WorldWideScience

Sample records for mdr tb regimen

  1. Comparison of effectiveness and safety of imipenem/clavulanate- versus meropenem/clavulanate-containing regimens in the treatment of MDR- and XDR-TB.

    Science.gov (United States)

    Tiberi, Simon; Sotgiu, Giovanni; D'Ambrosio, Lia; Centis, Rosella; Abdo Arbex, Marcos; Alarcon Arrascue, Edith; Alffenaar, Jan Willem; Caminero, Jose A; Gaga, Mina; Gualano, Gina; Skrahina, Alena; Solovic, Ivan; Sulis, Giorgia; Tadolini, Marina; Alarcon Guizado, Valentina; De Lorenzo, Saverio; Roby Arias, Aurora Jazmín; Scardigli, Anna; Akkerman, Onno W; Aleksa, Alena; Artsukevich, Janina; Auchynka, Vera; Bonini, Eduardo Henrique; Chong Marín, Félix Antonio; Collahuazo López, Lorena; de Vries, Gerard; Dore, Simone; Kunst, Heinke; Matteelli, Alberto; Moschos, Charalampos; Palmieri, Fabrizio; Papavasileiou, Apostolos; Payen, Marie-Christine; Piana, Andrea; Spanevello, Antonio; Vargas Vasquez, Dante; Viggiani, Pietro; White, Veronica; Zumla, Alimuddin; Migliori, Giovanni Battista

    2016-06-01

    No large study to date has ever evaluated the effectiveness, safety and tolerability of imipenem/clavulanate versus meropenem/clavulanate to treat multidrug- and extensively drug-resistant tuberculosis (MDR- and XDR-TB). The aim of this observational study was to compare the therapeutic contribution of imipenem/clavulanate versus meropenem/clavulanate added to background regimens to treat MDR- and XDR-TB cases.84 patients treated with imipenem/clavulanate-containing regimens showed a similar median number of antibiotic resistances (8 versus 8) but more fluoroquinolone resistance (79.0% versus 48.9%, pimipenem/clavulanate- and meropenem/clavulanate-containing regimens for a median (interquartile range) of 187 (60-428) versus 85 (49-156) days, respectively.Statistically significant differences were observed on sputum smear and culture conversion rates (79.7% versus 94.8%, p=0.02 and 71.9% versus 94.8%, pimipenem/clavulanate and meropenem/clavulanate were reported in 5.4% and 6.5% of cases only.Our study suggests that meropenem/clavulanate is more effective than imipenem/clavulanate in treating MDR/XDR-TB patients. Copyright ©ERS 2016.

  2. Efficacy, safety and tolerability of linezolid containing regimens in treating MDR-TB and XDR-TB : systematic review and meta-analysis

    NARCIS (Netherlands)

    Sotgiu, Giovanni; Centis, Rosella; D'Ambrosio, Lia; Alffenaar, Jan-William C.; Anger, Holly A.; Caminero, Jose A.; Castiglia, Paolo; De Lorenzo, Saverio; Ferrara, Giovanni; Koh, Won-Jung; Schecter, Giesela F.; Shim, Tae S.; Singla, Rupak; Skrahina, Alena; Spanevello, Antonio; Udwadia, Zarir F.; Villar, Miquel; Zampogna, Elisabetta; Zellweger, Jean-Pierre; Zumla, Alimuddin; Migliori, Giovanni Battista

    2012-01-01

    Linezolid is used off-label to treat multidrug-resistant tuberculosis (MDR-TB) in absence of systematic evidence. We performed a systematic review and meta-analysis on efficacy, safety and tolerability of linezolid-containing regimes based on individual data analysis. 12 studies (11 countries from

  3. Comparison of effectiveness and safety of imipenem/clavulanate- versus meropenem/clavulanate-containing regimens in the treatment of MDR- and XDR-TB

    NARCIS (Netherlands)

    Tiberi, Simon; Sotgiu, Giovanni; D'Ambrosio, Lia; Centis, Rosella; Arbex, Marcos Abdo; Arrascue, Edith Alarcon; Alffenaar, Jan Willem; Caminero, Jose A.; Gaga, Mina; Gualano, Gina; Skrahina, Alena; Solovic, Ivan; Sulis, Giorgia; Tadolini, Marina; Alarcon Guizado, Valentina; De Lorenzo, Saverio; Roby Arias, Aurora Jazmin; Scardigli, Anna; Akkerman, Onno W.; Aleksa, Alena; Artsukevich, Janina; Auchynka, Vera; Bonini, Eduardo Henrique; Chong Marin, Felix Antonio; Collahuazo Lopez, Lorena; de Vries, Gerard; Dore, Simone; Kunst, Heinke; Matteelli, Alberto; Moschos, Charalampos; Palmieri, Fabrizio; Papavasileiou, Apostolos; Payen, Marie-Christine; Piana, Andrea; Spanevello, Antonio; Vargas Vasquez, Dante; Viggiani, Pietro; White, Veronica; Zumla, Alimuddin; Migliori, Giovanni Battista

    No large study to date has ever evaluated the effectiveness, safety and tolerability of imipenem/clavulanate versus meropenem/clavulanate to treat multidrug-and extensively drug-resistant tuberculosis (MDR- and XDR-TB). The aim of this observational study was to compare the therapeutic contribution

  4. Management of MDR-TB in HIV co-infected patients in Eastern Europe

    DEFF Research Database (Denmark)

    Efsen, A M W; Schultze, A; Miller, R F

    2018-01-01

    below the target of 90%, reflecting the challenging patient population and the environment in which health care is provided. Urgent improvement of management of patients with TB/HIV in EE, in particular for those with MDR-TB, is needed and includes widespread access to rapid TB diagnostics, better......OBJECTIVES: Mortality among HIV patients with tuberculosis (TB) remains high in Eastern Europe (EE), but details of TB and HIV management remain scarce. METHODS: In this prospective study, we describe the TB treatment regimens of patients with multi-drug resistant (MDR) TB and use of antiretroviral...... access to and use of second-line TB drugs, timely ART initiation with viral load monitoring, and integration of TB/HIV care....

  5. Heightened vulnerability to MDR-TB epidemics after controlling drug-susceptible TB.

    Directory of Open Access Journals (Sweden)

    Jason D Bishai

    2010-09-01

    Full Text Available Prior infection with one strain TB has been linked with diminished likelihood of re-infection by a new strain. This paper attempts to determine the role of declining prevalence of drug-susceptible TB in enabling future epidemics of MDR-TB.A computer simulation of MDR-TB epidemics was developed using an agent-based model platform programmed in NetLogo (See http://mdr.tbtools.org/. Eighty-one scenarios were created, varying levels of treatment quality, diagnostic accuracy, microbial fitness cost, and the degree of immunogenicity elicited by drug-susceptible TB. Outcome measures were the number of independent MDR-TB cases per trial and the proportion of trials resulting in MDR-TB epidemics for a 500 year period after drug therapy for TB is introduced.MDR-TB epidemics propagated more extensively after TB prevalence had fallen. At a case detection rate of 75%, improving therapeutic compliance from 50% to 75% can reduce the probability of an epidemic from 45% to 15%. Paradoxically, improving the case-detection rate from 50% to 75% when compliance with DOT is constant at 75% increases the probability of MDR-TB epidemics from 3% to 45%.The ability of MDR-TB to spread depends on the prevalence of drug-susceptible TB. Immunologic protection conferred by exposure to drug-susceptible TB can be a crucial factor that prevents MDR-TB epidemics when TB treatment is poor. Any single population that successfully reduces its burden of drug-susceptible TB will have reduced herd immunity to externally or internally introduced strains of MDR-TB and can experience heightened vulnerability to an epidemic. Since countries with good TB control may be more vulnerable, their self interest dictates greater promotion of case detection and DOTS implementation in countries with poor control to control their risk of MDR-TB.

  6. Treatment Outcomes of Patients with Multidrug-Resistant Tuberculosis (MDR- TB) Compared with Non-MDR-TB Infections in Peninsular Malaysia.

    Science.gov (United States)

    Elmi, Omar Salad; Hasan, Habsah; Abdullah, Sarimah; Mat Jeab, Mat Zuki; Ba, Zilfalil; Naing, Nyi Nyi

    2016-07-01

    Treating patients with multidrug-resistant tuberculosis (MDR-TB) strains is more complicated, complex, toxic, expensive, than treating patients with susceptible TB strains. This study aims to compare the treatment outcomes and potential factors associated between patients with MDR-TB and non MDR TB infections in peninsular Malaysia. This study was a retrospective cohort study. Data were collected from the medical records of all registered MDR-TB patients and Non-MDR-TB patients at five TB hospitals in peninsular Malaysia from January 2010 to January 2014. A total of 314 subjects were studied, including 105 MDR-TB cases and 209 non-MDR-TB. After TB treatment, 24.8% of the MDR-TB patients and 17.7% of non MDR TB relapsed; 17.1% of the MDR-TB patients and 16.3% of non MDR TB defaulted from TB treatment. A significant difference seen in treatment success rate 17.1% for MDR-TB; 63.1% for non MDR TB (P history of TB treatment, and presence of HIV infection.

  7. Management and treatment outcomes of patients enrolled in MDR-TB treatment in Viet Nam.

    Science.gov (United States)

    Phuong, N T M; Nhung, N V; Hoa, N B; Thuy, H T; Takarinda, K C; Tayler-Smith, K; Harries, A D

    2016-03-21

    The programmatic management of drug-resistant tuberculosis (TB) in Viet Nam has been rapidly scaled up since 2009. To document the annual numbers of patients enrolled for multidrug-resistant tuberculosis (MDR-TB) treatment during 2010-2014 and to determine characteristics and treatment outcomes of patients initiating treatment during 2010-2012. A retrospective cohort study using national reports and data from the national electronic data system for drug-resistant TB. The number of patients enrolled annually for MDR-TB treatment increased from 97 in 2010 to 1522 in 2014. The majority of patients were middle-aged men who had pulmonary disease and had failed a retreatment regimen; 77% had received ⩾2 courses of TB treatment. Favourable outcomes (cured and treatment completed) were attained in 73% of patients. Unfavourable outcomes included loss to follow-up (12.5%), death (8%) and failure (6.3%). Having had ⩾2 previous treatment courses and being human immunodeficiency virus-positive were associated with unfavourable outcomes. Increasing numbers of patients are being treated for MDR-TB each year with good treatment outcomes under national programme management in Viet Nam. However, there is a need to increase case detection-currently at 30% of the estimated 5100 MDR-TB cases per year, reduce adverse outcomes and improve monitoring and evaluation.

  8. 8__Aisha_Detection ofMDR-TB

    African Journals Online (AJOL)

    User

    Among the MDR-TB cases rifampicin resistance was associated with rpoB WT gene and rpoB MUT gene in 100% and 62% of the ... diagnosis of TB patients, and proper treatment and management of the infected cases to minimize the spread and ..... in an amino acid change and concluded that this is one of the reasons ...

  9. Promising therapy of XDR-TB/MDR-TB with thioridazine an inhibitor of bacterial efflux pumps

    DEFF Research Database (Denmark)

    Amaral, L; Martins, M; Viveiros, M

    2008-01-01

    -TB) - a M. tuberculosis organism that is resistant to the most effective second line drugs available for the treatment of TB. This review provides detailed, significant evidence that supports the use of an old neuroleptic compound, thioridazine (TZ), for the management of MDR-TB and XDR-TB infections...... therapy predictably ineffective and death is inevitable, compassionate therapy with TZ should be contemplated. The risks are small and the rewards great....

  10. Risk factors for MDR and XDR-TB in a tertiary referral hospital in India.

    Directory of Open Access Journals (Sweden)

    V Balaji

    Full Text Available BACKGROUND: India has a high burden of drug resistant TB, although there are few data on XDR-TB. Although XDR-TB has existed previously in India, the definition has not been widely applied, and surveillance using second line drug susceptibility testing has not been performed. Our objective was to analyze clinical and demographic risk factors associated with isolation of MDR and XDR TB as compared to susceptible controls, at a tertiary center. METHODOLOGY/FINDINGS: Retrospective chart review based on positive cultures isolated in a high volume mycobacteriology laboratory between 2002 and 2007. 47 XDR, 30 MDR and 117 susceptible controls were examined. Drug resistant cases were less likely to be extrapulmonary, and had received more previous treatment regimens. Significant risk factors for XDR-TB included residence outside the local state (OR 7.43, 3.07-18.0 and care costs subsidized (OR 0.23, 0.097-0.54 in bivariate analysis and previous use of a fluoroquinolone and injectable agent (other than streptomycin (OR 7.00, 95% C.I. 1.14-43.03 and an initial treatment regimen which did not follow national guidelines (OR 5.68, 1.24-25.96 in multivariate analysis. Cavitation and HIV did not influence drug resistance. CONCLUSIONS/SIGNIFICANCE: There is significant selection bias in the sample available. Selection pressure from previous treatment and an inadequate initial regimen increases risk of drug resistance. Local patients and those requiring financial subsidies may be at lower risk of XDR-TB.

  11. Community-based MDR-TB care project improves treatment initiation in patients diagnosed with MDR-TB in Myanmar.

    Science.gov (United States)

    Wai, Pyae Phyo; Shewade, Hemant Deepak; Kyaw, Nang Thu Thu; Thein, Saw; Si Thu, Aung; Kyaw, Khine Wut Yee; Aye, Nyein Nyein; Phyo, Aye Mon; Maung, Htet Myet Win; Soe, Kyaw Thu; Aung, Si Thu

    2018-01-01

    The Union in collaboration with national TB programme (NTP) started the community-based MDR-TB care (CBMDR-TBC) project in 33 townships of upper Myanmar to improve treatment initiation and treatment adherence. Patients with MDR-TB diagnosed/registered under NTP received support through the project staff, in addition to the routine domiciliary care provided by NTP staff. Each township had a project nurse exclusively for MDR-TB and 30 USD per month (max. for 4 months) were provided to the patient as a pre-treatment support. To assess whether CBMDR-TBC project's support improved treatment initiation. In this cohort study (involving record review) of all diagnosed MDR-TB between January 2015 and June 2016 in project townships, CBMDR-TBC status was categorized as "receiving support" if date of project initiation in patient's township was before the date of diagnosis and "not receiving support", if otherwise. Cox proportional hazards regression (censored on 31 Dec 2016) was done to identify predictors of treatment initiation. Of 456 patients, 57% initiated treatment: 64% and 56% among patients "receiving support (n = 208)" and "not receiving support (n = 228)" respectively (CBMDR-TBC status was not known in 20 (4%) patients due to missing diagnosis dates). Among those initiated on treatment (n = 261), median (IQR) time to initiate treatment was 38 (20, 76) days: 31 (18, 50) among patients "receiving support" and 50 (26,101) among patients "not receiving support". After adjusting other potential confounders (age, sex, region, HIV, past history of TB treatment), patients "receiving support" had 80% higher chance of initiating treatment [aHR (0.95 CI): 1.8 (1.3, 2.3)] when compared to patients "not receiving support". In addition, age 15-54 years, previous history of TB and being HIV negative were independent predictors of treatment initiation. Receiving support under CBMDR-TBC project improved treatment initiation: it not only improved the proportion initiated but also

  12. Molecular detection of multi drug resistant tuberculosis (mdr-tb) in mdr-tb patients' attendant in north western pakistan

    International Nuclear Information System (INIS)

    Shah, T.; Hayat, A.; Shah, Z.; Hayat, A.; Khan, S.B.

    2017-01-01

    Objective: To determine the drugs susceptibility pattern of mycobacterium tuberculosis (M.TB) in multi-drug resistant tuberculosis (MDR-TB) patients' attendants in North Western, Pakistan. Study Design: Cross sectional study. Place and Duration of Study: This study was conducted at Peshawar Tuberculosis Research Laboratory (PTRL), Provincial TB Control Program Hayatabad Medical Complex Peshawar, (KP) from August 2013 to March 2014. Material and Methods: A cross sectional study in which four hundred and eighty sputum samples from MDR-TB patients' attendants were processed for the detection of M.TB through Ziehl-Neelsen staining, Lowenstein-Jensen, BACTEC MGIT-960 culture and line probe assay. Results: Out of 480 samples, 06 (2.1%) were found positive for M.TB through Ziehl-Neelsen staining while 10 (2.8%) were positive through LJ and BACTEC MGIT-960 culture. The 10 positive samples were further subjected to drugs susceptibility testing and line probes assay test to find out rifampicin, isoniazid, streptomycin and ethambutol resistant and it was found that 6 M.TB isolates were resistant while 4 were sensitive to rifampicin and isoniazid. Among the 6 resistant M.TB strains, 4 showed mutation in rpoB gene at 531, 516 and 526 codons. Conclusion: Majority of MDR-TB patients' attendants had drug-resistant tuberculosis and the rate of drug susceptible TB was low. (author)

  13. Social, economic, and psychological impacts of MDR-TB treatment in Tijuana, Mexico: a patient's perspective.

    Science.gov (United States)

    Morris, M D; Quezada, L; Bhat, P; Moser, K; Smith, J; Perez, H; Laniado-Laborin, R; Estrada-Guzman, J; Rodwell, T C

    2013-07-01

    The State of Baja California, Mexico, had the highest prevalence of multidrug-resistant tuberculosis (MDR-TB) in Mexico in 2009. To understand the socio-economic burden of MDR-TB disease and its treatment on patients in Tijuana and Mexicali, Mexico. From July to November 2009, qualitative interviews were conducted with 12 patients enrolled in a US-Mexico binational MDR-TB treatment program, Puentes de Esperanza (Bridges of Hope), which was designed to support MDR-TB patients. In-depth interviews were coded to identify major themes in patient experiences of MDR-TB diagnosis and care. While some patients were able to maintain their pre-MDR-TB lives to a limited extent, most patients reported losing their sense of identity due to their inability to work, social isolation, and stigmatization from family and friends. The majority of participants expressed appreciation for Puentes' role in 'saving their lives'. Being diagnosed with MDR-TB and undergoing treatment imposes significant psychological, social and economic stress on patients. Strong social support elements within Puentes helped alleviate these burdens. Improvements to the program might include peer-support groups for patients undergoing treatment and transitioning back into the community after treatment.

  14. Adverse Events among HIV/MDR-TB Co-Infected Patients Receiving Antiretroviral and Second Line Anti-TB Treatment in Mumbai, India

    Science.gov (United States)

    Isaakidis, Petros; Varghese, Bhanumati; Mansoor, Homa; Cox, Helen S.; Ladomirska, Joanna; Saranchuk, Peter; Da Silva, Esdras; Khan, Samsuddin; Paryani, Roma; Udwadia, Zarir; Migliori, Giovanni Battista; Sotgiu, Giovanni; Reid, Tony

    2012-01-01

    Background Significant adverse events (AE) have been reported in patients receiving medications for multidrug- and extensively-drug-resistant tuberculosis (MDR-TB & XDR-TB). However, there is little prospective data on AE in MDR- or XDR-TB/HIV co-infected patients on antituberculosis and antiretroviral therapy (ART) in programmatic settings. Methods Médecins Sans Frontières (MSF) is supporting a community-based treatment program for drug-resistant tuberculosis in HIV-infected patients in a slum setting in Mumbai, India since 2007. Patients are being treated for both diseases and the management of AE is done on an outpatient basis whenever possible. Prospective data were analysed to determine the occurrence and nature of AE. Results Between May 2007 and September 2011, 67 HIV/MDR-TB co-infected patients were being treated with anti-TB treatment and ART; 43.3% were female, median age was 35.5 years (Interquartile Range: 30.5–42) and the median duration of anti-TB treatment was 10 months (range 0.5–30). Overall, AE were common in this cohort: 71%, 63% and 40% of patients experienced one or more mild, moderate or severe AE, respectively. However, they were rarely life-threatening or debilitating. AE occurring most frequently included gastrointestinal symptoms (45% of patients), peripheral neuropathy (38%), hypothyroidism (32%), psychiatric symptoms (29%) and hypokalaemia (23%). Eleven patients were hospitalized for AE and one or more suspect drugs had to be permanently discontinued in 27 (40%). No AE led to indefinite suspension of an entire MDR-TB or ART regimen. Conclusions AE occurred frequently in this Mumbai HIV/MDR-TB cohort but not more frequently than in non-HIV patients on similar anti-TB treatment. Most AE can be successfully managed on an outpatient basis through a community-based treatment program, even in a resource-limited setting. Concerns about severe AE in the management of co-infected patients are justified, however, they should not cause delays

  15. Analysis of multi drug resistant tuberculosis (MDR-TB) financial protection policy: MDR-TB health insurance schemes, in Chhattisgarh state, India.

    Science.gov (United States)

    Kundu, Debashish; Sharma, Nandini; Chadha, Sarabjit; Laokri, Samia; Awungafac, George; Jiang, Lai; Asaria, Miqdad

    2018-01-27

    There are significant financial barriers to access treatment for multi drug resistant tuberculosis (MDR-TB) in India. To address these challenges, Chhattisgarh state in India has established a MDR-TB financial protection policy by creating MDR-TB benefit packages as part of the universal health insurance scheme that the state has rolled out in their effort towards attaining Universal Health Coverage for all its residents. In these schemes the state purchases health insurance against set packages of services from third party health insurance agencies on behalf of all its residents. Provider payment reform by strategic purchasing through output based payments (lump sum fee is reimbursed as per the MDR-TB benefit package rates) to the providers - both public and private health facilities empanelled under the insurance scheme was the key intervention. To understand the implementation gap between policy and practice of the benefit packages with respect to equity in utilization of package claims by the poor patients in public and private sector. Data from primary health insurance claims from January 2013 to December 2015, were analysed using an extension of 'Kingdon's multiple streams for policy implementation framework' to explain the implementation gap between policy and practice of the MDR-TB benefit packages. The total number of claims for MDR-TB benefit packages increased over the study period mainly from poor patients treated in public facilities, particularly for the pre-treatment evaluation and hospital stay packages. Variations and inequities in utilizing the packages were observed between poor and non-poor beneficiaries in public and private sector. Private providers participation in the new MDR-TB financial protection mechanism through the universal health insurance scheme was observed to be much lower than might be expected given their share of healthcare provision overall in India. Our findings suggest that there may be an implementation gap due to weak

  16. Mortality among MDR-TB cases: comparison with drug-susceptible tuberculosis and associated factors.

    Directory of Open Access Journals (Sweden)

    Kocfa Chung-Delgado

    Full Text Available An increase in multidrug-resistant tuberculosis (MDR-TB cases is evident worldwide. Its management implies a complex treatment, high costs, more toxic anti-tuberculosis drug use, longer treatment time and increased treatment failure and mortality. The aims of this study were to compare mortality between MDR and drug-susceptible cases of tuberculosis, and to determine risk factors associated with mortality among MDR-TB cases.A retrospective cohort study was performed using data from clinical records of the National Strategy for Prevention and Control of Tuberculosis in Lima, Peru. In the first objective, MDR-TB, compared to drug-susceptible cases, was the main exposure variable and time to death, censored at 180 days, the outcome of interest. For the second objective, different variables obtained from clinical records were assessed as potential risk factors for death among MDR-TB cases. Cox regression analysis was used to determine hazard ratios (HR and 95% confidence intervals (95%CI. A total of 1,232 patients were analyzed: mean age 30.9 ±14.0 years, 60.0% were males. 61 patients (5.0% died during treatment, whereas the MDR-TB prevalence was 19.2%. MDR-TB increased the risk of death during treatment (HR = 7.5; IC95%: 4.1-13.4 when compared to presumed drug-susceptible cases after controlling for potential confounders. Education level (p = 0.01, previous TB episodes (p<0.001, diabetes history (p<0.001 and HIV infection (p = 0.04 were factors associated with mortality among MDR-TB cases.MDR-TB is associated with an increased risk of death during treatment. Lower education, greater number of previous TB episodes, diabetes history, and HIV infection were independently associated with mortality among MDR-TB cases. New strategies for appropriate MDR-TB detection and management should be implemented, including drug sensitivity tests, diabetes and HIV screening, as well as guarantee for a complete adherence to therapy.

  17. Genome sequencing and annotation of multidrug resistant Mycobacterium tuberculosis (MDR-TB PR10 strain

    Directory of Open Access Journals (Sweden)

    Mohd Zakihalani A. Halim

    2016-03-01

    Full Text Available Here, we report the draft genome sequence and annotation of a multidrug resistant Mycobacterium tuberculosis strain PR10 (MDR-TB PR10 isolated from a patient diagnosed with tuberculosis. The size of the draft genome MDR-TB PR10 is 4.34 Mbp with 65.6% of G + C content and consists of 4637 predicted genes. The determinants were categorized by RAST into 400 subsystems with 4286 coding sequences and 50 RNAs. The whole genome shotgun project has been deposited at DDBJ/EMBL/GenBank under the accession number CP010968. Keywords: Mycobacterium tuberculosis, Genome, MDR, Extrapulmonary

  18. Psychiatric disorders in patients with multidrug resistant tuberculosis (MDR-TB in Sardjito Hospital, Yogyakarta, Indonesia

    Directory of Open Access Journals (Sweden)

    Irwan Supriyanto

    2017-08-01

    Full Text Available Introduction: Tuberculosis has become a chronic debilitating disease in developing countries, particularly after the emergence of multidrug resistant tuberculosis (MDR-TB. Second line treatments for the disease which were subsequently developed were associated with psychiatric disorders among patients. Psychiatric disorder can either be induced by treatment regiments or psychosocial factors. Cycloserine administration is frequently reported to be associated with psychiatric disorders. In this study, we examined the prevalence and characteristics of psychiatric disorders among MDR-TB patients in Sardjito Hospital, Yogyakarta, Indonesia. Methods: In this descriptive study, we studied medical records of MDR-TB patients admitted for MDR-TB treatments to Sardjito Hospital from January 2014 to July 2016 and screened for psychiatric disorders. Results: We found that 32.8% of the patients had psychiatric disorders, some of which had multiple psychiatric diagnoses (14.1%. The diagnoses were medication induced delirium, substance/medication induced psychotic disorder, substance/medication use depressive disorder, depressive type schizoaffective disorder, bipolar I disorder current episode severe manic with psychotic features, mild depression, moderate depression, major depression without psychotic features, major depression with psychotic features, adjustment disorders with mixed anxiety and depressed mood, adjustment disorder with anxiety, acute stress disorder, and insomnia. Psychiatric disorders were significantly associated with cycloserine dose and sex. Psychotic symptoms were significantly associated with sex and level of education. Conclusion: The presence of psychiatric disorders might disturb MDR-TB treatment resulting in poor outcomes. Precaution and prompt managements are required for psychiatric disorders in patients receiving MDR-TB treatment regiments.

  19. ASSESSMENT OF EFFECT OF MDR - TB/TB ON SOCIAL, FUNCTIONAL AND ECONOMIC WELL BEING OF PATIENTS – A CROSS SECTIONAL STUDY

    Directory of Open Access Journals (Sweden)

    Shiv Kumar

    2015-06-01

    Full Text Available CONTEXT : Tuberculosis is a contagious disease with social stigma attached to it. Various problems which are social and economic in nature are faced by TB patient. Therefore , it is essential to explore the overall effect of MDR - TB/TB on health and patients perception of Well - being. AIMS : To Document the effect of MDR - TB/TB on social , functional and economic well - being of patients. SETTINGS AND DESIGN : A Cross - sectional study , Conveniently Recruited 68 MDR - TB Patients and 136 non - MDR - TB Patients (from Rural as well as urban Area of Surat District diagnosed by CBNAAT were interviewed for investigating the effect of Tuberculosis. METHODS AND MATERIAL : A pre - tested standardized semi - structured questionnaire was used. Data was collected about socio - demographic profile of patients and interpreted in table. Data about effect of MDR - TB/TB was collected on Likert Scale and Frequency was calculated and Data wa s plotted on multiple bar charts. RESULTS : As compared to healthy status in the past , 93% MDR - TB and 82% TB patients have decreased ability to do work , about half of MDR - TB Patients and TB Patients have detiorated relations with family members , 67% of stud y participants have developed disharmonious relations with neighbor’s , 55% of Study participants have decreased income , 88% of study participants have decreased performance in day to day activities and 78% of study participants have faced discordial and di srespectful behavior from co - workers. CONCLUSION : Working ability more detiorated in MDR - TB patients while rest of the effect on social , functional and economic well - being is same in both TB and Multi Drug Resistant TB patients. This study emphasizes very clearly that social stigma still persist in community about Tuberculosis which needs to be eliminated in community by behavior change communication by health workers at all levels of health care.

  20. EDITORIAL Multi-drug-resistant tuberculosis (MDR-TB): Current ...

    African Journals Online (AJOL)

    A South African Health Systems Trust report indicated that despite a global ... less financial resources performed better. ... Healthcare providers need to be better trained at our various nursing colleges and medical schools on how to manage TB, with regular and intense follow-up in-service training sessions. In addition ...

  1. MDR-TB Outbreak among HIV-Negative Tunisian Patients followed during 11 Years.

    Directory of Open Access Journals (Sweden)

    Naira Dekhil

    Full Text Available Multidrug-resistant tuberculosis (MDR-TB outbreaks that evolve, from the outset, in a context strictly negative for HIV infection deserve special consideration since they reflect the true intrinsic epidemic potential of the causative strain. To our knowledge, the long-term evolution of such exceptional outbreaks and the treatment outcomes for the involved patients has never been reported hitherto. Here we provide a thorough description, over an 11-year period, of an MDR-TB outbreak that emerged and expanded in an HIV-negative context, Northern Tunisia.From October 2001 to June 2011, the MDR-TB outbreak involved 48 HIV-negative individuals that are mainly young (mean age 31.09 yrs; 89.6% male and noninstitutionalized. Drug susceptibility testing coupled to mutational analysis revealed that initial transmission involved an isolate that was simultaneously resistant to isoniazid, rifampicin, ethambutol, and streptomycin. The causative Haarlem3-ST50 outbreak strain expanded mainly as an 11-banded IS6110 RFLP profile (77.1%, from which a 12-banded subclone evolved. After undergoing a 2-year treatment with second-line drugs, 22 (45.8% patients were cured and 3 (6.2% completed treatment, thus yielding an overall treatment success rate of 52.1%. Among the patients that experienced unfavorable treatment outcomes, 10 (20.8% failed treatment, 3 (6.2% were lost to follow-up, 5 (10.4% died, and 5 (10.4% could not be evaluated. Poor adherence to treatment was found to be the main independent predictor of unfavorable outcomes (HR: 9.15; 95% CI 1.72-48.73; P = 0.014. Intriguingly, the evolved 12-banded subclone proved significantly associated with unfavorable outcomes (HR: 4.90; 95% CI 1.04-23.04, P = 0.044. High rate of fatality and relapse was further demonstrated at the long-term, since 70% of those whose treatment failed have died, and 24% among those deemed successfully treated have relapsed.Taken together, the data obtained in this study indicate that MDR-TB

  2. Comparison of bacteriological conversion and treatment outcomes among MDR-TB patients with and without diabetes in Mexico: Preliminary data

    Directory of Open Access Journals (Sweden)

    M. Muñoz-Torrico

    2017-01-01

    Full Text Available Diabetes mellitus (DM is a well-known risk factor for tuberculosis (TB. However, it is not known to what extent DM affects the outcome in patients with multidrug-resistant (MDR-TB and extensively drug-resistant TB (XDR-TB treated with second-line anti-TB drugs.The objective of this study was to compare the microbiological evolution (sputum smear and culture conversion and final outcomes of MDR/XDR-TB patients with and without DM, managed at the national TB reference centre in Mexico City. Results: Ninety patients were enrolled between 2010 and 2015: 73 with MDR-TB (81.1%, 11 with pre-XDR-TB (e.g. MDR-TB with additional resistance to one injectable drug or a fluoroquinolone, 12.2% and 6 (6.7% with XDR-TB. Out of these, 49 (54.4% had DM and 42 (86% were undergoing insulin treatment.No statistically significant differences were found in treatment outcomes comparing DM vs. non-DM MDR-TB cases: 18/32 (56.3% of DM cases and 19/24 (79.2% non DM patients achieved treatment success (p = 0.07. The time to sputum smear and culture conversion was longer (although not statistically in patients without DM, as follows: the mean (±SD time to sputum smear conversion was 53.9 (±31.4 days in DM patients and 65.2 (±34.8 days in non-DM ones (p = 0.15, while the time to culture conversion was 66.2 (±27.6 days for DM and 81.4 (±37.7 days for non-DM MDR-TB cases (p = 0.06. Conclusions: The study results support the Mexican National TB programme to strengthen its collaboration with the DM programme, as an entry point for TB (and latent TB infection screening and management. Keywords: Diabetes mellitus, Delay, Sputum and culture conversion, MDR-TB, High treatment adherence

  3. Molecular approaches for detection of the multi-drug resistant tuberculosis (MDR-TB in Bangladesh.

    Directory of Open Access Journals (Sweden)

    Tafsina Haque Aurin

    Full Text Available The principal obstacles in the treatment of tuberculosis (TB are delayed and inaccurate diagnosis which often leads to the onset of the drug resistant TB cases. To avail the appropriate treatment of the patients and to hinder the transmission of drug-resistant TB, accurate and rapid detection of resistant isolates is critical. Present study was designed to demonstrate the efficacy of molecular techniques inclusive of line probe assay (LPA and GeneXpert MTB/RIF methods for the detection of multi-drug resistant (MDR TB. Sputum samples from 300 different categories of treated and new TB cases were tested for the detection of possible mutation in the resistance specific genes (rpoB, inhA and katG through Genotype MTBDRplus assay or LPA and GeneXpert MTB/RIF tests. Culture based conventional drug susceptibility test (DST was also carried out to measure the efficacy of the molecular methods employed. Among 300 samples, 191 (63.7% and 193 (64.3% cases were found to be resistant against rifampicin in LPA and GeneXpert methods, respectively; while 189 (63% cases of rifampicin resistance were detected by conventional DST methods. On the other hand, 196 (65.3% and 191 (63.7% isolates showed isoniazid resistance as detected by LPA and conventional drug susceptibility test (DST, respectively. Among the drug resistant isolates (collectively 198 in LPA and 193 in conventional DST, 189 (95.6% and 187 (96.9% were considered to be MDR as examined by LPA and conventional DST, respectively. Category-II and -IV patients encountered higher frequency of drug resistance compared to those from category-I and new cases. Considering the higher sensitivity, specificity and accuracy along with the required time to results significantly shorter, our study supports the adoption of LPA and GeneXpert assay as efficient tools in detecting drug resistant TB in Bangladesh.

  4. Rapid Screening of MDR-TB in Cases of Extra Pulmonary Tuberculosis Using Geno Type MTBDRplus.

    Directory of Open Access Journals (Sweden)

    Richa Kumari

    Full Text Available Drug resistance in tuberculosis is a major public health challenge in developing countries. The limited data available on drug resistance in extra pulmonary tuberculosis stimulated us to design our study on anti-tuberculosis drug resistance pattern in cases of extra pulmonary tuberculosis in a tertiary referral hospital of North India. We performed Geno Type MTBDRplus assay in comparison with conventional drug susceptibility testing by proportion method to study the mutation patterns in rpoB, katG and inhA genes.A total of 510 extra pulmonary samples were included in this study. After the smear microscopy, all the specimens were subjected for culture on Lowenstein Jensen (LJ media. Phenotypic drug susceptibility testing (DST was performed on LJ media for all the MTB isolates and compared with the results of Geno Type MTBDRplus assay which was performed with the DNA isolated from the culture by conventional method.Of 510 specimens cultured, the total culture positivity obtained was 11.8% (60 encompassing 54 (10.6% Mycobacterium tuberculosis and 6 (1.2% non-tubercular mycobacteria (NTM. DST results by Geno Type MTBDRplus assay and solid culture methods were compared in 51 MTB isolates excluding the two Rif indeterminate and one invalid test. Geno Type MTBDRplus accurately identified 13 of 14 rifampicin-resistant strains, 14 of 15 isoniazid-resistant strains and 13 of 14 as multi drug resistant tuberculosis (MDR-TB in comparison with conventional method. Sensitivity and specificity were 92.86% and 97.30% respectively for detection of RIF resistance, 93.33% and 94.44% respectively for detection of INH resistance, 92.86% and 97.30% respectively for detection of MDR-TB, while the overall concordance of Geno Type MTBDRplus assay with conventional DST was 94.11%. The turn-around time for performing Geno Type MTBDRplus assay test was 48 hours.The problem of MDR in extra pulmonary tuberculosis (EPTB cannot be overlooked and due attention on patients

  5. Malnutrition associated with unfavorable outcome and death among South African MDR-TB and HIV co-infected children.

    Science.gov (United States)

    Hicks, R M; Padayatchi, N; Shah, N S; Wolf, A; Werner, L; Sunkari, V B; O'Donnell, M R

    2014-09-01

    Pediatric multidrug-resistant tuberculosis (MDR-TB) is complicated by difficult diagnosis, complex treatment, and high mortality. In South Africa, these challenges are amplified by human immunodeficiency virus (HIV) co-infection; however, evidence on treatment outcomes among co-infected children is limited. Using conventional and new pediatric definitions, to describe treatment outcomes and identify risk factors for unfavorable outcome and mortality in children aged children (median age 8 years, IQR 4-12) with MDR-TB (n = 78) or XDR-TB (n = 6) initiated treatment. Sixty-four (77%) were HIV-positive and 62 (97%) received antiretroviral therapy. Sixty-six (79%) achieved favorable treatment outcomes. Overall mortality was 11% (n = 9) at 18 months after initiation of treatment. Malnutrition (aOR 27.4, 95%CI 2.7-278.7) and severe radiographic findings (aOR 4.68, 95%CI 1.01-21.9) were associated with unfavorable outcome. New pediatric outcome definitions increased the proportion classified as cured. It is possible to successfully treat pediatric MDR-TB-HIV even in resource-poor settings. Malnutrition is a marker for severe TB-HIV disease, and is a potential target for future interventions in these patients.

  6. Direct nitrate reductase assay versus microscopic observation drug susceptibility test for rapid detection of MDR-TB in Uganda.

    Directory of Open Access Journals (Sweden)

    Freddie Bwanga

    Full Text Available The most common method for detection of drug resistant (DR TB in resource-limited settings (RLSs is indirect susceptibility testing on Lowenstein-Jensen medium (LJ which is very time consuming with results available only after 2-3 months. Effective therapy of DR TB is therefore markedly delayed and patients can transmit resistant strains. Rapid and accurate tests suitable for RLSs in the diagnosis of DR TB are thus highly needed. In this study we compared two direct techniques--Nitrate Reductase Assay (NRA and Microscopic Observation Drug Susceptibility (MODS for rapid detection of MDR-TB in a high burden RLS. The sensitivity, specificity, and proportion of interpretable results were studied. Smear positive sputum was collected from 245 consecutive re-treatment TB patients attending a TB clinic in Kampala, Uganda. Samples were processed at the national reference laboratory and tested for susceptibility to rifampicin and isoniazid with direct NRA, direct MODS and the indirect LJ proportion method as reference. A total of 229 specimens were confirmed as M. tuberculosis, of these interpretable results were obtained in 217 (95% with either the NRA or MODS. Sensitivity, specificity and kappa agreement for MDR-TB diagnosis was 97%, 98% and 0.93 with the NRA; and 87%, 95% and 0.78 with the MODS, respectively. The median time to results was 10, 7 and 64 days with NRA, MODS and the reference technique, respectively. The cost of laboratory supplies per sample was low, around 5 USD, for the rapid tests. The direct NRA and MODS offered rapid detection of resistance almost eight weeks earlier than with the reference method. In the study settings, the direct NRA was highly sensitive and specific. We consider it to have a strong potential for timely detection of MDR-TB in RLS.

  7. Risk factors associated with multidrug-resistant tuberculosis (MDR-TB) in a tertiary armed force referral and teaching hospital, Ethiopia.

    Science.gov (United States)

    Demile, Biresaw; Zenebu, Amare; Shewaye, Haile; Xia, Siqing; Guadie, Awoke

    2018-05-31

    Ethiopia is one of the world health organization defined higher tuberculosis (TB) burden countries where the disease remains a massive public health threat. This study aimed to identify the prevalence and associated factors of multidrug-resistant tuberculosis (MDR-TB) using all armed force and civilian TB attendants in a tertiary level armed force hospital, where data for MDR-TB are previously unpublished. Cross-sectional study was conducted from September 2014 to August 2015 in a tertiary level Armed Force Referral and Teaching Hospital (AFRTH), Ethiopia. Armed force members (n = 251) and civilians (n = 130) which has been undergone TB diagnosis at AFRTH were included. All the specimens collected were subjected to microscopic smear observation, culture growth and drug susceptibility testing. Data were analyzed using statistical package for social sciences following binary logistic regression and Chi-square. P-values < 0.05 were considered statistically significant. Among 381 TB patients, 355 (93.2%) new and 26 (6.8%) retreatment cases were identified. Culture and smear positive TB cases were identified in 297 (77.9%) and 252 (66.1%) patients, respectively. The overall prevalence of MDR-TB in AFRTH was found 1.8% (1.3% for armed force members and 0.5% for civilian patients) all of which were previously TB treated cases. The entire treatment success rates were 92.6% achieved highest in the armed force (active and pension) than the civilian patients. The failure and dead cases were also found 2.5 and 4.6%, respectively. Using bivariate analysis, category of attendants and TB contact history were strong predictors of MDR-TB in armed force and civilian patients. Moreover, human immunodeficiency virus (HIV) infection also identified a significant (OR = 14.6; 95% CI = 2.3-92.1; p = 0.004) predicting factor for MDR-TB in armed force members. However, sex, age and body mass index were not associated factor for MDR-TB. In AFRTH, lower prevalence of

  8. "When Treatment Is More Challenging than the Disease": A Qualitative Study of MDR-TB Patient Retention.

    Directory of Open Access Journals (Sweden)

    Kalpita S Shringarpure

    Full Text Available One-fifth of the patients on multidrug-resistant tuberculosis treatment at the Drug-Resistant-TB (DR-TB Site in Gujarat are lost-to-follow-up(LFU.To understand patients' and providers' perspectives on reasons for LFU and their suggestions to improve retention-in-care.Qualitative study conducted between December 2013-March 2014, including in-depth interviews with LFU patients and DOT-providers, and a focus group discussion with DR-TB site supervisors. A thematic-network analysis approach was utilised.Three sub-themes emerged: (i Struggle with prolonged treatment; (ii Strive against stigma and toward support; (iii Divergent perceptions and practices. Daily injections, pill burden, DOT, migratory work, social problems, prior TB treatment, and adverse drugs effects were reported as major barriers to treatment adherence and retention-in-care by patients and providers. Some providers felt that despite their best efforts, LFU patients remain. Patient movements between private practitioners and traditional healers further influenced LFU.The study points to a need for repeated patient counselling and education, improved co-ordination between various tiers of providers engaged in DR-TB care, collaboration between the public, private and traditional practitioners, and promotion of social and economic support to help patients adhere to MDR-TB treatment and avoid LFU.

  9. Development of a Patient-Centred, Psychosocial Support Intervention for Multi-Drug-Resistant Tuberculosis (MDR-TB Care in Nepal.

    Directory of Open Access Journals (Sweden)

    Sudeepa Khanal

    Full Text Available Multi-drug-resistant tuberculosis (MDR-TB poses a major threat to public health worldwide, particularly in low-income countries. The current long (20 month and arduous treatment regime uses powerful drugs with side-effects that include mental ill-health. It has a high loss-to-follow-up (25% and higher case fatality and lower cure-rates than those with drug sensitive tuberculosis (TB. While some national TB programmes provide small financial allowances to patients, other aspects of psychosocial ill-health, including iatrogenic ones, are not routinely assessed or addressed. We aimed to develop an intervention to improve psycho-social well-being for MDR-TB patients in Nepal. To do this we conducted qualitative work with MDR-TB patients, health professionals and the National TB programme (NTP in Nepal. We conducted semi-structured interviews (SSIs with 15 patients (10 men and 5 women, aged 21 to 68, four family members and three frontline health workers. In addition, three focus groups were held with MDR-TB patients and three with their family members. We conducted a series of meetings and workshops with key stakeholders to design the intervention, working closely with the NTP to enable government ownership. Our findings highlight the negative impacts of MDR-TB treatment on mental health, with greater impacts felt among those with limited social and financial support, predominantly married women. Michie et al's (2011 framework for behaviour change proved helpful in identifying corresponding practice- and policy-level changes. The findings from this study emphasise the need for tailored psycho-social support. Recent work on simple psychological support packages for the general population can usefully be adapted for use with people with MDR-TB.

  10. E-health systems for management of MDR-TB in resource-poor environments: a decade of experience and recommendations for future work.

    Science.gov (United States)

    Fraser, Hamish S F; Habib, Ali; Goodrich, Mark; Thomas, David; Blaya, Joaquin A; Fils-Aime, Joseph Reginald; Jazayeri, Darius; Seaton, Michael; Khan, Aamir J; Choi, Sharon S; Kerrison, Foster; Falzon, Dennis; Becerra, Mercedes C

    2013-01-01

    Multi-drug resistant TB (MDR-TB) is a complex infectious disease that is a growing threat to global health. It requires lengthy treatment with multiple drugs and specialized laboratory testing. To effectively scale up treatment to thousands of patients requires good information systems to support clinical care, reporting, drug forecasting, supply chain management and monitoring. Over the last decade we have developed the PIH-EMR electronic medical record system, and subsequently OpenMRS-TB, to support the treatment of MDR-TB in Peru, Haiti, Pakistan, and other resource-poor environments. We describe here the experience with implementing these systems and evaluating many aspects of their performance, and review other systems for MDR-TB management. We recommend a new approach to information systems to address the barriers to scale up MDR-TB treatment, particularly access to the appropriate drugs and lab data. We propose moving away from fragmented, vertical systems to focus on common platforms, addressing all stages of TB care, support for open data standards and interoperability, care for a wide range of diseases including HIV, integration with mHealth applications, and ability to function in resource-poor environments.

  11. Clinical and programmatic considerations in the treatment of MDR-TB in children: a series of 16 patients from Lima, Peru.

    Science.gov (United States)

    Mukherjee, J S; Joseph, J K; Rich, M L; Shin, S S; Furin, J J; Seung, K J; Sloutsky, A; Socci, A R; Vanderwarker, C; Vasquez, L; Palacios, E; Guerra, D; Viru, F A; Farmer, P; Del Castillo, H E

    2003-07-01

    Since 2000, the directly observed treatment, short-course (DOTS) strategy has been expanded in several countries to include treatment of multidrug-resistant tuberculosis (MDR-TB). This strategy is known as DOTS-Plus. Tuberculosis is a common cause of morbidity and mortality for children throughout the developing world. Children may also be infected with MDR-TB, yet most developing countries do not specifically address pediatric MDR-TB. To present the intermediate outcomes of the first 16 children enrolled in the Peruvian DOTS-Plus program and to demonstrate the tolerability of second-line anti-tuberculosis drugs. Three children completed therapy and are cured, one child had bacteriologic and clinical failure after 12 months of therapy and died of respiratory insufficiency, and 12 have intermediate outcomes demonstrating favorable clinical, bacteriologic, and radiographic evidence of improvement after 9-19 months of therapy. Of the 16 pediatric DOTS-Plus patients, 15 have tolerated therapy well and have had favorable clinical evolution. However, the diagnosis of pediatric MDR-TB is often extremely delayed due to reliance on the adult case definition and should be changed to prevent progressive, chronic illness in such children. Programmatic changes could facilitate earlier diagnosis and treatment of pediatric MDR-TB in Peru and in other DOTS-Plus programs.

  12. Active Sputum Monitoring Detects Substantial Rate of Multi-Drug Resistant Tuberculosis (MDR-TB) in an HIV-Infected Population in South Africa

    Science.gov (United States)

    Hassim, Shaheen; Shaw, Pamela A.; Sangweni, Phumelele; Malan, Lizette; Ntshani, Ella; Mathibedi, Monkwe Jethro; Stubbs, Nomso; Metcalf, Julia A; Eckes, Risa; Masur, Henry; Komati, Stephanus

    2010-01-01

    Background Tuberculosis (TB) co-infection with HIV is a substantial problem in South Africa. There has been a presumption that drug resistant strains of TB are common in South Africa, but few studies have documented this impression. Methods In Phidisa, a joint observational and randomized HIV treatment study for South African National Defence Force members and dependents, an initiative obtained microbiologic TB testing in subjects who appeared to be at high risk. We report results for HIV-infected subjects. Results TB was identified by culture in 116/584 (19.9%) of patients selected for sputum examination on the basis of suggestive symptoms. Smear was an insensitive technique for confirming the diagnosis: only 33% of culture-positive patients were identified by smear, with a 0.2% false positive rate. Of the 107 culture-positive individuals with susceptibility testing, 22 (20.6%) were identified to be MDR and 4 (3.7%) became extremely drug resistant tuberculosis (XDR) while under observation. Culture-positive cases with a history of TB treatment had more than twice the rate of MDR than those without, 27.1% vs. 11.9% (p=0.05). Conclusions TB is common in this cohort of HIV-infected patients. Smear was not a sensitive technique for identifying culture-positive cases in this health system. Drug susceptibility testing is essential to proper patient management because MDR was present in 20.6% of culture-positive patients. Better management strategies are needed to reduce the development of MDR-TB since so many such patients had received prior antituberculous therapy that was presumably not curative. PMID:20196651

  13. Procurement and Supply Management System for MDR-TB in Nigeria: Are the Early Warning Targets for Drug Stock Outs and Over Stock of Drugs Being Achieved?

    Science.gov (United States)

    Jatau, Bolajoko; Avong, Yohanna; Ogundahunsi, Olumide; Shah, Safieh; Tayler Smith, Katherine; Van den Bergh, Rafael; Zachariah, Rony; van Griensven, Johan; Ekong, Ernest; Dakum, Patrick

    2015-01-01

    The World Health Organisation (WHO) introduced the twelve early warning indicators for monitoring and evaluating drug Procurement and Supply management (PSM) systems, intended to prevent drug stock-outs and overstocking. Nigeria--one of the high Multi Drug Resistant Tuberculosis (MDR-TB) burden countries, scaled-up treatment in 2012 with the concurrent implementation of a PSM system. We evaluated how well this system functioned using the WHO indicators, including all seven MDR-TB treatment centres in the country that were functional throughout 2013. The quantity of MDR-TB drugs ordered for 2013 matched the annual forecast and all central orders placed during the year were delivered in full and on time. Drug consumption was 81%-106% of the quantity allocated for routine consumption. Timely submission of complete inventory reports ranged from 86-100%, late submissions being 5-15 days late. Forty to 71% of treatment centres placed a drug order when stock was below the minimum level of three months. The proportion of drug orders received at the treatment centres in full and on time ranged from 29-80%, late orders being 1-19 days late. The PSM was found to be performing well in terms of forecasting and procurement of MDR-TB drugs, but there were shortcomings in drug distribution, reporting at treatment centre level and in drug order placements. Despite these gaps, there were no stock outs. These findings indicate that where it matters most, namely ensuring that no drug stock outs affect patient management, the PSM system is effective. Addressing the observed shortcomings will help to strengthen the existing PSM system in anticipation of a growing MDR-TB case burden in the country.

  14. Association between health systems performance and treatment outcomes in patients co-infected with MDR-TB and HIV in KwaZulu-Natal, South Africa: implications for TB programmes.

    Directory of Open Access Journals (Sweden)

    Marian Loveday

    Full Text Available To improve the treatment of MDR-TB and HIV co-infected patients, we investigated the relationship between health system performance and patient treatment outcomes at 4 decentralised MDR-TB sites.In this mixed methods case study which included prospective comparative data, we measured health system performance using a framework of domains comprising key health service components. Using Pearson Product Moment Correlation coefficients we quantified the direction and magnitude of the association between health system performance and MDR-TB treatment outcomes. Qualitative data from participant observation and interviews analysed using systematic text condensation (STC complemented our quantitative findings.We found significant differences in treatment outcomes across the sites with successful outcomes varying from 72% at Site 1 to 52% at Site 4 (p<0.01. Health systems performance scores also varied considerably across the sites. Our findings suggest there is a correlation between treatment outcomes and overall health system performance which is significant (r = 0.99, p<0.01, with Site 1 having the highest number of successful treatment outcomes and the highest health system performance. Although the 'integration' domain, which measured integration of MDR-TB services into existing services appeared to have the strongest association with successful treatment outcomes (r = 0.99, p<0.01, qualitative data indicated that the 'context' domain influenced the other domains.We suggest that there is an association between treatment outcomes and health system performance. The chance of treatment success is greater if decentralised MDR-TB services are integrated into existing services. To optimise successful treatment outcomes, regular monitoring and support are needed at a district, facility and individual level to ensure the local context is supportive of new programmes and implementation is according to guidelines.

  15. Treatment outcomes of MDR-tuberculosis patients in Brazil: a retrospective cohort analysis

    Directory of Open Access Journals (Sweden)

    Mayara Lisboa Bastos

    2017-11-01

    Full Text Available Abstract Background Multidrug-resistant tuberculosis (MDR-TB is a threat for the global TB epidemic control. Despite existing evidence that individualized treatment of MDR-TB is superior to standardized regimens, the latter are recommended in Brazil, mainly because drug-susceptibility tests (DST are often restricted to first-line drugs in public laboratories. We compared treatment outcomes of MDR-TB patients using standardized versus individualized regimens in Brazil, a high TB-burden, low resistance setting. Methods The 2007–2013 cohort of the national electronic database (SITE-TB, which records all special treatments including drug-resistance, was analysed. Patients classified as MDR-TB in SITE-TB were eligible. Treatment outcomes were classified as successful (cure/treatment completed or unsuccessful (failure/relapse/death/loss to follow-up. The odds for successful treatment according to type of regimen were controlled for demographic and clinical variables. Results Out of 4029 registered patients, we included 1972 recorded from 2010 to 2012, who had more complete outcome data. The overall success proportion was 60%. Success was more likely in non-HIV patients, sputum-negative at baseline, with unilateral disease and without prior DR-TB. Adjusted for these variables, those receiving standardized regimens had 2.7-fold odds of success compared to those receiving individualized treatments when failure/relapse were considered, and 1.4-fold odds of success when death was included as an unsuccessful outcome. When loss to follow-up was added, no difference between types of treatment was observed. Patients who used levofloxacin instead of ofloxacin had 1.5-fold odds of success. Conclusion In this large cohort of MDR-TB patients with a low proportion of successful outcomes, standardized regimens had superior efficacy than individualized regimens, when adjusted for relevant variables. In addition to the limitations of any retrospective observational

  16. Economic evaluation of a shortened standardised treatment regimen of antituberculosis drugs for patients with multidrug-resistant tuberculosis (STREAM): study protocol

    OpenAIRE

    Gama, Elvis; Madan, Jason; Langley, Ivor; Girma, Mamo; Evans, Denise; Rosen, Sydney; Squire, S Bertel

    2016-01-01

    Introduction:\\ud Multidrug-resistant tuberculosis (MDR-TB) poses a serious financial challenge to health systems and patients. The current treatment for patients with MDR-TB takes up to 24 months to complete. Evidence for a shorter regimen which differs from the standard WHO recommended MDR-TB regimen and typically lasts between 9 and 12 months has been reported from Bangladesh. This evaluation aims to assess the economic impact of a shortened regimen on patients and health systems. This eval...

  17. Epidemia de tuberculosis multidrogo resistente y extensivamente resistente a drogas (TB MDR/XDR en el Perú: situación y propuestas para su control

    Directory of Open Access Journals (Sweden)

    Hernán Del Castillo

    2009-07-01

    Full Text Available En este artículo se describe el estado actual de las epidemias de tuberculosis multidrogo resitente (TB MDR y tuberculosis extensivamente resistente a drogas (TB XDR en el Perú. Se realiza un análisis de nuestra situación con respecto al resto de Latinoamérica, y de la distribución temporo espacial de los casos de TB XDR en Lima. También presentamos nuestra reflexión de lo que está pasando y debe cambiar; lo que se resume en darle la importancia debida a un problema que nos está rebasando y anteponer a nuestros propios intereses, los intereses de la humanidad; por consiguiente no podemos callar, y debemos declarar a la tuberculosis como emergencia sanitaria nacional. Eso constituye una respuesta, esperamos, aún viable para el Perú.

  18. Cycloserine Induced Late Onset Psychosis and Ethambutol Induced Peripheral Neuropathy Associated with MDR-TB Treatment in an Indian Patient- A Rare Case Report.

    Science.gov (United States)

    Holla, Sadhana; Amberkar, Mohan Babu; Bhandarypanambur, Rajeshkrishna; Kamalkishore, Meenakumari; Janardhanan, Manju

    2015-02-01

    Adverse reactions and toxicity inevitably accompany all treatment courses for drug-resistant TB. Our case underscores the importance of awareness regarding neuropsychiatric adverse reactions due to MDR-TB therapy and reversible nature of it. Cycloserine induced psychosis is most life threatening complication and sometimes could be fatal. A 42-year-old male on MDR-TB therapy got admitted for his persistent psychotic complaints like hallucinations, delusions and suicidal ideations, despite being treated with quetiapine/olanzapine. Eventually patient was rehabilitated, cycloserine was stopped and psychotic events regressed slowly. Other culprit drugs like ethambutol and levofloxacin causing psychosis was ruled out because there was no relapse of psychotic events despite being continued with these drugs. He also complained of tingling, numbness, swaying, pain and weakness. On examination, he had distal motor weakness in lower limbs, tandem gait positive, altered position sense, and tenderness over toes and positive Romberg's sign with ataxia. He was diagnosed to have drug induced sensorimotor peripheral neuropathy. All these symptoms persisted after stopping cycloserine and patient continued to have neuropathy with ethambutol and ethionamide. Considering the nature of neuropathy which was mild, mixed sensorimotor and resolved completely after 2-3 weeks of stopping, it was more in favour of ethambutol. However, we could not rule out the possibility of ethionamide or (ethionamide + ethambutol) causing neuropathy or both could have accelerated the neurotoxic effects of cycloserine which remained elusive.

  19. Aggressive regimens for multidrug-resistant tuberculosis decrease all-cause mortality.

    Directory of Open Access Journals (Sweden)

    Carole D Mitnick

    Full Text Available A better understanding of the composition of optimal treatment regimens for multidrug-resistant tuberculosis (MDR-TB is essential for expanding universal access to effective treatment and for developing new therapies for MDR-TB. Analysis of observational data may inform the definition of an optimized regimen.This study assessed the impact of an aggressive regimen-one containing at least five likely effective drugs, including a fluoroquinolone and injectable-on treatment outcomes in a large MDR-TB patient cohort.This was a retrospective cohort study of patients treated in a national outpatient program in Peru between 1999 and 2002. We examined the association between receiving an aggressive regimen and the rate of death.In total, 669 patients were treated with individualized regimens for laboratory-confirmed MDR-TB. Isolates were resistant to a mean of 5.4 (SD 1.7 drugs. Cure or completion was achieved in 66.1% (442 of patients; death occurred in 20.8% (139. Patients who received an aggressive regimen were less likely to die (crude hazard ratio [HR]: 0.62; 95% CI: 0.44,0.89, compared to those who did not receive such a regimen. This association held in analyses adjusted for comorbidities and indicators of severity (adjusted HR: 0.63; 95% CI: 0.43,0.93.The aggressive regimen is a robust predictor of MDR-TB treatment outcome. TB policy makers and program directors should consider this standard as they design and implement regimens for patients with drug-resistant disease. Furthermore, the aggressive regimen should be considered the standard background regimen when designing randomized trials of treatment for drug-resistant TB.

  20. Comparative evaluation of GenoType MTBDRplus line probe assay with solid culture method in early diagnosis of multidrug resistant tuberculosis (MDR-TB at a tertiary care centre in India.

    Directory of Open Access Journals (Sweden)

    Raj N Yadav

    Full Text Available The objectives of the study were to compare the performance of line probe assay (GenoType MTBDRplus with solid culture method for an early diagnosis of multidrug resistant tuberculosis (MDR-TB, and to study the mutation patterns associated with rpoB, katG and inhA genes at a tertiary care centre in north India.In this cross-sectional study, 269 previously treated sputum-smear acid-fast bacilli (AFB positive MDR-TB suspects were enrolled from January to September 2012 at the All India Institute of Medical Sciences hospital, New Delhi. Line probe assay (LPA was performed directly on the sputum specimens and the results were compared with that of conventional drug susceptibility testing (DST on solid media [Lowenstein Jensen (LJ method].DST results by LPA and LJ methods were compared in 242 MDR-TB suspects. The LPA detected rifampicin (RIF resistance in 70 of 71 cases, isoniazid (INH resistance in 86 of 93 cases, and MDR-TB in 66 of 68 cases as compared to the conventional method. Overall (rifampicin, isoniazid and MDR-TB concordance of the LPA with the conventional DST was 96%. Sensitivity and specificity were 98% and 99% respectively for detection of RIF resistance; 92% and 99% respectively for detection of INH resistance; 97% and 100% respectively for detection of MDR-TB. Frequencies of katG gene, inhA gene and combined katG and inhA gene mutations conferring all INH resistance were 72/87 (83%, 10/87 (11% and 5/87 (6% respectively. The turnaround time of the LPA test was 48 hours.The LPA test provides an early diagnosis of monoresistance to isoniazid and rifampicin and is highly sensitive and specific for an early diagnosis of MDR-TB. Based on these findings, it is concluded that the LPA test can be useful in early diagnosis of drug resistant TB in high TB burden countries.

  1. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

  2. A pilot study of an mHealth application for healthcare workers: poor uptake despite high reported acceptability at a rural South African community-based MDR-TB treatment program.

    Directory of Open Access Journals (Sweden)

    Krisda H Chaiyachati

    Full Text Available As the South African province of KwaZulu-Natal addresses a growing multidrug-resistant tuberculosis (MDR-TB epidemic by shifting care and treatment from trained specialty centers to community hospitals, delivering and monitoring MDR-TB therapy has presented new challenges. In particular, tracking and reporting adverse clinical events have been difficult for mobile healthcare workers (HCWs, trained health professionals who travel daily to patient homes to administer and monitor therapy. We designed and piloted a mobile phone application (Mobilize for mobile HCWs that electronically standardized the recording and tracking of MDR-TB patients on low-cost, functional phones.We assess the acceptability and feasibility of using Mobilize to record and submit adverse events forms weekly during the intensive phase of MDR-TB therapy and evaluate mobile HCW perceptions throughout the pilot period.All five mobile HCWs at one site were trained and provided with phones. Utilizing a mixed-methods evaluation, mobile HCWs' usage patterns were tracked electronically for seven months and analyzed. Qualitative focus groups and questionnaires were designed to understand the impact of mobile phone technology on the work environment.Mobile HCWs submitted nine of 33 (27% expected adverse events forms, conflicting with qualitative results in which mobile HCWs stated that Mobilize improved adverse events communication, helped their daily workflow, and could be successfully expanded to other health interventions. When presented with the conflict between their expressed views and actual practice, mobile HCWs cited forgetfulness and believed patients should take more responsibility for their own care.This pilot experience demonstrated poor uptake by HCWs despite positive responses to using mHealth. Though our results should be interpreted cautiously because of the small number of mobile HCWs and MDR-TB patients in this study, we recommend carefully exploring the motivations

  3. A pilot study of an mHealth application for healthcare workers: poor uptake despite high reported acceptability at a rural South African community-based MDR-TB treatment program.

    Science.gov (United States)

    Chaiyachati, Krisda H; Loveday, Marian; Lorenz, Stephen; Lesh, Neal; Larkan, Lee-Megan; Cinti, Sandro; Friedland, Gerald H; Haberer, Jessica E

    2013-01-01

    As the South African province of KwaZulu-Natal addresses a growing multidrug-resistant tuberculosis (MDR-TB) epidemic by shifting care and treatment from trained specialty centers to community hospitals, delivering and monitoring MDR-TB therapy has presented new challenges. In particular, tracking and reporting adverse clinical events have been difficult for mobile healthcare workers (HCWs), trained health professionals who travel daily to patient homes to administer and monitor therapy. We designed and piloted a mobile phone application (Mobilize) for mobile HCWs that electronically standardized the recording and tracking of MDR-TB patients on low-cost, functional phones. We assess the acceptability and feasibility of using Mobilize to record and submit adverse events forms weekly during the intensive phase of MDR-TB therapy and evaluate mobile HCW perceptions throughout the pilot period. All five mobile HCWs at one site were trained and provided with phones. Utilizing a mixed-methods evaluation, mobile HCWs' usage patterns were tracked electronically for seven months and analyzed. Qualitative focus groups and questionnaires were designed to understand the impact of mobile phone technology on the work environment. Mobile HCWs submitted nine of 33 (27%) expected adverse events forms, conflicting with qualitative results in which mobile HCWs stated that Mobilize improved adverse events communication, helped their daily workflow, and could be successfully expanded to other health interventions. When presented with the conflict between their expressed views and actual practice, mobile HCWs cited forgetfulness and believed patients should take more responsibility for their own care. This pilot experience demonstrated poor uptake by HCWs despite positive responses to using mHealth. Though our results should be interpreted cautiously because of the small number of mobile HCWs and MDR-TB patients in this study, we recommend carefully exploring the motivations of HCWs and

  4. Culture and Next-generation sequencing-based drug susceptibility testing unveil high levels of drug-resistant-TB in Djibouti: results from the first national survey.

    Science.gov (United States)

    Tagliani, Elisa; Hassan, Mohamed Osman; Waberi, Yacine; De Filippo, Maria Rosaria; Falzon, Dennis; Dean, Anna; Zignol, Matteo; Supply, Philip; Abdoulkader, Mohamed Ali; Hassangue, Hawa; Cirillo, Daniela Maria

    2017-12-15

    Djibouti is a small country in the Horn of Africa with a high TB incidence (378/100,000 in 2015). Multidrug-resistant TB (MDR-TB) and resistance to second-line agents have been previously identified in the country but the extent of the problem has yet to be quantified. A national survey was conducted to estimate the proportion of MDR-TB among a representative sample of TB patients. Sputum was tested using XpertMTB/RIF and samples positive for MTB and resistant to rifampicin underwent first line phenotypic susceptibility testing. The TB supranational reference laboratory in Milan, Italy, undertook external quality assurance, genotypic testing based on whole genome and targeted-deep sequencing and phylogenetic studies. 301 new and 66 previously treated TB cases were enrolled. MDR-TB was detected in 34 patients: 4.7% of new and 31% of previously treated cases. Resistance to pyrazinamide, aminoglycosides and capreomycin was detected in 68%, 18% and 29% of MDR-TB strains respectively, while resistance to fluoroquinolones was not detected. Cluster analysis identified transmission of MDR-TB as a critical factor fostering drug resistance in the country. Levels of MDR-TB in Djibouti are among the highest on the African continent. High prevalence of resistance to pyrazinamide and second-line injectable agents have important implications for treatment regimens.

  5. Possible impact of the standardized Category IV regimen on multidrug-resistant tuberculosis patients in Mumbai.

    Science.gov (United States)

    Udwadia, Zarir F; Mullerpattan, Jai Bharat; Shah, Kushal D; Rodrigues, Camilla S

    2016-01-01

    Treatment of multidrug-resistant tuberculosis (MDR-TB) in the Programmatic Management of Drug-resistant TB program involves a standard regimen with a 6-month intensive phase and an 18-month continuation phase. However, the local drug resistance patterns in high MDR regions such as Mumbai may not be adequately reflected in the design of the regimen for that particular area. The study was carried out at a private Tertiary Level Hospital in Mumbai in a mycobacteriology laboratory equipped to perform the second-line drug susceptibility testing (DST). We attempted to analyze the impact of prescribing the standardized Category IV regimen to all patients receiving a DST at our mycobacteriology laboratory. All samples confirmed to be MDR-TB and tested for the second-line drugs at Hinduja Hospital's Mycobacteriology Laboratory in the year 2012 were analyzed. A total of 1539 samples were analyzed. Of these, 464 (30.14%) were MDR-TB, 867 (56.33%) were MDR with fluoroquinolone resistance, and 198 (12.8%) were extensively drug-resistant TB. The average number of susceptible drugs per sample was 3.07 ± 1.29 (assuming 100% cycloserine susceptibility). Taking 4 effective drugs to be the cut or an effective regimen, the number of patients receiving 4 or more effective drugs from the standardized directly observed treatment, short-course plus regimen would be 516 (33.5%) while 66.5% of cases would receive 3 or less effective drugs. Our study shows that a high proportion of patients will have resistance to a number of the first- and second-line drugs. Local epidemiology must be factored in to avoid amplification of resistance.

  6. MDR and XDR-TB: Revolutionising our approach to facility design for long-term care facilities improved infrastructure and services for South Africa

    CSIR Research Space (South Africa)

    Parsons, SA

    2008-11-01

    Full Text Available of hospital design solutions to accommodate M(X)DR-TB patients and methodologies adopted to fast track the provision of much needed beds in the various high burden provinces in South Africa. TB Healthcare facilities: the South African Tuberculosis Strategic... categories: 20th Congress of the International Federation of Hospital Engineering, 19-22 October 2008, Barcelona, Spain 11 Risk Management As discussed earlier the key design issues in reducing the opportunities for patient-to-patient and patient...

  7. Transmission of MDR and XDR tuberculosis in Shanghai, China.

    Directory of Open Access Journals (Sweden)

    Ming Zhao

    Full Text Available Multidrug-resistant (MDR and extensively drug-resistant (XDR tuberculosis (TB are global health problems. We sought to determine the characteristics, prevalence, and relative frequency of transmission of MDR and XDR TB in Shanghai, one of the largest cities in Asia.TB is diagnosed in district TB hospitals in Shanghai, China. Drug susceptibility testing for first-line drugs was performed for all culture positive TB cases, and tests for second-line drugs were performed for MDR cases. VNTR-7 and VNTR-16 were used to genotype the strains, and prior treatment history and treatment outcomes were determined for each patient.There were 4,379 culture positive TB cases diagnosed with drug susceptibility test results available during March 2004 through November 2007. 247 (5.6% were infected with a MDR strain of M. tuberculosis and 11 (6.3% of the 175 MDR patients whose isolate was tested for susceptibility to second-line drugs, were XDR. More than half of the patients with MDR and XDR were newly diagnosed and had no prior history of TB treatment. Nearly 57% of the patients with MDR were successfully treated.Transmission of MDR and XDR strains is a serious problem in Shanghai. While a history of prior anti-TB treatment indicates which individuals may have acquired MDR or XDR TB, it does not accurately predict which TB patients have disease caused by transmission of MDR and XDR strains. Therefore, universal drug susceptibility testing is recommended for new and retreatment TB cases.

  8. A cross-sectional study of tuberculosis drug resistance among previously treated patients in a tertiary hospital in Accra, Ghana: public health implications of standardized regimens.

    Science.gov (United States)

    Forson, Audrey; Kwara, Awewura; Kudzawu, Samuel; Omari, Michael; Otu, Jacob; Gehre, Florian; de Jong, Bouke; Antonio, Martin

    2018-04-02

    Mycobacterium tuberculosis drug resistance is a major challenge to the use of standardized regimens for tuberculosis (TB) therapy, especially among previously treated patients. We aimed to investigate the frequency and pattern of drug resistance among previously treated patients with smear-positive pulmonary tuberculosis at the Korle-Bu Teaching Hospital Chest Clinic, Accra. This was a cross-sectional survey of mycobacterial isolates from previously treated patients referred to the Chest Clinic Laboratory between October 2010 and October 2013. The Bactec MGIT 960 system for mycobactrerial culture and drug sensitivity testing (DST) was used for sputum culture of AFB smear-positive patients with relapse, treatment failure, failure of smear conversion, or default. Descriptive statistics were used to summarize patient characteristics, and frequency and patterns of drug resistance. A total of 112 isolates were studied out of 155 from previously treated patients. Twenty contaminated (12.9%) and 23 non-viable isolates (14.8%) were excluded. Of the 112 studied isolates, 53 (47.3%) were pan-sensitive to all first-line drugs tested Any resistance (mono and poly resistance) to isoniazid was found in 44 isolates (39.3%) and any resistance to streptomycin in 43 (38.4%). Thirty-one (27.7%) were MDR-TB. Eleven (35.5%) out of 31 MDR-TB isolates were pre-XDR. MDR-TB isolates were more likely than non-MDR isolates to have streptomycin and ethambutol resistance. The main findings of this study were the high prevalence of MDR-TB and streptomycin resistance among previously treated TB patients, as well as a high prevalence of pre-XDR-TB among the MDR-TB patients, which suggest that first-line and second-line DST is essential to aid the design of effective regimens for these groups of patients in Ghana.

  9. Use of anti-retroviral therapy in tuberculosis patients on second-line anti-TB regimens: a systematic review.

    Directory of Open Access Journals (Sweden)

    Matthew Arentz

    Full Text Available Use of antiretroviral therapy (ART during treatment of drug susceptible tuberculosis (TB improves survival. However, data from HIV infected individuals with drug resistant TB are lacking. Second line TB drugs when combined with ART may increase drug interactions and lead to higher rates of toxicity and greater noncompliance. This systematic review sought to determine the benefit of ART in the setting of second line drug therapy for drug resistant TB.We included individual patient data from studies that evaluated treatment of drug-resistant tuberculosis in HIV-1 infected individuals published between January 1980 and December of 2009. We evaluated the effect of ART on treatment outcomes, time to smear and culture conversion, and adverse events.Ten observational studies, including data from 217 subjects, were analyzed. Patients using ART during TB treatment had increased likelihood of cure (hazard ratio (HR 3.4, 95% CI 1.6-7.4 and decreased likelihood of death (HR 0.4, 95% CI 0.3-0.6 during treatment for drug resistant TB. These associations remained significant in patients with a CD4 less than 200 cells/mm(3 and less than 50 cells/mm(3, and when correcting for drug resistance pattern.We identified only observational studies from which individual patient data could be drawn. Limitations in study design, and heterogeneity in a number of the outcomes of interest had the potential to introduce bias.While there are insufficient data to determine if ART use increases adverse drug interactions when used with second line TB drugs, ART use during treatment of drug resistant TB appears to improve cure rates and decrease risk of death. All individuals with HIV appear to benefit from ART use during treatment for TB.

  10. Definition of drug resistance of Mycobacterium tuberculosis to antituberculosis drugs in patients with multidrugresistant tuberculosis and TB with extremely drug resistant depending on the case of the disease

    Directory of Open Access Journals (Sweden)

    Kryzhanovsky D.G.

    2014-11-01

    Full Text Available There was studied the profile of drug resistance to the main (I line and reserve (II line antituberculosis drugs in patients with MDR and XDR tuberculosis, depending of the case of the disease. According to the randomized retrospective research 200 patients with MDR and XDR tuberculosis, who received treatment in the clinic of hospital Municipal institution «Dnipropetrovsk rigional clinical association «Phthisiology» Dnipropetrovsk regional Council» during the period 2010 – 2012 were involved. Data about patients contained the data on a case of the disease and the results of the test of drug sensitivity to MBT. XDR – TB was revealed in 7.5% of patients with MDR tuberculosis. In patients with MDR tuberculosis as compared with patients with XDR tuberculosis «new cases» were diagnosed in 19.5% against 18.5% (p <0.05. In patients with MDR tuberculosis and with XDR tuberculosis resistance to the antituberculosis drug more commonly developed to S - 88.5%, E - 55% and Z - 24%. The presence of MDR-TB and XDR-TB prevails in patients, who underwent previous courses of treatment with anti-TB drugs in case history as compared with patients with «new cases» of treatment. The development of resistance to anti-TB drugs depends on the availability of these drugs in the previous treatment regimens.

  11. New drugs and perspectives for new anti-tuberculosis regimens

    Directory of Open Access Journals (Sweden)

    S. Tiberi

    2018-03-01

    Full Text Available Tuberculosis (TB is the ninth cause of global death, more than any other infectious disease. With growing drug resistance the epidemic remains and will require significant attention and investment for the elimination of this disease to occur. With susceptible TB treatment not changing over the last four decades and the advent of drug resistance, new drugs and regimens are required.Recently, through greater collaboration and research networks some progress with significant advances has taken place, not withstanding the comparatively low amount of resources invested. Of late the availability of the new drugs bedaquiline, delamanid and repurposed drugs linezolid, clofazimine and carbapenems are being used more frequently in drug-resistant TB regimens.The WHO shorter multidrug-resistant tuberculosis regimen promises to reach more patients and treat them more quickly and more cheaply.With this new enthusiasm and hope we this review gives an update on the new drugs and perspectives for the treatment of drug-susceptible and drug-resistant tuberculosis. Keywords: Bedaquiline, Delamanid, Linezolid, MDR, XDR-TB, TB

  12. A comparison of liquid and solid culture for determining relapse and durable cure in phase III TB trials for new regimens.

