Human milk blocks DC-SIGN - pathogen interaction via MUC1
Directory of Open Access Journals (Sweden)
Nathalie eKoning
2015-03-01
Full Text Available Beneficial effects of breastfeeding are well-recognized and include both immediate neonatal protection against pathogens, as well as long term protection against allergies and autoimmune diseases. Although several proteins have been identified to have anti-viral or anti-bacterial effects like secretory IgA or lactoferrin, the mechanisms of immune modulation are not fully understood. Recent studies identified important beneficial effects of glycans in human milk, such as those expressed in oligosaccharides or on glycoproteins. Glycans are recognized by the carbohydrate receptors C-type lectins on DC and specific tissue macrophages, which exert important functions in immune modulation and immune homeostasis. A well-characterized C-type lectin is DC-SIGN, which binds terminal fucose. The present study shows that in human milk, MUC1 is the major milk glycoprotein that binds to the lectin domain of DC-SIGN and prevents pathogen interaction through the presence of Lewis x-type oligosaccharides. Surprisingly, this was specific for human milk, as formula, bovine or camel milk did not show any presence of proteins that interacted with DC-SIGN. The expression of DC-SIGN is found in young infants along the entire gastro-intestinal tract. Our data thus suggest the importance of human milk glycoproteins for blocking pathogen interaction to DC in young children. Moreover, a potential benefit of human milk later in life in shaping the infants immune system through DC-SIGN cannot be ruled out.
Directory of Open Access Journals (Sweden)
Patrycja Konieczna
Full Text Available The microbiota is required for optimal host development and ongoing immune homeostasis. Lactobacilli are common inhabitants of the mammalian large intestine and immunoregulatory effects have been described for certain, but not all, strains. The mechanisms underpinning these protective effects are beginning to be elucidated. One such protective organism is Lactobacillus rhamnosus JB-1 (Lb. rhamnosus JB-1. Lb. murinus has no such anti-inflammatory protective effects and was used as a comparator organism. Human monocyte-derived dendritic cells (MDDCs were co-incubated with bacteria and analysed over time for bacterial adhesion and intracellular processing, costimulatory molecule expression, cytokine secretion and induction of lymphocyte polarization. Neutralising antibodies were utilized to identify the responsible MDDC receptors. Lb. rhamnosus JB-1 adhered to MDDCs, but internalization and intracellular processing was significantly delayed, compared to Lb. murinus which was rapidly internalized and processed. Lb. murinus induced CD80 and CD86 expression, accompanied by high levels of cytokine secretion, while Lb. rhamnosus JB-1 was a poor inducer of costimulatory molecule expression and cytokine secretion. Lb. rhamnosus JB-1 primed MDDCs induced Foxp3 expression in autologous lymphocytes, while Lb. murinus primed MDDCs induced Foxp3, T-bet and Ror-γt expression. DC-SIGN was required for Lb. rhamnosus JB-1 adhesion and influenced IL-12 secretion, while TLR-2 influenced IL-10 and IL-12 secretion. Here we demonstrate that the delayed kinetics of bacterial processing by MDDCs correlates with MDDC activation and stimulation of lymphocytes. Thus, inhibition or delay of intracellular processing may be a novel strategy by which certain commensals may avoid the induction of proinflammatory responses.
Konieczna, Patrycja; Schiavi, Elisa; Ziegler, Mario; Groeger, David; Healy, Selena; Grant, Ray; O’Mahony, Liam
2015-01-01
The microbiota is required for optimal host development and ongoing immune homeostasis. Lactobacilli are common inhabitants of the mammalian large intestine and immunoregulatory effects have been described for certain, but not all, strains. The mechanisms underpinning these protective effects are beginning to be elucidated. One such protective organism is Lactobacillus rhamnosus JB-1 (Lb. rhamnosus JB-1). Lb. murinus has no such anti-inflammatory protective effects and was used as a comparator organism. Human monocyte-derived dendritic cells (MDDCs) were co-incubated with bacteria and analysed over time for bacterial adhesion and intracellular processing, costimulatory molecule expression, cytokine secretion and induction of lymphocyte polarization. Neutralising antibodies were utilized to identify the responsible MDDC receptors. Lb. rhamnosus JB-1 adhered to MDDCs, but internalization and intracellular processing was significantly delayed, compared to Lb. murinus which was rapidly internalized and processed. Lb. murinus induced CD80 and CD86 expression, accompanied by high levels of cytokine secretion, while Lb. rhamnosus JB-1 was a poor inducer of costimulatory molecule expression and cytokine secretion. Lb. rhamnosus JB-1 primed MDDCs induced Foxp3 expression in autologous lymphocytes, while Lb. murinus primed MDDCs induced Foxp3, T-bet and Ror-γt expression. DC-SIGN was required for Lb. rhamnosus JB-1 adhesion and influenced IL-12 secretion, while TLR-2 influenced IL-10 and IL-12 secretion. Here we demonstrate that the delayed kinetics of bacterial processing by MDDCs correlates with MDDC activation and stimulation of lymphocytes. Thus, inhibition or delay of intracellular processing may be a novel strategy by which certain commensals may avoid the induction of proinflammatory responses. PMID:25816321
Konieczna, Patrycja; Schiavi, Elisa; Ziegler, Mario; Groeger, David; Healy, Selena; Grant, Ray; O'Mahony, Liam
2015-01-01
The microbiota is required for optimal host development and ongoing immune homeostasis. Lactobacilli are common inhabitants of the mammalian large intestine and immunoregulatory effects have been described for certain, but not all, strains. The mechanisms underpinning these protective effects are beginning to be elucidated. One such protective organism is Lactobacillus rhamnosus JB-1 (Lb. rhamnosus JB-1). Lb. murinus has no such anti-inflammatory protective effects and was used as a comparator organism. Human monocyte-derived dendritic cells (MDDCs) were co-incubated with bacteria and analysed over time for bacterial adhesion and intracellular processing, costimulatory molecule expression, cytokine secretion and induction of lymphocyte polarization. Neutralising antibodies were utilized to identify the responsible MDDC receptors. Lb. rhamnosus JB-1 adhered to MDDCs, but internalization and intracellular processing was significantly delayed, compared to Lb. murinus which was rapidly internalized and processed. Lb. murinus induced CD80 and CD86 expression, accompanied by high levels of cytokine secretion, while Lb. rhamnosus JB-1 was a poor inducer of costimulatory molecule expression and cytokine secretion. Lb. rhamnosus JB-1 primed MDDCs induced Foxp3 expression in autologous lymphocytes, while Lb. murinus primed MDDCs induced Foxp3, T-bet and Ror-γt expression. DC-SIGN was required for Lb. rhamnosus JB-1 adhesion and influenced IL-12 secretion, while TLR-2 influenced IL-10 and IL-12 secretion. Here we demonstrate that the delayed kinetics of bacterial processing by MDDCs correlates with MDDC activation and stimulation of lymphocytes. Thus, inhibition or delay of intracellular processing may be a novel strategy by which certain commensals may avoid the induction of proinflammatory responses.
Directory of Open Access Journals (Sweden)
Masaud Shah
Full Text Available Membrane fusion is the central molecular event during the entry of enveloped viruses into cells. The critical agents of this process are viral surface proteins, primed to facilitate cell bilayer fusion. The important role of Dendritic-cell-specific ICAM3-grabbing non-integrin (DC-SIGN in Dengue virus transmission makes it an attractive target to interfere with Dengue virus Propagation. Receptor mediated endocytosis allows the entry of virions due to the presence of endosomal membranes and low pH-induced fusion of the virus. DC-SIGN is the best characterized molecule among the candidate protein receptors and is able to mediate infection with the four serotypes of dengue virus (DENV. Unrestrained pair wise docking was used for the interaction of dengue envelope protein with DC-SIGN and monoclonal antibody 2G12. Pre-processed the PDB coordinates of dengue envelope glycoprotein and other candidate proteins were prepared and energy minimized through AMBER99 force field distributed in MOE software. Protein-protein interaction server, ZDOCK was used to find molecular interaction among the candidate proteins. Based on these interactions it was found that antibody successfully blocks the glycosylation site ASN 67 and other conserved residues present at DC-SIGN-Den-E complex interface. In order to know for certain, the exact location of the antibody in the envelope protein, co-crystallize of the envelope protein with these compounds is needed so that their exact docking locations can be identified with respect to our results.
te Riet, Joost; Reinieren-Beeren, Inge; Figdor, Carl G; Cambi, Alessandra
2015-11-01
The fungus Candida albicans is the most common cause of mycotic infections in immunocompromised hosts. Little is known about the initial interactions between Candida and immune cell receptors, such as the C-type lectin dendritic cell-specific intracellular cell adhesion molecule-3 (ICAM-3)-grabbing non-integrin (DC-SIGN), because a detailed characterization at the structural level is lacking. DC-SIGN recognizes specific Candida-associated molecular patterns, that is, mannan structures present in the cell wall of Candida. The molecular recognition mechanism is however poorly understood. We postulated that small differences in mannan-branching may result in considerable differences in the binding affinity. Here, we exploit atomic force microscope-based dynamic force spectroscopy with single Candida cells to gain better insight in the carbohydrate recognition capacity of DC-SIGN. We demonstrate that slight differences in the N-mannan structure of Candida, that is, the absence or presence of a phosphomannan side chain, results in differences in the recognition by DC-SIGN as follows: (i) it contributes to the compliance of the outer cell wall of Candida, and (ii) its presence results in a higher binding energy of 1.6 kB T. The single-bond affinity of tetrameric DC-SIGN for wild-type C. albicans is ~10.7 kB T and a dissociation constant kD of 23 μM, which is relatively strong compared with other carbohydrate-protein interactions described in the literature. In conclusion, this study shows that DC-SIGN specifically recognizes mannan patterns on C. albicans with high affinity. Knowledge on the binding pocket of DC-SIGN and its pathogenic ligands will lead to a better understanding of how fungal-associated carbohydrate structures are recognized by receptors of the immune system and can ultimately contribute to the development of new anti-fungal drugs. Copyright © 2015 John Wiley & Sons, Ltd.
Polymeric mannosides prevent DC-SIGN-mediated cell-infection by cytomegalovirus.
Brument, S; Cheneau, C; Brissonnet, Y; Deniaud, D; Halary, F; Gouin, S G
2017-09-20
Human cytomegalovirus (HCMV) is a beta-herpesvirus with a high prevalence in the population. HCMV is asymptomatic for immunocompetent adults but is a leading cause of morbidity for new born and immunocompromised patients. It was recently shown that the envelope glycoprotein B (gB) of HCMV interacts with the Dendritic Cell-Specific ICAM-3 Grabbing Non integrin (DC-SIGN) to infect the host. In this work we developed a set of DC-SIGN blockers based on mono-, di-, tetra and polyvalent mannosides. The multivalent mannosides were designed to interact with the carbohydrate recognition domains of DC-SIGN in a chelate or bind and recapture process, and represent the first chemical antiadhesives of HCMV reported so far. Polymeric dextrans coated with triazolylheptylmannoside (THM) ligands were highly potent, blocking the gB and DC-SIGN interaction at nanomolar concentrations. The compounds were further assessed for their ability to prevent the DC-SIGN mediated HCMV infection of dendritic cells. A dextran polymer coated with an average of 902 THM ligands showed an outstanding effect in blocking the HCMV trans-infection with IC 50 values down to the picomolar range (nanomolar when expressed in THM concentration). Each THM moiety on the polymer surpassed the antiadhesive effect of the methylmannoside reference by more than four orders of magnitude. The compound proved non-cytotoxic at the high concentration of 2 mM and therefore represents an interesting antiadhesive candidate against HCMV and potentially against other virus hijacking dendritic cells to infect the host.
Identification of Multiple Druggable Secondary Sites by Fragment Screening against DC-SIGN.
Aretz, Jonas; Baukmann, Hannes; Shanina, Elena; Hanske, Jonas; Wawrzinek, Robert; Zapol'skii, Viktor A; Seeberger, Peter H; Kaufmann, Dieter E; Rademacher, Christoph
2017-06-12
DC-SIGN is a cell-surface receptor for several pathogenic threats, such as HIV, Ebola virus, or Mycobacterium tuberculosis. Multiple attempts to develop inhibitors of the underlying carbohydrate-protein interactions have been undertaken in the past fifteen years. Still, drug-like DC-SIGN ligands are sparse, which is most likely due to its hydrophilic, solvent-exposed carbohydrate-binding site. Herein, we report on a parallel fragment screening against DC-SIGN applying SPR and a reporter displacement assay, which complements previous screenings using 19 F NMR spectroscopy and chemical fragment microarrays. Hit validation by SPR and 1 H- 15 N HSQC NMR spectroscopy revealed that although no fragment bound in the primary carbohydrate site, five secondary sites are available to harbor drug-like molecules. Building on key interactions of the reported fragment hits, these pockets will be targeted in future approaches to accelerate the development of DC-SIGN inhibitors. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Rapid, directed transport of DC-SIGN clusters in the plasma membrane.
Liu, Ping; Weinreb, Violetta; Ridilla, Marc; Betts, Laurie; Patel, Pratik; de Silva, Aravinda M; Thompson, Nancy L; Jacobson, Ken
2017-11-01
C-type lectins, including dendritic cell-specific intercellular adhesion molecule-3-grabbing nonintegrin (DC-SIGN), are all-purpose pathogen receptors that exist in nanoclusters in plasma membranes of dendritic cells. A small fraction of these clusters, obvious from the videos, can undergo rapid, directed transport in the plane of the plasma membrane at average speeds of more than 1 μm/s in both dendritic cells and MX DC-SIGN murine fibroblasts ectopically expressing DC-SIGN. Surprisingly, instantaneous speeds can be considerably greater. In MX DC-SIGN cells, many cluster trajectories are colinear with microtubules that reside close to the ventral membrane, and the microtubule-depolymerizing drug, nocodazole, markedly reduced the areal density of directed movement trajectories, suggesting a microtubule motor-driven transport mechanism; by contrast, latrunculin A, which affects the actin network, did not depress this movement. Rapid, retrograde movement of DC-SIGN may be an efficient mechanism for bringing bound pathogen on the leading edge and projections of dendritic cells to the perinuclear region for internalization and processing. Dengue virus bound to DC-SIGN on dendritic projections was rapidly transported toward the cell center. The existence of this movement within the plasma membrane points to an unexpected lateral transport mechanism in mammalian cells and challenges our current concepts of cortex-membrane interactions.
Branched oligosaccharide structures on HBV prevent interaction with both DC-SIGN and L-SIGN
Op den Brouw, M. L.; de Jong, M. A. W. P.; Ludwig, I. S.; van der Molen, R. G.; Janssen, H. L. A.; Geijtenbeek, T. B. H.; Woltman, A. M.
2008-01-01
Hepatitis B virus (HBV) is a DNA virus that infects the liver as primary target. Currently, a high affinity receptor for HBV is still unknown. The dendritic cell specific C-type lectin DC-SIGN is involved in pathogen recognition through mannose and fucose containing carbohydrates leading to the
Lasala, Fátima; Arce, Eva; Otero, Joaquín R.; Rojo, Javier; Delgado, Rafael
2003-01-01
We have designed a glycodendritic structure, BH30sucMan, that blocks the interaction between dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin (DC-SIGN) and Ebola virus (EBOV) envelope. BH30sucMan inhibits DC-SIGN-mediated EBOV infection at nanomolar concentrations. BH30sucMan may counteract important steps of the infective process of EBOV and, potentially, of microorganisms shown to exploit DC-SIGN for cell entry and infection.
Lasala, Fátima; Arce, Eva; Otero, Joaquín R.; Rojo, Javier; Delgado, Rafael
2003-01-01
We have designed a glycodendritic structure, BH30sucMan, that blocks the interaction between dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin (DC-SIGN) and Ebola virus (EBOV) envelope. BH30sucMan inhibits DC-SIGN-mediated EBOV infection at nanomolar concentrations. BH30sucMan may counteract important steps of the infective process of EBOV and, potentially, of microorganisms shown to exploit DC-SIGN for cell entry and infection. PMID:14638512
da Silva, Ronaldo Celerino; Segat, Ludovica; Zanin, Valentina; Arraes, Luiz Claudio; Crovella, Sergio
2012-11-01
DC-SIGN and L-SIGN are receptors expressed on specialized macrophages in decidua, (Hofbauer and placental capillary endothelial cells), known to interact with several pathogens, including HIV-1. To disclose the possible involvement of these molecules in the susceptibility to HIV vertical transmission, we analyzed DC-SIGN and L-SIGN gene single nucleotide polymorphisms (SNPs) in 192 HIV-1 positive children and 58 HIV-1 negative children all born to HIV-1 positive mothers, as well as 96 healthy uninfected children not exposed to HIV-1, all from Northeast Brazil. The frequency of three SNPs in the DC-SIGN promoter (-139G>A, -201G>T and -336A>G) were significantly different when comparing HIV positive children with HIV-1 exposed uninfected children, indicating an association with susceptibility to HIV-1 vertical transmission. This genetic association suggests that DC-SIGN molecule may play a role in susceptibility to HIV-1 infection through vertical transmission. Copyright © 2012 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.
Rhesus macaque and chimpanzee DC-SIGN act as HIV/SIV gp120 trans-receptors, similar to human DC-SIGN
Geijtenbeek, T. B.; Koopman, G.; van Duijnhoven, G. C.; van Vliet, S. J.; van Schijndel, A. C.; Engering, A.; Heeney, J. L.; van Kooyk, Y.
2001-01-01
Dendritic cells (DC) have been implicated in the pathogenesis of both human and simian immunodeficiency viruses (HIV and SIV, respectively). The DC-specific HIV-1 trans-receptor DC-SIGN is thought to be essential for viral dissemination by DC. Abundant expression in lymphoid tissues also implies a
Lewis X component in human milk binds DC-SIGN and inhibits HIV-1 transfer to CD4(+) T lymphocytes
Naarding, Marloes A.; Ludwig, Irene S.; Groot, Fedde; Berkhout, Ben; Geijtenbeek, Teunis B. H.; Pollakis, Georgios; Paxton, William A.
2005-01-01
DC-specific ICAM3-grabbing non-integrin (DC-SIGN), which is expressed on DCs, can interact with a variety of pathogens such as HIV-1, hepatitis C, Ebola, cytomegalovirus, Dengue virus, Mycobacterium, Leisbmania, and Candida albicans. We demonstrate that human milk can inhibit the DC-SIGN-mediated
Mobile application MDDCS for modeling the expansion dynamics of a dislocation loop in FCC metals
Kirilyuk, Vasiliy; Petelin, Alexander; Eliseev, Andrey
2017-11-01
A mobile version of the software package Dynamic Dislocation of Crystallographic Slip (MDDCS) designed for modeling the expansion dynamics of dislocation loops and formation of a crystallographic slip zone in FCC-metals is examined. The paper describes the possibilities for using MDDCS, the application interface, and the database scheme. The software has a simple and intuitive interface and does not require special training. The user can set the initial parameters of the experiment, carry out computational experiments, export parameters and results of the experiment into separate text files, and display the experiment results on the device screen.
Steeghs, Liana; van Vliet, Sandra J; Uronen-Hansson, Heli; van Mourik, Andries; Engering, Anneke; Sanchez-Hernandez, Martha; Klein, Nigel; Callard, Robin; van Putten, Jos P M; van der Ley, Peter; van Kooyk, Yvette; van de Winkel, Jan G J
2006-02-01
Neisseria meningitidis lipopolysaccharide (LPS) has been identified as a major determinant of dendritic cell (DC) function. Here we report that one of a series of meningococcal mutants with defined truncations in the lacto-N-neotetraose outer core of the LPS exhibited unique strong adhesion and internalization properties towards DC. These properties were mediated by interaction of the GlcNAc(beta1-3)-Gal(beta1-4)-Glc-R oligosaccharide outer core of lgtB LPS with the dendritic-cell-specific ICAM-3 grabbing non-integrin (DC-SIGN) lectin receptor. Activation of DC-SIGN with this novel oligosaccharide ligand skewed T-cell responses driven by DC towards T helper type 1 activity. Thus, the use of lgtB LPS may provide a powerful instrument to selectively induce the desired arm of the immune response and potentially increase vaccine efficacy.
DC-SIGN mediates avian H5N1 influenza virus infection in cis and in trans
International Nuclear Information System (INIS)
Wang, S.-F.; Huang, Jason C.; Lee, Y.-M.; Liu, S.-J.; Chan, Yu-Jiun; Chau, Y.-P.; Chong, P.; Chen, Y.-M.A.
