Multidrug resistance in Lactococcus lactis

NARCIS (Netherlands)

Bolhuis, Hendrik

1996-01-01

Multidrug resistance (MDR) was initially recongnized as the major cause of the failure of the drug-based treatment of human cancers. It has become increasingly clear that MDR occurs in mammalian cells but also in lower eukaryotes and bacteria. The appearance of multiple antibiotic resistant

Detection of expression and modulation of multidrug-resistance (MDR) and establishment of a new bioassay

International Nuclear Information System (INIS)

Berger, W.

1993-08-01

The present thesis deals with the resistance of human malignant cells against cellular toxicity of anticancer drugs, a phenomenon representing one of the major obstacles to successful chemotherapy. One mechanism underlying a cross-resistance to different drugs called multidrug resistance (MDR) is characterized by the expression of an active transport protein (P-glycoprotein), causing decreased intracellular drug retention and cytotoxicity. The main subjects of the present work were to establish different detection methods for MDR and its modulation (by substances blocking activity of P-glycoprotein) including immunological methods (immunocytochemistry, radioimmunoassay), molecular biology (slot-blot analysis, in-situ hybridization) and functional assays (drug-accumulation analysis, drug-cytotoxicity analysis). The methods were evaluated and compared using human and mouse MDR control cell lines and human tumor cell lines established in our laboratory. In cell lines derived from human melanoma - a malignancy insensitive to chemotherapy - expression of P-glycoprotein of relatively low transporting activity was detected by different methods in 8 of 33 cases. Furthermore a new sensitive in vitro assay for the functional detection of MDR was established using the biological features of cytochalasins, a microfilament disrupting substance group. These compounds were shown to be substrates for the P-glycoprotein efflux pump and their effects on cell division (blockade of cytokinesis resulting in multinucleate cells) correlated with MDR-activity of the tested cells. With this new assay P-glycoprotein activity can be demonstrated and analysed over a wide range of resistance against different cytotoxic drugs. Therefore it may by a suitable tool for research and diagnosis in the field of drug resistance

The demise of multidrug-resistant HIV-1: the national time trend in Portugal

Science.gov (United States)

Vercauteren, Jurgen; Theys, Kristof; Carvalho, Ana Patricia; Valadas, Emília; Duque, Luis Miguel; Teófilo, Eugénio; Faria, Telo; Faria, Domitília; Vera, José; Águas, Maria João; Peres, Susana; Mansinho, Kamal; Vandamme, Anne-Mieke; Camacho, Ricardo Jorge; Mansinho, Kamal; Cláudia Miranda, Ana; Aldir, Isabel; Ventura, Fernando; Nina, Jaime; Borges, Fernando; Valadas, Emília; Doroana, Manuela; Antunes, Francisco; João Aleixo, Maria; João Águas, Maria; Botas, Júlio; Branco, Teresa; Vera, José; Vaz Pinto, Inês; Poças, José; Sá, Joana; Duque, Luis; Diniz, António; Mineiro, Ana; Gomes, Flora; Santos, Carlos; Faria, Domitília; Fonseca, Paula; Proença, Paula; Tavares, Luís; Guerreiro, Cristina; Narciso, Jorge; Faria, Telo; Teófilo, Eugénio; Pinheiro, Sofia; Germano, Isabel; Caixas, Umbelina; Faria, Nancy; Paula Reis, Ana; Bentes Jesus, Margarida; Amaro, Graça; Roxo, Fausto; Abreu, Ricardo; Neves, Isabel

2013-01-01

Objectives Despite a decreasing mortality and morbidity in treated HIV-1 patients, highly active antiretroviral treatment (HAART) can still fail due to the development of drug resistance. Especially, multidrug-resistant viruses pose a threat to efficient therapy. We studied the changing prevalence of multidrug resistance (MDR) over time in a cohort of HIV-1-infected patients in Portugal. Patients and methods We used data of 8065 HIV-1-infected patients followed from July 2001 up to April 2012 in 22 hospitals located in Portugal. MDR at a specific date of sampling was defined as no more than one fully active drug (excluding integrase and entry inhibitors) at that time authorized by the Portuguese National Authority of Medicines and Health Products (INFARMED), as interpreted with the Rega algorithm version 8.0.2. A generalized linear mixed model was used to study the time trend of the prevalence of MDR. Results We observed a statistically significant decrease in the prevalence of MDR over the last decade, from 6.9% (95% CI: 5.7–8.4) in 2001–03, 6.0% (95% CI: 4.9–7.2) in 2003–05, 3.7% (95% CI: 2.8–4.8) in 2005–07 and 1.6% (95% CI: 1.1–2.2) in 2007–09 down to 0.6% (95% CI: 0.3–0.9) in 2009–12 [OR = 0.80 (95% CI: 0.75–0.86); P < 0.001]. In July 2011 the last new case of MDR was seen. Conclusions The prevalence of multidrug-resistant HIV-1 is decreasing over time in Portugal, reflecting the increasing efficiency of HAART and the availability of new drugs. Therefore, in designing a new drug, safety and practical aspects, e.g. less toxicity and ease of use, may need more attention than focusing mainly on efficacy against resistant strains. PMID:23228933

Management of multidrug-resistant tuberculosis in human immunodeficiency virus patients

Science.gov (United States)

Jamil, K. F.

2018-03-01

Tuberculosis (TB) is a chronic infectious disease mainly caused by Mycobacterium tuberculosis(MTB). 10.4 million new TB cases will appear in 2015 worldwide. There were an estimated 1.4 million TB deaths in 2015, and an additional 0.4 million deaths resulting from TB disease among people living with human immunodeficiency virus (HIV). Multidrug- resistant and extensively drug-resistant tuberculosis (MDR and XDR-TB) are major public health concerns worldwide. 480.000 new cases of MDR-TB will appear in 2015 and an additional 100,000 people with rifampicin-resistant TB (RR-TB) who were also newly eligible for MDR-TB treatment. Their association with HIV infection has contributed to the slowing down of TB incidence decline over the last two decades, therefore representing one important barrier to reach TB elimination. Patients infected with MDR-TB require more expensive treatment regimens than drug-susceptible TB, with poor treatment.Patients with multidrug- resistant tuberculosis do not receive rifampin; drug interactions risk is markedly reduced. However, overlapping toxicities may limit options for co-treatment of HIV and multidrug- resistant tuberculosis.

Multidrug resistance in tumour cells: characterisation of the multidrug resistant cell line K562-Lucena 1

Directory of Open Access Journals (Sweden)

VIVIAN M. RUMJANEK

2001-03-01

Full Text Available Multidrug resistance to chemotherapy is a major obstacle in the treatment of cancer patients. The best characterised mechanism responsible for multidrug resistance involves the expression of the MDR-1 gene product, P-glycoprotein. However, the resistance process is multifactorial. Studies of multidrug resistance mechanisms have relied on the analysis of cancer cell lines that have been selected and present cross-reactivity to a broad range of anticancer agents. This work characterises a multidrug resistant cell line, originally selected for resistance to the Vinca alkaloid vincristine and derived from the human erythroleukaemia cell K562. This cell line, named Lucena 1, overexpresses P-glycoprotein and have its resistance reversed by the chemosensitisers verapamil, trifluoperazine and cyclosporins A, D and G. Furthermore, we demonstrated that methylene blue was capable of partially reversing the resistance in this cell line. On the contrary, the use of 5-fluorouracil increased the resistance of Lucena 1. In addition to chemotherapics, Lucena 1 cells were resistant to ultraviolet A radiation and hydrogen peroxide and failed to mobilise intracellular calcium when thapsigargin was used. Changes in the cytoskeleton of this cell line were also observed.A resistência a múltiplos fármacos é o principal obstáculo no tratamento de pacientes com câncer. O mecanismo responsável pela resistência múltipla mais bem caracterizado envolve a expressão do produto do gene MDR-1, a glicoproteína P. Entretanto, o processo de resistência tem fatores múltiplos. Estudos de mecanismos de resistência m��ltipla a fármacos têm dependido da análise de linhagens celulares tumorais que foram selecionadas e apresentam reatividade cruzada a uma ampla faixa de agentes anti-tumorais. Este trabalho caracteriza uma linhagem celular com múltipla resistência a fármacos, selecionada originalmente pela resistência ao alcalóide de Vinca vincristina e derivado

Study of tea polyphenol as a reversal agent for carcinoma cell lines' multidrug resistance (study of TP as a MDR reversal agent)

International Nuclear Information System (INIS)

Zhu Aizhi; Wang Xiangyun; Guo Zhenquan

2001-01-01

The aim of this study was to examine MDR1 expression product P-glycoprotein (Pgp) and study the effect and mechanism of tea polyphenol (TP) in reversion of multidrug resistance (MDR) in carcinoma cell lines. Immunocytochemical method was used for qualitative detection of Pgp. A comparative study of cytotoxicity and multidrug resistance reversion effect was made by MTT assay for tea polyphenol and quinidine in MCF-7 and MCF-7/Adr cell lines. The multidrug resistance reversion effect and mechanism were studied by measuring the uptake of 99m Tc-tetrofosmin in the carcinoma cell lines. (1) The Pgp overexpression in MCF-7/Adr cells was found to be strong positive, while the Pgp expression of MCF-7 was negative. (2) Although both tea polyphenol and quinidine could not remarkably change the toxicity of adriamycin to MCF-7, they could improve the sensitivity of MCF-7/Adr to adriamycin. The reversion index of tea polyphenol and quinidine was 3 and 10 respectively. (3) The cellular uptake of 99m Tc-tetrofosmin was remarkably lower in MCF-7/Adr than in MCF-7. The uptake of 99m Tc-tetrofosmin in MCF-7/Adr exhibited a 4, 13, 16 fold increase in the presence of 200, 400 and 500 μg/ml of tea polyphenol respectively. The uptake of 99m Tc-tetrofosmin in MCF-7/Adr exhibited only a 4-fold increase in the presence of 200 μM of quinidine. Immunocytochemistry can detect P-glycoprotein expression level qualitatively. Tea polyphenol is not only an anti-tumor agent, but also a multidrug resistant modulator similar to quinidine. The multidrug resistance reversion mechanism of tea polyphenol seems to be its inhibition of the activity of P-glycoprotein. Tea polyphenol has the advantage of very low toxicity in tumor treatment

Multidrug-resistant tuberculosis in Europe, 2010-2011

DEFF Research Database (Denmark)

Günther, Gunar; van Leth, Frank; Alexandru, Sofia

2015-01-01

Drug-resistant Mycobacterium tuberculosis is challenging elimination of tuberculosis (TB). We evaluated risk factors for TB and levels of second-line drug resistance in M. tuberculosis in patients in Europe with multidrug-resistant (MDR) TB. A total of 380 patients with MDR TB and 376 patients...... with non-MDR TB were enrolled at 23 centers in 16 countries in Europe during 2010-2011. A total of 52.4% of MDR TB patients had never been treated for TB, which suggests primary transmission of MDR M. tuberculosis. At initiation of treatment for MDR TB, 59.7% of M. tuberculosis strains tested were...

Functional evidence of multidrug resistance transporters (MDR in rodent olfactory epithelium.

Directory of Open Access Journals (Sweden)

Adrien Molinas

Full Text Available P-glycoprotein (Pgp and multidrug resistance-associated protein (MRP1 are membrane transporter proteins which function as efflux pumps at cell membranes and are considered to exert a protective function against the entry of xenobiotics. While evidence for Pgp and MRP transporter activity is reported for olfactory tissue, their possible interaction and participation in the olfactory response has not been investigated.Functional activity of putative MDR transporters was assessed by means of the fluorometric calcein acetoxymethyl ester (calcein-AM accumulation assay on acute rat and mouse olfactory tissue slices. Calcein-AM uptake was measured as fluorescence intensity changes in the presence of Pgp or MRP specific inhibitors. Epifluorescence microscopy measured time course analysis in the olfactory epithelium revealed significant inhibitor-dependent calcein uptake in the presence of each of the selected inhibitors. Furthermore, intracellular calcein accumulation in olfactory receptor neurons was also significantly increased in the presence of either one of the Pgp or MRP inhibitors. The presence of Pgp or MRP1 encoding genes in the olfactory mucosa of rat and mouse was confirmed by RT-PCR with appropriate pairs of species-specific primers. Both transporters were expressed in both newborn and adult olfactory mucosa of both species. To assess a possible involvement of MDR transporters in the olfactory response, we examined the electrophysiological response to odorants in the presence of the selected MDR inhibitors by recording electroolfactograms (EOG. In both animal species, MRPs inhibitors induced a marked reduction of the EOG magnitude, while Pgp inhibitors had only a minor or no measurable effect.The findings suggest that both Pgp and MRP transporters are functional in the olfactory mucosa and in olfactory receptor neurons. Pgp and MRPs may be cellular constituents of olfactory receptor neurons and represent potential mechanisms for modulation

Psychiatric disorders in patients with multidrug resistant tuberculosis (MDR-TB in Sardjito Hospital, Yogyakarta, Indonesia

Directory of Open Access Journals (Sweden)

Irwan Supriyanto

2017-08-01

Full Text Available Introduction: Tuberculosis has become a chronic debilitating disease in developing countries, particularly after the emergence of multidrug resistant tuberculosis (MDR-TB. Second line treatments for the disease which were subsequently developed were associated with psychiatric disorders among patients. Psychiatric disorder can either be induced by treatment regiments or psychosocial factors. Cycloserine administration is frequently reported to be associated with psychiatric disorders. In this study, we examined the prevalence and characteristics of psychiatric disorders among MDR-TB patients in Sardjito Hospital, Yogyakarta, Indonesia. Methods: In this descriptive study, we studied medical records of MDR-TB patients admitted for MDR-TB treatments to Sardjito Hospital from January 2014 to July 2016 and screened for psychiatric disorders. Results: We found that 32.8% of the patients had psychiatric disorders, some of which had multiple psychiatric diagnoses (14.1%. The diagnoses were medication induced delirium, substance/medication induced psychotic disorder, substance/medication use depressive disorder, depressive type schizoaffective disorder, bipolar I disorder current episode severe manic with psychotic features, mild depression, moderate depression, major depression without psychotic features, major depression with psychotic features, adjustment disorders with mixed anxiety and depressed mood, adjustment disorder with anxiety, acute stress disorder, and insomnia. Psychiatric disorders were significantly associated with cycloserine dose and sex. Psychotic symptoms were significantly associated with sex and level of education. Conclusion: The presence of psychiatric disorders might disturb MDR-TB treatment resulting in poor outcomes. Precaution and prompt managements are required for psychiatric disorders in patients receiving MDR-TB treatment regiments.

Evaluating the Role of Multidrug Resistance Protein 3 (MDR3) Inhibition in Predicting Drug-Induced Liver Injury Using 125 Pharmaceuticals.

Science.gov (United States)

Aleo, Michael D; Shah, Falgun; He, Kan; Bonin, Paul D; Rodrigues, A David

2017-05-15

The role of bile salt export protein (BSEP) inhibition in drug-induced liver injury (DILI) has been investigated widely, while inhibition of the canalicular multidrug resistant protein 3 (MDR3) has received less attention. This transporter plays a pivotal role in secretion of phospholipids into bile and functions coordinately with BSEP to mediate the formation of bile acid-containing biliary micelles. Therefore, inhibition of MDR3 in human hepatocytes was examined across 125 drugs (70 of Most-DILI-concern and 55 of No-DILI-concern). Of these tested, 41% of Most-DILI-concern and 47% of No-DILI-concern drugs had MDR3 IC 50 values of <50 μM. A better distinction across DILI classifications occurred when systemic exposure was considered where safety margins of 50-fold had low sensitivity (0.29), but high specificity (0.96). Analysis of physical chemical property space showed that basic compounds were twice as likely to be MDR3 inhibitors as acids, neutrals, and zwitterions and that inhibitors were more likely to have polar surface area (PSA) values of <100 Å 2 and cPFLogD values between 1.5 and 5. These descriptors, with different cutoffs, also highlighted a group of compounds that shared dual potency as MDR3 and BSEP inhibitors. Nine drugs classified as Most-DILI-concern compounds (four withdrawn, four boxed warning, and one liver injury warning in their approved label) had intrinsic potency features of <20 μM in both assays, thereby reinforcing the notion that multiple inhibitory mechanisms governing bile formation (bile acid and phospholipid efflux) may confer additional risk factors that play into more severe forms of DILI as shown by others for BSEP inhibitors combined with multidrug resistance-associated protein (MRP2, MRP3, MRP4) inhibitory properties. Avoiding physical property descriptors that highlight dual BSEP and MDR3 inhibition or testing drug candidates for inhibition of multiple efflux transporters (e.g., BSEP, MDR3, and MRPs) may be an effective

Higher Desolvation Energy Reduces Molecular Recognition in Multi-Drug Resistant HIV-1 Protease

Directory of Open Access Journals (Sweden)

Ladislau C. Kovari

2012-05-01

Full Text Available Designing HIV-1 protease inhibitors that overcome drug-resistance is still a challenging task. In this study, four clinical isolates of multi-drug resistant HIV-1 proteases that exhibit resistance to all the US FDA-approved HIV-1 protease inhibitors and also reduce the substrate recognition ability were examined. A multi-drug resistant HIV-1 protease isolate, MDR 769, was co-crystallized with the p2/NC substrate and the mutated CA/p2 substrate, CA/p2 P1’F. Both substrates display different levels of molecular recognition by the wild-type and multi-drug resistant HIV-1 protease. From the crystal structures, only limited differences can be identified between the wild-type and multi-drug resistant protease. Therefore, a wild-type HIV-1 protease and four multi-drug resistant HIV-1 proteases in complex with the two peptides were modeled based on the crystal structures and examined during a 10 ns-molecular dynamics simulation. The simulation results reveal that the multi-drug resistant HIV-1 proteases require higher desolvation energy to form complexes with the peptides. This result suggests that the desolvation of the HIV-1 protease active site is an important step of protease-ligand complex formation as well as drug resistance. Therefore, desolvation energy could be considered as a parameter in the evaluation of future HIV-1 protease inhibitor candidates.

Amurensin G, a potent natural SIRT1 inhibitor, rescues doxorubicin responsiveness via down-regulation of multidrug resistance 1

DEFF Research Database (Denmark)

Oh, Won Keun; Cho, Kyoung Bin; Hien, Tran Thi

2010-01-01

The transition from a chemotherapy-responsive cancer to a chemotherapy-resistant one is accompanied by increased expression of multidrug resistance 1 (MDR1, p-glycoprotein), which plays an important role in the efflux from the target cell of many anticancer agents. We recently showed that a Forkh...

Asiatic Acid (AA) Sensitizes Multidrug-Resistant Human Lung Adenocarcinoma A549/DDP Cells to Cisplatin (DDP) via Downregulation of P-Glycoprotein (MDR1) and Its Targets.

Science.gov (United States)

Cheng, Qilai; Liao, Meixiang; Hu, Haibo; Li, Hongliang; Wu, Longhuo

2018-01-01

P-glycoprotein (P-gp, i.e., MDR1) is associated with the phenotype of multidrug resistance (MDR) and causes chemotherapy failure in the management of cancers. Searching for effective MDR modulators and combining them with anticancer drugs is a promising strategy against MDR. Asiatic acid (AA), a natural triterpene isolated from the plant Centella asiatica, may have an antitumor activity. The present study assessed the reversing effect of AA on MDR and possible molecular mechanisms of AA action in MDR1-overexpressing cisplatin (DDP)-resistant lung cancer cells, A549/DDP. Human lung adenocarcinoma A549/DDP cells were either exposed to different concentrations of AA or treated with DDP, and their viability was measured by the MTT assay. A Rhodamine 123 efflux assay, immunofluorescent staining, ATPase assay, reverse-transcription PCR (RT-PCR), and western blot analysis were conducted to elucidate the mechanisms of action of AA on MDR. Our results showed that AA significantly enhanced the cytotoxicity of DDP toward A549/DDP cells but not its parental A549 cells. Furthermore, AA strongly inhibited P-gp expression by blocking MDR1 gene transcription and increased the intracellular accumulation of the P-gp substrate Rhodamine 123 in A549/DDP cells. Nuclear factor (NF)-kB (p65) activity, IkB degradation, and NF-kB/p65 nuclear translocation were markedly inhibited by pretreatment with AA. Additionally, AA inhibited the MAPK-ERK pathway, as indicated by decreased phosphorylation of ERK1 and -2, AKT, p38, and JNK, thus resulting in reduced activity of the Y-box binding protein 1 (YB1) via blockage of its nuclear translocation. AA reversed P-gp-mediated MDR by inhibition of P-gp expression. This effect was likely related to downregulation of YB1, and this effect was mediated by the NF-kB and MAPK-ERK pathways. AA may be useful as an MDR reversal agent for combination therapy in clinical trials. © 2018 The Author(s). Published by S. Karger AG, Basel.

Multidrug-resistant pathogens in the food supply.

Science.gov (United States)

Doyle, Marjorie E

2015-04-01

Antimicrobial resistance, including multidrug resistance (MDR), is an increasing problem globally. MDR bacteria are frequently detected in humans and animals from both more- and less-developed countries and pose a serious concern for human health. Infections caused by MDR microbes may increase morbidity and mortality and require use of expensive drugs and prolonged hospitalization. Humans may be exposed to MDR pathogens through exposure to environments at health-care facilities and farms, livestock and companion animals, human food, and exposure to other individuals carrying MDR microbes. The Centers for Disease Control and Prevention classifies drug-resistant foodborne bacteria, including Campylobacter, Salmonella Typhi, nontyphoidal salmonellae, and Shigella, as serious threats. MDR bacteria have been detected in both meat and fresh produce. Salmonellae carrying genes coding for resistance to multiple antibiotics have caused numerous foodborne MDR outbreaks. While there is some level of resistance to antimicrobials in environmental bacteria, the widespread use of antibiotics in medicine and agriculture has driven the selection of a great variety of microbes with resistance to multiple antimicrobials. MDR bacteria on meat may have originated in veterinary health-care settings or on farms where animals are given antibiotics in feed or to treat infections. Fresh produce may be contaminated by irrigation or wash water containing MDR bacteria. Livestock, fruits, and vegetables may also be contaminated by food handlers, farmers, and animal caretakers who carry MDR bacteria. All potential sources of MDR bacteria should be considered and strategies devised to reduce their presence in foods. Surveillance studies have documented increasing trends in MDR in many pathogens, although there are a few reports of the decline of certain multidrug pathogens. Better coordination of surveillance programs and strategies for controlling use of antimicrobials need to be implemented in

Multidrug-Resistant Tuberculosis

Centers for Disease Control (CDC) Podcasts

In this podcast, Dr. Oeltmann discusses multidrug-resistant tuberculosis. An outbreak occurred in Thailand, which led to 45 cases in the U.S. This serious illness can take up to 2 years to treat. MDR TB is a real threat and a serious condition.

Expression of multidrug resistance genes MVP, MDR1, and MRP1 determined sequentially before, during, and after hyperthermic isolated limb perfusion of soft tissue sarcoma and melanoma patients.

Science.gov (United States)

Stein, Ulrike; Jürchott, Karsten; Schläfke, Matthias; Hohenberger, Peter

2002-08-01

Isolated, hyperthermic limb perfusion (ILP) with recombinant human tumor necrosis factor alpha and melphalan is a highly effective treatment for advanced soft tissue sarcoma (STS) and locoregional metastatic malignant melanoma. Multidrug resistance (MDR)-associated genes are known to be inducible by heat and drugs; expression levels of the major vault protein (MVP), MDR1, and MDR-associated protein 1 (MRP1) were determined sequentially before, during, and after ILP of patients. Twenty-one STS or malignant melanoma patients were treated by ILP. Tumor tissue temperatures were recorded continuously and ranged from 33.4 degrees C initially to peak values of 40.4 degrees C during ILP. Serial true-cut biopsy specimens from tumor tissues were routinely microdissected. Expression analyses for MDR genes were performed by real-time reverse transcriptase polymerase chain reaction and immunohistochemistry. In 83% of the patients, MVP expression was induced during hyperthermic ILP. MVP-mRNA inductions often paralleled the increase in temperature during ILP. Increased MVP protein expressions either were observed simultaneously with the MVP-mRNA induction or were delayed until after the induction at the transcriptional level. Inductions of MDR1 and MRP1 were observed in only 13% and 27% of the specimens analyzed. Temperatures and drugs applied preferentially led to an induction of MVP and were not sufficient to induce MDR1 and MRP1 in the majority of tumors. This study is the first to analyze the expression of MDR-associated genes sequentially during ILP of patients and demonstrates that treatment might lead to increased levels of MVP, whereas enhanced levels of MDR1 and MRP1 remain rare events.

Normal viability and altered pharmacokinetics in mice lacking mdr1-type (drug-transporting) P-glycoproteins

NARCIS (Netherlands)

Schinkel, A. H.; Mayer, U.; Wagenaar, E.; Mol, C. A.; van Deemter, L.; Smit, J. J.; van der Valk, M. A.; Voordouw, A. C.; Spits, H.; van Tellingen, O.; Zijlmans, J. M.; Fibbe, W. E.; Borst, P.

1997-01-01

The mdr1-type P-glycoproteins (P-gps) confer multidrug resistance to cancer cells by active extrusion of a wide range of drugs from the cell. To study their physiological roles, we have generated mice genetically deficient in the mdr1b gene [mdr1b (-/-) mice] and in both the mdr1a and mdr1b genes

Risk factors associated with multidrug resistant tuberculosis among ...

African Journals Online (AJOL)

Background: Multidrug resistant tuberculosis (MDR-TB) remains is an important public health problem in developing world. We conducted this study to determine risk factors associated with MDR-TB and drug susceptibility pattern to second line drug among MDR TB patients in Tanzania. Methods: Unmatched case control ...

Factors influencing [F-18]2-fluoro-2-deoxy-D-glucose (F-18 FDG) accumulation in melanoma cells. Is FDG a substrate of multidrug resistance (MDR)?

International Nuclear Information System (INIS)

Yamada, Kiyoshi; Brink, I.; Engelhardt, R.

2005-01-01

In order to specify the influence of multidrug-resistance (MDR) on the accumulation of the PET tracer, F-18 FDG ([Fluorine-18]2-fluoro-2-deoxy-D-glucose, in melanoma cells, both the MDR function and expression of two human melanoma cell lines SK-MEL 23 and 24, were evaluated. The effects of MDR modulators on FDG accumulation and efflux were also investigated. A functional analysis using representative MDR fluorescent substrates and inhibitors clarified the following characteristics: SK-MEL 23 possesses a highly active function of multidrug resistance-associated protein (MRP), but not P-gp. SK-MEL 24 possesses weak functions of both MRP and P-gp. Western blot analysis using monoclonal antibodies for MDR expression demonstrated an exceedingly high MRP expression of SK-MEL 23 and only slight P-gp and MRP expression of SK-MEL 24, corresponding to the functional data. The efflux inhibition assay using F-18 FDG revealed a considerable retention of FDG in SK-MEL 23 in the presence of the MRP inhibitor probenecid. It was also found that the P-gp inhibitor verapamil depressed the FDG efflux of SK-MEL 24. Our present in vitro study suggests that FDG may be a substrate of MDR in some melanoma cells and further MDR may be one of the important factors affecting FDG-PET melanoma imaging. (author)

Antibacterial Activity Test of Nudibranches Polka - Dot (Jorunna funebris (Gastropods : Molusc Extract Against Multi(Aktivitas Antibakteri Ekstrak Nudibranch Polka-Dot (Jorunna funebris (Gastropoda : Moluska Terhadap Bakteri Multidrug Resistant (MDR

Directory of Open Access Journals (Sweden)

Delianis Pringgenies

2015-12-01

Full Text Available Terjadinya resistensi antibiotik menjadi permasalahan dalam dunia kesehatan. Peningkatan kemampuan patogen dalam menahan efek obat menyebabkan timbulnya resistensi. Beberapa bakteri patogen pada manusia dilaporkan telah mengalami resistensi terhadap lebih dari satu kelas antibiotik. Untuk mengatasi permasalahan tersebut, maka perlu dilakukan pencarian senyawa antibiotik baru yang lebih efektif dalam mengatasi permasalahan bakteri Multi-drug Resistant (MDR. Metabolit sekunder yang diproduksi oleh invertebrata laut  mempunyai prospek sebagai bahan obat dari laut. Nudibranch diduga mampu menghasilkan metabolit sekunder sebagai mekanisme pertahanan diri. Tujuan dari penelitian ini adalah untuk mengetahui fraksi dari ekstrak nudibranch Jorunna funebris yang menunjukkan bioaktivitas terhadap bakteri Multi-drug Resistant (MDR. Proses ekstraksi dilakukan dengan metode maserasi. Fraksinasi dengan Kromatografi Kolom Terbuka (KKT. Uji aktivitas antibakteri menggunakan metode difusi agar. Analisis komponen senyawa dengan GC-MS. Hasil penelitian menunjukkan bahwa 8 fraksi ekstrak nudibranch J. funebris menunjukkan aktivitas antibakteri. Hasil uji aktivitas menunjukkan fraksi I paling aktif terhadap 5 bakteri uji yaitu Klebsiella, Pseudomonas, Escherichia coli, Enterobacter 5 dan Enterobacter 10 dengan rata-rata zona hambatan secara berurutan sebesar 12,78 mm; 12,51 mm; 15,47 mm; 14,09 mm dan 12,46 mm. Fraksi II paling aktif terhadap bakteri Coagulase Negative Staphylococcus dengan rata-rata zona hambatan sebesar 12,70 mm. Analisis GC-MS menunjukkan bahwa dalam fraksi II terdapat senyawa 1-oktadekanol yang berpotensi sebagai antibakteri. Kata kunci : nudibranch, Jorunna funebris, antibakteri, multi-drug resistant, 1-oktadekanol Emergence of antibiotic resistance become a problems on medical world. Increasing pathogen ability to hold the antibiotic effect caused resistance. Several human-patogen bacteria were resistance to one or more classes of antibiotics

Non-p-glycoprotein-mediated multidrug resistance in detransformed rat cells selected for resistance to methylglyoxal bis(guanylhydrazone).

Science.gov (United States)

Weber, J M; Sircar, S; Horvath, J; Dion, P

1989-11-01

Three independent variants (G2, G4, G5), resistant to methylglyoxal bis(guanylhydrazone), an anticancer drug, have been isolated by single step selection from an adenovirus-transformed rat brain cell line (1). These variants display selective cross-resistance to several natural product drugs of dissimilar structure and action. Multidrug resistance has recently been shown to be caused by overexpression of the membrane-associated p-glycoprotein, most often caused by amplification of the mdr gene. Several types of experiments were conducted to determine whether the observed drug resistance in our cell lines could be due to changes at the mdr locus. The following results were obtained: (a) the mdr locus was not amplified; (b) transcription of the mdr gene and p-glycoprotein synthesis were not increased; (c) multidrug resistance cell lines, which carry an amplified mdr locus, were not cross-resistant to methylglyoxal bis(guanylhydrazone); (d) verapamil did not reverse the resistance of G cells or mdr cells to methylglyoxal bis(guanylhydrazone), nor that of G cells to vincristine; and (e) methylglyoxal bis(guanylhydrazone) resistance was recessive and depended on a block to drug uptake, as opposed to mdr cells which are dominant and express increased drug efflux. The results obtained suggest that the drug resistance in the G2, G4, and G5 cells was atypical and may be due to a mechanism distinct from that mediated by the mdr locus.

Localization and activity of multidrug resistance protein 1 in the secretory pathway of Leishmania parasites.

Science.gov (United States)

Dodge, Matthew A; Waller, Ross F; Chow, Larry M C; Zaman, Muhammad M; Cotton, Leanne M; McConville, Malcolm J; Wirth, Dyann F

2004-03-01

Upregulation of the multidrug resistance protein 1 (LeMDR1) in the protozoan parasite, Leishmania enriettii, confers resistance to hydrophobic drugs such as vinblastine, but increases the sensitivity of these parasites to the mitochondrial drug, rhodamine 123. In order to investigate the mechanism of action of LeMDR1, the subcellular localization of green fluorescent protein (GFP)-tagged versions of LeMDR1 and the fate of the traceable-fluorescent LeMDR1 substrate calcein AM were examined in both Leishmania mexicana and L. enriettii LeMDR1 -/- and overexpressing cell lines. The LeMDR1-GFP chimera was localized by fluorescence microscopy to a number of secretory and endocytic compartments, including the Golgi apparatus, endoplasmic reticulum (ER) and a multivesicular tubule (MVT)-lysosome. Pulse-chase labelling experiments with calcein AM suggested that the Golgi and ER pools, but not the MVT-lysosome pool, of LeMDR1 were active in pumping calcein AM out of the cell. Cells labelled with calcein AM under conditions that slow vesicular transport (low temperature and stationary growth) inhibited export and resulted in the accumulation of fluorescent calcein in both the Golgi and the mitochondria. We propose that LeMDR1 substrates are pumped into secretory compartments and exported from the parasite by exocytosis. Accumulation of MDR substrates in the ER can result in alternative transport to the mitochondrion, explaining the reciprocal sensitivity of drug-resistant Leishmania to vinblastine and rhodamine 123.

Molecular approaches for detection of the multi-drug resistant tuberculosis (MDR-TB in Bangladesh.

Directory of Open Access Journals (Sweden)

Tafsina Haque Aurin

Full Text Available The principal obstacles in the treatment of tuberculosis (TB are delayed and inaccurate diagnosis which often leads to the onset of the drug resistant TB cases. To avail the appropriate treatment of the patients and to hinder the transmission of drug-resistant TB, accurate and rapid detection of resistant isolates is critical. Present study was designed to demonstrate the efficacy of molecular techniques inclusive of line probe assay (LPA and GeneXpert MTB/RIF methods for the detection of multi-drug resistant (MDR TB. Sputum samples from 300 different categories of treated and new TB cases were tested for the detection of possible mutation in the resistance specific genes (rpoB, inhA and katG through Genotype MTBDRplus assay or LPA and GeneXpert MTB/RIF tests. Culture based conventional drug susceptibility test (DST was also carried out to measure the efficacy of the molecular methods employed. Among 300 samples, 191 (63.7% and 193 (64.3% cases were found to be resistant against rifampicin in LPA and GeneXpert methods, respectively; while 189 (63% cases of rifampicin resistance were detected by conventional DST methods. On the other hand, 196 (65.3% and 191 (63.7% isolates showed isoniazid resistance as detected by LPA and conventional drug susceptibility test (DST, respectively. Among the drug resistant isolates (collectively 198 in LPA and 193 in conventional DST, 189 (95.6% and 187 (96.9% were considered to be MDR as examined by LPA and conventional DST, respectively. Category-II and -IV patients encountered higher frequency of drug resistance compared to those from category-I and new cases. Considering the higher sensitivity, specificity and accuracy along with the required time to results significantly shorter, our study supports the adoption of LPA and GeneXpert assay as efficient tools in detecting drug resistant TB in Bangladesh.

Association between HIV/AIDS and multi-drug resistance tuberculosis: a systematic review and meta-analysis.

Directory of Open Access Journals (Sweden)

Yonatan Moges Mesfin

Full Text Available BACKGROUND: Human immunodeficiency virus (HIV, multi-drug resistant tuberculosis (MDR is emerging as major challenge facing tuberculosis control programs worldwide particularly in Asia and Africa. Findings from different studies on associations of HIV co-infection and drug resistance among patients with TB have been contradictory (discordant. Some institution based studies found strongly increased risks for multi-drug resistant TB (MDR TB among patients co-infected with TB and HIV, whereas other studies found no increased risk (it remains less clear in community based studies. The aim was to conduct a systematic review and meta-analysis of the association between multi-drug resistant tuberculosis and HIV infection. METHODS AND FINDINGS: Systematic review of the published literature of observational studies was conducted. Original studies were identified using databases of Medline/Pubmed, Google Scholar and HINARI. The descriptions of original studies were made using frequency and forest plot. Publication bias was assessed using Funnel plot graphically and Egger weighted and Begg rank regression tests statistically. Heterogeneity across studies was checked using Cochrane Q test statistic and I(2. Pool risk estimates of MDR-TB and sub-grouping analysis were computed to analyze associations with HIV. Random effects of the meta-analysis of all 24 observational studies showed that HIV is associated with a marginal increased risk of multi-drug resistant tuberculosis (estimated Pooled OR 1.24; 95%, 1.04-1.43. Subgroup analyses showed that effect estimates were higher (Pooled OR 2.28; 95%, 1.52-3.04 for primary multi-drug resistance tuberculosis and moderate association between HIV/AIDS and MDR-TB among population based studies and no significant association in institution settings. CONCLUSIONS: This study demonstrated that there is association between MDR-TB and HIV. Capacity for diagnosis of MDR-TB and initiating and scale up of antiretroviral

Decreasing prevalence of multi-drugs resistant Mycobacterium tuberculosis in Nashik City, India

Directory of Open Access Journals (Sweden)

Arun P. More

2013-03-01

Full Text Available Objective: In India, increasing prevalence of multi-drug resistant tuberculosis (MDR has aggravated the control oftuberculosis problem. In many urban and semi-urban regions of India, no surveillance data of multidrug resistance inMycobacterium tuberculosisis available.Methods: A surveillance study on multidrug resistance was carried out in semi-urban and rural regions in and aroundNashik City of Maharashtra, India. The surveillance study was conducted in this region found that the prevalence ofcombined resistance to first and second-line anti-tuberculosis drugs is remarkably high. The isolates of M. tuberculosiswas identified and subjected to drug susceptibility testing. The patterns of drug susceptibility of isolates of M. tuberculosisduring the periods 2000 and 2004 were compared with drug susceptibility patterns of the organisms during theperiod 2008 to 2011.Results: The 260 isolates identified as M. tuberculosis show mean drug resistance prevalence of 45.6% for more than anytwo drugs and the MDR rate as 37% in the years 2000 to 2004 whereas 305 isolates of the organism show mean drugresistance prevalence of 30.2% and the MDR rate as 25% in the years 2008 to 2011.Conclusion: The researcher found that, though the prevalence of multidrug resistance to the drugs tested is remarkablyhigh, it has come down noticeably during the past seven years due to efforts of State Government and strict implementationof treatment guidelines of WHO by the physicians. J Microbiol Infect Dis 2013; 3(1: 12-17Key words: MDR-TB, XDR-TB, DOTS, drug-resistance prevalence rate.

Inhibition of bacterial multidrug resistance by celecoxib, a cyclooxygenase-2 inhibitor.

Science.gov (United States)

Kalle, Arunasree M; Rizvi, Arshad

2011-01-01

Multidrug resistance (MDR) is a major problem in the treatment of infectious diseases and cancer. Accumulating evidence suggests that the cyclooxygenase-2 (COX-2)-specific inhibitor celecoxib would not only inhibit COX-2 but also help in the reversal of drug resistance in cancers by inhibiting the MDR1 efflux pump. Here, we demonstrate that celecoxib increases the sensitivity of bacteria to the antibiotics ampicillin, kanamycin, chloramphenicol, and ciprofloxacin by accumulating the drugs inside the cell, thus reversing MDR in bacteria.

Polymorphisms in the xenobiotic transporter Multidrug Resistance 1 (MDR1 and interaction with meat intake in relation to risk of colorectal cancer in a Danish prospective case-cohort study

Directory of Open Access Journals (Sweden)

Overvad Kim

2009-11-01

Full Text Available Abstract Background The xenobiotic transporters, Multidrug Resistance 1 (MDR1/ABCB1 and Breast Cancer Resistance Protein (BCRP/ABCG2 may restrict intestinal absorption of various carcinogens, including heterocyclic amines (HCA and polycyclic aromatic hydrocarbons (PAH. Cyclooxygenase-2 (COX-2 derived prostaglandins promote gastrointestinal carcinogenesis, affecting angiogenesis, apoptosis, and invasiveness. The aim of this study was to investigate if polymorphisms in these genes were associated with risk of colorectal cancer (CRC, and to investigate possible interactions with lifestyle factors such as smoking, meat consumption, and NSAID use. Methods The following polymorphisms were analyzed; a synonymous MDR1 C3435T (rs1045642 in exon26, G-rs3789243-A in intron3, the functional BCRP C421A (rs2231142, the two COX-2 A-1195G (rs689466 and G-765C (rs20417 in the promoter region, and the COX-2 T8473C (rs5275 polymorphisms in the 3'-untranslated region. The polymorphisms were assessed together with lifestyle factors in a nested case-cohort study of 359 cases and a random cohort sample of 765 participants from the Danish prospective Diet, Cancer and Health study. Results Carriers of the variant allele of MDR1 intron 3 polymorphism were at 1.52-fold higher risk of CRC than homozygous wild type allele carriers (Incidence rate ratio (IRR = 1.52, 95% Confidence Interval (CI: 1.12-2.06. Carriers of the variant allele of MDR1 C3435T exon 26 had a lower risk of CRC than homozygous C-allele carriers (IRR = 0.71 (CI:0.50-1.00. There was interaction between these MDR1 polymorphisms and intake of red and processed meat in relation to CRC risk. Homozygous MDR1 C3435T C-allele carriers were at 8% increased risk pr 25 gram meat per day (CI: 1.00-1.16 whereas variant allele carriers were not at increased risk (p for interaction = 0.02. COX-2 and BCRP polymorphisms were not associated with CRC risk. There was interaction between NSAID use and MDR1 C3435T and COX-2 T

Polymorphisms in the xenobiotic transporter Multidrug Resistance 1 (MDR1) and interaction with meat intake in relation to risk of colorectal cancer in a Danish prospective case-cohort study

International Nuclear Information System (INIS)

Andersen, Vibeke; Østergaard, Mette; Christensen, Jane; Overvad, Kim; Tjønneland, Anne; Vogel, Ulla

2009-01-01

The xenobiotic transporters, Multidrug Resistance 1 (MDR1/ABCB1) and Breast Cancer Resistance Protein (BCRP/ABCG2) may restrict intestinal absorption of various carcinogens, including heterocyclic amines (HCA) and polycyclic aromatic hydrocarbons (PAH). Cyclooxygenase-2 (COX-2) derived prostaglandins promote gastrointestinal carcinogenesis, affecting angiogenesis, apoptosis, and invasiveness. The aim of this study was to investigate if polymorphisms in these genes were associated with risk of colorectal cancer (CRC), and to investigate possible interactions with lifestyle factors such as smoking, meat consumption, and NSAID use. The following polymorphisms were analyzed; a synonymous MDR1 C3435T (rs1045642) in exon26, G-rs3789243-A in intron3, the functional BCRP C421A (rs2231142), the two COX-2 A-1195G (rs689466) and G-765C (rs20417) in the promoter region, and the COX-2 T8473C (rs5275) polymorphisms in the 3'-untranslated region. The polymorphisms were assessed together with lifestyle factors in a nested case-cohort study of 359 cases and a random cohort sample of 765 participants from the Danish prospective Diet, Cancer and Health study. Carriers of the variant allele of MDR1 intron 3 polymorphism were at 1.52-fold higher risk of CRC than homozygous wild type allele carriers (Incidence rate ratio (IRR) = 1.52, 95% Confidence Interval (CI): 1.12-2.06). Carriers of the variant allele of MDR1 C3435T exon 26 had a lower risk of CRC than homozygous C-allele carriers (IRR = 0.71 (CI:0.50-1.00)). There was interaction between these MDR1 polymorphisms and intake of red and processed meat in relation to CRC risk. Homozygous MDR1 C3435T C-allele carriers were at 8% increased risk pr 25 gram meat per day (CI: 1.00-1.16) whereas variant allele carriers were not at increased risk (p for interaction = 0.02). COX-2 and BCRP polymorphisms were not associated with CRC risk. There was interaction between NSAID use and MDR1 C3435T and COX-2 T8473C (p-values for interaction 0

The multidrug resistance 1 (MDR1) gene polymorphism G-rs3789243-A is not associated with disease susceptibility in Norwegian patients with colorectal adenoma and colorectal cancer; a case control study

DEFF Research Database (Denmark)

Andersen, V.; Agerstjerne, L.; Jensen, D.

2009-01-01

Background: Smoking, dietary factors, and alcohol consumption are known life style factors contributing to gastrointestinal carcinogenesis. Genetic variations in carcinogen handling may affect cancer risk. The multidrug resistance 1(MDR1/ABCB1) gene encodes the transport protein P-glycoprotein (a...... in inflammation, and may thereby affect the risk of malignity. Hence, genetic variations that modify the function of P-glycoprotein may be associated with the risk of colorectal cancer (CRC). We have previously found an association between the MDR1 intron 3 G-rs3789243-A polymorphism and the risk of CRC...... of colorectal carcinomas and adenomas in the Norwegian population was assessed in 167 carcinomas, 990 adenomas, and 400 controls. Genotypes were determined by allelic discrimination. Odds ratio (OR) and 95 confidence interval (95% CI) were estimated by binary logistic regression. Results: No association...

Inhibitory effect of the reversal agents V-104, GF120918 and Pluronic L61 on MDR1 Pgp-, MRP1- and MRP2-mediated transport

NARCIS (Netherlands)

Evers, R.; Kool, M.; Smith, A. J.; van Deemter, L.; de Haas, M.; Borst, P.

2000-01-01

The human multidrug transporter MDR1 P-glycoprotein and the multidrug resistance proteins MRP1 and MRP2 transport a range of cytotoxic drugs, resulting in multidrug resistance in tumour cells. To overcome this form of drug resistance in patients, several inhibitors (reversal agents) of these

Polymorphisms in the xenobiotic transporter Multidrug Resistance 1 (MDR1) and interaction with meat intake in relation to risk of colorectal cancer in a Danish prospective case-cohort study

DEFF Research Database (Denmark)

Andersen, Vibeke; Østergaard, Mette; Christensen, Jane

2009-01-01

(rs5275) polymorphisms in the 3'-untranslated region. The polymorphisms were assessed together with lifestyle factors in a nested case-cohort study of 359 cases and a random cohort sample of 765 participants from the Danish prospective Diet, Cancer and Health study. Results Carriers of the variant......Background The xenobiotic transporters, Multidrug Resistance 1 (MDR1/ABCB1) and Breast Cancer Resistance Protein (BCRP/ABCG2) may restrict intestinal absorption of various carcinogens, including heterocyclic amines (HCA) and polycyclic aromatic hydrocarbons (PAH). Cyclooxygenase-2 (COX-2) derived...... prostaglandins promote gastrointestinal carcinogenesis, affecting angiogenesis, apoptosis, and invasiveness. The aim of this study was to investigate if polymorphisms in these genes were associated with risk of colorectal cancer (CRC), and to investigate possible interactions with lifestyle factors...

Multidrug-Resistant Tuberculosis

Centers for Disease Control (CDC) Podcasts

2008-10-28

In this podcast, Dr. Oeltmann discusses multidrug-resistant tuberculosis. An outbreak occurred in Thailand, which led to 45 cases in the U.S. This serious illness can take up to 2 years to treat. MDR TB is a real threat and a serious condition.  Created: 10/28/2008 by Emerging Infectious Diseases.   Date Released: 10/28/2008.

A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

Science.gov (United States)

Wang, W.; Takezawa, D.; Poovaiah, B. W.

1996-01-01

A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

20(S)-Protopanaxadiol (PPD) analogues chemosensitize multidrug-resistant cancer cells to clinical anticancer drugs.

Science.gov (United States)

Liu, Junhua; Wang, Xu; Liu, Peng; Deng, Rongxin; Lei, Min; Chen, Wantao; Hu, Lihong

2013-07-15

Novel 20(S)-protopanoxadiol (PPD) analogues were designed, synthesized, and evaluated for the chemosensitizing activity against a multidrug resistant (MDR) cell line (KBvcr) overexpressing P-glycoprotein (P-gp). Structure-activity relationship analysis showed that aromatic substituted aliphatic amine at the 24-positions (groups V) effectively and significantly sensitized P-gp overexpressing multidrug resistant (MDR) cells to anticancer drugs, such as docetaxel (DOC), vincristine (VCR), and adriamycin (ADM). PPD derivatives 12 and 18 showed 1.3-2.6 times more effective reversal ability than verapamil (VER) for DOC and VCR. Importantly, no cytotoxicity was observed by the active PPD analogues (5μM) against both non-MDR and MDR cells, suggesting that PPD analogues serve as novel lead compounds toward a potent and safe resistance modulator. Moreover, a preliminary mechanism study demonstrated that the chemosensitizing activity of PPD analogues results from inhibition of P-glycoprotein (P-gp) overexpressed in MDR cancer cells. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

Pharmacological modification of multi-drug resistance (MDR) in vitro detected by a novel fluorometric microculture cytotoxicity assay. Reversal of resistance and selective cytotoxic actions of cyclosporin A and verapamil on MDR leukemia T-cells.

Science.gov (United States)

Larsson, R; Nygren, P

1990-07-15

A novel fluorometric microculture cytotoxicity assay (FMCA), based on measurements of fluorescein diacetate (FDA) hydrolysis and DNA staining by Hoechst 33342, was used for drug sensitivity testing and detection of resistance reversal in acute lymphoblastic leukemia (ALL) cell lines. The 72-hr assay was found to be sensitive, reproducible and linearly related to the number of viable cells within a broad range of cell concentrations. At clinically achievable drug concentrations, the calcium channel blocker Verapamil (ver) and the immunosuppressant Cyclosporin A (csA) were found to partly reverse acquired Vincristine (vcr) resistance in multi-drug resistant (MDR) T-ALL L100 cells with little or no effect on the drug-sensitive parental L0 cell line. By combining the fluorometric indices, we found that low concentrations of csA were growth-inhibitory, whereas higher concentrations (greater than 10 micrograms/ml) were progressively cytotoxic for drug-sensitive L0 cells. In MDR L100 cells, on the other hand, csA produced significant cell kill even at low drug concentrations. Ver had no effects on sensitive L0 cells but showed considerable cytotoxic action towards MDR L100 cells. There was no apparent relationship between drug reversal of vcr resistance and the cytotoxic actions of the drug per se since the calcium channel blocker diltiazem (dil) significantly potentiated the actions of vcr on MDR L100 cells without being more toxic to these cells (compared to vcr-sensitive L0 cells).

Association of ACE and MDR1 Gene Polymorphisms with Steroid Resistance in Children with Idiopathic Nephrotic Syndrome.

Science.gov (United States)

Dhandapani, Mohanapriya Chinambedu; Venkatesan, Vettriselvi; Rengaswamy, Nammalwar Bollam; Gowrishankar, Kalpana; Nageswaran, Prahlad; Perumal, Venkatachalam

2015-08-01

The purpose of the study was to investigate the distribution of insertion/deletion (I/D) polymorphisms of the angiotensin-converting enzyme (ACE) gene and three exonic polymorphisms of the multidrug resistance 1 (MDR1) gene (C3435T, C1236T, and G2677T) in children diagnosed with idiopathic nephrotic syndrome (INS). The study group consisted of 100 healthy controls and 150 INS patients, of which 50 were steroid resistant. Genomic DNA from blood samples was isolated from both of these groups and genotyping of the ACE and MDR1 genes was performed by polymerase chain reaction (PCR) using specific primers. There was no significant difference observed in the genotypic distribution and D allele frequency of the ACE gene. The two single-nucleotide polymorphisms (SNPs), C1236T and C3435T, of the MDR1 gene showed no significance, whereas the SNP G2677T/A was significantly associated with the genotypes GT and GA of the MDR1 gene, indicating it may be a potential marker to detect drug resistance. Screening these polymorphisms will pave the way to better understand the molecular mechanisms of the disease, which may be useful in developing targeted therapies for INS patients.

Development of PET and SPECT radiopharmaceuticals to study multi-drug resistance (MDR)

International Nuclear Information System (INIS)

Katsififs, A.; Dikic, B.; Greguric, I.; Knott, R.; Mattner, F.

2002-01-01

Full text: Cellular resistance or Multidrug Resistance (MDR) to cytotoxic agents is the major cause of treatment failure in many human cancers. P-glycoprotein (Pgp), a Mr 17,0000 transmembrane protein and Multi Resistance Protein (MRP) are two proteins that are over expressed and confer resistance to a large number of chemotherapeutic agents by enhancing their extracellular transport. P-glycoprotein is expressed at a relative high level in treated and untreated human malignant tumours, including renal, colonic, adrenal, hepatocellular carcinoma and a considerable percentage of breast carcinomas. 99m Tc-Sestamibi, a lipophilic cationic complex is a transport substrate for Pgp. In clinical studies of human neoplasms it was found that tumour uptake and clearance of this tracer correlate with Pgp expression and may be used for the phenotypic assessment of MDR. However, new tracers with better substrate specificity for Pgp and other drug transporters would greatly assist in optimising chemotherapeutic treatment and improving patient management by predicting tumour response to therapy and to assist in the development of antagonists, which may reverse or halt MDR. The aim of this project is therefore to develop PET and SPECT radiopharmaceuticals with improved affinity and selectivity for Pgp and MRP for the clinical evaluation of MDR in cancer patients. To optimise cellular transport characteristics, a number of chemical families that have been found to be substrates of Pgp and other drug efflux pumps, will be investigated. In the first instance, a series of drugs based on the flavonol natural product, Quercetin will be developed, screened for MDR and radiolabelled with PET and SPECT isotopes. Quercetin and related flavonol derivatives have been selected for this project because of their moderate to good affinity for Pgp. With the assistance of molecular modeling and in vitro studies, structural modification will be undertaken to improve the specificity and affinity for

Multidrug resistance among new tuberculosis cases: detecting local variation through lot quality-assurance sampling.

