the release of lactate dehydrogenase (LDH and reactive oxygen species (ROS, and elevated the content of glutathione peroxidase (GSH-Px and superoxide dismutase (SOD. TUNEL, fluorometric assays, and Western blotting showed that OSI upregulated the apoptosis ratio, the activity of caspase-3 and the level of proapoptotic protein Bax and decreased the level of antiapoptotic protein Bcl-2. However, PD treatment partially reversed these damage effects and Protein Kinase C (PKC activation by thymeleatoxin (THX in turn eliminated the antiapoptotic effect of PD. Furthermore, PD attenuated the H2O2-induced phosphorylation of PKCs α and δ and increased the phosphorylation of PKC ε. Our results indicated that PD might exert protective effects against OSI through various interactions with PKC pathway.
Vinpocetine Attenuates the Osteoblastic Differentiation of Vascular Smooth Muscle Cells.
Directory of Open Access Journals (Sweden)
Yun-Yun Ma
Full Text Available Vascular calcification is an active process of osteoblastic differentiation of vascular smooth muscle cells; however, its definite mechanism remains unknown. Vinpocetine, a derivative of the alkaloid vincamine, has been demonstrated to inhibit the high glucose-induced proliferation of vascular smooth muscle cells; however, it remains unknown whether vinpocetine can affect the osteoblastic differentiation of vascular smooth muscle cells. We hereby investigated the effect of vinpocetine on vascular calcification using a beta-glycerophosphate-induced cell model. Our results showed that vinpocetine significantly reduced the osteoblast-like phenotypes of vascular smooth muscle cells including ALP activity, osteocalcin, collagen type I, Runx2 and BMP-2 expression as well as the formation of mineralized nodule. Vinpocetine, binding to translocation protein, induced phosphorylation of extracellular signal-related kinase and Akt and thus inhibited the translocation of nuclear factor-kappa B into the nucleus. Silencing of translocator protein significantly attenuated the inhibitory effect of vinpocetine on osteoblastic differentiation of vascular smooth muscle cells. Taken together, vinpocetine may be a promising candidate for the clinical therapy of vascular calcification.
Altawashi, Azza; Gehring, Christoph A
2013-01-01
to as Non Syndromic Mental Retardation (NSMR). Findings. Here we demonstrate that in Mouse Embryonic Fibroblasts (MEF) CC2D1A co-localizes with PDE4D in the cytosol before cAMP stimulation and on the periphery after stimulation, and that the movement
Donehower, Lawrence A.; Creighton, Chad J.; Schultz, Nikolaus; Shinbrot, Eve; Chang, Kyle; Gunaratne, Preethi H.; Muzny, Donna; Sander, Chris; Hamilton, Stanley R.; Gibbs, Richard A.; Wheeler, David
2014-01-01
Approximately 15% of colorectal carcinomas (CRC) exhibit a hypermutated genotype accompanied by high levels of microsatellite instability (MSI-H) and defects in DNA mismatch repair. These tumors, unlike the majority of colorectal carcinomas, are often diploid, exhibit frequent epigenetic silencing of the MLH1 DNA mismatch repair gene, and have a better clinical prognosis. As an adjunct study to The Cancer Genome Atlas consortium that recently analyzed 224 colorectal cancers by whole exome sequencing, we compared the 35 CRC (15.6%) with a hypermutated genotype to those with a non-hypermutated genotype. We found that 22 (63%) of hypermutated CRC exhibited transcriptional silencing of the MLH1 gene, a high frequency of BRAF V600E gene mutations and infrequent APC and KRAS mutations, a mutational pattern significantly different from their non-hypermutated counterparts. However, the remaining 13 (37%) hypermutated CRC lacked MLH1 silencing, contained tumors with the highest mutation rates (“ultramutated” CRC), and exhibited higher incidences of APC and KRAS mutations, but infrequent BRAF mutations. These patterns were confirmed in an independent validation set of 250 exome-sequenced CRC. Analysis of mRNA and microRNA expression signatures revealed that hypermutated CRC with MLH1 silencing had greatly reduced levels of WNT signaling and increased BRAF signaling relative non-hypermutated CRC. Our findings suggest that hypermutated CRC include one subgroup with fundamentally different pathways to malignancy than the majority of CRC. Examination of MLH1 expression status and frequencies of APC, KRAS, and BRAF mutation in CRC may provide a useful diagnostic tool that could supplement the standard microsatellite instability assays and influence therapeutic decisions. PMID:22899370
MicroRNA-155 attenuates late sepsis-induced cardiac dysfunction through JNK and β-arrestin 2.
Zhou, Yu; Song, Yan; Shaikh, Zahir; Li, Hui; Zhang, Haiju; Caudle, Yi; Zheng, Shouhua; Yan, Hui; Hu, Dan; Stuart, Charles; Yin, Deling
2017-07-18
Cardiac dysfunction is correlated with detrimental prognosis of sepsis and contributes to a high risk of mortality. After an initial hyperinflammatory reaction, most patients enter a protracted state of immunosuppression (late sepsis) that alters both innate and adaptive immunity. The changes of cardiac function in late sepsis are not yet known. MicroRNA-155 (miR-155) is previously found to play important roles in both regulations of immune activation and cardiac function. In this study, C57BL/6 mice were operated to develop into early and late sepsis phases, and miR-155 mimic was injected through the tail vein 48 h after cecal ligation and puncture (CLP). The effect of miR-155 on CLP-induced cardiac dysfunction was explored in late sepsis. We found that increased expression of miR-155 in the myocardium protected against cardiac dysfunction in late sepsis evidenced by attenuating sepsis-reduced cardiac output and enhancing left ventricular systolic function. We also observed that miR-155 markedly reduced the infiltration of macrophages and neutrophils into the myocardium and attenuated the inflammatory response via suppression of JNK signaling pathway. Moreover, overexpression of β-arrestin 2 (Arrb2) exacerbated the mice mortality and immunosuppression in late sepsis. Furthermore, transfection of miR-155 mimic reduced Arrb2 expression, and then restored immunocompetence and improved survival in late septic mice. We conclude that increased miR-155 expression through systemic administration of miR-155 mimic attenuates cardiac dysfunction and improves late sepsis survival by targeting JNK associated inflammatory signaling and Arrb2 mediated immunosuppression.
Directory of Open Access Journals (Sweden)
Amanda Ackley
2013-01-01
Full Text Available Small noncoding antisense RNAs (sasRNAs guide epigenetic silencing complexes to target loci in human cells and modulate gene transcription. When these targeted loci are situated within a promoter, long-term, stable epigenetic silencing of transcription can occur. Recent studies suggest that there exists an endogenous form of such epigenetic regulation in human cells involving long noncoding RNAs. In this article, we present and validate an algorithm for the generation of highly effective sasRNAs that can mimic the endogenous noncoding RNAs involved in the epigenetic regulation of gene expression. We validate this algorithm by targeting several oncogenes including AKT-1, c-MYC, K-RAS, and H-RAS. We also target a long antisense RNA that mediates the epigenetic repression of the tumor suppressor gene DUSP6, silenced in pancreatic cancer. An algorithm that can efficiently design small noncoding RNAs for the epigenetic transcriptional silencing or activation of specific genes has potential therapeutic and experimental applications.
Mo, Xianchao; Li, Weizhong
2014-05-01
To investigate the effect of small interfering RNA (siRNA)-mediated COX-2 gene silencing in enhancing the chemosensitivity of KB/VCR cell lines. KB/VCR cells were trasnfected with COX-2 siRNA were examined for expressions of COX-2 and MDR-1 mRNAs with RT-PCR and for Rho-123 accumulation using flow cytometry. MTT assay was used to analyze the proliferation of the transfected KB/VCR cells. Compared with the negative and blank control groups, COX-2 siRNA transfection resulted in significant growth inhibition of KB/VCR cells exposed to vincristine (PKB/VCR cells. COX-2 gene silencing can enhance the chemosensitivity of KB/VCR cells to vincristine, the mechanism of which may involve down-regulated MDR-1 gene expression and inhibition of P-glycoprotein activity.
McClure, Julie M; Gallo, Christopher M; Smith, Daniel L; Matecic, Mirela; Hontz, Robert D; Buck, Stephen W; Racette, Frances G; Smith, Jeffrey S
2008-10-01
The histone deacetylase activity of Sir2p is dependent on NAD(+) and inhibited by nicotinamide (NAM). As a result, Sir2p-regulated processes in Saccharomyces cerevisiae such as silencing and replicative aging are susceptible to alterations in cellular NAD(+) and NAM levels. We have determined that high concentrations of NAM in the growth medium elevate the intracellular NAD(+) concentration through a mechanism that is partially dependent on NPT1, an important gene in the Preiss-Handler NAD(+) salvage pathway. Overexpression of the nicotinamidase, Pnc1p, prevents inhibition of Sir2p by the excess NAM while maintaining the elevated NAD(+) concentration. This growth condition alters the epigenetics of rDNA silencing, such that repression of a URA3 reporter gene located at the rDNA induces growth on media that either lacks uracil or contains 5-fluoroorotic acid (5-FOA), an unusual dual phenotype that is reminiscent of telomeric silencing (TPE) of URA3. Despite the similarities to TPE, the modified rDNA silencing phenotype does not require the SIR complex. Instead, it retains key characteristics of typical rDNA silencing, including RENT and Pol I dependence, as well as a requirement for the Preiss-Handler NAD(+) salvage pathway. Exogenous nicotinamide can therefore have negative or positive impacts on rDNA silencing, depending on the PNC1 expression level.
International Nuclear Information System (INIS)
Bancroft, A.J.; Devaney, E.; Grencis, R.K.; Else, K.J.
1993-01-01
BALB/c mice immunized with radiation-attenuated third stage larvae of the filarial nematode Brugia pahangi are strongly immune to challenge infection. Investigation of the profile of cytokines secreted by spleen cells from immune mice stimulated in vitro with either parasite Ag or with Con A revealed high levels of IL-5 and IL-9 and moderate levels of IL-4. In contrast, secretion of IFN-γ by spleen cells from immune animals was negligible. Spleen cells from control mice secreted low levels of all cytokines assayed. Levels of parasite-specific IgE were significantly elevated in immune animals and a peripheral blood eosinophilia was observed, which exhibited a biphasic distribution. Our results are consistent with the preferential expansion of Th2 cells in immune animals and provide the basis for dissecting the means by which radiation-attenuated larvae of filarial nematodes stimulate immunity. 5l refs., 3 figs., 3 tabs
The dynamics and efficacy of antiviral RNA silencing: A model study
Directory of Open Access Journals (Sweden)
Hogeweg Paulien
2008-03-01
Full Text Available Abstract Background Mathematical modeling is important to provide insight in the complicated pathway of RNA silencing. RNA silencing is an RNA based mechanism that is widely used by eukaryotes to fight viruses, and to control gene expression. Results We here present the first mathematical model that combines viral growth with RNA silencing. The model involves a plus-strand RNA virus that replicates through a double-strand RNA intermediate. The model of the RNA silencing pathway consists of cleavage of viral RNA into siRNA by Dicer, target cleavage of viral RNA via the RISC complex, and a secondary response. We found that, depending on the strength of the silencing response, different viral growth patterns can occur. Silencing can decrease viral growth, cause oscillations, or clear the virus completely. Our model can explain various observed phenomena, even when they seem contradictory at first: the diverse responses to the removal of RNA dependent RNA polymerase; different viral growth curves; and the great diversity in observed siRNA ratios. Conclusion The model presented here is an important step in the understanding of the natural functioning of RNA silencing in viral infections.
The organisational silence of midwives and nurses: reasons and results.
Yurdakul, Mine; Beşen, Meltem Aydin; Erdoğan, Semra
2016-07-01
The study was conducted to determine the issues about which nurses and midwives remain silent and the reasons for it and the perceived results of silence. Organisational silence is a vitally important issue in the health sector, due to the risks and mistakes that are not reported, and proposals for improvement that are not made. The sample of this descriptive survey, which investigated a cause and effect relationship, was 159 nurses and midwives. The data were collected using a questionnaire and the organisational silence scale. Of the study participants, 84.9% were nurses and 15.1% were midwives. Of all participants 88.7% were women. 8.8% of participants stated that they never remained silent about issues related to work and the workplace. Respondents most often remained silent about issues related to ethics and responsibility. 'Limited improvement and development' was frequently mentioned as a perceived result of organisational silence. Our study determined that organisational silence is quite common among nurses and midwives. Activities that raise the awareness of hospital administrations and employees about preventing the factors that cause and maintain silence in hospitals should be planned. © 2016 John Wiley & Sons Ltd.
The RNA silencing pathway: the bits and pieces that matter.
Directory of Open Access Journals (Sweden)
2005-07-01
Full Text Available Cellular pathways are generally proposed on the basis of available experimental knowledge. The proposed pathways, however, may be inadequate to describe the phenomena they are supposed to explain. For instance, by means of concise mathematical models we are able to reveal shortcomings in the current description of the pathway of RNA silencing. The silencing pathway operates by cleaving siRNAs from dsRNA. siRNAs can associate with RISC, leading to the degradation of the target mRNA. We propose and analyze a few small extensions to the pathway: a siRNA degrading RNase, primed amplification of aberrant RNA pieces, and cooperation between aberrant RNA to trigger amplification. These extensions allow for a consistent explanation for various types of silencing phenomena, such as virus induced silencing, transgene and transposon induced silencing, and avoidance of self-reactivity, as well as for differences found between species groups.
A Novel AT-Rich DNA Recognition Mechanism for Bacterial Xenogeneic Silencer MvaT.
Directory of Open Access Journals (Sweden)
Pengfei Ding
2015-06-01
Full Text Available Bacterial xenogeneic silencing proteins selectively bind to and silence expression from many AT rich regions of the chromosome. They serve as master regulators of horizontally acquired DNA, including a large number of virulence genes. To date, three distinct families of xenogeneic silencers have been identified: H-NS of Proteobacteria, Lsr2 of the Actinomycetes, and MvaT of Pseudomonas sp. Although H-NS and Lsr2 family proteins are structurally different, they all recognize the AT-rich DNA minor groove through a common AT-hook-like motif, which is absent in the MvaT family. Thus, the DNA binding mechanism of MvaT has not been determined. Here, we report the characteristics of DNA sequences targeted by MvaT with protein binding microarrays, which indicates that MvaT prefers binding flexible DNA sequences with multiple TpA steps. We demonstrate that there are clear differences in sequence preferences between MvaT and the other two xenogeneic silencer families. We also determined the structure of the DNA-binding domain of MvaT in complex with a high affinity DNA dodecamer using solution NMR. This is the first experimental structure of a xenogeneic silencer in complex with DNA, which reveals that MvaT recognizes the AT-rich DNA both through base readout by an "AT-pincer" motif inserted into the minor groove and through shape readout by multiple lysine side chains interacting with the DNA sugar-phosphate backbone. Mutations of key MvaT residues for DNA binding confirm their importance with both in vitro and in vivo assays. This novel DNA binding mode enables MvaT to better tolerate GC-base pair interruptions in the binding site and less prefer A tract DNA when compared to H-NS and Lsr2. Comparison of MvaT with other bacterial xenogeneic silencers provides a clear picture that nature has evolved unique solutions for different bacterial genera to distinguish foreign from self DNA.
Directory of Open Access Journals (Sweden)
Fernanda M Rodríguez-Tornos
Full Text Available A unique synaptic activity-responsive element (SARE sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein. Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease.
The role of cPLA2 in Methylglyoxal-induced cell apoptosis of HUVECs
International Nuclear Information System (INIS)
Yuan, Jie; Zhu, Chao; Hong, Yali; Sun, Zongxing; Fang, Xianjun; Wu, Biao; Li, Shengnan
2017-01-01
Methylglyoxal (MGO), a highly reactive dicarbonyl compound, is mainly formed as a byproduct of glycolysis. Elevated MGO level is known to induce apoptosis of vascular endothelial cells, which is implicated with progression of atherosclerosis and diabetic complications. However, the underlying mechanisms have not been exhaustively investigated yet. Here, we further characterized the mechanisms how MGO induced apoptosis in human umbilical vein endothelial cells (HUVECs). Our data revealed that cytosolic phospholipase A2 (cPLA2) played an important role in MGO-induced cell apoptosis. It was found that MGO could increase both the activity and expression of cPLA2. Inhibition of cPLA2 by Pyrrophenone (PYR) or siRNA significantly attenuated the MGO-induced apoptosis. Additionally, MGO time-dependently decreased the phosphorylation of nuclear factor κB (NF-κB). Pretreatment of the cells with NF-κB inhibitor, BAY11-7082, further increased MGO-induced apoptosis of HUVECs, indicating that NF-κB played a survival role in this MGO-induced apoptosis. Furthermore, in the presence of si-cPLA2 or PYR, MGO no longer decreased NF-κB phosphorylation. Beyond that, the antioxidant N-acetyl cysteine (NAC) could reverse the changes of both cPLA2 and NF-κB caused by MGO. p38, the upstream of cPLA2, was also significantly phosphorylated by MGO. However, p38 inhibitor failed to reverse the apoptosis induced by MGO. This study gives an important insight into the downstream signaling mechanisms of MGO, cPLA2-NF-κB, in endothelial apoptosis. - Highlights: • cPLA2 participated in MGO-induced HUVECs apoptosis. • Inhibition of NF-κB was involved in MGO-cPLA2-mediated cell apoptosis. • Antioxidant NAC attenuated MGO-induced cPLA2 activation and cell apoptosis.
The role of cPLA2 in Methylglyoxal-induced cell apoptosis of HUVECs
Energy Technology Data Exchange (ETDEWEB)
Yuan, Jie; Zhu, Chao; Hong, Yali; Sun, Zongxing; Fang, Xianjun [Jiangsu Provincial Key Lab of Cardiovascular Diseases and Molecular intervention, Department of Pharmacology, Nanjing Medical University, Nanjing 210029 (China); Wu, Biao, E-mail: wubiao@ncu.edu.cn [Department of Surgery, The First Affiliated Hospital, Nanchang University (China); Li, Shengnan, E-mail: snli@njmu.edu.cn [Jiangsu Provincial Key Lab of Cardiovascular Diseases and Molecular intervention, Department of Pharmacology, Nanjing Medical University, Nanjing 210029 (China)
2017-05-15
Methylglyoxal (MGO), a highly reactive dicarbonyl compound, is mainly formed as a byproduct of glycolysis. Elevated MGO level is known to induce apoptosis of vascular endothelial cells, which is implicated with progression of atherosclerosis and diabetic complications. However, the underlying mechanisms have not been exhaustively investigated yet. Here, we further characterized the mechanisms how MGO induced apoptosis in human umbilical vein endothelial cells (HUVECs). Our data revealed that cytosolic phospholipase A2 (cPLA2) played an important role in MGO-induced cell apoptosis. It was found that MGO could increase both the activity and expression of cPLA2. Inhibition of cPLA2 by Pyrrophenone (PYR) or siRNA significantly attenuated the MGO-induced apoptosis. Additionally, MGO time-dependently decreased the phosphorylation of nuclear factor κB (NF-κB). Pretreatment of the cells with NF-κB inhibitor, BAY11-7082, further increased MGO-induced apoptosis of HUVECs, indicating that NF-κB played a survival role in this MGO-induced apoptosis. Furthermore, in the presence of si-cPLA2 or PYR, MGO no longer decreased NF-κB phosphorylation. Beyond that, the antioxidant N-acetyl cysteine (NAC) could reverse the changes of both cPLA2 and NF-κB caused by MGO. p38, the upstream of cPLA2, was also significantly phosphorylated by MGO. However, p38 inhibitor failed to reverse the apoptosis induced by MGO. This study gives an important insight into the downstream signaling mechanisms of MGO, cPLA2-NF-κB, in endothelial apoptosis. - Highlights: • cPLA2 participated in MGO-induced HUVECs apoptosis. • Inhibition of NF-κB was involved in MGO-cPLA2-mediated cell apoptosis. • Antioxidant NAC attenuated MGO-induced cPLA2 activation and cell apoptosis.
Directory of Open Access Journals (Sweden)
Pizzichini Daniele
2007-03-01
Full Text Available Abstract Background Beta-carotene is the main dietary precursor of vitamin A. Potato tubers contain low levels of carotenoids, composed mainly of the xanthophylls lutein (in the beta-epsilon branch and violaxanthin (in the beta-beta branch. None of these carotenoids have provitamin A activity. We have previously shown that tuber-specific silencing of the first step in the epsilon-beta branch, LCY-e, redirects metabolic flux towards beta-beta carotenoids, increases total carotenoids up to 2.5-fold and beta-carotene up to 14-fold. Results In this work, we silenced the non-heme beta-carotene hydroxylases CHY1 and CHY2 in the tuber. Real Time RT-PCR measurements confirmed the tuber-specific silencing of both genes . CHY silenced tubers showed more dramatic changes in carotenoid content than LCY-e silenced tubers, with beta-carotene increasing up to 38-fold and total carotenoids up to 4.5-fold. These changes were accompanied by a decrease in the immediate product of beta-carotene hydroxylation, zeaxanthin, but not of the downstream xanthophylls, viola- and neoxanthin. Changes in endogenous gene expression were extensive and partially overlapping with those of LCY-e silenced tubers: CrtISO, LCY-b and ZEP were induced in both cases, indicating that they may respond to the balance between individual carotenoid species. Conclusion Together with epsilon-cyclization of lycopene, beta-carotene hydroxylation is another regulatory step in potato tuber carotenogenesis. The data are consistent with a prevalent role of CHY2, which is highly expressed in tubers, in the control of this step. Combination of different engineering strategies holds good promise for the manipulation of tuber carotenoid content.
Directory of Open Access Journals (Sweden)
Ximena Suárez
2017-10-01
Full Text Available Journalists and human rights defenders in Mexico are being attacked in an attempt to silence their criticism. Many are forced to flee or risk being assassinated. The consequences are both personal and of wider social significance.
Samuel, Glady Hazitha; Wiley, Michael R; Badawi, Atif; Adelman, Zach N; Myles, Kevin M
2016-11-29
Mosquito-borne flaviviruses, including yellow fever virus (YFV), Zika virus (ZIKV), and West Nile virus (WNV), profoundly affect human health. The successful transmission of these viruses to a human host depends on the pathogen's ability to overcome a potentially sterilizing immune response in the vector mosquito. Similar to other invertebrate animals and plants, the mosquito's RNA silencing pathway comprises its primary antiviral defense. Although a diverse range of plant and insect viruses has been found to encode suppressors of RNA silencing, the mechanisms by which flaviviruses antagonize antiviral small RNA pathways in disease vectors are unknown. Here we describe a viral suppressor of RNA silencing (VSR) encoded by the prototype flavivirus, YFV. We show that the YFV capsid (YFC) protein inhibits RNA silencing in the mosquito Aedes aegypti by interfering with Dicer. This VSR activity appears to be broadly conserved in the C proteins of other medically important flaviviruses, including that of ZIKV. These results suggest that a molecular "arms race" between vector and pathogen underlies the continued existence of flaviviruses in nature.
Sound velocity and attenuation in single-crystal YBa2Cu3O/sub 7-//sub δ/
International Nuclear Information System (INIS)
Shi, X.D.; Yu, R.C.; Wang, Z.Z.; Ong, N.P.; Chaikin, P.M.
1989-01-01
We have used a modified vibrating reed technique to measure the temperature dependence of the sound velocity and attenuation for modes corresponding to the Young's modulus and c/sub 14/ shear modulus of single crystals of YBa 2 Cu 3 O/sub 7-//sub δ/. The Young's sound velocity shows a tremendous softening during the superconducting transition: a smeared discontinuity of as high as 190 ppm. Below the transition, the temperature dependences of both sound velocities harden considerably. The discontinuities of the sound velocities and their temperature derivatives at T/sub c/ are related to the specific-heat jump at the superconducting transition
International Nuclear Information System (INIS)
Higgins, Larry G.; Kelleher, Michael O.; Eggleston, Ian M.; Itoh, Ken; Yamamoto, Masayuki; Hayes, John D.
2009-01-01
Sulforaphane can stimulate cellular adaptation to redox stressors through transcription factor Nrf2. Using mouse embryonic fibroblasts (MEFs) as a model, we show herein that the normal homeostatic level of glutathione in Nrf2 -/- MEFs was only 20% of that in their wild-type counterparts. Furthermore, the rate of glutathione synthesis following its acute depletion upon treatment with 3 μmol/l sulforaphane was very substantially lower in Nrf2 -/- MEFs than in wild-type cells, and the rebound leading to a ∼ 1.9-fold increase in glutathione that occurred 12-24 h after Nrf2 +/+ MEFs were treated with sulforaphane was not observed in Nrf2 -/- fibroblasts. Wild-type MEFs that had been pre-treated for 24 h with 3 μmol/l sulforaphane exhibited between 1.4- and 3.2-fold resistance against thiol-reactive electrophiles, including isothiocyanates, α,β-unsaturated carbonyl compounds (e.g. acrolein), aryl halides and alkene epoxides. Pre-treatment of Nrf2 +/+ MEFs with sulforaphane also protected against hydroperoxides (e.g. cumene hydroperoxide, CuOOH), free radical-generating compounds (e.g. menadione), and genotoxic electrophiles (e.g. chlorambucil). By contrast, Nrf2 -/- MEFs were typically ∼ 50% less tolerant of these agents than wild-type fibroblasts, and sulforaphane pre-treatment did not protect the mutant cells against xenobiotics. To test whether Nrf2-mediated up-regulation of glutathione represents the major cytoprotective mechanism stimulated by sulforaphane, 5 μmol/l buthionine sulfoximine (BSO) was used to inhibit glutathione synthesis. In Nrf2 +/+ MEFs pre-treated with sulforaphane, BSO diminished intrinsic resistance and abolished inducible resistance to acrolein, CuOOH and chlorambucil, but not menadione. Thus Nrf2-dependent up-regulation of GSH is the principal mechanism by which sulforaphane pre-treatment induced resistance to acrolein, CuOOH and chlorambucil, but not menadione.
Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder
2016-03-01
Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. Copyright © 2016
Suppressors of RNA silencing encoded by tomato leaf curl ...
Indian Academy of Sciences (India)
2013-01-06
Jan 6, 2013 ... Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to ... severe disease symptom in the host (Briddon et al. ..... Voinnet O 2001 RNA silencing as a plant immune system against.