    Science.gov (United States)

    Phillips, Patrick P J; Mendel, Carl M; Nunn, Andrew J; McHugh, Timothy D; Crook, Angela M; Hunt, Robert; Bateson, Anna; Gillespie, Stephen H

    2017-11-24

    Tuberculosis kills more people than any other infectious disease, and new regimens are essential. The primary endpoint for confirmatory phase III trials for new regimens is a composite outcome that includes bacteriological treatment failure and relapse. Culture methodology is critical to the primary trial outcome. Patients in clinical trials can have positive cultures after treatment ends that may not necessarily indicate relapse, which was ascribed previously to laboratory cross-contamination or breakdown of old lesions. Löwenstein-Jensen (LJ) medium was the previous standard in clinical trials, but almost all current and future trials will use the Mycobacteria Growth Indicator Tube (MGIT) system due to its simplicity and consistency of use, which will affect phase III trial results. LJ was used for the definition of the primary endpoint in the REMoxTB trial, but every culture was also inoculated in parallel into the MGIT system. The data from this trial, therefore, provide a unique opportunity to investigate and compare the incidence of false 'isolated positives' in liquid and solid media and their potential impact on the primary efficacy results. All post-treatment positive cultures were reviewed in the REMoxTB clinical trial. Logistic regression models were used to model the incidence of isolated positive cultures on MGIT and LJ. A total of 12,209 sputum samples were available from 1652 patients; cultures were more often positive on MGIT than LJ. In 1322 patients with a favourable trial outcome, 126 (9.5%) had cultures that were positive in MGIT compared to 34 (2.6%) patients with positive cultures on LJ. Among patients with a favourable outcome, the incidence of isolated positives on MGIT differed by study laboratory (p cultures in some patients even after adjusting for laboratory, p cultures, positive MGIT cultures were more likely to be associated with higher grade TB symptoms reported within 7 days either side of sputum collection in patients with an

  13. Operational challenges in diagnosing multi-drug resistant TB and initiating treatment in Andhra Pradesh, India.

    Directory of Open Access Journals (Sweden)

    Sarabjit S Chadha

    Full Text Available BACKGROUND: Revised National TB Control Programme (RNTCP, Andhra Pradesh, India. There is limited information on whether MDR-TB suspects are identified, undergo diagnostic assessment and are initiated on treatment according to the programme guidelines. OBJECTIVES: To assess i using the programme definition, the number and proportion of MDR-TB suspects in a large cohort of TB patients on first-line treatment under RNTCP ii the proportion of these MDR-TB suspects who underwent diagnosis for MDR-TB and iii the number and proportion of those diagnosed as MDR-TB who were successfully initiated on treatment. METHODS: A retrospective cohort analysis, by reviewing RNTCP records and reports, was conducted in four districts of Andhra Pradesh, India, among patients registered for first line treatment during October 2008 to December 2009. RESULTS: Among 23,999 TB patients registered for treatment there were 559 (2% MDR-TB suspects (according to programme definition of which 307 (55% underwent diagnosis and amongst these 169 (55% were found to be MDR-TB. Of the MDR-TB patients, 112 (66% were successfully initiated on treatment. Amongst those eligible for MDR-TB services, significant proportions are lost during the diagnostic and treatment initiation pathway due to a variety of operational challenges. The programme needs to urgently address these challenges for effective delivery and utilisation of the MDR-TB services.

  14. PROPOSAL OF ANTI-TUBERCULOSIS REGIMENS BASED ON SUSCEPTIBILITY TO ISONIAZID AND RIFAMPICIN

    Science.gov (United States)

    Mendoza-Ticona, Alberto; Moore, David AJ; Alarcón, Valentina; Samalvides, Frine; Seas, Carlos

    2014-01-01

    Objective To elaborate optimal anti-tuberculosis regimens following drug susceptibility testing (DST) to isoniazid (H) and rifampicin (R). Design 12 311 M. tuberculosis strains (National Health Institute of Peru 2007-2009) were classified in four groups according H and R resistance. In each group the sensitivity to ethambutol (E), pirazinamide (Z), streptomycin (S), kanamycin (Km), capreomycin (Cm), ciprofloxacin (Cfx), ethionamide (Eto), cicloserine (Cs) and p-amino salicilic acid (PAS) was determined. Based on resistance profiles, domestic costs, and following WHO guidelines, we elaborated and selected optimal putative regimens for each group. The potential efficacy (PE) variable was defined as the proportion of strains sensitive to at least three or four drugs for each regimen evaluated. Results Selected regimes with the lowest cost, and highest PE of containing 3 and 4 effective drugs for TB sensitive to H and R were: HRZ (99,5%) and HREZ (99,1%), respectively; RZECfx (PE=98,9%) and RZECfxKm (PE=97,7%) for TB resistant to H; HZECfx (96,8%) and HZECfxKm (95,4%) for TB resistant to R; and EZCfxKmEtoCs (82.9%) for MDR-TB. Conclusion Based on resistance to H and R it was possible to select anti-tuberculosis regimens with high probability of success. This proposal is a feasible alternative to tackle tuberculosis in Peru where the access to rapid DST to H and R is improving progressively. PMID:23949502

  15. Economic evaluation of a shortened standardised treatment regimen of antituberculosis drugs for patients with multidrug-resistant tuberculosis (STREAM): study protocol.

    Science.gov (United States)

    Gama, Elvis; Madan, Jason; Langley, Ivor; Girma, Mamo; Evans, Denise; Rosen, Sydney; Squire, S Bertel

    2016-10-17

    Multidrug-resistant tuberculosis (MDR-TB) poses a serious financial challenge to health systems and patients. The current treatment for patients with MDR-TB takes up to 24 months to complete. Evidence for a shorter regimen which differs from the standard WHO recommended MDR-TB regimen and typically lasts between 9 and 12 months has been reported from Bangladesh. This evaluation aims to assess the economic impact of a shortened regimen on patients and health systems. This evaluation is innovative as it combines patient and health system costs, as well as operational modelling in assessing the impact. An economic evaluation nested in a clinical trial with 2 arms will be performed at 4 facilities. The primary outcome measure is incremental cost to the health system of the study regimen compared with the control regimen. Secondary outcome measures are mean incremental costs incurred by patients by treatment outcome; patient costs by category (direct medical costs, transport, food and accommodation costs, and cost of guardians/accompanying persons and lost time); health systems cost by category and drugs; and costs related to serious adverse events. The study has been evaluated and approved by the Ethics Advisory Group of the International Union Against Tuberculosis and Lung Disease; South African Medical Research Ethics Committee; Wits Health Consortium Protocol Review Committee; University of the Witwatersrand Human Research Ethics Committee; University of Kwazulu-Natal Biomedical Research Ethics Committee; St Peter TB Specialized Hospital Ethical Review Committee; AHRI-ALERT Ethical Review Committee, and all participants will provide written informed consent. The results of the economic evaluation will be published in a peer-reviewed journal. ISRCTN78372190. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  16. Major Challenges in Clinical Management of TB/HIV Coinfected Patients in Eastern Europe Compared with Western Europe and Latin America

    DEFF Research Database (Denmark)

    Efsen, Anne Marie W; Schultze, Anna; Post, Frank A

    2015-01-01

    OBJECTIVES: Rates of TB/HIV coinfection and multi-drug resistant (MDR)-TB are increasing in Eastern Europe (EE). We aimed to study clinical characteristics, factors associated with MDR-TB and predicted activity of empiric anti-TB treatment at time of TB diagnosis among TB/HIV coinfected patients......% of participants in EE compared with 90-96% in other regions (pmanagement of TB/HIV patients in EE requires...... better access to TB diagnostics including DSTs, empiric anti-TB therapy directed at both susceptible and MDR-TB, and more widespread use of cART....

  17. From MDR to MXR

    DEFF Research Database (Denmark)

    Litman, Thomas; Druley, T E; Stein, W D

    2001-01-01

    The ATP binding cassette (ABC) superfamily of membrane transporters is one of the largest protein classes known, and counts numerous proteins involved in the trafficking of biological molecules across cell membranes. The first known human ABC transporter was P-glycoprotein (P-gp), which confers...... multidrug resistance (MDR) to anticancer drugs. In recent years, we have obtained an increased understanding of the mechanism of action of P-gp as its ATPase activity, substrate specificity and pharmacokinetic interactions have been investigated. This review focuses on the functional characterization of P...... for reversal of MDR in cancer and for drug delivery, are discussed....

  18. Inappropriate Tuberculosis Treatment Regimens in Chinese Tuberculosis Hospitals

    NARCIS (Netherlands)

    Xue He, Guang; van den Hof, Susan; van der Werf, Marieke J.; Guo, Hui; Hu, Yuan Lian; Fan, Ji Huan; Zhang, Wei Min; Tostado, Christopher P.; Borgdorff, Martien W.

    2011-01-01

    This investigation of tuberculosis (TB) treatment regimens in 6 TB hospitals in China showed that only 18% of patients with new cases and 9% of patients with retreatment cases were prescribed standard TB treatment regimens. Adherence to treatment guidelines needs to be improved in TB hospitals to

  19. Pharmacokinetics of Pyrazinamide and Optimal Dosing Regimens for Drug-Sensitive and -Resistant Tuberculosis.

    Science.gov (United States)

    Chirehwa, Maxwell T; McIlleron, Helen; Rustomjee, Roxana; Mthiyane, Thuli; Onyebujoh, Philip; Smith, Peter; Denti, Paolo

    2017-08-01

    Pyrazinamide is used in the treatment of tuberculosis (TB) because its sterilizing effect against tubercle bacilli allows the shortening of treatment. It is part of standard treatment for drug-susceptible and drug-resistant TB, and it is being considered as a companion drug in novel regimens. The aim of this analysis was to characterize factors contributing to the variability in exposure and to evaluate drug exposures using alternative doses, thus providing evidence to support revised dosing recommendations for drug-susceptible and multidrug-resistant tuberculosis (MDR-TB). Pyrazinamide pharmacokinetic (PK) data from 61 HIV/TB-coinfected patients in South Africa were used in the analysis. The patients were administered weight-adjusted doses of pyrazinamide, rifampin, isoniazid, and ethambutol in fixed-dose combination tablets according to WHO guidelines and underwent intensive PK sampling on days 1, 8, 15, and 29. The data were interpreted using nonlinear mixed-effects modeling. PK profiles were best described using a one-compartment model with first-order elimination. Allometric scaling was applied to disposition parameters using fat-free mass. Clearance increased by 14% from the 1st day to the 29th day of treatment. More than 50% of patients with weight less than 55 kg achieved lower pyrazinamide exposures at steady state than the targeted area under the concentration-time curve from 0 to 24 h of 363 mg · h/liter. Among patients with drug-susceptible TB, adding 400 mg to the dose for those weighing 30 to 54 kg improved exposure. Average pyrazinamide exposure in different weight bands among patients with MDR-TB could be matched by administering 1,500 mg, 1,750 mg, and 2,000 mg to patients in the 33- to 50-kg, 51- to 70-kg, and greater than 70-kg weight bands, respectively. Copyright © 2017 American Society for Microbiology.

  20. TB in Children in the United States

    Science.gov (United States)

    ... Regimen for Latent TB Infection-Patient Education Brochure Posters Mantoux Tuberculin Skin Test Wall Chart World TB ... site? Adobe PDF file Microsoft PowerPoint file Microsoft Word file Microsoft Excel file Audio/Video file Apple ...

  1. Proteins purified from Mycobacterium tuberculosis MDR and Susceptible clinical isolates: Identification by proteomics approach

    Directory of Open Access Journals (Sweden)

    A R. Hadizadeh Tasbiti

    2015-01-01

    Conclusion: Such information could be helpful for the development of newer therapeutic agents or of diagnostic markers for better treatment or diagnosis of TB. This study extends the list of the potential determinants of differences in virulence between the two isolates (MDR and susceptible TB and adds to the current understanding of MTB pathogenesis.

  2. TB Terms

    Science.gov (United States)

    ... sputum can also be used to do a culture. TB blood test – a test that uses a blood sample to find out if you are infected with TB bacteria. The test measures the response to TB proteins when they are mixed with a small amount of blood. Examples of these TB blood tests include QuantiFERON ® -TB ...

  3. Tuberculosis: The Connection between TB and HIV (the AIDS Virus)

    Science.gov (United States)

    ... Regimen for Latent TB Infection-Patient Education Brochure Posters Mantoux Tuberculin Skin Test Wall Chart World TB ... site? Adobe PDF file Microsoft PowerPoint file Microsoft Word file Microsoft Excel file Audio/Video file Apple ...

  4. Aggressive Regimens for Multidrug-Resistant Tuberculosis Reduce Recurrence

    Science.gov (United States)

    Franke, Molly F.; Appleton, Sasha C.; Mitnick, Carole D.; Furin, Jennifer J.; Bayona, Jaime; Chalco, Katiuska; Shin, Sonya; Murray, Megan; Becerra, Mercedes C.

    2013-01-01

    Background. Recurrent tuberculosis disease occurs within 2 years in as few as 1% and as many as 29% of individuals successfully treated for multidrug-resistant (MDR) tuberculosis. A better understanding of treatment-related factors associated with an elevated risk of recurrent tuberculosis after cure is urgently needed to optimize MDR tuberculosis therapy. Methods. We conducted a retrospective cohort study among adults successfully treated for MDR tuberculosis in Peru. We used multivariable Cox proportional hazards regression analysis to examine whether receipt of an aggressive MDR tuberculosis regimen for ≥18 months following sputum conversion from positive to negative was associated with a reduced rate of recurrent tuberculosis. Results. Among 402 patients, the median duration of follow-up was 40.5 months (interquartile range, 21.2–53.4). Receipt of an aggressive MDR tuberculosis regimen for ≥18 months following sputum conversion was associated with a lower risk of recurrent tuberculosis (hazard ratio, 0.40 [95% confidence interval, 0.17–0.96]; P = .04). A baseline diagnosis of diabetes mellitus also predicted recurrent tuberculosis (hazard ratio, 10.47 [95% confidence interval, 2.17–50.60]; P = .004). Conclusions. Individuals who received an aggressive MDR tuberculosis regimen for ≥18 months following sputum conversion experienced a lower rate of recurrence after cure. Efforts to ensure that an aggressive regimen is accessible to all patients with MDR tuberculosis, such as minimization of sequential ineffective regimens, expanded drug access, and development of new MDR tuberculosis compounds, are critical to reducing tuberculosis recurrence in this population. Patients with diabetes mellitus should be carefully managed during initial treatment and followed closely for recurrent disease. PMID:23223591

  5. THE EFFECT OF DIFFERENT TB DRUGS AND ANTIMICROBIAL AGENTS ON THE EFFICIENCY OF TREATMENT OF TUBERCULOSIS PATIENTS WITH MULTIPLE DRUG RESISTANCE

    Directory of Open Access Journals (Sweden)

    I. A. Vasilyeva

    2017-01-01

    Full Text Available Objective of the study: to study the effect of specific TB drugs and antimicrobial agents constituting chemotherapy regimens on the efficiency of treatment of tuberculosis patients with various patterns of multiple drug resistance.Subjects and Methods. 412 pulmonary tuberculosis patients with bacillary excretion and various patterns of multiple drug resistance were enrolled into the study (117 patients with MDR TB (non pre-XDR and non-XDR; 120 patients with pre-XDR TB and 175 with XDR TB. Patients in the subgroups were compatible regarding sex and age. The patients were prescribed regimens including 5-6 drugs in accordance with their drug resistance pattern. The time of sputum conversion (by culture versus the year of treatment was selected as a surrogate endpoint. The effect of specific TB drugs and antimicrobial agents on treatment efficiency was assessed through calculation of odds ratio (OR of achieving a surrogate endpoint in the patients receiving and not receiving a certain drug.Results. In the subgroup of pre-XDR TB, the following drugs demonstrated the valid increase of odds of sputum conversion: ethambutol (OR 11.8, pyrazinamide (OR 10.2, moxifloxacin (OR 7.8, capreomicin (OR 4.41. Sputum conversion was achieved in all 11 patients treated with bedaquiline.In the subgroup of XDR TB, the following drugs provided a positive effect on the achievement of sputum conversion: bedaquiline (OR 9.62, linezolid (OR 8.15, cycloserine (OR 7.88, pyrazinamide (OR 7.29, moxifloxacin (OR 7.08, and ethambutol (OR 6.69. Ofloxacin demonstrated a confident negative effect on achieving sputum conversion (95% CI 0.06-0.32. 

  6. HIV, multidrug-resistant TB and depressive symptoms: when three conditions collide.

    Science.gov (United States)

    Das, Mrinalini; Isaakidis, Petros; Van den Bergh, Rafael; Kumar, Ajay M V; Nagaraja, Sharath Burugina; Valikayath, Asmaa; Jha, Santosh; Jadhav, Bindoo; Ladomirska, Joanna

    2014-01-01

    Management of multidrug-resistant TB (MDR-TB) patients co-infected with human immunodeficiency virus (HIV) is highly challenging. Such patients are subject to long and potentially toxic treatments and may develop a number of different psychiatric illnesses such as anxiety and depressive disorders. A mental health assessment before MDR-TB treatment initiation may assist in early diagnosis and better management of psychiatric illnesses in patients already having two stigmatising and debilitating diseases. To address limited evidence on the baseline psychiatric conditions of HIV-infected MDR-TB patients, we aimed to document the levels of depressive symptoms at baseline, and any alteration following individualized clinical and psychological support during MDR-TB therapy, using the Patient Health Questionnaire-9 (PHQ-9) tool, among HIV-infected patients. This was a retrospective review of the medical records of an adult (aged >15 years) HIV/MDR-TB cohort registered for care during the period of August 2012 through to March 2014. A total of 45 HIV/MDR-TB patients underwent baseline assessment using the PHQ-9 tool, and seven (16%) were found to have depressive symptoms. Of these, four patients had moderate to severe depressive symptoms. Individualized psychological and clinical support was administered to these patients. Reassessments were carried out for all patients after 3 months of follow-up, except one, who died during the period. Among these 44 patients, three with baseline depressive symptoms still had depressive symptoms. However, improvements were observed in all but one after 3 months of follow-up. Psychiatric illnesses, including depressive symptoms, during MDR-TB treatment demand attention. Routine administration of baseline mental health assessments by trained staff has the potential to assist in determining appropriate measures for the management of depressive symptoms during MDR-TB treatment, and help in improving overall treatment outcomes. We recommend

  7. Testing for TB Infection

    Science.gov (United States)

    ... Adverse Events TB Treatment of Persons Living with HIV TB Treatment and Pregnancy TB Treatment for Children Drug-Resistant TB Research TB Epidemiologic Studies Consortium Research Projects Publications TB Trials Consortium Study ...

  8. Is Chemoprophylaxis for Child Contacts of Drug-Resistant TB Patients Beneficial? A Systematic Review

    Directory of Open Access Journals (Sweden)

    C. Padmapriyadarsini

    2018-01-01

    Full Text Available Background. Preventive therapy for child contacts of multidrug-resistant tuberculosis (MDR-TB patients is poorly studied, and no consensus about the role and the rationale of chemoprophylaxis has been reached. Objective. To conduct systematic review with an aim to determine the effectiveness of TB preventive therapy in reducing the incidence of TB disease in pediatric contacts of MDR-TB patients. Methods. We conducted a literature search for randomized control trials, cohort studies, and case reports of chemoprophylaxis for pediatric contacts of MDR-TB patients in PubMed, EMBASE, Cochrane Databases of Systematic Reviews, metaRegister of Controlled Trials, and other clinical registries through March 2017, using appropriate search strategy. In addition we searched abstracts from international conferences and references of published articles and reviews. Results. Of the 153 references assessed from various databases, seven studies were identified as relevant after adaption of eligibility criteria and assessed for systematic review. Of these, only two studies contributed data for the pooled meta-analysis. Conclusions. Though the available evidences suggest that the chemoprophylaxis for child contacts of MDR-TB patients is beneficial, data to support or reject preventive therapy is very limited. Further clinical research, in Tb endemic settings like India, needs to be performed to prove the beneficial effect of chemoprophylaxis for pediatric contacts of MDR-TB.

  9. TB control programmes: the challenges for Africa.

    Science.gov (United States)

    Harries, T

    1996-11-01

    Governmental neglect of tuberculosis (TB), inadequately managed and inaccurately designed TB control programs, population growth, and the HIV epidemic account for the resurgence of TB in sub-Saharan Africa. The World Health Organization and the International Union against TB and Lung Disease have developed a TB control strategy that aims to reduce mortality, morbidity, and transmission of TB. It aims for an 85% cure rate among detected new cases of smear-positive TB and a 70% rate of detecting existing smear-positive TB cases. The strategy involves the provision of short-course chemotherapy (SCC) to all identified smear-positive TB cases through directly observed treatment (DOTS). SCC treatment regimens for smear-positive pulmonary TB recommended for sub-Saharan African countries are: initial phase = daily administration over 2 months of streptomycin, rifampicin, isoniazid, and pyrazinamide; continuation phase = 3 doses over 4 months of isoniazid and rifampicin or daily administration of thiacetazone and isoniazid or of ethambutol and isoniazid. A TB control policy must be implemented to bring about effective TB control. The essential elements of this policy include political commitment, case detection through passive case-finding, SCC, a regular supply of essential drugs, and a monitoring and evaluation system. Political commitment involves establishing a National TB Control Program to be integrated into the existing health structure. Increased awareness of TB in the community and among health workers and a reference laboratory are needed to make case finding successful. A distribution and logistics system is needed to ensure uninterrupted intake of drugs throughout treatment. These regimens have been very successful and cost-effective but pose several disadvantages (e.g., heavy workload of recommended 3 sputum smear tests). A simplified approach involves 1 initial sputum smear for 6 months; 6-months, intermittent rifampicin-based therapy, 100% DOTS throughout

  10. Double Standards in Global Health: Medicine, Human Rights Law and Multidrug-Resistant TB Treatment Policy.

    Science.gov (United States)

    Nicholson, Thomas; Admay, Catherine; Shakow, Aaron; Keshavjee, Salmaan

    2016-06-01

    The human rights arguments that underpinned the fight against HIV over the last three decades were poised, but ultimately failed, to provide a similar foundation for success against multidrug-resistant TB (MDR-TB) and other diseases of the poor. With more than 1.5 million deaths since 2000 attributed to strains of MDR-TB, and with half a million new, and mostly untreated, MDR-TB cases in the world each year, the stakes could not be higher. The World Health Organization (WHO), whose mandate is to champion the attainment by all peoples of the highest possible level of health, recommended unsound medical treatment for MDR-TB patients in resource-poor settings from 1993-2002. Citing cost considerations, WHO did not recommend the available standard of care that had been successfully used to contain and defeat MDR-TB in rich countries. By acting as a strategic gatekeeper in its technical advisory role to donor agencies and countries, it also facilitated the global implementation of a double standard for TB care in low- and middle-income countries (LMICs), upending important legal and scientific priorities. This raises serious questions about whether the organization violated international human rights standards and those established in its own constitution. While calling for additional analysis and discussion on this topic, the authors propose that policymakers should reject double standards of this kind and instead embrace the challenge of implementing the highest standard of care on a global level.

  11. Physician-initiated courtesy MODS testing for TB and MDR-TB diagnosis and patient management.

    Science.gov (United States)

    Nic Fhogartaigh, C J; Vargas-Prada, S; Huancaré, V; Lopez, S; Rodríguez, J; Moore, D A J

    2008-05-01

    Laboratorio de Investigación de Enfermedades Infecciosas, Universidad Peruana Cayetano Heredia (UPCH) and government health centres, Lima, Peru. To evaluate the contribution of unselected (courtesy) microscopic observation drug susceptibility (MODS) testing to the diagnosis and/or drug susceptibility testing (DST) of tuberculosis and their subsequent impact upon patient management. Retrospective database analysis and case note review of MODS culture-positive cases. Mycobacterium tuberculosis was isolated in 28.9% of 225 samples (209 patients); 22.2% of 63 positive cases were multidrug-resistant. In 58 MODS culture-positive cases with follow-up data available, MODS provided culture confirmation of diagnosis, DST or both in 82.8%, before any standard method. In 41.4%, this result should have prompted a modification in patient management. Delays between laboratory result and initiation or change of treatment, where applicable, took on average 42 and 64 days, respectively, of which a delay of respectively 17 and 48 days occurred after the receipt of results by the health facility. MODS provides important data for clinical management within a meaningful timeframe and should contribute positively to patient outcomes due to earlier initiation of appropriate therapy. Although clinicians may successfully select patients likely to benefit from MODS, ongoing work is required to identify optimal implementation of the assay and to reduce logistical and health system derived delays.

  12. Molecular epidemiology of TB – Its impact on multidrug-resistant tuberculosis control in China☆

    Directory of Open Access Journals (Sweden)

    Biao Xu

    2015-01-01

    Results: In total, 238 bacteriologic confirmed pulmonary TB patients from DQ and 393 from GY diagnosed between 2008 and 2011 were recruited in the study. Of the 631 isolates, 220 (34.9% were resistant to at least one anti-TB drug, including 95 (15.1% simultaneously resistant to isoniazid and rifampicin or MDR, albeit with the similar distribution between DQ and GY (32/238 vs. 63/393; p, 0.378. The MIRU-VNTR genotyping revealed 35 isolates from DQ and 86 from GY exhibited 15 and 32 clustering patterns with four patterns shared between two counties. Compared with GY county, DQ had a significantly lower clustering proportion in MTB isolates susceptible to first-line drugs (25/167 vs. 46/198; p, 0.047 and total drug resistant TB isolates (12/71 vs. 44/149; p, 0.044, but a similar clustering proportion in MDR-TB isolates (8/32 vs. 18/63; p, 0.712. A significant higher clustering proportion was observed in the previously treated patients in both counties, but in the sputum smear-positive patients with cavitaries only in GY. Comparing the previously treated patients between the two counties, the proportion of MDR-TB and clustering proportion exhibited a similar distribution, while the average age of previously treated patients in DQ is significantly older than that in GY. Conclusions: A lower proportion of recent transmissions was observed in the county with long-term DOTS implementation. However, DOTS itself might not have worked enough on blocking the recent transmission of MDR-TB. This observation suggests the urgent needs of implementing the Stop-TB strategies; in particular, accelerating the use of rapid molecularbasedTBdiagnosisand drug susceptibility testing, providing active case findings in a high risk population of MDR-TB and enhancing infection control in high MDR-TB burden countries.

  13. Team approach to manage difficult-to-treat TB cases: Experiences in Europe and beyond

    Directory of Open Access Journals (Sweden)

    L. D’Ambrosio

    2018-03-01

    Full Text Available As recommended by the World Health Organization (WHO, optimal management of MDR-TB cases can be ensured by a multi-speciality consultation body known as ‘TB Consilium’. This body usually includes different medical specialities, competences and perspectives (e.g., clinical expertise both for adults and children; surgical, radiological and public health expertise; psychological background and nursing experience, among others, thus lowering the risk of making mistakes – or managing the patients inappropriately, in order to improve their clinical outcomes.At present, several high MDR-TB burden countries in the different WHO regions (and beyond have introduced TB Consilium-like bodies at the national or subnational level to reach consensus on the best treatment approach for their patients affected by TB.In addition, in countries/settings where a formal system of consultation does not exist, specialized staff from MDR-TB reference centres or international organizations usually spend a considerable amount of their working time responding to phone or e-mail clinical queries on how to manage M/XDR-TB cases.The aim of this manuscript is to describe the different experiences with the TB Consilia both at the international level (European Respiratory Society – ERS/WHO TB Consilium and in some of the countries where this experience operates successfully in Europe and beyond. The Consilium experiences are described around the following topics: (1 history, aims and focus; (2 management and funding; (3 technical functioning and structure; (4 results achieved.In addition a comparative analysis of the TB Consilia in the different countries has been performed. Keywords: MDR-TB, XDR-TB, Clinical management, Drug resistance, Prevention, Consilium

  14. Cost-effectiveness of adding bedaquiline to drug regimens for the treatment of multidrug-resistant tuberculosis in the UK.

    Directory of Open Access Journals (Sweden)

    Lara J Wolfson

    Full Text Available To evaluate the cost-effectiveness of adding bedaquiline to a background regimen (BR of drugs for multidrug-resistant tuberculosis (MDR-TB in the United Kingdom (UK.A cohort-based Markov model was developed to estimate the incremental cost-effectiveness ratio of bedaquiline plus BR (BBR versus BR alone (BR in the treatment of MDR-TB, over a 10-year time horizon. A National Health Service (NHS and personal social services perspective was considered. Cost-effectiveness was evaluated in terms of Quality-Adjusted Life Years (QALYs and Disability-Adjusted Life Years (DALYs. Data were sourced from a phase II, placebo-controlled trial, NHS reference costs, and the literature; the US list price of bedaquiline was used and converted to pounds (£18,800. Costs and effectiveness were discounted at a rate of 3.5% per annum. Probabilistic and deterministic sensitivity analysis was conducted.The total discounted cost per patient (pp on BBR was £106,487, compared with £117,922 for BR. The total discounted QALYs pp were 5.16 for BBR and 4.01 for BR. The addition of bedaquiline to a BR resulted in a cost-saving of £11,434 and an additional 1.14 QALYs pp over a 10-year period, and is therefore considered to be the dominant (less costly and more effective strategy over BR. BBR remained dominant in the majority of sensitivity analyses, with a 81% probability of being dominant versus BR in the probabilistic analysis.In the UK, bedaquiline is likely to be cost-effective and cost-saving, compared with the current MDR-TB standard of care under a range of scenarios. Cost-savings over a 10-year period were realized from reductions in length of hospitalization, which offset the bedaquiline drug costs. The cost-benefit conclusions held after several sensitivity analyses, thus validating assumptions made, and suggesting that the results would hold even if the actual price of bedaquiline in the UK were higher than in the US.

  15. Priority-Setting for Novel Drug Regimens to Treat Tuberculosis: An Epidemiologic Model.

    Directory of Open Access Journals (Sweden)

    Emily A Kendall

    2017-01-01

    Full Text Available Novel drug regimens are needed for tuberculosis (TB treatment. New regimens aim to improve on characteristics such as duration, efficacy, and safety profile, but no single regimen is likely to be ideal in all respects. By linking these regimen characteristics to a novel regimen's ability to reduce TB incidence and mortality, we sought to prioritize regimen characteristics from a population-level perspective.We developed a dynamic transmission model of multi-strain TB epidemics in hypothetical populations reflective of the epidemiological situations in India (primary analysis, South Africa, the Philippines, and Brazil. We modeled the introduction of various novel rifampicin-susceptible (RS or rifampicin-resistant (RR TB regimens that differed on six characteristics, identified in consultation with a team of global experts: (1 efficacy, (2 duration, (3 ease of adherence, (4 medical contraindications, (5 barrier to resistance, and (6 baseline prevalence of resistance to the novel regimen. We compared scale-up of these regimens to a baseline reflective of continued standard of care. For our primary analysis situated in India, our model generated baseline TB incidence and mortality of 157 (95% uncertainty range [UR]: 113-187 and 16 (95% UR: 9-23 per 100,000 per year at the time of novel regimen introduction and RR TB incidence and mortality of 6 (95% UR: 4-10 and 0.6 (95% UR: 0.3-1.1 per 100,000 per year. An optimal RS TB regimen was projected to reduce 10-y TB incidence and mortality in the India-like scenario by 12% (95% UR: 6%-20% and 11% (95% UR: 6%-20%, respectively, compared to current-care projections. An optimal RR TB regimen reduced RR TB incidence by an estimated 32% (95% UR: 18%-46% and RR TB mortality by 30% (95% UR: 18%-44%. Efficacy was the greatest determinant of impact; compared to a novel regimen meeting all minimal targets only, increasing RS TB treatment efficacy from 94% to 99% reduced TB mortality by 6% (95% UR: 1%-13%, half the

  16. Efficacy of moxifloxacin & econazole against multidrug resistant (MDR Mycobacterium tuberculosis in murine model

    Directory of Open Access Journals (Sweden)

    U D Gupta

    2015-01-01

    Full Text Available Background & objectives: Studies have shown the bactericidal potential of econazole and clotrimazole against Mycobacterium tuberculosis under in vitro and ex vivo conditions along with their synergism with conventional antituberculosis drugs. These molecules were also found to be effective against different multidrug resistant (MDR M. tuberculosis isolates in vitro. Hence the present study was designed to evaluate the in vivo antimycobacterial potential of moxifloxacin and econazole alone and in combination against multidrug resistant tuberculosis (MDR-TB in a mice model. Methods: Mice were infected with 2.5×10 [7] bacilli of MDR strain of M. tuberculosis by aerosol route of infection. After four weeks of infection, chemotherapy was started orally by moxifloxacin 8.0 mg/kg body wt and econazole 3.3 mg/kg alone and in combination, as well as with four first line anti-tuberculosis drugs as a positive control. The animals were sacrificed and the lungs and spleen were excised under aspetic conditions. The tissues were homogenized with sterile normal saline, an aliquot of the homogenate was plated on Middlebrook 7H11 agar supplemented with oleate albumin dextrose catalase (OADC and incubated at 37°C for four weeks. The number of visible and individual colonies were counted. Results: The first line anti-tuberculosis drugs (RIF+INH+EMB+PZA after eight weeks of therapy had no impact as the bacillary load in lungs and spleens remained unchanged. However, econazole, moxifloxacin alone as well as in combination significantly reduced the bacillary load in lungs as well as in spleens of MDR-TB bacilli infected mice. Interpretation & conclusions: Co-administration of the two drugs (econazole and moxifloxacin to MDR-TB strain JAL-7782 infected mice exhibited additive effect, the efficacy of the drugs in combination being higher as compared with ECZ or MOX alone. These results were substantiated by histopathological studies. This study suggests the utility of

  17. Treatment: Latent TB Infection (LTBI) and TB Disease

    Science.gov (United States)

    ... Adverse Events TB Treatment of Persons Living with HIV TB Treatment and Pregnancy TB Treatment for Children Drug-Resistant TB Research TB Epidemiologic Studies Consortium Research Projects Publications TB Trials Consortium Study ...

  18. The Impact of a Line Probe Assay Based Diagnostic Algorithm on Time to Treatment Initiation and Treatment Outcomes for Multidrug Resistant TB Patients in Arkhangelsk Region, Russia.

    Science.gov (United States)

    Eliseev, Platon; Balantcev, Grigory; Nikishova, Elena; Gaida, Anastasia; Bogdanova, Elena; Enarson, Donald; Ornstein, Tara; Detjen, Anne; Dacombe, Russell; Gospodarevskaya, Elena; Phillips, Patrick P J; Mann, Gillian; Squire, Stephen Bertel; Mariandyshev, Andrei

    2016-01-01

    In the Arkhangelsk region of Northern Russia, multidrug-resistant (MDR) tuberculosis (TB) rates in new cases are amongst the highest in the world. In 2014, MDR-TB rates reached 31.7% among new cases and 56.9% among retreatment cases. The development of new diagnostic tools allows for faster detection of both TB and MDR-TB and should lead to reduced transmission by earlier initiation of anti-TB therapy. The PROVE-IT (Policy Relevant Outcomes from Validating Evidence on Impact) Russia study aimed to assess the impact of the implementation of line probe assay (LPA) as part of an LPA-based diagnostic algorithm for patients with presumptive MDR-TB focusing on time to treatment initiation with time from first-care seeking visit to the initiation of MDR-TB treatment rather than diagnostic accuracy as the primary outcome, and to assess treatment outcomes. We hypothesized that the implementation of LPA would result in faster time to treatment initiation and better treatment outcomes. A culture-based diagnostic algorithm used prior to LPA implementation was compared to an LPA-based algorithm that replaced BacTAlert and Löwenstein Jensen (LJ) for drug sensitivity testing. A total of 295 MDR-TB patients were included in the study, 163 diagnosed with the culture-based algorithm, 132 with the LPA-based algorithm. Among smear positive patients, the implementation of the LPA-based algorithm was associated with a median decrease in time to MDR-TB treatment initiation of 50 and 66 days compared to the culture-based algorithm (BacTAlert and LJ respectively, ptime to MDR-TB treatment initiation of 78 days when compared to the culture-based algorithm (LJ, ptime to MDR diagnosis and earlier treatment initiation as well as better treatment outcomes for patients with MDR-TB. These findings also highlight the need for further improvements within the health system to reduce both patient and diagnostic delays to truly optimize the impact of new, rapid diagnostics.

  19. New Treatment Regimen for Latent Tuberculosis Infection

    Centers for Disease Control (CDC) Podcasts

    2012-03-15

    In this podcast, Dr. Kenneth Castro, Director of the Division of Tuberculosis Elimination, discusses the December 9, 2011 CDC guidelines for the use of a new regimen for the treatment of persons with latent tuberculosis infection.  Created: 3/15/2012 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 3/15/2012.

  20. Access to and affordability of healthcare for TB patients in China: issues and challenges.

    Science.gov (United States)

    Tang, Shenglan; Wang, Lixia; Wang, Hong; Chin, Daniel P

    2016-01-29

    This paper introduces the background, aim and objectives of the project entitled "China-the Gates Foundation Collaboration on TB Control in China" that has been underway for many years. It also summarizes the key findings of the nine papers included in this special issue, which used data from the baseline survey of Phase II of the project. Data were collected from the survey of TB and MDR-TB patients, from designated hospitals, health insurance agencies and the routine health information systems, as well as key informant interviews and focus group discussions with relevant key stakeholders. Key issues discussed in this series of papers include the uses of TB services and anti-TB medicines and their determining factors related to socio-economic and health systems development; expenditures on TB care and the financial burden incurred on TB patients; and the impact of health insurance schemes implemented in China on financial protection.

  1. Tuberculosis Facts - Exposure to TB

    Science.gov (United States)

    Tuberculosis (TB) Facts Exposure to TB What is TB? “TB” is short for a disease called tuberculosis. TB is spread through the air from one ... Viral Hepatitis, STD, and TB Prevention Division of Tuberculosis Elimination

  2. Tuberculosis Facts - Testing for TB

    Science.gov (United States)

    Tuberculosis (TB) Facts Testing for TB What is TB? “TB” is short for a disease called tuberculosis. TB is spread through the air from one ... Viral Hepatitis, STD, and TB Prevention Division of Tuberculosis Elimination

  3. Treatment outcomes of rifabutin-containing regimens for rifabutin-sensitive multidrug-resistant pulmonary tuberculosis

    Directory of Open Access Journals (Sweden)

    Hyun Lee

    2017-12-01

    Full Text Available Objectives: The aim of this study was to evaluate whether rifabutin can improve treatment outcomes in patients with rifabutin-sensitive MDR-TB. Methods: A retrospective cohort study was performed on 76 patients with rifabutin-sensitive MDR-TB who were treated with or without rifabutin between 2006 and 2011. Results: Overall, 75% (57/76 of patients achieved favorable outcomes, including cure (53/76, 70% and treatment completion (4/76, 5%. In contrast, 25% (19/76 had unfavorable treatment outcomes, which included treatment failure (6/76, 8%, death (2/76, 3%, loss to follow-up (4/76. 5%, and no evaluation due to transfer to other institutions (7/76, 9%. Rifabutin was given to 52 (68% of the 76 patients with rifabutin-sensitive MDR-TB. Although favorable treatment outcomes were more frequent in patients who received rifabutin [81% (42/52] than in those who did not receive rifabutin [63% (15/24], this difference was not statistically significant (P = 0.154. However, in multivariable regression logistic analysis, use of rifabutin was significantly associated with favorable treatment outcomes in patients with rifabutin-sensitive MDR-TB (adjusted odds ratio = 9.80, 95% confidence interval = 1.65–58.37, P = 0.012. Conclusions: These results suggest that the use of rifabutin can improve treatment outcomes in patients with rifabutin-sensitive MDR-TB. Keywords: Multidrug-resistant tuberculosis, Extensively drug-resistant tuberculosis, Rifabutin, Treatment outcome

  4. Find TB. Treat TB. Working together to eliminate TB.

    Centers for Disease Control (CDC) Podcasts

    2014-02-26

    In this podcast, Dr. Sundari Mase, Medical Team Lead in the Field Services and Evaluation Branch in the Division of Tuberculosis Elimination, discusses World TB Day and the 2014 theme.  Created: 2/26/2014 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 2/26/2014.

  5. Resistance to fluoroquinolones and second-line injectable drugs: impact on multidrug-resistant TB outcomes

    NARCIS (Netherlands)

    Falzon, Dennis; Gandhi, Neel; Migliori, Giovanni B.; Sotgiu, Giovanni; Cox, Helen S.; Holtz, Timothy H.; Hollm-Delgado, Maria-Graciela; Keshavjee, Salmaan; Deriemer, Kathryn; Centis, Rosella; D'Ambrosio, Lia; Lange, Christoph G.; Bauer, Melissa; Menzies, Dick; Ahuja, S. D.; Ashkin, D.; Avendaño, M.; Banerjee, R.; Bauer, M.; Becerra, M. C.; Benedetti, A.; Burgos, M.; Centis, R.; Chan, E. D.; Chiang, C. Y.; Cobelens, F.; Cox, H.; D'Ambrosio, L.; de Lange, W. C. M.; DeRiemer, K.; Enarson, D.; Falzon, D.; Flanagan, K. L.; Flood, J.; Gandhi, N.; Garcia-Garcia, M. L.; Granich, R. M.; Hollm-Delgado, M. G.; Holtz, T. H.; Hopewell, P.; Iseman, M. D.; Jarlsberg, L. G.; Keshavjee, S.; Kim, H. R.; Koh, W. J.; Lancaster, J. L.; Lange, C.; Leimane, V.; Leung, C. C.; Li, J.

    2013-01-01

    A meta-analysis for response to treatment was undertaken using individual data of multidrug-resistant tuberculosis (MDR-TB) (resistance to isoniazid and rifampicin) patients from 26 centres. The analysis assessed the impact of additional resistance to fluoroquinolones and/or second-line injectable

  6. Mycobacteria and TB

    National Research Council Canada - National Science Library

    Kaufmann, S. H. E. (Stephan H. E.); Hahn, Helmut

    2003-01-01

    .... Scientists investigating the epidemiology, immunology and molecular biology of TB or engaged in vaccine and drug development as well as physicians and social workers treating TB patients will benefit...

  7. Mechanisms of antibiotic resistance in Mycobacterium tuberculosis, validation of methods BACTECTM MGIT 960 and AnyplexM TII MTB / MDR / XDR Detection for detection of antibiotic resistance to first and second line in Mycobacterium tuberculosis strains

    International Nuclear Information System (INIS)

    Centeno Urena, Yadel

    2014-01-01

    A literature review is developed of drug-resistant TB in the world and in Costa Rica. The mechanisms of resistance to antibiotics are studied of the bacterium that causes tuberculosis; drug resistance to first-line and second-line, treatment regimen according to the World Health Organization and edge detection methods available in the market. The agreement between the results is studied by the phenotypic detection system of resistance of M. tuberculosis BACTEC MGIT960 and PCR, in real-time of commercial kit Anyplex II MTB/MDR/XDR, for genotypic identification of M. tuberculosis and related mutations to resistance with the referring results to thirty strains provided by the Pan American Health Organization, allowing a significant shortening in the time of obtaining reliable results. The results obtained have allowed to suggest a possible implementation at the Centro Nacional de Referencia en Micobacteriologia (CNRM), to perform antibiotic susceptibility testing and genotypic testing of multidrug cases respectively. The study results have allowed the implementation of the technology of genotypic detection of M. tuberculosis in the CNRM, obtaining for the first time in Costa Rica, information about genes of M. tuberculosis related to the generation of resistance to the major drugs of Primary treatment scheme as well as testing of resistance to second-line drug for resistant strains referred to the Centro Nacional de Referencia en Micobacteriologia in 2013. (author) [es

  8. Major challenges in clinical management of TB/HIV co-infected patients in Eastern Europe compared with Western Europe and Latin America

    DEFF Research Database (Denmark)

    Efsen, Anne Marie; Schultze, Anna; Post, Frank

    2014-01-01

    identified in logistic regression models. RESULTS: Significant differences were observed between EE (n=844), WE (n=152), SE (n=164) and LA (n=253) for use of combination antiretroviral therapy (cART) at TB diagnosis (17%, 40%, 44% and 35%, pdefinite TB diagnosis (culture and/or PCR positive......, Isoniazid, Pyrazinamide, Ethambutol (RHZE)], the corresponding proportions would have been 64% vs. 86-97%, respectively (Figure 1b). CONCLUSIONS: In EE, TB/HIV patients had poorer exposure to cART, less often a definitive TB diagnosis and more often MDR-TB compared to other parts of Europe and LA. Initial...

  9. Personalized Medicine Digoxin Theraphy in Individuals with MDR Gene Polymorphism

    Directory of Open Access Journals (Sweden)

    Em Sutrisna

    2015-06-01

    Full Text Available Digoxin is one of digitalis drugs. Wider applicability to heart failure and arrhythmias (supraventricular requires fairly strict scrutiny because of its narrow therapeutic index. Digoxin is a substrate of P-glycoprotein (P-gp encoded by multi drugs resistance-1 (MDR1. MDR-1 gen located on chromosome 7q21.1. This gene contains 28 exons that encoded a protein of 1280 amino acids. This gene plays an important role in the absorption, distribution and elimination of many drugs. MDR1C3435T polymorphism occurs in exon 26. There are three types of MDR1C3435T gene namely MDR1C3435T CC, MDR1C3435T CT and MDR1C3435T TT. These polymorphisms will affect to the formation of P-gp and consequently to change the kinetic profile of digoxin. The change of kinetic profile causes changes in the digoxin blood levels. The method used in this review is data search based on pubmed, medline, and embase with keywords MDR and digoxin. There are several different studies of the influence of polymorphisms MDR1C3435T on blood digoxin levels. Increased levels of digoxin in the blood due to polymorphism of MDR1C3435T will be at risk of digitalis intoxication. Long-term digoxin treatment or large dose should consider the patient’s genetic profile. Distribution of polymorphism of MDR1C3435T in Javanese population is approximately TT (0,10, CT (0,52, and CC(0, 38.

  10. Classifying insulin regimens

    DEFF Research Database (Denmark)

    Neu, A; Lange, K; Barrett, T

    2015-01-01

    Modern insulin regimens for the treatment of type 1 diabetes are highly individualized. The concept of an individually tailored medicine accounts for a broad variety of different insulin regimens applied. Despite clear recommendations for insulin management in children and adolescents with type 1...

  11. MDR1 P-glycoprotein transports endogenous opioid peptides

    NARCIS (Netherlands)

    Oude Elferink, R. P.; Zadina, J.

    2001-01-01

    MDR1 P-glycoprotein is generally regarded as an efflux pump for amphipathic toxic compounds. The question remains, however, whether certain endogenous compounds are also substrates for this transporter. Certain peptides have been shown to interact with MDR1 Pgp as well and we have therefore

  12. Mdr65 decreases toxicity of multiple insecticides in Drosophila melanogaster.

    Science.gov (United States)

    Sun, Haina; Buchon, Nicolas; Scott, Jeffrey G

    2017-10-01

    ABC transporters are ubiquitous membrane-bound proteins, present in both prokaryotes and eukaryotes. The major function of eukaryotic ABC transporters is to mediate the efflux of a variety of substrates (including xenobiotics) out of cells. ABC transporters have been widely investigated in humans, particularly for their involvement in multidrug resistance (MDR). Considerably less is known about their roles in transport and/or excretion in insects. ABC transporters are only known to function as exporters in insects. Drosophila melanogaster has 56 ABC transporter genes, including eight which are phylogenetically most similar to the human Mdr genes (ABCB1 clade). We investigated the role of ABC transporters in the ABCB1 clade in modulating the susceptibility to insecticides. We took advantage of the GAL4/UAS system in D. melanogaster to knockdown the expression levels of Mdr65, Mdr50, Mdr49 and ABCB6 using transgenic UAS-RNAi lines and conditional driver lines. The most notable effects were increased sensitivities to nine different insecticides by silencing of Mdr65. Furthermore, a null mutation of Mdr65 decreased the malathion, malaoxon and fipronil LC 50 values by a factor of 1.9, 2.1 and 3.9, respectively. Altogether, this data demonstrates the critical role of ABC transporters, particularly Mdr65, in altering the toxicity of specific, structurally diverse, insecticides in D. melanogaster. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. The Impact and Cost-Effectiveness of a Four-Month Regimen for First-Line Treatment of Active Tuberculosis in South Africa.

    Directory of Open Access Journals (Sweden)

    Gwenan M Knight

    Full Text Available A 4-month first-line treatment regimen for tuberculosis disease (TB is expected to have a direct impact on patient outcomes and societal costs, as well as an indirect impact on Mycobacterium tuberculosis transmission. We aimed to estimate this combined impact in a high TB-burden country: South Africa.An individual based M. tb transmission model was fitted to the TB burden of South Africa using a standard TB natural history framework. We measured the impact on TB burden from 2015-2035 of introduction of a non-inferior 4-month regimen replacing the standard 6-month regimen as first-line therapy. Impact was measured with respect to three separate baselines (Guidelines, Policy and Current, reflecting differences in adherence to TB and HIV treatment guidelines. Further scenario analyses considered the variation in treatment-related parameters and resistance levels. Impact was measured in terms of differences in TB burden and Disability Adjusted Life Years (DALYs averted. We also examined the highest cost at which the new regimen would be cost-effective for several willingness-to-pay thresholds.It was estimated that a 4-month regimen would avert less than 1% of the predicted 6 million person years with TB disease in South Africa between 2015 and 2035. A similarly small impact was seen on deaths and DALYs averted. Despite this small impact, with the health systems and patient cost savings from regimen shortening, the 4-month regimen could be cost-effective at $436 [NA, 5983] (mean [range] per month at a willingness-to-pay threshold of one GDP per capita ($6,618.The introduction of a non-inferior 4-month first-line TB regimen into South Africa would have little impact on the TB burden. However, under several scenarios, it is likely that the averted societal costs would make such a regimen cost-effective in South Africa.

  14. Drug Susceptibility of Mycobacterium tuberculosis Beijing Genotype and Association with MDR TB

    Science.gov (United States)

    ten Kate, Marian T.; de Knegt, Gerjo J.; Kremer, Kristin; Aarnoutse, Rob E.; Boeree, Martin J.; Verbrugh, Henri A.; van Soolingen, Dick; Bakker-Woudenberg, Irma A.J.M.

    2012-01-01

    To determine differences in the ability of Mycobacterium tuberculosis strains to withstand antituberculosis drug treatment, we compared the activity of antituberculosis drugs against susceptible Beijing and East-African/Indian genotype M. tuberculosis strains. Beijing genotype strains showed high rates of mutation within a wide range of drug concentrations, possibly explaining this genotype’s association with multidrug-resistant tuberculosis. PMID:22469099

  15. Silencage du gene MDR1 et resensibilisation des cellules MCF-7 MDR a la doxorubicine en utilisant les nanoparticules chitosane/MDR1-siARN

    Science.gov (United States)

    El-Ariss, Mohamad

    Cancer is the leading cause of death in Canada and is responsible for about 30% of all deaths in the country.[1] It is estimated that by 2015, one in four Canadians (24% women and 29% men) will die from cancer. In the world and only for 2012, 14 million new cancer cases and 8.2 million deaths from the disease were reported.[2] The worst is yet to come because, according to World Health Organization, the number of new cases is expected to increase by about 70% over the next two decades. The high mortality associated with cancer is partly explained by the acquisition of drug resistance that make patients refractory to chemotherapy. In fact, cancer cells exposed to a cytotoxic agent during chemotherapy, may develop a resistance to this agent as well as various agents sharing structural or functional similarities. These cancer cells are known for multidrug resistance ("Multiple Drug resistant cells"). The development of resistance to chimiodrogues is a major public health problem that presents an obstacle for the development of new cancer treatments. MCF-7 MDR are established cell lines of human breast cancer that have developed resistance to chimiodrogues such as doxorubicin. MCF-7 MDR have the particularity to over-express P-gp protein that is responsible for the detoxification of cells by reflux of chimiodrogues. The purpose of this study was therefore to reduce the expression of P-gp, encoded by the MDR1 gene (also called gene ABCB1) in cancer cells MCF-7, and re-sensitize MCF-7 MDR cells to anti-cancer treatments. In order to modify MDR1 gene expression, we used small RNAi called siRNA that are specific to the MDR1 gene. In total, 4 duplexes of siRNA have been used: siRNA_1, siRNA_1M, siRNA_2 and siRNA_2M. Each of the duplexes strands is consists of 21 nucleic acids and has two protruding nucleic acids (overhangs) at the 3' end. siRNA_1 and siRNA_1M are complementary to the nucleic acid sequence (577-595 nucleic acids ) of the MDR1 gene, whereas siARN_2 and si

  16. Questions and Answers about TB

    Science.gov (United States)

    ... disease. Introduction Testing and Treatment TB Disease Glossary Introduction Introduction What is TB? Why is TB still ... chest x-ray is made by exposing a film to x-rays that pass through the chest. ...

  17. TB in Captive Elephants

    Centers for Disease Control (CDC) Podcasts

    2017-04-27

    Dr. Barry Kreiswirth, founding director of the Public Health Research Institute, TB Center, at Rutgers University, discusses TB in three captive elephants.  Created: 4/27/2017 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 4/27/2017.

  18. Isolation, Characterization and Anti-Multiple Drug Resistant (MDR ...

    African Journals Online (AJOL)

    (MDR) Bacterial Activity of Endophytic Fungi Isolated from ... Institute of Protection & Development of Beibu Wan Ocean Resources, Qinzhou University, Qinzhou, Guangxi Province, ..... isolated from secondary metabolites of the mangrove.

  19. Experience with LDR and MDR brachytherapy for cervical cancer

    International Nuclear Information System (INIS)

    Okawa, Tomohiko; Okawa, Midori-Kita; Kaneyasu, Yuko; Karasawa, Kumiko; Fukuhara, Noboru

    1996-01-01

    As the brachytherapy dose-rate increases, it is necessary to reduce the total dose or to increase the fraction number with reducing the fraction dose in order not to increase the incidence of the late effect. With the introduction to the Tokyo Women's Medical College, Hospital of a remote afterloading system of Selectron - MDR, delivering dose-rate to point A became approximately twice of that with our classical cesium LDR manual afterloading technique. Material and Methods: Between 1987 to 1993 a total of, previously untreated 74 patients with cervical cancer received MDR brachytherapy using a Selection - MDR. This analysis is therefore of those patients series who underwent radical radioradiotherapy with MDR, 1987-1993, in comparison with the 347 cases who were treated with classical manual LDR afterloading machine, 1969-1986. The treatment was a brachytherapy during external radiotherapy and dos-rate at point A was 160-180 cGy/hour with MDR and 80-90 cGy/hour with LDR. The mean fraction dose was 800-1000 cGy by MDR and 1000-1200 cGy by LDR and fraction number was increased 1-2times in the MDR group with no change of a total dose at point A. Results: The mean age was 63.3 years in the MDR group and 60.2 in the LDR group. In the MDR group, 4 patients were at stage I, 16 stage II, 32 stage III, and 22 stage IV. In the LDR group, 32 were at stage I, 83 stage II, 183 stage III, and 49 stage IV. The medical rate was not significantly different between two groups. The tumor response by manual examination one month after radiotherapy showed no significant difference. The 5-year survival rate for the MDR and LDR groups were 100% : 78% at stage I, 61% : 71% at stage II and 52% : 53% at stage III, with no significant differences. Late complications by severity with grade II-III according to Kottureire's classification were not significantly different in the rectum or bladder. These results suggested that MDR brachytherapy was useful for the patients' QOL as it reduced the

  20. Time to initiation of multidrug-resistant tuberculosis treatment and its relation with outcome in a high incidence district in Lima, Peru.

    Science.gov (United States)

    Otero, L; De Orbegoso, A; Navarro, A F; Ríos, J; Párraga, T; Gotuzzo, E; Seas, C; Van der Stuyft, P

    2015-03-01

    To determine the time from diagnosis to start of multidrug resistant tuberculosis (MDR TB) treatment in Lima, Peru. We studied new smear-positive TB adults that were started on MDR TB treatment or that were switched to it between June 2008 and December 2011. Time from the first positive smear to MDR-TB treatment was >30 days in 35% (13/37) of patients. Among the 27% (24/88) of patients that switched to MDR-TB treatment, time from the last dose of a drug-susceptible regimen was >30 days. Start of and switching to MDR TB treatment is still delayed. © 2014 John Wiley & Sons Ltd.

  1. Tuberculosis Facts - TB and HIV/AIDS

    Science.gov (United States)

    Tuberculosis (TB) Facts TB and HIV/AIDS What is TB? “TB” is short for a disease called tuberculosis. TB is spread through the air from one ... Viral Hepatitis, STD, and TB Prevention Division of Tuberculosis Elimination

  2. Comparison of the pharmacokinetics of two dosage regimens of linezolid in multidrug-resistant and extensively drug-resistant tuberculosis patients.

    NARCIS (Netherlands)

    Alffenaar, J.W.C.; Altena, R. van; Harmelink, I.M.; Filguera, P.; Molenaar, E.; Wessels, A.M.; Soolingen, D. van; Kosterink, J.G.W.; Uges, D.R.A.; Werf, T.S. van der

    2010-01-01

    BACKGROUND AND OBJECTIVES: For the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis (TB), potent new drugs are urgently needed. Linezolid is a promising drug, but its use is limited by adverse effects with prolonged administration of 600 mg twice daily. In

  3. Comparison of the Pharmacokinetics of Two Dosage Regimens of Linezolid in Multidrug-Resistant and Extensively Drug-Resistant Tuberculosis Patients

    NARCIS (Netherlands)

    Alffenaar, Jan-Willem C.; van Altena, Richard; Harmelink, Ilse M.; Filguera, Patricia; Molenaar, Esther; Wessels, A. Mireille A.; van Soolingen, Dick; Kosterink, Jos G. W.; Uges, Donald R. A.; van der Werf, Tjip S.

    2010-01-01

    Background and Objectives: For the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis (TB), potent new drugs are urgently needed. Linezolid is a promising drug, but its use is limited by adverse effects with prolonged administration of 600 mg twice daily. In

  4. HIV and Tuberculosis (TB)

    Science.gov (United States)

    ... AIDS Drugs Clinical Trials Apps skip to content HIV and Opportunistic Infections, Coinfections, and Conditions Home Understanding ... 4 p.m. ET) Send us an email HIV and Tuberculosis (TB) Last Reviewed: June 14, 2018 ...

  5. Tuberculosis (TB): Treatment

    Science.gov (United States)

    ... Education & Training Home Conditions Tuberculosis (TB) Tuberculosis: Treatment Tuberculosis: Treatment Make an Appointment Refer a Patient Ask ... or bones is treated longer. NEXT: Preventive Treatment Tuberculosis: Diagnosis Tuberculosis: History Clinical Trials For more than ...

  6. Convergence of a diabetes mellitus, protein energy malnutrition, and TB epidemic: the neglected elderly population.

    Science.gov (United States)

    Menon, Sonia; Rossi, Rodolfo; Nshimyumukiza, Leon; Wusiman, Aibibula; Zdraveska, Natasha; Eldin, Manal Shams

    2016-07-26

    On a global scale, nearly two billion persons are infected with Mycobacterium tuberculosis. From this vast reservoir of latent tuberculosis (TB) infection, a substantial number will develop active TB during their lifetime, with some being able to transmit TB or Multi-drug- resistant (MDR) TB to others. There is clinical evidence pointing to a higher prevalence of infectious diseases including TB among individuals with Diabetes Mellitus (DM). Furthermore, ageing and diabetes mellitus may further aggravate protein-energy malnutrition (PEM), which in turn impairs T-lymphocyte mediated immunologic defenses, thereby increasing the risk of developing active TB and compromising TB treatment. This article aims to a) highlight synergistic mechanisms associated with immunosenescence, DM and PEM in relation to the development of active TB and b) identify nutritional, clinical and epidemiological research gaps. To explore the synergistic relationship between ageing, DM, tuberculosis and PEM, a comprehensive review was undertaken. The MEDLINE and the Google Scholar databases were searched for articles published from 1990 to March 2015, using different MESH keywords in various combinations. Ageing and DM act synergistically to reduce levels of interferon gamma (IFN- γ), thereby increasing susceptibility to TB, for which cell mediated immunity (CMI) plays an instrumental role. These processes can set in motion a vicious nutritional cycle which can predispose to PEM, further impairing the CMI and consequently limiting host defenses. This ultimately transforms the latent TB infection into active disease. A clinical diagnostic algorithm and clinical guidelines need to be established for this population. Given the increase in ageing population with DM and PEM, especially in resource-poor settings, these synergistic tripartite interactions must be examined if a burgeoning TB epidemic is to be averted. Implementation of a comprehensive, all-encompassing approach to curb transmission

  7. Tuberculosis Facts - You Can Prevent TB

    Science.gov (United States)

    Tuberculosis (TB) Facts You Can Prevent TB What is TB? “TB” is short for a disease called tuberculosis. TB is spread through the air from one ... Viral Hepatitis, STD, and TB Prevention Division of Tuberculosis Elimination TB Facts: You Can Prevent TB What ...

  8. Tuberculosis Facts - TB Can Be Treated

    Science.gov (United States)

    Tuberculosis (TB) Facts TB Can Be Treated What is TB? “TB” is short for a disease called tuberculosis. TB is spread through the air from one ... Viral Hepatitis, STD, and TB Prevention Division of Tuberculosis Elimination Page 1 of 2 TB Facts: TB ...

  9. Direct Application of the INNO-LiPA Rif.TB Line-Probe Assay for Rapid Identification of Mycobacterium tuberculosis Complex Strains and Detection of Rifampin Resistance in 360 Smear-Positive Respiratory Specimens from an Area of High Incidence of Multidrug-Resistant Tuberculosis

    Science.gov (United States)

    Viveiros, Miguel; Leandro, Clara; Rodrigues, Liliana; Almeida, Josefina; Bettencourt, Rosário; Couto, Isabel; Carrilho, Lurdes; Diogo, José; Fonseca, Ana; Lito, Luís; Lopes, João; Pacheco, Teresa; Pessanha, Mariana; Quirim, Judite; Sancho, Luísa; Salfinger, Max; Amaral, Leonard

    2005-01-01

    The INNO-LiPA Rif.TB assay for the identification of Mycobacterium tuberculosis complex strains and the detection of rifampin (RIF) resistance has been evaluated with 360 smear-positive respiratory specimens from an area of high incidence of multidrug-resistant tuberculosis (MDR-TB). The sensitivity when compared to conventional identification/culture methods was 82.2%, and the specificity was 66.7%; the sensitivity and specificity were 100.0% and 96.9%, respectively, for the detection of RIF resistance. This assay has the potential to provide rapid information that is essential for the effective management of MDR-TB. PMID:16145166

  10. Normal viability and altered pharmacokinetics in mice lacking mdr1-type (drug-transporting) P-glycoproteins

    NARCIS (Netherlands)

    Schinkel, A. H.; Mayer, U.; Wagenaar, E.; Mol, C. A.; van Deemter, L.; Smit, J. J.; van der Valk, M. A.; Voordouw, A. C.; Spits, H.; van Tellingen, O.; Zijlmans, J. M.; Fibbe, W. E.; Borst, P.

    1997-01-01

    The mdr1-type P-glycoproteins (P-gps) confer multidrug resistance to cancer cells by active extrusion of a wide range of drugs from the cell. To study their physiological roles, we have generated mice genetically deficient in the mdr1b gene [mdr1b (-/-) mice] and in both the mdr1a and mdr1b genes

  11. Analysis of mdr1-1Δ mutation of MDR1 gene in the “Cimarron Uruguayo” dog

    Directory of Open Access Journals (Sweden)

    Rosa Gagliardi B.

    2013-08-01

    Full Text Available Objective. The aim of this paper is to analyze the frequency of the mdr1-1D mutation of the MDR1 gene in a dog sample of the Uruguayan Cimarron breed with the objective of increasing the knowledge of this breed’s genome. Materials and methods. Thirty-six animals of this breed were analyzed. The MDR1 gene region, which includes the location where the mutation would be present, was amplified by PCR. Results. The mutation was not detected in any of the analyzed Uruguayan Cimarron. Conclusions. The lack of described ivermectin intoxication cases in veterinary clinic in this breed is explained by the lack of the mutation object of this study. The sequence studied in Cimarron dogs is kept compared to other breeds, except Collies and related breeds (Border Collie, Bearded Collie, Old English sheepdog.

  12. Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction

    International Nuclear Information System (INIS)

    Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B.; Wunder, J.S.; Andrulis, I.L.; Gazdar, A.F.; Willman, C.L.; Griffith, B.; Von Hoff, D.D.

    1990-01-01

    The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy

  13. Role of MRP-1 and GST-Pi in MDR and their inhibition by ...

    African Journals Online (AJOL)

    Samia A. Ebeed

    2016-08-16

    Aug 16, 2016 ... Various mechanisms were proposed that underlie MDR in malignant cells. ... the gene that confers MDR in lung cancer cells. MRP1 acts in order to protect ... the many physiological and pathophysiological processes influ-.

  14. Specificity of drug transport mediated by CaMDR1: a major facilitator ...

    Indian Academy of Sciences (India)

    Unknown

    CaMDR1 encodes a major facilitator superfamily (MFS) protein in Candida albicans whose expression has been linked to .... by plaque assay and the integration of CaMDR1 at the ... with recombinant virus, vAcCaMDR1 and cells infected.

  15. Second and third responses to the same induction regimen in relapsing patients with multiple myeloma.

    Science.gov (United States)

    Paccagnella, A; Chiarion-Sileni, V; Soesan, M; Baggio, G; Bolzonella, S; De Besi, P; Casara, D; Frizzarin, M; Salvagno, L; Favaretto, A

    1991-09-01

    From September 1975 to December 1986, 115 consecutive previously untreated patients with multiple myeloma (MM) were treated with combination chemotherapy consisting of BCNU, cyclophosphamide, melphalan, vincristine, and prednisone (M-2). No patients were excluded or lost during follow-up. Forty-three percent of the patients were Stage I plus II, and 57% were Stage III. Thirty-eight patients (33%) had blood urea nitrogen greater than or equal to 40 mg/dl (substage B). Reaching an objective response treatment was stopped, generally after 1 year, and restarted at relapse. After induction therapy, 94 patients (82%) responded and had a median duration of response (MDR) of 22 months. After first relapse, 26 of 38 patients (69%) responded again to the same regimen and had an MDR of 11 months. This response rate and MDR are significantly lower than the ones achieved in induction chemotherapy. After second relapse, 7 of 16 patients (44%) again responded with an MDR of 3.5 months. The median survival time (MST) was 50.5 months for all patients. The most relevant side effect was leukopenia. No case of secondary leukemia was noticed. The authors conclude that patients with MM can be treated safely without maintenance therapy after reaching remission because a high response rate can be obtained in first and even second relapse. The planned treatment pause at remission does not adversely affect the survival time. Secondary leukemia is infrequent after this policy. Quality of life improves during the treatment pause.

  16. TB or not TB?: a case of isolated testicular TB with scrotal involvement.

    LENUS (Irish Health Repository)

    Bhargava, A

    2009-06-01

    Despite the genitourinary tract being the most common site affected by extrapulmonary TB, isolated testicular TB remains a rare clinical entity. In patients with co-morbidities such as hepatic impairment, treatment proves a challenge, as first-line hepatotoxic pharmaceuticals are contraindicated. Here, we report a case of isolated testicular TB with scrotal involvement, on a background of hepatic dysfunction.

  17. Understanding Market Size and Reporting Gaps for Paediatric TB in Indonesia, Nigeria and Pakistan: Supporting Improved Treatment of Childhood TB in the Advent of New Medicines.

    Science.gov (United States)

    Coghlan, Renia; Gardiner, Elizabeth; Amanullah, Farhana; Ihekweazu, Chikwe; Triasih, Rina; Grzemska, Malgorzata; Sismanidis, Charalambos

    2015-01-01

    We sought to understand gaps in reporting childhood TB cases among public and private sector health facilities (dubbed "non-NTP" facilities) outside the network of national TB control programmes, and the resulting impact of under-reporting on estimates of paediatric disease burden and market demand for new medicines. Exploratory assessments were carried out in Indonesia, Nigeria and Pakistan, reaching a range of facility types in two selected areas of each country. Record reviews and interviews of healthcare providers were carried out to assess numbers of unreported paediatric TB cases, diagnostic pathways followed and treatment regimens prescribed. A total of 985 unreported diagnosed paediatric TB cases were identified over a three month period in 2013 in Indonesia from 64 facilities, 463 in Pakistan from 35 facilities and 24 in Nigeria from 20 facilities. These represent an absolute additional annualised yield to 2013 notifications reported to WHO of 15% for Indonesia, 2% for Nigeria and 7% for Pakistan. Only 12% of all facilities provided age and sex-disaggregated data. Findings highlight the challenges of confirming childhood TB. Diagnosis patterns in Nigeria highlight a very low suspicion for childhood TB. Providers note the need for paediatric medicines aligned to WHO recommendations. This study emphasises the impact of incomplete reporting on the estimation of disease burden and potential market size of paediatric TB medicines. Further studies on "hubs" (facilities treating large numbers of childhood TB cases) will improve our understanding of the epidemic, support introduction efforts for new treatments and better measure markets for new paediatric medicines.

  18. Multidrug resistant pulmonary tuberculosis treatment regimens and patient outcomes: an individual patient data meta-analysis of 9,153 patients.

    Directory of Open Access Journals (Sweden)

    Shama D Ahuja

    Full Text Available Treatment of multidrug resistant tuberculosis (MDR-TB is lengthy, toxic, expensive, and has generally poor outcomes. We undertook an individual patient data meta-analysis to assess the impact on outcomes of the type, number, and duration of drugs used to treat MDR-TB.Three recent systematic reviews were used to identify studies reporting treatment outcomes of microbiologically confirmed MDR-TB. Study authors were contacted to solicit individual patient data including clinical characteristics, treatment given, and outcomes. Random effects multivariable logistic meta-regression was used to estimate adjusted odds of treatment success. Adequate treatment and outcome data were provided for 9,153 patients with MDR-TB from 32 observational studies. Treatment success, compared to failure/relapse, was associated with use of: later generation quinolones, (adjusted odds ratio [aOR]: 2.5 [95% CI 1.1-6.0], ofloxacin (aOR: 2.5 [1.6-3.9], ethionamide or prothionamide (aOR: 1.7 [1.3-2.3], use of four or more likely effective drugs in the initial intensive phase (aOR: 2.3 [1.3-3.9], and three or more likely effective drugs in the continuation phase (aOR: 2.7 [1.7-4.1]. Similar results were seen for the association of treatment success compared to failure/relapse or death: later generation quinolones, (aOR: 2.7 [1.7-4.3], ofloxacin (aOR: 2.3 [1.3-3.8], ethionamide or prothionamide (aOR: 1.7 [1.4-2.1], use of four or more likely effective drugs in the initial intensive phase (aOR: 2.7 [1.9-3.9], and three or more likely effective drugs in the continuation phase (aOR: 4.5 [3.4-6.0].In this individual patient data meta-analysis of observational data, improved MDR-TB treatment success and survival were associated with use of certain fluoroquinolones, ethionamide, or prothionamide, and greater total number of effective drugs. However, randomized trials are urgently needed to optimize MDR-TB treatment. Please see later in the article for the Editors' Summary.

  19. Multimodal transfer of MDR by exosomes in human osteosarcoma.

    Science.gov (United States)

    Torreggiani, Elena; Roncuzzi, Laura; Perut, Francesca; Zini, Nicoletta; Baldini, Nicola

    2016-07-01

    Exosomes are extracellular vesicles released by both normal and tumour cells which are involved in a new intercellular communication pathway by delivering cargo (e.g., proteins, microRNAs, mRNAs) to recipient cells. Tumour-derived exosomes have been shown to play critical roles in different stages of tumour growth and progression. In this study, we investigated the potential role of exosomes to transfer the multidrug resistance (MDR) phenotype in human osteosarcoma cells. Exosomes were isolated by differential centrifugation of culture media from multidrug resistant human osteosarcoma MG-63DXR30 (Exo/DXR) and MG-63 parental cells (Exo/S). Exosome purity was examined by transmission electron microscopy and confirmed by immunoblot analysis for the expression of specific exosomal markers. Our data showed that exosomes derived from doxorubicin-resistant osteosarcoma cells could be taken up into secondary cells and induce a doxorubicin-resistant phenotype. The incubation of osteosarcoma cells with Exo/DXR decreased the sensitivity of parental cells to doxorubicin, while exposure with Exo/S was ineffective. In addition, we demonstrated that Exo/DXR expressed higher levels of MDR-1 mRNA and P-glycoprotein compared to Exo/S (p=0.03). Interestingly, both MDR-1 mRNA and P-gp increased in MG-63 cells after incubation with Exo/DXR, suggesting this as the main mechanism of exosome-mediated transfer of drug resistance. Our findings suggest that multidrug resistant osteosarcoma cells are able to spread their ability to resist the effects of doxorubicin treatment on sensitive cells by transferring exosomes carrying MDR-1 mRNA and its product P-glycoprotein.

  20. Efficacy and safety profile of linezolid in the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis: a systematic review and meta-analysis.

    Science.gov (United States)

    Agyeman, Akosua Adom; Ofori-Asenso, Richard

    2016-06-22

    Treatment options for drug-resistant tuberculosis are still limited. Linezolid has been recommended for treatment of patients with multidrug-resistant (MDR) or extensively-drug-resistant (XDR) tuberculosis, although uncertainties remain regarding its safety and tolerability in these circumstances. To systematically evaluate the existing evidence regarding the efficacy and tolerability of linezolid in the treatment of MDR or XDR tuberculosis. We conducted a systematic review and meta-analysis in accordance with the PRISMA guidelines. Searches were conducted in PubMed, Web of Science and EMBASE followed by direct search of abstracts in the International Journal of Tuberculosis and Lung Disease to retrieve primary studies published between January 2000 and January 2016 assessing linezolid efficacy and safety in the treatment of drug-resistant TB. We evaluated the occurrence of outcomes including culture conversion, treatment success and incidence of adverse events such as myelosuppression and neuropathy. Twenty-three (23) studies conducted in fourteen (14) countries and involving 507 patients were retrieved. Only 1 randomized controlled trial was identified and none of the identified studies involved participants from Africa. The pooled proportion for treatment success was 77.36 % (95 % CI = 71.38-82.83 %, I(2) = 37.6 %) with culture conversion rate determined as 88.45 % (95 % CI = 83.82-92.38 %, I(2) = 45.4 %). There was no strong evidence for both culture conversion (p = 0.0948) and treatment success (p = 0.0695) between linezolid daily doses ≤ 600 and > 600 mg. Only myelosuppression showed a strong statistical significance (p linezolid also showed no significance upon dose comparisons (p = 0.3213, p = 0.9050 respectively). Available evidence presents Linezolid as a viable option in the treatment of MDR/XDR TB although patients ought to be monitored closely for the incidence of major adverse events such as myelosuppression and

  1. Drug susceptibility of Mycobacterium tuberculosis in a rural area of Bangladesh and its relevance to the national treatment regimens.

    Science.gov (United States)

    Van Deun, A; Aung, K J; Chowdhury, S; Saha, S; Pankaj, A; Ashraf, A; Rigouts, L; Fissette, K; Portaels, F

    1999-02-01

    Greater Mymensingh District, a rural area of Bangladesh, at the start of the National Tuberculosis Programme (NTP). To determine the prevalence of initial and acquired drug resistance of Mycobacterium tuberculosis, and to assess the appropriateness of the NTP's standard regimens. Sampling of pre-treatment sputum from all newly registered smear-positive cases in five centres covering the area. Culture and susceptibility testing in a supra-national reference laboratory. Initial resistance to isoniazid (H) was 5.4%, and to rifampicin (R) 0.5%. Acquired H and R resistance were 25.9% and 7.4%, respectively. Multidrug resistance (MDR) was observed in one new case only and in 5.6% of previously treated patients. Changing the present NTP indication for retreatment regimen to one month of previous H intake would increase coverage of H-resistant cases from 52% to 89%, adding 6% to drug costs. The prevalence of drug resistance is surprisingly low in Bangladesh, but could rise with improving economic conditions. The NTP regimens for smear-positive cases are appropriate, all the more so since the human immunodeficiency virus is virtually absent. Indications for the retreatment regimen should be extended to include all patients treated for at least one month with any drug. The NTP regimen for smear-negative cases runs the risk of leading to MDR under present field conditions.

  2. Knowledge, attitude and practice of private practitioners regarding tb-dots in a rural district of Sindh, Pakistan

    International Nuclear Information System (INIS)

    Ahmed, M.; Fatmi, Z.; Ali, S.; Ahmed, S.; Ara, N.

    2009-01-01

    Tuberculosis is prevailing in both urban and rural areas of Pakistan. Knowledge, attitude and practice (KAP) of private practitioners (PPs) regarding tuberculosis management have been reported only in urban areas of Pakistan. This survey was conducted for the first time in a rural area of Sindh, Pakistan. This survey was conducted in January 2007 at Thatta, a rural district of Sindh, Pakistan. Study subjects were twenty-two allopathic qualified (MBBS) doctors of district Thatta, who were practicing in private setups for at least last one year. Before TB-DOTS training PPs had filled the KAP questionnaire regarding tuberculosis (TB) diagnosis and management through DOTS. Survey data was analysed through SPSS version 11.05 software. On average, five TB suspects per month were seen by each PP. Only 14% of PPs advised sputum microscopy solely for pulmonary TB diagnosis, while 86% of PPs used different combination of tests (chest x-ray/sputum microscopy/ESR/tuberculin test) for TB diagnosis. Over 40% PPs did not prescribe TB treatment regimen according to TB-DOTS category. Majority PPs (85%) did not follow the treatment through sputum microscopy and instead relied on clinical improvement and x-ray clearance. Nearly 60% of TB patients at PPs clinic did not show compliance to the TB treatment and none of PPs were following the retrieval of default cases. A gross lack of PPs knowledge and right practice regarding TB diagnosis and management through DOTS was identified and needed to be addressed through providing DOTS training. (author)

  3. Implementing the global plan to stop TB, 2011-2015--optimizing allocations and the Global Fund's contribution: a scenario projections study.