Science.gov (United States)

Hedt, Bethany Lynn; van Leth, Frank; Zignol, Matteo; Cobelens, Frank; van Gemert, Wayne; Nhung, Nguyen Viet; Lyepshina, Svitlana; Egwaga, Saidi; Cohen, Ted

2012-03-01

Current methodology for multidrug-resistant tuberculosis (MDR TB) surveys endorsed by the World Health Organization provides estimates of MDR TB prevalence among new cases at the national level. On the aggregate, local variation in the burden of MDR TB may be masked. This paper investigates the utility of applying lot quality-assurance sampling to identify geographic heterogeneity in the proportion of new cases with multidrug resistance. We simulated the performance of lot quality-assurance sampling by applying these classification-based approaches to data collected in the most recent TB drug-resistance surveys in Ukraine, Vietnam, and Tanzania. We explored 3 classification systems- two-way static, three-way static, and three-way truncated sequential sampling-at 2 sets of thresholds: low MDR TB = 2%, high MDR TB = 10%, and low MDR TB = 5%, high MDR TB = 20%. The lot quality-assurance sampling systems identified local variability in the prevalence of multidrug resistance in both high-resistance (Ukraine) and low-resistance settings (Vietnam). In Tanzania, prevalence was uniformly low, and the lot quality-assurance sampling approach did not reveal variability. The three-way classification systems provide additional information, but sample sizes may not be obtainable in some settings. New rapid drug-sensitivity testing methods may allow truncated sequential sampling designs and early stopping within static designs, producing even greater efficiency gains. Lot quality-assurance sampling study designs may offer an efficient approach for collecting critical information on local variability in the burden of multidrug-resistant TB. Before this methodology is adopted, programs must determine appropriate classification thresholds, the most useful classification system, and appropriate weighting if unbiased national estimates are also desired.

Reversal of multidrug resistance by surfactants.

Science.gov (United States)

Woodcock, D. M.; Linsenmeyer, M. E.; Chojnowski, G.; Kriegler, A. B.; Nink, V.; Webster, L. K.; Sawyer, W. H.

1992-01-01

Cremophor EL, a pharmacologically inactive solubilising agent, has been shown to reverse multidrug resistance (MDR). Using flow cytometric evaluation of equilibrium intracellular levels of daunorubicin (DNR), we found that eight other surface active agents will also reverse MDR. All the active detergents contain polyethoxylated moieties but have no similarities in their hydrophobic components. The properties of three polyethoxylated surfactants that showed the lowest toxicities, Cremophor, Tween 80 and Solutol HS15, were examined in more detail. The concentrations of Tween 80 and Solutol required to reverse DNR exclusion were 10-fold lower than for Cremophor. However while concentrations greater than or equal to 1:10(2) of the former two surfactants resulted in breakdown of cells, even 1:10 of Cremophor did not lyse cells. Studies of the effects of Cremophor on the uptake and efflux of DNR in normal and MDR cell types showed that Cremophor increases intracellular DNR primarily by locking the rapid efflux from the cells. This blockage of drug efflux may be mediated by a substantial alteration in the fluidity of cell membranes induced by Cremophor, as shown by decreased fluorescence anisotropy of a membrane probe. Consistent with these data, coinjection of adriamycin plus Cremophor into mice carrying a multidrug resistant P388 transplantable tumour significantly increased the survival time of the mice compared with adriamycin treatment alone. PMID:1637678

In vivo detection of multidrug-resistant (MDR1) phenotype by technetium-99m sestamibi scan in untreated breast cancer patients

International Nuclear Information System (INIS)

Del Vecchio, S.; Ciarmiello, A.; Potena, M.I.; Carriero, M.V.; Mainolfi, C.; Botti, G.; Thomas, R.; Cerra, M.; D'Aiuto, G.; Tsuruo, T.; Salvatore, M.

1997-01-01

Technetium-99m sestamibi is a transport substrate recognised by the multidrug-resistant P-glycoprotein (Pgp). To test whether 99m Tc-sestamibi efflux is enhanced in breast carcinomas overexpressing Pgp, we determined the efflux rates of 99m Tc-sestamibi and Pgp levels in tumours from 30 patients with untreated breast carcinoma. Patients were intravenously injected with 740 MBq of 99m Tc-sestamibi and underwent a 15-min dynamic study followed by the acquisition of static planar images at 0.5, 1, 2 and 4 h. Tumour specimens were obtained from each patient 24 h after 99m Tc-sestamibi scan and Pgp levels were determined using 125 I-MRK16 monoclonal antibody and in vitro quantitative autoradiography. All breast carcinomas showed high uptake of 99m Tc-sestamibi and data from region of interest analysis on sequential images were fitted with a monoexponential function. The efflux rates of 99m Tc-sestamibi, calculated from decay-corrected time-activity curves, ranged between 0.00121 and 0.01690 min -1 and were directly correlated with Pgp levels measured in the same tumours (r=0.62; P 99m Tc-sestamibi efflux from tumours of group A was 2.7 times higher than that observed in tumours of group B (0.00686 ±0.00390 min -1 vs 0.00250 ±0.00090 min -1 , P 99m Tc-sestamibi showed a sensitivity and a specificity of 80% and 95%, respectively. In conclusion, the efflux rate of 99m Tc-sestamibi may be used for the in vivo identification of the multidrug resistant (MDR1) phenotype in untreated breast cancer patients. (orig.). With 7 figs., 3 tabs

Increased multi-drug resistant Escherichia coli from hospitals in ...

African Journals Online (AJOL)

Background: Multidrug-resistant Escherichia coli (MDR E. coli) has become a major public health concern in Sudan and many countries, causing failure in treatment with consequent huge health burden. Objectives: To determine the prevalence and susceptibility of MDR E. coli isolated from patients in hospitals at Khartoum ...

Expression of multi-drug resistance-related genes MDR3 and MRP as prognostic factors in clinical liver cancer patients.

Science.gov (United States)

Yu, Zheng; Peng, Sun; Hong-Ming, Pan; Kai-Feng, Wang

2012-01-01

To investigate the expression of multi-drug resistance-related genes, MDR3 and MRP, in clinical specimens of primary liver cancer and their potential as prognostic factors in liver cancer patients. A total of 26 patients with primary liver cancer were enrolled. The expression of MDR3 and MRP genes was measured by real-time PCR and the association between gene expression and the prognosis of patients was analyzed by the Kaplan-Meier method and COX regression model. This study showed that increases in MDR3 gene expression were identified in cholangiocellular carcinoma, cirrhosis and HBsAg-positive patients, while MRP expression increased in hepatocellular carcinoma, non-cirrhosis and HBsAg-negative patients. Moreover, conjugated bilirubin and total bile acid in the serum were significantly reduced in patients with high MRP expression compared to patients with low expression. The overall survival tended to be longer in patients with high MDR3 and MRP expression compared to the control group. MRP might be an independent prognostic factor in patients with liver cancer by COX regression analysis. MDR3 and MRP may play important roles in liver cancer patients as prognostic factors and their underlying mechanisms in liver cancer are worthy of further investigation.

Role of Risk Factors in the Incidence of Multidrug-Resistant Tuberculosis

Directory of Open Access Journals (Sweden)

Alya Putri Khairani

2017-09-01

Full Text Available Objective: To determine the risk factors that played roles in the incidence of multidrug-resistant tuberculosis (MDR-TB in such patients. Multidrug-Resistant Tuberculosis is a form of tuberculosis caused by Mycobacterium tuberculosis that is resistant to at least isoniazid and rifampicin. Methods: This was a case control study to compare MDR-TB to non-MDR-TB pulmonary tuberculosis outpatients in Dr. Hasan Sadikin General Hospital, Bandung on August–September 2014. Fifty MDR-TB outpatients were included as the cases and 50 non-MDR-TB outpatients as controls. Data was collected by questionnaires and patient’s registration forms. Bivariate and multivariate analyses were performed using chi-square test and multiple logistic regression test, with p<0.05 considered significant. Results: From bivariate analysis, number of previous tuberculosis treatments, regularity of previous treatment, and burden of cost were significant risk factors for developing MDR-TB (p<0.05; while from multivariate analysis, number of previous TB treatments was the only risk factor that played a significant role in the incidence of MDR-TB (OR 24.128 95% CI 6.771-85,976. Conclusions: Patients and medication factors are risk factors that play roles in the incidence of MDR-TB. The significant risk factor is the number of previous TB treatment.

Small-molecule synthetic compound norcantharidin reverses multi-drug resistance by regulating Sonic hedgehog signaling in human breast cancer cells.

Directory of Open Access Journals (Sweden)

Yu-Jen Chen

Full Text Available Multi-drug resistance (MDR, an unfavorable factor compromising treatment efficacy of anticancer drugs, involves upregulated ATP binding cassette (ABC transporters and activated Sonic hedgehog (Shh signaling. By preparing human breast cancer MCF-7 cells resistant to doxorubicin (DOX, we examined the effect and mechanism of norcantharidin (NCTD, a small-molecule synthetic compound, on reversing multidrug resistance. The DOX-prepared MCF-7R cells also possessed resistance to vinorelbine, characteristic of MDR. At suboptimal concentration, NCTD significantly inhibited the viability of DOX-sensitive (MCF-7S and DOX-resistant (MCF-7R cells and reversed the resistance to DOX and vinorelbine. NCTD increased the intracellular accumulation of DOX in MCF-7R cells and suppressed the upregulated the mdr-1 mRNA, P-gp and BCRP protein expression, but not the MRP-1. The role of P-gp was strengthened by partial reversal of the DOX and vinorelbine resistance by cyclosporine A. NCTD treatment suppressed the upregulation of Shh expression and nuclear translocation of Gli-1, a hallmark of Shh signaling activation in the resistant clone. Furthermore, the Shh ligand upregulated the expression of P-gp and attenuated the growth inhibitory effect of NCTD. The knockdown of mdr-1 mRNA had not altered the expression of Shh and Smoothened in both MCF-7S and MCF-7R cells. This indicates that the role of Shh signaling in MDR might be upstream to mdr-1/P-gp, and similar effect was shown in breast cancer MDA-MB-231 and BT-474 cells. This study demonstrated that NCTD may overcome multidrug resistance through inhibiting Shh signaling and expression of its downstream mdr-1/P-gp expression in human breast cancer cells.

Multidrug-resistant tuberculosis, Somalia, 2010-2011.

Science.gov (United States)

Sindani, Ireneaus; Fitzpatrick, Christopher; Falzon, Dennis; Suleiman, Bashir; Arube, Peter; Adam, Ismail; Baghdadi, Samiha; Bassili, Amal; Zignol, Matteo

2013-03-01

In a nationwide survey in 2011, multidrug-resistant tuberculosis (MDR TB) was found in 5.2% and 40.8% of patients with new and previously treated TB, respectively. These levels of drug resistance are among the highest ever documented in Africa and the Middle East. This finding presents a serious challenge for TB control in Somalia.

Different phenotypic and molecular mechanisms associated with multidrug resistance in Gram-negative clinical isolates from Egypt

Directory of Open Access Journals (Sweden)

Helmy OM

2017-12-01

, accompanied by blaTEM-1, blaCTX-M-15, blaCTX-M-14, aac(6’-Ib-cr, qnrS, and multidrug efflux-mediated resistance.Conclusion: MDR phenotypes are predominant among third-generation cephalosporin-resistant Gram-negative bacteria in Egypt and mediated by different mechanisms, with an increased role of efflux pumps in Enterobacteriaceae. Keywords: multidrug resistance, efflux pump, Egypt, Gram-negative bacilli, RAPD typing

Optimizing the Safety of Multidrug-resistant Tuberculosis Therapy in Namibia

NARCIS (Netherlands)

Sagwa, Evans

2017-01-01

Introduction: Multidrug-resistant tuberculosis (MDR-TB), a growing global menace, is seriously undermining the previous successes made in the elimination of TB. MDR-TB treatment takes a long time, is complex, and is frequently associated with the occurrence of adverse drug reactions, some of which

The process behind the expression of mdr-1/P-gp and mrp/MRP in human leukemia/lymphoma.

Science.gov (United States)

Hirose, Masao

2009-04-01

There is a controversy over the link between phenotypes of multidrug resistance (MDR) and clinical outcome in leukemia/lymphoma patients. This may be because the process behind the induction and loss of expression of genotypes and phenotypes by which MDR develops and the role of MDR in fresh cells of human leukemia/lymphoma are not clearly defined. P-glycoprotein (P-gp) increased and decreased along with mdr-1 expression in three cell lines out of five vincristine (VCR)-resistant cell lines. MRP appeared with increased mrp expression in the other two cell lines. After the drug was removed from the culture system, mdr-1/P-gp changed in parallel with the level of VCR resistance, although mrp and MRP did not. It was concluded that P-gp is directly derived from mdr-1 and that mdr-1/P-gp supports the VCR-resistance but mrp/MRP is not directly linked to the VCR-resistance. These results should contribute to a better understanding of MDR phenomenon in cancer.

The Salmonella genomic island 1 is specifically mobilized in trans by the IncA/C multidrug resistance plasmid family.

Science.gov (United States)

Douard, Gregory; Praud, Karine; Cloeckaert, Axel; Doublet, Benoît

2010-12-20

The Salmonella genomic island 1 (SGI1) is a Salmonella enterica-derived integrative mobilizable element (IME) containing various complex multiple resistance integrons identified in several S. enterica serovars and in Proteus mirabilis. Previous studies have shown that SGI1 transfers horizontally by in trans mobilization in the presence of the IncA/C conjugative helper plasmid pR55. Here, we report the ability of different prevalent multidrug resistance (MDR) plasmids including extended-spectrum β-lactamase (ESBL) gene-carrying plasmids to mobilize the multidrug resistance genomic island SGI1. Through conjugation experiments, none of the 24 conjugative plasmids tested of the IncFI, FII, HI2, I1, L/M, N, P incompatibility groups were able to mobilize SGI1 at a detectable level (transfer frequency IncA/C incompatibility group. Several conjugative IncA/C MDR plasmids as well as the sequenced IncA/C reference plasmid pRA1 of 143,963 bp were shown to mobilize in trans SGI1 from a S. enterica donor to the Escherichia coli recipient strain. Depending on the IncA/C plasmid used, the conjugative transfer of SGI1 occurred at frequencies ranging from 10(-3) to 10(-6) transconjugants per donor. Of particular concern, some large IncA/C MDR plasmids carrying the extended-spectrum cephalosporinase bla(CMY-2) gene were shown to mobilize in trans SGI1. The ability of the IncA/C MDR plasmid family to mobilize SGI1 could contribute to its spread by horizontal transfer among enteric pathogens. Moreover, the increasing prevalence of IncA/C plasmids in MDR S. enterica isolates worldwide has potential implications for the epidemic success of the antibiotic resistance genomic island SGI1 and its close derivatives.

Potential antimicrobial agents for the treatment of multidrug-resistant tuberculosis

NARCIS (Netherlands)

Alsaad, Noor; Wilffert, Bob; van Altena, Richard; de Lange, Wiel C. M.; van der Werf, Tjip S.; Kosterink, Jos G. W.; Alffenaar, Jan-Willem C.

2014-01-01

Treatment of multidrug-resistant (MDR) tuberculosis (TB) is challenging because of the high toxicity of second-line drugs and the longer treatment duration than for drug-susceptible TB patients. In order to speed up novel treatment for MDR-TB, we suggest considering expanding the indications of

Sensitization of multidrug-resistant human cancer cells to Hsp90 inhibitors by down-regulation of SIRT1

Science.gov (United States)

Kim, Hak-Bong; Lee, Su-Hoon; Um, Jee-Hyun; Oh, Won Keun; Kim, Dong-Wan; Kang, Chi-Dug; Kim, Sun-Hee

2015-01-01

The effectiveness of Hsp90 inhibitors as anticancer agents was limited in multidrug-resistant (MDR) human cancer cells due to induction of heat shock proteins (Hsps) such as Hsp70/Hsp27 and P-glycoprotein (P-gp)-mediated efflux. In the present study, we showed that resistance to Hsp90 inhibitors of MDR human cancer cells could be overcome with SIRT1 inhibition. SIRT1 knock-down or SIRT1 inhibitors (amurensin G and EX527) effectively suppressed the resistance to Hsp90 inhibitors (17-AAG and AUY922) in several MDR variants of human lymphoblastic leukemia and human breast cancer cell lines. SIRT1 inhibition down-regulated the expression of heat shock factor 1 (HSF1) and subsequently Hsps and facilitated Hsp90 multichaperone complex disruption via hyperacetylation of Hsp90/Hsp70. These findings were followed by acceleration of ubiquitin ligase CHIP-mediated mutant p53 (mut p53) degradation and subsequent down-regulation of P-gp in 17-AAG-treated MDR cancer cells expressing P-gp and mut p53 after inhibition of SIRT1. Therefore, combined treatment with Hsp90 inhibitor and SIRT1 inhibitor could be a more effective therapeutic approach for Hsp90 inhibitor-resistant MDR cells via down-regulation of HSF1/Hsps, mut p53 and P-gp. PMID:26416354

MDR1 siRNA loaded hyaluronic acid-based CD44 targeted nanoparticle systems circumvent paclitaxel resistance in ovarian cancer

Science.gov (United States)

Yang, Xiaoqian; Lyer, Arun K.; Singh, Amit; Choy, Edwin; Hornicek, Francis J.; Amiji, Mansoor M.; Duan, Zhenfeng

2015-02-01

Development of multidrug resistance (MDR) is an almost universal phenomenon in patients with ovarian cancer, and this severely limits the ultimate success of chemotherapy in the clinic. Overexpression of the MDR1 gene and corresponding P-glycoprotein (Pgp) is one of the best known MDR mechanisms. MDR1 siRNA based strategies were proposed to circumvent MDR, however, systemic, safe, and effective targeted delivery is still a major challenge. Cluster of differentiation 44 (CD44) targeted hyaluronic acid (HA) based nanoparticle has been shown to successfully deliver chemotherapy agents or siRNAs into tumor cells. The goal of this study is to evaluate the ability of HA-PEI/HA-PEG to deliver MDR1 siRNA and the efficacy of the combination of HA-PEI/HA-PEG/MDR1 siRNA with paclitaxel to suppress growth of ovarian cancer. We observed that HA-PEI/HA-PEG nanoparticles can efficiently deliver MDR1 siRNA into MDR ovarian cancer cells, resulting in down-regulation of MDR1 and Pgp expression. Administration of HA-PEI/HA-PEG/MDR1 siRNA nanoparticles followed by paclitaxel treatment induced a significant inhibitory effect on the tumor growth, decreased Pgp expression and increased apoptosis in MDR ovarian cancer mice model. Our findings suggest that CD44 targeted HA-PEI/HA-PEG/MDR1 siRNA nanoparticles can serve as a therapeutic tool with great potentials to circumvent MDR in ovarian cancer.

Molecular characterization of multidrug-resistant Klebsiella pneumoniae isolates

Directory of Open Access Journals (Sweden)

Xiang-hua Hou

2015-09-01

Full Text Available Klebsiella pneumoniae is an important cause of healthcare-associated infections worldwide. Selective pressure, the extensive use of antibiotics, and the conjugational transmission of antibiotic resistance genes across bacterial species and genera facilitate the emergence of multidrug-resistant (MDR K. pneumoniae. Here, we examined the occurrence, phenotypes and genetic features of MDR K. pneumoniae isolated from patients in intensive care units (ICUs at the First Affiliated Hospital of Xiamen University in Xiamen, China, from January to December 2011. Thirty-eight MDR K. pneumoniae strains were collected. These MDR K. pneumoniae isolates possessed at least seven antibiotic resistance determinants, which contribute to the high-level resistance of these bacteria to aminoglycosides, macrolides, quinolones and β-lactams. Among these isolates, 24 strains were extended-spectrum β-lactamase (ESBL producers, 2 strains were AmpC producers, and 12 strains were both ESBL and AmpC producers. The 38 MDR isolates also contained class I (28/38 and class II integrons (10/38. All 28 class I-positive isolates contained aacC1, aacC4, orfX, orfX’ and aadA1 genes. β-lactam resistance was conferred through blaSHV (22/38, blaTEM (10/38, and blaCTX-M (7/38. The highly conserved blaKPC-2 (37/38 and blaOXA-23(1/38 alleles were responsible for carbapenem resistance, and a gyrAsite mutation (27/38 and the plasmid-mediated qnrB gene (13/38 were responsible for quinolone resistance. Repetitive-sequence-based PCR (REP-PCR fingerprinting of these MDR strains revealed the presence of five groups and sixteen patterns. The MDR strains from unrelated groups showed different drug resistance patterns; however, some homologous strains also showed different drug resistance profiles. Therefore, REP-PCR-based analyses can provide information to evaluate the epidemic status of nosocomial infection caused by MDR K. pneumoniae; however, this test lacks the power to discriminate some

Study of multidrug resistance and radioresistance

International Nuclear Information System (INIS)

Kang, Yoon Koo; Yoo, Young Do

1999-04-01

We investigated the mechanism of 5-FU, adriamycin, radiation resistance in Korean gastric cancer cells. First we investigated the relation between Rb and multidrug resistance. Rb stable transfectants exhibited 5- to 10- fold more resistance to adriamycin than the control cells. These Rb transfectants showed increased MDR1 expression. We also investigated up-regulation in radiation-resistant tumor tissues. HSP27, MRP-8, GST, and NKEF-B were up-regulated in radiation resistant tumor. Expression of NKEF-B was also increased by radiation exposure in Head and Neck cells. These results demonstrated that NKEF-B is a stress response protein and it may have an important role in radiation resistance

Multidrug-resistant tuberculosis and migration to Europe

DEFF Research Database (Denmark)

Hargreaves, S.; Lönnroth, K.; Nellums, L. B.

2017-01-01

Multidrug-resistant tuberculosis (MDR-TB) in low-incidence countries in Europe is more prevalent among migrants than the native population. The impact of the recent increase in migration to EU and EEA countries with a low incidence of TB (

Molecular Characterization of Multidrug Resistant Uropathogenic E. Coli Isolates from Jordanian Patients.

Science.gov (United States)

Nairoukh, Yacoub R; Mahafzah, Azmi M; Irshaid, Amal; Shehabi, Asem A

2018-01-01

Emergence of multi-drug resistant uropathogenic E. coli strains is an increasing problem to empirical treatment of urinary tract infections in many countries. This study investigated the magnitude of this problem in Jordan. A total of 262 E. coli isolates were recovered from urine samples of Jordanian patients which were suspected to have urinary tract infections (UTIs). All isolates were primarily identified by routine biochemical tests and tested for antimicrobial susceptibility by disc diffusion method. Fifty representative Multidrug Resistance (MDR) E. coli isolates to 3 or more antibiotic classes were tested for the presence of resistance genes of blaCTX-M- 1, 9 and 15, carbapenemase ( blaIMP, blaVIM, blaNDM-1, blaOXA-48 ), fluoroquinolones mutated genes ( parC and gyrA ) and clone of ST131 type using PCR methods. A total of 150/262 (57.3%) of E. coli isolates were MDR. Urine samples of hospitalized patients showed significantly more MDR isolates than outpatients. Fifty representative MDR E. coli isolates indicated the following molecular characteristics: All were positive for mutated parC gene and gyrA and for ST131 clone, and 78% were positive for genes of CTX-M-15 , 76% for CTX-M-I and for 8% CTX-M-9 , respectively. Additionally, all 50 MDR E. coli isolates were negative for carbapenemase genes ( blaIMP, blaVIM, blaNDM-1, blaOXA-48 ), except of one isolate was positive for blaKPC-2 . This study indicates alarming high rates recovery of MDR uropathogenic E. coli from Jordanian patients associated with high rates of positive ST131 clone, fluoroquinolone resistant and important types of blaCTX-M.

Multidrug-resistant opportunistic pathogens challenging veterinary infection control.

Science.gov (United States)

Walther, Birgit; Tedin, Karsten; Lübke-Becker, Antina

2017-02-01

Although the problems associated with healthcare-associated infections (HAI) and the emergence of zoonotic and multidrug-resistant pathogens in companion animal (dogs, cats and horses) medicine have been well-known for decades, current progress with respect to practical implementation of infection control programs in veterinary clinics has been limited. Clinical outbreak events reported for methicillin-resistant Staphylooccus aureus (MRSA) and Staphylococcus pseudintermedius (MRSP), extended spectrum beta-lactamase (ESBL)-producing Escherichia coli and multidrug-resistant (MDR) Salmonella Serovars indicate the necessity of infection control strategies for protecting animal patients at risk as well as veterinary personnel. The close bond between humans and their companion animals provides opportunities for exchange of microorganisms, including MDR pathogens. This particular aspect of the "One Health" idea requires more representative surveillance efforts and infection control strategies with respect to animal-species specific characters. Copyright © 2016 Elsevier B.V. All rights reserved.

Decreasing prevalence of multi-drugs resistant Mycobacterium tuberculosis in Nashik City, India

OpenAIRE

More, Arun Punaji; Nagdawane, Ramkrishna Panchamrao; Gangurde, Aniket K

2013-01-01

Objective: In India, increasing prevalence of multi-drug resistant tuberculosis (MDR) has aggravated the control oftuberculosis problem. In many urban and semi-urban regions of India, no surveillance data of multidrug resistance inMycobacterium tuberculosisis available.Methods: A surveillance study on multidrug resistance was carried out in semi-urban and rural regions in and aroundNashik City of Maharashtra, India. The surveillance study was conducted in this region found that the prevalence...

Resistance to fluoroquinolones and second-line injectable drugs: impact on multidrug-resistant TB outcomes

NARCIS (Netherlands)

Falzon, Dennis; Gandhi, Neel; Migliori, Giovanni B.; Sotgiu, Giovanni; Cox, Helen S.; Holtz, Timothy H.; Hollm-Delgado, Maria-Graciela; Keshavjee, Salmaan; Deriemer, Kathryn; Centis, Rosella; D'Ambrosio, Lia; Lange, Christoph G.; Bauer, Melissa; Menzies, Dick; Ahuja, S. D.; Ashkin, D.; Avendaño, M.; Banerjee, R.; Bauer, M.; Becerra, M. C.; Benedetti, A.; Burgos, M.; Centis, R.; Chan, E. D.; Chiang, C. Y.; Cobelens, F.; Cox, H.; D'Ambrosio, L.; de Lange, W. C. M.; DeRiemer, K.; Enarson, D.; Falzon, D.; Flanagan, K. L.; Flood, J.; Gandhi, N.; Garcia-Garcia, M. L.; Granich, R. M.; Hollm-Delgado, M. G.; Holtz, T. H.; Hopewell, P.; Iseman, M. D.; Jarlsberg, L. G.; Keshavjee, S.; Kim, H. R.; Koh, W. J.; Lancaster, J. L.; Lange, C.; Leimane, V.; Leung, C. C.; Li, J.

2013-01-01

A meta-analysis for response to treatment was undertaken using individual data of multidrug-resistant tuberculosis (MDR-TB) (resistance to isoniazid and rifampicin) patients from 26 centres. The analysis assessed the impact of additional resistance to fluoroquinolones and/or second-line injectable

Multidrug-Resistant Tuberculosis, Somalia, 2010–2011

Science.gov (United States)

Sindani, Ireneaus; Fitzpatrick, Christopher; Falzon, Dennis; Suleiman, Bashir; Arube, Peter; Adam, Ismail; Baghdadi, Samiha; Bassili, Amal

2013-01-01

In a nationwide survey in 2011, multidrug-resistant tuberculosis (MDR TB) was found in 5.2% and 40.8% of patients with new and previously treated TB, respectively. These levels of drug resistance are among the highest ever documented in Africa and the Middle East. This finding presents a serious challenge for TB control in Somalia. PMID:23621911

Detection of multidrug resistance using molecular nuclear technique

International Nuclear Information System (INIS)

Lee, Jae Tae; Ahn, Byeong Cheol

2004-01-01

Although the outcome of cancer patients after cytotoxic chemotherapy is related diverse mechanisms, multidrug resistance (MDR) for chemotherapeutic drugs due to cellular P-glycoprotein (Pgp) or multidrug-resistance associated protein (MRP) is most important factor in the chemotherapy failure to cancer. A large number of pharmacologic compounds, including verapamil, quinidine, tamoxifen, cyclosporin A and quinolone derivatives have been reported to overcome MDR. Single photon emission computed tomography (SPECT) and positron emission tomography (PET) are available for the detection of Pgp and MRP-mediated transporter. 99 m-Tc-MIBI and other 99 m-Tc-radiopharmaceuticals are substrates for Pgp and MRP, and have been used in clinical studies for tumor imaging, and to visualize blockade of Pgp-mediated transport after modulation of Pgp pump. Colchicine, verapamil and daunorubicin labeled with 11 C have been evaluated for the quantification of Pgp-mediated transport with PET in vivo and reported to be feasible substrates with which to image Pgp function in tumors. Leukotrienes are specific substrates for MRP and N-( 11 C)acetyl-leukotriene E4 provides an opportunity to study MRP function non-invasively in vivo. SPECT and PET pharmaceuticals have successfully used to evaluate pharmacologic effects of MDR modulators. Imaging of MDR and reversal of MDR with bioluminescence in a living animal is also evaluated for future clinical trial. We have described recent advances in molecular imaging of MDR and reviewed recent publications regarding feasibility of SPECT and PET imaging to study the functionality of MDR transporters in vivo

Several Virulence Factors of Multidrug-Resistant Staphylococcus aureus Isolates From Hospitalized Patients in Tehran

Directory of Open Access Journals (Sweden)

Abdolmajid Ghasemian

2015-05-01

Full Text Available Background: Biofilm formation plays an important role in resistance of Staphylococcus aureus isolates; especially multidrug-resistant isolates are a threat to healthcare settings. Objectives: The aims of this study were to detect biofilm formation and presence of several related genes among multidrug-resistant (MDR isolates of Staphylococcus aureus. Patients and Methods: A total Of 209 S. aureus strains were isolated from patients and identified by conventional diagnostic tests. The multidrug-resistant MRSA isolates were detected by antibiotic susceptibility test. The phenotypic biofilm formation was detected by micro-titre tissue plate assay. The polymerase chain reaction (PCR was performed to detect the mecA, Staphylococcal Cassette Chromosome mec (SCCmec types, accessory gene regulatory (agr genes, the icaADBC and several genes encoding staphylococcal surface proteins including clfAB, fnbAB, fib, eno, can, ebps and bbp genes with specific primers. Results: Sixty-four (30.6% isolates were methicillin-resistant, among which thirty-six (56.2% were MDR. These isolates were resistant to amoxicillin, tetracycline, ciprofloxacin, gentamicin, erythromycin and trimethoprim-sulfamethoxazole (except to 6 isolates. All the isolates were susceptible to vancomycin and linezolid. All the MDR-MRSA harbored SCCmec type III. All the MDR- MRSA isolates were strong biofilm producers in the phenotypic test. The majority of MDR- MRSA was belonged to agrI (67%, n = 24, followed by agr II (17%, n = 6, agrIV (11%, n = 4 and agrIII (5.5%, n = 2. The frequency of icaADBC genes were 75% (n = 27, 61% (n = 22, 72% (n = 26 and 72% (n = 26, respectively. Furthermore, the prevalence of clfA, clfB, fnbA, fnbB, fib, can, eno, ebps and bbp genes was 100%, 100%, 67%, 56%, 80%, 63%, 78%, 7% and 0%, respectively. Furthermore, approximately all the MRSA was strong biofilm producers. Conclusions: Multidrug-resistant isolates produced biofilm strongly and the majority harbored most

Risk factors for multidrug resistant tuberculosis patients in Amhara ...

African Journals Online (AJOL)

Risk factors for multidrug resistant tuberculosis patients in Amhara National ... risk factors of MDR-TB patients in Amhara National Regional State, Ethiopia. ... strict adherence to directly observed therapy, appropriate management of TB ...

Genetic modification of haematopoietic cells for combined resistance to podophyllotoxins, other agents covered by MDR1-mediated efflux activity and nitrosoureas.

Science.gov (United States)

Baum, C; Peinert, S; Carpinteiro, A; Eckert, H G; Fairbairn, L J

2000-05-01

Genetic transfer and expression of drug-resistance functions into haematopoietic stem and progenitor cells is a promising means to overcome both the acute and longterm side-effects of cytotoxic drugs in bone marrow. Here, we describe a functional analysis of a retroviral vector that co-expresses human cDNAs for multidrug resistance 1/P-glycoprotein (MDR1) and a double mutant of O(6)-alkylguanine-alkyltransferase (hATPA/GA) to high levels. The hATPA/GA protein contains two amino acid substitutions that render it resistant to compounds such as O(6)-benzylguanine that inhibit the wild-type protein which is often overexpressed in resistant tumour cells. Evidence for simultaneous drug resistance of genetically modified primary murine progenitor cells to colchicine or the podophyllotoxin etoposide, both covered by MDR1-mediated efflux activity, and the nitrosourea BCNU, which is counteracted by hATPA/GA, is presented using in vitro colony assays.

Multidrug Resistance Among New Tuberculosis Cases Detecting Local Variation Through Lot Quality-assurance Sampling

NARCIS (Netherlands)

Hedt, Bethany Lynn; van Leth, Frank; Zignol, Matteo; Cobelens, Frank; van Gemert, Wayne; Nhung, Nguyen Viet; Lyepshina, Svitlana; Egwaga, Saidi; Cohen, Ted

2012-01-01

Background: Current methodology for multidrug-resistant tuberculosis (MDR TB) surveys endorsed by the World Health Organization provides estimates of MDR TB prevalence among new cases at the national level. On the aggregate, local variation in the burden of MDR TB may be masked. This paper

ANTIBACTERIAL ACTIVITY OF DRACONTOMELON DAO EXTRACTS ON METHICILLIN-RESISTANT S. AUREUS (MRSA) AND E. COLI MULTIPLE DRUG RESISTANCE (MDR).

Science.gov (United States)

Yuniati, Yuniati; Hasanah, Nurul; Ismail, Sjarif; Anitasari, Silvia; Paramita, Swandari

2018-01-01

Staphylococcus aureus , methicillin-resistant and Escherichia coli , multidrug-resistant included in the list of antibiotic-resistant priority pathogens from WHO. As multidrug-resistant bacteria problem is increasing, it is necessary to probe new sources for identifying antimicrobial compounds. Medicinal plants represent a rich source of antimicrobial agents. One of the potential plants for further examined as antibacterial is Dracontomelon dao (Blanco) Merr. & Rolfe. The present study designed to find the antibacterial activity of D. dao stem bark extracts on Methicillin-resistant S. aureus (MRSA) and E. coli Multiple Drug Resistance (MDR), followed by determined secondary metabolites with antibacterial activity and determined the value of MIC (minimum inhibitory concentration) and MBC (minimum bactericidal concentration). D. dao stem bark extracted using 60% ethanol. Disc diffusion test methods used to find the antibacterial activity, following by microdilution methods to find the value of MIC and MBC. Secondary metabolites with antibacterial activity determined by bioautography using TLC (thin layer chromatography) methods. D. dao stem bark extracts are sensitive to MSSA, MRSA and E.coli MDR bacteria. The inhibition zone is 16.0 mm in MSSA, 11.7 mm in MRSA and 10.7 mm in E. coli MDR. The entire MBC/MIC ratios for MSSA, MRSA and E.coli MDR is lower than 4. The ratio showed bactericidal effects of D. dao stem bark extracts. In TLC results, colorless bands found to be secondary metabolites with antibacterial activity. D. dao stem bark extracts are potential to develop as antibacterial agent especially against MRSA and E. coli MDR strain.

Individualizing Risk of Multidrug-Resistant Pathogens in Community-Onset Pneumonia

OpenAIRE

Falcone, Marco; Russo, Alessandro; Giannella, Maddalena; Cangemi, Roberto; Scarpellini, Maria Gabriella; Bertazzoni, Giuliano; Alarc?n, Jos? Mart?nez; Taliani, Gloria; Palange, Paolo; Farcomeni, Alessio; Vestri, Annarita; Bouza, Emilio; Violi, Francesco; Venditti, Mario

2015-01-01

Introduction The diffusion of multidrug-resistant (MDR) bacteria has created the need to identify risk factors for acquiring resistant pathogens in patients living in the community. Objective To analyze clinical features of patients with community-onset pneumonia due to MDR pathogens, to evaluate performance of existing scoring tools and to develop a bedside risk score for an early identification of these patients in the Emergency Department. Patients and Methods This was an open, observation...

Risk factors associated with multidrug-resistant tuberculosis (MDR-TB) in a tertiary armed force referral and teaching hospital, Ethiopia.

Science.gov (United States)

Demile, Biresaw; Zenebu, Amare; Shewaye, Haile; Xia, Siqing; Guadie, Awoke

2018-05-31

Ethiopia is one of the world health organization defined higher tuberculosis (TB) burden countries where the disease remains a massive public health threat. This study aimed to identify the prevalence and associated factors of multidrug-resistant tuberculosis (MDR-TB) using all armed force and civilian TB attendants in a tertiary level armed force hospital, where data for MDR-TB are previously unpublished. Cross-sectional study was conducted from September 2014 to August 2015 in a tertiary level Armed Force Referral and Teaching Hospital (AFRTH), Ethiopia. Armed force members (n = 251) and civilians (n = 130) which has been undergone TB diagnosis at AFRTH were included. All the specimens collected were subjected to microscopic smear observation, culture growth and drug susceptibility testing. Data were analyzed using statistical package for social sciences following binary logistic regression and Chi-square. P-values < 0.05 were considered statistically significant. Among 381 TB patients, 355 (93.2%) new and 26 (6.8%) retreatment cases were identified. Culture and smear positive TB cases were identified in 297 (77.9%) and 252 (66.1%) patients, respectively. The overall prevalence of MDR-TB in AFRTH was found 1.8% (1.3% for armed force members and 0.5% for civilian patients) all of which were previously TB treated cases. The entire treatment success rates were 92.6% achieved highest in the armed force (active and pension) than the civilian patients. The failure and dead cases were also found 2.5 and 4.6%, respectively. Using bivariate analysis, category of attendants and TB contact history were strong predictors of MDR-TB in armed force and civilian patients. Moreover, human immunodeficiency virus (HIV) infection also identified a significant (OR = 14.6; 95% CI = 2.3-92.1; p = 0.004) predicting factor for MDR-TB in armed force members. However, sex, age and body mass index were not associated factor for MDR-TB. In AFRTH, lower prevalence of

Bloodstream infections caused by multi-drug resistant Proteus mirabilis: Epidemiology, risk factors and impact of multi-drug resistance.

Science.gov (United States)

Korytny, Alexander; Riesenberg, Klaris; Saidel-Odes, Lisa; Schlaeffer, Fransisc; Borer, Abraham

2016-01-01

The prevalence of antimicrobial co-resistance among ESBL-producing Enterobactereaceae is extremely high in Israel. Multidrug-resistant Proteus mirabilis strains (MDR-PM), resistant to almost all antibiotic classes have been described. The aim was to determine the risk factors for bloodstream infections caused by MDR-PM and clinical outcomes. A retrospective case-control study. Adult patients with PM bacteremia during 7 years were identified retrospectively and their files reviewed for demographics, underlying diseases, Charlson Comorbidity Index, treatment and outcome. One hundred and eighty patients with PM-bloodstream infection (BSI) were included; 90 cases with MDR-PM and 90 controls with sensitive PM (S-PM). Compared to controls, cases more frequently were from nursing homes, had recurrent hospital admissions in the past year and received antibiotic therapy in the previous 3 months, were bedridden and suffered from peripheral vascular disease and peptic ulcer disease (p < 0.001). Two-thirds of the MDR-PM isolates were ESBL-producers vs 4.4% of S-PM isolates (p < 0.001, OR = 47.6, 95% CI = 15.9-142.6). In-hospital crude mortality rate of patients with MDR-PM BSI was 37.7% vs 23.3% in those with S-PM BSI (p = 0.0359, OR = 2, 95% CI = 1.4-3.81). PM bacteremia in elderly and functionally-dependent patients is likely to be caused by nearly pan-resistant PM strains in the institution; 51.8% of the patients received inappropriate empiric antibiotic treatment. The crude mortality rate of patients with MDR-PM BSI was significantly higher than that of patients with S-PM BSI.

Factors influencing survival in patients with multidrug-resistant Acinetobacter baumannii infection

Directory of Open Access Journals (Sweden)

Mariana Lima Prata-Rocha

Full Text Available Multidrug-resistant (MDR Acinetobacter baumannii (Acb is a rapidly emerging pathogen in healthcare settings. The aim of this study was to evaluate the predictors of poor outcome in patients with MDR Acb. This is the first report documenting factors influencing survival in patients with MDR Acb in this tertiary hospital. This study is a prospective of the hospital epidemiology database. A total of 73 patients with 84 Acb isolates were obtained between August 2009 and October 2010 in this hospital. In the present study, the 30-day mortality rate was 39.7%. Of 84 Acb isolates, 50 (59% were MDR, nine (11% were pan-resistant, and 25 (30% were non-MDR. The non-MDR isolates were used as the control group. The factors significantly associated with multidrug resistance included previous surgeries, presence of comorbidity (renal disease, use of more than two devices, parenteral nutrition, and inappropriate antimicrobial therapy. Significant predictors of 30-day mortality in the univariate analysis included pneumonia, diabetes mellitus, renal disease, use of more than two devices, and inappropriate antimicrobial therapy administered within two days of the onset of infection. The factors associated with mortality in patients with MDR Acb infection in this study were: age > 60 years, pneumonia, diabetes mellitus, renal disease, use of more than two invasive procedures, and inappropriate antimicrobial therapy. Vigilance is needed to prevent outbreaks of this opportunistic and deadly pathogen.

Multidrug-resistant tuberculosis

Directory of Open Access Journals (Sweden)

McNerney Ruth

2008-01-01

Full Text Available Abstract Background With almost 9 million new cases each year, tuberculosis remains one of the most feared diseases on the planet. Led by the STOP-TB Partnership and WHO, recent efforts to combat the disease have made considerable progress in a number of countries. However, the emergence of mutated strains of Mycobacterium tuberculosis that are resistant to the major anti-tuberculosis drugs poses a deadly threat to control efforts. Multidrug-resistant tuberculosis (MDR-TB has been reported in all regions of the world. More recently, extensively drug resistant-tuberculosis (XDR-TB that is also resistant to second line drugs has emerged in a number of countries. To ensure that adequate resources are allocated to prevent the emergence and spread of drug resistance it is important to understand the scale of the problem. In this article we propose that current methods of describing the epidemiology of drug resistant tuberculosis are not adequate for this purpose and argue for the inclusion of population based statistics in global surveillance data. Discussion Whereas the prevalence of tuberculosis is presented as the proportion of individuals within a defined population having disease, the prevalence of drug resistant tuberculosis is usually presented as the proportion of tuberculosis cases exhibiting resistance to anti-tuberculosis drugs. Global surveillance activities have identified countries in Eastern Europe, the former Soviet Union and regions of China as having a high proportion of MDR-TB cases and international commentary has focused primarily on the urgent need to improve control in these settings. Other regions, such as sub-Saharan Africa have been observed as having a low proportion of drug resistant cases. However, if one considers the incidence of new tuberculosis cases with drug resistant disease in terms of the population then countries of sub-Saharan Africa have amongst the highest rates of transmitted MDR-TB in the world. We propose

Strategies to overcome or circumvent P-glycoprotein mediated multidrug resistance.

Science.gov (United States)

Yuan, Hongyu; Li, Xun; Wu, Jifeng; Li, Jinpei; Qu, Xianjun; Xu, Wenfang; Tang, Wei

2008-01-01

Cancer patients who receive chemotherapy often experience intrinsic or acquired resistance to a broad spectrum of chemotherapeutic agents. The phenomenon, termed multidrug resistance (MDR), is often associated with the over-expression of P-glycoprotein, a transmembrane protein pump, which can enhance efflux of a various chemicals structurally unrelated at the expense of ATP depletion, resulting in decrease of the intracellular cytotoxic drug accumulation. The MDR has been a big threaten to the human health and the war fight for it continues. Although several other mechanisms for MDR are elucidated in recent years, considerable efforts attempting to inverse MDR are involved in exploring P-glycoprotein modulators and suppressing P-glycoprotein expression. In this review, we will report on the recent advances in various strategies for overcoming or circumventing MDR mediated by P-glycoprotein.

Dominant incidence of multidrug and extensively drug-resistant specific Mycobacterium tuberculosis clones in Osaka Prefecture, Japan.

Directory of Open Access Journals (Sweden)

Aki Tamaru

Full Text Available Infection and transmission of multidrug-resistant Mycobacterium tuberculosis (MDR-Mtb and extensively drug-resistant M. tuberculosis (XDR-Mtb is a serious health problem. We analyzed a total of 1,110 Mtb isolates in Osaka Prefecture and neighboring areas from April 2000 to March 2009. A total of 89 MDR-Mtb were identified, 36 (48.5% of which were determined to be XDR-Mtb. Among the 89 MDR-Mtb isolates, 24 (27.0% phylogenetically distributed into six clusters based on mycobacterial interspersed repetitive units-various number of tandem repeats (MIRU-VNTR typing. Among these six clusters, the MIRU-VNTR patterns of four (OM-V02, OM-V03, OM-V04, and OM-V06 were only found for MDR-Mtb. Further analysis revealed that all isolates belonging to OM-V02 and OM-V03, and two isolates from OM-V04 were clonal. Importantly such genotypes were not observed for drug-sensitive isolates. These suggest that few but transmissible clones can transmit after acquiring multidrug resistance and colonize even in a country with a developed, well-organized healthcare system.

Metabolic Reprogramming During Multidrug Resistance in Leukemias

Directory of Open Access Journals (Sweden)

Raphael Silveira Vidal

2018-04-01

Full Text Available Cancer outcome has improved since introduction of target therapy. However, treatment success is still impaired by the same drug resistance mechanism of classical chemotherapy, known as multidrug resistance (MDR phenotype. This phenotype promotes resistance to drugs with different structures and mechanism of action. Recent reports have shown that resistance acquisition is coupled to metabolic reprogramming. High-gene expression, increase of active transport, and conservation of redox status are one of the few examples that increase energy and substrate demands. It is not clear if the role of this metabolic shift in the MDR phenotype is related to its maintenance or to its induction. Apart from the nature of this relation, the metabolism may represent a new target to avoid or to block the mechanism that has been impairing treatment success. In this mini-review, we discuss the relation between metabolism and MDR resistance focusing on the multiple non-metabolic functions that enzymes of the glycolytic pathway are known to display, with emphasis with the diverse activities of glyceraldehyde-3-phosphate dehydrogenase.

Conserved hydrogen bonds and water molecules in MDR HIV-1 protease substrate complexes

Energy Technology Data Exchange (ETDEWEB)

Liu, Zhigang [Wayne State Univ., Detroit, MI (United States); Case Western Reserve Univ., Cleveland, OH (United States); Harbor Hospital Baltimore, MD (United States); Wang, Yong [Wayne State Univ., Detroit, MI (United States); Yedidi, Ravikiran S. [Wayne State Univ., Detroit, MI (United States); National Institutes of Health, Bethesda, MD (United States); Dewdney, Tamaria G. [Wayne State Univ., Detroit, MI (United States); Reiter, Samuel J. [Wayne State Univ., Detroit, MI (United States); Brunzelle, Joseph S. [Northwestern Univ. Feinberg School of Medicine, Chicago, IL (United States); Kovari, Iulia A. [Wayne State Univ., Detroit, MI (United States); Kovari, Ladislau C. [Wayne State Univ., Detroit, MI (United States)

2012-12-19

Success of highly active antiretroviral therapy (HAART) in anti-HIV therapy is severely compromised by the rapidly developing drug resistance. HIV-1 protease inhibitors, part of HAART, are losing their potency and efficacy in inhibiting the target. Multi-drug resistant (MDR) 769 HIV-1 protease (resistant mutations at residues 10, 36, 46, 54, 62, 63, 71, 82, 84, 90) was selected for the present study to understand the binding to its natural substrates. The nine crystal structures of MDR769 HIV-1 protease substrate hepta-peptide complexes were analyzed in order to reveal the conserved structural elements for the purpose of drug design against MDR HIV-1 protease. Our structural studies demonstrated that highly conserved hydrogen bonds between the protease and substrate peptides, together with the conserved crystallographic water molecules, played a crucial role in the substrate recognition, substrate stabilization and protease stabilization. Additionally, the absence of the key flap-ligand bridging water molecule might imply a different catalytic mechanism of MDR769 HIV-1 protease compared to that of wild type (WT) HIV-1 protease.

Photodynamic therapy of cancer — Challenges of multidrug resistance

Directory of Open Access Journals (Sweden)

Zheng Huang

2015-01-01

Full Text Available Photodynamic therapy (PDT of cancer is a two-step drug-device combination modality, which involves the topical or systemic administration of a photosensitizer followed by light illumination of cancer site. In the presence of oxygen molecules, the light illumination of photosensitizer (PS can lead to the generation of cytotoxic reactive oxygen species (ROS and consequently destroy cancer. Similar to many other anticancer therapies, PDT is also subject to intrinsic cancer resistance mediated by multidrug resistance (MDR mechanisms. This paper will review the recent progress in understanding the interaction between MDR transporters and PS uptake. The strategies that can be used in a clinical setting to overcome or bypass MDR will also be discussed.

Multidrug-resistant Bacteroides fragilis group on the rise in Europe?

DEFF Research Database (Denmark)

Hartmeyer, G N; Sóki, J; Nagy, E

2012-01-01

We report a case of multidrug-resistance (MDR) in a strain of Bacteroides fragilis from a blood culture and abdominal fluid in a Danish patient. The patient had not been travelling for several years and had not received antibiotics prior to the present case. We also summarize the cases that have...... been reported to date of MDR B. fragilis group in Europe. As far as we know, a case like this with MDR B. fragilis has not been described in Scandinavia before....

Multimodal transfer of MDR by exosomes in human osteosarcoma.

Science.gov (United States)

Torreggiani, Elena; Roncuzzi, Laura; Perut, Francesca; Zini, Nicoletta; Baldini, Nicola

2016-07-01

Exosomes are extracellular vesicles released by both normal and tumour cells which are involved in a new intercellular communication pathway by delivering cargo (e.g., proteins, microRNAs, mRNAs) to recipient cells. Tumour-derived exosomes have been shown to play critical roles in different stages of tumour growth and progression. In this study, we investigated the potential role of exosomes to transfer the multidrug resistance (MDR) phenotype in human osteosarcoma cells. Exosomes were isolated by differential centrifugation of culture media from multidrug resistant human osteosarcoma MG-63DXR30 (Exo/DXR) and MG-63 parental cells (Exo/S). Exosome purity was examined by transmission electron microscopy and confirmed by immunoblot analysis for the expression of specific exosomal markers. Our data showed that exosomes derived from doxorubicin-resistant osteosarcoma cells could be taken up into secondary cells and induce a doxorubicin-resistant phenotype. The incubation of osteosarcoma cells with Exo/DXR decreased the sensitivity of parental cells to doxorubicin, while exposure with Exo/S was ineffective. In addition, we demonstrated that Exo/DXR expressed higher levels of MDR-1 mRNA and P-glycoprotein compared to Exo/S (p=0.03). Interestingly, both MDR-1 mRNA and P-gp increased in MG-63 cells after incubation with Exo/DXR, suggesting this as the main mechanism of exosome-mediated transfer of drug resistance. Our findings suggest that multidrug resistant osteosarcoma cells are able to spread their ability to resist the effects of doxorubicin treatment on sensitive cells by transferring exosomes carrying MDR-1 mRNA and its product P-glycoprotein.

Molecular detection of multi drug resistant tuberculosis (mdr-tb) in mdr-tb patients' attendant in north western pakistan

International Nuclear Information System (INIS)

Shah, T.; Hayat, A.; Shah, Z.; Hayat, A.; Khan, S.B.

2017-01-01

Objective: To determine the drugs susceptibility pattern of mycobacterium tuberculosis (M.TB) in multi-drug resistant tuberculosis (MDR-TB) patients' attendants in North Western, Pakistan. Study Design: Cross sectional study. Place and Duration of Study: This study was conducted at Peshawar Tuberculosis Research Laboratory (PTRL), Provincial TB Control Program Hayatabad Medical Complex Peshawar, (KP) from August 2013 to March 2014. Material and Methods: A cross sectional study in which four hundred and eighty sputum samples from MDR-TB patients' attendants were processed for the detection of M.TB through Ziehl-Neelsen staining, Lowenstein-Jensen, BACTEC MGIT-960 culture and line probe assay. Results: Out of 480 samples, 06 (2.1%) were found positive for M.TB through Ziehl-Neelsen staining while 10 (2.8%) were positive through LJ and BACTEC MGIT-960 culture. The 10 positive samples were further subjected to drugs susceptibility testing and line probes assay test to find out rifampicin, isoniazid, streptomycin and ethambutol resistant and it was found that 6 M.TB isolates were resistant while 4 were sensitive to rifampicin and isoniazid. Among the 6 resistant M.TB strains, 4 showed mutation in rpoB gene at 531, 516 and 526 codons. Conclusion: Majority of MDR-TB patients' attendants had drug-resistant tuberculosis and the rate of drug susceptible TB was low. (author)

Tigecycline use in two cases with multidrug-resistant Acinetobacter baumannii meningitis.