International Nuclear Information System (INIS)
Zhao Weihong; Zhong Li; Wu Jianqing; Chen Linyuan; Qing Keyun; Weigel-Kelley, Kirsten A.; Larsen, Steven H.; Shou Weinian; Warrington, Kenneth H.; Srivastava, Arun
2006-01-01
We have reported that tyrosine-phosphorylated forms of a cellular protein, FKBP52, inhibit the second-strand DNA synthesis of adeno-associated virus 2 (AAV), leading to inefficient transgene expression from recombinant AAV vectors. To further explore the role of FKBP52 in AAV-mediated transduction, we established murine embryo fibroblasts (MEFs) cultures from FKBP52 wild-type (WT), heterozygous (HE), and knockout (KO) mice. Conventional AAV vectors failed to transduce WT MEFs efficiently, and the transduction efficiency was not significantly increased in HE or KO MEFs. AAV vectors failed to traffic efficiently to the nucleus in these cells. Treatment with hydroxyurea (HU) increased the transduction efficiency of conventional AAV vectors by ∼25-fold in WT MEFs, but only by ∼4-fold in KO MEFs. The use of self-complementary AAV (scAAV) vectors, which bypass the requirement of viral second-strand DNA synthesis, revealed that HU treatment increased the transduction efficiency ∼23-fold in WT MEFs, but only ∼4-fold in KO MEFs, indicating that the lack of HU treatment-mediated increase in KO MEFs was not due to failure of AAV to undergo viral second-strand DNA synthesis. Following HU treatment, ∼59% of AAV genomes were present in the nuclear fraction from WT MEFs, but only ∼28% in KO MEFs, indicating that the pathway by which HU treatment mediates nuclear transport of AAV was impaired in KO MEFs. When KO MEFs were stably transfected with an FKBP52 expression plasmid, HU treatment-mediated increase in the transduction efficiency was restored in these cells, which correlated directly with improved intracellular trafficking. Intact AAV particles were also shown to interact with FKBP52 as well as with dynein, a known cellular protein involved in AAV trafficking. These studies suggest that FKBP52, being a cellular chaperone protein, facilitates intracellular trafficking of AAV, which has implications in the optimal use of recombinant AAV vectors in human gene
Directory of Open Access Journals (Sweden)
Hu Qi
2015-09-01
Full Text Available Background/Aims: Diabetic patients suffer from severe neointimal hyperplasia following angioplasty. The epigenetic abnormalities are increasingly considered to be relevant to the pathogenesis of diabetic cardiovascular complications. But the epigenetic mechanisms linking diabetes and coronary restenosis have not been fully elucidated. In this study, we explored the protective effect and underlying mechanisms of demethylases JMJD2A inhibition in balloon-injury induced neointimal formation in diabetic rats. Methods: JMJD2A inhibition was achieved by the chemical inhibitor 2,4-pyridinedicarboxylic acid (2,4-PDCA and small interfering RNA (siRNA. In vitro, we investigated the proliferation, migration and inflammation of rat vascular smooth muscle cells (VSMCs in response to high glucose (HG. In vivo, diabetic rats induced using high-fat diet and low-dose streptozotocin (35mg/kg underwent carotid artery balloon injury. Morphometric analysis was performed using hematein eosin and immumohistochemical staining. Chromatin Immunoprecipitation (ChIP was conducted to detect modification of H3K9me3 at inflammatory genes promoters. Results: The global JMJD2A was increased in HG-stimulated VSMCs and balloon-injured arteries of diabetic rats, accompanied by decreased H3K9me3. The inhibition of JMJD2A suppressed VSMCs proliferation, migration and inflammation induced by high glucose (HG in vitro. And JMJDA2A inhibition attenuated neointimal formation in balloon-injured diabetic rats. The underlying mechanisms were relevant to the restoration of H3K9me3 levels at the promoters of MCP-1 and IL-6, and then the suppressed expression of MCP-1 and IL-6. Conclusion: The JMJD2A inhibition significantly attenuated neointimal formation in balloon injured diabetic rats via the suppression of VSMCs proliferation, migration, and inflammation by restoring H3K9me3.
Bejerman, Nicolás; Mann, Krin S; Dietzgen, Ralf G
2016-09-15
Plants employ RNA silencing as an innate defense mechanism against viruses. As a counter-defense, plant viruses have evolved to express RNA silencing suppressor proteins (RSS), which target one or more steps of the silencing pathway. In this study, we show that the phosphoprotein (P) encoded by the negative-sense RNA virus alfalfa dwarf virus (ADV), a species of the genus Cytorhabdovirus, family Rhabdoviridae, is a suppressor of RNA silencing. ADV P has a relatively weak local RSS activity, and does not prevent siRNA accumulation. On the other hand, ADV P strongly suppresses systemic RNA silencing, but does not interfere with the short-distance spread of silencing, which is consistent with its lack of inhibition of siRNA accumulation. The mechanism of suppression appears to involve ADV P binding to RNA-induced silencing complex proteins AGO1 and AGO4 as shown in protein-protein interaction assays when ectopically expressed. In planta, we demonstrate that ADV P likely functions by inhibiting miRNA-guided AGO1 cleavage and prevents transitive amplification by repressing the production of secondary siRNAs. As recently described for lettuce necrotic yellows cytorhabdovirus P, but in contrast to other viral RSS known to disrupt AGO activity, ADV P sequence does not contain any recognizable GW/WG or F-box motifs, which suggests that cytorhabdovirus P proteins may use alternative motifs to bind to AGO proteins. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Huijuan Zhang
2016-08-01
Full Text Available Trehalose and its metabolism have been demonstrated to play important roles in control of plant growth, development and stress responses. However, direct genetic evidence supporting the functions of trehalose and its metabolism in defense response against pathogens is lacking. In the present study, genome-wide characterization of putative trehalose-related genes identified 11 SlTPSs for trehalose-6-phosphate synthase, 8 SlTPPs for trehalose-6-phosphate phosphatase and one SlTRE1 for trehalase in tomato genome. Nine SlTPSs, 4 SlTPPs and SlTRE1 were selected for functional analyses to explore their involvement in tomato disease resistance. Some selected SlTPSs, SlTPPs and SlTRE1 responded with distinct expression induction patterns to Botrytis cinerea and Pseudomonas syringae pv. tomato (Pst DC3000 as well as to defense signaling hormones (e.g. salicylic acid, jasmonic acid and a precursor of ethylene. Virus-induced gene silencing-mediated silencing of SlTPS3, SlTPS4 or SlTPS7 led to deregulation of ROS accumulation and attenuated the expression of defense-related genes upon pathogen infection and thus deteriorated the resistance against B. cinerea or Pst DC3000. By contrast, silencing of SlTPS5 or SlTPP2 led to an increased expression of the defense-related genes upon pathogen infection and conferred an increased resistance against Pst DC3000. Silencing of SlTPS3, SlTPS4, SlTPS5, SlTPS7 or SlTPP2 affected trehalose level in tomato plants with or without infection of B. cinerea or Pst DC3000. These results demonstrate that SlTPS3, SlTPS4, SlTPS5, SlTPS7 and SlTPP2 play roles in resistance against B. cinerea and Pst DC3000, implying the importance of trehalose and tis metabolism in regulation of defense response against pathogens in tomato.
DEFF Research Database (Denmark)
Bruce, E; Shenoy, V; Rathinasabapathy, A
2015-01-01
. However, the role of the angiotensin type II receptor (AT2 receptor) in PH has not been fully elucidated. We have taken advantage of a recently identified non-peptide AT2 receptor agonist, Compound 21 (C21), to investigate its effects on the well-established monocrotaline (MCT) rat model of PH....... EXPERIMENTAL APPROACH: A single subcutaneous injection of MCT (50 mg/kg) was used to induce PH in 8-week-old male Sprague Dawley rats. After 2-weeks of MCT administration, a subset of animals began receiving, either 0.03mg/kg C21, 3mg/kg PD-123319, 0.5mg/kg A779 for an additional 2-weeks, after which right......-ventricular hemodynamic parameters were measured and tissues collected for gene expression and histological analyses. KEY RESULTS: Initiation of C21 treatment significantly attenuated much of the pathophysiology associated with MCT-induced PH. Most notably, C21 reversed pulmonary fibrosis and prevented right ventricular...
The coriolis attenuation problem in the perturbed i13/2 neutronbands
Directory of Open Access Journals (Sweden)
T. Engeland
1983-01-01
Full Text Available The Coriolis attenuation problem in the particle-rotor model is shown to be related to the BCS approximation. A model including the full recoil effect of one- and two-body terms, and with an exact diagonalization of the pairing force, is applied on four nuclei in the rare earth region known to have strongly Coriolis-perturbed i13/2 rotational bands. In all nuclei, the old Coriolis attenuation problem has been removed.
Silencing p110β prevents rapid depletion of nuclear pAkt
International Nuclear Information System (INIS)
Ye, Zhi-wei; Ghalali, Aram; Högberg, Johan; Stenius, Ulla
2011-01-01
Highlights: ► p110β was essential for the statin- and ATP-induced depletion of nuclear pAkt and an associated inhibition of growth. ► p110β knock-out inhibited statin-induced changes in binding between FKBP51, pAkt and PTEN. ► Data supports the hypothesis that nuclear pAkt is important for anti-cancer effects of statins. -- Abstract: The p110β subunit in the class IA PI3K family may act as an oncogene and is critical for prostate tumor development in PTEN knockout mice. We tested the possible involvement of p110β in a recently described rapid depletion of phosphorylated Akt (pAkt) in the nucleus. Previous work showed that this down-regulation is induced by extracellular ATP or by statins and is mediated by the purinergic receptor P2X7. Here, we used p110β knock out mouse embryonic fibroblasts (MEFs) and siRNA-treated cancer cells. We found that p110β is essential for ATP- or statin-induced nuclear pAkt depletion in MEFs and in several cancer cell lines including prostate cancer cells. ATP, statin or the selective P2X7 agonist BzATP also inhibited cell growth, and this inhibition was not seen in p110β knock out cells. We also found that p110β was necessary for statin-induced changes in binding between FKBP51, pAkt and PTEN. Our data show that p110β is essential for the ATP- and statin-induced effects and support a role of nuclear pAkt in cancer development. They also provide support for a chemopreventive effect of statins mediated by depletion of nuclear pAkt.
Silencing p110{beta} prevents rapid depletion of nuclear pAkt
Energy Technology Data Exchange (ETDEWEB)
Ye, Zhi-wei; Ghalali, Aram; Hoegberg, Johan [Institute of Environmental Medicine, Karolinska Institutet, S-17177 Stockholm (Sweden); Stenius, Ulla, E-mail: ulla.stenius@ki.se [Institute of Environmental Medicine, Karolinska Institutet, S-17177 Stockholm (Sweden)
2011-12-02
Highlights: Black-Right-Pointing-Pointer p110{beta} was essential for the statin- and ATP-induced depletion of nuclear pAkt and an associated inhibition of growth. Black-Right-Pointing-Pointer p110{beta} knock-out inhibited statin-induced changes in binding between FKBP51, pAkt and PTEN. Black-Right-Pointing-Pointer Data supports the hypothesis that nuclear pAkt is important for anti-cancer effects of statins. -- Abstract: The p110{beta} subunit in the class IA PI3K family may act as an oncogene and is critical for prostate tumor development in PTEN knockout mice. We tested the possible involvement of p110{beta} in a recently described rapid depletion of phosphorylated Akt (pAkt) in the nucleus. Previous work showed that this down-regulation is induced by extracellular ATP or by statins and is mediated by the purinergic receptor P2X7. Here, we used p110{beta} knock out mouse embryonic fibroblasts (MEFs) and siRNA-treated cancer cells. We found that p110{beta} is essential for ATP- or statin-induced nuclear pAkt depletion in MEFs and in several cancer cell lines including prostate cancer cells. ATP, statin or the selective P2X7 agonist BzATP also inhibited cell growth, and this inhibition was not seen in p110{beta} knock out cells. We also found that p110{beta} was necessary for statin-induced changes in binding between FKBP51, pAkt and PTEN. Our data show that p110{beta} is essential for the ATP- and statin-induced effects and support a role of nuclear pAkt in cancer development. They also provide support for a chemopreventive effect of statins mediated by depletion of nuclear pAkt.
RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops.
Guo, Qigao; Liu, Qing; Smith, Neil A; Liang, Guolu; Wang, Ming-Bo
2016-12-01
Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing artificial RNA silencing technologies such as hairpin RNA, artificial microRNA, intrinsic direct repeat, 3' UTR inverted repeat, artificial trans-acting siRNA, and virus-induced gene silencing technologies. Some of these RNA silencing technologies, such as the hairpin RNA technology, have already been widely used for genetic improvement of crop plants in agriculture. For horticultural plants, RNA silencing technologies have been used to increase disease and pest resistance, alter plant architecture and flowering time, improve commercial traits of fruits and flowers, enhance nutritional values, remove toxic compounds and allergens, and develop high-value industrial products. In this article we aim to provide an overview of the RNA silencing pathways in plants, summarize the existing RNA silencing technologies, and review the current progress in applying these technologies for the improvement of agricultural crops particularly horticultural crops.
Fegers, Inga; Kob, Robert; Eckey, Maren; Schmidt, Oliver; Goeman, Frauke; Papaioannou, Maria; Escher, Niko; von Eggeling, Ferdinand; Melle, Christian; Baniahmad, Aria
2007-11-01
The tumor suppressor p33ING1 is involved in DNA repair and cell cycle regulation. Furthermore, p33ING1 is a transcriptional silencer that recognizes the histone mark for trimethylated lysine 4 at histone H3. Interestingly, expression of p33ING1 and p33ING2 is able to induce premature senescence in primary human fibroblasts. The corepressor Alien is involved in gene silencing mediated by selected members of nuclear hormone receptors. In addition, Alien acts as a corepressor for E2F1, a member of the E2F cell cycle regulatory family. Furthermore, recent findings suggest that Alien is complexed with transcription factors participating in DNA repair and chromatin. Here, using a proteomic approach by surface-enhanced laser desorption ionization and mass spectrometry (SELDI-MS) combined with immunological techniques, we show that Alien interacts in vivo with the tumor suppressor p33ING1 as well as with the related tumor suppressor candidate p33ING2. The interaction of Alien with p33ING1 and p33ING2 was confirmed in vitro with GST-pull-down, suggesting a direct binding of Alien to these factors. The binding domain was mapped to a central region of Alien. Functionally, the expression of p33ING1 or p33ING2 enhances the Alien-mediated silencing, suggesting that the interaction plays a role in transcriptional regulation. Thus, the findings suggest that the identified interaction between Alien and the tumor suppressors p33ING1 and p33ING2 reveals a novel cellular protein network.
Directory of Open Access Journals (Sweden)
Lim Chee Liew
Full Text Available Epigenetics has been recognised to play vital roles in many plant developmental processes, including floral initiation through the epigenetic regulation of gene expression. The histone modifying proteins that mediate these modifications involve the SET domain-containing histone methyltransferases, JmjC domain-containing demethylase, acetylases and deacetylases. In addition, RNA interference (RNAi-associated genes are also involved in epigenetic regulation via RNA-directed DNA methylation and post-transcriptional gene silencing. Soybean, a major crop legume, requires a short day to induce flowering. How histone modifications regulate the plant response to external cues that initiate flowering is still largely unknown. Here, we used RNA-seq to address the dynamics of transcripts that are potentially involved in the epigenetic programming and RNAi mediated gene silencing during the floral initiation of soybean. Soybean is a paleopolyploid that has been subjected to at least two rounds of whole genome duplication events. We report that the expanded genomic repertoire of histone modifiers and RNA silencing genes in soybean includes 14 histone acetyltransferases, 24 histone deacetylases, 47 histone methyltransferases, 15 protein arginine methyltransferases, 24 JmjC domain-containing demethylases and 47 RNAi-associated genes. To investigate the role of these histone modifiers and RNA silencing genes during floral initiation, we compared the transcriptional dynamics of the leaf and shoot apical meristem at different time points after a short-day treatment. Our data reveal that the extensive activation of genes that are usually involved in the epigenetic programming and RNAi gene silencing in the soybean shoot apical meristem are reprogrammed for floral development following an exposure to inductive conditions.
Directory of Open Access Journals (Sweden)
Noreen F Rizvi
Full Text Available The Catharanthus roseus plant is the source of many valuable terpenoid indole alkaloids (TIAs, including the anticancer compounds vinblastine and vincristine. Transcription factors (TFs are promising metabolic engineering targets due to their ability to regulate multiple biosynthetic pathway genes. To increase TIA biosynthesis, we elicited the TIA transcriptional activators (ORCAs and other unidentified TFs with the plant hormone, methyl jasmonate (MJ, while simultaneously silencing the expression of the transcriptional repressor ZCT1. To silence ZCT1, we developed transgenic hairy root cultures of C. roseus that expressed an estrogen-inducible Zct1 hairpin for activating RNA interference. The presence of 17β-estradiol (5μM effectively depleted Zct1 in hairy root cultures elicited with MJ dosages that either optimize or inhibit TIA production (250 or 1000μM. However, silencing Zct1 was not sufficient to increase TIA production or the expression of the TIA biosynthetic genes (G10h, Tdc, and Str, illustrating the tight regulation of TIA biosynthesis. The repression of the TIA biosynthetic genes at the inhibitory MJ dosage does not appear to be solely regulated by ZCT1. For instance, while Zct1 and Zct2 levels decreased through activating the Zct1 hairpin, Zct3 levels remained elevated. Since ZCT repressors have redundant yet distinct functions, silencing all three ZCTs may be necessary to relieve their repression of alkaloid biosynthesis.
Stability of RNA silencing-based traits after virus infection
DEFF Research Database (Denmark)
Jørgensen, Bodil; Albrechtsen, Merete
2007-01-01
with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... engineered virus resistance based on either a simple sense or an inverted repeat construct. We decided to use genetically engineered virus resistance in potato as a model system for further studies of the effect of virus infection on genetically engineered traits. We present for the first time a comparison...
FOXO/DAF-16 Activation Slows Down Turnover of the Majority of Proteins in C. elegans
Directory of Open Access Journals (Sweden)
Ineke Dhondt
2016-09-01
Full Text Available Most aging hypotheses assume the accumulation of damage, resulting in gradual physiological decline and, ultimately, death. Avoiding protein damage accumulation by enhanced turnover should slow down the aging process and extend the lifespan. However, lowering translational efficiency extends rather than shortens the lifespan in C. elegans. We studied turnover of individual proteins in the long-lived daf-2 mutant by combining SILeNCe (stable isotope labeling by nitrogen in Caenorhabditis elegans and mass spectrometry. Intriguingly, the majority of proteins displayed prolonged half-lives in daf-2, whereas others remained unchanged, signifying that longevity is not supported by high protein turnover. This slowdown was most prominent for translation-related and mitochondrial proteins. In contrast, the high turnover of lysosomal hydrolases and very low turnover of cytoskeletal proteins remained largely unchanged. The slowdown of protein dynamics and decreased abundance of the translational machinery may point to the importance of anabolic attenuation in lifespan extension, as suggested by the hyperfunction theory.
Sanders, Barbara P; Oakes, Isabel de los Rios; van Hoek, Vladimir; Liu, Ying; Marissen, Wilfred; Minor, Philip D; Wimmer, Eckard; Schuitemaker, Hanneke; Custers, Jerome H H V; Macadam, Andrew; Cello, Jeronimo; Edo-Matas, Diana
2015-11-27
As poliovirus eradication draws closer, alternative Inactivated Poliovirus Vaccines (IPV) are needed to overcome the risks associated with continued use of the Oral Poliovirus Vaccine and of neurovirulent strains used during manufacture of conventional (c) IPV. We have previously demonstrated the susceptibility of the PER.C6(®) cell line to cIPV strains; here we investigated the suspension cell culture platform for growth of attenuated poliovirus strains. We examined attenuated Sabin strain productivity on the PER.C6(®) cell platform compared to the conventional Vero cell platform. The suitability of the suspension cell platform for propagation of rationally-attenuated poliovirus strains (stabilized Sabin type 3 S19 derivatives and genetically attenuated and stabilized MonoCre(X) strains), was also assessed. Yields were quantified by infectious titer determination and D-antigen ELISA using either serotype-specific polyclonal rabbit sera for Sabin strains or monoclonal cIPV-strain-specific antibodies for cIPV, S19 and MonoCre(X) strains. PER.C6(®) cells supported the replication of Sabin strains to yields of infectious titers that were in the range of cIPV strains at 32.5°C. Sabin strains achieved 30-fold higher yields (pSabin strain productivity on the PER.C6(®) cell platform was maintained at 10l scale. Yields of infectious titers of S19 and MonoCre(X) strains were 0.5-1 log10 lower than seen for cIPV strains, whereas D-antigen yield and productivities in doses/ml using rationally-attenuated strains were in line with yields reported for cIPV strains. Sabin and rationally-attenuated polioviruses can be grown to high infectious titers and D-antigen yields. Sabin strain infection shows increased productivity on the PER.C6(®) cell platform as compared to the conventional Vero cell platform. Novel cell platforms with the potential for higher yields could contribute to increased affordability of a next generation of IPV vaccines needed for achieving and
McClure, Julie M.; Wierman, Margaret B.; Maqani, Nazif; Smith, Jeffrey S.
2012-01-01
Sirtuins are an evolutionarily conserved family of NAD+-dependent protein deacetylases that function in the regulation of gene transcription, cellular metabolism, and aging. Their activity requires the maintenance of an adequate intracellular NAD+ concentration through the combined action of NAD+ biosynthesis and salvage pathways. Nicotinamide (NAM) is a key NAD+ precursor that is also a byproduct and feedback inhibitor of the deacetylation reaction. In Saccharomyces cerevisiae, the nicotinamidase Pnc1 converts NAM to nicotinic acid (NA), which is then used as a substrate by the NAD+ salvage pathway enzyme NA phosphoribosyltransferase (Npt1). Isonicotinamide (INAM) is an isostere of NAM that stimulates yeast Sir2 deacetylase activity in vitro by alleviating the NAM inhibition. In this study, we determined that INAM stimulates Sir2 through an additional mechanism in vivo, which involves elevation of the intracellular NAD+ concentration. INAM enhanced normal silencing at the rDNA locus but only partially suppressed the silencing defects of an npt1Δ mutant. Yeast cells grown in media lacking NA had a short replicative life span, which was extended by INAM in a SIR2-dependent manner and correlated with increased NAD+. The INAM-induced increase in NAD+ was strongly dependent on Pnc1 and Npt1, suggesting that INAM increases flux through the NAD+ salvage pathway. Part of this effect was mediated by the NR salvage pathways, which generate NAM as a product and require Pnc1 to produce NAD+. We also provide evidence suggesting that INAM influences the expression of multiple NAD+ biosynthesis and salvage pathways to promote homeostasis during stationary phase. PMID:22539348
McClure, Julie M; Wierman, Margaret B; Maqani, Nazif; Smith, Jeffrey S
2012-06-15
Sirtuins are an evolutionarily conserved family of NAD(+)-dependent protein deacetylases that function in the regulation of gene transcription, cellular metabolism, and aging. Their activity requires the maintenance of an adequate intracellular NAD(+) concentration through the combined action of NAD(+) biosynthesis and salvage pathways. Nicotinamide (NAM) is a key NAD(+) precursor that is also a byproduct and feedback inhibitor of the deacetylation reaction. In Saccharomyces cerevisiae, the nicotinamidase Pnc1 converts NAM to nicotinic acid (NA), which is then used as a substrate by the NAD(+) salvage pathway enzyme NA phosphoribosyltransferase (Npt1). Isonicotinamide (INAM) is an isostere of NAM that stimulates yeast Sir2 deacetylase activity in vitro by alleviating the NAM inhibition. In this study, we determined that INAM stimulates Sir2 through an additional mechanism in vivo, which involves elevation of the intracellular NAD(+) concentration. INAM enhanced normal silencing at the rDNA locus but only partially suppressed the silencing defects of an npt1Δ mutant. Yeast cells grown in media lacking NA had a short replicative life span, which was extended by INAM in a SIR2-dependent manner and correlated with increased NAD(+). The INAM-induced increase in NAD(+) was strongly dependent on Pnc1 and Npt1, suggesting that INAM increases flux through the NAD(+) salvage pathway. Part of this effect was mediated by the NR salvage pathways, which generate NAM as a product and require Pnc1 to produce NAD(+). We also provide evidence suggesting that INAM influences the expression of multiple NAD(+) biosynthesis and salvage pathways to promote homeostasis during stationary phase.
High-efficient production of SiC/SiO2 core-shell nanowires for effective microwave absorption
Zhong, Bo; Sai, Tianqi; Xia, Long; Yu, Yuanlie; Wen, Guangwu
2017-01-01
In the current report, we have demonstrated that the high-efficient production of SiC/SiO2 core-shell nanowires can be achieved through the introduction of trace of water vapor during the chemical vapor deposition process. The yield of the SiC/SiO2 core-shell nanowires is dramatically improved due to the introduction of water vapor. The SiC/SiO2 core-shell nanowires exhibit an excellent microwave absorption property in the frequency range of 2.0–18.0GHz with a very low weight percentage of 0.50wt.% in the absorbers. A minimum reflection loss value of −32.72dB (>99.99% attenuation) at 13.84GHz has been observed with the absorber thickness of 3.0mm. Moreover, the SiC/SiO2 core-shell nanowires based absorber can reach an effective absorption bandwidth (<−10dB) of 5.32GHz with the absorber thickness of 3.5mm. Furthermore, a possible absorption mechanism is also proposed in detail for such effective attenuation of microwave which can be attributed to the dielectric loss and magnetic loss of SiC/SiO2 core-shell nanowires.
High-efficient production of SiC/SiO2 core-shell nanowires for effective microwave absorption
Zhong, Bo
2017-02-21
In the current report, we have demonstrated that the high-efficient production of SiC/SiO2 core-shell nanowires can be achieved through the introduction of trace of water vapor during the chemical vapor deposition process. The yield of the SiC/SiO2 core-shell nanowires is dramatically improved due to the introduction of water vapor. The SiC/SiO2 core-shell nanowires exhibit an excellent microwave absorption property in the frequency range of 2.0–18.0GHz with a very low weight percentage of 0.50wt.% in the absorbers. A minimum reflection loss value of −32.72dB (>99.99% attenuation) at 13.84GHz has been observed with the absorber thickness of 3.0mm. Moreover, the SiC/SiO2 core-shell nanowires based absorber can reach an effective absorption bandwidth (<−10dB) of 5.32GHz with the absorber thickness of 3.5mm. Furthermore, a possible absorption mechanism is also proposed in detail for such effective attenuation of microwave which can be attributed to the dielectric loss and magnetic loss of SiC/SiO2 core-shell nanowires.
Directory of Open Access Journals (Sweden)
Wang Haibo
2010-09-01
Full Text Available Abstract Background RhoA and RhoC have been proved to be over-expressed in many solid cancers, including colorectal cancer. The reduction of RhoA and RhoC expression by RNA interference (RNAi resulted growth inhibition of cancer cells. The present study was to evaluate the effect of silencing of RhoA and RhoC expression by RNAi on growth of human colorectal carcinoma (CRC in tumor-bearing nude mice in vivo. Methods To establish HCT116 cell transplantable model, the nude mice were subcutaneously inoculated with 1.0 × 107 HCT116 cells and kept growing till the tumor xenografts reached 5-7 mm in diameter. Then the mice were randomly assigned to three groups(seven mice in each group: (1 normal saline(NS group, (2replication-defective recombinant adenovirus carrying the negative control shRNA (Ad-HK group and (3replication-defective recombinant adenovirus carrying the 4-tandem linked RhoA and RhoC shRNAs (Ad-RhoA-RhoC group. Ad-HK (4 × 108 pfu, 30 ul/mouse, Ad-RhoA-RhoC (4 × 108 pfu, 30 ul/mouse or PBS (30 ul/mouse was injected intratumorally four times once every other day. The weight and volumes of tumor xenografts were recorded. The levels of RhoA and RhoC mRNA transcripts and proteins in tumor xenografts were detected by reverse quantitative transcription polymerase chain reaction (QRT-PCR and immunohistochemical staining respectively. The terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL assay was used to detect the death of cells. Results The xenografts in mice could be seen at 5th day from the implantation of HCT116 cells and all had reached 5-7 mm in size at 9th day. After injection intratumorally, the growth speed of tumor xenografts in Ad-RhoA-RhoC group was significantly delayed compared with those in NS and Ad-HK group(P RhoA and RhoC reduced more in Ad-RhoA-RhoC group than those in NS and Ad-HK group. The relative RhoA and RhoC mRNA transcripts were decreased to 48% and 43% respectively (P RhoA and RhoC
Antiviral RNA silencing suppression activity of Tomato spotted wilt virus NSs protein.