2008-01-01
DC-SIGN, a C-type lectin receptor expressed in dendritic cells (DCs), has been identified as a receptor for human immunodeficiency virus type 1, hepatitis C virus, Ebola virus, cytomegalovirus, dengue virus, and the SARS coronavirus. We used H5N1 pseudotyped and reverse-genetics (RG) virus particles to study their ability to bind with DC-SIGN. Electronic microscopy and functional assay results indicate that pseudotyped viruses containing both HA and NA proteins express hemagglutination and are capable of infecting cells expressing α-2,3-linked sialic acid receptors. Results from a capture assay show that DC-SIGN-expressing cells (including B-THP-1/DC-SIGN and T-THP-1/DC-SIGN) and peripheral blood dendritic cells are capable of transferring H5N1 pseudotyped and RG virus particles to target cells; this action can be blocked by anti-DC-SIGN monoclonal antibodies. In summary, (a) DC-SIGN acts as a capture or attachment molecule for avian H5N1 virus, and (b) DC-SIGN mediates infections in cis and in trans
Švajger, Urban; Dolenc, Marija Sollner; Jeras, Matjaž
2016-05-01
Bisphenols (BPs) are widely spread pollutants that act as estrogen-like endocrine disruptors and are potentially affecting human health on a long run. We explored the effects of BPA, BPF and BPAF, on in vitro differentiation and maturation of MDDCs. Monocytes were treated with 17β-estradiol (E2) and each BP at the beginning of their differentiation into iMDDCs. We found that 10 and 50 μM of BPA and BPF, 10 and 30μM of BPAF and 10 and 50 nM of E2 did not affect cell viability. However, 50 μM of BPA and BPF, as well as 10 and 30 μM of BPAF, significantly decreased the endocytotic capacity of iMDDCs. Both, BPA (50 μM) and BPAF (30 μM) decreased the expression of CD1a and increased the amount of DC-SIGN molecules on iMDDCs. The E2 pre-treatment moderately decreased expression of CD80, CD86 and CD83 co-stimulatory molecules while increasing the numbers of HLA-DR on mMDDCs. Only BPAF significantly influenced the expression of CD80 and CD86 (both decreased), as well as CD83 and HLA-DR molecules (both increased) on mMDDCs. In addition, BPAF modulated DC maturation signaling pathways by lowering the phosphorylation of p65 NF-κB (nuclear factor-kappaB) and ERK (extracellular signal regulated kinase) 1/2 proteins. Consequently, the in vitro proliferation of allogeneic T cells, stimulated with differently pre-treated iMDDCs and mMDDCs, was significantly reduced only in case of BPAF. Copyright © 2016 Elsevier B.V. All rights reserved.
Simian virus 40 inhibits differentiation and maturation of rhesus macaque DC-SIGN+-dendritic cells
Directory of Open Access Journals (Sweden)
Changyong G
2010-09-01
Full Text Available Abstract Dendritic cells (DC are the initiators and modulators of the immune responses. Some species of pathogenic microorganisms have developed immune evasion strategies by controlling antigen presentation function of DC. Simian virus 40 (SV40 is a DNA tumor virus of rhesus monkey origin. It can induce cell transformation and tumorigenesis in many vertebrate species, but often causes no visible effects and persists as a latent infection in rhesus monkeys under natural conditions. To investigate the interaction between SV40 and rhesus monkey DC, rhesus monkey peripheral blood monocyte-derived DC were induced using recombinant human Interleukin-4 (rhIL-4 and infective SV40, the phenotype and function of DC-specific intracellular adhesion molecule-3 grabbing nonintegrin (DC-SIGN+ DC were analyzed by flow cytometry (FCM and mixed lymphocyte reaction (MLR. Results showed that SV40 can down-regulate the expression of CD83 and CD86 on DC and impair DC-induced activation of T cell proliferation. These findings suggest that SV40 might also cause immune suppression by influencing differentiation and maturation of DC.
Directory of Open Access Journals (Sweden)
Bart Hoorelbeke
Full Text Available BACKGROUND: The glycan-targeting C-type DC-SIGN lectin receptor is implicated in the transmission of the human immunodeficiency virus (HIV by binding the virus and transferring the captured HIV-1 to CD4(+ T lymphocytes. Carbohydrate binding agents (CBAs have been reported to block HIV-1 infection. We have now investigated the potent mannose-specific anti-HIV CBA griffithsin (GRFT on its ability to inhibit the capture of HIV-1 to DC-SIGN, its DC-SIGN-directed transmission to CD4(+ T-lymphocytes and the role of the three carbohydrate-binding sites (CBS of GRFT in these processes. FINDINGS: GRFT inhibited HIV-1(IIIB infection of CEM and HIV-1(NL4.3 infection of C8166 CD4(+ T-lymphocytes at an EC50 of 0.059 and 0.444 nM, respectively. The single mutant CBS variants of GRFT (in which a key Asp in one of the CBS was mutated to Ala were about ∼20 to 60-fold less potent to prevent HIV-1 infection and ∼20 to 90-fold less potent to inhibit syncytia formation in co-cultures of persistently HIV-1 infected HuT-78 and uninfected C8166 CD4(+ T-lymphocytes. GRFT prevents DC-SIGN-mediated virus capture and HIV-1 transmission to CD4(+ T-lymphocytes at an EC50 of 1.5 nM and 0.012 nM, respectively. Surface plasmon resonance (SPR studies revealed that wild-type GRFT efficiently blocked the binding between DC-SIGN and immobilized gp120, whereas the point mutant CBS variants of GRFT were ∼10- to 15-fold less efficient. SPR-analysis also demonstrated that wild-type GRFT and its single mutant CBS variants have the capacity to expel bound gp120 from the gp120-DC-SIGN complex in a dose dependent manner, a property that was not observed for HHA, another mannose-specific potent anti-HIV-1 CBA. CONCLUSION: GRFT is inhibitory against HIV gp120 binding to DC-SIGN, efficiently prevents DC-SIGN-mediated transfer of HIV-1 to CD4(+ T-lymphocytes and is able to expel gp120 from the gp120-DC-SIGN complex. Functionally intact CBS of GRFT are important for the optimal action of
Colorectal mucus binds DC-SIGN and inhibits HIV-1 trans-infection of CD4+ T-lymphocytes.
Stax, Martijn J; Mouser, Emily E I M; van Montfort, Thijs; Sanders, Rogier W; de Vries, Henry J C; Dekker, Henk L; Herrera, Carolina; Speijer, Dave; Pollakis, Georgios; Paxton, William A
2015-01-01
Bodily secretions, including breast milk and semen, contain factors that modulate HIV-1 infection. Since anal intercourse caries one of the highest risks for HIV-1 transmission, our aim was to determine whether colorectal mucus (CM) also contains factors interfering with HIV-1 infection and replication. CM from a number of individuals was collected and tested for the capacity to bind DC-SIGN and inhibit HIV-1 cis- or trans-infection of CD4+ T-lymphocytes. To this end, a DC-SIGN binding ELISA, a gp140 trimer competition ELISA and HIV-1 capture/ transfer assays were utilized. Subsequently we aimed to identify the DC-SIGN binding component through biochemical characterization and mass spectrometry analysis. CM was shown to bind DC-SIGN and competes with HIV-1 gp140 trimer for binding. Pre-incubation of Raji-DC-SIGN cells or immature dendritic cells (iDCs) with CM potently inhibits DC-SIGN mediated trans-infection of CD4+ T-lymphocytes with CCR5 and CXCR4 using HIV-1 strains, while no effect on direct infection is observed. Preliminary biochemical characterization demonstrates that the component seems to be large (>100kDa), heat and proteinase K resistant, binds in a α1-3 mannose independent manner and is highly variant between individuals. Immunoprecipitation using DC-SIGN-Fc coated agarose beads followed by mass spectrometry indicated lactoferrin (fragments) and its receptor (intelectin-1) as candidates. Using ELISA we showed that lactoferrin levels within CM correlate with DC-SIGN binding capacity. In conclusion, CM can bind the C-type lectin DC-SIGN and block HIV-1 trans-infection of both CCR5 and CXCR4 using HIV-1 strains. Furthermore, our data indicate that lactoferrin is a DC-SIGN binding component of CM. These results indicate that CM has the potential to interfere with pathogen transmission and modulate immune responses at the colorectal mucosa.
Colorectal mucus binds DC-SIGN and inhibits HIV-1 trans-infection of CD4+ T-lymphocytes.
Directory of Open Access Journals (Sweden)
Martijn J Stax
Full Text Available Bodily secretions, including breast milk and semen, contain factors that modulate HIV-1 infection. Since anal intercourse caries one of the highest risks for HIV-1 transmission, our aim was to determine whether colorectal mucus (CM also contains factors interfering with HIV-1 infection and replication. CM from a number of individuals was collected and tested for the capacity to bind DC-SIGN and inhibit HIV-1 cis- or trans-infection of CD4+ T-lymphocytes. To this end, a DC-SIGN binding ELISA, a gp140 trimer competition ELISA and HIV-1 capture/ transfer assays were utilized. Subsequently we aimed to identify the DC-SIGN binding component through biochemical characterization and mass spectrometry analysis. CM was shown to bind DC-SIGN and competes with HIV-1 gp140 trimer for binding. Pre-incubation of Raji-DC-SIGN cells or immature dendritic cells (iDCs with CM potently inhibits DC-SIGN mediated trans-infection of CD4+ T-lymphocytes with CCR5 and CXCR4 using HIV-1 strains, while no effect on direct infection is observed. Preliminary biochemical characterization demonstrates that the component seems to be large (>100kDa, heat and proteinase K resistant, binds in a α1-3 mannose independent manner and is highly variant between individuals. Immunoprecipitation using DC-SIGN-Fc coated agarose beads followed by mass spectrometry indicated lactoferrin (fragments and its receptor (intelectin-1 as candidates. Using ELISA we showed that lactoferrin levels within CM correlate with DC-SIGN binding capacity. In conclusion, CM can bind the C-type lectin DC-SIGN and block HIV-1 trans-infection of both CCR5 and CXCR4 using HIV-1 strains. Furthermore, our data indicate that lactoferrin is a DC-SIGN binding component of CM. These results indicate that CM has the potential to interfere with pathogen transmission and modulate immune responses at the colorectal mucosa.
Insights into molecular recognition of LewisX mimics by DC-SIGN using NMR and molecular modelling
International Nuclear Information System (INIS)
Guzzi, C.; Angulo, J.; Rojo, J.; Nieto, P.M.; Doro, F.; Bernardi, A.; Thepaut, M.; Fieschi, F.; Thepaut, M.; Fieschi, F.
2011-01-01
In this work, we have studied in detail the binding of two α-fucosyl-amide-based mimics of Lewis X to DC-SIGN ECD (ECD = extracellular domain) using STD NMR and docking. We have concluded that the binding mode occurs mainly through the fucose moiety, in the same way as Lewis X . Similarly to other mimics containing mannose or fucose previously studied, we have shown that both compounds bind to DC-SIGN ECD in a multimodal fashion. In this case, the main contact is the interaction of two hydroxyl groups one equatorial and the other one axial (O3 and O4) of the fucose with the Ca 2+ as Lewis X and similarly to mannose-containing mimics (in this case the interacting groups are both in the equatorial position). Finally, we have measured the K D of one mimic that was 0.4 mM. Competitive STD NMR experiments indicate that the aromatic moiety provides additional binding contacts that increase the affinity. (authors)
Tabarani, Georges; Thépaut, Michel; Stroebel, David; Ebel, Christine; Vivès, Corinne; Vachette, Patrice; Durand, Dominique; Fieschi, Franck
2009-08-07
DC-SIGN is a C-type lectin receptor of dendritic cells and is involved in the early stages of numerous infectious diseases. DC-SIGN is organized into a tetramer enabling multivalent interaction with pathogens. Once formed, the DC-SIGN-pathogen complex can be internalized into compartments of increasing acidity. We have studied the pH dependence of the oligomerization state and conformation of the entire extracellular domain and neck region. We present evidence for equilibrium between the monomeric and tetrameric states of the extracellular domain, which exhibits a marked dependence with respect to both pH and ionic strength. Using solution x-ray scattering we have obtained a molecular envelope of the extracellular domain in which a model has been built. Our results highlight the central role of the neck domain in the pH-sensitive control of the oligomerization state, in the extended conformation of the protein, and in carbohydrate recognition domain organization and presentation. This work opens new insight into the molecular mechanism of ligand release and points to new avenues to block the first step of this important infection pathway.
Naarding, Marloes A.; Dirac, Annette M.; Ludwig, Irene S.; Speijer, Dave; Lindquist, Susanne; Vestman, Eva-Lotta; Stax, Martijn J.; Geijtenbeek, Teunis B. H.; Pollakis, Georgios; Hernell, Olle; Paxton, William A.
2006-01-01
A wide range of pathogens, including human immunodeficiency virus type 1 (HIV-1), hepatitis C virus, Ebola virus, cytomegalovirus, dengue virus, Mycobacterium, Leishmania, and Helicobacter pylori, can interact with dendritic cell (DC)-specific ICAM3-grabbing nonintegrin (DC-SIGN), expressed on DCs
Energy Technology Data Exchange (ETDEWEB)
Liu, Wan; Qin, Yan; Bai, Lei [Key Laboratory of Molecular Virology and Immunology, Institute Pasteur of Shanghai, the Chinese Academy of Sciences, Shanghai (China); Graduate School of the Chinese Academy of Sciences, Beijing (China); Lan, Ke [Key Laboratory of Molecular Virology and Immunology, Institute Pasteur of Shanghai, the Chinese Academy of Sciences, Shanghai (China); Wang, Jian-Hua, E-mail: Jh_wang@sibs.ac.cn [Key Laboratory of Molecular Virology and Immunology, Institute Pasteur of Shanghai, the Chinese Academy of Sciences, Shanghai (China)
2013-06-05
Infection of Kaposi's sarcoma-associated herpesvirus (KSHV) is commonly occurred in AIDS patients. KSHV and HIV-1 act cooperatively in regulating infection with each other and in human carcinogenesis. Dendritic cells (DCs), as the pivotal cells in host immunity, may be modulated by both viruses, for immunoevasion and dissemination, therefore, the interaction between DCs and each virus has been a prior focus for pathogenesis elucidation. Here, we assessed the potential effect of KSHV on DC–HIV-1 interaction. We found that KSHV stimulation could promote maturation of monocyte-derived DCs (MDDCs) and impaired the ability of MDDCs to drive proliferation of resting CD4{sup +} T cells, demonstrating the immunosuppression induced by KSHV. More importantly, KSHV-stimulated MDDCs could capture more HIV-1 and efficiently transferred these infectious viruses to Hut/CCR5 T cell line. Our results reveal the novel modulation of DC-mediated HIV-1 dissemination by KSHV, and highlight the importance of studying DC–HIV-1 interaction to elucidate HIV/AIDS pathogenesis. - Highlights: ► KSHV impaired the ability of MDDCs to drive proliferation of resting CD4{sup +} T cells. ► KSHV stimulation matured MDDCs and enhanced HIV-1 endocytosis. ► KSHV stimulated MDDCs increased ICAM-1 expression and tighten contact with T cells. ► KSHV-stimulated MDDCs promoted HIV-1 trans-infection of CD4{sup +} T cells.
International Nuclear Information System (INIS)
Liu, Wan; Qin, Yan; Bai, Lei; Lan, Ke; Wang, Jian-Hua
2013-01-01
Infection of Kaposi's sarcoma-associated herpesvirus (KSHV) is commonly occurred in AIDS patients. KSHV and HIV-1 act cooperatively in regulating infection with each other and in human carcinogenesis. Dendritic cells (DCs), as the pivotal cells in host immunity, may be modulated by both viruses, for immunoevasion and dissemination, therefore, the interaction between DCs and each virus has been a prior focus for pathogenesis elucidation. Here, we assessed the potential effect of KSHV on DC–HIV-1 interaction. We found that KSHV stimulation could promote maturation of monocyte-derived DCs (MDDCs) and impaired the ability of MDDCs to drive proliferation of resting CD4 + T cells, demonstrating the immunosuppression induced by KSHV. More importantly, KSHV-stimulated MDDCs could capture more HIV-1 and efficiently transferred these infectious viruses to Hut/CCR5 T cell line. Our results reveal the novel modulation of DC-mediated HIV-1 dissemination by KSHV, and highlight the importance of studying DC–HIV-1 interaction to elucidate HIV/AIDS pathogenesis. - Highlights: ► KSHV impaired the ability of MDDCs to drive proliferation of resting CD4 + T cells. ► KSHV stimulation matured MDDCs and enhanced HIV-1 endocytosis. ► KSHV stimulated MDDCs increased ICAM-1 expression and tighten contact with T cells. ► KSHV-stimulated MDDCs promoted HIV-1 trans-infection of CD4 + T cells
Directory of Open Access Journals (Sweden)
Liu Wen-Sheng
2010-11-01
Full Text Available Abstract Background The dendritic cell-specific intercellular adhesion molecule 3 grabbing non-integrin (DC-SIGN is an important pathogen recognition receptor of the innate immune system. DC-SIGN promoter variants play important role in the susceptibility to various infectious diseases. Nasopharyngeal carcinoma (NPC is a malignancy that is common in southern China and whether DC-SIGN promoter variants have effects on susceptibility to NPC is still unknown. The aim of this study is to ascertain the potential involvement of DC-SIGN promoter single nucleotide polymorphisms (SNPs in NPC susceptibility. Methods We conducted a case control study based on Cantonese population including 444 NPC patients and 464 controls matched on age and sex. The 1041 bp of DC-SIGN promoter region was directly sequenced for all samples. Sequence alignment and SNP search were inspected using DNAStar analysis programs and haplotype frequencies were estimated in Haploview V 4.0. The associations between the SNPs and the risk of NPC were analyzed using chi-square test and non-conditional logistic regression analysis with SPSS 13.0 software. Results A total of six variants were observed in the DC-SIGN promoter region and DC-SIGN -139 GG and -939 AA were significantly associated with NPC risk with adjusted Odds Ratios (ORs of 2.10 (95% confidence interval [CI] = 1.23-3.59; P = 0.006 and 2.52 (1.29-4.93; P = 0.007 respectively and subjects carrying the risk allele DC-SIGN -871 G had 1.47-fold (95% CI = 1.14-1.90 increased risks of developing NPC (P = 0.003. Haplotype analysis revealed that h1 'AAAG' was significantly associated with protection against NPC (OR = 0.69; P = 0.0002 and the association was still significant when using 1000 permutation test runs (P = 0.001. Conclusions Our study indicated that DC-SIGN promoter variants appear to be involved in the susceptibility to NPC and the detailed mechanism of this effect need further studies.
Bakker, B.I. de; Lange, F. de; Cambi, A.; Korterik, J.P.; Dijk, E.M. van; Hulst, N.F. van; Figdor, C.G.; Garcia-Parajo, M.F.
2007-01-01
DC-SIGN, a C-type lectin exclusively expressed on dendritic cells (DCs), plays an important role in pathogen recognition by binding with high affinity to a large variety of microorganisms. Recent experimental evidence points to a direct relation between the function of DC-SIGN as a viral receptor
de Bakker, B.I.; de Lange, Frank; Cambi, Alessandra; Cambi, A.; Korterik, Jeroen P.; van Dijk, E.M.H.P.; van Hulst, N.F.; Figdor, Carl; Garcia Parajo, M.F.
2007-01-01
DC-SIGN, a C-type lectin exclusively expressed on dendritic cells (DCs), plays an important role in pathogen recognition by binding with high affinity to a large variety of microorganisms. Recent experimental evidence points to a direct relation between the function of DC-SIGN as a viral receptor
Li, Jinyao; Geng, Shuang; Liu, Xiuping; Liu, Hu; Jin, Huali; Liu, Chang-Gong; Wang, Bin
2013-10-01
We previously demonstrated that DNA and protein co-administration induced differentiation of immature dendritic cells (iDCs) into CD11c(+)CD40(low)IL-10(+) regulatory DCs (DCregs) via the caveolin-1 (Cav-1) -mediated signal pathway. Here, we demonstrate that production of IL-10 and the low expression of CD40 play a critical role in the subsequent induction of regulatory T cells (Tregs) by the DCregs. We observed that DNA and protein were co-localized with DC-SIGN in caveolae and early lysosomes in the treated DCs, as indicated by co-localization with Cav-1 and EEA-1 compartment markers. DNA and protein also co-localized with LAMP-2. Gene-array analysis of gene expression showed that more than a thousand genes were significantly changed by the DC co-treatment with DNA + protein compared with controls. Notably, the level of DC-SIGN expression was dramatically upregulated in pOVA + OVA co-treated DCs. The expression levels of Rho and Rho GNEF, the down-stream molecules of DC-SIGN mediated signal pathway, were also greatly upregulated. Further, the level of TLR9, the traditional DNA receptor, was significantly downregulated. These results suggest that DC-SIGN as the potential receptor for DNA and protein might trigger the negative pathway to contribute the induction of DCreg combining with Cav-1 mediated negative signal pathway.
Phoenix, Inaia; Nishiyama, Shoko; Lokugamage, Nandadeva; Hill, Terence E.; Huante, Matthew B.; Slack, Olga A.L.; Carpio, Victor H.; Freiberg, Alexander N.; Ikegami, Tetsuro
2016-01-01
Rift Valley fever is a mosquito-transmitted, zoonotic disease that infects humans and ruminants. Dendritic cell specific intercellular adhesion molecule 3 (ICAM-3) grabbing non-integrin (DC-SIGN) acts as a receptor for members of the phlebovirus genus. The Rift Valley fever virus (RVFV) glycoproteins (Gn/Gc) encode five putative N-glycan sequons (asparagine (N)–any amino acid (X)–serine (S)/threonine (T)) at positions: N438 (Gn), and N794, N829, N1035, and N1077 (Gc). The N-glycosylation profile and significance in viral infection via DC-SIGN have not been elucidated. Gc N-glycosylation was first evaluated by using Gc asparagine (N) to glutamine (Q) mutants. Subsequently, we generated a series of recombinant RVFV MP-12 strain mutants, which encode N-to-Q mutations, and the infectivity of each mutant in Jurkat cells stably expressing DC-SIGN was evaluated. Results showed that Gc N794, N1035, and N1077 were N-glycosylated but N829 was not. Gc N1077 was heterogeneously N-glycosylated. RVFV Gc made two distinct N-glycoforms: “Gc-large” and “Gc-small”, and N1077 was responsible for “Gc-large” band. RVFV showed increased infection of cells expressing DC-SIGN compared to cells lacking DC-SIGN. Infection via DC-SIGN was increased in the presence of either Gn N438 or Gc N1077. Our study showed that N-glycans on the Gc and Gn surface glycoproteins redundantly support RVFV infection via DC-SIGN. PMID:27223297
El-Awady, Ahmed R; Miles, Brodie; Scisci, Elizabeth; Kurago, Zoya B; Palani, Chithra D; Arce, Roger M; Waller, Jennifer L; Genco, Caroline A; Slocum, Connie; Manning, Matthew; Schoenlein, Patricia V; Cutler, Christopher W
2015-02-01
Signaling via pattern recognition receptors (PRRs) expressed on professional antigen presenting cells, such as dendritic cells (DCs), is crucial to the fate of engulfed microbes. Among the many PRRs expressed by DCs are Toll-like receptors (TLRs) and C-type lectins such as DC-SIGN. DC-SIGN is targeted by several major human pathogens for immune-evasion, although its role in intracellular routing of pathogens to autophagosomes is poorly understood. Here we examined the role of DC-SIGN and TLRs in evasion of autophagy and survival of Porphyromonas gingivalis in human monocyte-derived DCs (MoDCs). We employed a panel of P. gingivalis isogenic fimbriae deficient strains with defined defects in Mfa-1 fimbriae, a DC-SIGN ligand, and FimA fimbriae, a TLR2 agonist. Our results show that DC-SIGN dependent uptake of Mfa1+P. gingivalis strains by MoDCs resulted in lower intracellular killing and higher intracellular content of P. gingivalis. Moreover, Mfa1+P. gingivalis was mostly contained within single membrane vesicles, where it survived intracellularly. Survival was decreased by activation of TLR2 and/or autophagy. Mfa1+P. gingivalis strain did not induce significant levels of Rab5, LC3-II, and LAMP1. In contrast, P. gingivalis uptake through a DC-SIGN independent manner was associated with early endosomal routing through Rab5, increased LC3-II and LAMP-1, as well as the formation of double membrane intracellular phagophores, a characteristic feature of autophagy. These results suggest that selective engagement of DC-SIGN by Mfa-1+P. gingivalis promotes evasion of antibacterial autophagy and lysosome fusion, resulting in intracellular persistence in myeloid DCs; however TLR2 activation can overcome autophagy evasion and pathogen persistence in DCs.