Science.gov (United States)

Tutuncu, E Ediz; Kuscu, Ferit; Gurbuz, Yunus; Ozturk, Baris; Haykir, Asli; Sencan, Irfan

2010-09-01

The treatment of post-surgical meningitis due to multidrug-resistant (MDR) Acinetobacter baumannii is a therapeutic dilemma. The cases of two patients with MDR A. baumannii meningitis secondary to surgical site infections, successfully treated with combination regimens including tigecycline, are presented. Copyright © 2009 International Society for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Molecular identification of marine symbiont bacteria of gastropods from the waters of the Krakal coast Yogyakarta and its potential as a Multi-Drug Resistant (MDR) antibacterial agent

Science.gov (United States)

Bahry, Muhammad Syaifudien; Pringgenies, Delianis; Trianto, Agus

2017-01-01

The resistance of pathogenic bacteria may occur to many types of antibiotics, especially in cases of non-compliance use of antibiotics, which likely to allow the evolution of Multi-Drug Resistant (MDR) bacteria. Gastropods seas are marine invertebrates informed capable of production of secondary metabolites as antibacterial MDR. The purpose of the study was the isolation and identification of gastropod symbiont bacteria found in the waters of Krakal, Gunung Kidul, Yogyakarta, which has the ability to produce antibacterial compounds against MDR(Escherichia coli, Enterobacter cloacae, Klebsiella pneumoniae, MRSA (methicillin-Resistant Staphylococcus aureus), Staphylococcus aureus, and Staphylococcus homunis) molecular. Stages of this research began with the isolation of bacteria, bacteria screening for anti-MDR compound, mass culture, and extraction, antibacterial activity test, DNA extraction, amplification by PCR 16S rDNA and sequencing. The results of the study showed that 19 isolates of bacteria were isolated from three species of gastropods namely Littorina scabra, Cypraea moneta and Conus ebraeus. Among them, 4 isolates showed activity against MDR test bacteria (E. coli, E. cloacae, K. pneumoniae, S. aureus and S. homunis). The highest activity was displayed by code LS.G1.8 isolate with the largest inhibition zone 15.47±0.45mm on S. humonis at 250 µg/disk concentration. Isolate CM.G2.1 showed largest inhibition zone, with 21.5±0.07mm on MRSA at 1000 µg/disk concentration and isolate the largest inhibition zone CM.G2.5 14.37±0.81mm on MRSA 14.37±0.81mm at concentrations 1000 µg/disk. The molecular identification of isolates LS.G1.8 has 99% homology with Bacillus subtilis and isolates CM.G2.1 has 99% homology with Bacillus pumillus.

Multidrug-resistant tuberculosis in pregnancy

International Nuclear Information System (INIS)

Dhingra, V.K.; Arora, V.K.; Rajpal, S.

2007-01-01

This is a case report of 26 years old pregnant woman with multidrug-resistant tuberculosis (MDR TB), treated at outpatient department of New Delhi Tuberculosis (NDTB) Centre, India with second line agents. Before presentation at NDTB Centre, she had been treated with first line drugs for approximately one and-a-half-year, including category II re-treatment DOTS regimen under RNTCP. Patient conceived twice during her anti-TB treatment. The first one was during her category II treatment, when put on second line drugs. We describe congenital abnormalities documented in her second child exposed in-utero to second line anti-tubercular drugs with a brief review of treatment of MDR TB in pregnancy. (author)

A simple reduction-sensitive micelles co-delivery of paclitaxel and dasatinib to overcome tumor multidrug resistance

Directory of Open Access Journals (Sweden)

Li J

2017-11-01

Full Text Available Jun Li,1,* Ruitong Xu,2,* Xiao Lu,3 Jing He,1 Shidai Jin1 1Department of Medical Oncology, 2Department of General Practice, The First Affiliated Hospital with Nanjing Medical University, Nanjing, 3Department of Medical Oncology, Changshu No 1 People’s Hospital, Changshu, People’s Republic of China *These authors contributed equally to this work Abstract: Multidrug resistance (MDR is one of the major obstacles in successful chemotherapy. The combination of chemotherapy drugs and multidrug-resistant reversing agents for treating MDR tumor is a good strategy to overcome MDR. In this work, we prepared the simple redox-responsive micelles based on mPEG-SS-C18 as a co-delivery system to load the paclitaxel (PTX and dasatinib (DAS for treatment of MCF-7/ADR cells. The co-loaded micelles had a good dispersity and a spherical shape with a uniform size distribution, and they could quickly disassemble and rapidly release drugs under the reduction environment. Compared with MCF-7 cells, the DAS and PTX co-loaded redox-sensitive micelle (SS-PDNPs showed stronger cytotoxicity and a more improving intracellular drug concentration than other drug formulations in MCF-7/ADR cells. In summary, the results suggested that the simple co-delivery micelles of PTX and DAS possessed significant potential to overcome drug resistance in cancer therapy. Keywords: redox responsive, overcoming multidrug resistant, co-delivery, paclitaxel, dasatinib 

Use of GenoType® MTBDRplus assay to assess drug resistance and mutation patterns of multidrug-resistant tuberculosis isolates in northern India

Directory of Open Access Journals (Sweden)

A K Maurya

2013-01-01

Full Text Available Purpose: The emergence and spread of multidrug-resistant tuberculosis (MDR-TB is a major public health problem. The diagnosis of MDR-TB is of paramount importance in establishing appropriate clinical management and infection control measures. The aim of this study was to evaluate drug resistance and mutational patterns in clinical isolates MDR-TB by GenoType® MTBDRplus assay. Material and Methods: A total of 350 non-repeated sputum specimens were collected from highly suspected drug-resistant pulmonary tuberculosis (PTB cases; which were processed by microscopy, culture, differentiation and first line drug susceptibility testing (DST using BacT/ALERT 3D system. Results: Among a total of 125 mycobacterium tuberculosis complex (MTBC strains, readable results were obtained from 120 (96% strains by GenoType® MTBDRplus assay. Only 45 MDR-TB isolates were analysed for the performance, frequency and mutational patterns by GenoType® MTBDRplus assay. The sensitivity of the GenoType® MDRTBplus assay for detecting individual resistance to rifampicin (RIF, isoniazid (INH and multidrug resistance was found to be 95.8%, 96.3% and 97.7%, respectively. Mutation in codon S531L of the rpoB gene and codon S315T1 of katG genes were dominated in MDR-TB strains, respectively (P < 0.05. Conclusions: The GenoType® MTBDRplus assay is highly sensitive with short turnaround times and a rapid test for the detection of the most common mutations conferring resistance in MDR-TB strains that can readily be included in a routine laboratory workflow.

Influence of multidrug resistance on 18F-FCH cellular uptake in a glioblastoma model

International Nuclear Information System (INIS)

Vanpouille, Claire; Jeune, Nathalie le; Clotagatide, Anthony; Dubois, Francis; Kryza, David; Janier, Marc; Perek, Nathalie

2009-01-01

Multidrug resistance, aggressiveness and accelerated choline metabolism are hallmarks of malignancy and have motivated the development of new PET tracers like 18 F-FCH, an analogue of choline. Our aim was to study the relationship of multidrug resistance of cultured glioma cell lines and 18 F-FCH tracer uptake. We used an in vitro multidrug-resistant (MDR) glioma model composed of sensitive parental U87MG and derived resistant cells U87MG-CIS and U87MG-DOX. Aggressiveness, choline metabolism and transport were studied, particularly the expression of choline kinase (CK) and high-affinity choline transporter (CHT1). FCH transport studies were assessed in our glioblastoma model. As expected, the resistant cell lines express P-glycoprotein (Pgp), multidrug resistance-associated protein isoform 1 (MRP1) and elevated glutathione (GSH) content and are also more mobile and more invasive than the sensitive U87MG cells. Our results show an overexpression of CK and CHT1 in the resistant cell lines compared to the sensitive cell lines. We found an increased uptake of FCH (in % of uptake per 200,000 cells) in the resistant cells compared to the sensitive ones (U87MG: 0.89±0.14; U87MG-CIS: 1.27±0.18; U87MG-DOX: 1.33±0.13) in line with accelerated choline metabolism and aggressive phenotype. FCH uptake is not influenced by the two ATP-dependant efflux pumps: Pgp and MRP1. FCH would be an interesting probe for glioma imaging which would not be effluxed from the resistant cells by the classic MDR ABC transporters. Our results clearly show that FCH uptake reflects accelerated choline metabolism and is related to tumour aggressiveness and drug resistance. (orig.)

Bafetinib (INNO-406) reverses multidrug resistance by inhibiting the efflux function of ABCB1 and ABCG2 transporters

Science.gov (United States)

Zhang, Yun-Kai; Zhang, Guan-Nan; Wang, Yi-Jun; Patel, Bhargav A.; Talele, Tanaji T.; Yang, Dong-Hua; Chen, Zhe-Sheng

2016-05-01

ATP-Binding Cassette transporters are involved in the efflux of xenobiotic compounds and are responsible for decreasing drug accumulation in multidrug resistant (MDR) cells. Discovered by structure-based virtual screening algorithms, bafetinib, a Bcr-Abl/Lyn tyrosine kinase inhibitor, was found to have inhibitory effects on both ABCB1- and ABCG2-mediated MDR in this in-vitro investigation. Bafetinib significantly sensitized ABCB1 and ABCG2 overexpressing MDR cells to their anticancer substrates and increased the intracellular accumulation of anticancer drugs, particularly doxorubicin and [3H]-paclitaxel in ABCB1 overexpressing cells; mitoxantrone and [3H]-mitoxantrone in ABCG2 overexpressing cells, respectively. Bafetinib stimulated ABCB1 ATPase activities while inhibited ABCG2 ATPase activities. There were no significant changes in the expression level or the subcellular distribution of ABCB1 and ABCG2 in the cells exposed to 3 μM of bafetinib. Overall, our study indicated that bafetinib reversed ABCB1- and ABCG2-mediated MDR by blocking the drug efflux function of these transporters. These findings might be useful in developing combination therapy for MDR cancer treatment.

Role of hypoxia-inducible factor-α in hepatitis-B-virus X protein-mediated MDR1 activation

International Nuclear Information System (INIS)

Han, Hyo-Kyung; Han, Chang Yeob; Cheon, Eun-Pa; Lee, Jaewon; Kang, Keon Wook

2007-01-01

The transition from chemotherapy-responsive cancer cells to chemotherapy-resistant cancer cells is mainly accompanied by the increased expression of multi-drug resistance 1 (MDR1). We found that hepatitis-B-virus X protein (HBx) increases the transcriptional activity and protein level of MDR1 in a hepatoma cell line, H4IIE. In addition, HBx overexpression made H4IIE cells more resistant to verapamil-uptake. HBx stabilized hypoxia-inducible factor-1α (HIF-1α) and induced the nuclear translocation of C/EBPβ. Reporter gene analyses showed that HBx increased the reporter activity in the cells transfected with the reporter containing MDR1 gene promoter. Moreover, the luciferase reporter gene activity was significantly inhibited by HIF-1α siRNA but not by overexpression of C/EBP dominant negative mutant. These results imply that HBx increases the MDR1 transporter activity through the transcriptional activation of the MDR1 gene with HIF-1α activation, and suggest HIF-1α for the therapeutic target of HBV-mediated chemoresistance

National Survey of Practices to Prevent Methicillin-Resistant Staphylococcus aureus and Multidrug-Resistant Acinetobacter baumannii in Thailand.

Science.gov (United States)

Apisarnthanarak, Anucha; Ratz, David; Khawcharoenporn, Thana; Patel, Payal K; Weber, David J; Saint, Sanjay; Greene, M Todd

2017-05-15

We evaluated the extent to which hospital characteristics, infection control practices, and compliance with prevention bundles impacted multidrug-resistant organism (MDRO) infections in Thai hospitals. From 1 January 2014 to 30 November 2014, we surveyed all Thai hospitals with an intensive care unit and ≥250 beds. Infection control practices for methicillin-resistant Staphylococcus aureus (MRSA) and multidrug-resistant Acinetobacter baumannii (MDR-AB) were assessed. Linear regression was used to examine associations between hospital characteristics and prevention bundle compliance and changes in MDRO infection rates. A total of 212 of 245 (86.5%) eligible hospitals responded. Most hospitals regularly used several fundamental infection control practices for MRSA and MDR-AB (ie, contact precautions, private room/cohorting, hand hygiene, environmental cleaning, and antibiotic stewardship); advanced infection control practices (ie, active surveillance, chlorhexidine bathing, decolonization for MRSA, and hydrogen peroxide vaporizer for MDR-AB) were used less commonly. Facilities with ≥75% compliance with the MRSA prevention bundle experienced a 17.4% reduction in MRSA rates (P = .03). Although the presence of environmental cleaning services (41.3% reduction, P = .01) and a microbiology laboratory (82.8% reduction, P = .02) were among characteristics associated with decreases in MDR-AB rates, greater compliance with the MDR-AB prevention bundle did not lead to reductions in MDR-AB rates. Although fundamental MRSA and MDR-AB control practices are used regularly in most Thai hospitals, compliance with more comprehensive bundled prevention approaches is suboptimal. Improving compliance with bundled infection prevention approaches and promoting the integration of certain hospital factors into infection control efforts may help reduce MDRO infections in Thai hospitals. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America

Proteome analysis of multidrug-resistant, breast cancer–derived microparticles

Directory of Open Access Journals (Sweden)

Deep Pokharel

2014-08-01

Full Text Available Cancer multidrug resistance (MDR occurs when cancer cells evade the cytotoxic actions of chemotherapeutics through the active efflux of drugs from within the cells. Our group have previously demonstrated that multidrug-resistant breast cancer cells spontaneously shed microparticles (MPs and that these MPs can transfer resistance to drug-responsive cells and confer MDR on those cells in as little as 4 h. Furthermore, we also showed that, unlike MPs derived from leukaemia cells, breast cancer–derived MPs display a tissue selectivity in the transfer of P-glycoprotein (P-gp, transferring the resistance protein only to malignant breast cells. This study aims to define the proteome of breast cancer–derived MPs in order to understand the differences in protein profiles between those shed from drug-resistant versus drug-sensitive breast cancer cells. In doing so, we detail the protein cargo required for the intercellular transfer of MDR to drug-sensitive recipient cells and the factors governing the transfer selectivity to malignant breast cells. We describe the first proteomic analysis of MPs derived from human breast cancer cells using SDS PAGE and liquid chromatography–tandem mass spectrometry (LC/MS/MS, in which we identify 120 unique proteins found only in drug-resistant, breast cancer–derived MPs. Our results demonstrate that the MP-mediated transfer of P-gp to recipient cells occurs alongside CD44; the Ezrin, Radixin and Moesin protein family (ERM; and cytoskeleton motor proteins within the MP cargo.

The culturable soil antibiotic resistome: a community of multi-drug resistant bacteria.

Science.gov (United States)

Walsh, Fiona; Duffy, Brion

2013-01-01

Understanding the soil bacterial resistome is essential to understanding the evolution and development of antibiotic resistance, and its spread between species and biomes. We have identified and characterized multi-drug resistance (MDR) mechanisms in the culturable soil antibiotic resistome and linked the resistance profiles to bacterial species. We isolated 412 antibiotic resistant bacteria from agricultural, urban and pristine soils. All isolates were multi-drug resistant, of which greater than 80% were resistant to 16-23 antibiotics, comprising almost all classes of antibiotic. The mobile resistance genes investigated, (ESBL, bla NDM-1, and plasmid mediated quinolone resistance (PMQR) resistance genes) were not responsible for the respective resistance phenotypes nor were they present in the extracted soil DNA. Efflux was demonstrated to play an important role in MDR and many resistance phenotypes. Clinically relevant Burkholderia species are intrinsically resistant to ciprofloxacin but the soil Burkholderia species were not intrinsically resistant to ciprofloxacin. Using a phenotypic enzyme assay we identified the antibiotic specific inactivation of trimethoprim in 21 bacteria from different soils. The results of this study identified the importance of the efflux mechanism in the soil resistome and variations between the intrinsic resistance profiles of clinical and soil bacteria of the same family.

The culturable soil antibiotic resistome: a community of multi-drug resistant bacteria.

Directory of Open Access Journals (Sweden)

Fiona Walsh

Full Text Available Understanding the soil bacterial resistome is essential to understanding the evolution and development of antibiotic resistance, and its spread between species and biomes. We have identified and characterized multi-drug resistance (MDR mechanisms in the culturable soil antibiotic resistome and linked the resistance profiles to bacterial species. We isolated 412 antibiotic resistant bacteria from agricultural, urban and pristine soils. All isolates were multi-drug resistant, of which greater than 80% were resistant to 16-23 antibiotics, comprising almost all classes of antibiotic. The mobile resistance genes investigated, (ESBL, bla NDM-1, and plasmid mediated quinolone resistance (PMQR resistance genes were not responsible for the respective resistance phenotypes nor were they present in the extracted soil DNA. Efflux was demonstrated to play an important role in MDR and many resistance phenotypes. Clinically relevant Burkholderia species are intrinsically resistant to ciprofloxacin but the soil Burkholderia species were not intrinsically resistant to ciprofloxacin. Using a phenotypic enzyme assay we identified the antibiotic specific inactivation of trimethoprim in 21 bacteria from different soils. The results of this study identified the importance of the efflux mechanism in the soil resistome and variations between the intrinsic resistance profiles of clinical and soil bacteria of the same family.

Efficacy and safety profile of linezolid in the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis: a systematic review and meta-analysis.

Science.gov (United States)

Agyeman, Akosua Adom; Ofori-Asenso, Richard

2016-06-22

Treatment options for drug-resistant tuberculosis are still limited. Linezolid has been recommended for treatment of patients with multidrug-resistant (MDR) or extensively-drug-resistant (XDR) tuberculosis, although uncertainties remain regarding its safety and tolerability in these circumstances. To systematically evaluate the existing evidence regarding the efficacy and tolerability of linezolid in the treatment of MDR or XDR tuberculosis. We conducted a systematic review and meta-analysis in accordance with the PRISMA guidelines. Searches were conducted in PubMed, Web of Science and EMBASE followed by direct search of abstracts in the International Journal of Tuberculosis and Lung Disease to retrieve primary studies published between January 2000 and January 2016 assessing linezolid efficacy and safety in the treatment of drug-resistant TB. We evaluated the occurrence of outcomes including culture conversion, treatment success and incidence of adverse events such as myelosuppression and neuropathy. Twenty-three (23) studies conducted in fourteen (14) countries and involving 507 patients were retrieved. Only 1 randomized controlled trial was identified and none of the identified studies involved participants from Africa. The pooled proportion for treatment success was 77.36 % (95 % CI = 71.38-82.83 %, I(2) = 37.6 %) with culture conversion rate determined as 88.45 % (95 % CI = 83.82-92.38 %, I(2) = 45.4 %). There was no strong evidence for both culture conversion (p = 0.0948) and treatment success (p = 0.0695) between linezolid daily doses ≤ 600 and > 600 mg. Only myelosuppression showed a strong statistical significance (p linezolid also showed no significance upon dose comparisons (p = 0.3213, p = 0.9050 respectively). Available evidence presents Linezolid as a viable option in the treatment of MDR/XDR TB although patients ought to be monitored closely for the incidence of major adverse events such as myelosuppression and

Celastraceae sesquiterpenes as a new class of modulators that bind specifically to human P-glycoprotein and reverse cellular multidrug resistance.

Science.gov (United States)

Muñoz-Martínez, Francisco; Lu, Peihua; Cortés-Selva, Fernando; Pérez-Victoria, José María; Jiménez, Ignacio A; Ravelo, Angel G; Sharom, Frances J; Gamarro, Francisco; Castanys, Santiago

2004-10-01

Overexpression of ABCB1 (MDR1) P-glycoprotein, a multidrug efflux pump, is one mechanism by which tumor cells may develop multidrug resistance (MDR), preventing the successful chemotherapeutic treatment of cancer. Sesquiterpenes from Celastraceae family are natural compounds shown previously to reverse MDR in several human cancer cell lines and Leishmania strains. However, their molecular mechanism of reversion has not been characterized. In the present work, we have studied the ability of 28 dihydro-beta-agarofuran sesquiterpenes to reverse the P-glycoprotein-dependent MDR phenotype and elucidated their molecular mechanism of action. Cytotoxicity assays using human MDR1-transfected NIH-3T3 cells allowed us to select the most potent sesquiterpenes reversing the in vitro resistance to daunomycin and vinblastine. Flow cytometry experiments showed that the above active compounds specifically inhibited drug transport activity of P-glycoprotein in a saturable, concentration-dependent manner (K(i) down to 0.24 +/- 0.01 micromol/L) but not that of ABCC1 (multidrug resistance protein 1; MRP1), ABCC2 (MRP2), and ABCG2 (breast cancer resistance protein; BCRP) transporters. Moreover, sesquiterpenes inhibited at submicromolar concentrations the P-glycoprotein-mediated transport of [(3)H]colchicine and tetramethylrosamine in plasma membrane from CH(R)B30 cells and P-glycoprotein-enriched proteoliposomes, supporting that P-glycoprotein is their molecular target. Photoaffinity labeling in plasma membrane and fluorescence spectroscopy experiments with purified protein suggested that sesquiterpenes interact with transmembrane domains of P-glycoprotein. Finally, sesquiterpenes modulated P-glycoprotein ATPase-activity in a biphasic, concentration-dependent manner: they stimulated at very low concentrations but inhibited ATPase activity as noncompetitive inhibitors at higher concentrations. Sesquiterpenes from Celastraceae are promising P-glycoprotein modulators with potential

New Roads Leading to Old Destinations: Efflux Pumps as Targets to Reverse Multidrug Resistance in Bacteria

Directory of Open Access Journals (Sweden)

Gabriella Spengler

2017-03-01

Full Text Available Multidrug resistance (MDR has appeared in response to selective pressures resulting from the incorrect use of antibiotics and other antimicrobials. This inappropriate application and mismanagement of antibiotics have led to serious problems in the therapy of infectious diseases. Bacteria can develop resistance by various mechanisms and one of the most important factors resulting in MDR is efflux pump-mediated resistance. Because of the importance of the efflux-related multidrug resistance the development of new therapeutic approaches aiming to inhibit bacterial efflux pumps is a promising way to combat bacteria having over-expressed MDR efflux systems. The definition of an efflux pump inhibitor (EPI includes the ability to render the bacterium increasingly more sensitive to a given antibiotic or even reverse the multidrug resistant phenotype. In the recent years numerous EPIs have been developed, although so far their clinical application has not yet been achieved due to their in vivo toxicity and side effects. In this review, we aim to give a short overview of efflux mediated resistance in bacteria, EPI compounds of plant and synthetic origin, and the possible methods to investigate and screen EPI compounds in bacterial systems.

Soluble Urokinase Plasminogen Activator Receptor Levels in Tuberculosis Patients at High Risk for Multidrug Resistance

Directory of Open Access Journals (Sweden)

Tri Yudani Mardining Raras

2012-01-01

Full Text Available The soluble urokinase plasminogen activator receptor (suPAR has been shown to be a strong prognostic biomarker for tuberculosis (TB. In the present study, the profiles of plasma suPAR levels in pulmonary TB patients at high risk for multidrug resistance were analyzed and compared with those in multidrug resistant (MDR-TB patients. Forty patients were prospectively included, consisting of 10 MDR-TB patients and 30 TB patients at high risk for MDR, underwent clinical assesment. Plasma suPAR levels were measured using ELISA (SUPARnostic, Denmark and bacterial cultures were performed in addition to drug susceptibility tests. All patients of suspected MDR-TB group demonstrated significantly higher suPAR levels compared with the healthy TB-negative group (1.79 ng/mL. Among the three groups at high risk for MDR-TB, only the relapse group (7.87 ng/mL demonstrated suPAR levels comparable with those of MDR-TB patients (7.67 ng/mL. suPAR levels in the two-month negative acid-fast bacilli conversion group (9.29 ng/mL were higher than positive control, whereas levels in the group consisting of therapy failure patients (5.32 ng/mL were lower. Our results strongly suggest that suPAR levels enable rapid screening of suspected MDR-TB patients, but cannot differentiate between groups.

Prevalence of Multidrug-Resistant Tuberculosis and Associated Factors in Ethiopia: A Systematic Review

OpenAIRE

Asgedom, Solomon Weldegebreal; Teweldemedhin, Mebrahtu; Gebreyesus, Hailay

2018-01-01

Background. Multidrug-resistant tuberculosis (MDR-TB) has continued to be a challenge for tuberculosis (TB) control globally. Ethiopia is one of the countries with high MDR-TB burden. Objective. The main purpose of this study was to determine the prevalence of MDR-TB and associated factors in Ethiopia. Methods. A systematic review of the literatures on prevalence of MDR-TB and associated factors was conducted in the country. Results. In our electronic search, 546 citations were depicted. Amon...

Significance of MDR1 and multiple drug resistance in refractory human epileptic brain

Directory of Open Access Journals (Sweden)

Dini Gabriele

2004-10-01

Full Text Available Abstract Background The multiple drug resistance protein (MDR1/P-glycoprotein is overexpressed in glia and blood-brain barrier (BBB endothelium in drug refractory human epileptic tissue. Since various antiepileptic drugs (AEDs can act as substrates for MDR1, the enhanced expression/function of this protein may increase their active extrusion from the brain, resulting in decreased responsiveness to AEDs. Methods Human drug resistant epileptic brain tissues were collected after surgical resection. Astrocyte cell cultures were established from these tissues, and commercially available normal human astrocytes were used as controls. Uptake of fluorescent doxorubicin and radioactive-labeled Phenytoin was measured in the two cell populations, and the effect of MDR1 blockers was evaluated. Frozen human epileptic brain tissue slices were double immunostained to locate MDR1 in neurons and glia. Other slices were exposed to toxic concentrations of Phenytoin to study cell viability in the presence or absence of a specific MDR1 blocker. Results MDR1 was overexpressed in blood vessels, astrocytes and neurons in human epileptic drug-resistant brain. In addition, MDR1-mediated cellular drug extrusion was increased in human 'epileptic' astrocytes compared to 'normal' ones. Concomitantly, cell viability in the presence of cytotoxic compounds was increased. Conclusions Overexpression of MDR1 in different cell types in drug-resistant epileptic human brain leads to functional alterations, not all of which are linked to drug pharmacokinetics. In particular, the modulation of glioneuronal MDR1 function in epileptic brain in the presence of toxic concentrations of xenobiotics may constitute a novel cytoprotective mechanism.

Exploring the iron metabolism in multidrug resistant tuberculosis ...

African Journals Online (AJOL)

The iron metabolism plays a key role in the progression of active Tuberculosis. Several studies have shown a link between iron metabolism disorders an active tuberculosis. The aim of this study was to explore the iron metabolism of 100 patients with multidrug-resistant tuberculosis (MDR-TB) treated with second generation ...

Exploring the iron metabolism in multidrug resistant tuberculosis ...

African Journals Online (AJOL)

The iron metabolism plays a key role in the progression of active Tuberculosis. Several studies have shown a link between iron metabolism disorders an active tuberculosis. The aim of this study was to explore the iron metabolism of 100 patients with multidrug-resistant tuberculosis. (MDR-TB) treated with second ...

Converging risk factors but no association between HIV infection and multidrug-resistant tuberculosis in Kazakhstan.

Science.gov (United States)

van den Hof, S; Tursynbayeva, A; Abildaev, T; Adenov, M; Pak, S; Bekembayeva, G; Ismailov, S

2013-04-01

Kazakhstan is a country with a low HIV/AIDS (human immunodeficiency virus/acquired immune-deficiency syndrome) burden, but a high prevalence of multidrug-resistant tuberculosis (MDR-TB). We describe the epidemiology of multidrug resistance and HIV among TB patients, using the 2007-2011 national electronic TB register. HIV test results were available for 97.2% of TB patients. HIV prevalence among TB patients increased from 0.6% in 2007 to 1.5% in 2011. Overall, 41.6% of patients had a positive smear at diagnosis, 38.6% a positive culture and 51.7% either a positive smear or culture. Drug susceptibility testing (DST) results were available for 92.7% of culture-positive cases. Socio-economic factors independently associated with both HIV and MDR-TB were urban residency, drug use, homelessness and a history of incarceration. In adjusted analysis, HIV positivity was not associated with MDR-TB (OR 1.0, 95%CI 0.86-1.2). Overall, among TB patients with DST and HIV test results available, 65.0% were positive for neither HIV nor MDR-TB, 33.5% only for MDR-TB, 0.9% only for HIV and 0.6% for both HIV and MDR-TB. Among injection drug users, 12.5% were positive for HIV and MDR-TB. We showed increasing HIV prevalence among TB patients in Kazakhstan. HIV was not an independent risk factor for MDR-TB, but risk factors were largely overlapping and we did identify subgroups at particular risk of HIV-MDR-TB co-infection, notably drug users. Enhanced efforts are necessary to provide care to these socially vulnerable populations.

Silencage du gene MDR1 et resensibilisation des cellules MCF-7 MDR a la doxorubicine en utilisant les nanoparticules chitosane/MDR1-siARN

Science.gov (United States)

El-Ariss, Mohamad

Cancer is the leading cause of death in Canada and is responsible for about 30% of all deaths in the country.[1] It is estimated that by 2015, one in four Canadians (24% women and 29% men) will die from cancer. In the world and only for 2012, 14 million new cancer cases and 8.2 million deaths from the disease were reported.[2] The worst is yet to come because, according to World Health Organization, the number of new cases is expected to increase by about 70% over the next two decades. The high mortality associated with cancer is partly explained by the acquisition of drug resistance that make patients refractory to chemotherapy. In fact, cancer cells exposed to a cytotoxic agent during chemotherapy, may develop a resistance to this agent as well as various agents sharing structural or functional similarities. These cancer cells are known for multidrug resistance ("Multiple Drug resistant cells"). The development of resistance to chimiodrogues is a major public health problem that presents an obstacle for the development of new cancer treatments. MCF-7 MDR are established cell lines of human breast cancer that have developed resistance to chimiodrogues such as doxorubicin. MCF-7 MDR have the particularity to over-express P-gp protein that is responsible for the detoxification of cells by reflux of chimiodrogues. The purpose of this study was therefore to reduce the expression of P-gp, encoded by the MDR1 gene (also called gene ABCB1) in cancer cells MCF-7, and re-sensitize MCF-7 MDR cells to anti-cancer treatments. In order to modify MDR1 gene expression, we used small RNAi called siRNA that are specific to the MDR1 gene. In total, 4 duplexes of siRNA have been used: siRNA_1, siRNA_1M, siRNA_2 and siRNA_2M. Each of the duplexes strands is consists of 21 nucleic acids and has two protruding nucleic acids (overhangs) at the 3' end. siRNA_1 and siRNA_1M are complementary to the nucleic acid sequence (577-595 nucleic acids ) of the MDR1 gene, whereas siARN_2 and si

Molecular detection of multidrug-resistant Mycobacterium leprae from Indian leprosy patients.

Science.gov (United States)

Lavania, Mallika; Singh, Itu; Turankar, Ravindra P; Ahuja, Madhvi; Pathak, Vinay; Sengupta, Utpal; Das, Loretta; Kumar, Archana; Darlong, Joydeepa; Nathan, Rajeev; Maseey, Asha

2018-03-01

The emergence of multidrug-resistant (MDR) organisms for any infectious disease is a public health concern. Global efforts to control leprosy by intensive chemotherapy have led to a significant decrease in the number of registered patients. Currently recommended control measures for treating leprosy with multidrug therapy (MDT) were designed to prevent the spread of dapsone-resistant Mycobacterium leprae strains. Here we report the identification of MDR M. leprae from relapse leprosy patients from endemic regions in India. Resistance profiles to rifampicin, dapsone and ofloxacin of the isolated strains were confirmed by identification of mutations in genes previously shown to be associated with resistance to each drug. Between 2009-2016, slit-skin smear samples were collected from 239 relapse and 11 new leprosy cases from hospitals of The Leprosy Mission across India. DNA was extracted from the samples and was analysed by PCR targeting the rpoB, folP and gyrA genes associated with resistance to rifampicin, dapsone and ofloxacin, respectively, in M. leprae. M. leprae Thai-53 (wild-type) and Zensho-4 (MDR) were used as reference strains. Fifteen strains showed representative mutations in at least two resistance genes. Two strains showed mutations in all three genes responsible for drug resistance. Seven, seven and one strain, respectively, showed mutations in genes responsible for rifampicin and dapsone resistance, for dapsone and ofloxacin resistance and for rifampicin and ofloxacin resistance. This study showed the emergence of MDR M. leprae in MDT-treated leprosy patients from endemic regions of India. Copyright © 2017 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

Regorafenib overcomes chemotherapeutic multidrug resistance mediated by ABCB1 transporter in colorectal cancer: In vitro and in vivo study.

Science.gov (United States)

Wang, Yi-Jun; Zhang, Yun-Kai; Zhang, Guan-Nan; Al Rihani, Sweilem B; Wei, Meng-Ning; Gupta, Pranav; Zhang, Xiao-Yu; Shukla, Suneet; Ambudkar, Suresh V; Kaddoumi, Amal; Shi, Zhi; Chen, Zhe-Sheng

2017-06-28

Chemotherapeutic multidrug resistance (MDR) is a significant challenge to overcome in clinic practice. Several mechanisms contribute to MDR, one of which is the augmented drug efflux induced by the upregulation of ABCB1 in cancer cells. Regorafenib, a multikinase inhibitor targeting the RAS/RAF/MEK/ERK pathway, was approved by the FDA to treat metastatic colorectal cancer and gastrointestinal stromal tumors. We investigated whether and how regorafenib overcame MDR mediated by ABCB1. The results showed that regorafenib reversed the ABCB1-mediated MDR and increased the accumulation of [ 3 H]-paclitaxel in ABCB1-overexpressing cells by suppressing efflux activity of ABCB1, but not altering expression level and localization of ABCB1. Regorafenib inhibited ATPase activity of ABCB1. In mice bearing resistant colorectal tumors, regorafenib raised the intratumoral concentration of paclitaxel and suppressed the growth of resistant colorectal tumors. But regorafenib did not induce cardiotoxicity/myelosuppression of paclitaxel in mice. Strategy to reposition one FDA-approved anticancer drug regorafenib to overcome the resistance of another FDA-approved, widely used chemotherapeutic paclitaxel, may be a promising direction for the field of adjuvant chemotherapy. This study provides clinical rationale for combination of conventional chemotherapy and targeted anticancer agents. Copyright © 2017 Elsevier B.V. All rights reserved.

Expression profiles of vault components MVP, TEP1 and vPARP and their correlation to other multidrug resistance proteins in ovarian cancer.

Science.gov (United States)

Szaflarski, Witold; Sujka-Kordowska, Patrycja; Pula, Bartosz; Jaszczyńska-Nowinka, Karolina; Andrzejewska, Małgorzata; Zawierucha, Piotr; Dziegiel, Piotr; Nowicki, Michał; Ivanov, Pavel; Zabel, Maciej

2013-08-01

Vaults are cytoplasmic ribonucleoprotein particles composed of three proteins (MVP, TEP1, vPARP) and vault‑associated RNAs (vRNAs). Although the cellular functions of vaults remain unclear, vaults are strongly linked to the development of multidrug resistance (MDR), the major obstacle to the efficient treatment of cancers. Available published data suggest that vaults and their components are frequently upregulated in broad variety of multidrug-resistant cancer cell lines and tumors of different histological origin. Here, we provide detailed analysis of vault protein expression in post-surgery ovarian cancer samples from patients that were not exposed to chemotherapy. Our analysis suggests that vault proteins are expressed in the ovaries of healthy individuals but their expression in cancer patients is changed. Specifically, MVP, TEP1 and vPARP mRNA levels are significantly decreased in cancer samples with tendency of lower expression in higher-grade tumors. The pattern of vault protein mRNA expression is strongly correlated with the expression of other MDR-associated proteins such as MDR1, MRP1 and BCRP. Surprisingly, the protein levels of MVP, TEP1 and vPARP are actually increased in the higher‑grade tumors suggesting existence of post-transcriptional regulation of vault component production.

Fecal Microbiota Transfer for Multidrug-Resistant Gram-Negatives: A Clinical Success Combined With Microbiological Failure.

Science.gov (United States)

Stalenhoef, Janneke E; Terveer, Elisabeth M; Knetsch, Cornelis W; Van't Hof, Peter J; Vlasveld, Imro N; Keller, Josbert J; Visser, Leo G; Kuijper, Eduard J

2017-01-01

Combined fecal microbiota transfer and antibiotic treatment prevented recurrences of urinary tract infections with multidrug-resistant (MDR) Pseudomonas aeruginosa , but it failed to eradicate intestinal colonization with MDR Escherichia coli . Based on microbiota analysis, failure was not associated with distinct diminished microbiota diversity.

Resistance patterns among multidrug-resistant tuberculosis patients in greater metropolitan Mumbai: trends over time.

Science.gov (United States)

Dalal, Alpa; Pawaskar, Akshay; Das, Mrinalini; Desai, Ranjan; Prabhudesai, Pralhad; Chhajed, Prashant; Rajan, Sujeet; Reddy, Deepesh; Babu, Sajit; Jayalakshmi, T K; Saranchuk, Peter; Rodrigues, Camilla; Isaakidis, Petros

2015-01-01

While the high burden of multidrug-resistant tuberculosis (MDR-TB) itself is a matter of great concern, the emergence and rise of advanced forms of drug-resistance such as extensively drug-resistant TB (XDR-TB) and extremely drug-resistant TB (XXDR-TB) is more troubling. The aim of this study was to investigate the trends over time of patterns of drug resistance in a sample of MDR-TB patients in greater metropolitan Mumbai, India. This was a retrospective, observational study of drug susceptibility testing (DST) results among MDR-TB patients from eight health care facilities in greater Mumbai between 2005 and 2013. We classified resistance patterns into four categories: MDR-TB, pre-XDR-TB, XDR-TB and XXDR-TB. A total of 340 MDR-TB patients were included in the study. Pre-XDR-TB was the most common form of drug-resistant TB observed overall in this Mumbai population at 56.8% compared to 29.4% for MDR-TB. The proportion of patients with MDR-TB was 39.4% in the period 2005-2007 and 27.8% in 2011-2013, while the proportion of those with XDR-TB and XXDR-TB was changed from 6.1% and 0% respectively to 10.6% and 5.6% during the same time period. During the same periods, the proportions of patients with ofloxacin, moxifloxacin and ethionamide resistance significantly increased from 57.6% to 75.3%, from 60.0% to 69.5% and from 24.2% to 52.5% respectively (pMumbai highlight the need for individualized drug regimens, designed on the basis of DST results involving first- and second-line anti-TB drugs and treatment history of the patient. A drug-resistant TB case-finding strategy based on molecular techniques that identify only rifampicin resistance will lead to initiation of suboptimal treatment regimens for a significant number of patients, which may in turn contribute to amplification of resistance and transmission of strains with increasingly advanced resistance within the community.

Circumvention of multi-drug resistance of cancer cells by Chinese herbal medicines.

Science.gov (United States)

Chai, Stella; To, Kenneth Kw; Lin, Ge

2010-07-25

Multi-drug resistance (MDR) of cancer cells severely limits therapeutic outcomes. A proposed mechanism for MDR involves the efflux of anti-cancer drugs from cancer cells, primarily mediated by ATP-binding cassette (ABC) membrane transporters including P-glycoprotein. This article reviews the recent progress of using active ingredients, extracts and formulae from Chinese medicine (CM) in circumventing ABC transporters-mediated MDR. Among the ABC transporters, Pgp is the most extensively studied for its role in MDR reversal effects. While other MDR reversal mechanisms remain unclear, Pgp inhibition is a criterion for further mechanistic study. More mechanistic studies are needed to fully establish the pharmacological effects of potential MDR reversing agents.

Effect of methylxanthines derived from pentoxifylline on P-glycoprotein mediated multidrug resistance

International Nuclear Information System (INIS)

Kupsakova, I.; Drobna, Z.; Breier, A.

2001-01-01

In this paper study of multidrug resistance (MDR) antitumor agents - P-glycoprotein (PGP) is presented. The ability of pentoxifylline (PTX) to depress resistance mediated by overexpression of PGP in mouse leukemic cell line L 121 ONCR resistant to vincristine (VCR) was described earlier. PTX depressed the resistance of these cells in a dose and time dependent manner. This effect was accompanied by increased level of [ 3 H]-vincristine accumulation by these cells. The methylxanthines with different length of this aliphatic side chain were synthesized and their capability to depress MDR was tested. The results indicated that the position of carbonyl group plays a crucial role for the ability of the derivative to depress MDR of L 121 ONCR cells. (authors)

Treatment strategy for a multidrug-resistant Klebsiella UTI.

Science.gov (United States)

Fleming, Erin; Heil, Emily L; Hynicka, Lauren M

2014-01-01

To describe the management strategy for a multidrug-resistant (MDR) Klebsiella urinary tract infection (UTI). A 69-year-old Caucasian woman with a past medical history of recurrent UTIs and a right-lung transplant presented with fever to 101.4°F, chills, malaise, and cloudy, foul-smelling urine for approximately 1 week. She was found to have a MDR Klebsiella UTI that was sensitive to tigecycline and cefepime. To further evaluate the degree of resistance Etest minimum inhibitory concentrations were requested for cefepime, amikacin, meropenem, and ertapenem. The patient received a 14-day course of amikacin, which resulted in resolution of her symptoms. One month later, the patient's UTI symptoms returned. The urine culture again grew MDR Klebsiella, sensitive only to tigecycline. Fosfomycin was initiated and resulted in limited resolution of her symptoms. Colistin was started, however, therapy was discontinued on day 5 secondary to the development of acute kidney injury. Despite the short course of therapy, the patient's symptoms resolved. The case presented lends itself well to numerous discussion items that are important to consider when determining optimal treatment for MDR Gram-negative bacilli (GNBs). Susceptibility testing is an important tool for optimizing antibiotic therapy, however, automated systems may overestimate the susceptibility profile for a MDR GNB. Treatment strategies evaluated to treat MDR GNB, include combination therapy with a carbepenem and synergy using polymyxin. We have described the management strategy for a MDR Klebsiella UTI, the consequences of the initial management strategy, and potential strategies to manage these types of infections in future patients.

Hearing loss in children treated for multidrug-resistant tuberculosis.

Science.gov (United States)

Seddon, James A; Thee, Stephanie; Jacobs, Kayleen; Ebrahim, Adam; Hesseling, Anneke C; Schaaf, H Simon

2013-04-01

The aminoglycosides and polypeptides are vital drugs for the management of multidrug-resistant (MDR) tuberculosis (TB). Both classes of drug cause hearing loss. We aimed to determine the extent of hearing loss in children treated for MDR-TB. In this retrospective study, children (Hearing was assessed and classified using audiometry and otoacoustic emissions. Ninety-four children were included (median age: 43 months). Of 93 tested, 28 (30%) were HIV-infected. Twenty-three (24%) children had hearing loss. Culture-confirmed, as opposed to presumed, diagnosis of TB was a risk factor for hearing loss (OR: 4.12; 95% CI: 1.13-15.0; p = 0.02). Seven of 11 (64%) children classified as having hearing loss using audiometry had progression of hearing loss after finishing the injectable drug. Hearing loss is common in children treated for MDR-TB. Alternative drugs are required for the treatment of paediatric MDR-TB. Copyright © 2012 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

Regulation of multidrug resistance by microRNAs in anti-cancer therapy

Directory of Open Access Journals (Sweden)

Xin An

2017-01-01

Full Text Available Multidrug resistance (MDR remains a major clinical obstacle to successful cancer treatment. Although diverse mechanisms of MDR have been well elucidated, such as dysregulation of drugs transporters, defects of apoptosis and autophagy machinery, alterations of drug metabolism and drug targets, disrupti on of redox homeostasis, the exact mechanisms of MDR in a specific cancer patient and the cross-talk among these different mechanisms and how they are regulated are poorly understood. MicroRNAs (miRNAs are a new class of small noncoding RNAs that could control the global activity of the cell by post-transcriptionally regulating a large variety of target genes and proteins expression. Accumulating evidence shows that miRNAs play a key regulatory role in MDR through modulating various drug resistant mechanisms mentioned above, thereby holding much promise for developing novel and more effective individualized therapies for cancer treatment. This review summarizes the various MDR mechanisms and mainly focuses on the role of miRNAs in regulating MDR in cancer treatment.

Cancer multidrug resistance: mechanisms involved and strategies for circumvention using a drug delivery system.

Science.gov (United States)

Kibria, Golam; Hatakeyama, Hiroto; Harashima, Hideyoshi

2014-01-01

Multidrug resistance (MDR), the principal mechanism by which many cancers develop resistance to chemotherapy, is one of the major obstacles to the successful clinical treatment of various types of cancer. Several key regulators are responsible for mediating MDR, a process that renders chemotherapeutic drugs ineffective in the internal organelles of target cells. A nanoparticulate drug delivery system (DDS) is a potentially promising tool for circumventing such MDR, which can be achieved by targeting tumor cells themselves or tumor endothelial cells that support the survival of MDR cancer cells. The present article discusses key factors that are responsible for MDR in cancer cells, with a specific focus on the application of DDS to overcome MDR via the use of chemotherapy or macromolecules.

MDR1 haplotypes conferring an increased expression of intestinal CYP3A4 rather than MDR1 in female living-donor liver transplant patients.

Science.gov (United States)

Hosohata, Keiko; Masuda, Satohiro; Yonezawa, Atsushi; Katsura, Toshiya; Oike, Fumitaka; Ogura, Yasuhiro; Takada, Yasutsugu; Egawa, Hiroto; Uemoto, Shinji; Inui, Ken-Ichi

2009-07-01

This study investigated whether haplotypes in the multidrug resistance 1 (MDR1) gene had effects on mRNA expression levels of MDR1 and cytochrome P450 (CYP) 3A4, and on the pharmacokinetics of tacrolimus in living-donor liver transplant (LDLT) patients, considering the gender difference. Haplotype analysis of MDR1 with G2677T/A and C3435T was performed in 63 de novo Japanese LDLT patients (17 to 55 years; 44.4% women). The expression levels of MDR1 and CYP3A4 mRNAs in jejunal biopsy specimens were quantified by real-time PCR. Intestinal CYP3A4 mRNA expression levels (amol/microg total RNA) showed significantly higher values in women carrying the 2677TT-3435TT haplotype (median, 10.7; range, 5.92-15.2) than those with 2677GG-3435CC (3.03; range 1.38-4.68) and 2677GT-3435CT (median, 4.31; range, 0.07-9.42) (P = 0.022), but not in men (P = 0.81). However, MDR1 haplotype did not influence mRNA expression levels of MDR1 nor the concentration/dose ratio [(ng/mL)/(mg/day)] of oral tacrolimus for the postoperative 7 days, irrespective of gender. MDR1 haplotype may have a minor association with the tacrolimus pharmacokinetics after LDLT, but could be a good predictor of the inter-individual variation of intestinal expression of CYP3A4 in women.

Use of generalized ordered logistic regression for the analysis of multidrug resistance data.

Science.gov (United States)

Agga, Getahun E; Scott, H Morgan

2015-10-01

Statistical analysis of antimicrobial resistance data largely focuses on individual antimicrobial's binary outcome (susceptible or resistant). However, bacteria are becoming increasingly multidrug resistant (MDR). Statistical analysis of MDR data is mostly descriptive often with tabular or graphical presentations. Here we report the applicability of generalized ordinal logistic regression model for the analysis of MDR data. A total of 1,152 Escherichia coli, isolated from the feces of weaned pigs experimentally supplemented with chlortetracycline (CTC) and copper, were tested for susceptibilities against 15 antimicrobials and were binary classified into resistant or susceptible. The 15 antimicrobial agents tested were grouped into eight different antimicrobial classes. We defined MDR as the number of antimicrobial classes to which E. coli isolates were resistant ranging from 0 to 8. Proportionality of the odds assumption of the ordinal logistic regression model was violated only for the effect of treatment period (pre-treatment, during-treatment and post-treatment); but not for the effect of CTC or copper supplementation. Subsequently, a partially constrained generalized ordinal logistic model was built that allows for the effect of treatment period to vary while constraining the effects of treatment (CTC and copper supplementation) to be constant across the levels of MDR classes. Copper (Proportional Odds Ratio [Prop OR]=1.03; 95% CI=0.73-1.47) and CTC (Prop OR=1.1; 95% CI=0.78-1.56) supplementation were not significantly associated with the level of MDR adjusted for the effect of treatment period. MDR generally declined over the trial period. In conclusion, generalized ordered logistic regression can be used for the analysis of ordinal data such as MDR data when the proportionality assumptions for ordered logistic regression are violated. Published by Elsevier B.V.

Vital and dispensable roles of Plasmodium multidrug resistance transporters during blood- and mosquito-stage development

NARCIS (Netherlands)

Rijpma, S.R.; Velden, M. van der; Annoura, T.; Matz, J.M.; Kenthirapalan, S.; Kooij, T.W.; Matuschewski, K.; Gemert, G.J.A. van; Vegte-Bolmer, M.G. van de; Siebelink-Stoter, R.; Graumans, W.; Ramesar, J.; Klop, O.; Russel, F.G.; Sauerwein, R.W.; Janse, C.J.; Franke-Fayard, B.M.; Koenderink, J.B.

2016-01-01

Multidrug resistance (MDR) proteins belong to the B subfamily of the ATP Binding Cassette (ABC) transporters, which export a wide range of compounds including pharmaceuticals. In this study, we used reverse genetics to study the role of all seven Plasmodium MDR proteins during the life cycle of

Anethole inhibits growth of recently emerged multidrug resistant toxigenic Vibrio cholerae O1 El Tor variant strains in vitro

OpenAIRE

ZAHID, M. Shamim Hasan; AWASTHI, Sharda Prasad; HINENOYA, Atsushi; YAMASAKI, Shinji

2015-01-01

To search natural compounds having inhibitory effect on bacterial growth is important, particularly in view of growing multidrug resistant (MDR) strains of bacterial pathogens. Like other bacterial pathogens, MDR Vibrio cholerae, the causative agent of diarrheal disease cholera, is becoming a great concern. As an approach of searching new antimicrobial agents, here, we show that anethole, a well-studied natural component of sweet fennel and star anise seeds, could potentially inhibit the grow...

Circumvention of multi-drug resistance of cancer cells by Chinese herbal medicines

Directory of Open Access Journals (Sweden)

Lin Ge

2010-07-01

Full Text Available Abstract Multi-drug resistance (MDR of cancer cells severely limits therapeutic outcomes. A proposed mechanism for MDR involves the efflux of anti-cancer drugs from cancer cells, primarily mediated by ATP-binding cassette (ABC membrane transporters including P-glycoprotein. This article reviews the recent progress of using active ingredients, extracts and formulae from Chinese medicine (CM in circumventing ABC transporters-mediated MDR. Among the ABC transporters, Pgp is the most extensively studied for its role in MDR reversal effects. While other MDR reversal mechanisms remain unclear, Pgp inhibition is a criterion for further mechanistic study. More mechanistic studies are needed to fully establish the pharmacological effects of potential MDR reversing agents.

Association between C3435T polymorphism of MDR1 gene and the incidence of drug-resistant epilepsy in the population of Polish children.

Science.gov (United States)

Stasiołek, Mariusz; Romanowicz, Hanna; Połatyńska, Katarzyna; Chamielec, Maciej; Skalski, Dominik; Makowska, Marianna; Smolarz, Beata

2016-07-08

Epilepsy is a disease of neurological character. Approximately one third of epileptic patients demonstrate a drug-resistant phenotype, which is associated with the development of drug-resistant epilepsy. The multidrug resistance protein 1 and glycoprotein P, encoded by MDR1, play a significant role in the transmembrane transport of anti-epileptic agents. Single nucleotide polymorphism C3435T (rs1045642) within MDR1 gene may be associated with an increased expression of P-gp which affects the levels of antiepileptic drugs in plasma. The presented studies analysed the association between C3435T polymorphism of MDR1 gene and the incidence of drug-resistant epilepsy in the population of Polish children. C3435T polymorphism of MDR1 gene was analysed by the high resolution melting technique in a group of patients with drug-resistant (n = 106) and drug-responsive epilepsy (n = 67), as well as in non-epileptic children (n = 98) hospitalised at the Department of Neurology, Polish Mother's Memorial Hospital in Lodz. Genotype and allele distributions were evaluated and their compatibility with the Hardy-Weinberg distribution was assessed by means of the χ(2) test. Genotype and allele evaluation, regarding their relationship with a given feature, was supported by an analysis of odds ratio and 95 % confidence interval, calculated according to the logistic regression model. An association was observed between the incidence rate of DRE and the presence of C allele in C3435T polymorphism of MDR1 gene, which may enhance the risk of the disease. The T allele may then play a protective role. No differences were found in the studied groups, regarding either genotype or allele distribution in reference to patient's gender or concomitant diseases. Following the obtained results, C3435T polymorphism of MDR1 gene may be connected with the incidence of drug-resistant epilepsy in the population of Polish children. ISRCTN ISRCTN73824458. Registered 28th September 2014.

Genome Sequence of a Multidrug-Resistant Strain of Stenotrophomonas maltophilia with Carbapenem Resistance, Isolated from King Abdullah Medical City, Makkah, Saudi Arabia

KAUST Repository

Abdel-Haleem, Alyaa M.; Rchiad, ‍ Zineb; Khan, Babar Khalid; Abdallah, Abdallah; Naeem, Raeece; Nikhat Sheerin, Shalam; Solovyev, Victor; Ahmed, Abdalla; Pain, Arnab

2015-01-01

The emergence and spread of multidrug-resistant (MDR) bacteria have been regarded as major challenges among health care-associated infections worldwide. Here, we report the draft genome sequence of an MDR Stenotrophomonas maltophilia strain isolated in 2014 from King Abdulla Medical City, Makkah, Saudi Arabia.

Genome Sequence of a Multidrug-Resistant Strain of Stenotrophomonas maltophilia with Carbapenem Resistance, Isolated from King Abdullah Medical City, Makkah, Saudi Arabia

KAUST Repository

Abdel-Haleem, Alyaa M.

2015-10-15

The emergence and spread of multidrug-resistant (MDR) bacteria have been regarded as major challenges among health care-associated infections worldwide. Here, we report the draft genome sequence of an MDR Stenotrophomonas maltophilia strain isolated in 2014 from King Abdulla Medical City, Makkah, Saudi Arabia.

Imaging and Targeted Therapy of Multidrug Resistance. Final Report

International Nuclear Information System (INIS)

Piwnica-Worms, David

2009-01-01

One focus area of DOE Office of Science was the Imaging of Gene Expression in Health and Disease in real time in tissue culture, whole animals and ultimately patients. Investigators of the Molecular Imaging Group, Washington University Medical School, ascribed to this objective and a major focus of this group directly tied into the DOE program through their efforts targeting the multidrug resistance gene (MDR1). Our plans for continuation of the program were to extend and build on this line of investigation, incorporating new molecular tools into our methodology to selectively inhibit MDR1 gene expression with novel modulation strategies. Two approaches were to be pursued: (1) high throughput screening of compounds that disrupted mutant p53 transactivation of the MDR1 promoter, and (2) knockdown of MDR1 messenger RNA with retroviral-mediated delivery of small interfering RNA constructs. These would be combined with our continuing effort to synthesize ligands and examine structure-activity relationships of bis-salicylaldehydes labeled with gallium-68 to generate PET agents for imaging MDR1 P-glycoprotein function. We would be uniquely positioned to correlate therapeutic modulation of MDR1 gene expression and protein function in the same systems in vivo using PET and bioluminescence reporters. Use of animal models such as the mdr1a/1b(-/-) gene deleted mice would also have enabled refined analysis of modulation and tracer pharmacokinetics in vivo. Overall, this DOE program and resultant tools would enable direct monitoring of novel therapeutic strategies and the MDR phenotype in relation to gene expression and protein function in vivo.