Ocampo Ocampo, T; Gabriel Peralta, S M; Bacheller, N; Uiterwaal, S; Knapp, A; Hennen, A; Ochoa-Martinez, D L; Garcia-Ruiz, H
2016-06-17
In addition to regulating gene expression, RNA silencing is an essential antiviral defense system in plants. Triggered by double-stranded RNA, silencing results in degradation or translational repression of target transcripts. Viruses are inducers and targets of RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressors that interfere with this process, such as the Tomato spotted wilt virus (TSWV) NSs protein. The mechanism by which NSs suppresses RNA silencing and its role in viral infection and movement remain to be determined. We cloned NSs from the Hawaii isolate of TSWV and using two independent assays show for the first time that this protein restored pathogenicity and supported the formation of local infection foci by suppressor-deficient Turnip mosaic virus and Turnip crinkle virus. Demonstrating the suppression of RNA silencing directed against heterologous viruses establishes the foundation to determine the means used by NSs to block this antiviral process.
DEFF Research Database (Denmark)
Worm, Jesper; Stenvang, Jan; Petri, Andreas
2009-01-01
microRNA-155 (miR-155) has been implicated as a central regulator of the immune system, but its function during acute inflammatory responses is still poorly understood. Here we show that exposure of cultured macrophages and mice to lipopolysaccharide (LPS) leads to up-regulation of miR-155......-stimulating factor (G-CSF), a central regulator of granulopoiesis during inflammatory responses. Consistent with these data, we show that silencing of miR-155 in LPS-treated mice by systemically administered LNA-antimiR results in derepression of the c/ebp Beta isoforms and down-regulation of G-CSF expression...
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 4. Silence of the Genes - 2006 Nobel Prize in Physiology or Medicine. Utpal Nath Saumitra Das. General Article Volume 12 Issue 4 April 2007 pp 6-18. Fulltext. Click here to view fulltext PDF. Permanent link:
Maternal Silences: Motherhood and Voluntary Childlessness in Contemporary Christianity
Directory of Open Access Journals (Sweden)
Dawn Llewellyn
2016-06-01
Full Text Available In Christianity, there is an ideology of motherhood that pervades scripture, ritual, and doctrine, yet there is an academic silence that means relatively little space has been given to motherhood and mothering, and even less to voluntary childlessness, from a faith perspective. By drawing on qualitative in-depth interviews with Christian women living in Britain, narrating their experiences of motherhood and voluntary childlessness, I suggest there are also lived maternal silences encountered by women in contemporary Christianity. There is a maternal expectation produced through church teaching, liturgy and culture that constructs women as ‘maternal bodies’ (Gatrell 2008; this silences and marginalises women from articulating their complex relationship with religion, motherhood, and childlessness in ways that challenge their spiritual development. However, this article also introduces the everyday and intentional tactics women employ to disrupt the maternal expectation, and hereby interrupt the maternal silence.
Bodies, Spaces, Voices, Silences
Directory of Open Access Journals (Sweden)
Donatella Mazzoleni
2013-07-01
Full Text Available A good architecture should not only allow functional, formal and technical quality for urban spaces, but also let the voice of the city be perceived, listened, enjoyed. Every city has got its specific sound identity, or “ISO” (R. O. Benenzon, made up of a complex texture of background noises and fluctuation of sound figures emerging and disappearing in a game of continuous fadings. For instance, the ISO of Naples is characterized by a spread need of hearing the sound return of one’s/others voices, by a hate of silence. Cities may fall ill: illness from noise, within super-crowded neighbourhoods, or illness from silence, in the forced isolation of peripheries. The proposal of an urban music therapy denotes an unpublished and innovative enlarged interdisciplinary research path, where architecture, music, medicine, psychology, communication science may converge, in order to work for rebalancing spaces and relation life of the urban collectivity, through the care of body and sound dimensions.
Tamoxifen attenuates development of lithium-induced nephrogenic diabetes insipidus in rats
DEFF Research Database (Denmark)
Tingskov, Stine Julie; Hu, Shan; Frøkiær, Jorgen
2018-01-01
of aquaporin-2 (AQP2), which are essential for water reabsorption of tubular fluid in the collecting duct. Sex hormones have previously been shown to affect the regulation of AQP2, so we tested whether tamoxifen (TAM), a selective estrogen receptor modulator, would attenuate lithium-induced alterations...... on renal water homeostasis. Rats were treated for 14 days with lithium and TAM treatment was initiated one week after onset of lithium administration. Lithium treatment resulted in severe polyuria and reduced AQP2 expression, which was ameliorated by TAM. Consistent with this, TAM attenuated downregulation...... of AQP2 and increased phosphorylation of the cAMP responsive element binding protein (CREB), which induced AQP2 expression, in freshly isolated inner medullary collecting duct suspension prepared from lithium-treated rats. In conclusion, TAM attenuated dose-dependently polyuria, impaired urine...
Ajjappala, Hemavathi; Chung, Ha Young; Sim, Joon-Soo; Choi, Inchan; Hahn, Bum-Soo
2015-03-01
The aim of this study is to demonstrate the feasibility of down-regulating endogeneous prefoldin-2 root-knot nematode transcripts by expressing dsRNA with sequence identity to the nematode gene in tobacco roots under the influence of strong Arabidopsis ubiquitin (UBQ1) promoter. Root-knot nematodes (RKNs) are sedentary endoparasites infecting a wide range of plant species. They parasitise the root system, thereby disrupting water and nutrient uptake and causing major reductions in crop yields. The most reliable means of controlling RKNs is via the use of soil fumigants such as methyl bromide. With the emergence of RNA interference (RNAi) technology, which permits host-mediated nematode gene silencing, a new strategy to control plant pathogens has become available. In the present study, we investigated host-induced RNAi gene silencing of prefoldin-2 in transgenic Nicotiana benthamiana. Reductions in prefoldin-2 mRNA transcript levels were observed when nematodes were soaked in a dsRNA solution in vitro. Furthermore, nematode reproduction was suppressed in RNAi transgenic lines, as evident by reductions in the numbers of root knots (by 34-60 % in independent RNAi lines) and egg masses (by 33-58 %). Endogenous expression of prefoldin-2, analysed via real-time polymerase chain reaction and Western blotting, revealed that the gene was strongly expressed in the pre-parasitic J2 stage. Our observations demonstrate the relevance and potential importance of targeting the prefoldin gene during the nematode life cycle. The work also suggests that further improvements in silencing efficiency in economically important crops can be accomplished using RNAi directed against plant-parasitic nematodes.
Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing
Hedil, Marcio; Sterken, Mark G.; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard
2015-01-01
RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silen...
DNA triplet repeats mediate heterochromatin-protein-1-sensitive variegated gene silencing.
Saveliev, Alexander; Everett, Christopher; Sharpe, Tammy; Webster, Zoë; Festenstein, Richard
2003-04-24
Gene repression is crucial to the maintenance of differentiated cell types in multicellular organisms, whereas aberrant silencing can lead to disease. The organization of DNA into chromatin and heterochromatin is implicated in gene silencing. In chromatin, DNA wraps around histones, creating nucleosomes. Further condensation of chromatin, associated with large blocks of repetitive DNA sequences, is known as heterochromatin. Position effect variegation (PEV) occurs when a gene is located abnormally close to heterochromatin, silencing the affected gene in a proportion of cells. Here we show that the relatively short triplet-repeat expansions found in myotonic dystrophy and Friedreich's ataxia confer variegation of expression on a linked transgene in mice. Silencing was correlated with a decrease in promoter accessibility and was enhanced by the classical PEV modifier heterochromatin protein 1 (HP1). Notably, triplet-repeat-associated variegation was not restricted to classical heterochromatic regions but occurred irrespective of chromosomal location. Because the phenomenon described here shares important features with PEV, the mechanisms underlying heterochromatin-mediated silencing might have a role in gene regulation at many sites throughout the mammalian genome and modulate the extent of gene silencing and hence severity in several triplet-repeat diseases.
Papaioannou, Garyfallia; Mirzamohammadi, Fatemeh; Lisse, Thomas S; Nishimori, Shigeki; Wein, Marc N; Kobayashi, Tatsuya
2015-06-01
Growth plate chondrocytes go through multiple differentiation steps and eventually become hypertrophic chondrocytes. The parathyroid hormone (PTH)-related peptide (PTHrP) signaling pathway plays a central role in regulation of hypertrophic differentiation, at least in part, through enhancing activity of histone deacetylase 4 (HDAC4), a negative regulator of MEF2 transcription factors that drive hypertrophy. We have previously shown that loss of the chondrocyte-specific microRNA (miRNA), miR-140, alters chondrocyte differentiation including mild acceleration of hypertrophic differentiation. Here, we provide evidence that miR-140 interacts with the PTHrP-HDAC4 pathway to control chondrocyte differentiation. Heterozygosity of PTHrP or HDAC4 substantially impaired animal growth in miR-140 deficiency, whereas these mutations had no effect in the presence of miR-140. miR-140-deficient chondrocytes showed increased MEF2C expression with normal levels of total and phosphorylated HDAC4, indicating that the miR-140 pathway merges with the PTHrP-HDAC4 pathway at the level of MEF2C. miR-140 negatively regulated p38 mitogen-activated protein kinase (MAPK) signaling, and inhibition of p38 MAPK signaling reduced MEF2C expression. These results demonstrate that miR-140 ensures the robustness of the PTHrP/HDAC4 regulatory system by suppressing MEF2C-inducing stimuli. © 2014 American Society for Bone and Mineral Research © 2015 American Society for Bone and Mineral Research. © 2014 American Society for Bone and Mineral Research.
Korhan, Peyda; Erdal, Esra; Kandemiş, Emine; Cokaklı, Murat; Nart, Deniz; Yılmaz, Funda; Can, Alp; Atabey, Neşe
2014-01-01
c-Met, the receptor for Hepatocyte Growth Factor (HGF), overexpressed and deregulated in Hepatocellular Carcinoma (HCC). Caveolin 1 (CAV1), a plasma membrane protein that modulates signal transduction molecules, is also overexpressed in HCC. The aim of this study was to investigate biological and clinical significance of co-expression and activation of c-Met and CAV1 in HCC. We showed that c-Met and CAV1 were co-localized in HCC cells and HGF treatment increased this association. HGF-triggered c-Met activation caused a concurrent rise in both phosphorylation and expression of CAV1. Ectopic expression of CAV1 accelerated c-Met signaling, resulted in enhanced migration, invasion, and branching-morphogenesis. Silencing of CAV1 downregulated c-Met signaling, and decreased migratory/invasive capability of cells and attenuated branching morphogenesis. In addition, activation and co-localization of c-Met and CAV1 were elevated during hepatocarcinogenesis. In conclusion reciprocal activating crosstalk between c-Met and CAV1 promoted oncogenic signaling of c-Met contributed to the initiation and progression of HCC.
Directory of Open Access Journals (Sweden)
Peyda Korhan
Full Text Available c-Met, the receptor for Hepatocyte Growth Factor (HGF, overexpressed and deregulated in Hepatocellular Carcinoma (HCC. Caveolin 1 (CAV1, a plasma membrane protein that modulates signal transduction molecules, is also overexpressed in HCC. The aim of this study was to investigate biological and clinical significance of co-expression and activation of c-Met and CAV1 in HCC. We showed that c-Met and CAV1 were co-localized in HCC cells and HGF treatment increased this association. HGF-triggered c-Met activation caused a concurrent rise in both phosphorylation and expression of CAV1. Ectopic expression of CAV1 accelerated c-Met signaling, resulted in enhanced migration, invasion, and branching-morphogenesis. Silencing of CAV1 downregulated c-Met signaling, and decreased migratory/invasive capability of cells and attenuated branching morphogenesis. In addition, activation and co-localization of c-Met and CAV1 were elevated during hepatocarcinogenesis. In conclusion reciprocal activating crosstalk between c-Met and CAV1 promoted oncogenic signaling of c-Met contributed to the initiation and progression of HCC.
Knockdown of hypocretin attenuates extended access of cocaine self-administration in rats.
Schmeichel, Brooke E; Matzeu, Alessandra; Koebel, Pascale; Vendruscolo, Leandro F; Sidhu, Harpreet; Shahryari, Roxana; Kieffer, Brigitte L; Koob, George F; Martin-Fardon, Rémi; Contet, Candice
2018-04-06
The hypocretin/orexin (HCRT) neuropeptide system regulates feeding, arousal state, stress responses, and reward, especially under conditions of enhanced motivational relevance. In particular, HCRT neurotransmission facilitates drug-seeking behavior in circumstances that demand increased effort and/or motivation to take the drug. The present study used a shRNA-encoding adeno-associated viral vector to knockdown Hcrt expression throughout the dorsal hypothalamus in adult rats and determine the role of HCRT in cocaine self-administration. Chronic Hcrt silencing did not impact cocaine self-administration under short-access conditions, but robustly attenuated cocaine intake under extended access conditions, a model that mimics key features of compulsive cocaine taking. In addition, Hcrt silencing decreased motivation for both cocaine and a highly palatable food reward (i.e., sweetened condensed milk; SCM) under a progressive ratio schedule of reinforcement, but did not alter responding for SCM under a fixed ratio schedule. Importantly, Hcrt silencing did not affect food or water consumption, and had no consequence for general measures of arousal and stress reactivity. At the molecular level, chronic Hcrt knockdown reduced the number of neurons expressing dynorphin (DYN), and to a smaller extent melanin-concentrating hormone (MCH), in the dorsal hypothalamus. These original findings support the hypothesis that HCRT neurotransmission promotes operant responding for both drug and non-drug rewards, preferentially under conditions requiring a high degree of motivation. Furthermore, the current study provides compelling evidence for the involvement of the HCRT system in cocaine self-administration also under low-effort conditions in rats allowed extended access, possibly via functional interactions with DYN and MCH signaling.
Progressive attenuation fields: Fast 2D-3D image registration without precomputation
International Nuclear Information System (INIS)
Rohlfing, Torsten; Russakoff, Daniel B.; Denzler, Joachim; Mori, Kensaku; Maurer, Calvin R. Jr.
2005-01-01
Computation of digitally reconstructed radiograph (DRR) images is the rate-limiting step in most current intensity-based algorithms for the registration of three-dimensional (3D) images to two-dimensional (2D) projection images. This paper introduces and evaluates the progressive attenuation field (PAF), which is a new method to speed up DRR computation. A PAF is closely related to an attenuation field (AF). A major difference is that a PAF is constructed on the fly as the registration proceeds; it does not require any precomputation time, nor does it make any prior assumptions of the patient pose or limit the permissible range of patient motion. A PAF effectively acts as a cache memory for projection values once they are computed, rather than as a lookup table for precomputed projections like standard AFs. We use a cylindrical attenuation field parametrization, which is better suited for many medical applications of 2D-3D registration than the usual two-plane parametrization. The computed attenuation values are stored in a hash table for time-efficient storage and access. Using clinical gold-standard spine image data sets from five patients, we demonstrate consistent speedups of intensity-based 2D-3D image registration using PAF DRRs by a factor of 10 over conventional ray casting DRRs with no decrease of registration accuracy or robustness
Englert, Neal A; Luo, George; Goldstein, Joyce A; Surapureddi, Sailesh
2015-01-23
The Mediator complex is vital for the transcriptional regulation of eukaryotic genes. Mediator binds to nuclear receptors at target response elements and recruits chromatin-modifying enzymes and RNA polymerase II. Here, we examine the involvement of Mediator subunit MED25 in the epigenetic regulation of human cytochrome P450 2C9 (CYP2C9). MED25 is recruited to the CYP2C9 promoter through association with liver-enriched HNF4α, and we show that MED25 influences the H3K27 status of the HNF4α binding region. This region was enriched for the activating marker H3K27ac and histone acetyltransferase CREBBP after MED25 overexpression but was trimethylated when MED25 expression was silenced. The epigenetic regulator Polycomb repressive complex (PRC2), which represses expression by methylating H3K27, plays an important role in target gene regulation. Silencing MED25 correlated with increased association of PRC2 not only with the promoter region chromatin but with HNF4α itself. We confirmed the involvement of MED25 for fully functional preinitiation complex recruitment and transcriptional output in vitro. Formaldehyde-assisted isolation of regulatory elements (FAIRE) revealed chromatin conformation changes that were reliant on MED25, indicating that MED25 induced a permissive chromatin state that reflected increases in CYP2C9 mRNA. For the first time, we showed evidence that a functionally relevant human gene is transcriptionally regulated by HNF4α via MED25 and PRC2. CYP2C9 is important for the metabolism of many exogenous chemicals including pharmaceutical drugs as well as endogenous substrates. Thus, MED25 is important for regulating the epigenetic landscape resulting in transcriptional activation of a highly inducible gene, CYP2C9. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Kim, Soo Gon; Jo, Yong Hun; Seong, Jeong Hwan; Park, Ki Beom; Noh, Mi Young; Cho, Jun Ho; Ko, Hye Jin; Kim, Chang Eun; Tindwa, Hamisi; Patnaik, Bharat Bhusan; Bang, In Seok; Lee, Yong Seok; Han, Yeon Soo
2017-10-01
Scavenger receptors (SRs) constitute a family of membrane-bound receptors that bind to multiple ligands. The SR family of proteins is involved in removing cellular debris, oxidized low-density lipoproteins, and pathogens. Specifically, class C scavenger receptors (SR-C) have also been reported to be involved in phagocytosis of gram-positive and -negative bacteria in Drosophila and viruses in shrimp. However, reports are unavailable regarding the role of SR-C in antifungal immune mechanisms in insects. In this study, a full-length Tenebrio molitor SR-C (TmSR-C) sequence was obtained by 5'- and 3'-Rapid amplification of cDNA ends-polymerase chain reaction (RACE-PCR). The TmSR-C full-length cDNA comprised 1671 bp with 5'- and 3'-untranslated regions of 23- and 107-bp, respectively. TmSR-C encodes a putative protein of 556 amino acid residues that is constitutively expressed in all tissues of late instar larvae and 2-day-old adults, with the highest transcript levels observed in hemocytes of larvae and adults. TmSR-C mRNA showed a 2.5-fold and 3-fold increase at 24 and 6 h after infection with Candida albicans and β-glucan, respectively. Immunoassay with TmSR-C polyclonal antibody showed induction of the putative protein in the cytosols of hemocytes at 3 h after inoculation of C. albicans. RNA interference (RNAi)-based gene silencing and phagocytosis assays were used to understand the role of TmSR-C in antifungal immunity. Silencing of TmSR-C transcripts reduced the survivability of late instar larvae at 2 days post-inoculation of C. albicans, Escherichia coli, or Staphylococcus aureus. Furthermore, in TmSR-C-silenced larvae, there was a decline in the rate of microorganism phagocytosis. Taken together, results of this study suggest that TmSR-C plays a pivotal role in phagocytosing not only fungi but also gram-negative and -positive bacteria in T. molitor. Copyright © 2017. Published by Elsevier Ltd.
Influence of PM1 and PM2.5 on lung function parameters in healthy schoolchildren-a panel study.
Zwozdziak, A; Sówka, I; Willak-Janc, E; Zwozdziak, J; Kwiecińska, K; Balińska-Miśkiewicz, W
2016-12-01
To evaluate lung function responses to short-term indoor PM 1 and PM 2.5 concentrations, we conducted a panel study of healthy schoolchildren aged 13-14 years. The following lung function parameters FVC, FEV 1 , PEF, and mid expiratory flows MEF 25 , MEF 50 , and MEF 75 were measured in 141 schoolchildren of the secondary school in Wroclaw, Poland in years 2009-2010. On days when spirometry tests were conducted, simultaneously, PM 1 and PM 2.5 samples were collected inside the school premises. Information about differentiating factors for children including smoking parents, sex, living close to busy streets, dust, mold, and pollen allergies were collected by means of questionnaires. To account for repeated measurements, the method of generalized estimating equations (GEE) was used. The GEE models for the entire group of children revealed the adverse effects (p < 0.05) of PM 1 and PM 2.5 . Small differences in effects estimates per interquartile range (IQR) of PM 1 and PM 2.5 on MEF 25 (5.1 and 4.8 %), MEF 50 (3.7 and 3.9 %), MEF 75 (3.5 and 3.6 %) and FEV 1 (1.3 and 1.0 %) imply that PM 1 was likely the component of PM 2.5 that might have a principal health effect on these lung function parameters. However, the reduction of FVC and PEF per IQR for PM 2.5 (2.1 and 5.2 %, respectively) was higher than for PM 1 (1.0 and 4.4 %, respectively). Adjustment for potential confounders did not change the unadjusted analysis.
Zhu, Yali; Cherukuri, Nil Celebi; Jackel, Jamie N; Wu, Zetang; Crary, Monica; Buckley, Kenneth J; Bisaro, David M; Parris, Deborah S
2012-03-01
Ebola virus (EBOV) causes a lethal hemorrhagic fever for which there is no approved effective treatment or prevention strategy. EBOV VP35 is a virulence factor that blocks innate antiviral host responses, including the induction of and response to alpha/beta interferon. VP35 is also an RNA silencing suppressor (RSS). By inhibiting microRNA-directed silencing, mammalian virus RSSs have the capacity to alter the cellular environment to benefit replication. A reporter gene containing specific microRNA target sequences was used to demonstrate that prior expression of wild-type VP35 was able to block establishment of microRNA silencing in mammalian cells. In addition, wild-type VP35 C-terminal domain (CTD) protein fusions were shown to bind small interfering RNA (siRNA). Analysis of mutant proteins demonstrated that reporter activity in RSS assays did not correlate with their ability to antagonize double-stranded RNA (dsRNA)-activated protein kinase R (PKR) or bind siRNA. The results suggest that enhanced reporter activity in the presence of VP35 is a composite of nonspecific translational enhancement and silencing suppression. Moreover, most of the specific RSS activity in mammalian cells is RNA binding independent, consistent with VP35's proposed role in sequestering one or more silencing complex proteins. To examine RSS activity in a system without interferon, VP35 was tested in well-characterized plant silencing suppression assays. VP35 was shown to possess potent plant RSS activity, and the activities of mutant proteins correlated strongly, but not exclusively, with RNA binding ability. The results suggest the importance of VP35-protein interactions in blocking silencing in a system (mammalian) that cannot amplify dsRNA.
Moore, Erika M; Swerdlow, Steven H; Gibson, Sarah E
2017-10-01
Although most classical Hodgkin lymphomas (CHLs) are easily distinguished from nodular lymphocyte predominant Hodgkin lymphoma (NLPHL) and primary mediastinal large B-cell lymphoma (PMBL), cases with significant CD20 expression cause diagnostic confusion. Although the absence of OCT-2 and BOB.1 are useful in these circumstances, a variable proportion of CHLs are positive for these antigens. We investigated the utility of J chain and myocyte enhancer factor 2B (MEF2B) in the diagnosis of CHL; NLPHL; PMBL; T-cell/histiocyte-rich large B-cell lymphoma (TCRLBL); and B-cell lymphoma, unclassifiable, with features intermediate between diffuse large B-cell lymphoma and CHL, compared with OCT-2 and BOB.1. J chain and MEF2B highlighted lymphocyte predominant (LP) cells in 20/20 (100%) NLPHLs and were negative in 43/43 (100%) CHLs. Fourteen of 15 (93%) PMBLs and 4/4 (100%) TCRLBLs were MEF2B positive, whereas 67% of PMBLs and 50% of TCRLBLs were J chain positive. Three of 3 B-cell lymphomas, unclassifiable, with features intermediate between diffuse large B-cell lymphoma and CHL, were negative for J chain and MEF2B. J chain and MEF2B were 100% sensitive and specific for NLPHL versus CHL. MEF2B was 100% sensitive and 98% specific for PMBL versus CHL. Whereas loss of OCT-2 and/or BOB.1 expression had a sensitivity of only 86% and specificity of 100% for CHL versus NLPHL, PMBL, and TCRLBL, lack of both J chain and MEF2B expression was 100% sensitive and 97% specific. J chain and MEF2B are highly sensitive and specific markers of NLPHL versus CHL; are particularly useful in highlighting LP cells; and, with rare exception, are of greater utility than OCT-2 and BOB.1 in differentiating CHL from NLPHL and other large B-cell lymphomas. Copyright © 2017 Elsevier Inc. All rights reserved.
The Curious Silence of the Dog and Paul of Tarsus; Revisiting The Argument from Silence
Directory of Open Access Journals (Sweden)
Michael Gary Duncan
2012-03-01
Full Text Available In this essay I propose an interpretative and explanatory structure for the so-called argumentum ex silento, or argument from silence (henceforth referred to as the AFS. To this end, I explore two examples, namely, Sherlock Holmes’s oft-quoted notice of the “curious incident of the dog in the night-time” from Arthur Conan Doyle’s short story “Silver Blaze,” and the historical question of Paul of Tarsus’s silence on biographical details of the historical Jesus. Through these cases, I conclude that the AFS serves as a dialogical topos best evaluated and understood through the perceived authority of the arguer and the willingness of the audience to accept that authority, due to the “curious” nature of the negative evidence that the argument employed.
Surprised by Bird, Bard, and Bach: Language, Silence, and Transcendence.