Cox, Nehemiah; Pilling, Darrell; Gomer, Richard H
2015-07-07
Fibrosis is caused by scar tissue formation in internal organs and is associated with 45% of deaths in the United States. Two closely related human serum proteins, serum amyloid P (SAP) and C-reactive protein (CRP), strongly affect fibrosis. In multiple animal models, and in Phase 1 and Phase 2 clinical trials, SAP affects several aspects of the innate immune system to reduce fibrosis, whereas CRP appears to potentiate fibrosis. However, SAP and CRP bind the same Fcγ receptors (FcγR) with similar affinities, and why SAP and CRP have opposing effects is unknown. Here, we report that SAP but not CRP binds the receptor DC-SIGN (SIGN-R1) to affect the innate immune system, and that FcγR are not necessary for SAP function. A polycyclic aminothiazole DC-SIGN ligand and anti-DC-SIGN antibodies mimic SAP effects in vitro. In mice, the aminothiazole reduces neutrophil accumulation in a model of acute lung inflammation and, at 0.001 mg/kg, alleviates pulmonary fibrosis by increasing levels of the immunosuppressant IL-10. DC-SIGN (SIGN-R1) is present on mouse lung epithelial cells, and SAP and the aminothiazole potentiate IL-10 production from these cells. Our data suggest that SAP activates DC-SIGN to regulate the innate immune system differently from CRP, and that DC-SIGN is a target for antifibrotics.
Borggren, Marie; Navér, Lars; Casper, Charlotte; Ehrnst, Anneka; Jansson, Marianne
2013-04-01
The binding of human immunodeficiency virus (HIV) to C-type lectin receptors may result in either enhanced trans-infection of T-cells or virus degradation. We have investigated the efficacy of HIV-1 utilization of DC-SIGN, a C-type lectin receptor, in the setting of intrauterine or intrapartum mother-to-child transmission (MTCT). Viruses isolated from HIV-1-infected mothers at delivery and from their vertically infected children both shortly after birth and later during the progression of the disease were analysed for their use of DC-SIGN, binding and ability to trans-infect. DC-SIGN use of a child's earlier virus isolate tended to be reduced as compared with that of the corresponding maternal isolate. Furthermore, the children's later isolate displayed enhanced DC-SIGN utilization compared with that of the corresponding earlier virus. These results were also supported in head-to-head competition assays and suggest that HIV-1 variants displaying efficient DC-SIGN use are not selected for during intrauterine or intrapartum MTCT. However, viruses with increased DC-SIGN use may evolve later in paediatric HIV-1 infections.
DEFF Research Database (Denmark)
Olesen, R; Wejse, C; Velez, D R
2007-01-01
We investigated the role of DC-SIGN (CD209), long pentraxin 3 (PTX3) and vitamin D receptor (VDR) gene single nucleotide polymorphisms (SNPs) in susceptibility to pulmonary tuberculosis (TB) in 321 TB cases and 347 healthy controls from Guinea-Bissau. Five additional, functionally relevant SNPs...... within toll-like receptors (TLRs) 2, 4 and 9 were typed but found, when polymorphic, not to affect host vulnerability to pulmonary TB. We did not replicate an association between SNPs in the DC-SIGN promoter and TB. However, we found that two polymorphisms, one in DC-SIGN and one in VDR, were associated...
bg/sup J//bg/sup J/:W/W/sup v/ bone marrow chimera. A model for studying stem cell regulation
Energy Technology Data Exchange (ETDEWEB)
Patt, H M; Maloney, M A
1978-01-01
In studies with bg/sup J//bg/sup J/:W/W/sup v/ chimeric mice, we used the beige neutrophil marker as a criterion of W/W/sup v/ marrow replacement by implanted bg/sup J//bg/sup J/ stem cells. Data from a 50-fold range of inoculum doses and a 2 y period of observation indicate a hyperbolic pattern of replacement expressed as a log dose-response relationship. The saturating effect with increasing inoculum dose was interpreted as reflecting random initial stem cell seeding in bone marrow coupled with a decreasing efficiency of colonization by migration. From the statistics of random sampling and the exponential decrease of the 63% replacement dose with time, we estimate that W/W/sup v/ marrow contains about 2600 stem cell regulatory volumes of about 10/sup 8/ ..mu../sup 3/ (50 cell diameters) each, a dimension consistent with concepts of short-range cell-cell interactions. Our observations suggest that each regulatory volume is essentially self-contained and that stem cell migration is generally restricted to contiguous volumes.
Plate impact experiments on DC745U cooled to ~ -60 °C
Energy Technology Data Exchange (ETDEWEB)
Gustavsen, Richard L. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States). Shock and Detonation Physics; Dattelbaum, Dana M. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States). Shock and Detonation Physics; Bartram, Brian Douglas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States). Shock and Detonation Physics; Gibson, Lloyd Lee [Los Alamos National Lab. (LANL), Los Alamos, NM (United States). Shock and Detonation Physics; Jones, Justin Daniel [Los Alamos National Lab. (LANL), Los Alamos, NM (United States). Shock and Detonation Physics; Goodbody, Austin Bernard [Los Alamos National Lab. (LANL), Los Alamos, NM (United States). Shock and Detonation Physics
2016-08-11
Using gas-gun driven plate impact experiments, we have measured the US - up Hugoniot of the silicone elastomer DC745U cooled to -60 °C. In summary, the initial density changes from p0 (23°C) = 1.312 ± 0.010 g/cm3 to p0 (-60°C) = 1.447 ± 0.011 g/cm3. The linear US - up Hugoniot changes from US = 1.62 + 1.74up km/s at +23°C, to US = 2.03 ± 0.06 + (2.03 ± 0.06) up km/s at -60°C. DC745U, therefore is much stiffer at -60°C than at +23°C, probably due to the crystallization that occurs at ~ -50°C. Caveats/deficiencies: 1) This report does not provide an adequate pedigree of the DC745U used. 2) References to unpublished room temperature shock compression data on the elastomer are inadequate. 3) The report has not been fact checked by a DC745 subject matter expert.
Bullard, Kristen M; Gullberg, Rebekah C; Soltani, Elnaz; Steel, J Jordan; Geiss, Brian J; Keenan, Susan M
2015-01-01
Arthropod-borne flavivirus infection continues to cause significant morbidity and mortality worldwide. Identification of drug targets and novel antiflaviviral compounds to treat these diseases has become a global health imperative. A previous screen of 235,456 commercially available small molecules identified the 2-thioxothiazolidin-4-one family of compounds as inhibitors of the flaviviral NS5 capping enzyme, a promising target for antiviral drug development. Rational drug design methodologies enabled identification of lead compound BG-323 from this series. We have shown previously that BG-323 potently inhibits NS5 capping enzyme activity, displays antiviral effects in dengue virus replicon assays and inhibits growth of West Nile and yellow fever viruses with low cytotoxicity in vitro. In this study we further characterized BG-323's antiviral activity in vitro and in vivo. We found that BG-323 was able to reduce replication of WNV (NY99) and Powassan viruses in culture, and we were unable to force resistance into WNV (Kunjin) in long-term culture experiments. We then evaluated the antiviral activity of BG-323 in a murine model. Mice were challenged with WNV NY99 and administered BG-323 or mock by IP inoculation immediately post challenge and twice daily thereafter. Mice were bled and viremia was quantified on day three. No significant differences in viremia were observed between BG-323-treated and control groups and clinical scores indicated both BG-323-treated and control mice developed signs of illness on approximately the same day post challenge. To determine whether differences in in vitro and in vivo efficacy were due to unfavorable pharmacokinetic properties of BG-323, we conducted a pharmacokinetic evaluation of this small molecule. Insights from pharmacokinetic studies indicate that BG-323 is cell permeable, has a low efflux ratio and does not significantly inhibit two common cytochrome P450 (CYP P450) isoforms thus suggesting this molecule may be less
Directory of Open Access Journals (Sweden)
Kristen M Bullard
Full Text Available Arthropod-borne flavivirus infection continues to cause significant morbidity and mortality worldwide. Identification of drug targets and novel antiflaviviral compounds to treat these diseases has become a global health imperative. A previous screen of 235,456 commercially available small molecules identified the 2-thioxothiazolidin-4-one family of compounds as inhibitors of the flaviviral NS5 capping enzyme, a promising target for antiviral drug development. Rational drug design methodologies enabled identification of lead compound BG-323 from this series. We have shown previously that BG-323 potently inhibits NS5 capping enzyme activity, displays antiviral effects in dengue virus replicon assays and inhibits growth of West Nile and yellow fever viruses with low cytotoxicity in vitro. In this study we further characterized BG-323's antiviral activity in vitro and in vivo. We found that BG-323 was able to reduce replication of WNV (NY99 and Powassan viruses in culture, and we were unable to force resistance into WNV (Kunjin in long-term culture experiments. We then evaluated the antiviral activity of BG-323 in a murine model. Mice were challenged with WNV NY99 and administered BG-323 or mock by IP inoculation immediately post challenge and twice daily thereafter. Mice were bled and viremia was quantified on day three. No significant differences in viremia were observed between BG-323-treated and control groups and clinical scores indicated both BG-323-treated and control mice developed signs of illness on approximately the same day post challenge. To determine whether differences in in vitro and in vivo efficacy were due to unfavorable pharmacokinetic properties of BG-323, we conducted a pharmacokinetic evaluation of this small molecule. Insights from pharmacokinetic studies indicate that BG-323 is cell permeable, has a low efflux ratio and does not significantly inhibit two common cytochrome P450 (CYP P450 isoforms thus suggesting this molecule
Lent, P.L.E.M. van; Figdor, C.G.; Barrera Rico, P.; Ginkel, K. van; Sloetjes, A.W.; Berg, W.B. van den; Torensma, R.
2003-01-01
OBJECTIVE: To determine whether matrix metalloproteinase (MMP)-producing inflammatory macrophages in the synovium of rheumatoid arthritis (RA) patients express the novel dendritic cell (DC)-specific C-type lectin DC-SIGN and whether this expression is associated with the presence of naive T cells
Polyvalent C-glycomimetics based on L-fucose or D-mannose as potent DC-SIGN antagonists
Czech Academy of Sciences Publication Activity Database
Bertolotti, B.; Sutkeviciute, I.; Ambrosini, M.; Ribeiro-Viana, R.; Rojo, J.; Fieschi, F.; Dvořáková, H.; Kašáková, M.; Parkan, K.; Hlaváčková, M.; Nováková, Kateřina; Moravcová, J.
2017-01-01
Roč. 15, č. 18 (2017), s. 3995-4004 ISSN 1477-0520 Institutional support: RVO:61388963 Keywords : glycomimetics * DC_SIGN * antagonist Subject RIV: CC - Organic Chemistry OBOR OECD: Organic chemistry Impact factor: 3.564, year: 2016
Manzo, C.; Torreno-Pina, J.A.; Joosten, B.; Reinieren-Beeren, I.; Gualda, E.J.; Loza-Alvarez, P.; Figdor, Carl; Garcia Parajo, M.F.; Cambi, A.
2012-01-01
The C-type lectin DC-SIGN expressed on dendritic cells (DCs) facilitates capture and internalization of a plethora of different pathogens. Although it is known that DC-SIGN organizes in nanoclusters at the surface of DCs, the molecular mechanisms responsible for this well defined nanopatterning and
Manzo, C.; Torreno-Pina, J.A.; Joosten, B.; Reinieren-Beeren, I.; Gualda, E.J.; Loza-Alvarez, P.; Figdor, C.G.; Garcia-Parajo, M.F.; Cambi, A.
2012-01-01
The C-type lectin DC-SIGN expressed on dendritic cells (DCs) facilitates capture and internalization of a plethora of different pathogens. Although it is known that DC-SIGN organizes in nanoclusters at the surface of DCs, the molecular mechanisms responsible for this well defined nanopatterning and
Channel of Axial Injection of DC-60 Cyclotron
Gikal, B N; Bogomolov, S L; Borisenko, A N; Borisov, O N; Gulbekyan, G G; Ivanenko, I A; Kalagin, I V; Kazacha, V I; Kazarinov, N Yu; Khabarov, M V; Lysukhin, S N; Melnikov, V N; Paschenko, S V; Tikhomirov, A V
2006-01-01
The design study and realization of the axial injection beam line of DC-60 cyclotron constructed at the Flerov Laboratory of Nuclear Reactions of the Joint Institute for Nuclear Research are given. The channel allows one to transport and to inject into the cyclotron ions with mass-to-charge ratio $A/Z$ being within interval A/Z=6-12 and kinetic energy up to 17 $Z/A$ keV/m.u.
Directory of Open Access Journals (Sweden)
Yongxiong Chen
2013-01-01
Full Text Available During disease progression to AIDS, HIV-1 infected individuals become increasingly immunosuppressed and susceptible to opportunistic infections. It has also been demonstrated that multiple subsets of dendritic cells (DC, including DC-SIGN⁺ cells, become significantly depleted in the blood and lymphoid tissues of AIDS patients, which may contribute to the failure in initiating effective host immune responses. The mechanism for DC depletion, however, is unclear. It is also known that vast quantities of viral envelope protein gp120 are shed from maturing HIV-1 virions and form circulating immune complexes in the serum of HIV-1-infected individuals, but the pathological role of gp120 in HIV-1 pathogenesis remains elusive. Here we describe a previously unrecognized mechanism of DC death in chronic HIV-1 infection, in which ligation of DC-SIGN by gp120 sensitizes DC to undergo accelerated apoptosis in response to a variety of activation stimuli. The cultured monocyte-derived DC and also freshly-isolated DC-SIGN⁺ blood DC that were exposed to either cross-linked recombinant gp120 or immune-complex gp120 in HIV⁺ serum underwent considerable apoptosis after CD40 ligation or exposure to bacterial lipopolysaccharide (LPS or pro-inflammatory cytokines such as TNFα and IL-1β. Furthermore, circulating DC-SIGN⁺ DC that were isolated directly from HIV-1⁺ individuals had actually been pre-sensitized by serum gp120 for activation-induced exorbitant apoptosis. In all cases the DC apoptosis was substantially inhibited by DC-SIGN blockade. Finally, we showed that accelerated DC apoptosis was a direct consequence of excessive activation of the pro-apoptotic molecule ASK-1 and transfection of siRNA against ASK-1 significantly prevented the activation-induced excessive DC death. Our study discloses a previously unknown mechanism of immune modulation by envelope protein gp120, provides new insights into HIV immunopathogenesis, and suggests potential
Masuda, Akihiro; Nishikawa, Toshio
2014-08-01
The distribution of dendritic cells (DCs) expressing DC-specific ICAM-3-grabbing non-integrin (DC-SIGN, CD209) and the morphological interaction of DC-SIGN⁺ DCs with other cells, especially B cells, in tonsillar and other lymphoid tissues were investigated by multiple immunohistochemistry (IHC) using the graphics editing program Photoshop, which enabled staining with 4 or more antibodies in formalin-fixed paraffin sections. Images obtained by repetition of conventional IHC using diaminobenzidine color development in a tissue section were processed on Photoshop for multiple staining. DC-SIGN⁺ DCs were present in the area around the lymphoid follicles and formed a DC-SIGN⁺ DC-rich area, and these cells contacted not only T cells, fascin⁺ DCs, and blood vessels but also several subsets of B cells simultaneously, including naïve and memory B cells. DC-SIGN⁺ DCs may play an important role in the regulation of the immune response mediated by not only T cells but also B cells. The multiple IHC method introduced in the present study is a simple and useful method for analyzing details of complex structures. Because this method can be applied to routinely processed paraffin sections with conventional IHC with diaminobenzidine, it can be applied to a wide variety of archival specimens.
Jo, Eunyoung; Elvitigala, Don Anushka Sandaruwan; Wan, Qiang; Oh, Minyoung; Oh, Chulhong; Lee, Jehee
2017-12-01
Dendritic-cell-specific ICAM-3-grabbing non-integrin (DC-SIGN) is a C-type lectin that functions as a pattern recognition receptor by recognizing pathogen-associated molecular patterns (PAMPs). It is also involved in various events of the dendritic cell (DC) life cycle, such as DC migration, antigen capture and presentation, and T cell priming. In this study, a DC-SIGN-like gene from the big belly seahorse Hippocampus abdominalis (designated as ShDCS-like) was identified and molecularly characterized. The putative, complete ORF was found to be 1368 bp in length, encoding a protein of 462 amino acids with a molecular mass of 52.6 kDa and a theoretical isoelectric point of 8.26. The deduced amino acid sequence contains a single carbohydrate recognition domain (CRD), in which six conserved cysteine residues and two Ca 2+ -binding site motifs (QPN, WND) were identified. Based on pairwise sequence analysis, ShDCS-like exhibits the highest amino acid identity (94.6%) and similarity (97.4%) with DC-SIGN-like counterpart from tiger tail seahorse Hippocampus comes. Quantitative real-time PCR revealed that ShDCS-like mRNA is transcribed universally in all tissues examined, but with abundance in kidney and gill tissues. The basal mRNA expression of ShDCS-like was modulated in blood cell, kidney, gill and liver tissues in response to the stimulation of healthy fish with lipopolysaccharides (LPS), Edwardsiella tarda, or Streptococcus iniae. Moreover, recombinant ShDCS-like-CRD domain exhibited detectable agglutination activity against different bacteria. Collectively, these results suggest that ShDCS-like may potentially involve in immune function in big belly seahorses. Copyright © 2017 Elsevier Ltd. All rights reserved.
Luo, Fang Lin
2003-01-01
DC/DC conversion techniques have undergone rapid development in recent decades. With the pioneering work of these authors, DC/DC converters have now moved into their sixth generation. This book offers a concise, practical presentation of DC/DC converters, summarizing the spectrum of conversion tecnologies and presentingmany new ideas and more than 100 new topologies. Nowhere else in the literature are DC/DC converters so logically sorted and systematically introduced, and nowhere else can readers find detailed information on prototype topologies that represent a major contribution to modern power engineering. More than 320 figures, 60 tables, and 500 formulae facilitate understand and provide precise data.