Multidrug-Resistant Salmonella enterica Serovar Muenchen from Pigs and Humans and Potential Interserovar Transfer of Antimicrobial Resistance

OpenAIRE

Gebreyes, Wondwossen A.; Thakur, Siddhartha

2005-01-01

Salmonella serovars are important reservoirs of antimicrobial resistance. Recently, we reported on multidrug-resistant (MDR) Salmonella enterica serovar Typhimurium strains among pigs with resistance to ampicillin, kanamycin, streptomycin, sulfamethoxazole, and tetracycline (resistance [R] type AKSSuT) and resistance to amoxicillin-clavulanic acid, ampicillin, chloramphenicol, streptomycin, sulfamethoxazole, and tetracycline (R type AxACSSuT). In the present study, 67 isolates (39 from humans...

Comparative evaluation of GenoType MTBDRplus line probe assay with solid culture method in early diagnosis of multidrug resistant tuberculosis (MDR-TB at a tertiary care centre in India.

Directory of Open Access Journals (Sweden)

Raj N Yadav

Full Text Available The objectives of the study were to compare the performance of line probe assay (GenoType MTBDRplus with solid culture method for an early diagnosis of multidrug resistant tuberculosis (MDR-TB, and to study the mutation patterns associated with rpoB, katG and inhA genes at a tertiary care centre in north India.In this cross-sectional study, 269 previously treated sputum-smear acid-fast bacilli (AFB positive MDR-TB suspects were enrolled from January to September 2012 at the All India Institute of Medical Sciences hospital, New Delhi. Line probe assay (LPA was performed directly on the sputum specimens and the results were compared with that of conventional drug susceptibility testing (DST on solid media [Lowenstein Jensen (LJ method].DST results by LPA and LJ methods were compared in 242 MDR-TB suspects. The LPA detected rifampicin (RIF resistance in 70 of 71 cases, isoniazid (INH resistance in 86 of 93 cases, and MDR-TB in 66 of 68 cases as compared to the conventional method. Overall (rifampicin, isoniazid and MDR-TB concordance of the LPA with the conventional DST was 96%. Sensitivity and specificity were 98% and 99% respectively for detection of RIF resistance; 92% and 99% respectively for detection of INH resistance; 97% and 100% respectively for detection of MDR-TB. Frequencies of katG gene, inhA gene and combined katG and inhA gene mutations conferring all INH resistance were 72/87 (83%, 10/87 (11% and 5/87 (6% respectively. The turnaround time of the LPA test was 48 hours.The LPA test provides an early diagnosis of monoresistance to isoniazid and rifampicin and is highly sensitive and specific for an early diagnosis of MDR-TB. Based on these findings, it is concluded that the LPA test can be useful in early diagnosis of drug resistant TB in high TB burden countries.

Genomic analysis of globally diverse Mycobacterium tuberculosis strains provides insights into emergence and spread of multidrug resistance

Science.gov (United States)

Manson, Abigail L.; Cohen, Keira A.; Abeel, Thomas; Desjardins, Christopher A.; Armstrong, Derek T.; Barry, Clifton E.; Brand, Jeannette; Chapman, Sinéad B.; Cho, Sang-Nae; Gabrielian, Andrei; Gomez, James; Jodals, Andreea M.; Joloba, Moses; Jureen, Pontus; Lee, Jong Seok; Malinga, Lesibana; Maiga, Mamoudou; Nordenberg, Dale; Noroc, Ecaterina; Romancenco, Elena; Salazar, Alex; Ssengooba, Willy; Velayati, A. A.; Winglee, Kathryn; Zalutskaya, Aksana; Via, Laura E.; Cassell, Gail H.; Dorman, Susan E.; Ellner, Jerrold; Farnia, Parissa; Galagan, James E.; Rosenthal, Alex; Crudu, Valeriu; Homorodean, Daniela; Hsueh, Po-Ren; Narayanan, Sujatha; Pym, Alexander S.; Skrahina, Alena; Swaminathan, Soumya; Van der Walt, Martie; Alland, David; Bishai, William R.; Cohen, Ted; Hoffner, Sven; Birren, Bruce W.; Earl, Ashlee M.

2017-01-01

Multidrug-resistant tuberculosis (MDR-TB), caused by drug resistant strains of Mycobacterium tuberculosis, is an increasingly serious problem worldwide. In this study, we examined a dataset of 5,310 M. tuberculosis whole genome sequences from five continents. Despite great diversity with respect to geographic point of isolation, genetic background and drug resistance, patterns of drug resistance emergence were conserved globally. We have identified harbinger mutations that often precede MDR. In particular, the katG S315T mutation, conferring resistance to isoniazid, overwhelmingly arose before rifampicin resistance across all lineages, geographic regions, and time periods. Molecular diagnostics that include markers for rifampicin resistance alone will be insufficient to identify pre-MDR strains. Incorporating knowledge of pre-MDR polymorphisms, particularly katG S315, into molecular diagnostics will enable targeted treatment of patients with pre-MDR-TB to prevent further development of MDR-TB. PMID:28092681

Lipoteichoic acid synthesis inhibition in combination with antibiotics abrogates growth of multidrug-resistant Enterococcus faecium

NARCIS (Netherlands)

Paganelli, Fernanda L.; van de Kamer, Tim; Brouwer, Ellen C.; Leavis, Helen L.; Woodford, Neil; Bonten, Marc J M; Willems, Rob J L; Hendrickx, Antoni P A

Enterococcus faecium is a multidrug-resistant (MDR) nosocomial pathogen causing significant morbidity in debilitated patients. New antimicrobials are needed to treat antibiotic-resistant E. faecium infections in hospitalised patients. E. faecium incorporates lipoteichoic acid (LTA)

Infection by multidrug-resistant Elizabethkingia meningoseptica: case reports

Directory of Open Access Journals (Sweden)

Jailton Lobo da Costa Lima

2014-12-01

Full Text Available We report two cases of sepsis in critically ill patients in two tertiary care hospitals in Recife-PE, Brazil. The first case is an 87-year-old patient with chronic myeloid leukemia and sepsis; and the second case is a 93-year-old patient with prostate cancer and septic shock caused by multidrug-resistant (MDR Elizabethkingia meningoseptica.

Targeting protein kinases to reverse multidrug resistance in sarcoma.

Science.gov (United States)

Chen, Hua; Shen, Jacson; Choy, Edwin; Hornicek, Francis J; Duan, Zhenfeng

2016-02-01

Sarcomas are a group of cancers that arise from transformed cells of mesenchymal origin. They can be classified into over 50 subtypes, accounting for approximately 1% of adult and 15% of pediatric cancers. Wide surgical resection, radiotherapy, and chemotherapy are the most common treatments for the majority of sarcomas. Among these therapies, chemotherapy can palliate symptoms and prolong life for some sarcoma patients. However, sarcoma cells can have intrinsic or acquired resistance after treatment with chemotherapeutics drugs, leading to the development of multidrug resistance (MDR). MDR attenuates the efficacy of anticancer drugs and results in treatment failure for sarcomas. Therefore, overcoming MDR is an unmet need for sarcoma therapy. Certain protein kinases demonstrate aberrant expression and/or activity in sarcoma cells, which have been found to be involved in the regulation of sarcoma cell progression, such as cell cycle, apoptosis, and survival. Inhibiting these protein kinases may not only decrease the proliferation and growth of sarcoma cells, but also reverse their resistance to chemotherapeutic drugs to subsequently reduce the doses of anticancer drugs and decrease drug side-effects. The discovery of novel strategies targeting protein kinases opens a door to a new area of sarcoma research and provides insight into the mechanisms of MDR in chemotherapy. This review will focus on the recent studies in targeting protein kinase to reverse chemotherapeutic drug resistance in sarcoma. Copyright © 2015 Elsevier Ltd. All rights reserved.

Prevalence and molecular characterization of pyrazinamide resistance among multidrug-resistant Mycobacterium tuberculosis isolates from Southern China.

Science.gov (United States)

Pang, Yu; Zhu, Damian; Zheng, Huiwen; Shen, Jing; Hu, Yan; Liu, Jie; Zhao, Yanlin

2017-11-06

Pyrazinamide (PZA) plays a unique role in the treatment for multidrug-resistant tuberculosis (MDR-TB) in both first- and second-line regimens. The aim of this study was to investigate the prevalence and molecular characterization of PZA resistance among MDR-TB isolates collected in Chongqing municipality. A total of 133 MDR-TB isolates were collected from the smear-positive tuberculosis patients who were registered at local TB dispensaries of Chongqing. PZA susceptibility testing was determined with a Bactec MGIT 960 system. In addition, the genes conferring for PZA resistance were screened by DNA sequencing. Of these 133 MDR-TB isolates, 83 (62.4%) were determined as PZA-resistant by MGIT 960. In addition, streptomycin- (83.1% vs. 56.0%, P < 0.01), ofloxacin- (51.8% vs. 18.0%, P < 0.01), kanamycin- (22.9% vs. 2.0%, P < 0.01), amikacin- (18.1% vs. 2.0%, P = 0.01), capromycin-resistance (12.0% vs. 2.0%, P = 0.05), were more frequently observed among PZA-resistant isolates compared with PZA-susceptible isolates. Sequence analysis revealed that 73 out of 83 (88.0%) MDR strains harbored a mutation located in the pncA gene, including 55 (75.3%, 55/73) of single nucleotide substitutions and 18 (24.7%, 18/73) of frameshift mutation, while no genetic mutation associated with PZA resistance was found in the rpsA gene. The pncA expression of strains harboring substitution from A to G at position -11 in the promoter region of pncA was significantly lower than that of H37Rv (P < 0.01). In conclusion, our data have demonstrated that the analysis of the pncA gene rather than rpsA gene provides rapid and accurate information regarding PZA susceptibility for MDR-TB isolates in Chongqing. In addition, loss of pncA expression caused by promoter mutation confers PZA resistance in MDR-TB isolates.

Chlortetracycline and florfenicol induce expression of genes associated with pathogenicity in multidrug-resistant Salmonella enterica serovar Typhimurium

Science.gov (United States)

Background Multidrug-resistant (MDR) Salmonella enterica serovar Typhimurium (S. Typhimurium) is a serious public health threat as infections caused by these strains are more difficult and expensive to treat. Livestock serve as a reservoir for MDR Salmonella, and the antibiotics chlortetracycline an...

Serum vitamin d level and susceptibility to multidrug-resistant tuberculosis among household contacts

Science.gov (United States)

Herlina, N.; Sinaga, B. Y. M.; Siagian, P.; Mutiara, E.

2018-03-01

Low levels of vitamin D is a predisposing factor for Multidrug-resistant tuberculosis. Family members in contact with the patient are also at risk of infection. Currently, there is no study that compares vitamin D levels between MDR-TB patients and household contact. This study aims to identify the association between level vitamin D within MDR-TB occurrence. This was a case-control study, with the number of samples in each group (MDR-TB) patients and household contactswere40 people. Each member of each group was checked for vitamin D levels using enzyme-linked immunosorbent assay (ELISA) technique. Statistical analysis was by using Chi-Square analysis using SPSS. Mean levels of vitamin D in MDR-TB patients were 32.21, household contact 31.7. There was anosignificant association between vitamin D levels and MDR-TB occurrence (p=1.0).No significant associationbetween vitamin D level with theMDR-TB occurrence.

In vitro screening of snake venom against multidrug-resistant tuberculosis

Directory of Open Access Journals (Sweden)

Sujay Kumar Bhunia

2015-12-01

Full Text Available The re-emergence of multidrug-resistant tuberculosis (MDR-TB has brought to light the importance of screening effective novel drugs. In the present study, in vitro activities of different snake (Naja naja, Bungarus fasciatus, Daboia russelli russelli, Naja kaouthia venoms have been investigated against clinical isolate of MDR-TB strains. The treatment with all the venoms inhibited the mycobacterial growth for at least a week in common and two of them (Naja naja and Naja kaouthia showed significantly longer inhibition up to two weeks against the MDR-TB strain with single dose and a repetition of those two venoms exhibited inhibition up to more than four weeks.

Development of novel strategies to combat multidrug resistance mediated by efflux transporters and intracellular bacteria

OpenAIRE

Kuriakose, Jerrin

2014-01-01

Multidrug resistance (MDR) is the condition where cancer cells or microorganisms cease to respond to multiple drugs. MDR conferred by efflux transporters, that deprive the bioavailability of drugs at their site of action, are a threat to cancer and malarial chemotherapy. Specifically, the mammalian ABC transporter Pglycoprotein (P-gp) has undermined many drugs in treatment of cancer and other disease states. Mutations in the parasitic transporter Plasmodium falciparum chloroquine resistance t...

Rapid diagnosis of pyrazinamide-resistant multidrug-resistant tuberculosis using a molecular-based diagnostic algorithm.

Science.gov (United States)

Simons, S O; van der Laan, T; Mulder, A; van Ingen, J; Rigouts, L; Dekhuijzen, P N R; Boeree, M J; van Soolingen, D

2014-10-01

There is an urgent need for rapid and accurate diagnosis of pyrazinamide-resistant multidrug-resistant tuberculosis (MDR-TB). No diagnostic algorithm has been validated in this population. We hypothesized that pncA sequencing added to rpoB mutation analysis can accurately identify patients with pyrazinamide-resistant MDR-TB. We identified from the Dutch national database (2007-11) patients with a positive Mycobacterium tuberculosis culture containing a mutation in the rpoB gene. In these cases, we prospectively sequenced the pncA gene. Results from the rpoB and pncA mutation analysis (pncA added to rpoB) were compared with phenotypic susceptibility testing results to rifampicin, isoniazid and pyrazinamide (reference standard) using the Mycobacterial Growth Indicator Tube 960 system. We included 83 clinical M. tuberculosis isolates containing rpoB mutations in the primary analysis. Rifampicin resistance was seen in 72 isolates (87%), isoniazid resistance in 73 isolates (88%) and MDR-TB in 65 isolates (78%). Phenotypic reference testing identified pyrazinamide-resistant MDR-TB in 31 isolates (48%). Sensitivity of pncA sequencing added to rpoB mutation analysis for detecting pyrazinamide-resistant MDR-TB was 96.8%, the specificity was 94.2%, the positive predictive value was 90.9%, the negative predictive value was 98.0%, the positive likelihood was 16.8 and the negative likelihood was 0.03. In conclusion, pyrazinamide-resistant MDR-TB can be accurately detected using pncA sequencing added to rpoB mutation analysis. We propose to include pncA sequencing in every isolate with an rpoB mutation, allowing for stratification of MDR-TB treatment according to pyrazinamide susceptibility. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

Comparison of the pharmacokinetics of two dosage regimens of linezolid in multidrug-resistant and extensively drug-resistant tuberculosis patients.

NARCIS (Netherlands)

Alffenaar, J.W.C.; Altena, R. van; Harmelink, I.M.; Filguera, P.; Molenaar, E.; Wessels, A.M.; Soolingen, D. van; Kosterink, J.G.W.; Uges, D.R.A.; Werf, T.S. van der

2010-01-01

BACKGROUND AND OBJECTIVES: For the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis (TB), potent new drugs are urgently needed. Linezolid is a promising drug, but its use is limited by adverse effects with prolonged administration of 600 mg twice daily. In

Comparison of the Pharmacokinetics of Two Dosage Regimens of Linezolid in Multidrug-Resistant and Extensively Drug-Resistant Tuberculosis Patients

NARCIS (Netherlands)

Alffenaar, Jan-Willem C.; van Altena, Richard; Harmelink, Ilse M.; Filguera, Patricia; Molenaar, Esther; Wessels, A. Mireille A.; van Soolingen, Dick; Kosterink, Jos G. W.; Uges, Donald R. A.; van der Werf, Tjip S.

2010-01-01

Background and Objectives: For the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis (TB), potent new drugs are urgently needed. Linezolid is a promising drug, but its use is limited by adverse effects with prolonged administration of 600 mg twice daily. In

Identification of microRNAs and mRNAs associated with multidrug resistance of human laryngeal cancer Hep-2 cells

Energy Technology Data Exchange (ETDEWEB)

Yin, Wanzhong; Wang, Ping; Wang, Xin [Department of Otorhinolaryngology, Head and Neck Surgery, The First Clinical Hospital, Norman Bethune College of Medicine, Jilin University, Changchun (China); Song, Wenzhi [Department of Stomatology, China-Japan Friendship Hospital, Jilin University, Changchun (China); Cui, Xiangyan; Yu, Hong; Zhu, Wei [Department of Otorhinolaryngology, Head and Neck Surgery, The First Clinical Hospital, Norman Bethune College of Medicine, Jilin University, Changchun (China)

2013-06-12

Multidrug resistance (MDR) poses a serious impediment to the success of chemotherapy for laryngeal cancer. To identify microRNAs and mRNAs associated with MDR of human laryngeal cancer Hep-2 cells, we developed a multidrug-resistant human laryngeal cancer subline, designated Hep-2/v, by exposing Hep-2 cells to stepwise increasing concentrations of vincristine (0.02-0.96'µM). Microarray assays were performed to compare the microRNA and mRNA expression profiles of Hep-2 and Hep-2/v cells. Compared to Hep-2 cells, Hep-2/v cells were more resistant to chemotherapy drugs (∼45-fold more resistant to vincristine, 5.1-fold more resistant to cisplatin, and 5.6-fold more resistant to 5-fluorouracil) and had a longer doubling time (42.33±1.76 vs 28.75±1.12'h, P<0.05), higher percentage of cells in G0/G1 phase (80.98±0.52 vs 69.14±0.89, P<0.05), increased efflux of rhodamine 123 (95.97±0.56 vs 12.40±0.44%, P<0.01), and up-regulated MDR1 expression. A total of 7 microRNAs and 605 mRNAs were differentially expressed between the two cell types. Of the differentially expressed mRNAs identified, regulator of G-protein signaling 10, high-temperature requirement protein A1, and nuclear protein 1 were found to be the putative targets of the differentially expressed microRNAs identified. These findings may open a new avenue for clarifying the mechanisms responsible for MDR in laryngeal cancer.

Identification of microRNAs and mRNAs associated with multidrug resistance of human laryngeal cancer Hep-2 cells

International Nuclear Information System (INIS)

Yin, Wanzhong; Wang, Ping; Wang, Xin; Song, Wenzhi; Cui, Xiangyan; Yu, Hong; Zhu, Wei

2013-01-01

Multidrug resistance (MDR) poses a serious impediment to the success of chemotherapy for laryngeal cancer. To identify microRNAs and mRNAs associated with MDR of human laryngeal cancer Hep-2 cells, we developed a multidrug-resistant human laryngeal cancer subline, designated Hep-2/v, by exposing Hep-2 cells to stepwise increasing concentrations of vincristine (0.02-0.96'µM). Microarray assays were performed to compare the microRNA and mRNA expression profiles of Hep-2 and Hep-2/v cells. Compared to Hep-2 cells, Hep-2/v cells were more resistant to chemotherapy drugs (∼45-fold more resistant to vincristine, 5.1-fold more resistant to cisplatin, and 5.6-fold more resistant to 5-fluorouracil) and had a longer doubling time (42.33±1.76 vs 28.75±1.12'h, P<0.05), higher percentage of cells in G0/G1 phase (80.98±0.52 vs 69.14±0.89, P<0.05), increased efflux of rhodamine 123 (95.97±0.56 vs 12.40±0.44%, P<0.01), and up-regulated MDR1 expression. A total of 7 microRNAs and 605 mRNAs were differentially expressed between the two cell types. Of the differentially expressed mRNAs identified, regulator of G-protein signaling 10, high-temperature requirement protein A1, and nuclear protein 1 were found to be the putative targets of the differentially expressed microRNAs identified. These findings may open a new avenue for clarifying the mechanisms responsible for MDR in laryngeal cancer

Synergistic antimicrobial therapy using nanoparticles and antibiotics for the treatment of multidrug-resistant bacterial infection

Science.gov (United States)

Gupta, Akash; Saleh, Neveen M.; Das, Riddha; Landis, Ryan F.; Bigdeli, Arafeh; Motamedchaboki, Khatereh; Rosa Campos, Alexandre; Pomeroy, Kenneth; Mahmoudi, Morteza; Rotello, Vincent M.

2017-06-01

Infections caused by multidrug-resistant (MDR) bacteria pose a serious global burden of mortality, causing thousands of deaths each year. Antibiotic treatment of resistant infections further contributes to the rapidly increasing number of antibiotic-resistant species and strains. Synthetic macromolecules such as nanoparticles (NPs) exhibit broad-spectrum activity against MDR species, however lack of specificity towards bacteria relative to their mammalian hosts limits their widespread therapeutic application. Here, we demonstrate synergistic antimicrobial therapy using hydrophobically functionalized NPs and fluoroquinolone antibiotics for treatment of MDR bacterial strains. An 8-16-fold decrease in antibiotic dosage is achieved in presence of engineered NPs to combat MDR strains. This strategy demonstrates the potential of using NPs to ‘revive’ antibiotics that have been rendered ineffective due to the development of resistance by pathogenic bacteria.

Low-level quinolone-resistance in multi-drug resistant typhoid

Energy Technology Data Exchange (ETDEWEB)

Mirza, S H; Khan, M A [Armed Forces Inst. of Pathology, Rawalpindi (Pakistan). Dept. of Microbiolgy

2008-01-15

To find out the frequency of low-level quinolone-resistance in Multi-Drug Resistant (MDR) typhoid using nalidixic acid screening disc. Blood was obtained from suspected cases of typhoid fever and cultured in to BacT/ALERT. The positive blood cultures bottles were subcultured. The isolates were identified by colony morphology and biochemical tests using API-20E galleries. Susceptibility testing of isolates was done by modified Kirby-Bauer disc diffusion method on Muellar Hinton Agar. For the isolates, which were resistant to nalidixic acid by disc diffusion method, Minimal Inhibitory Concentrations (MICs) of ciprofloxacin and nalidixic acid were determined by using the E-test strips. Disc diffusion susceptibility tests and MICs were interpreted according to the guidelines provided by National Committee for Control Laboratory Standard (NCCLS). A total of 21(65.5%) out of 32 isolates of Salmonellae were nalidixic acid-resistant by disk diffusion method. All the nalidixic acid-resistant isolates by disc diffusion method were confirmed by MICs for both ciprofloxacin and nalidixic acid. All the nalidixic acid-resistant isolates had a ciprofloxacin MIC of 0.25-1 microg/ml (reduced susceptibility) and nalidixic acid MICs > 32 microg (resistant). Out of all Salmonella isolates, 24 (75%) were found to be MDR, and all were S. typbi. Low-level quinolone-resistance in typhoid was high in this small series. Screening for nalidixic acid resistance with a 30 microg nalidixic acid disk is a reliable and cost-effective method to detect low-level fluoroquinolone resistance, especially in the developing countries. (author)

Low-level quinolone-resistance in multi-drug resistant typhoid

International Nuclear Information System (INIS)

Mirza, S.H.; Khan, M.A.

2008-01-01

To find out the frequency of low-level quinolone-resistance in Multi-Drug Resistant (MDR) typhoid using nalidixic acid screening disc. Blood was obtained from suspected cases of typhoid fever and cultured in to BacT/ALERT. The positive blood cultures bottles were subcultured. The isolates were identified by colony morphology and biochemical tests using API-20E galleries. Susceptibility testing of isolates was done by modified Kirby-Bauer disc diffusion method on Muellar Hinton Agar. For the isolates, which were resistant to nalidixic acid by disc diffusion method, Minimal Inhibitory Concentrations (MICs) of ciprofloxacin and nalidixic acid were determined by using the E-test strips. Disc diffusion susceptibility tests and MICs were interpreted according to the guidelines provided by National Committee for Control Laboratory Standard (NCCLS). A total of 21(65.5%) out of 32 isolates of Salmonellae were nalidixic acid-resistant by disk diffusion method. All the nalidixic acid-resistant isolates by disc diffusion method were confirmed by MICs for both ciprofloxacin and nalidixic acid. All the nalidixic acid-resistant isolates had a ciprofloxacin MIC of 0.25-1 microg/ml (reduced susceptibility) and nalidixic acid MICs > 32 microg (resistant). Out of all Salmonella isolates, 24 (75%) were found to be MDR, and all were S. typbi. Low-level quinolone-resistance in typhoid was high in this small series. Screening for nalidixic acid resistance with a 30 microg nalidixic acid disk is a reliable and cost-effective method to detect low-level fluoroquinolone resistance, especially in the developing countries. (author)

Aggressive regimens for multidrug-resistant tuberculosis decrease all-cause mortality.

Directory of Open Access Journals (Sweden)

Carole D Mitnick

Full Text Available A better understanding of the composition of optimal treatment regimens for multidrug-resistant tuberculosis (MDR-TB is essential for expanding universal access to effective treatment and for developing new therapies for MDR-TB. Analysis of observational data may inform the definition of an optimized regimen.This study assessed the impact of an aggressive regimen-one containing at least five likely effective drugs, including a fluoroquinolone and injectable-on treatment outcomes in a large MDR-TB patient cohort.This was a retrospective cohort study of patients treated in a national outpatient program in Peru between 1999 and 2002. We examined the association between receiving an aggressive regimen and the rate of death.In total, 669 patients were treated with individualized regimens for laboratory-confirmed MDR-TB. Isolates were resistant to a mean of 5.4 (SD 1.7 drugs. Cure or completion was achieved in 66.1% (442 of patients; death occurred in 20.8% (139. Patients who received an aggressive regimen were less likely to die (crude hazard ratio [HR]: 0.62; 95% CI: 0.44,0.89, compared to those who did not receive such a regimen. This association held in analyses adjusted for comorbidities and indicators of severity (adjusted HR: 0.63; 95% CI: 0.43,0.93.The aggressive regimen is a robust predictor of MDR-TB treatment outcome. TB policy makers and program directors should consider this standard as they design and implement regimens for patients with drug-resistant disease. Furthermore, the aggressive regimen should be considered the standard background regimen when designing randomized trials of treatment for drug-resistant TB.

Thermodynamic secrets of multidrug resistance: A new take on transport mechanisms of secondary active antiporters.

Science.gov (United States)

Zhang, Xuejun C; Liu, Min; Lu, Guangyuan; Heng, Jie

2018-03-01

Multidrug resistance (MDR) presents a growing challenge to global public health. Drug extrusion transporters play a critical part in MDR; thus, their mechanisms of substrate recognition are being studied in great detail. In this work, we review common structural features of key transporters involved in MDR. Based on our membrane potential-driving hypothesis, we propose a general energy-coupling mechanism for secondary-active antiporters. This putative mechanism provides a common framework for understanding poly-specificity of most-if not all-MDR transporters. © 2017 The Protein Society.

Clusters of Multidrug-Resistant Mycobacterium tuberculosis Cases, Europe

Science.gov (United States)

Kremer, Kristin; Heersma, Herre; Van Soolingen, Dick

2009-01-01

Molecular surveillance of multidrug-resistant tuberculosis (MDR TB) was implemented in Europe as case reporting in 2005. For all new MDR TB cases detected from January 2003 through June 2007, countries reported case-based epidemiologic data and DNA fingerprint patterns of MDR TB strains when available. International clusters were detected and analyzed. From 2003 through mid-2007 in Europe, 2,494 cases of MDR TB were reported from 24 European countries. Epidemiologic and molecular data were linked for 593 (39%) cases, and 672 insertion sequence 6110 DNA fingerprint patterns were reported from 19 countries. Of these patterns, 288 (43%) belonged to 18 European clusters; 7 clusters (242/288 cases, 84%) were characterized by strains of the Beijing genotype family, including the largest cluster (175/288 cases, 61%). Both clustering and the Beijing genotype were associated with strains originating in eastern European countries. Molecular cluster detection contributes to identification of transmission profile, risk factors, and control measures. PMID:19624920

Fecal Microbiota Transplantation Inhibits Multidrug-Resistant Gut Pathogens: Preliminary Report Performed in an Immunocompromised Host.

Science.gov (United States)

Biliński, Jarosław; Grzesiowski, Paweł; Muszyński, Jacek; Wróblewska, Marta; Mądry, Krzysztof; Robak, Katarzyna; Dzieciątkowski, Tomasz; Wiktor-Jedrzejczak, Wiesław; Basak, Grzegorz W

2016-06-01

Colonization of the gastrointestinal tract with multidrug-resistant (MDR) bacteria is a consequence of gut dysbiosis. We describe the successful utilization of fecal microbiota transplantation to inhibit Klebsiella pneumoniae MBL(+) and Escherichia coli ESBL(+) gut colonization in the immunocompromised host as a novel tool in the battle against MDR microorganisms. ClinicalTrials.gov identifier NCT02461199.

Expression of multidrug resistance gene and P-glycoprotein in nasopharyngealcarcinoma cells after irradiation

International Nuclear Information System (INIS)

Wang Ruoyu; Wang Hui; Fan Kai; Lv Shen

2007-01-01

Objective: To mimick a clinical fractionated protocol of exposure to X-radiation in vitro in order to investigate the changes in the function of MDR1 and P-gp in nasopharyngeal carcinoma (NPC) CNE cell before and after irradiation to determine the sequential order of radiotherapy and chemotherapy or the time of chemotherapy after radiotherapy in the treatment of NPC. Methods: Exponentially growing CNE cells were treated with fractionated X-radiation with total dose of 10 Gy (2 Gy per day for 5 days consecutively) in vitro. The expression of MDR1 gene was examined in CNE cells before irradiation and on days 4,8,13,17 and 21 after irradiation by RT-PCR, and its protein P-gp were detected by immunocytochemistry. The function of multidrug resistance protein P-gp was examined by MTT method. Results: Expression of MDR1 gene was below the level of detection before irradiation. Irradiation induced an overexpression of MDR1 gene on day 4, expression of MDR1 was decreased from day 8 to day 21. The overall expression of MDR1 was significantly more than that before irradiation (P<0.05) Expression of P-gp was below the level of detection before irradiation, which demonstrated that irradiation induced an overexpression of P-gp. This overexpression was increased from day 8 to day 21. The overpression of MDR1 gene was maintained dining a short period, however, the emergence of overpression of protein P-gp was later than that of MDR1 gene. Resistance index was 1 for both pre-irradiation and on day 8, and up to 8,10,11.2 on days 13, 17 and 21, respectively. The change of resistance index was accordant with the condition of overexpression of P-gp . Conclusions: Expression of P-gp in nasopharyngeal carcinoma (NPC) CNE cell was below the level of detection before irradiation. Irradiation can induce an overexpression of MDR1 gene and its protein P-gp in CNE cells. The overexpression of MDR1 gene and its protein P-gp lasted a long term. (authors)

Complete Sequences of Six IncA/C Plasmids of Multidrug-Resistant Salmonella enterica subsp. enterica Serotype Newport.

Science.gov (United States)

Cao, Guojie; Allard, Marc W; Hoffmann, Maria; Monday, Steven R; Muruvanda, Tim; Luo, Yan; Payne, Justin; Rump, Lydia; Meng, Kevin; Zhao, Shaohua; McDermott, Patrick F; Brown, Eric W; Meng, Jianghong

2015-02-26

Multidrug-resistant (MDR) Salmonella enterica subsp. enterica serotype Newport has been a long-standing public health concern in the United States. We present the complete sequences of six IncA/C plasmids from animal-derived MDR S. Newport ranging from 80.1 to 158.5 kb. They shared a genetic backbone with S. Newport IncA/C plasmids pSN254 and pAM04528. Copyright © 2015 Cao et al.

Bypassing multidrug resistance in human breast cancer cells with lipid/polymer particle assemblies

Directory of Open Access Journals (Sweden)

Li B

2012-01-01

Full Text Available Bo Li1, Hui Xu2, Zhen Li1, Mingfei Yao1, Meng Xie1, Haijun Shen1, Song Shen1, Xinshi Wang1, Yi Jin11College of Pharmaceutical sciences, Zhejiang University, Hangzhou, 2No. 202 Hospital of People's Liberation Army, Shenyang, ChinaBackground: Multidrug resistance (MDR mediated by the overexpression of adenosine triphosphate (ATP-binding cassette (ABC transporters, such as P-glycoprotein (P-gp, remains one of the major obstacles to effective cancer chemotherapy. In this study, lipid/particle assemblies named LipoParticles (LNPs, consisting of a dimethyldidodecylammonium bromide (DMAB-modified poly(lactic-co-glycolic acid (PLGA nanoparticle core surrounded by a 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC shell, were specially designed for anticancer drugs to bypass MDR in human breast cancer cells that overexpress P-gp.Methods: Doxorubicin (DOX, a chemotherapy drug that is a P-gp substrate, was conjugated to PLGA and encapsulated in the self-assembled LNP structure. Physiochemical properties of the DOX-loaded LNPs were characterized in vitro. Cellular uptake, intracellular accumulation, and cytotoxicity were compared in parental Michigan Cancer Foundation (MCF-7 cells and P-gp-overexpressing, resistant MCF-7/adriamycin (MCF-7/ADR cells.Results: This study found that the DOX formulated in LNPs showed a significantly increased accumulation in the nuclei of drug-resistant cells relative to the free drug, indicating that LNPs could alter intracellular traffic and bypass drug efflux. The cytotoxicity of DOX loaded-LNPs had a 30-fold lower half maximal inhibitory concentration (IC50 value than free DOX in MCF-7/ADR, measured by the colorimetric cell viability (MTT assay, correlated with the strong nuclear retention of the drug.Conclusion: The results show that this core-shell lipid/particle structure could be a promising strategy to bypass MDR.Keywords: chemotherapy, drug delivery, polymeric nanoparticles, multidrug resistance

News in the studies of multidrug resistance of breast cancer cells

Directory of Open Access Journals (Sweden)

A. A. Stavrovskaya

2015-01-01

Full Text Available Breast cancer (BC is the most common cancer among women in Russia. One of the main treatment methods of BC is systemic chemotherapy. Multidrug resistance of tumor cells (MDR is the important hindrance on the way to successful chemotherapy. The new data concerning molecular mechanisms of MDR will be presented in this review. The recent data concerning some new biological prognostic markers will be also discussed. There are data showing that transporters of ABC family (ABC transporters influence tumor progression not only by MDR induction but also by the influence on the traits of malignancy in tumor cells. The results of the studies of ABC transporters, participation in the processes of accumulation of tumor stem cells under the influence of chemotherapy will be discussed. The problem of the participation of ABC transporters in the phenomenon of influence of PI3K/AKT/PTEN signal transduction pathway on the MDR regulation is discussed. The results of the studies of the role of microRNA deregulation in breast cancer drug resistance as well as studies of some epigenetic mechanisms of MDR regulation will be considered. Protein phosphatase 2A (PP2A, serine/threonine phosphatase, PTK7 (protein tyrosine kinase 7. fascin (an actin bundling cytoskeletal protein multifunctional YB-1 protein will considered as new BC prognostic markers. The perspectives of MDR studies will be discussed as well.

Congenital Multidrug-resistant Tuberculosis in a Neonate: A Case Report.

Science.gov (United States)

Lhadon, Tenzin; Jullien, Sophie

2018-04-20

Multidrug-resistant tuberculosis (MDR-TB) is a well-identified raising public health concern worldwide. However, the data available on MDR-TB in children and particularly in the neonate age group are limited. Congenital tuberculosis (TB) is rare, and its diagnosis is challenging because of non-specific manifestations. The choice of anti-tubercular drugs is difficult because of the lack of international consensus as a consequence of the scarcity of evidence-based data on this age group. We hereby present a case from Bhutan of a 23-day-old male neonate with congenital MDR-TB. His mother was diagnosed with disseminated TB, and treatment was commenced 11 days post-partum. Congenital transmission of TB was suspected, as direct postnatal transmission was unlikely and thorough screening of contacts for TB was negative. In this case, the mother's MDR-TB status was revealed only after her newborn's MDR-TB diagnosis.

Multidrug-resistant Salmonella enterica serovar Typhimurium isolates are resistant to antibiotics that influence their swimming and swarming motility

Science.gov (United States)

Motile bacteria utilize one or more strategies for movement, such as darting, gliding, sliding, swarming, swimming, and twitching. The ability to move is considered a virulence factor in many pathogenic bacteria, including Salmonella. Multidrug-resistant (MDR) Salmonella encodes acquired factors t...

Anethole inhibits growth of recently emerged multidrug resistant toxigenic Vibrio cholerae O1 El Tor variant strains in vitro.

Science.gov (United States)

Zahid, M Shamim Hasan; Awasthi, Sharda Prasad; Hinenoya, Atsushi; Yamasaki, Shinji

2015-05-01

To search natural compounds having inhibitory effect on bacterial growth is important, particularly in view of growing multidrug resistant (MDR) strains of bacterial pathogens. Like other bacterial pathogens, MDR Vibrio cholerae, the causative agent of diarrheal disease cholera, is becoming a great concern. As an approach of searching new antimicrobial agents, here, we show that anethole, a well-studied natural component of sweet fennel and star anise seeds, could potentially inhibit the growth of MDR O1 El Tor biotype, the ongoing 7th cholera pandemic variant strains of toxigenic V. cholerae. The minimum inhibitory concentration (MIC) of anethole against diverse O1 El Tor biotype strains is evaluated as 200 µg/ml. Moreover, the effect of anethole is bactericidal and exerts rapid-killing action on V. cholerae cells. This study is the first report which demonstrates that anethole, purified from natural compound, is a potent inhibitor of growth of toxigenic V. cholerae. Our data suggest that anethole could be a potential antimicrobial drug candidate, particularly against MDR V. cholerae mediated infections.

Carcinogen-induced mdr overexpression is associated with xenobiotic resistance in rat preneoplastic liver nodules and hepatocellular carcinomas.

Science.gov (United States)

Fairchild, C R; Ivy, S P; Rushmore, T; Lee, G; Koo, P; Goldsmith, M E; Myers, C E; Farber, E; Cowan, K H

1987-11-01

We have previously reported the isolation of a human breast cancer cell line resistant to doxorubicin (adriamycin; AdrR MCF-7 cells) that has also developed the phenotype of multidrug resistance (MDR). MDR in this cell line is associated with increased expression of mdr (P glycoprotein) gene sequences. The development of MDR in AdrR MCF-7 cells is also associated with changes in the expression of several phase I and phase II drug-detoxifying enzymes. These changes are remarkably similar to those associated with development of xenobiotic resistance in rat hyperplastic liver nodules, a well-studied model system of chemical carcinogenesis. Using an mdr-encoded cDNA sequence isolated from AdrR MCF-7 cells, we have examined the expression of mdr sequences in rat livers under a variety of experimental conditions. The expression of mdr increased 3-fold in regenerating liver. It was also elevated (3- to 12-fold) in several different samples of rat hyperplastic nodules and in four of five hepatomas that developed in this system. This suggests that overexpression of mdr, a gene previously associated with resistance to antineoplastic agents, may also be involved in the development of resistance to xenobiotics in rat hyperplastic nodules. In addition, although the acute administration of 2-acetylaminofluorene induced an 8-fold increase in hepatic mdr-encoded RNA, performance of a partial hepatectomy either before or after administration of 2-acetylaminofluorene resulted in a greater than 80-fold increase in mdr gene expression over that in normal untreated livers. This represents an important in vivo model system in which to study the acute regulation of this drug resistance gene.

Photochemical internalisation of chemotherapy potentiates killing of multidrug-resistant breast and bladder cancer cells

OpenAIRE

Adigbli, D. K.; Wilson, D. G. G.; Farooqui, N.; Sousi, E.; Risley, P.; Taylor, I.; MacRobert, A. J.; Loizidou, M.

2007-01-01

Multidrug resistance (MDR) is the major confounding factor in adjuvant solid tumour chemotherapy. Increasing intracellular amounts of chemotherapeutics to circumvent MDR may be achieved by a novel delivery method, photochemical internalisation (PCI). PCI consists of the co-administration of drug and photosensitiser; upon light activation the latter induces intracellular release of organelle-bound drug. We investigated whether co-administration of hypericin ( photosensitiser) with mitoxantrone...

Photochemical internalisation of chemotherapy potentiates killing of multidrug-resistant breast and bladder cancer cells

OpenAIRE

Adigbli, D K; Wilson, D G G; Farooqui, N; Sousi, E; Risley, P; Taylor, I; MacRobert, A J; Loizidou, M

2007-01-01

Multidrug resistance (MDR) is the major confounding factor in adjuvant solid tumour chemotherapy. Increasing intracellular amounts of chemotherapeutics to circumvent MDR may be achieved by a novel delivery method, photochemical internalisation (PCI). PCI consists of the co-administration of drug and photosensitiser; upon light activation the latter induces intracellular release of organelle-bound drug. We investigated whether co-administration of hypericin (photosensitiser) with mitoxantrone ...

[Multidrug-resistant tuberculosis: challenges of a global emergence].

Science.gov (United States)

Comolet, T

2015-10-01

Drug-resistant tuberculosis, in particular Multi-Drug Resistant (MDR-TB) is an increasing global concern and a major burden for some developing countries, especially the BRICS. It is assumed that every year roughly 350 000 new MDR-TB cases occur in the world, on average in 20.5% of TB patients that have been previously treated but also in 3.5% of persons that have never been on TB treatment before. The global distribution of cases is very heterogeneous and is now better understood thanks to a growing number of specific surveys and routine surveillance systems: incidence is much higher in southern Africa and in all countries formerly part of the USSR. Countries with weak health systems and previously inefficient TB control programs are highly vulnerable to MDR epidemics because program failures do help creating, maintaining and spreading resistances. Global response is slowly rolled out and diagnosis capacities are on the rise (mostly with genotypic methods) but adequate and successful treatment and care is still limited to a minority of global cases. From a public health perspective the MDR-TB growing epidemics will not be controlled merely by the introduction of few new antibiotics because it is also linked to patient's compliance and adequate case management supported by efficient TB program. In depth quality improvement will only be achieved after previous errors are thoroughly analyzed and boldly corrected.

Molecular Genetic Analysis of Multi-drug Resistance in Indian Isolates of Mycobacterium tuberculosis

Directory of Open Access Journals (Sweden)

Noman Siddiqi

1998-09-01

Full Text Available A total of 116 isolates from patients attending the out-patient department at the All India Institute of Medical Sciences, New Delhi and the New Delhi Tuberculosis Centre, New Delhi, India were collected. They were analyzed for resistance to drugs prescribed in the treatment for tuberculosis. The drug resistance was initially determined by microbiological techniques. The Bactec 460TB system was employed to determine the type and level of resistance in each isolate. The isolates were further characterized at molecular level. The multi-drug loci corresponding to rpo b, gyr A, kat G were studied for mutation(s by the polymerase chain reaction-single strand conformational polymorphism (PCR-SSCP technique. The SSCP positive samples were sequenced to characterize the mutations in rpo b, and gyr A loci. While previously reported mutations in the gyr A and rpo b loci were found to be present, several novel mutations were also scored in the rpo b locus. Interestingly, analysis of the gyr A locus showed the presence of point mutation(s that could not be detected by PCR-SSCP. Furthermore, rifampicin resistance was found to be an important marker for checking multi-drug resistance (MDR in clinical isolates of Mycobacterium tuberculosis. This is the first report on molecular genetic analysis of MDR tuberculosis one from India, highlights the increasing incidence of MDR in the Indian isolates of M. tuberculosis.

Incidence of multidrug-resistant, extensively drug-resistant and pan-drug-resistant bacteria in children hospitalized at Dr. Hasan Sadikin general hospital Bandung Indonesia

Science.gov (United States)

Adrizain, R.; Suryaningrat, F.; Alam, A.; Setiabudi, D.

2018-03-01

Antibiotic resistance has become a global issue, with 700,000 deaths attributable to multidrug-resistance (MDR) occurring each year. Centers for Disease Control and Prevention (CDC) show rapidly increasing rates of infection due to antibiotic-resistant bacteria. The aim of the study isto describe the incidence of MDR, extensively drug-resistant (XDR) and pan drug-resistant (PDR) in Enterococcus spp., Staphylococcus aureus, K. pneumonia, Acinetobacter baumanii, P. aeruginosin, and Enterobacter spp. (ESKAPE) pathogens in children admitted to Dr. Hasan Sadikin Hospital. All pediatric patients having blood culture drawn from January 2015 to December 2016 were retrospectively studied. Data include the number of drawn blood culture, number of positive results, type of bacteria, sensitivity pattern. International standard definitions for acquired resistance by ECDC and CDC was used as definitions for MDR, XDR and PDR bacteria. From January 2015 to December 2016, 299 from 2.542 (11.7%) blood culture was positive, with Staphylococcus aureus, Enterococcus spp., Enterobacteriaceae, Pseudomonas aeruginosa, Acinetobacter spp., respectively 5, 6, 24, 5, 20 with total 60 (20%). The MDR and XDR pathogen found were 47 and 13 patients, respectively.

Functional analysis of P-glycoprotein and multidrug resistance associated protein related multidrug resistance in AML-blasts.

Science.gov (United States)

Brügger, D; Herbart, H; Gekeler, V; Seitz, G; Liu, C; Klingebiel, T; Orlikowsky, T; Einsele, H; Denzlinger, C; Bader, P; Niethammer, D; Beck, J F

1999-05-01

Despite the high effectiveness of various P-glycoprotein (P-gp) modulating substances in vitro their clinical value e.g. for combination treatment of acute myelogenous leukemias (AML) remains still unclear. This might be explainable by recent findings that other factors than P-gp (e.g. the multidrug resistance associated protein (MRP)) may also be involved in clinical occurring drug resistance. To study P-gp and MRP mediated MDR in AML blasts from patients with relapses at the functional level we measured rhodamine 123 (RHO) efflux in combination with a P-gp specific (SDZ PSC 833) or a MRP specific (MK571) modulator, respectively. Furthermore, direct antineoplastic drug action was monitored by determination of damaged cell fraction of a blast population using flow cytometry. We generally found strongly modulated RHO efflux by SDZ PSC 833 but slight RHO-efflux modulation by MK571 in blasts from relapsed states of AML expressing MDR1 or MRP mRNA at various levels. We could not demonstrate, though, significant PSC 833 or MK571 mediated modulation of the cytotoxic effects of etoposide. The results point to the possibility that combination of etoposide and a modulator might not improve responses to chemotherapy by targeting P-gp or MRP exclusively.

Dioscin enhances methotrexate absorption by down-regulating MDR1 in vitro and in vivo

Energy Technology Data Exchange (ETDEWEB)

Wang, Lijuan, E-mail: jlwang1979@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Wang, Changyuan, E-mail: wangcyuan@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Peng, Jinyong, E-mail: jinyongpeng2005@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Liu, Qi, E-mail: llaqii@yahoo.com.cn [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Meng, Qiang, E-mail: mengq531@yahoo.cn [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Sun, Huijun, E-mail: sunhuijun@hotmail.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Huo, Xiaokui, E-mail: huoxiaokui@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); and others

2014-06-01

The purpose of this study was to investigate the enhancing effect of dioscin on the absorption of methotrexate (MTX) and clarify the molecular mechanism involved in vivo and in vitro. Dioscin increased MTX chemosensitivity and transepithelial flux in the absorptive direction, significantly inhibiting multidrug resistance 1 (MDR1) mRNA and protein expression and MDR1 promoter and nuclear factor κ-B (NF-κB) activities in Caco-2 cells. Moreover, inhibitor κB-α (IκB-α) degradation was inhibited by dioscin. Dioscin enhanced the intracellular concentration of MTX by down-regulating MDR1 expression through a mechanism that involves NF-κB signaling pathway inhibition in Caco-2 cells. Dioscin strengthened MTX absorption by inhibiting MDR1 expression in rat intestine. In addition, even though MTX is absorbed into the enterocytes, there was no increase in toxicity observed, and that, in fact, decreased toxicity was seen. - Highlights: • Dioscin raised MTX concentration by inhibiting MDR1 in Caco-2 cells. • Dioscin suppresses MDR1 by inhibiting NF-κB signaling pathway in Caco-2 cells. • Dioscin can enhance MTX absorption via inhibiting MDR1 in vivo and in vitro. • Dioscin did not increase MTX-induced gastrointestinal mucosal toxicity.

Distribution and physiology of ABC-Type transporters contributing to multidrug resistance in bacteria

NARCIS (Netherlands)

Lubelski, Jacek; Konings, Wil N.; Driessen, Arnold J. M.

Membrane proteins responsible for the active efflux of structurally and functionally unrelated drugs were first characterized in higher eukalyotes. To date, a vast number of transporters contributing to multidrug resistance (MDR transporters) have been reported for a large variety of organisms.

Frequent Multidrug-Resistant Acinetobacter baumannii Contamination of Gloves, Gowns, and Hands of Healthcare Workers

Science.gov (United States)

Morgan, Daniel J.; Liang, Stephen Y.; Smith, Catherine L.; Johnson, J. Kristie; Harris, Anthony D.; Furuno, Jon P.; Thom, Kerri A.; Snyder, Graham M.; Day, Hannah R.; Perencevich, Eli N.

2010-01-01

BACKGROUND Multidrug-resistant (MDR) gram-negative bacilli are important nosocomial pathogens. OBJECTIVE To determine the incidence of transmission of MDR Acinetobacter baumannii and Pseudomonas aeruginosa from patients to healthcare workers (HCWs) during routine patient care. DESIGN Prospective cohort study. SETTING Medical and surgical intensive care units. METHODS We observed HCWs who entered the rooms of patients colonized with MDR A. baumannii or colonized with both MDR A. baumannii and MDR P. aeruginosa. We examined their hands before room entry, their disposable gloves and/or gowns upon completion of patient care, and their hands after removal of gloves and/or gowns and before hand hygiene. RESULTS Sixty-five interactions occurred with patients colonized with MDR A. baumannii and 134 with patients colonized with both MDR A. baumannii and MDR P. aeruginosa. Of 199 interactions between HCWs and patients colonized with MDR A. baumannii, 77 (38.7% [95% confidence interval {CI}, 31.9%–45.5%]) resulted in HCW contamination of gloves and/or gowns, and 9 (4.5% [95% CI, 1.6%–7.4%]) resulted in contamination of HCW hands after glove removal before hand hygiene. Of 134 interactions with patients colonized with MDR P. aeruginosa, 11 (8.2% [95% CI, 3.6%–12.9%]) resulted in HCW contamination of gloves and/or gowns, and 1 resulted in HCW contamination of hands. Independent risk factors for contamination with MDR A. baumannii were manipulation of wound dressing (adjusted odds ratio [aOR], 25.9 [95% CI, 3.1–208.8]), manipulation of artificial airway (aOR, 2.1 [95% CI, 1.1–4.0]), time in room longer than 5 minutes (aOR, 4.3 [95% CI, 2.0–9.1]), being a physician or nurse practitioner (aOR, 7.4 [95% CI, 1.6–35.2]), and being a nurse (aOR, 2.3 [95% CI, 1.1–4.8]). CONCLUSIONS Gowns, gloves, and unwashed hands of HCWs were frequently contaminated with MDR A. baumannii. MDR A. baumannii appears to be more easily transmitted than MDR P. aeruginosa and perhaps more

Mesoporous silica nanoparticles loading doxorubicin reverse multidrug resistance: performance and mechanism

Science.gov (United States)

Shen, Jianan; He, Qianjun; Gao, Yu; Shi, Jianlin; Li, Yaping

2011-10-01

Multidrug resistance (MDR) is one of the major obstacles for successful chemotherapy in cancer. One of the effective approaches to overcome MDR is to use nanoparticle-mediated drug delivery to increase drug accumulation in drug resistant cancer cells. In this work, we first report that the performance and mechanism of an inorganic engineered delivery system based on mesoporous silica nanoparticles (MSNs) loading doxorubicin (DMNs) to overcome the MDR of MCF-7/ADR (a DOX-resistant and P-glycoprotein (P-gp) over-expression cancer cell line). The experimental results showed that DMNs could enhance the cellular uptake of doxorubicin (DOX) and increase the cell proliferation suppression effect of DOX against MCF-7/ADR cells. The IC50 of DMNs against MCF-7/ADR cells was 8-fold lower than that of free DOX. However, an improved effect of DOX in DMNs against MCF-7 cells (a DOX-sensitive cancer cell line) was not found. The increased cellular uptake and nuclear accumulation of DOX delivered by DMNs in MCF-7/ADR cells was confirmed by confocal laser scanning microscopy, and could result from the down-regulation of P-gp and bypassing the efflux action by MSNs themselves. The cellular uptake mechanism of DMNs indicated that the macropinocytosis was one of the pathways for the uptake of DMNs by MCF-7/ADR cells. The in vivo biodistribution showed that DMNs induced a higher accumulation of DOX in drug resistant tumors than free DOX. These results suggested that MSNs could be an effective delivery system to overcome multidrug resistance.