Suhor, Charles
1991-01-01
Argues the importance of the relationships among silence and literature, the arts, and other experiences that point toward transcendence. Suggests that English teachers can expand the repertoire of classroom activities and teaching techniques that make use of silence. (KEH)
Strategy of gene silencing in cassava for validation of resistance genes
International Nuclear Information System (INIS)
Cortes, Simon; Lopez, Camilo
2010-01-01
Cassava (Manihot esculenta) is a major source of food for more than 1000 million people in the world and constitutes an important staple crop. Cassava bacterial blight, caused by the gram negative bacterium Xanthomonas axonopodis pv. manihotis, is one of the most important constraints for this crop. A candidate resistance gene against cassava bacterial blight, named RXam1, has been identified previously. In this work, we employed the gene silencing approach using the African cassava mosaic virus (ACMV) to validate the function of the RXam1 gene. We used as positive control the su gen, which produce photo blanching in leaves when is silenced. Plants from the SG10735 variety were bombardment with the ACMV-A-SU+ACMV-B y ACMV-A-RXam1+ACMV-B constructions. The silencing efficiency employing the su gene was low, only one of seven plants showed photo blanching. In the putative silenced plants for the RXam1 gene, no presence of siRNAs corresponding to RXam1 was observed; although a low diminution of the RXam1 gene expression was obtained. The growth curves for the Xam strain CIO136 in cassava plants inoculated showing a little but no significance difference in the susceptibility in the silenced plants compared to not silenced
The Nuclear Cap-Binding Complex Mediates Meiotic Silencing by Unpaired DNA
Directory of Open Access Journals (Sweden)
Logan M. Decker
2017-04-01
Full Text Available In the filamentous fungus Neurospora crassa, cross walls between individual cells are normally incomplete, making the entire fungal network vulnerable to attack by viruses and selfish DNAs. Accordingly, several genome surveillance mechanisms are maintained to help the fungus combat these repetitive elements. One of these defense mechanisms is called meiotic silencing by unpaired DNA (MSUD, which identifies and silences unpaired genes during meiosis. Utilizing common RNA interference (RNAi proteins, such as Dicer and Argonaute, MSUD targets mRNAs homologous to the unpaired sequence to achieve silencing. In this study, we have identified an additional silencing component, namely the cap-binding complex (CBC. Made up of cap-binding proteins CBP20 and CBP80, CBC associates with the 5′ cap of mRNA transcripts in eukaryotes. The loss of CBC leads to a deficiency in MSUD activity, suggesting its role in mediating silencing. As confirmed in this study, CBC is predominantly nuclear, although it is known to travel in and out of the nucleus to facilitate RNA transport. As seen in animals but not in plants, CBP20’s robust nuclear import depends on CBP80 in Neurospora. CBC interacts with a component (Argonaute of the perinuclear meiotic silencing complex (MSC, directly linking the two cellular factors.
Ma, Hong-Zhen; Liu, Guo-Qin; Li, Cheng-Wei; Kang, Guo-Zhang; Guo, Tian-Cai
2012-10-05
The full-length cDNA (882bp) and DNA (1742bp) sequences encoding a basic transcription factor 3, designated as TaBTF3, were first isolated from common wheat (Triticum aestivum L.). Subcellular localization studies revealed that the TaBTF3 protein was mainly located in the cytoplasm and nucleus. In TaBTF3-silenced transgenic wheat seedlings obtained using the Virus-induced gene silencing (VIGS) method, the chlorophyll pigment content was markedly reduced. However, the malonaldehyde (MDA) and H(2)O(2) contents were enhanced, and the structure of the wheat mesophyll cell was seriously damaged. Furthermore, transcripts of the chloroplast- and mitochondrial-encoded genes were significantly reduced in TaBTF3-silenced transgenic wheat plants. These results suggest that the TaBTF3 gene might function in the development of the wheat chloroplast, mitochondria and mesophyll cell. This paper is the first report to describe the involvement of TaBTF3 in maintaining the normal plant mesophyll cell structure. Copyright © 2012 Elsevier Inc. All rights reserved.
Arabidopsis HDA6 regulates locus-directed heterochromatin silencing in cooperation with MET1.
Taiko Kim To; Jong-Myong Kim; Akihiro Matsui; Yukio Kurihara; Taeko Morosawa; Junko Ishida; Maho Tanaka; Takaho Endo; Tetsuji Kakutani; Tetsuro Toyoda; Hiroshi Kimura; Shigeyuki Yokoyama; Kazuo Shinozaki; Motoaki Seki
2011-01-01
Heterochromatin silencing is pivotal for genome stability in eukaryotes. In Arabidopsis, a plant-specific mechanism called RNA–directed DNA methylation (RdDM) is involved in heterochromatin silencing. Histone deacetylase HDA6 has been identified as a component of such machineries; however, its endogenous targets and the silencing mechanisms have not been analyzed globally. In this study, we investigated the silencing mechanism mediated by HDA6. Genome-wide transcript profiling revealed that t...
Hammond, Thomas M.; Xiao, Hua; Boone, Erin C.; Perdue, Tony D.; Pukkila, Patricia J.; Shiu, Patrick K. T.
2011-01-01
In Neurospora crassa, genes lacking a pairing partner during meiosis are suppressed by a process known as meiotic silencing by unpaired DNA (MSUD). To identify novel MSUD components, we have developed a high-throughput reverse-genetic screen for use with the N. crassa knockout library. Here we describe the screening method and the characterization of a gene (sad-3) subsequently discovered. SAD-3 is a putative helicase required for MSUD and sexual spore production. It exists in a complex with other known MSUD proteins in the perinuclear region, a center for meiotic silencing activity. Orthologs of SAD-3 include Schizosaccharomyces pombe Hrr1, a helicase required for RNAi-induced heterochromatin formation. Both SAD-3 and Hrr1 interact with an RNA-directed RNA polymerase and an Argonaute, suggesting that certain aspects of silencing complex formation may be conserved between the two fungal species. PMID:22384347
Active compressor engine silencer reduces exhaust noise
International Nuclear Information System (INIS)
Denenberg, J.N.; Miller, S.K.; Jay, M.A.
1994-01-01
An active industrial silencer on a compressor engine at a Tenneco Gas station has reduced low-frequency 'rumbling' noise by 8 dB during trials while lowering backpressure about 90$. This 8 dB reduction of the piston firing frequency corresponds to a more than 80% decrease in emitted acoustic power. The silencing unit, installed on one of six engines at the station near Eden, N.Y., continues in operation. Based on the results, the manufacturer is identifying additional compressor sites for further tests. This paper reviews this project
Directory of Open Access Journals (Sweden)
Liang Xu
2017-06-01
Full Text Available Sodium-glucose cotransporter (SGLT 2 inhibitors increase urinary glucose excretion (UGE, leading to blood glucose reductions and weight loss. However, the impacts of SGLT2 inhibition on energy homeostasis and obesity-induced insulin resistance are less well known. Here, we show that empagliflozin, a SGLT2 inhibitor, enhanced energy expenditure and attenuated inflammation and insulin resistance in high-fat-diet-induced obese (DIO mice. C57BL/6J mice were pair-fed a high-fat diet (HFD or a HFD with empagliflozin for 16 weeks. Empagliflozin administration increased UGE in the DIO mice, whereas it suppressed HFD-induced weight gain, insulin resistance, and hepatic steatosis. Moreover, empagliflozin shifted energy metabolism towards fat utilization, elevated AMP-activated protein kinase and acetyl-CoA carbolxylase phosphorylation in skeletal muscle, and increased hepatic and plasma fibroblast growth factor 21 levels. Importantly, empagliflozin increased energy expenditure, heat production, and the expression of uncoupling protein 1 in brown fat and in inguinal and epididymal white adipose tissue (WAT. Furthermore, empagliflozin reduced M1-polarized macrophage accumulation while inducing the anti-inflammatory M2 phenotype of macrophages within WAT and liver, lowering plasma TNFα levels and attenuating obesity-related chronic inflammation. Thus, empagliflozin suppressed weight gain by enhancing fat utilization and browning and attenuated obesity-induced inflammation and insulin resistance by polarizing M2 macrophages in WAT and liver.
Directory of Open Access Journals (Sweden)
Tobias Gröβl
Full Text Available In failing rat hearts, post-transcriptonal inhibition of phospholamban (PLB expression by AAV9 vector-mediated cardiac delivery of short hairpin RNAs directed against PLB (shPLBr improves both impaired SERCA2a controlled Ca2+ cycling and contractile dysfunction. Cardiac delivery of shPLB, however, was reported to cause cardiac toxicity in canines. Thus we developed a new AAV vector, scAAV6-amiR155-PLBr, expressing a novel engineered artificial microRNA (amiR155-PLBr directed against PLB under control of a heart-specific hybrid promoter. Its PLB silencing efficiency and safety were compared with those of an AAV vector expressing shPLBr (scAAV6-shPLBr from an ubiquitously active U6 promoter. Investigations were carried out in cultured neonatal rat cardiomyocytes (CM over a period of 14 days. Compared to shPLBr, amiR155-PLBr was expressed at a significantly lower level, resulting in delayed and less pronounced PLB silencing. Despite decreased knockdown efficiency of scAAV6-amiR155-PLBr, a similar increase of the SERCA2a-catalyzed Ca2+ uptake into sarcoplasmic reticulum (SR vesicles was observed for both the shPLBr and amiR155-PLBr vectors. Proteomic analysis confirmed PLB silencing of both therapeutic vectors and revealed that shPLBr, but not the amiR155-PLBr vector, increased the proinflammatory proteins STAT3, STAT1 and activated STAT1 phosphorylation at the key amino acid residue Tyr701. Quantitative RT-PCR analysis detected alterations in the expression of several cardiac microRNAs after treatment of CM with scAAV6-shPLBr and scAAV6-amiR155-PLBr, as well as after treatment with its related amiR155- and shRNAs-expressing control AAV vectors. The results demonstrate that scAAV6-amiR155-PLBr is capable of enhancing the Ca2+ transport function of the cardiac SR PLB/SERCA2a system as efficiently as scAAV6-shPLBr while offering a superior safety profile.
Agarwal, Aditya Vikram; Singh, Deeksha; Dhar, Yogeshwar Vikram; Michael, Rahul; Gupta, Parul; Chandra, Deepak; Trivedi, Prabodh Kumar
2018-02-01
Withanolides are a collection of naturally occurring, pharmacologically active, secondary metabolites synthesized in the medicinally important plant, Withania somnifera. These bioactive molecules are C28-steroidal lactone triterpenoids and their synthesis is proposed to take place via the mevalonate (MVA) and 2-C-methyl-d-erythritol-4-phosphate (MEP) pathways through the sterol pathway using 24-methylene cholesterol as substrate flux. Although the phytochemical profiles as well as pharmaceutical activities of Withania extracts have been well studied, limited genomic information and difficult genetic transformation have been a major bottleneck towards understanding the participation of specific genes in withanolide biosynthesis. In this study, we used the Tobacco rattle virus (TRV)-mediated virus-induced gene silencing (VIGS) approach to study the participation of key genes from MVA, MEP and triterpenoid biosynthesis for their involvement in withanolide biosynthesis. TRV-infected W. somnifera plants displayed unique phenotypic characteristics and differential accumulation of total Chl as well as carotenoid content for each silenced gene suggesting a reduction in overall isoprenoid synthesis. Comprehensive expression analysis of putative genes of withanolide biosynthesis revealed transcriptional modulations conferring the presence of complex regulatory mechanisms leading to withanolide biosynthesis. In addition, silencing of genes exhibited modulated total and specific withanolide accumulation at different levels as compared with control plants. Comparative analysis also suggests a major role for the MVA pathway as compared with the MEP pathway in providing substrate flux for withanolide biosynthesis. These results demonstrate that transcriptional regulation of selected Withania genes of the triterpenoid biosynthetic pathway critically affects withanolide biosynthesis, providing new horizons to explore this process further, in planta.
Oral vaccination with attenuated Salmonella choleraesuis C500 ...
African Journals Online (AJOL)
user
Marshall, 1983), and well known as the major gastro- duodenal ... The CagA is encoded in a pathogenicity island known as 'Cag PAI' and is .... HindIII to release the CagA fragment. The purified .... vaccine strain attenuated by chemical methods, which is .... pylori antigens is achieved using a non-toxic mutant of E. coli heat-.
Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W
2007-09-01
The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.
International Nuclear Information System (INIS)
Liu Xiaoqun; Qiao Tiankui
2014-01-01
Objective: To investigate the effect of silencing of ataxia-telangiectasia mutated (ATM) expression by plasmid-mediated RNA interference on the radiosensitivity of human lung adenocarcinoma A 549 cells. Methods: Eukaryotic expression plasmid containing ATM small interfering RNA (siRNA) (pSilencer2.1-ATM), as well as pSilencer2.1-nonspecific, was constructed.Lung adenocarcinoma A 549 cells were divided into positive group, negative group,and control group to be transfected with pSilencer2.1-ATM, pSilencer2.1-nonspecific, and no plasmid, respectively. The mRNA and protein expression of ATM was measured by RT-PCR and Western blot, respectively. The change in cell radiosensitivity was observed by colony-forming assay. Cell cycle and cell apoptosis were analyzed by flow cytometry. Results: The eukaryotic expression plasmid containing ATM siRNA was successfully constructed. The RT-PCR and Western blot demonstrated that the expression of ATM was down-regulated in the positive group. The sensitization enhancement ratios (D 0 ratios) for the positive group and negative group were 1.50 and 1.01, respectively. The flow cytometry revealed that the proportions of A 549 cells in G 1 and G 2 /M phases were significantly lower in the positive group than in the control group (51.27% vs 61.85%, P = 0.012; 6.34% vs 10.91%, P = 0.008) and that the apoptosis rate was significantly higher in the positive group than in the control group and negative group (49.31% vs 13.58%, P = 0.000; 49.31% vs 13.17%, P = 0.000). Conclusions: Silencing of ATM expression may increase the radiosensitivity of human lung adenocarcinoma A 549 cells, probably by affecting the cell cycle and promoting cell apoptosis. (authors)
Directory of Open Access Journals (Sweden)
Saeedeh Shafiee Nahrkhalaji
2013-05-01
Full Text Available This study examined naturally-occurring university classroominteractions at Iranian universities and provided an analysis ofsilence patterns as politeness strategies used by male andfemale students. Since empirical studies of silence inclassroom settings are scarce, this paper aimed to explainsuch phenomena using participant interviews, classroomobservation and detailed discourse analysis of classroominteraction. Silence patterns and their interpretations werescrutinized in these observations and were discussed inrelation to specific conceptualization of politeness anddevices employed to exercise it. The study found that femalesseem to be the most silent in the cross-sex classrooms, whilethe distribution of silence is more nearly equal in the same sexclassrooms. Based on the comments from follow-upinterviews, reasons for intentional silence as a politenessstrategy were categorized into four groups: silence as a face savingstrategy, silence as a ‘don’t do the FTA’ strategy,silence as a power strategy, and silence as an off-recordstrategy.
Milochau, Alexandra; Lagrée, Valérie; Benassy, Marie-Noëlle; Chaignepain, Stéphane; Papin, Julien; Garcia-Arcos, Itsaso; Lajoix, Anne; Monterrat, Carole; Coudert, Laetitia; Schmitter, Jean-Marie; Ochoa, Begoña; Lang, Jochen
2014-06-27
Synaptotagmins are two C2 domain-containing transmembrane proteins. The function of calcium-sensitive members in the regulation of post-Golgi traffic has been well established whereas little is known about the calcium-insensitive isoforms constituting half of the protein family. Novel binding partners of synaptotagmin 11 were identified in β-cells. A number of them had been assigned previously to ER/Golgi derived-vesicles or linked to RNA synthesis, translation and processing. Whereas the C2A domain interacted with the Q-SNARE Vti1a, the C2B domain of syt11 interacted with the SND1, Ago2 and FMRP, components of the RNA-induced silencing complex (RISC). Binding to SND was direct via its N-terminal tandem repeats. Our data indicate that syt11 may provide a link between gene regulation by microRNAs and membrane traffic. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Communicative Silences: Forms and Functions
Bruneau, Thomas J.
1973-01-01
The nature of silence is discussed as an imposition of mind, as an interdependent signification ground for speech signs, as a relationship to mental time (as opposed to artificial time), and as it relates to sensation, perception and metaphorical movement. (Author)
Energy Technology Data Exchange (ETDEWEB)
Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)
2014-11-14
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Silencing of the rotavirus NSP4 protein decreases the incidence of biliary atresia in murine model.
Directory of Open Access Journals (Sweden)
Jiexiong Feng
Full Text Available Biliary atresia is a common disease in neonates which causes obstructive jaundice and progressive hepatic fibrosis. Our previous studies indicate that rotavirus infection is an initiator in the pathogenesis of experimental biliary atresia (BA through the induction of increased nuclear factor-kappaB and abnormal activation of the osteopontin inflammation pathway. In the setting of rotavirus infection, rotavirus nonstructural protein 4 (NSP4 serves as an important immunogen, viral protein 7 (VP7 is necessary in rotavirus maturity and viral protein 4 (VP4 is a virulence determiner. The purpose of the current study is to clarify the roles of NSP4, VP7 and VP4 in the pathogenesis of experimental BA. Primary cultured extrahepatic biliary epithelia were infected with Rotavirus (mmu18006. Small interfering RNA targeting NSP4, VP7 or VP4 was transfected before rotavirus infection both in vitro and in vivo. We analyzed the incidence of BA, morphological change, morphogenesis of viral particles and viral mRNA and protein expression. The in vitro experiments showed NSP4 silencing decreased the levels of VP7 and VP4, reduced viral particles and decreased cytopathic effect. NSP4-positive cells had strongly positive expression of integrin subunit α2. Silencing of VP7 or VP4 partially decreased epithelial injury. Animal experiments indicated after NSP4 silencing, mouse pups had lower incidence of BA than after VP7 or VP4 silencing. However, 33.3% of VP4-silenced pups (N = 6 suffered BA and 50% of pups (N = 6 suffered biliary injury after VP7 silencing. Hepatic injury was decreased after NSP4 or VP4 silencing. Neither VP4 nor VP7 were detected in the biliary ducts after NSP4. All together, NSP4 silencing down-regulates VP7 and VP4, resulting in decreased incidence of BA.
Attenuation of trace organic compounds (TOrCs) inbioelectrochemical systems
Werner, Craig M.
2015-04-01
Microbial fuel cells (MFCs) and microbial electrolysis cells (MECs) are two types of microbial bioelectrochemical systems (BESs) that use microorganisms to convert chemical energy in wastewaters into useful energy products such as (bio)electricity (MFC) or hydrogen gas (MEC). These two systems were evaluated for their capacity to attenuate trace organic compounds (TOrCs), commonly found in municipal wastewater, under closed circuit (current generation) and open circuit (no current generation) conditions, using acetate as the carbon source. A biocide was used to evaluate attenuation in terms of biotransformation versus sorption. The difference in attenuation observed before and after addition of the biocide represented biotransformation, while attenuation after addition of a biocide primarily indicated sorption. Attenuation of TOrCs was similar in MFCs and MECs for eight different TOrCs, except for caffeine and trimethoprim where slightly higher attenuation was observed in MECs. Electric current generation did not enhance attenuation of the TOrCs except for caffeine, which showed slightly higher attenuation under closed circuit conditions in both MFCs and MECs. Substantial sorption of the TOrCs occurred to the biofilm-covered electrodes, but no consistent trend could be identified regarding the physico-chemical properties of the TOrCs tested and the extent of sorption. The octanol-water distribution coefficient at pH 7.4 (log DpH 7.4) appeared to be a reasonable predictor for sorption of some of the compounds (carbamazepine, atrazine, tris(2-chloroethyl) phosphate and diphenhydramine) but not for others (N,N-Diethyl-meta-toluamide). Atenolol also showed high levels of sorption despite being the most hydrophilic in the suite of compounds studied (log DpH 7.4=-1.99). Though BESs do not show any inherent advantages over conventional wastewater treatment, with respect to TOrC removal, overall removals in BESs are similar to that reported for conventional wastewater
Vickers Attenuator. Volume 3C(VA) - Technical appraisal. Consultants' 1983 report
Energy Technology Data Exchange (ETDEWEB)
1986-01-01
A report is given by a team of Consultants on the estimated cost of converting wave energy to electrical energy by a 2 GW array of Vickers Attenuator wave energy devices and delivering this to a sub-station on the west coast of Skye. Comparisons of the estimates made by the team developing the concept are presented and discrepancies discussed. A detailed engineering assessment is given.
ORGANIZATIONAL SILENCE: SUATU PENGHAMBAT DALAM MEWUJUDKAN KREATIFITAS ORGANISASIONAL
Directory of Open Access Journals (Sweden)
Berta Bekti Retnawati
2016-11-01
Full Text Available There are powerful forces in many organzations that cause widespread withholding of information about potential problems or issues by employess, this collective-level phenomenon as ‘organizational silence’. One significant effect of organizational silence relates to lack of organizational creativity.There are five major organizational factors that enhance creativity in a work environment: organizational climate, leadership style, organizational culture, resources and skills, the structure and system of an organization. Keywords: organizational silence, organizational creativity
Perez, Virgili; Unzeta, Mercedes
2003-02-01
Monoamine oxidase isoform B (MAO-B) is involved in Parkinson's disease (PD) induced by the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine toxin (MPTP) in human and non-human-primate. MAO-B inhibitors, such as L-deprenyl have shown to prevent against MPTP-toxicity in different species, and it has been used in Parkinson therapy, however, the fact that it is metabolized to (-)-methamphetamine and (-)-amphetamine highlights the need to find out new MAO-B inhibitors without a structural amphetaminic moiety. In this context we herein report, for the first time, anywhere a novel non-amphetamine-like MAO-B inhibitor, PF 9601N, N-(2-propynyl)-2-(5-benzyloxy-indolyl) methylamine. This attenuates the MPTP-induced striatal dopamine depletion in young-adult and adult-old C57/BL mice, using different schedules of administration, and which behave "ex vivo" as a slightly more potent and selective MAO-B inhibitor than L-deprenyl, assayed for comparative purposes in the same experimental conditions. The MAO-B ID(50) values were calculated from the total MAO-B activity measured against [14C] phenylethylamine (22 microM) as substrate, at each inhibitor concentration. The MAO-B ID(50) values resulted to be 381 and 577 nmol/kg for PF 9601N and L-deprenyl, respectively. The intraperitoneally (i.p.) co-administration to young-adult C57/BL6 mice of MPTP (30 mg/kg), with different concentrations of PF 9601N or L-deprenyl (29.5-0.357 micromol/kg) showed a dose-dependent protective effect against striatal dopamine depletion, measuring the dopamine contents and its metabolites by HPLC. The ED(50) value proved to be 3.07 micromol/kg without any significant differences between either MAO-B inhibitor. Nevertheless, lower doses of PF 9601N (1.5 micromol/kg) were necessary to get almost total protection, without any change in the DOPAC and HVA content, when administered 2 h before MPTP (30 mg/kg), whereas partial protection (45%) against dopamine depletion was observed in the case of L-deprenyl. In
Haskins, Cathleen
2011-01-01
Slowing down, quieting the mind and body, and experiencing silence nourishes the spirit. Montessori educators are mandated to cultivate not just the intellect but the whole child. They recognize that nurturing the spirit of the child is part of what makes this form of education work so well. This article discusses the benefits of stillness and…
Foda, Bardees M.; Singh, Upinder
2015-01-01
RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5′-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. PMID:26149683
Foda, Bardees M; Singh, Upinder
2015-08-21
RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5'-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Vyas, Falguni S; Hargreaves, Alan J; Bonner, Philip L R; Boocock, David J; Coveney, Clare; Dickenson, John M
2016-05-01
The regulation of tissue transglutaminase (TG2) activity by the GPCR family is poorly understood. In this study, we investigated the modulation of TG2 activity by the A1 adenosine receptor in cardiomyocyte-like H9c2 cells. H9c2 cells were lysed following stimulation with the A1 adenosine receptor agonist N(6)-cyclopentyladenosine (CPA). Transglutaminase activity was determined using an amine incorporating and a protein cross linking assay. TG2 phosphorylation was assessed via immunoprecipitation and Western blotting. The role of TG2 in A1 adenosine receptor-induced cytoprotection was investigated by monitoring hypoxia-induced cell death. CPA induced time and concentration-dependent increases in amine incorporating and protein crosslinking activity of TG2. CPA-induced increases in TG2 activity were attenuated by the TG2 inhibitors Z-DON and R283. Responses to CPA were blocked by PKC (Ro 31-8220), MEK1/2 (PD 98059), p38 MAPK (SB 203580) and JNK1/2 (SP 600125) inhibitors and by removal of extracellular Ca(2+). CPA triggered robust increases in the levels of TG2-associated phosphoserine and phosphothreonine, which were attenuated by PKC, MEK1/2 and JNK1/2 inhibitors. Fluorescence microscopy revealed TG2-mediated biotin-X-cadaverine incorporation into proteins and proteomic analysis identified known (Histone H4) and novel (Hexokinase 1) protein substrates for TG2. CPA pre-treatment reversed hypoxia-induced LDH release and decreases in MTT reduction. TG2 inhibitors R283 and Z-DON attenuated A1 adenosine receptor-induced cytoprotection. TG2 activity was stimulated by the A1 adenosine receptor in H9c2 cells via a multi protein kinase dependent pathway. These results suggest a role for TG2 in A1 adenosine receptor-induced cytoprotection. Copyright © 2016 Elsevier Inc. All rights reserved.
Strategies underlying RNA silencing suppression by negative strand RNA viruses
Hemmes, J.C.
2007-01-01
The research described in this thesis focused on the strategies of negative strand RNA viruses to counteract antiviral RNA silencing. In plants and insects, RNA silencing has been shown to act as a sequence specific antiviral defence mechanism that is characterised by the processing of double
Le silence, ce cri qui résonne dans l’écriture de Viviane Forrester
Directory of Open Access Journals (Sweden)
Amelia Peral Crespo
2015-11-01
Full Text Available The Holocaust Literature is tied to Silence from its beginning as the writing to silence. Write about the Holocaust and relate the experiences lived in first person or transmit them to the coming generations means leaving the silence which, for years, was the ideal refuge. This research focuses on the literary production of Viviane Forrester. The different expressions of silence that characterize her writings are analyzed. Silence is the cry that underlies in the most profound of the human being that return from the concentration camps, as Lazarus from the dead. It is a silence that grows to a cry because Forrester’s writing, almost in parallel to the fragmentary writing of Blanchot, an-nounces livre à venir, expressing the cry in silence without the ending of the word
Nomura, M; Tsujimura, A; Begum, N A; Matsumoto, M; Wabiko, H; Toyoshima, K; Seya, T
2000-01-01
The murine membrane cofactor protein (CD46) gene is expressed exclusively in testis, in contrast to human CD46, which is expressed ubiquitously. To elucidate the mechanism of differential CD46 gene expression among species, we cloned entire murine CD46 genomic DNA and possible regulatory regions were placed in the flanking region of the luciferase reporter gene. The reporter gene assay revealed a silencing activity not in the promoter, but in the 3'-flanking region of the gene and the silencer-like element was identified within a 0.2-kb region between 0.6 and 0.8 kb downstream of the stop codon. This silencer-like element was highly similar to that of the pig MHC class-I gene. The introduction of a mutation into this putative silencer element of murine CD46 resulted in an abrogation of the silencing effect. Electrophoretic mobility-shift assay indicated the presence of the binding molecule(s) for this silencer sequence in murine cell lines and tissues. A size difference of the protein-silencer-element complex was observed depending upon the solubilizers used for preparation of the nuclear extracts. A mutated silencer sequence failed to interact with the binding molecules. The level of the binding factor was lower in the testicular germ cells compared with other organs. Thus the silencer element and its binding factor may play a role in transcriptional regulation of murine CD46 gene expression. These results imply that the effects of the CD46 silencer element encompass the innate immune and reproductive systems, and in mice may determine the testicular germ-cell-dominant expression of CD46. PMID:11023821
Cieplak-Rotowska, Maja K.; Tarnowski, Krzysztof; Rubin, Marcin; Fabian, Marc R.; Sonenberg, Nahum; Dadlez, Michal; Niedzwiecka, Anna
2018-01-01
The human GW182 protein plays an essential role in micro(mi)RNA-dependent gene silencing. miRNA silencing is mediated, in part, by a GW182 C-terminal region called the silencing domain, which interacts with the poly(A) binding protein and the CCR4-NOT deadenylase complex to repress protein synthesis. Structural studies of this GW182 fragment are challenging due to its predicted intrinsically disordered character, except for its RRM domain. However, detailed insights into the properties of proteins containing disordered regions can be provided by hydrogen-deuterium exchange mass spectrometry (HDX/MS). In this work, we applied HDX/MS to define the structural state of the GW182 silencing domain. HDX/MS analysis revealed that this domain is clearly divided into a natively unstructured part, including the CCR4-NOT interacting motif 1, and a distinct RRM domain. The GW182 RRM has a very dynamic structure, since water molecules can penetrate the whole domain in 2 h. The finding of this high structural dynamics sheds new light on the RRM structure. Though this domain is one of the most frequently occurring canonical protein domains in eukaryotes, these results are - to our knowledge - the first HDX/MS characteristics of an RRM. The HDX/MS studies show also that the α2 helix of the RRM can display EX1 behavior after a freezing-thawing cycle. This means that the RRM structure is sensitive to environmental conditions and can change its conformation, which suggests that the state of the RRM containing proteins should be checked by HDX/MS in regard of the conformational uniformity. [Figure not available: see fulltext.