First Symmetry Tests in Polarized Z0 Decays to b anti-bg
International Nuclear Information System (INIS)
Burrows, Phil
2000-01-01
The authors have made the first direct symmetry tests in the decays of polarized Z 0 bosons into fully-identified b anti-bg states, collected in the SLD experiment at SLAC. The authors searched for evidence of parity violation at the b anti-bg vertex by studying the asymmetries in the b-quark polar- and azimuthal-angle distributions, and for evidence of T-odd, CP-even or odd, final-state interactions by measuring angular correlations between the three-jet plane and the Z 0 polarization. They found results consistent with Standard Model expectations and set 95% C.L. limits on anomalous contributions
Rolan, Paul E; O'Neill, Gilmore; Versage, Eve; Rana, Jitesh; Tang, Yongqiang; Galluppi, Gerald; Aycardi, Ernesto
2015-01-01
To evaluate the safety, tolerability, and pharmacokinetics of single doses of BG00010 (neublastin, artemin, enovin) in subjects with unilateral sciatica. This was a single-center, blinded, placebo-controlled, randomized Phase 1 sequential-cohort, dose-escalation study (ClinicalTrials.gov identifier NCT00961766; funded by Biogen Idec). Adults with unilateral sciatica were enrolled at The Royal Adelaide Hospital, Australia. Four subjects were assigned to each of eleven cohorts (intravenous BG00010 0.3, 1, 3, 10, 25, 50, 100, 200, 400, or 800 μg/kg, or subcutaneous BG00010 50 μg/kg) and were randomized 3:1 to receive a single dose of BG00010 or placebo. The primary safety and tolerability assessments were: adverse events; clinical laboratory parameters and vital signs; pain as measured by a Likert rating scale; intra-epidermal nerve fiber density; and longitudinal assessment of quantitative sensory test parameters. Blood, serum, and plasma samples were collected for pharmacokinetic and pharmacodynamic assessments. Subjects were blinded to treatment assignment throughout the study. The investigator was blinded to treatment assignment until the Data Safety Review Committee review of unblinded data, which occurred after day 28. Beyond the planned enrollment of 44 subjects, four additional subjects were enrolled into to the intravenous BG00010 200 μg/kg cohort after one original subject experienced mild generalized pruritus. Therefore, a total of 48 subjects were enrolled between August 2009 and December 2011; all were included in the safety analyses. BG00010 was generally well tolerated: in primary analyses, the most common treatment-emergent adverse events were changes in temperature perception, pruritus, rash, or headache; no trends were observed in clinical laboratory parameters, vital signs, intra-epidermal nerve fiber density, or quantitative sensory testing. BG00010 was not associated with any clear, dose-dependent trends in Likert pain scores. BG00010 was
Directory of Open Access Journals (Sweden)
Ciampolini M
2011-05-01
Full Text Available Mario Ciampolini1, Massimiliano Sifone21Preventive Gastroenterology Unit, Department of Paediatrics, Università di Firenze, Florence, Italy; 2Department of Statistics, Università di Firenze, Florence, ItalyBackground: Meals begin and end subjectively. We trained healthy subjects to recognize initial hunger as a preprandial target for meal consumption, and to create a “recognizing hunger” or initial hunger meal pattern.Objective: Training subjects to “recognize hunger” lowers blood glucose (BG and improves energy balance, and lowers metabolic risks and bodyweight. A minority may have low BG and low metabolic risks at recruitment, but the others may recover this favorable condition by training.Methods: In a 7-day food diary, subjects reported their preprandial BG measurements; BG and energy availability by blood were assessed at the lowest BG during the day, and diary-mean BG thus characterized the individual meal pattern (daily energy intake. We analyzed the same diaries of a recent paper on a global, randomized comparison of subjects trained in “recognizing hunger” with control subjects. This time, we checked whether subjects who had maintained low BG (LBG subgroup at recruitment were able to decrease mean BG and metabolic risk factors during “hunger recognition” like those who presented high BG (HBG subgroup.Results: At recruitment, the BG means of 120 investigated subjects were within mean confidence limits of ± 3.84 mg/dL, and we could stratify subjects in ten small strata of which each significantly differed by mean BG. Mean BG was stable in each control subject over five months; the mean absolute change being 6.0 ± 4.6 mg/dL. Only three out of 34 trained subjects who had lower mean BG than 81.8 mg/dL significantly decreased mean BG, whereas 41 out of 55 subjects whose mean BG was greater than 81.8 mg/dL significantly decreased mean BG after training (P < 0.0001. At recruitment, the LBG subgroup showed significantly lower
DEFF Research Database (Denmark)
Salomonsen, Jan; Chattaway, John A.; Chan, Andrew C. Y.
2014-01-01
complex (MHC), and show striking association with particular autoimmune diseases. In chickens, BG genes encode homologues with somewhat different domain organisation. Only a few BG genes have been characterised, one involved in actin-myosin interaction in the intestinal brush border, and another...... implicated in resistance to viral diseases. We characterise all BG genes in B12 chickens, finding a multigene family organised as tandem repeats in the BG region outside the MHC, a single gene in the MHC (the BF-BL region), and another single gene on a different chromosome. There is a precise cell and tissue...... many hybrid genes, suggesting recombination and/or deletion as major evolutionary forces. We identify BG genes in the chicken whole genome shotgun sequence, as well as by comparison to other haplotypes by fibre fluorescence in situ hybridisation, confirming dynamic expansion and contraction within...
Prado Acosta, Mariano; Ruzal, Sandra M; Cordo, Sandra M
2016-11-01
Many species of Lactobacillus sp. possess Surface(s) layer proteins in their envelope. Among other important characteristics S-layer from Lactobacillus acidophilus binds to the cellular receptor DC-SIGN (Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin; CD209), which is involved in adhesion and infection of several families of bacteria. In this report we investigate the activity of new S-layer proteins from the Lactobacillus family (Lactobacillus acidophilus, Lactobacillus brevis, Lactobacillus helveticus and Lactobacillus kefiri) over the infection of representative microorganisms important to human health. After the treatment of DC-SIGN expressing cells with these proteins, we were able to diminish bacterial infection by up to 79% in both gram negative and mycobacterial models. We discovered that pre-treatment of the bacteria with S-layers from Lactobacillus acidophilus and Lactobacillus brevis reduced bacteria viability but also prevent infection by the pathogenic bacteria. We also proved the importance of the glycosylation of the S-layer from Lactobacillus kefiri in the binding to the receptor and thus inhibition of infection. This novel characteristic of the S-layers proteins may contribute to the already reported pathogen exclusion activity for these Lactobacillus probiotic strains; and might be also considered as a novel enzymatic antimicrobial agents to inhibit bacterial infection and entry to host cells. Copyright © 2016 Elsevier B.V. All rights reserved.
Targeting the C-type lectins-mediated host-pathogen interactions with dextran.
Pustylnikov, Sergey; Sagar, Divya; Jain, Pooja; Khan, Zafar K
2014-01-01
Dextran, the α-1,6-linked glucose polymer widely used in biology and medicine, promises new applications. Linear dextran applied as a blood plasma substitute demonstrates a high rate of biocompatibility. Dextran is present in foods, drugs, and vaccines and in most cases is applied as a biologically inert substance. In this review we analyze dextran's cellular uptake principles, receptor specificity and, therefore, its ability to interfere with pathogen-lectin interactions: a promising basis for new antimicrobial strategies. Dextran-binding receptors in humans include the DC-SIGN (dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin) family receptors: DC-SIGN (CD209) and L-SIGN (the liver and lymphatic endothelium homologue of DC-SIGN), the mannose receptor (CD206), and langerin. These receptors take part in the uptake of pathogens by dendritic cells and macrophages and may also participate in the modulation of immune responses, mostly shown to be beneficial for pathogens per se rather than host(s). It is logical to predict that owing to receptor-specific interactions, dextran or its derivatives can interfere with these immune responses and improve infection outcome. Recent data support this hypothesis. We consider dextran a promising molecule for the development of lectin-glycan interaction-blocking molecules (such as DC-SIGN inhibitors) that could be applied in the treatment of diseases including tuberculosis, influenza, hepatitis B and C, human immunodeficiency virus infection and AIDS, etc. Dextran derivatives indeed change the pathology of infections dependent on DC-SIGN and mannose receptors. Complete knowledge of specific dextran-lectin interactions may also be important for development of future dextran applications in biological research and medicine.
El-Bashir, S. M.; Alwadai, N. M.; AlZayed, N.
2018-02-01
Polymer nanocomposite films were prepared by doping fullerene C60 in polymer blend composed of polymethacrylate/polyvinyl acetate blends (PMMA/PVAc) using solution cast technique. The films were characterized by differential scanning calorimeter (DSC), Transmission electron microscope (TEM), DC/AC electrical conductivity and dielectric measurements in the frequency range (100 Hz- 1 MHz). The glass transition temperature, Tg, was increased by increasing the concentration of fullerene C60; this property reflects the increase of thermal stability by increasing the nanofiller content. The DC and AC electrical conductivities were enhanced by increasing C60 concentration due to the electron hopping or tunneling between filled and empty localized states above Tg. The relaxation time was determined from the αβ -relaxations and found to be attenuated by increasing the temperature as a typical behavior of amorphous polymers. The calculated values of thermodynamic parameters revealed the increase of molecular stability by increasing the doping concentration; this feature supports the application of PMMA/PVAc/C60 nanocomposite films in a wide scale of solar energy conversion applications such as luminescent down-shifting (LDS) coatings for photovoltaic cells.
Vital Signs â Defeating Breast Cancer PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the November 2012 CDC Vital Signs report. Breast cancer is the second leading cause of cancer deaths among women in the United States. Better screening and treatment have contributed to a decline in breast cancer deaths, however, not all women have benefited equally from these improvements. Learn how we can all help reduce deaths from breast cancer.
Pabalan, Noel; Chaisri, Suwit; Tabunhan, Sompong; Phumyen, Achara; Jarjanazi, Hamdi; Steiner, Theodore S
2018-01-01
Dengue virus entry into a host is associated with a cell surface protein, DC-SIGN (dendritic cell-specific intercellular adhesion molecule-3 grabbing non-integrin). A common CD209-336G/A (rs4804803) polymorphism in DC-SIGN may affect severity of dengue virus infection (DEN) and incidence of dengue fever (DF) or the more severe dengue hemorrhagic fever (DHF). However, the reported associations of these two outcomes and CD-209 have been inconsistent, which prompted a meta-analysis to obtain more precise estimates. A literature search yielded seven case-control studies. We calculated pooled odds ratios (OR) and 95% confidence intervals using standard genetic models. Outlier treatment examined sources of potential heterogeneity. Subgroup analysis was performed for ethnicity and age. All significant outcomes for association indicating reduced risk were pegged at P=0.007-0.05. In the homozygous and recessive models, these were observed in the overall analysis (OR 0.52-0.55), and subgroups of South/Central Americans (OR 0.30-0.32) and school-age children (OR 0.44) in the DHF analysis as well as the codominant model among Asians in DF (OR 0.59). These significant outcomes are strengthened by their non-heterogeneity (P>0.10) and robustness of the effects. Most pooled effects in DF and DEN were variable. The DC-SIGN -336G/A polymorphism significantly affects DHF and DF incidence with the effect more pronounced in certain analyzed patient subgroups. Copyright © 2017 Elsevier B.V. All rights reserved.
DeLucia, Diana C; Rinaldo, Charles R; Rappocciolo, Giovanna
2018-04-11
Professional antigen presenting cells (APC: myeloid dendritic cells (DC) and macrophages (MΦ); B lymphocytes) mediate highly efficient HIV-1 infection of CD4 + T cells, termed trans infection, that could contribute to HIV-1 pathogenesis. We have previously shown that lower cholesterol content in DC and B lymphocytes is associated with a lack of HIV-1 trans infection in HIV-1 infected nonprogressors (NP). Here we assessed whether HIV-1 trans infection mediated by another major APC, MΦ, is deficient in NP due to altered cholesterol metabolism. When comparing healthy HIV-1 seronegatives (SN), rapid progressors (PR), and NP, we found that monocyte-derived MΦ from NP did not mediate HIV-1 trans infection of autologous CD4 + T cells, in contrast to efficient trans infection mediated by SN and PR MΦ. MΦ trans infection efficiency was directly associated with the number of DC-specific intercellular adhesion molecule-3-grabbing non-integrin (DC-SIGN)-expressing MΦ. Significantly fewer NP MΦ expressed DC-SIGN. Unesterified (free) cholesterol in MΦ cell membranes and lipid rafting was significantly lower in NP than PR, as well as virus internalization in early endosomes. Furthermore, simvastatin (SIMV), decreased the subpopulation of DC-SIGN + MΦ, as well as MΦ cis and trans infection. Notably, SIMV decreased cell membrane cholesterol and led to lipid raft dissociation, effectively mimicking the incompetent APC trans infection environment characteristic of NP. Our data support that DC-SIGN and membrane cholesterol are central to MΦ trans infection, and a lack of these limits HIV-1 disease progression. Targeting the ability of MΦ to drive HIV-1 dissemination in trans could enhance HIV-1 therapeutic strategies. IMPORTANCE Despite the success of combination anti-retroviral therapy, neither a vaccine nor a cure for HIV infection has been developed, demonstrating a need for novel prophylactic and therapeutic strategies. Here we show that efficiency of macrophage (M
CSIR Research Space (South Africa)
Alexandre, Kabamba B
2012-02-01
Full Text Available It is generally believed that during the sexual transmission of HIV-1, the glycan-specific DC-SIGN receptor binds the virus and mediates its transfer to CD4(+) cells. The lectins griffithsin (GRFT), cyanovirin-N (CV-N) and scytovirin (SVN) inhibit...
Ramezanpour, Abolfazl; Mashaghi, Alireza
2017-07-01
A fundamental problem in medicine and biology is to assign states, e.g. healthy or diseased, to cells, organs or individuals. State assignment or making a diagnosis is often a nontrivial and challenging process and, with the advent of omics technologies, the diagnostic challenge is becoming more and more serious. The challenge lies not only in the increasing number of measured properties and dynamics of the system (e.g. cell or human body) but also in the co-evolution of multiple states and overlapping properties, and degeneracy of states. We develop, from first principles, a generic rational framework for state assignment in cell biology and medicine, and demonstrate its applicability with a few simple theoretical case studies from medical diagnostics. We show how disease-related statistical information can be used to build a comprehensive model that includes the relevant dependencies between clinical and laboratory findings (signs) and diseases. In particular, we include disease-disease and sign-sign interactions and study how one can infer the probability of a disease in a patient with given signs. We perform comparative analysis with simple benchmark models to check the performances of our models. We find that including interactions can significantly change the statistical importance of the signs and diseases. This first principles approach, as we show, facilitates the early diagnosis of disease by taking interactions into accounts, and enables the construction of consensus diagnostic flow charts. Additionally, we envision that our approach will find applications in systems biology, and in particular, in characterizing the phenome via the metabolome, the proteome, the transcriptome, and the genome.
Digital model for harmonic interactions in AC/DC/AC systems
Energy Technology Data Exchange (ETDEWEB)
Guarini, A P; Rangel, R D; Pilotto, L A.S.; Pinto, R J; Passos, Junior, R [Centro de Pesquisas de Energia Eletrica (CEPEL), Rio de Janeiro, RJ (Brazil)
1994-12-31
The main purpose of this paper is to present a model for calculation of HVdc converter harmonics taking into account the influence of the harmonic interactions between the ac systems in dc link transmissions. The ideas and methodologies used in the model development take into account the dc current ripple and ac voltage distortion in the ac systems. The theory of switching functions is applied to contemplate for the frequency conversions between the ac and dc sides, in an iterative process. It is possible then to obtain, even in balanced situations, non-characteristic harmonics that are produced by frequencies originated in the other terminal, which can be significant in a strongly coupled system, such as back-to-back configuration. (author) 9 refs., 3 figs.
BgTEP: An Antiprotease Involved in Innate Immune Sensing in Biomphalaria glabrata
Directory of Open Access Journals (Sweden)
Anaïs Portet
2018-05-01
Full Text Available Insect thioester-containing protein (iTEP is the most recently defined group among the thioester-containing protein (TEP superfamily. TEPs are key components of the immune system, and iTEPs from flies and mosquitoes were shown to be major immune weapons. Initially characterized from insects, TEP genes homologous to iTEP were further described from several other invertebrates including arthropods, cniderians, and mollusks albeit with few functional characterizations. In the freshwater snail Biomphalaria glabrata, a vector of the schistosomiasis disease, the presence of a TEP protein (BgTEP was previously described in a well-defined immune complex involving snail lectins (fibrinogen-related proteins and schistosome parasite mucins (SmPoMuc. To investigate the potential role of BgTEP in the immune response of the snail, we first characterized its genomic organization and its predicted protein structure. A phylogenetic analysis clustered BgTEP in a well-conserved subgroup of mollusk TEP. We then investigated the BgTEP expression profile in different snail tissues and followed immune challenges using different kinds of intruders during infection kinetics. Results revealed that BgTEP is particularly expressed in hemocytes, the immune-specialized cells in invertebrates, and is secreted into the hemolymph. Transcriptomic results further evidenced an intruder-dependent differential expression pattern of BgTEP, while interactome experiments showed that BgTEP is capable of binding to the surface of different microbes and parasite either in its full length form or in processed forms. An immunolocalization approach during snail infection by the Schistosoma mansoni parasite revealed that BgTEP is solely expressed by a subtype of hemocytes, the blast-like cells. This hemocyte subtype is present in the hemocytic capsule surrounding the parasite, suggesting a potential role in the parasite clearance by encapsulation. Through this work, we report the first
Vital Signs â Defeating Breast Cancer PSA (:60)
Centers for Disease Control (CDC) Podcasts
2012-11-12
This 60 second public service announcement is based on the November 2012 CDC Vital Signs report. Breast cancer is the second leading cause of cancer deaths among women in the United States. Better screening and treatment have contributed to a decline in breast cancer deaths, however, not all women have benefited equally from these improvements. Learn how we can all help reduce deaths from breast cancer. Created: 11/12/2012 by Centers for Disease Control and Prevention (CDC). Date Released: 11/12/2012.
Okkerse, Pieter; Hay, Justin L; Versage, Eve; Tang, Yongqiang; Galluppi, Gerald; Ravina, Bernard; Verma, Ajay; Williams, Leslie; Aycardi, Ernesto; Groeneveld, Geert Jan
2016-07-01
BG00010 is a protein in the glial cell line-derived neurotrophic factor (GDNF) family. It is a selective ligand for the GDNF family receptor alpha-3 (GFRα3) co-receptor that normalizes cellular changes resulting from damage or disease, and potentially alleviates neuropathic pain. The main objectives of this study were to evaluate the pharmacokinetic and safety profiles and to determine the effects on pain of ascending doses of intravenous injections of BG00010 in patients with sciatica. This was a randomized, blinded, placebo-controlled multiple-dose study in subjects with sciatica. In Part I (16 patients), four IV dose levels were examined (50, 150, 400, 800 μg kg(-1) ) and in Part II (12 patients), three dose levels were examined (400, 600 and 1200 μg kg(-1) ). Safety and efficacy assessments were used as endpoints. The BG00010 concentration-time data indicated relatively low inter-patient variability and there was a dose-dependent (not dose-proportional) increase in serum exposure from 150 to 1200 μg kg(-1) . The effective half-life was between 40 and 60 h. The most frequently occurring adverse events (AEs) reported by patients receiving BG00010 were headache (67-83%), feeling hot (50-100%), and pruritus (42-67%). Most AEs were mild; no serious AEs or AEs leading to discontinuation occurred. Higher dose regimens of BG00010 resulted in greater pain reduction than placebo or lower dose regimens, although a clear dose-response relationship was not seen. The pharmacokinetic profile of BG00010 was characterized by low intra-patient variability. These data from a small sample suggest that BG00010 may have a benefit for patients with sciatica. © 2016 The British Pharmacological Society.
DEFF Research Database (Denmark)
Wickramasinghe, Harith R.; Konstantinou, Georgios; Pou, Josep
2018-01-01
Estimation-based indirect dc-voltage control in MMCs interacts with circulating current control methods. This paper proposes an estimation-based indirect dc-voltage control method for MMC-HVDC systems and analyzes its performance compared to alternative estimations. The interactions between......-state and transient performance is demonstrated using a benchmark MMC-HVDC transmission system, implemented in a real-time digital simulator. The results verify the theoretical evaluations and illustrate the operation and performance of the proposed indirect dc-voltage control method....
Ansari, Meenhaz; Ashraf, S. S. Z.
2017-10-01
We investigate the energy dependent electron-phonon relaxation rate, energy loss rate, and phonon drag thermopower in single layer graphene (SLG) and bilayer graphene (BLG) under the Bloch-Gruneisen (BG) regime through coupling to acoustic phonons interacting via the Deformation potential in the Boltzmann transport equation approach. We find that the consideration of the chiral nature of electrons alters the temperature dependencies in two-dimensional structures of SLG and BLG from that shown by other conventional 2DEG system. Our investigations indicate that the BG analytical results are valid for temperatures far below the BG limit (˜TBG/4) which is in conformity with a recent experimental investigation for SLG [C. B. McKitterick et al., Phys. Rev. B 93, 075410 (2016)]. For temperatures above this renewed limit (˜TBG/4), there is observed a suppression in energy loss rate and thermo power in SLG, but enhancement is observed in relaxation rate and thermopower in BLG, while a suppression in the energy loss rate is observed in BLG. This strong nonmonotonic temperature dependence in SLG has also been experimentally observed within the BG limit [Q. Ma et al., Phys. Rev. Lett. 112, 247401 (2014)].
Directory of Open Access Journals (Sweden)
Abolfazl Ramezanpour
2017-07-01
Full Text Available A fundamental problem in medicine and biology is to assign states, e.g., healthy or diseased, to cells, organs or individuals. State assignment or making a diagnosis is often a nontrivial and challenging process and, with the advent of omics technologies, the diagnostic challenge is becoming more and more serious. The challenge lies not only in the increasing number of measured properties and dynamics of the system (e.g., cell or human body but also in the co-evolution of multiple states and overlapping properties, and degeneracy of states. We develop, from first principles, a generic rational framework for state assignment in cell biology and medicine, and demonstrate its applicability with a few simple theoretical case studies from medical diagnostics. We show how disease–related statistical information can be used to build a comprehensive model that includes the relevant dependencies between clinical and laboratory findings (signs and diseases. In particular, we include disease-disease and sign–sign interactions and study how one can infer the probability of a disease in a patient with given signs. We perform comparative analysis with simple benchmark models to check the performances of our models. We find that including interactions can significantly change the statistical importance of the signs and diseases. This first principles approach, as we show, facilitates the early diagnosis of disease by taking interactions into accounts, and enables the construction of consensus diagnostic flow charts. Additionally, we envision that our approach will find applications in systems biology, and in particular, in characterizing the phenome via the metabolome, the proteome, the transcriptome, and the genome.
Directory of Open Access Journals (Sweden)
Huimin Zhang
2018-04-01
Full Text Available Androgen receptor (AR is a key target in the discovery of anti-PCa (Prostate Cancer drugs. Recently, a novel cyclopeptide Diffusa Cyclotide-3 (DC3, isolated from Hedyotisdiffusa, has been experimentally demonstrated to inhibit the survival and growth of LNCap cells, which typically express T877A-mutated AR, the most frequently detected point mutation of AR in castration-resistant prostate cancer (CRPC. But the interaction mechanism between DC3 and AR is not clear. Here in this study we aim to explore the possible binding mode of DC3 to T877A-mutated AR from molecular perspective. Firstly, homology modeling was employed to construct the three-dimensional structure of the cyclopeptide DC3 using 2kux.1.A as the template. Then molecular docking, molecular dynamics (MD simulations, and molecular mechanics/generalized Born surface area (MM-GBSA methods were performed to determine the bind site and explore the detailed interaction mechanism of DC3-AR complex. The obtained results suggested that the site formed by H11, loop888-893, and H12 (site 2 was the most possible position of DC3 binding to AR. Besides, hydrogen bonds, hydrophobic, and electrostatic interactions play dominant roles in the recognition and combination of DC3-AR complex. The essential residues dominant in each interaction were specifically revealed. This work facilitates our understanding of the interaction mechanism of DC3 binding to AR at the molecular level and contributes to the rational cyclopeptide drug design for prostate cancer.