    Directory of Open Access Journals (Sweden)

    Eline L Korenromp

    Full Text Available BACKGROUND: The Global Plan to Stop TB estimates funding required in low- and middle-income countries to achieve TB control targets set by the Stop TB Partnership within the context of the Millennium Development Goals. We estimate the contribution and impact of Global Fund investments under various scenarios of allocations across interventions and regions. METHODOLOGY/PRINCIPAL FINDINGS: Using Global Plan assumptions on expected cases and mortality, we estimate treatment costs and mortality impact for diagnosis and treatment for drug-sensitive and multidrug-resistant TB (MDR-TB, including antiretroviral treatment (ART during DOTS for HIV-co-infected patients, for four country groups, overall and for the Global Fund investments. In 2015, China and India account for 24% of funding need, Eastern Europe and Central Asia (EECA for 33%, sub-Saharan Africa (SSA for 20%, and other low- and middle-income countries for 24%. Scale-up of MDR-TB treatment, especially in EECA, drives an increasing global TB funding need--an essential investment to contain the mortality burden associated with MDR-TB and future disease costs. Funding needs rise fastest in SSA, reflecting increasing coverage need of improved TB/HIV management, which saves most lives per dollar spent in the short term. The Global Fund is expected to finance 8-12% of Global Plan implementation costs annually. Lives saved through Global Fund TB support within the available funding envelope could increase 37% if allocations shifted from current regional demand patterns to a prioritized scale-up of improved TB/HIV treatment and secondly DOTS, both mainly in Africa--with EECA region, which has disproportionately high per-patient costs, funded from alternative resources. CONCLUSIONS/SIGNIFICANCE: These findings, alongside country funding gaps, domestic funding and implementation capacity and equity considerations, should inform strategies and policies for international donors, national governments and

  4. How many sputum culture results do we need to monitor multidrug-resistant-tuberculosis (MDR-TB) patients during treatment?

    NARCIS (Netherlands)

    Janssen, Saskia; Padanilam, Xavier; Louw, Rianna; Mahanyele, Russel; Coetzee, Gerrit; Hänscheid, Thomas; Leenstra, Tjalling; Grobusch, Martin P.

    2013-01-01

    Discharge of a hospital patient after a single negative sputum culture may save money when treating multidrug-resistant tuberculosis. However, after initial sputum conversion in 336 South Africans, 11.6% and 5.4% reconverted after 1 and 2 months, respectively. These findings endorse the WHO

  5. Detectemos la TB. Tratemos la TB. Trabajemos juntos para eliminar la TB. (Find TB. Treat TB. Working together to eliminate TB.)

    Centers for Disease Control (CDC) Podcasts

    2014-02-26

    Este podcast trata sobre el Día Mundial de la Tuberculosis y el tema de los CDC para el año 2014.  Created: 2/26/2014 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 2/26/2014.

  6. Construction of retrovirus vector taking MDR1/ACBC1 and its ...

    African Journals Online (AJOL)

    We successfully observed the expression of the reporter gene-GFP by using the green light fluorescence microscope and the p-glycoprotein (P-gp) expressed by exogenous gene MDR1 by Western Blotting. All these facts indicated that the retroviral vector PMX-flag-MDR1-GFP had successfully been transfected into ...

  7. Splice form variant and amino acid changes in MDR49 confers DDT resistance in transgenic Drosophila.

    Science.gov (United States)

    Seong, Keon Mook; Sun, Weilin; Clark, John M; Pittendrigh, Barry R

    2016-03-22

    The ATP-binding cassette (ABC) transporters represent a superfamily of proteins that have important physiological roles in both prokaryotes and eukaryotes. In insects, ABC transporters have previously been implicated in insecticide resistance. The 91-R strain of Drosophila melanogaster has been intensely selected with DDT over six decades. A recent selective sweeps analysis of 91-R implicated the potential role of MDR49, an ABC transporter, in DDT resistance, however, to date the details of how MDR49 may play a role in resistance have not been elucidated. In this study, we investigated the impact of structural changes and an alternative splicing event in MDR49 on DDT-resistance in 91-R, as compared to the DDT susceptible strain 91-C. We observed three amino acid differences in MDR49 when 91-R was compared with 91-C, and only one isoform (MDR49B) was implicated in DDT resistance. A transgenic Drosophila strain containing the 91-R-MDR49B isoform had a significantly higher LD50 value as compared to the 91-C-MDR49B isoform at the early time points (6 h to 12 h) during DDT exposure. Our data support the hypothesis that the MDR49B isoform, with three amino acid mutations, plays a role in the early aspects of DDT resistance in 91-R.

  8. Recovery, modernization and computerization of the monochromator MDR-23

    International Nuclear Information System (INIS)

    Miranda, L. J.

    2012-01-01

    For use in the Optics Laboratory, newly created in the CEADEN, one of the necessary equipment is the Monochromator MDR-23, which was necessary for recovery, modernization (replacing the power supply and control) and computerization by designing a VI (virtual instrument) to control stepper motor through a PC using Lab VIEW 7.1 that allows users to select the address mode, the number of steps and the engine speed and give the initial value of the position and limits the range of the monochromator to start working with it. The principle of operation of the program is done in detail to facilitate understanding of how to operate and use the graphical programming designed and achieve efficient use of equipment. (Author)

  9. A preliminary characterisation of recovered uranium produced by MDR

    International Nuclear Information System (INIS)

    Kwon, Hyuk Il; Davison, J.; Marsh, G.

    1997-10-01

    The CANFLEX-RU fuel to be developed for the future should be verified if it has any major problems in RU handling techniques and related technology development. For this purpose, a preliminary R and D efforts on the RU handling characteristics were executed by joint effort with BNFL in following area. 1) preparation of RU powder by the MDR process 2) Compaction and sintering characteristics of RU powder 3) required special process for the production of CANFLEX-RU fuel 4) characterization of fission product residue composition in the RU powder 5) radiological characterization of RU powder and sintered pellets. Physical characterization of RU UO 2 powder and pellet produced by the MDR process were similar with those of NU UO 2 powder and pellet. The density of RU pellets, however, were higher than those of NU pellets and RU pellets showed little higher values in pore size distributions. RU contained only negligibly low concentrations of fission products and actinides. Especially, the Cs-137 content in the powder (before sintering) were undetectable and therefore would not contaminate the sintering furnace. RU pellet showed higher impurity levels, especially in the Ni content. Radioactivity on the RU powder showed about twice higher value at the surface than those of NU, but showed drastic reduction by distance and became similar at the 1 meter distance. RU pellets showed close coincidence between NU and RU at any distance. This result could be used close coincidence between NU and RU at any distance. This result could be used as a basis of the feasibility assessment on the development of CANFLEX-RU. Through basic research works on the improvement of CANFLEX-RU fabrication processes, compatibility with CANFLEX-NU fabrication process will be evaluated and analysed. (author). 4 refs

  10. A preliminary characterisation of recovered uranium produced by MDR

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Hyuk Il [Korea Atomic Energy Research Inst., Daeduk (Korea, Republic of); Davison, J.; Marsh, G. [British Nuclear Forum, London (United Kingdom)

    1997-10-01

    The CANFLEX-RU fuel to be developed for the future should be verified if it has any major problems in RU handling techniques and related technology development. For this purpose, a preliminary R and D efforts on the RU handling characteristics were executed by joint effort with BNFL in following area. 1) preparation of RU powder by the MDR process 2) Compaction and sintering characteristics of RU powder 3) required special process for the production of CANFLEX-RU fuel 4) characterization of fission product residue composition in the RU powder 5) radiological characterization of RU powder and sintered pellets. Physical characterization of RU UO{sub 2} powder and pellet produced by the MDR process were similar with those of NU UO{sub 2} powder and pellet. The density of RU pellets, however, were higher than those of NU pellets and RU pellets showed little higher values in pore size distributions. RU contained only negligibly low concentrations of fission products and actinides. Especially, the Cs-137 content in the powder (before sintering) were undetectable and therefore would not contaminate the sintering furnace. RU pellet showed higher impurity levels, especially in the Ni content. Radioactivity on the RU powder showed about twice higher value at the surface than those of NU, but showed drastic reduction by distance and became similar at the 1 meter distance. RU pellets showed close coincidence between NU and RU at any distance. This result could be used close coincidence between NU and RU at any distance. This result could be used as a basis of the feasibility assessment on the development of CANFLEX-RU. Through basic research works on the improvement of CANFLEX-RU fabrication processes, compatibility with CANFLEX-NU fabrication process will be evaluated and analysed. (author). 4 refs.

  11. ECG-triggered MDR-CT for the detection of pulmonary metastases

    International Nuclear Information System (INIS)

    Pauls, S.; Wahl, J.; Aschoff, A.J.; Brambs, H.J.; Fleiter, T.R.

    2003-01-01

    Purpose: Comparison of multidetector-row CT (MDR-CT) of the chest with and without ECG triggering for the detection of pulmonary metastases. Materials and Methods: Fifty patients with malignant tumors underwent CT of the chest. The unenhanced phase was performed with ECG-triggered MDR-CT and the contrast-enhanced phase with helical MDR-CT. The ECG-triggered and standard helical scans were interpreted in separate sessions, with the analysis determining the number and demarcation of the intrapulmonary nodules and the delineation of the mediastinal structure (rated 1 = excellent to 5 = poor). Results: ECG-MDR-CT images detected 38% more pulmonary nodules than MDR-CT. The detection rate for tumors [de

  12. Modulation of human multidrug-resistance MDR-1 gene by natural curcuminoids

    Directory of Open Access Journals (Sweden)

    Buddhasukh Duang

    2004-04-01

    Full Text Available Abstract Background Multidrug resistance (MDR is a phenomenon that is often associated with decreased intracellular drug accumulation in patient's tumor cells resulting from enhanced drug efflux. It is related to the overexpression of a membrane protein, P-glycoprotein (Pgp-170, thereby reducing drug cytotoxicity. A variety of studies have tried to find MDR modulators which increase drug accumulation in cancer cells. Methods In this study, natural curcuminoids, pure curcumin, demethoxycurcumin and bisdemethoxycurcumin, isolated from turmeric (Curcuma longa Linn, were compared for their potential ability to modulate the human MDR-1 gene expression in multidrug resistant human cervical carcinoma cell line, KB-V1 by Western blot analysis and RT-PCR. Results Western blot analysis and RT-PCR showed that all the three curcuminoids inhibited MDR-1 gene expression, and bisdemethoxycurcumin produced maximum effect. In additional studies we found that commercial grade curcuminoid (approximately 77% curcumin, 17% demethoxycurcumin and 3% bisdemthoxycurcumin decreased MDR-1 gene expression in a dose dependent manner and had about the same potent inhibitory effect on MDR-1 gene expression as our natural curcuminoid mixtures. Conclusion These results indicate that bisdemethoxycurcumin is the most active of the curcuminoids present in turmeric for modulation of MDR-1 gene. Treatment of drug resistant KB-V1 cells with curcumin increased their sensitivity to vinblastine, which was consistent with a decreased MDR-1 gene product, a P-glycoprotein, on the cell plasma membrane. Although many drugs that prevent the P-glycoprotein function have been reported, this report describes the inhibition of MDR-1 expression by a phytochemical. The modulation of MDR-1 expression may be an attractive target for new chemosensitizing agents.

  13. Modulation of human multidrug-resistance MDR-1 gene by natural curcuminoids

    International Nuclear Information System (INIS)

    Limtrakul, Pornngarm; Anuchapreeda, Songyot; Buddhasukh, Duang

    2004-01-01

    Multidrug resistance (MDR) is a phenomenon that is often associated with decreased intracellular drug accumulation in patient's tumor cells resulting from enhanced drug efflux. It is related to the overexpression of a membrane protein, P-glycoprotein (Pgp-170), thereby reducing drug cytotoxicity. A variety of studies have tried to find MDR modulators which increase drug accumulation in cancer cells. In this study, natural curcuminoids, pure curcumin, demethoxycurcumin and bisdemethoxycurcumin, isolated from turmeric (Curcuma longa Linn), were compared for their potential ability to modulate the human MDR-1 gene expression in multidrug resistant human cervical carcinoma cell line, KB-V1 by Western blot analysis and RT-PCR. Western blot analysis and RT-PCR showed that all the three curcuminoids inhibited MDR-1 gene expression, and bisdemethoxycurcumin produced maximum effect. In additional studies we found that commercial grade curcuminoid (approximately 77% curcumin, 17% demethoxycurcumin and 3% bisdemthoxycurcumin) decreased MDR-1 gene expression in a dose dependent manner and had about the same potent inhibitory effect on MDR-1 gene expression as our natural curcuminoid mixtures. These results indicate that bisdemethoxycurcumin is the most active of the curcuminoids present in turmeric for modulation of MDR-1 gene. Treatment of drug resistant KB-V1 cells with curcumin increased their sensitivity to vinblastine, which was consistent with a decreased MDR-1 gene product, a P-glycoprotein, on the cell plasma membrane. Although many drugs that prevent the P-glycoprotein function have been reported, this report describes the inhibition of MDR-1 expression by a phytochemical. The modulation of MDR-1 expression may be an attractive target for new chemosensitizing agents

  14. MDR1 haplotypes conferring an increased expression of intestinal CYP3A4 rather than MDR1 in female living-donor liver transplant patients.

    Science.gov (United States)

    Hosohata, Keiko; Masuda, Satohiro; Yonezawa, Atsushi; Katsura, Toshiya; Oike, Fumitaka; Ogura, Yasuhiro; Takada, Yasutsugu; Egawa, Hiroto; Uemoto, Shinji; Inui, Ken-Ichi

    2009-07-01

    This study investigated whether haplotypes in the multidrug resistance 1 (MDR1) gene had effects on mRNA expression levels of MDR1 and cytochrome P450 (CYP) 3A4, and on the pharmacokinetics of tacrolimus in living-donor liver transplant (LDLT) patients, considering the gender difference. Haplotype analysis of MDR1 with G2677T/A and C3435T was performed in 63 de novo Japanese LDLT patients (17 to 55 years; 44.4% women). The expression levels of MDR1 and CYP3A4 mRNAs in jejunal biopsy specimens were quantified by real-time PCR. Intestinal CYP3A4 mRNA expression levels (amol/microg total RNA) showed significantly higher values in women carrying the 2677TT-3435TT haplotype (median, 10.7; range, 5.92-15.2) than those with 2677GG-3435CC (3.03; range 1.38-4.68) and 2677GT-3435CT (median, 4.31; range, 0.07-9.42) (P = 0.022), but not in men (P = 0.81). However, MDR1 haplotype did not influence mRNA expression levels of MDR1 nor the concentration/dose ratio [(ng/mL)/(mg/day)] of oral tacrolimus for the postoperative 7 days, irrespective of gender. MDR1 haplotype may have a minor association with the tacrolimus pharmacokinetics after LDLT, but could be a good predictor of the inter-individual variation of intestinal expression of CYP3A4 in women.

  15. Dioscin enhances methotrexate absorption by down-regulating MDR1 in vitro and in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Lijuan, E-mail: jlwang1979@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Wang, Changyuan, E-mail: wangcyuan@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Peng, Jinyong, E-mail: jinyongpeng2005@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Liu, Qi, E-mail: llaqii@yahoo.com.cn [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Meng, Qiang, E-mail: mengq531@yahoo.cn [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Sun, Huijun, E-mail: sunhuijun@hotmail.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Huo, Xiaokui, E-mail: huoxiaokui@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); and others

    2014-06-01

    The purpose of this study was to investigate the enhancing effect of dioscin on the absorption of methotrexate (MTX) and clarify the molecular mechanism involved in vivo and in vitro. Dioscin increased MTX chemosensitivity and transepithelial flux in the absorptive direction, significantly inhibiting multidrug resistance 1 (MDR1) mRNA and protein expression and MDR1 promoter and nuclear factor κ-B (NF-κB) activities in Caco-2 cells. Moreover, inhibitor κB-α (IκB-α) degradation was inhibited by dioscin. Dioscin enhanced the intracellular concentration of MTX by down-regulating MDR1 expression through a mechanism that involves NF-κB signaling pathway inhibition in Caco-2 cells. Dioscin strengthened MTX absorption by inhibiting MDR1 expression in rat intestine. In addition, even though MTX is absorbed into the enterocytes, there was no increase in toxicity observed, and that, in fact, decreased toxicity was seen. - Highlights: • Dioscin raised MTX concentration by inhibiting MDR1 in Caco-2 cells. • Dioscin suppresses MDR1 by inhibiting NF-κB signaling pathway in Caco-2 cells. • Dioscin can enhance MTX absorption via inhibiting MDR1 in vivo and in vitro. • Dioscin did not increase MTX-induced gastrointestinal mucosal toxicity.

  16. Litigation as TB Rights Advocacy

    Science.gov (United States)

    2016-01-01

    Abstract One thousand people die every day in India as a result of TB, a preventable and treatable disease, even though the Constitution of India, government schemes, and international law guarantee available, accessible, acceptable, quality health care. Failure to address the spread of TB and to provide quality treatment to all affected populations constitutes a public health and human rights emergency that demands action and accountability. As part of a broader strategy, health activists in India employ Public Interest Litigation (PIL) to hold the state accountable for rights violations and to demand new legislation, standards for patient care, accountability for under-spending, improvements in services at individual facilities, and access to government entitlements in marginalized communities. Taking inspiration from right to health PIL cases (PILs), lawyers in a New Delhi-based rights organization used desk research, fact-findings, and the Right To Information Act to build a TB PIL for the Delhi High Court, Sanjai Sharma v. NCT of Delhi and Others (2015). The case argues that inadequate implementation of government TB schemes violates the Constitutional rights to life, health, food, and equality. Although PILs face substantial challenges, this paper concludes that litigation can be a crucial advocacy and accountability tool for people living with TB and their allies. PMID:27781000

  17. Significance of MDR1 and multiple drug resistance in refractory human epileptic brain

    Directory of Open Access Journals (Sweden)

    Dini Gabriele

    2004-10-01

    Full Text Available Abstract Background The multiple drug resistance protein (MDR1/P-glycoprotein is overexpressed in glia and blood-brain barrier (BBB endothelium in drug refractory human epileptic tissue. Since various antiepileptic drugs (AEDs can act as substrates for MDR1, the enhanced expression/function of this protein may increase their active extrusion from the brain, resulting in decreased responsiveness to AEDs. Methods Human drug resistant epileptic brain tissues were collected after surgical resection. Astrocyte cell cultures were established from these tissues, and commercially available normal human astrocytes were used as controls. Uptake of fluorescent doxorubicin and radioactive-labeled Phenytoin was measured in the two cell populations, and the effect of MDR1 blockers was evaluated. Frozen human epileptic brain tissue slices were double immunostained to locate MDR1 in neurons and glia. Other slices were exposed to toxic concentrations of Phenytoin to study cell viability in the presence or absence of a specific MDR1 blocker. Results MDR1 was overexpressed in blood vessels, astrocytes and neurons in human epileptic drug-resistant brain. In addition, MDR1-mediated cellular drug extrusion was increased in human 'epileptic' astrocytes compared to 'normal' ones. Concomitantly, cell viability in the presence of cytotoxic compounds was increased. Conclusions Overexpression of MDR1 in different cell types in drug-resistant epileptic human brain leads to functional alterations, not all of which are linked to drug pharmacokinetics. In particular, the modulation of glioneuronal MDR1 function in epileptic brain in the presence of toxic concentrations of xenobiotics may constitute a novel cytoprotective mechanism.

  18. Bakteri Simbion Gastropoda Pleuroploca trapesium Dari Perairan Ternate, Sebagai Alternatif Antibakteri MDR (Bacterial Symbiont Gastropoda Pleuroploca trapezium from Ternate, as Alternative Antibacterial MDR

    Directory of Open Access Journals (Sweden)

    Delianis Pringgenies

    2014-03-01

    The bacteria resistant to some antibiotics are known as multi drug resistant (MDR. To overcome the problem, it is needed to search for a new antibiotic compounds more effectively and efficiently. This study aims to identify potential from symbionts of Pleuroploca trapezium as a source of antibacteria MDR and identifying the bacteria that were active against the MDR. Samples were collected from Ternate, Maluku. Isolation of symbiotic bacteria, screening for bacteria which producing secondary metabolites as anti-MDR bacteria, antibacterial test, isolation of clinical pathogenic bacteria of MDR. Conducting anti-bacterial sensitivity test,  sensitivity test for antibacterial,  DNA exctraction, DNA amplification based on PCR method, DNA sequencing.  Result of 16S r-DNA sequence was then analyzed and edited using GENETYX program and followed by 16S rDNA sequence analysis. Screening of bacteria associated with P. trapezium resulted in 19 isolates with 5 active bacteria. Based on the size of the zone forming and the consistency of zone, so the best isolate is TPT 4.7. The identification shows that TPT 4.7 has a close relationship with the Paracoccus sp. MBIC4019 with homologi of 95%, which shows the relationship at the genus level. Its suggest that these results are very promising as a new antibacterial material. Keywords: antibacterial, symbiotic bacteria, Pleuroploca trapezium, multi drugs resistant

  19. Biomarkers of latent TB infection

    DEFF Research Database (Denmark)

    Ruhwald, Morten; Ravn, Pernille

    2009-01-01

    For the last 100 years, the tuberculin skin test (TST) has been the only diagnostic tool available for latent TB infection (LTBI) and no biomarker per se is available to diagnose the presence of LTBI. With the introduction of M. tuberculosis-specific IFN-gamma release assays (IGRAs), a new area...... of in vitro immunodiagnostic tests for LTBI based on biomarker readout has become a reality. In this review, we discuss existing evidence on the clinical usefulness of IGRAs and the indefinite number of potential new biomarkers that can be used to improve diagnosis of latent TB infection. We also present...... early data suggesting that the monocyte-derived chemokine inducible protein-10 may be useful as a novel biomarker for the immunodiagnosis of latent TB infection....

  20. Influence knowledge and behavior of TB medical personnels’ concordance principle based communications skill at primary healthcare, Medan, Indonesia

    Science.gov (United States)

    Wahyuni, A. S.; Soeroso, N. N.; Alona, I.; Yunanda, Y.; Siregar, I.

    2018-03-01

    Concordance behavior of TB management is a form of collaboration among doctors, personnel, and patients in treating TB. Approvalamong them could be achieved if credibility and policy occur. This study is aimed to analyze the influence of TB medical personnel’s concordance behaviour principle to patient obedience at primary health care in Medan.The design of this study was quasi experimental, focusing on interventional primary health care, which is those who applied concordance behaviour principle to non-interventionalprimary health care. The population is TB patients, starting from 18 years old, TB category I with positive Acid Fast Bacilli Smear Test (AFBST), and taking TB regimens at Medan. Seventy- four patients were selected to be samples. They had undergone interview based on validated concordance principle, knowledge, behavior, and treatment. Data were analyzed using chi- square. The percentage of knowledge, behavior of TB patient to the treatment is higher on interventional primary health care than noninterventional ones. Treatment awareness based on concordance principle is expected to planish DOTS-based TB programs.

  1. Treating tuberculosis with high doses of anti-TB drugs: mechanisms and outcomes.

    Science.gov (United States)

    Xu, Yuhui; Wu, Jianan; Liao, Sha; Sun, Zhaogang

    2017-10-03

    Tuberculosis (TB) is considered as one of the most serious threats to public health in many parts of the world. The threat is even more severe in the developing countries where there is a lack of advanced medical amenities and contemporary anti-TB drugs. In such situations, dosage optimization of existing medication regimens seems to be the only viable option. Therapeutic drug monitoring study results suggest that high-dose treatment regimens can compensate the low serum concentration of anti-TB drugs and shorten the therapy duration. The article presents a critical review on the possible changes that occur in the host and the pathogen upon the administration of standard and high-dose regimens. Some of the most common factors that are responsible for low anti-TB drug concentrations in the serum are differences in hosts' body weight, metabolic processing of the drug, malabsorption and/or drug-drug interaction. Furthermore, failure to reach the cavitary pulmonary and extrapulmonary tissues also contributes to the therapeutic inefficiency of the drugs. In such conditions, administration of higher doses can help in compensating the pathogenic outcomes of enhancement of the pathogen's physical barriers, efflux pumps and genetic mutations. The present article also presents a summary of the recorded treatment outcomes of clinical trials that were conducted to test the efficacy of administration of high dose of anti-tuberculosis drugs. This review will help physicians across the globe to understand the underlying pathophysiological changes (including side effects) that dictate the clinical outcomes in patients administered with standard and/or high dose anti-TB drugs.

  2. Screening of Antibacterial MDR derived from Sponge Associated Fungus of Riung Water, Nusa Tenggara Timur

    OpenAIRE

    Khoeruddin Wittriansyah; Agus Trianto; Sekar Widyaningsih; Ocky Karna Radjasa; Rudhi Pribadi

    2016-01-01

    Marine sponge-associated fungi are the sources of bioactive compounds with various pharmacologicals potency. This study aimed to isolate the sponge-associated fungi as the producer of the MDR anti-bacterial compounds.  The associated fungi were isolated from the sponges collected from Riung water, Nusa Tenggara Timur. Five of the best isolates were cultured on MEA to obtain the methanolic extract for further studies.  The antagonistic test was conducted using overlay method towards the MDR St...

  3. Extensively Drug-Resistant TB

    Centers for Disease Control (CDC) Podcasts

    2016-12-16

    Dr. Charlotte Kvasnovsky, a surgery resident and Ph.D. candidate in biostatistics, discusses various types of drug resistance in TB patients in South Africa.  Created: 12/16/2016 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 12/16/2016.

  4. TB in Wild Asian Elephants

    Centers for Disease Control (CDC) Podcasts

    2017-05-10

    Dr. Susan Mikota, co-founder of Elephant Care International, discusses TB in wild Asian elephants.  Created: 5/10/2017 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 5/10/2017.

  5. Community Involvement in TB Research

    NARCIS (Netherlands)

    M. van der Werf (Marloes); S.G. Heumann (Silke); E.M.H. Mitchell

    2011-01-01

    textabstractWhile communities at risk have been both drivers and partners in HIV research, their important role in TB research is yet to be fully realized. Involvement of communities in tuberculosis care and prevention is currently on the international agenda. This creates opportunities and

  6. The Xenobiotic Transporter Mdr1 Enforces T Cell Homeostasis in the Presence of Intestinal Bile Acids.

    Science.gov (United States)

    Cao, Wei; Kayama, Hisako; Chen, Mei Lan; Delmas, Amber; Sun, Amy; Kim, Sang Yong; Rangarajan, Erumbi S; McKevitt, Kelly; Beck, Amanda P; Jackson, Cody B; Crynen, Gogce; Oikonomopoulos, Angelos; Lacey, Precious N; Martinez, Gustavo J; Izard, Tina; Lorenz, Robin G; Rodriguez-Palacios, Alex; Cominelli, Fabio; Abreu, Maria T; Hommes, Daniel W; Koralov, Sergei B; Takeda, Kiyoshi; Sundrud, Mark S

    2017-12-19

    CD4 + T cells are tightly regulated by microbiota in the intestine, but whether intestinal T cells interface with host-derived metabolites is less clear. Here, we show that CD4 + T effector (Teff) cells upregulated the xenobiotic transporter, Mdr1, in the ileum to maintain homeostasis in the presence of bile acids. Whereas wild-type Teff cells upregulated Mdr1 in the ileum, those lacking Mdr1 displayed mucosal dysfunction and induced Crohn's disease-like ileitis following transfer into Rag1 -/- hosts. Mdr1 mitigated oxidative stress and enforced homeostasis in Teff cells exposed to conjugated bile acids (CBAs), a class of liver-derived emulsifying agents that actively circulate through the ileal mucosa. Blocking ileal CBA reabsorption in transferred Rag1 -/- mice restored Mdr1-deficient Teff cell homeostasis and attenuated ileitis. Further, a subset of ileal Crohn's disease patients displayed MDR1 loss of function. Together, these results suggest that coordinated interaction between mucosal Teff cells and CBAs in the ileum regulate intestinal immune homeostasis. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Measurement of 160Tb and 161Tb in nuclear forensics samples

    International Nuclear Information System (INIS)

    Jiang, J.; Davies, A.V.; Britton, R.E.

    2017-01-01

    160 Tb and 161 Tb are important radionuclides to measure when analysing a Nuclear Forensics sample. An analytical method for the measurement of both 160 Tb and 161 Tb was developed in this study. Terbium was separated and purified using exchange resin and TrisKem LN Resin. The purified fraction containing 160 Tb and 161 Tb was measured by gamma spectrometry and liquid scintillation counting. The counting efficiencies of 160 Tb and 161 Tb were determined using the CIEMAT/NIST efficiency tracing method. The LSC count rate ratio, R160 Tb /R161 Tb , on the reference date was determined by sequential counting and calculated using a custom script based on their half-lives. (author)

  8. Prospective use of soluble urokinase plasminogen activator receptor to screen TB co-infected with HIV patient among TB patient

    Directory of Open Access Journals (Sweden)

    Tri Yudani Mardining Raras

    2017-10-01

    Conclusion: Plasma suPAR level of TB patients co-infected with HIV showed significantly difference from that of TB-AFB(+ patients suggested its potential to screen the TB/HIV among pulmonary TB-AFB(+ patients.

  9. The search for the mdr1-1Δ mutation of the MDR1 gene in four canine breeds in Uruguay (preliminary study

    Directory of Open Access Journals (Sweden)

    Rosa Gagliardi B.

    2015-01-01

    Full Text Available Objective. The objective of this study is to analyze the frequency of mdr1-1Δ mutation in German Shepherd, Doberman, Border Collie and Greyhound dog breeds in Uruguay. Materials and methods. A total of 95 animals from the four breeds mentioned above were studied. DNA was isolated from blood using potassium acetate with a subsequent degradation from RNA with RNAsaH. The concentration and quality of the DNA obtained was evaluated with a Nanodrop, ND-1000 spectrophotometer. To determine the presence or absence of the mdr1-1Δ mutation, DNA samples were sent to Gene Seek, Neogen Corporation of Chicago, United States, for genotyping. Results. In all 95 animals studied, the mdr1-1Δ mutation was not present. Conclusions. Based on the preliminary results obtained, other elements that may cause adverse drug reactions must be considered: unidentified mutations in other regions of the MDR1 gene; mutations in other genes involved in the transport of drugs from the same subfamily or another; mutations in enzymes involved in drug metabolism (e.g. Cytochrome P450. Moreover, especially with Border Collies and Greyhounds, it is advisable to increase the number of animals in the study.

  10. FAM-MDR: a flexible family-based multifactor dimensionality reduction technique to detect epistasis using related individuals.

    Directory of Open Access Journals (Sweden)

    Tom Cattaert

    Full Text Available We propose a novel multifactor dimensionality reduction method for epistasis detection in small or extended pedigrees, FAM-MDR. It combines features of the Genome-wide Rapid Association using Mixed Model And Regression approach (GRAMMAR with Model-Based MDR (MB-MDR. We focus on continuous traits, although the method is general and can be used for outcomes of any type, including binary and censored traits. When comparing FAM-MDR with Pedigree-based Generalized MDR (PGMDR, which is a generalization of Multifactor Dimensionality Reduction (MDR to continuous traits and related individuals, FAM-MDR was found to outperform PGMDR in terms of power, in most of the considered simulated scenarios. Additional simulations revealed that PGMDR does not appropriately deal with multiple testing and consequently gives rise to overly optimistic results. FAM-MDR adequately deals with multiple testing in epistasis screens and is in contrast rather conservative, by construction. Furthermore, simulations show that correcting for lower order (main effects is of utmost importance when claiming epistasis. As Type 2 Diabetes Mellitus (T2DM is a complex phenotype likely influenced by gene-gene interactions, we applied FAM-MDR to examine data on glucose area-under-the-curve (GAUC, an endophenotype of T2DM for which multiple independent genetic associations have been observed, in the Amish Family Diabetes Study (AFDS. This application reveals that FAM-MDR makes more efficient use of the available data than PGMDR and can deal with multi-generational pedigrees more easily. In conclusion, we have validated FAM-MDR and compared it to PGMDR, the current state-of-the-art MDR method for family data, using both simulations and a practical dataset. FAM-MDR is found to outperform PGMDR in that it handles the multiple testing issue more correctly, has increased power, and efficiently uses all available information.

  11. Advancing tuberculosis drug regimen development through innovative quantitative translational pharmacology methods and approaches.

    Science.gov (United States)

    Hanna, Debra; Romero, Klaus; Schito, Marco

    2017-03-01

    The development of novel tuberculosis (TB) multi-drug regimens that are more efficacious and of shorter duration requires a robust drug development pipeline. Advances in quantitative modeling and simulation can be used to maximize the utility of patient-level data from prior and contemporary clinical trials, thus optimizing study design for anti-TB regimens. This perspective article highlights the work of seven project teams developing first-in-class translational and quantitative methodologies that aim to inform drug development decision-making, dose selection, trial design, and safety assessments, in order to achieve shorter and safer therapies for patients in need. These tools offer the opportunity to evaluate multiple hypotheses and provide a means to identify, quantify, and understand relevant sources of variability, to optimize translation and clinical trial design. When incorporated into the broader regulatory sciences framework, these efforts have the potential to transform the development paradigm for TB combination development, as well as other areas of global health. Copyright © 2016. Published by Elsevier Ltd.

  12. Commercial grade item (CGI) dedication of MDR relays for nuclear safety related applications

    Science.gov (United States)

    Das, Ranjit K.; Julka, Anil; Modi, Govind

    1994-08-01

    MDR relays manufactured by Potter & Brumfield (P&B) have been used in various safety related applications in commercial nuclear power plants. These include emergency safety features (ESF) actuation systems, emergency core cooling systems (ECCS) actuation, and reactor protection systems. The MDR relays manufactured prior to May 1990 showed signs of generic failure due to corrosion and outgassing of coil varnish. P&B has made design changes to correct these problems in relays manufactured after May 1990. However, P&B does not manufacture the relays under any 10CFR50 Appendix B quality assurance (QA) program. They manufacture the relays under their commercial QA program and supply these as commercial grade items. This necessitates CGI Dedication of these relays for use in nuclear-safety-related applications. This paper presents a CGI dedication program that has been used to dedicate the MDR relays manufactured after been used to dedicate the MDR relays manufactured after May 1990. The program is in compliance with current Nuclear Regulatory Commission (NRC) and Electric Power Research Institute (EPRI) guidelines and applicable industry standards; it specifies the critical characteristics of the relays, provides the tests and analysis required to verify the critical characteristics, the acceptance criteria for the test results, performs source verification to quality P&B for its control of the critical characteristics, and provides documentation. The program provides reasonable assurance that the new MDR relays will perform their intended safety functions.

  13. MDR1 siRNA loaded hyaluronic acid-based CD44 targeted nanoparticle systems circumvent paclitaxel resistance in ovarian cancer

    Science.gov (United States)

    Yang, Xiaoqian; Lyer, Arun K.; Singh, Amit; Choy, Edwin; Hornicek, Francis J.; Amiji, Mansoor M.; Duan, Zhenfeng

    2015-02-01

    Development of multidrug resistance (MDR) is an almost universal phenomenon in patients with ovarian cancer, and this severely limits the ultimate success of chemotherapy in the clinic. Overexpression of the MDR1 gene and corresponding P-glycoprotein (Pgp) is one of the best known MDR mechanisms. MDR1 siRNA based strategies were proposed to circumvent MDR, however, systemic, safe, and effective targeted delivery is still a major challenge. Cluster of differentiation 44 (CD44) targeted hyaluronic acid (HA) based nanoparticle has been shown to successfully deliver chemotherapy agents or siRNAs into tumor cells. The goal of this study is to evaluate the ability of HA-PEI/HA-PEG to deliver MDR1 siRNA and the efficacy of the combination of HA-PEI/HA-PEG/MDR1 siRNA with paclitaxel to suppress growth of ovarian cancer. We observed that HA-PEI/HA-PEG nanoparticles can efficiently deliver MDR1 siRNA into MDR ovarian cancer cells, resulting in down-regulation of MDR1 and Pgp expression. Administration of HA-PEI/HA-PEG/MDR1 siRNA nanoparticles followed by paclitaxel treatment induced a significant inhibitory effect on the tumor growth, decreased Pgp expression and increased apoptosis in MDR ovarian cancer mice model. Our findings suggest that CD44 targeted HA-PEI/HA-PEG/MDR1 siRNA nanoparticles can serve as a therapeutic tool with great potentials to circumvent MDR in ovarian cancer.

  14. Breed distribution of the nt230(del4) MDR1 mutation in dogs.

    Science.gov (United States)

    Gramer, Irina; Leidolf, Regina; Döring, Barbara; Klintzsch, Stefanie; Krämer, Eva-Maria; Yalcin, Ebru; Petzinger, Ernst; Geyer, Joachim

    2011-07-01

    A 4-bp deletion mutation associated with multiple drug sensitivity exists in the canine multidrug resistance (MDR1) gene. This mutation has been detected in more than 10 purebred dog breeds as well as in mixed breed dogs. To evaluate the breed distribution of this mutation in Germany, 7378 dogs were screened, including 6999 purebred and 379 mixed breed dogs. The study included dog breeds that show close genetic relationship or share breeding history with one of the predisposed breeds but in which the occurrence of the MDR1 mutation has not been reported. The breeds comprised Bearded Collies, Anatolian Shepherd Dog, Greyhound, Belgian Tervuren, Kelpie, Borzoi, Australian Cattle Dog and the Irish Wolfhound. The MDR1 mutation was not detected is any of these breeds, although it was found as expected in the Collie, Longhaired Whippet, Shetland Sheepdog, Miniature Australian Shepherd, Australian Shepherd, Wäller, White Swiss Shepherd, Old English Sheepdog and Border Collie with varying allelic frequencies for the mutant MDR1 allele of 59%, 45%, 30%, 24%, 22%, 17%, 14%, 4% and 1%, respectively. Allelic frequencies of 8% and 2% were determined in herding breed mixes and unclassified mixed breeds, respectively. Because of its widespread breed distribution and occurrence in many mixed breed dogs, it is difficult for veterinarians and dog owners to recognise whether MDR1-related drug sensitivity is relevant for an individual animal. This study provides a comprehensive overview of all affected dog breeds and many dog breeds that are probably unaffected on the basis of ∼15,000 worldwide MDR1 genotyping data. Copyright © 2010 Elsevier Ltd. All rights reserved.

  15. Nitrofuranyl Methyl Piperazines as New Anti-TB Agents: Identification, Validation, Medicinal Chemistry, and PK Studies

    Science.gov (United States)

    2015-01-01

    Whole-cell screening of 20,000 drug-like small molecules led to the identification of nitrofuranyl methylpiperazines as potent anti-TB agents. In the present study, validation followed by medicinal chemistry has been used to explore the structure–activity relationship. Ten compounds demonstrated potent MIC in the range of 0.17–0.0072 μM against H37Rv Mycobacterium tuberculosis (MTB) and were further investigated against nonreplicating and resistant (RifR and MDR) strains of MTB. These compounds were also tested for cytotoxicity. Among the 10 tested compounds, five showed submicromolar to nanomolar potency against nonreplicating and resistant (RifR and MDR) strains of MTB along with a good safety index. Based on their overall in vitro profiles, the solubility and pharmacokinetic properties of five potent compounds were studied, and two analogues, 14f and 16g, were found to have comparatively better solubility than others tested and acceptable pharmacokinetic properties. This study presents the rediscovery of a nitrofuranyl class of compounds with improved aqueous solubility and acceptable oral PK properties, opening a new direction for further development. PMID:26487909

  16. Ecdysteroids Sensitize MDR and Non-MDR Cancer Cell Lines to Doxorubicin, Paclitaxel, and Vincristine but Tend to Protect Them from Cisplatin

    Directory of Open Access Journals (Sweden)

    Ana Martins

    2015-01-01

    Full Text Available Ecdysteroids, analogs of the insect molting hormone, are known for their various mild, nonhormonal bioactivities in mammals. Previously, we reported that less-polar ecdysteroids can modulate the doxorubicin resistance of a multidrug resistant (MDR mouse lymphoma cell line expressing the human ABCB1 transporter. Here, we describe the ability of 20-hydroxyecdysone (1 and its mono- (2 and diacetonide (3 derivatives to sensitize various MDR and non-MDR cancer cell lines towards doxorubicin, paclitaxel, vincristine, or cisplatin. Drug IC50 values with or without ecdysteroid were determined by MTT assay. Compound 3 significantly sensitized all cell lines to each chemotherapeutic except for cisplatin, whose activity was decreased. In order to overcome solubility and stability issues for the future in vivo administration of compound 3, liposomal formulations were developed. By means of their combination index values obtained via checkerboard microplate method, a formulation showed superior activity to that of compound 3 alone. Because ecdysteroids act also on non-ABCB1 expressing (sensitive cell lines, our results demonstrate that they do not or not exclusively exert their adjuvant anticancer activity as ABCB1 inhibitors, but other mechanisms must be involved, and they opened the way towards their in vivo bioactivity testing against various cancer xenografts.

  17. Why healthcare workers are sick of TB

    Directory of Open Access Journals (Sweden)

    Arne von Delft

    2015-03-01

    Full Text Available Dr Thato Mosidi never expected to be diagnosed with tuberculosis (TB, despite widely prevalent exposure and very limited infection control measures. The life-threatening diagnosis of primary extensively drug-resistant TB (XDR-TB came as an even greater shock. The inconvenient truth is that, rather than being protected, Dr Mosidi and thousands of her healthcare colleagues are at an increased risk of TB and especially drug-resistant TB. In this viewpoint paper we debunk the widely held false belief that healthcare workers are somehow immune to TB disease (TB-proof and explore some of the key factors contributing to the pervasive stigmatization and subsequent non-disclosure of occupational TB. Our front-line workers are some of the first to suffer the consequences of a progressively more resistant and fatal TB epidemic, and urgent interventions are needed to ensure the safety and continued availability of these precious healthcare resources. These include the rapid development and scale-up of improved diagnostic and treatment options, strengthened infection control measures, and focused interventions to tackle stigma and discrimination in all its forms. We call our colleagues to action to protect themselves and those they care for.

  18. Predictors of tuberculosis (TB) and antiretroviral (ARV) medication non-adherence in public primary care patients in South Africa: a cross sectional study.

    Science.gov (United States)

    Naidoo, Pamela; Peltzer, Karl; Louw, Julia; Matseke, Gladys; McHunu, Gugu; Tutshana, Bomkazi

    2013-04-26

    Despite the downward trend in the absolute number of tuberculosis (TB) cases since 2006 and the fall in the incidence rates since 2001, the burden of disease caused by TB remains a global health challenge. The co-infection between TB and HIV adds to this disease burden. TB is completely curable through the intake of a strict anti-TB drug treatment regimen which requires an extremely high and consistent level of adherence.The aim of this study was to investigate factors associated with adherence to anti-TB and HIV treatment drugs. A cross-sectional survey method was used. Three study districts (14 primary health care facilities in each) were selected on the basis of the highest TB caseload per clinic. All new TB and new TB retreatment patients were consecutively screened within one month of anti-tuberculosis treatment. The sample comprised of 3107 TB patients who had been on treatment for at least three weeks and a sub-sample of the total sample were on both anti-TB treatment and anti-retro-viral therapy(ART) (N = 757). Data collection tools included: a Socio-Demographic Questionnaire; a Post-Traumatic-Stress-Disorder (PTSD) Screen; a Psychological Distress Scale; the Alcohol Use Disorder Identification Test (AUDIT); and self-report measures of tobacco use, perceived health status and adherence to anti-TB drugs and ART. The majority of the participants (N = 3107) were new TB cases with a 55.9% HIV co-infection rate in this adult male and female sample 18 years and older. Significant predictors of non-adherence common to both anti-TB drugs and to dual therapy (ART and anti-TB drugs) included poverty, having one or more co-morbid health condition, being a high risk for alcohol mis-use and a partner who is HIV positive. An additional predictor for non-adherence to anti-TB drugs was tobacco use. A comprehensive treatment programme addressing poverty, alcohol mis-use, tobacco use and psycho-social counseling is indicated for TB patients (with and without HIV

  19. Stop TB in My Lifetime: A Call for a World Free of TB - World TB Day 2013

    Centers for Disease Control (CDC) Podcasts

    2012-03-12

    In this podcast Dr. Kenneth Castro, Director of the Division of Tuberculosis Elimination, discusses World TB Day, the 2013 slogan and theme.  Created: 3/12/2012 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 3/13/2012.

  20. The association between ARV and TB drug resistance on TB treatment outcome among Kazakh TB/HIV patients.

    Science.gov (United States)

    Mishkin, Kathryn; Alaei, Kamiar; Alikeyeva, Elmira; Paynter, Christopher; Aringazina, Altyn; Alaei, Arash

    2018-02-26

    TB drug resistance poses a serious threat to the public health of Kazakhstan. This paper presents findings related to TB treatment outcome and drug resistant status among people coinfected with HIV and TB in Kazakhstan. Cohort study using data were provided by the Kazakhstan Ministry of Health's National Tuberculosis Program for 2014 and 2015. Chi-square and logistical regression were performed to understand factors associated with drug resistant TB status and TB treatment outcome. In bivariate analysis, drug resistant status was significantly associated with year of TB diagnosis (p=0.001) viral load (p=0.03). TB treatment outcome was significantly associated with age at diagnosis (p=01), ARV treatment (p <0.0001), and TB drug resistant status (p=0.02). In adjusted analysis, drug resistance was associated with increased odds of successful completion of treatment with successful result compared to treatment failure (OR 6.94, 95% CI: 1.39-34.44) CONCLUSIONS: Our results suggest that being drug resistant is associated with higher odds of completing treatment with successful outcome, even when controlling for receipt of ARV therapy. Copyright © 2018. Published by Elsevier Ltd.

  1. The process behind the expression of mdr-1/P-gp and mrp/MRP in human leukemia/lymphoma.

    Science.gov (United States)

    Hirose, Masao

    2009-04-01

    There is a controversy over the link between phenotypes of multidrug resistance (MDR) and clinical outcome in leukemia/lymphoma patients. This may be because the process behind the induction and loss of expression of genotypes and phenotypes by which MDR develops and the role of MDR in fresh cells of human leukemia/lymphoma are not clearly defined. P-glycoprotein (P-gp) increased and decreased along with mdr-1 expression in three cell lines out of five vincristine (VCR)-resistant cell lines. MRP appeared with increased mrp expression in the other two cell lines. After the drug was removed from the culture system, mdr-1/P-gp changed in parallel with the level of VCR resistance, although mrp and MRP did not. It was concluded that P-gp is directly derived from mdr-1 and that mdr-1/P-gp supports the VCR-resistance but mrp/MRP is not directly linked to the VCR-resistance. These results should contribute to a better understanding of MDR phenomenon in cancer.

  2. Mice heterozygous for the Mdr2 gene demonstrate decreased PEMT activity and diminished steatohepatitis on the MCD diet.

    Science.gov (United States)

    Igolnikov, Alexander C; Green, Richard M

    2006-03-01

    The administration of a methionine and choline deficient (MCD) diet to mice serves as an animal model of NASH. The multidrug resistant 2 (Mdr2) P-glycoprotein encodes for the canalicular phospholipid transporter, and Mdr2 (+/-) mice secrete 40% less phosphatidylcholine than wild-type mice. We have hypothesized that phosphatidylethanolamine-N-methyl transferase (PEMT) up-regulation is a consequence of MCD diet administration, and is important for the pathogenesis of steatohepatitis in this model. However, the effect of decreased phosphatidylcholine secretion and modulation of PEMT on the development of diet-induced steatohepatitis in Mdr2 (+/-) mice has not been explored. Thus, the purpose of the study is to examine the effects of the MCD diet on Mdr2 (+/-) mice. Mdr2 (+/-) and Mdr2 (+/+) mice were treated with an MCD or control diet for up to 30 days, and the severity of steatohepatitis, PEMT activity and hepatic S-adenosylmethionine (SAM), and S-adenosylhomocysteine (SAH) levels were measured. Serum ALT levels, hepatic inflammation, and PEMT activity were significantly lower, and hepatic SAM:SAH ratios were significantly higher in Mdr2 (+/-) mice at 7 and 30 days on the MCD diet. Mdr2 (+/-) mice have diminished susceptibility to MCD diet-induced NASH, which is associated with a relative decrease in PEMT activity and increased SAM:SAH ratios.

  3. TB preventive therapy for people living with HIV: key considerations for scale-up in resource-limited settings.

    Science.gov (United States)

    Pathmanathan, I; Ahmedov, S; Pevzner, E; Anyalechi, G; Modi, S; Kirking, H; Cavanaugh, J S

    2018-06-01

    Tuberculosis (TB) is the leading cause of death for persons living with the human immunodeficiency virus (PLHIV). TB preventive therapy (TPT) works synergistically with, and independently of, antiretroviral therapy to reduce TB morbidity, mortality and incidence among PLHIV. However, although TPT is a crucial and cost-effective component of HIV care for adults and children and has been recommended as an international standard of care for over a decade, it remains highly underutilized. If we are to end the global TB epidemic, we must address the significant reservoir of tuberculous infection, especially in those, such as PLHIV, who are most likely to progress to TB disease. To do so, we must confront the pervasive perception that barriers to TPT scale-up are insurmountable in resource-limited settings. Here we review available evidence to address several commonly stated obstacles to TPT scale-up, including the need for the tuberculin skin test, limited diagnostic capacity to reliably exclude TB disease, concerns about creating drug resistance, suboptimal patient adherence to therapy, inability to monitor for and prevent adverse events, a 'one size fits all' option for TPT regimen and duration, and uncertainty about TPT use in children, adolescents, and pregnant women. We also discuss TPT delivery in the era of differentiated care for PLHIV, how best to tackle advanced planning for drug procurement and supply chain management, and how to create an enabling environment for TPT scale-up success.

  4. Cost-effectiveness of a 12-dose regimen for treating latent tuberculous infection in the United States

    Science.gov (United States)

    Shepardson, D.; Marks, S. M.; Chesson, H.; Kerrigan, A.; Holland, D. P.; Scott, N.; Tian, X.; Borisov, A. S.; Shang, N.; Heilig, C. M.; Sterling, T. R.; Villarino, M. E.; Mac Kenzie, W. R.

    2017-01-01

    SUMMARY SETTING A large randomized controlled trial recently showed that for treating latent tuberculous infection (LTBI) in persons at high risk of progression to tuberculosis (TB) disease, a 12-dose regimen of weekly rifapentine plus isoniazid (3HP) administered as directly observed treatment (DOT) can be as effective as 9 months of daily self-administered isoniazid (9H). OBJECTIVES To assess the cost-effectiveness of 3HP compared to 9H. DESIGN A computational model was designed to simulate individuals with LTBI treated with 9H or 3HP. Costs and health outcomes were estimated to determine the incremental costs per active TB case prevented and per quality-adjusted life year (QALY) gained by 3HP compared to 9H. RESULTS Over a 20-year period, treatment of LTBI with 3HP rather than 9H resulted in 5.2 fewer cases of TB and 25 fewer lost QALYs per 1000 individuals treated. From the health system and societal perspectives, 3HP would cost respectively US$21 525 and $4294 more per TB case prevented, and respectively $4565 and $911 more per QALY gained. CONCLUSIONS 3HP may be a cost-effective alternative to 9H, particularly if the cost of rifapentine decreases, the effectiveness of 3HP can be maintained without DOT, and 3HP treatment is limited to those with a high risk of progression to TB disease. PMID:24200264

  5. Coumpounds affecting cell membrane functions and integrity: MDR pumps and theit exploration

    Czech Academy of Sciences Publication Activity Database

    Sigler, Karel; Gášková, D.

    2002-01-01

    Roč. 51, č. 24 (2002), s. 19-22 ISSN 0137-1398. [Uroczyste Seminarium z okazji urodzin Profesora Stanislawa Witka /70./. Wroclaw, 21.07.2002] R&D Projects: GA AV ČR IBS5020202; GA MŠk ME 577 Keywords : xenobioticexporting * multidrug resistance * mdr pumps Subject RIV: EE - Microbiology, Virology

  6. Monoclonal antibody to an external epitope of the human mdr1 P-glycoprotein

    NARCIS (Netherlands)

    Arceci, R. J.; Stieglitz, K.; Bras, J.; Schinkel, A.; Baas, F.; Croop, J.

    1993-01-01

    A membrane glycoprotein, termed P-glycoprotein, has been shown to be responsible for cross-resistance to a broad range of structurally and functionally distinct cytotoxic agents. P-glycoprotein, encoded in humans by the mdr1 gene, functions as an energy-dependent efflux pump to exclude these

  7. Conserved hydrogen bonds and water molecules in MDR HIV-1 protease substrate complexes

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Zhigang [Wayne State Univ., Detroit, MI (United States); Case Western Reserve Univ., Cleveland, OH (United States); Harbor Hospital Baltimore, MD (United States); Wang, Yong [Wayne State Univ., Detroit, MI (United States); Yedidi, Ravikiran S. [Wayne State Univ., Detroit, MI (United States); National Institutes of Health, Bethesda, MD (United States); Dewdney, Tamaria G. [Wayne State Univ., Detroit, MI (United States); Reiter, Samuel J. [Wayne State Univ., Detroit, MI (United States); Brunzelle, Joseph S. [Northwestern Univ. Feinberg School of Medicine, Chicago, IL (United States); Kovari, Iulia A. [Wayne State Univ., Detroit, MI (United States); Kovari, Ladislau C. [Wayne State Univ., Detroit, MI (United States)

    2012-12-19

    Success of highly active antiretroviral therapy (HAART) in anti-HIV therapy is severely compromised by the rapidly developing drug resistance. HIV-1 protease inhibitors, part of HAART, are losing their potency and efficacy in inhibiting the target. Multi-drug resistant (MDR) 769 HIV-1 protease (resistant mutations at residues 10, 36, 46, 54, 62, 63, 71, 82, 84, 90) was selected for the present study to understand the binding to its natural substrates. The nine crystal structures of MDR769 HIV-1 protease substrate hepta-peptide complexes were analyzed in order to reveal the conserved structural elements for the purpose of drug design against MDR HIV-1 protease. Our structural studies demonstrated that highly conserved hydrogen bonds between the protease and substrate peptides, together with the conserved crystallographic water molecules, played a crucial role in the substrate recognition, substrate stabilization and protease stabilization. Additionally, the absence of the key flap-ligand bridging water molecule might imply a different catalytic mechanism of MDR769 HIV-1 protease compared to that of wild type (WT) HIV-1 protease.

  8. Beyond cellular detoxification: a plethora of physiological roles for MDR transporter homologs in plants

    Science.gov (United States)

    Remy, Estelle; Duque, Paula

    2014-01-01

    Higher plants possess a multitude of Multiple Drug Resistance (MDR) transporter homologs that group into three distinct and ubiquitous families—the ATP-Binding Cassette (ABC) superfamily, the Major Facilitator Superfamily (MFS), and the Multidrug And Toxic compound Extrusion (MATE) family. As in other organisms, such as fungi, mammals, and bacteria, MDR transporters make a primary contribution to cellular detoxification processes in plants, mainly through the extrusion of toxic compounds from the cell or their sequestration in the central vacuole. This review aims at summarizing the currently available information on the in vivo roles of MDR transporters in plant systems. Taken together, these data clearly indicate that the biological functions of ABC, MFS, and MATE carriers are not restricted to xenobiotic and metal detoxification. Importantly, the activity of plant MDR transporters also mediates biotic stress resistance and is instrumental in numerous physiological processes essential for optimal plant growth and development, including the regulation of ion homeostasis and polar transport of the phytohormone auxin. PMID:24910617

  9. 75 FR 59176 - DoD Mandatory Declassification Review (MDR) Program

    Science.gov (United States)

    2010-09-27

    ..., VA 22060-6201. (13) Missile Defense Agency. Missile Defense Agency, Attention: MDA/DS, 7100 Defense... DEPARTMENT OF DEFENSE Office of the Secretary 32 CFR Part 222 [DoD-2010-OS-0043; RIN 0790-AI62] DoD Mandatory Declassification Review (MDR) Program AGENCY: Department of Defense. ACTION: Proposed...

  10. Extensively Drug-Resistant Tuberculosis (XDR TB)

    Science.gov (United States)

    ... TB Reference Laboratory Network, the National TB Surveillance System in the United States, the national reference laboratory of South Korea, and ... capacity in the U.S. and abroad; and Developing education, risk, and media communications ... – United States, 1993–2006 CDC. CDC’s Role in Preventing XDR ...

  11. TB Testing for People Living with HIV

    Centers for Disease Control (CDC) Podcasts

    2012-07-23

    Dr. Kenneth Castro, Director of the Division of Tuberculosis Elimination, explains why it is important for people living with HIV to be tested for TB.  Created: 7/23/2012 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 7/23/2012.

  12. New Treatment Regimen for Latent Tuberculosis Infection

    Centers for Disease Control (CDC) Podcasts

    In this podcast, Dr. Kenneth Castro, Director of the Division of Tuberculosis Elimination, discusses the December 9, 2011 CDC guidelines for the use of a new regimen for the treatment of persons with latent tuberculosis infection.

  13. Carcinogen-induced mdr overexpression is associated with xenobiotic resistance in rat preneoplastic liver nodules and hepatocellular carcinomas.

    Science.gov (United States)

    Fairchild, C R; Ivy, S P; Rushmore, T; Lee, G; Koo, P; Goldsmith, M E; Myers, C E; Farber, E; Cowan, K H

    1987-11-01

    We have previously reported the isolation of a human breast cancer cell line resistant to doxorubicin (adriamycin; AdrR MCF-7 cells) that has also developed the phenotype of multidrug resistance (MDR). MDR in this cell line is associated with increased expression of mdr (P glycoprotein) gene sequences. The development of MDR in AdrR MCF-7 cells is also associated with changes in the expression of several phase I and phase II drug-detoxifying enzymes. These changes are remarkably similar to those associated with development of xenobiotic resistance in rat hyperplastic liver nodules, a well-studied model system of chemical carcinogenesis. Using an mdr-encoded cDNA sequence isolated from AdrR MCF-7 cells, we have examined the expression of mdr sequences in rat livers under a variety of experimental conditions. The expression of mdr increased 3-fold in regenerating liver. It was also elevated (3- to 12-fold) in several different samples of rat hyperplastic nodules and in four of five hepatomas that developed in this system. This suggests that overexpression of mdr, a gene previously associated with resistance to antineoplastic agents, may also be involved in the development of resistance to xenobiotics in rat hyperplastic nodules. In addition, although the acute administration of 2-acetylaminofluorene induced an 8-fold increase in hepatic mdr-encoded RNA, performance of a partial hepatectomy either before or after administration of 2-acetylaminofluorene resulted in a greater than 80-fold increase in mdr gene expression over that in normal untreated livers. This represents an important in vivo model system in which to study the acute regulation of this drug resistance gene.

  14. TB-HIV co-infection among pregnant women in Karnataka, South India: A case series.

    Science.gov (United States)

    Suresh, Shastri; Sharath, Burugina N; Anita, Shet; Lalitha, Ravindra; Prasad, Tripathy J; Rewari, Bharat B

    2016-01-01

    Tuberculosis (TB) is a significant contributor to mortality in HIV-infected patients. Concurrent TB infection is also a significant contributing factor to maternal mortality in human immunodeficiency virus (HIV)-infected pregnant women. Studies addressing the outcomes of TB and HIV co-infection among pregnant women are generally infrequent. Although limited, the records maintained by the Revised National Tuberculosis Control Programme (RNTCP) and the National AIDS Control Programme (NACP) in Karnataka State, Southern India provide information about the numbers of pregnant women who are co-infected with TB and HIV and their pregnancy outcomes. We reviewed the data and conducted this study to understand how TB-HIV co-infection influences the outcomes of pregnancy in this setting. We sought to determine the incidence and treatment and delivery outcomes of TB-HIV co-infected pregnant women in programmatic settings in Karnataka State in southern India. The study participants were all the HIV-infected pregnant women who were screened for tuberculosis under the NACP from 2008 to 2012. For the purposes of this study, the program staff in the field gathered the data regarding on treatment and delivery outcomes of pregnant women. A total of seventeen pregnant women with TB-HIV co-infection were identified among 3,165,729 pregnant women (for an incidence of 5.4 per million pregnancies). The median age of these pregnant women was 24 years, and majority were primiparous women with WHO HIV stage III disease and were on a stavudine-based ART regimen. The maternal mortality rates were 18% before delivery and 24% after delivery. The abortion rate was 24%, and the neonatal mortality rate was 10%. The anti-tuberculosis treatment and anti-retroviral treatment outcome mortality rates were 30% and 53%, respectively. Although the incidence of TB among the HIV-infected pregnant women was marginally less than that among the non-HIV-infected women, the delivery outcomes were relatively

  15. Impact of BCRP/MXR, MRP1 and MDR1/P-Glycoprotein on thermoresistant variants of atypical and classical multidrug resistant cancer cells

    DEFF Research Database (Denmark)

    Stein, Ulrike; Lage, Hermann; Jordan, Andreas

    2002-01-01

    The impact of the ABC transporters breast cancer resistance protein/mitoxantrone resistance associated transporter (BCRP/MXR), multidrug resistance-associated protein 1 (MRP1) and multidrug resistance gene-1/P-glycoprotein (MDR1/PGP) on the multidrug resistance (MDR) phenotype in chemoresistance...... expression of BCRP/MXR and of MRP1 were clearly enhanced (vs. parental and classical MDR lines). MDR1/PGP expression was distinctly elevated in the classical MDR subline EPG85-257RDB (vs. parental and atypical MDR sublines). In all thermoresistant counterparts basal expression of BCRP/MXR, MRP1 and MDR1/PGP...... was increased relative to thermosensitive sublines. Although it could be shown that the overexpressed ABC transporters were functionally active, however, no decreased drug accumulations of doxorubicin, mitoxantrone and rhodamine 123 were observed. Thus, expression of BCRP/MXR, MRP1 and MDR1/PGP was found...

  16. EXSPRESSION OF MDR-GENES AND MONORESISTANCE GENES IN NON-SMALL-CELL LUNG CANCER

    Directory of Open Access Journals (Sweden)

    E. L. Yumov

    2014-01-01

    Full Text Available We studied the expression of multidrug resistance genes (MDR and monoresistance genes in normal bronchial tissue and tumor tissue of the non-small cell lung cancer (NSCLC after neoadjuvant chemotherapy (NACT (vinorelbine-carboplatine. The study included 30 patients with NSCLC (Т2–4N0–3M0. Normal bronchial tissue, normal lung tissue and tumor tissue collected during surgery following neoadjuvant chemotherapy (NACT served as a material of the study. The expression levels of MDR genes (ABCB1, ABCB2, ABCC1, ABCC2, ABCС5, ABCG1, ABCG2, GSTP and MVP, and monoresistance genes (BRCA1, ERCC1, RRM1, TOP1, TOP2A, TUBB3 and TYMS were estimated by quantitative reverse transcriptase PCR (RT-qPCR. The expression levels of some MDR genes and monoresistance genes (АВСВ1, АВСВ2, ABCG1, ERCC1, GSTP1 and MVP were significantly higher in the bronchi than in tumor tissue. The expression of ABCG1, ABCG2 and ERCC1 genes was higher in patients with T1-2 cancer than in patients with T3-4 cancer. Patients with adenocarcinoma had higher expression of BRCA1, MVP and ABCB1 genes than patients with squamous cell lung cancer. A tendency towards reduction in the expression level of MDR-genes and monoresistance genes was observed in patients with partial tumor regression compared to that observed in patients with stable disease. These findings were consistent with the previous data on reduction in the MDR-gene expression after chemotherapy with a good response in breast cancer patients.

  17. HIV-1 integrase inhibitors are substrates for the multidrug transporter MDR1-P-glycoprotein

    Directory of Open Access Journals (Sweden)

    Cara Andrea

    2007-03-01

    Full Text Available Abstract Background The discovery of diketoacid-containing derivatives as inhibitors of HIV-1 Integrase (IN (IN inhibitors, IINs has played a major role in validating this enzyme as an important target for antiretroviral therapy. Since the in vivo efficacy depends on access of these drugs to intracellular sites where HIV-1 replicates, we determined whether the IINs are recognized by the multidrug transporter MDR1-P-glycoprotein (P-gp thereby reducing their intracellular accumulation. To address the effect of IINs on drug transport, nine quinolonyl diketo acid (DKA derivatives active on the HIV-1 IN strand transfer (ST step and with EC50 ranging from 1.83 to >50 μm in cell-based assays were tested for their in vitro interaction with P-gp in the CEM-MDR cell system. IINs were investigated for the inhibition and induction of the P-gp function and expression as well as for multidrug resistance (MDR reversing ability. Results The HIV-1 IINs act as genuine P-gp substrates by inhibiting doxorubicin efflux and inducing P-gp functional conformation changes as evaluated by the modulation of UIC2 mAb epitope. Further, IINs chemosensitize MDR cells to vinblastine and induce P-gp expression in drug sensitive revertants of CEM-MDR cells. Conclusion To our knowledge, this is the first demonstration that HIV-1 IINs are P-gp substrates. This biological property may influence the absorption, distribution and elimination of these novels anti HIV-1 compounds.

  18. Detection of expression and modulation of multidrug-resistance (MDR) and establishment of a new bioassay

    International Nuclear Information System (INIS)

    Berger, W.

    1993-08-01

    The present thesis deals with the resistance of human malignant cells against cellular toxicity of anticancer drugs, a phenomenon representing one of the major obstacles to successful chemotherapy. One mechanism underlying a cross-resistance to different drugs called multidrug resistance (MDR) is characterized by the expression of an active transport protein (P-glycoprotein), causing decreased intracellular drug retention and cytotoxicity. The main subjects of the present work were to establish different detection methods for MDR and its modulation (by substances blocking activity of P-glycoprotein) including immunological methods (immunocytochemistry, radioimmunoassay), molecular biology (slot-blot analysis, in-situ hybridization) and functional assays (drug-accumulation analysis, drug-cytotoxicity analysis). The methods were evaluated and compared using human and mouse MDR control cell lines and human tumor cell lines established in our laboratory. In cell lines derived from human melanoma - a malignancy insensitive to chemotherapy - expression of P-glycoprotein of relatively low transporting activity was detected by different methods in 8 of 33 cases. Furthermore a new sensitive in vitro assay for the functional detection of MDR was established using the biological features of cytochalasins, a microfilament disrupting substance group. These compounds were shown to be substrates for the P-glycoprotein efflux pump and their effects on cell division (blockade of cytokinesis resulting in multinucleate cells) correlated with MDR-activity of the tested cells. With this new assay P-glycoprotein activity can be demonstrated and analysed over a wide range of resistance against different cytotoxic drugs. Therefore it may by a suitable tool for research and diagnosis in the field of drug resistance

  19. Understanding social context on TB cases

    Science.gov (United States)

    Ariyanto, Y.; Wati, D. M.

    2017-01-01

    Tuberculosis (TB) nowadays still becomes one of the world’s deadliest communicable disease. More than half were in South-East Asia and Western Pacific Regions, including Indonesia. As developing country, Indonesia remains classic problems in overcoming TB, that is discontinuation on treatment. Most of discontinuation on treatment among TB patients are affected by diagnostic delay that caused by patient delay. These phenomena occur in many areas, rural to suburb, coastal to plantation, and so on, and they are related with social context among community that could be social capital for each community to deal with TB. Jember as one of county in East Java is known as plantation area. It also has a high prevalence of TB. This study focused on understanding about social context among community, especially on plantation area. This cross-sectional study involved in three districts of Jember, those are Tanggul, Pakusari, and Kalisat. The data were obtained directly from the TB patients, local community, and Primary Health Care (PHC) where the patients recorded. Spatial analysis and social network analysis (SNA) were applied to obtain health seeking behavior pattern among the TB patients coincide the community. Most of TB patients had already chosen health professionals to lead the treatment, although some of them remained to choose self-medication. Meanwhile, SNA showed that religious leader was considered as main part of countermeasures of TB. But they didn’t ever become central figures. So it can be concluded that there are other parts among community who can contribute due to combatting on TB.

  20. HIV/TB co-infection:perspectives of TB patients and providers on the integrated HIV/TB pilot program in Tamilnadu, India

    OpenAIRE

    Lakshminarayanan, Mahalakshmi

    2009-01-01

    The WHO recommends routine HIV testing among TB patients as a key strategy to combat the dual HIV/TB epidemic. India has integrated its HIV and TB control programs and is offering provider initiated HIV testing for all TB patients since 2007. Using a mixed methods approach, this study aims to understand the perspectives of TB patients and providers on the integrated HIV/TB pilot program in Tamilnadu, India. A survey conducted by the Tuberculosis Research Center, India on 300 TB patients is th...

  1. Frequency of the MDR1 mutant allele associated with multidrug sensitivity in dogs from Brazil

    Directory of Open Access Journals (Sweden)

    Monobe MM

    2015-04-01

    Full Text Available Marina M Monobe,1 João P Araujo Junior,2 Kari V Lunsford,3 Rodrigo C Silva,4 Camilo Bulla41Department of Veterinary Clinics, School of Veterinary Medicine and Animal Science, 2Department of Microbiology and Immunology, Biosciences Institute, Sao Paulo State University (UNESP, Botucatu, Brazil; 3Department of Clinical Sciences and Animal Health Center, 4Department of Pathobiology and Population Medicine, College of Veterinary Medicine, Mississippi State University, Mississippi, MS, USAAbstract: To date, a 4-bp deletion in the MDR1 gene has been detected in more than ten dog breeds, as well as in mixed breed dogs, in several countries, however information regarding this mutation in dogs from Brazil is lacking. For this reason, 103 Collies, 77 Border Collies, 76 Shetland Sheepdogs, 20 Old English Sheepdogs, 55 German Shepherds, 16 Australian Shepherds, and 53 Whippets from Brazil were screened for the presence of the mutation. The heterozygous mutated genotype, MDR1 (+/−, frequency found for Collies, Australian Shepherd, and Shetland Sheepdog was 50.5% (95% CI =41.1%–59.9%, 31.3% (95% CI =8.6%–53.2%, and 15.8% (95% CI =7.7%–23.9%, respectively. Homozygous mutated genotype, MDR1 (−/−, was detected only in Collies 35.9%. The MDR1 allele mutant frequency found for Collies, Australian Shepherd, and Shetland Sheepdog was 61.2% (95% CI =54.8%–67.5%, 15.6% (95% CI =3.1%–28.2%, and 7.9% (95% CI =3.7%–12.1%, respectively. Additionally, even free of the mutant allele, the maximum mutant prevalence (MMP in that population, with 95% CI, was 3.8%, 5.2%, 5.4%, and 13.8% for Border Collies, German Shepherds, Whippets, and Old English Sheepdogs, respectively. In this way, this information is important, not only for MDR1 genotype-based breeding programs and international exchange of breeding animals of predisposed breeds, but also for modification of drug therapy for breeds at risk.Keywords: P-glycoprotein, MDR1 mutation, ivermectin, dog, drug

  2. A pivotal registration phase III, multicenter, randomized tuberculosis controlled trial: design issues and lessons learnt from the Gatifloxacin for TB (OFLOTUB project

    Directory of Open Access Journals (Sweden)

    Merle Corinne SC

    2012-05-01

    Full Text Available Abstract Background There have been no major advances in tuberculosis (TB drug development since the first East African/British Medical Research Council short course chemotherapy trial 35 years ago. Since then, the landscape for conducting TB clinical trials has profoundly changed with the emergence of HIV infection, the spread of resistant TB bacilli strains, recent advances in mycobacteriological capacity, and drug discovery. As a consequence questions have arisen on the most appropriate approach to design and conduct current TB trials. To highlight key issues discussed: Is a superiority, equivalence, or non-inferiority design most appropriate? What should be the primary efficacy outcome? How to consider re-infections in the definition of the outcome? What is the optimal length of patient follow-up? Is blinding appropriate when treatment duration in test arm is shorter? What are the appropriate assumptions for sample size calculation? Methods Various drugs are currently in the development pipeline. We are presenting in this paper the design of the most recently completed phase III TB trial, the OFLOTUB project, which is the pivotal trial of a registration portfolio for a gatifloxacin-containing TB regimen. It is a randomized, open-label, multicenter, controlled trial aiming to evaluate the efficacy and safety of a gatifloxacin-containing 4-month regimen (trial registration: ClinicalTrial.gov database: NCT00216385. Results In the light of the recent scientific and regulatory discussions, we discuss some of the design issues in TB clinical trials and more specifically the reasons that guided our choices, in order to best answer the trial objectives, while at the same time satisfying regulatory authority requirements. Conclusion When shortening TB treatment, we are advocating for a non-inferiority, non-blinded design, with a composite unfavorable endpoint assessed 12 months post treatment completion, and added trial procedures specifically

  3. Prophylactic antibiotic regimens in tumour surgery (PARITY)

    DEFF Research Database (Denmark)

    Petersen, Michael Mørk; Hettwer, Werner H; Grum-Schwensen, Tomas

    2015-01-01

    -day regimen of post-operative antibiotics, in comparison to a 24-hour regimen, decreases surgical site infections in patients undergoing endoprosthetic reconstruction for lower extremity primary bone tumours. METHODS: We performed a pilot international multi-centre RCT. We used central randomisation...... to conceal treatment allocation and sham antibiotics to blind participants, surgeons, and data collectors. We determined feasibility by measuring patient enrolment, completeness of follow-up, and protocol deviations for the antibiotic regimens. RESULTS: We screened 96 patients and enrolled 60 participants......% at one year (the remainder with partial data or pending queries). In total, 18 participants missed at least one dose of antibiotics or placebo post-operatively, but 93% of all post-operative doses were administered per protocol. CONCLUSIONS: It is feasible to conduct a definitive multi-centre RCT of post...

  4. Prevalence of multidrug resistance among retreatment pulmonary tuberculosis cases in a tertiary care hospital, Hyderabad, India

    Directory of Open Access Journals (Sweden)

    Subhakar Kandi

    2013-01-01

    Full Text Available Background: India is one of the high tuberculosis (TB burden countries in the world. India ranks second in harboring multi drug resistant (MDR-TB cases. About 50,000 of MDR cases are recorded in retreatment pulmonary TB cases. This study was conducted in a tertiary care facility (Government General and Chest Hospital in Hyderabad, India. Objectives: Toassess: Proportion of the TB patients having MDR-TB at the initiation of retreatment regimen; the prevalence of isoniazid (INH resistance in this geographical area. Materials and Methods: An analytical, observational, prospective cohort study of patients attending the out-patient department from December 2010 to March 2011. Results: Sputum samples from 100 patients were subjected to acid fast bacilli (AFB culture and drug sensitivity testing. Of these, 28 (28% were MDR-TB, 42 (42% were non-MDR-TB and 39% being INH resistance. Conclusions: In conclusion, one third of the retreatment pulmonary TB cases attending a tertiary care institute for TB will be MDR-TB at the initiation of treatment and there is a need to include ethambutol in the continuation phase of new TB case treatment in view of high INH resistance.

  5. Magnetic properties of ball-milled TbFe2 and TbFe2B

    Indian Academy of Sciences (India)

    Unknown

    1. Introduction. The RFe2 (R = rare earth) Laves phase compounds are known to possess large cubic anisotropy (Clark et al 1972) and highest Curie temperature (TC) of all RT2 compounds. (T = transition metal). RFe2 ... TbFe2 and TbFe2B were prepared by arc melting the high pure elements (Tb and B, 99⋅9% purity; Fe, ...

  6. Host markers in Quantiferon supernatants differentiate active TB from latent TB infection: preliminary report

    Directory of Open Access Journals (Sweden)

    Walzl Gerhard

    2009-05-01

    Full Text Available Abstract Background Interferon gamma release assays, including the QuantiFERON® TB Gold In Tube (QFT have been shown to be accurate in diagnosing Mycobacterium tuberculosis infection. These assays however, do not discriminate between latent TB infection (LTBI and active TB disease. Methods We recruited twenty-three pulmonary TB patients and 34 household contacts from Cape Town, South Africa and performed the QFT test. To investigate the ability of new host markers to differentiate between LTBI and active TB, levels of 29 biomarkers in QFT supernatants were evaluated using a Luminex multiplex cytokine assay. Results Eight out of 29 biomarkers distinguished active TB from LTBI in a pilot study. Baseline levels of epidermal growth factor (EGF soluble CD40 ligand (sCD40L, antigen stimulated levels of EGF, and the background corrected antigen stimulated levels of EGF and macrophage inflammatory protein (MIP-1β were the most informative single markers for differentiation between TB disease and LTBI, with AUCs of 0.88, 0.84, 0.87, 0.90 and 0.79 respectively. The combination of EGF and MIP-1β predicted 96% of active TB cases and 92% of LTBIs. Combinations between EGF, sCD40L, VEGF, TGF-α and IL-1α also showed potential to differentiate between TB infection states. EGF, VEGF, TGF-α and sCD40L levels were higher in TB patients. Conclusion These preliminary data suggest that active TB may be accurately differentiated from LTBI utilizing adaptations of the commercial QFT test that includes measurement of EGF, sCD40L, MIP-1β, VEGF, TGF-α or IL-1α in supernatants from QFT assays. This approach holds promise for development as a rapid diagnostic test for active TB.