Directory of Open Access Journals (Sweden)
Skiadopoulos Mario H
2007-07-01
Full Text Available Abstract Background Two recombinant, live attenuated human parainfluenza virus type 1 (rHPIV1 mutant viruses have been developed, using a reverse genetics system, for evaluation as potential intranasal vaccine candidates. These rHPIV1 vaccine candidates have two non-temperature sensitive (non-ts attenuating (att mutations primarily in the P/C gene, namely CR84GHNT553A (two point mutations used together as a set and CΔ170 (a short deletion mutation, and two ts att mutations in the L gene, namely LY942A (a point mutation, and LΔ1710–11 (a short deletion, the last of which has not been previously described. The latter three mutations were specifically designed for increased genetic and phenotypic stability. These mutations were evaluated on the HPIV1 backbone, both individually and in combination, for attenuation, immunogenicity, and protective efficacy in African green monkeys (AGMs. Results The rHPIV1 mutant bearing the novel LΔ1710–11 mutation was highly ts and attenuated in AGMs and was immunogenic and efficacious against HPIV1 wt challenge. The rHPIV1-CR84G/Δ170HNT553ALY942A and rHPIV1-CR84G/Δ170HNT553ALΔ1710–11 vaccine candidates were highly ts, with shut-off temperatures of 38°C and 35°C, respectively, and were highly attenuated in AGMs. Immunization with rHPIV1-CR84G/Δ170HNT553ALY942A protected against HPIV1 wt challenge in both the upper and lower respiratory tracts. In contrast, rHPIV1-CR84G/Δ170HNT553ALΔ1710–11 was not protective in AGMs due to over-attenuation, but it is expected to replicate more efficiently and be more immunogenic in the natural human host. Conclusion The rHPIV1-CR84G/Δ170HNT553ALY942A and rHPIV1-CR84G/Δ170HNT553ALΔ1710–11 vaccine candidates are clearly highly attenuated in AGMs and clinical trials are planned to address safety and immunogenicity in humans.
Energy Technology Data Exchange (ETDEWEB)
Ichida, Yu, E-mail: ichida-y@ncchd.go.jp; Utsunomiya, Yuko; Onodera, Masafumi
2016-03-18
Zinc finger protein 809 (ZFP809) belongs to the Kruppel-associated box-containing zinc finger protein (KRAB-ZFP) family and functions in repressing the expression of Moloney murine leukemia virus (MoMLV). ZFP809 binds to the primer-binding site (PBS)located downstream of the MoMLV-long terminal repeat (LTR) and induces epigenetic modifications at integration sites, such as repressive histone modifications and de novo DNA methylation. KRAB-ZFPs contain consensus TGEKP linkers between C2H2 zinc fingers. The phosphorylation of threonine residues within linkers leads to the inactivation of zinc finger binding to target sequences. ZFP809 also contains consensus linkers between zinc fingers. However, the function of ZFP809 linkers remains unknown. In the present study, we constructed ZFP809 proteins containing mutated linkers and examined their ability to silence transgene expression driven by MLV, binding ability to MLV PBS, and cellular localization. The results of the present study revealed that the linkers affected the ability of ZFP809 to silence transgene expression. Furthermore, this effect could be partly attributed to changes in the localization of ZFP809 proteins containing mutated linkers. Further characterization of ZFP809 linkers is required for understanding the functions and features of KRAB-ZFP-containing linkers. - Highlights: • ZFP809 has three consensus linkers between the zinc fingers. • Linkers are required for ZFP809 to silence transgene expression driven by MLV-LTR. • Linkers affect the precise nuclear localization of ZFP809.
International Nuclear Information System (INIS)
Xue, Xiaofeng; Liu, Fei; Han, Ye; Li, Pu; Yuan, Bin; Wang, Xu; Chen, Yan; Kuang, Yuting; Zhi, Qiaoming; Zhao, Hong
2014-01-01
Highlights: • NPAS2 mRNA was down-regulated in clinical colorectal cancer tissues. • Low NPAS2 level was associated with the tumor size, TNM stage and distance metastasis in CRC. • Silencing NPAS2 promoted cell proliferation, the wound healing and cell invasion abilities. - Abstract: Emerging evidences show that circadian rhythm disorder is an important factor of tumor initiation and development. Neuronal PAS domain protein2 (NPAS2), which is the largest circadian gene, has been proved to be a novel prognostic biomarker in breast cancer and non-Hodgkin’s lymphoma. However, the potential functions of NPAS2 in colorectal cancer are still unknown. In our present study, we detected the mRNA expressions of NPAS2 in 108 CRC patients by RT-PCR, and found that NPAS2 expression was significantly down-regulated in tumor tissues than that in NATs. Clinicopathologic analysis revealed that low expression of NPAS2 was associated with the tumor size, TNM stage and tumor distance metastasis in colorectal cancer (p < 0.05). Furthermore, we effectively down-regulated NPAS2 mRNA expression by transfecting RNA interfere fragments into DLD-1 cells, and our results in vitro demonstrated that silencing NPAS2 expression could promote cell proliferation, cell invasion and increase the wound healing ability (p < 0.05). However, down-regulating NPAS2 expression did not influence the apoptotic rate in DLD-1 cells (p > 0.05). In conclusion, our study suggested that NPAS2, functioned as a potential tumor suppressor gene, could serve as a promising target and potential prognostic indicator for colorectal cancer
Energy Technology Data Exchange (ETDEWEB)
Xue, Xiaofeng [Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Liu, Fei [Department of Gastroenterology, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Han, Ye [Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Li, Pu [Shanghai Key Laboratory of Gastric Neoplasms, Shanghai Institute of Digestive Surgery, Department of Surgery, Ruijin Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200025 (China); Yuan, Bin; Wang, Xu; Chen, Yan; Kuang, Yuting [Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Zhi, Qiaoming, E-mail: strexboy@163.com [Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Zhao, Hong, E-mail: zhaohong600@sina.com [Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China)
2014-07-25
Highlights: • NPAS2 mRNA was down-regulated in clinical colorectal cancer tissues. • Low NPAS2 level was associated with the tumor size, TNM stage and distance metastasis in CRC. • Silencing NPAS2 promoted cell proliferation, the wound healing and cell invasion abilities. - Abstract: Emerging evidences show that circadian rhythm disorder is an important factor of tumor initiation and development. Neuronal PAS domain protein2 (NPAS2), which is the largest circadian gene, has been proved to be a novel prognostic biomarker in breast cancer and non-Hodgkin’s lymphoma. However, the potential functions of NPAS2 in colorectal cancer are still unknown. In our present study, we detected the mRNA expressions of NPAS2 in 108 CRC patients by RT-PCR, and found that NPAS2 expression was significantly down-regulated in tumor tissues than that in NATs. Clinicopathologic analysis revealed that low expression of NPAS2 was associated with the tumor size, TNM stage and tumor distance metastasis in colorectal cancer (p < 0.05). Furthermore, we effectively down-regulated NPAS2 mRNA expression by transfecting RNA interfere fragments into DLD-1 cells, and our results in vitro demonstrated that silencing NPAS2 expression could promote cell proliferation, cell invasion and increase the wound healing ability (p < 0.05). However, down-regulating NPAS2 expression did not influence the apoptotic rate in DLD-1 cells (p > 0.05). In conclusion, our study suggested that NPAS2, functioned as a potential tumor suppressor gene, could serve as a promising target and potential prognostic indicator for colorectal cancer.
Nucleases as a barrier to gene silencing in the cotton boll weevil, Anthonomus grandis.
Almeida Garcia, Rayssa; Lima Pepino Macedo, Leonardo; Cabral do Nascimento, Danila; Gillet, François-Xavier; Moreira-Pinto, Clidia Eduarda; Faheem, Muhammad; Moreschi Basso, Angelina Maria; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima
2017-01-01
RNA interference (RNAi) approaches have been applied as a biotechnological tool for controlling plant insect pests via selective gene down regulation. However, the inefficiency of RNAi mechanism in insects is associated with several barriers, including dsRNA delivery and uptake by the cell, dsRNA interaction with the cellular membrane receptor and dsRNA exposure to insect gut nucleases during feeding. The cotton boll weevil (Anthonomus grandis) is a coleopteran in which RNAi-mediated gene silencing does not function efficiently through dsRNA feeding, and the factors involved in the mechanism remain unknown. Herein, we identified three nucleases in the cotton boll weevil transcriptome denoted AgraNuc1, AgraNuc2, and AgraNuc3, and the influences of these nucleases on the gene silencing of A. grandis chitin synthase II (AgraChSII) were evaluated through oral dsRNA feeding trials. A phylogenetic analysis showed that all three nucleases share high similarity with the DNA/RNA non-specific endonuclease family of other insects. These nucleases were found to be mainly expressed in the posterior midgut region of the insect. Two days after nuclease RNAi-mediated gene silencing, dsRNA degradation by the gut juice was substantially reduced. Notably, after nucleases gene silencing, the orally delivered dsRNA against the AgraChSII gene resulted in improved gene silencing efficiency when compared to the control (non-silenced nucleases). The data presented here demonstrates that A. grandis midgut nucleases are effectively one of the main barriers to dsRNA delivery and emphasize the need to develop novel RNAi delivery strategies focusing on protecting the dsRNA from gut nucleases and enhancing its oral delivery and uptake to crop insect pests.
Garcia, P; Shoelson, S E; Drew, J S; Miller, W T
1994-12-02
Phosphorylation of c-Src at carboxyl-terminal Tyr-527 suppresses tyrosine kinase activity and transforming potential, presumably by facilitating the intramolecular interaction of the C terminus of Src with its SH2 domain. In addition, it has been shown previously that occupancy of the c-Src SH2 domain with a phosphopeptide stimulates c-Src kinase catalytic activity. We have performed analogous studies with v-Src, the transforming protein from Rous sarcoma virus, which has extensive homology with c-Src. v-Src lacks an autoregulatory phosphorylation site, and its kinase domain is constitutively active. Phosphopeptides corresponding to the sequences surrounding c-Src Tyr-527 and a Tyr-Glu-Glu-Ile motif from the hamster polyoma virus middle T antigen inhibit tyrosine kinase activity of baculovirus-expressed v-Src 2- and 4-fold, respectively. To determine the mechanism of this regulation, the Tyr-527 phosphopeptide was substituted with the photoactive amino acid p-benzoylphenylalanine at the adjacent positions (N- and C-terminal) to phosphotyrosine. These peptides photoinactivate the v-Src tyrosine kinase 5-fold in a time- and concentration-dependent manner. Furthermore, the peptides cross-link an isolated Src SH2 domain with similar rates and specificity. These data indicate that occupancy of the v-Src SH2 domain induces a conformational change that is transmitted to the kinase domain and attenuates tyrosine kinase activity.
Directory of Open Access Journals (Sweden)
Sajad Zare
2017-08-01
Full Text Available Background One of the most common harmful factors in the workplace is noise. Noise control is a factor beneficial for health and safety in the workplace. Objectives The current study aimed to design and manufacture a silencer for the cooling tower pump of Sarcheshmeh Copper power station in order to control noise. Methods In this study, sound pressure level was measured by the use of a sound level meter (B & K 2260. Measurement was carried out in the light of ISO 1996 standard. After studying technical and acoustic features of the noise source, a dispersive-absorptive silencer was designed to control noise pollution generated by the cooling tower pump of the thermal station. After analyzing the frequencies of sound pressure level and using available data, a cylindrical silencer (with a diameter of 1.5 m and height of 3 m was designed and manufactured. The internal part of the silencer was filled with different columns of absorbent material covered with punched metal. Therefore, the silencer consisted of (1 acoustic diffuser, (2 acoustic chamber, and (3 acoustic channels. Results Measurements showed that, at a distance of 1 m from the source, sound pressure level reduced from 127 dBA before installing the silencer to 79 dBA after the installation, resulting in a reduction of 48 dBA. Conclusions Using a silencer with absorbent material (glass wool is very effective in reducing the noise generated by the pump.
Impact of target mRNA structure on siRNA silencing efficiency: A large-scale study.
Gredell, Joseph A; Berger, Angela K; Walton, S Patrick
2008-07-01
The selection of active siRNAs is generally based on identifying siRNAs with certain sequence and structural properties. However, the efficiency of RNA interference has also been shown to depend on the structure of the target mRNA, primarily through studies using exogenous transcripts with well-defined secondary structures in the vicinity of the target sequence. While these studies provide a means for examining the impact of target sequence and structure independently, the predicted secondary structures for these transcripts are often not reflective of structures that form in full-length, native mRNAs where interactions can occur between relatively remote segments of the mRNAs. Here, using a combination of experimental results and analysis of a large dataset, we demonstrate that the accessibility of certain local target structures on the mRNA is an important determinant in the gene silencing ability of siRNAs. siRNAs targeting the enhanced green fluorescent protein were chosen using a minimal siRNA selection algorithm followed by classification based on the predicted minimum free energy structures of the target transcripts. Transfection into HeLa and HepG2 cells revealed that siRNAs targeting regions of the mRNA predicted to have unpaired 5'- and 3'-ends resulted in greater gene silencing than regions predicted to have other types of secondary structure. These results were confirmed by analysis of gene silencing data from previously published siRNAs, which showed that mRNA target regions unpaired at either the 5'-end or 3'-end were silenced, on average, approximately 10% more strongly than target regions unpaired in the center or primarily paired throughout. We found this effect to be independent of the structure of the siRNA guide strand. Taken together, these results suggest minimal requirements for nucleation of hybridization between the siRNA guide strand and mRNA and that both mRNA and guide strand structure should be considered when choosing candidate si
Directory of Open Access Journals (Sweden)
Miguel A
2017-01-01
Full Text Available Antonio Miguel,1 Luis Sendra,1 Verónica Noé,2 Carles J Ciudad,2 Francisco Dasí,3,4 David Hervas,5 María José Herrero,1,6 Salvador F Aliño17 1Department of Pharmacology, Faculty of Medicine, University of Valencia, 2Department of Biochemistry and Molecular Biology, Faculty of Pharmacy, University of Barcelona, 3Research University Hospital of Valencia, INCLIVA Health Research Institute, 4Department of Physiology, Faculty of Medicine, University of Valencia Foundation, 5Biostatistics Unit, 6Pharmacogenetics Unit, Instituto de Investigación Sanitaria La Fe (IIS La Fe, 7Clinical Pharmacology Unit, ACM Hospital Universitario y Politécnico La Fe, Valencia, Spain Abstract: The antitumor response after therapeutic vaccination has a limited effect and seems to be related to the presence of T regulatory cells (Treg, which express the immunoregulatory molecules CTLA4 and Foxp3. The blockage of CTLA4 using antibodies has shown an effective antitumor response conducing to the approval of the human anti-CTLA4 antibody ipilimumab by the US Food and Drug Administration. On the other hand, Foxp3 is crucial for Treg development. For this reason, it is an attractive target for cancer treatment. This study aims to evaluate whether combining therapeutic vaccination with CTLA4 or Foxp3 gene silencing enhances the antitumor response. First, the “in vitro” cell entrance and gene silencing efficacy of two tools, 2'-O-methyl phosphorotioate-modified oligonucleotides (2'-OMe-PS-ASOs and polypurine reverse Hoogsteen hairpins (PPRHs, were evaluated in EL4 cells and cultured primary lymphocytes. Following B16 tumor transplant, C57BL6 mice were vaccinated with irradiated B16 tumor cells engineered to produce granulocyte-macrophage colony-stimulating factor (GM-CSF and were intraperitoneally treated with CTLA4 and Foxp3 2'-OMe-PS-ASO before and after vaccination. Tumor growth, mice survival, and CTLA4 and Foxp3 expression in blood cells were measured. The following
Intercomparison of attenuation correction algorithms for single-polarized X-band radars
Lengfeld, K.; Berenguer, M.; Sempere Torres, D.
2018-03-01
Attenuation due to liquid water is one of the largest uncertainties in radar observations. The effects of attenuation are generally inversely proportional to the wavelength, i.e. observations from X-band radars are more affected by attenuation than those from C- or S-band systems. On the other hand, X-band radars can measure precipitation fields in higher temporal and spatial resolution and are more mobile and easier to install due to smaller antennas. A first algorithm for attenuation correction in single-polarized systems was proposed by Hitschfeld and Bordan (1954) (HB), but it gets unstable in case of small errors (e.g. in the radar calibration) and strong attenuation. Therefore, methods have been developed that restrict attenuation correction to keep the algorithm stable, using e.g. surface echoes (for space-borne radars) and mountain returns (for ground radars) as a final value (FV), or adjustment of the radar constant (C) or the coefficient α. In the absence of mountain returns, measurements from C- or S-band radars can be used to constrain the correction. All these methods are based on the statistical relation between reflectivity and specific attenuation. Another way to correct for attenuation in X-band radar observations is to use additional information from less attenuated radar systems, e.g. the ratio between X-band and C- or S-band radar measurements. Lengfeld et al. (2016) proposed such a method based isotonic regression of the ratio between X- and C-band radar observations along the radar beam. This study presents a comparison of the original HB algorithm and three algorithms based on the statistical relation between reflectivity and specific attenuation as well as two methods implementing additional information of C-band radar measurements. Their performance in two precipitation events (one mainly convective and the other one stratiform) shows that a restriction of the HB is necessary to avoid instabilities. A comparison with vertically pointing
Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A
2015-12-01
Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides
Role of SUMO-specific protease 2 in reprogramming cellular glucose metabolism.
Directory of Open Access Journals (Sweden)
Shuang Tang
Full Text Available Most cancer cells exhibit a shift in glucose metabolic strategy, displaying increased glycolysis even with adequate oxygen supply. SUMO-specific proteases (SENPs de-SUMOylate substrates including HIF1α and p53,two key regulators in cancer glucose metabolism, to regulate their activity, stability and subcellular localization. However, the role of SENPs in tumor glucose metabolism remains unclear. Here we report that SUMO-specific protease 2 (SENP2 negatively regulates aerobic glycolysis in MCF7 and MEF cells. Over-expression of SENP2 reduces the glucose uptake and lactate production, increasing the cellular ATP levels in MCF7 cells, while SENP2 knockout MEF cells show increased glucose uptake and lactate production along with the decreased ATP levels. Consistently, the MCF7 cells over-expressing SENP2 exhibit decreased expression levels of key glycolytic enzymes and an increased rate of glucose oxidation compared with control MCF7 cells, indicating inhibited glycolysis but enhanced oxidative mitochondrial respiration. Moreover, SENP2 over-expressing MCF7 cells demonstrated a reduced amount of phosphorylated AKT, whereas SENP2 knockout MEFs exhibit increased levels of phosphorylated AKT. Furthermore, inhibiting AKT phosphorylation by LY294002 rescued the phenotype induced by SENP2 deficiency in MEFs. In conclusion, SENP2 represses glycolysis and shifts glucose metabolic strategy, in part through inhibition of AKT phosphorylation. Our study reveals a novel function of SENP2 in regulating glucose metabolism.
Liu, Te; Cheng, Weiwei; Liu, Tianjin; Guo, Lihe; Huang, Qin; Jiang, Lizhen; Du, Xiling; Xu, Fuhui; Liu, Zhixue; Lai, Dongmei
2010-02-01
Mouse embryonic stem cells (ESCs) are typically cultured on a feeder layer of mouse embryonic fibroblasts (MEFs), with leukemia inhibitory factor (LIF) added to maintain them in an undifferentiated state. We have previously shown that human amniotic epithelial cells (hAECs) can be used as feeder cells to maintain mouse ESC pluripotency, but the mechanism for this is unknown. In the present study, we found that CpG islands 5' of the c-Myc gene remain hypomethylated in mouse ESCs cultured on hAECs. In addition, levels of acetylation of histone H3 and trimethylation of histone H3K4 in the c-Myc gene promoter were higher in ES cells cultured on hAECs than those in ES cells cultured on MEFs. These data suggested that hAECs can alter mouse ESC gene expression via epigenetic modification of c-Myc, providing a possible mechanism for the hAEC-induced maintenance of ESCs in an undifferentiated state.
Cobalt triggers necrotic cell death and atrophy in skeletal C2C12 myotubes
International Nuclear Information System (INIS)
Rovetta, Francesca; Stacchiotti, Alessandra; Faggi, Fiorella; Catalani, Simona; Apostoli, Pietro; Fanzani, Alessandro; Aleo, Maria Francesca
2013-01-01
Severe poisoning has recently been diagnosed in humans having hip implants composed of cobalt–chrome alloys due to the release of particulate wear debris on polyethylene and ceramic implants which stimulates macrophagic infiltration and destroys bone and soft tissue, leading to neurological, sensorial and muscular impairments. Consistent with this premise, in this study, we focused on the mechanisms underlying the toxicity of Co(II) ions on skeletal muscle using mouse skeletal C2C12 myotubes as an in vitro model. As detected using propidium iodide incorporation, increasing CoCl 2 doses (from 5 to 200 μM) affected the viability of C2C12 myotubes, mainly by cell necrosis, which was attenuated by necrostatin-1, an inhibitor of the necroptotic branch of the death domain receptor signaling pathway. On the other hand, apoptosis was hardly detectable as supported by the lack of caspase-3 and -8 activation, the latter resulting in only faint activation after exposure to higher CoCl 2 doses for prolonged time points. Furthermore, CoCl 2 treatment resulted in atrophy of the C2C12 myotubes which was characterized by the increased expression of HSP25 and GRP94 stress proteins and other typical 'pro-atrophic molecular hallmarks, such as early activation of the NF-kB pathway and down-regulation of AKT phosphorylation, followed by the activation of the proteasome and autophagy systems. Overall, these results suggested that cobalt may impact skeletal muscle homeostasis as an inducer of cell necrosis and myofiber atrophy. - Highlights: • The effects of cobalt on muscle myofibers in vitro were investigated. • Cobalt treatment mainly causes cell necrosis in skeletal C2C12 myotubes. • Cobalt impacts the PI3K/AKT and NFkB pathways and induces cell stress markers. • Cobalt induces atrophy of C2C12 myotubes through the activation of proteasome and autophagy systems. • Co treatment triggers NF-kB and PI3K/AKT pathways in C2C12 myotubes
Cobalt triggers necrotic cell death and atrophy in skeletal C2C12 myotubes
Energy Technology Data Exchange (ETDEWEB)
Rovetta, Francesca [Unit of Biotechnologies, Department of Molecular and Translational Medicine, University of Brescia, Brescia I-25123 (Italy); Interuniversity Institute of Myology (IIM) (Italy); Stacchiotti, Alessandra [Institute of Human Anatomy, Department of Clinical and Experimental Sciences, University of Brescia, Brescia I-25123 (Italy); Faggi, Fiorella [Unit of Biotechnologies, Department of Molecular and Translational Medicine, University of Brescia, Brescia I-25123 (Italy); Interuniversity Institute of Myology (IIM) (Italy); Catalani, Simona; Apostoli, Pietro [Unit of Occupational Health and Industrial Hygiene, Department of Medical and Surgical Specialties, Radiological Sciences and Public Health, University of Brescia, Brescia I-25123 (Italy); Fanzani, Alessandro, E-mail: fanzani@med.unibs.it [Unit of Biotechnologies, Department of Molecular and Translational Medicine, University of Brescia, Brescia I-25123 (Italy); Interuniversity Institute of Myology (IIM) (Italy); Aleo, Maria Francesca, E-mail: aleo@med.unibs.it [Unit of Biotechnologies, Department of Molecular and Translational Medicine, University of Brescia, Brescia I-25123 (Italy); Interuniversity Institute of Myology (IIM) (Italy)
2013-09-01
Severe poisoning has recently been diagnosed in humans having hip implants composed of cobalt–chrome alloys due to the release of particulate wear debris on polyethylene and ceramic implants which stimulates macrophagic infiltration and destroys bone and soft tissue, leading to neurological, sensorial and muscular impairments. Consistent with this premise, in this study, we focused on the mechanisms underlying the toxicity of Co(II) ions on skeletal muscle using mouse skeletal C2C12 myotubes as an in vitro model. As detected using propidium iodide incorporation, increasing CoCl{sub 2} doses (from 5 to 200 μM) affected the viability of C2C12 myotubes, mainly by cell necrosis, which was attenuated by necrostatin-1, an inhibitor of the necroptotic branch of the death domain receptor signaling pathway. On the other hand, apoptosis was hardly detectable as supported by the lack of caspase-3 and -8 activation, the latter resulting in only faint activation after exposure to higher CoCl{sub 2} doses for prolonged time points. Furthermore, CoCl{sub 2} treatment resulted in atrophy of the C2C12 myotubes which was characterized by the increased expression of HSP25 and GRP94 stress proteins and other typical 'pro-atrophic molecular hallmarks, such as early activation of the NF-kB pathway and down-regulation of AKT phosphorylation, followed by the activation of the proteasome and autophagy systems. Overall, these results suggested that cobalt may impact skeletal muscle homeostasis as an inducer of cell necrosis and myofiber atrophy. - Highlights: • The effects of cobalt on muscle myofibers in vitro were investigated. • Cobalt treatment mainly causes cell necrosis in skeletal C2C12 myotubes. • Cobalt impacts the PI3K/AKT and NFkB pathways and induces cell stress markers. • Cobalt induces atrophy of C2C12 myotubes through the activation of proteasome and autophagy systems. • Co treatment triggers NF-kB and PI3K/AKT pathways in C2C12 myotubes.