The role of FaBG3 in fruit ripening and B. cinerea fungal infection of strawberry.
Li, Qian; Ji, Kai; Sun, Yufei; Luo, Hao; Wang, Hongqing; Leng, Ping
2013-10-01
In plants, β-glucosidases (BG) have been implicated in developmental and pathogen defense, and are thought to take part in abscisic acid (ABA) synthesis via hydrolysis of ABA glucose ester to release active ABA; however, there is no genetic evidence for the role of BG genes in ripening and biotic/abiotic stress in fruits. To clarify the role of BG genes in fruit, eight Fa/FvBG genes encoding β-glucosidase were isolated using information from the GenBank strawberry nucleotide database. Of the Fa/FvBG genes examined, expression of FaBG3 was the highest, showing peaks at the mature stage, coincident with the changes observed in ABA content. To verify the role of this gene, we suppressed the expression of FaBG3 via inoculation with Agrobacterium tumefaciens containing tobacco rattle virus carrying a FaBG3 fragment (RNAi). The expression of FaBG3 in FaBG3-RNAi-treated fruit was markedly reduced, and the ABA content was lower than that of the control. FaBG3-RNAi-treated fruit did not exhibit full ripening, and were firmer, had lower sugar content, and were pale compared with the control due to down-regulation of ripening-related genes. FaBG3-RNAi-treated fruit with reduced ABA levels were much more resistant to Botrytis cinerea fungus but were more sensitive to dehydration stress than control fruit. These results indicate that FaBG3 may play key roles in fruit ripening, dehydration stress and B. cinerea fungal infection in strawberries via modulation of ABA homeostasis and transcriptional regulation of ripening-related genes. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.
Energy Technology Data Exchange (ETDEWEB)
Li, Song [Vanderbilt University, Department of Chemical and Biomolecular Engineering (United States); Zhao, Xiongce [NIDDK, National Institutes of Health (United States); Mo, Yiming [Institute of Agriculture, University of Tennessee (United States); Cummings, Peter T., E-mail: cummingspt@ornl.gov [Vanderbilt University, Department of Chemical and Biomolecular Engineering (United States); Heller, William T., E-mail: hellerwt@ornl.gov [Oak Ridge National Laboratory, Center for Structural Molecular Biology (United States)
2013-07-15
Concern about the toxicity of engineered nanoparticles, such as the prototypical nanomaterial C{sub 60} fullerene, continues to grow. While, evidence continues to mount that C{sub 60} and its derivatives may pose health hazards, the specific molecular interactions of these particles with biological macromolecules require further investigation. In this article, we report combined experimental and theoretical studies on the interaction of one of the most prevalent proteins in the human body, human serum albumin (HSA), with C{sub 60} in an aqueous environment. The C{sub 60}-HSA interaction was probed by circular dichroism (CD) spectroscopy, small-angle neutron scattering (SANS), and atomistic molecular dynamics (MD) simulations to understand C{sub 60}-driven changes in the structure of HSA in solution. The CD spectroscopy demonstrates that the secondary structure of the protein decreases in {alpha}-helical content in response to the presence of C{sub 60} (0.68 nm in diameter). Similarly, C{sub 60} produces subtle changes in the solution conformation of HSA (an 8.0 nm Multiplication-Sign 3.8 nm protein), as evidenced by the SANS data and MD simulations, but the data do not indicate that C{sub 60} changes the oligomerization state of the protein, such as by inducing aggregation. The results demonstrate that the interaction is not highly disruptive to the protein in a manner that would prevent it from performing its physiological function.
Early diagnostic value of plasma PCT and BG assay for CRBSI after OLT.
Chen, J; Wang, Y; Shen, Z; Zhu, Z; Song, Y; Han, R
2011-06-01
The aim was to evaluate the role of procalcitonin (PCT) and (1-3)-β-D-glucan (BG) tests for early detection or exclusion of central venous catheter-related bloodstream infections (CRBSI) in patients after orthotopic liver transplantation (OLT). Fifty-five patients with clinically suspected CRBSI were assessed after OLT in this prospective study. On the day of clinical suspicion of CRBSI, blood samples were obtained from central venous catheters and a peripheral vein for blood cultures and from a peripheral vein for PCT and BG tests. Plasma PCT and BG values were measured by using an immunoluminometric assay and Fungitell BG assay, respectively. No prisoners or organs from prisoners were used in this study. Twenty-five patients (45%) were diagnosed with CRBIS. Among them, 13 (52%) displayed gram-positive bacteriemia, 11 (44%) gram-negative bacteriemia, and 1 (4%) fungemia. The PCT values were higher in CRBSI than in non-CRBSI patients (P = .003). CRBSI patients did not show significant increases in plasma BG values compared with non-CRBSI subjects (P = .051). PCT and BG area under receiver operating characteristic curves were 0.840 and 0.486, respectively. Sensitivity, specificity, and positive and negative predictive values of a PCT of ≥ 3.1 ng/mL for the diagnosis of CRBSI were 0.72, 0.87, 0.82, and 0.79, respectively. The figures for a BG of ≥ 83 pg/mL were 0.32, 0.90, 0.73, and 0.61, respectively. Among the 24 patients with bacteria infections, PCT was higher in patients with gram-negative than those with gram-positive bacterial infections (P = .022). We concluded that the PCT assay may be a useful rapid diagnostic adjunct for the diagnosis of suspected CRBSI in OLT patients. Copyright © 2011 Elsevier Inc. All rights reserved.
The life test of a DC circuit breaker of tokamak device JT-60 for a nuclear fusion research
International Nuclear Information System (INIS)
Shimada, Ryuichi; Tani, Keiji; Kishimoto, Hiroshi; Tamura, Sanae; Yanabu, Satoru.
1979-01-01
In the Tokamak devices for nuclear fusion research, the construction of the current transformer circuits having plasma as the secondary circuit and the change of the primary circuit current are necessary for generating current in the plasma. This is considered to be fairly difficult in practice if conventional methods using capacitor discharge and iron core coils are employed. Considering such circumstances, it was decided for JT-60 to use an air-core current transformer coil and to employ the method of storing energy in the form of current in the coil inductance instead of a capacitor. For this reason, a DC circuit breaker is required to interrupt coil current. The authors improved an AV vacuum breaker, which had been developed as the vacuum breaker of longitudinal magnetic field type applying a magnetic field in parallel with an arc, to get the one for DC circuit for the purpose of applying it to JT-60. In this paper, the operational characteristic of the DC breaker is described, the construction and function of the life test circuit is explained, and the test results are reported. Finally, interruptions of 10,000 times at 20 kA were carried out. It is successful that the restrike of arc occurring during tens of milli-seconds after interruptions was improved to 0.05% or less for 10,000 times operations. Further, it was found that the generation of arc restrike can be reduced practically to zero with two breakers in series. (Wakatsuki, Y.)
BG7: A New Approach for Bacterial Genome Annotation Designed for Next Generation Sequencing Data
Pareja-Tobes, Pablo; Manrique, Marina; Pareja-Tobes, Eduardo; Pareja, Eduardo; Tobes, Raquel
2012-01-01
BG7 is a new system for de novo bacterial, archaeal and viral genome annotation based on a new approach specifically designed for annotating genomes sequenced with next generation sequencing technologies. The system is versatile and able to annotate genes even in the step of preliminary assembly of the genome. It is especially efficient detecting unexpected genes horizontally acquired from bacterial or archaeal distant genomes, phages, plasmids, and mobile elements. From the initial phases of the gene annotation process, BG7 exploits the massive availability of annotated protein sequences in databases. BG7 predicts ORFs and infers their function based on protein similarity with a wide set of reference proteins, integrating ORF prediction and functional annotation phases in just one step. BG7 is especially tolerant to sequencing errors in start and stop codons, to frameshifts, and to assembly or scaffolding errors. The system is also tolerant to the high level of gene fragmentation which is frequently found in not fully assembled genomes. BG7 current version – which is developed in Java, takes advantage of Amazon Web Services (AWS) cloud computing features, but it can also be run locally in any operating system. BG7 is a fast, automated and scalable system that can cope with the challenge of analyzing the huge amount of genomes that are being sequenced with NGS technologies. Its capabilities and efficiency were demonstrated in the 2011 EHEC Germany outbreak in which BG7 was used to get the first annotations right the next day after the first entero-hemorrhagic E. coli genome sequences were made publicly available. The suitability of BG7 for genome annotation has been proved for Illumina, 454, Ion Torrent, and PacBio sequencing technologies. Besides, thanks to its plasticity, our system could be very easily adapted to work with new technologies in the future. PMID:23185310
BG7: a new approach for bacterial genome annotation designed for next generation sequencing data.
Directory of Open Access Journals (Sweden)
Pablo Pareja-Tobes
Full Text Available BG7 is a new system for de novo bacterial, archaeal and viral genome annotation based on a new approach specifically designed for annotating genomes sequenced with next generation sequencing technologies. The system is versatile and able to annotate genes even in the step of preliminary assembly of the genome. It is especially efficient detecting unexpected genes horizontally acquired from bacterial or archaeal distant genomes, phages, plasmids, and mobile elements. From the initial phases of the gene annotation process, BG7 exploits the massive availability of annotated protein sequences in databases. BG7 predicts ORFs and infers their function based on protein similarity with a wide set of reference proteins, integrating ORF prediction and functional annotation phases in just one step. BG7 is especially tolerant to sequencing errors in start and stop codons, to frameshifts, and to assembly or scaffolding errors. The system is also tolerant to the high level of gene fragmentation which is frequently found in not fully assembled genomes. BG7 current version - which is developed in Java, takes advantage of Amazon Web Services (AWS cloud computing features, but it can also be run locally in any operating system. BG7 is a fast, automated and scalable system that can cope with the challenge of analyzing the huge amount of genomes that are being sequenced with NGS technologies. Its capabilities and efficiency were demonstrated in the 2011 EHEC Germany outbreak in which BG7 was used to get the first annotations right the next day after the first entero-hemorrhagic E. coli genome sequences were made publicly available. The suitability of BG7 for genome annotation has been proved for Illumina, 454, Ion Torrent, and PacBio sequencing technologies. Besides, thanks to its plasticity, our system could be very easily adapted to work with new technologies in the future.
Modelling an Interactive Road Signs System, Using Petri Nets
Directory of Open Access Journals (Sweden)
Kombe Timothee
2017-03-01
Full Text Available This paper is a contribution to the problems of road insecurity in Africa. Due to non-respect of road sign and to the lack of signing, roads have become places of all dangers. It becomes imperative to establish an interaction between the authorities and the offending drivers. To reach this goal, we modelled an interactive road-vehicle-signage system, who locally informs the driver on the requirements of traffic signs. This model having interest only in the event of driving by bad weather or deterioration of panels, we are amending by inserting functions aimed to warn and punish the driver in the event of maintenance of an offense. Indeed, when the driver is about to commit a fault, firstly the system issues a warming (visual, audible or mechanical. Then, a message (SMS is sent to the authorities. We include the concept of floating process engaged by devices other than the signage. We show that, with a few considerations, from the functional point of view, they are identical to the process engaged by the signage. Furthermore, in terms of performance, the model renewed warnings that occurred just before the end panel of prohibitions. It stores messages of offenses occurred without the network, then notifies them when a network is detected. We propose algorithms for incremental design and analysis of the model, whose processes are activated and / or are extinguished, according to the type of sign or tag encountered. We show by simulation and by linear algebra that, the model retains its properties of absence of blocking and boundedness during the evolution of the system, hence its validation.
Electronic structure of C28, Pa at sign C28, and U at sign C28
International Nuclear Information System (INIS)
Zhao, K.; Pitzer, R.M.
1996-01-01
Electronic structure calculations, including relativistic core potentials and the spin-orbit interaction, have been carried out on the C 28 , Pa at sign C 28 , and U at sign C 28 species. Excitation energies, spin-orbit splittings, the electron affinity, and the ionization potential are computed for C 28 . The ground state of C 28 is described well by the Hartree-Fock wave functions, but other states are not. The computed electron affinity and ionization potential are similar to those of C 60 . Strong metal-cage binding is found for Pa at sign C 28 and U at sign C 28 , similar to that in U(C 8 H 8 ) 2 . The ground electronic states depend on the order of the lowest-energy cage π * and metal 5f orbitals, with (π * ) 1 and (π * ) 1 (5f) 1 found to be the ground electronic configurations for the two complexes. U at sign C 28 is found to be diamagnetic. 30 refs., 1 fig., 13 tabs
Gene calling and bacterial genome annotation with BG7.
Tobes, Raquel; Pareja-Tobes, Pablo; Manrique, Marina; Pareja-Tobes, Eduardo; Kovach, Evdokim; Alekhin, Alexey; Pareja, Eduardo
2015-01-01
New massive sequencing technologies are providing many bacterial genome sequences from diverse taxa but a refined annotation of these genomes is crucial for obtaining scientific findings and new knowledge. Thus, bacterial genome annotation has emerged as a key point to investigate in bacteria. Any efficient tool designed specifically to annotate bacterial genomes sequenced with massively parallel technologies has to consider the specific features of bacterial genomes (absence of introns and scarcity of nonprotein-coding sequence) and of next-generation sequencing (NGS) technologies (presence of errors and not perfectly assembled genomes). These features make it convenient to focus on coding regions and, hence, on protein sequences that are the elements directly related with biological functions. In this chapter we describe how to annotate bacterial genomes with BG7, an open-source tool based on a protein-centered gene calling/annotation paradigm. BG7 is specifically designed for the annotation of bacterial genomes sequenced with NGS. This tool is sequence error tolerant maintaining their capabilities for the annotation of highly fragmented genomes or for annotating mixed sequences coming from several genomes (as those obtained through metagenomics samples). BG7 has been designed with scalability as a requirement, with a computing infrastructure completely based on cloud computing (Amazon Web Services).
A study of wrong-sign single muon production in νμ-nucleon interaction
International Nuclear Information System (INIS)
Mishra, S.R.; Auchincloss, P.S.; Blair, R.; Haber, C.; Ruiz, M.; Oltman, E.; Sciulli, F.J.; Shaevitz, M.H.; Smith, W.H.; Merritt, F.S.; Oreglia, M.; Reutens, P.; Coleman, R.; Fisk, H.E.; Lamm, M.J.; Levinthal, D.; Yovanovitch, D.D.; Marsh, W.; Rapidis, P.A.; White, H.B.; Bodek, A.; Borcherding, F.; Giokaris, N.; Lang, K.; Stockdale, I.E.
1989-01-01
We report on a search for ν μ -induced events where the single emerging muon carries lepton number opposite that of the incident neutrino. The rate and kinematic quantities of the candidate events are compared with known backgrounds from anti ν μ -induced charged current interactions and ν-induced interactions that produce dileptons. We derive an upper limit on the rate of wrong-sign single muon production relative to the rate of ν μ charged current interactions to be 1.6x10 -4 for y -4 for y>0.5 (90% CL). These upper limits enable us to constrain exotic sources of wrong-sign muons such as the charm component of the nucleon sea, flavor changing neutral currents and lepton number violating processes. Finally, the rate and kinematic properties of these events are compared with those of the neutrino-induced opposite-sign dimuon events. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Ma Yanxuan; Zheng Yudong; Huang Xiaoshan; Xi Tingfei; Han Dongfei [School of Materials Science and Engineering, Beijing University of Science and Technology, Beijing 100083 (China); Lin Xiaodan [College of Materials Science and Engineering, South China University of Technology, Guangzhou 510640 (China); Song Wenhui, E-mail: zhengyudong@mater.ustb.edu.c, E-mail: wenhui.song@brunel.ac.u [Wolfson Center for Materials Processing, School of Engineering and Design, Brunel University, West London, UB8 3PH (United Kingdom)
2010-04-15
Due to the non-bioactivity and poor conjunction performance of present cartilage prostheses, the main work here is to develop the bioactive glass-polyvinyl alcohol hydrogel articular cartilage/bone (BG-PVA/bone) composite implants. The essential criterion for a biomaterial to bond with living bone is well-matched mechanical properties as well as biocompatibility and bioactivity. In vitro studies on the formation of a surface layer of carbonate hydroxyl apatite (HCA) and the corresponding variation of the properties of biomaterials are imperative for their clinical application. In this paper, the mineralization behavior and variation of the interface properties of BG-PVA/bone composites were studied in vitro by using simulated body fluid (SBF). The mineralization and HCA layer formed on the interface between the BG-PVA hydrogel and bone in SBF could provide the composites with bioactivity and firmer combination. The compression property, shear strength and interface morphology of BG-PVA/bone composite implants varying with the immersion time in SBF were characterized. Also, the influence laws of the immersion time, content of BG in the composites and aperture of bones to the mineralization behavior and interface properties were investigated. The good mineralization behavior and enhanced conjunction performance of BG-PVA/bone composites demonstrated that this kind of composite implant might be more appropriate cartilage replacements.
Ma, Yanxuan; Zheng, Yudong; Huang, Xiaoshan; Xi, Tingfei; Lin, Xiaodan; Han, Dongfei; Song, Wenhui
2010-04-01
Due to the non-bioactivity and poor conjunction performance of present cartilage prostheses, the main work here is to develop the bioactive glass-polyvinyl alcohol hydrogel articular cartilage/bone (BG-PVA/bone) composite implants. The essential criterion for a biomaterial to bond with living bone is well-matched mechanical properties as well as biocompatibility and bioactivity. In vitro studies on the formation of a surface layer of carbonate hydroxyl apatite (HCA) and the corresponding variation of the properties of biomaterials are imperative for their clinical application. In this paper, the mineralization behavior and variation of the interface properties of BG-PVA/bone composites were studied in vitro by using simulated body fluid (SBF). The mineralization and HCA layer formed on the interface between the BG-PVA hydrogel and bone in SBF could provide the composites with bioactivity and firmer combination. The compression property, shear strength and interface morphology of BG-PVA/bone composite implants varying with the immersion time in SBF were characterized. Also, the influence laws of the immersion time, content of BG in the composites and aperture of bones to the mineralization behavior and interface properties were investigated. The good mineralization behavior and enhanced conjunction performance of BG-PVA/bone composites demonstrated that this kind of composite implant might be more appropriate cartilage replacements.
Electronic structure of an anticancer drug DC81 and its interaction with DNA base pairs
Energy Technology Data Exchange (ETDEWEB)
Tiwari, Gargi, E-mail: gargi.tiwari@rediffmail.com; Sharma, Dipendra, E-mail: d-11sharma@rediffmail.com; Dwivedi, K. K., E-mail: dwivedikarunesh4@gmail.com [Department of Physics, DDU Gorakhpur University, Gorakhpur (India); Dwivedi, M. K., E-mail: dwivedi-ji@rediffmail.com [Department of Physics, Banaras Hindu University, Varanasi (India)
2016-05-06
The drug, 8-Hydroxy-7-methoxy-pyrrolo-[2,1-c][1,4] benzodiazepine-5-one, commonly christened as DC81 belongs to the pyrrolo-[2,1-c][1,4]benzodiazepine (PBDs) family. It is a member of the group of naturally occurring antitumour antibiotics produced by various Streptomyces species. The antitumour activity of DC81 is attributed to its sequence specific interaction with G-C rich DNA region in particular, for Pu-G-Pu motifs. In the present paper, physico-chemical properties DC81 have been carried out using an ab-initio method, HF/6-31G(d,p) with GAMESS program. MEP, HOMO and LUMO surfaces have been scanned. Ionization potential, electron affinity, electronegativity, global hardness and softness of the drug have been calculated. Further, drug-DNA interactions have been examined using modified second order perturbation theory along with multicentred-multipole expansion technique. Results have been discussed in the light of other theoretical and experimental observations. Efforts have been made to elucidate the binding patterns and thereby biological properties of the drug.