Effectiveness of a novel cellular therapy to treat multidrug-resistant tuberculosis

Directory of Open Access Journals (Sweden)

Aliaksandr Skrahin

2016-08-01

Full Text Available Introduction: We urgently need novel treatments for multidrug-resistant tuberculosis (MDR-TB. Autologous mesenchymal stromal cell (MSC infusion is one such possibility due to its potential to repair damaged lung tissue and boost immune responses. We aimed to assess the effectiveness of MSC to improve outcomes among MDR-TB patients. Methods: We analyzed outcomes for 108 Belarussian MDR-TB patients receiving chemotherapy. Thirty-six patients (“cases” also had MSCs extracted, cultured and re-infused (average time from chemotherapy start to infusion was 49 days; another 36 patients were “study controls”. We identified another control group: 36 patients from the Belarussian surveillance database (“surveillance controls” 1:1 matched to cases. Results: Of the cases, 81% had successful outcomes versus 42% of surveillance controls and 39% of study controls. Successful outcome odds were 6.5 (95% Confidence Interval: 1.2–36.2, p=0.032 times greater for cases than surveillance controls (age-adjusted. Radiological improvement was more likely in cases than study controls. Culture analysis prior to infusion demonstrated a poorer initial prognosis in cases, yet despite this they had better outcomes than the control groups. Conclusion: MSC treatment could vastly improve outcomes for MDR-TB patients. Our findings could revolutionize therapy options and have strong implications for future directions of MDR-TB therapy research. Keywords: Mesenchymal stromal cells, Extensively drug resistant, Outcomes, Treatment

Multidrug-resistant and extensively drug-resistant tuberculosis: implications for the HIV epidemic and antiretroviral therapy rollout in South Africa.

Science.gov (United States)

Andrews, Jason R; Shah, N Sarita; Gandhi, Neel; Moll, Tony; Friedland, Gerald

2007-12-01

Drug-resistant tuberculosis (TB) is emerging as a major clinical and public health challenge in areas of sub-Saharan Africa where there is a high prevalence of human immunodeficiency virus (HIV) infection. TB drug-resistance surveillance in this region has been limited by laboratory capacity and the public health infrastructure; however, with the maturation of the HIV epidemic, the burden of drug-resistant TB is increasing rapidly. The recent discovery of large numbers of cases of multidrug-resistant (MDR) TB and extensively drug-resistant (XDR) TB in South Africa likely represents an unrecognized and evolving epidemic rather than sporadic, localized outbreaks. The combination of a large population of HIV-infected susceptible hosts with poor TB treatment success rates, a lack of airborne infection control, limited drug-resistance testing, and an overburdened MDR-TB treatment program provides ideal conditions for an MDR-TB and XDR-TB epidemic of unparalleled magnitude. In the present article, we review the history of drug-resistant TB in South Africa, describe its interaction with the HIV epidemic and the resultant consequences, and suggest measures necessary for controlling MDR-TB and XDR-TB in this context. A successful response to the emergence of MDR-TB and XDR-TB will necessitate increased resources for and collaboration between TB and HIV programs.

Multidrug resistance and retroviral transduction potential in human small cell lung cancer cell lines

DEFF Research Database (Denmark)

Theilade, M D; Gram, G J; Jensen, P B

1999-01-01

Multidrug resistance (MDR) remains a major problem in the successful treatment of small cell lung cancer (SCLC). New treatment strategies are needed, such as gene therapy specifically targeting the MDR cells in the tumor. Retroviral LacZ gene-containing vectors that were either pseudotyped...... for the gibbon ape leukemia virus (GALV-1) receptor or had specificity for the amphotropic murine leukemia virus (MLV-A) receptor were used for transduction of five SCLC cell lines differing by a range of MDR mechanisms. Transduction efficiencies in these cell lines were compared by calculating the percentage...... of blue colonies after X-Gal staining of the cells grown in soft agar. All examined SCLC cell lines were transducible with either vector. Transduction efficiencies varied from 5.7% to 33.5% independent of the presence of MDR. These results indicate that MDR does not severely impair transduction of SCLC...

IncA/C plasmids harboured in serious multidrug-resistant Vibrio cholerae serogroup O139 strains in China.

Science.gov (United States)

Wang, Ruibai; Yu, Dong; Zhu, Lianhui; Li, Jie; Yue, Junjie; Kan, Biao

2015-03-01

Vibrio cholerae serogroup O139 emerged in 1992 and is one of two major serogroups to have caused cholera epidemics. After 1998, serious multidrug-resistant (MDR) O139 strains quickly became common in China, showing a multidrug resistance profile to eight antibiotics. It is a great threat to public health, and elucidation of its mechanisms of resistance will provide a helpful guide for the clinical treatment and prevention of cholera. In this study, mega-plasmids from MDR V. cholerae O139 strains were identified by pulsed-field gel electrophoresis (PFGE) without enzyme digestion. One plasmid was isolated and sequenced, belonging to the IncA/C family. Ten antibiotic resistance genes were found in the MDR regions, including a blaTEM-20 gene, and these genes endowed the host with resistance to seven antibiotics. This kind of plasmid was positive in 71.2% (198/278) of toxigenic O139 strains, and the rate of plasmid positivity was consistent with the yearly change in MDR rates of these strains. This study reveals an important role of the IncA/C family plasmid in the spread of multiple antibiotic resistance of epidemic V. cholerae serogroup O139 strains, which has recombined with plasmids from different bacterial species and transferred among V. cholerae strains. Copyright © 2014 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

Comparative study on reversal efficacy of SDZ PSC 833, cyclosporin a and verapamil on multidrug resistance in vitro and in vivo

International Nuclear Information System (INIS)

Watanabe, Toru; Tsuge, Harumi; Oh-Hara, Tomoko; Naito, Mikihiko; Tsuruo, Takashi

1995-01-01

A non-immunosuppressive cyclosporin, SDZ PSC 833 (PSC833), shows a reversal effect on multidrug resistance (MDR) by functional modulation of MDR1 gene product, P-glycoprotein. The objective of the present study was to compare the reversal efficacy of three multidrug resistance modulators, PSC833, cyclosporin A (CsA) and verapamil (Vp). PSC833 has approximately 3-10-fold greater potency than CsA and Vp with respect to the restoring effect on reduced accumulation of doxorubicin (ADM) and vincristine (VCR) in ADM-resistant K562 myelogenous leukemia cells (K562/ADM) in vitro and also on the sensitivity of K562/ADM to ADM and VCR in in vitro growth inhibition. The in vivo efficacy of a combination of modifiers (PSC833 and CsA: 50 mg/kg, Vp 100 mg/kg administered p.o. 4 h before the administration of anticancer drugs) with anticancer drugs (ADM 2.5 mg/kg i.p., Q4D days 1, 5 and 9, VCR 0.05 mg/kg i.p., QD days 1-5) was tested in ADM-resistant P388-bearing mice. PSC833 significantly enhanced the increase in life span by more than 80%, whereas CsA and Vp enhanced by less than 50%. This reversal potency, which exceeded that of CsA and Vp, was confirmed by therapeutic experiments using colon adenocarcinoma 26-bearing mice. These results demonstrated that PSC833 has significant potency to reverse MDR in vitro and in vivo, suggesting that PSC833 is a good candidate for reversing multidrug resistance in clinical situations. (orig.)

Novel understanding of ABC transporters ABCB1/MDR/P-glycoprotein, ABCC2/MRP2, and ABCG2/BCRP in colorectal pathophysiology

DEFF Research Database (Denmark)

Andersen, Vibeke; Svenningsen, Katrine; Knudsen, Lina Almind

2015-01-01

transporter proteins, inflammatory bowel disease, ulcerative, colitis, Crohns disease, colorectal cancer, colitis, intestinal inflammation, intestinal carcinogenesis, ABCB1/P-glycoprotein (P-gp/CD243/MDR1), ABCC2/multidrug resistance protein 2 (MRP2) and ABCG2/breast cancer resistance protein (BCRP), Abcb1....../Mdr1a, abcc2/Mrp2, abcg2/Bcrp, knock-out mice, tight junction, membrane lipid function. RESULTS: Recently, human studies reported that changes in the levels of ABC transporters were early events in the adenoma-carcinoma sequence leading to CRC. A link between ABCB1, high fat diet and gut microbes...

Knockdown of HOXA10 reverses the multidrug resistance of human chronic mylogenous leukemia K562/ADM cells by downregulating P-gp and MRP-1.

Science.gov (United States)

Yi, Ying-Jie; Jia, Xiu-Hong; Wang, Jian-Yong; Li, You-Jie; Wang, Hong; Xie, Shu-Yang

2016-05-01

Multidrug resistance (MDR) of leukemia cells is a major obstacle in chemotherapeutic treatment. The high expression and constitutive activation of P-glycoprotein (P-gp) and multidrug resistance protein-1 (MRP-1) have been reported to play a vital role in enhancing cell resistance to anticancer drugs in many tumors. The present study aimed to investigate the reversal of MDR by silencing homeobox A10 (HOXA10) in adriamycin (ADR)-resistant human chronic myelogenous leukemia (CML) K562/ADM cells by modulating the expression of P-gp and MRP-1. K562/ADM cells were stably transfected with HOXA10-targeted short hairpin RNA (shRNA). The results of reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blot analysis showed that the mRNA and protein expression of HOXA10 was markedly suppressed following transfection with a shRNA-containing vector. The sensitivity of the K562/ADM cells to ADR was enhanced by the silencing of HOXA10, due to the increased intracellular accumulation of ADR. The accumulation of ADR induced by the silencing of HOXA10 may be due to the downregulation of P-gp and MRP-1. Western blot analysis revealed that downregulating HOXA10 inhibited the protein expression of P-gp and MRP-1. Taken together, these results suggest that knockdown of HOXA10 combats resistance and that HOXA10 is a potential target for resistant human CML.

[Polymorphisms of the multiple drug resistance gene (MDR1) in Mapuche, Mestizo and Maori populations in Chile].

Science.gov (United States)

Wielandt, Ana María; Vollrath, Valeska; Chianale, José

2004-09-01

There are significant differences in drug responses among different ethnic groups. The multidrug transporter P-gp, encoded by the MDR1 gene, plays a key role in determining drug bioavailability, and an association between a polymorphism in exon 26 (C3435T) and lower P-gp expression has been found. The co-segregation of this polymorphism with the polymorphism in exon 12 (C1236T) and in exon 21 (G2677T/A) determines several MDR1 haplotypes in humans. To characterize the polymorphisms of exons 26, 21 and 12 of the MDR1 gene in different Chilean populations. Using a polymerase chain reaction and restriction fragment length polymorphism technique, we studied the allelic frequencies and the distribution of MDR1 haplotypes in 3 Chilean populations: Mestizo (n=104), Mapuche (n=96, living in the National Reservation of the Huapi Island, Ranico Lake) and Maori (n=52, living in Eastern Island). The frequency of the normal MDR1*1 haplotype, without mutations, was lower in Mapuches than in Mestizos or Maoris (p0.0.5), but lower than the frequencies reported in Caucasians or Asians (p<0.05). We found significant differences in the frequencies of genetic polymorphisms of the MDR1 gene in Chilean populations, related to the ethnic origins of our ancestors.

Characterization of a multidrug-resistant Salmonella enterica serovar Heidelberg outbreak strain in commercial turkeys: Colonization, transmission, and host transcriptional response

Science.gov (United States)

In recent years, multidrug-resistant (MDR) Salmonella enterica serovar Heidelberg has been associated with numerous human foodborne illness outbreaks due to consumption of poultry. For example, in 2011, an MDR S. Heidelberg outbreak associated with ground turkey sickened 136 individuals and resulted...

Breast cancer resistance protein is localized at the plasma membrane in mitoxantrone- and topotecan-resistant cell lines

NARCIS (Netherlands)

Scheffer, GL; Maliepaard, M; Pijnenborg, ACLM; van Gastelen, MA; Schroeijers, AB; Allen, JD; Ross, DD; van der Valk, P; Dalton, WS; Schellens, JHM; Scheper, RJ; de Jong, MC

2000-01-01

Tumor cells may display a multidrug resistant phenotype by overexpression of ATP-binding cassette transporters such as multidrug resistance (,MDR1) P-glycoprotein, multidrug resistance protein 1 (MRP1), and breast cancer resistance protein (BCRP). The presence of BCRP has thus far been reported

Multidrug-resistant Enterobacteriaceae from indoor air of an urban wastewater treatment plant.

Science.gov (United States)

Teixeira, Juliana V; Cecílio, Pedro; Gonçalves, Daniela; Vilar, Vítor J P; Pinto, Eugénia; Ferreira, Helena N

2016-07-01

Wastewater treatment plants (WWTPs) have been recognized as sources of bioaerosols that may act as vehicles for dissemination of pathogens and multidrug-resistant (MDR) bacteria. The occurrence of MDR Enterobacteriaceae in indoor air of an urban WWTP was investigated. A possible airborne contamination with extended-spectrum beta-lactamase (ESBL) and carbapenemase-producing Enterobacteriaceae was also explored. Fourteen of 39 Enterobacteriaceae isolates were MDR. These isolates were found at all sampling sites, mainly at the secondary sedimentation settings. The highest levels of resistance were detected in three different species: Enterobacter cloacae, Escherichia coli, and Citrobacter freundii. Furthermore, one of the airborne E. coli isolates was phenotypically characterized as an ESBL producer. Additionally, five isolates showed non-susceptibility to at least one carbapenem tested. The presence of genes encoding relevant beta-lactamase types in these ESBL-producing and carbapenem-resistant Enterobacteriaceae isolates was investigated by PCR. Results showed amplification for bla CTX-M and bla OXA. These findings are relevant both in terms of occupational/public health and of environmental dissemination of MDR bacteria.

A study of multidrug-resistant tuberculosis in risk groups in the city of Santos, São Paulo, Brazil

Directory of Open Access Journals (Sweden)

Andréa Gobetti Vieira Coelho

2012-09-01

Full Text Available Monitoring the extent of and trends in multidrug-resistant tuberculosis (MDR-TB is a priority of the Brazilian National Tuberculosis Control Programme. The current study aimed to estimate the incidence of MDR-TB, describe the profile of TB drug resistance in risk groups and examine whether screening for MDR-TB adhered to the recommended guidelines. A descriptive study that examined diagnosed cases of pulmonary TB was conducted in the city of Santos, Brazil, between 2000-2004. Of the 2,176 pulmonary TB cases studied, 671 (30.8% met the criteria for drug sensitivity testing and, of these cases, 31.7% (213/671 were tested. Among the tested cases, 9.4% were resistant to one anti-TB drug and 15% were MDR. MDR was observed in 11.6% of 86 new TB cases and 17.3% of 127 previously treated cases. The average annual incidence of MDR-TB was 1.9 per 100,000 inhabitants-years. The extent of known MDR-TB in the city of Santos is high, though likely to be underestimated. Our study therefore indicates an inadequate adherence to the guidelines for MDR-TB screening and suggests the necessity of alternative strategies of MDR-TB surveillance.

Diabetes and Other Risk Factors for Multi-drug Resistant Tuberculosis in a Mexican Population with Pulmonary Tuberculosis: Case Control Study.

Science.gov (United States)

Gómez-Gómez, Alejandro; Magaña-Aquino, Martin; López-Meza, Salvador; Aranda-Álvarez, Marcelo; Díaz-Ornelas, Dora E; Hernández-Segura, María Guadalupe; Salazar-Lezama, Miguel Ángel; Castellanos-Joya, Martín; Noyola, Daniel E

2015-02-01

Multidrug resistant tuberculosis (MDR-TB) poses problems in treatment, costs and treatment outcomes. It is not known if classically described risk factors for MDR-TB in other countries are the same in Mexico and the frequency of the association between diabetes mellitus (DM) and MDR-TB in our country is not clear. We undertook this study to analyze risk factors associated with the development of MDR-TB, with emphasis on DM. A case-control study in the state of San Luis Potosi (SLP), Mexico was carried out. All pulmonary MDR-TB patients diagnosed in the state of SLP between 1998 and 2013 (36 cases) evaluated at a state pharmacoresistant tuberculosis (TB) clinic and committee; 139 controls were randomly selected from all pulmonary non-multidrug-resistant tuberculosis (non-MDR-TB) cases identified between 2003 and 2008. Cases and controls were diagnosed and treated under programmatic conditions. Age, gender, malnutrition, being a health-care worker, HIV/AIDS status, and drug abuse were not significantly different between MDR-TB and non-MDR-TB patients. Significant differences between MDR-TB and non-MDR-TB patients were DM (47.2 vs. 28.1%; p = 0.028); previous anti-TB treatments (3 vs. 0, respectively; p <0.001), and duration of first anti-TB treatment (8 vs. 6 months, respectively; p <0.001). MDR-TB and DM are associated in 47.2% of MDR TB cases (17/36) in this study. Other recognized factors were not found to be significantly different in MDR-TB compared to non-MDR-TB in this study. Cost-feasible strategies must be implemented in the treatment of DM-TB in order to prevent the selection of MDR-TB. Copyright © 2015 IMSS. Published by Elsevier Inc. All rights reserved.

Aggressive Regimens for Multidrug-Resistant Tuberculosis Reduce Recurrence

Science.gov (United States)

Franke, Molly F.; Appleton, Sasha C.; Mitnick, Carole D.; Furin, Jennifer J.; Bayona, Jaime; Chalco, Katiuska; Shin, Sonya; Murray, Megan; Becerra, Mercedes C.

2013-01-01

Background. Recurrent tuberculosis disease occurs within 2 years in as few as 1% and as many as 29% of individuals successfully treated for multidrug-resistant (MDR) tuberculosis. A better understanding of treatment-related factors associated with an elevated risk of recurrent tuberculosis after cure is urgently needed to optimize MDR tuberculosis therapy. Methods. We conducted a retrospective cohort study among adults successfully treated for MDR tuberculosis in Peru. We used multivariable Cox proportional hazards regression analysis to examine whether receipt of an aggressive MDR tuberculosis regimen for ≥18 months following sputum conversion from positive to negative was associated with a reduced rate of recurrent tuberculosis. Results. Among 402 patients, the median duration of follow-up was 40.5 months (interquartile range, 21.2–53.4). Receipt of an aggressive MDR tuberculosis regimen for ≥18 months following sputum conversion was associated with a lower risk of recurrent tuberculosis (hazard ratio, 0.40 [95% confidence interval, 0.17–0.96]; P = .04). A baseline diagnosis of diabetes mellitus also predicted recurrent tuberculosis (hazard ratio, 10.47 [95% confidence interval, 2.17–50.60]; P = .004). Conclusions. Individuals who received an aggressive MDR tuberculosis regimen for ≥18 months following sputum conversion experienced a lower rate of recurrence after cure. Efforts to ensure that an aggressive regimen is accessible to all patients with MDR tuberculosis, such as minimization of sequential ineffective regimens, expanded drug access, and development of new MDR tuberculosis compounds, are critical to reducing tuberculosis recurrence in this population. Patients with diabetes mellitus should be carefully managed during initial treatment and followed closely for recurrent disease. PMID:23223591

Molecular characterization of multidrug-resistant Mycobacterium tuberculosis isolated in Nepal.

Science.gov (United States)

Poudel, Ajay; Nakajima, Chie; Fukushima, Yukari; Suzuki, Haruka; Pandey, Basu Dev; Maharjan, Bhagwan; Suzuki, Yasuhiko

2012-06-01

Despite the fact that Nepal is one of the first countries globally to introduce multidrug-resistant tuberculosis (MDR-TB) case management, the number of MDR-TB cases is continuing to rise in Nepal. Rapid molecular tests applicable in this setting to identify resistant organisms would be an effective tool in reversing this trend. To develop such tools, information about the frequency and distribution of mutations that are associated with phenotypic drug resistance in Mycobacterium tuberculosis is required. In the present study, we investigated the prevalence of mutations in rpoB and katG genes and the inhA promoter region in 158 M. tuberculosis isolates (109 phenotypically MDR and 49 non-MDR isolates collected in Nepal) by DNA sequencing. Mutations affecting the 81-bp rifampin (RIF) resistance-determining region (RRDR) of rpoB were identified in 106 of 109 (97.3%) RIF-resistant isolates. Codons 531, 526, and 516 were the most commonly affected, at percentages of 58.7, 15.6, and 15.6%, respectively. Of 113 isoniazid (INH)-resistant isolates, 99 (87.6%) had mutations in the katG gene, with Ser315Thr being the most prevalent (81.4%) substitution. Mutations in the inhA promoter region were detected in 14 (12.4%) INH-resistant isolates. The results from this study provide an overview of the current situation of RIF and INH resistance in M. tuberculosis in Nepal and can serve as a basis for developing or improving rapid molecular tests to monitor drug-resistant strains in this country.

Prevalence of resistance to second-line tuberculosis drug among multidrug-resistant tuberculosis patients in Viet Nam, 2011.

Science.gov (United States)

Nguyen, Hoa Binh; Nguyen, Nhung Viet; Tran, Huong Thi Giang; Nguyen, Hai Viet; Bui, Quyen Thi Tu

2016-01-01

Extensively drug-resistant tuberculosis (XDR-TB) represents an emerging public health problem worldwide. According to the World Health Organization, an estimated 9.7% of multidrug-resistant TB (MDR-TB) cases are defined as XDR-TB globally. The objective of this study was to determine the prevalence of drug resistance to second-line TB drugs among MDR-TB cases detected in the Fourth National Anti-Tuberculosis Drug Resistance Survey in Viet Nam. Eighty clusters of TB cases were selected using a probability-proportion-to-size approach. To identify MDR-TB cases, drug susceptibility testing (DST) was performed for the four major first-line TB drugs. DST of second-line drugs (ofloxacin, amikacin, kanamycin, capreomycin) was performed on isolates from MDR-TB cases to identify pre-XDR and XDR cases. A total of 1629 smear-positive TB cases were eligible for culture and DST. Of those, DST results for first-line drugs were available for 1312 cases, and 91 (6.9%) had MDR-TB. Second-line DST results were available for 84 of these cases. Of those, 15 cases (17.9%) had ofloxacin resistance and 6.0% were resistant to kanamycin and capreomycin. Five MDR-TB cases (6.0%) met the criteria of XDR-TB. This survey provides the first estimates of the proportion of XDR-TB among MDR-TB cases in Viet Nam and provides important information for local policies regarding second-line DST. Local policies and programmes that are geared towards TB prevention, early diagnosis and treatment with effective regimens are of high importance.

Contribution of AcrAB-ToIC to multidrug resistance in an Escherichia coli sequence type 131 isolate

NARCIS (Netherlands)

Schuster, Sabine; Vavra, Martina; Schweigger, Tobias M.; Rossen, John W. A.; Matsumura, Yasufumi; Kern, Winfried V.

Drug efflux by resistance-nodulation-cell division (RND)-type transporters, such as AcrAB-ToIC of Escherichia can, is an important resistance mechanism in Gram-negative bacteria; however, its contribution to multidrug resistance (MDR) in clinical isolates is poorly defined. We inactivated acrB of a

Multidrug Resistance Acinetobacter Bacteremia Secondary to Ventilator-Associated Pneumonia: Risk Factors and Outcome.

Science.gov (United States)

Brotfain, Evgeni; Borer, Abraham; Koyfman, Leonid; Saidel-Odes, Lisa; Frenkel, Amit; Gruenbaum, Shaun E; Rosenzweig, Vsevolod; Zlotnik, Alexander; Klein, Moti

2017-10-01

Acinetobacter baumannii is a multidrug resistant (MDR), gram-negative bacterium commonly implicated in ventilator-associated pneumonia (VAP) in critically ill patients. Patients in the intensive care unit (ICU) with VAP often subsequently develop A baumannii bacteremia, which may significantly worsen outcomes. In this study, we retrospectively reviewed the clinical and laboratory records of 129 ICU patients spanning 6 years with MDR A baumannii VAP; 46 (35%) of these patients had concomitant MDR A baumannii bacteremia. The ICU mortality rate was higher in patients with VAP having A baumannii bacteremia compared to nonbacteremic patients (32.4% vs 9.6% respectively, P 65 years, an Acute Physiology and Chronic Health Evaluation II (APACHE-II) score higher than 20, a Sequential Organ Failure Assessment (SOFA) score higher than 7 on the day of bacteremia, and the presence of comorbid disease (chronic obstructive pulmonary disease [COPD] and chronic renal failure) were found to be independent risk factors for in-hospital mortality in this population. Multidrug resistant A baumannii was not an independent risk factor for mortality. Although the presence of comorbid diseases (COPD and chronic renal failure) and severity of disease (APACHE > 20 and SOFA >7) were found to be independent risk factors for ICU mortality, MDR A baumannii bacteremia was not an independent risk factor for mortality in our critically ill population.

NSC23925, identified in a high-throughput cell-based screen, reverses multidrug resistance.

Directory of Open Access Journals (Sweden)

Zhenfeng Duan

2009-10-01

Full Text Available Multidrug resistance (MDR is a major factor which contributes to the failure of cancer chemotherapy, and numerous efforts have been attempted to overcome MDR. To date, none of these attempts have yielded a tolerable and effective therapy to reverse MDR; thus, identification of new agents would be useful both clinically and scientifically.To identify small molecule compounds that can reverse chemoresistance, we developed a 96-well plate high-throughput cell-based screening assay in a paclitaxel resistant ovarian cancer cell line. Coincubating cells with a sublethal concentration of paclitaxel in combination with each of 2,000 small molecule compounds from the National Cancer Institute Diversity Set Library, we identified a previously uncharacterized molecule, NSC23925, that inhibits Pgp1 and reverses MDR1 (Pgp1 but does not inhibit MRP or BCRP-mediated MDR. The cytotoxic activity of NSC23925 was further evaluated using a panel of cancer cell lines expressing Pgp1, MRP, and BCRP. We found that at a concentration of >10 microM NSC23925 moderately inhibits the proliferation of both sensitive and resistant cell lines with almost equal activity, but its inhibitory effect was not altered by co-incubation with the Pgp1 inhibitor, verapamil, suggesting that NSC23925 itself is not a substrate of Pgp1. Additionally, NSC23925 increases the intracellular accumulation of Pgp1 substrates: calcein AM, Rhodamine-123, paclitaxel, mitoxantrone, and doxorubicin. Interestingly, we further observed that, although NSC23925 directly inhibits the function of Pgp1 in a dose-dependent manner without altering the total expression level of Pgp1, NSC23925 actually stimulates ATPase activity of Pgp, a phenomenon seen in other Pgp inhibitors.The ability of NSC23925 to restore sensitivity to the cytotoxic effects of chemotherapy or to prevent resistance could significantly benefit cancer patients.

Structure and function of ABCG2-rich extracellular vesicles mediating multidrug resistance.

Directory of Open Access Journals (Sweden)

Vicky Goler-Baron

2011-01-01

Full Text Available Multidrug resistance (MDR is a major impediment to curative cancer chemotherapy. The ATP-Binding Cassette transporters ABCG2, ABCB1 and ABCC2 form a unique defense network against multiple structurally and functionally distinct chemotherapeutics, thereby resulting in MDR. Thus, deciphering novel mechanisms of MDR and their overcoming is a major goal of cancer research. Recently we have shown that overexpression of ABCG2 in the membrane of novel extracellular vesicles (EVs in breast cancer cells results in mitoxantrone resistance due to its dramatic sequestration in EVs. However, nothing is known about EVs structure, biogenesis and their ability to concentrate multiple antitumor agents. To this end, we here found that EVs are structural and functional homologues of bile canaliculi, are apically localized, sealed structures reinforced by an actin-based cytoskeleton and secluded from the extracellular milieu by the tight junction proteins occludin and ZO-1. Apart from ABCG2, ABCB1 and ABCC2 were also selectively targeted to the membrane of EVs. Moreover, Ezrin-Radixin-Moesin protein complex selectively localized to the border of the EVs membrane, suggesting a key role for the tethering of MDR pumps to the actin cytoskeleton. The ability of EVs to concentrate and sequester different antitumor drugs was also explored. Taking advantage of the endogenous fluorescence of anticancer drugs, we found that EVs-forming breast cancer cells display high level resistance to topotecan, imidazoacridinones and methotrexate via efficient intravesicular drug concentration hence sequestering them away from their cellular targets. Thus, we identified a new modality of anticancer drug compartmentalization and resistance in which multiple chemotherapeutics are actively pumped from the cytoplasm and highly concentrated within the lumen of EVs via a network of MDR transporters differentially targeted to the EVs membrane. We propose a composite model for the structure and

Physiological characterisation of the efflux pump system of antibiotic-susceptible and multidrug-resistant

OpenAIRE

Martins , A.; Spengler , G.; Martins , M.; Rodrigues , L.; Viveiros , M.; Davin-Regli , A.; Chevalier , J.; Couto , I.; Pagès , J.M.; Amaral , L.

2010-01-01

Abstract Enterobacter aerogenes predominates among Enterobacteriaceae species that are increasingly reported as producers of extended-spectrum ?-lactamases. Although this mechanism of resistance to ?-lactams is important, other mechanisms bestowing a multidrug-resistant (MDR) phenotype in this species are now well documented. Among these mechanisms is the overexpression of efflux pumps that extrude structurally unrelated antibiotics prior to their reaching their targets. Interestin...

Surgery as an Adjunctive Treatment for Multidrug-Resistant Tuberculosis : An Individual Patient Data Metaanalysis

NARCIS (Netherlands)

Fox, Gregory J.; Mitnick, Carole D.; Benedetti, Andrea; Chan, Edward D.; Becerra, Mercedes; Chiang, Chen-Yuan; Keshavjee, Salmaan; Koh, Won-Jung; Shiraishi, Yuji; Viiklepp, Piret; Yim, Jae-Joon; Pasvol, Geoffrey; Robert, Jerome; Shim, Tae Sun; Shin, Sonya S.; Menzies, Dick; van der Werf, Tjip S.

2016-01-01

Background. Medical treatment for multidrug-resistant (MDR)-tuberculosis is complex, toxic, and associated with poor outcomes. Surgical lung resection may be used as an adjunct to medical therapy, with the intent of reducing bacterial burden and improving cure rates. We conducted an individual

In Vitro activity of novel glycopolymer against clinical isolates of multidrug-resistant Staphylococcus aureus.

Directory of Open Access Journals (Sweden)

Vidya P Narayanaswamy

Full Text Available The incidence of multidrug-resistant (MDR organisms, including methicillin-resistant Staphylococcus aureus (MRSA, is a serious threat to public health. Progress in developing new therapeutics is being outpaced by antibiotic resistance development, and alternative agents that rapidly permeabilize bacteria hold tremendous potential for treating MDR infections. A new class of glycopolymers includes polycationic poly-N (acetyl, arginyl glucosamine (PAAG is under development as an alternative to traditional antibiotic strategies to treat MRSA infections. This study demonstrates the antibacterial activity of PAAG against clinical isolates of methicillin and mupirocin-resistant Staphylococcus aureus. Multidrug-resistant S. aureus was rapidly killed by PAAG, which completely eradicated 88% (15/17 of all tested strains (6-log reduction in CFU in ≤ 12-hours at doses that are non-toxic to mammalian cells. PAAG also sensitized all the clinical MRSA strains (17/17 to oxacillin as demonstrated by the observed reduction in the oxacillin MIC to below the antibiotic resistance breakpoint. The effect of PAAG and standard antibiotics including vancomycin, oxacillin, mupirocin and bacitracin on MRSA permeability was studied by measuring propidium iodide (PI uptake by bacterial cells. Antimicrobial resistance studies showed that S. aureus developed resistance to PAAG at a rate slower than to mupirocin but similar to bacitracin. PAAG was observed to resensitize drug-resistant S. aureus strains sampled from passage 13 and 20 of the multi-passage resistance study, reducing MICs of mupirocin and bacitracin below their clinical sensitivity breakpoints. This class of bacterial permeabilizing glycopolymers may provide a new tool in the battle against multidrug-resistant bacteria.

In Vitro activity of novel glycopolymer against clinical isolates of multidrug-resistant Staphylococcus aureus.

Science.gov (United States)

Narayanaswamy, Vidya P; Giatpaiboon, Scott A; Uhrig, John; Orwin, Paul; Wiesmann, William; Baker, Shenda M; Townsend, Stacy M

2018-01-01

The incidence of multidrug-resistant (MDR) organisms, including methicillin-resistant Staphylococcus aureus (MRSA), is a serious threat to public health. Progress in developing new therapeutics is being outpaced by antibiotic resistance development, and alternative agents that rapidly permeabilize bacteria hold tremendous potential for treating MDR infections. A new class of glycopolymers includes polycationic poly-N (acetyl, arginyl) glucosamine (PAAG) is under development as an alternative to traditional antibiotic strategies to treat MRSA infections. This study demonstrates the antibacterial activity of PAAG against clinical isolates of methicillin and mupirocin-resistant Staphylococcus aureus. Multidrug-resistant S. aureus was rapidly killed by PAAG, which completely eradicated 88% (15/17) of all tested strains (6-log reduction in CFU) in ≤ 12-hours at doses that are non-toxic to mammalian cells. PAAG also sensitized all the clinical MRSA strains (17/17) to oxacillin as demonstrated by the observed reduction in the oxacillin MIC to below the antibiotic resistance breakpoint. The effect of PAAG and standard antibiotics including vancomycin, oxacillin, mupirocin and bacitracin on MRSA permeability was studied by measuring propidium iodide (PI) uptake by bacterial cells. Antimicrobial resistance studies showed that S. aureus developed resistance to PAAG at a rate slower than to mupirocin but similar to bacitracin. PAAG was observed to resensitize drug-resistant S. aureus strains sampled from passage 13 and 20 of the multi-passage resistance study, reducing MICs of mupirocin and bacitracin below their clinical sensitivity breakpoints. This class of bacterial permeabilizing glycopolymers may provide a new tool in the battle against multidrug-resistant bacteria.

Investigational drugs for the treatment of infections caused by multidrug-resistant Gram-negative bacteria.

Science.gov (United States)

Avery, Lindsay M; Nicolau, David P

2018-04-01

Infections caused by multidrug-resistant Gram-negative bacteria (MDR-GNB) are associated with significant mortality and costs. New drugs in development to combat these difficult-to-treat infections primarily target carbapenem-resistant Enterobacteriaceae, MDR Pseudomonas aeruginosa, and MDR Acinetobacter baumannii. Areas covered: The authors summarize in vitro and in vivo efficacy studies, as well as available clinical trial findings, for new agents in development for treatment of infection caused by MDR-GNB. Information regarding dosage regimens utilized in clinical trials and key pharmacokinetic and pharmacodynamic considerations are provided if available. A summary of recently approved agents, delafloxacin and meropenem/vaborbactam, is also included. Expert opinion: The development of multiple novel agents to fight MDR-GNB is promising to help save the lives of patients who acquire infection, and judicious use of these agents is imperative once they come to market to prevent the development of resistance. The other component paramount to this field of research is implementation of effective infection control policies and carbapenem-resistant Enterobacteriaceae (CRE) carrier screening protocols to mitigate the worldwide spread of MDR-GNB. Further investigation of anti-infective synergistic combinations will also be important, as well as support for economic research to reveal the true cost-benefit of utilization of the new agents discussed herein.

Laser thermal ablation of multidrug-resistant bacteria using functionalized gold nanoparticles

Directory of Open Access Journals (Sweden)

Mocan L

2017-03-01

Full Text Available Lucian Mocan,1,2 Flaviu A Tabaran,3 Teodora Mocan,2,4 Teodora Pop,5 Ofelia Mosteanu,5 Lucia Agoston-Coldea,6 Cristian T Matea,2 Diana Gonciar,2 Claudiu Zdrehus,1,2 Cornel Iancu1 13rd Department of General Surgery, “Iuliu Hatieganu” University of Medicine and Pharmacy, 2Department of Nanomedicine, “Octavian Fodor” Gastroenterology Institute, 3Department of Pathology, University of Agricultural Sciences and Veterinary Medicine, Faculty of Veterinary Medicine, 4Department of Physiology, 53rd Gastroenterology Department, 6Department of Internal Medicine, “Iuliu Hatieganu” University of Medicine and Pharmacy, Cluj-Napoca, Romania Abstract: The issue of multidrug resistance (MDR has become an increasing threat to public health. One alternative strategy against MDR bacteria would be to construct therapeutic vectors capable of physically damaging these microorganisms. Gold nanoparticles hold great promise for the development of such therapeutic agents, since the nanoparticles exhibit impressive properties, of which the most important is the ability to convert light into heat. This property has scientific significance since is exploited to develop nano-photothermal vectors to destroy bacteria at a molecular level. The present paper summarizes the latest advancements in the field of nanotargeted laser hyperthermia of MDR bacteria mediated by gold nanoparticles. Keywords: bacteria, photo-thermal ablation, gold nanoparticles, antibiotic resistance

Role of wild birds as carriers of multi-drug resistant Escherichia coli and Escherichia vulneris

Directory of Open Access Journals (Sweden)

Mohammed Y. Shobrak

2014-12-01

Full Text Available Emergence and distribution of multi-drug resistant (MDR bacteria in environments pose a risk to human and animal health. A total of 82 isolates of Escherichia spp. were recovered from cloacal swabs of migrating and non-migrating wild birds. All bacterial isolates were identified and characterized morphologically and biochemically. 72% and 50% of isolates recovered from non-migrating and migrating birds, respectively, showed positive congo red dye binding (a virulence factor. Also, hemolysin production (a virulence factor was showed in 8% of isolates recovered from non-migrating birds and 75% of isolates recovered from migrating birds. All isolates recovered from non-migrating birds were found resistant to Oxacillin while all isolates recovered from migrating birds demonstrated resistance to Oxacillin, Chloramphenicol, Oxytetracycline and Lincomycin. Some bacterial isolates recovered from non-migrating birds and migrating birds exhibited MDR phenotype. The MDR isolates were further characterized by API 20E and 16S rRNA as E. coli and E. vulneris. MDR Escherichia isolates contain ~1-5 plasmids of high-molecular weights. Accordingly, wild birds could create a potential threat to human and animal health by transmitting MDR bacteria to water streams and other environmental sources through their faecal residues, and to remote regions by migration.

Role of wild birds as carriers of multi-drug resistant Escherichia coli and Escherichia vulneris

Science.gov (United States)

Shobrak, Mohammed Y.; Abo-Amer, Aly E.

2014-01-01

Emergence and distribution of multi-drug resistant (MDR) bacteria in environments pose a risk to human and animal health. A total of 82 isolates of Escherichia spp. were recovered from cloacal swabs of migrating and non-migrating wild birds. All bacterial isolates were identified and characterized morphologically and biochemically. 72% and 50% of isolates recovered from non-migrating and migrating birds, respectively, showed positive congo red dye binding (a virulence factor). Also, hemolysin production (a virulence factor) was showed in 8% of isolates recovered from non-migrating birds and 75% of isolates recovered from migrating birds. All isolates recovered from non-migrating birds were found resistant to Oxacillin while all isolates recovered from migrating birds demonstrated resistance to Oxacillin, Chloramphenicol, Oxytetracycline and Lincomycin. Some bacterial isolates recovered from non-migrating birds and migrating birds exhibited MDR phenotype. The MDR isolates were further characterized by API 20E and 16S rRNA as E. coli and E. vulneris. MDR Escherichia isolates contain ~1–5 plasmids of high-molecular weights. Accordingly, wild birds could create a potential threat to human and animal health by transmitting MDR bacteria to water streams and other environmental sources through their faecal residues, and to remote regions by migration. PMID:25763023

Phenotypic Characterization of Multidrug-resistant Escherichia Coli with Special Reference to Extended-spectrum-beta-lactamases and Metallo-beta-lactamases in a Tertiary Care Center

Directory of Open Access Journals (Sweden)

Basudha Shrestha

2015-06-01

Conclusions: Beta-lactamase mediated resistance mechanisms are accounting very high in the multidrug resistant isolates of E. coli. Therefore, early detection of beta lactamase mediated resistant strains and their current antibiotic susceptibility pattern is necessary to avoid treatment failure and prevent the spread of MDR. Keywords: e. coli; extended-spectrum-β-lactamase; metallo-β-lactamase; multidrug-resistance.

vPARP Adjusts MVP Expression in Drug-resistant Cell Lines in Conjunction with MDR Proteins.

Science.gov (United States)

Wojtowicz, Karolina; Januchowski, Radoslaw; Nowicki, Michal; Zabel, Maciej

2017-06-01

The definition of vault (ribonucleoprotein particles) function remains highly complex. Vaults may cooperate with multidrug resistance (MDR) proteins, supporting their role in drug resistance. This topic is the main theme of this publication. The cell viability was determined by an MTT assay. The protein expression was detected by western blot analysis. The proteins were knocked-down using siRNA. No major vault protein (MVP) in the LoVo/Dx and W1PR cell lines after tunicamycin treatment was shown. In W1PR cells with knocked-down MVP, a statistically significant decrease in cell viability was noted. In LoVo/Dx, W1TR and A2780TR cells were vault poly-ADP-ribose polymerase (vPARP) was knockdown, a decrease in cell viability was shown. Also, MVP silencing induced an increase in glycoprotein P (Pgp) expression in LoVo/Dx cells. MVP is important for the drug resistance of cancer cells, but it probably requires the presence of vPARP for full activation. Some correlations between MDR proteins and vaults exist. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Controlling endemic multidrug-resistant Acinetobacter baumannii in Intensive Care Units using antimicrobial stewardship and infection control.

Science.gov (United States)

Cheon, Shinhye; Kim, Mi-Ja; Yun, Seon-Jin; Moon, Jae Young; Kim, Yeon-Sook

2016-03-01

Nosocomial infections caused by multidrug-resistant (MDR) Acinetobacter baumannii have become public-health problem. However, few studies have evaluated the control of endemic MDR A. baumannii in Intensive Care Units (ICUs). Therefore, we investigated the effectiveness of antimicrobial stewardship and comprehensive intensified infection control measures for controlling endemic MDR A. baumannii in ICUs at a tertiary care center. Carbapenem use was strictly restricted through antimicrobial stewardship. Environmental cleaning and disinfection was performed at least 3 times per day in addition to basic infection control measures. Isolation using plastic curtains and contact precautions were applied to patients who were colonized or infected with MDR A. baumannii. The outcome was measured as the incidence density rate of hospital-onset MDR A. baumannii among patients in the ICUs. The incidence density rate of hospital-onset MDR A. baumannii decreased from 22.82 cases per 1,000 patient-days to 2.68 cases per 1,000 patient-days after the interventions were implemented (odds ratio, 0.12; 95% confidence interval, 0.03 to 0.4; p baumannii in our ICUs within 1 year.

DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Luk Ketut Budi Maitriani

2015-10-01

Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

Multidrug-resistant tuberculosis: The problem and some priorities in controlling it

Directory of Open Access Journals (Sweden)

Sven Hoffner

2016-01-01

Full Text Available Multidrug-resistant tuberculosis (MDR-TB, and even more severe forms of drug resistance, cause significant problems and costs for national TB control programs and constitutes an increasing public health concern globally. In parts of the former Soviet Union, the prevalence of MDR-TB is as high as 50% and one third of all newly detected TB patients are infected with MDR strains. Such strains transmit and certain MDR-TB clones constitute an important part of the problem, especially in high MDR-TB burden areas. There are several actions that should be given priority to control this situation. A first important step is timely detection of all patients infected with resistant strains, which makes possible prompt change of standard TB chemotherapy to more effective combinations of drugs. This is important both from the public health and clinical perspectives, since it renders the individual patient noninfectious and subsequently cured. Early detection of MDR-TB also allows infection control to be focused where it is most needed. Strengthened infection control measures are crucial for limiting the ongoing spread of resistant TB in hospitals and elsewhere. In addition, a sustainable drug supply must be ensured to guarantee that all patients are initiated on effective treatment and can avoid interruptions due to drug shortages. An extra focus should be put on vulnerable cases, such as immunosuppressed individuals, prisoners, drug addicts, and migrants, in whom TB is generally more frequent and difficult to control than in the normal population. Finally, political support is needed to ensure necessary infrastructures, human and financial resources to effectively control drug resistant TB.

Multidrug-resistant tuberculosis: The problem and some priorities in controlling it.

Science.gov (United States)

Hoffner, Sven

2016-12-01

Multidrug-resistant tuberculosis (MDR-TB), and even more severe forms of drug resistance, cause significant problems and costs for national TB control programs and constitutes an increasing public health concern globally. In parts of the former Soviet Union, the prevalence of MDR-TB is as high as 50% and one third of all newly detected TB patients are infected with MDR strains. Such strains transmit and certain MDR-TB clones constitute an important part of the problem, especially in high MDR-TB burden areas. There are several actions that should be given priority to control this situation. A first important step is timely detection of all patients infected with resistant strains, which makes possible prompt change of standard TB chemotherapy to more effective combinations of drugs. This is important both from the public health and clinical perspectives, since it renders the individual patient noninfectious and subsequently cured. Early detection of MDR-TB also allows infection control to be focused where it is most needed. Strengthened infection control measures are crucial for limiting the ongoing spread of resistant TB in hospitals and elsewhere. In addition, a sustainable drug supply must be ensured to guarantee that all patients are initiated on effective treatment and can avoid interruptions due to drug shortages. An extra focus should be put on vulnerable cases, such as immunosuppressed individuals, prisoners, drug addicts, and migrants, in whom TB is generally more frequent and difficult to control than in the normal population. Finally, political support is needed to ensure necessary infrastructures, human and financial resources to effectively control drug resistant TB. Copyright © 2016.

Circumvention of tumor multidrug resistance by a new annonaceous acetogenin: atemoyacin-B.

Science.gov (United States)

Fu, L W; Pan, Q C; Liang, Y J; Huang, H B

1999-05-01

To explore the effect of atemoyacin-B (Ate) on overcoming multidrug resistance (MDR). Bullatacin (Bul) was used as a positive control. Cytotoxic effects of Bul and Ate were studied with cell culture of human MDR breast adenocarcinoma cells, MCF-7/Dox and human KBv200 cells, and their parental sensitive cell lines MCF-7 and KB. Cytotoxicity was determined by tetrazolium (MTT) assay. The function of P-glycoprotein (P-gp) was examined by Fura 2-AM assay. Cellular accumulation of doxorubicin (Dox) was determined by fluorescence spectrophotometry. Apoptosis was measured by flow cytometry. IC50 of Ate for MCF-7/Dox, MCF-7, KBv200, and KB cells were 122, 120, 1.34, and 1.27 nmol.L-1, respectively. IC50 of Bul for MCF-7/Dox, MCF-7, KBv200, and KB cells were 0.60, 0.59, 0.04, and 0.04 nmol.L-1, respectively. The cytotoxicities of Bul and Ate to MDR cells were similar to those to parental sensitive cells. Bul and Ate markedly increased cellular Fura-2 and Dox accumulation in MCF-7/Dox cells, but not in MCF-7 cells. The rates of apoptosis in MDR cells were similar to those in sensitive cells induced by Ate. There was no cross-resistance of P-gp positive MCF-7/Dox and KBv200 cell lines to Bul and Ate as compared with their sensitive P-gp negative MCF-7 and KB cell lines. The mechanism of the circumvention of MDR was associated with the decrease of P-gp function and the increase of cellular drug accumulation in MDR cells.

Expression of P-glycoprotein and multidrug resistance associated protein in Ehrlich ascites tumor cells after fractionated irradiation

International Nuclear Information System (INIS)

Nielsen, Dorte; Maare, Christian; Eriksen, Jens; Litman, Thomas; Skovsgaard, Torben

2001-01-01

Purpose: To characterize irradiated murine tumor cells with respect to drug resistance, drug kinetics, and ATPase activity, and to evaluate the possible role of P-glycoprotein (PGP) and murine multidrug resistance associated protein (Mrp1) in the drug-resistant phenotype of these cells. Methods and Materials: Sensitive Ehrlich ascites tumor cells (EHR2) were in vitro exposed to fractionated irradiation (60 Gy). Western blot analysis was performed for determination of PGP and Mrp1, reverse transcriptase-polymerase chain reaction (RT-PCR) for determination of mdr1a + b mRNA, and semiquantitative RT-PCR for Mrp1 mRNA. The clonogenic assay was applied to investigate sensitivity, whereas the steady-state drug accumulation of daunorubicin (DNR), 3 H-vincristine (VCR), and 3 H-etoposide (VP16) was measured by spectrofluorometry and scintillation counting, respectively. For determining of ATPase activity, the release of inorganic phosphate from ATP was quantified using a colorimetric method. Results: Compared with EHR2, the irradiated cell line EHR2/irr showed increased expression of PGP (threefold), Mrp1 (eightfold), and Mrp1 mRNA (sixfold), and a slight reduction of mdr1b mRNA, whereas mdr1a was present in EHR2 but could not be detected in EHR2/irr. EHR2/irr developed sixfold resistance to VP16, twofold resistance to vincristine, but remained sensitive to DNR. Addition of the PGP inhibitor, verapamil (VER) or depletion of glutathione by buthionine sulfoximine (BSO) partly reversed the resistance in EHR2/irr. In EHR2/irr, the steady-state accumulation of 3 H-VCR and 3 H-VP16 was significantly decreased as compared with EHR2, whereas the accumulation of DNR was unchanged. The ATPase activity of plasma membrane vesicles prepared from EHR2/irr cells was similar to that of wild-type EHR2 cells. The ATPase activity was neither stimulated by vinblastine nor VER. Conclusion: Irradiation induced a multidrug-resistant phenotype in sensitive tumor cells. This phenotype was

Utility of lytic bacteriophage in the treatment of multidrug-resistant Pseudomonas aeruginosa septicemia in mice

Directory of Open Access Journals (Sweden)

Vinodkumar C

2008-07-01

Full Text Available Drug resistance is the major cause of increase in morbidity and mortality in neonates. One thousand six hundred forty-seven suspected septicemic neonates were subjected for microbiological analysis over a period of 5 years. Forty-two P. aeruginosa were isolated and the antibiogram revealed that 28 P. aeruginosa were resistant to almost all the common drugs used (multidrug-resistant. The emergence of antibiotic-resistant bacterial strains is one of the most critical problems of modern medicine. As a result, a novel and most effective approaches for treating infection caused by multidrug-resistant bacteria are urgently required. In this context, one intriguing approach is to use bacteriophages (viruses that kill bacteria in the treatment of infection caused by drug-resistant bacteria. In the present study, the utility of lytic bacteriophages to rescue septicemic mice with multidrug-resistant (MDR P. aeruginosa infection was evaluated. MDR P. aeruginosa was used to induce septicemia in mice by intraperitoneal (i.p. injection of 10 7 CFU. The resulting bacteremia was fatal within 48 hrs. The phage strain used in this study had lytic activity against a wide range of clinical isolates of MDR P. aeruginosa. A single i.p. injection of 3 x 10 9 PFU of the phage strain, administered 45 min after the bacterial challenge, was sufficient to rescue 100% of the animals. Even when treatment was delayed to the point where all animals were moribund, approximately 50% of them were rescued by a single injection of this phage preparation. The ability of this phage to rescue septicemic mice was demonstrated to be due to the functional capabilities of the phage and not to a nonspecific immune effect. The rescue of septicemic mice could be affected only by phage strains able to grow in vitro on the bacterial host used to infect the animals and when such strains are heat-inactivated, they lose their ability to rescue the infected mice. Multidrug-resistant bacteria have

Multidrug resistant tuberculosis in prisons located in former Soviet countries: A systematic review.

Directory of Open Access Journals (Sweden)

Maxwell Droznin

Full Text Available A systematic literature review was performed to investigate the occurrence of multidrug-resistant tuberculosis (MDR TB in prisons located in countries formerly part of the Soviet Union.A systematic search of published studies reporting MDR TB occurrence in prisons located in former Soviet countries was conducted by probing PubMed and Cumulative Index Nursing and Allied Health Literature for articles that met predetermined inclusion criteria.Seventeen studies were identified for systematic review. Studies were conducted in six different countries. Overall, prevalence of MDR TB among prisoners varied greatly between studies. Our findings suggest a high prevalence of MDR TB in prisons of Post-Soviet states with percentages as high as 16 times more than the worldwide prevalence estimated by the WHO in 2014.All studies suggested a high prevalence of MDR TB in prison populations in Post-Soviet states.

Marine Natural Products as Models to Circumvent Multidrug Resistance

Directory of Open Access Journals (Sweden)

Solida Long

2016-07-01

Full Text Available Multidrug resistance (MDR to anticancer drugs is a serious health problem that in many cases leads to cancer treatment failure. The ATP binding cassette (ABC transporter P-glycoprotein (P-gp, which leads to premature efflux of drugs from cancer cells, is often responsible for MDR. On the other hand, a strategy to search for modulators from natural products to overcome MDR had been in place during the last decades. However, Nature limits the amount of some natural products, which has led to the development of synthetic strategies to increase their availability. This review summarizes the research findings on marine natural products and derivatives, mainly alkaloids, polyoxygenated sterols, polyketides, terpenoids, diketopiperazines, and peptides, with P-gp inhibitory activity highlighting the established structure-activity relationships. The synthetic pathways for the total synthesis of the most promising members and analogs are also presented. It is expected that the data gathered during the last decades concerning their synthesis and MDR-inhibiting activities will help medicinal chemists develop potential drug candidates using marine natural products as models which can deliver new ABC transporter inhibitor scaffolds.

Involvement of CUL4A in Regulation of Multidrug Resistance to P-gp Substrate Drugs in Breast Cancer Cells

Directory of Open Access Journals (Sweden)

Yunshan Wang

2013-12-01

Full Text Available CUL4A encodes a core component of a cullin-based E3 ubiquitin ligase complex that regulates many critical processes such as cell cycle progression, DNA replication, DNA repair and chromatin remodeling by targeting a variety of proteins for ubiquitination and degradation. In the research described in this report we aimed to clarify whether CUL4A participates in multiple drug resistance (MDR in breast cancer cells. We first transfected vectors carrying CUL4A and specific shCUL4A into breast cancer cells and corresponding Adr cells respectively. Using reverse transcription polymerase chain reactions and western blots, we found that overexpression of CUL4A in MCF7 and MDA-MB-468 cells up-regulated MDR1/P-gp expression on both the transcription and protein levels, which conferred multidrug resistance to P-gp substrate drugs, as determined by 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assays. On the other hand, silencing CUL4A in MCF7/Adr and MDA-MB-468/Adr cells led to the opposite effect. Moreover, ERK1/2 in CUL4A-overexpressing cells was highly activated and after treatment with PD98059, an ERK1/2-specific inhibitor, CUL4A-induced expression of MDR1/P-gp was decreased significantly. Lastly, immunohistochemistry in breast cancer tissues showed that P-gp expression had a positive correlation with the expression of CUL4A and ERK1/2. Thus, these results implied that CUL4A and ERK1/2 participated in multi-drug resistance in breast cancer through regulation of MDR1/P-gp expression.