Ketoconazole attenuates radiation-induction of tumor necrosis factor
Energy Technology Data Exchange (ETDEWEB)
Hallahan, D.E.; Virudachalam, S.; Kufe, D.W.; Weichselbaum, R.R. [Dana Farber Cancer Institute, Boston, MA (United States)
1994-07-01
Previous work has demonstrated that inhibitors of phospholipase A2 attenuate ionizing radiation-induced arachidonic acid production, protein kinase C activation, and prevent subsequent induction of the tumor necrosis factor gene. Because arachidonic acid contributes to radiation-induced tumor necrosis factor expression, the authors analyzed the effects of agents which alter arachidonate metabolism on the regulation of this gene. Phospholipase A2 inhibitors quinicrine, bromphenyl bromide, and pentoxyfylline or the inhibitor of lipoxygenase (ketoconazole) or the inhibitor of cycloxygenase (indomethacine) were added to cell culture 1 h prior to irradiation. Radiation-induced tumor necrosis factor gene expression was attenuated by each of the phospholipase A2 inhibitors (quinicrine, bromphenylbromide, and pentoxyfylline). Furthermore, ketoconazole attenuated X ray induced tumor necrosis factor gene expression. Conversely, indomethacin enhanced tumor necrosis factor expression following irradiation. The finding that radiation-induced tumor necrosis factor gene expression was attenuated by ketoconazole suggests that the lipoxygenase pathway participates in signal transduction preceding tumor necrosis factor induction. Enhancement of tumor necrosis factor expression by indomethacin following irradiation suggests that prostaglandins produced by cyclooxygenase act as negative regulators of tumor necrosis factor expression. Inhibitors of tumor necrosis factor induction ameliorate acute and subacute sequelae of radiotherapy. The authors propose therefore, that ketoconazole may reduce acute radiation sequelae such as mucositis and esophagitis through a reduction in tumor necrosis factor induction or inhibition of phospholipase A2 in addition to its antifungal activity. 25 refs., 2 figs.
Deng, Changchun; Lipstein, Mark R; Scotto, Luigi; Jirau Serrano, Xavier O; Mangone, Michael A; Li, Shirong; Vendome, Jeremie; Hao, Yun; Xu, Xiaoming; Deng, Shi-Xian; Realubit, Ronald B; Tatonetti, Nicholas P; Karan, Charles; Lentzsch, Suzanne; Fruman, David A; Honig, Barry; Landry, Donald W; O'Connor, Owen A
2017-01-05
Phosphoinositide 3-kinase (PI3K) and the proteasome pathway are both involved in activating the mechanistic target of rapamycin (mTOR). Because mTOR signaling is required for initiation of messenger RNA translation, we hypothesized that cotargeting the PI3K and proteasome pathways might synergistically inhibit translation of c-Myc. We found that a novel PI3K δ isoform inhibitor TGR-1202, but not the approved PI3Kδ inhibitor idelalisib, was highly synergistic with the proteasome inhibitor carfilzomib in lymphoma, leukemia, and myeloma cell lines and primary lymphoma and leukemia cells. TGR-1202 and carfilzomib (TC) synergistically inhibited phosphorylation of the eukaryotic translation initiation factor 4E (eIF4E)-binding protein 1 (4E-BP1), leading to suppression of c-Myc translation and silencing of c-Myc-dependent transcription. The synergistic cytotoxicity of TC was rescued by overexpression of eIF4E or c-Myc. TGR-1202, but not other PI3Kδ inhibitors, inhibited casein kinase-1 ε (CK1ε). Targeting CK1ε using a selective chemical inhibitor or short hairpin RNA complements the effects of idelalisib, as a single agent or in combination with carfilzomib, in repressing phosphorylation of 4E-BP1 and the protein level of c-Myc. These results suggest that TGR-1202 is a dual PI3Kδ/CK1ε inhibitor, which may in part explain the clinical activity of TGR-1202 in aggressive lymphoma not found with idelalisib. Targeting CK1ε should become an integral part of therapeutic strategies targeting translation of oncogenes such as c-Myc. © 2017 by The American Society of Hematology.
Giving Voice: Narrating silence, history and memory in André Brink ...
African Journals Online (AJOL)
Giving Voice: Narrating silence, history and memory in André Brink\\'s The Other Side of Silence and Before I Forget. ... Both narrators, though, draw attention to the problems associated with this reconstructive and potentially ... Article Metrics.
Self-Silencing, Emotional Awareness, and Eating Behaviors in College Women
Shouse, Sarah H.; Nilsson, Johanna
2011-01-01
Self-silencing (or the suppression of expressing one's thoughts, feelings, and needs) can have a negative impact on the mental health of women, from depression to disordered eating behaviors. The authors examined the relationship between self-silencing and disordered eating as well as intuitive eating. The authors also explored whether emotional…
Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria; Dagnæs-Hansen, Frederik; Wengel, Jesper; Malle, Birgitte Mølholm; Kragh-Hansen, Ulrich; Cameron, Jason; Bukrinski, Jens Thostrup; Howard, Kenneth A
2016-06-28
Major challenges for the clinical translation of small interfering RNA (siRNA) include overcoming the poor plasma half-life, site-specific delivery and modulation of gene silencing. In this work, we exploit the intrinsic transport properties of human serum albumin to tune the blood circulatory half-life, hepatic accumulation and gene silencing; based on the number of siRNA cholesteryl modifications. We demonstrate by a gel shift assay a strong and specific affinity of recombinant human serum albumin (rHSA) towards cholesteryl-modified siRNA (Kd>1×10(-7)M) dependent on number of modifications. The rHSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies using multiple cholesteryl modifications. A structural-activity-based screen of in vitro EGFP-silencing was used to select optimal siRNA designs containing cholesteryl modifications within the sense strand that were used for in vivo studies. We demonstrate plasma half-life extension in NMRI mice from t1/2 12min (naked) to t1/2 45min (single cholesteryl) and t1/2 71min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing of 28% (rHSA/siRNA) compared to 4% (naked siRNA) 6days post-injection. This work presents a novel albumin-mediated cholesteryl design-based strategy for tuning pharmacokinetics and systemic gene silencing. Copyright © 2016 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
El-Mas, Mahmoud M.; El-gowilly, Sahar M.; Fouda, Mohamed A.; Saad, Evan I.
2011-01-01
Baroreflex dysfunction contributes to increased cardiovascular risk in cigarette smokers. Given the importance of adenosinergic pathways in baroreflex control, the hypothesis was tested that defective central adenosinergic modulation of cardiac autonomic activity mediates the nicotine-baroreflex interaction. Baroreflex curves relating changes in heart rate (HR) to increases or decreases in blood pressure (BP) evoked by i.v. doses (1-16 μg/kg) of phenylephrine (PE) and sodium nitroprusside (SNP), respectively, were constructed in conscious rats; slopes of the curves were taken as measures of baroreflex sensitivity (BRS). Nicotine (25 and 100 μg/kg i.v.) dose-dependently reduced BRS SNP in contrast to no effect on BRS PE . BRS SNP was also attenuated after intracisternal (i.c.) administration of nicotine. Similar reductions in BRS SNP were observed in rats pretreated with atropine or propranolol. The combined treatment with nicotine and atropine produced additive inhibitory effects on BRS, an effect that was not demonstrated upon concurrent exposure to nicotine and propranolol. BRS SNP was reduced in preparations treated with i.c. 8-phenyltheophylline (8-PT, nonselective adenosine receptor antagonist), 8-(3-Chlorostyryl) caffeine (CSC, A 2A antagonist), or VUF5574 (A 3 antagonist). In contrast, BRS SNP was preserved after blockade of A 1 (DPCPX) or A 2B (alloxazine) receptors or inhibition of adenosine uptake by dipyridamole. CSC or 8-PT abrogated the BRS SNP depressant effect of nicotine whereas other adenosinergic antagonists were without effect. Together, nicotine preferentially impairs reflex tachycardia via disruption of adenosine A 2A receptor-mediated facilitation of reflex cardiac sympathoexcitation. Clinically, the attenuation by nicotine of compensatory sympathoexcitation may be detrimental in conditions such as hypothalamic defense response, posture changes, and ventricular rhythms. - Research highlights: → The role of central adenosinergic sites in
Landeo-Ríos, Yazmín; Navas-Castillo, Jesús; Moriones, Enrique; Cañizares, M. Carmen
2017-11-24
To counteract host antiviral RNA silencing, plant viruses express suppressor proteins that function as pathogenicity enhancers. The genome of the Tomato chlorosis virus (ToCV) (genus Crinivirus , family Closteroviridae ) encodes an RNA silencing suppressor, the protein p22, that has been described as having one of the longest lasting local suppressor activities when assayed in Nicotiana benthamiana . Since suppression of RNA silencing and the ability to enhance disease severity are closely associated, we analyzed the effect of expressing p22 in heterologous viral contexts. Thus, we studied the effect of the expression of ToCV p22 from viral vectors Tobacco rattle virus (TRV) and Potato virus X (PVX), and from attenuated suppressor mutants in N. benthamiana plants. Our results show that although an exacerbation of disease symptoms leading to plant death was observed in the heterologous expression of ToCV p22 from both viruses, only in the case of TRV did increased viral accumulation occur. The heterologous expression of ToCV p22 could not complement suppressor-defective mutant viruses.
Luo, Kun; Pang, Ya; Li, Xue; Chen, Fei; Liao, Xingsheng; Lei, Min; Song, Yong
2018-02-07
Landfill leachate was pretreated by chemical flocculation with polyaluminum chloride (PAC) as a flocculant, and subsequently purified by the microelectrolysis-Fenton (MEF) process. Response surface methodology was employed to optimize the MEF process, and the optimal conditions were initial pH 3.20, H 2 O 2 concentration 3.57 g/L, and Fe-C dosage 104.52 g/L. The PAC coagulation combined with MEF processes obtained a superior decontamination performance, and the predicted chemical oxygen demand (COD) and humic acids (HA) removal were respectively 90.27% and 93.79%. The strong fluorescence peak at 425 nm and the trapping experiment showed that [Formula: see text] was generated during MEF, which had a strong oxidation ability to degrade organic recalcitrant pollutants. The ultraviolet-visible spectra and three-dimensional excitation-emission matrices spectra (3D-EEMs) indicated that PAC coagulation could preferentially remove protein-like substances, while the MEF process was effective in destructing organic recalcitrant pollutants, especially humic-like and fulvic-like substances.
L’architecture du silence de la Shoah dans les fictions de Sylvie Germain
Directory of Open Access Journals (Sweden)
José Luis Arráez Llobregat
2015-11-01
Full Text Available Silences concerning the Shoah constitute a leitmotiv in Sylvie Germain’s narrative work. Motive and motivation intentionally emerge as a proteiform phenomenon from the writer-philosopher’s genius and from the historical and ideological substance, which imbue the novelist in every sec-tion of her literary creation. The pur-pose of this study is to interpret those silences in a set of selected novels where the Shoah takes up either a primary or a secondary role, but in any case a relevant one. To this end this study carries out a detailed study of the silence coming from the narrator’s origin, the victims, the murderers or God. Beyond the silence in humans and supreme beings, this study also investigates the spatial silence in that apocalyptic world.
Influence of density and mean atomic number on CT attenuation corrected PET: Phantom studies
International Nuclear Information System (INIS)
Maintas, D.; Houzard, C.; Galy, G.; Maintas, C.; Itti, R.; Cachin, F.; Mognetti, Th.; Slosman
2007-01-01
Aim: the aim of this work is to study the influence of medium density on the CT or external source attenuation corrected images, by simulation on a phantom, with various positron emission tomographs. Material and method: a series of experiments on a cylindrical phantom filled with water marked with [18 F]-FDG, containing six vials filled per pair with mediums of different densities or solutions of KI, CaCl 2 and saccharose with various densities, was carried out under comparable conditions on three different tomographs. In only one of the vials of each pair, an identical radioactivity of [18 F]-FDG was added, three to five fold the surrounding activity. The reconstructions and attenuation corrections suggested by the manufacturers, were carried out under the usual conditions of each site. The activity of each structure was estimated by the methods of profiles and regions of interest, on the non attenuation corrected images (N.A.C.), the images corrected by CT (C.T.A.C.), and/or external source (G.P.A.C.). Results: with all three tomographs, the activities estimated on the N.A.C. images present an inverse correlation to the medium density (important absorption by dense material). On C.T.A.C. images, we observed with only two of the three tomographs, an overestimation of the activity in the 'radioactive' vials, depending on the medium mean Z number and density (over correction), and a artifactual 'activity' in the denser 'cold' vial (incorrect attenuation correction. The dense saccharose solutions, with non elevated Z number, do not affect the CT attenuation correction. (authors)
RELATIONSHIP BETWEEN AFFECTIVE COMMITMENT ANDORGANIZATIONAL SILENCE: A CONCEPTUAL DISCUSSION
Directory of Open Access Journals (Sweden)
Fitnat Nazlı Sayğan
2011-07-01
Full Text Available In this study, the affective commitment that is oneof the components oforganizational commitment put forth by Allen and Meyer (Allen, Meyer 1996will be differentiated from the other commitment components. The importance ofcreating an emotional commitment to organizations will be examined and theorganizational factors needed to form organizational commitment will beinvestigated. Also, organizational silence is a situation that the company avoided.In the study, the reasons and the drawbacks of silence are focused on and thefactors that cause employees to remain silent are discussed.The aim of this study is intended to manifest the relationship of ‘organizationalsilence' with affective commitment’ which is one ofthe components of‘organizational commitment’ on the basis of literature. In this study, a negativecorrelation between affective commitment and organizational silence is suggested
International Nuclear Information System (INIS)
Chen, L. X.; Jager, W. J.; Niemczyk, M. P.; Wasielewski, M. R.
1999-01-01
The effect of π-conjugation attenuation on the photophysics and exciton dynamics of two conjugated polymers 1 and 2 are examined in solution. The structures of polymers 1 and 2 have 2,2'-bipyridyl-5-vinylene units that alternate with one and three 2,5-bis(n-decyloxy)-1,4-phenylenevinylene monomer units, respectively. The photophysics and exciton dynamics of polymers 1 and 2 were compared to those of the homopolymer, poly(2,5-bis(2'-ethylhexyloxy)-1,4-phenylenevinylene) (BEH-PPV). A series of changes in the photophysics of polymers 1 and 2 were found as a result of π-conjugation attenuation. These changes include blue shifts in absorption and emission spectra, spectral diffusion in stimulated emission, enhancement in photoluminescence quantum yields and lifetimes, and increases in photoinduced absorption intensities and lifetimes. These changes are systematically more pronounced in polymer 1 than in polymer 2 and are correlated with π-conjugation attenuation in the polymers due to twisting of the 2,2'-bipyridine groups about the 2,2' single bond. An exciton dynamics model involving an ensemble of initial exciton states localized on oligomeric segments within the polymer with different conjugation lengths is proposed to describe the observed differences between polymers 1 and 2 and BEH-PPV. When the electronic coupling between these segments is strong, the polymer displays characteristics that are close to those of a one-dimensional semiconductor. However, when these couplings are weakened by groups, such as the 2,2'-bipyridine that attenuate π-conjugation, the polymer displays properties of an ensemble of oligomers
Co-evolution of transcriptional silencing proteins and the DNA elements specifying their assembly.
Directory of Open Access Journals (Sweden)
Oliver A Zill
Full Text Available Co-evolution of transcriptional regulatory proteins and their sites of action has been often hypothesized but rarely demonstrated. Here we provide experimental evidence of such co-evolution in yeast silent chromatin, a finding that emerged from studies of hybrids formed between two closely related Saccharomyces species. A unidirectional silencing incompatibility between S. cerevisiae and S. bayanus led to a key discovery: asymmetrical complementation of divergent orthologs of the silent chromatin component Sir4. In S. cerevisiae/S. bayanus interspecies hybrids, ChIP-Seq analysis revealed a restriction against S. cerevisiae Sir4 associating with most S. bayanus silenced regions; in contrast, S. bayanus Sir4 associated with S. cerevisiae silenced loci to an even greater degree than did S. cerevisiae's own Sir4. Functional changes in silencer sequences paralleled changes in Sir4 sequence and a reduction in Sir1 family members in S. cerevisiae. Critically, species-specific silencing of the S. bayanus HMR locus could be reconstituted in S. cerevisiae by co-transfer of the S. bayanus Sir4 and Kos3 (the ancestral relative of Sir1 proteins. As Sir1/Kos3 and Sir4 bind conserved silencer-binding proteins, but not specific DNA sequences, these rapidly evolving proteins served to interpret differences in the two species' silencers presumably involving emergent features created by the regulatory proteins that bind sequences within silencers. The results presented here, and in particular the high resolution ChIP-Seq localization of the Sir4 protein, provided unanticipated insights into the mechanism of silent chromatin assembly in yeast.
Marine Mammal Brucella Reference Strains Are Attenuated in a BALB/c Mouse Model.
Nymo, Ingebjørg H; Arias, Maykel A; Pardo, Julián; Álvarez, María Pilar; Alcaraz, Ana; Godfroid, Jacques; Jiménez de Bagüés, María Pilar
2016-01-01
Brucellosis is a zoonosis of worldwide distribution with numerous animal host species. Since the novel isolation of Brucella spp. from marine mammals in 1994 the bacteria have been isolated from various marine mammal hosts. The marine mammal reference strains Brucella pinnipedialis 12890 (harbour seal, Phoca vitulina) and Brucella ceti 12891 (harbour porpoise, Phocoena phocoena) were included in genus Brucella in 2007, however, their pathogenicity in the mouse model is pending. Herein this is evaluated in BALB/c mice with Brucella suis 1330 as a control. Both marine mammal strains were attenuated, however, B. ceti was present at higher levels than B. pinnipedialis in blood, spleen and liver throughout the infection, in addition B. suis and B. ceti were isolated from brains and faeces at times with high levels of bacteraemia. In B. suis-infected mice serum cytokines peaked at day 7. In B. pinnipedialis-infected mice, levels were similar, but peaked predominantly at day 3 and an earlier peak in spleen weight likewise implied an earlier response. The inflammatory response induced pathology in the spleen and liver. In B. ceti-infected mice, most serum cytokine levels were comparable to those in uninfected mice, consistent with a limited inflammatory response, which also was indicated by restricted spleen and liver pathology. Specific immune responses against all three strains were detected in vitro after stimulation of splenocytes from infected mice with the homologous heat-killed brucellae. Antibody responses in vivo were also induced by the three brucellae. The immunological pattern of B. ceti in combination with persistence in organs and limited pathology has heretofore not been described for other brucellae. These two marine mammal wildtype strains show an attenuated pattern in BALB/c mice only previously described for Brucella neotomea.
Marine Mammal Brucella Reference Strains Are Attenuated in a BALB/c Mouse Model.
Directory of Open Access Journals (Sweden)
Ingebjørg H Nymo
Full Text Available Brucellosis is a zoonosis of worldwide distribution with numerous animal host species. Since the novel isolation of Brucella spp. from marine mammals in 1994 the bacteria have been isolated from various marine mammal hosts. The marine mammal reference strains Brucella pinnipedialis 12890 (harbour seal, Phoca vitulina and Brucella ceti 12891 (harbour porpoise, Phocoena phocoena were included in genus Brucella in 2007, however, their pathogenicity in the mouse model is pending. Herein this is evaluated in BALB/c mice with Brucella suis 1330 as a control. Both marine mammal strains were attenuated, however, B. ceti was present at higher levels than B. pinnipedialis in blood, spleen and liver throughout the infection, in addition B. suis and B. ceti were isolated from brains and faeces at times with high levels of bacteraemia. In B. suis-infected mice serum cytokines peaked at day 7. In B. pinnipedialis-infected mice, levels were similar, but peaked predominantly at day 3 and an earlier peak in spleen weight likewise implied an earlier response. The inflammatory response induced pathology in the spleen and liver. In B. ceti-infected mice, most serum cytokine levels were comparable to those in uninfected mice, consistent with a limited inflammatory response, which also was indicated by restricted spleen and liver pathology. Specific immune responses against all three strains were detected in vitro after stimulation of splenocytes from infected mice with the homologous heat-killed brucellae. Antibody responses in vivo were also induced by the three brucellae. The immunological pattern of B. ceti in combination with persistence in organs and limited pathology has heretofore not been described for other brucellae. These two marine mammal wildtype strains show an attenuated pattern in BALB/c mice only previously described for Brucella neotomea.
Moazeni, Maryam; Khoramizadeh, Mohammad Reza; Kordbacheh, Parivash; Sepehrizadeh, Zargham; Zeraati, Hojat; Noorbakhsh, Fatemeh; Teimoori-Toolabi, Ladan; Rezaie, Sassan
2012-09-01
The introduction of RNA silencing machinery in fungi has led to the promising application of RNAi methodology to knock down essential vital factor or virulence factor genes in the microorganisms. Efg1p is required for development of a true hyphal growth form which is known to be essential for interactions with human host cells and for the yeast's pathogenesis. In this paper, we describe the development of a system for presenting and studying the RNAi function on the EFG1 gene in C. albicans. The 19-nucleotide siRNA was designed on the basis of the cDNA sequence of the EFG1 gene in C. albicans and transfection was performed by use of a modified-PEG/LiAc method. To investigate EFG1 gene silencing in siRNA-treated cells, the yeasts were grown in human serum; to induce germ tubes a solid medium was used with the serum. Quantitative changes in expression of the EFG1 gene were analyzed by measuring the cognate EFG1 mRNA level by use of a quantitative real-time RT-PCR assay. Compared with the positive control, true hyphae formation was significantly reduced by siRNA at concentrations of 1 μM, 500 nM, and 100 nM (P < 0.05). In addition, siRNA at a concentration of 1 μM was revealed to inhibit expression of the EFG1 gene effectively (P < 0.05). On the basis of the potential of post-transcriptional gene silencing to control the expression of specific genes, these techniques may be regarded as promising means of drug discovery, with applications in biomedicine and functional genomics analysis.
The most potent peanut allergens, Ara h 2 and 6, were silenced in transgenic plants by RNA interference. Three independent transgenic lines were recovered after microprojectile bombardment, of which two contained single, integrated copies of the transgene. The third line contained multiple copies ...
Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins
Directory of Open Access Journals (Sweden)
Marcio Hedil
2016-07-01
Full Text Available The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.
Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins.
Hedil, Marcio; Kormelink, Richard
2016-07-23
The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.
Knockaert, Marie; Sapkota, Gopal; Alarcón, Claudio; Massagué, Joan; Brivanlou, Ali H.
2006-01-01
Smad transcription factors are key signal transducers for the TGF-β/bone morphogenetic protein (BMP) family of cytokines and morphogens. C-terminal serine phosphorylation by TGF-β and BMP membrane receptors drives Smads into the nucleus as transcriptional regulators. Dephosphorylation and recycling of activated Smads is an integral part of this process, which is critical for agonist sensing by the cell. However, the nuclear phosphatases involved have remained unknown. Here we provide functional, biochemical, and embryological evidence identifying the SCP (small C-terminal domain phosphatase) family of nuclear phosphatases as mediators of Smad1 dephosphorylation in the BMP signaling pathway in vertebrates. Xenopus SCP2/Os4 inhibits BMP activity in the presumptive ectoderm and leads to neuralization. In Xenopus embryos, SCP2/Os4 and human SCP1, 2, and 3 cause selective dephosphorylation of Smad1 compared with Smad2, inhibiting BMP- and Smad1-dependent transcription and leading to the induction of the secondary dorsal axis. In human cells, RNAi-mediated depletion of SCP1 and SCP2 increases the extent and duration of Smad1 phosphorylation in response to BMP, the transcriptional action of Smad1, and the strength of endogenous BMP gene responses. The present identification of the SCP family as Smad C-terminal phosphatases sheds light on the events that attenuate Smad signaling and reveals unexpected links to the essential phosphatases that control RNA polymerase II in eukaryotes. PMID:16882717
Yu, Li; Sun, Yifan; Li, Jingjing; Wang, Yan; Zhu, Yuxing; Shi, Yong; Fan, Xiaojun; Zhou, Jianda; Bao, Ying; Xiao, Jie; Cao, Ke; Cao, Peiguo
2017-08-15
Radiotherapy has been used increasingly to treat primary hepatocellular carcinoma. Clinically, the main cause of radiotherapy failure is cellular radioresistance, conferred via glycolytic metabolism. Our previous study demonstrated that Girdin is upregulated in primary hepatocellular carcinoma and promotes the invasion and metastasis of tumor cells. However, whether Girdin underlies the radio-sensitivity of hepatocellular carcinoma remains unclear. A short hairpin RNA (shRNA) was used to silence CCDC88A (encoding Girdin), and real-time PCR was performed to determine CCDC88A mRNA expression. Then, cell proliferation, colony formation, flow cytometric, scratch, and transwell assays were to examine the influence of Girdin silencing on cellular radiosensitivity. Glycolysis assays were conducted to exam cell glycolysis process. Western blotting was performed to explore the signaling pathway downstream of Girdin. Finally, animal experiments were performed to demonstrate the effect of CCDC88A silencing on the radiosensitivity of hepatoma in vivo. shRNA-induced Girdin silencing suppressed glycolysis and enhanced the radio-sensitivity of hepatic cell lines, HepG2 and Huh-7. Furthermore, silencing of Girdin inhibited the PI3K/AKT/HIF-1α signaling pathway, which is a central regulator of glycolysis. Girdin can regulate glycolysis in hepatocellular carcinoma cells through the PI3K/AKT/HIF-1α signaling pathway, which decreases the sensitivity of tumor cells to radiotherapy.
Adaptation of the Four Forms of Employee Silence Scale in a Polish sample
Directory of Open Access Journals (Sweden)
Krystyna Adamska
2017-06-01
Full Text Available Background Silence is understood as a decision not to speak up in situations of observed irregularities both in productivity and ethics. The study examined the validity of the Four Forms of Employee Silence Scale (FFESS in the Polish population. The scale is a four-factor measure designed to capture differently motivated tendencies to be silent in organizations. The scale distinguishes acquiescent, quiescent, prosocial and opportunistic silence. Employee silence has been linked to many important individual outcomes: failure to react to ethical transgressions, stress and depression, and lower creativity and productivity. Participants and procedure A total of 1044 employees of various organizations working for at least six months at a given position provided the responses for the validation study. Results The results confirmed the superiority of the four-factor model shown by adequate fit indexes: The FFESS has adequate internal consistency at both the scale and item levels. The criterion-related validity of the scale was established by correlating four forms of silence with measures of emotional attitude toward organization, procedural justice, relational contract and turnover intention. Conclusions The four forms of employee silence are empirically distinct concepts in the Polish sample. The scale may be used as the measurement of individual differences. It can also serve as a tool for diagnosing a climate of silence in an organization.
FOXO/DAF-16 Activation Slows Down Turnover of the Majority of Proteins in C. elegans.
Dhondt, Ineke; Petyuk, Vladislav A; Cai, Huaihan; Vandemeulebroucke, Lieselot; Vierstraete, Andy; Smith, Richard D; Depuydt, Geert; Braeckman, Bart P
2016-09-13
Most aging hypotheses assume the accumulation of damage, resulting in gradual physiological decline and, ultimately, death. Avoiding protein damage accumulation by enhanced turnover should slow down the aging process and extend the lifespan. However, lowering translational efficiency extends rather than shortens the lifespan in C. elegans. We studied turnover of individual proteins in the long-lived daf-2 mutant by combining SILeNCe (stable isotope labeling by nitrogen in Caenorhabditiselegans) and mass spectrometry. Intriguingly, the majority of proteins displayed prolonged half-lives in daf-2, whereas others remained unchanged, signifying that longevity is not supported by high protein turnover. This slowdown was most prominent for translation-related and mitochondrial proteins. In contrast, the high turnover of lysosomal hydrolases and very low turnover of cytoskeletal proteins remained largely unchanged. The slowdown of protein dynamics and decreased abundance of the translational machinery may point to the importance of anabolic attenuation in lifespan extension, as suggested by the hyperfunction theory. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.