  7. The Role of Adjunctive Therapies in Septic Shock by Gram Negative MDR/XDR Infections.

    Science.gov (United States)

    Busani, Stefano; Roat, Erika; Serafini, Giulia; Mantovani, Elena; Biagioni, Emanuela; Girardis, Massimo

    2017-01-01

    Patients with septic shock by multidrug resistant microorganisms (MDR) are a specific sepsis population with a high mortality risk. The exposure to an initial inappropriate empiric antibiotic therapy has been considered responsible for the increased mortality, although other factors such as immune-paralysis seem to play a pivotal role. Therefore, beyond conventional early antibiotic therapy and fluid resuscitation, this population may benefit from the use of alternative strategies aimed at supporting the immune system. In this review we present an overview of the relationship between MDR infections and immune response and focus on the rationale and the clinical data available on the possible adjunctive immunotherapies, including blood purification techniques and different pharmacological approaches.

  8. The Role of Adjunctive Therapies in Septic Shock by Gram Negative MDR/XDR Infections

    Directory of Open Access Journals (Sweden)

    Stefano Busani

    2017-01-01

    Full Text Available Patients with septic shock by multidrug resistant microorganisms (MDR are a specific sepsis population with a high mortality risk. The exposure to an initial inappropriate empiric antibiotic therapy has been considered responsible for the increased mortality, although other factors such as immune-paralysis seem to play a pivotal role. Therefore, beyond conventional early antibiotic therapy and fluid resuscitation, this population may benefit from the use of alternative strategies aimed at supporting the immune system. In this review we present an overview of the relationship between MDR infections and immune response and focus on the rationale and the clinical data available on the possible adjunctive immunotherapies, including blood purification techniques and different pharmacological approaches.

  9. Prevalence of resistance to second-line tuberculosis drug among multidrug-resistant tuberculosis patients in Viet Nam, 2011.

    Science.gov (United States)

    Nguyen, Hoa Binh; Nguyen, Nhung Viet; Tran, Huong Thi Giang; Nguyen, Hai Viet; Bui, Quyen Thi Tu

    2016-01-01

    Extensively drug-resistant tuberculosis (XDR-TB) represents an emerging public health problem worldwide. According to the World Health Organization, an estimated 9.7% of multidrug-resistant TB (MDR-TB) cases are defined as XDR-TB globally. The objective of this study was to determine the prevalence of drug resistance to second-line TB drugs among MDR-TB cases detected in the Fourth National Anti-Tuberculosis Drug Resistance Survey in Viet Nam. Eighty clusters of TB cases were selected using a probability-proportion-to-size approach. To identify MDR-TB cases, drug susceptibility testing (DST) was performed for the four major first-line TB drugs. DST of second-line drugs (ofloxacin, amikacin, kanamycin, capreomycin) was performed on isolates from MDR-TB cases to identify pre-XDR and XDR cases. A total of 1629 smear-positive TB cases were eligible for culture and DST. Of those, DST results for first-line drugs were available for 1312 cases, and 91 (6.9%) had MDR-TB. Second-line DST results were available for 84 of these cases. Of those, 15 cases (17.9%) had ofloxacin resistance and 6.0% were resistant to kanamycin and capreomycin. Five MDR-TB cases (6.0%) met the criteria of XDR-TB. This survey provides the first estimates of the proportion of XDR-TB among MDR-TB cases in Viet Nam and provides important information for local policies regarding second-line DST. Local policies and programmes that are geared towards TB prevention, early diagnosis and treatment with effective regimens are of high importance.

  10. Efficacy and Safety of a Colistin Loading Dose, High-Dose Maintenance Regimen in Critically Ill Patients With Multidrug-Resistant Gram-Negative Pneumonia.

    Science.gov (United States)

    Elefritz, Jessica L; Bauer, Karri A; Jones, Christian; Mangino, Julie E; Porter, Kyle; Murphy, Claire V

    2017-09-01

    Emergence of multidrug-resistant (MDR) gram-negative (GN) pathogens and lack of novel antibiotics have increased the use of colistin, despite unknown optimal dosing. This study aimed to evaluate the safety and efficacy of a colistin loading dose, high-dose (LDHD) maintenance regimen in patients with MDR-GN pneumonia. A retrospective cohort analysis was performed comparing critically ill patients with MDR-GN pneumonia pre- and postimplementation of a colistin LDHD guideline with a primary outcome of clinical cure. Safety was assessed using incidence of acute kidney injury (AKI) based on RIFLE (risk, injury, failure, loss, end-stage renal disease) criteria. Seventy-two patients met the inclusion criteria (42 preimplementation and 30 postimplementation). Clinical cure was achieved in 23 (55%) patients in the preimplementation group and 20 (67%) patients in the postimplementation group ( P = .31). AKI occurred in 50% of the patients during the preimplementation period and 58% during the postimplementation period ( P = .59) with no difference in initiation rates of renal replacement therapy. The increased clinical cure rate after implementation of the colistin LDHD guideline did not reach statistical significance. The LDHD guideline, however, was not associated with an increased incidence of AKI, despite higher intravenous colistin doses. Opportunity exists to optimize colistin dosage while balancing toxicity, but larger studies are warranted.

  11. Providing an address for delivery of nanoencapsulated TB drugs

    CSIR Research Space (South Africa)

    Lemmer, Yolandy

    2010-06-01

    Full Text Available compliance and drug resistance pose a great challenge to TB treatment programs worldwide. To improve the current inadequate therapeutic management of TB, a polymeric anti-TB nanodrug delivery system, for anti-TB drugs, was developed that could enable entry...

  12. HIV-Associated TB: Facts 2013

    Science.gov (United States)

    ... 2012 . Around 75% of these people live in sub-Saharan Africa.  TB is the leading cause of death among ... adopted by policy makers and implemented by all health facilities offering HIV care services.  The number of ...

  13. Thermally stimulated properties in ZnSe:Tb and ZnSe:(Mn, Tb) phosphors

    Science.gov (United States)

    Mishra, A. K.; Mishra, S. K.; Pandey, S. P.; Lakshmi Mishra, Kshama

    2018-02-01

    Thermoluminescence studies were performed of ZnSe:Tb and ZnSe:(Mn, Tb) phosphors. A method of preparation for ZnSe phosphors doped with Tb and (Mn, Tb) has been discussed. The thermoluminescence (TL) properties of these phosphors have been studied from 100 to 370 K temperature after exciting by UV radiation (365 nm) at three uniform heating rates 0.4, 0.6 and 0.9 K/s. The trapping parameters like trap depth, lifetime of electrons and capture cross-section have also been determined using various methods.

  14. Isolation and in vitro evaluation of bacteriophages against MDR-bacterial isolates from septic wound infections.

    Directory of Open Access Journals (Sweden)

    Roja Rani Pallavali

    Full Text Available Multi-drug resistance has become a major problem for the treatment of pathogenic bacterial infections. The use of bacteriophages is an attractive approach to overcome the problem of drug resistance in several pathogens that cause fatal diseases. Our study aimed to isolate multi drug resistant bacteria from patients with septic wounds and then isolate and apply bacteriophages in vitro as alternative therapeutic agents. Pus samples were aseptically collected from Rajiv Gandhi Institute of Medical Science (RIMS, Kadapa, A.P., and samples were analyzed by gram staining, evaluating morphological characteristics, and biochemical methods. MDR-bacterial strains were collected using the Kirby-Bauer disk diffusion method against a variety of antibiotics. Bacteriophages were collected and tested in vitro for lytic activity against MDR-bacterial isolates. Analysis of the pus swab samples revealed that the most of the isolates detected had Pseudomonas aeruginosa as the predominant bacterium, followed by Staphylococcus aureus, Klebsiella pneumoniae and Escherichia coli. Our results suggested that gram-negative bacteria were more predominant than gram-positive bacteria in septic wounds; most of these isolates were resistant to ampicillin, amoxicillin, penicillin, vancomycin and tetracycline. All the gram-positive isolates (100% were multi-drug resistant, whereas 86% of the gram-negative isolates had a drug resistant nature. Further bacteriophages isolated from sewage demonstrated perfect lytic activity against the multi-drug resistant bacteria causing septic wounds. In vitro analysis of the isolated bacteriophages demonstrated perfect lysis against the corresponding MDR-bacteria, and these isolated phages may be promising as a first choice for prophylaxis against wound sepsis, Moreover, phage therapy does not enhance multi-drug resistance in bacteria and could work simultaneously on a wide variety of MDR-bacteria when used in a bacteriophage cocktail. Hence

  15. Glucose-induced MDR pump resynthesis in respiring yeast cells depends on nutrient level

    Czech Academy of Sciences Publication Activity Database

    Maláč, J.; Sigler, Karel; Gášková, D.

    -, č. 337 (2005), s. 138-141 ISSN 0006-291X R&D Projects: GA ČR GD204/03/H066; GA ČR GP202/04/P110 Grant - others:GA FRVŠ FRVS 555/2005/G3 Institutional research plan: CEZ:AV0Z50200510 Keywords : MDR pumps * yeast * fluorimetric assay Subject RIV: EE - Microbiology, Virology Impact factor: 3.000, year: 2005

  16. Immunomodulation by vitamin D: implications for TB

    OpenAIRE

    Chun, Rene F; Adams, John S; Hewison, Martin

    2011-01-01

    TB remains a major cause of mortality throughout the world. Low vitamin D status has been linked to increased risk of TB and other immune disorders. These observations suggest a role for vitamin D as a modulator of normal human immune function. This article will detail the cellular and molecular mechanisms by which vitamin D regulates the immune system and how vitamin D insufficiency may lead to immune dysregulation. The importance of vitamin D bioavailability as a mechanism for defining the ...

  17. Outcomes after chemotherapy with WHO category II regimen in a population with high prevalence of drug resistant tuberculosis.

    Directory of Open Access Journals (Sweden)

    Francine Matthys

    Full Text Available Standard short course chemotherapy is recommended by the World Health Organization to control tuberculosis worldwide. However, in settings with high drug resistance, first line standard regimens are linked with high treatment failure. We evaluated treatment outcomes after standardized chemotherapy with the WHO recommended category II retreatment regimen in a prison with a high prevalence of drug resistant tuberculosis (TB. A cohort of 233 culture positive TB patients was followed through smear microscopy, culture, drug susceptibility testing and DNA fingerprinting at baseline, after 3 months and at the end of treatment. Overall 172 patients (74% became culture negative, while 43 (18% remained positive at the end of treatment. Among those 43 cases, 58% of failures were determined to be due to treatment with an inadequate drug regimen and 42% to either an initial mixed infection or re-infection while under treatment. Overall, drug resistance amplification during treatment occurred in 3.4% of the patient cohort. This study demonstrates that treatment failure is linked to initial drug resistance, that amplification of drug resistance occurs, and that mixed infection and re-infection during standard treatment contribute to treatment failure in confined settings with high prevalence of drug resistance.

  18. Screening of Antibacterial MDR derived from Sponge Associated Fungus of Riung Water, Nusa Tenggara Timur

    Directory of Open Access Journals (Sweden)

    Khoeruddin Wittriansyah

    2016-12-01

    Full Text Available Marine sponge-associated fungi are the sources of bioactive compounds with various pharmacologicals potency. This study aimed to isolate the sponge-associated fungi as the producer of the MDR anti-bacterial compounds.  The associated fungi were isolated from the sponges collected from Riung water, Nusa Tenggara Timur. Five of the best isolates were cultured on MEA to obtain the methanolic extract for further studies.  The antagonistic test was conducted using overlay method towards the MDR Staphylococcus aureus and Escherichia coli. A total of 33 fungi were isolated from 19 sponge specimens. The antagonistic test showed that 19 isolates were active against both S. aureus and E. coli, and 13 of them were merely active against one of the bacteria. However, only five isolates have strong activity against one or both of the bacteria.  The KN-15-3 had the strongest activity against S. aureus (18.75±0.777mm and E. coli (15.10±0.141mm at the concentration of 400 μg.disc-1 so it can be developed further as a source of drug candicate.   Keywords: Fungi symbiont, Sponges, MDR Antibacterial, Staphylococcus aureus,  Escherichia coli.

  19. Subdivision of the MDR superfamily of medium-chain dehydrogenases/reductases through iterative hidden Markov model refinement

    Directory of Open Access Journals (Sweden)

    Persson Bengt

    2010-10-01

    Full Text Available Abstract Background The Medium-chain Dehydrogenases/Reductases (MDR form a protein superfamily whose size and complexity defeats traditional means of subclassification; it currently has over 15000 members in the databases, the pairwise sequence identity is typically around 25%, there are members from all kingdoms of life, the chain-lengths vary as does the oligomericity, and the members are partaking in a multitude of biological processes. There are profile hidden Markov models (HMMs available for detecting MDR superfamily members, but none for determining which MDR family each protein belongs to. The current torrential influx of new sequence data enables elucidation of more and more protein families, and at an increasingly fine granularity. However, gathering good quality training data usually requires manual attention by experts and has therefore been the rate limiting step for expanding the number of available models. Results We have developed an automated algorithm for HMM refinement that produces stable and reliable models for protein families. This algorithm uses relationships found in data to generate confident seed sets. Using this algorithm we have produced HMMs for 86 distinct MDR families and 34 of their subfamilies which can be used in automated annotation of new sequences. We find that MDR forms with 2 Zn2+ ions in general are dehydrogenases, while MDR forms with no Zn2+ in general are reductases. Furthermore, in Bacteria MDRs without Zn2+ are more frequent than those with Zn2+, while the opposite is true for eukaryotic MDRs, indicating that Zn2+ has been recruited into the MDR superfamily after the initial life kingdom separations. We have also developed a web site http://mdr-enzymes.org that provides textual and numeric search against various characterised MDR family properties, as well as sequence scan functions for reliable classification of novel MDR sequences. Conclusions Our method of refinement can be readily applied to

  20. Effect of pO2 on antitumor drug cytotoxicity on MDR and non-MDR variants selected from the LoVo metastatic colon carcinoma cell line.

    Science.gov (United States)

    Lelong-Rebel, Isabelle; Brisson, Christine; Fabre, Michel; Bergerat, Jean-Pierre; Rebel, Gérard

    2008-01-01

    Two chemosensitive cell lines, LoVo-fusoid (LoVo-f) and LoVo-small cells (LoVo-sc) were derived from the original LoVo cell line. These two variants and the multidrug-resistant (MDR) cell line LoVo-Dox were screened for various properties. In non-permeabilized cells, only LoVo-sc showed mucin-2 staining whereas labelling was positive in all permeabilized cell lines. As shown by electron microscopy screening and by relative resistance to trypsin detachment, only LoVo-sc cells showed strong mucus secretion. All three cell lines displayed strong staining for P-glycoprotein (P-gp), multidrug resistance-associated protein (MRP) and lung-resistance-related protein (LRP) in different locations according to the drug resistance state. The three cell lines showed intracellular labelling of LRP and MRP. The sensitive cells showed P-gp in a large perinuclear ring and in the cytoplasm, but little (LoVo-sc cells) or no staining (LoVo-f cells) was shown at the plasma membrane level. For the Lovo-Dox cells, P-gp was located in the plasma membrane, in cellular anchorages and in the cytoplasm as well. Cell resistance against antineoplastic agents often results from mobilization of various factors, the modulation of which is linked to the culture conditions. As most of the protocols utilize cells growing in (air + 5-10% CO2) atmosphere e.g. 20% O2, balance of the respective participants in the MDR multi-modal mechanism may not be representative of the in vivo situation and may lead to erratic pharmacological response. Indeed, cells within solid tumours were exposed to low pO2, most of them being under hypoxic condition (0.1-5% O2). In the absence of anticancer drugs, all LoVo cell lines grew notably faster at 20% O2 than at 5% O2. Moreover, respective sensitivities of both non-MDR variants to doxorubicin were altered according the pO2. Whatever the pO2 was, virtually none of the antioxidants tested affected the cytotoxic activity of doxorubicin for the three cell lines. By contrast

  1. Non-clinical efficacy and safety of HyVac4:IC31 vaccine administered in a BCG prime-boost regimen.

    Science.gov (United States)

    Skeiky, Yasir A W; Dietrich, Jes; Lasco, Todd M; Stagliano, Katherine; Dheenadhayalan, Veerabadran; Goetz, Margaret Ann; Cantarero, Luis; Basaraba, Randall J; Bang, Peter; Kromann, Ingrid; McMclain, J Bruce; Sadoff, Jerald C; Andersen, Peter

    2010-01-22

    Despite the extensive success with the introduction of M. bovis Bacille Calmette-Guérin (BCG), tuberculosis (TB) remains a major global epidemic infecting between 8 and 9 million people annually with an estimated 1.7 million deaths each year. However, because of its demonstrated effectiveness against some of the most severe forms of childhood TB, it is now realized that BCG vaccination of newborns is unlikely to be replaced. Therefore, BCG or an improved BCG will continue to be used as a prime TB vaccine and there is a need to develop effective boost vaccines that would enhance and prolong the protective immunity induced by BCG prime immunization. We report on a heterologous booster approach using two highly immunogenic TB antigens comprising Ag85B and TB10.4 (HyVac4) delivered as a fusion molecule and formulated in the proprietary adjuvant IC31. This vaccine was found to be immunogenic and demonstrated greater protection in the more stringent guinea pig model of pulmonary tuberculosis than BCG alone when used in a prime/boost regimen. Significant difference in lung involvement was observed for all animals in the HyVac4 boosted group compared to BCG alone regardless of time to death or sacrifice. A vaccine toxicology study of the HyVac4:IC31 regimen was performed and it was judged safe to advance the vaccine into clinical trials. Therefore, all non-clinical data supports the suitability of HyVac4 as a safe, immunogenic, and effective vaccination in a prime-boost regimen with BCG.

  2. Association between MDR1 gene polymorphisms and the risk of Crohn's disease in a cohort of Algerian pediatric patients.

    Science.gov (United States)

    Bouzidi, Amira; Mesbah-Amroun, Hamida; Boukercha, Aziza; Benhassine, Fadila; Belboueb, Réda; Berkouk, Karima; Messadi, Wassila; Touil-Boukoffa, Chafia

    2016-12-01

    The multi-drug resistance gene (MDR1) has raised increasing interest as a susceptibility gene for Crohn's disease (CD). The role of MDR1 single-nucleotide polymorphisms (SNPs) in the predisposition and behavior of CD in the pediatric population is still elusive. Here, we investigated whether SNPs in MDR1 are associated with CD in Algerian pediatric patients. A case-control study was conducted enrolling 47 pediatric CD patients and 100 controls. All subjects were genotyped for the most common MDR1 SNPs (C3434T, C1236T, and G2677A/T) using PCR-RFLP method. We also explored the association between polymorphisms and clinical sub-phenotypes. We have detected no significant association of C3435T SNP and pediatric CD. However, we observed a significantly higher frequency of the risk alleles, 1236T and 2677T/A among the CD patients compared to controls. Moreover, the risk allele 1236T was associated to a higher risk for resective surgery. Our data suggest that the C1236T and G2677A/T SNPs in the MDR1 gene are associated with CD and the C1236T risk allele with a more severe course of disease in Algerian pediatric patients. Further analysis using larger patients group and functional studies would be interesting to elucidate the role of MDR1 gene in pediatric CD.Pediatric Research (2016); doi:10.1038/pr.2016.163.

  3. [Polymorphisms of the multiple drug resistance gene (MDR1) in Mapuche, Mestizo and Maori populations in Chile].

    Science.gov (United States)

    Wielandt, Ana María; Vollrath, Valeska; Chianale, José

    2004-09-01

    There are significant differences in drug responses among different ethnic groups. The multidrug transporter P-gp, encoded by the MDR1 gene, plays a key role in determining drug bioavailability, and an association between a polymorphism in exon 26 (C3435T) and lower P-gp expression has been found. The co-segregation of this polymorphism with the polymorphism in exon 12 (C1236T) and in exon 21 (G2677T/A) determines several MDR1 haplotypes in humans. To characterize the polymorphisms of exons 26, 21 and 12 of the MDR1 gene in different Chilean populations. Using a polymerase chain reaction and restriction fragment length polymorphism technique, we studied the allelic frequencies and the distribution of MDR1 haplotypes in 3 Chilean populations: Mestizo (n=104), Mapuche (n=96, living in the National Reservation of the Huapi Island, Ranico Lake) and Maori (n=52, living in Eastern Island). The frequency of the normal MDR1*1 haplotype, without mutations, was lower in Mapuches than in Mestizos or Maoris (p0.0.5), but lower than the frequencies reported in Caucasians or Asians (p<0.05). We found significant differences in the frequencies of genetic polymorphisms of the MDR1 gene in Chilean populations, related to the ethnic origins of our ancestors.

  4. Non-adherence to anti-TB drugs among TB/HIV co-infected patients ...

    African Journals Online (AJOL)

    Non-adherence to anti-TB drugs among TB/HIV co-infected patients in Mbarara Hospital ... and its associated factors have not been studied in these patients in Uganda. ... Methods: A cross-sectional study with qualitative and quantitative data ...

  5. tb diagnostics challenges of tb diagnosis and treatment in south africa

    African Journals Online (AJOL)

    2007-06-01

    Jun 1, 2007 ... 45 currently provides treatment to 3 000 patients. Eighty-nine per cent of those accessing ART have symptomatic HIV disease. (WHO clinical stage 3 and 4) with a median CD4 cell count of. 95 cells/µl. More than 50% have a history of prior completed. TB treatment, 15% are on current TB treatment, 11% are.

  6. Integration of TB and ART services fails to improve TB treatment ...

    African Journals Online (AJOL)

    The median CD4+ count of HIV-positive patients was 152 cells/μl (interquartile range (IQR) 71 - 277) for integrated facilities and 148 cells/μl (IQR 67 - 260) for single-service facilities. There was no statistical difference in the TB treatment outcome profile between integrated and single-service facilities for all TB patients (p=0.

  7. The role of antiretroviral therapy in reducing TB incidence and mortality in high HIV-TB burden countries

    Directory of Open Access Journals (Sweden)

    Anthony D Harries

    2016-03-01

    Full Text Available With the adoption of the new Sustainable Development Goals in 2016, all countries have committed to end the tuberculosis (TB epidemic by 2030, defined as dramatic reductions in TB incidence and mortality combined with zero TB-induced catastrophic costs for families. This paper explores how antiretroviral therapy (ART in high HIV-TB burden countries may help in reducing TB incidence and mortality and thus contribute to the ambitious goal of ending TB. ART in people living with HIV has a potent TB preventive effect, with this being most apparent in those with the most advanced immunodeficiency. Early ART also significantly reduces the risk of TB, and with new World Health Organization guidance released in 2015 about initiating ART in all persons living with HIV irrespective of CD4 count, there is the potential for enormous benefit at the population level. Already, several countries with high HIVTB burdens have seen dramatic declines in TB case notification rates since ART scale up started in 2004. In patients already diagnosed with HIV-associated TB, mortality can be significantly decreased by ART, especially if started within 2–8 weeks of anti-TB treatment. The benefits of ART on TB incidence and TB mortality can be further augmented respectively by the addition of isoniazid preventive therapy and cotrimoxazole preventive therapy. These interventions must be effectively implemented and scaled up in order to end the TB epidemic by 2030.

  8. Magnetic properties of TbTiGe

    International Nuclear Information System (INIS)

    Prokes, K.; Tegus, O.; Brueck, E.; Gortenmulder, T.J.; Boer, F.R. de; Buschow, K.H.J.

    2001-01-01

    We have studied the magnetic properties of the compound TbTiGe by means of neutron diffraction in the temperature range 1.7-310 K. We also report on magnetization measurements made at different temperatures and fields. The compound TbTiGe adopts the tetragonal CeFeSi-structure type and orders antiferromagnetically at T N =286 K. The structure is collinear antiferromagnetic in the whole temperature range below T N , with the magnetic moments aligned along the tetragonal c-axis. The uncommon shape of the temperature dependence of the magnetization observed in our sample is attributed to small amounts of the ferromagnetic low-temperature modification of TbTiGe

  9. Multi-quasiparticle excitations in 145Tb

    International Nuclear Information System (INIS)

    Zheng Yong; Zhou Xiaohong; Zhang Yuhu; Liu Minliang; Guo Yingxiang; Lei Xiangguo; Kusakari, H.; Sugawara, M.

    2004-01-01

    High-spin states in 145 Tb have been populated using the 118 Sn( 32 S, 1p4n) reaction at a beam energy of 165 MeV. The level scheme of 145 Tb has been established for the first time. The level scheme shows characteristics of spherical or slightly oblate nucleus. Based on the systematic trends of the level structure in the neighboring N=80 isotones, the level structure in 145 Tb below 2 MeV excitation is well explained by coupling an h 11/2 valence proton to the even-even 144 Gd core. Above 2 MeV excitation, most of the yrast levels are interpreted with multi-quasiparticle shell-model configurations. (authors)

  10. Functional evidence of multidrug resistance transporters (MDR in rodent olfactory epithelium.

    Directory of Open Access Journals (Sweden)

    Adrien Molinas

    Full Text Available P-glycoprotein (Pgp and multidrug resistance-associated protein (MRP1 are membrane transporter proteins which function as efflux pumps at cell membranes and are considered to exert a protective function against the entry of xenobiotics. While evidence for Pgp and MRP transporter activity is reported for olfactory tissue, their possible interaction and participation in the olfactory response has not been investigated.Functional activity of putative MDR transporters was assessed by means of the fluorometric calcein acetoxymethyl ester (calcein-AM accumulation assay on acute rat and mouse olfactory tissue slices. Calcein-AM uptake was measured as fluorescence intensity changes in the presence of Pgp or MRP specific inhibitors. Epifluorescence microscopy measured time course analysis in the olfactory epithelium revealed significant inhibitor-dependent calcein uptake in the presence of each of the selected inhibitors. Furthermore, intracellular calcein accumulation in olfactory receptor neurons was also significantly increased in the presence of either one of the Pgp or MRP inhibitors. The presence of Pgp or MRP1 encoding genes in the olfactory mucosa of rat and mouse was confirmed by RT-PCR with appropriate pairs of species-specific primers. Both transporters were expressed in both newborn and adult olfactory mucosa of both species. To assess a possible involvement of MDR transporters in the olfactory response, we examined the electrophysiological response to odorants in the presence of the selected MDR inhibitors by recording electroolfactograms (EOG. In both animal species, MRPs inhibitors induced a marked reduction of the EOG magnitude, while Pgp inhibitors had only a minor or no measurable effect.The findings suggest that both Pgp and MRP transporters are functional in the olfactory mucosa and in olfactory receptor neurons. Pgp and MRPs may be cellular constituents of olfactory receptor neurons and represent potential mechanisms for modulation

  11. Limited role of culture conversion for decision-making in individual patient care and for advancing novel regimens to confirmatory clinical trials.

    Science.gov (United States)

    Phillips, Patrick P J; Mendel, Carl M; Burger, Divan A; Crook, Angela M; Crook, Angela; Nunn, Andrew J; Dawson, Rodney; Diacon, Andreas H; Gillespie, Stephen H

    2016-02-04

    Despite recent increased clinical trials activity, no regimen has proved able to replace the standard 6-month regimen for drug-sensitive tuberculosis. Understanding the relationship between microbiological markers measured during treatment and long-term clinical outcomes is critical to evaluate their usefulness for decision-making for both individual patient care and for advancing novel regimens into time-consuming and expensive pivotal phase III trials. Using data from the randomized controlled phase III trial REMoxTB, we evaluated sputum-based markers of speed of clearance of bacilli: time to smear negative status; time to culture negative status on LJ or in MGIT; daily rate of change of log10(TTP) to day 56; and smear or culture results at weeks 6, 8 or 12; as individual- and trial-level surrogate endpoints for long-term clinical outcome. Time to culture negative status on LJ or in MGIT, time to smear negative status and daily rate of change in log10(TTP) were each independent predictors of clinical outcome, adjusted for treatment (p limited role in decision-making for advancing regimens into phase III trials or in predicting the outcome of treatment for individual patients. REMoxTB ClinicalTrials.gov number: NCT00864383.

  12. Drug-resistant tuberculosis

    African Journals Online (AJOL)

    statistics show that almost half a million new ... testing for second-line drugs, no international consensus has been reached about .... Given the high background rates of TB and MDR-TB in several countries, regimens are often constructed ...

  13. Assessment of non-standard HIV antiretroviral therapy regimens at ...

    African Journals Online (AJOL)

    2016-03-06

    Mar 6, 2016 ... Most patients were transitioned to standard regimens, ... In cases of first-line regimen treatment failure, ..... tute; National Heart, Lung, and Blood Institute; National. Institute of Dental & Craniofacial Research; National Insti-.

  14. TB case detection in Tajikistan – analysis of existing obstacles

    Directory of Open Access Journals (Sweden)

    Alexei Korobitsyn

    2013-10-01

    Full Text Available Background: Tajikistan National TB Control ProgramObjective: (1 To identify the main obstacles to increasing TB Detection in Tajikistan. (2 To identify interventions that improve TB detection.Methods: Review of the available original research data, health normative base, health systems performance and national economic data, following WHO framework for detection of TB cases, which is based on three scenarios of why incident cases of TB may not be notified.Results: Data analysis revealed that some aspects of TB case detection are more problematic than others and that there are gaps in the knowledge of specific obstacles to TB case detection. The phenomenon of “initial default” in Tajikistan has been documented; however, it needs to be studied further. The laboratory services detect infectious TB cases effectively; however, referrals of appropriate suspects for TB diagnosis may lag behind. The knowledge about TB in the general population has improved. Yet, the problem of TB related stigma persists, thus being an obstacle for effective TB detection. High economic cost of health services driven by under-the-table payments was identified as another barrier for access to health services.Conclusion: Health system strengthening should become a primary intervention to improve case detection in Tajikistan. More research on reasons contributing to the failure to register TB cases, as well as factors underlying stigma is needed.

  15. HIF-1α inhibition reverses multidrug resistance in colon cancer cells via downregulation of MDR1/P-glycoprotein.

    Directory of Open Access Journals (Sweden)

    Jianfang Chen

    Full Text Available Multidrug resistance (MDR is one of the major reasons chemotherapy-based treatments fail. Hypoxia is generally associated with tumor chemoresistance. However, the correlation between the heterodimeric hypoxia-inducible factor-1 (HIF-1 and the multidrug resistance (MDR1 gene/transporter P-glycoprotein (P-gp remains unclear. This study aims to explore the molecular mechanisms of reversing colon cancer MDR by focusing on the target gene HIF-1α.A chemotherapeutic sensitivity assay was used to observe the efficiency of MDR reversal in LoVo multicellular spheroids (MCS. The apoptotic level induced by different drugs was examined by flow cytometry (FCM. Binding of HIF-1α to the MDR1 gene promoter was evaluated by Chromatin immunoprecipitation (ChIP. The relationship between HIF-1α/P-gp expression and sensitivity to chemotherapy was analyzed.The sensitivity of LoVo MCS to all four chemotherapy drugs was decreased to varying degrees under hypoxic conditions. After silencing the HIF-1α gene, the sensitivities of LoVo MCS to all four chemotherapy drugs were restored. The apoptotic levels that all the drugs induced were all decreased to various extents in the hypoxic group. After silencing HIF-1α, the apoptosis level induced by all four chemotherapy drugs increased. The expression of HIF-1α and P-gp was significantly enhanced in LoVo MCS after treatment with hypoxia. Inhibiting HIF-1α significantly decreased the expression of MDR1/P-gp mRNA or protein in both the LoVo monolayers and LoVo MCS. The ChIP assay showed that HIF-1α was bound to the MDR1 gene promoter. Advanced colon carcinoma patients with expression of both HIF-1α and P-gp were more resistant to chemotherapy than that with non expression.HIF-1α inhibition reverses multidrug resistance in colon cancer cells via downregulation of MDR1/P-gp. The expression of HIF-1α and MDR1/P-gp can be used as a predictive marker for chemotherapy resistance in colon cancer.

  16. Role of hypoxia-inducible factor-α in hepatitis-B-virus X protein-mediated MDR1 activation

    International Nuclear Information System (INIS)

    Han, Hyo-Kyung; Han, Chang Yeob; Cheon, Eun-Pa; Lee, Jaewon; Kang, Keon Wook

    2007-01-01

    The transition from chemotherapy-responsive cancer cells to chemotherapy-resistant cancer cells is mainly accompanied by the increased expression of multi-drug resistance 1 (MDR1). We found that hepatitis-B-virus X protein (HBx) increases the transcriptional activity and protein level of MDR1 in a hepatoma cell line, H4IIE. In addition, HBx overexpression made H4IIE cells more resistant to verapamil-uptake. HBx stabilized hypoxia-inducible factor-1α (HIF-1α) and induced the nuclear translocation of C/EBPβ. Reporter gene analyses showed that HBx increased the reporter activity in the cells transfected with the reporter containing MDR1 gene promoter. Moreover, the luciferase reporter gene activity was significantly inhibited by HIF-1α siRNA but not by overexpression of C/EBP dominant negative mutant. These results imply that HBx increases the MDR1 transporter activity through the transcriptional activation of the MDR1 gene with HIF-1α activation, and suggest HIF-1α for the therapeutic target of HBV-mediated chemoresistance

  17. Combination of TB lymphadenitis and metastatic LAP in breast cancer

    Directory of Open Access Journals (Sweden)

    Abdolhassan Talaiezadeh

    2015-06-01

    Full Text Available Tuberculosis (TB may present as pulmonary and extra-pulmonary. TB lymphadenitis is the most common presentation of extra-pulmonary TB. TB lymphadenitis should be taken into account in the differential diagnosis of different disorders such as metastatic lymphadenopathy. The reported patient was a 65-year-old lady with breast cancer and conglomerated and matted axillary lymphadenopathy who received chemotherapy. She presented with more extensive axillary LAP contrary to our expectation. Modified radical mastectomy was done and pathology analysis reported TB lymphadenitis associated with metastatic LAP. Under cover of anti-TB therapy adjuvant chemoradiation therapy was started. Accordingly, we recommend TB be ruled out in every patient who needs chemotherapy in the endemic region because chemotherapy may cause the extension of TB in the body.

  18. Patient satisfaction with TB care clinical consultations in Kampala: a ...

    African Journals Online (AJOL)

    ... on treatment outcome. Keywords: Patient satisfaction, TB care clinical consultations, cross sectional study. ... Background: Tuberculosis (TB) remains a major global ... Measurement of outcome: Variables considered were; how long the ... Key: ART= Antiretroviral Therapy. Characteristic. Parameter n (%). Sex. Female.

  19. Tuberculosis: Learn the Signs and Symptoms of TB Disease

    Science.gov (United States)

    ... this? Submit What's this? Submit Button Past Emails Tuberculosis (TB) Disease: Symptoms and Risk Factors Language: English ( ... Español (Spanish) Recommend on Facebook Tweet Share Compartir Tuberculosis (TB) is a disease caused by bacteria that ...

  20. Investigation of Susceptibility of Mycobacterium tuberculosis Complex Strains Isolated from Clinical Samples Against the First and Second-Line Anti-tuberculosis Drugs by the Sensititre MycoTB Plate Method

    Directory of Open Access Journals (Sweden)

    Figen KAYSERİLİ ORHAN

    2018-03-01

    Full Text Available Introduction: Phenotypic methods for drug susceptibility testing of Mycobacterium tuberculosis complex (MTC to second-line drugs are not yet standardized. The Sensititre MycoTB Plate is a microtiter plate containing lyophilized antibiotics and configured for determination of MIC to first and second-line anti-tuberculosis drugs. The purpose of this study is to detect the susceptibility rates of MTC strains isolated from patients’ specimens for first and second-line anti-tuberculosis drugs. Materials and Methods: This study included 50 MTC strains isolated from various clinical specimens. Out of the 50 strains, 38 were isolated from sputum, three from cerebrospinal fluid, three from bronchoalveolar lavage, and six from other samples in this study. The susceptibility of strains to anti-tuberculosis drugs were determined by the Sensititre MycoTB Plate Method. Thawed isolates were subcultured, and dilutions were inoculated into MycoTB wells. The results were read at days 7, 14 and 21. Results: At the end of study, out of 50 MTC isolates, 7 (14% showed resistance to Isoniazid (INH, 5 (10% to streptomycin (SM, 4 (8% to ethambutol (EMB, 4 (8% to ethionamide (ETH, 3 (6% to rifampicin (RIF, 3 (6% to rifabutin (RFB, 2 (4% to kanamycin (KAN, 2 (4% to ofloxacin (OFL, 2 (4% to P-aminosalicyclic acid (PAS, 1 (2% to moxiflocacin (MOX, and 1 (2% to cycloserine (CYC. All strains were found sensitive to amikacin while 2 strains (4% were identified as multidrug-resistant tuberculosis (MDR-TB. Thirty-five strains (70% were sensitive to all drugs. Extensively drug resistant tuberculosis (XDR-TB was not determined in this study. Conclusion: This is the first study that tests second line anti-tuberculosis drugs in our location and provides us valuable data regarding MDR-TB and XDR-TB rates. The Sensititre MycoTB Plate Method is a fast, reliable and practical method and can be used to determine the susceptibility of first and second-line anti-tuberculosis drugs.

  1. Mdr1a plays a crucial role in regulating the analgesic effect and toxicity of aconitine by altering its pharmacokinetic characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Lijun; Wu, Jinjun; Zhao, Min; Song, Wenjie; Qi, Xiaoxiao; Wang, Ying [International Institute for Translational Chinese Medicine, Guangzhou University of Chinese Medicine, Guangzhou, Guangdong 510006 (China); Lu, Linlin [International Institute for Translational Chinese Medicine, Guangzhou University of Chinese Medicine, Guangzhou, Guangdong 510006 (China); State Key Laboratory of Quality Research in Chinese Medicine, Macau University of Science and Technology, Macau (SAR) 999078 (China); Liu, Zhongqiu, E-mail: liuzq@gzucm.edu.cn [International Institute for Translational Chinese Medicine, Guangzhou University of Chinese Medicine, Guangzhou, Guangdong 510006 (China); State Key Laboratory of Quality Research in Chinese Medicine, Macau University of Science and Technology, Macau (SAR) 999078 (China)

    2017-04-01

    Aconitine (AC) is the primary bioactive/toxic alkaloid in plants of the Aconitum species. Our previous study demonstrated that Mdr1 was involved in efflux of AC. However, the mechanism by which Mdr1 regulates the efficacy/toxicity of AC in vivo remains unclear. The present study aimed to determine the effects of Mdr1a on the efficacy/toxicity and pharmacokinetics of AC in wild-type and Mdr1a{sup −/−} FVB mice. After oral administration of AC, significantly higher analgesic effect was observed in Mdr1a{sup −/−} mice (49% to 105%) compared to wild-type mice (P < 0.05). The levels of s100-β protein and creatine kinase, which indicate cerebral and myocardial damage, respectively, were also significantly increased (P < 0.05) in Mdr1a{sup −/−} mice. Histopathological examination revealed that the Mdr1a{sup −/−} mice suffered from evident cerebral and myocardial damages, but the wild-type mice did not. These findings suggested that Mdr1a deficiency significantly promoted the analgesic effect of AC and exacerbated its toxicity. Pharmacokinetic experiments showed that T{sub 1/2} of AC in the Mdr1a{sup −/−} mice was significantly higher (from 87% to 300%) than that in wild-type mice (P < 0.05). The distribution of AC in the brain of Mdr1a{sup −/−} mice was 2- to 32-fold higher than that in the brains of wild-type mice (P < 0.05). Toxic reactions were more severe in Mdr1a{sup −/−} mice compared to wild-type mice. In conclusion, Mdr1a deficiency significantly enhanced the analgesic effect of AC and exacerbated its toxicity by upregulating its distribution to the brain and decreasing its plasma elimination rate. Thus, Mdr1a dysfunction may cause severe AC poisoning. - Highlights: • The efficacy and toxicity of aconitine were significantly enhanced in Mdr1a{sup −/−} mice. • The distribution of aconitine to the brain was remarkably increased in Mdr1a{sup −/−} mice. • The elimination rate of aconitine was significantly decreased in Mdr1a

  2. Exploration of Fungal Association From Hard Coral Against Pathogen MDR Staphylococcus haemolyticus

    Science.gov (United States)

    Cristianawati, O.; Radjasa, O. K.; Sabdono, A.; Trianto, A.; Sabdaningsih, A.; Sibero, M. T.; Nuryadi, H.

    2017-02-01

    Staphylococcus haemolyticus are opportunistic bacteria and as the second leading cause of nosocomial infections. It is a disease causing septicemia, peritonitis, otitis, and urinary tract infections and infections of the eye. It also a phenotype resistant to multiple antibiotics commercial. There is now an urgency to find an alternative antibiotics to combat this bacteria. It has been widely reported that many bioactive marine natural products from marine invertebrate have striking similarities to metabolites of their associated microorganisms including fungi. Hard coral associated microorganisms are among of the most interesting and promising marine natural product sources, which produce with various biological activities. The proposed work focused on the discovery of bioactive compounds and also estimated the phylogenetic diversity from fungal association of hard coral against pathogen MDR Staphylococcus haemolyticus. A total of 32 fungal association, FHP 7 which were isolated from Favia sp. capable of inhibiting the growth MDR. Molecular identification based on 18S rRNA gene sequences revealed that the active fungal association belonged 100% to the members from one of the genera Trichoderma longibrachiatum. Accession Number LC185084.1.

  3. PD173074, a selective FGFR inhibitor, reverses MRP7 (ABCC10-mediated MDR

    Directory of Open Access Journals (Sweden)

    Nagaraju Anreddy

    2014-06-01

    Full Text Available Multidrug resistance protein 7 (MRP7, ABCC10 is a recently identified member of the ATP-binding cassette (ABC transporter family, which adequately confers resistance to a diverse group of antineoplastic agents, including taxanes, vinca alkaloids and nucleoside analogs among others. Clinical studies indicate an increased MRP7 expression in non-small cell lung carcinomas (NSCLC compared to a normal healthy lung tissue. Recent studies revealed increased paclitaxel sensitivity in the Mrp7−/− mouse model compared to their wild-type counterparts. This demonstrates that MRP7 is a key contributor in developing drug resistance. Recently our group reported that PD173074, a specific fibroblast growth factor receptor (FGFR inhibitor, could significantly reverse P-glycoprotein-mediated MDR. However, whether PD173074 can interact with and inhibit other MRP members is unknown. In the present study, we investigated the ability of PD173074 to reverse MRP7-mediated MDR. We found that PD173074, at non-toxic concentration, could significantly increase the cellular sensitivity to MRP7 substrates. Mechanistic studies indicated that PD173074 (1 μmol/L significantly increased the intracellular accumulation and in-turn decreased the efflux of paclitaxel by inhibiting the transport activity without altering expression levels of the MRP7 protein, thereby representing a promising therapeutic agent in the clinical treatment of chemoresistant cancer patients.

  4. Development of PET and SPECT radiopharmaceuticals to study multi-drug resistance (MDR)

    International Nuclear Information System (INIS)

    Katsififs, A.; Dikic, B.; Greguric, I.; Knott, R.; Mattner, F.

    2002-01-01

    Full text: Cellular resistance or Multidrug Resistance (MDR) to cytotoxic agents is the major cause of treatment failure in many human cancers. P-glycoprotein (Pgp), a Mr 17,0000 transmembrane protein and Multi Resistance Protein (MRP) are two proteins that are over expressed and confer resistance to a large number of chemotherapeutic agents by enhancing their extracellular transport. P-glycoprotein is expressed at a relative high level in treated and untreated human malignant tumours, including renal, colonic, adrenal, hepatocellular carcinoma and a considerable percentage of breast carcinomas. 99m Tc-Sestamibi, a lipophilic cationic complex is a transport substrate for Pgp. In clinical studies of human neoplasms it was found that tumour uptake and clearance of this tracer correlate with Pgp expression and may be used for the phenotypic assessment of MDR. However, new tracers with better substrate specificity for Pgp and other drug transporters would greatly assist in optimising chemotherapeutic treatment and improving patient management by predicting tumour response to therapy and to assist in the development of antagonists, which may reverse or halt MDR. The aim of this project is therefore to develop PET and SPECT radiopharmaceuticals with improved affinity and selectivity for Pgp and MRP for the clinical evaluation of MDR in cancer patients. To optimise cellular transport characteristics, a number of chemical families that have been found to be substrates of Pgp and other drug efflux pumps, will be investigated. In the first instance, a series of drugs based on the flavonol natural product, Quercetin will be developed, screened for MDR and radiolabelled with PET and SPECT isotopes. Quercetin and related flavonol derivatives have been selected for this project because of their moderate to good affinity for Pgp. With the assistance of molecular modeling and in vitro studies, structural modification will be undertaken to improve the specificity and affinity for

  5. [Considerations about the efficiency of treatment regimens with fixed Rifampicin-Isoniazid combinations in pulmonary tuberculosis].

    Science.gov (United States)

    Munteanu, Ioana; Husar, Iulia; Didilescu, C; Stoicescu, I P

    2004-01-01

    Here are presented the results of a prospective, randomized study regarding the efficiency of regimens with fixed drug combination Rifampicin-Isoniazide manufactured by Antibiotics S.A. of Iasi in comparison with single drugs routinely used in treatment of patients with pulmonary tuberculosis. Newly diagnosed (confirmed by smear and culture) pulmonary tuberculosis patients were selected, and those who accepted to be included in the study, were admitted to the National Institute of Pneumology "Marius Nasta" between August 2001 and September 2002. At the time of admission, they were randomized into two groups: 20 patients received fixed drug combination RMP300 HIN150, and 18 patients received RMP and HIN in single drug tablets (2 patients were excluded). The follow-up of the patients was for one year from the date of enclosure. The smear conversion rate was 83,3% for the patients using single drug tablets, and 70% for those using fixed drug combination, motivated with some more severe TB patterns. The success rate was 100% for all TB patients. Although the present study was done for few patients, we can say that it demonstrated the same efficiency of fixed drug combination produced in Romania, with the single drug tablets, and it suggests a better compliance to treatment with a lower price.

  6. Comparison of PPD test in household contacts of smear-positive and -negative tuberculosis (TB

    Directory of Open Access Journals (Sweden)

    Zohreh Azarkar

    2015-01-01

    Conclusions: The most important way to prevent TB is omission of the disease transmission sources (TB patients by anti-TB treatment. Extensive studies are needed to ensure that contacts of patients with pulmonary TB are identified and appropriately screened.

  7. Exploring workplace TB interventions with foreign-born Latino workers.

    Science.gov (United States)

    Eggerth, Donald E; Keller, Brenna M; Flynn, Michael A

    2018-05-15

    Persons born outside the United States are more likely to be diagnosed with tuberculosis disease (TB) than native-born individuals. Foreign-born Latinos at risk of TB may be difficult to reach with public health interventions due to cultural and institutional barriers. Workplaces employing large concentrations of foreign-born Latinos may be useful locations for TB interventions targeting this high-risk population. This study used a two-phase approach to investigate the feasibility of workplace TB interventions. The first phase investigated employer knowledge of TB and receptiveness to allowing TB interventions in their businesses through 5 structured interviews. The second phase investigated foreign-born workers' knowledge of TB and their receptiveness to receiving TB interventions in their places of employment through 12 focus groups stratified by gender and education. Phase 1: Only 1 of the 5 employers interviewed had a high level of knowledge about TB, and three had no knowledge other than that TB was a disease that involved coughing. They were receptive to workplace TB interventions, but were concerned about lost productivity and customers finding out if an employee had TB. Phase 2: There was no observed differences in responses between gender and between the bottom two education groups, so the final analysis took place between a gender-combined lower education group and higher education group. The higher education group tended to have knowledge that was more accurate and to view TB as a disease associated with poverty. The lower education group tended to have more misconceptions about TB and more often expressed concern that their employers would not support worksite interventions. The results from both phases indicate that more TB education is needed among both foreign-born Latino workers and their employers. Obstacles to implementing workplace TB interventions include knowledge, potential productivity loss, employer liability, and perceived customer response

  8. Diagnosis of active TB using aptamers

    CSIR Research Space (South Africa)

    Khati, M

    2013-08-01

    Full Text Available of the disease. We have shown in a proof-of-concept case-controlled study that the aptamer-based diagnostic tool was able to accurately detect all cases of active TB from sputum samples of patients, including smear-negative culture positive and samples from...

  9. Management of multidrug-resistant tuberculosis in human immunodeficiency virus patients

    Science.gov (United States)

    Jamil, K. F.

    2018-03-01

    Tuberculosis (TB) is a chronic infectious disease mainly caused by Mycobacterium tuberculosis(MTB). 10.4 million new TB cases will appear in 2015 worldwide. There were an estimated 1.4 million TB deaths in 2015, and an additional 0.4 million deaths resulting from TB disease among people living with human immunodeficiency virus (HIV). Multidrug- resistant and extensively drug-resistant tuberculosis (MDR and XDR-TB) are major public health concerns worldwide. 480.000 new cases of MDR-TB will appear in 2015 and an additional 100,000 people with rifampicin-resistant TB (RR-TB) who were also newly eligible for MDR-TB treatment. Their association with HIV infection has contributed to the slowing down of TB incidence decline over the last two decades, therefore representing one important barrier to reach TB elimination. Patients infected with MDR-TB require more expensive treatment regimens than drug-susceptible TB, with poor treatment.Patients with multidrug- resistant tuberculosis do not receive rifampin; drug interactions risk is markedly reduced. However, overlapping toxicities may limit options for co-treatment of HIV and multidrug- resistant tuberculosis.

  10. Differences in pharmacokinetics and pharmacodynamics of colistimethate sodium (CMS) and colistin between three different CMS dosage regimens in a critically ill patient infected by a multidrug-resistant Acinetobacter baumannii.

    Science.gov (United States)

    Luque, Sònia; Grau, Santiago; Valle, Marta; Sorlí, Luisa; Horcajada, Juan Pablo; Segura, Concha; Alvarez-Lerma, Francisco

    2013-08-01

    Use of colistin has re-emerged for the treatment of infections caused by multidrug-resistant (MDR) Gram-negative bacteria, but information on its pharmacokinetics and pharmacodynamics is limited, especially in critically ill patients. Recent data from pharmacokinetic/pharmacodynamic (PK/PD) population studies have suggested that this population could benefit from administration of higher than standard doses of colistimethate sodium (CMS), but the relationship between administration of incremental doses of CMS and corresponding PK/PD parameters as well as its efficacy and toxicity have not yet been investigated in a clinical setting. The objective was to study the PK/PD differences of CMS and colistin between three different CMS dosage regimens in the same critically ill patient. A critically ill patient with nosocomial pneumonia caused by a MDR Acinetobacter baumannii received incremental doses of CMS. During administration of the different CMS dosage regimens, CMS and colistin plasma concentrations were determined and PK/PD indexes were calculated. With administration of the highest CMS dose once daily (720 mg every 24h), the peak plasma concentration of CMS and colistin increased to 40.51 mg/L and 1.81 mg/L, respectively, and the AUC0-24/MIC of colistin was 184.41. This dosage regimen was efficacious, and no nephrotoxicity or neurotoxicity was observed. In conclusion, a higher and extended-interval CMS dosage made it possible to increase the exposure of CMS and colistin in a critically ill patient infected by a MDR A. baumannii and allowed a clinical and microbiological optimal response to be achieved without evidence of toxicity. Copyright © 2013 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  11. Antiretroviral treatment uptake in patients with HIV- associated TB ...

    African Journals Online (AJOL)

    ART results in a 64 - 95% reduction in mortality risk 5 and is an essential component of care. How soon to start. ART after TB treatment initiation has become clearer from randomised controlled trials. These show that integration of ART and TB treatment in all HIV-associated TB patients regardless of CD4 count significantly.

  12. Assessment of the Diagnostic Potential of Clinotech TB Screen Test ...

    African Journals Online (AJOL)

    The Clinotech TB Screen test, a 3rd generation multi-antigen rapid chromatographic immunoassay for detection of IgG antibodies in serum against recombinant protein antigens 38kDa, 16kDa and 6kDa, was assessed for its diagnostic potential for diagnosis of active pulmonary TB in routine TB control programme in Abia ...

  13. Antiretroviral treatment uptake in patients with HIV associated TB ...

    African Journals Online (AJOL)

    Background. Delivery of integrated care for patients with HIV-associated TB is challenging. We assessed the uptake and timing of antiretroviral treatment (ART) among eligible patients attending a primary care service with co-located ART and TB clinics. Methods. In a retrospective cohort study, all HIV-associated TB patients ...

  14. Genetic polymorphisms in MDR1 and CYP3A4 genes in Asians and the influence of MDR1 haplotypes on cyclosporin disposition in heart transplant recipients.

    Science.gov (United States)

    Chowbay, Balram; Cumaraswamy, Sivathasan; Cheung, Yin Bun; Zhou, Qingyu; Lee, Edmund J D

    2003-02-01

    Intestinal cytochrome P450 3A4 (CYP3A4) and P-glycoprotein (P-gp) both play a vital role in the metabolism of oral cyclosporine (CsA). We investigated the genetic polymorphisms in CYP3A4(promoter region and exons 5, 7 and 9) and MDR1 (exons 12, 21 and 26) genes and the impact of these polymorphisms on the pharmacokinetics of oral CsA in stable heart transplant patients (n = 14). CYP3A4 polymorphisms were rare in the Asian population and transplant patients. Haplotype analysis revealed 12 haplotypes in the Chinese, eight in the Malays and 10 in the Indians. T-T-T was the most common haplotype in all ethnic groups. The frequency of the homozygous mutant genotype at all three loci (TT-TT-TT) was highest in the Indians (31%) compared to 19% and 15% in the Chinese and Malays, respectively. In heart transplant patients, CsA exposure (AUC(0-4 h), AUC(0-12 h) and C(max)) was high in patients with the T-T-T haplotypes compared to those with C-G-C haplotypes. These findings suggest that haplotypes rather than genotypes influence CsA disposition in transplant patients.

  15. Anaplasia and drug selection-independent overexpression of the multidrug resistance gene, MDR1, in Wilms' tumor.

    Science.gov (United States)

    Re, G G; Willingham, M C; el Bahtimi, R; Brownlee, N A; Hazen-Martin, D J; Garvin, A J

    1997-02-01

    One reason for the failure of chemotherapy is the overexpression of the multidrug resistance gene, MDR1. The product of this gene is the multidrug transporter P-glycoprotein, an ATP-dependent pump that extrudes drugs from the cytoplasm. Some tumors inherently express P-glycoprotein, whereas others acquire the ability to do so after exposure to certain chemotherapeutic agents, often by the mechanism of gene amplification. Classical Wilms' tumors (nephroblastoma) typically respond to therapy and have a good prognosis. On the contrary, anaplastic Wilms' tumors are generally refractory to chemotherapy. These anaplastic variants are rare (4.5% of all Wilms' tumors reported in the United States), aggressive, and often fatal forms of tumor, which are commonly thought to result from the progression of classical Wilms' tumors. To investigate the basis for this differential response to therapy, we examined a number of classical and anaplastic Wilms' tumors for the expression of the MDR1 gene by immunohistochemical and mRNA analysis. Classical Wilms' tumors consistently did not express P-glycoprotein except in areas of tubular differentiation, as in normal kidney. Similarly, two of three anaplastic tumors failed to show P-glycoprotein expression. In contrast, cultured cells derived from a third anaplastic tumor, W4, exhibited strong P-glycoprotein expression and were drug resistant in vitro. Southern analysis revealed that W4 cells contained a single copy of the MDR1 gene per haploid genome similar to normal cells, demonstrating that the overexpression of MDR1 was not caused by gene amplification. Transcriptional activation of the MDR1 gene would be in keeping with the concept that p53 might act as a transcriptional repressor of the MDR1 gene.

  16. Candida albicans Swi/Snf and Mediator Complexes Differentially Regulate Mrr1-Induced MDR1 Expression and Fluconazole Resistance.

    Science.gov (United States)

    Liu, Zhongle; Myers, Lawrence C

    2017-11-01

    Long-term azole treatment of patients with chronic Candida albicans infections can lead to drug resistance. Gain-of-function (GOF) mutations in the transcription factor Mrr1 and the consequent transcriptional activation of MDR1 , a drug efflux coding gene, is a common pathway by which this human fungal pathogen acquires fluconazole resistance. This work elucidates the previously unknown downstream transcription mechanisms utilized by hyperactive Mrr1. We identified the Swi/Snf chromatin remodeling complex as a key coactivator for Mrr1, which is required to maintain basal and induced open chromatin, and Mrr1 occupancy, at the MDR1 promoter. Deletion of snf2 , the catalytic subunit of Swi/Snf, largely abrogates the increases in MDR1 expression and fluconazole MIC observed in MRR1 GOF mutant strains. Mediator positively and negatively regulates key Mrr1 target promoters. Deletion of the Mediator tail module med3 subunit reduces, but does not eliminate, the increased MDR1 expression and fluconazole MIC conferred by MRR1 GOF mutations. Eliminating the kinase activity of the Mediator Ssn3 subunit suppresses the decreased MDR1 expression and fluconazole MIC of the snf2 null mutation in MRR1 GOF strains. Ssn3 deletion also suppresses MDR1 promoter histone displacement defects in snf2 null mutants. The combination of this work with studies on other hyperactive zinc cluster transcription factors that confer azole resistance in fungal pathogens reveals a complex picture where the induction of drug efflux pump expression requires the coordination of multiple coactivators. The observed variations in transcription factor and target promoter dependence of this process may make the search for azole sensitivity-restoring small molecules more complicated. Copyright © 2017 American Society for Microbiology.

  17. Expression of the MDR1 gene and P-glycoprotein in canine mast cell tumor cell lines

    OpenAIRE

    NAKAICHI, Munekazu; TAKESHITA, Yoko; OKUDA, Masaru; NAKAMOTO, Yuya; ITAMOTO, Kazuhito; UNE, Satoshi; SASAKI, Nobuo; KADOSAWA, Tsuyoshi; TAKAHASHI, Tomoko; TAURA, Yasuho

    2007-01-01

    Cellular drug resistance to antineoplastic drugs is often due to the presence of a drug efflux pump that reduces intracellular drug accumulation and chemosensitivity. P-glycoprotein (P-gp), which is encoded by the MDR1 gene, is considered to function as an ATP-driven membrane drug efflux pump and appears to play an important role in tumor cell resistance. In the present report, we assessed the expression of MDR1 by RT-PCR in three canine mast cell tumor cell lines, TiMC, CoMS and LuMC, origin...

  18. Inhibition of ABCB1 (MDR1 expression by an siRNA nanoparticulate delivery system to overcome drug resistance in osteosarcoma.

    Directory of Open Access Journals (Sweden)

    Michiro Susa

    2010-05-01

    Full Text Available The use of neo-adjuvant chemotherapy in treating osteosarcoma has improved patients' average 5 year survival rate from 20% to 70% in the past 30 years. However, for patients who progress after chemotherapy, its effectiveness diminishes due to the emergence of multi-drug resistance (MDR after prolonged therapy.In order to overcome both the dose-limiting side effects of conventional chemotherapeutic agents and the therapeutic failure resulting from MDR, we designed and evaluated a novel drug delivery system for MDR1 siRNA delivery. Novel biocompatible, lipid-modified dextran-based polymeric nanoparticles were used as the platform for MDR1 siRNA delivery; and the efficacy of combination therapy with this system was evaluated. In this study, multi-drug resistant osteosarcoma cell lines (KHOS(R2 and U-2OS(R2 were treated with the MDR1 siRNA nanocarriers and MDR1 protein (P-gp expression, drug retention, and immunofluoresence were analyzed. Combination therapy of the MDR1 siRNA loaded nanocarriers with increasing concentrations of doxorubicin was also analyzed. We observed that MDR1 siRNA loaded dextran nanoparticles efficiently suppresses P-gp expression in the drug resistant osteosarcoma cell lines. The results also demonstrated that this approach may be capable of reversing drug resistance by increasing the amount of drug accumulation in MDR cell lines.Lipid-modified dextran-based polymeric nanoparticles are a promising platform for siRNA delivery. Nanocarriers loaded with MDR1 siRNA are a potential treatment strategy for reversing MDR in osteosarcoma.

  19. TIME Impact - a new user-friendly tuberculosis (TB) model to inform TB policy decisions.

    Science.gov (United States)

    Houben, R M G J; Lalli, M; Sumner, T; Hamilton, M; Pedrazzoli, D; Bonsu, F; Hippner, P; Pillay, Y; Kimerling, M; Ahmedov, S; Pretorius, C; White, R G

    2016-03-24

    Tuberculosis (TB) is the leading cause of death from infectious disease worldwide, predominantly affecting low- and middle-income countries (LMICs), where resources are limited. As such, countries need to be able to choose the most efficient interventions for their respective setting. Mathematical models can be valuable tools to inform rational policy decisions and improve resource allocation, but are often unavailable or inaccessible for LMICs, particularly in TB. We developed TIME Impact, a user-friendly TB model that enables local capacity building and strengthens country-specific policy discussions to inform support funding applications at the (sub-)national level (e.g. Ministry of Finance) or to international donors (e.g. the Global Fund to Fight AIDS, Tuberculosis and Malaria).TIME Impact is an epidemiological transmission model nested in TIME, a set of TB modelling tools available for free download within the widely-used Spectrum software. The TIME Impact model reflects key aspects of the natural history of TB, with additional structure for HIV/ART, drug resistance, treatment history and age. TIME Impact enables national TB programmes (NTPs) and other TB policymakers to better understand their own TB epidemic, plan their response, apply for funding and evaluate the implementation of the response.The explicit aim of TIME Impact's user-friendly interface is to enable training of local and international TB experts towards independent use. During application of TIME Impact, close involvement of the NTPs and other local partners also builds critical understanding of the modelling methods, assumptions and limitations inherent to modelling. This is essential to generate broad country-level ownership of the modelling data inputs and results. In turn, it stimulates discussions and a review of the current evidence and assumptions, strengthening the decision-making process in general.TIME Impact has been effectively applied in a variety of settings. In South Africa, it

  20. Obstructive lung disease as a complication in post pulmonary TB

    Science.gov (United States)

    Tarigan, A. P.; Pandia, P.; Eyanoer, P.; Tina, D.; Pratama, R.; Fresia, A.; Tamara; Silvanna

    2018-03-01

    The case of post TB is a problem that arises in the community. Pulmonary tuberculosis (TB) can affect lung function. Therefore, we evaluated impaired pulmonary function in subjects with diagnosed prior pulmonary TB. A Case Series study, pulmonary function test was performed in subjects with a history of pulmonary tuberculosis; aged ≥18 years were included. Exclusion criteria was a subject who had asthma, obesity, abnormal thorax and smoking history. We measured FEV1 and FVC to evaluate pulmonary function. Airflow obstruction was FEV1/FVC%pulmonary TB, 5 subjects (23%) had airflow obstruction with FEV1/FVC% value pulmonary TB.

  1. Technology and tuberculosis control: the OUT-TB Web experience.

    Science.gov (United States)

    Guthrie, Jennifer L; Alexander, David C; Marchand-Austin, Alex; Lam, Karen; Whelan, Michael; Lee, Brenda; Furness, Colin; Rea, Elizabeth; Stuart, Rebecca; Lechner, Julia; Varia, Monali; McLean, Jennifer; Jamieson, Frances B

    2017-04-01

    Develop a tool to disseminate integrated laboratory, clinical, and demographic case data necessary for improved contact tracing and outbreak detection of tuberculosis (TB). In 2007, the Public Health Ontario Laboratories implemented a universal genotyping program to monitor the spread of TB strains within Ontario. Ontario Universal Typing of TB (OUT-TB) Web utilizes geographic information system (GIS) technology with a relational database platform, allowing TB control staff to visualize genotyping matches and microbiological data within the context of relevant epidemiological and demographic data. OUT-TB Web is currently available to the 8 health units responsible for >85% of Ontario's TB cases and is a valuable tool for TB case investigation. Users identified key features to implement for application enhancements, including an e-mail alert function, customizable heat maps for visualizing TB and drug-resistant cases, socioeconomic map layers, a dashboard providing TB surveillance metrics, and a feature for animating the geographic spread of strains over time. OUT-TB Web has proven to be an award-winning application and a useful tool. Developed and enhanced using regular user feedback, future versions will include additional data sources, enhanced map and line-list filter capabilities, and development of a mobile app. © The Author 2016. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  2. Lay beliefs of TB and TB/HIV co-infection in Addis Ababa, Ethiopia: a qualitative study

    Directory of Open Access Journals (Sweden)

    Frich Jan C

    2011-08-01

    Full Text Available Abstract Background Knowledge about lay beliefs of etiology, transmission and treatment of TB, and lay perceptions of the relationship between TB and HIV is important for understanding patients' health seeking behavior and adherence to treatment. We conducted a study to explore lay beliefs about TB and TB/HIV co-infection in Addis Ababa, Ethiopia. Findings We conducted a qualitative study using in-depth interviews with 15 TB/HIV co-infected patients and 9 health professionals and focus group discussions with 14 co-infected patients in Addis-Ababa, Ethiopia. We found that a predominant lay belief was that TB was caused by exposure to cold. Excessive sun exposure, exposure to mud, smoking, alcohol, khat and inadequate food intake were also reported as causes for TB. Such beliefs initially led to self-treatment. The majority of patients were aware of an association between TB and HIV. Some reported that TB could transform into HIV, while others said that the body could be weakened by HIV and become more susceptible to illnesses such as TB. Some patients classified TB as either HIV-related or non-HIV-related, and weight loss was a hallmark for HIV-related TB. The majority of patients believed that people in the community knew that there was an association between TB and HIV, and some feared that this would predispose them to HIV-related stigma. Conclusion There is a need for culturally sensitive information and educational efforts to address misperceptions about TB and HIV. Health professionals should provide information about causes and treatment of TB and HIV to co-infected patients.

  3. Pharmacological modification of multi-drug resistance (MDR) in vitro detected by a novel fluorometric microculture cytotoxicity assay. Reversal of resistance and selective cytotoxic actions of cyclosporin A and verapamil on MDR leukemia T-cells.

    Science.gov (United States)

    Larsson, R; Nygren, P

    1990-07-15

    A novel fluorometric microculture cytotoxicity assay (FMCA), based on measurements of fluorescein diacetate (FDA) hydrolysis and DNA staining by Hoechst 33342, was used for drug sensitivity testing and detection of resistance reversal in acute lymphoblastic leukemia (ALL) cell lines. The 72-hr assay was found to be sensitive, reproducible and linearly related to the number of viable cells within a broad range of cell concentrations. At clinically achievable drug concentrations, the calcium channel blocker Verapamil (ver) and the immunosuppressant Cyclosporin A (csA) were found to partly reverse acquired Vincristine (vcr) resistance in multi-drug resistant (MDR) T-ALL L100 cells with little or no effect on the drug-sensitive parental L0 cell line. By combining the fluorometric indices, we found that low concentrations of csA were growth-inhibitory, whereas higher concentrations (greater than 10 micrograms/ml) were progressively cytotoxic for drug-sensitive L0 cells. In MDR L100 cells, on the other hand, csA produced significant cell kill even at low drug concentrations. Ver had no effects on sensitive L0 cells but showed considerable cytotoxic action towards MDR L100 cells. There was no apparent relationship between drug reversal of vcr resistance and the cytotoxic actions of the drug per se since the calcium channel blocker diltiazem (dil) significantly potentiated the actions of vcr on MDR L100 cells without being more toxic to these cells (compared to vcr-sensitive L0 cells).

  4. Effect of the mutation (C3435T) at exon 26 of the MDR1 gene on expression level of MDR1 messenger ribonucleic acid in duodenal enterocytes of healthy Japanese subjects.

    Science.gov (United States)

    Nakamura, Tsutomu; Sakaeda, Toshiyuki; Horinouchi, Masanori; Tamura, Takao; Aoyama, Nobuo; Shirakawa, Toshiro; Matsuo, Masafumi; Kasuga, Masato; Okumura, Katsuhiko

    2002-04-01

    The effect of the C3435T mutation at exon 26 of the MDR1 gene on the expression levels of MDR1 messenger ribonucleic acid (mRNA) was evaluated by means of real-time polymerase chain reaction in 51 biopsy specimens of duodenum obtained from 13 healthy Japanese subjects. The mRNA levels of MDR1 were 0.38 +/- 0.15, 0.56 +/- 0.14, and 1.13 +/- 0.42 (mean value +/- SE) in the subjects with the homozygote of wild-type allele (C/C), compound heterozygote with mutant T allele (C/T), and the homozygote of the mutant allele (T/T), respectively, reasonably explaining the lower digoxin serum concentration after administration of a single oral dose to subjects harboring a mutant T allele. Good correlation (r =.797; P CYP3A4 in the individual biopsy specimens. This finding suggested a lower plasma concentration of the substrates for CYP3A4 in subjects harboring the C3435T mutation of the MDR1 gene.

  5. Transmission of MDR MRSA between primates, their environment and personnel at a United States primate centre.

    Science.gov (United States)

    Soge, Olusegun O; No, David; Michael, Karen E; Dankoff, Jennifer; Lane, Jennifer; Vogel, Keith; Smedley, Jeremy; Roberts, Marilyn C

    2016-10-01

    MDR MRSA isolates cultured from primates, their facility and primate personnel from the Washington National Primate Research Center were characterized to determine whether they were epidemiologically related to each other and if they represented common local human-associated MRSA strains. Human and primate nasal and composite environmental samples were collected, enriched and selected on medium supplemented with oxacillin and polymyxin B. Isolates were biochemically verified as Staphylococcus aureus and screened for the mecA gene. Selected isolates were characterized using SCCmec typing, MLST and WGS. Nasal cultures were performed on 596 primates and 105 (17.6%) were MRSA positive. Two of 79 (2.5%) personnel and two of 56 (3.6%) composite primate environmental facility samples were MRSA positive. Three MRSA isolates from primates, one MRSA from personnel, two environmental MRSA and one primate MSSA were ST188 and were the same strain type by conventional typing methods. ST188 isolates were related to a 2007 ST188 human isolate from Hong Kong. Both MRSA isolates from out-of-state primates had a novel MLST type, ST3268, and an unrelated group. All isolates carried ≥1 other antibiotic resistance gene(s), including tet(38), the only tet gene identified. ST188 is very rare in North America and has almost exclusively been identified in people from Pan-Asia, while ST3268 is a newly reported MRSA type. The data suggest that the primate MDR MRSA was unlikely to come from primate centre employees. Captive primates are likely to be an unappreciated source of MRSA. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  6. High Field Magnetization of Tb Single Crystals

    DEFF Research Database (Denmark)

    Roeland, L. W.; Cock, G. J.; Lindgård, Per-Anker

    1975-01-01

    Hamiltonian including isotropic exchange interactions, effective single-ion anisotropy and magnetoelastic contributions. The parameters of this Hamiltonian were determined by fitting the theoretical results for the spin wave dispersion and energy gap as a function of temperature and magnetic field to existing...... data on Tb. The conduction-electron polarization at zero field and temperature is (0.33+or-0.05) mu B/ion, and the susceptibility is greater than the Pauli susceptibility calculated from the band-structure....

  7. Radiorespirometry in TB diagnosis and drug discovery

    International Nuclear Information System (INIS)

    Ray Mukti, K.; Kulkarni, Savita; Rajan, M.G.R.

    2015-01-01

    Tuberculosis remains a major health problem worldwide and especially in India with 1.9 million new cases and 0.35 million deaths per year. Early and rapid diagnosis of pulmonary tuberculosis is mandatory for controlling the transmission of the disease. Conventional test like sputum AFB is not sensitive and gold standard culture test is time consuming. Our laboratory has standardized a Radiorespirometry technique for primary diagnosis which offers advantage of both less turnaround time and sensitivity. Radiorespirometry is a true radiotracer technique that detects the presence of live microorganism in a biological sample. In this method, bacteria (or clinical sample) is inoculated into a medium supplemented with radiolabelled ( 14 C) carbon compounds. Only metabolically active organism present in the sample will metabolize the carbon source and produce radiolabelled carbon dioxide ( 14 CO 2 ) . This 14 CO 2 can be efficiently trapped in an alkaline-scintillant matrix and counted in a liquid scintillation counter. The whole thing is suitably assembled in a regular scintillation vial. We used radiorespirometry in a retrospective study using culture positive sputum samples (which was detected positive by culture in 3-8 weeks time) and it detected presence of TB bacilli in 1 to 3 weeks. Further, series of Phenyl acrylamide derivatives synthesized against RecA of mycobacteria were evaluated for anti-TB properties using radiorespirometry. More than 90% of the compounds exhibited anti-TB properties with MIC 3.25 to 25 μg/ml. Structure activity relationship of these compound was studied to understand the anti-TB pharmacophores. Interesting results obtained using radiorespirometry will be discussed. (author)

  8. Magnetostriction of Tb-Dy-Fe crystals

    International Nuclear Information System (INIS)

    Mei Wu; Okane, T.; Umeda, T.

    1998-01-01

    left angle 111 right angle -oriented twin free Tb-Dy-Fe single crystals, left angle 112 right angle - and left angle 110 right angle -oriented twinned ''single'' Tb-Dy-Fe crystals were prepared using floating zone melting crystal growth methods. Magnetostrictive performances of the crystals were investigated. Better low-field properties were observed in the left angle 110 right angle twinned crystals than in the left angle 112 right angle crystals. The highest properties were achieved in the left angle 111 right angle twin free single crystals. Even though there were still oxidized particles in the present left angle 111 right angle single crystals, a large magnetostrictive jump of 1700 ppm and a very low saturation magnetic field of 500 Oe were obtained. To understand magnetization and magnetostriction of different Tb-Dy-Fe crystals, theoretical modeling was carried out based on a simplified domain rotation model. Magnetization moment rotation paths of different domains were simulated and hence the resultant magnetostriction was obtained, which could adequately account for the experimental results of different crystals. The limitation of the domain rotation model was also discussed. (orig.)

  9. Association of ACE and MDR1 Gene Polymorphisms with Steroid Resistance in Children with Idiopathic Nephrotic Syndrome.

    Science.gov (United States)

    Dhandapani, Mohanapriya Chinambedu; Venkatesan, Vettriselvi; Rengaswamy, Nammalwar Bollam; Gowrishankar, Kalpana; Nageswaran, Prahlad; Perumal, Venkatachalam

    2015-08-01

    The purpose of the study was to investigate the distribution of insertion/deletion (I/D) polymorphisms of the angiotensin-converting enzyme (ACE) gene and three exonic polymorphisms of the multidrug resistance 1 (MDR1) gene (C3435T, C1236T, and G2677T) in children diagnosed with idiopathic nephrotic syndrome (INS). The study group consisted of 100 healthy controls and 150 INS patients, of which 50 were steroid resistant. Genomic DNA from blood samples was isolated from both of these groups and genotyping of the ACE and MDR1 genes was performed by polymerase chain reaction (PCR) using specific primers. There was no significant difference observed in the genotypic distribution and D allele frequency of the ACE gene. The two single-nucleotide polymorphisms (SNPs), C1236T and C3435T, of the MDR1 gene showed no significance, whereas the SNP G2677T/A was significantly associated with the genotypes GT and GA of the MDR1 gene, indicating it may be a potential marker to detect drug resistance. Screening these polymorphisms will pave the way to better understand the molecular mechanisms of the disease, which may be useful in developing targeted therapies for INS patients.

  10. Isolation, Identification And Screening Antibacterial Activity from Marine Sponge-Associated Fungi Against Multidrug-Resistant (MDR) Escherichia coli

    Science.gov (United States)

    Triandala Sibero, Mada; Sabdaningsih, Aninditia; Cristianawati, Olvi; Nuryadi, Handung; Karna Radjasa, Ocky; Sabdono, Agus; Trianto, Agus

    2017-02-01

    Irrational used of antibiotic in several decades ago causing resistant in bacteria and decreasing the cure rate of infectious diseases. Multidrug-resistant (MDR) Escherichia coli is known to cause various of infectious diseases such as urinary tract infection, nosocomial bloodstream infection, meningitis, bacteraemia, and gastrointestinal disease. Marine sponge-associated fungi have potential as source of new compound to combat MDR E. coli. The aims of this research were to isolate marine sponge-assosiated fungi, to screen potential fungi against MDR E. coli, to identify the potential fungi and its host sponge. There were 29 marine sponge-associated fungi successfully isolated from 9 sponges. Among 29 sponge-associated fungi screened, there were 7 isolates showed antibacterial activity against MDR E. coli. The best inhibition zone produced by MPS 14.1/MT 02 and MPS 14.3/MT 04 from sponge PP.SP.16.14. According to fungi identification result fungus MPS 14.1/MT 02 was identified as Trichoderma asperellum while MPS 14.3/MT 04 was identified as Trichoderma reesei. Sponge identification leaded the PP.SP.16.14 as Cinachyrella sp.