Single photon emission computed tomography imaging using 99Tcm-methoxyisobutylisonitrile predict the multi-drug resistance and chemotherapy efficacy of lung cancer

International Nuclear Information System (INIS)

Zhang Yiqiu; Shi Hongcheng

2008-01-01

Chemotherapy is one of the main comprehensive treatments for lung cancer, especially for non-small cell lung cancer (NSCIC) Multi-drug resistance of lung cancer plays an important role in the failure of chemotherapy. Early detection of multi-drug resistance (MDR) is essential for choosing a suitable chemotherapy regimen for the patients of lung cancer. In recent years lots of literature reports that MDR of lung cancer is related to many kinds of multi-drug resistance protein (MRP) expression in lung cancer. Some lipophilic chemotherapy drugs and 99 Tc m -methoxyisobutylisonitrile( 99 Tc m -MIBI)may be the same substrate for some MRP. These MRP can transport them out of the tumor cells, then the chemotherapy is invalid or non-radioactive concentration. The retention of 99 Tc m -MIBI in tumor cells is correlated with the expression of MRP, thus the prediction of the MRP expression before chemotherapy or monitoring MRP expression changes in the process of chemotherapy by using the noninvasive 99 Tc m -MIBI single photon emission computed tomography imaging is helpful to predict the MDR and chemotherapy efficacy of lung cancer. (authors)

Photochemical internalisation of chemotherapy potentiates killing of multidrug-resistant breast and bladder cancer cells.

Science.gov (United States)

Adigbli, D K; Wilson, D G G; Farooqui, N; Sousi, E; Risley, P; Taylor, I; Macrobert, A J; Loizidou, M

2007-08-20

Multidrug resistance (MDR) is the major confounding factor in adjuvant solid tumour chemotherapy. Increasing intracellular amounts of chemotherapeutics to circumvent MDR may be achieved by a novel delivery method, photochemical internalisation (PCI). PCI consists of the co-administration of drug and photosensitiser; upon light activation the latter induces intracellular release of organelle-bound drug. We investigated whether co-administration of hypericin (photosensitiser) with mitoxantrone (MTZ, chemotherapeutic) plus illumination potentiates cytotoxicity in MDR cancer cells. We mapped the extent of intracellular co-localisation of drug/photosensitiser. We determined whether PCI altered drug-excreting efflux pump P-glycoprotein (Pgp) expression or function in MDR cells. Bladder and breast cancer cells and their Pgp-overexpressing MDR subclones (MGHU1, MGHU1/R, MCF-7, MCF-7/R) were given hypericin/MTZ combinations, with/without blue-light illumination. Pilot experiments determined appropriate sublethal doses for each. Viability was determined by the 3-[4,5-dimethylthiazolyl]-2,5-diphenyltetrazolium bromide assay. Intracellular localisation was mapped by confocal microscopy. Pgp expression was detected by immunofluorescence and Pgp function investigated by Rhodamine123 efflux on confocal microscopy. MTZ alone (0.1-0.2 microg ml(-1)) killed up to 89% of drug-sensitive cells; MDR cells exhibited less cytotoxicity (6-28%). Hypericin (0.1-0.2 microM) effects were similar for all cells; light illumination caused none or minimal toxicity. In combination, MTZ /hypericin plus illumination, potentiated MDR cell killing, vs hypericin or MTZ alone. (MGHU1/R: 38.65 and 36.63% increase, Phypericin increased killing by 28.15% (Phypericin was evident before illumination and at serial times post-illumination. MTZ was always found in sensitive cell nuclei, but not in dark resistant cell nuclei. In illuminated resistant cells there was some mobilisation of MTZ into the nucleus. Pgp

Concordance of programmatic and laboratory-based multidrug-resistant tuberculosis treatment outcomes in Peru.

Science.gov (United States)

Alexy, E R; Podewils, L J; Mitnick, C D; Becerra, M C; Laserson, K F; Bonilla, C

2012-01-01

Confirmation of cure for multidrug-resistant tuberculosis (MDR-TB) patients requires laboratory tests for Mycobacterium tuberculosis growth on culture media. Outcome decisions dictate patient management, and inaccuracies place patients at an increased risk of morbidity and mortality, and may contribute to continued transmission of MDR-TB. To examine concordance between programmatic and laboratory-based MDR-TB treatment outcomes. The study population included 1658 MDR-TB patients in Peru treated between 1996 and 2002 with both program and laboratory-based outcomes. Laboratory-based outcomes were assigned according to international standards requiring at least five consecutive negative cultures in the last 12 months of treatment to confirm cure. Compared to the global culture-defined standard classification, only 1.1% of treatment successes, but 54.3% of failures, were misclassified programmatically. Overall, 10.4% of patients identified by a clinician as having a successful treatment outcome still had cultures positive for MDR-TB. Most patients with successful treatment outcomes by strict culture definitions were also classified by clinicians as having successful outcomes. However, many culture-confirmed failures were missed. In light of delays and incomplete access to culture in MDR-TB programs, efforts should be made to improve the accuracy of programmatically determined treatment outcomes.

Structural Biology Meets Drug Resistance: An Overview on Multidrug Resistance Transporters

DEFF Research Database (Denmark)

Shaheen, Aqsa; Iqbal, Mazhar; Mirza, Osman

2017-01-01

. Research on the underlying causes of multidrug resistance in cancerous cells and later on in infectious bacteria revealed the involvement of integral membrane transporters, capable of recognizing a broad range of structurally different molecules as substrates and exporting them from the cell using cellular...... superfamilies, viz., ATP-binding cassette superfamily, major facilitator superfamily and resistance nodulation division superfamily are presented. Further, the future role of structural biology in improving our understanding of drug-transporter interactions and in designing novel inhibitors against MDR pump...... century, mankind has become aware and confronted with the emergence of antibiotic-resistant pathogens. In parallel to the failure of antibiotic therapy against infectious pathogens, there had been continuous reports of cancerous cells not responding to chemotherapy with increase in the duration of therapy...

Mouse ATP-Binding Cassette (ABC) Transporters Conferring Multi-Drug Resistance

Science.gov (United States)

Shuaizhang, L I; Zhang, Wen; Yin, Xuejiao; Xing, Shilai; Xie, Qunhui; Cao, Zhengyu; Zhao, Bin

2015-04-28

The ABC (ATP-binding cassette) transporter is one of the largest and most ancient protein families with members functioning from protozoa to human. The resistance of cancer and tumor cells to anticancer drugs is due to the over-expression of some ABC transporters, which may finally lead to chemotherapy failure. The mouse ABC transporters are classified into seven subfamilies by phylogenetic analysis. The mouse ABC transporter gene, alias, chromosomal location and function have been determined. Within the ABC super-family, the MDR transporters (Abcb1, Abcc1, Abcg2) in mouse models have been proved to be valuable to investigate the biochemistry and physiological functions. This review concentrates on the multidrug resistance of mouse ABC transporters in cancer and tumor cells.

Risk Factors for Acquisition of Drug Resistance during Multidrug-Resistant Tuberculosis Treatment, Arkhangelsk Oblast, Russia, 2005–2010

Science.gov (United States)

Ershova, Julia; Vlasova, Natalia; Nikishova, Elena; Tarasova, Irina; Eliseev, Platon; Maryandyshev, Andrey O.; Shemyakin, Igor G.; Kurbatova, Ekaterina; Cegielski, J. Peter

2015-01-01

Acquired resistance to antituberculosis drugs decreases effective treatment options and the likelihood of treatment success. We identified risk factors for acquisition of drug resistance during treatment for multidrug-resistant tuberculosis (MDR TB) and evaluated the effect on treatment outcomes. Data were collected prospectively from adults from Arkhangelsk Oblast, Russia, who had pulmonary MDR TB during 2005–2008. Acquisition of resistance to capreomycin and of extensively drug-resistant TB were more likely among patients who received 3 effective drugs (9.4% vs. 0% and 8.6% vs. 0.8%, respectively). Poor outcomes were more likely among patients with acquired capreomycin resistance (100% vs. 25.9%), acquired ofloxacin resistance (83.6% vs. 22.7%), or acquired extensive drug resistance (100% vs. 24.4%). To prevent acquired drug resistance and poor outcomes, baseline susceptibility to first- and second-line drugs should be determined quickly, and treatment should be adjusted to contain >3 effective drugs. PMID:25988954

Changing patterns and trends of multidrug-resistant tuberculosis at referral centre in Northern India: A 4-year experience

Directory of Open Access Journals (Sweden)

A K Maurya

2013-01-01

Full Text Available Purpose: India has a high burden of drug-resistant tuberculosis (TB, although there is little data on multidrug-resistant tuberculosis (MDR-TB. Although MDR-TB has existed for long time in India, very few diagnostic laboratories are well-equipped to test drug sensitivity. The objectives of this study were to determine the prevalence of MDR-TB, first-line drug resistance patterns and its changing trends in northern India in the 4 years. Materials and Methods: This was a prospective study from July 2007 to December 2010. Microscopy, culture by Bactec460 and p-nitro-α-acetylamino-β-hydroxypropiophenone (NAP test was performed to isolate and identify Mycobacterium tuberculosis (M. tb complex (MTBC. Drug sensitivity testing (DST was performed by 1% proportional method (Bactec460 for four drugs: Rifampicin, isoniazid, ethambutol and streptomycin. Various clinical and demographical profiles were evaluated to analyse risk factors for development of drug resistance. Results: We found the overall prevalence rate of MDR-TB to be 38.8%, increasing from 36.4% in 2007 to 40.8% in 2010. we found that the prevalence of MDR-TB in new and previously treated cases was 29.1% and 43.3% ( P < 0.05; CI 95%. The increasing trend of MDR-TB was more likely in pulmonary TB when compared with extra-pulmonary TB ( P < 0.05; CI 95%. Conclusions: we found a high prevalence (38.8% of MDR-TB both in new cases (29.1% and previously treated cases (43.3%.This study strongly highlights the need to make strategies for testing, surveillance, monitoring and management of such drug-resistant cases.

Alkanna tinctoria leaves extracts: a prospective remedy against multidrug resistant human pathogenic bacteria.

Science.gov (United States)

Khan, Usman Ali; Rahman, Hazir; Qasim, Muhammad; Hussain, Anwar; Azizllah, Azizullah; Murad, Waheed; Khan, Zakir; Anees, Muhammad; Adnan, Muhammad

2015-04-23

Plants are rich source of chemical compounds that are used to accomplish biological activity. Indigenously crude extracts of plants are widely used as herbal medicine for the treatment of infections by people of different ethnic groups. The present investigation was carried out to evaluate the biological potential of Alkanna tinctoria leaves extract from district Charsadda, Pakistan against multidrug resistant human pathogenic bacteria including Acinetobacter baumannii, Escherichia coli, Pseudomonas aeruginosa and Staphylococcus aureus. Anti-multi-drug resistant bacterial activity of aqueous, chloroform, ethanol and hexane extracts of Alkanna tinctoria leaves were evaluated by well diffusion method. Minimum inhibitory concentrations (MICs) and minimum bactericidal concentrations (MBCs) of different extracts were determined. Moreover qualitative phytochemicals screening of the studied extracts was performed. All four selected bacteria including A. baumannii, E. coli, P. aeruginosa and S. aureus were categorized as multi-drug resistant (MDR) as they were found to be resistant to 13, 10, 19 and 22 antibiotics belonging to different groups respectively. All the four extract showed potential activity against S. aureus as compare to positive control antibiotic (Imipenem). Similarly among the four extracts of Alkanna tinctoria leaves, aqueous extract showed best activity against A. baumannii (10±03 mm), P. aeruginosa (12±0.5 mm), and S. aureus (14±0.5 mm) as compare to Imipenem. The MICs and MBCs results also showed quantitative concentration of plant extracts to inhibit or kill MDR bacteria. When phytochemicals analysis was performed it was observed that aqueous and ethanol extracts showed phytochemicals with large number as well as volume, especially Alkaloides, Flavonoides and Charbohydrates. The undertaken study demonstrated that all the four extracts of Alkanna tinctoria leaves exhibited considerable antibacterial activity against MDR isolates. Finding from the

Multidrug Resistance in Breast Cancer: From In Vitro Models to Clinical Studies

International Nuclear Information System (INIS)

Wind, N.S.; Holen, I.

2011-01-01

The development of multidrug resistance (MDR) and subsequent relapse on therapy is a widespread problem in breast cancer, but our understanding of the underlying molecular mechanisms is incomplete. Numerous studies have aimed to establish the role of drug transporter pumps in MDR and to link their expression to response to chemotherapy. The ATP-binding cassette (ABC) transporters are central to breast cancer MDR, and increases in ABC expression levels have been shown to correlate with decreases in response to various chemotherapy drugs and a reduction in overall survival. But as there is a large degree of redundancy between different ABC transporters, this correlation has not been seen in all studies. This paper provides an introduction to the key molecules associated with breast cancer MDR and summarises evidence of their potential roles reported from model systems and clinical studies. We provide possible explanations for why despite several decades of research, the precise role of ABC transporters in breast cancer MDR remains elusive

From MDR to MXR

DEFF Research Database (Denmark)

Litman, Thomas; Druley, T E; Stein, W D

2001-01-01

The ATP binding cassette (ABC) superfamily of membrane transporters is one of the largest protein classes known, and counts numerous proteins involved in the trafficking of biological molecules across cell membranes. The first known human ABC transporter was P-glycoprotein (P-gp), which confers...... multidrug resistance (MDR) to anticancer drugs. In recent years, we have obtained an increased understanding of the mechanism of action of P-gp as its ATPase activity, substrate specificity and pharmacokinetic interactions have been investigated. This review focuses on the functional characterization of P...... for reversal of MDR in cancer and for drug delivery, are discussed....

Additional risk factors for infection by multidrug-resistant pathogens in healthcare-associated infection: a large cohort study

Directory of Open Access Journals (Sweden)

Cardoso Teresa

2012-12-01

Full Text Available Abstract Background There is a lack of consensus regarding the definition of risk factors for healthcare-associated infection (HCAI. The purpose of this study was to identify additional risk factors for HCAI, which are not included in the current definition of HCAI, associated with infection by multidrug-resistant (MDR pathogens, in all hospitalized infected patients from the community. Methods This 1-year prospective cohort study included all patients with infection admitted to a large, tertiary care, university hospital. Risk factors not included in the HCAI definition, and independently associated with MDR pathogen infection, namely MDR Gram-negative (MDR-GN and ESKAPE microorganisms (vancomycin-resistant Enterococcus faecium, methicillin-resistant Staphylococcus aureus, extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella species, carbapenem-hydrolyzing Klebsiella pneumonia and MDR Acinetobacter baumannii, Pseudomonas aeruginosa, Enterobacter species, were identified by logistic regression among patients admitted from the community (either with community-acquired or HCAI. Results There were 1035 patients with infection, 718 from the community. Of these, 439 (61% had microbiologic documentation; 123 were MDR (28%. Among MDR: 104 (85% had MDR-GN and 41 (33% had an ESKAPE infection. Independent risk factors associated with MDR and MDR-GN infection were: age (adjusted odds ratio (OR = 1.7 and 1.5, p = 0.001 and p = 0.009, respectively, and hospitalization in the previous year (between 4 and 12 months previously (adjusted OR = 2.0 and 1,7, p = 0.008 and p = 0.048, respectively. Infection by pathogens from the ESKAPE group was independently associated with previous antibiotic therapy (adjusted OR = 7.2, p p = 0.003. Patients with infection by MDR, MDR-GN and pathogens from the ESKAPE group had significantly higher rates of inadequate antibiotic therapy than those without (46% vs 7%, 44% vs 10%, 61% vs 15%, respectively, p

Surgical Face Masks Worn by Patients with Multidrug-Resistant Tuberculosis

Science.gov (United States)

Mphahlele, Matsie; Stoltz, Anton; Venter, Kobus; Mathebula, Rirhandzu; Masotla, Thabiso; Lubbe, Willem; Pagano, Marcello; First, Melvin; Jensen, Paul A.; van der Walt, Martie; Nardell, Edward A.

2012-01-01

Rationale: Drug-resistant tuberculosis transmission in hospitals threatens staff and patient health. Surgical face masks used by patients with tuberculosis (TB) are believed to reduce transmission but have not been rigorously tested. Objectives: We sought to quantify the efficacy of surgical face masks when worn by patients with multidrug-resistant TB (MDR-TB). Methods: Over 3 months, 17 patients with pulmonary MDR-TB occupied an MDR-TB ward in South Africa and wore face masks on alternate days. Ward air was exhausted to two identical chambers, each housing 90 pathogen-free guinea pigs that breathed ward air either when patients wore surgical face masks (intervention group) or when patients did not wear masks (control group). Efficacy was based on differences in guinea pig infections in each chamber. Measurements and Main Results: Sixty-nine of 90 control guinea pigs (76.6%; 95% confidence interval [CI], 68–85%) became infected, compared with 36 of 90 intervention guinea pigs (40%; 95% CI, 31–51%), representing a 56% (95% CI, 33–70.5%) decreased risk of TB transmission when patients used masks. Conclusions: Surgical face masks on patients with MDR-TB significantly reduced transmission and offer an adjunct measure for reducing TB transmission from infectious patients. PMID:22323300

[Cluster of multidrug-resistant tuberculosis cases in a school of the district of Ica, Peru].

Science.gov (United States)

Torres, Julio; Sardón, Victoria; Soto, Mirtha G; Anicama, Rolado; Arroyo-Hernández, Hugo; Munayco, César V

2011-01-01

We describe the evolution and features of a cluster of Multidrug-resistant tuberculosis (MDR TB) cases that occurred in 2001, in a school located in a sub-urban area of the district of Ica, Peru. We identified 15 students related before becoming infected with tuberculosis. The mean age of the cluster was 15 years. A total of 12 students were MDR-TB cases and 7 were drug-resistant to 5 first-line drugs (RHEZS). Five out of the 15 cases received at least 3 different anti-tuberculosis treatment schemes. The average treatment duration was 37 months (minimum 21 and maximum 59 months). A total of 13 cases recovered and 2 died. This study describes a cluster of MDR -TB cases in an educational facility, which due to the epidemiological link and time presentation, is probably an outbreak of MDR TB with a satisfactory outcome after prolonged treatment.

Estimating the future burden of multidrug-resistant and extensively drug-resistant tuberculosis in India, the Philippines, Russia, and South Africa: a mathematical modelling study.

Science.gov (United States)

Sharma, Aditya; Hill, Andrew; Kurbatova, Ekaterina; van der Walt, Martie; Kvasnovsky, Charlotte; Tupasi, Thelma E; Caoili, Janice C; Gler, Maria Tarcela; Volchenkov, Grigory V; Kazennyy, Boris Y; Demikhova, Olga V; Bayona, Jaime; Contreras, Carmen; Yagui, Martin; Leimane, Vaira; Cho, Sang Nae; Kim, Hee Jin; Kliiman, Kai; Akksilp, Somsak; Jou, Ruwen; Ershova, Julia; Dalton, Tracy; Cegielski, Peter

2017-07-01

Multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis are emerging worldwide. The Green Light Committee initiative supported programmatic management of drug-resistant tuberculosis in 90 countries. We used estimates from the Preserving Effective TB Treatment Study to predict MDR and XDR tuberculosis trends in four countries with a high burden of MDR tuberculosis: India, the Philippines, Russia, and South Africa. We calibrated a compartmental model to data from drug resistance surveys and WHO tuberculosis reports to forecast estimates of incident MDR and XDR tuberculosis and the percentage of incident MDR and XDR tuberculosis caused by acquired drug resistance, assuming no fitness cost of resistance from 2000 to 2040 in India, the Philippines, Russia, and South Africa. The model forecasted the percentage of MDR tuberculosis among incident cases of tuberculosis to increase, reaching 12·4% (95% prediction interval 9·4-16·2) in India, 8·9% (4·5-11·7) in the Philippines, 32·5% (27·0-35·8) in Russia, and 5·7% (3·0-7·6) in South Africa in 2040. It also predicted the percentage of XDR tuberculosis among incident MDR tuberculosis to increase, reaching 8·9% (95% prediction interval 5·1-12·9) in India, 9·0% (4·0-14·7) in the Philippines, 9·0% (4·8-14·2) in Russia, and 8·5% (2·5-14·7) in South Africa in 2040. Acquired drug resistance would cause less than 30% of incident MDR tuberculosis during 2000-40. Acquired drug resistance caused 80% of incident XDR tuberculosis in 2000, but this estimate would decrease to less than 50% by 2040. MDR and XDR tuberculosis were forecast to increase in all four countries despite improvements in acquired drug resistance shown by the Green Light Committee-supported programmatic management of drug-resistant tuberculosis. Additional control efforts beyond improving acquired drug resistance rates are needed to stop the spread of MDR and XDR tuberculosis in countries with a high burden of MDR

Vital and dispensable roles of Plasmodium multidrug resistance transporters during blood- and mosquito-stage development.

Science.gov (United States)

Rijpma, Sanna R; van der Velden, Maarten; Annoura, Takeshi; Matz, Joachim M; Kenthirapalan, Sanketha; Kooij, Taco W A; Matuschewski, Kai; van Gemert, Geert-Jan; van de Vegte-Bolmer, Marga; Siebelink-Stoter, Rianne; Graumans, Wouter; Ramesar, Jai; Klop, Onny; Russel, Frans G M; Sauerwein, Robert W; Janse, Chris J; Franke-Fayard, Blandine M; Koenderink, Jan B

2016-07-01

Multidrug resistance (MDR) proteins belong to the B subfamily of the ATP Binding Cassette (ABC) transporters, which export a wide range of compounds including pharmaceuticals. In this study, we used reverse genetics to study the role of all seven Plasmodium MDR proteins during the life cycle of malaria parasites. Four P. berghei genes (encoding MDR1, 4, 6 and 7) were refractory to deletion, indicating a vital role during blood stage multiplication and validating them as potential targets for antimalarial drugs. Mutants lacking expression of MDR2, MDR3 and MDR5 were generated in both P. berghei and P. falciparum, indicating a dispensable role for blood stage development. Whereas P. berghei mutants lacking MDR3 and MDR5 had a reduced blood stage multiplication in vivo, blood stage growth of P. falciparum mutants in vitro was not significantly different. Oocyst maturation and sporozoite formation in Plasmodium mutants lacking MDR2 or MDR5 was reduced. Sporozoites of these P. berghei mutants were capable of infecting mice and life cycle completion, indicating the absence of vital roles during liver stage development. Our results demonstrate vital and dispensable roles of MDR proteins during blood stages and an important function in sporogony for MDR2 and MDR5 in both Plasmodium species. © 2016 John Wiley & Sons Ltd.

Modulation of P-glycoprotein-mediated multidrug resistance in K562 leukemic cells by indole-3-carbinol

International Nuclear Information System (INIS)

Arora, Annu; Seth, Kavita; Kalra, Neetu; Shukla, Yogeshwer

2005-01-01

Resistance to chemotherapeutic drugs is one of the major problems in the treatment of cancer. P-glycoprotein (P-gp) encoded by the mdr gene is a highly conserved protein, acts as a multidrug transporter, and has a major role in multiple drug resistance (MDR). Targeting of P-gp by naturally occurring compounds is an effective strategy to overcome MDR. Indole-3-carbinol (I3C), a glucosinolates present in cruciferous vegetables, is a promising chemopreventive agent as it is reported to possess antimutagenic, antitumorigenic, and antiestrogenic properties in experimental studies. In the present investigation, the potential of I3C to modulate P-gp expression was evaluated in vinblastine (VBL)-resistant K562 human leukemic cells. The resistant K562 cells (K562/R10) were found to be cross-resistant to vincristine (VCR), doxorubicin (DXR), and other antineoplastic agents. I3C at a nontoxic dose (10 x 10 -3 M) enhanced the cytotoxic effects of VBL time dependently in VBL-resistant human leukemia (K562/R10) cells but had no effect on parent-sensitive cells (K562/S). The Western blot analysis of K 562/R 10 cells showed that I3C downregulates the induced levels of P-gp in resistant cells near to normal levels. The quantitation of immunocytochemically stained K562/R10 cells showed 24%, 48%, and 80% decrease in the levels of P-gp by I3C for 24, 48, and 72 h of incubation. The above features thus indicate that I3C could be used as a novel modulator of P-gp-mediated multidrug resistance in vitro and may be effective as a dietary adjuvant in the treatment of MDR cancers

Multidrug-resistant gram-negative bacteria colonization of healthy US military personnel in the US and Afghanistan.

Science.gov (United States)

Vento, Todd J; Cole, David W; Mende, Katrin; Calvano, Tatjana P; Rini, Elizabeth A; Tully, Charla C; Zera, Wendy C; Guymon, Charles H; Yu, Xin; Cheatle, Kristelle A; Akers, Kevin S; Beckius, Miriam L; Landrum, Michael L; Murray, Clinton K

2013-02-05

The US military has seen steady increases in multidrug-resistant (MDR) gram-negative bacteria (GNB) infections in casualties from Iraq and Afghanistan. This study evaluates the prevalence of MDR GNB colonization in US military personnel. GNB colonization surveillance of healthy, asymptomatic military personnel (101 in the US and 100 in Afghanistan) was performed by swabbing 7 anatomical sites. US-based personnel had received no antibiotics within 30 days of specimen collection, and Afghanistan-based personnel were receiving doxycycline for malaria chemoprophylaxis at time of specimen collection. Isolates underwent genotypic and phenotypic characterization. The only colonizing MDR GNB recovered in both populations was Escherichia coli (p=0.01), which was seen in 2% of US-based personnel (all perirectal) and 11% of Afghanistan-based personnel (10 perirectal, 1 foot+groin). Individuals with higher off-base exposures in Afghanistan did not show a difference in overall GNB colonization or MDR E. coli colonization, compared with those with limited off-base exposures. Healthy US- and Afghanistan-based military personnel have community onset-MDR E. coli colonization, with Afghanistan-based personnel showing a 5.5-fold higher prevalence. The association of doxycycline prophylaxis or other exposures with antimicrobial resistance and increased rates of MDR E. coli colonization needs further evaluation.

Border Malaria Associated with Multidrug Resistance on Thailand-Myanmar and Thailand-Cambodia Borders: Transmission Dynamic, Vulnerability, and Surveillance

Science.gov (United States)

Bhumiratana, Adisak; Intarapuk, Apiradee; Sorosjinda-Nunthawarasilp, Prapa; Maneekan, Pannamas; Koyadun, Surachart

2013-01-01

This systematic review elaborates the concepts and impacts of border malaria, particularly on the emergence and spread of Plasmodium falciparum and Plasmodium vivax multidrug resistance (MDR) malaria on Thailand-Myanmar and Thailand-Cambodia borders. Border malaria encompasses any complex epidemiological settings of forest-related and forest fringe-related malaria, both regularly occurring in certain transmission areas and manifesting a trend of increased incidence in transmission prone areas along these borders, as the result of interconnections of human settlements and movement activities, cross-border population migrations, ecological changes, vector population dynamics, and multidrug resistance. For regional and global perspectives, this review analyzes and synthesizes the rationales pertaining to transmission dynamics and the vulnerabilities of border malaria that constrain surveillance and control of the world's most MDR falciparum and vivax malaria on these chaotic borders. PMID:23865048

Identification and characterization of SSE15206, a microtubule depolymerizing agent that overcomes multidrug resistance

KAUST Repository

Manzoor, Safia

2018-02-13

Microtubules are highly dynamic structures that form spindle fibres during mitosis and are one of the most validated cancer targets. The success of drugs targeting microtubules, however, is often limited by the development of multidrug resistance. Here we describe the discovery and characterization of SSE15206, a pyrazolinethioamide derivative [3-phenyl-5-(3,4,5-trimethoxyphenyl)-4,5-dihydro-1H-pyrazole-1-carbothioamide] that has potent antiproliferative activities in cancer cell lines of different origins and overcomes resistance to microtubule-targeting agents. Treatment of cells with SSE15206 causes aberrant mitosis resulting in G2/M arrest due to incomplete spindle formation, a phenotype often associated with drugs that interfere with microtubule dynamics. SSE15206 inhibits microtubule polymerization both in biochemical and cellular assays by binding to colchicine site in tubulin as shown by docking and competition studies. Prolonged treatment of cells with the compound results in apoptotic cell death [increased Poly (ADP-ribose) polymerase cleavage and Annexin V/PI staining] accompanied by p53 induction. More importantly, we demonstrate that SSE15206 is able to overcome resistance to chemotherapeutic drugs in different cancer cell lines including multidrug-resistant KB-V1 and A2780-Pac-Res cell lines overexpressing MDR-1, making it a promising hit for the lead optimization studies to target multidrug resistance.

Dried blood spot analysis for therapeutic drug monitoring of linezolid in patients with multidrug-resistant tuberculosis

NARCIS (Netherlands)

Vu, D H; Bolhuis, M S; Koster, R A; Greijdanus, B; de Lange, W C M; van Altena, R; Brouwers, J R B J; Uges, D R A; Alffenaar, J W C

2012-01-01

Linezolid is a promising antimicrobial agent for the treatment of multidrug-resistant tuberculosis (MDR-TB), but its use is limited by toxicity. Therapeutic drug monitoring (TDM) may help to minimize toxicity while adequate drug exposure is maintained. Conventional plasma sampling and monitoring

Impact of diabetes on treatment outcomes and long-term survival in multidrug-resistant tuberculosis.

Science.gov (United States)

Kang, Young Ae; Kim, Song Yee; Jo, Kyung-Wook; Kim, Hee Jin; Park, Seung-Kyu; Kim, Tae-Hyung; Kim, Eun Kyung; Lee, Ki Man; Lee, Sung Soon; Park, Jae Seuk; Koh, Won-Jung; Kim, Dae Yun; Shim, Tae Sun

2013-01-01

Few studies have investigated the impact of diabetes mellitus (DM), a globally increasing metabolic disease, on treatment outcomes and long-term survival in patients with multidrug-resistant forms of tuberculosis (MDR-TB). We analyzed outcomes in a large cohort to assess the impact of DM on treatment outcomes of patients with MDR-TB. MDR-TB patients newly diagnosed or retreated between 2000 and 2002 and followed for 8-11 years were retrospectively analyzed with respect to the effect of DM as a comorbidity on their treatment outcome and long-term survival. Of 1,407 patients with MDR-TB, 239 (17.0%) had coexisting DM. The mean age and body mass index were higher in MDR-TB patients with DM [MDR-TBDM(+)] than in those without DM [MDR-TBDM(-)]. Patients with MDR-TB and a comorbidity of DM had a significantly lower treatment success rate than those without a history of DM (36.0 vs. 47.2%, p = 0.002). In addition, DM was the negative predictor for MDR-TB treatment success in multivariate analyses [odds ratio 0.51, 95% confidence interval (CI) 0.26-0.99]. Mean survival times were also lower in MDR-TBDM(+) than in MDR-TBDM(-) patients (102 vs. 114 months, p = 0.001), with DM as a significant predictor of poor long-term survival in multivariate analyses (hazard ratio 1.59, 95% CI 1.01-2.50). Among MDR-TB patients, DM was a relatively common comorbidity. In patients undergoing treatment for MDR-TB and followed for 8-11 years, it was found to be independently associated with an increased risk of both treatment failure and death. Copyright © 2013 S. Karger AG, Basel.

Possible impact of the standardized Category IV regimen on multidrug-resistant tuberculosis patients in Mumbai.

Science.gov (United States)

Udwadia, Zarir F; Mullerpattan, Jai Bharat; Shah, Kushal D; Rodrigues, Camilla S

2016-01-01

Treatment of multidrug-resistant tuberculosis (MDR-TB) in the Programmatic Management of Drug-resistant TB program involves a standard regimen with a 6-month intensive phase and an 18-month continuation phase. However, the local drug resistance patterns in high MDR regions such as Mumbai may not be adequately reflected in the design of the regimen for that particular area. The study was carried out at a private Tertiary Level Hospital in Mumbai in a mycobacteriology laboratory equipped to perform the second-line drug susceptibility testing (DST). We attempted to analyze the impact of prescribing the standardized Category IV regimen to all patients receiving a DST at our mycobacteriology laboratory. All samples confirmed to be MDR-TB and tested for the second-line drugs at Hinduja Hospital's Mycobacteriology Laboratory in the year 2012 were analyzed. A total of 1539 samples were analyzed. Of these, 464 (30.14%) were MDR-TB, 867 (56.33%) were MDR with fluoroquinolone resistance, and 198 (12.8%) were extensively drug-resistant TB. The average number of susceptible drugs per sample was 3.07 ± 1.29 (assuming 100% cycloserine susceptibility). Taking 4 effective drugs to be the cut or an effective regimen, the number of patients receiving 4 or more effective drugs from the standardized directly observed treatment, short-course plus regimen would be 516 (33.5%) while 66.5% of cases would receive 3 or less effective drugs. Our study shows that a high proportion of patients will have resistance to a number of the first- and second-line drugs. Local epidemiology must be factored in to avoid amplification of resistance.

The Growing Threat of Multidrug-Resistant Gram-Negative Infections in Patients with Hematologic Malignancies

Science.gov (United States)

Baker, Thomas M.; Satlin, Michael J.

2016-01-01

Prolonged neutropenia and chemotherapy-induced mucositis render patients with hematologic malignancies highly vulnerable to Gram-negative bacteremia. Unfortunately, multidrug-resistant (MDR) Gram-negative bacteria are increasingly encountered globally, and current guidelines for empirical antibiotic coverage in these patients may not adequately treat these bacteria. This expansion of resistance, coupled with traditional culturing techniques requiring 2-4 days for bacterial identification and antimicrobial susceptibility results, have grave implications for these immunocompromised hosts. This review characterizes the epidemiology, risk factors, resistance mechanisms, recommended treatments, and outcomes of the MDR Gram-negative bacteria that commonly cause infections in patients with hematologic malignancies. We also examine infection prevention strategies in hematology patients, such as infection control practices, antimicrobial stewardship, and targeted decolonization. Finally, we assess strategies to improve outcomes of infected patients, including gastrointestinal screening to guide empirical antibiotic therapy, new rapid diagnostic tools for expeditious identification of MDR pathogens, and use of two new antimicrobial agents, ceftolozane/tazobactam and ceftazidime/avibactam. PMID:27339405

Multidrug-resistant tuberculosis in Lithuania – Still a long way ahead

Directory of Open Access Journals (Sweden)

Greta Musteikienė

2016-01-01

Full Text Available Despite the recent advances in the diagnosis of tuberculosis, treatment of the disease, for the most part, remains the same as it was half a century ago. In recent years only two new anti-tuberculosis drugs have been approved by the European Medicines Agency and Food and Drug Administration. Though the prevalence of this disease is slowly decreasing all over Europe, new challenges appear. One of them is multidrug-resistant tuberculosis (MDR-TB. This problem is especially prominent in Lithuania, which is one of the 27 high MDR-TB burden countries in the world and falls behind neighboring countries in terms of the prevalence of the disease. The objective of this paper was to review the situation of tuberculosis and MDR-TB in Lithuania, and current available methods of treatment, control and diagnosis of this disease.

Multidrug Resistant Tuberculosis involving the Clavicle, Spine and Ribs

Directory of Open Access Journals (Sweden)

H Krishnan

2011-03-01

Full Text Available This report describes an unusual case of multidrug resistant tuberculosis (MDR-TB, involving the right clavicle and multicentric aytpical spine involvement without any neurological deficit. The female patient presented with acute onset of right clavicular pain associated with a one-month history of lower backache with constitutional symptoms. The clavicular lesion and MRI spine findings were highly suggestive of TB. Anti TB drugs (ATD were started empirically as Sabah, Malaysia the patient’s home, is an endemic area for TB. Despite, 2 months of ATD administration, the patient did not respond well clinically and developed left sided chest wall abscesses arising from the left 3rd and 6th ribs. She was then treated for MDR-TB infection and has responded well to this treatment.

Candida albicans Swi/Snf and Mediator Complexes Differentially Regulate Mrr1-Induced MDR1 Expression and Fluconazole Resistance.

Science.gov (United States)

Liu, Zhongle; Myers, Lawrence C

2017-11-01

Long-term azole treatment of patients with chronic Candida albicans infections can lead to drug resistance. Gain-of-function (GOF) mutations in the transcription factor Mrr1 and the consequent transcriptional activation of MDR1 , a drug efflux coding gene, is a common pathway by which this human fungal pathogen acquires fluconazole resistance. This work elucidates the previously unknown downstream transcription mechanisms utilized by hyperactive Mrr1. We identified the Swi/Snf chromatin remodeling complex as a key coactivator for Mrr1, which is required to maintain basal and induced open chromatin, and Mrr1 occupancy, at the MDR1 promoter. Deletion of snf2 , the catalytic subunit of Swi/Snf, largely abrogates the increases in MDR1 expression and fluconazole MIC observed in MRR1 GOF mutant strains. Mediator positively and negatively regulates key Mrr1 target promoters. Deletion of the Mediator tail module med3 subunit reduces, but does not eliminate, the increased MDR1 expression and fluconazole MIC conferred by MRR1 GOF mutations. Eliminating the kinase activity of the Mediator Ssn3 subunit suppresses the decreased MDR1 expression and fluconazole MIC of the snf2 null mutation in MRR1 GOF strains. Ssn3 deletion also suppresses MDR1 promoter histone displacement defects in snf2 null mutants. The combination of this work with studies on other hyperactive zinc cluster transcription factors that confer azole resistance in fungal pathogens reveals a complex picture where the induction of drug efflux pump expression requires the coordination of multiple coactivators. The observed variations in transcription factor and target promoter dependence of this process may make the search for azole sensitivity-restoring small molecules more complicated. Copyright © 2017 American Society for Microbiology.

The socioeconomic impact of multidrug resistant tuberculosis on patients: results from Ethiopia, Indonesia and Kazakhstan

NARCIS (Netherlands)

van den Hof, Susan; Collins, David; Hafidz, Firdaus; Beyene, Demissew; Tursynbayeva, Aigul; Tiemersma, Edine

2016-01-01

One of the main goals of the post-2015 global tuberculosis (TB) strategy is that no families affected by TB face catastrophic costs. We revised an existing TB patient cost measurement tool to specifically also measure multi-drug resistant (MDR) TB patients' costs and applied it in Ethiopia,

Hepatocyte SLAMF3 reduced specifically the multidrugs resistance protein MRP-1 and increases HCC cells sensitization to anti-cancer drugs.

Science.gov (United States)

Fouquet, Grégory; Debuysscher, Véronique; Ouled-Haddou, Hakim; Eugenio, Mélanie Simoes; Demey, Baptiste; Singh, Amrathlal Rabbind; Ossart, Christèle; Al Bagami, Mohammed; Regimbeau, Jean-Marc; Nguyen-Khac, Eric; Naassila, Mickael; Marcq, Ingrid; Bouhlal, Hicham

2016-05-31

Multidrug resistance MDR proteins (MRPs) are members of the C family of a group of proteins named ATP binding cassette (ABC) transporters. MRPs can transport drugs including anticancer drugs, nucleoside analogs, antimetabolites and tyrosine kinase inhibitors. Drugs used in HCC therapy, such as tyrosine kinase inhibitor sorafenib, are substrates of uptake and/or efflux transporters. Variable expression of MRPs at the plasma membrane of tumor cells may contribute to drug resistance and subsequent clinical response. Recently, we reported that the hepatocyte SLAMF3 expression (Signaling Lymphocytic Activation Molecule Family member 3) was reduced in tumor cells from hepatocellular carcinoma (HCC) compared to its high expression in adjacent tissues. In the present study, we make a strong correlation between induced SLAMF3 overexpression and the specific loss of MRP-1 expression and its functionalities as a drugs resistance transporter. No changes were observed on expression of ABCG2 and MDR. More importantly, we highlight a strong inverse correlation between MRP-1 and SLAMF3 expression in patients with HCC. We propose that the SLAMF3 overexpression in cancerous cells could represent a potential therapeutic strategy to improve the drugs sensibility of resistant cells and thus control the therapeutic failure in HCC patients.

Multidrug resistance in amoebiasis patients.

Science.gov (United States)

Bansal, Devendra; Sehgal, Rakesh; Chawla, Yogesh; Malla, Nancy; Mahajan, R C

2006-08-01

Amoebiasis, caused by Entamoeba sp. a protozoan parasite, is a major public health problem in tropical and subtropical countries. The symptomatic patients are treated by specific chemotherapy. However, there are reports of treatment failure in some cases suggesting the possibility of drug resistance. The present study was therefore planned to assess the presence and expression of mRNA of multidrug resistance (MDR) gene in clinical isolates of Entamoeba histolytica and E. dispar. Forty five clinical isolates of Entamoeba sp. [E. histolytica (15) and E. dispar (30)] were maintained in polyxenic followed by monoxenic medium. DNA and total RNA were extracted from clinical isolates of Entamoeba sp. and from sensitive strain of E. histolytica (HM1: IMSS) and subjected to polymerase chain reaction (PCR) and multiplex reverse transcription (RT)-PCR techniques. The 344 bp segment of E. histolytica DNA was seen by PCR using primers specific to EhPgp1 in all clinical isolates and sensitive strain of E. histolytica. Over expression of EhPgp1 was observed only in resistant mutant of E. histolytica; however, transcription of EhPgp1 was not seen in any clinical isolates and sensitive strain of E. histolytica. The findings of the present study indicate that, so far, drug resistance in clinical isolates of E. histolytica does not seem to be a major problem in this country. However, susceptibility of clinical isolates of E. histolytica against various antiamoebic drugs needs to be investigated for better management.

Emerging biocide resistance among multidrug-resistant bacteria: Myth or reality? A pilot study

Directory of Open Access Journals (Sweden)

Priyanka Gupta

2018-01-01

Full Text Available Context: Possible linkage between biocide and antibiotic resistance in bacteria is a major area of concern. Aim: To evaluate the susceptibility of multidrug-resistant (MDR bacteria to four commonly used biocides. Settings and Design: A pilot study was conducted in a tertiary care hospital from April to November 2017. Materials and Methods: Fifty-four MDR bacterial isolates, namely Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Staphylococcus aureus, were obtained from various clinical samples of inpatients. These isolates were subjected to tube dilution method for determining minimum inhibitory concentration (MIC of four commonly used biocides in our hospital, namely 5% w/v povidone iodine, absolute ethanol (99.9%, sodium hypochlorite (4% available chlorine, and quaternary ammonium compounds (QACs (3.39%. Minimum bactericidal concentration (MBC of these biocides was determined as per standard guidelines. Similar tests were also performed on corresponding American Type Culture Collection (ATCC bacterial strains. Statistical Analysis: The Fisher exact test. Results: Twenty-two MDR bacterial isolates had higher MIC values for QACs than their corresponding ATCC strains. Statistically significant difference in proportion of test isolates exhibiting higher MIC values for QACs and absolute ethanol was observed (P-value = 0.02. Twenty-four MDR bacterial isolates exhibited higher MBC values for sodium hypochlorite than their corresponding ATCC strains. The difference in proportion of test isolates exhibiting higher MBC values for sodium hypochlorite and absolute ethanol, respectively, was statistically significant (P-value <0.0001. The difference in proportion of test isolates exhibiting higher MBC values for absolute ethanol versus QACs and povidone iodine, respectively, was statistically significant (P-values = 0.0003 and 0.0076. Statistically significant differences in susceptibility to biocides among test isolates were also

Molecular screening of antibiotic-resistant determinants among multidrug-resistant clinical isolates of Proteus mirabilis from SouthWest Nigeria.

Science.gov (United States)

Alabi, Olumuyiwa Samuel; Mendonça, Nuno; Adeleke, Olufemi Ezekiel; da Silva, Gabriela Jorge

2017-06-01

Globally, and particularly in developing countries, the menace of anti-microbial resistance is an accelerating problem. In Nigeria, increase in bacterial resistance has been phenotypically established but due to high cost, few molecular studies have been reported. This study screened for presence of transferable resistance genes and mobile genetic elements (MGEs) such as integron among multi-drug resistant (MDR) P. mirabilis . A total of 108 P. mirabilis strains collected from five tertiary hospitals in SouthWest Nigeria were subjected to antibiotic susceptibility study using disc-diffusion method. Transferable resistance genes and MGEs were amplified using Polymerase chain reaction (PCR) analysis and amplicons sequenced. Varied resistance was observed against all the antibiotics tested. About 56% of the isolates were MDR including those from 0-12 years old children. PCR analysis revealed the presence of aac(6')-Ib (33.3%), plasmid mediated quinolone resistance (PMQR) genes [qnrA (36.7%), acc(6')-Ib-cr (5%)], TEM (48.3%), CTX-M (6.7%) and integrons class 1 (58.3%) and class 2 (26.7%). Sequencing analysis revealed bla TEM-1 , bla CTX-M-15 associated with IS Ecp1 and eight different arrays of gene cassettes: aadA1, aadA1-qacH, aadB-aadA2, aadA5, dfrA7, dfrA15, dfrA17, dfrA17-aadA5 . Transferable resistance genes in association with MGEs are present in Nigerian P. mirabilis thus their potential in disseminating resistance.

Border Malaria Associated with Multidrug Resistance on Thailand-Myanmar and Thailand-Cambodia Borders: Transmission Dynamic, Vulnerability, and Surveillance

Directory of Open Access Journals (Sweden)

Adisak Bhumiratana

2013-01-01

Full Text Available This systematic review elaborates the concepts and impacts of border malaria, particularly on the emergence and spread of Plasmodium falciparum and Plasmodium vivax multidrug resistance (MDR malaria on Thailand-Myanmar and Thailand-Cambodia borders. Border malaria encompasses any complex epidemiological settings of forest-related and forest fringe-related malaria, both regularly occurring in certain transmission areas and manifesting a trend of increased incidence in transmission prone areas along these borders, as the result of interconnections of human settlements and movement activities, cross-border population migrations, ecological changes, vector population dynamics, and multidrug resistance. For regional and global perspectives, this review analyzes and synthesizes the rationales pertaining to transmission dynamics and the vulnerabilities of border malaria that constrain surveillance and control of the world’s most MDR falciparum and vivax malaria on these chaotic borders.

Multidrug resistance-selective antiproliferative activity of Piper amide alkaloids and synthetic analogues.

Science.gov (United States)

Wang, Yue-Hu; Goto, Masuo; Wang, Li-Ting; Hsieh, Kan-Yen; Morris-Natschke, Susan L; Tang, Gui-Hua; Long, Chun-Lin; Lee, Kuo-Hsiung

2014-10-15

Twenty-five amide alkaloids (1-25) from Piper boehmeriifolium and 10 synthetic amide alkaloid derivatives (39-48) were evaluated for antiproliferative activity against eight human tumor cell lines, including chemosensitive and multidrug-resistant (MDR) cell lines. The results suggested tumor type-selectivity. 1-[7-(3,4,5-Trimethoxyphenyl)heptanoyl]piperidine (46) exhibited the best inhibitory activity (IC50=4.94 μM) against the P-glycoprotein (P-gp)-overexpressing KBvin MDR sub-line, while it and all other tested compounds, except 9, were inactive (IC50 >40 μM) against MDA-MB-231 and SK-BR-3. Structure-activity relationships (SARs) indicated that (i) 3,4,5-trimethoxy phenyl substitution is critical for selectivity against KBvin, (ii) the 4-methoxy group in this pattern is crucial for antiproliferative activity, (iii) double bonds in the side chain are not needed for activity, and (iv), in arylalkenylacyl amide alkaloids, replacement of an isobutylamino group with pyrrolidin-1-yl or piperidin-1-yl significantly improved activity. Further study on Piper amides is warranted, particularly whether side chain length affects the ability to overcome the MDR cancer phenotype. Copyright © 2014 Elsevier Ltd. All rights reserved.

Glycyrrhiza glabra HPLC fractions: identification of Aldehydo Isoophiopogonone and Liquirtigenin having activity against multidrug resistant bacteria.

Science.gov (United States)

Rahman, Hazir; Khan, Ilyas; Hussain, Anwar; Shahat, Abdelaaty Abdelaziz; Tawab, Abdul; Qasim, Muhammad; Adnan, Muhammad; Al-Said, Mansour S; Ullah, Riaz; Khan, Shahid Niaz

2018-05-02

Medicinal plants have been founded as traditional herbal medicine worldwide. Most of the plant's therapeutic properties are due to the presence of secondary metabolites such as alkaloids, glycosides, tannins and volatile oil. The present investigation analyzed the High-Pressure Liquid Chromatography (HPLC) fractions of Glycyrrhiza glabra (Aqueous, Chloroform, Ethanol and Hexane) against multidrug resistant human bacterial pathogens (Escherichia coli, Acinetobacter baumannii, Staphylococcus aureus and Pseudomonas aeruginosa). All the fractions showed antibacterial activity, were subjected to LC MS/MS analysis for identification of bioactive compounds. Among total HPLC fractions of G. glabra (n = 20), three HPLC fractions showed potential activity against multidrug resistant (MDR) bacterial isolates. Fraction 1 (F1) of aqueous extracts, showed activity against A. baumannii (15 ± 0.5 mm). F4 from hexane extract of G. glabra showed activity against S. aureus (10 ± 0.2 mm). However, F2 from ethanol extract exhibited activity against S. aureus (10 ± 0.3 mm). These active fractions were further processed by LC MS/MS analysis for the identification of compounds. Ellagic acid was identified in the F1 of aqueous extract while 6-aldehydo-isoophiopogonone was present in F4 of hexane extract. Similarly, Liquirtigenin was identified in F2 of ethanol. Glycyrrhiza glabra extracts HPLC fractions showed anti-MDR activity. Three bioactive compounds were identified in the study. 6-aldehydo-isoophiopogonone and Liquirtigenin were for the first time reported in G. glabra. Further characterization of the identified compounds will be helpful for possible therapeutic uses against infectious diseases caused by multidrug resistant bacteria.

Multidrug resistance gene expression is controlled by steroid hormones in the secretory epithelium of the uterus

NARCIS (Netherlands)

Arceci, R. J.; Baas, F.; Raponi, R.; Horwitz, S. B.; Housman, D.; Croop, J. M.

1990-01-01

The multidrug resistance (mdr) gene family has been shown to encode a membrane glycoprotein, termed the P-glycoprotein, which functions as a drug efflux pump with broad substrate specificity. This multigene family is expressed in a tissue-specific fashion in a wide variety of normal and neoplastic

Treatment outcomes of rifabutin-containing regimens for rifabutin-sensitive multidrug-resistant pulmonary tuberculosis

Directory of Open Access Journals (Sweden)

Hyun Lee

2017-12-01

Full Text Available Objectives: The aim of this study was to evaluate whether rifabutin can improve treatment outcomes in patients with rifabutin-sensitive MDR-TB. Methods: A retrospective cohort study was performed on 76 patients with rifabutin-sensitive MDR-TB who were treated with or without rifabutin between 2006 and 2011. Results: Overall, 75% (57/76 of patients achieved favorable outcomes, including cure (53/76, 70% and treatment completion (4/76, 5%. In contrast, 25% (19/76 had unfavorable treatment outcomes, which included treatment failure (6/76, 8%, death (2/76, 3%, loss to follow-up (4/76. 5%, and no evaluation due to transfer to other institutions (7/76, 9%. Rifabutin was given to 52 (68% of the 76 patients with rifabutin-sensitive MDR-TB. Although favorable treatment outcomes were more frequent in patients who received rifabutin [81% (42/52] than in those who did not receive rifabutin [63% (15/24], this difference was not statistically significant (P = 0.154. However, in multivariable regression logistic analysis, use of rifabutin was significantly associated with favorable treatment outcomes in patients with rifabutin-sensitive MDR-TB (adjusted odds ratio = 9.80, 95% confidence interval = 1.65–58.37, P = 0.012. Conclusions: These results suggest that the use of rifabutin can improve treatment outcomes in patients with rifabutin-sensitive MDR-TB. Keywords: Multidrug-resistant tuberculosis, Extensively drug-resistant tuberculosis, Rifabutin, Treatment outcome

Sequence Analysis of IncA/C and IncI1 Plasmids Isolated from Multidrug-Resistant Salmonella Newport Using Single-Molecule Real-Time Sequencing.