Sharawy, Maha H; El-Awady, Mohammed S; Megahed, Nirmeen; Gameil, Nariman M
2016-05-01
This study investigates the effect of the ergogenic supplement β-hydroxy-β-methylbutyrate (HMB) on insulin resistance induced by high-fructose diet (HFD) in rats. Male Sprague Dawley rats were fed 60% HFD for 12 weeks and HMB (320 mg·kg(-1)·day(-1), orally) for 4 weeks. HFD significantly increased fasting insulin, fasting glucose, glycosylated hemoglobin (HBA1C), liver glycogen content, and homeostasis model assessment of insulin resistance (HOMA-IR) index, while it decreased glucose and insulin tolerance. Furthermore, HFD significantly increased serum triglycerides (TG), low density lipoprotein cholesterol (LDL-C), and very low density lipoprotein cholesterol (VLDL-C) levels, while it significantly decreased high density lipoprotein cholesterol (HDL-C). Moreover, HFD significantly increased mRNA expression of glucose transporter type-2 (GLUT-2), the mammalian target of rapamycin (mTOR), and sterol regulatory element-binding protein-1c (SREBP-1c) but decreased peroxisome proliferator-activated receptor-alpha (PPAR-α) in liver. Aortic relaxation to acetylcholine (ACh) was impaired and histopathology showed severe hepatic steatosis. HMB significantly increased insulin tolerance and decreased fasting insulin, HOMA-IR, HBA1C, hepatic glycogen content, serum TG, LDL-C, and VLDL-C. Additionally, HMB enhanced ACh-induced relaxation, ameliorated hepatic steatosis, and decreased mRNA expression of GLUT-2. In conclusion, HMB may attenuate insulin resistance and hepatic steatosis through inhibiting GLUT-2 in liver.
Decreasing erucic acid level by RNAi-mediated silencing of fatty ...
African Journals Online (AJOL)
To develop low level of erucic acid in rapeseeds by intron-spliced hairpin RNA, an inverted repeat unit of a partial BnFAE1.1 gene interrupted by a spliceable intron ... In conclusion, the expression of endogenous BnFAE1.1 was efficiently silenced by the designed RNAi silencer, causing a significant down-regulation in the ...
Fast neutron attenuation measurements for detection of illicit materials
International Nuclear Information System (INIS)
Lee, Hee Seock; Chung, Chin Wha; Guon, Ki Il; Lee, Bo Young; Ko, Seung Kook; Shin, Yong Mu
2002-01-01
Experiments were carried out to develop a novel method using neutron attenuation for the detection of illicit materials. By using pulsed fast neutrons generated from a Bi target bombarded with a 2 GeV electron beam, attenuation spectra of C, N, and O have been measured to study the feasibility of a practical application. The spectral dependence on the material thickness and the geometrical distribution as well as the ability to identify different elements in a layered environment have been studied. For the elements mentioned here, the total cross sections have been obtained from the measured attenuation spectra and compared with ENDF-VI, which showed good agreement. The study confirms that a conventional low energy electron linac can be put into a practical use, and some practical idea is presented
Ko, Hyun-Kyung; Guo, Li-wu; Su, Bing; Gao, Lingqiu; Gelman, Irwin H
2014-01-01
Chemotaxis is controlled by interactions between receptors, Rho-family GTPases, phosphatidylinositol 3-kinases, and cytoskeleton remodeling proteins. We investigated how the metastasis suppressor, SSeCKS, attenuates chemotaxis. Chemotaxis activity inversely correlated with SSeCKS levels in mouse embryo fibroblasts (MEF), DU145 and MDA-MB-231 cancer cells. SSeCKS loss induced chemotactic velocity and linear directionality, correlating with replacement of leading edge lamellipodia with fascin-enriched filopodia-like extensions, the formation of thickened longitudinal F-actin stress fibers reaching to filopodial tips, relative enrichments at the leading edge of phosphatidylinositol (3,4,5)P3 (PIP3), Akt, PKC-ζ, Cdc42-GTP and active Src (SrcpoY416), and a loss of Rac1. Leading edge lamellipodia and chemotaxis inhibition in SSeCKS-null MEF could be restored by full-length SSeCKS or SSeCKS deleted of its Src-binding domain (ΔSrc), but not by SSeCKS deleted of its three MARCKS (myristylated alanine-rich C kinase substrate) polybasic domains (ΔPBD), which bind PIP2 and PIP3. The enrichment of activated Cdc42 in SSeCKS-null leading edge filopodia correlated with recruitment of the Cdc42-specific guanine nucleotide exchange factor, Frabin, likely recruited via multiple PIP2/3-binding domains. Frabin knockdown in SSeCKS-null MEF restores leading edge lamellipodia and chemotaxis inhibition. However, SSeCKS failed to co-immunoprecipitate with Rac1, Cdc42 or Frabin. Consistent with the notion that chemotaxis is controlled by SSeCKS-PIP (vs. -Src) scaffolding activity, constitutively-active phosphatidylinositol 3-kinase could override the ability of the Src inhibitor, SKI-606, to suppress chemotaxis and filopodial enrichment of Frabin in SSeCKS-null MEF. Our data suggest a role for SSeCKS in controlling Rac1 vs. Cdc42-induced cellular dynamics at the leading chemotactic edge through the scaffolding of phospholipids and signal mediators, and through the reorganization of the
PO2 Cycling Reduces Diaphragm Fatigue by Attenuating ROS Formation
Zuo, Li; Diaz, Philip T.; Chien, Michael T.; Roberts, William J.; Kishek, Juliana; Best, Thomas M.; Wagner, Peter D.
2014-01-01
Prolonged muscle exposure to low PO2 conditions may cause oxidative stress resulting in severe muscular injuries. We hypothesize that PO2 cycling preconditioning, which involves brief cycles of diaphragmatic muscle exposure to a low oxygen level (40 Torr) followed by a high oxygen level (550 Torr), can reduce intracellular reactive oxygen species (ROS) as well as attenuate muscle fatigue in mouse diaphragm under low PO2. Accordingly, dihydrofluorescein (a fluorescent probe) was used to monito...
RNA silencing is required for Arabidopsis defence against Verticillium wilt disease
Ellendorff, U.; Fradin, E.F.; Jonge, de R.; Thomma, B.P.H.J.
2009-01-01
RNA silencing is a conserved mechanism in eukaryotes that plays an important role in various biological processes including regulation of gene expression. RNA silencing also plays a role in genome stability and protects plants against invading nucleic acids such as transgenes and viruses. Recently,
Leucine Modulates Mitochondrial Biogenesis and SIRT1-AMPK Signaling in C2C12 Myotubes
Directory of Open Access Journals (Sweden)
Chunzi Liang
2014-01-01
Full Text Available Previous studies from this laboratory demonstrate that dietary leucine protects against high fat diet-induced mitochondrial impairments and stimulates mitochondrial biogenesis and energy partitioning from adipocytes to muscle cells through SIRT1-mediated mechanisms. Moreover, β-hydroxy-β-methyl butyrate (HMB, a metabolite of leucine, has been reported to activate AMPK synergistically with resveratrol in C2C12 myotubes. Therefore, we hypothesize that leucine-induced activation of SIRT1 and AMPK is the central event that links the upregulated mitochondrial biogenesis and fatty acid oxidation in skeletal muscle. Thus, C2C12 myotubes were treated with leucine (0.5 mM, alanine (0.5 mM, valine (0.5 mM, EX527 (SIRT1 inhibitor, 25 μM, and Compound C (AMPK inhibitor, 25 μM alone or in combination to determine the roles of AMPK and SIRT1 in leucine-modulation of energy metabolism. Leucine significantly increased mitochondrial content, mitochondrial biogenesis-related genes expression, fatty acid oxidation, SIRT1 activity and gene expression, and AMPK phosphorylation in C2C12 myotubes compared to the controls, while EX527 and Compound C markedly attenuated these effects. Furthermore, leucine treatment for 24 hours resulted in time-dependent increases in cellular NAD+, SIRT1 activity, and p-AMPK level, with SIRT1 activation preceding that of AMPK, indicating that leucine activation of SIRT1, rather than AMPK, is the primary event.
Driving in unheard silence: Disability and the politics of shutting up.
Lourens, Heidi
2018-03-01
The politics of silence is central to disability experience and the field of disability studies. In this analytical autoethnography, I write about my silences as a visually impaired woman. I explore and make sense of personal life stories through a theoretical perspective. The analysis of these personal experiences lead me to argue that disability-related silences are mostly created through the confluence of inaccessible physical and social environments and the psychological internalisation of these worlds. I also discuss the ways in which I am currently regaining my voice. Further research on resistance by disabled persons is recommended.
Hou, Xu; Liu, Yaohua; Liu, Huailei; Chen, Xin; Liu, Min; Che, Hui; Guo, Fei; Wang, Chunlei; Zhang, Daming; Wu, Jianing; Chen, Xiaofeng; Shen, Chen; Li, Chenguang; Peng, Fei; Bi, Yunke; Yang, Zhuowen; Yang, Guang; Ai, Jing; Gao, Xin; Zhao, Shiguang
2015-01-01
Glioma relies on glycolysis to obtain energy and sustain its survival under low glucose microenvironment in vivo. The mechanisms on glioma cell glycolysis regulation are still unclear. Signaling mediated by Double-stranded RNA-activated protein kinase (PKR) - like ER kinase (PERK) is one of the important pathways of unfolded protein response (UPR) which is comprehensively activated in cancer cells upon the hypoxic and low glucose stress. Here we show that PERK is significantly activated in human glioma tissues. PERK silencing results in decreased glioma cell viability and ATP/lactate production upon low glucose stress, which is mediated by partially blocked AKT activation and subsequent inhibition of Hexokinase II (HK2)'s mitochondria translocation. More importantly, PERK silenced glioma cells show decreased tumor formation capacity. Our results reveal that PERK activation is involved in glioma glycolysis regulation and may be a potential molecular target for glioma treatment.
Hou, Xu
2015-03-12
Glioma relies on glycolysis to obtain energy and sustain its survival under low glucose microenvironment in vivo. The mechanisms on glioma cell glycolysis regulation are still unclear. Signaling mediated by Double-stranded RNA-activated protein kinase (PKR) - like ER kinase (PERK) is one of the important pathways of unfolded protein response (UPR) which is comprehensively activated in cancer cells upon the hypoxic and low glucose stress. Here we show that PERK is significantly activated in human glioma tissues. PERK silencing results in decreased glioma cell viability and ATP/lactate production upon low glucose stress, which is mediated by partially blocked AKT activation and subsequent inhibition of Hexokinase II (HK2)\\'s mitochondria translocation. More importantly, PERK silenced glioma cells show decreased tumor formation capacity. Our results reveal that PERK activation is involved in glioma glycolysis regulation and may be a potential molecular target for glioma treatment.
β-Hydroxy-β-Methylbutyrate (HMB) Promotes Neurite Outgrowth in Neuro2a Cells.
Salto, Rafael; Vílchez, Jose D; Girón, María D; Cabrera, Elena; Campos, Nefertiti; Manzano, Manuel; Rueda, Ricardo; López-Pedrosa, Jose M
2015-01-01
β-Hydroxy-β-methylbutyrate (HMB) has been shown to enhance cell survival, differentiation and protein turnover in muscle, mainly activating phosphoinositide-3-kinase/protein kinase B (PI3K/Akt) and mitogen-activated protein kinases/ extracellular-signal-regulated kinases (MAPK/ERK) signaling pathways. Since these two pathways are related to neuronal survival and differentiation, in this study, we have investigated the neurotrophic effects of HMB in mouse neuroblastoma Neuro2a cells. In Neuro2a cells, HMB promotes differentiation to neurites independent from any effects on proliferation. These effects are mediated by activation of both the PI3K/Akt and the extracellular-signal-regulated kinases (ERK1/2) signaling as demonstrated by the use of specific inhibitors of these two pathways. As myocyte-enhancer factor 2 (MEF2) family of transcription factors are involved in neuronal survival and plasticity, the transcriptional activity and protein levels of MEF2 were also evaluated. HMB promoted MEF2-dependent transcriptional activity mediated by the activation of Akt and ERK1/2 pathways. Furthermore, HMB increases the expression of brain glucose transporters 1 (GLUT1) and 3 (GLUT3), and mTOR phosphorylation, which translates in a higher protein synthesis in Neuro2a cells. Furthermore, Torin1 and rapamycin effects on MEF2 transcriptional activity and HMB-dependent neurite outgrowth support that HMB acts through mTORC2. Together, these findings provide clear evidence to support an important role of HMB in neurite outgrowth.
Piecing Together Past and Present in Bhutan: Narration, Silence and Forgetting in Conflict
Directory of Open Access Journals (Sweden)
Line Kikkenborg Christensen
2018-02-01
Full Text Available What happens when conflict is silenced in official narratives but not forgotten among a population? This article explores this question using interview data from anthropological fieldwork in Bhutan. In Bhutan, the ethnic conflict of the early 1990s is surrounded by silence and is not openly discussed. Despite this silence, young Bhutanese have formed a multiplicity of narratives about the conflict. The article highlights three different narratives of conflict, as well as the oblivion found among informants. The main argument is that the silence surrounding the conflict in Bhutan has contributed to two forms of societal rift: between the authorities and the people, and between people themselves. The article contributes to the discussion about what role social memories play in conflicts, by suggesting that silence may cause wariness and hinder processes that help societies to move past conflict in a constructive way.
Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J
2015-01-01
In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.
Li, Peng; Huang, Pei-Pei; Yang, Yun; Liu, Chi; Lu, Yan; Wang, Fang; Sun, Wei; Kong, Xiang-Qing
2017-01-01
Li P, Huang P, Yang Y, Liu C, Lu Y, Wang F, Sun W, Kong X. Renal sympathetic denervation attenuates hypertension and vascular remodeling in renovascular hypertensive rats. J Appl Physiol 122: 121-129, 2017. First published October 14, 2016; doi:10.1152/japplphysiol.01019.2015-Sympathetic activity is enhanced in patients with essential or secondary hypertension, as well as in various hypertensive animal models. Therapeutic targeting of sympathetic activation is considered an effective antihypertensive strategy. We hypothesized that renal sympathetic denervation (RSD) attenuates hypertension and improves vascular remodeling and renal disease in the 2-kidney, 1-clip (2K1C) rat model. Rats underwent 2K1C modeling or sham surgery; then rats underwent RSD or sham surgery 4 wk later, thus resulting in four groups (normotensive-sham, normotensive-RSD, 2K1C-sham, and 2K1C-RSD). Norepinephrine was measured by ELISA. Echocardiography was used to assess heart function. Fibrosis and apoptosis were assessed by Masson and TUNEL staining. Changes in mean arterial blood pressure in response to hexamethonium and plasma norepinephrine levels were used to evaluate basal sympathetic nerve activity. The 2K1C modeling success rate was 86.8%. RSD reversed the elevated systolic blood pressure induced by 2K1C, but had no effect on body weight. Compared with rats in the 2K1C-sham group, rats in the 2K1C-RSD group showed lower left ventricular mass/body weight ratio, interventricular septal thickness in diastole, left ventricular end-systolic diameter, and left ventricular posterior wall thickness in systole, whereas fractional shortening and ejection fraction were higher. Right kidney apoptosis and left kidney hypertrophy were not changed by RSD. Arterial fibrosis was lower in animals in the 2K1C-RSD group compared with those in the 2K1C-sham group. RSD reduced plasma norepinephrine and basal sympathetic activity in rats in the 2K1C-RSD group compared with rats in the 2K1C-sham group. These
Canine parvovirus type 2 vaccine protects against virulent challenge with type 2c virus.
Spibey, N; Greenwood, N M; Sutton, D; Chalmers, W S K; Tarpey, I
2008-04-01
The ability of dogs vaccinated with a live attenuated CPV type 2 (Nobivac Intervet) vaccine to resist challenge with a current CPV2c isolate was investigated. Six SPF beagle dogs were given the minimum recommended course of vaccination, comprising a single inoculation of vaccine (Nobivac Lepto+Nobivac Pi) at 8-10 weeks of age followed 3 weeks later with a parvovirus vaccine in combination with distemper, adenovirus and parainfluenza virus (Nobivac DHPPi) and a repeat leptospirosis vaccine. Six control dogs were kept unvaccinated. All animals were challenged orally with a type 2c isolate of CPV and monitored for clinical signs, virus shedding, white blood cell fluctuations and serological responses. All vaccinated dogs were fully protected; showing no clinical signs nor shedding challenge virus in the faeces, in contrast to control animals, which displayed all the typical signs of infection with pathogenic CPV and shed challenge virus in the faeces.
H. pylori attenuates TNBS-induced colitis via increasing mucosal Th2 cells in mice.
Wu, Yi-Zhong; Tan, Gao; Wu, Fang; Zhi, Fa-Chao
2017-09-26
There is an epidemiological inverse relationship between Helicobacter pylori ( H. pylori ) infection and Crohn's disease (CD). However, whether H. pylori plays a protective role against CD remains unclear. Since 2, 4, 6-trinitrobenzene sulfonic acid (TNBS)-induced colitis is thought to resemble CD, we investigated whether H. pylori can attenuate TNBS-induced colitis in mice. Here we show that H. pylori can attenuate the severity of TNBS-induced colitis. In addition, H. pylori not only down-regulates Th17 and Th1 cytokine expression, but can up-regulate Th2 cytokine expression and increase the Th2:Th17 ratio of CD4 + T in the colonic mucosa of TNBS-induced colitis. Our results indicate that H. pylori attenuates TNBS-induced colitis mainly through increasing Th2 cells in murine colonic mucosa. Our finding offers a novel view on the role of H. pylori in regulating gastrointestinal immunity, and may open a new avenue for development of therapeutic strategies in CD by making use of asymptomatic H. pylori colonization.
Brescó de Luna, Ignacio
2018-05-04
This paper explores the role of silence in Spain's post-dictatorship memory politics. More specifically, the paper examines the forgotten Spanish colonial past in North Africa vis-à-vis the so-called pact of silence that accompanied Spain's transition to democracy after the Franco dictatorship. Drawing on various theoretical approaches in relation to collective memory, traditionally assumed associations between silence and forgetting are questioned. As is argued, silence may nurture and preserve memory just as it may also feed into forgetting. In the former case, silence typically enshrouds a living memory of a past that still weighs on the present, as the pact of silence in Spain clearly illustrates. In the latter case, silence signals a past perceived as already left behind and alien to society's current problems, as is the case of the Spanish colonial past in North Africa. In order to further explore the latter case, the notion of banal silence is introduced. Such notion points to cases where silence over certain contentious historical issues goes unnoticed by society, thus becoming naturalized. The paper concludes with some final reflexions on memory, banal silence and political change.
International Nuclear Information System (INIS)
Mori, Yasuji; Hinchcliff, Monique; Wu, Minghua; Warner-Blankenship, Matthew; Lyons, Karen M.; Varga, John
2008-01-01
Background: The matricellular protein connective tissue growth factor (CCN2) has been implicated in pathological fibrosis, but its physiologic role remains elusive. In vitro, transforming growth factor-β (TGF-β) induces CCN2 expression in mesenchymal cells. Because CCN2 can enhance profibrotic responses elicited by TGF-β, it has been proposed that CCN2 functions as an essential downstream signaling mediator for TGF-β. To explore this notion, we characterized TGF-β-induced activation of fibroblasts from CCN2-null (CCN2 -/- ) mouse embryos. Methods: The regulation of CCN2 expression was examined in vivo in a model of fibrosis induced by bleomycin. Cellular TGF-β signal transduction and regulation of collagen gene expression were examined in CCN2 -/- MEFs by immunohistochemistry, Northern, Western and RT-PCR analysis, immunocytochemistry and transient transfection assays. Results: Bleomycin-induced skin fibrosis in the mouse was associated with substantial CCN2 up-regulation in lesional fibroblasts. Whereas in vitro proliferation rate of CCN2 -/- MEFs was markedly reduced compared to wild type MEFs, TGF-β-induced activation of the Smad pathways, including Smad2 phosphorylation, Smad2/3 and Smad4 nuclear accumulation and Smad-dependent transcriptional responses, were unaffected by loss of CCN2. The stimulation of COL1A2 and fibronectin mRNA expression and promoter activity, and of corresponding protein levels, showed comparable time and dose-response in wild type and CCN2 -/- MEFs, whereas stimulation of alpha smooth muscle actin and myofibroblast transdifferentiation showed subtle impairment in MEFs lacking CCN2. Conclusion: Whereas endogenous CCN2 plays a role in regulation of proliferation and TGF-β-induced myofibroblast transdifferentiation, it appears to be dispensable for Smad-dependent stimulation of collagen and extracellular matrix synthesis in murine embryonic fibroblasts
Wu, H; Zhang, J; Shi, H
2016-01-01
Effect of the tumor suppression gene p16 on the biological characteristics of HeLa cervical carcinoma cells was explored. The expression of p16 protein was increased in HeLa tumor sphere cells, and no significant difference in tumor spheres from the first to the fourth passages. Compared with those of parental HeLa cells, the proportion of CD44+/CD24- and ABCG2+ cells increased significantly in tumor spheres. However after the cells were silenced by the p16-sh289 vector, expression of P16 protein and the cell number of CD44+/CD24- and ABCG2+ decreased. Moreover, HeLa cells with p16 gene silencing showed decreased abilities of sphere formation and matrigel invasion. More HeLa cells with p16 gene silence were needed for tumor formation in nude mice. Tumor size and weight in mouse model established with p16 gene silenced HeLa cells were less than those with HeLa parental cell model. The present results indicate that silencing of the p16 gene inhibits expression of cancer stem cell markers and tumorigenic ability of HeLa cells.
Silence in liturgy as the space for the Holy Ghost’s activity
Directory of Open Access Journals (Sweden)
Adelajda Sielepin
2006-06-01
Full Text Available The aim of this article is to clarify the essential and often neglected function of liturgical silence. In practice silence is usually intended to prepare the participants for listening or reflecting upon the word, especially when proclaimed by the minister. Whereas it is vital to know that silence constitutes a creative element of the liturgy, because the involvement of the Holy Spirit. In His action and cooperation with the participants He enables them to get into communion with Christ the Word and the Person and eventually to join effectively His mission. In that sense silence helps the Holy Ghost to fulfill His function in continuing the dialogue between God and man as well as in enhancing one’s spiritual skills for the fruitful participation in the Mystery of Christ and the Church.
The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing.
Fusaro, Adriana F; Barton, Deborah A; Nakasugi, Kenlee; Jackson, Craig; Kalischuk, Melanie L; Kawchuk, Lawrence M; Vaslin, Maite F S; Correa, Regis L; Waterhouse, Peter M
2017-10-10
The plant viral family Luteoviridae is divided into three genera: Luteovirus , Polerovirus and Enamovirus . Without assistance from another virus, members of the family are confined to the cells of the host plant's vascular system. The first open reading frame (ORF) of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs) against the plant's viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV), however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant's silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant's anti-viral defense.
DEFF Research Database (Denmark)
Nielsen, Inga Sig; Nielsen, Olaf; Murray, Johanne M
2002-01-01
Genes transcribed by RNA polymerase II are silenced when introduced near the mat2 or mat3 mating-type loci of the fission yeast Schizosaccharomyces pombe. Silencing is mediated by a number of gene products and cis-acting elements. We report here the finding of novel trans-acting factors identified...... was not suppressed by a mutation in the 26S proteasome, suggesting that loss of silencing is not due to an increased degradation of silencing factors but rather to the posttranslational modification of proteins by ubiquitination. We discuss the implications of these results for the possible modes of action of UbcP3...
Li, Zhiyuan; Zhang, Zhanxiu; Zhao, Lili; Li, Hui; Wang, Suxia; Shen, Yong
2014-01-01
We hypothesized that RNA interference to silence Nogo-66 receptor gene expression in bone marrow mesenchymal stem cells before transplantation might further improve neurological function in rats with spinal cord transection injury. After 2 weeks, the number of neurons and BrdU-positive cells in the Nogo-66 receptor gene silencing group was higher than in the bone marrow mesenchymal stem cell group, and significantly greater compared with the model group. After 4 weeks, behavioral performance was significantly enhanced in the model group. After 8 weeks, the number of horseradish peroxidase-labeled nerve fibers was higher in the Nogo-66 receptor gene silencing group than in the bone marrow mesenchymal stem cell group, and significantly higher than in the model group. The newly formed nerve fibers and myelinated nerve fibers were detectable in the central transverse plane section in the bone marrow mesenchymal stem cell group and in the Nogo-66 receptor gene silencing group. PMID:25206893
Zhao, Xiaoyan; Dou, Mengmeng; Zhang, Zhihao; Zhang, Duoduo; Huang, Chengzhi
2017-10-01
The preliminary studies have shown that Dendrobium officinale possessed therapeutic effects on hypertension and atherosclerosis. Studies also reported that Dendrobium officinale polysaccharides showed antioxidant capabilities. However, little is known about its effects on myocardial cells under oxidative stress. The present study was designed to study the protective effect of Dendrobium officinale polysaccharides against H 2 O 2 -induced oxidative stress in H9c2 cells. MTT assay was carried out to determine the cell viability of H9c2 cells when pretreated with Dendrobium officinale polysaccharides. Fluorescent microscopy measurements were performed for evaluating the apoptosis in H9c2 cells. Furthermore, effects of Dendrobium officinale polysaccharides on the activities of antioxidative indicators (malondialdehyde, superoxide dismutase), reactive oxygen species (ROS) production and mitochondrial membrane potential (MMP) levels were analyzed. Dendrobium officinale polysaccharides attenuated H 2 O 2 -induced cell death, as determined by the MTT assay. Dendrobium officinale polysaccharides decreased malondialdehyde levels, increased superoxide dismutase activities, and inhibited the generation of intracellular ROS. Moreover, pretreatment with Dendrobium officinale polysaccharides also inhibited apoptosis and increased the MMP levels in H9c2 cells. These results suggested the protective effects of Dendrobium officinale polysaccharides against H 2 O 2 -induced injury in H9c2 cells. The results also indicated the anti-oxidative capability of Dendrobium officinale polysaccharides. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Identification and characterization of two RNA silencing suppressors encoded by ophioviruses
Robles Luna, Gabriel; Reyes, Carina A.; Peña, Eduardo J.; Ocolotobiche, Eliana; Baeza, Cecilia; Borniego, Maria Belén; Kormelink, Richard; García, María Laura
2017-01-01
Citrus psorosis virus and Mirafiori lettuce big-vein virus are two members of the genus Ophiovirus, family Ophioviridae. So far, how these viruses can interfere in the antiviral RNA silencing pathway is not known. In this study, using a local GFP silencing assay on Nicotiana benthamiana, the
Vyas, Falguni S; Nelson, Carl P; Dickenson, John M
2018-01-15
Pharmacologically-induced pre- and post-conditioning represent attractive therapeutic strategies to reduce ischaemia/reperfusion injury during cardiac surgery and following myocardial infarction. We have previously reported that transglutaminase 2 (TG2) activity is modulated by the A 1 adenosine receptor and β 2 -adrenoceptor in H9c2 cardiomyoblasts. The primary aim of this study was to determine the role of TG2 in A 1 adenosine receptor and β 2 -adrenoceptor-induced pharmacological pre- and post-conditioning in the H9c2 cells. H9c2 cells were exposed to 8h hypoxia (1% O 2 ) followed by 18h reoxygenation, after which cell viability was assessed by monitoring mitochondrial reduction of MTT, lactate dehydrogenase release and caspase-3 activation. N 6 -cyclopentyladenosine (CPA; A 1 adenosine receptor agonist), formoterol (β 2 -adrenoceptor agonist) or isoprenaline (non-selective β-adrenoceptor agonist) were added before hypoxia/reoxygenation (pre-conditioning) or at the start of reoxygenation following hypoxia (post-conditioning). Pharmacological pre- and post-conditioning with CPA and isoprenaline significantly reduced hypoxia/reoxygenation-induced cell death. In contrast, formoterol did not elicit protection. Pre-treatment with pertussis toxin (G i/o -protein inhibitor), DPCPX (A 1 adenosine receptor antagonist) or TG2 inhibitors (Z-DON and R283) attenuated the A 1 adenosine receptor-induced pharmacological pre- and post-conditioning. Similarly, pertussis toxin, ICI 118,551 (β 2 -adrenoceptor antagonist) or TG2 inhibition attenuated the isoprenaline-induced cell survival. Knockdown of TG2 using small interfering RNA (siRNA) attenuated CPA and isoprenaline-induced pharmacological pre- and post-conditioning. Finally, proteomic analysis following isoprenaline treatment identified known (e.g. protein S100-A6) and novel (e.g. adenine phosphoribosyltransferase) protein substrates for TG2. These results have shown that A 1 adenosine receptor and β 2 -adrenoceptor
Directory of Open Access Journals (Sweden)
Cem KAHYA
2015-06-01
Full Text Available The concept of occupational self-efficacy means the efficacy perceptions of employees in their occupational fields, and the concept of organizational silence means the employees avoid to voice their ideas and suggestions about organizational issues. The main aim of this study is to examine the relationship between the concepts of occupational self-efficacy and organizational silence by revealing employees’ perceptions of occupational self-efficacy and organizational silence level. With this aim, the survey study was conducted on total 114 academicians who work in University of Bayburt. As a result of research, while the significant relationship was found between employees’ perceptions of occupational self-efficacy and organizational silence level, there was reached a result that this relationship incurred the negatively relationship between perceptions of occupational self-efficacy and negative silence.