  11. Outcomes of multidrug-resistant tuberculosis treatment with early initiation of antiretroviral therapy for HIV co-infected patients in Lesotho.

    Directory of Open Access Journals (Sweden)

    Hind Satti

    Full Text Available BACKGROUND: Although the importance of concurrent treatment for multidrug-resistant tuberculosis (MDR-TB and HIV co-infection has been increasingly recognized, there have been few studies reporting outcomes of MDR-TB and HIV co-treatment. We report final outcomes of comprehensive, integrated MDR-TB and HIV treatment in Lesotho and examine factors associated with death or treatment failure. METHODS: We reviewed clinical charts of all adult patients who initiated MDR-TB treatment in Lesotho between January 2008 and September 2009. We calculated hazard ratios (HR and used multivariable Cox proportional hazards regression to identify predictors of poor outcomes. RESULTS: Of 134 confirmed MDR-TB patients, 83 (62% were cured or completed treatment, 46 (34% died, 3 (2% transferred, 1 (1% defaulted, and 1 (1% failed treatment. Treatment outcomes did not differ significantly by HIV status. Among the 94 (70% patients with HIV co-infection, 53% were already on antiretroviral therapy (ART before MDR-TB treatment initiation, and 43% started ART a median of 16 days after the start of the MDR-TB regimen. Among HIV co-infected patients who died, those who had not started ART before MDR-TB treatment had a shorter median time to death (80 days vs. 138 days, p=0.065. In multivariable analysis, predictors of increased hazard of failure or death were low and severely low body mass index (HR 2.75, 95% confidence interval [CI] 1.27-5.93; HR 5.50, 95% CI 2.38-12.69, and a history of working in South Africa (HR 2.37, 95% CI 1.24-4.52. CONCLUSIONS: Favorable outcomes can be achieved in co-infected patients using a community-based treatment model when both MDR-TB and HIV disease are treated concurrently and treatment is initiated promptly.

  12. Prognostic significance of multidrug-resistance protein (MDR-1 in renal clear cell carcinomas: A five year follow-up analysis

    Directory of Open Access Journals (Sweden)

    Strazzullo Viviana

    2006-12-01

    Full Text Available Abstract Background A large number of renal cancer patients shows poor or partial response to chemotherapy and the mechanisms have not been still understood. Multi-drug resistance is the principal mechanism by which many cancers develop resistance to chemotherapic drugs. The role of the multi-drug resistant transporter (MDR-1/P-glycoprotein, the gene product of MDR-1, and that one of the so-called multi-drug resistance associated protein (MRP, two energy-dependent efflux pumps, are commonly known to confer drug resistance. We studied MDR-1 expression in selected cases of renal cell carcinoma (RCC, clear cell type, with long-term follow-up, in order to establish its prognostic role and its possible contribution in the choice of post-surgical therapy. Methods MDR-1 has been studied by standard LSAB-HRP immunohistochemical technique, in paraffin embedded RCC samples. Protein expression has been compared to clinical and histopathological data and to disease specific survival of RCC patients, by Kaplan-Meier curve and Cox multivariate regression analyses. Results Two groups of RCCs were obtained by esteeming MDR-1 expression and disease specific survival (obtained with Kaplan-Meier curve and Cox multivariate regression analyses: the first one presents low or absent MDR-1 expression and good survival; the second one is characterized by high MDR-1 expression and significant poor outcome (p p p p Conclusion In our opinion, the results of this study well prove the relationship between MDR-1 expression and worse clinical prognosis in RCC, because MDR-1 over-expressing RCCs can be considered a group of tumours with a more aggressive behavior. This finding outlines a possible role of MDR-1 as prognostic factor, dependent and independent of multidrug resistance. These results could be useful to predict cancer evolution and to choose the appropriate treatment: this is another step that can stimulate further promising and interesting investigations on broader

  13. Resistance patterns among multidrug-resistant tuberculosis patients in greater metropolitan Mumbai: trends over time.

    Science.gov (United States)

    Dalal, Alpa; Pawaskar, Akshay; Das, Mrinalini; Desai, Ranjan; Prabhudesai, Pralhad; Chhajed, Prashant; Rajan, Sujeet; Reddy, Deepesh; Babu, Sajit; Jayalakshmi, T K; Saranchuk, Peter; Rodrigues, Camilla; Isaakidis, Petros

    2015-01-01

    While the high burden of multidrug-resistant tuberculosis (MDR-TB) itself is a matter of great concern, the emergence and rise of advanced forms of drug-resistance such as extensively drug-resistant TB (XDR-TB) and extremely drug-resistant TB (XXDR-TB) is more troubling. The aim of this study was to investigate the trends over time of patterns of drug resistance in a sample of MDR-TB patients in greater metropolitan Mumbai, India. This was a retrospective, observational study of drug susceptibility testing (DST) results among MDR-TB patients from eight health care facilities in greater Mumbai between 2005 and 2013. We classified resistance patterns into four categories: MDR-TB, pre-XDR-TB, XDR-TB and XXDR-TB. A total of 340 MDR-TB patients were included in the study. Pre-XDR-TB was the most common form of drug-resistant TB observed overall in this Mumbai population at 56.8% compared to 29.4% for MDR-TB. The proportion of patients with MDR-TB was 39.4% in the period 2005-2007 and 27.8% in 2011-2013, while the proportion of those with XDR-TB and XXDR-TB was changed from 6.1% and 0% respectively to 10.6% and 5.6% during the same time period. During the same periods, the proportions of patients with ofloxacin, moxifloxacin and ethionamide resistance significantly increased from 57.6% to 75.3%, from 60.0% to 69.5% and from 24.2% to 52.5% respectively (pMumbai highlight the need for individualized drug regimens, designed on the basis of DST results involving first- and second-line anti-TB drugs and treatment history of the patient. A drug-resistant TB case-finding strategy based on molecular techniques that identify only rifampicin resistance will lead to initiation of suboptimal treatment regimens for a significant number of patients, which may in turn contribute to amplification of resistance and transmission of strains with increasingly advanced resistance within the community.

  14. ANTIBACTERIAL ACTIVITY OF DRACONTOMELON DAO EXTRACTS ON METHICILLIN-RESISTANT S. AUREUS (MRSA) AND E. COLI MULTIPLE DRUG RESISTANCE (MDR).

    Science.gov (United States)

    Yuniati, Yuniati; Hasanah, Nurul; Ismail, Sjarif; Anitasari, Silvia; Paramita, Swandari

    2018-01-01

    Staphylococcus aureus , methicillin-resistant and Escherichia coli , multidrug-resistant included in the list of antibiotic-resistant priority pathogens from WHO. As multidrug-resistant bacteria problem is increasing, it is necessary to probe new sources for identifying antimicrobial compounds. Medicinal plants represent a rich source of antimicrobial agents. One of the potential plants for further examined as antibacterial is Dracontomelon dao (Blanco) Merr. & Rolfe. The present study designed to find the antibacterial activity of D. dao stem bark extracts on Methicillin-resistant S. aureus (MRSA) and E. coli Multiple Drug Resistance (MDR), followed by determined secondary metabolites with antibacterial activity and determined the value of MIC (minimum inhibitory concentration) and MBC (minimum bactericidal concentration). D. dao stem bark extracted using 60% ethanol. Disc diffusion test methods used to find the antibacterial activity, following by microdilution methods to find the value of MIC and MBC. Secondary metabolites with antibacterial activity determined by bioautography using TLC (thin layer chromatography) methods. D. dao stem bark extracts are sensitive to MSSA, MRSA and E.coli MDR bacteria. The inhibition zone is 16.0 mm in MSSA, 11.7 mm in MRSA and 10.7 mm in E. coli MDR. The entire MBC/MIC ratios for MSSA, MRSA and E.coli MDR is lower than 4. The ratio showed bactericidal effects of D. dao stem bark extracts. In TLC results, colorless bands found to be secondary metabolites with antibacterial activity. D. dao stem bark extracts are potential to develop as antibacterial agent especially against MRSA and E. coli MDR strain.

  15. Optimization of TB/HIV co-treatment in Ethiopian patients

    OpenAIRE

    Degu, Wondwossen Amogne

    2015-01-01

    Tuberculosis (TB) and HIV infection act with deadly synergy. HIV is the most important risk factor for latent TB reactivation and active TB progression following exposure or reinfection while TB accelerates HIV progression. TB is the most frequent cause of morbidity and mortality in HIV infection. Anti-TB therapy (ATT) must precede initiation of combination Antiretroviral Therapy (cART), TB being the most immediate threat. Undoubtedly cART benefits; however, important clinical ...

  16. Emerging epidemic of drug resistant tuberculosis in vulnerable ...

    African Journals Online (AJOL)

    the incidence of TB/MDR-TB in domestic interactions of MDR-TB patients1. Domestic contacts of MDR-TB suggest more recurrent threat of developing active TB and MDR-TB but such studies are rare19. Homelessness is a miserable condition, incorporating several liabilities that strikingly intensify the risk of being diseased, ...

  17. Ambulatory Multi-Drug Resistant Tuberculosis Treatment Outcomes in a Cohort of HIV-Infected Patients in a Slum Setting in Mumbai, India

    Science.gov (United States)

    Isaakidis, Petros; Cox, Helen S.; Varghese, Bhanumati; Montaldo, Chiara; Da Silva, Esdras; Mansoor, Homa; Ladomirska, Joanna; Sotgiu, Giovanni; Migliori, Giovanni B.; Pontali, Emanuele; Saranchuk, Peter; Rodrigues, Camilla; Reid, Tony

    2011-01-01

    Background India carries one quarter of the global burden of multi-drug resistant TB (MDR-TB) and has an estimated 2.5 million people living with HIV. Despite this reality, provision of treatment for MDR-TB is extremely limited, particularly for HIV-infected individuals. Médecins Sans Frontières (MSF) has been treating HIV-infected MDR-TB patients in Mumbai since May 2007. This is the first report of treatment outcomes among HIV-infected MDR-TB patients in India. Methods HIV-infected patients with suspected MDR-TB were referred to the MSF-clinic by public Antiretroviral Therapy (ART) Centers or by a network of community non-governmental organizations. Patients were initiated on either empiric or individualized second-line TB-treatment as per WHO recommendations. MDR-TB treatment was given on an ambulatory basis and under directly observed therapy using a decentralized network of providers. Patients not already receiving ART were started on treatment within two months of initiating MDR-TB treatment. Results Between May 2007 and May 2011, 71 HIV-infected patients were suspected to have MDR-TB, and 58 were initiated on treatment. MDR-TB was confirmed in 45 (78%), of which 18 (40%) were resistant to ofloxacin. Final treatment outcomes were available for 23 patients; 11 (48%) were successfully treated, 4 (17%) died, 6 (26%) defaulted, and 2 (9%) failed treatment. Overall, among 58 patients on treatment, 13 (22%) were successfully treated, 13 (22%) died, 7 (12%) defaulted, two (3%) failed treatment, and 23 (40%) were alive and still on treatment at the end of the observation period. Twenty-six patients (45%) experienced moderate to severe adverse events, requiring modification of the regimen in 12 (20%). Overall, 20 (28%) of the 71 patients with MDR-TB died, including 7 not initiated on treatment. Conclusions Despite high fluoroquinolone resistance and extensive prior second-line treatment, encouraging results are being achieved in an ambulatory MDR-T- program in a

  18. Laboratory-Based Surveillance of Extensively Drug-Resistant Tuberculosis in Eastern China.

    Science.gov (United States)

    Huang, Yu; Wu, Qingqing; Xu, Shuiyang; Zhong, Jieming; Chen, Songhua; Xu, Jinghang; Zhu, Liping; He, Haibo; Wang, Xiaomeng

    2017-03-01

    With 25% of the global burden, China has the highest incidence of drug-resistant tuberculosis (TB) in the world. However, surveillance data on extensively drug-resistant TB (XDR-TB) from China are scant. To estimate the prevalence of XDR-TB in Zhejiang, Eastern China, 30 of 90 TB treatment centers in Zhejiang were recruited. Patients with suspected TB who reported to the clinics for diagnosis were requested to undergo a smear sputum test. Positive sputum samples were tested for drug susceptibility. Data on anti-TB drug resistance from 1999 to 2008 were also collected to assess drug resistance trends. A total of 931 cases were recruited for drug susceptibility testing (DST). Among these, 23.6% (95% confidence interval [CI], 18.8-24.4) were resistant to any of the following drugs: isoniazid, rifampin, streptomycin, and ethambutol. Multidrug resistant (MDR) strains were identified in 5.1% of all cases (95% CI, 3.61-6.49). Among MDR-TB cases, 6.4% were XDR (95% CI, 1.7-18.6) and 8.9% (95% CI, 7.0-10.8) of all cases were resistant to either isoniazid or rifampin (but not both). Among MDR-TB cases, 23.4% (95% CI, 12.8-38.4) were resistant to either fluoroquinolones or a second-line anti-TB injectable drug, but not both. From 1999 to 2014, the percentage of MDR cases decreased significantly, from 8.6% to 5.1% (p = 0.00). The Global Fund to Fight TB program showed signs of success in Eastern China. However, drug-resistant TB, MDR-TB, and XDR-TB still pose a challenge for TB control in Eastern China. High-quality directly observed treatment, short-course, and universal DST for TB cases to determine appropriate treatment regimens are urgently needed to prevent acquired drug resistance.

  19. The Host Response to a Clinical MDR Mycobacterial Strain Cultured in a Detergent-Free Environment: A Global Transcriptomics Approach.

    Science.gov (United States)

    Leisching, Gina; Pietersen, Ray-Dean; Mpongoshe, Vuyiseka; van Heerden, Carel; van Helden, Paul; Wiid, Ian; Baker, Bienyameen

    2016-01-01

    During Mycobacterium tuberculosis (M.tb) infection, the initial interactions between the pathogen and the host cell determines internalization and innate immune response events. It is established that detergents such as Tween alter the mycobacterial cell wall and solubilize various lipids and proteins. The implication of this is significant since induced changes on the cell wall affect macrophage uptake and the immune response to M.tb. Importantly, during transmission between hosts, aerosolized M.tb enters the host in its native form, i.e. in a detergent-free environment, thus in vitro and in vivo studies should mimic this as closely as possible. To this end, we have optimized a procedure for growing and processing detergent-free M.tb and assessed the response of murine macrophages (BMDM) infected with multi drug-resistant M.tb (R179 Beijing 220 clinical isolate) using RNAseq. We compared the effects of the host response to M.tb cultured under standard laboratory conditions (Tween 80 containing medium -R179T), or in detergent-free medium (R179NT). RNAseq comparisons reveal 2651 differentially expressed genes in BMDMs infected with R179T M.tb vs. BMDMs infected with R179NT M.tb. A range of differentially expressed genes involved in BMDM receptor interaction with M.tb (Mrc1, Ifngr1, Tlr9, Fpr1 and Itgax) and pro-inflammatory cytokines/chemokines (Il6, Il1b, Tnf, Ccl5 and Cxcl14) were selected for analysis through qPCR. BMDMs infected with R179NT stimulate a robust inflammatory response. Interestingly, R179NT M.tb induce transcription of Fpr1, a receptor which detects bacterial formyl peptides and initiates a myriad of immune responses. Additionally we show that the host components Cxcl14, with an unknown role in M.tb infection, and Tlr9, an emerging role player, are only stimulated by infection with R179NT M.tb. Taken together, our results suggest that the host response differs significantly in response to Tween 80 cultured M.tb and should therefore not be used in

  20. The Host Response to a Clinical MDR Mycobacterial Strain Cultured in a Detergent-Free Environment: A Global Transcriptomics Approach.

    Directory of Open Access Journals (Sweden)

    Gina Leisching

    Full Text Available During Mycobacterium tuberculosis (M.tb infection, the initial interactions between the pathogen and the host cell determines internalization and innate immune response events. It is established that detergents such as Tween alter the mycobacterial cell wall and solubilize various lipids and proteins. The implication of this is significant since induced changes on the cell wall affect macrophage uptake and the immune response to M.tb. Importantly, during transmission between hosts, aerosolized M.tb enters the host in its native form, i.e. in a detergent-free environment, thus in vitro and in vivo studies should mimic this as closely as possible. To this end, we have optimized a procedure for growing and processing detergent-free M.tb and assessed the response of murine macrophages (BMDM infected with multi drug-resistant M.tb (R179 Beijing 220 clinical isolate using RNAseq. We compared the effects of the host response to M.tb cultured under standard laboratory conditions (Tween 80 containing medium -R179T, or in detergent-free medium (R179NT. RNAseq comparisons reveal 2651 differentially expressed genes in BMDMs infected with R179T M.tb vs. BMDMs infected with R179NT M.tb. A range of differentially expressed genes involved in BMDM receptor interaction with M.tb (Mrc1, Ifngr1, Tlr9, Fpr1 and Itgax and pro-inflammatory cytokines/chemokines (Il6, Il1b, Tnf, Ccl5 and Cxcl14 were selected for analysis through qPCR. BMDMs infected with R179NT stimulate a robust inflammatory response. Interestingly, R179NT M.tb induce transcription of Fpr1, a receptor which detects bacterial formyl peptides and initiates a myriad of immune responses. Additionally we show that the host components Cxcl14, with an unknown role in M.tb infection, and Tlr9, an emerging role player, are only stimulated by infection with R179NT M.tb. Taken together, our results suggest that the host response differs significantly in response to Tween 80 cultured M.tb and should therefore not

  1. Appropriate fluid regimens to prevent bronchopulmonary dysplasia.

    Science.gov (United States)

    Tammela, O K

    1995-01-01

    Pulmonary oedema is an important problem in premature neonates with surfactant deficiency because of fluid accumulation in the lung interstitium and reduced urine output. Some retrospective reports suggest that excessive early hydration might increase the risk of bronchopulmonary dysplasia (BPD). Only three prospective studies evaluating low or conventional fluid administration regimens to very low birth weight infants have been published. According to their results no significant differences in the incidence of BPD have been shown. However, fluid restriction seems to improve the outcome of the infants because of decreased incidence of haemodynamically significant patent ductus arteriosus, necrotizing enterocolitis, pulmonary air leaks and decreased mortality. The appropriate amount of sodium in the intravenous fluids during the first days of life needs further evaluation. In tiny infants with birth weights from 500 to 800g intensive monitoring of fluid balance is essential to control the extremely high fluid losses due to evaporation. Undernutrition is a risk factor of BPD and therefore it is important to start parenteral nutrition early. The benefit of the use of colloids as volume expanders is controversial. According to some retrospective reports there might be an association with increased use of colloidal fluids during the first days of life and the development of BPD. Early excessive fluid administration might constitute a potential risk for low birth weight infants with hyaline membrane disease.(ABSTRACT TRUNCATED AT 250 WORDS)

  2. Factors influencing [F-18]2-fluoro-2-deoxy-D-glucose (F-18 FDG) accumulation in melanoma cells. Is FDG a substrate of multidrug resistance (MDR)?

    International Nuclear Information System (INIS)

    Yamada, Kiyoshi; Brink, I.; Engelhardt, R.

    2005-01-01

    In order to specify the influence of multidrug-resistance (MDR) on the accumulation of the PET tracer, F-18 FDG ([Fluorine-18]2-fluoro-2-deoxy-D-glucose, in melanoma cells, both the MDR function and expression of two human melanoma cell lines SK-MEL 23 and 24, were evaluated. The effects of MDR modulators on FDG accumulation and efflux were also investigated. A functional analysis using representative MDR fluorescent substrates and inhibitors clarified the following characteristics: SK-MEL 23 possesses a highly active function of multidrug resistance-associated protein (MRP), but not P-gp. SK-MEL 24 possesses weak functions of both MRP and P-gp. Western blot analysis using monoclonal antibodies for MDR expression demonstrated an exceedingly high MRP expression of SK-MEL 23 and only slight P-gp and MRP expression of SK-MEL 24, corresponding to the functional data. The efflux inhibition assay using F-18 FDG revealed a considerable retention of FDG in SK-MEL 23 in the presence of the MRP inhibitor probenecid. It was also found that the P-gp inhibitor verapamil depressed the FDG efflux of SK-MEL 24. Our present in vitro study suggests that FDG may be a substrate of MDR in some melanoma cells and further MDR may be one of the important factors affecting FDG-PET melanoma imaging. (author)

  3. The Sex Res Non Naturales and the Regimen of Health

    DEFF Research Database (Denmark)

    Agerholm, Frank Juul

    The paper discusses the ethical and social soundness of the classical idea of diaita/regimen vis-à-vis the contemporary focus on healthy lifestyle......The paper discusses the ethical and social soundness of the classical idea of diaita/regimen vis-à-vis the contemporary focus on healthy lifestyle...

  4. Variation in training regimens in professional showjumping yards

    NARCIS (Netherlands)

    Lönnell, A C; Bröjer, J; Nostell, K; Hernlund, E; Roepstorff, L; Tranquille, C A; Murray, R C; Oomen, A; van Weeren, René; Bitschnau, C; Montavon, S; Weishaupt, M A; Egenvall, A

    2014-01-01

    REASONS FOR PERFORMING STUDY: Training regimens of showjumping horses under field conditions are largely undocumented. OBJECTIVES: The aims of this study were to quantify and compare training regimens used in professional-level showjumping yards, with respect to time exercised and type of activity.

  5. Chest Radiographs for Pediatric TB Diagnosis: Interrater Agreement and Utility

    Directory of Open Access Journals (Sweden)

    G. Kaguthi

    2014-01-01

    Full Text Available The chest radiograph (CXR is considered a key diagnostic tool for pediatric tuberculosis (TB in clinical management and endpoint determination in TB vaccine trials. We set out to compare interrater agreement for TB diagnosis in western Kenya. A pediatric pulmonologist and radiologist (experts, a medical officer (M.O, and four clinical officers (C.Os with basic training in pediatric CXR reading blindly assessed CXRs of infants who were TB suspects in a cohort study. C.Os had access to clinical findings for patient management. Weighted kappa scores summarized interrater agreement on lymphadenopathy and abnormalities consistent with TB. Sensitivity and specificity of raters were determined using microbiologically confirmed TB as the gold standard (n=8. A total of 691 radiographs were reviewed. Agreement on abnormalities consistent with TB was poor; k=0.14 (95% CI: 0.10–0.18 and on lymphadenopathy moderate k=0.26 (95% CI: 0.18–0.36. M.O [75% (95% CI: 34.9%–96.8%] and C.Os [63% (95% CI: 24.5%–91.5%] had high sensitivity for culture confirmed TB. TB vaccine trials utilizing expert agreement on CXR as a nonmicrobiologically confirmed endpoint will have reduced specificity and will underestimate vaccine efficacy. C.Os detected many of the bacteriologically confirmed cases; however, this must be interpreted cautiously as they were unblinded to clinical features.

  6. Fixed Dose Combination for TB treatment

    Directory of Open Access Journals (Sweden)

    Tjandra Y. Aditama

    2003-06-01

    Full Text Available According to the World Health Organization, a third of the world’s population is infected with tuberculosis. The disease is responsible for nearly 2 million deaths each year and over 8 million were developing active diseases. Moreover, according to WHO (2000, tuberculosis deaths are estimated to increase to 35 million between 2000-2020. The majority of tuberculosis patients worldwide are still treated with single drugs, or with 2-drug fixed-dose combinations (FDCs. To improve tuberculosis treatment, 2- and 3-drug FDCs were recommended by the World Health Organization (WHO as part of the DOTS strategy. Since 1999 a 4-drug FDC was included on the WHO Model List of Essential Drugs. Today, FDCs are important tools to further improve the quality of care for people with TB, and accelerate DOTS expansion to reach the global TB control targets. Fixed dose combination TB drugs could simplifies both treatment and management of drug supply, and may prevent the emergence of drug resistance .Prevention of drug resistance is just one of the potential benefits of the use of FDCs. FDCs simplify administration of drugs by reducing the number of pills a patient takes each day and decreasing the risk of incorrect prescriptions. Most tuberculosis patients need only take 3–4 FDCs tablets per day during the intensive phase of treatment, instead of the 15–16 tablets per day that is common with single-drug formulations It is much simpler to explain to patients that they need to take four tablets of the same type and colour, rather than a mixture of tablets of different shapes, colours and sizes. Also, the chance of taking an incomplete combination of drugs is eliminated, since the four essential drugs are combined into one tablet. FDCs are also simpler for care-givers as they minimize the risk of confusion. Finally, drug procurement, in all its components (stock management, shipping, distribution, is simplified by FDCs. Adverse reactions to drugs are not more

  7. Economic support to patients in HIV and TB grants in rounds 7 and 10 from the global fund to fight AIDS, tuberculosis and malaria.

    Directory of Open Access Journals (Sweden)

    Linda M Richter

    Full Text Available People with TB and/or HIV frequently experience severe economic barriers to health care, including out-of-pocket expenses related to diagnosis and treatment, as well as indirect costs due to loss of income. These barriers can both aggravate economic hardship and prevent or delay diagnosis, treatment and successful outcome, leading to increased transmission, morbidity and mortality. WHO, UNAIDS and the ILO argue that economic support of various kinds is essential to enable vulnerable people to protect themselves from infection, avoid delayed diagnosis and treatment, overcome barriers to adherence, and avert destitution. This paper analyses successful country proposals to the Global Fund to Fight AIDS, Tuberculosis and Malaria that include economic support in Rounds 7 and 10; 36 and 20 HIV and TB grants in Round 7 and 32 and 26, respectively, in Round 10. Of these, up to 84 percent included direct or indirect economic support for beneficiaries, although the amount constituted a very small proportion of the total grant. In TB grants, the objectives of economic support were generally clearly stated, and focused on mechanisms to improve treatment uptake and adherence, and the case was most clearly made for MDR-TB patients. In HIV grants, the objectives were much broader in scope, including mitigation of adverse economic and social effects of HIV and its treatment on both patients and families. The analysis shows that economic support is on the radar for countries developing Global Fund proposals, and a wide range of economic support activities are in place. In order to move forward in this area, the wealth of country experience that exists needs to be collated, assessed and disseminated. In addition to trials, operational research and programme evaluations, more precise guidance to countries is needed to inform evidence-based decision about activities that are cost-effective, affordable and feasible.

  8. One of the possible mechanisms for the inhibition effect of Tb(III) on peroxidase activity in horseradish (Armoracia rusticana) treated with Tb(III).

    Science.gov (United States)

    Guo, Shaofen; Cao, Rui; Lu, Aihua; Zhou, Qing; Lu, Tianhong; Ding, Xiaolan; Li, Chaojun; Huang, Xiaohua

    2008-05-01

    One of the possible mechanisms for the inhibition effect of Tb(III) on peroxidase activity in horseradish (Armoracia rusticana) treated with Tb(III) was investigated using some biophysical and biochemical methods. Firstly, it was found that a large amount of Tb(III) can be distributed on the cell wall, that some Tb(III) can enter into the horseradish cell, indicating that peroxidase was mainly distributed on cell wall, and thus that Tb(III) would interact with horseradish peroxidase (HRP) in the plant. In addition, peroxidase bioactivity was decreased in the presence of Tb(III). Secondly, a new peroxidase-containing Tb(III) complex (Tb-HRP) was obtained from horseradish after treatment with Tb(III); the molecular mass of Tb-HRP is near 44 kDa and the pI is about 8.80. Thirdly, the electrocatalytic activity of Tb-HRP is much lower than that of HRP obtained from horseradish without treatment with Tb(III). The decrease in the activity of Tb-HRP is due to the destruction (unfolding) of the conformation in Tb-HRP. The planarity of the heme active center in the Tb-HRP molecule was increased and the extent of exposure of Fe(III) in heme was decreased, leading to inhibition of the electron transfer. The microstructure change in Tb-HRP might be the result of the inhibition effect of Tb(III) on peroxidase activity in horseradish.

  9. In vitro detection of mdr1 mRNA in murine leukemia cells with 111In-labeled oligonucleotide

    International Nuclear Information System (INIS)

    Bai Jingming; Yokoyama, Kunihiko; Kinuya, Seigo; Michigishi, Takatoshi; Tonami, Norihisa; Shiba, Kazuhiro; Matsushita, Ryo; Nomura, Masaaki

    2004-01-01

    The feasibility of intracellular mdr1 mRNA expression detection with radiolabeled antisense oligonucleotide (ODN) was investigated in the murine leukemia cell line, P388/S, and its subclonal, adriamycin-resistant cell line, P388/R. The expression level of mdr1 mRNA was analyzed by reverse transcription-polymerase chain reaction (RT-PCR). Existence of the multidrug resistance (MDR) phenomenon was assessed via cellular uptake of 99m Tc-sestamibi (MIBI), a known substrate for P-glycoprotein. A 15-mer phosphorothioate antisense ODN complementary to the sequences located at -1 to 14 of mdr1 mRNA and its corresponding sense ODN were conjugated with the cyclic anhydride of diethylene triamine penta-acetic acid (cDTPA) via an amino group linked to the terminal phosphate at the 5' end at pH 8-9. The DTPA-ODN complexes at concentrations of 0.1-17.4 μMwere reacted with 111 InCl 3 at pH 5 for 1 h. The hybridization affinity of labeled ODN was evaluated with size-exclusion high-performance liquid chromatography following incubation with the complementary sequence. Cellular uptake of labeled ODN was examined in vitro. Furthermore, enhancing effects of synthetic lipid carriers (Transfast) on transmembrane delivery of ODN were assessed. P388/R cells displayed intense mdr1 mRNA expression in comparison with P388/S cells. 99m Tc-MIBI uptake in P388/S cells was higher than that in P388/R cells. Specific radioactivity up to 1,634 MBq/nmol was achieved via elevation of added radioactivity relative to ODN molar amount. The hybridization affinity of antisense 111 In-ODN was preserved at approximately 85% irrespective of specific activity. Cellular uptake of antisense 111 In-ODN did not differ from that of sense 111 In-ODN in either P388/S cells or P388/R cells. However, lipid carrier incorporation significantly increased transmembrane delivery of 111 In-ODN; moreover, specific uptake of antisense 111 In-ODN was demonstrated in P388/R cells. Radiolabeling of ODN at high specific

  10. Supporting clinical management of the difficult-to-treat TB cases: the ERS-WHO TB Consilium

    Directory of Open Access Journals (Sweden)

    Lia D’Ambrosio

    2015-03-01

    The primary objective of the ERS/WHO TB Consilium is to provide clinical consultation for drug-resistant TB and other difficult-to-treat TB cases, including co-infection with HIV and paediatric cases. Through technical guidance to clinicians managing complex TB cases, the main contribution and outcome of the initiative will be a public health response aimed at achieving correct treatment of affected patients and preventing further development of drug resistance. The Consilum's secondary objective is to ensure monitoring and evaluation of clinical practices on the ground (diagnosis, treatment and prevention.

  11. Patients direct costs to undergo TB diagnosis.

    Science.gov (United States)

    de Cuevas, Rachel M Anderson; Lawson, Lovett; Al-Sonboli, Najla; Al-Aghbari, Nasher; Arbide, Isabel; Sherchand, Jeevan B; Nnamdi, Emenyonu E; Aseffa, Abraham; Yassin, Mohammed A; Abdurrahman, Saddiq T; Obasanya, Joshua; Olanrewaju, Oladimeji; Datiko, Daniel; Theobald, Sally J; Ramsay, Andrew; Squire, S Bertel; Cuevas, Luis E

    2016-03-24

    A major impediment to the treatment of TB is a diagnostic process that requires multiple visits. Descriptions of patient costs associated with diagnosis use different protocols and are not comparable. We aimed to describe the direct costs incurred by adults attending TB diagnostic centres in four countries and factors associated with expenditure for diagnosis. Surveys of 2225 adults attending smear-microscopy centres in Nigeria, Nepal, Ethiopia and Yemen. Adults >18 years with cough >2 weeks were enrolled prospectively. Direct costs were quantified using structured questionnaires. Patients with costs >75(th) quartile were considered to have high expenditure (cases) and compared with patients with costs <75(th) quartile to identify factors associated with high expenditure. The most significant expenses were due to clinic fees and transport. Most participants attended the centres with companions. High expenditure was associated with attending with company, residing in rural areas/other towns and illiteracy. The costs incurred by patients are substantial and share common patterns across countries. Removing user fees, transparent charging policies and reimbursing clinic expenses would reduce the poverty-inducing effects of direct diagnostic costs. In locations with limited resources, support could be prioritised for those most at risk of high expenditure; those who are illiterate, attend the service with company and rural residents.

  12. Risk factors for acquiring MDR pathogen in a tertiary care hospital

    International Nuclear Information System (INIS)

    Noman, F.; Usmani, B.; Imtiaz, A.; Mahmood, F.

    2012-01-01

    Objective: To find out common risk factors in patients from whose samples Multi-Drug Resistant pathogens were isolated. Study Design Prospective observational study. Setting: Microbiology department of Liaquat National Hospital Karachi, a 750-bedded tertiary care Hospital. Material and Method All multi-drug resistant pathogens (resistant to representative antibiotics of at least three different classes of antimicrobial agents including carbapenems) isolated from samples like blood, bronchial wash, sputum, pus, etc, received from different units of hospital at Microbiology laboratory Liaquat National Hospital from December 2006 through February 2007 were included in this study. Patient information was collected from their personal file and through concerned treating physicians. Results and Conclusion A total of 228 MDR pathogens were isolated from different samples in 3 months, these included: Acinetobacter spp 184 (81 %) and Pseudomonas aeruginosa 44 (19%). Majority were from lower respiratory tract specimen, followed by blood. Most (86%) patients were in intensive care unit or high dependency unit. Mechanical ventilation was predominant finding in patients with Acinetobacter spp while surgical procedures were more frequently associated with Pseudomonas aeruginosa. Only 3% of Acinetobacter spp and 7 % of Pseudomonas aeruginosa were isolated during first 48 hours of hospital stay. (author)

  13. Cytotoxicity and Phytochemical Profiling of Sargassum Sp. Extract As Anti-Mdr Bacteria

    Science.gov (United States)

    Setyati, Wilis A.; Pramesti, Rini; Zainuddin, Muhamad; Puspita, Maya; Renta, Person P.

    2018-02-01

    Sargassum sp. contains bioactive compounds having the potential as an antibacterial agent. Sargassum sp. was collected from five different locations, i.e., Teluk Awur, Panjang Island, Bandengan, Ujung Piring, and Bondo. There were several different species of Sargassum sp. identified from each sampling locations. The collected seaweeds were washed, naturally dried, and ground to the powder-sized dry material. Dry seaweed was extracted gradually using n-hexane, ethyl acetate, and methanol (1:3 w/v). The antibacterial analysis was conducted based on Agar Diffusion method using Zobell as media. Resistance analysis was performed to evaluate the resistance of pathogen against commercial antibiotics, namely, chloramphenicol, ampicillin, erythromycin, amoxycillin, and tetracycline. Each Sargassum sp. extract was tested against three candidates of MDR bacteria, i.e., Staphylococcus aureus, Escherichia coli, and S. epidermidis. Results showed that S. aureus was resistant towards four out of five commercial antibiotics. E. coli and S. epidermidis were not susceptible to two and three out of five commercial antibiotics, respectively. N-hexane, ethyl acetate and methanol yielded 0.1-0.3%, 0.3-0.7 % and 0.8-4.7% of dry extract. Ethyl acetate extract of Sargassum from Teluk Awur performed the best antibacterial activity and contained an alkaloid, flavonoid, and phenolic compounds. Toxicity analysis showed that this ethyl acetate extract had LC50 at 463 ppm and categorized as chronic toxicity.

  14. Amplification of genome sections in mammalian somatic cells resistant to colchicine. VII. Localization of original and amplified copes of the mdr gene in the same segment of chromosome 4 of the Dzungarian hamster

    International Nuclear Information System (INIS)

    Sokova, O.I.; Siyanova, E.Yu.; Gudkov, A.V.; Kopnin, B.P.

    1988-01-01

    Using in situ hybridization, the mdr gene was mapped in chromosomes of Dzungarian hamster embryonic cells, amplification of which accompanies development of multidrug resistance (MDR). It was shown that the mdr gene is located in chromosome segment 4q15-21, in which, according to data obtained previously, amplified copes of open quotes MDR genes close quotes (mdr, et al.) are distributed, as a rule. Results obtained, as well as data of other investigators, attest to the fact that integration recombination of amplified copies of DNA occurs primarily at the site of disposition of homologous sequences

  15. Antibacterial effect of silver nanoparticles and capsaicin against MDR-ESBL producing Escherichia coli: An in vitro study

    Directory of Open Access Journals (Sweden)

    Debasish Kar

    2016-10-01

    Full Text Available Objective: To evaluate the antibacterial property of silver nanoparticles (AgNPs and capsaicin against multidrug resistant (MDR and extended spectrum beta-lactamase (ESBL producing Escherichia coli of bovine and poultry origin. Methods: Antibacterial efficacy of AgNPs and capsaicin was measured using broth dilution method. Five MDR-ESBL producing E. coli isolates of poultry (PEC4, PEC6, PEC15 and PEC16 and cattle mastitis origin (MEC2 were taken to evaluate the antibacterial effect of AgNPs and capsaicin. Results: At 50 mmol/L AgNPs, the viability of MDR of bacterial pathogens was reduced to almost 80%–90% and at 1000 mmol/L, the viability went down to 0%–3%. The minimum inhibitory concentration (MIC50 of AgNPs against these MDR-ESBL producing isolates was found to vary between 172–218 mmol/L whereas the MIC80 varied between 450–640 mmol/L. Capsaicin showed more prominent bactericidal effect and only at 2.5 mmol/L concentration, the viability was shown to be reduced by 20%–35% whereas at 7.5 mmol/L concentration, there was approximately 60% reduction in viability. Further at 25 mmol/L concentration, the viability was reduced to 0%–8%. The MIC50 and MIC80 of capsaicin against these MDRESBL producing isolates were found to vary between 4.6–7.5 mmol/L and 10.9–16.9 mmol/L, respectively. Conclusions: The results point out that capsaicin and AgNPs could be of use in treating ESBL infection.

  16. Preferential cytotoxicity of bortezomib toward highly malignant human liposarcoma cells via suppression of MDR1 expression and function

    International Nuclear Information System (INIS)

    Hu, Yamei; Wang, Lingxian; Wang, Lu; Wu, Xuefeng; Wu, Xudong; Gu, Yanhong; Shu, Yongqian; Sun, Yang; Shen, Yan; Xu, Qiang

    2015-01-01

    Liposarcoma is the most common soft tissue sarcoma with a high risk of relapse. Few therapeutic options are available for the aggressive local or metastatic disease. Here, we report that the clinically used proteasome inhibitor bortezomib exhibits significantly stronger cytotoxicity toward highly malignant human liposarcoma SW872-S cells compared with its parental SW872 cells, which is accompanied by enhanced activation of apoptotic signaling both in vitro and in vivo. Treatment of cells with Jun-N-terminal kinase (JNK) inhibitor SP60015 or the translation inhibitor cycloheximide ameliorated this enhanced apoptosis. Bortezomib inhibited MDR1 expression and function more effectively in SW872-S cells than in SW872 cells, indicating that the increased cytotoxicity relies on the degree of proteasome inhibition. Furthermore, the pharmacological or genetic inhibition of sarco/endoplasmic reticulum calcium-ATPase (SERCA) 2, which is highly expressed in SW872-S cells, resulted in partial reversal of cell growth inhibition and increase of MDR1 expression in bortezomib-treated SW872-S cells. These results show that bortezomib exhibits preferential cytotoxicity toward SW872-S cells possibly via highly expressed SERCA2-associated MDR1 suppression and suggest that bortezomib may serve as a potent agent for treating advanced liposarcoma. - Highlights: • We compare the cytotoxicity of different drugs between SW872-S and SW872 cells. • Highly malignant liposarcoma cells SW872-S show hypersensitivity to bortezomib. • Apoptotic signaling is robustly enhanced in bortezomib-treated SW872-S cells. • Bortezomib has strong suppression on MDR1 expression and function in SW872-S cells. • Inhibition of SERCA2 protects SW872-S cells from bortezomib

  17. Preferential cytotoxicity of bortezomib toward highly malignant human liposarcoma cells via suppression of MDR1 expression and function

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Yamei; Wang, Lingxian; Wang, Lu; Wu, Xuefeng; Wu, Xudong [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093 (China); Gu, Yanhong; Shu, Yongqian [Department of Clinical Oncology, The First Affiliated Hospital of Nanjing Medical University, Nanjing 210029 (China); Sun, Yang [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093 (China); Shen, Yan, E-mail: shenyan@nju.edu.cn [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093 (China); Xu, Qiang, E-mail: molpharm@163.com [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093 (China)

    2015-02-15

    Liposarcoma is the most common soft tissue sarcoma with a high risk of relapse. Few therapeutic options are available for the aggressive local or metastatic disease. Here, we report that the clinically used proteasome inhibitor bortezomib exhibits significantly stronger cytotoxicity toward highly malignant human liposarcoma SW872-S cells compared with its parental SW872 cells, which is accompanied by enhanced activation of apoptotic signaling both in vitro and in vivo. Treatment of cells with Jun-N-terminal kinase (JNK) inhibitor SP60015 or the translation inhibitor cycloheximide ameliorated this enhanced apoptosis. Bortezomib inhibited MDR1 expression and function more effectively in SW872-S cells than in SW872 cells, indicating that the increased cytotoxicity relies on the degree of proteasome inhibition. Furthermore, the pharmacological or genetic inhibition of sarco/endoplasmic reticulum calcium-ATPase (SERCA) 2, which is highly expressed in SW872-S cells, resulted in partial reversal of cell growth inhibition and increase of MDR1 expression in bortezomib-treated SW872-S cells. These results show that bortezomib exhibits preferential cytotoxicity toward SW872-S cells possibly via highly expressed SERCA2-associated MDR1 suppression and suggest that bortezomib may serve as a potent agent for treating advanced liposarcoma. - Highlights: • We compare the cytotoxicity of different drugs between SW872-S and SW872 cells. • Highly malignant liposarcoma cells SW872-S show hypersensitivity to bortezomib. • Apoptotic signaling is robustly enhanced in bortezomib-treated SW872-S cells. • Bortezomib has strong suppression on MDR1 expression and function in SW872-S cells. • Inhibition of SERCA2 protects SW872-S cells from bortezomib.

  18. A Comprehensive Investigation on Common Polymorphisms in the MDR1/ABCB1 Transporter Gene and Susceptibility to Colorectal Cancer

    Czech Academy of Sciences Publication Activity Database

    Campa, D.; Sainz, J.; Pardini, Barbara; Vodičková, Ludmila; Naccarati, Alessio; Rudolph, A.; Novotný, J.; Försti, A.; Buch, S.; von Schönfels, W.; Schafmayer, C.; Völzke, H.; Hoffmeister, M.; Frank, B.; Barale, R.; Hemminki, K.; Hampe, J.; Chang-Claude, J.; Brenner, H.; Vodička, Pavel; Canzian, F.

    2012-01-01

    Roč. 7, č. 3 (2012), e32784 E-ISSN 1932-6203 R&D Projects: GA ČR GA310/07/1430; GA ČR GAP304/10/1286 Institutional research plan: CEZ:AV0Z50390703 Keywords : single-nucleotide polymorphisms * resistance 1 mdr1 * p-glycoprotein Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.730, year: 2012

  19. The Characteristics of TB Epidemic and TB/HIV Co-Infection Epidemic: A 2007-2013 Retrospective Study in Urumqi, Xinjiang Province, China.

    Directory of Open Access Journals (Sweden)

    Wang Wei

    Full Text Available This study was aimed to find out epidemiologic characteristic of tuberculosis (TB cases, and Human Immunodeficiency Virus (HIV positive cases among TB patients (TB/HIV co-infection through demographic, temporal, and spatial study in Urumqi.Descriptive statistics and multivariate logistic regression were applied to identify the epidemiologic characteristics and risk factors of TB epidemic and TB/HIV co-infection epidemic. All addresses of each TB case, TB/HIV co-infection case, and administrative street were transformed into geographical coordinate. Subsequently, the geocoded address for 82 streets was transformed into a dot map used as the basis of spatial datasets. In addition, the paper also used quantile map and the spatial scan statistic in order to identify the spatial distribution and spatial clusters of TB epidemic and TB/HIV co-infection epidemic.There was a declining trend of the notification rates of TB epidemic from 2007 to 2009, as well as a rising trend from 2010 to 2013. However, the notification rates of TB/HIV co-infection epidemic showed a rising trend from 2007 to 2010, and a declining trend from 2011 to 2013. Moreover, a significant share of TB epidemic and TB/HIV co-infection epidemic happened between the age of 15 to 45 years old, indicating an increase in risk of TB and TB/HIV infection. It is worth noting that the risk of HIV infection for male TB patients was 2.947 times (95% CI [2.178, 3.988] than that of female patients. Han ethnicity and Uygur ethnicity in urban region accounted for a large proportion of total TB and TB/HIV co-infection cases. Most of the TB cases of minorities in Urumqi showed a statistically significant increase in risk of HIV infection than Han ethnicity in Urumqi. In addition, the spatial distribution of TB epidemic and TB/HIV co-infection epidemic was highly skewed. Most of the local clusters were located in urban area and rural-urban continuum where showed an increase in risk of TB and TB

  20. Paediatric TB/HIV co-infection – 'an uncompromising duet that ...

    African Journals Online (AJOL)

    2011-10-01

    Oct 1, 2011 ... tuberculosis (TB) in 2009, childhood TB accounted for 11% (884 000 cases).1 ... reduction in incident TB in ART-treated children compared with ..... Obesity is associated with an increased risk of miscarriage but its effect on.

  1. Prevalence and management out comes of anti TB drugs induced ...

    African Journals Online (AJOL)

    Patients and Methods: All TB patients admitted in the Hospital during the study period are the source of population, the study groups were been selected by detecting the possible confounding factors for jaundice. Base line LFT before anti TB initiation was determined before developed jaundice. Those patients, whom the ...

  2. 46 CFR 31.20-1 - Waters-TB/ALL.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 1 2010-10-01 2010-10-01 false Waters-TB/ALL. 31.20-1 Section 31.20-1 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY TANK VESSELS INSPECTION AND CERTIFICATION Waters Operated Over § 31.20-1 Waters—TB/ALL. The certificate of inspection shall show the waters over which the tank vessel...

  3. EVALUATION OF DTECII AND IIEXAGO 1 TB KJTS USED FOR ...

    African Journals Online (AJOL)

    BSN

    of TB infection and the risk of TB if infection has occurred (ATS-CDC, 1990) or as a dependent on the population being tested (ATS-CDC, 1994; Bass, 1993). ... environment, a cut off point of ;::: l 5mm is positive (ATS-CDC, 1994). Although tuberculin testing is the standard method for screening asymptomatic populations for ...

  4. Antiferromagnetism in a 20% Ho-80% Tb alloy single crystal

    DEFF Research Database (Denmark)

    Lebech, Bente

    1968-01-01

    20% Ho-80% Tb exhibits two magnetic phases, similar to those of Tb. The spiral turn angle varies from 31.1° to 21.4°. A minimum effective spin for the occurrence of stable simple ferromagnetic structure at low temperatures is predicted....

  5. The social determinants of tuberculosis and their association with TB ...

    African Journals Online (AJOL)

    Progress made in TB control through the implementation of the DOTS strategy, has been retarded by factors such as poverty, the HIV pandemic and the advent of multidrug resistant tuberculosis. There is currently an increasing shift in TB control ...

  6. Not just pretty pictures: Geographical Information Systems in TB ...

    African Journals Online (AJOL)

    Geographical Information Systems (GIS) is becoming a useful tool in disease control by health planners. However little is known about its potential in tuberculosis (TB) control. In 2000 the National TB Programme (NTP) in Malawi assessed its usefulness. Routinely collected case-finding data from the 3 previous years (1997 ...

  7. HIV/TB CO-INFECTION:THE CHALLENGES

    African Journals Online (AJOL)

    2013-12-02

    Dec 2, 2013 ... latent MTB infection to active TB disease, in which the annual risk of developing TB disease from MTB ... fresh air ventilation; exposure of highly vulnerable individuals; and reduced efficacy or failure of .... Consequently, some patients may develop acute renal failure or acute respiratory distress syndrome.

  8. 46 CFR 30.10-45 - Ocean-TB/O.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 1 2010-10-01 2010-10-01 false Ocean-TB/O. 30.10-45 Section 30.10-45 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY TANK VESSELS GENERAL PROVISIONS Definitions § 30.10-45 Ocean—TB/O. Under this designation shall be included all tank vessels normally navigating the waters of any ocean or...

  9. Challenges of TB diagnosis and treatment in South Africa | Wood ...

    African Journals Online (AJOL)

    It is estimated that 2 billion of the world\\'s population are latently infected with Mycobacterium tuberculosis (Mtb) with a resultant 8 - 9 million cases of active tuberculosis (TB) and 1.6 million deaths annually.1 The tools used for diagnosis of TB have remained largely unchanged since the 1880s when sputum microscopy, Mtb ...

  10. Investigation on the magnetocaloric effect in TbN compound

    Energy Technology Data Exchange (ETDEWEB)

    Ranke, P.J. von, E-mail: von.ranke@uol.com.br [Instituto de Física, Universidade do Estado do Rio de Janeiro—UERJ, Rua São Francisco Xavier, 524, 20550-013 RJ (Brazil); Alvarenga, T.S.T.; Nóbrega, E.P.; Alho, B.P.; Ribeiro, P.O. [Instituto de Física, Universidade do Estado do Rio de Janeiro—UERJ, Rua São Francisco Xavier, 524, 20550-013 RJ (Brazil); Carvalho, A. Magnus G. [Divisão de Metrologia de Materiais (DIMAT), Instituto Nacional de Metrologia, Normalização e Qualidade Industrial (INMETRO), Duque de Caxias, RJ 25250-020 (Brazil); Sousa, V.S.R. de; Caldas, A.; Oliveira, N.A. de [Instituto de Física, Universidade do Estado do Rio de Janeiro—UERJ, Rua São Francisco Xavier, 524, 20550-013 RJ (Brazil)

    2013-09-15

    One of the biggest challenges in materials science is to understand the microscopic mechanisms responsible in storage and release material entropy. TbN compound, which presents non-degeneracy in ground state, was studied and the calculated magnetocaloric effect is in good agreement with the recent experimental data. Also inverse magnetocaloric effect and spin reorientation transition were predicted in TbN. The theoretical investigations were carried out using a Hamiltonian, which includes the crystalline electrical field, Zeeman and exchange interactions. - Highlights: • Theoretical description of the magnetocaloric effect in TbN. • Influence of the crystalline electrical field anisotropy on TbN. • Predictions of inverse and anomalous magnetocaloric effect in TbN.

  11. Epigenetic mechanisms involved in differential MDR1 mRNA expression between gastric and colon cancer cell lines and rationales for clinical chemotherapy

    Directory of Open Access Journals (Sweden)

    Kim Kyung-Jong

    2008-08-01

    Full Text Available Abstract Background The membrane transporters such as P-glycoprotein (Pgp, the MDR1 gene product, are one of causes of treatment failure in cancer patients. In this study, the epigenetic mechanisms involved in differential MDR1 mRNA expression were compared between 10 gastric and 9 colon cancer cell lines. Methods The MDR1 mRNA levels were determined using PCR and real-time PCR assays after reverse transcription. Cytotoxicity was performed using the MTT assay. Methylation status was explored by quantification PCR-based methylation and bisulfite DNA sequencing analyses. Results The MDR1 mRNA levels obtained by 35 cycles of RT-PCR in gastric cancer cells were just comparable to those obtained by 22 cycles of RT-PCR in colon cancer cells. Real-time RT-PCR analysis revealed that MDR1 mRNA was not detected in the 10 gastric cancer cell lines but variable MDR1 mRNA levels in 7 of 9 colon cancer cell lines except the SNU-C5 and HT-29 cells. MTT assay showed that Pgp inhibitors such as cyclosporine A, verapamil and PSC833 sensitized Colo320HSR (colon, highest MDR1 expression but not SNU-668 (gastric, highest and SNU-C5 (gastric, no expression to paclitaxel. Quantification PCR-based methylation analysis revealed that 90% of gastric cancer cells, and 33% of colon cancer cells were methylated, which were completely matched with the results obtained by bisulfite DNA sequencing analysis. 5-aza-2'-deoxcytidine (5AC, a DNA methyltransferase inhibitor increased the MDR1 mRNA levels in 60% of gastric cells, and in 11% of colon cancer cells. Trichostatin A (TSA, histone deacetylase inhibitor increased the MDR1 mRNA levels in 70% of gastric cancer cells and 55% of colon cancer cells. The combined treatment of 5AC with TSA increased the MDR1 mRNA levels additively in 20% of gastric cancer cells, but synergistically in 40% of gastric and 11% of colon cancer cells. Conclusion These results indicate that the MDR1 mRNA levels in gastric cancer cells are significantly

  12. Detekce polymorfismu v genu MDR1 u ovčáckých a honáckých psů

    OpenAIRE

    Staroveská, Marieta

    2016-01-01

    This thesis is focused on polymorphism of MDR1 gene and related drug resistance. Resistance is caused by deletion of four nucleotids, that resulting in a frame shift and synthesis of nonfunctional transport of P-glycoprotein. The text describes a polymorphism of MDR1 (ABCB1) gene, which results in reduced resistance to drugs belonging to the group of macrocyclic lactones. It also describes inheritance of this phenomenon and it deals with the detection of mutation using PCR (polymerase chain r...

  13. Expression of multidrug resistance genes MVP, MDR1, and MRP1 determined sequentially before, during, and after hyperthermic isolated limb perfusion of soft tissue sarcoma and melanoma patients.

    Science.gov (United States)

    Stein, Ulrike; Jürchott, Karsten; Schläfke, Matthias; Hohenberger, Peter

    2002-08-01

    Isolated, hyperthermic limb perfusion (ILP) with recombinant human tumor necrosis factor alpha and melphalan is a highly effective treatment for advanced soft tissue sarcoma (STS) and locoregional metastatic malignant melanoma. Multidrug resistance (MDR)-associated genes are known to be inducible by heat and drugs; expression levels of the major vault protein (MVP), MDR1, and MDR-associated protein 1 (MRP1) were determined sequentially before, during, and after ILP of patients. Twenty-one STS or malignant melanoma patients were treated by ILP. Tumor tissue temperatures were recorded continuously and ranged from 33.4 degrees C initially to peak values of 40.4 degrees C during ILP. Serial true-cut biopsy specimens from tumor tissues were routinely microdissected. Expression analyses for MDR genes were performed by real-time reverse transcriptase polymerase chain reaction and immunohistochemistry. In 83% of the patients, MVP expression was induced during hyperthermic ILP. MVP-mRNA inductions often paralleled the increase in temperature during ILP. Increased MVP protein expressions either were observed simultaneously with the MVP-mRNA induction or were delayed until after the induction at the transcriptional level. Inductions of MDR1 and MRP1 were observed in only 13% and 27% of the specimens analyzed. Temperatures and drugs applied preferentially led to an induction of MVP and were not sufficient to induce MDR1 and MRP1 in the majority of tumors. This study is the first to analyze the expression of MDR-associated genes sequentially during ILP of patients and demonstrates that treatment might lead to increased levels of MVP, whereas enhanced levels of MDR1 and MRP1 remain rare events.

  14. A mutation within the extended X loop abolished substrate-induced ATPase activity of the human liver ATP-binding cassette (ABC) transporter MDR3.

    Science.gov (United States)

    Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz

    2015-02-20

    The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. In vitro antibacterial activity of crude extracts of 9 selected medicinal plants against UTI causing MDR bacteria

    Directory of Open Access Journals (Sweden)

    Monali P. Mishra

    2017-01-01

    Full Text Available Urinary tract infection (UTI has become a more grievous problem today, due to multidrug resistance of infecting Gram-positive (GP and Gram-negative (GN bacteria, sometimes even with multiple infections. This study examines effectivity of 9 tropical flowering plants (Anogeissus acuminata, Azadirachta indica, Bauhinia variegata, Boerhaavia diffusa, Punica granatum, Soymida febrifuga, Terminalia chebula, Tinospora cordifolia and Tribulus terrestris for possible use as source of antimicrobials for multidrug resistant (MDR bacteria, along with main-stream antibiotics. Pathogenic bacteria were isolated from urine samples of patients attending and admitted in the hospital. Antibiograms of 11 isolated bacteria (GPs, Enterococcus faecalis and Staphylococcus aureus; and GNs, Acinetobacter baumannii, Citrobacter freundii, Enterobacter aerogenes, Escherichia coli, Klebsiella oxytoca, Klebsiella pneumoniae, Proteus mirabilis, Proteus vulgaris and Pseudomonas aeruginosa were ascertained by the disc-diffusion method, and antibacterial effectivity of plant extracts was monitored by the agar-well diffusion method. Isolated bacteria were floridly MDR to most antibiotics of the day. Methanol extracts of 9 plants were used, and extracts of 3 plants, A. acuminata, P. granatum and S. febrifuga at least caused 25–29 mm as the maximum size of zone of inhibition on bacterial lawns. Minimum inhibitory concentration (MIC and minimum bactericidal concentration (MBC values of methanol extracts of 9 plants were recorded. The methanol extract of A. acuminata had 0.29 mg/ml as the lowest MIC value and 0.67 mg/ml as the lowest MBC value, against MDR S. aureus, signifying effectivity; but, it had the highest MIC value of 3.41 mg/ml. and the highest MBC value of 4.27 mg/ml for most other MDR bacteria including E. coli. Qualitative phytochemical analysis was done for these 9 plants and information on leading phytochemicals was presented retrieved from PubChem database. Thus

  16. Application Values of T-SPOT.TB in Clinical Rapid Diagnosis of Tuberculosis.

    Science.gov (United States)

    Zhu, Feng; Ou, Qinfang; Zheng, Jian

    2018-01-01

    This paper aims to explore the application value of tuberculosis-specific enzyme-linked immunospot assay (T-SPOT.TB) in the diagnosis of tuberculosis. Fifty one patients with tuberculosis (TB) admitted to Wuxi No.5 People's Hospital, Wuxi, China from June 2015 to June 2017 were selected as the TB group, and 40 patients without tuberculosis admitted in the same period were randomly selected as the non-TB group. Patients in the two groups received T-SPOT.TB, TB antibody (TB-Ab) test and mycobacterium TB deoxyribonucleic acid (TB-DNA) test, and the results were compared. Comparisons of the sensitivity of the three methods showed that the sensitivity of T-SPOT.TB was the highest, followed by TB-DNA from sputum samples, and that of TB-Ab was the lowest. The specificity of TB-Ab was the highest, followed by T-SPOT.TB, and that of TB-DNA from sputum samples was the lowest. In the receiver operating characteristic (ROC) curve analysis, the area under curve (AUC) of T-SPOT.TB (0.896) was the highest, followed by TB-DNA from sputum samples (0.772), and that of sputum smears (0.698) was the lowest. T-SPOT.TB can quickly and accurately determine the presence of tuberculosis infection, and it is a non-invasive examination, which can further assist in the diagnosis and guide the treatment.

  17. Implementation and outcomes of an active defaulter tracing system for HIV, prevention of mother to child transmission of HIV (PMTCT), and TB patients in Kibera, Nairobi, Kenya.

    Science.gov (United States)

    Thomson, Kerry A; Cheti, Erastus O; Reid, Tony

    2011-06-01

    Retention of patients in long term care and adherence to treatment regimens are a constant challenge for HIV, prevention of mother to child transmission of HIV (PMTCT), and TB programmes in sub-Saharan Africa. This study describes the implementation and outcomes of an active defaulter tracing system used to reduce loss to follow-up (LTFU) among HIV, PMTCT, TB, and HIV/TB co-infected patients receiving treatment at three Médecins Sans Frontières clinics in the informal settlement of Kibera, Nairobi, Kenya. Patients are routinely contacted by a social worker via telephone, in-person visit, or both very soon after they miss an appointment. Patient outcomes identified through 1066 tracing activities conducted between 1 April 2008 and 31 March 2009 included: 59.4% returned to the clinic, 9.0% unable to return to clinic, 6.3% died, 4.7% refused to return to clinic, 4.5% went to a different clinic, and 0.8% were hospitalized. Fifteen percent of patients identified for tracing could not be contacted. LTFU among all HIV patients decreased from 21.2% in 2006 to 11.5% in 2009. An active defaulter tracing system is feasible in a resource poor setting, solicits feedback from patients, retains a mobile population of patients in care, and reduces LTFU among HIV, PMTCT, and TB patients. Copyright © 2011 Royal Society of Tropical Medicine and Hygiene. Published by Elsevier Ltd. All rights reserved.

  18. Association between smoking, tuberculosis and diabetes-TB: an analysis on Indian TB patients

    Directory of Open Access Journals (Sweden)

    Ashok Bhardwaj

    2018-03-01

    400 (100 P value Non Smoker 20 (10.5 170 (89.5 190 (100 0.03 Current 17 (12.5 119 (87.5 136 (100 Ex -Smoker 17 (33.0 57 (77.0 74 (100 Median duration of smoking (IQR in years 20 (30 0.5 (25 3 (65 0.03 [Prevalence of Smoking with TB DM

  19. Propolis as an antibacterial agent against clinical isolates of mdr-acinetobacter baumannii

    International Nuclear Information System (INIS)

    Hannan, A.; Batool, A.; Qamar, U.; Khalid, F.

    2015-01-01

    Multidrug resistant (MDR) Acinetobacter baumannii has emerged as an important health care problem. The organism is now identified as an important nosocomial pathogen particularly in the intensive care settings. The therapeutic options to treat this pathogen are limited; thus it needs testing for alternatives, like those of plant origin or natural products. Propolis is one of such products which have been tested against this organism. Methods: A. baumannii (n=32) were collected from Fatima Memorial Hospital, Lahore. The isolates were identified on the basis of their morphology, cultural characteristics and biochemical profile. The susceptibility of the isolates to various antimicrobials was evaluated as per Kirby-Bauer disc diffusion method according to (CLSI 2010). An ethanolic extract of propolis was prepared by the ultrasonic extraction method and its antibacterial activity was evaluated by the agar well diffusion technique. Minimum inhibitory concentration (MIC) was also determined by the agar dilution technique. Results: The isolates were found to be resistant to most of the commonly used anti-acinetobacter antimicrobials; doxycycline however was the exception. Propolis from Sargodha (EPS) and Lahore (EPL) showed zones of inhibition of 21.8 ± .29 mm and 15.66 ± 2.18 mm respectively. MIC ranges of EPS and EPL similarly was from 1.5-2.0 mg/ml and 4.0-4.5 mg/ml respectively. Conclusion: It is clear that EPS has potential edge of activity as compared to EPL. Nevertheless the potential efficacy of propolis must be subjected to pharmaceutical kinetics and dynamics to precisely determine its potential antimicrobial usefulness. (author)

  20. Qualitative analysis of MDR-reversing Anastasia Black (Russian black sweet pepper, Capsicum annuum, Solanaceae) extracts and fractions by HPLC and LC-MS-MS methods.

    Science.gov (United States)

    Schelz, Zsuzsanna; Molnár, Joseph; Fogliano, Vincenzo; Ferracane, Rosalia; Pernice, Rita; Shirataki, Yoshiaki; Motohashi, Noboru

    2006-01-01

    In earlier experiments, the MDR (multidrug resistance)-reversal activities of Anastasia Black (Russian black sweet pepper) extracts had been analysed. Recently, the most effective MDR reversing extracts and fractions have been separated by HPLC (high-performance liquid chromatography, for carotenoids) and LC-MS-MS (HPLC combined with mass spectrometry, for phenolic compounds) methods. As a result of the analytical studies, the following flavonoids had been identified: feruloyl glucopyranoside, quercetin rhamnopyranoside glucopyranoside, luteolin glucopyranoside arabinopyranoside, apigenin glucopyranoside arabinopyranoside, quercetin rhamnopyranoside, luteolin arabinopyranoside diglucopy-ranoside, hesperidine and luteolin glucuronide. According to the literature, the aglycones of these phenolic compounds exhibit MDR-reversal activity in vitro, and the connection between the phenolic content of Anastasia Black and MDR-reversal action was therefore studied by different analytical methods. The results of this study revealed that the identified flavonoids of Anastasia Black may be only partially responsible for the modulation of the MDR of mouse lymphoma cells. Other lipophilic compounds, most probably carotenoids, present in Russian black sweet pepper may act as inhibitors of MDR reversal.

  1. Prevalence of pulmonary TB and spoligotype pattern of Mycobacterium tuberculosis among TB suspects in a rural community in Southwest Ethiopia

    Directory of Open Access Journals (Sweden)

    Deribew Amare

    2012-03-01

    Full Text Available Abstract Background In Ethiopia where there is no strong surveillance system and state of the art diagnostic facilities are limited, the real burden of tuberculosis (TB is not well known. We conducted a community based survey to estimate the prevalence of pulmonary TB and spoligotype pattern of the Mycobacterium tuberculosis isolates in Southwest Ethiopia. Methods A total of 30040 adults in 10882 households were screened for pulmonary TB in Gilgel Gibe field research centre in Southwest Ethiopia. A total of 482 TB suspects were identified and smear microscopy and culture was done for 428 TB suspects. Counseling and testing for HIV/AIDS was done for all TB suspects. Spoligotyping was done to characterize the Mycobacterium tuberculosis isolates. Results Majority of the TB suspects were females (60.7% and non-literates (83.6%. Using smear microscopy, a total of 5 new and 4 old cases of pulmonary TB cases were identified making the prevalence of TB 30 per 100,000. However, using the culture method, we identified 17 new cases with a prevalence of 76.1 per 100,000. There were 4.3 undiagnosed pulmonary TB cases for every TB case who was diagnosed through the passive case detection mechanism in the health facility. Eleven isolates (64.7% belonged to the six previously known spoligotypes: T, Haarlem and Central-Asian (CAS. Six new spoligotype patterns of Mycobacterium tuberculosis, not present in the international database (SpolDB4 were identified. None of the rural residents was HIV infected and only 5 (5.5% of the urban TB suspects were positive for HIV. Conclusion The prevalence of TB in the rural community of Southwest Ethiopia is low. There are large numbers of undiagnosed TB cases in the community. However, the number of sputum smear-positive cases was very low and therefore the risk of transmitting the infection to others may be limited. Active case finding through health extension workers in the community can improve the low case detection rate

  2. Regional Lymphotropic Therapy in Combination with Low Level Laser Therapy for Treating Multi-Drug-Resistant Tuberculosis

    Directory of Open Access Journals (Sweden)

    Oksana Dogorova

    2016-03-01

    Full Text Available With the growing incidence of Multi-Drug-Resistant Tuberculosis (MDR-TB in newly identified patients, novel multimodality treatment methods are needed, aimed at reducing the time to sputum conversion and cavity healing, which would be applicable in MDR cases. Our experimental treatment consisted of the following: 1 chemotherapy based on the drug sensitivity profile, 2 local laser irradiation therapy for 25 days, and lymphotropic administration of isoniazid (to subcutaneous tissue in alternating locations: underarm area; fifth intercostal space along the sterna border; subclavian area where the first rib meets the sternum in a daily dose of 10mg/kg 5 times a week. This treatment was significantly more effective in newly detected destructive MDR-TB versus the standard Category IV regimen for MDR-TB in terms of reduced time for sputum culture conversion and cavity healing, estimated to be 6 months after initiation of treatment.

  3. AtriplaR/anti-TB combination in TB/HIV patients. Drug in focus

    Directory of Open Access Journals (Sweden)

    Semvua Hadija H

    2011-11-01

    Full Text Available Abstract Background Co-administration of anti-tuberculosis and antiretroviral therapy is often inevitable in high-burden countries where tuberculosis is the most common opportunistic infection associated with HIV/AIDS. Concurrent use of rifampicin and several antiretroviral drugs is complicated by pharmacokinetic drug-drug interaction. Method Pubmed and Google search following the key words tuberculosis, HIV, emtricitabine, tenofovir efavirenz, interaction were used to find relevant information on each drug of the fixed dose combination AtriplaR Results Information on generic name, trade name, pharmacokinetic parameter, metabolism and the pharmacokinetic interaction with Anti-TB drugs of emtricitabine, tenofovir, and efavirenz was obtained. Conclusion Fixed dose combination of emtricitabine/tenofovir/efavirenz (ATRIPLAR which has been approved by Food and Drug Administration shows promising results as far as safety and efficacy is concerned in TB/HIV co-infection patients, hence can be considered effective and safe antiretroviral drug in TB/HIV management for adult and children above 3 years of age.

  4. Chemotherapy Regimen Extends Survival in Advanced Pancreatic Cancer Patients

    Science.gov (United States)

    A four-drug chemotherapy regimen has produced the longest improvement in survival ever seen in a phase III clinical trial of patients with metastatic pancreatic cancer, one of the deadliest types of cancer.

  5. Genital lesions: An indication for changing ART regimen.

    Science.gov (United States)

    Kumar, S Arun; Kumar, N; Kumarasamy, N

    2011-01-01

    Genital lesions are common in HIV positive patients and aetiology for these are mainly due to HSV, HPV or bacterial. They usually respond to HAART, antiviral or antimicrobials. We are presenting a young patient on HAART with non-healing genital ulcer lesions for sixteen months. He responded well to a change in ART regimen within a period of 15 days. This happened after a change to a more potent ART regimen.

  6. Integration of childhood TB into guidelines for the management of acute malnutrition in high burden countries.

    Science.gov (United States)

    Patel, L N; Detjen, A K

    2017-06-21

    Introduction: Childhood tuberculosis (TB) and undernutrition are major global public health challenges. In 2015, although an estimated 1 million children aged malnutrition from 17 high TB burden countries were reviewed to gather information on TB symptom screening, exposure history, and treatment. Results: Seven (41%) countries recommend routine TB screening among children with acute malnutrition, and six (35%) recommend obtaining a TB exposure history. Conclusion: TB screening is not consistently included in guidelines for acute malnutrition in high TB burden countries. Routine TB risk assessment, especially history of TB exposure, among acutely malnourished children, combined with improved linkages with TB services, would help increase TB case finding and could impact outcomes. Operational research on how best to integrate services at different levels of the health care system is needed.

  7. Predictors of Prolonged TB Treatment in a Dutch Outpatient Setting.

    Directory of Open Access Journals (Sweden)

    Natasha Van't Boveneind-Vrubleuskaya

    Full Text Available Standard treatment duration for drug-susceptible tuberculosis (TB treatment is 6 months. Treatment duration is often extended-and for various different reasons. The aim of this study was to determine the prevalence and to assess risk factors associated with extended TB treatment.A cross-sectional study was conducted. Data including demographic, clinical, radiological and microbiological information from the Netherlands TB Register (NTR of 90 patients with smear and culture positive pulmonary TB of the region Haaglanden, The Netherlands, was eligible for analysis.Treatment was extended to ≥ 200 days by 46 (51% patients. Extended TB treatment was associated with a higher frequency of symptoms, presumed to be due to adverse drug reactions (ADR; OR 2.39 95% CI: 1.01-5.69, drug-induced liver injury (DILI (OR: 13.51; 95% CI: 1.66-109.82 and longer than 2 month smear and culture conversion rate (OR: 11.00; 95% CI: 1.24-97.96 and OR: 8.56; 95% CI: 1.53-47.96. In the multivariable logistic analysis, development of DILI emerged as the single statistically strong risk factor necessitating extension of TB treatment.This finding will need further confirmation in a prospective study, exploring the possible mutual role of pharmacokinetic and pharmacogenetic determinants of DILI among TB patients.

  8. Immigrants and health system challenges to TB control in Oman

    Directory of Open Access Journals (Sweden)

    Fochsen Grethe

    2010-07-01

    Full Text Available Abstract Background During the past three decades, Oman has made significant progress in controlling TB within it's borders. However, the national TB control program elimination target has yet to be reached. This study aims to explore the perceived roles played by the immigrant population and the private health sector in relation to TB control in Oman. Methods We conducted seventeen interviews with different health care providers. The verbatim transcripts were processed using content analysis. Results Three main themes emerged. Firstly the threat of repatriation faced by underprivileged expatriates, secondly the criticized and forgotten private health sector as a key player and thirdly the user and provider barriers faced by Omani patients in the Omani public health system. Conclusions The study has identified some of the challenges and barriers to TB control in Oman. These challenges are mainly related to unintended negative consequences arising from the current repatriation policy of immigrants and to and the lack of involvement of the private sector in TB control. TB control strategies designed to address these challenges are needed, for Oman to reach its TB elimination targets.

  9. Asiatic Acid (AA) Sensitizes Multidrug-Resistant Human Lung Adenocarcinoma A549/DDP Cells to Cisplatin (DDP) via Downregulation of P-Glycoprotein (MDR1) and Its Targets.

    Science.gov (United States)

    Cheng, Qilai; Liao, Meixiang; Hu, Haibo; Li, Hongliang; Wu, Longhuo

    2018-01-01

    P-glycoprotein (P-gp, i.e., MDR1) is associated with the phenotype of multidrug resistance (MDR) and causes chemotherapy failure in the management of cancers. Searching for effective MDR modulators and combining them with anticancer drugs is a promising strategy against MDR. Asiatic acid (AA), a natural triterpene isolated from the plant Centella asiatica, may have an antitumor activity. The present study assessed the reversing effect of AA on MDR and possible molecular mechanisms of AA action in MDR1-overexpressing cisplatin (DDP)-resistant lung cancer cells, A549/DDP. Human lung adenocarcinoma A549/DDP cells were either exposed to different concentrations of AA or treated with DDP, and their viability was measured by the MTT assay. A Rhodamine 123 efflux assay, immunofluorescent staining, ATPase assay, reverse-transcription PCR (RT-PCR), and western blot analysis were conducted to elucidate the mechanisms of action of AA on MDR. Our results showed that AA significantly enhanced the cytotoxicity of DDP toward A549/DDP cells but not its parental A549 cells. Furthermore, AA strongly inhibited P-gp expression by blocking MDR1 gene transcription and increased the intracellular accumulation of the P-gp substrate Rhodamine 123 in A549/DDP cells. Nuclear factor (NF)-kB (p65) activity, IkB degradation, and NF-kB/p65 nuclear translocation were markedly inhibited by pretreatment with AA. Additionally, AA inhibited the MAPK-ERK pathway, as indicated by decreased phosphorylation of ERK1 and -2, AKT, p38, and JNK, thus resulting in reduced activity of the Y-box binding protein 1 (YB1) via blockage of its nuclear translocation. AA reversed P-gp-mediated MDR by inhibition of P-gp expression. This effect was likely related to downregulation of YB1, and this effect was mediated by the NF-kB and MAPK-ERK pathways. AA may be useful as an MDR reversal agent for combination therapy in clinical trials. © 2018 The Author(s). Published by S. Karger AG, Basel.

  10. Identification of antibiotic resistance genes in the multidrug-resistant Acinetobacter baumannii strain, MDR-SHH02, using whole-genome sequencing.

    Science.gov (United States)

    Wang, Hualiang; Wang, Jinghua; Yu, Peijuan; Ge, Ping; Jiang, Yanqun; Xu, Rong; Chen, Rong; Liu, Xuejie

    2017-02-01

    This study aimed to investigate antibiotic resistance genes in the multidrug-resistant (MDR) Acinetobacter baumannii (A. baumanii) strain, MDR-SHH02, using whole‑genome sequencing (WGS). The antibiotic resistance of MDR-SHH02 isolated from a patient with breast cancer to 19 types of antibiotics was determined using the Kirby‑Bauer method. WGS of MDR-SHH02 was then performed. Following quality control and transcriptome assembly, functional annotation of genes was conducted, and the phylogenetic tree of MDR-SHH02, along with another 5 A. baumanii species and 2 Acinetobacter species, was constructed using PHYLIP 3.695 and FigTree v1.4.2. Furthermore, pathogenicity islands (PAIs) were predicted by the pathogenicity island database. Potential antibiotic resistance genes in MDR-SHH02 were predicted based on the information in the Antibiotic Resistance Genes Database (ARDB). MDR-SHH02 was found to be resistant to all of the tested antibiotics. The total draft genome length of MDR-SHH02 was 4,003,808 bp. There were 74.25% of coding sequences to be annotated into 21 of the Clusters of Orthologous Groups (COGs) of protein terms, such as 'transcription' and 'amino acid transport and metabolism'. Furthermore, there were 45 PAIs homologous to the sequence MDRSHH02000806. Additionally, a total of 12 gene sequences in MDR-SHH02 were highly similar to the sequences of antibiotic resistance genes in ARDB, including genes encoding aminoglycoside‑modifying enzymes [e.g., aac(3)-Ia, ant(2'')‑Ia, aph33ib and aph(3')-Ia], β-lactamase genes (bl2b_tem and bl2b_tem1), sulfonamide-resistant dihydropteroate synthase genes (sul1 and sul2), catb3 and tetb. These results suggest that numerous genes mediate resistance to various antibiotics in MDR-SHH02, and provide a clinical guidance for the personalized therapy of A. baumannii-infected patients.

  11. Integration of HIV and TB services results in improved TB treatment outcomes and earlier prioritized ART initiation in a large urban HIV clinic in Uganda.