Science.gov (United States)

Cao, Guojie; Allard, Marc; Hoffmann, Maria; Muruvanda, Tim; Luo, Yan; Payne, Justin; Meng, Kevin; Zhao, Shaohua; McDermott, Patrick; Brown, Eric; Meng, Jianghong

2018-04-05

Multidrug-resistant (MDR) plasmids play an important role in disseminating antimicrobial resistance genes. To elucidate the antimicrobial resistance gene compositions in A/C incompatibility complex (IncA/C) plasmids carried by animal-derived MDR Salmonella Newport, and to investigate the spread mechanism of IncA/C plasmids, this study characterizes the complete nucleotide sequences of IncA/C plasmids by comparative analysis. Complete nucleotide sequencing of plasmids and chromosomes of six MDR Salmonella Newport strains was performed using PacBio RSII. Open reading frames were assigned using prokaryotic genome annotation pipeline (PGAP). To understand genomic diversity and evolutionary relationships among Salmonella Newport IncA/C plasmids, we included three complete IncA/C plasmid sequences with similar backbones from Salmonella Newport and Escherichia coli: pSN254, pAM04528, and peH4H, and additional 200 draft chromosomes. With the exception of canine isolate CVM22462, which contained an additional IncI1 plasmid, each of the six MDR Salmonella Newport strains contained only the IncA/C plasmid. These IncA/C plasmids (including references) ranged in size from 80.1 (pCVM21538) to 176.5 kb (pSN254) and carried various resistance genes. Resistance genes floR, tetA, tetR, strA, strB, sul, and mer were identified in all IncA/C plasmids. Additionally, bla CMY-2 and sugE were present in all IncA/C plasmids, excepting pCVM21538. Plasmid pCVM22462 was capable of being transferred by conjugation. The IncI1 plasmid pCVM22462b in CVM22462 carried bla CMY-2 and sugE. Our data showed that MDR Salmonella Newport strains carrying similar IncA/C plasmids clustered together in the phylogenetic tree using chromosome sequences and the IncA/C plasmids from animal-derived Salmonella Newport contained diverse resistance genes. In the current study, we analyzed genomic diversities and phylogenetic relationships among MDR Salmonella Newport using complete plasmids and chromosome

Heterologously expressed bacterial and human multidrug resistance proteins confer cadmium resistance to Escherichia coli

NARCIS (Netherlands)

Achard-Joris, M; van Saparoea, HBV; Driessen, AJM; Bourdineaud, JP; Bourdineaud, Jean-Paul

2005-01-01

The human MDR1 gene is induced by cadmium exposure although no resistance to this metal is observed in human cells overexpressing hMDR1. To access the role of MDR proteins in cadmium resistance, human MDR1, Lactococcus lactis lmrA, and Oenococcus oeni omrA were expressed in an Escherichia coli tolC

Epithelial-Mesenchymal Transitions and the Expression of Twist in MCF-7/ADR,Human Multidrug-Resistant Breast Cancer Cells

Institute of Scientific and Technical Information of China (English)

Fei Zhang; Yurong Shi; Lin Zhang; Bin Zhang; Xiyin Wei; Yi Yang; RUi Wang; Ruifang Niu

2007-01-01

OBJECTIVE To study the expression levels of Twist and epithelialmesenchymal transitions in multidrug-resistant MCF-7/ADR breast cancer cells,and to study the relationship between multidrug resistance (MDR) and metastatic potential of the cells.METHODS RT-PCR,immunohislochemical and Western blotting methods were used to examine the changes of expression levels of the transcription factor Twist.E-cadherin and N-cadherin in the MCF-7 breast cancer cell line and its multidrug-resistant variant.MCF-7/ADR.RESULTS In MCF-7 cells,the expression of E-cadherin can be detected,but there is no expression of Twisl or N-cadherin.In MCF-7/ADR cells,E-cadherin expression is lost.bul the expression of two other genes was significantly positive.CONCLUSION Epithelial-mesenchymal transitions induced by Twist,may have a relationship with enhanced invasion and metastatic potential during the development of multidrug-resistant MCF-7/ADR breast cancer cells.

Economic evaluation of a shortened standardised treatment regimen of antituberculosis drugs for patients with multidrug-resistant tuberculosis (STREAM): study protocol

OpenAIRE

Gama, Elvis; Madan, Jason; Langley, Ivor; Girma, Mamo; Evans, Denise; Rosen, Sydney; Squire, S Bertel

2016-01-01

Introduction:\\ud Multidrug-resistant tuberculosis (MDR-TB) poses a serious financial challenge to health systems and patients. The current treatment for patients with MDR-TB takes up to 24 months to complete. Evidence for a shorter regimen which differs from the standard WHO recommended MDR-TB regimen and typically lasts between 9 and 12 months has been reported from Bangladesh. This evaluation aims to assess the economic impact of a shortened regimen on patients and health systems. This eval...

Molecular epidemiology of multidrug-resistant Acinetobacter baumannii isolates in a university hospital in Nepal reveals the emergence of a novel epidemic clonal lineage.

Science.gov (United States)

Shrestha, Shovita; Tada, Tatsuya; Miyoshi-Akiyama, Tohru; Ohara, Hiroshi; Shimada, Kayo; Satou, Kazuhito; Teruya, Kuniko; Nakano, Kazuma; Shiroma, Akino; Sherchand, Jeevan Bdr; Rijal, Basista Psd; Hirano, Takashi; Kirikae, Teruo; Pokhrel, Bharat Mani

2015-11-01

The emergence of multidrug-resistant (MDR) Acinetobacter baumannii has become a serious medical problem worldwide. To clarify the genetic and epidemiological properties of MDR A. baumannii strains isolated from a medical setting in Nepal, 246 Acinetobacter spp. isolates obtained from different patients were screened for MDR A. baumannii by antimicrobial disk susceptibility testing. Whole genomes of the MDR A. baumannii isolates were sequenced by MiSeq™ (Illumina), and the complete genome of one isolate (IOMTU433) was sequenced by PacBio RS II. Phylogenetic trees were constructed from single nucleotide polymorphism concatemers. Multilocus sequence types were deduced and drug resistance genes were identified. Of the 246 Acinetobacter spp. isolates, 122 (49.6%) were MDR A. baumannii, with the majority being resistant to aminoglycosides, carbapenems and fluoroquinolones but not to colistin and tigecycline. These isolates harboured the 16S rRNA methylase gene armA as well as bla(NDM-1), bla(OXA-23) or bla(OXA-58). MDR A. baumannii isolates belonging to clonal complex 1 (CC1) and CC2 as well as a novel clonal complex (CC149) have spread throughout a medical setting in Nepal. The MDR isolates harboured genes encoding carbapenemases (OXA and NDM-1) and a 16S rRNA methylase (ArmA). Copyright © 2015 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

The management of multidrug-resistant Enterobacteriaceae.

Science.gov (United States)

Bassetti, Matteo; Peghin, Maddalena; Pecori, Davide

2016-12-01

Multidrug-resistant (MDR) Enterobacteriaceae are often related to the production of extended-spectrum b-lactamases (ESBLs) and carbapenemase-producing Enterobacteriaceae (CRE), and represent an increasing global threat. Recommendations for the therapeutic management of MDR-related infections, however, are mainly derived from retrospective and nonrandomized prospective studies. The aim of this review is to discuss the challenges in the treatment of patients with infections because of MDR Enterobacteriaceae and provide an expert opinion while awaiting for more definitive data. To avoid the selection of carbapenemase-producing Enterobacteriaceae, carbapenem-sparing strategies should be considered. B-lactams/b-lactamase inhibitors, mainly piperacillin-tazobactam, minimum inhibitory concentration (MIC) 16/4mg/ml or less represents the best alternative to carbapenems for the treatment of ESBL-producing strains. Overall, combination therapy may be preferred over monotherapy for CRE. The combination of a carbapenem-containing regimen with colistin or high-dose tigecycline or aminoglycoside can be administered at high-dose prolonged infusion with therapeutic drug monitoring for the treatment of CRE with MIC for meropenem 8-16 mg/l or less. For MIC higher than 8-16 mg/l, the use of meropenem should be avoided and various combination therapies based on the in-vitro susceptibility of antimicrobials (e.g., colistin, high-dose tigecycline, fosfomycin, and aminoglycosides) should be selected. Carbapenem-sparing strategies should be used, when feasible, for ESBL infections. The majority of available nonrandomized studies highlight that combination for CRE seem to offer some therapeutic advantage over monotherapy. Strict infection control measures toward MDR Gram-negative pathogens remain necessary while awaiting for new treatment options.

Transcriptional profiles of pulmonary innate immune responses to isogenic antibiotic-susceptible and multidrug-resistant Pseudomonas aeruginosa.

Science.gov (United States)

Tam, Vincent H; Pérez, Cynthia; Ledesma, Kimberly R; Lewis, Russell E

2018-04-01

The virulence of an isogenic pair of Pseudomonas aeruginosa strains was studied under similar experimental conditions in two animal infection models. The time to death was significantly longer for the multidrug resistant (MDR) than the wild-type strain. The transcriptional profiles of 84 innate immune response genes in the lungs of immune competent Balb/C mice were further compared. Significantly weaker expression of genes involved in production of soluble pattern recognition receptor and complement were observed in animals infected with the MDR strain. Altered patterns of innate immune system activation may explain the attenuated virulence in MDR bacteria. © 2018 The Societies and John Wiley & Sons Australia, Ltd.

Direct sequencing for rapid detection of multidrug resistant Mycobacterium tuberculosis strains in Morocco

Directory of Open Access Journals (Sweden)

Zakham F

2013-11-01

Full Text Available Fathiah Zakham,1,4 Imane Chaoui,1 Amina Hadbae Echchaoui,2 Fouad Chetioui,3 My Driss Elmessaoudi,3 My Mustapha Ennaji,4 Mohammed Abid,2 Mohammed El Mzibri11Unité de Biologie et Recherché Médicale, Centre National de l'Energie, des Sciences et des Techniques Nucléaires (CNESTEN, Rabat, 2Laboratoire de Génétique Mycobacterienne, Institut Pasteur, Tangier, 3Laboratoire de Tuberculose Institut Pasteur, Casablanca, 4Laboratoire de Microbiologie, Hygiène et Virologie, Faculté des Sciences et Techniques, Mohammedia, MoroccoBackground: Tuberculosis (TB is a major public health problem with high mortality and morbidity rates, especially in low-income countries. Disturbingly, the emergence of multidrug resistant (MDR and extensively drug resistant (XDR TB cases has worsened the situation, raising concerns of a future epidemic of virtually untreatable TB. Indeed, the rapid diagnosis of MDR TB is a critical issue for TB management. This study is an attempt to establish a rapid diagnosis of MDR TB by sequencing the target fragments of the rpoB gene which linked to resistance against rifampicin and the katG gene and inhA promoter region, which are associated with resistance to isoniazid.Methods: For this purpose, 133 sputum samples of TB patients from Morocco were enrolled in this study. One hundred samples were collected from new cases, and the remaining 33 were from previously treated patients (drug relapse or failure, chronic cases and did not respond to anti-TB drugs after a sufficient duration of treatment. All samples were subjected to rpoB, katG and pinhA mutation analysis by polymerase chain reaction and DNA sequencing.Results: Molecular analysis showed that seven strains were isoniazid-monoresistant and 17 were rifampicin-monoresistant. MDR TB strains were identified in nine cases (6.8%. Among them, eight were traditionally diagnosed as critical cases, comprising four chronic and four drug-relapse cases. The last strain was isolated from a

Multidrug-resistant pulmonary tuberculosis in Los Altos, Selva and Norte regions, Chiapas, Mexico.

Science.gov (United States)

Sánchez-Pérez, H J; Díaz-Vázquez, A; Nájera-Ortiz, J C; Balandrano, S; Martín-Mateo, M

2010-01-01

To analyse the proportion of multidrug-resistant tuberculosis (MDR-TB) in cultures performed during the period 2000-2002 in Los Altos, Selva and Norte regions, Chiapas, Mexico, and to analyse MDR-TB in terms of clinical and sociodemographic indicators. Cross-sectional study of patients with pulmonary tuberculosis (PTB) from the above regions. Drug susceptibility testing results from two research projects were analysed, as were those of routine sputum samples sent in by health personnel for processing (n = 114). MDR-TB was analysed in terms of the various variables of interest using bivariate tests of association and logistic regression. The proportion of primary MDR-TB was 4.6% (2 of 43), that of secondary MDR-TB was 29.2% (7/24), while among those whose history of treatment was unknown the proportion was 14.3% (3/21). According to the logistic regression model, the variables most highly associated with MDR-TB were as follows: having received anti-tuberculosis treatment previously, cough of >3 years' duration and not being indigenous. The high proportion of MDR cases found in the regions studied shows that it is necessary to significantly improve the control and surveillance of PTB.

Sensitivity Pattern of Second Line Anti-Tuberculosis Drugs against Clinical Isolates of Multidrug Resistant Mycobacterium Tuberculosis

International Nuclear Information System (INIS)

Ghafoor, T.; Ikram, A.; Abbasi, S. A.; Zaman, G.; Ayyub, M.; Palomino, J. C.; Vandamme, P.; Martin, A.

2015-01-01

Objective:To determine the current sensitivity pattern of second line anti-tuberculosis drugs against clinical isolates of Multidrug Resistant Mycobacterium tuberculosis (MDR-TB). Study Design: A cross-sectional study. Place and Duration of Study: Department of Microbiology, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from November 2011 to April 2013. Methodology: Samples received during the study period were processed on BACTEC MGIT 960 system for Mycobacterium tuberculosis (MTB) culture followed by first line drugs susceptibility testing of culture proven MTB isolates. On the basis of resistance to rifampicin and isoniazid, 100 clinical isolates of MDR-TB were further subjected to susceptibility testing against amikacin (AMK), capreomycin (CAP), ofloxacin (OFL) and ethionamide (ETH) as per standard BACTEC MGIT 960 instructions. Results: Out of 100 MDR-TB isolates, 62% were from male patients and 38% from female patients. 97% were sensitive to AMK, 53% to OFL, 87% to CAP; and 87% were sensitive to ETH. Conclusion: The majority of the MDR-TB isolates showed excellent sensitivity against AMK, CAP and ETH. However, sensitivity of MDR-TB isolates against fluoroquinolones like OFL was not encouraging. (author)

Risk factors and timing of default from treatment for non-multidrug-resistant tuberculosis in Moldova.

Science.gov (United States)

Jenkins, H E; Ciobanu, A; Plesca, V; Crudu, V; Galusca, I; Soltan, V; Cohen, T

2013-03-01

The Republic of Moldova, in Eastern Europe, has among the highest reported nationwide proportions of tuberculosis (TB) patients with multidrug-resistant tuberculosis (MDR-TB) worldwide. Default has been associated with increased mortality and amplification of drug resistance, and may contribute to the high MDR-TB rates in Moldova. To assess risk factors and timing of default from treatment for non-MDR-TB from 2007 to 2010. A retrospective analysis of routine surveillance data on all non-MDR-TB patients reported. A total of 14.7% of non-MDR-TB patients defaulted from treatment during the study period. Independent risk factors for default included sociodemographic factors, such as homelessness, living alone, less formal education and spending substantial time outside Moldova in the year prior to diagnosis; and health-related factors such as human immunodeficiency virus co-infection, greater lung pathology and increasing TB drug resistance. Anti-tuberculosis treatment is usually initiated within an institutional setting in Moldova, and the default risk was highest in the month following the phase of hospitalized treatment (among civilians) and after leaving prison (among those diagnosed while incarcerated). Targeted interventions to increase treatment adherence for patients at highest risk of default, and improving the continuity of care for patients transitioning from institutional to community care may substantially reduce risk of default.

Management of multidrug-resistant Pseudomonas aeruginosa in the intensive care unit: state of the art.

Science.gov (United States)

Maraolo, Alberto Enrico; Cascella, Marco; Corcione, Silvia; Cuomo, Arturo; Nappa, Salvatore; Borgia, Guglielmo; De Rosa, Francesco Giuseppe; Gentile, Ivan

2017-09-01

Pseudomonas aeruginosa (PA) is one of the most important causes of healthcare-related infections among Gram-negative bacteria. The best therapeutic approach is controversial, especially for multidrug-resistant (MDR) and extensively drug-resistant (XDR) strains as well as in the setting of most severe patients, such as in the intensive care unit (ICU). Areas covered: This article addresses several points. First, the main microbiological aspects of PA, focusing on its wide array of resistance mechanisms. Second, risk factors and the worse outcome linked to MDR-PA infection. Third, the pharmacological peculiarity of ICU patients, that makes the choice of a proper antimicrobial therapy difficult. Eventually, the current therapeutic options against MDR-PA are reviewed, taking into account the main variables that drive antimicrobial optimization in critically ill patients. Literature search was carried out using Pubmed and Web of Science. Expert commentary: Methodologically rigorous studies are urgently needed to clarify crucial aspects of the treatment against MDR-PA, namely monotherapy versus combination therapy in empiric and targeted settings. In the meanwhile, useful options are represented by newly approved drugs, such as ceftolozane/tazobactam and ceftazidime/avibactam. In critically ill patients, at least as empirical approach, a combination therapy is a prudent choice when a MDR-PA strain is suspected.

Breed distribution of the nt230(del4) MDR1 mutation in dogs.

Science.gov (United States)

Gramer, Irina; Leidolf, Regina; Döring, Barbara; Klintzsch, Stefanie; Krämer, Eva-Maria; Yalcin, Ebru; Petzinger, Ernst; Geyer, Joachim

2011-07-01

A 4-bp deletion mutation associated with multiple drug sensitivity exists in the canine multidrug resistance (MDR1) gene. This mutation has been detected in more than 10 purebred dog breeds as well as in mixed breed dogs. To evaluate the breed distribution of this mutation in Germany, 7378 dogs were screened, including 6999 purebred and 379 mixed breed dogs. The study included dog breeds that show close genetic relationship or share breeding history with one of the predisposed breeds but in which the occurrence of the MDR1 mutation has not been reported. The breeds comprised Bearded Collies, Anatolian Shepherd Dog, Greyhound, Belgian Tervuren, Kelpie, Borzoi, Australian Cattle Dog and the Irish Wolfhound. The MDR1 mutation was not detected is any of these breeds, although it was found as expected in the Collie, Longhaired Whippet, Shetland Sheepdog, Miniature Australian Shepherd, Australian Shepherd, Wäller, White Swiss Shepherd, Old English Sheepdog and Border Collie with varying allelic frequencies for the mutant MDR1 allele of 59%, 45%, 30%, 24%, 22%, 17%, 14%, 4% and 1%, respectively. Allelic frequencies of 8% and 2% were determined in herding breed mixes and unclassified mixed breeds, respectively. Because of its widespread breed distribution and occurrence in many mixed breed dogs, it is difficult for veterinarians and dog owners to recognise whether MDR1-related drug sensitivity is relevant for an individual animal. This study provides a comprehensive overview of all affected dog breeds and many dog breeds that are probably unaffected on the basis of ∼15,000 worldwide MDR1 genotyping data. Copyright © 2010 Elsevier Ltd. All rights reserved.

Emergence of multidrug-resistant Acinetobacter baumannii producing OXA-23 Carbapenemase in Qatar

Directory of Open Access Journals (Sweden)

J.-M. Rolain

2016-05-01

Full Text Available The objective of our study was to describe the molecular support of carbapenem resistance from randomly selected clinical isolates of multidrug-resistant (MDR Acinetobacter baumannii as a pilot study from the Hamad Medical Corporation (HMC, Qatar. Results of our report will be used to study carbapenemases using molecular techniques in all isolated MDR A. baumannii. Forty-eight MDR A. baumannii were randomly selected from isolates preserved at HMC. Identification of all isolates was confirmed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Antibiotic resistance was tested phenotypically by Phoenix and confirmed by Etest. The molecular support of carbapenemases (blaOXA-23, blaOXA-24, blaOXA-58, blaNDM was investigated by real-time PCR. The epidemiologic relatedness of the isolates was verified by phylogenetic analysis based on partial sequences of CsuE and blaOXA-51 genes. All 48 isolates were identified as A. baumannii and were confirmed to be resistant to most antibiotics, especially meropenem, imipenems, ciprofloxacin, levofloxacin, amikacin, gentamicin and most of the β-lactams; they were sensitive to colistin. All the isolates were positive for blaOXA-23 and negative for the other tested carbapenemase genes. Clonality analysis demonstrated that different lineages were actually circulating in Qatar; and we suggest that an outbreak occurred in the medical intensive care unit of HMC between 2011 and 2012. Here we report the emergence of MDR A. baumannii producing the carbapenemase OXA-23 in Qatar.

Combating multidrug-resistant Gram-negative bacterial infections.

Science.gov (United States)

Xu, Ze-Qi; Flavin, Michael T; Flavin, John

2014-02-01

Multidrug-resistant (MDR) bacterial infections, especially those caused by Gram-negative pathogens, have emerged as one of the world's greatest health threats. The development of novel antibiotics to treat MDR Gram-negative bacteria has, however, stagnated over the last half century. This review provides an overview of recent R&D activities in the search for novel antibiotics against MDR Gram-negatives. It provides emphasis in three key areas. First, the article looks at new analogs of existing antibiotic molecules such as β-lactams, tetracyclines, and aminoglycoside as well as agents against novel bacterial targets such as aminoacyl-tRNA synthetase and peptide deformylase. Second, it also examines alternative strategies to conventional approaches including cationic antimicrobial peptides, siderophores, efflux pump inhibitors, therapeutic antibodies, and renewed interest in abandoned treatments or those with limited indications. Third, the authors aim to provide an update on the current clinical development status for each drug candidate. The traditional analog approach is insufficient to meet the formidable challenge brought forth by MDR superbugs. With the disappointing results of the genomics approach for delivering novel targets and drug candidates, alternative strategies to permeate the bacterial cell membrane, enhance influx, disrupt efflux, and target specific pathogens via therapeutic antibodies are attractive and promising. Coupled with incentivized business models, governmental policies, and a clarified regulatory pathway, it is hoped that the antibiotic pipeline will be filled with an effective armamentarium to safeguard global health.

Rapid molecular detection of rifampicin resistance facilitates early diagnosis and treatment of multi-drug resistant tuberculosis: case control study.

Directory of Open Access Journals (Sweden)

Philly O'Riordan

2008-09-01

Full Text Available Multi-drug resistant tuberculosis (MDR-TB is a major public health concern since diagnosis is often delayed, increasing the risk of spread to the community and health care workers. Treatment is prolonged, and the total cost of treating a single case is high. Diagnosis has traditionally relied upon clinical suspicion, based on risk factors and culture with sensitivity testing, a process that can take weeks or months. Rapid diagnostic molecular techniques have the potential to shorten the time to commencing appropriate therapy, but have not been put to the test under field conditions.This retrospective case-control study aimed to identify risk factors for MDR-TB, and analyse the impact of testing for rifampicin resistance using RNA polymerase B (rpoB mutations as a surrogate for MDR-TB. Forty two MDR-TB cases and 84 fully sensitive TB controls were matched by date of diagnosis; and factors including demographics, clinical presentation, microbiology findings, management and outcome were analysed using their medical records. Conventionally recognised risk factors for MDR-TB were absent in almost half (43% of the cases, and 15% of cases were asymptomatic. A significant number of MDR-TB cases were identified in new entrants to the country. Using rpoB mutation testing, the time to diagnosis of MDR-TB was dramatically shortened by a median of 6 weeks, allowing patients to be commenced on appropriate therapy a median of 51days earlier than those diagnosed by conventional culture and sensitivity testing.MDR-TB is frequently an unexpected finding, may be asymptomatic, and is particularly prevalent among TB infected new entrants to the country. Molecular resistance testing of all acid fast bacilli positive specimens has the potential to rapidly identify MDR-TB patients and commence them on appropriate therapy significantly earlier than by conventional methods.

Clinical Validation of the Analysis of Linezolid and Clarithromycin in Oral Fluid of Patients with Multidrug-Resistant Tuberculosis

NARCIS (Netherlands)

Bolhuis, M. S.; van Altena, R.; van Hateren, K.; de Lange, W. C. M.; Greijdanus, B.; Uges, D. R. A.; Kosterink, J. G. W.; van der Werf, T. S.; Alffenaar, J. W. C.

Linezolid plays an increasingly important role in the treatment of multidrug-resistant tuberculosis (MDR-TB). However, patients should be carefully monitored due to time-and dose-dependent toxicity. Clarithromycin plays a more modest role. Therapeutic drug monitoring may contribute to assessment of

Impact of single room design on the spread of multi-drug resistant bacteria in an intensive care unit.

NARCIS (Netherlands)

Halaby, Teysir; Al Naiemi, Nashwan; Beishuizen, Bert; Verkooijen, Roel; Ferreira, José A; Klont, Rob; Vandenbroucke-Grauls, Christina

2017-01-01

Cross-transmission of nosocomial pathogens occurs frequently in intensive care units (ICU). The aim of this study was to investigate whether the introduction of a single room policy resulted in a decrease in transmission of multidrug-resistant (MDR) bacteria in an ICU.

Design, synthesis and evaluation of a potent substrate analog inhibitor identified by scanning Ala/Phe mutagenesis, mimicking substrate co-evolution, against multidrug-resistant HIV-1 protease

Energy Technology Data Exchange (ETDEWEB)

Yedidi, Ravikiran S. [Department of Biochemistry and Molecular Biology, School of Medicine, Wayne State University, Detroit, MI 48201 (United States); Muhuhi, Joseck M. [Department of Chemistry, Wayne State University, Detroit, MI 48202 (United States); Liu, Zhigang [Department of Biochemistry and Molecular Biology, School of Medicine, Wayne State University, Detroit, MI 48201 (United States); Bencze, Krisztina Z. [Department of Chemistry, Fort Hays State University, Hays, KS 67601 (United States); Koupparis, Kyriacos [Department of Biochemistry and Molecular Biology, School of Medicine, Wayne State University, Detroit, MI 48201 (United States); Department of Chemistry, Wayne State University, Detroit, MI 48202 (United States); O’Connor, Carrie E.; Kovari, Iulia A. [Department of Biochemistry and Molecular Biology, School of Medicine, Wayne State University, Detroit, MI 48201 (United States); Spaller, Mark R. [Department of Chemistry, Wayne State University, Detroit, MI 48202 (United States); Kovari, Ladislau C., E-mail: kovari@med.wayne.edu [Department of Biochemistry and Molecular Biology, School of Medicine, Wayne State University, Detroit, MI 48201 (United States)

2013-09-06

Highlights: •Inhibitors against MDR HIV-1 protease were designed, synthesized and evaluated. •Lead peptide (6a) showed potent inhibition (IC{sub 50}: 4.4 nM) of MDR HIV-1 protease. •(6a) Showed favorable binding isotherms against NL4-3 and MDR proteases. •(6a) Induced perturbations in the {sup 15}N-HSQC spectrum of MDR HIV-1 protease. •Molecular modeling suggested that (6a) may induce total flap closure inMDR protease. -- Abstract: Multidrug-resistant (MDR) clinical isolate-769, human immunodeficiency virus type-1 (HIV-1) protease (PDB ID: (1TW7)), was shown to exhibit wide-open flaps and an expanded active site cavity, causing loss of contacts with protease inhibitors. In the current study, the expanded active site cavity of MDR769 HIV-1 protease was screened with a series of peptide-inhibitors that were designed to mimic the natural substrate cleavage site, capsid/p2. Scanning Ala/Phe chemical mutagenesis approach was incorporated into the design of the peptide series to mimic the substrate co-evolution. Among the peptides synthesized and evaluated, a lead peptide (6a) with potent activity (IC{sub 50}: 4.4 nM) was identified against the MDR769 HIV-1 protease. Isothermal titration calorimetry data showed favorable binding profile for 6aagainst both wild type and MDR769 HIV-1 protease variants. Nuclear magnetic resonance spectrum of {sup 15}N-labeled MDR769 HIV-1 protease in complex with 6a showed some major perturbations in chemical shift, supporting the peptide induced conformational changes in protease. Modeling analysis revealed multiple contacts between 6a and MDR769 HIV-1 protease. The lead peptide-inhibitor, 6a, with high potency and good binding profile can be used as the basis for developing potent small molecule inhibitors against MDR variants of HIV.

Design, synthesis and evaluation of a potent substrate analog inhibitor identified by scanning Ala/Phe mutagenesis, mimicking substrate co-evolution, against multidrug-resistant HIV-1 protease

International Nuclear Information System (INIS)

Yedidi, Ravikiran S.; Muhuhi, Joseck M.; Liu, Zhigang; Bencze, Krisztina Z.; Koupparis, Kyriacos; O’Connor, Carrie E.; Kovari, Iulia A.; Spaller, Mark R.; Kovari, Ladislau C.

2013-01-01

Highlights: •Inhibitors against MDR HIV-1 protease were designed, synthesized and evaluated. •Lead peptide (6a) showed potent inhibition (IC 50 : 4.4 nM) of MDR HIV-1 protease. •(6a) Showed favorable binding isotherms against NL4-3 and MDR proteases. •(6a) Induced perturbations in the 15 N-HSQC spectrum of MDR HIV-1 protease. •Molecular modeling suggested that (6a) may induce total flap closure inMDR protease. -- Abstract: Multidrug-resistant (MDR) clinical isolate-769, human immunodeficiency virus type-1 (HIV-1) protease (PDB ID: (1TW7)), was shown to exhibit wide-open flaps and an expanded active site cavity, causing loss of contacts with protease inhibitors. In the current study, the expanded active site cavity of MDR769 HIV-1 protease was screened with a series of peptide-inhibitors that were designed to mimic the natural substrate cleavage site, capsid/p2. Scanning Ala/Phe chemical mutagenesis approach was incorporated into the design of the peptide series to mimic the substrate co-evolution. Among the peptides synthesized and evaluated, a lead peptide (6a) with potent activity (IC 50 : 4.4 nM) was identified against the MDR769 HIV-1 protease. Isothermal titration calorimetry data showed favorable binding profile for 6aagainst both wild type and MDR769 HIV-1 protease variants. Nuclear magnetic resonance spectrum of 15 N-labeled MDR769 HIV-1 protease in complex with 6a showed some major perturbations in chemical shift, supporting the peptide induced conformational changes in protease. Modeling analysis revealed multiple contacts between 6a and MDR769 HIV-1 protease. The lead peptide-inhibitor, 6a, with high potency and good binding profile can be used as the basis for developing potent small molecule inhibitors against MDR variants of HIV

Predation Efficacy of Bdellovibrio bacteriovorus on Multidrug-Resistant Clinical Pathogens and Their Corresponding Biofilms.

Science.gov (United States)

Sun, Yao; Ye, Jianzhong; Hou, Yuanbo; Chen, Huale; Cao, Jianming; Zhou, Tieli

2017-09-25

The aim of the present study was to evaluate the predation efficacy of Bdellovibrio bacteriovorus on multidrug-resistant (MDR) or extensive drug resistant (XDR) gram-negative pathogens and their corresponding biofilms. In this study, we examined the ability of B. bacteriovorus to prey on MDR and XDR gram-negative clinical bacteria, including Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Acinetobacter baumannii. Results showed that B. bacteriovorus was able to prey on all planktonic cultures, among which the most efficient predation was observed for drug-resistant E. coli, with a 3.11 log10 reduction in viability. Furthermore, B. bacteriovorus demonstrated promising efficacy in preventing biofilm formation and dispersing the established biofilm. Reductions in biofilm formation of E. coli, K. pneumoniae, P. aeruginosa, and A. baumannii co-cultured with B. bacteriovorus were 65.2%, 37.1%, 44.7%, and 36.8%, respectively. Meanwhile, the established biofilms of E. coli, K. pneumoniae, P. aeruginosa, and A. baumannii were significantly reduced by 83.4%, 81.8%, 83.1%, and 79.9%, respectively. A visual analysis supported by scanning electron microscopy demonstrated the role of B. bacteriovorus in removing the established biofilms. This study highlights the potential use of B. bacteriovorus as a biological control agent with the capability to prey on MDR/XDR gram-negative pathogens and eradicate biofilms.

Outbreak of multidrug-resistant tuberculosis in two secondary schools.

Science.gov (United States)

Miravet Sorribes, Luis; Arnedo Pena, Alberto; Bellido Blasco, Juan B; Romeu García, María Angeles; Gil Fortuño, María; García Sidro, Patricia; Cortés Miró, Pascual

2016-02-01

To describe an outbreak of multidrug-resistant tuberculosis (MDR-TB) in two schools This was a prospective, observational study of an outbreak of MDR-TB in 2 schools located in the towns of Onda and Nules, in the Spanish province of Castellon, from the moment of detection in November 2008 until November 2014, including patient follow-up and contact tracing. Five cases of MDR-TB were diagnosed. Overall attack rate was 0.9%, and among the contacts traced, 66 had latent tuberculous infection, with an infection rate of 14.4%. Molecular characterization of the 5M. tuberculosis isolates was performed by restriction fragment length polymorphism (RFLP) analysis of the IS6110 sequence. In all 5 patients, cultures were negative at 4-month follow-up, showing the efficacy of the treatment given. No recurrence has been reported to date. In the context of globalization and the increased prevalence of MDR-TB, outbreaks such as the one presented here are only to be expected. Contact tracing, strict follow-up of confirmed cases, the availability of fast diagnostic techniques to avoid treatment delay, and chemoprophylaxis, together with the molecular characterization of strains, are still essential. Copyright © 2015 SEPAR. Published by Elsevier Espana. All rights reserved.

Resident cats in small animal veterinary hospitals carry multi-drug resistant enterococci and are likely involved in cross-contamination of the hospital environment

Directory of Open Access Journals (Sweden)

Anuradha eGhosh

2012-02-01

Full Text Available In the U.S., small animal veterinary hospitals (SAVHs commonly keep resident cats living permanently as pets within their facilities. Previously, multi-drug resistant (MDR enterococci were found as a contaminant of multiple surfaces within such veterinary hospitals, and nosocomial infections are a concern. The objectives of this study were to determine whether resident cats carry MDR enterococci and if they potentially play a role in the contamination of the hospital environment. Enterococcal strains (n=180 were isolated from the feces of six healthy resident cats from different SAVHs. The concentration of enterococci ranged from 1.1 x 105 to 6.0 x 108 CFU g-1 of feces, and the population comprised E. hirae (38.3±18.6%, E. faecium (35.0±14.3%, E. faecalis (23.9±11.0%, and E. avium (2.8±2.2%. Testing of phenotypic resistance to 14 antimicrobial agents revealed multi-drug resistance (≥3 antimicrobials in 48.9% of all enterococcal isolates with most frequent resistance to tetracycline (72.8%, erythromycin (47.8%, and rifampicin (35.6%. Vancomycin resistant E. faecalis (3.9% with vanB not horizontally transferable in in vitro conjugation assays were detected from one cat. Genotyping (pulsed-field gel electrophoresis demonstrated a host-specific clonal population of MDR E. faecalis and E. faecium. Importantly, several feline isolates were genotypically identical or closely related to isolates from surfaces of cage door, thermometer, and stethoscope of the corresponding SAVHs. These data demonstrate that healthy resident cats at SAVHs carry MDR enterococci and likely contribute to contamination of the SAVH environment. Proper disposal and handling of fecal material and restricted movement of resident cats within the ward is recommended.

Carbapenem Susceptibility and Multidrug-Resistance in Pseudomonas aeruginosa Isolates in Egypt.

Science.gov (United States)

Hashem, Hany; Hanora, Amro; Abdalla, Salah; Shawky, Alaa; Saad, Alaa

2016-11-01

Resistant Pseudomonas aeruginosa is a serious concern for antimicrobial therapy, as the common isolates exhibit variable grades of resistance, involving beta-lactamase enzymes, beside native defense mechanisms. The present study was designed to determine the occurrence of Metallo-β- Lactamases (MBL) and Amp C harboring P. aeruginosa isolates from Suez Canal university hospital in Ismailia, Egypt. A total of 147 P. aeruginosa isolates, recovered from 311 patients during a 10-month period, were collected between May 2013 and February 2014; the isolates were collected from urine, wound and sputum. Minimum inhibitory concentration (MIC) determined by agar dilution methods was ≥2 μg/mL for meropenem and imipenem. Identification of P. aeruginosa was confirmed using API 20NE. Metallo-β- Lactamases and Amp C were detected based on different phenotypic methods. Overall, 26.5% of P. aeruginosa isolates (39/147) were carbapenem resistant isolates. Furthermore, 64.1% (25/39) were MBL producers, these isolates were screened by the combined disc and disc diffusion methods to determine the ability of MBL production. Both MBL and Amp C harbored P. aeruginosa isolates were 28% (7/25). Sixty-four percent of P. aeruginosa isolates were multidrug resistant (MDR) (16/25). The sensitivity toward polymyxin, imipenem, norfloxacin, piperacillin-tazobactam and gentamicin was 99%, 91%, 88%, 82% and 78%, respectively. The resistance rate towards cefotaxime, ceftazidime, cefepime, aztreonam and meropenem was 98.6%, 86%, 71.4%, 34% and 30%, respectively. Multidrug resistance was significantly associated with MBL production in P. aeruginosa . Early detection of MBL-producing P. aeruginosa and hospital antibiotic policy prescription helps proper antimicrobial therapy and avoidance of dissemination of these multidrug resistance isolates.

Diabetes is Associated with Severe Adverse Events in Multidrug-Resistant Tuberculosis.

Science.gov (United States)

Muñoz-Torrico, Marcela; Caminero-Luna, José; Migliori, Giovanni Battista; D'Ambrosio, Lia; Carrillo-Alduenda, José Luis; Villareal-Velarde, Héctor; Torres-Cruz, Alfredo; Flores-Vergara, Héctor; Martínez-Mendoza, Dina; García-Sancho, Cecilia; Centis, Rosella; Salazar-Lezama, Miguel Ángel; Pérez-Padilla, Rogelio

2017-05-01

Diabetes mellitus (DM), a very common disease in Mexico, is a well-known risk factor for tuberculosis (TB). However, it is not known by which extent DM predisposes to adverse events (AE) to anti-TB drugs and/or to worse outcomes in patients with multidrug-resistant (MDR-TB) and extensively drug-resistant TB (XDR-TB). The main objective of this study was to describe the outcomes of TB treatment, the impact of DM and the prevalence of AE in a cohort of patients with MDR-/XDR pulmonary TB treated at the national TB referral centre in Mexico City. Ninety patients were enrolled between 2010 and 2015: 73 with MDR-TB (81.1%), 11 with pre-XDR-TB (12.2%) and 6 (6.7%) with XDR-TB, including 49 (54.4%) with DM, and 3 with Human Immunodeficiency Virus (HIV) co-infection (3.3%). In 98% of patients, diagnosis was made by culture and drug susceptibility testing, while in a single case the diagnosis was made by a molecular test. The presence of DM was associated with an increased risk of serious drug-related AEs, such as nephrotoxicity (Odds Ratio [OR]=6.5; 95% Confidence Interval [95% CI]: 1.9-21.8) and hypothyroidism (OR=8.8; 95% CI: 1.8-54.2), but not for a worse outcome. Our data suggest that DM does not impact second-line TB treatment outcomes, but patients with DM have a higher risk of developing serious AEs to drug-resistant TB treatment, such as nephrotoxicity and hypothyroidism. Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.

Characterization of a Novel 99mTc-Carbonyl Complex as a Functional Probe of MDR1 P-Glycoprotein Transport Activity

Directory of Open Access Journals (Sweden)

Mary Dyszlewski

2002-01-01

Full Text Available Multidrug resistance (MDR mediated by overexpression of MDR1 P-glycoprotein (Pgp is one of the best characterized barriers to chemotherapy in cancer patients. Furthermore, the protective function of Pgp-mediated efflux of xenobiotics in various organs has a profound effect on the bioavailability of drugs in general. Thus, there is an expanding requirement to noninvasively interrogate Pgp transport activity in vivo. We herein report the Pgp recognition properties of a novel 99mTc(I-tricarbonyl complex, [99mTc(CO3(MIBI3] + (Tc-CO-MIBI. Tc-CO-MIBI showed 60-fold higher accumulation in drug-sensitive KB 3–1 cells compared to colchicine-selected drug-resistant KB 8-5 cells. In KB 8-5 cells, tracer enhancement was observed with the potent MDR modulator LY335979 (EC50 = 62 nM. Similar behavior was observed using drug-sensitive MCF-7 breast adenocarcinoma cells and MCF-7/MDR1 stable transfectants, confirming that Tc-CO-MIBI is specifically excluded by overexpression of MDR1 Pgp. By comparison, net accumulation in control H69 lung tumor cells was 9-fold higher than in MDR-associated protein (MRP1-expressing H69AR cells, indicating only modest transport by MRP1. Biodistribution analysis following tail vein injection of Tc-CO-MIBI showed delayed liver clearance as well as enhanced brain uptake and retention in mdr1a/1b(−/− gene deleted mice versus wild-type mice, directly demonstrating that Tc-CO-MIBI is a functional probe of Pgp transport activity in vivo.

Time to initiation of multidrug-resistant tuberculosis treatment and its relation with outcome in a high incidence district in Lima, Peru.

Science.gov (United States)

Otero, L; De Orbegoso, A; Navarro, A F; Ríos, J; Párraga, T; Gotuzzo, E; Seas, C; Van der Stuyft, P

2015-03-01

To determine the time from diagnosis to start of multidrug resistant tuberculosis (MDR TB) treatment in Lima, Peru. We studied new smear-positive TB adults that were started on MDR TB treatment or that were switched to it between June 2008 and December 2011. Time from the first positive smear to MDR-TB treatment was >30 days in 35% (13/37) of patients. Among the 27% (24/88) of patients that switched to MDR-TB treatment, time from the last dose of a drug-susceptible regimen was >30 days. Start of and switching to MDR TB treatment is still delayed. © 2014 John Wiley & Sons Ltd.

Lack of Association of Multidrug Resistance Gene-1 Polymorphisms with Treatment Outcome in Chronic Myeloid Leukemia Patients Treated with Imatinib

Directory of Open Access Journals (Sweden)

Yaya Kassogue

2015-10-01

Full Text Available Background: Despite the impressive results obtained with imatinib, inadequate response or resistance are observed in certain patients. It is known that imatinib is a substrate of a multidrug resistance gene (MDR1. Thus, interindividual genetic differences linked to single nucleotide polymorphisms in MDR1 may influence the metabolism of imatinib. The present study has aimed to examine the impact of MDR1 polymorphisms on the hematologic and cytogenetic responses in 70 chronic myeloid leukemia patients who received imatinib. Methods: We used a polymerase chain reaction followed by restriction fragment length polymorphism to identify different profiles of 1236C>T, 2677G>T and 3435C>T in MDR1. Results: The distribution of the three SNPs in responders and poor responders did not show any particular trend (P>0.05. The T allele was slightly higher in responders, but not significantly regardless of the type of SNP (40.3% vs. 33.8% for 1236C>T; 25% vs. 14.7% for 2677G>T and 33.3% vs. 22% for 3435C>T. The dominant model showed a similar trend (P>0.05. Diplotypes composed by the T allele in different exons were frequent in responders. Haplotype analysis showed that 1236C-2677G-3435C was slightly higher in poor responders (60.02% compared to responders (50.42%. However, 1236T-2677T-3435T was frequent in responders (16.98% compared to poor responders (13.1%. Overall, none of the haplotypes were associated with IM response in our cohort (global haplotype association test, P=0.39. Conclusion: The identification of 1236C>T, 2677G>T and 3435C>T polymorphisms may not be advantageous to predict imatinib response for our chronic myeloid leukemia patients.

Diagnostic and therapeutic progress of multi-drug resistance with anti-HBV nucleos(t)ide analogues

Institute of Scientific and Technical Information of China (English)

Zhuo-Lun Song; Yu-Jun Cui; Wei-Ping Zheng; Da-Hong Teng; Hong Zheng

2012-01-01

Nucleos(t)ide analogues (NA) are a breakthrough in the treatment and management of chronic hepatitis B.NA could suppress the replication of hepatitis B virus (HBV) and control the progression of the disease.However,drug resistance caused by their long-term use becomes a practical problem,which influences the long-term outcomes in patients.Liver transplantation is the only choice for patients with HBV-related end-stage liver disease.But,the recurrence of HBV after transplantation often caused by the development of drug resistance leads to unfavorable outcomes for the recipients.Recentiy,the multi-drug resistance (MDR) has become a common issue raised due to the development and clinical application of a variety of NA.This may complicate the antiviral therapy and bring poorly prognostic outcomes.Although clinical evidence has suggested that combination therapy with different NA could effectively reduce the viral load in patients with MDR,the advent of new antiviral agents with high potency and high genetic barrier to resistance brings hope to antiviral therapy.The future of HBV researches relies on how to prevent the MDR occurrence and develop reasonable and effective treatment strategies.This review focuses on the diagnostic and therapeutic progress in MDR caused by the anti-HBV NA and describes some new research progress in this field.

Characterization of Multidrug Resistant ESBL-Producing Escherichia coli Isolates from Hospitals in Malaysia

Directory of Open Access Journals (Sweden)

King-Ting Lim

2009-01-01

Full Text Available The emergence of Escherichia coli that produce extended spectrum β-lactamases (ESBLs and are multidrug resistant (MDR poses antibiotic management problems. Forty-seven E. coli isolates from various public hospitals in Malaysia were studied. All isolates were sensitive to imipenem whereas 36 were MDR (resistant to 2 or more classes of antibiotics. PCR detection using gene-specific primers showed that 87.5% of the ESBL-producing E. coli harbored the blaTEM gene. Other ESBL-encoding genes detected were blaOXA, blaSHV, and blaCTX-M. Integron-encoded integrases were detected in 55.3% of isolates, with class 1 integron-encoded intI1 integrase being the majority. Amplification and sequence analysis of the 5′CS region of the integrons showed known antibiotic resistance-encoding gene cassettes of various sizes that were inserted within the respective integrons. Conjugation and transformation experiments indicated that some of the antibiotic resistance genes were likely plasmid-encoded and transmissible. All 47 isolates were subtyped by PFGE and PCR-based fingerprinting using random amplified polymorphic DNA (RAPD, repetitive extragenic palindromes (REPs, and enterobacterial repetitive intergenic consensus (ERIC. These isolates were very diverse and heterogeneous. PFGE, ERIC, and REP-PCR methods were more discriminative than RAPD in subtyping the E. coli isolates.

MRJP1-containing glycoproteins isolated from honey, a novel antibacterial drug candidate with broad spectrum activity against multi-drug resistant clinical isolates

Directory of Open Access Journals (Sweden)

Katrina eBrudzynski

2015-07-01

Full Text Available The emergence of extended- spectrum β-lactamase (ESBL is the underlying cause of growing antibiotic resistance among Gram-negative bacteria to β-lactam antibiotics. We recently reported the discovery of honey glycoproteins (glps that exhibited a rapid, concentration-dependent antibacterial activity against both Gram-positive Bacillus subtilis and Gram-negative Escherichia coli that resembled action of cell wall-active β-lactam drugs. Glps showed sequence identity with the Major Royal Jelly Protein 1 (MRJP1 precursor that harbors three antimicrobial peptides: Jelleins 1, 2 and 4. Here, we used semi-quantitative radial diffusion assay and broth microdilution assay to evaluate susceptibility of a number of multi-drug resistant (MDR clinical isolates to the MRJP1-contaning honey glycoproteins. The MDR bacterial strains comprised 3 MRSA, 4 Pseudomonas aeruginosa, 2 Klebsiella pneumoniae, 2 VRE and 5 Extended-spectrum beta-lactamase (ESBL identified as 1 Proteus mirabilis, 3 Escherichia coli and 1 Escherichia coli NDM. Their resistance to different classes of antibiotics was confirmed using automated system Vitek 2. MDR isolates differred in their susceptibility to glps with MIC90 values ranging from 4.8μg/ml against B. subtilis to 14.4μg/ml against ESBL K. pneumoniae, Klebsiella spp ESBL and E. coli and up to 33μg/ml against highly resistant strains of P. aeruginosa. Glps isolated from different honeys showed a similar ability to overcome bacterial resistance to β-lactams suggesting that (a their mode of action is distinct from other classes of β-lactams and that (b the common glps structure was the lead structure responsible for the activity. The results of the current study together with our previous evidence of a rapid bactericidal activity of glps demonstrate that glps possess suitable characteristics to be considered a novel antibacterial drug candidate.

Knowledge and Attitude about Multidrug-Resistant Tuberculosis among Healthcare Workers in Public Health Centres

Directory of Open Access Journals (Sweden)

Bony Wiem Lestari

2016-12-01

Full Text Available Background: Multidrug-resistant Tuberculosis (MDR-TB is a significant public health problem and poses a threat to global tuberculosis (TB control. In 2015, at least 504 new MDR-TB cases were identified in Indonesia. Treating MDR-TB patients is very challenging. It may take more than two years for MDR-TB treatment. Therefore, it is crucial healthcare workers (HCWs are knowledgeable about MDR-TB. The aim of this study was to measure level of knowledge and attitude regarding MDR-TB among HCWs in public health centres. Methods: A cross-sectional study was conducted at 73 Public Health Centres in Bandung the capital of West Java Province from August until November 2015. The samples were 73 TB nurses and 32 laboratory staff. A self-administered questionnaire was given comprising 27 knowledge questions and 29 attitude questions. Correlation between knowledge and attitude scores was calculated by Pearson correlation test. Results: The majority of study participants were women (82.9%, married (92.4%, nursing staff (65.7% with history of TB training (98.1%. Most of the participants were 40-59 years old (69.5% with working experience in TB programme < 10 years (69.5%. Less than half (38.1% of study participants had good knowledge. In terms of attitude, more than half (53.3% of study participants had a positive attitude towards MDR-TB. Conclusions: The level of knowledge among HCWs about MDR-TB is still at an unacceptable level. Certain educational interventions aim to ensure prompt diagnosis, implement infection control and accurate treatment should be established among those HCWs.

Photochemical internalisation of chemotherapy potentiates killing of multidrug-resistant breast and bladder cancer cells

Science.gov (United States)

Adigbli, D K; Wilson, D G G; Farooqui, N; Sousi, E; Risley, P; Taylor, I; MacRobert, A J; Loizidou, M

2007-01-01

Multidrug resistance (MDR) is the major confounding factor in adjuvant solid tumour chemotherapy. Increasing intracellular amounts of chemotherapeutics to circumvent MDR may be achieved by a novel delivery method, photochemical internalisation (PCI). PCI consists of the co-administration of drug and photosensitiser; upon light activation the latter induces intracellular release of organelle-bound drug. We investigated whether co-administration of hypericin (photosensitiser) with mitoxantrone (MTZ, chemotherapeutic) plus illumination potentiates cytotoxicity in MDR cancer cells. We mapped the extent of intracellular co-localisation of drug/photosensitiser. We determined whether PCI altered drug-excreting efflux pump P-glycoprotein (Pgp) expression or function in MDR cells. Bladder and breast cancer cells and their Pgp-overexpressing MDR subclones (MGHU1, MGHU1/R, MCF-7, MCF-7/R) were given hypericin/MTZ combinations, with/without blue-light illumination. Pilot experiments determined appropriate sublethal doses for each. Viability was determined by the 3-[4,5-dimethylthiazolyl]-2,5-diphenyltetrazolium bromide assay. Intracellular localisation was mapped by confocal microscopy. Pgp expression was detected by immunofluorescence and Pgp function investigated by Rhodamine123 efflux on confocal microscopy. MTZ alone (0.1–0.2 μg ml−1) killed up to 89% of drug-sensitive cells; MDR cells exhibited less cytotoxicity (6–28%). Hypericin (0.1–0.2 μM) effects were similar for all cells; light illumination caused none or minimal toxicity. In combination, MTZ /hypericin plus illumination, potentiated MDR cell killing, vs hypericin or MTZ alone. (MGHU1/R: 38.65 and 36.63% increase, P<0.05; MCF-7/R: 80.2 and 46.1% increase, P<0.001). Illumination of combined MTZ/hypericin increased killing by 28.15% (P<0.05 MGHU1/R) compared to dark controls. Intracytoplasmic vesicular co-localisation of MTZ/hypericin was evident before illumination and at serial times post

In vitro and in vivo reversal of cancer cell multidrug resistance by the semi-synthetic antibiotic tiamulin.

Science.gov (United States)

Baggetto, L G; Dong, M; Bernaud, J; Espinosa, L; Rigal, D; Bonvallet, R; Marthinet, E

1998-11-01

A large number of multidrug resistance (MDR) modulators, termed chemosensitizers, have been identified from a variety of chemicals, but most have been proven to be clinically toxic. Low concentrations of the pleuromutilin-derived semi-synthetic antibiotic tiamulin (0.1 to 10 microM) sensitized the three highly resistant P-glycoprotein (Pgp)-overexpressing tumor cell lines P388 (murine lymphoid leukemia), AS30-D (rat hepatoma), CEM (human lymphoblastic leukemia), and the barely resistant AS30-D/S cell lines to several MDR-related anticancer drugs. Flow cytometric analysis showed that tiamulin significantly increased the intracellular accumulation of daunomycin. When compared to reference modulating agents such as verapamil and cyclosporin A, tiamulin proved to be 1.1 to 8.3 times more efficient in sensitizing the resistant cell lines. Moreover, when given i.p. (1.6 microg/mg body weight), tiamulin increased the survival rate of adriamycin-treated mice bearing the P388/ADR25 tumor line by 29%. In the presence of an anticancer drug, tiamulin inhibited both ATPase and drug transport activities of Pgp in plasma membranes from tumor cells. Tiamulin is thus a potent chemosensitizer that antagonizes the Pgp-mediated chemoresistance in many tumor cell lines expressing the MDR phenotype at different levels and displays no toxic effects on contractile tissues at active doses, therefore providing the promise for potential clinical applications.

Heterocyclic cyclohexanone monocarbonyl analogs of curcumin can inhibit the activity of ATP-binding cassette transporters in cancer multidrug resistance.

Science.gov (United States)

Revalde, Jezrael L; Li, Yan; Hawkins, Bill C; Rosengren, Rhonda J; Paxton, James W

2015-02-01

Curcumin (CUR) is a phytochemical that inhibits the xenobiotic ABC efflux transporters implicated in cancer multidrug resistance (MDR), such as P-glycoprotein (P-gp), breast cancer resistance protein (BCRP) and multidrug resistance-associated proteins 1 and 5 (MRP1 and MRP5). The use of CUR in the clinic however, is complicated by its instability and poor pharmacokinetic profile. Monocarbonyl analogs of CUR (MACs) are compounds without CUR's unstable β-diketone moiety and were reported to have improved stability and in vivo disposition. Whether the MACs can be used as MDR reversal agents is less clear, as the absence of a β-diketone may negatively impact transporter inhibition. In this study, we investigated 23 heterocyclic cyclohexanone MACs for inhibitory effects against P-gp, BCRP, MRP1 and MRP5. Using flow cytometry and resistance reversal assays, we found that many of these compounds inhibited the transport activity of the ABC transporters investigated, often with much greater potency than CUR. Overall the analogs were most effective at inhibiting BCRP and we identified three compounds, A12 (2,6-bis((E)-2,5-dimethoxy-benzylidene)cyclohexanone), A13 (2,6-bis((E)-4-hydroxyl-3-methoxybenzylidene)-cyclohexanone) and B11 (3,5-bis((E)-2-fluoro-4,5-dimethoxybenzylidene)-1-methylpiperidin-4-one), as the most promising BCRP inhibitors. These compounds inhibited BCRP activity in a non-cell line, non-substrate-specific manner. Their inhibition occurred by direct transporter interaction rather than modulating protein or cell surface expression. From these results, we concluded that MACs, such as the heterocyclic cyclohexanone analogs in this study, also have potential as MDR reversal agents and may be superior alternatives to the unstable parent compound, CUR. Copyright © 2014 Elsevier Inc. All rights reserved.