Directory of Open Access Journals (Sweden)
Elis P A Batista
Full Text Available Odour-baited technologies are increasingly considered for effective monitoring of mosquito populations and for the evaluation of vector control interventions. The BG-Malaria trap (BGM, which is an upside-down variant of the widely used BG-Sentinel trap (BGS, has been demonstrated to be effective to sample the Brazilian malaria vector, Anopheles darlingi. We evaluated the BGM as an improved method for sampling the African malaria vectors, Anopheles arabiensis. Experiments were conducted inside a large semi-field cage to compare trapping efficiencies of BGM and BGS traps, both baited with the synthetic attractant, Ifakara blend, supplemented with CO2. We then compared BGMs baited with either of four synthetic mosquito lures, Ifakara blend, Mbita blend, BG-lure or CO2, and an unbaited BGM. Lastly, we compared BGMs baited with the Ifakara blend dispensed via either nylon strips, BG cartridges (attractant-infused microcapsules encased in cylindrical plastic cartridge or BG sachets (attractant-infused microcapsules encased in plastic sachets. All tests were conducted between 6P.M. and 7A.M., with 200-600 laboratory-reared An. arabiensis released nightly in the test chamber. The median number of An. arabiensis caught by the BGM per night was 83, IQR:(73.5-97.75, demonstrating clear superiority over BGS (median catch = 32.5 (25.25-37.5. Compared to unbaited controls, BGMs baited with Mbita blend caught most mosquitoes (45 (29.5-70.25, followed by BGMs baited with CO2 (42.5 (27.5-64, Ifakara blend (31 (9.25-41.25 and BG lure (16 (4-22. BGM caught 51 (29.5-72.25 mosquitoes/night, when the attractants were dispensed using BG-Cartridges, compared to BG-Sachet (29.5 (24.75-40.5, and nylon strips (27 (19.25-38.25, in all cases being significantly superior to unbaited controls (p < 000.1. The findings demonstrate potential of the BGM as a sampling tool for African malaria vectors over the standard BGS trap. Its efficacy can be optimized by selecting
Van Hamme, Evelien; Desmarets, Lowiese; Dewerchin, Hannah L; Nauwynck, Hans J
2011-09-01
Two potential receptors have been described for the feline infectious peritonitis virus (FIPV): feline aminopeptidase N (fAPN) and feline dendritic cell-specific intercellular adhesion molecule grabbing non-integrin (fDC-SIGN). In cell lines, fAPN serves as a receptor for serotype II, but not for serotype I FIPV. The role of fAPN in infection of in vivo target cells, monocytes, is not yet confirmed. Both serotype I and II FIPVs use fDC-SIGN for infection of monocyte-derived cells but how is not known. In this study, the role of fAPN and fDC-SIGN was studied at different stages in FIPV infection of monocytes. First, the effects of blocking the potential receptor(s) were studied for the processes of attachment and infection. Secondly, the level of co-localization of FIPV and the receptors was determined. It was found that FIPV I binding and infection were not affected by blocking fAPN while blocking fDC-SIGN reduced FIPV I binding to 36% and practically completely inhibited infection. Accordingly, 66% of bound FIPV I particles co-localized with fDC-SIGN. Blocking fAPN reduced FIPV II binding by 53% and infection by 80%. Further, 60% of bound FIPV II co-localized with fAPN. fDC-SIGN was not involved in FIPV II binding but infection was reduced with 64% when fDC-SIGN was blocked. In conclusion, FIPV I infection of monocytes depends on fDC-SIGN. Most FIPV I particles already interact with fDC-SIGN at the plasma membrane. For FIPV II, both fAPN and fDC-SIGN are involved in infection with only fAPN playing a receptor role at the plasma membrane. Copyright © 2011 Elsevier B.V. All rights reserved.
Synthesis and degradation properties of β-TCP/BG porous ...
Indian Academy of Sciences (India)
-TCP/BG porous composite materials were successfully fabricated by foaming technology. X-ray diffraction was used to determine the crystal structure of powders. The pore size and distribution of the resulting materials were characterized using scanning electron microscopy. The porosity and degradation performance of ...
Polymerization kinetics of experimental bioactive composites containing bioactive glass.
Par, Matej; Tarle, Zrinka; Hickel, Reinhard; Ilie, Nicoleta
2018-06-21
To investigate the polymerization kinetics and the degree of conversion (DC) of experimental resin composites with varying amount of bioactive glass 45S5 (BG). Experimental resin composites based on a photo-curable Bis-GMA/TEGDMA resin system were prepared. The composite series contained 0, 5, 10, 20, and 40 wt% of BG and reinforcing fillers up to the total filler amount of 70 wt%. Composite specimens were light cured with 1,219 mW/cm 2 for 20 or 40 s and their DC was monitored during 5 min at the data collection rate of 2 s -1 using attenuated total reflectance Fourier transform infrared spectroscopy (ATR-FTIR). The 5-min DC values for experimental composites were in the range of 42.4-55.9% and 47.3-57.9% for curing times of 20 and 40 s, respectively. The differences in the 5-min DC between curing times of 20 s or 40 s became more pronounced in materials with higher BG amount. Within both curing times, a decreasing trend of the 5-min DC values was observed with the increasing percentage of BG fillers. The maximum polymerization rate also decreased consistently with the increasing BG amount. Unsilanized BG fillers showed a dose-dependent inhibitory effect on polymerization rate and the DC. Extending the curing time from 20 to 40 s showed a limited potential to improve the DC of composites with higher BG amount. The observed inhibitory effect of BG fillers on the polymerization of resin composites may have a negative influence on mechanical properties and biocompatibility. Copyright © 2018. Published by Elsevier Ltd.
International Nuclear Information System (INIS)
Kiselev, M.A.; Janich, M.; Hildebrand, A.; Strunz, P.; Neubert, R.H.H.; Lombardo, D.
2013-01-01
Highlights: • Self-assembly in model DPPC lipids and NaDC bile salt by SANS and DLS experiments. • Bile salt creates structural interference against cohesive tendency of DPPC bilayers. • NaDC steric interactions cause transition toward different supramolecular structures. - Abstract: Small angle neutron scattering (SANS) and dynamic light scattering (DLS) were used to study different aggregation states in sodium deoxycholate (NaDC)-phosphatidylcholine systems at T = 60 °C. Size and shape of the aggregates investigated as a function of the NaDC bile salt concentration (at the constant DPPC concentration of 6 mM) indicate a strong dependence of the size and morphology of the generated aggregates on the relative amount of NaDC bile salt. More specifically large occupied area of the bile salt induces a steric interaction which promotes the transition toward a variety of supramolecular structures ranging from ellipsoidal vesicles, ribbon-like structures, up to final spherical mixed micelles at the large amount of bile salt of 10 mM NaDC. The findings of the obtained results give important insight for understanding the formation of different topologies in aqueous lipid–bile salt mixtures as well as stimulate new routes for liposome reconstitution–solubilisation processes suitable for technological applications
Cicchino, Jessica B; Wells, Joann K; McCartt, Anne T
2014-01-01
Pedestrians represent more than one third of all traffic deaths in Washington, D.C. The District plans to expand its long-standing automated traffic enforcement program in 2013 from speed and red light cameras to cameras to enforce pedestrian right-of-way laws at crosswalks and stop sign laws. This study collected information on the opinions, behaviors, and knowledge of D.C. residents related to camera enforcement and pedestrian safety issues. A telephone survey of 801 adult D.C. residents was conducted in November 2012 with approximately equal numbers of respondents in each of D.C.'s eight wards. Quotas were used to ensure that the sample was representative of the demographic characteristics of adults in each ward. For analyses combining responses across the wards, data were weighted to correspond with the demographic characteristics of adults in the city. Most respondents believed that drivers speeding, running red lights, running stop signs, and not stopping for pedestrians are serious threats to their safety. Respondents strongly supported the speed and red light camera programs, with 76 percent of respondents favoring speed cameras and 87 percent favoring red light cameras. Support was more limited for the camera enforcement that was not yet in place at the time of the survey, with 50 percent of respondents favoring stop sign cameras and 47 percent of respondents favoring crosswalk cameras. Twenty-four percent of respondents had not driven a car in D.C. in the past month, and higher proportions of these nondrivers favored speed cameras (90%), stop sign cameras (67%), and crosswalk cameras (59%) than respondents who drove in D.C. in the past month. Respondents who supported camera enforcement cited safety as their main reason. More than 9 in 10 respondents knew that D.C. law requires drivers to stop for pedestrians crossing the street in marked crosswalks at intersections without traffic signals and midblock, but only 54 percent knew that drivers must stop for
International Nuclear Information System (INIS)
2003-01-01
In the Chapter 2 the DC-60 specialized accelerator project of the Inter-disciplinary research complex in the L.N. Gumilev Eurasian State University is described. The DC-60 cyclotron is intended for applied studies which can be accomplished on both the ion beams of the electron cyclotron resonance source with voltage up to 25 kV and the accelerated ions from carbon to xenon. The cyclotron is design on the base of compact magnet with weight about 74 tonnes, and it mean magnetic field is 1.6 T, section angle - 50 Deg. Design of the Inter-disciplinary research complex building in the L.N. Gumilev Eurasian State University is described as well. Technical performances of the building and their parameters are given
Dia, Vermont P; Krishnan, Hari B
2016-09-15
Momordica charantia is a perennial plant with reported health benefits. BG-4, a novel peptide from Momordica charantia, was isolated, purified and characterized. The trypsin inhibitory activity of BG-4 is 8.6 times higher than purified soybean trypsin inhibitor. The high trypsin inhibitory activity of BG-4 may be responsible for its capability to cause cytotoxicity to HCT-116 and HT-29 human colon cancer cells with ED50 values of 134.4 and 217.0 μg/mL after 48 h of treatment, respectively. The mechanism involved in the cytotoxic effect may be associated with induction of apoptosis as evidenced by increased percentage of HCT-116 and HT-29 colon cancer cells undergoing apoptosis from 5.4% (untreated) to 24.8% (BG-4 treated, 125 μg/mL for 16 h) and 8.5% (untreated) to 31.9% (BG-4 treated, 125 μg/mL for 16 h), respectively. The molecular mechanistic explanation in the apoptosis inducing property of BG-4 is due to reduced expression of Bcl-2 and increased expression of Bax leading to increased expression of caspase-3 and affecting the expression of cell cycle proteins p21 and CDK2. This is the first report on the anti-cancer potential of a novel bioactive peptide isolated from Momordica charantia in vitro supporting the potential therapeutic property of BG-4 against colon cancer that must be addressed using in vivo models of colon carcinogenesis.
Integrated Fuel-Coolant Interaction (IFCI 6.0) code
International Nuclear Information System (INIS)
Davis, F.J.; Young, M.F.
1994-04-01
The integrated Fuel-Coolant interaction (IFCI) computer code is being developed at Sandia National Laboratories to investigate the fuel-coolant interaction (FCI) problem at large scale using a two-dimensional, four-field hydrodynamic framework and physically based models. IFCI will be capable of treating all major FCI processes in an integrated manner. This document is a product of the effort to generate a stand-alone version of IFCI, IFCI 6.0. The User's Manual describes in detail the hydrodynamic method and physical models used in IFCI 6.0. Appendix A is an input manual, provided for the creation of working decks
Directory of Open Access Journals (Sweden)
Eka Prasetyono
2015-09-01
Full Text Available Bidirectional DC-DC converter is needed in the energy storage system. The converter topology used in this paper was a non-isolated bidirectional DC-DC buck-boost converter. This converter worked in two ways, which the charging mode stored energy into battery when load current was less than nominal main DC current (set point and discharging mode transferred energy from battery to the load when its current exceeded set point value. Both of these modes worked automatically according to the load current. The charging and discharging currents were controlled by fuzzy logic controller which was implemented on microcontroller ARM Cortex-M4F STM32F407VG. This paper compares two types of fuzzy membership function (triangular and sigmoid in controlling bidirectional DC-DC converter. The results showed that fuzzy logic controller with triangle membership function and sigmoid as control bidirectional DC-DC converter had no significant different response, both had an average error for charging and discharging process under 4% with ripple current on the main DC bus around 0.5%. The computing time of program for fuzzy logic controller with triangular membership functions had 19.01% faster than sigmoid, and fuzzy logic computation time on a microcontroller with hardware floating point was 60% faster than software floating point.
International Nuclear Information System (INIS)
Kim, Ho Sung; Jeong, Jong Cheol; Kim, Keon Jung; Choi, Jae Sun; Sung, Dae Kyung; Lee, Gye Huyk; Kim, Jong Ho
1998-01-01
The aims of this study was to compare the diagnostic accuracy of Conventional Radiography (CR). Radionuclide Angiography (RNA). Planar Scintigraphy (PS) and Single Photon Emission Computed Tomography (SPECT) for the evaluation of temporomandibular joint (TMJ) disorder; and to show whether technetium-99m-MDP uptake on quantitative SPECT correlated with the symptom and/or signs. Three Phase Bone Scintigraphy (TPBS) and SPECT of both TMJ were performed in 51 patients (M : F = 10 : 41 mean age= 30.4 :28.6, respectively) with unilateral TMJ disorder after an intravenous injection of 25 mCi (925 MBq) of 99mTc-MDP. Data were analyzed by creating three regions of interest (ROIs) over designated areas both on the PS and SPECT: Lesion (L). Non-lesion(NL) which is contralateral to L and Background (BG). L/ NL and L/BG (=[(L-BG)/500,000] x 100 (%)] ratios were calculated for each patients. L/NL ratios on SPECT were compared according to the symptom/signs or not. There was a fair correlation of L/N values between three slice-and seven slice-added SPECT images (r=0.5124, p=0.006, y=0.5588 + 0.5414X). The percentages of symptoms or signs were: pain (76.5%), mouth opening limitation (49.0%), joint sound (39.2%), discomfort (43.1%), headache(27.5%), neck stiffness (21.6%), closed lock (5.9%) / tenderness (47.1%), joint click (54.9%) and limitation of maximum mouth opening (45.1%). The Sensitive of SPECT(86.3%) was better than PS(66.7%), RNA(27.5%), and CR(26.3%). According to the presence of symptom/sign or not, comparative analysis of L/NL ratios on SPECT showed a fair correlation in pain (1.16 : 1.11) mouth opening limitation (1.21 : 1.09), joint sound (1.19 : 1.08), discomfort (1.22 : 1.09), headache (1.19: 1.13), tenderness (1.16 : 1.14) and limitation of maximum mouth opening (1.16 : 1.13), but little correlation in neck stiffness (1.12 : 1.15), closed lock (1.06 : 1.15), dislocation (1.08 : 1.15) joint click (1.12 : 1.18). In conclusion, quantitative SPECT is the noninvasive
Implementation of DoS attack and mitigation strategies in IEEE 802.11b/g WLAN
Deng, Julia; Meng, Ke; Xiao, Yang; Xu, Roger
2010-04-01
IEEE 802.11 wireless Local Area Network (WLAN) becomes very prevalent nowadays. Either as a simple range extender for a home wired Ethernet interface, or as a wireless deployment throughout an enterprise, WLAN provides mobility, convenience, and low cost. However, an IEEE 802.11b/g wireless network uses the frequency of unlicensed 2.4GHz, which makes the network unsafe and more vulnerable than traditional Ethernet networks. As a result, anyone who is familiar with wireless network may initiate a Denial of Service (DoS) attack to influence the common communication of the network or even make it crash. In this paper, we present our studies on the DoS attacks and mitigation strategies for IEEE 802.11b/g WLANs and describe some initial implementations using IEEE 802.11b/g wireless devices.
Characterization of BG28 and KG3 filter glass for Drive Diagnostic Attenuators
Energy Technology Data Exchange (ETDEWEB)
Page, R H; Weiland, T; Folta, J
2007-11-30
BG28 and KG3 filter glasses were tested for use as attenuators in the NIF drive diagnostic (DrD) systems. Tests were performed in the Optical Sciences Laser facility with a 351 nm, 2-step, 3-nsec pulse at fluences ranging up to {approx} 1 J/cm{sup 2}. Single-shot measurements showed no solarization when the samples were allowed to relax for a week after exposure. KG3 filters exhibited no luminescence and no transient pulse distortion. BG28 filters luminesced appreciably and imposed a 'droop' (similar to 'square-pulse distortion') on the signals. The droop parameter is estimated at 0.50 {+-} 0.11 cm{sup 2}/J. Droop is explained in terms of known copper-doped-glass spectroscopy and kinetics (buildup of triplet-state populations, with excited-state absorption). Simulation of the distortion ({approx}1.6%) expected on a 1.8 MJ Haan pulse led to a minor redesign of the Drive Diagnostic with reduced fluence on the BG28 filters to reduce the droop distortion to 0.5%.
B-G cDNA clones have multiple small repeats and hybridize to both chicken MHC regions
DEFF Research Database (Denmark)
Kaufman, J; Salomonsen, J; Skjødt, K
1989-01-01
We used rabbit antisera to the chicken MHC erythrocyte molecule B-G and to the class I alpha chain (B-F) to screen lambda gt11 cDNA expression libraries made with RNA selected by oligo-dT from bone marrow cells of anemic B19 homozygous chickens. Eight clones were found to encode B-G molecules which...
Retrospective evaluation of xylitol ingestion in dogs: 192 cases (2007-2012).
DuHadway, Meghan R; Sharp, Claire R; Meyers, Katherine E; Koenigshof, Amy M
2015-01-01
To summarize the signalment, clinical signs, prevalence of decreased blood glucose concentration (BG), prevalence of increased liver values, treatment, and outcome in dogs known to have ingested xylitol. Retrospective study from December 2007 to February 2012 SETTING: Three university teaching hospitals. One hundred ninety-two client-owned dogs with known or suspected xylitol ingestion. None. The median ingested xylitol dose was 0.32 g/kg (range 0.03-3.64 g/kg). Clinical signs were present in 39 (20%) dogs on presentation to the veterinary teaching hospitals. The most common clinical sign was vomiting (n = 25), followed by lethargy (12). The median duration of clinical signs prior to presentation was 93 minutes (range 0-5,040 minutes). Dogs that developed clinical signs ingested a significantly higher dose of xylitol than those that were asymptomatic. Thirty dogs became hypoglycemic (BG ≤ 3.3 mmol/L [60 mg/dL]) at some time point during their hospitalization. When evaluating all dogs, there was a significant difference between the initial and lowest BGs. Thirty dogs had increased alanine aminotransferase activity or total serum bilirubin concentration. Dogs with increases in alanine aminotransferase activity or total serum bilirubin concentration had a significantly lower nadir BG. All dogs survived to discharge and 158 were known to be alive at 28 days. The rest were lost to follow up. The prognosis for dogs evaluated by a veterinarian that ingest lower doses of xylitol and do not develop liver failure is excellent. Dogs ingesting xylitol should be hospitalized and monitored for variations in BG, because BG drops in most dogs following presentation. Additional studies are needed in dogs ingesting higher doses of xylitol before correlations between dose and the development of clinical signs or liver failure can be established. Treatment and prognosis for these dogs warrants further investigation. © Veterinary Emergency and Critical Care Society 2015.
Directory of Open Access Journals (Sweden)
Barbara Nieradko-Iwanicka
2018-02-01
Full Text Available Background Archibald's sign, or metacarpal sign is defined as shortening of the IV and V metacarpal bones, is a rare phenomenon found in the Turner syndrome, homocystinuria and in Albright's osteodystrophy. Objectives The aim of the article was to show a rare case of metacarpal sign with atypical shortening of the III and IV metacarpal bones not connected with gonadal dysgenesia, genetic disorders nor osteodystrophy. Material and methods Case report of a 60-year-old female patient. Results Artchibald's metacarpal sign in the described case was accompanied by erosive arthritis in the left lower extremity. No features of genetic disorders nor gonadal disgenesia were found in the patient. Undifferentiated seronegative asymmetric erosive arthritis developed in the patient. The level of parathormon was within the normal range. No signs of tumor were seen in bone scintigraphy. Conclusions Archibald's metacarpal sign may be present in patients without genetic disorders.
Colwell, Cynthia; Memmott, Jenny; Meeker-Miller, Anne
2014-01-01
The purpose of this study was to determine the efficacy of using music and/or sign language to promote early communication in infants and toddlers (6-20 months) and to enhance parent-child interactions. Three groups used for this study were pairs of participants (care-giver(s) and child) assigned to each group: 1) Music Alone 2) Sign Language…
DC electric springs with DC/DC converters
DEFF Research Database (Denmark)
Wang, Qingsong; Cheng, Ming; Jiang, Yunlei
2016-01-01
The concept of DC electric spring (DCES) was recently proposed to solve the stability issue caused by integrating intermittent renewable energy sources (RESs) to DC microgrids. In this paper, a new topology of DCES is proposed based on DC/DC converters. The proposed DCES consists of a bi-directio......The concept of DC electric spring (DCES) was recently proposed to solve the stability issue caused by integrating intermittent renewable energy sources (RESs) to DC microgrids. In this paper, a new topology of DCES is proposed based on DC/DC converters. The proposed DCES consists of a bi...... and/or constant discharging for batteries is adopted and four operating modes are analyzed as charging-positive, charging-negative, discharging-positive and discharging-negative modes. An additional mechanism for fast charging or fast discharging is also designed to secure normal operation...... of batteries. With the proposed DCES, the power fluctuations due to intermittent RESs can be passed to non-critical loads (NCLs) and batteries while power on critical loads (CLs) is kept stable. This is possibly the first attempt to design a DCES with only DC/DC converters. The performances of the proposed...
Directory of Open Access Journals (Sweden)
P. Kowstubha
2016-12-01
Full Text Available Performance Analysis of Pulse Analog Control Schemes, predominantly Pulse-Width Modulation (PWM and Pulse-Position Modulation (PPM for LLC resonant DC/DC converter suitable in portable applications is addressed in this paper. The analysis is done for closed loop performance, frequency domain performance, primary and secondary side conduction losses and soft commutation using PSIM 6.0 software and observed that PPM scheme provides better performance at high input voltage with a good selectivity of frequency over a wide range of line and load variations. The performance of LLC resonant DC/DC converter is demonstrated using PPM scheme for a design specifications of 12 V, 5 A output.
Czech Academy of Sciences Publication Activity Database
Aad, G.; Abajyan, T.; Abbott, B.; Böhm, Jan; Chudoba, Jiří; Havránek, Miroslav; Hejbal, Jiří; Jakoubek, Tomáš; Kepka, Oldřich; Kupčo, Alexander; Kůs, Vlastimil; Lysák, Roman; Lokajíček, Miloš; Marčišovský, Michal; Mikeštíková, Marcela; Myška, Miroslav; Němeček, Stanislav; Růžička, Pavel; Schovancová, Jaroslava; Šícho, Petr; Staroba, Pavel; Svatoš, Michal; Taševský, Marek; Tic, Tomáš; Vrba, Václav
2013-01-01
Roč. 88, č. 7 (2013), "072001-1"-"072001-22" ISSN 1550-7998 R&D Projects: GA MŠk(CZ) LG13009 Institutional support: RVO:68378271 Keywords : tracks * multiplicity * final state * dimuon * same sign * black hole * mass * gravitation * model * ATLAS * CERN LHC Coll * background Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders Impact factor: 4.864, year: 2013
DEFF Research Database (Denmark)
Salomonsen, J; Eriksson, H; Skjødt, K
1991-01-01
The polymorphic B-G region of the chicken major histocompatibility complex has previously been shown to mediate an "adjuvant effect" on the humoral response to other erythrocyte alloantigens. We demonstrate here that B-G molecules purified with monoclonal antibodies exert this adjuvant effect...... on the production of alloantibodies to chicken class I (B-F) molecules, when the two are in the same liposome. The adjuvant effect may in part be mediated by antibodies, since the antibody response to B-G molecules occurs much faster than the response to B-F molecules, and conditions in which antibodies to B......-G are present increase the speed of the response to B-F molecules. We also found that the presence of B-G molecules in separate liposomes results in a lack of response to B-F molecules. In the light of this and other data, we consider the possible roles for the polymorphic B-G molecules, particularly...