    Science.gov (United States)

    Hermans, Sabine M; Castelnuovo, Barbara; Katabira, Catherine; Mbidde, Peter; Lange, Joep M A; Hoepelman, Andy I M; Coutinho, Alex; Manabe, Yukari C

    2012-06-01

    The World Health Organization recommends that treatment of tuberculosis (TB) in HIV-infected patients should be integrated with HIV care. In December 2008, a separate outdoor-integrated TB/HIV clinic was instituted for attendees of a large urban HIV clinic in Uganda. We sought to evaluate associated TB and HIV treatment outcomes. Routinely collected clinical, pharmacy, and laboratory data were merged with TB clinic data for patients initiating TB treatment in 2009 and with TB register data for patients in 2007. TB treatment outcomes and (timing of) antiretroviral therapy (ART) initiation in ART-naive patients [overall and stratified by CD4+ T cell (CD4) count] in 2007 and 2009 were compared. Nosocomial transmission rates could not be assessed. Three hundred forty-six patients were initiated on TB treatment in 2007 and 366 in 2009. Median CD4 counts at TB diagnosis did not differ. TB treatment cure or completion increased from 62% to 68%, death or default decreased from 33% to 25% (P ART-naive TB patients were initiated on ART in 2009 versus 2007 (57% and 66%, P = 0.031), but this decrease was only in patients with CD4 counts >250 cells per cubic millimeter (19% vs. 48%, P = 0.003). More patients were started on ART during TB treatment (94% vs. 78%, P ART initiation. This supports rollout of a fully integrated TB/HIV service delivery model throughout high-prevalence TB and HIV settings.

  12. Antigen-Specific Interferon-Gamma Responses and Innate Cytokine Balance in TB-IRIS

    Science.gov (United States)

    Goovaerts, Odin; Jennes, Wim; Massinga-Loembé, Marguerite; Ceulemans, Ann; Worodria, William; Mayanja-Kizza, Harriet; Colebunders, Robert; Kestens, Luc

    2014-01-01

    Background Tuberculosis-associated immune reconstitution inflammatory syndrome (TB-IRIS) remains a poorly understood complication in HIV-TB patients receiving antiretroviral therapy (ART). TB-IRIS could be associated with an exaggerated immune response to TB-antigens. We compared the recovery of IFNγ responses to recall and TB-antigens and explored in vitro innate cytokine production in TB-IRIS patients. Methods In a prospective cohort study of HIV-TB co-infected patients treated for TB before ART initiation, we compared 18 patients who developed TB-IRIS with 18 non-IRIS controls matched for age, sex and CD4 count. We analyzed IFNγ ELISpot responses to CMV, influenza, TB and LPS before ART and during TB-IRIS. CMV and LPS stimulated ELISpot supernatants were subsequently evaluated for production of IL-12p70, IL-6, TNFα and IL-10 by Luminex. Results Before ART, all responses were similar between TB-IRIS patients and non-IRIS controls. During TB-IRIS, IFNγ responses to TB and influenza antigens were comparable between TB-IRIS patients and non-IRIS controls, but responses to CMV and LPS remained significantly lower in TB-IRIS patients. Production of innate cytokines was similar between TB-IRIS patients and non-IRIS controls. However, upon LPS stimulation, IL-6/IL-10 and TNFα/IL-10 ratios were increased in TB-IRIS patients compared to non-IRIS controls. Conclusion TB-IRIS patients did not display excessive IFNγ responses to TB-antigens. In contrast, the reconstitution of CMV and LPS responses was delayed in the TB-IRIS group. For LPS, this was linked with a pro-inflammatory shift in the innate cytokine balance. These data are in support of a prominent role of the innate immune system in TB-IRIS. PMID:25415590

  13. Efficacy of a six-month versus a 36-month regimen for prevention of tuberculosis in HIV-infected persons in India: a randomized clinical trial.

    Directory of Open Access Journals (Sweden)

    Soumya Swaminathan

    Full Text Available The optimal duration of preventive therapy for tuberculosis (TB among HIV-infected persons in TB-endemic countries is unknown.An open-label randomized clinical trial was performed and analyzed for equivalence. Seven hundred and twelve HIV-infected, ART-naïve patients without active TB were randomized to receive either ethambutol 800 mg and isoniazid 300 mg daily for six-months (6EH or isoniazid 300 mg daily for 36-months (36H. Drugs were dispensed fortnightly and adherence checked by home visits. Patients had chest radiograph, sputum smear and culture performed every six months, in addition to investigations if they developed symptoms. The primary endpoint was incident TB while secondary endpoints were all-cause mortality and adverse events. Survival analysis was performed on the modified intent to treat population (m-ITT and rates compared.Tuberculosis developed in 22 (6.4% of 344 subjects in the 6EH arm and 13 (3.8% of 339 subjects in the 36H arm with incidence rates of 2.4/100 py (95%CI- 1.4-3.5 and 1.6/100 py (95% CI-0.8-3.0 with an adjusted rate ratio (aIRR of 1.6 (0.8-3.2. Among TST-positive subjects, the aIRR of 6EH was 1.7 (0.6-4.3 compared to 36H, p = 0.8. All-cause mortality and toxicity were similar in the two arms. Among 15 patients with confirmed TB, 4 isolates were resistant to isoniazid and 2 were multidrug-resistant.Both regimens were similarly effective in preventing TB, when compared to historical incidence rates. However, there was a trend to lower TB incidence with 36H. There was no increase in isoniazid resistance compared to the expected rate in HIV-infected patients. The trial is registered at ClinicalTrials.gov, NCT00351702.

  14. Effect of calcinations temperature on the luminescence intensity and fluorescent lifetime of Tb3+-doped hydroxyapatite (Tb-HA nanocrystallines

    Directory of Open Access Journals (Sweden)

    Hairong Yin

    2017-06-01

    Full Text Available Hydroxyapatite luminescent nanocrystallines doped with 6 mol.% Tb3+ (Tb-HA were prepared via chemical deposition method and calcined at different temperature, and the effects of calcinations temperature on the luminescence intensity and fluorescent lifetime were studied. TEM image of Tb-HA revealed that the shape of nanocrystallines changed from needle-like to short rod-like and sphere-like with the increase of calcinations temperature; while the particles sizes decreased from 190 nm to 110 nm. The crystallinity degree increased. The typical emission peaks attributed to Tb3+ ions were observed in emission spectra of 6 mol.% Tb-HA under 378 nm excitation. The luminescent intensity of Tb-HA, which showed the fluorescence quenching, firstly enhanced and then decreased at 700 °C; while the fluorescent lifetime increased firstly and then decreased after 600 °C. Furthermore, the ratio of intensity between 545 nm and 490 nm corresponding to electric-dipole and magnetic-dipole transition (IR: IO increases firstly and then decreases, which revealed that the proportion of substitute type and site of Ca2+ ions by Tb3+ ions were helpful to realize the substitute process and functional structure design.

  15. Immune TB Antibody Phage Display Library as a Tool To Study B Cell Immunity in TB Infections.

    Science.gov (United States)

    Hamidon, Nurul Hamizah; Suraiya, Siti; Sarmiento, Maria E; Acosta, Armando; Norazmi, Mohd Nor; Lim, Theam Soon

    2018-03-01

    B cells and in particular antibodies has always played second fiddle to cellular immunity in regard to tuberculosis (TB). However, recent studies has helped position humoral immunity especially antibodies back into the foray in relation to TB immunity. Therefore, the ability to correlate the natural antibody responses of infected individuals toward TB antigens would help strengthen this concept. Phage display is an intriguing approach that can be utilized to study antibody-mediated responses against a particular infection via harvesting the B cell repertoire from infected individuals. The development of disease-specific antibody libraries or immune libraries is useful to better understand antibody-mediated immune responses against specific disease antigens. This study describes the generation of an immune single-chain variable fragment (scFv) library derived from TB-infected individuals. The immune library with an estimated diversity of 10 9 independent clones was then applied for the identification of monoclonal antibodies against Mycobacterium tuberculosis α-crystalline as a model antigen. Biopanning of the library isolated three monoclonal antibodies with unique gene usage. This strengthens the role of antibodies in TB immunity in addition to the role played by cellular immunity. The developed library can be applied against other TB antigens and aid antibody-derived TB immunity studies in the future.

  16. MDR-1 and MRP2 gene polymorphisms in Mexican epileptic pediatric patients with complex partial seizures.

    Directory of Open Access Journals (Sweden)

    David eEscalante-Santiago

    2014-10-01

    Full Text Available Although the Pgp efflux transport protein is overexpressed in resected tissue of patients with epilepsy, the presence of polymorphisms in MDR1 / ABCB1 and MRP2 / ABCC2 in patients with antiepileptic-drugs resistant epilepsy is controversial. The aim of this study was to perform an exploratory study to identify nucleotide changes and search new and reported mutations in patients with antiepileptic-drugs resistant epilepsy (ADR and patients with good response to anti-epileptic drugs (CTR in a rigorously selected population. We analyzed 22 samples from drug-resistant patients with epilepsy and 7 samples from patients with good response to anti-epileptic drugs. Genomic DNA was obtained from leukocytes. Eleven exons in both genes were genotyped. The concentration of drugs in saliva and plasma was determined. The concentration of valproic acid in saliva was lower in ADR than in CRT. In ABCB1, five reported SNPs and five unreported nucleotide changes were identified; rs2229109 (GA and rs2032582 (AT and AG were found only in the ADR. Of six SNPs associated with the ABCC2 that were found in the study population, rs3740066 (TT and 66744T>A (TG were found only in the ADR. The strongest risk factor in the ABCB1 gene was identified as the TA genotype of rs2032582, whereas for the ABCC2 gene the strongest risk factor was the T allele of rs3740066. The screening of SNPs in ACBC1 and ABCC2 indicates that the Mexican patients with epilepsy in this study display frequently reported ABCC1 polymorphisms; however, in the study subjects with a higher risk factor for drug resistance, new nucleotide changes were found in the ABCC2 gene. Thus, the population of Mexican patients with AED-resistant epilepsy used in this study exhibits genetic variability with respect to those reported in other study populations; however, it is necessary to explore this polymorphism in a larger population of patients with AED-resistant epilepsy.

  17. Genotype frequencies of polymorphic MDR1 variants in the Kazakhstani population

    Directory of Open Access Journals (Sweden)

    Samat Kozhakhmetov

    2014-03-01

    Full Text Available Introduction: Statins appear to be handled by an ATP-dependent membrane transporter and three SNPs (C1236T (rs1128503, G2677T (rs2032582, and C3435T (rs1045642, which capture the common genetic variation at this locus. Individuals, who carry the T allele at each SNP (i.e., the T-T-T haplotype, have higher systemic exposure to simvastatin. A triallelic thymine (T - guanine (G - adenine (A, which is  a point mutation at nucleotide 2677 in exon 22, leads to ABCB1 in a non-synonymous codons (GCT alanine, TCT serine, threonine ACT at position 893 in a cytoplasmic loop of ATP-dependent membrane transporters. Methods: Blood samples from healthy individuals were collected in the Republican Diagnostic Center, Astana, Kazakhstan. The research samples included 461 healthy people. Genomic DNA was extracted from peripheral blood using the ‘salting out’ procedure. For the MDR1 exon 21, 2677G˃T/A (Ala893Ser/Thr polymorphism was genotyped by PCR sequencing by the use of dye-terminator (ABI 3730xl sequencer. Results: The GG allele appeared in 23% of samples, the GA in 6.7%, the GT in 44%, the non-G heterozygote in 4.5%, and the non-G homozygote in 18%. These results are consistent with previously published data. Importantly, the frequency of 2677T alleles in our group was 15.4%. This represents the lowest frequency of this allele compared to published data in different populations. The frequency of the 2677T allele in Asians and Caucasians varies from 38 to 62%, and is 15% for African Americans. On the other hand, the 2677A allele frequency in the Japanese varies from 15 to 22%, and in Caucasians from 2% and 4%. The 2677A allele frequency has been found in 4.6% of samples. Conclusions: Our study further emphasizes differences between various Asian populations and the importance of repeating this genetic study  in different ethnic groups.

  18. Hypofractionation Regimens for Stereotactic Radiotherapy for Large Brain Tumors

    International Nuclear Information System (INIS)

    Yuan Jiankui; Wang, Jian Z.; Lo, Simon; Grecula, John C.; Ammirati, Mario; Montebello, Joseph F.; Zhang Hualin; Gupta, Nilendu; Yuh, William T.C.; Mayr, Nina A.

    2008-01-01

    Purpose: To investigate equivalent regimens for hypofractionated stereotactic radiotherapy (HSRT) for brain tumor treatment and to provide dose-escalation guidance to maximize the tumor control within the normal brain tolerance. Methods and Materials: The linear-quadratic model, including the effect of nonuniform dose distributions, was used to evaluate the HSRT regimens. The α/β ratio was estimated using the Gammaknife stereotactic radiosurgery (GKSRS) and whole-brain radiotherapy experience for large brain tumors. The HSRT regimens were derived using two methods: (1) an equivalent tumor control approach, which matches the whole-brain radiotherapy experience for many fractions and merges it with the GKSRS data for few fractions; and (2) a normal-tissue tolerance approach, which takes advantages of the dose conformity and fractionation of HSRT to approach the maximal dose tolerance of the normal brain. Results: A plausible α/β ratio of 12 Gy for brain tumor and a volume parameter n of 0.23 for normal brain were derived from the GKSRS and whole-brain radiotherapy data. The HSRT prescription regimens for the isoeffect of tumor irradiation were calculated. The normal-brain equivalent uniform dose decreased as the number of fractions increased, because of the advantage of fractionation. The regimens for potential dose escalation of HSRT within the limits of normal-brain tolerance were derived. Conclusions: The designed hypofractionated regimens could be used as a preliminary guide for HSRT dose prescription for large brain tumors to mimic the GKSRS experience and for dose escalation trials. Clinical studies are necessary to further tune the model parameters and validate these regimens

  19. Characterization of a Novel 99mTc-Carbonyl Complex as a Functional Probe of MDR1 P-Glycoprotein Transport Activity

    Directory of Open Access Journals (Sweden)

    Mary Dyszlewski

    2002-01-01

    Full Text Available Multidrug resistance (MDR mediated by overexpression of MDR1 P-glycoprotein (Pgp is one of the best characterized barriers to chemotherapy in cancer patients. Furthermore, the protective function of Pgp-mediated efflux of xenobiotics in various organs has a profound effect on the bioavailability of drugs in general. Thus, there is an expanding requirement to noninvasively interrogate Pgp transport activity in vivo. We herein report the Pgp recognition properties of a novel 99mTc(I-tricarbonyl complex, [99mTc(CO3(MIBI3] + (Tc-CO-MIBI. Tc-CO-MIBI showed 60-fold higher accumulation in drug-sensitive KB 3–1 cells compared to colchicine-selected drug-resistant KB 8-5 cells. In KB 8-5 cells, tracer enhancement was observed with the potent MDR modulator LY335979 (EC50 = 62 nM. Similar behavior was observed using drug-sensitive MCF-7 breast adenocarcinoma cells and MCF-7/MDR1 stable transfectants, confirming that Tc-CO-MIBI is specifically excluded by overexpression of MDR1 Pgp. By comparison, net accumulation in control H69 lung tumor cells was 9-fold higher than in MDR-associated protein (MRP1-expressing H69AR cells, indicating only modest transport by MRP1. Biodistribution analysis following tail vein injection of Tc-CO-MIBI showed delayed liver clearance as well as enhanced brain uptake and retention in mdr1a/1b(−/− gene deleted mice versus wild-type mice, directly demonstrating that Tc-CO-MIBI is a functional probe of Pgp transport activity in vivo.

  20. TTFields alone and in combination with chemotherapeutic agents effectively reduce the viability of MDR cell sub-lines that over-express ABC transporters

    International Nuclear Information System (INIS)

    Schneiderman, Rosa S; Shmueli, Esther; Kirson, Eilon D; Palti, Yoram

    2010-01-01

    Exposure of cancer cells to chemotherapeutic agents may result in reduced sensitivity to structurally unrelated agents, a phenomenon known as multidrug resistance, MDR. The purpose of this study is to investigate cell growth inhibition of wild type and the corresponding MDR cells by Tumor Treating Fields - TTFields, a new cancer treatment modality that is free of systemic toxicity. The TTFields were applied alone and in combination with paclitaxel and doxorubicin. Three pairs of wild type/MDR cell lines, having resistivity resulting from over-expression of ABC transporters, were studied: a clonal derivative (C11) of parental Chinese hamster ovary AA8 cells and their emetine-resistant sub-line Emt R1 ; human breast cancer cells MCF-7 and their mitoxantrone-resistant sub lines MCF-7/Mx and human breast cancer cells MDA-MB-231 and their doxorubicin resistant MDA-MB-231/Dox cells. TTFields were applied for 72 hours with and without the chemotherapeutic agents. The numbers of viable cells in the treated cultures and the untreated control groups were determined using the XTT assay. Student t-test was applied to asses the significance of the differences between results obtained for each of the three cell pairs. TTFields caused a similar reduction in the number of viable cells of wild type and MDR cells. Treatments by TTFields/drug combinations resulted in a similar increased reduction in cell survival of wild type and MDR cells. TTFields had no effect on intracellular doxorubicin accumulation in both wild type and MDR cells. The results indicate that TTFields alone and in combination with paclitaxel and doxorubicin effectively reduce the viability of both wild type and MDR cell sub-lines and thus can potentially be used as an effective treatment of drug resistant tumors

  1. Multiple Origins of Mutations in the mdr1 Gene—A Putative Marker of Chloroquine Resistance in P. vivax

    DEFF Research Database (Denmark)

    Schousboe, Mette L; Ranjitkar, Samir; Rajakaruna, Rupika S

    2015-01-01

    BACKGROUND: Chloroquine combined with primaquine has been the recommended antimalarial treatment of Plasmodium vivax malaria infections for six decades but the efficacy of this treatment regimen is threatened by chloroquine resistance (CQR). Single nucleotide polymorphisms (SNPs) in the multidrug...

  2. Distinct genotype distribution and haplotype profiles in MDR1 gene among Chinese Han, Bai, Wa and Tibetan ethnic groups.

    Science.gov (United States)

    Lai, Yong; Huang, Min; Li, Hui; Wang, Xue-Ding; Li, Jia-Li

    2012-11-01

    P-Glycoprotein (P-gp, encoded by MDR1 gene) plays an important role in determining bioavailability and pharmacologic effects of many drugs. There is increasing evidence that P-gp activity may be genetically determined. In this study, we investigated the genotype distribution and the haplotype profiles of MDR1 gene in Chinese Han, Bai, Wa and Tibetan subjects. Much lower frequencies of the 1236T allele and the 2677T allele were found in Wa subjects than those in other three ethnic groups, while the 2677A allele was found about 6-fold more frequently in Han subjects than in subjects of other three ethnic groups. The Han, Bai and Tibetan subjects share the same three predominant haplotypes (T-T-T, T-G-C and C-G-C), and T-T-T is the highest and accounts for more than one third of the number of haplotypes in the subjects from each ethnic group. However, T-T-T was less common than T-G-C, T-G-T and C-G-C and occurring at only 13.8% in Wa subjects, furthermore, higher frequencies of T-G-T, C-T-C, C-G-T and C-T-T were observed in Wa subjects compared to those in other three ethnic groups. Frequencies of C-A-C and T-A-C in Han subjects were higher than those in other three ethnic groups. The findings of this study will be of some relevance in predicting MDR1 phenotype and pharmacokinetics as well as pharmacodynamic effects of many commonly used drugs that are P-gp substrates in these four Chinese ethnic groups.

  3. Accelerating TB notification from the private health sector in Delhi, India.

    Science.gov (United States)

    Kundu, Debashish; Chopra, Kamal; Khanna, Ashwani; Babbar, Neeti; Padmini, T J

    2016-01-01

    In India, almost half of all patients with tuberculosis (TB) seek care in the private sector as the first point of care. The national programme is unable to support such TB patients and facilitate effective treatment, as there is no information on TB and Multi or Extensively Drug Resistant TB (M/XDR-TB) diagnosis and treatment in private sector. To improve this situation, Government of India declared TB a notifiable disease for establishing TB surveillance system, to extend supportive mechanism for TB treatment adherence and standardised practices in the private sector. But TB notification from the private sector is a challenge and still a lot needs to be done to accelerate TB notification. Delhi State TB Control Programme had taken initiatives for improving notification of TB cases from the private sector in 2014. Key steps taken were to constitute a state level TB notification committee to oversee the progress of TB notification efforts in the state and direct 'one to one' sensitisation of private practitioners (PPs) (in single PP's clinic, corporate hospitals and laboratories) by the state notification teams with the help of available tools for sensitising the PP on TB notification - TB Notification Government Order, Guidance Tool for TB Notification and Standards of TB Care in India. As a result of focussed state level interventions, without much external support, there was an accelerated notification of TB cases from the private sector. TB notification cases from the private sector rose from 341 (in 2013) to 4049 (by the end of March 2015). Active state level initiatives have led to increase in TB case notification. Copyright © 2016 Tuberculosis Association of India. Published by Elsevier B.V. All rights reserved.

  4. [Expression and significance of P-gp/mdr1 mRNA, MRP and LRP in non-Hodgkin's lymphoma].

    Science.gov (United States)

    Li, Le; Su, Li-ping; Ma, Li; Zhao, Jin; Zhu, Lei; Zhou, Yong-an

    2009-03-01

    To explore the expression and clinical significance of P-glycoprotein (P-gp)/mdr1mRNA, multidrug resistance-associated protein (MRP) and lung resistance protein (LRP) in newly diagnosed non-Hodgkin's lymphoma. mdr1 mRNA of in 41 patients with non-Hodgkin's lymphoma was assayed by semi-quantitative RT-PCR. The expressions of P-gp, MRP and LRP proteins in lymph node viable blasts were identified by flow cytometry. The results were compared with those obtained from control cases, and the correlation of the changes with clinical outcomes was analyzed. (1) Among the 41 cases, the positive expression of P-gp protein was detected in 8 cases, MRP in 7 cases, LRP in 15 cases, and mdr 1 mRNA in 11 cases. (2) The P-gp and LRP levels in NHL were significantly higher than those in control group, but MRP wasn't. The P-gp over-expression was significantly associated with mdr1mRNA (r = 0.396, P = 0.01). No correlation was showed among the expressions of P-gp, MRP and LRP. (3) Patients with P-gp expression had a poorer outcome of chemotherapy than those with P-gp-negative (P = 0.005). P-gp expression was significantly associated with higher clinical stage (P = 0.046) and elevated serum lactate dehydrogenase level (P = 0.032), but not associated with malignant degree (P = 0.298). MRP had no impact on the outcome of chemotherapy (P = 0.212), and wasn't significantly associated with higher clinical stage (P = 0.369), elevated LDH (P = 0.762) and higher malignant degree (P = 0.451). Patients with LRP expression had a poorer outcome of chemotherapy than those LRP-negative (P = 0.012). LRP expression was significantly associated with higher clinical stage (P = 0.0019), elevated LDH (P = 0.02) and higher malignant degree (P = 0.01). The data of this study indicate that P-gp and LRP expressions but not MRP expression are important in the mechanism of drug resistance associated with a poor clinical outcome in previously untreated NHL.

  5. Osteoarticular infection caused by MDR Pseudomonas aeruginosa: the benefits of combination therapy with colistin plus β-lactams.

    Science.gov (United States)

    Ribera, Alba; Benavent, Eva; Lora-Tamayo, Jaime; Tubau, Fe; Pedrero, Salvador; Cabo, Xavier; Ariza, Javier; Murillo, Oscar

    2015-12-01

    In the era of emergence of MDR Pseudomonas aeruginosa, osteoarticular infections (OIs) add more difficulties to its treatment. The role of β-lactams (BLs) is questioned and older drugs need to be reconsidered. The objective of this study was to describe our experience in the management of OIs caused by MDR P. aeruginosa and evaluate different therapeutic options. This was a retrospective analysis of a prospectively collected cohort (2004-13) of patients with OI caused by MDR P. aeruginosa. We created two groups: (i) Group A (more difficult to treat), prosthetic joint infections (PJIs) and osteoarthritis (OA) managed with device retention; and (ii) Group B (less difficult to treat), OA managed without device retention. Antibiotic treatment was administered according to clinician criteria: monotherapy/combined therapy; and BL used by intermittent bolus (IB)/continuous infusion. Of 34 patients, 15 (44.1%) had PJI and 19 (55.9%) had OA (8 related to an orthopaedic device). Twenty-three cases (68%) were caused by XDR P. aeruginosa. The initial management included removal of an orthopaedic device in 14 cases, together with antibiotic [alone, 19 (55.9%; 4 colistin, 14 BL-IB and 1 BL continuous infusion); and in combination, 15 (44.1%; 5 BL-IB and 10 BL continuous infusion)]. The overall cure rate was 50% (39% and 63% in Groups A and B, respectively), ranging from 31.6% with monotherapy to 73.3% with combined therapy (P = 0.016), with special interest within Group A (cure rate with combined therapy 71.4%, P = 0.049). After rescue therapy, which included removal of remaining devices, the cure rate reached 85.3%. We suggest that the BL/colistin combination is an optimized therapy for OI caused by MDR P. aeruginosa, together with an appropriate surgical treatment. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  6. Antigen-Specific Interferon-Gamma Responses and Innate Cytokine Balance in TB-IRIS

    NARCIS (Netherlands)

    Goovaerts, Odin; Jennes, Wim; Massinga-Loembé, Marguerite; Ceulemans, Ann; Worodria, William; Mayanja-Kizza, Harriet; Colebunders, Robert; Kestens, Luc; Loembé, Marguerite Massinga; Mayanja, Harriet; Mascart, Francoise; van den Bergh, Rafael; Locht, Camille; Reiss, Peter; Cobelens, Frank; Ondoa, Pascale; Pakker, Nadine; Mugerwa, Roy

    2014-01-01

    Background: Tuberculosis-associated immune reconstitution inflammatory syndrome (TB-IRIS) remains a poorly understood complication in HIV-TB patients receiving antiretroviral therapy (ART). TB-IRIS could be associated with an exaggerated immune response to TB-antigens. We compared the recovery of

  7. Magnetic properties of the Tb4 + ion in Li2TbF6

    Science.gov (United States)

    Guillot, M.; El-Ghozzi, M.; Avignant, D.; Ferey, G.

    1993-05-01

    Both oxygen and fluorine have a partiality towards the stabilization of high oxidation states of rare earths such as Ce, Pr, and Tb. During the study of the MF-M'F4 (M=alkaline metal; M' rare ion) the compound Li2TbF6 was found to constitute the only representative obtained under ambient pressure of a structural type, namely α-Li2ZrF6, known until now only through the high pressure form. Magnetic measurements were carried out over the 1.4-300 K temperature range in continuous magnetic fields up to 20 T produced by a Bitter magnet. At low temperature and in H higher than 15 T, the magnetization M was observed to be field independent and very close to the calculated Tb4+ free ion value, i.e., 7μB; on the other hand, the data do not present any departure from the Brillouin function of the pure 8S7/2 state. The reciprocal magnetic susceptibility obeys a Curie-Weiss law leading to an effective moment of 7.86μB. A very unusual behavior of the terbium ion which presents a 4+ oxidation state is concluded: to the best of our knowledge, it is the first observation of this form. The so-found spherical 4f7 electronic configuration is the most compatible with the high coordination number of eight. Finally, the discussion within the series Li2MIVF6 compounds to understand the influence of both electronic configuration and size effects is presented.

  8. Dextran solution optical activity in Tb (III) ion presence

    International Nuclear Information System (INIS)

    Vasconcellos, Sandra S.; Rodrigues, J.F.; Faljoni-Alario, A.

    1984-01-01

    Optical activity studies of aqueous solutions of dextrana in presence of Tb (III) or without it shows the complex with the hidroxyl groups of C 2 and C 3 of monomeric unit participation is formed. (L.M.J.) [pt

  9. management of pulmonary tb in nurse-based cape town

    African Journals Online (AJOL)

    Kurt

    a recording and reporting system enabling assessment of the outcomes of each patient ... scopically at the regional laboratory. (NHLS) for .... auditing of aspects of clinical and resource management. ... and information systems. The TB nurs-.

  10. Health Inequities and HIV, Viral Hepatitis, TB, and STDs

    Centers for Disease Control (CDC) Podcasts

    Dr. Kevin A. Fenton, Director of CDC's National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP), discusses health inequities in the United States and how NCHHSTP research, policies, and programs can address them.

  11. Disparities in HIV/AIDS, Viral Hepatitis, STDs, and TB

    Science.gov (United States)

    ... Search The CDC Health Disparities in HIV/AIDS, Viral Hepatitis, STDs, and TB Note: Javascript is disabled or ... Other Pacific Islanders MMWR Publications HIV and AIDS Viral Hepatitis STDs Tuberculosis Training and Networking Resources Call for ...

  12. Luminescence properties of Tb implanted ZnO

    International Nuclear Information System (INIS)

    Cetin, A.; Kibar, R.; Selvi, S.; Townsend, P.D.; Can, N.

    2009-01-01

    ZnO [0 0 0 1] crystals were irradiated at room temperature with Tb + ions of 400 keV with fluences from 1x10 16 to 2x10 17 cm -2 . The implanted layer was examined by several methods, including radioluminescence (RL), Rutherford backscattering spectrometry (RBS) and optical spectroscopy. The optical extinction spectra were simulated using Mie scattering theory. Absorption spectra predicted by Mie theory for particles of decreasing diameter were compared with those obtained experimentally. Some qualitative agreement between theoretical and experimental data was achieved. It was also shown that the intensities of the characteristic green emission bands associated with Tb produced by 5 D 4 → 7 F j=5,4 transitions have increased about 8 times after annealing. Optical spectroscopy and radioluminescence data have revealed that the ion implantation is a promising tool for synthesizing Tb nanoparticles in the ZnO surface. The Tb nanoparticles exhibit a rather weak plasma resonance.

  13. 46 CFR 32.75-1 - Application-TB/ALL.

    Science.gov (United States)

    2010-10-01

    ... REQUIREMENTS Hull Requirements for Wood Hull Tank Vessels Constructed Prior to November 10, 1936 § 32.75-1 Application—TB/ALL. All wood hull tank vessels, the construction or conversion of which was started prior to...

  14. Thermomagnetically written domains in TbFeCo thin films

    International Nuclear Information System (INIS)

    Reim, W.; Weller, D.

    1988-01-01

    Characteristic features of thermomagnetically written domains in amorphous Tb x (Fe 90 Co 10 ) 100-x alloy thin films having different magnetic properties are reported. In particular, the writing process in materials with low Tb content chi ≤ 21 dominated by the demagnetizing field is compared to the bias field dominated process in Tb rich samples 22 ≤ chi ≤ 25. Domain wall movement over lateral dimensions of the bit size is found for Tb poor materials while for chi ≥ 22 domain boundaries are primarily determined by the area heated up to the Curie-temperature. The importance of mechanical stress on domain formation and irreversible changes of the storage medium due to overheating in the writing process are reported

  15. TB and HIV Therapeutics: Pharmacology Research Priorities

    Directory of Open Access Journals (Sweden)

    Kelly E. Dooley

    2012-01-01

    Full Text Available An unprecedented number of investigational drugs are in the development pipeline for the treatment of tuberculosis. Among patients with tuberculosis, co-infection with HIV is common, and concurrent treatment of tuberculosis and HIV is now the standard of care. To ensure that combinations of anti-tuberculosis drugs and antiretrovirals are safe and are tested at doses most likely to be effective, selected pharmacokinetic studies based on knowledge of their metabolic pathways and their capacity to induce or inhibit metabolizing enzymes of companion drugs must be conducted. Drug interaction studies should be followed up by evaluations in larger populations to evaluate safety and pharmacodynamics more fully. Involving patients with HIV in trials of TB drugs early in development enhances the knowledge gained from the trials and will ensure that promising new tuberculosis treatments are available to patients with HIV as early as possible. In this review, we summarize current and planned pharmacokinetic and drug interaction studies involving investigational and licensed tuberculosis drugs and antiretrovirals and suggest priorities for tuberculosis-HIV pharmacokinetic, pharmacodynamic, and drug-drug interaction studies for the future. Priority studies for children and pregnant women with HIV and tuberculosis co-infection are briefly discussed.

  16. HUBUNGAN FAKTOR LINGKUNGAN RUMAH DENGAN PENULARAN TB PARU KONTAK SERUMAH

    Directory of Open Access Journals (Sweden)

    Anwar Musadad

    2012-11-01

    Full Text Available Environmental Factor Relation of House With Infection of TB Paru through Housing Contact.Tuberculosis of the Lung (Lung TB still become health problem for world, including Indonesia in the third sequence after India And China. If cannot overcome each and everyone with Active Lung TB with mean infection 10-15 people/year. This research aim to know environmental factor relation of house with infection of Lung TB through contact house. The research population consist of entire household which inside there is 1 (one or more patient of Adult Lung TB with the result of positive bacteria inspection by public health center in 2002, while as sample is entire household which inside there is 1 (one or more patient of Adult Lung TB and have under 5 years baby. Inclusion criteria is patient of Lung TB paru noted by public health center and reside in region of Tangerang District in 2002. The collection of data was conducted with interview using questionnaire, enviromental perception, and tuberculine test. Uji Tuberculin test done by Mantoux (inoculation intracutane for 5 years baby use PPD RT 23 strength 2 TU with tuberkulin 1 cc needle with number 26. Criteria of Lung TB infection if diameter transversal from period that happened as a result of tuberculine test >10 mm and have clinical history of such as coughing more than 3 weeks, pain and recuring or old fever without clear cause, body weight descend or not go up in 1 month; moon without clear cause, or have specific clinical symptom. Result showed that from 254 households there are 33 (13.0% occurence of infection Lung TB. Environmental factor of house which deal with infection TB as an entry of the indoor direct sunlight with value OR=3,50; CI 95% 1,19-10,34 (p=0,015. The conclusion stated that direct sunlight play important role for infection of Lung TB in the same house.Keywords: Tuberculosis, infection through housing ccontact, tuberculine test, sunlight

  17. Development of antibiotic regimens using graph based evolutionary algorithms.

    Science.gov (United States)

    Corns, Steven M; Ashlock, Daniel A; Bryden, Kenneth M

    2013-12-01

    This paper examines the use of evolutionary algorithms in the development of antibiotic regimens given to production animals. A model is constructed that combines the lifespan of the animal and the bacteria living in the animal's gastro-intestinal tract from the early finishing stage until the animal reaches market weight. This model is used as the fitness evaluation for a set of graph based evolutionary algorithms to assess the impact of diversity control on the evolving antibiotic regimens. The graph based evolutionary algorithms have two objectives: to find an antibiotic treatment regimen that maintains the weight gain and health benefits of antibiotic use and to reduce the risk of spreading antibiotic resistant bacteria. This study examines different regimens of tylosin phosphate use on bacteria populations divided into Gram positive and Gram negative types, with a focus on Campylobacter spp. Treatment regimens were found that provided decreased antibiotic resistance relative to conventional methods while providing nearly the same benefits as conventional antibiotic regimes. By using a graph to control the information flow in the evolutionary algorithm, a variety of solutions along the Pareto front can be found automatically for this and other multi-objective problems. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  18. Direct costs of managing adverse drug reactions during rifampicin-resistant tuberculosis treatment in South Africa.

    Science.gov (United States)

    Schnippel, K; Firnhaber, C; Berhanu, R; Page-Shipp, L; Sinanovic, E

    2018-04-01

    To estimate the provider costs of managing adverse drug reactions (ADRs) to standard long-course treatment for multidrug- and rifampicin-resistant tuberculosis (MDR/RR-TB) according to South African guidelines. We parameterised a published Markov health state model for MDR/RR-TB with guidelines-based, bottom-up public-sector provider costing of ADR management. Frequency of ADR occurrence was extracted from the literature. Costs were estimated over 10 years, discounted 3% annually and tested using probabilistic sensitivity analysis. On average, guidelines-based costing of moderate ADRs weighted by the frequency of occurrence was US$135.76 (standard deviation [SD] US$17.18) and the cost of serious ADRs was US$521.29 (SD US$55.99). We estimated that the incremental costs of ADR management were US$380.17 annually per patient initiating MDR/RR-TB treatment. The incremental costs of ADR management for the public health sector in South Africa was US$4.76 million, 8.3% of the estimated cohort costs of MDR/RR-TB treatment ($57.55 million) for the 2015 cohort of 12 527 patients. Management of multiple ADRs and serious ADRs, which are common during the first 6 months of standard, long-course MDR/RR-TB treatment, substantially increases provider treatment costs. These results need to be taken into account when comparing regimen costs, and highlight the urgent need to identify drug regimens with improved safety profiles.

  19. Magnetic and crystallographic properties of TbCo4B

    International Nuclear Information System (INIS)

    Caspi, E.N.; Dubman, M.; Ettedgui, H.; Shaked, H.; Melamud, M.; Keller, L.; Avdeev, M.

    2006-01-01

    The compound TbCo 4 B was studied using measurements of AC magnetic susceptibility, magnetization and neutron powder diffraction. It is found that this compound orders at T C ∼450 K. Each of the two Tb and two Co sublattices orders ferromagnetically. The coupling is ferromagnetic within each pair and ferrimagnetic between pairs. A compensation point at ∼300 K and a spin reorientation between 400 and 430 K were found

  20. Health Inequities and HIV, Viral Hepatitis, TB, and STDs

    Centers for Disease Control (CDC) Podcasts

    2010-09-15

    Dr. Kevin A. Fenton, Director of CDC's National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP), discusses health inequities in the United States and how NCHHSTP research, policies, and programs can address them.  Created: 9/15/2010 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention.   Date Released: 9/15/2010.

  1. Treatment outcomes of fixed-dose combination versus separate tablet regimens in pulmonary tuberculosis patients with or without diabetes in Qatar.

    Science.gov (United States)

    Al-Shaer, Mohammad H; Mansour, Hanine; Elewa, Hazem; Salameh, Pascale; Iqbal, Fatima

    2017-02-02

    Tuberculosis is considered the second most common cause of death due to infectious agent. The currently preferred regimen for treatment of pulmonary tuberculosis (PTB) is isoniazid, rifampin, pyrazinamide, and ethambutol, which has been used either as separate tablets (ST) or as fixed-dose combination (FDC). To date, no studies have compared both regimens in Qatar. We aim to evaluate the safety and effectiveness of FDC and ST regimen for treating PTB, in addition to comparing safety and efficacy of FDC and ST regimens in patients with diabetes treated for TB. A retrospective observational study was conducted in two general hospitals in Qatar. Patients diagnosed with PTB received anti-tuberculosis medications (either as FDC or ST) administered by the nurse. Sputum smears were tested weekly. We assessed the time to negative sputum smear and incidence of adverse events among FDC and ST groups. The study included 148 patients. FDC was used in 90 patients (61%). Effectiveness was not different between FDC and ST regimens as shown by mean time to sputum conversion (29.9 ± 18.3 vs. 35.6 ± 23 days, p = 0.12). Similarly, there was no difference in the incidence of adverse events, except for visual one that was higher in ST group. Among the 33 diabetic patients, 19 received the FDC and had faster sputum conversion compared to those who received ST (31 ± 12 vs. 49.4 ± 30.9 days, p = 0.05). Overall, diabetic patients needed longer time for sputum conversion and had more hepatotoxic and gastric adverse events compared to non-diabetics. ST group had higher visual side effects compared to FDC. FDC may be more effective in diabetic patients; however, further studies are required to confirm such finding.

  2. HIV screening among TB patients and co-trimoxazole preventive therapy for TB/HIV patients in Addis Ababa: facility based descriptive study.

    Science.gov (United States)

    Denegetu, Amenu Wesen; Dolamo, Bethabile Lovely

    2014-01-01

    Collaborative TB/HIV management is essential to ensure that HIV positive TB patients are identified and treated appropriately, and to prevent tuberculosis (TB) in HIV positive patients. The purpose of this study was to assess HIV case finding among TB patients and Co-trimoxazole Preventive Therapy (CPT) for HIV/TB patients in Addis Ababa. A descriptive cross-sectional, facility-based survey was conducted between June and July 2011. Data was collected by interviewing 834 TB patients from ten health facilities in Addis Ababa. Both descriptive and inferential statistics were used to summarize and analyze findings. The proportion of TB patients who (self reported) were offered for HIV test, tested for HIV and tested HIV positive during their anti-TB treatment follow-up were; 87.4%, 69.4% and 20.2%; respectively. Eighty seven HIV positive patients were identified, who knew their status before diagnosed for the current TB disease, bringing the cumulative prevalence of HIV among TB patients to 24.5%. Hence, the proportion of TB patients who knew their HIV status becomes 79.9%. The study revealed that 43.6% of those newly identified HIV positives during anti-TB treatment follow-up were actually treated with CPT. However, the commutative proportion of HIV positive TB patients who were ever treated with CPT was 54.4%; both those treated before the current TB disease and during anti-TB treatment follow-up. HIV case finding among TB patients and provision of CPT for TB/HIV co-infected patients needs boosting. Hence, routine offering of HIV test and provision of CPT for PLHIV should be strengthened in-line with the national guidelines.

  3. Magnetic structure of Tb-Fe films with an artificially layered structure

    International Nuclear Information System (INIS)

    Yamauchi, K.; Habu, K.; Sato, N.

    1988-01-01

    The magnetic structure of Tb-Fe films with an artificially layered structure has been investigated by measuring the temperature dependence of the magnetization of the films. Ferrimagnetic coupling between Tb and Fe through the interface was explicitly observed up to about 9-A Tb and 10-A Fe layers. Films with thinner Tb and Fe layers than these thicknesses are composed of only ferrimagnetically coupled Tb-Fe regions. Films with thicker layers of Tb and Fe are composed of ferrimagnetically coupled Tb-Fe, ferromagnetic Fe, ferromagnetic Tb, and/or magnetically compensated Tb regions. The Tb-Fe films exhibit various temperature dependencies of the magnetization corresponding to these magnetic structures

  4. Temperature-dependent structure of Tb-doped magnetite nanoparticles

    International Nuclear Information System (INIS)

    Rice, Katherine P.; Russek, Stephen E.; Shaw, Justin M.; Usselman, Robert J.; Evarts, Eric R.; Silva, Thomas J.; Nembach, Hans T.; Geiss, Roy H.; Arenholz, Elke; Idzerda, Yves U.

    2015-01-01

    High quality 5 nm cubic Tb-doped magnetite nanoparticles have been synthesized by a wet-chemical method to investigate tailoring of magnetic properties for imaging and biomedical applications. We show that the Tb is incorporated into the octahedral 3+ sites. High-angle annular dark-field microscopy shows that the dopant is well-distributed throughout the particle, and x-ray diffraction measurements show a small lattice parameter shift with the inclusion of a rare-earth dopant. Magnetization and x-ray magnetic circular dichroism data indicate that the Tb spins are unpolarized and weakly coupled to the iron spin lattice at room temperature, and begin to polarize and couple to the iron oxide lattice at temperatures below 50 K. Broadband ferromagnetic resonance measurements show no increase in magnetic damping at room temperature for Tb-doped nanoparticles relative to undoped nanoparticles, further confirming weak coupling between Fe and Tb spins at room temperature. The Gilbert damping constant, α, is remarkably low for the Tb-doped nanoparticles, with α = 0.024 ± 0.003. These nanoparticles, which have a large fixed moment, a large fluctuating moment and optically active rare-earth elements, are potential high-relaxivity T1 and T2 MRI agents with integrated optical signatures

  5. Temperature-dependent structure of Tb-doped magnetite nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Rice, Katherine P.; Russek, Stephen E., E-mail: stephen.russek@nist.gov; Shaw, Justin M.; Usselman, Robert J.; Evarts, Eric R.; Silva, Thomas J.; Nembach, Hans T. [National Institute of Standards and Technology, Boulder, Colorado 80305 (United States); Geiss, Roy H. [Colorado State University, Fort Collins, Colorado 80523 (United States); Arenholz, Elke [Lawrence Berkeley National Laboratory, Advanced Light Source, Berkeley, California 94720 (United States); Idzerda, Yves U. [Department of Physics, Montana State University, Bozeman, Montana 59717 (United States)

    2015-02-09

    High quality 5 nm cubic Tb-doped magnetite nanoparticles have been synthesized by a wet-chemical method to investigate tailoring of magnetic properties for imaging and biomedical applications. We show that the Tb is incorporated into the octahedral 3+ sites. High-angle annular dark-field microscopy shows that the dopant is well-distributed throughout the particle, and x-ray diffraction measurements show a small lattice parameter shift with the inclusion of a rare-earth dopant. Magnetization and x-ray magnetic circular dichroism data indicate that the Tb spins are unpolarized and weakly coupled to the iron spin lattice at room temperature, and begin to polarize and couple to the iron oxide lattice at temperatures below 50 K. Broadband ferromagnetic resonance measurements show no increase in magnetic damping at room temperature for Tb-doped nanoparticles relative to undoped nanoparticles, further confirming weak coupling between Fe and Tb spins at room temperature. The Gilbert damping constant, α, is remarkably low for the Tb-doped nanoparticles, with α = 0.024 ± 0.003. These nanoparticles, which have a large fixed moment, a large fluctuating moment and optically active rare-earth elements, are potential high-relaxivity T1 and T2 MRI agents with integrated optical signatures.

  6. Reversing multidrug resistance in Caco-2 by silencing MDR1, MRP1, MRP2, and BCL-2/BCL-xL using liposomal antisense oligonucleotides.

    Directory of Open Access Journals (Sweden)

    Yu-Li Lo

    Full Text Available Multidrug resistance (MDR is a major impediment to chemotherapy. In the present study, we designed antisense oligonucleotides (ASOs against MDR1, MDR-associated protein (MRP1, MRP2, and/or BCL-2/BCL-xL to reverse MDR transporters and induce apoptosis, respectively. The cationic liposomes (100 nm composed of N-[1-(2,3-dioleyloxypropyl]-n,n,n-trimethylammonium chloride and dioleoyl phosphotidylethanolamine core surrounded by a polyethylene glycol (PEG shell were prepared to carry ASOs and/or epirubicin, an antineoplastic agent. We aimed to simultaneously suppress efflux pumps, provoke apoptosis, and enhance the chemosensitivity of human colon adenocarcinoma Caco-2 cells to epirubicin. We evaluated encapsulation efficiency, particle size, cytotoxicity, intracellular accumulation, mRNA levels, cell cycle distribution, and caspase activity of these formulations. We found that PEGylated liposomal ASOs significantly reduced Caco-2 cell viability and thus intensified epirubicin-mediated apoptosis. These formulations also decreased the MDR1 promoter activity levels and enhanced the intracellular retention of epirubicin in Caco-2 cells. Epirubicin and ASOs in PEGylated liposomes remarkably decreased mRNA expression levels of human MDR1, MRP1, MRP2, and BCL-2. The combined treatments all significantly increased the mRNA expressions of p53 and BAX, and activity levels of caspase-3, -8, and -9. The formulation of epirubicin and ASOs targeting both pump resistance of MDR1, MRP1, and MRP2 and nonpump resistance of BCL-2/BCL-xL demonstrated more superior effect to all the other formulations used in this study. Our results provide a novel insight into the mechanisms by which PEGylated liposomal ASOs against both resistance types act as activators to epirubicin-induced apoptosis through suppressing MDR1, MRP1, and MRP2, as well as triggering intrinsic mitochondrial and extrinsic death receptor pathways. The complicated regulation of MDR highlights the necessity

  7. Expression of multi-drug resistance-related genes MDR3 and MRP as prognostic factors in clinical liver cancer patients.

    Science.gov (United States)

    Yu, Zheng; Peng, Sun; Hong-Ming, Pan; Kai-Feng, Wang

    2012-01-01

    To investigate the expression of multi-drug resistance-related genes, MDR3 and MRP, in clinical specimens of primary liver cancer and their potential as prognostic factors in liver cancer patients. A total of 26 patients with primary liver cancer were enrolled. The expression of MDR3 and MRP genes was measured by real-time PCR and the association between gene expression and the prognosis of patients was analyzed by the Kaplan-Meier method and COX regression model. This study showed that increases in MDR3 gene expression were identified in cholangiocellular carcinoma, cirrhosis and HBsAg-positive patients, while MRP expression increased in hepatocellular carcinoma, non-cirrhosis and HBsAg-negative patients. Moreover, conjugated bilirubin and total bile acid in the serum were significantly reduced in patients with high MRP expression compared to patients with low expression. The overall survival tended to be longer in patients with high MDR3 and MRP expression compared to the control group. MRP might be an independent prognostic factor in patients with liver cancer by COX regression analysis. MDR3 and MRP may play important roles in liver cancer patients as prognostic factors and their underlying mechanisms in liver cancer are worthy of further investigation.

  8. Expression of multidrug resistance markers ABCB1 (MDR-1/P-gp) and ABCC1 (MRP-1) in renal cell carcinoma.

    LENUS (Irish Health Repository)

    Walsh, Naomi

    2009-01-01

    BACKGROUND: Renal cell carcinoma patients respond poorly to conventional chemotherapy, this unresponsiveness may be attributable to multidrug resistance (MDR). The mechanisms of MDR in renal cancer are not fully understood and the specific contribution of ABC transporter proteins which have been implicated in the chemoresistance of various cancers has not been fully defined in this disease. METHODS: In this retrospective study the expression of two of these transporter efflux pumps, namely MDR-1 P-gp (ABCB1) and MRP-1 (ABCC1) were studied by immunohistochemistry in archival material from 95 renal cell carcinoma patients. RESULTS: In the first study investigating MDR-1 P-gp and MRP-1 protein expression patterns in renal cell carcinoma patients, high levels of expression of both efflux pumps are observed with 100% of tumours studied showing MDR-1 P-gp and MRP-1 positivity. CONCLUSION: Although these findings do not prove a causal role, the high frequency of tumours expressing these efflux pumps suggests that they may be important contributors to the chemoresistance of this tumour type.

  9. Emergence of fluoroquinolone resistance among drug resistant tuberculosis patients at a tertiary care facility in Karachi, Pakistan.

    Science.gov (United States)

    Zaidi, Syed Mohammad Asad; Haseeb, Abdul; Habib, Shifa Salman; Malik, Amyn; Khowaja, Saira; SaifUllah, Nausheen; Rizvi, Nadeem

    2017-07-25

    Pakistan is classified as one of the high multi-drug resistant tuberculosis (MDR-TB) burden countries. A poorly regulated private sector, over-prescription of antibiotics and self-medication has led to augmented rates of drug-resistance in the country. Pakistan's first national anti-tuberculosis drug resistance survey identified high prevalence of fluoroquinolone resistance among MDR-TB patients. Further institutional evidence of fluoroquinolone drug-resistance can support re-evaluation of treatment regimens as well as invigorate efforts to control antibiotic resistance in the country. In this study, data for drug-susceptibility testing (DST) was retrospectively analyzed for a total of 133 patients receiving MDR-TB treatment at the Chest Department of Jinnah Postgraduate Medical Center, Karachi, Pakistan. Frequency analyses for resistance patterns was carried out and association of fluoroquinolone (ofloxacin) resistance with demographics and past TB treatment category were assessed. Within first-line drugs, resistance to isoniazid was detected in 97.7% of cases, followed by rifampicin (96.9%), pyrazinamide (86.4%), ethambutol (69.2%) and streptomycin (64.6%). Within second-line drugs, ofloxacin resistance was detected in 34.6% of cases. Resistance to ethionamide and amikacin was 2.3% and 1.6%, respectively. Combined resistance of oflaxacin and isoniazid was detected in 33.9% of cases. Age, gender and past TB treatment category were not significantly associated with resistance to ofloxacin. Fluoroquinolone resistance was observed in an alarmingly high proportion of MDR-TB cases. Our results suggest caution in their use for empirical management of MDR-TB cases and recommended treatment regimens for MDR-TB may require re-evaluation. Greater engagement of private providers and stringent pharmacy regulations are urgently required.

  10. Characteristics of HIV antiretroviral regimen and treatment adherence

    Directory of Open Access Journals (Sweden)

    Vera Lúcia da Silveira

    Full Text Available The relationship between characteristics of HIV antiretroviral regimens and treatment adherence was studied in adolescent and adult patients who underwent antiretroviral therapy from January 1998 to September 2000, at the Service for Specialized Assistance in Pelotas. The patients were interviewed on two occasions, and the use of antiretrovirals during the previous 48 hours was investigated by a self-report. Adherence was defined as use of 95% or more of the prescribed medication. Social-demographic variables were collected through direct questionnaires. The antiretroviral regimen and clinical data were copied from the patients' records. Associations between the independent variables and adherence were analyzed by means of logistic regression. The multivariate analysis included characteristics of the antiretroviral regimens, social-demographic variables, as well as perception of negative effects, negative physiological states, and adverse effects of the treatment. Among the 224 selected patients, 194 participated in our study. Their ages varied from 17 to 67 years; most patients were men, with few years of schooling and a low family income. Only 49% adhered to the treatment. Adherence to treatment regimens was reduced when more daily doses were indicated: three to four doses (odds ratio of adherence to treatment (OR=0.47, 95% confidence interval (CI 0.22-1.01 and five to six (OR=0.24, 95% CI 0.09-0.62; two or more doses taken in a fasting state (OR=0.59, 95% CI 0.11-0.68, and for patients who reported adverse effects to the treatment (OR=0.39, 95% CI 0.19-0.77. Most of the regimens with more than two daily doses of medication included at least one dose apart from mealtimes. The results suggest that, if possible, regimens with a reduced number of doses should be chosen, with no compulsory fasting, and with few adverse effects. Strategies to minimize these effects should be discussed with the patients.

  11. On the role of the ground state Tb(3)/acetylacetone complex in sensitized emission of Tb(3) in ethanol solution

    International Nuclear Information System (INIS)

    Lis, S.; Elbanowski, M.; Marciniak, B.

    1989-01-01

    The Tb(3)-acetylacetone system in ethanol solution has been studied by spectroscopic methods. The formation of a Tb(3)/acetylacetone (1:1) complex in the ground state has been proved and its stability constant determined, K = (0,97 ± 0,06).10 4 dm 3 mol -1 . The role of this complex in the spectrofluorimetric determination of Ln(3) ions in the presence of acetylacetone has been discussed. (Authors)

  12. Zagreb regimen, an abbreviated intramuscular schedule for rabies vaccination.

    Science.gov (United States)

    Ren, Jiangping; Yao, Linong; Sun, Jimin; Gong, Zhenyu

    2015-01-01

    The Zagreb regimen, an abbreviated intramuscular schedule for rabies vaccination, was developed by I. Vodopija and colleagues of the Zagreb Institute of Public Health in Croatia in the 1980s. It was recommended by WHO as one of the intramuscular (IM) schedules for rabies vaccination in 2010. We reviewed the literature on the immunogenicity, safety, economic burden, and compliance of the Zagreb 2-1-1 regimen. Compared to Essen, another IM schedule recommended by WHO, Zagreb has higher compliance, lower medical cost, and better immunogenicity at an early stage. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  13. Eruptive furunculosis following the soak and smear regimen.

    Science.gov (United States)

    Martires, Kathryn; Sukhdeo, Kumar; Meinhardt, Eric

    2015-02-18

    The 'soak and smear' regimen is a highly effective method for localised topical therapy employed by dermatologists for widespread inflammatory skin conditions. The regimen involves application of topical medication under occlusion after soaking in water. Complications from this treatment method are rare. We present a case of multiple, generalised methicillin-resistant Staphylococcus aureus (MRSA)-positive furuncles arising in a patient as an unexpected consequence of therapy. The case highlights an unanticipated risk of a commonly employed treatment amid an epidemic of MRSA in the community. 2015 BMJ Publishing Group Ltd.

  14. vPARP Adjusts MVP Expression in Drug-resistant Cell Lines in Conjunction with MDR Proteins.

    Science.gov (United States)

    Wojtowicz, Karolina; Januchowski, Radoslaw; Nowicki, Michal; Zabel, Maciej

    2017-06-01

    The definition of vault (ribonucleoprotein particles) function remains highly complex. Vaults may cooperate with multidrug resistance (MDR) proteins, supporting their role in drug resistance. This topic is the main theme of this publication. The cell viability was determined by an MTT assay. The protein expression was detected by western blot analysis. The proteins were knocked-down using siRNA. No major vault protein (MVP) in the LoVo/Dx and W1PR cell lines after tunicamycin treatment was shown. In W1PR cells with knocked-down MVP, a statistically significant decrease in cell viability was noted. In LoVo/Dx, W1TR and A2780TR cells were vault poly-ADP-ribose polymerase (vPARP) was knockdown, a decrease in cell viability was shown. Also, MVP silencing induced an increase in glycoprotein P (Pgp) expression in LoVo/Dx cells. MVP is important for the drug resistance of cancer cells, but it probably requires the presence of vPARP for full activation. Some correlations between MDR proteins and vaults exist. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  15. Multi-drug resistance (MDR1 gene and P-glycoprotein influence on pharmacokinetic and pharmacodymanic of therapeutic drugs

    Directory of Open Access Journals (Sweden)

    Linardi Renata Lehn

    2006-01-01

    Full Text Available (MDR1 gene expressed in tumor cells and also in several normal tissues, such as intestine, liver, kidney, blood-brain barrier, spinal cord, and placenta. P-gp has been identified in mice, rat, bovine, monkey, rodents, and human beings and has been receiving a particular clinical relevance because this protein expression limits brain access and intestinal absorption of many drugs. This protein plays a role as a protective barrier against a wide variety of substrates, avoiding drug entry into the central nervous system. P-glycoprotein also interferes with drug bioavailability and disposition, including absorption, distribution, metabolization, and excretion, influencing pharmacokinetic and pharmacodynamic of drugs. Modulation of P-gp may help the efficacy of treatment of several diseases and can explain some adverse central nervous system effects induced by drugs after intravenous administration and the poor response of oral administration in patients. Alteration in P-gp expression or function has been associated with several diseases susceptibility in humans and animals. Furthermore, additional studies relating MDR1 and P-gp expression has an important clinical implication also in terms of treatment efficacy.

  16. Screening Antibacterial Agent from Crude Extract of Marine-Derived Fungi Associated with Soft Corals against MDR-Staphylococcus haemolyticus

    Science.gov (United States)

    Sabdaningsih, A.; Cristianawati, O.; Sibero, M. T.; Nuryadi, H.; Radjasa, O. K.; Sabdono, A.; Trianto, A.

    2017-02-01

    Multidrug resistant Staphylococcus haemolyticus is a Gram-positive bacteria and member of coagulase negative staphylococci (CoNS) which has the highest level of antimicrobial resistance. This nosocomial pathogen due to skin or soft tissue infections, bacteremia, septicemia, peritonitis, otitis media, meningitis and urinary tract infections. The ability to produce enterotoxins, hemolysins, biofilm, and cytotoxins could be an important characteristic for the successful of infection. Marine-derived fungi have potency as a continuous supply of bioactive compound. The aim of this research was screening antibacterial agent from crude extracts of marine-derived fungi associated with soft corals against MDR-S. haemolyticus. Among 23 isolates of marine-derived fungi isolated from 7 soft corals, there were 4 isolates active against MDR-S. haemolyticus. The screening was conducted by using agar plug diffusion method. Isolate PPSC-27-A4 had the highest antibacterial activity with diameter 23±9,6 mm. The crude extract from this isolate had been confirmed to antibacterial susceptibility test and it had the highest antibacterial activity in 12.2 mm with concentration of 300μg/ml from mycelia extract. PPSC-27-A4 had been characterized in molecular, based on the sequence analysis of 18S rRNA, PPSC-27-A4 isolate was identified as Trichoderma longibrachiatum.

  17. Community-based management versus traditional hospitalization in treatment of drug-resistant tuberculosis: a systematic review and meta-analysis.

    Science.gov (United States)

    Williams, Abimbola Onigbanjo; Makinde, Olusesan Ayodeji; Ojo, Mojisola

    2016-01-01

    Multidrug drug resistant Tuberculosis (MDR-TB) and extensively drug resistant Tuberculosis (XDR-TB) have emerged as significant public health threats worldwide. This systematic review and meta-analysis aimed to investigate the effects of community-based treatment to traditional hospitalization in improving treatment success rates among MDR-TB and XDR-TB patients in the 27 MDR-TB High burden countries (HBC). We searched PubMed, Cochrane, Lancet, Web of Science, International Journal of Tuberculosis and Lung Disease, and Centre for Reviews and Dissemination (CRD) for studies on community-based treatment and traditional hospitalization and MDR-TB and XDR-TB from the 27 MDR-TB HBC. Data on treatment success and failure rates were extracted from retrospective and prospective cohort studies, and a case control study. Sensitivity analysis, subgroup analyses, and meta-regression analysis were used to explore bias and potential sources of heterogeneity. The final sample included 16 studies involving 3344 patients from nine countries; Bangladesh, China, Ethiopia, Kenya, India, South Africa, Philippines, Russia, and Uzbekistan. Based on a random-effects model, we observed a higher treatment success rate in community-based treatment (Point estimate = 0.68, 95 % CI: 0.59 to 0.76, p   18 months, and regimen with drugs >5 reported higher treatment success rate. In the meta-regression model, age of patients, adverse events, treatment duration, and lost to follow up explains some of the heterogeneity of treatment effects between studies. Community-based management improved treatment outcomes. A mix of interventions with DOTS-Plus throughout therapy and treatment duration > 18 months as well as strategies in place for lost to follow up and adverse events should be considered in MDR-TB and XDR-TB interventions, as they influenced positively, treatment success.

  18. Tracking and Treating Mobile Populations. The TB Net System. Migrant Clinicians Network Monograph Series. = El Sistema de Red para la TB.

    Science.gov (United States)

    Migrant Clinicians Network, Inc., Austin, TX.

    A comprehensive tracking and referral network that helps provide continuity of care for mobile populations with active tuberculosis (TB) or TB infection is considered essential for effective treatment of TB. However, the interstate referral system that exists between state health departments has been highly inefficient for serving migrant…

  19. Once-daily dose regimen of ribavirin is interchangeable with a twice-daily dose regimen: randomized open clinical trial

    Directory of Open Access Journals (Sweden)

    Balk JM

    2015-08-01

    Full Text Available Jiska M Balk,1 Guido RMM Haenen,1 Özgür M Koc,2 Ron Peters,3 Aalt Bast,1 Wim JF van der Vijgh,1 Ger H Koek,4 1Department of Toxicology, NUTRIM School for Nutrition, Toxicology and Metabolism, Maastricht University Medical Centre, 2Faculty of Health, Medicine and Life Sciences, Maastricht University, Maastricht, 3DSM Resolve, Geleen, 4Department of Internal Medicine, Division of Gastroenterology and Hepatology, Maastricht University Medical Centre, Maastricht, the Netherlands Background: The combination of ribavirin (RBV and pegylated interferon (PEG-IFN is effective in the treatment of chronic hepatitis C infection. Reducing the frequency of RBV intake from twice to once a day will improve compliance and opens up the opportunity to combine RBV with new and more specific direct-acting agents in one pill. Therefore, the purpose of this study was to evaluate the pharmacokinetic profile of RBV in a once-daily to twice-daily regimen. The secondary aim was to determine tolerability as well as the severity and differences in side effects of both treatment regimens. Methods: In this randomized open-label crossover study, twelve patients with chronic type 1 hepatitis C infection and weighing more than 75 kg were treated with 180 µg of PEG-IFN weekly and 1,200 mg RBV daily for 24 weeks. The patients received RBV dosed as 1,200 mg once-daily for 12 weeks followed by RBV dosed as 600 mg twice-daily for 12 weeks, or vice versa. In addition to the pharmacokinetic profile, the hematological profile and side effects were recorded. The RBV concentrations in plasma were determined using liquid chromatography-tandem mass spectrometry. Results: Eight of twelve patients completed the study. Neither the time taken for RBV to reach peak plasma concentration nor the AUC0-last (adjusted for difference in dose was significantly different between the two groups (P>0.05. Furthermore, the once-daily regimen did not give more side effects than the twice-daily regimen (P>0

  20. Do polymorphisms in MDR1 and CYP3A5 genes influence the risk of cytogenetic relapse in patients with chronic myeloid leukemia on imatinib therapy?

    Science.gov (United States)

    Harivenkatesh, Natarajan; Kumar, Lalit; Bakhshi, Sameer; Sharma, Atul; Kabra, Madhulika; Velpandian, Thirumurthy; Gogia, Ajay; Shastri, Shivaram S; Gupta, Yogendra Kumar

    2017-09-01

    Influence of polymorphisms in the genes coding for imatinib transporters and metabolizing enzymes on cytogenetic relapse in patients with chronic myeloid leukemia (CML) is not known. One hundred and four patients (52 cases with cytogenetic relapse and 52 controls without relapse) with chronic-phase CML on imatinib therapy and have completed 5 years of follow-up were enrolled. The following single nucleotide polymorphisms (SNPs) were genotyped; C1236T, C3435T, G2677T/A in MDR1 gene and A6986G in CYP3A5 gene, using PCR-RFLP method and validated by direct gene sequencing. Imatinib trough levels were measured using LC-MS/MS. Patients with CC genotype for MDR1-C1236T polymorphism were at significantly higher risk for cytogenetic relapse [OR =4.382, 95% CI (1.145, 16.774), p = .022], while those with TT genotype for MDR1-C3435T polymorphism had significantly lower risk of relapse [OR =0.309, 95% CI (0.134, 0.708), p = .005]. Imatinib trough levels were lower in patients with relapse compared to those without relapse (1551.4 ± 1324.1 vs. 2154.2 ± 1358.3 ng/mL; p = .041). MDR1-C3435T genotype [adjusted-OR: 0.266; 95% CI (0.111, 0.636); p = .003] and trough levels (p = .014) were independent predictors of relapse in multivariate analysis. To conclude, C1236T and C3435T polymorphisms in MDR1 gene and trough levels significantly influence the risk of cytogenetic relapse. MDR1-C3435T genotype might emerge as a potential biomarker to predict the risk of cytogenetic relapse in patients with CML.

  1. Gonzalez Regimen (PDQ®)—Health Professional Version

    Science.gov (United States)

    The Gonzalez regimen is a specialized diet that uses enzymes, supplements, and other factors in cancer management. It is based on a theory that involves the use of pancreatic enzymes to help the body get rid of toxins that lead to cancer. Read about existing clinical data in this expert-reviewed summary.

  2. What to Start: Selecting a First HIV Regimen

    Science.gov (United States)

    ... CCR5 antagonists Integrase strand transfer inhibitors (INSTIs) Post-attachment inhibitors In general, a person's first HIV regimen includes two NRTIs plus an INSTI, an NNRTI, or a PI boosted with cobicistat (brand name: Tybost) or ritonavir (brand name: Norvir). Cobicistat ...

  3. Efficacy of Some Combination Regimens of Oral Hypoglycaemic ...

    African Journals Online (AJOL)

    Purpose: To examine the efficacy of selected oral hypoglycaemic agent (OHA) regimens in a small group of patients receiving such treatment. Methods: This was a retrospective, observational study that involved patients who had been diagnosed with type 2 diabetes mellitus and undergoing routine follow-up at a teaching ...

  4. Novel understanding of ABC transporters ABCB1/MDR/P-glycoprotein, ABCC2/MRP2, and ABCG2/BCRP in colorectal pathophysiology

    DEFF Research Database (Denmark)

    Andersen, Vibeke; Svenningsen, Katrine; Knudsen, Lina Almind

    2015-01-01

    transporter proteins, inflammatory bowel disease, ulcerative, colitis, Crohns disease, colorectal cancer, colitis, intestinal inflammation, intestinal carcinogenesis, ABCB1/P-glycoprotein (P-gp/CD243/MDR1), ABCC2/multidrug resistance protein 2 (MRP2) and ABCG2/breast cancer resistance protein (BCRP), Abcb1....../Mdr1a, abcc2/Mrp2, abcg2/Bcrp, knock-out mice, tight junction, membrane lipid function. RESULTS: Recently, human studies reported that changes in the levels of ABC transporters were early events in the adenoma-carcinoma sequence leading to CRC. A link between ABCB1, high fat diet and gut microbes...

  5. Importancia pronóstica de la expresión de MDR-1 en la leucemia mieloblástica aguda

    Directory of Open Access Journals (Sweden)

    J. Arbelbide

    2003-08-01

    Full Text Available Una proporción importante de pacientes con leucemia mieloblástica aguda (LMA presentan recaída o resistencia con el tratamiento. Uno de los mecanismos involucrados en la resistencia a drogas, es la presencia de la glicoproteína P 170 (gp-P 170 resultante de la expresión del gen MDR-1 sobre las células leucémicas. El objetivo de este trabajo es valorar el impacto pronóstico de la expresión de MDR-1 en una población de pacientes tratados por LMA. Se evaluó retrospectivamente la expresión de MDR-1 en una cohorte de 55 pacientes con LMA, mayores de 16 años, que recibieron tratamiento quimioterápico desde 1990 hasta el 2000. Se evaluó sobre biopsia de médula ósea, la expresión de MDR-1/gp-P 170 por inmunohistoquímica. Mediante una curva ROC, se estableció que una expresión de MDR-1 > 50% en células blásticas, resultó significativa para el logro de remisión completa. Esta expresión de MDR-1+ correlacionó con la presencia de leucocitosis: (p:0.002, expresion de células CD34+ (p:0.006, menor tasa de remisión completa (p:0.001, mayor tasa de recaída (p:0.02 y de estudios citogenéticos no favorables (p:0.02. La SLE fue de 21.2% ES:9.3 con un seguimiento de 22 meses para el grupo MDR-1+ versus 56.4% ES:12.5 con un seguimiento de 78 meses en los casos MDR-1- (p:0.007. Se puede concluir que la expresion de MDR-1 ha demostrado ser un factor pronóstico de resistencia a la quimioterapia. Estos pacientes presentan una menor tasa de remisión completa, una mayor tasa de recaída por persistencia de enfermedad residual post-tratamiento, lo que produce una menor sobrevida global.An important number of patients with Acute Myeloid Leukemia (AML experience relapse or resistance to chemotherapy. One of the mechanisms involved in this resistance is the presence of glycoprotein P170 (gp-P 170, which results of the MDR-1 gene in leukemic cells. The objective of this article is to assess the prognostic impact of the expression of MDR-1 in a

  6. CYP3A5*3 and MDR1 C3435T are influencing factors of inter-subject variability in rupatadine pharmacokinetics in healthy Chinese volunteers.

    Science.gov (United States)

    Xiong, Yuqing; Yuan, Zhao; Yang, Jingzhi; Xia, Chunhua; Li, Xinhua; Huang, Shibo; Zhang, Hong; Liu, Mingyi

    2016-04-01

    Rupatadine (RUP) is an oral antihistamine and platelet-activating factor antagonist and is shown as the substrate of CYP3A5 and P-gp. The significant interindividual differences of CYP3A5 and P-gp often cause bioavailability differences of some clinical drugs. The present study is aimed to evaluate the effect of genetic polymorphisms of CYP3A5 and MDR1 on RUP pharmacokinetics in healthy male Chinese volunteer subjects. Blood samples were collected from 36 subjects before and after a single, oral RUP 10 mg dose. A PCR-RFLP assay was used to genotype CYP3A5*3 and assess MDR1 C3435T variation. A validated LC-MS/MS method quantified plasma RUP concentration. The relationship between RUP plasma concentration, pharmacokinetic parameters, and polymorphic alleles (CYP3A5 and MDR1) were assessed. Plasma RUP concentrations were lower for CYP3A5*1/*1 carriers than for CYP3A5*3/*3 and CYP3A5*1/*3 carriers. Mean C(max), AUC(0-t) and AUC(0-∞) were significantly lower, and the CLz and Vd were significantly higher in the CYP3A5 wild-type group, than in the CYP3A5 mutated group. MDR1 CT and MDR1 TT carriers had lower plasma RUP concentrations than MDR1 CC carriers. The mean C(max), AUC(0-t), AUC(0-∞) and T max were significantly lower in the TT group than in the CC and CT groups. The mean CLz was higher in the TT group than in the CC and CT groups, but not significantly. These results suggest that CYP3A5 and MDR1 may play a key role in the variability of RUP metabolism and transport, respectively. CYP3A5 and MDR1 polymorphisms may be the main explanation for the differences observed in RUP pharmacokinetics, and therefore may provide a rationale for safe and effective clinical use of RUP. Our research lays down a solid theory foundation to guide the safe and effective clinical use of RUP and a route to achieve individualized therapy.

  7. Liver toxicity associated with tuberculosis chemotherapy in the REMoxTB study.

    Science.gov (United States)

    Tweed, Conor Duncan; Wills, Genevieve Helen; Crook, Angela M; Dawson, Rodney; Diacon, Andreas H; Louw, Cheryl E; McHugh, Timothy D; Mendel, Carl; Meredith, Sarah; Mohapi, Lerato; Murphy, Michael E; Murray, Stephen; Murthy, Sara; Nunn, Andrew J; Phillips, Patrick P J; Singh, Kasha; Spigelman, M; Gillespie, S H

    2018-03-28

    Drug-induced liver injury (DILI) is a common complication of tuberculosis treatment. We utilised data from the REMoxTB clinical trial to describe the incidence of predisposing factors and the natural history in patients with liver enzyme levels elevated in response to tuberculosis treatment. Patients received either standard tuberculosis treatment (2EHRZ/4HR), or a 4-month regimen in which moxifloxacin replaced either ethambutol (isoniazid arm, 2MHRZ/2MHR) or isoniazid (ethambutol arm, 2EMRZ/2MR). Hepatic enzymes were measured at 0, 2, 4, 8, 12 and 17 weeks and as clinically indicated during reported adverse events. Patients included were those receiving at least one dose of drug and with two or more hepatic enzyme measurements. A total of 1928 patients were included (639 2EHRZ/4HR, 654 2MHRZ/2MHR and 635 2EMRZ/2MR). DILI was defined as peak alanine aminotransferase (ALT) ≥ 5 times the upper limit of normal (5 × ULN) or ALT ≥ 3 × ULN with total bilirubin > 2 × ULN. DILI was identified in 58 of the 1928 (3.0%) patients at a median time of 28 days (interquartile range IQR 14-56). Of 639 (6.4%) patients taking standard tuberculosis therapy, 41 experienced clinically significant enzyme elevations (peak ALT ≥ 3 × ULN). On standard therapy, 21.1% of patients aged >55 years developed a peak ALT/aspartate aminotransferase (AST) ≥ 3 × ULN (p = 0.01) and 15% of HIV-positive patients experienced a peak ALT/AST ≥ 3 × ULN compared to 9% of HIV-negative patients (p = 0.160). The median peak ALT/AST was higher in isoniazid-containing regimens vs no-isoniazid regimens (p tuberculosis patients on standard treatment. Older patients on standard therapy, HIV-positive patients, Asian patients and those receiving isoniazid were at higher risk of elevated enzyme levels. Monitoring hepatic enzymes during the first 2 months of standard therapy detected approximately 75% of patients with a peak enzyme elevation ≥3 × ULN, suggesting this should be a standard of care. These

  8. Fluid regimens for colostomy irrigation: a systematic review.

    Science.gov (United States)

    Lizarondo, Lucylynn; Aye Gyi, Aye; Schultz, Tim

    2008-09-01

    Background  Various techniques for managing faecal evacuation have been proposed; however, colostomy irrigation is favoured as it leads to better patient outcomes. Alternative fluid regimens for colostomy irrigation have been suggested to achieve effective evacuation. Aim  The objective of this review was to summarise the best available evidence on the most effective fluid regimen for colostomy irrigation. Search strategy  Trials were identified by electronic searches of CINAHL, PubMed, MEDLINE, Current Contents, the Cochrane Library and EMBASE. Unpublished articles and references lists from included studies were also searched. Selection criteria  Randomised controlled trials and before-and-after studies investigating any fluid regimen for colostomy irrigation were eligible for inclusion. Outcomes measured included fluid inflow time, total wash-out time, haemodynamic changes during irrigation, cramps, leakage episodes, quality of life and level of satisfaction. Data collection and analysis  Trial selection, quality appraisal and data extraction were carried out independently by two reviewers. Differences in opinion were resolved by discussion. Main results  The systematic literature search strategy identified two cross-over trials that compared water with another fluid regimen. Owing to the differences in irrigating solutions used, the results were not pooled for analysis. Both the polyethylene glycol electrolyte solution and glyceryl trinitrate performed significantly better than water. Conclusion  There is some evidence to support the effectiveness of fluid regimens other than water, such as polyethylene glycol electrolyte and glyceryl trinitrate, for colostomy irrigation. Further well-designed clinical trials are required to establish solid evidence on the effectiveness of other irrigating solutions that might enhance colonic irrigation. © 2008 The Authors. Journal Compilation © Blackwell Publishing Asia Pty Ltd.