Directory of Open Access Journals (Sweden)
Zeenia Jagga
Full Text Available Viral encoded RNA silencing suppressor proteins interfere with the host RNA silencing machinery, facilitating viral infection by evading host immunity. In plant hosts, the viral proteins have several basic science implications and biotechnology applications. However in silico identification of these proteins is limited by their high sequence diversity. In this study we developed supervised learning based classification models for plant viral RNA silencing suppressor proteins in plant viruses. We developed four classifiers based on supervised learning algorithms: J48, Random Forest, LibSVM and Naïve Bayes algorithms, with enriched model learning by correlation based feature selection. Structural and physicochemical features calculated for experimentally verified primary protein sequences were used to train the classifiers. The training features include amino acid composition; auto correlation coefficients; composition, transition, and distribution of various physicochemical properties; and pseudo amino acid composition. Performance analysis of predictive models based on 10 fold cross-validation and independent data testing revealed that the Random Forest based model was the best and achieved 86.11% overall accuracy and 86.22% balanced accuracy with a remarkably high area under the Receivers Operating Characteristic curve of 0.95 to predict viral RNA silencing suppressor proteins. The prediction models for plant viral RNA silencing suppressors can potentially aid identification of novel viral RNA silencing suppressors, which will provide valuable insights into the mechanism of RNA silencing and could be further explored as potential targets for designing novel antiviral therapeutics. Also, the key subset of identified optimal features may help in determining compositional patterns in the viral proteins which are important determinants for RNA silencing suppressor activities. The best prediction model developed in the study is available as a
Highly Complementary Target RNAs Promote Release of Guide RNAs from Human Argonaute2
De, Nabanita; Young, Lisa; Lau, Pick-Wei; Meisner, Nicole-Claudia; Morrissey, David V.; MacRae, Ian J.
2013-01-01
SUMMARY Argonaute proteins use small RNAs to guide the silencing of complementary target RNAs in many eukaryotes. Although small RNA biogenesis pathways are well studied, mechanisms for removal of guide RNAs from Argonaute are poorly understood. Here we show that the Argonaute2 (Ago2) guide RNA complex is extremely stable, with a half-life on the order of days. However, highly complementary target RNAs destabilize the complex and significantly accelerate release of the guide RNA from Ago2. This “unloading” activity can be enhanced by mismatches between the target and the guide 5′ end and attenuated by mismatches to the guide 3′ end. The introduction of 3′ mismatches leads to more potent silencing of abundant mRNAs in mammalian cells. These findings help to explain why the 3′ ends of mammalian microRNAs (miRNAs) rarely match their targets, suggest a mechanism for sequence-specific small RNA turnover, and offer insights for controlling small RNAs in mammalian cells. PMID:23664376
Attenuation factors for B(E2) in the microscopic description of multiphonon states
International Nuclear Information System (INIS)
Matsuyanagi, Kenichi
1982-01-01
With an exactly solvable O(4) model of Piepenbring, Silvestre-Brac and Szymanski, we demonstrate that the attenuation factor for the B(E2) values, derived by the lowest-order approximation of the multiphonon method, takes excellent care of the kinematical anharmonicity effects, if multiphonon states are defined in the intrinsic subspace orthogonal to the pairing rotation. It is also shown that the other attenuation effect characterizing the interacting boson model is not a dominant effect in the model analysed here. (author)
Biochemical and single-molecule analyses of the RNA silencing suppressing activity of CrPV-1A.
Watanabe, Mariko; Iwakawa, Hiro-Oki; Tadakuma, Hisashi; Tomari, Yukihide
2017-10-13
Viruses often encode viral silencing suppressors (VSSs) to counteract the hosts' RNA silencing activity. The cricket paralysis virus 1A protein (CrPV-1A) is a unique VSS that binds to a specific Argonaute protein (Ago)-the core of the RNA-induced silencing complex (RISC)-in insects to suppress its target cleavage reaction. However, the precise molecular mechanism of CrPV-1A action remains unclear. Here we utilized biochemical and single-molecule imaging approaches to analyze the effect of CrPV-1A during target recognition and cleavage by Drosophila Ago2-RISC. Our results suggest that CrPV-1A obstructs the initial target searching by Ago2-RISC via base pairing in the seed region. The combination of biochemistry and single-molecule imaging may help to pave the way for mechanistic understanding of VSSs with diverse functions. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
High-Throughput Screening of a Luciferase Reporter of Gene Silencing on the Inactive X Chromosome.
Keegan, Alissa; Plath, Kathrin; Damoiseaux, Robert
2018-01-01
Assays of luciferase gene activity are a sensitive and quantitative reporter system suited to high-throughput screening. We adapted a luciferase assay to a screening strategy for identifying factors that reactivate epigenetically silenced genes. This epigenetic luciferase reporter is subject to endogenous gene silencing mechanisms on the inactive X chromosome (Xi) in primary mouse cells and thus captures the multilayered nature of chromatin silencing in development. Here, we describe the optimization of an Xi-linked luciferase reactivation assay in 384-well format and adaptation of the assay for high-throughput siRNA and chemical screening. Xi-luciferase reactivation screening has applications in stem cell biology and cancer therapy. We have used the approach described here to identify chromatin-modifying proteins and to identify drug combinations that enhance the gene reactivation activity of the DNA demethylating drug 5-aza-2'-deoxycytidine.
Evaluation of PVDF/MWCNT - ZRO{sub 2} nanocomposites for X-Rays attenuation
Energy Technology Data Exchange (ETDEWEB)
Pereira, Esther L.M.; Oliveira, Arno H., E-mail: esther_machado@outlook.com.br, E-mail: heeren@nuclear.ufmg.br [Universidade Federal de Minas Gerais (CCTN/UFMG), Belo Horizonte, MG (Brazil). Departamento de Engenharia Nuclear; Batista, Adriana S.M., E-mail: adriananuclear@yahoo.com.br [Departamento de Anatomia e Imagem (IMA), Belo Horizonte, MG (Brazil); Ribeiro, Fabíola A.S.; Santos, Adelina P.; Faria, Luiz O., E-mail: adelina@cdtn.br, E-mail: farialo@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)
2017-07-01
Recently, polymer-based nanocomposites filled with zirconium oxide (ZrO{sub 2}) nanoparticles have been suggested to be used in radiology procedures as X-rays attenuators. On the other hand, multi walled carbon nanotubes (MWCNT) has been reported to have enhanced X-rays attenuation features, when compared to other materials. In this work polymer-based nanocomposites made of a poly(vinylidene fluoride) [PVDF] homopolymer co-filled with MWCNT and zirconia (ZrO{sub 2}) were prepared, in order to investigate them for radiation shielding purposes. The PVDF matrix was added to 1.3% ZrO{sub 2} and the MWCNT in three different proportions: 0.33%, 0.66% and 1% of MWCNT.The arrangement between these materials causes new properties to be introduced to the constituents due to morphological modifications or electronic interactions between them, resulting in a nanocomposite of higher properties. The radiation shielding characterization was performed by using the X-ray beam of a XRD equipment. Photons with energies of 6.5 keV, 17.5 keV and 22.1 keV, corresponding to the anodes of cobalt, molybdenum and silver respectively, were used. The results are discussed in terms of the attenuation percentage of the nanocomposites produced in relation to the energy of the exposed radiation beam and varying the thickness of the samples. A comparison with cataloged aluminum data is also performed. (author)
Li, Junjie; Xie, Jiangang; Liu, Shanshou; Li, Xiao; Zhang, Dongliang; Wang, Xianqi; Jiang, Jinquan; Hu, Wei; Zhang, Yuan; Jin, Boquan; Zhuang, Ran; Yin, Wen
2018-04-25
ADAR1 (adenosine deaminase acting on double-stranded RNA 1) is an RNA-editing enzyme that mediates adenosine-to-inosine RNA editing events, an important post-transcriptional modification mechanism that can alter the coding properties of mRNA or regulate microRNA biogenesis. ADAR1 also regulates the innate immune response. Here, we have demonstrated that ADAR1 expression increased in LPS-stimulated macrophages. Silencing ADAR1 by using small interfering RNA in macrophages resulted in the pronounced polarization of macrophages to M1, whereas ADAR1 overexpression promoted M2 polarization, which indicated that ADAR1 can inhibit macrophage hyperpolarization and prevent immune hyperactivity. The RNA-RNP immunoprecipitation binding assay demonstrated a direct interaction between ADAR1 and miR-21 precursor. Significant up-regulation in IL-10 and down-regulation in miR-21 were observed in ADAR1-overexpressing macrophages. We evaluated miR-21 target mRNAs and macrophage polarization signaling pathways and found that forkhead box protein O1 (Foxo1) was up-regulated in cells that overexpressed ADAR1. In a mouse allogeneic skin transplantation model, grafts in the ADAR1-overexpressed group survived longer and suffered less immune cell infiltration. In ADAR1-overexpressed recipients, splenic macrophages were significantly polarized to M2, and levels of sera IL-10 were markedly higher than those in the control group. In summary, ADAR1 modulates macrophage M2 polarization via the ADAR1-miR-21-Foxo1-IL-10 axis, thereby suppressing allogeneic graft rejection.-Li, J., Xie, J., Liu, S., Li, X., Zhang, D., Wang, X., Jiang, J., Hu, W., Zhang, Y., Jin, B., Zhuang, R., Yin, W. ADAR1 attenuates allogeneic graft rejection by suppressing miR-21 biogenesis in macrophages and promoting M2 polarization.
Liu, Xin Hua; Pan, Li Long; Gong, Qi Hai; Zhu, Yi Zhun
2010-12-01
Apoptosis of cardiomyocytes induced by oxidative stress play a critical role in cardiac dysfunction associated with ventricular remodeling and heart failure. We recently reported that leonurine attenuated hypoxia-induced cardiomyocyte damage. In this study, we investigated the mechanism of leonurine (originally from Herba leonuri but we synthesized it chemically it as also called SCM-198) (H₂O₂)-induced rat embryonic heart-derived H9c2 cells from apoptosis. Exposing H9c2 cells to H₂O₂ significantly decreased cell viability, and this was attenuated by pretreatment with leonurine for 4 h in a concentration-dependent manner. Meanwhile, leonurine was found to reduce intracellular reactive oxygen species (ROS) generation in H₂O₂-stimulated cell. Moreover, H9c2 cells stimulated by H₂O₂ was accompanied with apparent apoptotic characteristics, including fragmentation of DNA, apoptotic body formation, release of cytochrome c, translocation of Bax to mitochondria, loss of mitochondrial membrane potential (ΔΨ(m)) and activation of caspase 3. Furthermore, H₂O₂ also induced rapid and significant phosphorylation of the c-Jun-N-terminal kinase 1/2 (JNK1/2), which was inhibited SP600125 (a JNK1/2 inhibitor). All of these events were attenuated by leonurine pretreatment. Taken together, these results demonstrated that leonurine could protect H9c2 cells from H₂O₂-induced apoptosis via modulation of mitochondrial dysfunction associated with blocking the activation of JNK1/2.
Identifying Silence Climate in Organizations in the Framework of Contemporary Management Approaches
Directory of Open Access Journals (Sweden)
Mustafa Emre Civelek
2015-10-01
Full Text Available Dynamic competition conditions in present day, bring about the consequence for businesses to face varied problems with each passing day. At this point, current management approaches include studies that would shed light on the new problems of businesses. Organizational Silence, a concept that has recently been being voiced in business world, has come up in such context. Organizational silence could be expressed as the employee behavior of keeping silent about certain negativities due to various reasons in an organization. Since knowledge sharing in modern organizations is of capital importance in terms of responding hastily to the changes in a competitive environment, spread of this behavior of employees to organization culture and climate presents a threat of indifference. In this study, the concept of Organizational Silence is defined and the effects of conceived silence climate on management of organizations are discussed.
Identifying Silence Climate in Organizations in the Framework of Contemporary Management Approaches
Directory of Open Access Journals (Sweden)
Mustafa Emre Civelek
2015-12-01
Full Text Available Dynamic competition conditions in present day bring about the consequence for businesses to face varied problems with each passing day. At this point, current management approaches include studies that would shed light on the new problems of businesses. Organizational Silence, a concept that has recently been being voiced in business world, has come up in such context. Organizational silence could be expressed as the employee behavior of keeping silent about certain negativities due to various reasons in an organization. Since knowledge sharing in modern organizations is of capital importance in terms of responding hastily to the changes in a competitive environment, spread of this behavior of employees to organization culture and climate presents a threat of indifference. In this study, the concept of Organizational Silence is defined and the effects of conceived silence climate on management of organizations are discussed.
Ribosomal Stalk Protein Silencing Partially Corrects the ΔF508-CFTR Functional Expression Defect.
Directory of Open Access Journals (Sweden)
Guido Veit
2016-05-01
Full Text Available The most common cystic fibrosis (CF causing mutation, deletion of phenylalanine 508 (ΔF508 or Phe508del, results in functional expression defect of the CF transmembrane conductance regulator (CFTR at the apical plasma membrane (PM of secretory epithelia, which is attributed to the degradation of the misfolded channel at the endoplasmic reticulum (ER. Deletion of phenylalanine 670 (ΔF670 in the yeast oligomycin resistance 1 gene (YOR1, an ABC transporter of Saccharomyces cerevisiae phenocopies the ΔF508-CFTR folding and trafficking defects. Genome-wide phenotypic (phenomic analysis of the Yor1-ΔF670 biogenesis identified several modifier genes of mRNA processing and translation, which conferred oligomycin resistance to yeast. Silencing of orthologues of these candidate genes enhanced the ΔF508-CFTR functional expression at the apical PM in human CF bronchial epithelia. Although knockdown of RPL12, a component of the ribosomal stalk, attenuated the translational elongation rate, it increased the folding efficiency as well as the conformational stability of the ΔF508-CFTR, manifesting in 3-fold augmented PM density and function of the mutant. Combination of RPL12 knockdown with the corrector drug, VX-809 (lumacaftor restored the mutant function to ~50% of the wild-type channel in primary CFTRΔF508/ΔF508 human bronchial epithelia. These results and the observation that silencing of other ribosomal stalk proteins partially rescue the loss-of-function phenotype of ΔF508-CFTR suggest that the ribosomal stalk modulates the folding efficiency of the mutant and is a potential therapeutic target for correction of the ΔF508-CFTR folding defect.
Impaired ALDH2 activity decreases the mitochondrial respiration in H9C2 cardiomyocytes.
Mali, Vishal R; Deshpande, Mandar; Pan, Guodong; Thandavarayan, Rajarajan A; Palaniyandi, Suresh S
2016-02-01
Reactive oxygen species (ROS)-mediated reactive aldehydes induce cellular stress. In cardiovascular diseases such as ischemia-reperfusion injury, lipid-peroxidation derived reactive aldehydes such as 4-hydroxy-2-nonenal (4HNE) are known to contribute to the pathogenesis. 4HNE is involved in ROS formation, abnormal calcium handling and more importantly defective mitochondrial respiration. Aldehyde dehydrogenase (ALDH) superfamily contains NAD(P)(+)-dependent isozymes which can detoxify endogenous and exogenous aldehydes into non-toxic carboxylic acids. Therefore we hypothesize that 4HNE afflicts mitochondrial respiration and leads to cell death by impairing ALDH2 activity in cultured H9C2 cardiomyocyte cell lines. H9C2 cardiomyocytes were treated with 25, 50 and 75 μM 4HNE and its vehicle, ethanol as well as 25, 50 and 75 μM disulfiram (DSF), an inhibitor of ALDH2 and its vehicle (DMSO) for 4 h. 4HNE significantly decreased ALDH2 activity, ALDH2 protein levels, mitochondrial respiration and mitochondrial respiratory reserve capacity, and increased 4HNE adduct formation and cell death in cultured H9C2 cardiomyocytes. ALDH2 inhibition by DSF and ALDH2 siRNA attenuated ALDH2 activity besides reducing ALDH2 levels, mitochondrial respiration and mitochondrial respiratory reserve capacity and increased cell death. Our results indicate that ALDH2 impairment can lead to poor mitochondrial respiration and increased cell death in cultured H9C2 cardiomyocytes. Copyright © 2015 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Bengtsson, Tea Torbenfeldt; Fynbo, Lars
2017-01-01
In this article we analyse the significance of silence in qualitative interviews with 36 individuals interviewed about high-risk, illegal activities. We describe how silence expresses a dynamic power relationship between interviewer and interviewee. In the analysis, we focus on two different types...... significant data. We conclude that silence constitutes possibilities for interviewees and interviewers to handle the complex power at play in qualitative interviewing either by maintaining or by losing control of the situation....
The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing
Directory of Open Access Journals (Sweden)
Adriana F. Fusaro
2017-10-01
Full Text Available The plant viral family Luteoviridae is divided into three genera: Luteovirus, Polerovirus and Enamovirus. Without assistance from another virus, members of the family are confined to the cells of the host plant’s vascular system. The first open reading frame (ORF of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs against the plant’s viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV, however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant’s silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant’s anti-viral defense.
Is our knowledge of voice and silence in organizations growing?
DEFF Research Database (Denmark)
Knoll, Michael; Wegge, Jürgen; Unterrainer, Christine
2016-01-01
This article has three objectives. Firstly, we seek to demonstrate the relevance of voice and silence – that is, whether employees contribute or withhold information, ideas, views and/or concerns at work – for the sustainable development of individuals, organizations and societies. Our second...... objective is to identify emerging (and enduring) issues – conceptual, theoretical and methodological – that have not yet been adequately addressed in voice and silence research. These issues include the relationship between voice and silence, how they may manifest in organizations, their manifold...... antecedents inside and beyond organizational boundaries, their potentially positive and negative effects for internal and external stakeholders, and methodological questions. The third objective is to propose opportunities for addressing these issues with the ultimate aim to build a broader and more...
Plasmodium yoelii: induction of attenuated mutants by irradiation
International Nuclear Information System (INIS)
Waki, S.; Yonome, I.; Suzuki, M.
1986-01-01
When erythrocytic forms of Plasmodium yoelii nigeriensis, which is invariably fatal in mice, were exposed to X rays, the dose to reduce surviving parasites to one millionth was 100 gray (10 Krad). A suspension of 5 X 10(6) per ml of parasitized erythrocyte was irradiated at 100 gray, and 0.2 ml aliquots were inoculated into 22 mice. Eleven mice showed patent parasitemia, and in these the growth curves were less steep than that found in nonirradiated parasites. The infections of 8 mice of the 11 were self-resolving, and the attenuated feature of the parasites maintained following a limited number of blood passages. The parasites were slowly growing even in nude mice and cause self-resolving infections in intact mice. BALB/c mice immunized with the attenuated parasites were protected against subsequent challenge infections with the original virulent erythrocytic and sporogonic forms. These findings indicate that attenuated mutants of malaria parasites can be readily induced by this method
Linares, Javier; Arellano-Viera, Estibaliz; Iglesias-García, Olalla; Ferreira, Carmen; Iglesias, Elena; Abizanda, Gloria; Prósper, Felipe; Carvajal-Vergara, Xonia
2016-05-01
Mef2c Anterior Heart Field (AHF) enhancer is activated during embryonic heart development and it is expressed in multipotent cardiovascular progenitors (CVP) giving rise to endothelial and myocardial components of the outflow tract, right ventricle and ventricular septum. Here we have generated iPSC from transgenic Mef2c-AHF-Cre x Ai6(RCLZsGreen) mice. These iPSC will provide a novel tool to investigate the AHF-CVP and their cell progeny. Copyright © 2016 Roslin Cells Ltd. Published by Elsevier B.V. All rights reserved.
Schnettler, Esther; Hemmes, Hans; Huismann, Rik; Goldbach, Rob; Prins, Marcel; Kormelink, Richard
2010-11-01
The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs proteins analyzed exhibited affinity to small double-stranded RNA molecules, i.e., small interfering RNAs (siRNAs) and micro-RNA (miRNA)/miRNA* duplexes. Interestingly, the NSs proteins from tomato spotted wilt virus (TSWV), impatiens necrotic spot virus (INSV), and groundnut ringspot virus (GRSV) also showed affinity to long double-stranded RNA (dsRNA), whereas tomato yellow ring virus (TYRV) NSs did not. The TSWV NSs protein was shown to be capable of inhibiting Dicer-mediated cleavage of long dsRNA in vitro. In addition, it suppressed the accumulation of green fluorescent protein (GFP)-specific siRNAs during coinfiltration with an inverted-repeat-GFP RNA construct in Nicotiana benthamiana. In vivo interference of TSWV NSs in the miRNA pathway was shown by suppression of an enhanced GFP (eGFP) miRNA sensor construct. The ability to stabilize miRNA/miRNA* by different tospovirus NSs proteins in vivo was demonstrated by increased accumulation and detection of both miRNA171c and miRNA171c* in tospovirus-infected N. benthamiana. All together, these data suggest that tospoviruses interfere in the RNA silencing pathway by sequestering siRNA and miRNA/miRNA* molecules before they are uploaded into their respective RNA-induced silencing complexes. The observed affinity to long dsRNA for only a subset of the tospoviruses studied is discussed in light of evolutional divergence and their ancestral relation to the animal-infecting members of the Bunyaviridae.
Directory of Open Access Journals (Sweden)
Tanurdzic Milos
2004-04-01
Full Text Available Abstract Background Ceratopteris richardii is a useful experimental system for studying gametophyte development and sexual reproduction in plants. However, few tools for cloning mutant genes or disrupting gene function exist for this species. The feasibility of systemic gene silencing as a reverse genetics tool was examined in this study. Results Several DNA constructs targeting a Ceratopteris protoporphyrin IX magnesium chelatase (CrChlI gene that is required for chlorophyll biosynthesis were each introduced into young gametophytes by biolistic delivery. Their transient expression in individual cells resulted in a colorless cell phenotype that affected most cells of the mature gametophyte, including the meristem and gametangia. The colorless phenotype was associated with a 7-fold decrease in the abundance of the endogenous transcript. While a construct designed to promote the transient expression of a CrChlI double stranded, potentially hairpin-forming RNA was found to be the most efficient in systemically silencing the endogenous gene, a plasmid containing the CrChlI cDNA insert alone was sufficient to induce silencing. Bombarded, colorless hermaphroditic gametophytes produced colorless embryos following self-fertilization, demonstrating that the silencing signal could be transmitted through gametogenesis and fertilization. Bombardment of young gametophytes with constructs targeting the Ceratopteris filamentous temperature sensitive (CrFtsZ and uroporphyrin dehydrogenase (CrUrod genes also produced the expected mutant phenotypes. Conclusion A method that induces the systemic silencing of target genes in the Ceratopteris gametophyte is described. It provides a simple, inexpensive and rapid means to test the functions of genes involved in gametophyte development, especially those involved in cellular processes common to all plants.
Directory of Open Access Journals (Sweden)
Sha Lu
Full Text Available In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.
Li, Lili; Hamel, Nancy; Baker, Kristi; McGuffin, Michael J; Couillard, Martin; Gologan, Adrian; Marcus, Victoria A; Chodirker, Bernard; Chudley, Albert; Stefanovici, Camelia; Durandy, Anne; Hegele, Robert A; Feng, Bing-Jian; Goldgar, David E; Zhu, Jun; De Rosa, Marina; Gruber, Stephen B; Wimmer, Katharina; Young, Barbara; Chong, George; Tischkowitz, Marc D; Foulkes, William D
2015-05-01
Inherited mutations in DNA mismatch repair genes predispose to different cancer syndromes depending on whether they are mono-allelic or bi-allelic. This supports a causal relationship between expression level in the germline and phenotype variation. As a model to study this relationship, our study aimed to define the pathogenic characteristics of a recurrent homozygous coding variant in PMS2 displaying an attenuated phenotype identified by clinical genetic testing in seven Inuit families from Northern Quebec. Pathogenic characteristics of the PMS2 mutation NM_000535.5:c.2002A>G were studied using genotype-phenotype correlation, single-molecule expression detection and single genome microsatellite instability analysis. This PMS2 mutation generates a de novo splice site that competes with the authentic site. In homozygotes, expression of the full-length protein is reduced to a level barely detectable by conventional diagnostics. Median age at primary cancer diagnosis is 22 years among 13 NM_000535.5:c.2002A>G homozygotes, versus 8 years in individuals carrying bi-allelic truncating mutations. Residual expression of full-length PMS2 transcript was detected in normal tissues from homozygotes with cancers in their 20s. Our genotype-phenotype study of c.2002A>G illustrates that an extremely low level of PMS2 expression likely delays cancer onset, a feature that could be exploited in cancer preventive intervention. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.