Stability analysis of a high-step-Up DC grid-connected two-stage boost DC-DC converter
Directory of Open Access Journals (Sweden)
El Aroudi A.
2014-01-01
Full Text Available High conversion ratio switching converters are used whenever there is a need to step-up dc source voltage level to a much higher output dc voltage level such as in photovoltaic systems, telecommunications and in some medical applications. A simple solution for achieving this high conversion ratio is by cascading different stages of dc-dc boost converters. The individual converters in such a cascaded system are usually designed separately applying classical design criteria. However these criteria may not be applicable for the complete cascaded system . This paper first presents a glimpse on the bifurcation behavior that a cascade connection of two boost converters can exhibit. It is shown that the desired periodic orbit can undergo period doubling leading to subharmonic oscillations and chaotic regimes. Then, in order to simplify the analysis the second stage is considered as constant current sink and design-oriented analysis is carried out to obtain stability boundaries in the parameter space by taking into account slope interactions between the state variables in the two-different stages.
Momordica charantia is a perennial plant with reported health benefits. BG-4, a novel peptide from Momordica charantia, was isolated, purified and characterized. The trypsin inhibitory activity of BG-4 is 8.6 times higher than purified soybean trypsin inhibitor. The high trypsin inhibitory activity ...
TeBG- and CBG-bound steroid hormones in rabbits are available for influx into uterus in vivo
International Nuclear Information System (INIS)
Chaudhuri, G.; Steingold, K.A.; Pardridge, W.M.; Judd, H.L.
1988-01-01
The metabolic clearance rate (MCR) of gonadal or adrenal steroid hormones in rabbits often does not bear the expected inverse relationship with hormone binding to testosterone-binding globulin (TeBG) or corticosteroid-binding globulin (CBG). This suggests TeBG or CBG may not impede steroid hormone delivery to tissues. The effects of rabbit plasma proteins on the influxes of 3 H-labeled steroids from the circulation into the rabbit uterus were measured in vivo using a tissue sampling single-injection technique. In the absence of plasma proteins, estradiol (E 2 ) and testosterone (T) were freely diffusible through the uterine microvasculature (i.e., extraction >80%). The extractions of dihydrostestosterone (DHT) and corticosterone (B) ranged from 60 to 72%, while that of cortisol (F) was reduced at 40%. Rabbit serum exerted no inhibition of the influxes of the steroids tested. The influxes of T and B greatly exceeded the rates that would be expected if only the free and albumin-bound fractions estimated in vitro were diffusible in vivo. However, the extraction of [ 3 H]corticosteroid-binding globulin or bovine [ 3 H]albumin were low, consistent with little, if any, extravascular uptake of the plasma proteins. The results indicate both albumin-bound and globulin-bound steroid hormone are available for transport into the uterus in the rabbit in vivo without significant exodus of the plasma protein, per se
A Unidirectional DC-DC Autotransformer for DC Grid Application
Directory of Open Access Journals (Sweden)
Meng Zhou
2018-03-01
Full Text Available Conventional unidirectional DC-DC converters for DC grid application employ DC-AC-DC two-stage conversion technology and suffer from high converter cost and power loss. To solve these issues, a unidirectional step-up DC-DC autotransformer (UUDAT and a unidirectional step-down DC-DC autotransformer (DUDAT are studied. The UUDAT and DUDAT are composed of a series connection of diode bridges and voltage source converters. Topologies of UUDAT and DUDAT are detailed. The harmonic and un-controllability issues are discussed. Control and possible application scenarios for UUDAT and DUDAT are depicted. DC fault isolation mechanism and the methods of dimensioning the voltage and power ratings of the components in UUDAT and DUDAT are studied. Extensive simulations on power system level and experiments on a UUDAT and DUDAT prototype verified their technical feasibility.
Medvedeff, Megan; Gregory, Jane Brodie; Levy, Paul E
2008-01-01
In the current study, we examined the interactive effects of feedback type and sign on feedback-seeking behaviour, as well as the moderating role of regulatory focus. Using a behavioural measure of feedback seeking, we demonstrated a strong interaction between feedback type and sign, such that individuals subsequently sought the most feedback after they were provided with negative process feedback. Additionally, results suggested that an individual's chronic regulatory focus has implications ...
LENUS (Irish Health Repository)
Hutchinson, Michael
2013-09-01
In the phase 3, randomized, placebo-controlled and active reference (glatiramer acetate) comparator CONFIRM study in patients with relapsing-remitting multiple sclerosis, oral BG-12 (dimethyl fumarate) reduced the annualized relapse rate (ARR; primary endpoint), as well as the proportion of patients relapsed, magnetic resonance imaging lesion activity, and confirmed disability progression, compared with placebo. We investigated the clinical efficacy of BG-12 240 mg twice daily (BID) and three times daily (TID) in patient subgroups stratified according to baseline demographic and disease characteristics including gender, age, relapse history, McDonald criteria, treatment history, Expanded Disability Status Scale score, T2 lesion volume, and gadolinium-enhancing lesions. BG-12 treatment demonstrated generally consistent benefits on relapse-related outcomes across patient subgroups, reflecting the positive findings in the overall CONFIRM study population. Treatment with BG-12 BID and TID reduced the ARR and the proportion of patients relapsed at 2 years compared with placebo in all subgroups analyzed. Reductions in ARR with BG-12 BID versus placebo ranged from 34% [rate ratio 0.664 (95% confidence interval 0.422-1.043)] to 53% [0.466 (0.313-0.694)] and from 13% [0.870 (0.551-1.373)] to 67% [0.334 (0.226-0.493)] with BG-12 TID versus placebo. Treatment with glatiramer acetate reduced the ARR and the proportion of patients relapsed at 2 years compared with placebo in most patient subgroups. The results of these analyses indicate that treatment with BG-12 is effective on relapses across a broad range of patients with relapsing-remitting multiple sclerosis with varied demographic and disease characteristics.
Symmetry tests in polarized Z0 decays to b anti bg
International Nuclear Information System (INIS)
Abe, K.; Abe, K.; Akagi, T.
1997-06-01
Angular asymmetries have been measured in polarized Z 0 decays to b anti bg collected by the SLD experiment at the SLC. A high purity b anti bg event sample is selected utilizing lifetime information given by the SLD CCD pixel vertex detector and the stable micron-size SLC beams, and the b- and anti b-jets are identified using lifetime information and momentum-weighted track charge. The forward-backward asymmetry is observed in the b-jet polar angle distribution, and the parity-violation parameter is measured to test the Standard Model. Two angular correlations between the three-jet plane and the Z 0 polarization are studied. The CP-even and T-odd angular asymmetry, and the CP-odd and T-odd angular asymmetry are sensitive to physics beyond the Standard Model. The authors measure the expectation values of these quantities to be consistent with zero and set limits on the correlations
BG1 has a major role in MHC-linked resistance to malignant lymphoma in the chicken.
Goto, Ronald M; Wang, Yujun; Taylor, Robert L; Wakenell, Patricia S; Hosomichi, Kazuyoshi; Shiina, Takashi; Blackmore, Craig S; Briles, W Elwood; Miller, Marcia M
2009-09-29
Pathogen selection is postulated to drive MHC allelic diversity at loci for antigen presentation. However, readily apparent MHC infectious disease associations are rare in most species. The strong link between MHC-B haplotype and the occurrence of virally induced tumors in the chicken provides a means for defining the relationship between pathogen selection and MHC polymorphism. Here, we verified a significant difference in resistance to gallid herpesvirus-2 (GaHV-2)-induced lymphomas (Marek's disease) conferred by two closely-related recombinant MHC-B haplotypes. We mapped the crossover breakpoints that distinguish these haplotypes to the highly polymorphic BG1 locus. BG1 encodes an Ig-superfamily type I transmembrane receptor-like protein that contains an immunoreceptor tyrosine-based inhibition motif (ITIM), which undergoes phosphorylation and is recognized by Src homology 2 domain-containing protein tyrosine phosphatase (SHP-2). The recombinant haplotypes are identical, except for differences within the BG1 3'-untranslated region (3'-UTR). The 3'-UTR of the BG1 allele associated with increased lymphoma contains a 225-bp insert of retroviral origin and showed greater inhibition of luciferase reporter gene translation compared to the other allele. These findings suggest that BG1 could affect the outcome of GaHV-2 infection through modulation of the lymphoid cell responsiveness to infection, a condition that is critical for GaHV-2 replication and in which the MHC-B haplotype has been previously implicated. This work provides a mechanism by which MHC-B region genetics contributes to the incidence of GaHV-2-induced malignant lymphoma in the chicken and invites consideration of the possibility that similar mechanisms might affect the incidence of lymphomas associated with other oncogenic viral infections.
A resonant dc-dc power converter assembly
DEFF Research Database (Denmark)
2015-01-01
The present invention relates to a resonant DC-DC power converter assembly comprising a first resonant DC-DC power converter and a second resonant DC-DC power converter having identical circuit topologies. A first inductor of the first resonant DC-DC power converter and a second inductor of the s......The present invention relates to a resonant DC-DC power converter assembly comprising a first resonant DC-DC power converter and a second resonant DC-DC power converter having identical circuit topologies. A first inductor of the first resonant DC-DC power converter and a second inductor...... of the second resonant DC-DC power converter are configured for magnetically coupling the first and second resonant DC-DC power converters to each other to forcing substantially 180 degrees phase shift, or forcing substantially 0 degree phase shift, between corresponding resonant voltage waveforms of the first...
DEFF Research Database (Denmark)
Forouzesh, Mojtaba; Siwakoti, Yam P.; Gorji, Saman A.
2017-01-01
on the general law and framework of the development of next-generation step-up dc-dc converters, this paper aims to comprehensively review and classify various step-up dc-dc converters based on their characteristics and voltage-boosting techniques. In addition, the advantages and disadvantages of these voltage......DC-DC converters with voltage boost capability are widely used in a large number of power conversion applications, from fraction-of-volt to tens of thousands of volts at power levels from milliwatts to megawatts. The literature has reported on various voltage-boosting techniques, in which......-boosting techniques and associated converters are discussed in detail. Finally, broad applications of dc-dc converters are presented and summarized with comparative study of different voltage-boosting techniques....
A resonant dc-dc power converter assembly
Madsen, Mickey Pierre
2015-01-01
The present invention relates to a resonant DC-DC power converter assembly comprising a first resonant DC-DC power converter and a second resonant DC-DC power converter having identical circuit topologies. A first inductor of the first resonant DC-DC power converter and a second inductor of the second resonant DC-DC power converter are configured for magnetically coupling the first and second resonant DC-DC power converters to each other to forcing substantially 180 degrees phase shift, or fo...
Pulsed-DC selfsputtering of copper
International Nuclear Information System (INIS)
Wiatrowski, A; Posadowski, W M; Radzimski, Z J
2008-01-01
At standard magnetron sputtering conditions (argon pressure ∼0.5 Pa) inert gas particles are often entrapped in the formed films. Inert gas contamination can be eliminated by using the self-sustained magnetron sputtering process because it is done in the absence of the inert gas atmosphere. The self-sustained sputtering (SSS) gives also a unique condition during the transport of sputtered particles to the substrate. It is especially useful for filling high aspect ratio submicron scale structures for microelectronics. So far it has been shown that the self-sputtering process can be sustained in the DC operation mode (DC-SSS) only. The main disadvantage of DC-SSS process is instability related to possible arc formation. Usage of pulsed sputtering, similarly to reactive pulsed magnetron sputtering, could eliminate this problem. In this paper results of pulsed-DC self-sustained magnetron sputtering (pulsed DC-SSS) of copper are presented for the first time. The planar magnetron equipped with a 50 mm in diameter and 6 mm thick copper target was powered by DC-power supply modulated by power switch. The maximum target power was about 11 kW (∼550W/cm 2 ). The magnetron operation was investigated as a function of pulsing frequency (20-100 kHz) and duty factor (50-90%). The discharge extinction pressure was determined for these conditions. The plasma emission spectra (400-410nm range) and deposition rates were observed for both DC and pulsed DC sustained self-sputtering processes. The presented results illustrate that stable pulsed DC-SSS process can be obtained at pulsing frequency in the range of 60-100 kHz and duty factor of 70-90%
Pulsed-DC selfsputtering of copper
Wiatrowski, A.; Posadowski, W. M.; Radzimski, Z. J.
2008-03-01
At standard magnetron sputtering conditions (argon pressure ~0.5 Pa) inert gas particles are often entrapped in the formed films. Inert gas contamination can be eliminated by using the self-sustained magnetron sputtering process because it is done in the absence of the inert gas atmosphere. The self-sustained sputtering (SSS) gives also a unique condition during the transport of sputtered particles to the substrate. It is especially useful for filling high aspect ratio submicron scale structures for microelectronics. So far it has been shown that the self-sputtering process can be sustained in the DC operation mode (DC-SSS) only. The main disadvantage of DC-SSS process is instability related to possible arc formation. Usage of pulsed sputtering, similarly to reactive pulsed magnetron sputtering, could eliminate this problem. In this paper results of pulsed-DC self-sustained magnetron sputtering (pulsed DC-SSS) of copper are presented for the first time. The planar magnetron equipped with a 50 mm in diameter and 6 mm thick copper target was powered by DC-power supply modulated by power switch. The maximum target power was about 11 kW (~550W/cm2). The magnetron operation was investigated as a function of pulsing frequency (20-100 kHz) and duty factor (50-90%). The discharge extinction pressure was determined for these conditions. The plasma emission spectra (400-410nm range) and deposition rates were observed for both DC and pulsed DC sustained self-sputtering processes. The presented results illustrate that stable pulsed DC-SSS process can be obtained at pulsing frequency in the range of 60-100 kHz and duty factor of 70-90%.
Series-Connected High Frequency Converters in a DC Microgrid System for DC Light Rail Transit
Directory of Open Access Journals (Sweden)
Bor-Ren Lin
2018-01-01
Full Text Available This paper studies and presents a series-connected high frequency DC/DC converter connected to a DC microgrid system to provide auxiliary power for lighting, control and communication in a DC light rail vehicle. Three converters with low voltage and current stresses of power devices are series-connected with single transformers to convert a high voltage input to a low voltage output for a DC light rail vehicle. Thus, Metal-Oxide-Semiconductor Field-Effect Transistors (MOSFETs with a low voltage rating and a turn-on resistance are adopted in the proposed circuit topology in order to decrease power losses on power switches and copper losses on transformer windings. A duty cycle control with an asymmetric pulse-width modulation is adopted to control the output voltage at the desired voltage level. It is also adopted to reduce switching losses on MOSFETs due to the resonant behavior from a leakage inductor of an isolated transformer and output capacitor of MOSFETs at the turn-on instant. The feasibility and effectiveness of the proposed circuit have been verified by a laboratory prototype with a 760 V input and a 24 V/60 A output.
Salleh, Noor Shafryna; Murad, Abdul Munir Abdul
2016-11-01
In this work, the ability of commercial Trichoderma reesei cellulases preparation, Celluclast® or in combination with Accellerase®BG β-glucosidase to hydrolyse pretreated oil palm empty fruit bunch (OPEFB) was evaluated. Celluclast® alone hydrolyzed OPEFB to produce 2.41±0.44 mg glucose per gram OPEFB. However, the production of glucose was significantly improved with supplementation of Accellerase®BG (8.12±0.93 mg/g). This result suggested that the endoglucanases and exoglucanases in Celluclast® and β-glucosidase in Accellerase®BG able to work synergistically to increase the production of glucose from OPEFB. In addition, the production of xylose was also improved by 30% when the enzyme mixture was used. The result suggested that the mixture of Celluclast® with Accellerase®BG work synergistically to improve the production of sugars by removing the inhibition by cellobiose for complete cellulose hydrolysis. The production of glucose and xylose from OPEFB wastes showed the potential of this biomass as the source of renewable energy and fine chemicals production in Malaysia.
Dobson, Rosie; Whittaker, Robyn; Jiang, Yannan; Shepherd, Matthew; Maddison, Ralph; Carter, Karen; Cutfield, Richard; McNamara, Catherine; Khanolkar, Manish; Murphy, Rinki
2016-04-02
Addressing the increasing prevalence, and associated disease burden, of diabetes is a priority of health services internationally. Interventions to support patients to effectively self-manage their condition have the potential to reduce the risk of costly and debilitating complications. The utilisation of mobile phones to deliver self-management support allows for patient-centred care at the frequency and intensity that patients desire from outside the clinic environment. Self-Management Support for Blood Glucose (SMS4BG) is a novel text message-based intervention for supporting people with diabetes to improve self-management behaviours and achieve better glycaemic control and is tailored to individual patient preferences, demographics, clinical characteristics, and culture. This study aims to assess whether SMS4BG can improve glycaemic control in adults with poorly controlled diabetes. This paper outlines the rationale and methods of the trial. A two-arm, parallel, randomised controlled trial will be conducted across New Zealand health districts. One thousand participants will be randomised at a 1:1 ratio to receive SMS4BG, a theoretically based and individually tailored automated text message-based diabetes self-management support programme (intervention) in addition to usual care, or usual care alone (control). The primary outcome is change in glycaemic control (HbA1c) at 9 months. Secondary outcomes include glycaemic control at 3 and 6 months, self-efficacy, self-care behaviours, diabetes distress, health-related quality of life, perceived social support, and illness perceptions. Cost information and healthcare utilisation will also be collected as well as intervention satisfaction and interaction. This study will provide information on the effectiveness of a text message-based self-management support tool for people with diabetes. If found to be effective it has the potential to provide individualised support to people with diabetes across New Zealand (and
DEFF Research Database (Denmark)
Forouzesh, Mojtaba; Siwakoti, Yam P.; Gorji, Saman A.
2017-01-01
on the general law and framework of the development of next-generation step-up dc-dc converters, this paper aims to comprehensively review and classify various step-up dc-dc converters based on their characteristics and voltage-boosting techniques. In addition, the advantages and disadvantages of these voltage...
DC-SIGN, a C-type lectin on dendritic cells that unveils many aspects of dendritic cell biology
Geijtenbeek, Teunis B. H.; Engering, Anneke; van Kooyk, Yvette
2002-01-01
Dendritic cells (DC) are present in essentially every tissue where they operate at the interface of innate and acquired immunity by recognizing pathogens and presenting pathogen-derived peptides to T cells. It is becoming clear that not all C-type lectins on DC serve as antigen receptors recognizing
International Nuclear Information System (INIS)
Takei, Masao; Nakagawa, Hideyuki
2006-01-01
The sea urchin Toxopneustes pileolus belonging to the family Toxopneustidae, they have well-developed globiferous pedicellariae with pharmacologically active substances. We have purified a novel sea urchin lectin-1 (SUL-1) from the large globiferous pedicellariae of T. pileolus. Dendritic cells (DC) are professional APC and play a pivotal role in controlling immune responses. This study investigated whether SUL-1 can drive DC maturation from human immature monocyte-derived DC in vitro. Human monocytes were cultured with GM-CSF and IL-4 for 6 days followed by another 1 day in the presence of SUL-1 or LPS. DC harvested on day 7 were examined using functional assays. The expression levels of CD1a, CD80, CD83, CD86 and HLA-DR as expressed by mean fluorescence intensity (MFI) on DC differentiated from immature DC after culture with 1.0 μg/ml of SUL-1 for 1 day were enhanced and decreased endocytic activity. SUL-1-treated DC also displayed enhanced T cell stimulatory capacity in an MLR, as measured by T cell proliferation. Cell surface expression of CD80, CD83 and CD86 on SUL-1-treated DC was inhibited by anti-DC-SIGN mAb, while anti-DC-SIGN mAb had no influence on allogeneic T cell proliferation by SUL-1-treated DC. DC differentiated with SUL-1 induced the differentiation of naive T cell towards a helper T cell type 1 (Th1) response at DC/T (1:5) cells ratio depending on IL-12 secretion. In CTL assay, the production of IFN-γ and 51 Cr release on SUL-1-treated DC were more augmented than of immature DC or LPS-treated DC. SUL-1-treated DC expressed CCR7 and had a high migration to MIP-3β. Intracellular Ca 2+ mobilization in SUL-1-treated DC was also induced by MIP-3β. These results suggest that SUL-1 bindings to DC-SIGN on surface of immature DC may lead to differentiate DC from immature DC. Moreover, it suggests that SUL-1 may be used on DC-based vaccines for cancer immunotherapy
Electromagnetic microwaves in metal films with electron-phonon interaction and a dc magnetic field
DEFF Research Database (Denmark)
Hasselberg, L.E.
1976-01-01
A quantum-mechanical treatment of electromagnetic microwaves is performed for a metal film. The directions of the exterior ac and dc fields are taken to be arbitrary and boundary conditions for the electrons are assumed to be specular. The relation between the current and the electromagnetic field...... in the transmission spectrum can perhaps be obtained by assuming a finite Debye temperature and specular reflections of the electrons at the boundary surfaces. A sharp peak entirely caused by the finite electron-phonon interaction is also discussed....