Increased p38-MAPK is responsible for chemotherapy resistance in human gastric cancer cells

International Nuclear Information System (INIS)

Guo, Xianling; Zhang, Baihe; Wu, Mengchao; Wei, Lixin; Ma, Nannan; Wang, Jin; Song, Jianrui; Bu, Xinxin; Cheng, Yue; Sun, Kai; Xiong, Haiyan; Jiang, Guocheng

2008-01-01

Chemoresistance is one of the main obstacles to successful cancer therapy and is frequently associated with Multidrug resistance (MDR). Many different mechanisms have been suggested to explain the development of an MDR phenotype in cancer cells. One of the most studied mechanisms is the overexpression of P-glycoprotein (P-gp), which is a product of the MDR1 gene. Tumor cells often acquire the drug-resistance phenotype due to upregulation of the MDR1 gene. Overexpression of MDR1 gene has often been reported in primary gastric adenocarcinoma. This study investigated the role of p38-MAPK signal pathway in vincristine-resistant SGC7901/VCR cells. P-gp and MDR1 RNA were detected by Western blot analysis and RT-PCR amplification. Mitgen-activated protein kinases and function of P-gp were demonstrated by Western blot and FACS Aria cytometer analysis. Ap-1 activity and cell apoptosis were detected by Dual-Luciferase Reporter Assay and annexin V-PI dual staining. The vincristine-resistant SGC7901/VCR cells with increased expression of the multidrug-resistance 1 (MDR1) gene were resistant to P-gp-related drug and P-gp-unrelated drugs. Constitutive increases of phosphorylated p38-MAPK and AP-1 activities were also found in the drug-resistant cells. Inhibition of p38-MAPK by SB202190 reduced activator protein-1 (AP-1) activity and MDR1 expression levels and increased the sensitivity of SGC7901/VCR cells to chemotherapy. Activation of the p38-MAPK pathway might be responsible for the modulation of P-glycoprotein-mediated and P-glycoprotein-unmediated multidrug resistance in the SGC7901/VCR cell line

Visualization of multidrug resistance in vivo

International Nuclear Information System (INIS)

Hendrikse, N.H.; Franssen, E.J.F.; Graaf, W.T.A. van der; Vries, E.G.E. de; Vaalburg, W.

1999-01-01

Various mechanisms are involved in multidrug resistance (MDR) for chemotherapeutic drugs, such as the drug efflux pumps, P-glycoprotein (Pgp) and multidrug resistance-associated protein (MRP). In this review the mechanisms involved in MDR are described and results are reviewed with particular attention to the in vivo imaging of Pgp and MRP. Various detection assays provide information about the presence of drug efflux pumps at the mRNA and protein levels. However, these methods do not yield information about the dynamic function of Pgp and MRP in vivo. For the study of Pgp- and MRP-mediated transport, single-photon emission tomography (SPET) and positron emission tomography (PET) are available. Technetium-99m sestamibi is a substrate for Pgp and MRP, and has been used in clinical studies for tumour imaging, and to visualize blockade of Pgp-mediated transport after modulation of the Pgp pump. Other 99m Tc radiopharmaceuticals, such as 99m Tc-tetrofosmin and several 99 Tc-Q complexes, are also substrates for Pgp, but to date only results from in vitro and animal studies are available for these compounds. Several agents, including [ 11 C]colchicine, [ 11 C]verapamil and [ 11 C]daunorubicin, have been evaluated for the quantification of Pgp-mediated transport with PET in vivo. The results suggest that radiolabelled colchicine, verapamil and daunorubicin are feasible substrates with which to image Pgp function in tumours. Uptake of [ 11 C]colchicine and [ 11 C]verapamil is relatively high in the chest area, reducing the value of both tracers for monitoring Pgp-mediated drug transport in tumours located in this region. In addition, it has to be borne in mind that only comparison of Pgp-mediated transport of radioalabelled substrates in the absence and in the presence of Pgp blockade gives quantitative information on Pgp-mediated pharmacokinetics. Leukotrienes are specific substrates for MRP. Therefore, N-[ 11 C]acetyl-leukotriene E 4 provides an opportunity to study MRP

Multidrug Efflux Pumps in Staphylococcus aureus: an Update

OpenAIRE

Costa, Sofia Santos; Viveiros, Miguel; Amaral, Leonard; Couto, Isabel

2013-01-01

The emergence of infections caused by multi- or pan-resistant bacteria in the hospital or in the community settings is an increasing health concern. Albeit there is no single resistance mechanism behind multiresistance, multidrug efflux pumps, proteins that cells use to detoxify from noxious compounds, seem to play a key role in the emergence of these multidrug resistant (MDR) bacteria. During the last decades, experimental data has established their contribution to low level resistance to an...

[Reflection on Medical Treatment of Multi-drug Resistance Tuberculosis: The Necessity of Chinese Medicine Holistic View].

Science.gov (United States)

Zhang, Lei-lei; Jin, Hua

2015-12-01

Causative factors of multi-drug resistance tuberculosis (MDR-TB) were analyzed from iatrogenic angles, patients themselves, and society. Reviewed was the development of treatment strategies for MDR-TB from directly observed treatment short-course (DOTS) to DOTS-Plus. The history of Chinese medicine (CM) fighting TB and characteristics at the present stage were also analyzed. Authors pointed out that CM pays attention not only to killing pathogens and confirms the necessity of getting rid of pathogens, but also to cascade response caused by pathogens. It also regards the occurrence and development of MDR-TB as a whole by combining patients' conditions, climatic, geographic, psychological, and social factors. Authors believed that therapeutic principles under guidance of CM holistic view are of positive significance and inspiration in treating MDR-TB, and emphasized holistic view as basic strategies for treating MDR-TB, but not a single countermeasure.

Isolation and in vitro evaluation of bacteriophages against MDR-bacterial isolates from septic wound infections.

Directory of Open Access Journals (Sweden)

Roja Rani Pallavali

Full Text Available Multi-drug resistance has become a major problem for the treatment of pathogenic bacterial infections. The use of bacteriophages is an attractive approach to overcome the problem of drug resistance in several pathogens that cause fatal diseases. Our study aimed to isolate multi drug resistant bacteria from patients with septic wounds and then isolate and apply bacteriophages in vitro as alternative therapeutic agents. Pus samples were aseptically collected from Rajiv Gandhi Institute of Medical Science (RIMS, Kadapa, A.P., and samples were analyzed by gram staining, evaluating morphological characteristics, and biochemical methods. MDR-bacterial strains were collected using the Kirby-Bauer disk diffusion method against a variety of antibiotics. Bacteriophages were collected and tested in vitro for lytic activity against MDR-bacterial isolates. Analysis of the pus swab samples revealed that the most of the isolates detected had Pseudomonas aeruginosa as the predominant bacterium, followed by Staphylococcus aureus, Klebsiella pneumoniae and Escherichia coli. Our results suggested that gram-negative bacteria were more predominant than gram-positive bacteria in septic wounds; most of these isolates were resistant to ampicillin, amoxicillin, penicillin, vancomycin and tetracycline. All the gram-positive isolates (100% were multi-drug resistant, whereas 86% of the gram-negative isolates had a drug resistant nature. Further bacteriophages isolated from sewage demonstrated perfect lytic activity against the multi-drug resistant bacteria causing septic wounds. In vitro analysis of the isolated bacteriophages demonstrated perfect lysis against the corresponding MDR-bacteria, and these isolated phages may be promising as a first choice for prophylaxis against wound sepsis, Moreover, phage therapy does not enhance multi-drug resistance in bacteria and could work simultaneously on a wide variety of MDR-bacteria when used in a bacteriophage cocktail. Hence

Risk factors for multidrug-resistant Gram-negative infection in burn patients.

Science.gov (United States)

Vickers, Mark L; Dulhunty, Joel M; Ballard, Emma; Chapman, Paul; Muller, Michael; Roberts, Jason A; Cotta, Menino O

2018-05-01

Infection with multidrug-resistant (MDR) Gram-negative organisms leads to poorer outcomes in the critically ill burn patient. The aim of this study was to identify the risk factors for MDR Gram-negative pathogen infection in critically ill burn patients admitted to a major tertiary referral intensive care unit (ICU) in Australia. A retrospective case-control study of all adult burn patients admitted over a 7-year period was conducted. Twenty-one cases that cultured an MDR Gram-negative organism were matched with 21 controls of similar age, gender, burn size and ICU stay. Multivariable conditional logistic regression was used to individually assess risk factors after adjusting for Acute Burn Severity Index. Adjusted odds ratios (ORs) were reported. P-values negative infection included superficial partial thickness burn size (OR: 1.08; 95% confidence interval (CI): 1.01-1.16; P-value: 0.034), prior meropenem exposure (OR: 10.39; 95% CI: 0.96-112.00; P-value: 0.054), Gram-negative colonization on admission (OR: 9.23; 95% CI: 0.65-130.15; P-value: 0.10) and escharotomy (OR: 2.66; 95% CI: 0.52-13.65; P-value: 0.24). For cases, mean age was 41 (SD: 13) years, mean total body surface area burned was 47% (SD: 18) and mean days in ICU until MDR specimen collection was 17 (SD: 10) days. Prior meropenem exposure, Gram-negative colonization on admission, escharotomy and superficial partial thickness burn size may be potentially important factors for increasing the risk of MDR Gram-negative infection in the critically ill burn patient. © 2017 Royal Australasian College of Surgeons.

Overcoming Multidrug Resistance via Photodestruction of ABCG2-Rich Extracellular Vesicles Sequestering Photosensitive Chemotherapeutics

Science.gov (United States)

Goler-Baron, Vicky; Assaraf, Yehuda G.

2012-01-01

Multidrug resistance (MDR) remains a dominant impediment to curative cancer chemotherapy. Efflux transporters of the ATP-binding cassette (ABC) superfamily including ABCG2, ABCB1 and ABCC1 mediate MDR to multiple structurally and functionally distinct antitumor agents. Recently we identified a novel mechanism of MDR in which ABCG2-rich extracellular vesicles (EVs) form in between attached neighbor breast cancer cells and highly concentrate various chemotherapeutics in an ABCG2-dependent manner, thereby sequestering them away from their intracellular targets. Hence, development of novel strategies to overcome MDR modalities is a major goal of cancer research. Towards this end, we here developed a novel approach to selectively target and kill MDR cancer cells. We show that illumination of EVs that accumulated photosensitive cytotoxic drugs including imidazoacridinones (IAs) and topotecan resulted in intravesicular formation of reactive oxygen species (ROS) and severe damage to the EVs membrane that is shared by EVs-forming cells, thereby leading to tumor cell lysis and the overcoming of MDR. Furthermore, consistent with the weak base nature of IAs, MDR cells that are devoid of EVs but contained an increased number of lysosomes, highly accumulated IAs in lysosomes and upon photosensitization were efficiently killed via ROS-dependent lysosomal rupture. Combining targeted lysis of IAs-loaded EVs and lysosomes elicited a synergistic cytotoxic effect resulting in MDR reversal. In contrast, topotecan, a bona fide transport substrate of ABCG2, accumulated exclusively in EVs of MDR cells but was neither detected in lysosomes of normal breast epithelial cells nor in non-MDR breast cancer cells. This exclusive accumulation in EVs enhanced the selectivity of the cytotoxic effect exerted by photodynamic therapy to MDR cells without harming normal cells. Moreover, lysosomal alkalinization with bafilomycin A1 abrogated lysosomal accumulation of IAs, consequently preventing

How many sputum culture results do we need to monitor multidrug-resistant-tuberculosis (MDR-TB) patients during treatment?

NARCIS (Netherlands)

Janssen, Saskia; Padanilam, Xavier; Louw, Rianna; Mahanyele, Russel; Coetzee, Gerrit; Hänscheid, Thomas; Leenstra, Tjalling; Grobusch, Martin P.

2013-01-01

Discharge of a hospital patient after a single negative sputum culture may save money when treating multidrug-resistant tuberculosis. However, after initial sputum conversion in 336 South Africans, 11.6% and 5.4% reconverted after 1 and 2 months, respectively. These findings endorse the WHO

Asclepiasterol, a novel C21 steroidal glycoside derived from Asclepias curassavica, reverses tumor multidrug resistance by down-regulating P-glycoprotein expression.

Science.gov (United States)

Yuan, Wei-Qi; Zhang, Rong-Rong; Wang, Jun; Ma, Yan; Li, Wen-Xue; Jiang, Ren-Wang; Cai, Shao-Hui

2016-05-24

Multidrug resistance (MDR) mediated by P-glycoprotein (P-gp) is a major cause of cancer therapy failure. In this study, we identified a novel C21 steroidal glycoside, asclepiasterol, capable of reversing P-gp-mediated MDR. Asclepiasterol (2.5 and 5.0μM) enhanced the cytotoxity of P-gp substrate anticancer drugs in MCF-7/ADR and HepG-2/ADM cells. MDR cells were more responsive to paclitaxel in the presence of asclepiasterol, and colony formation of MDR cells was only reduced upon treatment with a combination of asclepiasterol and doxorubicin. Consistent with these findings, asclepiasterol treatment increased the intracellular accumulation of doxorubicin and rhodamine 123 (Rh123) in MDR cells. Asclepiasterol decreased expression of P-gp protein without stimulating or suppressing MDR1 mRNA levels. Asclepiasterol-mediated P-gp suppression caused inhibition of ERK1/2 phosphorylation in two MDR cell types, and EGF, an activator of the MAPK/ERK pathway, reversed the P-gp down-regulation, implicating the MAPK/ERK pathway in asclepiasterol-mediated P-gp down-regulation. These results suggest that asclepiasterol could be developed as a modulator for reversing P-gp-mediated MDR in P-gp-overexpressing cancer variants.

Co-ordinate loss of protein kinase C and multidrug resistance gene expression in revertant MCF-7/Adr breast carcinoma cells.

Science.gov (United States)

Budworth, J; Gant, T W; Gescher, A

1997-01-01

The aim of this study was to investigate the link between protein kinase C (PKC) and multidrug resistance (mdr) phenotype. The expression of both was studied in doxorubicin-resistant MCF-7/Adr cells as they reverted to the wild-type phenotype when cultured in the absence of drug. The following parameters were measured in cells 4, 10, 15, 20 and 24 weeks after removal of doxorubicin; (1) sensitivity of the cells towards doxorubicin; (2) levels of P-glycoprotein (P-gp) and MDR1 mRNA; (3) levels and cellular localization of PKC isoenzyme proteins alpha, theta and epsilon; and (4) gene copy number of PKC-alpha and MDR1 genes. Cells lost their resistance gradually with time, so that by week 24 they had almost completely regained the drug sensitivity seen in wild-type MCF-7 cells. P-gp levels measured by Western blot mirrored the change in doxorubicin sensitivity. By week 20, P-gp had decreased to 18% of P-gp protein levels at the outset, and P-gp was not detectable at week 24. Similarly, MDR1 mRNA levels had disappeared by week 24. MCF-7/Adr cells expressed more PKCs-alpha and -theta than wild-type cells and possessed a different cellular localization of PKC-epsilon. The expression and distribution pattern of these PKCs did not change for up to 20 weeks, but reverted back to that seen in wild-type cells by week 24. MDR1 gene amplification remained unchanged until week 20, but then was lost precipitously between weeks 20 and 24. The PKC-alpha gene was not amplified in MCF-7/Adr cells. The results suggest that MCF-7/Adr cells lose MDR1 gene expression and PKC activity in a co-ordinate fashion, consistent with the existence of a mechanistic link between MDR1 and certain PKC isoenzymes.

Diagnosis and interim treatment outcomes from the first cohort of multidrug-resistant tuberculosis patients in Tanzania.

Directory of Open Access Journals (Sweden)

Stellah G Mpagama

Full Text Available Kibong'oto National Tuberculosis Hospital (KNTH, Kilimanjaro, Tanzania.Characterize the diagnostic process and interim treatment outcomes from patients treated for multidrug-resistant tuberculosis (MDR-TB in Tanzania.A retrospective cohort study was performed among all patients treated at KNTH for pulmonary MDR-TB between November 2009 and September 2011.Sixty-one culture-positive MDR-TB patients initiated therapy, 60 (98% with a prior history of TB treatment. Forty-one (67% were male and 9 (14% were HIV infected with a mean CD4 count of 424 (±106 cells/µl. The median time from specimen collection to MDR-TB diagnosis and from diagnosis to initiation of MDR-TB treatment was 138 days (IQR 101-159 and 131 days (IQR 32-233, respectively. Following treatment initiation four (7% patients died (all HIV negative, 3 (5% defaulted, and the remaining 54 (89% completed the intensive phase. Most adverse drug reactions were mild to moderate and did not require discontinuation of treatment. Median time to culture conversion was 2 months (IQR 1-3 and did not vary by HIV status. In 28 isolates available for additional second-line drug susceptibility testing, fluoroquinolone, aminoglycoside and para-aminosalicylic acid resistance was rare yet ethionamide resistance was present in 9 (32%.The majority of MDR-TB patients from this cohort had survived a prolonged referral process, had multiple episodes of prior TB treatment, but did not have advanced AIDS and converted to culture negative early while completing an intensive inpatient regimen without serious adverse event. Further study is required to determine the clinical impact of second-line drug susceptibility testing and the feasibility of alternatives to prolonged hospitalization.

Development of liposomal pemetrexed for enhanced therapy against multidrug resistance mediated by ABCC5 in breast cancer

Directory of Open Access Journals (Sweden)

Bai F

2018-03-01

Full Text Available Fang Bai,1–3,* You Yin,4,* Ting Chen,1,* Jihui Chen,1 Meixin Ge,2 Yunshu Lu,2 Fangyuan Xie,5 Jian Zhang,1 Kejin Wu,3 Yan Liu1,6 1Department of Pharmacy, Xinhua Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, 2Department of General Surgery, Xinhua Hospital, Affiliated to Shanghai Jiao Tong University, School of Medicine, Shanghai, 3Department of Breast Surgery, Obstetrics and Gynaecology Hospital, Fudan University, Shanghai, 4Department of Neurology, Changzheng Hospital Affiliated to Second Military Medical University, Shanghai, 5Department of Pharmacy, Shanghai Eastern Hepatobiliary Surgery Hospital, Shanghai, 6Department of Pharmacy, Changzheng Hospital Affiliated to Second Military Medical University, Shanghai, People’s Republic of China *These authors contributed equally to this work Purpose: Breast cancer is the most common cancer among women. Pemetrexed, a new generation antifolate drug, is one of the primary treatments for breast cancer. However, multidrug resistance (MDR in breast cancer greatly hampers the therapeutic efficacy of chemotherapies such as pemetrexed. Nanomedicine is emerging as a promising alternative technique to overcome cancer MDR. Thus, pemetrexed-loaded d-alpha tocopheryl polyethylene glycol 1000 succinate (vitamin E TPGS liposomes (liposomal pemetrexed were developed as a strategy to overcome MDR to pemetrexed in breast cancer. Materials and methods: Liposomal pemetrexed was developed using the calcium acetate gradient method. The cytotoxic effects, apoptosis-inducing activity, in vivo distribution, and antitumor activity of liposomal pemetrexed were investigated. Results: Liposomal pemetrexed was small in size (160.77 nm, with a small polydispersity of <0.1. The encapsulation efficacy of liposomal pemetrexed was 63.5%, which is rather high for water-soluble drugs in liposomes. The IC50 of liposomal pemetrexed following treatment with MDR breast cancer cells (MCF-7 cells overexpressing ABCC5

Expression of the human multidrug transporter in insect cells by a recombinant baculovirus

International Nuclear Information System (INIS)

Germann, U.A.; Willingham, M.C.; Pastan, I.; Gottesman, M.M.

1990-01-01

The plasma membrane associated human multidrug resistance (MDR1) gene product, known as the 170-kDa P-glycoprotein or the multidrug transporter, acts as an ATP-dependent efflux pump for various cytotoxic agents. The authors expressed recombinant human multidrug transporter in a baculovirus expression system to obtain large quantities and further investigate its structure and mechanism of action. MDR1 cDNA was inserted into the genome of the Autographa californica nuclear polyhedrosis virus under the control of the polyhedrin promoter. Spodoptera frugiperda insect cells synthesized high levels of recombinant multidrug transporter 2-3 days after infection. The transporter was localized by immunocytochemical methods on the external surface of the plasma membranes, in the Golgi apparatus, and within the nuclear envelope. The human multidrug transporter expressed in insect cells is not susceptible to endoglycosidase F treatment and has a lower apparent molecular weight of 140,000, corresponding to the nonglycosylated precursor of its authentic counterpart expressed in multidrug-resistant cells. Labeling experiments showed that the recombinant multidrug transporter is phosphorylated and can be photoaffinity labeled by [ 3 H]azidopine, presumably at the same two sites as the native protein. Various drugs and reversing agents compete with the [ 3 H]azidopine binding reaction when added in excess, indicating that the recombinant human multidrug transporter expressed in insect cells is functionally similar to its authentic counterpart

Folate decorated dual drug loaded nanoparticle: role of curcumin in enhancing therapeutic potential of nutlin-3a by reversing multidrug resistance.

Directory of Open Access Journals (Sweden)

Manasi Das

Full Text Available Retinoblastoma is the most common intraocular tumor in children. Malfunctioning of many signaling pathways regulating cell survival or apoptosis, make the disease more vulnerable. Notably, resistance to chemotherapy mediated by MRP-1, lung-resistance protein (LRP is the most challenging aspect to treat this disease. Presently, much attention has been given to the recently developed anticancer drug nutlin-3a because of its non-genotoxic nature and potency to activate tumor suppressor protein p53. However, being a substrate of multidrug resistance protein MRP1 and Pgp its application has become limited. Currently, research has step towards reversing Multi drug resistance (MDR by using curcumin, however its clinical relevance is restricted by plasma instability and poor bioavailability. In the present investigation we tried to encapsulate nutlin-3a and curcumin in PLGA nanoparticle (NPs surface functionalized with folate to enhance therapeutic potential of nutlin-3a by modulating MDR. We document that curcumin can inhibit the expression of MRP-1 and LRP gene/protein in a concentration dependent manner in Y79 cells. In vitro cellular cytotoxicity, cell cycle analysis and apoptosis studies were done to compare the effectiveness of native drugs (single or combined and single or dual drug loaded nanoparticles (unconjugated/folate conjugated. The result demonstrated an augmented therapeutic efficacy of targeted dual drug loaded NPs (Fol-Nut-Cur-NPs over other formulation. Enhanced expression or down regulation of proapoptotic/antiapoptotic proteins respectively and down-regulation of bcl2 and NFκB gene/protein by Fol-Nut-Cur-NPs substantiate the above findings. This is the first investigation exploring the role of curcumin as MDR modulator to enhance the therapeutic potentiality of nutlin-3a, which may opens new direction for targeting cancer with multidrug resistance phenotype.

Co-ordinate regulation of the cystic fibrosis and multidrug resistance genes in cystic fibrosis knockout mice.

Science.gov (United States)

Trezise, A E; Ratcliff, R; Hawkins, T E; Evans, M J; Freeman, T C; Romano, P R; Higgins, C F; Colledge, W H

1997-04-01

The cystic fibrosis (Cftr and multidrug resistance (Mdr1) genes encode structurally similar proteins which are members of the ABC transporter superfamily. These genes exhibit complementary patterns of expression in vivo, suggesting that the regulation of their expression may be co-ordinated. We have tested this hypothesis in vivo by examining Cftr and Mdr1 expression in cystic fibrosis knockout transgenic mice (Cftr(tm1CAM)). Cftr mRNA expression in Cftr(tm1CAM)/Cftr(tm1CAM) mice was 4-fold reduced in the intestine, as compared with littermate wild-type mice. All other Cftr(tm1CAM)/Cftr(tm1CAM) mouse tissues examined showed similar reductions in Cftr expression. In contrast, we observed a 4-fold increase in Mdr1 mRNA expression in the intestines of neonatal and 3- to 4-week-old Cftr(tm1CAM)/Cftr(tm1CAM) mice, as compared with age-matched +/+ mice, and an intermediate level of Mdr1 mRNA in heterozygous Cftr(tm1CAM) mice. In 10-week-old, Cftr(tm1CAM)/Cftr(tm1CAM) mice and in contrast to the younger mice, Mdr1 mRNA expression was reduced, by 3-fold. The expression of two control genes, Pgk-1 and Mdr2, was similar in all genotypes, suggesting that the changes in Mdr1 mRNA levels observed in the Cftr(tm1CAM)/Cftr(tm1CAM) mice are specific to the loss of Cftr expression and/or function. These data provide further evidence supporting the hypothesis that the regulation Cftr and Mdr1 expression is co-ordinated in vivo, and that this co-ordinate regulation is influenced by temporal factors.

Antimicrobial blue light inactivation of biofilms formed by clinical isolates of multidrug-resistant microorganisms

Science.gov (United States)

Ferrer-Espada, Raquel; Fang, Yanyan; Dai, Tianhong

2018-02-01

Antibiotic resistance is one of the most serious threats to public health. It is estimated that at least 23,000 people die each year in the USA as a direct result of antibiotic-resistant infections. In addition, many antibiotic-resistant microorganisms develop biofilms, surface-associated microbial communities that are extremely resistant to antibiotics and the immune system. A light-based approach, antimicrobial blue light (aBL), has attracted increasing attention due to its intrinsic antimicrobial effect without the involvement of exogenous photosensitizers. In this study, we investigated the effectiveness of this non-antibiotic approach against biofilms formed by multidrug-resistant (MDR) microorganisms. MDR Acinetobacter baumannii, Escherichia coli, Candida albicans, and Pseudomonas aeruginosa biofilms were grown either in 96-well microtiter plates for 24 h or in a CDC biofilm reactor for 48 h, and then exposed to aBL at 405 nm emitted from a light-emitting diode (LED). We demonstrated that, for the biofilms grown in the CDC biofilm reactor, approximately 1.88 log10 CFU reduction was achieved in A. baumannii, 2.78 log10 CFU in E. coli and 3.18 log10 CFU in P. aeruginosa after 162 J/cm2 , 576 J/cm2 and 500 J/cm2 aBL were delivered, respectively. For the biofilms formed in the 96-well microtiter plates, 5.67 and 2.46 log10 CFU reduction was observed in P. aeruginosa and C. albicans polymicrobial biofilm after an exposure of 216 J/cm2 . In conclusion, aBL is potentially an alternative non-antibiotic approach against MDR biofilm-related infections. Future studies are warranted to investigate other important MDR microorganisms, the mechanism of action of aBL, and aBL efficacy in vivo.

miR-297 modulates multidrug resistance in human colorectal carcinoma by down-regulating MRP-2.

Science.gov (United States)

Xu, Ke; Liang, Xin; Shen, Ke; Cui, Daling; Zheng, Yuanhong; Xu, Jianhua; Fan, Zhongze; Qiu, Yanyan; Li, Qi; Ni, Lei; Liu, Jianwen

2012-09-01

Colorectal carcinoma is a frequent cause of cancer-related death in men and women. miRNAs (microRNAs) are endogenous small non-coding RNAs that regulate gene expression negatively at the post-transcriptional level. In the present study we investigated the possible role of microRNAs in the development of MDR (multidrug resistance) in colorectal carcinoma cells. We analysed miRNA expression levels between MDR colorectal carcinoma cell line HCT116/L-OHP cells and their parent cell line HCT116 using a miRNA microarray. miR-297 showed lower expression in HCT116/L-OHP cells compared with its parental cells. MRP-2 (MDR-associated protein 2) is an important MDR protein in platinum-drug-resistance cells and is a predicted target of miR-297. Additionally miR-297 was down-regulated in a panel of human colorectal carcinoma tissues and negatively correlated with expression levels of MRP-2. Furthermore, we found that ectopic expression of miR-297 in MDR colorectal carcinoma cells reduced MRP-2 protein level and sensitized these cells to anti-cancer drugs in vitro and in vivo. Taken together, our findings suggest that miR-297 could play a role in the development of MDR in colorectal carcinoma cells, at least in part by modulation of MRP-2.

Chronic airflow obstruction after successful treatment of multidrug-resistant tuberculosis

Directory of Open Access Journals (Sweden)

Anthony L. Byrne

2017-07-01

Full Text Available Cross-sectional studies reveal an association between tuberculosis (TB and chronic airflow obstruction, but cannot adequately address confounding. We hypothesised that treated pulmonary TB is an independent risk factor for chronic airflow obstruction. The Pulmones Post TB cohort study enrolled participants from Lima, Peru, aged 10–70 years with a history of drug-susceptible (DS- or multidrug-resistant (MDR-TB who had completed treatment and were clinically cured. Unexposed participants without TB were randomly selected from the same districts. We assessed respiratory symptoms, relevant environmental exposures, and spirometric lung function pre- and post-bronchodilator. In total, 144 participants with DS-TB, 33 with MDR-TB and 161 unexposed participants were fully evaluated. Compared with unexposed participants, MDR-TB patients had lower lung volumes (adjusted mean difference in forced vital capacity −370 mL, 95% CI −644– −97 and post-bronchodilator airflow obstruction (adjusted OR 4.89, 95% CI 1.27–18.78. Participants who had recovered from DS-TB did not have lower lung volumes than unexposed participants, but were more likely to have a reduced forced expiratory volume in 1 s/forced vital capacity ratio <0.70 (adjusted OR 2.47, 95% CI 1.01–6.03. Individuals successfully treated for TB may experience long-lasting sequelae. Interventions facilitating earlier TB treatment and management of chronic respiratory disease should be explored.

Bacterial multidrug efflux pumps: mechanisms, physiology and pharmacological exploitations.

Science.gov (United States)

Sun, Jingjing; Deng, Ziqing; Yan, Aixin

2014-10-17

Multidrug resistance (MDR) refers to the capability of bacterial pathogens to withstand lethal doses of structurally diverse drugs which are capable of eradicating non-resistant strains. MDR has been identified as a major threat to the public health of human being by the World Health Organization (WHO). Among the four general mechanisms that cause antibiotic resistance including target alteration, drug inactivation, decreased permeability and increased efflux, drug extrusion by the multidrug efflux pumps serves as an important mechanism of MDR. Efflux pumps not only can expel a broad range of antibiotics owing to their poly-substrate specificity, but also drive the acquisition of additional resistance mechanisms by lowering intracellular antibiotic concentration and promoting mutation accumulation. Over-expression of multidrug efflux pumps have been increasingly found to be associated with clinically relevant drug resistance. On the other hand, accumulating evidence has suggested that efflux pumps also have physiological functions in bacteria and their expression is subject tight regulation in response to various of environmental and physiological signals. A comprehensive understanding of the mechanisms of drug extrusion, and regulation and physiological functions of efflux pumps is essential for the development of anti-resistance interventions. In this review, we summarize the development of these research areas in the recent decades and present the pharmacological exploitation of efflux pump inhibitors as a promising anti-drug resistance intervention. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

P-glycoprotein binds to ezrin at amino acid residues 149-242 in the FERM domain and plays a key role in the multidrug resistance of human osteosarcoma.

Science.gov (United States)

Brambilla, Daria; Zamboni, Silvia; Federici, Cristina; Lugini, Luana; Lozupone, Francesco; De Milito, Angelo; Cecchetti, Serena; Cianfriglia, Maurizio; Fais, Stefano

2012-06-15

Overexpression of the mdr1 gene encoding P-glycoprotein (Pgp) exerts a major role in reducing the effectiveness of cytotoxic therapy in osteosarcoma. The interaction between actin and Pgp has been shown to be instrumental in the establishment of multidrug resistance (MDR) in human tumor cells. The cytoskeleton linker ezrin exerts a pivotal role in maintaining the functional connection between actin and Pgp. We investigated the role of ezrin in a human multidrug-resistant osteosarcoma cell line overexpressing Pgp and compared it to its counterpart that overexpresses an ezrin deletion mutant. The results showed that Pgp binds at amino acid residues 149-242 of the N-terminal domain of ezrin. The interaction between ezrin and Pgp occurs in the plasma membrane of MDR cells, where they also co-localize with the ganglioside G(M1) located in lipid rafts. The overexpression of the ezrin deletion mutant entirely restored drug susceptibility of osteosarcoma cells, consistent with Pgp dislocation to cytoplasmic compartments and abrogation of G(M1) /Pgp co-localization at the plasma membrane. Our study provides evidence that ezrin exerts a key role in MDR of human osteosarcoma cells through a Pgp-ezrin-actin connection that is instrumental for the permanence of Pgp into plasma membrane lipid rafts. We also show for the first time that Pgp-binding site is localized to amino acid residues 149-242 of the ezrin Band 4.1, Ezrin/Radixin/Moesin (FERM) domain, thus proposing a specific target for future molecular therapy aimed at counteracting MDR in osteosarcoma patients. Copyright © 2011 UICC.

Expression and activity of multidrug resistance proteins in mature endothelial cells and their precursors: A challenging correlation.

Science.gov (United States)

Krawczenko, Agnieszka; Bielawska-Pohl, Aleksandra; Wojtowicz, Karolina; Jura, Roksana; Paprocka, Maria; Wojdat, Elżbieta; Kozłowska, Urszula; Klimczak, Aleksandra; Grillon, Catherine; Kieda, Claudine; Duś, Danuta

2017-01-01

Active cellular transporters of harmful agents-multidrug resistance (mdr) proteins-are present in tumor, stem and endothelial cells, among others. While mdr proteins are broadly studied in tumor cells, their role in non-tumor cells and the significance of their action not connected with removal of harmful xenobiotics is less extensively documented. Proper assessment of mdr proteins expression is difficult. Mdr mRNA presence is most often evaluated but that does not necessarily correlate with the protein level. The protein expression itself is difficult to determine; usually cells with mdr overexpression are studied, not cells under physiological conditions, in which a low expression level of mdr protein is often insufficient for detection in vitro. Various methods are used to identify mdr mRNA and protein expression, together with functional tests demonstrating their biological drug transporting activities. Data comparing different methods of investigating expression of mdr mRNAs and their corresponding proteins are still scarce. In this article we present the results of a study concerning mdr mRNA and protein expression. Our goal was to search for the best method to investigate the expression level and functional activity of five selected mdr proteins-MDR1, BCRP, MRP1, MRP4 and MRP5-in established in vitro cell lines of human endothelial cells (ECs) and their progenitors. Endothelial cells demonstrated mdr presence at the mRNA level, which was not always confirmed at the protein level or in functional tests. Therefore, several different assays had to be applied for evaluation of mdr proteins expression and functions in endothelial cells. Among them functional tests seemed to be the most conclusive, although not very specific.

Phenotypic Characterization of Multidrug-resistant Escherichia Coli with Special Reference to Extended-spectrum-beta-lactamases and Metallo-beta-lactamases in a Tertiary Care Center.

Science.gov (United States)

Shrestha, B; Shrestha, S; Mishra, S K; Kattel, H P; Tada, T; Ohara, H; Kirikae, T; Rijal, B P; Sherchand, J B; Pokhrel, B M

2015-01-01

The increasing reports on extended-spectrum-beta-lactamase and metallo-beta-lactamase producing Escherichia coli have addressed a potential threat to global health since it is found to be highly resistance to most of the currently available antibiotics including carbapenems. The present study was aimed to determine the antibiogram of extended-spectrum-beta-lactamase and metallo-beta-lactamase producing MDR E. coli isolates from various clinical samples. This was a cross-sectional study conducted over a period of seven months from December 2013 to July 2014 at bacteriology laboratory of Tribhuvan University Teaching Hospital. A total of 250 clinical specimens (urine, pus, sputum, blood, body fluid, bile, tissue and central venous pressure line tip) were processed from inpatients, with multidrug-resistant Escherichia coli infections. Standard microbiological techniques were used for isolation and identification of the isolates. The presence of extended-spectrum-beta-lactamase was detected by phenotypic confirmatory test recommended by Clinical and Laboratory Standards Institute and imipenem (IMP) /EDTA combined disc method was performed to detect metallo-beta-lactamase mediated resistance mechanism. We found high level of beta lactamase mediated resistance mechanism as part of multidrug resistance. Among 250 MDR isolates, 60% isolates were extended-spectrum-beta-lactamase producers and 17.2% isolates were metallo-beta-lactamase producers. Co-existence of extended-spectrum-beta-lactamase and metallo-beta-lactamase identified in 6.8% isolates. Beta-lactamase mediated resistance mechanisms are accounting very high in the multidrug resistant isolates of E. coli. Therefore, early detection of beta lactamase mediated resistant strains and their current antibiotic susceptibility pattern is necessary to avoid treatment failure and prevent the spread of MDR.

The draft genome sequence of multidrug-resistant Pseudomonas aeruginosa strain CCBH4851, a nosocomial isolate belonging to clone SP (ST277 that is prevalent in Brazil

Directory of Open Access Journals (Sweden)

Melise Silveira

2014-12-01

Full Text Available The high occurrence of nosocomial multidrug-resistant (MDR microorganisms is considered a global health problem. Here, we report the draft genome sequence of a MDR Pseudomonas aeruginosa strain isolated in Brazil that belongs to the endemic clone ST277. The genome encodes important resistance determinant genes and consists of 6.7 Mb with a G+C content of 66.86% and 6,347 predicted coding regions including 60 RNAs.

Dissemination of Multidrug-Resistant, Class I and II Integrons and Molecular Typing of CTX-M-producing Klebsiella pneumoniae.

Science.gov (United States)

Akya, Alisha; Elahi, Azam; Chegenelorestani, Roya; Rezaee, Mahya

2018-01-01

Klebsiella pneumoniae ( K. pneumoniae ) is an important opportunistic pathogen causes serious community and hospital-acquired infections, which is highly resistant to antibiotics. We aimed to determine the frequency of multidrug resistant (MDR) and molecular typing of clinical isolates of K. pneumoniae . One hundred isolates of K. pneumoniae were collected from clinical samples in three general hospitals in Kermanshah. The antimicrobial susceptibility and extended-spectrum beta-lactamases (ESBL) production of isolates were determined using disk diffusion and combined disk methods, respectively. The bla CTX-M gene, class I and II integrons were detected using polymerase chain reaction. The bla CTX-M positive isolates were selected for genotyping using pulsed-field gel electrophoresis (PFGE). MDR phenotype was observed in 56% of isolates. The 40% of isolates were ESBL positive and 35 isolates contained bla CTX-M . Class I and II of integrons were detected in 50 (89.2%) and 39 (69.6%) of MDR isolates, respectively. PFGE patterns of K. pneumoniae bla CTX-M positive isolates indicated 19 clusters (X 1-19 ) with different genotype patterns. The study findings highlight the concern of circulating MDR strains of K. pneumoniae with bla CTX-M and class I and II integrons in Kermanshah hospitals. The presence of integrons among isolates may facilitate the spread of new resistance genes in this bacterium. Therefore, surveillance for the spread of MDR strains of this bacterium is recommended in hospitals.

Mdr65 decreases toxicity of multiple insecticides in Drosophila melanogaster.

Science.gov (United States)

Sun, Haina; Buchon, Nicolas; Scott, Jeffrey G

2017-10-01

ABC transporters are ubiquitous membrane-bound proteins, present in both prokaryotes and eukaryotes. The major function of eukaryotic ABC transporters is to mediate the efflux of a variety of substrates (including xenobiotics) out of cells. ABC transporters have been widely investigated in humans, particularly for their involvement in multidrug resistance (MDR). Considerably less is known about their roles in transport and/or excretion in insects. ABC transporters are only known to function as exporters in insects. Drosophila melanogaster has 56 ABC transporter genes, including eight which are phylogenetically most similar to the human Mdr genes (ABCB1 clade). We investigated the role of ABC transporters in the ABCB1 clade in modulating the susceptibility to insecticides. We took advantage of the GAL4/UAS system in D. melanogaster to knockdown the expression levels of Mdr65, Mdr50, Mdr49 and ABCB6 using transgenic UAS-RNAi lines and conditional driver lines. The most notable effects were increased sensitivities to nine different insecticides by silencing of Mdr65. Furthermore, a null mutation of Mdr65 decreased the malathion, malaoxon and fipronil LC 50 values by a factor of 1.9, 2.1 and 3.9, respectively. Altogether, this data demonstrates the critical role of ABC transporters, particularly Mdr65, in altering the toxicity of specific, structurally diverse, insecticides in D. melanogaster. Copyright © 2017 Elsevier Ltd. All rights reserved.

Association of ABCB1, β tubulin I, and III with multidrug resistance of MCF7/DOC subline from breast cancer cell line MCF7.

Science.gov (United States)

Li, Wentao; Zhai, Baoping; Zhi, Hui; Li, Yuhong; Jia, Linjiao; Ding, Chao; Zhang, Bin; You, Wei

2014-09-01

Docetaxel is a first-line chemotherapeutic agent for treating advanced breast cancer. The development of chemoresistance or multidrug resistance (MDR), however, results in breast cancer chemotherapy failure. This study aims to explore the molecular mechanisms underlying docetaxel-resistance in treatment of breast cancer. The docetaxel-resistant subline MCF7/DOC, derived from the parental sensitive breast cancer cell line MCF7, was established by intermittent exposure to moderate concentrations of docetaxel, followed by examination of its phenotypes. The MCF7/DOC subline showed cross resistance against paclitaxel, doxorubicin, methotrexate, and 5-Fu. Compared to the parental MCF7, MCF7/DOC cells were enlarged with heterogeneous sizes and a cobblestone and polygonal appearance. They were arrested at G2/M phase and proliferated slowly. The colony formation potential of MCF7/DOC in soft agar was significantly increased. MCF7/DOC cells showed reduced intracellular accumulation and increased efflux of rhodamine 123. The mRNA expression level of adenosine triphosphate binding cassette (ABC) transporter family, i.e., ABCB1, ABCC1, ABCC2, ABCG2, and β tubulin isotypes were characterized by quantitative PCR. High-level expression of ABCB1, βI, and βIII tubulin mRNA in MCF7/DOC was detected. Downregulation of ABCB1, βI, and βIII tubulin mediated by three combined siRNAs resulted in stronger growth inhibition of MCF7/DOC than inhibition of the expression of individual genes. ABCB1, βI, and βIII tubulin might contribute to the MDR of MCF7/DOC and be potential therapeutic targets for overcoming MDR of breast cancer.

Rapid diagnosis of multidrug resistance in cancer by electrochemical sensor based on carbon nanotubes-drug supramolecular nanocomposites.

Science.gov (United States)

Zhang, Haijun; Jiang, Hui; Sun, Feifei; Wang, Huangping; Zhao, Juan; Chen, Baoan; Wang, Xuemei

2011-03-15

The multidrug resistance (MDR) in cancer is a major chemotherapy obstacle, rendering many currently available chemotherapeutic drugs ineffective. The aim of this study was to explore the new strategy to early diagnose the MDR by electrochemical sensor based on carbon nanotubes-drug supramolecular interaction. The carbon nanotubes modified glassy carbon electrodes (CNTs/GCE) were directly immersed into the cells suspension of the sensitive leukemia cells K562 and/or its MDR cells K562/A02 to detect the response of the electrochemical probe of daunorubicin (DNR) residues after incubated with cells for 1h. The fresh evidence from the electrochemical studies based on CNTs/GCE demonstrated that the homogeneous, label-free strategy could directly measure the function of cell membrane transporters in MDR cancer cells, identify the cell phenotype (sensitive or MDR). When the different ratios of the sensitive leukemia cells K562 and its MDR ones K562/A02 were applied as a model of MDR levels to simulate the MDR occurrence in cancer, the cathodic peak current showed good linear response to the fraction of MDR with a correlation coefficient of 0.995. Therefore, the MDR fraction can be easily predicted based on the calibration curve of the cathodic peak current versus the fraction of MDR. These results indicated that the sensing strategy could provide a powerful tool for assessment of MDR in cancer. The new electrochemical sensor based on carbon nanotubes-drug supramolecular nanocomposites could represent promising approach in the rapid diagnosis of MDR in cancer. Copyright © 2011 Elsevier B.V. All rights reserved.

Childhood multidrug-resistant tuberculosis in the European Union and European Economic Area: an analysis of tuberculosis surveillance data from 2007 to 2015.

Science.gov (United States)

Ködmön, Csaba; van den Boom, Martin; Zucs, Phillip; van der Werf, Marieke Johanna

2017-11-01

BackgroundConfirming tuberculosis (TB) in children and obtaining information on drug susceptibility is essential to ensure adequate treatment. We assessed whether there are gaps in diagnosis and treatment of multidrug-resistant (MDR) TB in children in the European Union and European Economic Area (EU/EEA), quantified the burden of MDR TB in children and characterised cases. Methods : We analysed surveillance data from 2007 to 2015 for paediatric cases younger than 15 years. Results : In that period, 26 EU/EEA countries reported 18,826 paediatric TB cases of whom 4,129 (21.9%) were laboratory-confirmed. Drug susceptibility testing results were available for 3,378 (17.9%), representing 81.8% of the confirmed cases. The majority (n = 2,967; 87.8%) had drug-sensitive TB, 249 (7.4%) mono-resistant TB, 64 (1.9%) poly-resistant TB, 90 (2.7%) MDR TB and eight (0.2%) had extensively drug-resistant (XDR) TB. MDR TB was more frequently reported among paediatric cases with foreign background (adjusted odds ratio (aOR) = 1.73; 95% confidence interval (95% CI): 1.12-2.67) or previous TB treatment (aOR: 6.42; 95% CI: 3.24-12.75). Successful treatment outcome was reported for 58 of 74 paediatric MDR TB cases with outcome reported from 2007 to 2013; only the group of 5-9 years-olds was significantly associated with unsuccessful treatment outcome (crude odds ratio (cOR) = 11.45; 95% CI: 1.24-106.04). Conclusions : The burden of MDR TB in children in the EU/EEA appears low, but may be underestimated owing to challenges in laboratory confirmation. Diagnostic improvements are needed for early detection and adequate treatment of MDR TB. Children previously treated for TB or of foreign origin may warrant higher attention.

Cost-Effectiveness of Antiretroviral Therapy for Multidrug-Resistant HIV: Past, Present, and Future

Directory of Open Access Journals (Sweden)

Marianne Harris

2012-01-01

Full Text Available In the early years of the highly active antiretroviral therapy (HAART era, HIV with resistance to two or more agents in different antiretroviral classes posed a significant clinical challenge. Multidrug-resistant (MDR HIV was an important cause of treatment failure, morbidity, and mortality. Treatment options at the time were limited; multiple drug regimens with or without enfuvirtide were used with some success but proved to be difficult to sustain for reasons of tolerability, toxicity, and cost. Starting in 2006, data began to emerge supporting the use of new drugs from the original antiretroviral classes (tipranavir, darunavir, and etravirine and drugs from new classes (raltegravir and maraviroc for the treatment of MDR HIV. Their availability has enabled patients with MDR HIV to achieve full and durable viral suppression with more compact and cost-effective regimens including at least two and often three fully active agents. The emergence of drug-resistant HIV is expected to continue to become less frequent in the future, driven by improvements in the convenience, tolerability, efficacy, and durability of first-line HAART regimens. To continue this trend, the optimal rollout of HAART in both rich and resource-limited settings will require careful planning and strategic use of antiretroviral drugs and monitoring technologies.

Pulsed-field gel electrophoresis of multidrug-resistant and -sensitive strains of Pseudomonas aeruginosa from a Malaysian hospital.

Science.gov (United States)

Thong, Kwai Lin; Lai, Kin Seng; Ganeswrie, R; Puthucheary, S D

2004-10-01

Over a period of 6 months from January to June 2002, an unusual increase in the isolation of highly resistant Pseudomonas aeruginosa strains was observed in the various wards and intensive care units of a large general hospital in Johor Bahru, Malaysia. An equal number of multidrug resistant (MDR) and drug-susceptible strains were collected randomly from swabs, respiratory specimens, urine, blood, cerebral spinal fluid, and central venous catheters to determine the clonality and genetic variation of the strains. Macrorestriction analysis by pulsed-field gel electrophoresis showed that the 19 MDR strains were genetically very homogenous; the majority showed the dominant profile S1 (n = 10), the rest very closely related profiles S1a (n = 1), S2 (n = 4), and S2a (n = 3), indicating the endemicity of these strains. In contrast, the 19 drug-sensitive strains isolated during the same time period were genetically more diverse, showing 17 pulsed-field profiles (F = 0.50-1.00), and probably derived from the patients themselves. The presence of the MDR clone poses serious therapeutic problems as it may become endemic in the hospital and give rise to future clonal outbreaks. There is also the potential for wider geographical spread.

Features of Cytokine Regulation in Multidrug-Resistant Tuberculosis Depending on Severity of Endogenous Intoxication

Directory of Open Access Journals (Sweden)

L.D. Todoriko

2016-02-01

Conclusions. Comprehensive assessment of integral indices of endogenous intoxication and level of certain pro- and anti-inflammatory cytokines in the blood plasma of patients with MDR TB shows a moderate endogenous intoxication, break down of the cellular component of the immune reactivity due to the formation of conditions for the development of Mycobacterium tuberculosis resistance, with further growth of cytotoxic hypoxia and activation of systemic inflammatory response syndrome. Analysis of plasma concentration of IL-6, IL-10 and IL-18 in patients with multidrug-resistance proved, that their level depends on the nature of Mycobacterium tuberculosis resistance.

From phenothiazine to 3-phenyl-1,4-benzothiazine derivatives as inhibitors of the Staphylococcus aureus NorA multidrug efflux pump.

Science.gov (United States)

Sabatini, Stefano; Kaatz, Glenn W; Rossolini, Gian Maria; Brandini, David; Fravolini, Arnaldo

2008-07-24

Overexpression of efflux pumps is an important mechanism by which bacteria evade effects of substrate antimicrobial agents and inhibition of such pumps is a promising strategy to circumvent this resistance mechanism. NorA is a Staphylococcus aureus multidrug efflux pump, the activity of which confers decreased susceptibility to many structurally unrelated agents, including fluoroquinolones, resulting in a multidrug resistant (MDR) phenotype. In this work, a series of 1,4-benzothiazine derivatives were designed and synthesized as a minimized structural template of phenothiazine MDR efflux pump inhibitors (EPIs) in an effort to identify more potent S. aureus NorA EPIs. Almost all derivatives evaluated showed good activity in combination with ciprofloxacin against S. aureus ATCC 25923; some were capable of completely restoring ciprofloxacin activity in a norA-overexpressing strain (SA-K2378). Compounds 6k and 7j displayed good activity against SA-1199B, a strain that also overexpresses norA, in an ethidium bromide (EtBr) efflux inhibition assay.

Fighting infections due to multidrug-resistant Gram-positive pathogens.

Science.gov (United States)

Cornaglia, G

2009-03-01

Growing bacterial resistance in Gram-positive pathogens means that what were once effective and inexpensive treatments for infections caused by these bacteria are now being seriously questioned, including penicillin and macrolides for use against pneumococcal infections and-in hospitals-oxacillin for use against staphylococcal infections. As a whole, multidrug-resistant (MDR) Gram-positive pathogens are rapidly becoming an urgent and sometimes unmanageable clinical problem. Nevertheless, and despite decades of research into the effects of antibiotics, the actual risk posed to human health by antibiotic resistance has been poorly defined; the lack of reliable data concerning the outcomes resulting from antimicrobial resistance stems, in part, from problems with study designs and the methods used in resistence determination. Surprisingly little is known, too, about the actual effectiveness of the many types of intervention aimed at controlling antibiotic resistance. New antibiotics active against MDR Gram-positive pathogens have been recently introduced into clinical practice, and the antibiotic pipeline contains additional compounds at an advanced stage of development, including new glycopeptides, new anti-methicillin-resistant Staphylococcus aureus (MRSA) beta-lactams, and new diaminopyrimidines. Many novel antimicrobial agents are likely to be niche products, endowed with narrow antibacterial spectra and/or targeted at specific clinical problems. Therefore, an important educational goal will be to change the current, long-lasting attitudes of both physicians and customers towards broad-spectrum and multipurpose compounds. Scientific societies, such as the European Society of Clinical Microbiology and Infectious Diseases (ESCMID), must play a leading role in this process.

Multidrug resistance 1 gene polymorphisms may determine Crohn's disease behavior in patients from Rio de Janeiro

Directory of Open Access Journals (Sweden)

Ana Teresa P. Carvalho

2014-01-01

Full Text Available OBJECTIVES: Conflicting data from studies on the potential role of multidrug resistance 1 gene polymorphisms in inflammatory bowel disease may result from the analysis of genetically and geographically distinct populations. Here, we investigated whether multidrug resistance 1 gene polymorphisms are associated with inflammatory bowel diseases in patients from Rio de Janeiro. METHODS: We analyzed 123 Crohn's disease patients and 83 ulcerative colitis patients to determine the presence of the multidrug resistance 1 gene polymorphisms C1236T, G2677T and C3435T. In particular, the genotype frequencies of Crohn's disease and ulcerative colitis patients were analyzed. Genotype-phenotype associations with major clinical characteristics were established, and estimated risks were calculated for the mutations. RESULTS: No significant difference was observed in the genotype frequencies of the multidrug resistance 1 G2677T/A and C3435T polymorphisms between Crohn's disease and ulcerative colitis patients. In contrast, the C1236T polymorphism was significantly more common in Crohn's disease than in ulcerative colitis (p = 0.047. A significant association was also found between the multidrug resistance 1 C3435T polymorphism and the stricturing form of Crohn's disease (OR: 4.13; p = 0.009, whereas no association was found with penetrating behavior (OR: 0.33; p = 0.094. In Crohn's disease, a positive association was also found between the C3435T polymorphism and corticosteroid resistance/refractoriness (OR: 4.14; p = 0.010. However, no significant association was found between multidrug resistance 1 gene polymorphisms and UC subphenotypic categories. CONCLUSION: The multidrug resistance 1 gene polymorphism C3435T is associated with the stricturing phenotype and an inappropriate response to therapy in Crohn's disease. This association with Crohn's disease may support additional pathogenic roles for the multidrug resistance 1 gene in regulating gut