  9. Energy transfer mechanism between Ce and Tb ions in sol–gel synthesized YSO crystals

    International Nuclear Information System (INIS)

    Chiriu, Daniele; Stagi, Luigi; Carbonaro, Carlo Maria; Corpino, Riccardo; Ricci, Pier Carlo

    2016-01-01

    The luminescence properties of Tb and Ce in Rare Earth Doped crystalline oxides largely depend on their relative concentrations: by increasing the dopant concentration, the luminescence profile changes from blue to green because of the energy transfer among centers. The kinetic properties of the luminescence of optically excited Terbium–Cerium co-doped Y_2SiO_5 sol–gel synthesized crystal powders have been investigated as a function of the Tb dopant concentration (Ce content fixed at 1% atomic). The interaction among different Tb emitting centers and their relation with Ce centers was explained within the Inokuti-Hirayama model for a dipole–dipole energy transfer mechanism in the low-middle Tb concentration range whilst the Forster–Dexter model was applied in the middle-high Tb concentration range. The kinetic model allows elucidating the role of sensitizer and activator ion as a function of Tb concentration, successfully estimating the energy transfer mechanism efficiency and calculating the critical Tb concentration. - Highlights: • The kinetic properties of Ce, Tb recombination in YSO matrix were studied. • The Inokuti-Hirayama and Forster–Dexter models were applied. • At high Tb content, the Ce to Tb energy transfer acts through the dipole−quadrupole. • At low Tb content, the Ce to Tb energy transfer acts through the dipole−dipole. • The presence of Ce reduces the critical Tb concentration (at low Tb content).

  10. Energy transfer mechanism between Ce and Tb ions in sol–gel synthesized YSO crystals

    Energy Technology Data Exchange (ETDEWEB)

    Chiriu, Daniele; Stagi, Luigi; Carbonaro, Carlo Maria; Corpino, Riccardo; Ricci, Pier Carlo, E-mail: carlo.ricci@dsf.unica.it

    2016-03-01

    The luminescence properties of Tb and Ce in Rare Earth Doped crystalline oxides largely depend on their relative concentrations: by increasing the dopant concentration, the luminescence profile changes from blue to green because of the energy transfer among centers. The kinetic properties of the luminescence of optically excited Terbium–Cerium co-doped Y{sub 2}SiO{sub 5} sol–gel synthesized crystal powders have been investigated as a function of the Tb dopant concentration (Ce content fixed at 1% atomic). The interaction among different Tb emitting centers and their relation with Ce centers was explained within the Inokuti-Hirayama model for a dipole–dipole energy transfer mechanism in the low-middle Tb concentration range whilst the Forster–Dexter model was applied in the middle-high Tb concentration range. The kinetic model allows elucidating the role of sensitizer and activator ion as a function of Tb concentration, successfully estimating the energy transfer mechanism efficiency and calculating the critical Tb concentration. - Highlights: • The kinetic properties of Ce, Tb recombination in YSO matrix were studied. • The Inokuti-Hirayama and Forster–Dexter models were applied. • At high Tb content, the Ce to Tb energy transfer acts through the dipole−quadrupole. • At low Tb content, the Ce to Tb energy transfer acts through the dipole−dipole. • The presence of Ce reduces the critical Tb concentration (at low Tb content).

  11. Litigation as TB Rights Advocacy: A New Delhi Case Study.

    Science.gov (United States)

    McBroom, Kerry

    2016-06-01

    One thousand people die every day in India as a result of TB, a preventable and treatable disease, even though the Constitution of India, government schemes, and international law guarantee available, accessible, acceptable, quality health care. Failure to address the spread of TB and to provide quality treatment to all affected populations constitutes a public health and human rights emergency that demands action and accountability. As part of a broader strategy, health activists in India employ Public Interest Litigation (PIL) to hold the state accountable for rights violations and to demand new legislation, standards for patient care, accountability for under-spending, improvements in services at individual facilities, and access to government entitlements in marginalized communities. Taking inspiration from right to health PIL cases (PILs), lawyers in a New Delhi-based rights organization used desk research, fact-findings, and the Right To Information Act to build a TB PIL for the Delhi High Court, Sanjai Sharma v. NCT of Delhi and Others (2015). The case argues that inadequate implementation of government TB schemes violates the Constitutional rights to life, health, food, and equality. Although PILs face substantial challenges, this paper concludes that litigation can be a crucial advocacy and accountability tool for people living with TB and their allies.

  12. Solution growth of Tb doped Gd_2O_3 film

    International Nuclear Information System (INIS)

    Ghosh, M.; Pitale, S.; Desai, D.G.; Patra, G.D.; Sen, S.; Gadkari, S.C.

    2016-01-01

    Nanomaterials of Gd_2O_3 have proven applications in medical imaging and cancer therapy due to the presence of element Gd. Also Gd_2O_3 films have been grown by vapor phase method as well as self assembly in solution and studied as a high-k dielectric and efficient luminescence material. Here, we report a method to obtain Tb doped Gd_2O_3 film by solution growth method followed by suitable heat treatment. Uniform films of Tb doped Gadolinium hydroxycarbonate have been deposited on fused quartz substrates kept inside a solution containing gadolinium nitrate, terbium nitrate and Urea maintained at 90°C. Gadolinium hydroxy-carbonate films are then treated at 800°C for 2 hour to obtain Tb doped cubic Gd_2O_3 as confirmed by X-ray diffraction measurement. The photoluminescence spectra display characteristic Tb emission at 544 nm when excited at 285 nm. The lifetime of Tb emission is found to be of the order of few microseconds. (author)

  13. EXAFS study of Tb-doped silica xerogels

    International Nuclear Information System (INIS)

    Rocca, F.; Monti, F.; Kuzmin, A.; Dalmaso, A.; Pasqualini, D.

    1999-01-01

    The modification of the local environment of Tb 3+ ions in optically active silica xerogels as a function of concentration (from 400 ppm to 40000 ppm) and thermal treatment (which induces densification) was studied by x-ray absorption spectroscopy at the Tb L 3 edge. Quantitative analysis of the first Tb-O coordination shell was performed using the experimental signal from Tb 3+ ions in water solution as a reference. The radial distribution functions (RDF) of the non-thermally treated (NT) gels are characterised by a nearly gaussian shape, as for the reference sample. On the contrary, the RDF of the densified gels (T) are asymmetric having the main peak at a shorter distance, with a reduced coordination number (N=4-5) and a secondary peak, with N=1-2, at a longer distance. The local environment of Tb in the low concentration sample (400 ppm) is different from that at higher concentrations, both in the NT- and in the T-gels. (au)

  14. EXAFS study of Tb-doped silica xerogels

    Energy Technology Data Exchange (ETDEWEB)

    Rocca, F. [CeFsa - Centro CNR-ITC de Fisica degli Stati Aggregati, Povo (Italy); Monti, F. [Univ. de Verona, Facolta di Scienze (Italy); Kuzmin, A. [Inst. of Solid State Physics, Riga (Latvia); Dalmaso, A.; Pasqualini, D. [Univ. di Trento, INFM - Dipartimento di Fisica (Italy)

    1999-11-01

    The modification of the local environment of Tb{sup 3+} ions in optically active silica xerogels as a function of concentration (from 400 ppm to 40000 ppm) and thermal treatment (which induces densification) was studied by x-ray absorption spectroscopy at the Tb L{sub 3} edge. Quantitative analysis of the first Tb-O coordination shell was performed using the experimental signal from Tb{sup 3+} ions in water solution as a reference. The radial distribution functions (RDF) of the non-thermally treated (NT) gels are characterised by a nearly gaussian shape, as for the reference sample. On the contrary, the RDF of the densified gels (T) are asymmetric having the main peak at a shorter distance, with a reduced coordination number (N=4-5) and a secondary peak, with N=1-2, at a longer distance. The local environment of Tb in the low concentration sample (400 ppm) is different from that at higher concentrations, both in the NT- and in the T-gels. (au) 15 refs.

  15. EXAFS study of Tb-doped silica xerogels

    CERN Document Server

    Rocca, F; Kuzmin, A; Dalmaso, A; Pasqualini, D

    1999-01-01

    The modification of the local environment of Tb/sup 3+/ ions in optically active silica xerogels as a function of concentration (from 400 ppm to 40000 ppm) and thermal treatment (which induces densification) was studied by X-ray absorption spectroscopy at the Tb L/sub 3/ edge. Quantitative analysis of the first Tb-O coordination shell was performed using the experimental signal from Tb/sup 3+/ ions in water solution as a reference. The radial distribution functions (RDF) of the non-thermally treated (NT) gels are characterized by a nearly Gaussian shape, as for the reference sample. On the contrary, the RDF of the densified gels (T) are asymmetric having the main peak at a shorter distance, with a reduced coordination number (N=4-5) and a secondary peak, with N=1-2, at a longer distance. The local environment of Tb in the low concentration sample (400 ppm) is different from that at higher concentrations, both in the NT- and in the T-gels. (15 refs).

  16. A tuberculosis biomarker database: the key to novel TB diagnostics

    Directory of Open Access Journals (Sweden)

    Seda Yerlikaya

    2017-03-01

    Full Text Available New diagnostic innovations for tuberculosis (TB, including point-of-care solutions, are critical to reach the goals of the End TB Strategy. However, despite decades of research, numerous reports on new biomarker candidates, and significant investment, no well-performing, simple and rapid TB diagnostic test is yet available on the market, and the search for accurate, non-DNA biomarkers remains a priority. To help overcome this ‘biomarker pipeline problem’, FIND and partners are working on the development of a well-curated and user-friendly TB biomarker database. The web-based database will enable the dynamic tracking of evidence surrounding biomarker candidates in relation to target product profiles (TPPs for needed TB diagnostics. It will be able to accommodate raw datasets and facilitate the verification of promising biomarker candidates and the identification of novel biomarker combinations. As such, the database will simplify data and knowledge sharing, empower collaboration, help in the coordination of efforts and allocation of resources, streamline the verification and validation of biomarker candidates, and ultimately lead to an accelerated translation into clinically useful tools.

  17. Magnetic Interactions in Tb and Tb-10% Ho from Inelastic Neutron Scattering

    DEFF Research Database (Denmark)

    Bjerrum Møller, Hans; Houmann, Jens Christian Gylden; Mackintosh, A.R.

    1968-01-01

    The magnon dispersion relations and lifetimes have been measured in Tb and a Tb‐10% Ho alloy by inelastic neutron scattering, in regions of both ferromagnetic and spiral ordering. In the ferromagnetic phase, the magnon energy is generally finite at zero wavevector and rises quadratically at low q....... The magnon energies scale approximately with the magnetization. In the spiral phase the magnon energy rises linearly from zero at low q. The Fourier‐transformed exchange parameter J(q) has pronounced peaks in the c direction, which are ascribed to transitions between states close to the Fermi surface....... These peaks are less pronounced in the ferromagnetic phase. The primary mechanism limiting the magnon lifetimes appears to be interaction with the conduction electrons. In the alloy, the lifetime for magnons propagating in the c direction in the ferromagnetic phase falls abruptly at about q  =  0.35 Å−1...

  18. State of affairs of tuberculosis in prison facilities: a systematic review of screening practices and recommendations for best TB control

    NARCIS (Netherlands)

    Vinkeles Melchers, Natalie V. S.; van Elsland, Sabine L.; Lange, Joep M. A.; Borgdorff, Martien W.; van den Hombergh, Jan

    2013-01-01

    Prisoners are at high risk of developing tuberculosis (TB), causing morbidity and mortality. Prison facilities encounter many challenges in TB screening procedures and TB control. This review explores screening practices for detection of TB and describes limitations of TB control in prison

  19. Interferon gamma release assays for the diagnosis of latent TB infection in HIV-infected individuals in a low TB burden country.

    LENUS (Irish Health Repository)

    Cheallaigh, Clíona Ní

    2013-01-01

    Interferon gamma release assays (IGRAs) are used to diagnose latent tuberculosis infection. Two IGRAs are commercially available: the Quantiferon TB Gold In Tube (QFT-IT) and the T-SPOT.TB. There is debate as to which test to use in HIV+ individuals. Previous publications from high TB burden countries have raised concerns that the sensitivity of the QFT-IT assay, but not the T-SPOT.TB, may be impaired in HIV+ individuals with low CD4+ T-cell counts. We sought to compare the tests in a low TB burden setting.

  20. Risk Factors for DOTS Treatment Default Among New HIV-TB Coinfected Patients in Nalgonda (Dist.) Telangana (State): A Case Control Study.

    Science.gov (United States)

    Reddy Satti, Siva Balaji; Kondagunta, Nagaraj

    2016-01-01

    The therapeutic regimens as recommended by the Revised National TB Control Programme (RNTCP) have been shown to be highly effective for both preventing and treating tuberculosis, but poor adherence to medication is a major barrier to its global control. The study was conducted to assess the influence of patient related factors for DOTS Treatment Default among HIV-TB Co-infected cases. This was a case control study conducted in Nalgond, Telangana. All new HIV-TB coinfected and DOTS-defaulted patients registered under RNTCP for the period from January 2010 to December 2012 were selected. Of the 154 patients, 23 had died and 11 could not be traced, and these were excluded. Thus the total number of available cases were 120 for those age- and sex-matched controls (HIV-TB coinfected patients and those who had completed the DOTS regimen successfully) were selected. The mean age was 36.5 ± 9 years; the majority (23.3%) of patients defaulted during the second month of treatment. Significant risk factors associated with defaulting included unskilled occupation [adjusted odds ratio (AOR: 3.56; 95% confidence interval (CI): 1.1-11.56], lower middle class socioeconomic status (AOR: 17.16; 95% CI: 3.93-74.82), small family size (AOR: 21.3; 95% CI: 6.4-70.91), marital disharmony (AOR: 6.78; 95% CI: 1.93-23.76), not being satisfied with the conduct of health personnel (AOR: 7.38; 95% CI: 2.32-23.39), smoking (AOR: 8.5; 95% CI: 2.31-31.21), and side effects of drugs (AOR: 4.18; 95% CI: 1.35-12.9). Unskilled occupation, marital disharmony, small family size, lower middle class socioeconomic status, not being satisfied with the conduct of health personnel, smoking, and drug side effects were significantly associated with defaulting. Information on the pattern of tuberculosis (TB), the outcome of anti-tuberculosis treatment (ATT), and the factors associated with it will help in planning interventions to improve adherence to DOTS treatment.

  1. Difference in TB10.4 T-cell epitope recognition following immunization with recombinant TB10.4, BCG or infection with Mycobacterium tuberculosis

    DEFF Research Database (Denmark)

    Billeskov, Rolf; Grandal, Michael V; Poulsen, Christian

    2010-01-01

    vaccine Ag, TB10.4, in a recombinant form, or when expressed by the pathogen Mycobacterium tuberculosis (M.tb), or by the current anti-tuberculosis vaccine, Mycobacterium bovis BCG. We showed that BCG and M.tb induced a similar CD4(+) T-cell specific TB10.4 epitope-pattern, which differed completely from...... that induced by recombinant TB10.4. This difference was not due to post-translational modifications of TB10.4 or because TB10.4 is secreted from BCG and M.tb as a complex with Rv0287. In addition, BCG and TB10.4/CAF01 were both taken up by DC and macrophages in vivo, and in vitro uptake experiments revealed...... that both TB10.4 and BCG were transported to Lamp(+)-compartments. BCG and TB10.4 however, were directed to different types of Lamp(+)-compartments in the same APC, which may lead to different epitope recognition patterns. In conclusion, we show that different vectors can induce completely different...

  2. Preparation and characterization of Tb3+ and Tb(sal)3.nH2O doped PC:PMMA blend

    International Nuclear Information System (INIS)

    Dwivedi, Y.; Singh, A.K.; Prakash, Rajiv; Rai, S.B.

    2011-01-01

    Tb doped polycarbonate:poly(methyl methacrylate) (Tb-PC:PMMA) blend was prepared with varying proportions of PC and PMMA. Thermal and spectroscopic properties of the doped polymer have been investigated employing Fourier Transform Infrared (FTIR) absorption and differential scanning calorimetric (DSC) techniques. PC:PMMA blend (with 10 wt% PC and 90 wt% PMMA) shows better miscibility. Optical properties of the dopant Tb 3+ ions have been investigated using UV-vis absorption and fluorescence excited by 355 nm radiation. It is seen that luminescence intensity of Tb 3+ ion depends on PC:PMMA ratio and on Tb 3+ ion concentration. Concentration quenching is seen for TbCl 3 .6H 2 O concentration larger than 4 wt%. Addition of salicylic acid to the polymer blend increases the luminescence from Tb 3+ ions. Luminescence decay curve analysis affirms the non-radiative energy transfer from salicylic acid to Tb 3+ ions, which is identified as the reason behind this enhancement. - Highlights: → Blend formation is confirmed at PC/90PMMA, using FTIR and DSC techniques. → Absorption and bandgap studies of blend and parent components were studied. → Optical properties of Tb and Tb(sal) 3 .nH 2 O complex have been studied in PC/PMMA blend. → Luminescence decay curves confirm non-radiative energy transfer from Sal to Tb 3+ ions.

  3. KEMANDIRIAN MASYARAKAT DALAM PERILAKU PENCEGAHAN PENULARAN PENYAKIT TB PARU

    Directory of Open Access Journals (Sweden)

    Niniek Lely Pratiwi

    2013-03-01

    Full Text Available ABSTRACT Background: Prevention of tuberculosis, particularly pulmonary tuberculosis in lndonesia was started in 1969, but the number of pulmonary TB patients is increasing. Methods:Ethnographic qualitative study aims to assess the independence of the community effort in preventing pulmonary TB disease transmission. Methods: of data collection participatory observation, in-depth interviews with informants pulmonary TB patients and families. Research sites in the city of Pariaman, West Lombok district and the district Rote Ndao NTT. Results:The analysis of four independent indicators of the knowledge society is stilllow considering that most of the informants consider pulmonary TB disease as a hereditary disease, and infectious diseases as the people in the district Hossa Rote Ndao. Illness perceptions of people in the city of Pariaman, pulmonary TB disease as a disease because "ismeken", due to use-for others who are not happy ln the town of West Lombok fear of stigma, shame as people with TB, so there are many people who call it the perception of illness as a disease of old cough, dry cough of 40 days, and asthma. Confidence/trust society still depends on health workers, yet there are cadres who provide direct counseling on prevention of transmission. Capability community is lacking, people still believe in the health care workers to provide counseling. Selection of the PMO staff (Supervisors taking medication were not appropriate to the social structures that exist in society Lobar districts with 'sasak' social structure, then the host teacher, 'Kyai' can be as social support surrounding communities. 'Kyai' expected to affect the mindset of people, motivate people to air PHBs. Rote Ndao district as a social support from church leaders as well as the city of Pariaman, a descendant of the king, can motivate people. Participatory community by providing prevention counseling in a variety of pulmonary TB disease or group of containers carried on a

  4. CD4 cell count recovery in HIV/TB co-infected patients versus TB uninfected HIV patients

    Directory of Open Access Journals (Sweden)

    Wanchu A

    2010-10-01

    Full Text Available Background: There is lack of data comparing the improvement in CD4 count following antitubercular (ATT and antiretroviral therapy (ART in patients presenting with Human Immunodeficiency Virus/Tuberculosis (HIV/TB dual infection compared with CD4 matched cohort of TB uninfected HIV patients initiated on ART. We sought to test the hypothesis; TB additionally contributes to reduction in CD4 count in HIV/TB co-infected patients and this would result in greater improvement in count following treatment compared with CD4 matched TB uninfected individuals. Materials and Methods: In a retrospective cohort study design we studied the change in CD4 cell counts in two groups of patients - those with CD4 cell count >100 cells / mm 3 (Group 1 and <100/mm 3 (Group 2 at presentation. In each group the change in CD4 cell count in dually infected patients following six-month ATT and ART was compared to cohorts of CD4 matched TB uninfected patients initiated on ART. Results: In Group 1 (52 patients dually infected subjects′ CD4 count improved from 150 cells/ mm 3 to 345 cells/mm 3 (P=0.001. In the control TB uninfected patients, the change was from 159 cells/mm 3 to 317 cells/mm 3 (P=0.001. Additional improvement in dually infected patients compared to the control group was not statistically significant (P=0.24. In Group 2 (65 patients dually infected subjects count improved from 49 cells/mm3 to 249 cells/mm 3 (P=0.001 where as in control TB uninfected patients improvement was from 50 cells/ mm 3 to 205 cells/mm 3 (P=0.001, there being statistically significant additional improvement in dually infected subjects (P=0.01. Conclusion: Greater increment in CD4 counts with ATT and ART in dually infected patients suggests that TB additionally influences the reduction of CD4 counts in HIV patients.

  5. Fusion cross sections measurement for 6Li + 159Tb

    International Nuclear Information System (INIS)

    Pradhan, M.K.; Mukherjee, A.; Kshetri, R.; Roy, Subinit; Basu, P.; Goswami, A.; Saha Sarkar, M.; Ray, M.; Parkar, V.; Santra, S.; Kailas, S.; Palit, R.

    2009-01-01

    In order to investigate the effect of projectile breakup threshold energy on fusion in mass region around A∼170, we have carried out a systematic investigation of the fusion (both CF and ICF) cross sections for the systems 11 B, 10 B + 159 Tb and 7 Li + 159 Tb at energies near and close to the barrier where 11 B was considered to be a strongly bound nucleus. The nucleus 10 B has a α-separation energy of 4.5 MeV. The measurements show that the extent of suppression of CF cross sections is correlated with the α-separation energies of the projectiles. As a further continuation of this work, we have recently carried out fusion excitation function measurement for the system 6 Li + 159 Tb (Coulomb barrier 27 MeV) at energies near and close to the barrier

  6. Inhibition of placenta growth factor with TB-403

    DEFF Research Database (Denmark)

    Nielsen, Dorte Lisbet; Sengeløv, Lisa

    2012-01-01

    INTRODUCTION: There is clinical evidence that therapies targeting the vascular endothelial growth factor pathway are effective in delaying cancer progression. However, tumors may be either intrinsically resistant or evolve resistance to such therapies. Hence, there is a need for new therapies...... targeting angiogenesis. AREAS COVERED: The data are obtained by searching in the PubMed database. The search terms used included antiangiogenic therapy, TB-403 (RO5323441), placenta growth factor (PlGF) and VEGFR-1 (Flt-1). We review preclinical data concerning the function and inhibition of Pl......GF and summarize data on expression of PlGF in cancer patients. Data from early-phase clinical trials of TB-403 (RO5323441), a monoclonal antibody inhibiting PlGF, are discussed. Future development strategies, therapeutic potentials and limitations of TB-403 are further evaluated. EXPERT OPINION: There are some...

  7. P-Glycoprotein/MDR1 regulates pokemon gene transcription through p53 expression in human breast cancer cells.

    Science.gov (United States)

    He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang

    2010-08-27

    P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

  8. P-Glycoprotein/MDR1 Regulates Pokemon Gene Transcription Through p53 Expression in Human Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Wei Xu

    2010-08-01

    Full Text Available P-glycoprotein (Pgp, encoded by the multidrug resistance 1 (MDR1 gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

  9. TB-IRIS and remodelling of the T cell compartment in highly immunosuppressed HIV+ patients with TB: the CAPRI T (ANRS-12614) study

    Science.gov (United States)

    Haridas, V.; Pean, P.; Jasenosky, L.D.; Madec, Y.; Laureillard, D.; Sok, T.; Sath, S.; Borand, L.; Marcy, O.; Chan, S.; Tsitsikov, E.; Delfraissy, J.-F.; Blanc, F.-X.; Goldfeld, A.E.

    2015-01-01

    Objective To investigate the impact of tuberculosis (TB)-associated immune reconstitution syndrome (IRIS) upon immunological recovery and the T cell compartment after initiation of TB and antiretroviral therapy (ART). Design and methods We prospectively evaluated T cell immunophenotypes by flow cytometry and cytokines by Luminex assays in a subset (n=154) of highly immunosuppressed HIV+ patients with TB from the CAMELIA randomized clinical trial. We compared findings from patients who developed TB-IRIS to findings from patients who did not develop TB-IRIS. Data were evaluated with mixed effect linear regression, Kaplan-Meier estimates, and Wilcoxon rank sum tests, and q-values were calculated to control for multiple comparisons. Results Development of TB-IRIS was associated with significantly greater pre-ART frequencies of HLA-DR+CD45RO+CD4+, CCR5+CD4+, OX40+CD4+, and Fas+ effector memory (EM) CD8+ T cells, and significantly elevated levels of plasma IL-6, IL-1β, IL-8, and IL-10 and viral load. Post-ART initiation, EM CD4+ and Fas+ EM CD4+ T cell frequencies significantly expanded, and central memory (CM) CD4+ T cell frequencies significantly contracted in patients who experienced TB-IRIS. By week 34 post-TB treatment initiation, EM/CM CD4+ T cell ratios were markedly higher in TB-IRIS versus non-TB-IRIS patients. Conclusions A distinct pattern of pre-ART T cell and cytokine markers appear to poise the immune response to develop TB-IRIS. Experience of TB-IRIS is then associated with long-term remodeling of the CD4+ T cell memory compartment towards an EM-dominated phenotype. We speculate that these pre- and post-ART TB-IRIS-associated immune parameters may contribute to superior immune control of TB/HIV co-infection and better clinical outcome. PMID:25486415

  10. Reaching out to take on TB in Somalia.

    Science.gov (United States)

    Moore, David A J; Granat, Simo M

    2014-01-01

    Among the many challenges facing populations disrupted by complex emergencies, personal security and food security rank much higher than access to healthcare. However, over time health needs assume increasing importance. Many complex crises occur in settings where the background incidence of TB is already high; social and economic conditions in crises are then highly conducive to amplification of the existing TB problem. Innovative approaches to delivery of diagnostic and treatment services, transition planning and integration with other healthcare providers and services are vital. In the extremely challenging environment of Somalia, multiple partners are making headway though collaboration and innovation.

  11. Analysis of the fourth spectrum of terbium (Tb IV)

    International Nuclear Information System (INIS)

    Spector, N.; Sugar, J.

    1976-01-01

    The low-energy level structure of Tb 3+ has been derived from spectra obtained with a sliding spark light source. The 7 F ground term of the 4f 8 configuration was found as well as all levels of the configurations 4f 7 5d, 6s, and 6p built on the 8 S 7 / 2 core state of 4f 7 . Of the possible 51 lines connecting these levels, 48 were observed. Optimized radial parameters are given for the observed configurations. A value for the ionization energy of 39.37(0.10) eV is derived for Tb 3+

  12. Optimal treatment interruptions control of TB transmission model

    Science.gov (United States)

    Nainggolan, Jonner; Suparwati, Titik; Kawuwung, Westy B.

    2018-03-01

    A tuberculosis model which incorporates treatment interruptions of infectives is established. Optimal control of individuals infected with active TB is given in the model. It is obtained that the control reproduction numbers is smaller than the reproduction number, this means treatment controls could optimize the decrease in the spread of active TB. For this model, controls on treatment of infection individuals to reduce the actively infected individual populations, by application the Pontryagins Maximum Principle for optimal control. The result further emphasized the importance of controlling disease relapse in reducing the number of actively infected and treatment interruptions individuals with tuberculosis.

  13. Random anisotropy studies in amorphous Co-Tb ribbons

    International Nuclear Information System (INIS)

    Hassanain, N.; Berrada, A.; Lassri, H.; Krishnan, R.

    1995-01-01

    Amorphous Co 1-x Tb x ribbons with x=0.45, 0.55 and 0.65 have been prepared by melt spinning technique. Magnetization measurements were carried out at 4.2 K, under magnetic fields up to 150 kOe. The Co moment is found to be very small and the Tb moment is 7.15μ B at 4.2 K, which indicates a speromagnetic spin structure. Using Chudnovsky's theory we have extracted some fundamental magnetic parameters. ((orig.))

  14. Random anisotropy studies in amorphous CoTb ribbons

    Science.gov (United States)

    Hassanain, N.; Berrada, A.; Lassri, H.; Krishnan, R.

    1995-02-01

    Amorphous Co 1- xTb x ribbons with x = 0.45, 0.55 and 0.65 have been prepared by melt spinning technique. Magnetization measurements were carried out at 4.2 K, under magnetic fields up to 150 kOe. The Co moment is found to be very small and the Tb moment is 7.15 μB at 4.2 K, which indicates a speromagnetic spin structure. Using Chudnovsky's theory we have extracted some fundamental magnetic parameters.

  15. Decay out of superdeformed bands in Tb isotopes

    International Nuclear Information System (INIS)

    Petrache, C.M.; Beck, F.A.; Flibotte, S.; France, G. de; Theisen, C.; Vivien, J.P.

    1995-01-01

    Excited states in the 150,151,152 Tb isotopes have been investigated using the 130 Te( 27 Al, xn) reaction and the EUROGAM array. The theoretical interpretation of the level schemes has been performed in the framework of the deformed independent particle model. The feeding patterns of the normal-deformed states by the superdeformed bands in 150,151 Tb istopes have also been established. The results indicate that the decay-out mechanism of the bands is not of purely statistical nature, but depends on the configurations of both normal- and superdeformed states. (orig.)

  16. Divergent Small Tim Homologues Are Associated with TbTim17 and Critical for the Biogenesis of TbTim17 Protein Complexes in Trypanosoma brucei

    Science.gov (United States)

    Smith, Joseph T.; Singha, Ujjal K.; Misra, Smita

    2018-01-01

    ABSTRACT The small Tim proteins belong to a group of mitochondrial intermembrane space chaperones that aid in the import of mitochondrial inner membrane proteins with internal targeting signals. Trypanosoma brucei, the protozoan parasite that causes African trypanosomiasis, possesses multiple small Tim proteins that include homologues of T. brucei Tim9 (TbTim9) and Tim10 (TbTim10) and a unique small Tim that shares homology with both Tim8 and Tim13 (TbTim8/13). Here, we found that these three small TbTims are expressed as soluble mitochondrial intermembrane space proteins. Coimmunoprecipitation and mass spectrometry analysis showed that the small TbTims stably associated with each other and with TbTim17, the major component of the mitochondrial inner membrane translocase in T. brucei. Yeast two-hybrid analysis indicated direct interactions among the small TbTims; however, their interaction patterns appeared to be different from those of their counterparts in yeast and humans. Knockdown of the small TbTims reduced cell growth and decreased the steady-state level of TbTim17 and T. brucei ADP/ATP carrier (TbAAC), two polytopic mitochondrial inner membrane proteins. Knockdown of small TbTims also reduced the matured complexes of TbTim17 in mitochondria. Depletion of any of the small TbTims reduced TbTim17 import moderately but greatly hampered the stability of the TbTim17 complexes in T. brucei. Altogether, our results revealed that TbTim9, TbTim10, and TbTim8/13 interact with each other, associate with TbTim17, and play a crucial role in the integrity and maintenance of the levels of TbTim17 complexes. IMPORTANCE Trypanosoma brucei is the causative agent of African sleeping sickness. The parasite’s mitochondrion represents a useful source for potential chemotherapeutic targets. Similarly to yeast and humans, mitochondrial functions depend on the import of proteins that are encoded in the nucleus and made in the cytosol. Even though the machinery involved in this

  17. Oxidative Stress Markers in Tuberculosis and HIV/TB Co-Infection.

    Science.gov (United States)

    Rajopadhye, Shreewardhan Haribhau; Mukherjee, Sandeepan R; Chowdhary, Abhay S; Dandekar, Sucheta P

    2017-08-01

    Dysfunction of redox homeostasis has been implicated in many pathological conditions. An imbalance of pro- and anti-oxidants have been observed in Tuberculosis (TB) and its co-morbidities especially HIV/AIDS. The pro inflammatory milieu in either condition aggravates the physiological balance of the redox mechanisms. The present study therefore focuses on assessing the redox status of patients suffering from TB and HIV-TB co-infection. To assess the oxidative stress markers in the HIV-TB and TB study cohort. The current prospective study was conducted in Haffkine Institute, Parel, Maharashtra, India, during January 2013 to December 2015. Blood samples from 50 patients each suffering from active TB and HIV-TB co-infection were collected from Seth G.S.Medical College and KEM Hospital Mumbai and Group of Tuberculosis Hospital, Sewree Mumbai. Samples were processed and the experiments were carried out at the Department of Biochemistry, Haffkine Institute. Samples from 50 healthy volunteers were used as controls. Serum was assessed for pro-oxidant markers such as Nitric Oxide (NO), Thiobarbituric Acid Reactive Species (TBARS), C-Reactive Protein (CRP), superoxide anion. Antioxidant markers such as catalase and Superoxide Dismutase (SOD) were assessed. Total serum protein, was also assessed. Among the pro-oxidants, serum NO levels were decreased in TB group while no change was seen in HIV-TB group. TBARS and CRP levels showed significant increase in both groups; superoxide anion increased significantly in HIV-TB group. Catalase levels showed decreased activities in TB group. SOD activity significantly increased in HIV-TB but not in TB group. The total serum proteins were significantly increased in HIV-TB and TB groups. The values of Control cohort were with the normal reference ranges. In the present study, we found the presence of oxidative stress to be profound in the TB and HIV-TB co-infection population.

  18. Usefulness of the mycobacterium tuberculosis direct assay in early diagnosis of extrapulmonary TB

    Directory of Open Access Journals (Sweden)

    Zhang Hui-Zhang

    2014-01-01

    Full Text Available The aim of this study was to evaluate the in situ detection of living mycobacterium TB rRNA by the mycobacterium TB direct assay (MTD and its clinical significance in the early diagnosis of extrapulmonary TB. Eighty-six patients were recruited from the Shanghai Public Health Clinical Center from June to November in 2010, having been diagnosed with extrapulmonary TB, including tuberculous peritonitis (n=22, lymphatic TB (n=21, tuberculous meningitis (n=15, HIV-associated TB (n=13, nephroTB (n=9, spinal TB (n=2, cutaneous TB (n=13, parotid TB (n=1, chest wall TB (n=1, intestinal TB (n=1. One hundred and five extrapulmonary specimens, including CSF, puncture fluid, drainage, pleural fluid, urine, secretion, ascites, lymphatic tissue and marrow were collected from the patients. The samples were examined using acid-fast stain, solid culture, liquid culture and MTD in parallel. In MTD, the target segments of MTB rRNA in either cultures or clinical specimens were amplified prior to being qualitatively detected with the hybridization protection assay (HPA. The sensitivities of MTD and acid-fast staining in liquid and solid cultures were 48.6%, 41.9%, 20.0% and 14.3%, respectively. MTD sensitivity was higher than that of the others and its specificity was 100%. We concluded that MTD rRNA detection is an effective, rapid, convenient, sensitive and reliable method for the early diagnosis of extrapulmonary TB.

  19. The isothermal section at 500 deg. C of the Gd-Tb-Ga ternary system

    International Nuclear Information System (INIS)

    Li, J.Q.; Jian, Y.X.; Ao, W.Q.; Zhuang, Y.H.; He, W.

    2006-01-01

    Phase equilibria in the Gd-Tb-Ga ternary system at 500 deg. C were investigated by X-ray powder diffraction and differential scanning calorimetry. The binary compounds, Gd 5 Ga 3 , Gd 3 Ga 2 , GdGa, GdGa 2 , Tb 5 Ga 3 , TbGa, TbGa 2 and TbGa 3 have been confirmed at 500 deg. C. No ternary compound was found in this system. The isothermal section of this system at 500 deg. C was constructed. It is composed of 7 single-phase regions, 8 two-phase regions and 2 three-phase regions. Four ternary continuous solid solutions (Gd, Tb), (Gd, Tb) 5 Ga 3 , (Gd, Tb)Ga, (Gd, Tb)Ga 2 were formed in this isothermal section. The maximum solid solubilities of Ga in (Gd, Tb) at 500 deg. C is 5.0 at.%. The homogeneity range of (Gd, Tb)Ga 2 is from 20 to 33.3 at.% Ga in Gd-Ga side but limited in Tb-Ga side. The solid solubilities of Ga in the other phases cannot be detected. The Curie temperatures of the Gd 0.6 Tb 0.4-x Ga x alloys increase from 270 to 298 K as x increases from 0 to 0.03

  20. Cholesterol-Containing Nuclease-Resistant siRNA Accumulates in Tumors in a Carrier-free Mode and Silences MDR1 Gene

    Directory of Open Access Journals (Sweden)

    Ivan V. Chernikov

    2017-03-01

    Full Text Available Chemical modifications are an effective way to improve the therapeutic properties of small interfering RNAs (siRNAs, making them more resistant to degradation in serum and ensuring their delivery to target cells and tissues. Here, we studied the carrier-free biodistribution and biological activity of a nuclease-resistant anti-MDR1 cholesterol-siRNA conjugate in healthy and tumor-bearing severe combined immune deficiency (SCID mice. The attachment of cholesterol to siRNA provided its efficient accumulation in the liver and in tumors, and reduced its retention in the kidneys after intravenous and intraperitoneal injection. The major part of cholesterol-siRNA after intramuscular and subcutaneous injections remained in the injection place. Confocal microscopy data demonstrated that cholesterol-siRNA spread deep in the tissue and was present in the cytoplasm of almost all the liver and tumor cells. The reduction of P-glycoprotein level in human KB-8-5 xenograft overexpressing the MDR1 gene by 60% was observed at days 5–6 after injection. Then, its initial level recovered by the eighth day. The data showed that, regardless of the mode of administration (intravenous, intraperitoneal, or peritumoral, cholesterol-siMDR efficiently reduced the P-glycoprotein level in tumors. The designed anti-MDR1 conjugate has potential as an adjuvant therapeutic for the reversal of multiple drug resistance of cancer cells.

  1. Substantial excretion of digoxin via the intestinal mucosa and prevention of long-term digoxin accumulation in the brain by the mdr1a P-glycoprotein

    NARCIS (Netherlands)

    Mayer, U; Wagenaar, E; Beijnen, J.H; Smit, J.W; Meijer, D.K F; van Asperen, J.; Borst, P; Schinkel, A.H

    1 We have used mice with a disrupted mdrla P-glycoprotein gene (mdrIa (-/-) mice) to study the role of P-glycoprotein in the pharmacokinetics of digoxin, a model P-glycoprotein substrate. 2 [K-3]-digoxin at a dose of 0.2 mg kg(-1) was administered as a single i.v. or oral bolus injection. We

  2. Changes of Tc-99m sestamibi uptake in P-glycoprotein expressing leukaemia cells treated in vivo with antisense oligodeoxynucleotide complementary to mdr1 mRNA

    International Nuclear Information System (INIS)

    Kinuya, S.; Yokoyama, K; Fukuoka, M.; Michigishi, T.; Tonami, N.; Shiba, K.; Mori, H.; Watanabe, N.; Shuke, N.

    2006-01-01

    We examined the feasibility of Tc-99m sestamibi to monitor changes of mRNA expression of MDRl/P-glycoprotein (Pgp) following antisense oligodeoxynucleotide (AS-ODN) treatment in vivo. Three days after the intraperitoneal inoculation of murine leukaemia P388/R cells expressing MDR1/P-gp in CDFI mice, 15-mer phosphorothioate ASODN to the initiation codon of mouse mdr1 mRNA was administered intraperitoneally at 10 mg/kg daily for 3 or 4 days. Cells collected from ascites were suspended in medium for Tc-99m sestamibi uptake studies. To know the duration of antisense effects, cells were harvested 2 days later after the 3-day treatment. AS-ODN treatment increased Tc-99m sestamibi uptake. Effects of 3-day treatment and 4-day treatment were the same. Treatment effects were not detected when uptake was observed 2 days after 3-day treatment. Based on the results it was concluded that in vivo treatment with AS-ODN specific to the coding portion of mdr1 mRNA increased Tc-99m sestamibi uptake in leukaemia cells possessing MDR function. (author)

  3. Effects of genetic polymorphisms of CYP2C19*2/*3 and MDR1 C3435T on the pharmacokinetics of lansoprazole in healthy Chinese subjects.

    Science.gov (United States)

    Zhang, Yu-Xin; Wei, Shi-Jie; Yang, Xiao-Ying; Zhang, Wen-Ping; Wang, Xin-Yu; Dang, Hong-Wan

    2014-10-01

    To evaluate the influence of CYP2C19*2/*3 and MDR1 C3435T polymorphisms on the pharmacokinetics of lansoprazole (LPZ) in healthy Chinese subjects. All 24 subjects were from a study of bioequivalence. Plasma concentrations of LPZ were determined by liquid chromatography/mass spectrometry. Cytochrome P450 (CYP) 2C19*2/*3 and multidrug resistance transporter gene 1 (MDR1) C3435T of the subjects were genotyped by polymerase chain reaction-restriction fragment length polymorphism. Significant differences were found in the area under the concentration-time curve from predose to T (AUC(0-T)), area under the concentration-time curve from predose to infinity (AUC(0-∞), t(1/2)), and apparent oral clearance (CL/F) of LPZ between CYP2C19 extensive metabolizers and intermediate metabolizers (p < 0.05). The AUC(0-T), AUC(0-∞), maximum plasma concentration, and CL/F of LPZ were significantly different between subjects with the MDR1 C3435T C/C, C/T, and T/T polymorphisms (p < 0.05). CYP2C19*2/*3 and MDR1 C3435T polymorphisms are important determinants of LPZ pharmacokinetics.

  4. Lack of biliary lipid excretion in the little skate, Raja erinacea, indicates the absence of functional Mdr2, Abcg5, and Abcg8 transporters

    NARCIS (Netherlands)

    Elferink, Ronald P. J. Oude; Ottenhoff, Roelof; Fricker, Gert; Seward, David J.; Ballatori, Nazzareno; Boyer, James

    2004-01-01

    The ABC transporters bile salt export pump ( BSEP; encoded by the ABCB11 gene), MDR3 P-glycoprotein (ABCB4), and sterolin 1 and 2 (ABCG5 and ABCG8) are crucial for the excretion of bile salt, phospholipid, and cholesterol, respectively, into the bile of mammals. The current paradigm is that

  5. Inhibitory effect of the reversal agents V-104, GF120918 and Pluronic L61 on MDR1 Pgp-, MRP1- and MRP2-mediated transport

    NARCIS (Netherlands)

    Evers, R.; Kool, M.; Smith, A. J.; van Deemter, L.; de Haas, M.; Borst, P.

    2000-01-01

    The human multidrug transporter MDR1 P-glycoprotein and the multidrug resistance proteins MRP1 and MRP2 transport a range of cytotoxic drugs, resulting in multidrug resistance in tumour cells. To overcome this form of drug resistance in patients, several inhibitors (reversal agents) of these

  6. Basis for selecting optimum antibiotic regimens for secondary peritonitis.

    Science.gov (United States)

    Maseda, Emilio; Gimenez, Maria-Jose; Gilsanz, Fernando; Aguilar, Lorenzo

    2016-01-01

    Adequate management of severely ill patients with secondary peritonitis requires supportive therapy of organ dysfunction, source control of infection and antimicrobial therapy. Since secondary peritonitis is polymicrobial, appropriate empiric therapy requires combination therapy in order to achieve the needed coverage for both common and more unusual organisms. This article reviews etiological agents, resistance mechanisms and their prevalence, how and when to cover them and guidelines for treatment in the literature. Local surveillances are the basis for the selection of compounds in antibiotic regimens, which should be further adapted to the increasing number of patients with risk factors for resistance (clinical setting, comorbidities, previous antibiotic treatments, previous colonization, severity…). Inadequate antimicrobial regimens are strongly associated with unfavorable outcomes. Awareness of resistance epidemiology and of clinical consequences of inadequate therapy against resistant bacteria is crucial for clinicians treating secondary peritonitis, with delicate balance between optimization of empirical therapy (improving outcomes) and antimicrobial overuse (increasing resistance emergence).

  7. Evaluating the Role of Multidrug Resistance Protein 3 (MDR3) Inhibition in Predicting Drug-Induced Liver Injury Using 125 Pharmaceuticals.

    Science.gov (United States)

    Aleo, Michael D; Shah, Falgun; He, Kan; Bonin, Paul D; Rodrigues, A David

    2017-05-15

    The role of bile salt export protein (BSEP) inhibition in drug-induced liver injury (DILI) has been investigated widely, while inhibition of the canalicular multidrug resistant protein 3 (MDR3) has received less attention. This transporter plays a pivotal role in secretion of phospholipids into bile and functions coordinately with BSEP to mediate the formation of bile acid-containing biliary micelles. Therefore, inhibition of MDR3 in human hepatocytes was examined across 125 drugs (70 of Most-DILI-concern and 55 of No-DILI-concern). Of these tested, 41% of Most-DILI-concern and 47% of No-DILI-concern drugs had MDR3 IC 50 values of <50 μM. A better distinction across DILI classifications occurred when systemic exposure was considered where safety margins of 50-fold had low sensitivity (0.29), but high specificity (0.96). Analysis of physical chemical property space showed that basic compounds were twice as likely to be MDR3 inhibitors as acids, neutrals, and zwitterions and that inhibitors were more likely to have polar surface area (PSA) values of <100 Å 2 and cPFLogD values between 1.5 and 5. These descriptors, with different cutoffs, also highlighted a group of compounds that shared dual potency as MDR3 and BSEP inhibitors. Nine drugs classified as Most-DILI-concern compounds (four withdrawn, four boxed warning, and one liver injury warning in their approved label) had intrinsic potency features of <20 μM in both assays, thereby reinforcing the notion that multiple inhibitory mechanisms governing bile formation (bile acid and phospholipid efflux) may confer additional risk factors that play into more severe forms of DILI as shown by others for BSEP inhibitors combined with multidrug resistance-associated protein (MRP2, MRP3, MRP4) inhibitory properties. Avoiding physical property descriptors that highlight dual BSEP and MDR3 inhibition or testing drug candidates for inhibition of multiple efflux transporters (e.g., BSEP, MDR3, and MRPs) may be an effective

  8. A comparative study of various therapeutic regimens in urticaria

    Directory of Open Access Journals (Sweden)

    Mukhopadhyay Amiyakumar

    1995-01-01

    Full Text Available 127 patients of urticaria were treated with chlorpheniramine maleate alone and in combination with cyproheptadine hydrochloride, ranitidine and doxepin and levamisole. Chlorpheniramine and doxepin combination showed a satisfactory result in 88.46% of patients. Overall study showed that a combination regimen is better than the antihistaminics alone. Drowsiness was the commonest side effect. Levamisole and chlorpheniramine maleate combination was found to be more effective than the antihimstamine alone.

  9. Comparison of Current Recommended Regimens of Atropinization in Organophosphate Poisoning

    OpenAIRE

    Connors, Nicholas J.; Harnett, Zachary H.; Hoffman, Robert S.

    2013-01-01

    Atropine is the mainstay of therapy in organophosphate (OP) toxicity, though research and consensus on dosing is lacking. In 2004, as reported by Eddleston et al. (J Toxicol Clin Toxicol 42(6):865-75, 2004), they noted variation in recommended regimens. We assessed revisions of original references, additional citations, and electronic sources to determine the current variability in atropine dosing recommendations. Updated editions of references from Eddleston et al.’s work, texts of Internal ...

  10. Direct two-photon excitation of Sm3+, Eu3+, Tb3+, Tb.DOTA-, and Tb.propargylDO3A in solution

    Science.gov (United States)

    Sørensen, Thomas Just; Blackburn, Octavia A.; Tropiano, Manuel; Faulkner, Stephen

    2012-07-01

    We have observed direct two-photon excitation of samarium, europium and terbium ions in solution upon near IR excitation using a tuneable pulsed light source, and have also studied two-photon processes in a pair of related terbium complexes, namely [Tb.DOTA]- and Tb.propargylDO3A. Direct two-photon excitation of lanthanides is observed in simple systems in the absence of sensitizing chromophores. Where even simple chromophores such as a triple bond are present in the complex, then single and two-photon excitation of chromophore excited states competes with direct two-photon excitation of the ions and is the dominant pathway for sensitizing formation of the lanthanide excited state.

  11. Preclinical Evaluations To Identify Optimal Linezolid Regimens for Tuberculosis Therapy

    Science.gov (United States)

    Drusano, George L.; Adams, Jonathan R.; Rodriquez, Jaime L.; Jambunathan, Kalyani; Baluya, Dodge L.; Brown, David L.; Kwara, Awewura; Mirsalis, Jon C.; Hafner, Richard; Louie, Arnold

    2015-01-01

    ABSTRACT Linezolid is an oxazolidinone with potent activity against Mycobacterium tuberculosis. Linezolid toxicity in patients correlates with the dose and duration of therapy. These toxicities are attributable to the inhibition of mitochondrial protein synthesis. Clinically relevant linezolid regimens were simulated in the in vitro hollow-fiber infection model (HFIM) system to identify the linezolid therapies that minimize toxicity, maximize antibacterial activity, and prevent drug resistance. Linezolid inhibited mitochondrial proteins in an exposure-dependent manner, with toxicity being driven by trough concentrations. Once-daily linezolid killed M. tuberculosis in an exposure-dependent manner. Further, 300 mg linezolid given every 12 hours generated more bacterial kill but more toxicity than 600 mg linezolid given once daily. None of the regimens prevented linezolid resistance. These findings show that with linezolid monotherapy, a clear tradeoff exists between antibacterial activity and toxicity. By identifying the pharmacokinetic parameters linked with toxicity and antibacterial activity, these data can provide guidance for clinical trials evaluating linezolid in multidrug antituberculosis regimens. PMID:26530386

  12. Investigation of luminescence properties in SiO2: Tb, Yb upconversion inverse opal

    International Nuclear Information System (INIS)

    Yang Zhengwen; Yan Dong; Song Zhiguo; Zhou Dacheng; Yu Xue; Yang Yong; Yin Zhaoyi; Yan Lei; Wang Rongfei; Wu Hangjun; Qiu Jianbei

    2012-01-01

    The SiO 2 : Tb, Yb inverse opals with photonic band gap at 465 or 543 nm were prepared, and an effect of photonic band gap on upconversion spontaneous emission from Tb 3+ was investigated. The results show that the photonic band gap has a significant influence on the upconversion emission of the SiO 2 : Tb, Yb inverse opals. The upconversion luminescence of the Tb 3+ ions is suppressed in the inverse opal compared with the luminescence of that of the reference sample. - Highlights: ► Upconversion emission from Tb 3+ was observed in the SiO 2 : Tb, Yb inverse opal. ► UC emission of Tb 3+ was modulated by controlling the structure of inverse opal. ► UC emission of Tb 3+ was depressed in the inverse opal.

  13. What are the reasons for patients not adhering to their anti-TB ...

    African Journals Online (AJOL)

    2008-11-13

    Nov 13, 2008 ... patients started their anti-TB treatment, according to the known factors that influence TB adherence. The patients .... Inadequate relationship between health care provider and patient ..... on the Internet] [cited 2009 Jan. 12].

  14. Molecular identification of marine symbiont bacteria of gastropods from the waters of the Krakal coast Yogyakarta and its potential as a Multi-Drug Resistant (MDR) antibacterial agent

    Science.gov (United States)

    Bahry, Muhammad Syaifudien; Pringgenies, Delianis; Trianto, Agus

    2017-01-01

    The resistance of pathogenic bacteria may occur to many types of antibiotics, especially in cases of non-compliance use of antibiotics, which likely to allow the evolution of Multi-Drug Resistant (MDR) bacteria. Gastropods seas are marine invertebrates informed capable of production of secondary metabolites as antibacterial MDR. The purpose of the study was the isolation and identification of gastropod symbiont bacteria found in the waters of Krakal, Gunung Kidul, Yogyakarta, which has the ability to produce antibacterial compounds against MDR(Escherichia coli, Enterobacter cloacae, Klebsiella pneumoniae, MRSA (methicillin-Resistant Staphylococcus aureus), Staphylococcus aureus, and Staphylococcus homunis) molecular. Stages of this research began with the isolation of bacteria, bacteria screening for anti-MDR compound, mass culture, and extraction, antibacterial activity test, DNA extraction, amplification by PCR 16S rDNA and sequencing. The results of the study showed that 19 isolates of bacteria were isolated from three species of gastropods namely Littorina scabra, Cypraea moneta and Conus ebraeus. Among them, 4 isolates showed activity against MDR test bacteria (E. coli, E. cloacae, K. pneumoniae, S. aureus and S. homunis). The highest activity was displayed by code LS.G1.8 isolate with the largest inhibition zone 15.47±0.45mm on S. humonis at 250 µg/disk concentration. Isolate CM.G2.1 showed largest inhibition zone, with 21.5±0.07mm on MRSA at 1000 µg/disk concentration and isolate the largest inhibition zone CM.G2.5 14.37±0.81mm on MRSA 14.37±0.81mm at concentrations 1000 µg/disk. The molecular identification of isolates LS.G1.8 has 99% homology with Bacillus subtilis and isolates CM.G2.1 has 99% homology with Bacillus pumillus.

  15. Frequency of canine nt230(del4) MDR1 mutation in prone pure breeds, their crosses and mongrels in Israel - insights from a worldwide comparative perspective.

    Science.gov (United States)

    Dekel, Yaron; Machluf, Yossy; Stoler, Aviad; Aderet, Arava; Baumel, Daniel; Kellerman, Efrat; Plotsky, Yoram; Noked Partouche, Oshrat; Elhalal, Gal; Ben-Shlomo, Izhar; Bercovich, Dani

    2017-11-13

    Sensitivity to macrocyclic lactones, which are commonly used in veterinary clinics, was first found in Rough Collies, and was attributed in 2001 to a 4 bp deletion in the MDR1 gene. The list of affected breeds currently includes 13 breeds. Researchers from different countries and continents examined the allelic frequencies of the nt230(del4) MDR1 mutation, emphasizing the clinical importance of this test not only to mutation-prone dogs, but also to their crosses and mongrels, since treatment of a deletion carrier with these compounds may lead to its death. In this study, the allelic frequencies of nt230(del4) MDR1 mutation in affected breeds, their crosses, unrelated pure breeds and mongrels are reported for the state of Israel (n = 1416 dogs). The Israeli data were compared with reports from the US, Europe, UK, Australia and Japan. The allelic frequencies of nt230(del4) MDR1 mutation in Israel for Australian, Swiss and German Shepherds (31%, 17% and 2.4%, respectively) are similar to the corresponding frequencies worldwide, much higher for Border Collies (4.8%), twice lower for Rough Collies (28%, compared to 55% or more elsewhere), and ~1% for mongrels. The frequencies for crosses of Australian Shepherd and Border Collies in Israel are 4 and 1.6 times lower, respectively, compared to the frequencies for the respective pure breeds. This work, that for the first time presents the frequency of nt230(del4) MDR1 mutation in Israel, along with a worldwide survey, has implications for clinicians, owners and breeders of sheepdogs and their crosses and supports the need for extra care in treatment and in future breeding. Of note, the relative proportion of affected breeds, in the overall tested dogs, might be higher than their actual proportion in Israel due to directed samples collection by veterinarians for clinical purposes, as these are mainly limited to certain affected breeds or dogs that resemble them.

  16. Utility of urine lipoarabinomannan (LAM) in diagnosing tuberculosis and predicting mortality with and without HIV: prospective TB cohort from the Thailand Big City TB Research Network.

    Science.gov (United States)

    Suwanpimolkul, Gompol; Kawkitinarong, Kamon; Manosuthi, Weerawat; Sophonphan, Jiratchaya; Gatechompol, Sivaporn; Ohata, Pirapon June; Ubolyam, Sasiwimol; Iampornsin, Thatri; Katerattanakul, Pairaj; Avihingsanon, Anchalee; Ruxrungtham, Kiat

    2017-06-01

    To evaluate the applicability and accuracy of the urine lipoarabinomannan (LAM) test in tuberculosis (TB)/HIV co-infected patients and HIV-negative patients with disseminated TB. Frozen urine samples obtained at baseline from patients in the TB research cohort with proven culture-positive TB were selected for blinded urine LAM testing. One hundred and nine patients were categorized into four groups: (1) HIV-positive patients with TB; (2) HIV-negative patients with disseminated TB; (3) HIV-negative immunocompromised patients with TB; and (4) patients with diseases other than TB. The sensitivity of urine LAM testing for culture-positive TB, specificity of urine LAM testing for patients without TB, positive predictive value (PPV), and negative predictive value (NPV) were assessed. The sensitivity of the urine LAM test in group 1 patients with a CD4 T-cell count of >100, ≤100, and ≤50 cells/mm 3 was 38.5%, 40.6%, and 45%, respectively. The specificity and PPV of the urine LAM test were >80%. The sensitivity of the test was 20% in group 2 and 12.5% in group 3, and the specificity and PPV were 100% for both groups. A positive urine LAM test result was significantly associated with death. This promising diagnostic tool could increase the yield of TB diagnosis and may predict the mortality rate of TB infection, particularly in TB/HIV co-infected patients. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  17. A model of population dynamics of TB in a prison system and application to South Africa

    OpenAIRE

    Witbooi, Peter; Vyambwera, Sibaliwe Maku

    2017-01-01

    Background Tuberculosis (TB) continues to spread in South African prisons in particular, as prisons are over-capacitated and have poor ventilation. The awaiting trial detainees are not screened on admission and are at high risk of getting infected with TB. Results We propose a compartmental model to describe the population dynamics of TB disease in prisons. Our model considers the inflow of susceptible, exposed and TB infectives into the prison population. Removal of individuals out of the pr...

  18. Tb3+ and Eu3+ luminescence in imidazolium ionic liquids

    International Nuclear Information System (INIS)

    Hopkins, Todd; Goldey, Matt

    2009-01-01

    The luminescence properties of Tb 3+ and Eu 3+ dissolved in ionic liquids are studied. Solutes in this study include simple lanthanide compounds (e.g., EuBr 3 , TbCl 3 ) and lanthanide complexes (e.g., Eu(dpa) 3 3- where dpa = 2,6 pyridine dicarboxylate dianion) dissolved in a 1-butyl-3-methylimidazolium bromide(BMIBr)/water mixture. Emission, excitation, and time-resolved emission measurements are utilized to characterize the spectroscopic properties. It is well established in the literature that the solubility and spectroscopic properties of lanthanides in ionic liquids are highly dependent upon environmental factors including purity, and water content [K. Binnemans, Chemical Reviews (2007); I. Billard, S. Mekki, C. Gaillard, P. Hesemann, C. Mariet, G. Moutiers, A. Labet, J.-C.G. Buenzli, European Journal of Inorganic Chemistry 6 (2004) 1190-1197; S. Samikkanu, K. Mellem, M. Berry, P.S. May, Inorganic Chemistry 46 (2007) 7121-7128]. The water in this ionic liquid system acts as a co-solvent to facilitate solubility of Tb 3+ and Eu 3+ compounds. The observed spectroscopic properties of Eu 3+ and Tb 3+ salts are expectedly impacted by the high water content, but unexpectedly impacted by the BMIBr ionic liquid. However, the spectroscopy of Eu(dpa) 3 3- is unaffected by the presence of BMIBr.

  19. When students become patients: TB disease among medical ...

    African Journals Online (AJOL)

    A self-administered questionnaire was distributed via email and social media to current medical students and recently graduated ... of stigma will be reported in a separate article. ... help was 3.2 weeks (range 0 - 16 weeks, SD 4.6); the mean diagnostic ... students' health-seeking behaviour and delayed TB diagnosis:.

  20. The effects of Tb 3+ doping concentration on luminescence ...

    Indian Academy of Sciences (India)

    BaF2 phosphor; crystal structure; luminescence properties; X-ray diffraction; concentration quenching. 1. Introduction ... reported that the particle size, shape, crystallinity, etc., sig- nificantly ... Figure 3 shows the excitation and emission spectra of sam- ple with 4 ... gies obtained earlier.9,10 The ground term of the Tb3+ ion is.

  1. EDITORIAL South Africa and national TB control: Are we making ...

    African Journals Online (AJOL)

    accounting for 7.2% of deaths, followed by diabetes mellitus with 5.4% of deaths. Although tuberculosis has maintained its position ... and indirect costs before, during, and after a TB diagnosis. The largest costs these patients incur are for hospitalization, medication, transportation, and treatment or care in the private sector.

  2. Design of a 1 Tb/s superchannel coherent receiver

    NARCIS (Netherlands)

    Millar, D.S.; Maher, R.; Lavery, D.; Koike-Akino, T.; Pajovic, M.; Alvarado, A.; Paskov, M.; Kojima, K.; Parsons, K.; Thomsen, B.C.; Savory, S.J.; Bayvel, P.

    2016-01-01

    We describe the design of a trained and pilot-aided digital coherent receiver, capable of detecting a 1 Tb/s superchannel with a single optical front-end. Algorithms for receiver training are described, which calculate the equalizer coefficients, subchannel SNRs, and centroids of the transmitted

  3. Deexcitation of superdeformed bands in the nucleus Tb-151

    NARCIS (Netherlands)

    Finck, C; Appelbe, D; Beck, FA; Byrski, T; Cullen, D; Curien, D; deFrance, G; Duchene, G; Erturk, S; Haas, B; Khadiri, N; Kharraja, B; Prevost, D; Rigollet, C; Stezowski, O; Twin, P; Vivien, JP; Zuber, K

    1997-01-01

    The aim of this work is to get more informations about the decay-out of superdeformed bands. One of the best candidates in the mass A similar or equal to 150 region for that kind of research is the nucleus Tb-151. From previous works, it has been established that the first excited band goes lower in

  4. RESEARCH Diagnosing Xpert MTB/RIF-negative TB: Impact and ...

    African Journals Online (AJOL)

    Health Economics and Epidemiology Research O ce, Department of Internal ... have a positive culture result, accounting for only 10% of all TB ... information and patient follow-up systems, results may only reach ..... Raviglione M, Zumla A, Marais B, Horton R, Motsoaledi A. A sustainable agenda for tuberculosis control.

  5. Spin dynamics in Tb studied by critical neutron scattering

    DEFF Research Database (Denmark)

    Dietrich, O. W.; Als-Nielsen, Jens Aage

    1971-01-01

    The inelasticity of the critical neutron scattering in Tb was measured at and above the Neel temperature. In the hydrodynamic region the line width Gamma (q=0, kappa 1)=C kappa z1, with z=1.4+or-0.1 and c=4.3+or-0.3 meVAAz. This result deviates from the conventional theory, which predicts...

  6. Predicting Efficient Antenna Ligands for Tb(III) Emission

    Energy Technology Data Exchange (ETDEWEB)

    Samuel, Amanda P.S.; Xu, Jide; Raymond, Kenneth

    2008-10-06

    A series of highly luminescent Tb(III) complexes of para-substituted 2-hydroxyisophthalamide ligands (5LI-IAM-X) has been prepared (X = H, CH{sub 3}, (C=O)NHCH{sub 3}, SO{sub 3}{sup -}, NO{sub 2}, OCH{sub 3}, F, Cl, Br) to probe the effect of substituting the isophthalamide ring on ligand and Tb(III) emission in order to establish a method for predicting the effects of chromophore modification on Tb(III) luminescence. The energies of the ligand singlet and triplet excited states are found to increase linearly with the {pi}-withdrawing ability of the substituent. The experimental results are supported by time-dependent density functional theory (TD-DFT) calculations performed on model systems, which predict ligand singlet and triplet energies within {approx}5% of the experimental values. The quantum yield ({Phi}) values of the Tb(III) complex increases with the triplet energy of the ligand, which is in part due to the decreased non-radiative deactivation caused by thermal repopulation of the triplet. Together, the experimental and theoretical results serve as a predictive tool that can be used to guide the synthesis of ligands used to sensitize lanthanide luminescence.

  7. H+ searches in ATLAS (II): H+ to tb

    CERN Document Server

    Mir, Lluisa-Maria; The ATLAS collaboration

    2016-01-01

    A search for charged Higgs bosons heavier than the top quark and decaying via to tb is presented. The analysis uses 13.2 ifb of pp collision data at a centre-of-mass energy of sqrt(s) = 13 TeV collected with the ATLAS detector at the Large Hadron Collider. The production of a charged Higgs boson in association with a top quark and a bottom quark, pp to tbH+-, is explored in the mass range 300 to 1000 GeV using multi-jet final states with one electron or muon from the top-quark decay. Events are categorised according to the multiplicity of jets and b-tagged jets. Multivariate techniques are used to discriminate between signal and background events. No significant excess above the background-only hypothesis is observed and upper limits are set on the tbH+- production cross section times the branching fraction BR(H+- to tb), together with their interpretation in benchmark scenarios of the Minimal Supersymmetric Standard Model.

  8. Autopsy case of pulmonary aspergilloma. [After long chemotherapy for TB

    Energy Technology Data Exchange (ETDEWEB)

    II, Yohei; Akizuki, S

    1973-01-01

    A 73-year-old female received anti-TB chemotherapy for pulmonary tuberculosis for a long period and died from severe hemoptysis which suddenly developed after recovery from the disease. Autopsy showed a large aspergilloma in the upper lobe of the right lung. This case is reported along with a review of the literature on aspergillosis. (30 refs) (DLC)

  9. Five years retrospective cohort analysis of treatment outcomes of TB ...

    African Journals Online (AJOL)

    Background: Human immunodeficiency virus (HIV) associated tuberculosis (TB) remains a major global public health chal- lenge, with an estimated 1.4 .... completed treatment and who is smear negative at the end of 6th or 7th month of treat- ..... the course of management of the dual disease entity. Conclusion. This study ...

  10. Five years retrospective cohort analysis of treatment outcomes of TB ...

    African Journals Online (AJOL)

    Background: Human immunodeficiency virus (HIV) associated tuberculosis (TB) remains a major global public health challenge, with an estimated 1.4 million patients worldwide. Co-infection with HIV leads to challenges in the diagnosis and treatment of patients. Objectives: The aim of this study was to assess treatment ...

  11. Applicability of the shorter ‘Bangladesh regimen’ in high multidrug-resistant tuberculosis settings

    Directory of Open Access Journals (Sweden)

    Giovanni Sotgiu

    2017-03-01

    Full Text Available In spite of the recent introduction of two new drugs (delamanid and bedaquiline and a few repurposed compounds to treat multidrug-resistant and extensively drug-resistant tuberculosis (MDR- and XDR-TB, clinicians are facing increasing problems in designing effective regimens in severe cases. Recently a 9 to 12-month regimen (known as the ‘Bangladesh regimen’ proved to be effective in treating MDR-TB cases. It included an initial phase of 4 to 6 months of kanamycin, moxifloxacin, prothionamide, clofazimine, pyrazinamide, high-dose isoniazid, and ethambutol, followed by 5 months of moxifloxacin, clofazimine, pyrazinamide, and ethambutol. However, recent evidence from Europe and Latin America identified prevalences of resistance to the first-line drugs in this regimen (ethambutol and pyrazinamide exceeding 60%, and of prothionamide exceeding 50%. Furthermore, the proportions of resistance to the two most important pillars of the regimen – quinolones and kanamycin – were higher than 40%. Overall, only 14 out of 348 adult patients (4.0% were susceptible to all of the drugs composing the regimen, and were therefore potentially suitable for the ‘shorter regimen’. A shorter, cheaper, and well-tolerated MDR-TB regimen is likely to impact the number of patients treated and improve adherence if prescribed to the right patients through the systematic use of rapid MTBDRsl testing.

  12. Enhancing TB case detection: experience in offering upfront Xpert MTB/RIF testing to pediatric presumptive TB and DR TB cases for early rapid diagnosis of drug sensitive and drug resistant TB.

    Directory of Open Access Journals (Sweden)

    Neeraj Raizada

    Full Text Available Diagnosis of pulmonary tuberculosis (PTB in children is challenging due to difficulties in obtaining good quality sputum specimens as well as the paucibacillary nature of disease. Globally a large proportion of pediatric tuberculosis (TB cases are diagnosed based only on clinical findings. Xpert MTB/RIF, a highly sensitive and specific rapid tool, offers a promising solution in addressing these challenges. This study presents the results from pediatric groups taking part in a large demonstration study wherein Xpert MTB/RIF testing replaced smear microscopy for all presumptive PTB cases in public health facilities across India.The study covered a population of 8.8 million across 18 programmatic sub-district level tuberculosis units (TU, with one Xpert MTB/RIF platform established at each study TU. Pediatric presumptive PTB cases (both TB and Drug Resistant TB (DR-TB accessing any public health facilities in study area were prospectively enrolled and tested on Xpert MTB/RIF following a standardized diagnostic algorithm.4,600 pediatric presumptive pulmonary TB cases were enrolled. 590 (12.8%, CI 11.8-13.8 pediatric PTB were diagnosed. Overall 10.4% (CI 9.5-11.2 of presumptive PTB cases had positive results by Xpert MTB/RIF, compared with 4.8% (CI 4.2-5.4 who had smear-positive results. Upfront Xpert MTB/RIF testing of presumptive PTB and presumptive DR-TB cases resulted in diagnosis of 79 and 12 rifampicin resistance cases, respectively. Positive predictive value (PPV for rifampicin resistance detection was high (98%, CI 90.1-99.9, with no statistically significant variation with respect to past history of treatment.Upfront access to Xpert MTB/RIF testing in pediatric presumptive PTB cases was associated with a two-fold increase in bacteriologically-confirmed PTB, and increased detection of rifampicin-resistant TB cases under routine operational conditions across India. These results suggest that routine Xpert MTB/RIF testing is a promising

  13. Multidrug-resistant tuberculosis in Europe, 2010-2011

    DEFF Research Database (Denmark)

    Günther, Gunar; van Leth, Frank; Alexandru, Sofia

    2015-01-01

    Drug-resistant Mycobacterium tuberculosis is challenging elimination of tuberculosis (TB). We evaluated risk factors for TB and levels of second-line drug resistance in M. tuberculosis in patients in Europe with multidrug-resistant (MDR) TB. A total of 380 patients with MDR TB and 376 patients...... with non-MDR TB were enrolled at 23 centers in 16 countries in Europe during 2010-2011. A total of 52.4% of MDR TB patients had never been treated for TB, which suggests primary transmission of MDR M. tuberculosis. At initiation of treatment for MDR TB, 59.7% of M. tuberculosis strains tested were...

  14. Microstructural and photoluminescence properties of sol–gel derived Tb3+ doped ZnO nanocrystals

    CSIR Research Space (South Africa)

    Kabongo, GL

    2014-04-01

    Full Text Available Un-doped and Tb(Sup3+) doped ZnO nanocrystals with different concentrations of Tb(Sup3+) were synthesized by a sol–gel method and their photoluminescence (PL) properties were investigated. The successful incorporation of Tb(sup3+) ions...

  15. RESEARCH Improving access and quality of care in a TB control ...

    African Journals Online (AJOL)

    or treatment. Improving access and quality of care in a. TB control programme. Vera Scott, Virginia Azevedo, Judy Caldwell. Objectives. To use a quality improvement approach to improve access to and quality of tuberculosis (TB) diagnosis and care in. Cape Town. Methods. Five HIV/AIDS/sexually transmitted infections/TB.

  16. A review of the literature on the economics of vaccination against TB

    NARCIS (Netherlands)

    Tu, H.A.; Vu, H.D.; Rozenbaum, M.H.; Woerdenbag, H.J.; Postma, M.J.

    The BCG vaccine was introduced in 1921 and remains the only licensed vaccine for the prevention of TB worldwide. Despite its extensive use, the BCG vaccine lacks the ability to fully control the TB-endemic and -pandemic situations. The BCG vaccine is most effective in preventing pediatric TB, in

  17. The progression of tb diagnosis in the hiv era: from microscopes to ...

    African Journals Online (AJOL)

    smear-negative pulmonary TB, hospitalised. HIV-infected patients with advanced and disseminated disease, young children and patients with extrapulmonary forms of TB, clinical case definitions and algorithms can be beneficial for guiding the empiric use of anti-TB treatment. Multiple clinical case definitions and algorithms ...

  18. Provider-initiated HIV testing and counselling for TB patients and suspects in Nairobi, Kenya.

    Science.gov (United States)

    Odhiambo, J; Kizito, W; Njoroge, A; Wambua, N; Nganga, L; Mburu, M; Mansoer, J; Marum, L; Phillips, E; Chakaya, J; De Cock, K M

    2008-03-01

    Integrated tuberculosis (TB) and human immunodeficiency virus (HIV) services in a resource-constrained setting. Pilot provider-initiated HIV testing and counselling (PITC) for TB patients and suspects. Through partnerships, resources were mobilised to establish and support services. After community sensitisation and staff training, PITC was introduced to TB patients and then to TB suspects from December 2003 to December 2005. Of 5457 TB suspects who received PITC, 89% underwent HIV testing. Although not statistically significant, TB suspects with TB disease had an HIV prevalence of 61% compared to 63% for those without. Of the 614 suspects who declined HIV testing, 402 (65%) had TB disease. Of 2283 patients referred for cotrimoxazole prophylaxis, 1951 (86%) were enrolled, and of 1727 patients assessed for antiretroviral treatment (ART), 1618 (94%) were eligible and 1441 (83%) started treatment. PITC represents a paradigm shift and is feasible and acceptable to TB patients and TB suspects. Clear directives are nevertheless required to change practice. When offered to TB suspects, PITC identifies large numbers of persons requiring HIV care. Community sensitisation, staff training, multitasking and access to HIV care contributed to a high acceptance of HIV testing. Kenya is using this experience to inform national response and advocate wide PITC implementation in settings faced with the TB-HIV epidemic.

  19. TB truths : Patients’ experience with tuberculosis and healthcare in sub-Saharan Africa

    NARCIS (Netherlands)

    Cremers, A.L.

    2018-01-01

    TB remains one of the most alarming global health threats of this age. Despite the often available TB medication for free, rates are not being significantly reduced or in some areas even going up. TB epidemiology have become more complex, due to the HIV epidemic and development of drug-resistance.

  20. The time delay of patients presenting with symptoms of TB at TC ...

    African Journals Online (AJOL)

    Tuberculosis (TB) is a major health problem in South Africa. The early detection and treatment of TB cases are essential. The impression of senior staff working at the TC Newman Community Health Centre (TCN), Paarl was that there often is an unnecessary time delay between the presentation of TB symptoms and the ...

  1. Medicinal plants used to treat TB in Ghana.

    Science.gov (United States)

    Nguta, Joseph Mwanzia; Appiah-Opong, Regina; Nyarko, Alexander K; Yeboah-Manu, Dorothy; Addo, Phyllis G A

    2015-06-01

    The current study was designed to document medicinal plant species that are traditionally used to treat tuberculosis (TB) by Ghanaian communities. The medicinal plants used against TB or its signs and symptoms were selected using library and online published data searches. A guided questionnaire interview was also conducted with a botanist involved in plant collection at the Centre for Scientific Research into Plant Medicine (CSRPM) at Mampong. Data obtained were entered in Excel and summarized into means and frequencies using SPSS 12.0.1 for windows, and expressed as tables and bar graphs. A total of 15 medicinal plant species distributed between 13 genera and 13 families were documented. The following medicinal plant species were found to be used against TB in Greater Accra and Eastern parts of Ghana: Azadirachta indica A. Juss. Stem bark (Meliaceae), Hygrophila auriculata Heine, whole plant (Acanthaceae), Chenopodium ambrosioides L. leaves (Amaranthaceae), Coix lacryma-jobi L. glumes (Poaceae), Solanum torvum Sw. unripe fruits (Solanaceae), Solanum torvum Sw. leaves (Solanaceae), Bidens pilosa L. whole plant (Asteraceae), Phyllanthus fraternus G.L. Webster leaves (Phyllanthaceae), Dissotis rotundifolia (Sm.) Triana, leaves (Melastomataceae), Cymbopogon giganteus Chiov. Leaves (Poaceae), Cyperus articulatus L. roots (Cyperaceae), Allium sativum L. bulb (Amaryllidaceae), Zingiber officinale Roscoe, rhizomes (Zingiberaceae), Allium cepa L. bulbs (Amaryllidaceae), Allium cepa L. leaves (Amaryllidaceae), Aloe vera var. barbadensis aqueous extract from leaves (Xanthorrhoeaceae), Aloe vera var. barbadensis organic extract from leaves (Xanthorrhoeaceae), Cocos nucifera Linn, water (Arecaceae) and Cocos nucifera Linn. Husk (Arecaceae). The collected plant species could be a source of a new class of drugs against TB. Bioactivity guided fractionation is recommended to identify lead compounds for antimycobacterial activity. The current paper documents for the first time

  2. Extended regimen combined oral contraception: A review of evolving concepts and acceptance by women and clinicians.

    Science.gov (United States)

    Nappi, Rossella E; Kaunitz, Andrew M; Bitzer, Johannes

    2016-01-01

    The clinical utility of extended regimen combined oral contraceptives (COCs) is increasingly being recognised. Our objective was to understand the attitudes of women and clinicians about the use of these regimens. We present the rationale for extended regimen COCs from a historical perspective, and trace their evolution and growing popularity in light of their clinical benefits. We conclude by offering potential strategies for counselling women about extended regimen COC options. We conducted a MEDLINE search to identify and summarise studies of extended regimen COCs, focusing on attitudes of women and clinicians regarding efficacy, safety/tolerability and fewer scheduled bleeding episodes and other potential benefits. The body of contemporary literature on extended regimen COCs suggests that their contraceptive efficacy is comparable to that of conventional 28-day (i.e., 21/7) regimens. For women seeking contraception that allows infrequent scheduled bleeding episodes, particularly those who suffer from hormone withdrawal symptoms and cyclical symptoms (e.g., headache, mood changes, dysmenorrhoea, heavy menstrual bleeding), extended regimen COCs are an effective and safe option. Although satisfaction with extended regimen COCs in clinical trials is high, misperceptions about continuous hormone use may still limit the widespread acceptance of this approach. Despite the widespread acceptance among clinicians of extended regimen COCs as an effective and safe contraceptive option, these regimens are underused, likely due to a lack of awareness about their availability and utility among women. Improved patient education and counselling regarding the safety and benefits of extended regimen COCs may help women make more informed contraceptive choices.

  3. Challenges of using new and repurposed drugs for the treatment of multidrug-resistant tuberculosis in children.

    Science.gov (United States)

    Schaaf, H Simon; Garcia-Prats, Anthony J; McKenna, Lindsay; Seddon, James A

    2018-03-01

    New and repurposed antituberculosis drugs are urgently needed to more safely and effectively treat multidrug-resistant (MDR) tuberculosis (TB) in children. Multiple challenges limit timely access to new MDR-TB treatments in children. Areas covered: Diagnosis of MDR-TB in children remains a barrier, with few children with MDR-TB diagnosed and treated. Other barriers to timely access to new and repurposed drugs are discussed, and include delayed initiation of paediatric trials, limited funding for paediatric drug development, fragmented regulatory systems and operational challenges. The status of access to current repurposed and novel drugs is presented. Expert commentary: More timely initiation of paediatric trials is needed and paediatric work should happen and be funded in parallel with each phase of adult trials. Better quality data, increased regulator resources and expertise, harmonization of regulatory requirements across borders/organisations and registration fee waivers would improve registration timelines. Improved diagnosis, recording and reporting will establish better demand. Improved systems for procurement and supply chain management would reduce in-country operational barriers to getting medications to children. The challenges must be addressed to ensure timely and equitable access to new drugs and regimens that are urgently needed for effective, safe and shorter treatment of children with MDR-TB.

  4. Diagnosis and interim treatment outcomes from the first cohort of multidrug-resistant tuberculosis patients in Tanzania.

    Directory of Open Access Journals (Sweden)

    Stellah G Mpagama

    Full Text Available Kibong'oto National Tuberculosis Hospital (KNTH, Kilimanjaro, Tanzania.Characterize the diagnostic process and interim treatment outcomes from patients treated for multidrug-resistant tuberculosis (MDR-TB in Tanzania.A retrospective cohort study was performed among all patients treated at KNTH for pulmonary MDR-TB between November 2009 and September 2011.Sixty-one culture-positive MDR-TB patients initiated therapy, 60 (98% with a prior history of TB treatment. Forty-one (67% were male and 9 (14% were HIV infected with a mean CD4 count of 424 (±106 cells/µl. The median time from specimen collection to MDR-TB diagnosis and from diagnosis to initiation of MDR-TB treatment was 138 days (IQR 101-159 and 131 days (IQR 32-233, respectively. Following treatment initiation four (7% patients died (all HIV negative, 3 (5% defaulted, and the remaining 54 (89% completed the intensive phase. Most adverse drug reactions were mild to moderate and did not require discontinuation of treatment. Median time to culture conversion was 2 months (IQR 1-3 and did not vary by HIV status. In 28 isolates available for additional second-line drug susceptibility testing, fluoroquinolone, aminoglycoside and para-aminosalicylic acid resistance was rare yet ethionamide resistance was present in 9 (32%.The majority of MDR-TB patients from this cohort had survived a prolonged referral process, had multiple episodes of prior TB treatment, but did not have advanced AIDS and converted to culture negative early while completing an intensive inpatient regimen without serious adverse event. Further study is required to determine the clinical impact of second-line drug susceptibility testing and the feasibility of alternatives to prolonged hospitalization.

  5. World Health Organization treatment guidelines for drug-resistant tuberculosis, 2016 update.

    Science.gov (United States)

    Falzon, Dennis; Schünemann, Holger J; Harausz, Elizabeth; González-Angulo, Licé; Lienhardt, Christian; Jaramillo, Ernesto; Weyer, Karin

    2017-03-01

    Antimicrobial resistance is a major global concern. Tuberculosis (TB) strains resistant to rifampicin and other TB medicines challenge patient survival and public health. The World Health Organization (WHO) has published treatment guidelines for drug-resistant TB since 1997 and last updated them in 2016 based on reviews of aggregated and individual patient data from published and unpublished studies. An international expert panel formulated recommendations following the GRADE approach. The new WHO guidelines recommend a standardised 9-12 months shorter treatment regimen as first choice in patients with multidrug- or rifampicin-resistant TB (MDR/RR-TB) strains not resistant to fluoroquinolones or second-line injectable agents; resistance to these two classes of core second-line medicines is rapidly detectable with molecular diagnostics also approved by WHO in 2016. The composition of longer regimens for patients ineligible for the shorter regimen was modified. A first-ever meta-analysis of individual paediatric patient data allowed treatment recommendations for childhood MDR/RR-TB to be made. Delamanid is now also recommended in patients aged 6-17 years. Partial lung resection is a recommended option in MDR/RR-TB care. The 2016 revision highlighted the continued shortage of high-quality evidence and implementation research, and reiterated the need for clinical trials and best-practice studies to improve MDR/RR-TB patient treatment outcomes and strengthen policy. The content of this work is copyright of the authors or their employers. Design and branding are copyright ©ERS 2017.

  6. Luminescence and Tb3+-Ce3+-Eu3+ ion energy transfer in single-crystalline films of Tb3Al5O12:Ce,Eu garnet

    International Nuclear Information System (INIS)

    Zorenko, Y.; Gorbenko, V.; Voznyak, T.; Batentschuk, M.; Osvet, A.; Winnacker, A.

    2008-01-01

    The paper is devoted to investigation of the processes of excitation energy transfer between the host cations (Tb 3+ ions) and the activators (Ce 3+ and Eu 3+ ions) in single-crystalline films of Tb 3 Al 5 O 12 :Ce,Eu (TbAG:Ce,Eu) garnet which is considered as a promising luminescent material for the conversion of LED's radiation. The cascade process of excitation energy transfer is shown to be realized in TbAG:Ce,Eu: (i) from Tb 3+ ions to Ce 3+ and Eu 3+ ions; (ii) from Ce 3+ ions to Eu 3+ ions by means of dipole-dipole interaction and through Tb 3+ ion sublattice

  7. Thermoelectric properties of TbFe{sub 2} and TbCo{sub 2} in C15- laves phase: Spin-polarized DFT+U approach

    Energy Technology Data Exchange (ETDEWEB)

    Reshak, A.H., E-mail: maalidph@yahoo.co.uk [New Technologies - Research Centre, University of West Bohemia, Univerzitni 8, Pilsen 306 14 (Czech Republic); School of Material Engineering, University Malaysia Perlis, Kangar, Perlis 01007 (Malaysia)

    2017-01-15

    Thermoelectric properties of materials are intimately related to their electronic band structure. Combining first- and second-principles calculations, we have obtained the transport properties for the spin-up and spin-down electrons of the laves phase TbFe{sub 2} and TbCo{sub 2} compounds. The unique band structure feature and the density of states at Fermi level (E{sub F}) promote the E{sub F} to a point where carriers are in energetic proximity to these features. The non-zero density of states at E{sub F} for the spin-up (↑) and spin-down (↓) electrons leads to unusual transport properties because both the (↑) and (↓) densities contributes to the states at E{sub F}. The parabolic bands in the vicinity of E{sub F} enhance the carriers mobility and hence the transport properties of TbFe{sub 2} and TbCo{sub 2}. Calculations show that the spin-up/down transport coefficients are temperature-dependent. It has been found that TbCo{sub 2} possess larger Seebeck coefficient than that of TbFe{sub 2} and hence the power factor. The calculated Seebeck coefficient of TbCo{sub 2} agree well with the available experimental data. - Highlights: • The transport properties of TbFe{sub 2} and TbCo{sub 2} are obtained. • The non-zero density of states at E{sub F} leads to unusual transport properties. • Spin-up/down transport coefficients are temperature-dependent. • The calculated Seebeck coefficient of TbCo{sub 2} agree with the experimental data. • TbCo{sub 2} possesses larger Seebeck coefficient than that of TbFe{sub 2}.

  8. When students become patients: TB disease among medical undergraduates in Cape Town, South Africa

    Directory of Open Access Journals (Sweden)

    Helene-Mari van der Westhuizen

    2017-06-01

    Full Text Available Background. Medical students acquire latent tuberculosis (TB infection at a rate of 23 cases/100 person-years. The frequency and impact of occupational TB disease in this population are unknown. Methods. A self-administered questionnaire was distributed via email and social media to current medical students and recently graduated doctors (2010 - 2015 at two medical schools in Cape Town. Individuals who had developed TB disease as undergraduate students were eligible to participate. Quantitative and qualitative data collected from the questionnaire and semi-structured interviews were analysed with descriptive statistics and a framework approach to identify emerging themes. Results. Twelve individuals (10 female reported a diagnosis of TB: pulmonary TB (n=6, pleural TB (n=3, TB lymphadenitis (n=2 and TB spine (n=1; 2/12 (17% had drug-resistant disease (DR-TB. Mean diagnostic delay post consultation was 8.1 weeks, with only 42% of initial diagnoses being correct. Most consulted private healthcare providers (general practitioners (n=7; pulmonologists (n=4, and nine underwent invasive procedures (bronchoscopy, pleural fluid aspiration and tissue biopsy. Substantial healthcare costs were incurred (mean ZAR25 000 for drug-sensitive TB, up to ZAR104 000 for DR-TB. Students struggled to obtain treatment, incurred high transport costs and missed academic time. Students with DR-TB interrupted their studies and experienced severe side-effects (hepatotoxicity, depression and permanent ototoxicity. Most participants cited poor TB infection-control practices at their training hospitals as a major risk factor for occupational TB. Conclusions. Undergraduate medical students in Cape Town are at high risk of occupationally acquired TB, with an unmet need for comprehensive occupational health services and support.

  9. Does the integration of TB medical services in the general hospital improve the quality of TB care? Evidence from a case study in China.

    Science.gov (United States)

    Sun, Qiang; Yin, Jia; Yin, Xiao; Zou, Guanyang; Liang, Mingli; Zhong, Jieming; Walley, John; Wei, Xiaolin

    2013-06-01

    Moving the clinical services from tuberculosis (TB) dispensary to the integrated county hospital (called integrated approach) has been practiced in China; however, it is unknown the quality of TB care in the integrated approach and in the dispensary approach. A total of 202 new TB patients were investigated using structured questionnaires in three counties implementing the integrated approach and one county implementing the dispensary approach. The quality of TB care is measured based on success rate of treatment, medical expenditure, health system delay and second-line drug use. The integrated approach showed a high success treatment rate. The medical expenditure in the integrated approach was USD 432, significantly lower than that in the dispensary approach (Z = -5.771, P < 0.001). The integrated approach had a shorter health system delay (5 days) than the dispensary approach (32 days). Twenty-six percent of patients in integrated hospitals were prescribed with second-line TB drugs, significantly lower than that in the TB dispensary (47%, χ(2) = 7.452, P = 0.006). However, the medical expenditure, use of second-line anti-TB drug and liver-protection drugs indeed varied greatly across the three integrated hospitals. The integrated approach showed better quality of TB care, but the performance of the integrated hospitals varied greatly. A method to standardize TB treatment and management of this approach is urgent.

  10. Fabrication and properties of highly luminescent materials from Tb(OH)3-SiO2 and Tb(OH)3-SiO2:Eu3+ nanotubes

    International Nuclear Information System (INIS)

    Tran Thu Huong; Tran Kim Anh; Le Quoc Minh

    2009-01-01

    Luminescent nanomaterials with one-dimensional (1D) structures have attracted much attention due to their unique properties and potential applications in nanophotonics and nanobiophotonics. In this paper, we report a synthesis of terbium - hydroxide - at - silica Tb(OH) 3 -SiO 2 and Tb(OH) 3 -SiO 2 :Eu 3+ nanotubes. Terbium - hydroxide tubes were synthesized by soft template method. The size of the tubes can be controlled precisely and have outer diameters ranging from 80 to 120 nm, wall thickness of about 30 nm, and lengths ranging from 300 to 800 nm. To fabricate core/shell materials, the seed growth method is used. FESEM, X-ray diffraction, Raman spectra of Tb(OH) 3 and Tb(OH) 3 -SiO 2 nanotubes were investigated. The photoluminescence (PL) spectrum of Tb(OH) 3 under 325 nm excitation consists of four main peaks at 488, 542, 582, and 618 nm. Furthermore, a preliminary suggestion for the mechanism of growth of the Tb(OH) 3 nanotubes using the soft - template synthesis technique has been proposed. The PL intensity from Tb(OH) 3 -SiO 2 or Tb(OH) 3 -SiO 2 :Eu 3+ nanotubes is much stronger than that of Tb(OH) 3 .

  11. Esquemas alternativos de hemodiálise Alternative hemodialysis regimens

    Directory of Open Access Journals (Sweden)

    Jorge Paulo Strogoff de Matos

    2010-03-01

    Full Text Available A taxa de mortalidade entre os pacientes em hemodiálise (HD é extremamente elevada. A expectativa de vida restante de um paciente ao iniciar HD é apenas cerca de um quarto daquela da população geral com a mesma idade. O esquema convencional de HD, com três sessões semanais de cerca de quatro horas, foi estabelecido de maneira empírica há cerca de quatro décadas e merece ser reavaliado criticamente. Desde a falha do Estudo HEMO em demonstrar benefícios clínicos com o aumento do Kt/V de ureia nos pacientes em esquema convencional de HD, tem havido um crescente interesse pelos esquemas alternativos de HD com o intuito de prover um tratamento associado com uma melhor sobrevida. Dentre os esquemas mais promissores, destacam-se a HD diária de curta duração e a HD noturna prolongada. As limitações econômicas que inibem a aplicação dos conhecimentos emergentes nesta área devem ser vencidas.The mortality rate among patients on hemodialysis (HD is extremely high. Remaining life expectancy for a patient initiating HD is only approximately one quarter of that of the general population at the same age bracket. The conventional HD regimen based on four-hour sessions three times a week was empirically established nearly four decades ago and needs to be revisited. Since the failure of the HEMO Study to demonstrate the clinical benefits of higher urea Kt/V for patients on conventional HD, an increasing interest for alternative HD regimens has emerged aiming at providing a treatment for improving survival rates. Short daily HD and long nocturnal HD stand out as the most promising alternative regimens. Economical obstacles which could hinder the clinical application of emerging knowledge in the field should be overcome.

  12. Predictors of nonadherence with blood pressure regimens in hemodialysis

    Directory of Open Access Journals (Sweden)

    Kauric-Klein Z

    2013-09-01

    Full Text Available Zorica Kauric-KleinCollege of Nursing, Wayne State University, Detroit, MI, USABackground: Hypertension is very poorly controlled in patients on hemodialysis (HD. Demographic and psychosocial predictors of nonadherence with blood pressure (BP regimens in HD have not been investigated. A study of 118 HD patients from six outpatient HD units was conducted to determine the relationship between demographic/psychosocial factors and adherence with BP-related regimens, ie, fluid restriction, BP medication adherence, and HD treatment adherence.Methods: Descriptive statistics, Pearson correlations, and multiple regressions were conducted to analyze and determine the relationships between variables.Results: Younger age was related to increased fluid gains (r = -0.37, P < 0.01, decreased medication adherence (r = -0.19, P = 0.04, increased missed HD treatments (r = -0.37, P < 0.01, and diastolic BP (r = -0.60, P < 0.01. Female sex was significantly related to decreased fluid gains (r = -0.28, P < 0.01. Race was related to increased missed HD treatments (r = 0.22, P = 0.02. Increased social support was related to decreased missed HD treatments (r = -0.22, P = 0.02. Depression scores were inversely related to decreased medication adherence scores (r = 0.24, P = 0.01.Conclusion: By identifying risk factors for nonadherence with BP-related regimens (young age, male sex, decreased social support, and depression, health care providers can plan early clinical intervention to minimize the risk of nonadherence.Keywords: nonadherence, hemodialysis, blood pressure, demographic predictors, psychosocial predictors

  13. Comparison of current recommended regimens of atropinization in organophosphate poisoning.

    Science.gov (United States)

    Connors, Nicholas J; Harnett, Zachary H; Hoffman, Robert S

    2014-06-01

    Atropine is the mainstay of therapy in organophosphate (OP) toxicity, though research and consensus on dosing is lacking. In 2004, as reported by Eddleston et al. (J Toxicol Clin Toxicol 42(6):865-75, 2004), they noted variation in recommended regimens. We assessed revisions of original references, additional citations, and electronic sources to determine the current variability in atropine dosing recommendations. Updated editions of references from Eddleston et al.'s work, texts of Internal and Emergency Medicine, and electronic resources were reviewed for atropine dosing recommendations. For comparison, recommendations were assessed using the same mean dose (23.4 mg) and the highest dose (75 mg) of atropine as used in the original paper. Recommendations were also compared with the dosing regimen from the World Health Organization (WHO). Thirteen of the original recommendations were updated and 15 additional references were added giving a convenience sample of 28. Sufficient information to calculate time to targeted dose was provided by 24 of these samples. Compared to 2004, current recommendations have greatly increased the speed of atropinization with 13/24 able to reach the mean and high atropine dose within 30 min compared to 1/36 in 2004. In 2004, there were 13 regimens where the maximum time to reach 75 mg was over 18 h, whereas now, there are 2. While only one recommendation called for doubling the dose for faster escalation in 2004, 15 of the 24 current works include dose doubling. In 2004, Eddleston et al. called for an evidence-based guideline for the treatment of OP poisoning that could be disseminated worldwide. Many current recommendations can adequately treat patients within 1 h. While the WHO recommendations remain slow to treat patients with OP poisoning, other authorities are close to a consensus on rapid atropinization.

  14. Association between C3435T polymorphism of MDR1 gene and the incidence of drug-resistant epilepsy in the population of Polish children.

    Science.gov (United States)

    Stasiołek, Mariusz; Romanowicz, Hanna; Połatyńska, Katarzyna; Chamielec, Maciej; Skalski, Dominik; Makowska, Marianna; Smolarz, Beata

    2016-07-08

    Epilepsy is a disease of neurological character. Approximately one third of epileptic patients demonstrate a drug-resistant phenotype, which is associated with the development of drug-resistant epilepsy. The multidrug resistance protein 1 and glycoprotein P, encoded by MDR1, play a significant role in the transmembrane transport of anti-epileptic agents. Single nucleotide polymorphism C3435T (rs1045642) within MDR1 gene may be associated with an increased expression of P-gp which affects the levels of antiepileptic drugs in plasma. The presented studies analysed the association between C3435T polymorphism of MDR1 gene and the incidence of drug-resistant epilepsy in the population of Polish children. C3435T polymorphism of MDR1 gene was analysed by the high resolution melting technique in a group of patients with drug-resistant (n = 106) and drug-responsive epilepsy (n = 67), as well as in non-epileptic children (n = 98) hospitalised at the Department of Neurology, Polish Mother's Memorial Hospital in Lodz. Genotype and allele distributions were evaluated and their compatibility with the Hardy-Weinberg distribution was assessed by means of the χ(2) test. Genotype and allele evaluation, regarding their relationship with a given feature, was supported by an analysis of odds ratio and 95 % confidence interval, calculated according to the logistic regression model. An association was observed between the incidence rate of DRE and the presence of C allele in C3435T polymorphism of MDR1 gene, which may enhance the risk of the disease. The T allele may then play a protective role. No differences were found in the studied groups, regarding either genotype or allele distribution in reference to patient's gender or concomitant diseases. Following the obtained results, C3435T polymorphism of MDR1 gene may be connected with the incidence of drug-resistant epilepsy in the population of Polish children. ISRCTN ISRCTN73824458. Registered 28th September 2014.

  15. The Alaska earthquake, March 27, 1964: effects on hydrologic regimen

    Science.gov (United States)

    Waller, Roger M.; Coble, R.W.; Post, Austin; McGarr, Arthur; Vorhis, Robert C.

    1966-01-01

    This is the fourth in a series of six reports that the U.S. Geological Survey published on the results of a comprehensive geologic study that began, as a reconnaissance survey, within 24 hours after the March 27, 1964, Magnitude 9.2 Great Alaska Earthquake and extended, as detailed investigations, through several field seasons. The 1964 Great Alaska earthquake was the largest earthquake in the U.S. since 1700. Professional Paper 544, in 5 parts, describes the effects on hydrologic regimen.

  16. TB Risk Perceptions among Medical Residents at a Tertiary Care Center in India

    Directory of Open Access Journals (Sweden)

    Geeta S. Pardeshi

    2017-01-01

    Full Text Available Setting. Government tertiary health care center in India. Objective. To understand the perceptions of medical residents about their risk of developing TB in the workplace. Design. Cross-sectional study in which a semistructured questionnaire which included an open-ended question to assess their main concerns regarding TB in workplace was used to collect data. Results. Out of 305 resident doctors approached, 263 (94% completed a structured questionnaire and 200 of these responded to an open-ended question. Daily exposure to TB was reported by 141 (64% residents, 13 (5% reported a prior history of TB, and 175 (69% respondents were aware of TB infection control guidelines. A majority reported concerns about acquiring TB (78% and drug-resistant TB (88%. The key themes identified were concerns about developing drug-resistant TB (n=100; 50%; disease and its clinical consequences (n=39; 20%; social and professional consequences (n=37; 19%; exposure to TB patients (n=32; 16%; poor infection control measures (n=27; 14%; and high workload and its health consequences (n=16; 8%. Conclusion. Though many resident doctors were aware of TB infection control guidelines, only few expressed concern about lack of TB infection control measures. Doctors need to be convinced of the importance of these measures which should be implemented urgently.

  17. Screening for TB by sputum culture in high-risk groups in Copenhagen, Denmark

    DEFF Research Database (Denmark)

    Jensen, Sidse Graff; Wrona Olsen, Nete; Seersholm, Niels

    2015-01-01

    . METHODS: On seven occasions, from September 2012 through June 2014, we offered TB screening to all persons present at 11 locations where socially marginalised people gather in Copenhagen. Spot sputum samples from participants were examined by smear microscopy and culture. Genotype, nucleic acid......INTRODUCTION: Evidence on screening high-risk groups for TB by mobile X-ray in low-incidence countries is building, but knowledge on other possible screening methods is limited. In this retrospective study we report results from a community based programme screening for TB by spot sputum culture...... amplification test and chest X-ray were done if TB was found. RESULTS: Among 1075 participants, we identified 36 cases of TB. Twenty-four cases (66.7%) were identified at the first screening of each participant, that is, the prevalence of TB was 2233/100 000. Thirty-five (97%) of the TB cases were culture...

  18. Diallylthiosulfinate (Allicin), a Volatile Antimicrobial from Garlic (Allium sativum), Kills Human Lung Pathogenic Bacteria, Including MDR Strains, as a Vapor.

    Science.gov (United States)

    Reiter, Jana; Levina, Natalja; van der Linden, Mark; Gruhlke, Martin; Martin, Christian; Slusarenko, Alan J

    2017-10-12

    Garlic ( Allium sativum ) has potent antimicrobial activity due to allicin (diallylthiosulfinate) synthesized by enzyme catalysis in damaged garlic tissues. Allicin gives crushed garlic its characteristic odor and its volatility makes it potentially useful for combating lung infections. Allicin was synthesized (>98% pure) by oxidation of diallyl disulfide by H₂O₂ using formic acid as a catalyst and the growth inhibitory effect of allicin vapor and allicin in solution to clinical isolates of lung pathogenic bacteria from the genera Pseudomonas , Streptococcus , and Staphylococcus , including multi-drug resistant (MDR) strains, was demonstrated. Minimal inhibitory (MIC) and minimal bactericidal concentrations (MBC) were determined and compared to clinical antibiotics using standard European Committee on Antimicrobial Susceptibility Testing (EUCAST) procedures. The cytotoxicity of allicin to human lung and colon epithelial and murine fibroblast cells was tested in vitro and shown to be ameliorated by glutathione (GSH). Similarly, the sensitivity of rat precision-cut lung slices (PCLS) to allicin was decreased by raising the [GSH] to the approximate blood plasma level of 1 mM. Because allicin inhibited bacterial growth as a vapor, it could be used to combat bacterial lung infections via direct inhalation. Since there are no volatile antibiotics available to treat pulmonary infections, allicin, particularly at sublethal doses in combination with oral antibiotics, could make a valuable addition to currently available treatments.

  19. Correlation between ability of biofilm formation with their responsible genes and MDR patterns in clinical and environmental Acinetobacter baumannii isolates.

    Science.gov (United States)

    Bardbari, Ali Mohammadi; Arabestani, Mohammad Reza; Karami, Manoochehr; Keramat, Fariba; Alikhani, Mohammad Yousef; Bagheri, Kamran Pooshang

    2017-07-01

    Acinetobacter baumannii potential to form biofilm and exhibit multiple antibiotic resistances may be responsible in its survival in hospital environment. Accordingly, our study was aimed to determine the correlation between ability of biofilm formation and the frequency of biofilm related genes with antibiotic resistance phenotypes, and also the categorization of their patterns in clinical and environmental isolates. A total of 75 clinical and 32 environmental strains of the A. baumannii were collected and identified via API 20NE. Antibiotic susceptibility was evaluated by disk diffusion and microdilution broth methods. Biofilm formation assay was performed by microtiter plate method. OXA types and biofilm related genes including Bla OXA-51 , Bla OXA-23 , Bla OXA-24 , Bla OXA-58 , bap, bla PER-1 , and ompA were amplified by PCR. The rate of MDR A. baumannii in clinical isolates (100%) was higher than environmental (81.2%) isolates (p baumannii isolates was associated with biofilm formation. There was a significant correlation between multiple drug resistance and biofilm formation. The clinical isolates had a higher ability to form strong biofilms compared to the environmental samples. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Diallylthiosulfinate (Allicin, a Volatile Antimicrobial from Garlic (Allium sativum, Kills Human Lung Pathogenic Bacteria, Including MDR Strains, as a Vapor

    Directory of Open Access Journals (Sweden)

    Jana Reiter

    2017-10-01

    Full Text Available Garlic (Allium sativum has potent antimicrobial activity due to allicin (diallylthiosulfinate synthesized by enzyme catalysis in damaged garlic tissues. Allicin gives crushed garlic its characteristic odor and its volatility makes it potentially useful for combating lung infections. Allicin was synthesized (>98% pure by oxidation of diallyl disulfide by H2O2 using formic acid as a catalyst and the growth inhibitory effect of allicin vapor and allicin in solution to clinical isolates of lung pathogenic bacteria from the genera Pseudomonas, Streptococcus, and Staphylococcus, including multi-drug resistant (MDR strains, was demonstrated. Minimal inhibitory (MIC and minimal bactericidal concentrations (MBC were determined and compared to clinical antibiotics using standard European Committee on Antimicrobial Susceptibility Testing (EUCAST procedures. The cytotoxicity of allicin to human lung and colon epithelial and murine fibroblast cells was tested in vitro and shown to be ameliorated by glutathione (GSH. Similarly, the sensitivity of rat precision-cut lung slices (PCLS to allicin was decreased by raising the [GSH] to the approximate blood plasma level of 1 mM. Because allicin inhibited bacterial growth as a vapor, it could be used to combat bacterial lung infections via direct inhalation. Since there are no volatile antibiotics available to treat pulmonary infections, allicin, particularly at sublethal doses in combination with oral antibiotics, could make a valuable addition to currently available treatments.

  1. Radiosensitivity of a monoclonal human lung adenocarcinoma cell line with MDR phenotype induced by CDDP: an in vitro study

    International Nuclear Information System (INIS)

    Zhang Junxiang; Kong Zhaolu; Shen Zhifen; Tong Shungao; Jin Yizun

    2006-01-01

    The study was to evaluate radiosensitivity of a monoclonal human lung adenocarcinoma cell line SPC-A-1/CDDP-4 with MDR phenotype induced by cisplatin (CDDP) compared with its parental cell SPC-A-1 in vitro. The glutathione (GSH) content and the radiosensitivity of SPC-A-1/CDDP-4 and SPC-A-1 cells were investigated in aerobic and under hypoxia, respectively. The radiosensitization effect of buthionine sulfoximine (BSO), an inhibitor of glutathione (GSH) synthesis, to SPC-A-1/CDDP-4 and SPC-A-1 cells was observed. The results indicated that the monoclonal human lung adenocarcinoma cell line SPC-A-1/CDDP-4 showed, to some extent, a cross-resistance to 137 Cs γ-ray, in addition to its resistance to anticancer drugs (CDDP, ADM, MTX and VCR). The GSH content of SPC-A-1/CDDP-4 cells was higher than that of SPC-A-1 cells both in aerobic and under hypoxia which might account for it. BSO had radiosensitization effect to SPC-A-1/CDDP-4 and SPC-A-1 cells both in aerobic and under hypoxia, but it was stronger under hypoxia than in aerobic and it was stronger to SPC-A-1/CDDP-4 cells than to SPC-A-1 cells. (authors)

  2. [Antituberculous retreatement in case of failure to category I regimen].

    Science.gov (United States)

    Horo, K; Koffi, N B; Kouassi, B A; Brou-Godé, V C; Ahui, B J M; Silué, Y; Touré, K; Gnazé, Z A; Kouakou, K M; N'gom, A; Aka-Danguy, E

    2010-11-01

    In Côte d'Ivoire, since April 2002, the antituberculous regime for category I patients (ARC-I) passed from 2RHZ/4RH to 2RHZE/4RH, without modification of the antituberculous regime for category II (ARC-II) for treatment of cases of the failures to respond to treatment with ARC-I (FARC-I) and patients with a relapse of tuberculosis (TR). The objective of this study was to determine the outcome of patients treated by ARC-II (2RHZES/1RHZE/5RHE). This study was retrospective and compared outcomes during patient follow-up under ARC-II between 1999-2000 (period 1=267 cases) and 2004-2005 (period 2=434 cases). The ARC-II regime has been prescribed for 297 cases of FARC-I and 404 cases of TR. The failure rate of the ARC-II regime was estimated to be 11.98% during the first period compared to 5.53% during the second (PFARC-I cases, therapeutic failure was estimated to 20.54% versus 5.92% in TR group (PFARC-I : 16.16% at the second month, 13.13% to the third month and 20.54% at the fifth month versus 4.20% at the second month, 1.48% to the third month and 5.92% at the fifth month within TB cases (P<0.001). Management of failures to the ARC-I regime must be reviewed to prevent the development of multidrug resistant TB. Copyright © 2010 SPLF. Published by Elsevier Masson SAS. All rights reserved.

  3. Late effects of various dose-fractionation regimens

    International Nuclear Information System (INIS)

    Turesson, I.; Notter, G.

    1983-01-01

    These clinical investigations of various dose-fractionation regimens on human skin show that: The late reactions cannot be predicted from the early reactions; The dose-response curves for late reactions are much steeper than for early reactions; Equivalent doses for various fractionation schedules concerning late effects can be calculated by means of a corrected CRE (NSD) formula; the correction must be considered preliminary because further follow-up is needed. A clinical fractionation study of this type requires: Extremely careful dosimetry; Study of the same anatomical region; Very long follow-up; Studies at different effect levels; Skin reaction is the only end point we have studied systematically for different fractionation regimens. Experience with the CRE formula as a model for calculating isoeffect doses for different fractionation schedules in routine clinical use can be summarized as follows: The CRE formula has been used prospectively since 1972 in all patients; CRE-equivalent weekly doses to 5 x 2.0 Gy per week has been used. (Although the fractionation schedule is changed, the overall treatment time is still the same); The CRE range was 18 to 21 for curative radiotherapy on carcinomas; No irradiation was applied during pronounced acute reactions. No unexpected complications have been observed under these conditions

  4. Accelerated split course regimen in the treatment of brain metastases

    International Nuclear Information System (INIS)

    Franchin, G.; Minatel, E.; Roncadin, M.; Trovo, M.G.; De Paoli, A.; Bortolus, R.; Arcicasa, M.; Boz, G.; Gobitti, C.; Grigoletto, E.; Bassignano, G.

    1988-01-01

    63 patients, with brain metastases were treated with an accelerated split course regimen; irradiation was given to the whole brain in 3 daily fractions of 160 cGy each for 5 days a week. The cycle was repeated after 2 weeks to a total dose of 4800 cGy. Male-female ratio was 3:1. Median age was 58 years. The most frequent site of primary tumor was lung (41 patients), breast in 6 patients, melanoma in 3 patients, other sites in 8 patients and unknown cancer in 5 patients. Thirty-five patients had multiple brain metastases localizations. Two patients failed to complete the scheduled treatment: one because of early death and the other by refusal of therapy during treatment. Complete remission was obtained in 4 patients and partial remission in 24 patients. The median survival time was 21 weeks. The overall response rate was 42.5%. Toxicity was not considerable. The treatment results were not influenced by the site of primary tumor or by disease spreading; only the neurologic status before radiotherapy and the response to treatment influenced survival. The results obtained are similar to those reported by others; however, with the accelerated split course regimen the treatment time was reduced and a shorter period of hospitalization was required. 36 refs.; 2 figs.; 3 tabs

  5. Atypical Amniotic Fluid Embolism Managed with a Novel Therapeutic Regimen

    Directory of Open Access Journals (Sweden)

    Shadi Rezai

    2017-01-01

    Full Text Available Amniotic fluid embolism (AFE is the second leading cause of maternal mortality in the USA with an incidence of 1 : 15,200 births. The case fatality rate and perinatal mortality associated with AFE are 13–30% and 9–44%, respectively. This rare but devastating complication can be difficult to diagnose as many of the early signs and symptoms are nonspecific. Compounding this diagnostic challenge is a lack of effective treatment regimens which to date are mostly supportive. We present the case of a 26-year-old woman who suffered from suspected AFE and was successfully treated with the novel regimen of Atropine, Ondansetron, and Ketorolac (A-OK. The authors acknowledge that this case does not meet the new criteria proposed, by Clark in 2016, but feel that it is important to share this case report, due to dramatic patient response to the provided supportive therapy presented in this case report. We hope this case report will prompt further research into this novel approach to treating AFE with Atropine, Ondansetron, and Ketorolac.

  6. Predictive tools for designing new insulins and treatment regimens

    DEFF Research Database (Denmark)

    Klim, Søren

    The thesis deals with the development of "Predictive tools for designing new insulins and treatments regimens" and consists of two parts: A model based approach for bridging properties of new insulin analogues from glucose clamp experiments to meal tolerance tests (MTT) and a second part that des......The thesis deals with the development of "Predictive tools for designing new insulins and treatments regimens" and consists of two parts: A model based approach for bridging properties of new insulin analogues from glucose clamp experiments to meal tolerance tests (MTT) and a second part...... that describes an implemented software program able to handle stochastic differential equations (SDEs) with mixed effects. The thesis is supplemented with scientific papers published during the PhD. Developing an insulin analogue from candidate molecule to a clinical drug consists of a development programme...... and efficacy are investigated. Numerous methods are used to quantify dose and efficacy in Phase II - especially of interest is the 24-hour meal tolerance test as it tries to portray near normal living conditions. Part I describes an integrated model for insulin and glucose which is aimed at simulating 24-hour...

  7. A deadly combination of AIDS, TB and cardiac tumour.

    Science.gov (United States)

    Sahasrabudhe, Tushar Ramesh

    2013-05-22

    Immunocompromised status in AIDS makes differential diagnosis of any symptom very difficult for a clinician. Sharp clinical judgement and plenty of investigations may be needed to reach the diagnosis, as in this case. We hereby present a case of AIDS and active tuberculosis (TB) under treatment. The patient developed acute onset multifocal neurological symptoms following an episode of fever and diarrhoea. The MRI scan revealed numerous large cerebral infarcts. On investigations to evaluate brain infarcts, we made a diagnosis of left atrial cardiac tumour. Association of cardiac tumours with AIDS has only been rarely reported. It is uncertain if these can be opportunistic tumours in AIDS. The patient successfully came out of this deadly combination of diseases, viz AIDS, TB and large brain infarcts due to atrial tumour; with almost complete recovery.

  8. Synchrotron diffraction characterization of nanostructured KY3F10:Tb

    International Nuclear Information System (INIS)

    Ichikawa, Rodrigo U.; Teixeira, Maria I.; Ranieri, Izilda M.; Martinez, Luis G.; Linhares, Horacio M.S.M.D.; Turrillas, Xavier

    2015-01-01

    Nanostructured rare-earth fluorides materials are being intensively studied recently due to their potential applications in high-dose dosimetry. Particularly, nanostructured Tb-doped KY 3 F 10 has shown satisfactory results to be used in this area. In the present work, the structure and microstructure of KY 3 F 10 :Tb was investigated by means of X-ray synchrotron diffraction. One of the samples was analyzed as synthesized and another after a heat treatment. Rietveld refinement of synchrotron diffraction data was applied to obtain cell parameters, atomic positions and atomic displacement factors and the results were compared to values found in literature. X-ray line profile analysis methods were applied to determine mean crystallite sizes and their distribution. (author)

  9. Advocacy, partnership and political commitment for TB vaccine research.

    Science.gov (United States)

    Olesen, Ole F; Chan, Sharon; Chappell, Janice; Guo, Yan; Leite, Luciana C C

    2016-08-01

    The 4th Global Forum on TB Vaccines, convened in Shanghai, China, from 21 - 24 April 2015, brought together a wide and diverse community involved in tuberculosis vaccine research and development to discuss the current status of, and future directions for this critical effort. This paper summarizes the sessions on Advancing the Pipeline: A Vision for the Next Decade, Engaging the BRICS: Basic Research to Manufacturing, and Regulatory and Access Issues for New TB Vaccines. Summaries of all sessions from the 4th Global Forum are compiled in a special supplement of Tuberculosis. [August 2016, Vol 99, Supp S1, S1-S30]. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  10. Genetic modification of haematopoietic cells for combined resistance to podophyllotoxins, other agents covered by MDR1-mediated efflux activity and nitrosoureas.

    Science.gov (United States)

    Baum, C; Peinert, S; Carpinteiro, A; Eckert, H G; Fairbairn, L J

    2000-05-01

    Genetic transfer and expression of drug-resistance functions into haematopoietic stem and progenitor cells is a promising means to overcome both the acute and longterm side-effects of cytotoxic drugs in bone marrow. Here, we describe a functional analysis of a retroviral vector that co-expresses human cDNAs for multidrug resistance 1/P-glycoprotein (MDR1) and a double mutant of O(6)-alkylguanine-alkyltransferase (hATPA/GA) to high levels. The hATPA/GA protein contains two amino acid substitutions that render it resistant to compounds such as O(6)-benzylguanine that inhibit the wild-type protein which is often overexpressed in resistant tumour cells. Evidence for simultaneous drug resistance of genetically modified primary murine progenitor cells to colchicine or the podophyllotoxin etoposide, both covered by MDR1-mediated efflux activity, and the nitrosourea BCNU, which is counteracted by hATPA/GA, is presented using in vitro colony assays.

  11. [Small interfering RNA-mediated COX-2 gene silencing enhances chemosensitivity of KB/VCR cells by suppressing MDR-1 gene expression and P-glycoprotein activity].

    Science.gov (United States)

    Mo, Xianchao; Li, Weizhong

    2014-05-01

    To investigate the effect of small interfering RNA (siRNA)-mediated COX-2 gene silencing in enhancing the chemosensitivity of KB/VCR cell lines. KB/VCR cells were trasnfected with COX-2 siRNA were examined for expressions of COX-2 and MDR-1 mRNAs with RT-PCR and for Rho-123 accumulation using flow cytometry. MTT assay was used to analyze the proliferation of the transfected KB/VCR cells. Compared with the negative and blank control groups, COX-2 siRNA transfection resulted in significant growth inhibition of KB/VCR cells exposed to vincristine (PKB/VCR cells. COX-2 gene silencing can enhance the chemosensitivity of KB/VCR cells to vincristine, the mechanism of which may involve down-regulated MDR-1 gene expression and inhibition of P-glycoprotein activity.

  12. SNP genetic polymorphisms of MDR-1, CYP1A2 and CYPB11 genes in four canine breeds upon toxicological evaluation.

    Science.gov (United States)

    Gagliardi, Rosa; Llambí, Silvia; Arruga, M Victoria

    2015-01-01

    The fields of pharmacogenetics and pharmacogenomics have become increasingly promising regarding the clinical application of genetic data to aid in prevention of adverse reactions. Specific screening tests can predict which animals express modified proteins or genetic sequences responsible for adverse effects associated with a drug. Among the genetic variations that have been investigated in dogs, the multidrug resistance gene (MDR) is the best studied. However, other genes such as CYP1A2 and CYP2B11 control the protein syntheses involved in the metabolism of many drugs. In the present study, the MDR-1, CYP1A2 and CYP2B11 genes were examined to identify SNP polymorphisms associated with these genes in the following four canine breeds: Uruguayan Cimarron, Border Collie, Labrador Retriever and German Shepherd. The results revealed that several SNPs of the CYP1A2 and CYP2B11 genes are potential targets for drug sensitivity investigations.

  13. Toward a Generation Free of Tuberculosis: TB Disease and Infection in Individuals of College Age in the United States

    Science.gov (United States)

    Shah, N. S.; Flood-Bryzman, A.; Jeffries, C.; Scott, J.

    2018-01-01

    Objectives: To assess the magnitude of active TB disease and latent TB infection (LTBI) in young adults of college age. Participants: Individuals who were aged 18-24 years in 2011 were used as a proxy for college students. Methods: Active TB cases reported to the 2011 US National TB Surveillance System (NTSS) were included. LTBI prevalence was…

  14. Evaluation of three refurbished Guralp CMG-3TB seismometers.

    Energy Technology Data Exchange (ETDEWEB)

    Hart, Darren M. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Merchant, Bion J. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2014-05-01

    The overall objective of testing the Guralp CMG-3TB refurbished seismometers is to determine whether or not the refurbished sensors exhibit better data quality and require less maintenance when deployed than the original Guralp CMG-3TBs. SNL will test these 3 refurbished Guralps to verify performance specifications. The specifications that will be evaluated are sensitivity, bandwidth, self-noise, output impedance, clip-level, dynamic range over application passband, verify mathematical response and calibration response parameters for amplitude and phase.

  15. A deadly combination of AIDS, TB and cardiac tumour

    OpenAIRE

    Sahasrabudhe, Tushar Ramesh

    2013-01-01

    Immunocompromised status in AIDS makes differential diagnosis of any symptom very difficult for a clinician. Sharp clinical judgement and plenty of investigations may be needed to reach the diagnosis, as in this case. We hereby present a case of AIDS and active tuberculosis (TB) under treatment. The patient developed acute onset multifocal neurological symptoms following an episode of fever and diarrhoea. The MRI scan revealed numerous large cerebral infarcts. On investigations to evaluate br...

  16. Index-TB Guidelines: Guidelines on extrapulmonary tuberculosis for India

    Science.gov (United States)

    Sharma, Surendra K.; Ryan, H.; Khaparde, Sunil; Sachdeva, K. S.; Singh, Achintya D.; Mohan, Alladi; Sarin, Rohit; Paramasivan, C N; Kumar, Prahlad; Nischal, Neeraj; Khatiwada, Saurav; Garner, Paul; Tharyan, Prathap

    2017-01-01

    Extrapulmonary tuberculosis (EPTB) is frequently a diagnostic and therapeutic challenge. It is a common opportunistic infection in people living with HIV/AIDS and other immunocompromised states such as diabetes mellitus and malnutrition. There is a paucity of data from clinical trials in EPTB and most of the information regarding diagnosis and management is extrapolated from pulmonary TB. Further, there are no formal national or international guidelines on EPTB. To address these concerns, Indian EPTB guidelines were developed under the auspices of Central TB Division and Directorate of Health Services, Ministry of Health and Family Welfare, Government of India. The objective was to provide guidance on uniform, evidence-informed practices for suspecting, diagnosing and managing EPTB at all levels of healthcare delivery. The guidelines describe agreed principles relevant to 10 key areas of EPTB which are complementary to the existing country standards of TB care and technical operational guidelines for pulmonary TB. These guidelines provide recommendations on three priority areas for EPTB: (i) use of Xpert MTB/RIF in diagnosis, (ii) use of adjunct corticosteroids in treatment, and (iii) duration of treatment. The guidelines were developed using the Grading of Recommendations Assessment, Development and Evaluation (GRADE) criteria, which were evidence based, and due consideration was given to various healthcare settings across India. Further, for those forms of EPTB in which evidence regarding best practice was lacking, clinical practice points were developed by consensus on accumulated knowledge and experience of specialists who participated in the working groups. This would also reflect the needs of healthcare providers and develop a platform for future research. PMID:28862176

  17. Index-TB guidelines: Guidelines on extrapulmonary tuberculosis for India

    Directory of Open Access Journals (Sweden)

    Surendra K Sharma

    2017-01-01

    Full Text Available Extrapulmonary tuberculosis (EPTB is frequently a diagnostic and therapeutic challenge. It is a common opportunistic infection in people living with HIV/AIDS and other immunocompromised states such as diabetes mellitus and malnutrition. There is a paucity of data from clinical trials in EPTB and most of the information regarding diagnosis and management is extrapolated from pulmonary TB. Further, there are no formal national or international guidelines on EPTB. To address these concerns, Indian EPTB guidelines were developed under the auspices of Central TB Division and Directorate of Health Services, Ministry of Health and Family Welfare, Government of India. The objective was to provide guidance on uniform, evidence-informed practices for suspecting, diagnosing and managing EPTB at all levels of healthcare delivery. The guidelines describe agreed principles relevant to 10 key areas of EPTB which are complementary to the existing country standards of TB care and technical operational guidelines for pulmonary TB. These guidelines provide recommendations on three priority areas for EPTB: (i use of Xpert MTB/RIF in diagnosis, (ii use of adjunct corticosteroids in treatment, and (iii duration of treatment. The guidelines were developed using the Grading of Recommendations Assessment, Development and Evaluation (GRADE criteria, which were evidence based, and due consideration was given to various healthcare settings across India. Further, for those forms of EPTB in which evidence regarding best practice was lacking, clinical practice points were developed by consensus on accumulated knowledge and experience of specialists who participated in the working groups. This would also reflect the needs of healthcare providers and develop a platform for future research.

  18. Comparative efficacy and safety of treatment options for MDR and XDR Acinetobacter baumannii infections: a systematic review and network meta-analysis.

    Science.gov (United States)

    Kengkla, Kirati; Kongpakwattana, Khachen; Saokaew, Surasak; Apisarnthanarak, Anucha; Chaiyakunapruk, Nathorn

    2018-01-01

    To comprehensively compare and rank the efficacy and safety of available treatment options for patients with MDR and XDR Acinetobacter baumannii (AB) infection. We searched PubMed, Embase and the Cochrane register of trials systematically for studies that examined treatment options for patients with MDR- and XDR-AB infections until April 2016. Network meta-analysis (NMA) was performed to estimate the risk ratio (RR) and 95% CI from both direct and indirect evidence. Primary outcomes were clinical cure and microbiological cure. Secondary outcomes were all-cause mortality and nephrotoxic and non-nephrotoxic adverse events. A total of 29 studies with 2529 patients (median age 60 years; 65% male; median APACHE II score 19.0) were included. Although there were no statistically significant differences between treatment options, triple therapy with colistin, sulbactam and tigecycline had the highest clinical cure rate. Colistin in combination with sulbactam was associated with a significantly higher microbiological cure rate compared with colistin in combination with tigecycline (RR 1.23; 95% CI 1.03-1.47) and colistin monotherapy (RR 1.21; 95% CI 1.06-1.38). No significant differences in all-cause mortality were noted between treatment options. Tigecycline-based therapy also appeared less effective for achieving a microbiological cure and is not appropriate for treating bloodstream MDR- and XDR-AB infections. Combination therapy of colistin with sulbactam demonstrates superiority in terms of microbiological cure with a safety profile similar to that of colistin monotherapy. Thus, our findings support the use of this combination as a treatment for MDR- and XDR-AB infections. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  19. Enzyme-mediated formulation of stable elliptical silver nanoparticles tested against clinical pathogens and MDR bacteria and development of antimicrobial surgical thread.

    Science.gov (United States)

    Thapa, Rupak; Bhagat, Chintan; Shrestha, Pragya; Awal, Suvash; Dudhagara, Pravin

    2017-05-16

    Silver nanoparticles (AgNPs) are believed to be emerging tool against various infectious diseases including multi-drug resistant (MDR) bacteria. In the present study, in vitro synthesis of AgNPs was optimized using 1:50 ratio of macerozyme (25 μg/μl) and 1 mM AgNO 3 incubated at 80 °C for 8 h. AgNPs were characterized by UV-Visible spectroscopy, dynamic light scattering (DLS), scanning electron microscopy, energy-dispersive X-ray spectroscopy, transmission electron microscopy (TEM) and X-ray diffraction (XRD). Characterization studies suggest the synthesis of elliptical, stable and crystalline AgNPs with an average size of 38.26 ± 0.4 nm calculated using TEM. The XRD pattern revealed the face-centered-cubic (fcc) form of metallic silver. Good shape integrity and dispersion of AgNPs after 1 year of incubation confirmed their stability. AgNPs were exibited the antimicrobial property against ten pathogenic bacteria, three molds and one yeast. The AgNPs also revealed remarkable antimicrobial activity against three MDR strains i.e. Extended spectrum beta-lactamase positive Escherichia coli, Staphylococcus aureus (MRSA) and Teicoplanin resistant Streptococcus Pneumoniae. The AgNPs coated surgical threads (suture) were revealed the remarkble antibacterial activity against three MDR strains. This is the first report to synthesize antimicrobial elliptical AgNPs using enzymes. The results suggest the possibilities to develop the nanoparticles coated antimicrobial medical fabric to combat against MDR infection.

  20. Inhibitory Effects of Neochamaejasmin B on P-Glycoprotein in MDCK-hMDR1 Cells and Molecular Docking of NCB Binding in P-Glycoprotein

    Directory of Open Access Journals (Sweden)

    Lanying Pan

    2015-02-01

    Full Text Available Stellera chamaejasme L. (Thymelaeaceae is widely distributed in Mongolia, Tibet and the northern parts of China. Its roots are commonly used as “Langdu”, which is embodied in the Pharmacopoeia of the P.R. China (2010 as a toxic Traditional Chinese Medicine. It is claimed to have antivirus, antitumor and antibacterial properties in China and other Asian countries. Studies were carried out to characterize the inhibition of neochamaejasmin B (NCB on P-glycoprotein (P-gp, ABCB1, MDR1. Rhodamine-123 (R-123 transport and accumulation studies were performed in MDCK-hMDR1 cells. ABCB1 (MDR1 mRNA gene expression and P-gp protein expression were analyzed. Binding selectivity studies based on molecular docking were explored. R-123 transport and accumulation studies in MDCK-hMDR1 cells indicated that NCB inhibited the P-gp-mediated efflux in a concentration-dependent manner. RT-PCR and Western blot demonstrated that the P-gp expression was suppressed by NCB. To investigate the inhibition type of NCB on P-gp, Ki and Ki’ values were determined by double-reciprocal plots in R-123 accumulation studies. Since Ki was greater than Ki’, the inhibition of NCB on P-gp was likely a mixed type of competitive and non-competitive inhibition. The results were confirmed by molecular docking in our current work. The docking data indicated that NCB had higher affinity to P-gp than to Lig1 ((S-5,7-dihydroxy-2-(4-hydroxyphenylchroman-4-one.

  1. PolyTB: A genomic variation map for Mycobacterium tuberculosis

    KAUST Repository

    Coll, Francesc

    2014-02-15

    Tuberculosis (TB) caused by Mycobacterium tuberculosis (Mtb) is the second major cause of death from an infectious disease worldwide. Recent advances in DNA sequencing are leading to the ability to generate whole genome information in clinical isolates of M. tuberculosis complex (MTBC). The identification of informative genetic variants such as phylogenetic markers and those associated with drug resistance or virulence will help barcode Mtb in the context of epidemiological, diagnostic and clinical studies. Mtb genomic datasets are increasingly available as raw sequences, which are potentially difficult and computer intensive to process, and compare across studies. Here we have processed the raw sequence data (>1500 isolates, eight studies) to compile a catalogue of SNPs (n = 74,039, 63% non-synonymous, 51.1% in more than one isolate, i.e. non-private), small indels (n = 4810) and larger structural variants (n = 800). We have developed the PolyTB web-based tool (http://pathogenseq.lshtm.ac.uk/polytb) to visualise the resulting variation and important meta-data (e.g. in silico inferred strain-types, location) within geographical map and phylogenetic views. This resource will allow researchers to identify polymorphisms within candidate genes of interest, as well as examine the genomic diversity and distribution of strains. PolyTB source code is freely available to researchers wishing to develop similar tools for their pathogen of interest. 2014 Elsevier Ltd. All rights reserved.

  2. HIV-associated TB syndemic: A growing clinical challenge worldwide

    Directory of Open Access Journals (Sweden)

    Maria Theresa Montales

    2015-12-01

    Full Text Available The association of tuberculosis (TB with human immunodeficiency virus (HIV infection and acquired immune deficiency syndrome (AIDS over the past several years has become an emerging syndemic. Approximately 10% of people living with HIV (PLHIV with latent TB infection will develop active TB disease each year. In this review, we highlight that this phenomenon is not limited to high endemic regions like Afro-Asian nations, but globalization/migration is causing increased case detection even in developed nations such as the United States (US. Active screening should be performed for tuberculosis in PLHIV. A high degree of clinical suspicion for tuberculosis is warranted in PLHIV presenting with fever, cough and unintentional weight loss. HIV-Mycobacterium tuberculosis (MTB coinfection is often paucibacillary, precluding diagnosis by conventional diagnostics and/or smear-microscopy/culture. Improved detection of pulmonary and extrapulmonary tuberculosis is now possible by incorporation of the GeneXPERT MTB/RIF assay (Cepheid Inc, Sunnyvale, USA. The World Health Organization (WHO recommends instituting immediate therapy for Mycobacterium tuberculosis, in conjunction with ongoing or newly introduced antiretroviral therapy (ART. Vigilance is required to detect drug-induced organ injuries, and early-treatment induced immune reconstitution inflammatory syndrome (IRIS. Collaborating MTB and HIV activities in concentrated HIV epidemic settings should become a high public health priority.

  3. Magnetoelastic coupling in TbFe2 (110) thin films

    International Nuclear Information System (INIS)

    Ciria, M.; Arnaudas, J.I.; Dufour, C.; Oderno, V.; Dumesnil, K.; del Moral, A.

    1997-01-01

    We have determined the rhombohedral magnetoelastic stress of a Laves phase TbFe 2 (110) single-crystal film, grown by molecular-beam epitaxy. The film thickness was 1300 Angstrom. The magnetoelastic stress was directly measured by using a low-temperature cantilever capacitive method, between 300 and 10 K. The isotherms clearly display the coercive field but, unlike bulk alloy behavior, do not saturate even at the maximum field of 12 T. The determined rhombohedral magnetoelastic parameter of the film is B ε,2 =-0.43 GPa, at 0 K and 12 T, which is 0.67 times the value for bulk TbFe 2 . B ε,2 follows a power m 3 of the reduced magnetization m, indicating a single-ion volume origin for the rhombohedral magnetoelastic stress of this film. Measurements performed in a 300 Angstrom TbFe 2 (110) film deposited onto a YFe 2 buffer show that the coercive field is drastically lowered and that the magnetoelastic distortion is negligible. copyright 1997 American Institute of Physics

  4. Impact of ART on TB case fatality stratified by CD4 count for HIV-positive TB patients in Cape Town, South Africa (2009-2011).

    Science.gov (United States)

    Kaplan, Richard; Caldwell, Judy; Middelkoop, Keren; Bekker, Linda-Gail; Wood, Robin

    2014-08-15

    To identify determinants of tuberculosis (TB) case fatality including the impact of antiretroviral therapy (ART) at different CD4 thresholds for HIV-positive adult and adolescent TB patients. Through a retrospective analysis of the electronic TB database, we identified the HIV status of newly registered patients aged ≥15 years. Multivariable Cox proportional hazard models were used to determine the risk factors for TB case fatality in these patients. In 2009, 2010, and 2011, 25,841, 26,104, and 25,554 newly registered adult TB patients were treated in primary health care clinics in Cape Town, of whom 49.7%, 50.4%, and 50.9% were HIV positive. ART uptake increased over 3 years from 43% to 64.9%, and case fatality of the HIV-positive patients decreased from 7.0% to 5.8% (P ART had a substantial decrease in case fatality. The difference in case fatality between patients on ART and not on ART was most pronounced at low CD4 counts with the positive influence of ART noted up to a CD4 count threshold of 350 cells per cubic millimeter (P ART uptake, in 2011, 21% of the patients with CD4 counts ART during TB treatment. This study showed a relatively poor uptake of ART among severely immune-compromised TB patients. Patients with CD4 counts ART during TB treatment, and ART initiation should be prioritized for this category of patients.

  5. Integration of HIV and TB Services Results in Improved TB Treatment Outcomes and Earlier Prioritized ART Initiation in a Large Urban HIV Clinic in Uganda

    NARCIS (Netherlands)

    Hermans, Sabine M.; Castelnuovo, Barbara; Katabira, Catherine; Mbidde, Peter; Lange, Joep M. A.; Hoepelman, Andy I. M.; Coutinho, Alex; Manabe, Yukari C.

    2012-01-01

    Background: The World Health Organization recommends that treatment of tuberculosis (TB) in HIV-infected patients should be integrated with HIV care. In December 2008, a separate outdoor-integrated TB/HIV clinic was instituted for attendees of a large urban HIV clinic in Uganda. We sought to

  6. Lithium-aluminum-zinc phosphate glasses activated with Tb3+ and Tb3+/Eu3+ for green laser medium, reddish-orange and white phosphor applications

    Science.gov (United States)

    Francisco-Rodriguez, H. I.; Lira, A.; Soriano-Romero, O.; Meza-Rocha, A. N.; Bordignon, S.; Speghini, A.; Lozada-Morales, R.; Caldiño, U.

    2018-05-01

    A spectroscopic analysis of Tb3+ and Tb3+/Eu3+ doped lithium-aluminum-zinc phosphate glasses is performed through their absorbance and photoluminescence spectra, and decay time profiles. Laser parameter values (stimulated emission cross section, effective bandwidth, gain bandwidth and optical gain) were obtained for the terbium 5D4 → 7F5 green emission from the Tb3+ singly-doped glass (LAZT) excited at 350 nm to judge the suitability of the glass phosphor for fiber lasers. A quantum yield of (47.68 ± 0.49)% was measured for the 5D4 level luminescence. Upon 350 nm excitation the LAZT glass phosphor emits green light with a color purity of 65.6% and chromaticity coordinates (0.285, 0.585) very close to those (0.29, 0.60) of European Broadcasting Union illuminant green. The Tb3+/Eu3+codoped glass emission color can be tuned from reddish-orange of 1865 K upon 318 nm excitation to warm white of 3599 K and neutral white of 4049 K upon 359 and 340 nm excitations, respectively. Upon Tb3+ excitation at 340 nm Eu3+ is sensitized by Tb3+ through a non-radiative energy transfer with an efficiency of 0.23-0.26. An electric dipole-dipole interaction might be the dominant mechanism in the Tb3+ to Eu3+ energy transfer taking place into Tb3+ - Eu3+ clusters.

  7. Estimating the effect of lay knowledge and prior contact with pulmonary TB patients, on health-belief model in a high-risk pulmonary TB transmission population.

    Science.gov (United States)

    Zein, Rizqy Amelia; Suhariadi, Fendy; Hendriani, Wiwin

    2017-01-01

    The research aimed to investigate the effect of lay knowledge of pulmonary tuberculosis (TB) and prior contact with pulmonary TB patients on a health-belief model (HBM) as well as to identify the social determinants that affect lay knowledge. Survey research design was conducted, where participants were required to fill in a questionnaire, which measured HBM and lay knowledge of pulmonary TB. Research participants were 500 residents of Semampir, Asemrowo, Bubutan, Pabean Cantian, and Simokerto districts, where the risk of pulmonary TB transmission is higher than other districts in Surabaya. Being a female, older in age, and having prior contact with pulmonary TB patients significantly increase the likelihood of having a higher level of lay knowledge. Lay knowledge is a substantial determinant to estimate belief in the effectiveness of health behavior and personal health threat. Prior contact with pulmonary TB patients is able to explain the belief in the effectiveness of a health behavior, yet fails to estimate participants' belief in the personal health threat. Health authorities should prioritize males and young people as their main target groups in a pulmonary TB awareness campaign. The campaign should be able to reconstruct people's misconception about pulmonary TB, thereby bringing around the health-risk perception so that it is not solely focused on improving lay knowledge.

  8. Different antibiotic regimens for treating asymptomatic bacteriuria in pregnancy.

    Science.gov (United States)

    Guinto, Valerie T; De Guia, Blanca; Festin, Mario R; Dowswell, Therese

    2010-09-08

    Asymptomatic bacteriuria occurs in 5% to 10% of pregnancies and, if left untreated, can lead to serious complications. To assess which antibiotic is most effective and least harmful as initial treatment for asymptomatic bacteriuria in pregnancy. We searched the Cochrane Pregnancy and Childbirth Group's Trials Register (March 2010) and reference lists of retrieved studies. Randomized controlled trials comparing two antibiotic regimens for treating asymptomatic bacteriuria. Review authors independently screened the studies for inclusion and extracted data. We included five studies involving 1140 women with asymptomatic bacteriuria. We did not perform meta-analysis; each trial examined different antibiotic regimens and so we were not able to pool results. In a study comparing a single dose of fosfomycin trometamol 3 g with a five-day course of cefuroxime, there was no significant difference in persistent infection (risk ratio (RR) 1.36, 95% confidence interval (CI) 0.24 to 7.75), shift to other antibiotics (RR 0.08, 95% CI 0.00 to 1.45), or in allergy or pruritus (RR 2.73, 95% CI 0.11 to 65.24). A comparison of seven-day courses of 400 mg pivmecillinam versus 500 mg ampicillin, both given four times daily, showed no significant difference in persistent infection at two weeks or recurrent infection, but there was an increase in vomiting (RR 4.57, 95% CI 1.40 to 14.90) and women were more likely to stop treatment early with pivmecillinam (RR 8.82, 95% CI 1.16 to 66.95). When cephalexin 1 g versus Miraxid(R) (pivmecillinam 200 mg and pivampicillin 250 mg) were given twice-daily for three days, there was no significant difference in persistent or recurrent infection. A one- versus seven-day course of nitrofurantoin resulted in more persistent infection with the shorter course (RR 1.76, 95% CI 1.29 to 2.40), but no significant difference in symptomatic infection at two weeks, nausea, or preterm birth. Comparing cycloserine with sulphadimidine, no significant differences in

  9. First reported case of fulminant TB with progression of infection from lungs to the genitourinary region

    Directory of Open Access Journals (Sweden)

    Tatjana Adzic-Vukicevic

    Full Text Available ABSTRACT Although tuberculosis (TB is a curable disease, it continues to be one of the leading infections associated with death in the world. Extra-pulmonary TB (EPTB occurs in approximately 10% of the total cases, presenting with lymph nodes, pleura, bone and genitourinary tract as the most common locations. Genitourinary tuberculosis, the second most common EPTB, is very difficult to diagnose unless there is a high index of suspicion. Isolated TB orchitis or prostatitis without clinical evidence of renal involvement is a rare entity among genitourinary tuberculosis. We presented the first reported case of TB prostatitis and orchitis associated with pulmonary TB and the presence of an acute massive caseous pneumonia in an immunocompetent man. Despite the anti-TB therapy, the patient presented a rapid progression of disease and deterioration of general conditions taking to death, which occurred four days after TB treatment had started. Disseminated TB is a relatively uncommon cause of acute massive caseous pneumonia; however, there should always be suspicion of the disease, since it is a potentially treatable cause. This rare case supports the assertion that TB should be considered as an important differential diagnosis of genitourinary tumors irrespective of evidence of active TB elsewhere in the body.

  10. Factors Associated with Mortality among Patients on TB Treatment in the Southern Region of Zimbabwe, 2013

    Science.gov (United States)

    Sandy, Charles; Masuka, Nyasha; Hazangwe, Patrick; Choto, Regis C.; Mutasa-Apollo, Tsitsi; Nkomo, Brilliant; Sibanda, Edwin; Mugurungi, Owen; Siziba, Nicholas

    2017-01-01

    Background. In 2013, the tuberculosis (TB) mortality rate was highest in southern Zimbabwe at 16%. We therefore sought to determine factors associated with mortality among registered TB patients in this region. Methodology. This was a retrospective record review of registered patients receiving anti-TB treatment in 2013. Results. Of 1,971 registered TB patients, 1,653 (84%) were new cases compared with 314 (16%) retreatment cases. There were 1,538 (78%) TB/human immunodeficiency virus (HIV) coinfected patients, of whom 1,399 (91%) were on antiretroviral therapy (ART) with median pre-ART CD4 count of 133 cells/uL (IQR, 46–282). Overall, 428 (22%) TB patients died. Factors associated with increased mortality included being ≥65 years old [adjusted relative risk (ARR) = 2.48 (95% CI 1.35–4.55)], a retreatment TB case [ARR = 1.34 (95% CI, 1.10–1.63)], and being HIV-positive [ARR = 1.87 (95% CI, 1.44–2.42)] whilst ART initiation was protective [ARR = 0.25 (95% CI, 0.22–0.29)]. Cumulative mortality rates were 10%, 14%, and 21% at one, two, and six months, respectively, after starting TB treatment. Conclusion. There was high mortality especially in the first two months of anti-TB treatment, with risk factors being recurrent TB and being HIV-infected, despite a high uptake of ART. PMID:28352474

  11. Factors Associated with Mortality among Patients on TB Treatment in the Southern Region of Zimbabwe, 2013

    Directory of Open Access Journals (Sweden)

    Kudakwashe C. Takarinda

    2017-01-01

    Full Text Available Background. In 2013, the tuberculosis (TB mortality rate was highest in southern Zimbabwe at 16%. We therefore sought to determine factors associated with mortality among registered TB patients in this region. Methodology. This was a retrospective record review of registered patients receiving anti-TB treatment in 2013. Results. Of 1,971 registered TB patients, 1,653 (84% were new cases compared with 314 (16% retreatment cases. There were 1,538 (78% TB/human immunodeficiency virus (HIV coinfected patients, of whom 1,399 (91% were on antiretroviral therapy (ART with median pre-ART CD4 count of 133 cells/uL (IQR, 46–282. Overall, 428 (22% TB patients died. Factors associated with increased mortality included being ≥65 years old [adjusted relative risk (ARR = 2.48 (95% CI 1.35–4.55], a retreatment TB case [ARR = 1.34 (95% CI, 1.10–1.63], and being HIV-positive [ARR = 1.87 (95% CI, 1.44–2.42] whilst ART initiation was protective [ARR = 0.25 (95% CI, 0.22–0.29]. Cumulative mortality rates were 10%, 14%, and 21% at one, two, and six months, respectively, after starting TB treatment. Conclusion. There was high mortality especially in the first two months of anti-TB treatment, with risk factors being recurrent TB and being HIV-infected, despite a high uptake of ART.

  12. The 500 deg. C isothermal section of the Gd-Tb-Co ternary system

    International Nuclear Information System (INIS)

    Zhou, K.W.; Zhuang, Y.H.; Li, J.Q.; Zhu, Q.M.; Deng, J.Q.

    2006-01-01

    The isothermal section of the phase diagram of the Gd-Tb-Co ternary system at 500 deg. C was investigated by X-ray powder diffraction, differential thermal analysis and metallographic analysis techniques. In this isothermal section, there are nine single-phase regions, eight two-phase regions and none three-phase region. No ternary compound was found. The compounds Gd 2 Co 17 and Tb 2 Co 17 , Gd 2 Co 7 and Tb 2 Co 7 , GdCo 3 and TbCo 3 , GdCo 2 and TbCo 2 , Gd 4 Co 3 and Tb 4 Co 3 , Gd 12 Co 7 and Tb 12 Co 7 , Gd 3 Co and Tb 3 Co, Gd and Tb form a continuous series of solid solutions. In addition, we experimentally determined the vertical section of pseudobinary system and the Curie temperature of Gd 1-x Tb x Co 2 (x from 0 to 1) series alloys

  13. TbRGG2 facilitates kinetoplastid RNA editing initiation and progression past intrinsic pause sites.

    Science.gov (United States)

    Ammerman, Michelle L; Presnyak, Vladimir; Fisk, John C; Foda, Bardees M; Read, Laurie K

    2010-11-01

    TbRGG2 is an essential kinetoplastid RNA editing accessory factor that acts specifically on pan-edited RNAs. To understand the mechanism of TbRGG2 action, we undertook an in-depth analysis of edited RNA populations in TbRGG2 knockdown cells and an in vitro examination of the biochemical activities of the protein. We demonstrate that TbRGG2 down-regulation more severely impacts editing at the 5' ends of pan-edited RNAs than at their 3' ends. The initiation of editing is reduced to some extent in TbRGG2 knockdown cells. In addition, TbRGG2 plays a post-initiation role as editing becomes stalled in TbRGG2-depleted cells, resulting in an overall decrease in the 3' to 5' progression of editing. Detailed analyses of edited RNAs from wild-type and TbRGG2-depleted cells reveal that TbRGG2 facilitates progression of editing past intrinsic pause sites that often correspond to the 3' ends of cognate guide RNAs (gRNAs). In addition, noncanonically edited junction regions are either absent or significantly shortened in TbRGG2-depleted cells, consistent with impaired gRNA transitions. Sequence analysis further suggests that TbRGG2 facilitates complete utilization of certain gRNAs. In vitro RNA annealing and in vivo RNA unwinding assays demonstrate that TbRGG2 can modulate RNA-RNA interactions. Collectively, these data are consistent with a model in which TbRGG2 facilitates initiation and 3' to 5' progression of editing through its ability to affect gRNA utilization, both during the transition between specific gRNAs and during usage of certain gRNAs.

  14. Processing of metacaspase 2 from Trypanosoma brucei (TbMCA2) broadens its substrate specificity.

    Science.gov (United States)

    Gilio, Joyce M; Marcondes, Marcelo F; Ferrari, Débora; Juliano, Maria A; Juliano, Luiz; Oliveira, Vitor; Machado, Maurício F M

    2017-04-01

    Metacaspases are members of the cysteine peptidase family and may be implicated in programmed cell death in plants and lower eukaryotes. These proteases exhibit calcium-dependent activity and specificity for arginine residues at P 1 . In contrast to caspases, they do not require processing or dimerization for activity. Indeed, unprocessed metacaspase-2 of Trypanosoma brucei (TbMCA2) is active; however, it has been shown that cleavages at Lys 55 and Lys 268 increase TbMCA2 hydrolytic activity on synthetic substrates. The processed TbMCA2 comprises 3 polypeptide chains that remain attached by non-covalent bonds. Replacement of Lys 55 and Lys 268 with Gly via site-directed mutagenesis results in non-processed but enzymatically active mutant, TbMCA2 K55/268G. To investigate the importance of this processing for the activity and specificity of TbMCA2, we performed activity assays comparing the non-processed mutant (TbMCA2 K55/268G) with the processed TbMCA2 form. Significant differences between TbMCA2 WT (processed form) and TbMCA2 K55/268G (non-processed form) were observed. Specifically, we verified that although non-processed TbMCA2 is active when assayed with small synthetic substrates, the TbMCA2 form does not exhibit hydrolytic activity on large substrates such as azocasein, while processed TbMCA2 is able to readily digest this protein. Such differences can be relevant for understanding the physiological regulation and function of TbMCA2. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. TB infection prevention and control experiences of South African nurses - a phenomenological study

    Science.gov (United States)

    2011-01-01

    Background The tuberculosis (TB) epidemic in South Africa is characterised by one of the highest levels of TB/HIV co-infection and growing multidrug-resistant TB worldwide. Hospitals play a central role in the management of TB. We investigated nurses' experiences of factors influencing TB infection prevention and control (IPC) practices to identify risks associated with potential nosocomial transmission. Methods The qualitative study employed a phenomenological approach, using semi-structured interviews with a quota sample of 20 nurses in a large tertiary academic hospital in Cape Town, South Africa. The data was subjected to thematic analysis. Results Nurses expressed concerns about the possible risk of TB transmission to both patients and staff. Factors influencing TB-IPC, and increasing the potential risk of nosocomial transmission, emerged in interconnected overarching themes. Influences related to the healthcare system included suboptimal IPC provision such as the lack of isolation facilities and personal protective equipment, and the lack of a TB-IPC policy. Further influences included inadequate TB training for staff and patients, communication barriers owing to cultural and linguistic differences between staff and patients, the excessive workload of nurses, and a sense of duty of care. Influences related to wider contextual conditions included TB concerns and stigma, and the role of traditional healers. Influences related to patient behaviour included late uptake of hospital care owing to poverty and the use of traditional medicine, and poor adherence to IPC measures by patients, family members and carers. Conclusions Several interconnected influences related to the healthcare system, wider contextual conditions and patient behavior could increase the potential risk of nosocomial TB transmission at hospital level. There is an urgent need for the implementation and evaluation of a comprehensive contextually appropriate TB IPC policy with the setting and

  16. Patient reported delays in seeking treatment for Tuberculosis (TB among adult and pediatric TB patients and TB patients co-infected with HIV in Lima, Peru: a qualitative study

    Directory of Open Access Journals (Sweden)

    Valerie A Paz-Soldan

    2014-12-01

    Full Text Available Abstract: Tuberculosis (TB remains a significant public health challenge worldwide, and particularly in Peru with one of the highest incidence rates in Latin America. TB patient behavior has a direct influence on whether a patient will receive timely diagnosis and successful treatment of their illness. Objectives: The objective was to understand the complex factors that can impact TB patient health seeking behavior. Methods: In-depth interviews were conducted with adult and parents of pediatric patients receiving TB treatment (n=43, within that group a sub-group was also co-infected with HIV (n=11. Results: Almost all of the study participants recognized delays in seeking either their child’s or their own diagnosis of their TB symptoms. The principal reasons for treatment-seeking delays were lack of knowledge and confusion of tuberculosis symptoms, fear and embarrassment of receiving a TB diagnosis, and a patient tendency to self-medicate prior to seeking formal medical attention.Conclusions: Health promotion activities that target patient delays have the potential to improve individual patient outcomes and mitigate the spread of TB at a community level.

  17. Determination of in vitro synergy between linezolid and other antimicrobial agents against Mycobacterium tuberculosis isolates.

    Science.gov (United States)

    Zou, Lin; Liu, Min; Wang, Yufeng; Lu, Jie; Pang, Yu

    2015-12-01

    In this study, our objective was to explore the potential in vitro synergy between linezolid (LZD) and six other anti-TB drugs in Mycobacterium tuberculosis strains, especially multidrug-resistant tuberculosis (MDR-TB) strains. Among the different combinations, the LZD-clarithromycin (CLA) combination showed the best synergism, which was observed in 85% (34/40) of 40 isolates. In addition, one (2.5%) and twenty-one (52.5%) of 40 isolates showed synergism for the LZD-levofloxcin (LEV) and LZD-moxifloxacin (MOX) combinations, respectively, and the difference in the proportion of synergy between these two combinations was significantly different (P synergy against non-MDR group seemed higher than that against MDR group in each combination, while the significant difference was only observed in the LZD-EMB combination (P = 0.046). In conclusion, our findings demonstrate that LZD shows the synergistic activity against both non-MDR and MDR M. tuberculosis strains when in combination with CLA, EMB, MOX, amikacin and clofazimine, indicating that LZD may be considered as a promising component involving the regimen for the treatment of MDR-TB. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Antirelapse Efficacy of Various Primaquine Regimens for Plasmodium vivax

    Directory of Open Access Journals (Sweden)

    D. D. Rajgor

    2014-01-01

    respectively P=0.004. The relapse rate was 6.89%, 1.55%, 4%, and 3.85% as per the month of recurrence; 8.2%, 2%, 4.58%, and 3.68% P=0.007 as per PCR-RFLP; and 2.73%, 1.47%, 1.55%, and 1.53% as per PCR sequencing for groups A, B, C, and D, respectively. The concordance between methods was low, 45%. Conclusion. The higher recurrence rate in no PQ as compared to PQ groups documents PQ antirelapse activity. Regimens tested were safe. However, probable resistance to PQ warrants continuous monitoring and low concordance and limitations in the methods warrant caution in interpreting.

  19. NAGD regimen for the coma of drug-related overdose.

    Science.gov (United States)

    Rappolt, R T; Gay, G R; Decker, W J; Inaba, D S

    1980-07-01

    A specific arousal therapy with NAGD (Naloxone, Activated Charcoal, Glucagon, Doxapram) is outlined for victims of drug overdose in comatose and semi-comatose states. Several direct benefits accrue if early awakening or lightening of such patients is safely accomplished. There are: 1) elimination of need for prolonged intubation or tracheostomy; 2) patient's ability to tell which drug(s) were taken; 3) excessively frantic and vigorous supportive treatment is obviated; and 4) the overall hospital stay is shortened. The NAGD regimen has been found to effectively, safely, and predictably reverse coma. Therapy consists of: naloxone 0.8 mg to 1.6 mg intravenously; large-bore orogastric tube instillation of 100 gm to 120 gm activated charcoal slurry; glucagon 1 mg to 2 mg intravenously; and, in selected cases, doxapram 1 mg/kg to 2 mg/kg intravenously.

  20. Comparison of antiplatelet regimens in secondary stroke prevention

    DEFF Research Database (Denmark)

    Christiansen, Christine Benn; Pal