Yusa, Noriaki; Kim, Jungho; Koizumi, Masatoshi; Sugiura, Motoaki; Kawashima, Ryuta
2017-01-01
Children naturally acquire a language in social contexts where they interact with their caregivers. Indeed, research shows that social interaction facilitates lexical and phonological development at the early stages of child language acquisition. It is not clear, however, whether the relationship between social interaction and learning applies to adult second language acquisition of syntactic rules. Does learning second language syntactic rules through social interactions with a native speaker or without such interactions impact behavior and the brain? The current study aims to answer this question. Adult Japanese participants learned a new foreign language, Japanese sign language (JSL), either through a native deaf signer or via DVDs. Neural correlates of acquiring new linguistic knowledge were investigated using functional magnetic resonance imaging (fMRI). The participants in each group were indistinguishable in terms of their behavioral data after the instruction. The fMRI data, however, revealed significant differences in the neural activities between two groups. Significant activations in the left inferior frontal gyrus (IFG) were found for the participants who learned JSL through interactions with the native signer. In contrast, no cortical activation change in the left IFG was found for the group who experienced the same visual input for the same duration via the DVD presentation. Given that the left IFG is involved in the syntactic processing of language, spoken or signed, learning through social interactions resulted in an fMRI signature typical of native speakers: activation of the left IFG. Thus, broadly speaking, availability of communicative interaction is necessary for second language acquisition and this results in observed changes in the brain.
2010-05-04
... Airworthiness Directives; McDonnell Douglas Corporation Model DC- 10-10, DC-10-10F, DC-10-15, DC-10-30, DC-10... amends Sec. 39.13 by adding the following new AD: 2010-09-12 McDonnell Douglas Corporation: Amendment 39... to McDonnell Douglas Corporation Model DC- 10-10, DC-10-10F, DC-10-15, DC-10-30, DC-10-30F (KC-10A...
Pizarro, María Dolores; Mediavilla, María Gabriela; Berardi, Florencia; Tiribelli, Claudio; Rodríguez, Joaquín V; Mamprin, María Eugenia
2014-01-01
This work focuses on ammonia metabolism of Liver Microorgans (LMOs) after cold preservation in a normothermic reoxygenation system (NRS). We have previously reported the development of a novel preservation solution, Bes-Gluconate-PEG 35 kDa (BG35) that showed the same efficacy as ViaSpan to protect LMOs against cold preservation injury. The objective of this work was to study mRNA levels and activities of two key Urea Cycle enzymes, Carbamyl Phosphate Synthetase I (CPSI) and Ornithine Transcarbamylase (OTC), after preservation of LMOs in BG35 and ViaSpan and the ability of these tissue slices to detoxify an ammonia overload in a NRS model. After 48 h of cold storage (0°C in BG35 or ViaSpan) LMOs were rewarmed in KHR containing an ammonium chloride overload (1 mM). We determined ammonium detoxification capacity (ADC), urea synthesis and enzyme activities and relative mRNA levels for CPSI and OTC. At the end of reoxygenation LMOs cold preserved in BG35 have ADC and urea synthesis similar to controls. ViaSpan group demonstrated a lower capacity to detoxify ammonia and to synthesize urea than fresh LMOs during the whole reoxygenation period which correlated with the lower mRNA levels and activities for CPSI and OTC observed for this group. We demonstrate that our preservation conditions (48 hours, BG35 solution, anoxia, 0ºC) did not affect ammonia metabolism of cold preserved LMOs maintaining the physiological and biochemical liver functions tested, which allows their future use as biological component of a BAL system.
Alcântara, Pauline Lima; Wogel, Ariane Zonho; Rossi, Maria Isabela Lobo; Neves, Isabela Rodrigues; Sabates, Ana Llonch; Puggina, Ana Cláudia
2016-12-01
Compare the non-verbal communication of children before and during interaction with clowns and compare their vital signs before and after this interaction. Uncontrolled, intervention, cross-sectional, quantitative study with children admitted to a public university hospital. The intervention was performed by medical students dressed as clowns and included magic tricks, juggling, singing with the children, making soap bubbles and comedic performances. The intervention time was 20minutes. Vital signs were assessed in two measurements with an interval of one minute immediately before and after the interaction. Non-verbal communication was observed before and during the interaction using the Non-Verbal Communication Template Chart, a tool in which nonverbal behaviors are assessed as effective or ineffective in the interactions. The sample consisted of 41 children with a mean age of 7.6±2.7 years; most were aged 7 to 11 years (n=23; 56%) and were males (n=26; 63.4%). There was a statistically significant difference in systolic and diastolic blood pressure, pain and non-verbal behavior of children with the intervention. Systolic and diastolic blood pressure increased and pain scales showed decreased scores. The playful interaction with clowns can be a therapeutic resource to minimize the effects of the stressing environment during the intervention, improve the children's emotional state and reduce the perception of pain. Copyright © 2016 Sociedade de Pediatria de São Paulo. Publicado por Elsevier Editora Ltda. All rights reserved.
Updated BG Prasad socioeconomic classification, 2014: a commentary.
Mangal, Abha; Kumar, Varun; Panesar, Sanjeet; Talwar, Richa; Raut, Deepak; Singh, Saudan
2015-01-01
Modified BG Prasad socioeconomic scale is widely used to determine the socioeconomic status of study subjects in health studies in India. It is an income-based scale and, therefore, has to be constantly updated to take inflation and depreciation of rupee into account. The Consumer Price Index (CPI) for industrial workers (IW) is used to calculate updated income categories for January 2014. Details of the calculations involved will enable young researchers to calculate specific income categories for their research work. State-specific CPI values are also available on the Department of Labour website and should be used to determine more accurate income categories for the study area.
Matias, Mariana Santos; de Sousa, Bruna Barbosa; da Cunha Pereira, Déborah Fernanda; Dias, Edigar Henrique Vaz; Mamede, Carla Cristine Neves; de Queiroz, Mayara Ribeiro; Silva, Anielle Christine Almeida; Dantas, Noelio Oliveira; Soares, Andreimar Martins; de Oliveira Costa, Júnia; de Oliveira, Fábio
2017-01-01
Snake venoms are a complex mixture of proteins, organic and inorganic compounds. Some of these proteins, enzymatic or non-enzymatic ones, are able to interact with platelet receptors, causing hemostatic disorders. The possible therapeutic potential of toxins with antiplatelet properties may arouse interest in the pharmacological areas. The present study aimed to purify and characterize an antiplatelet DC protein from Bothrops alternatus snake venom. The protein, called BaltDC (DC protein from B. alternatus snake venom), was purified by a combination of ion-exchange chromatography on DEAE-Sephacel column and gel filtration on Sephadex G-75. The molecular mass was estimated by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate (SDS-PAGE). The amino acid sequence of the N-terminal region was carried out by Edman degradation method. Platelet aggregation assays were performed in human platelet-rich plasma (PRP). Infrared (IR) spectroscopy was used in order to elucidate the interactions between BaltDC and platelet membrane. BaltDC ran as a single protein band on SDS-PAGE and showed apparent molecular mass of 32 kDa under reducing or non-reducing conditions. The N-terminal region of the purified protein revealed the amino acid sequence IISPPVCGNELLEVGEECDCGTPENCQNECCDA, which showed identity with other snake venom metalloproteinases (SVMPs). BaltDC was devoid of proteolytic, hemorrhagic, defibrinating or coagulant activities, but it showed a specific inhibitory effect on platelet aggregation induced by ristocetin and epinephrine in PRP. IR analysis spectra strongly suggests that PO 3 2- groups, present in BaltDC, form hydrogen bonds with the PO 2 - groups present in the non-lipid portion of the membrane platelets. BaltDC may be of medical interest since it was able to inhibit platelet aggregation.
International Nuclear Information System (INIS)
Wei, D.Y.C.
1987-01-01
Integral process models were developed to predict particle melting in both DC and RF plasmas. Specifically, a numerical model has been developed to predict the temperature history of particles injected in a low pressure DC plasma jet. The temperature and velocity fields of the plasma jet are predicted as a free jet by solving the parabolized Navier-Stokes equations using a spatial marching scheme. Correction factors were introduced to take into account non continuum effects encountered in the low pressure environment. The plasma jet profiles as well as the particle/plasma interactions under different jet pressure ratios (from underexpanded to overexpanded) were investigated. The flow and temperature fields in the RF plasma torch are calculated using the axisymmetric Navier-Stokes equations based on the primitive variables, along with pseudo two-dimensional electromagnetic field equations. Particle trajectories and heat transfer characteristics in both DC and RF plasmas are calculated using predicted plasma jet profiles. Particle melting efficiencies in both DC and RF plasmas are evaluated and compared using model alloy systems. Based on the theoretical considerations, an alternative route of plasma spraying process (hybrid plasma spraying process) is proposed. An evaluation of particle melting in hybrid plasma jets had indicated that further improvement in deposit properties could be made
DC Characterisation of C60 Whiskers and Nanowhiskers
DEFF Research Database (Denmark)
Larsson, Michael; Kjelstrup-Hansen, Jakob; Lucyszyn, Stepan
2007-01-01
C60 whiskers exhibit increasing conductivity with decreasing diameter. At diameters of 1 mm and below, a single-crystal structure predominates, and enhanced electrical characteristics are expected; however, no supporting data exists in the literature. Here, results of four-point probe measurements......, indicating strong potential for use in organic electronic applications of the future. Repeated current cycling in air is observed to promote sample degradation, possibly due to progressive oxidation of the carbon structure. A micromachined four-point probe is also used to try to establish non...... on C60 whiskers and nanowhiskers with diameters in the range 650 nm to 1.3 mm are reported for the first time. Samples are attached to pre-patterned planar and raised electrodes using FIB-deposited tungsten. A low resistivity of 3 Wcm is measured in air, on a C60 whisker having a diameter of 650 nm...
Interaction between MHD generator and DC-AC power conversion system
International Nuclear Information System (INIS)
Tanaka, D.
1982-01-01
Transient characteristics of an MHD power generating system including a DC-AC inverter are analyzed using a time-dependent quasi-one-dimensional approximation. The generator model considered is Faraday type of U-25 class with heavy-oil and air combustion gas. It is found that a short-circuited fault of the invertor may become more serious than an open-circuited fault, resulting in significant gas velocity reduction. An open-circuited fault, if retained for more than 5-8 ms, can substantially increase the gas velocity at the upstream end of the fault region. A protection system composed of a fast-acting DC circuit-breaker and an emergency load resistance is proposed. The switching speed of the DC breaker must be about 500 microsec to stop a pressure increase, resulting, for example, from the short-circuiting of 20 electrode pairs, before it reaches 120% of the initial level
EST Table: DC547331 [KAIKOcDNA[Archive
Lifescience Database Archive (English)
Full Text Available AGAP003179 10/09/10 60 %/160 aa gnl|Amel|GB14313-PA 10/09/10 69 %/166 aa gi|91087035|ref|XP_974421.1| PREDICTED: similar to synoviolin [Tribolium castaneum] DC547331 phe- ... ...DICTED: similar to synoviolin [Tribolium castaneum] gb|EFA06968.1| hypothetical protein TcasGA2_TC009927 [Tr...DC547331 E_FL_phe-_10B17_F_0 11/12/09 n.h 10/09/28 69 %/166 aa ref|XP_974421.1| PRE
DC Home Appliances for DC Distribution System
Directory of Open Access Journals (Sweden)
MUHAMMAD KAMRAN
2017-10-01
Full Text Available This paper strengthens the idea of DC distribution system for DC microgrid consisting of a building of 50 apartments. Since the war of currents AC system has been dominant because of the paucity of research in the protection of the DC system. Now with the advance research in power electronics material and components, generation of electricity is inherently DC as by solar PV, fuel cell and thermoelectric generator that eliminates the rectification process. Transformers are replaced by the power electronics buck-boost converters. DC circuit breakers have solved the protection problems for both DC transmission and distribution system. In this paper 308V DC microgrid is proposed and home appliances (DC internal are modified to operate on 48V DC from DC distribution line. Instead of using universal and induction motors in rotary appliances, BLDC (Brushless DC motors are proposed that are highly efficient with minimum electro-mechanical and no commutation losses. Proposed DC system reduces the power conversion stages, hence diminishes the associated power losses and standby losses that boost the overall system efficiency. So in view of all this a conventional AC system can be replaced by a DC system that has many advantages by cost as well as by performance
Pochard, Pierre; Hammad, Hamida; Ratajczak, Céline; Charbonnier-Hatzfeld, Anne-Sophie; Just, Nicolas; Tonnel, André-Bernard; Pestel, Joël
2005-07-01
Lactic acid bacteria (LAB) are suggested to play a regulatory role in the development of allergic reactions. However, their potential effects on dendritic cells (DCs) directing the immune polarization remain unclear. The immunologic effect of Lactobacillus plantarum NCIMB 8826 (LAB1) on monocyte-derived dendritic cells (MD-DCs) from patients allergic to house dust mite was evaluated. MD-DCs were stimulated for 24 hours with the related allergen Der p 1 in the presence or absence of LAB1. Cell-surface markers were assessed by means of FACS analysis, and the key polarizing cytokines IL-12 and IL-10 were quantified. The subsequent regulatory effect of pulsed MD-DCs on naive or memory T cells was evaluated by determining the T-cell cytokine profile. LAB1 induced the maturation of MD-DCs, even if pulsed with Der p 1. Interestingly, after incubation with LAB1 and Der p 1, MD-DCs produced higher amounts of IL-12 than Der p 1-pulsed DCs. Indeed, the T H 2 cytokine (IL-4 and IL-5) production observed when naive or memory autologous T cells were cocultured with Der p 1-pulsed MD-DCs was highly reduced in the presence of LAB1. Finally, in contrast to naive or memory T cells exposed once to Der p 1-pulsed DCs, T cells stimulated by MD-DCs pulsed with Der p 1 and LAB1 failed to produce T H 2 cytokines in response to a new stimulation with Der p 1-pulsed DCs. Thus in the presence of LAB1, MD-DCs from allergic patients tend to reorientate the T-cell response toward a beneficial T H 1 profile.
International Nuclear Information System (INIS)
Schmidt, Sabine; Lepori, Domenico; Meuwly, Jean-Yves; Duvoisin, Bertrand; Meuli, Reto; Schnyder, Pierre; Denys, Alban; Michetti, Pierre; Felley, Christian; Melle, Guy van
2003-01-01
Our objective was a prospective comparison of MR enteroclysis (MRE) with multidetector spiral-CT enteroclysis (MSCTE). Fifty patients with various suspected small bowel diseases were investigated by MSCTE and MRE. The MSCTE was performed using slices of 2.5 mm, immediately followed by MRE, obtaining T1- and T2-weighted sequences, including gadolinium-enhanced acquisition with fat saturation. Three radiologists independently evaluated MSCTE and MRE searching for 12 pathological signs. Interobserver agreement was calculated. Sensitivities and specificities resulted from comparison with pathological results (n=29) and patient's clinical evolution (n=21). Most pathological signs, such as bowel wall thickening (BWT), bowel wall enhancement (BWE) and lymphadenopathy (ADP), showed better interobserver agreement on MSCTE than on MRE (BWT: 0.65 vs 0.48; BWE: 0.51 vs 0.37; ADP: 0.52 vs 0.15). Sensitivity of MSCTE was higher than that of MRE in detecting BWT (88.9 vs 60%), BWE (78.6 vs 55.5%) and ADP (63.8 vs 14.3%). Wilcoxon signed-rank test revealed significantly better sensitivity of MSCTE than that of MRE for each observer (p=0.028, p=0.046, p=0.028, respectively). Taking the given study design into account, MSCTE provides better sensitivity in detecting lesions of the small bowel than MRE, with higher interobserver agreement. (orig.)
Li, Xiuxia; Li, Ran; Zhu, Bin; Gao, Xiwu; Liang, Pei
2018-06-01
The diamondback moth Plutella xylostella (L.) is the most widely distributed pest of cruciferous crops and has developed resistance to most commonly used insecticides, including chlorantraniliprole. Resistance to chlorantraniliprole is likely caused by mutations of the target, the ryanodine receptor, and/or mediated by an increase in detoxification enzyme activities. Although target-site resistance is documented in detail, resistance mediated by increased metabolism has rarely been reported. The activity of cytochrome P450 was significantly higher in two resistant P. xylostella populations than in a susceptible one. Among ten detected cytochrome P450 genes, CYP6BG1 was significantly overexpressed (over 80-fold) in a field-resistant population compared with expression in a susceptible one. Knockdown of CYP6BG1 by RNA interference dramatically reduced the 7-ethoxycoumarin-O-deethylase (7-ECOD) activity of P450 by 45.5% and increased the toxicity of chlorantraniliprole toward P. xylostella by 26.8% at 48 h postinjection of double-stranded RNA. By contrast, overexpression of CYP6BG1 in a transgenic Drosophila melanogaster line significantly decreased the toxicity of the insecticide to the transgenic flies. Overexpression of CYP6BG1 may contribute to chlorantraniliprole resistance in P. xylostella. Our findings will provide new insights into the mechanisms of resistance to diamide insecticides in other insect pests. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Family of multiport bidirectional DC-DC converters
Tao, H.; Kotsopoulos, A.; Duarte, J.L.; Hendrix, M.A.M.
2006-01-01
Multiport DC-DC converters are of potential interest in applications such as generation systems utilising multiple sustainable energy sources. A family of multiport bidirectional DC-DC converters derived from a general topology is presented. The topology shows a combination of DC-link and magnetic
Yan, K.; Yamamoto, T.; Kanazawa, S.; Ohkubo, T.; Nomoto, Y.; Chang, Jen-Shih
2001-01-01
In this paper, the effects of the applied voltage modes on the positive corona discharge morphology and NO removal characteristics from air streams are experimentally investigated. By using a DC superimposed high frequency AC power supply (10-60 kHz), a uniform streamer corona can be generated,
Clinical application of l-123 MlBG cardiac imaging
International Nuclear Information System (INIS)
Kang, Do Young
2004-01-01
Cardiac neurotransmission imaging allows in vivo assessment of presynaptic reuptake, neurotransmitter storage and postsynaptic receptors. Among the various neurotransmitter, I-123 MlBG is most available and relatively well-established. Metaiodobenzylguanidine (MIBG) is an analogue of the false neurotransmitter guanethidine. It is taken up to adrenergic neurons by uptake-1 mechanism as same as norepinephrine. As tagged with I-123, it can be used to image sympathetic function in various organs including heart with planar or SPECT techniques. I-123 MIBG imaging has a unique advantage to evaluate myocardial neuronal activity in which the heart has no significant structural abnormality or even no functional derangement measured with other conventional examination. In patients with cardiomyopathy and heart failure, this imaging has most sensitive technique to predict prognosis and treatment response of betablocker or ACE inhibitor. In diabetic patients, it allow very early detection of autonomic neuropathy. In patients with dangerous arrhythmia such as ventricular tachycardia or fibrillation, MIBG imaging may be only an abnormal result among various exams. In patients with ischemic heart disease, sympathetic derangement may be used as the method of risk stratification. In heart transplanted patients, sympathetic reinnervation is well evaluated. Adriamycin-induced cardiotoxicity is detected earlier than ventricular dysfunction with sympathetic dysfunction. Neurodegenerative disorder such as Parkinson's disease or dementia with Lewy bodies has also cardiac sympathetic dysfunction. Noninvasive assessment of cardiac sympathetic nerve activity with l-123 MlBG imaging may be improve understanding of the pathophysiology of cardiac disease and make a contribution to predict survival and therapy efficacy
Clinical application of l-123 MlBG cardiac imaging
Energy Technology Data Exchange (ETDEWEB)
Kang, Do Young [College of Medicine, Donga Univ., Busan (Korea, Republic of)
2004-10-01
Cardiac neurotransmission imaging allows in vivo assessment of presynaptic reuptake, neurotransmitter storage and postsynaptic receptors. Among the various neurotransmitter, I-123 MlBG is most available and relatively well-established. Metaiodobenzylguanidine (MIBG) is an analogue of the false neurotransmitter guanethidine. It is taken up to adrenergic neurons by uptake-1 mechanism as same as norepinephrine. As tagged with I-123, it can be used to image sympathetic function in various organs including heart with planar or SPECT techniques. I-123 MIBG imaging has a unique advantage to evaluate myocardial neuronal activity in which the heart has no significant structural abnormality or even no functional derangement measured with other conventional examination. In patients with cardiomyopathy and heart failure, this imaging has most sensitive technique to predict prognosis and treatment response of betablocker or ACE inhibitor. In diabetic patients, it allow very early detection of autonomic neuropathy. In patients with dangerous arrhythmia such as ventricular tachycardia or fibrillation, MIBG imaging may be only an abnormal result among various exams. In patients with ischemic heart disease, sympathetic derangement may be used as the method of risk stratification. In heart transplanted patients, sympathetic reinnervation is well evaluated. Adriamycin-induced cardiotoxicity is detected earlier than ventricular dysfunction with sympathetic dysfunction. Neurodegenerative disorder such as Parkinson's disease or dementia with Lewy bodies has also cardiac sympathetic dysfunction. Noninvasive assessment of cardiac sympathetic nerve activity with l-123 MlBG imaging may be improve understanding of the pathophysiology of cardiac disease and make a contribution to predict survival and therapy efficacy.
Li, Xiaoqiong; Guo, Wenfeng; Siemann, Evan; Wen, Yuanguang; Huang, Wei; Ding, Jianqing
2016-12-01
Spatially separated aboveground (AG) and belowground (BG) herbivores are closely linked through shared host plants, and both patterns of AG-BG interactions and plant responses may vary among plant genotypes. We subjected invasive (USA) and native (China) genotypes of tallow tree (Triadica sebifera) to herbivory by the AG specialist leaf-rolling weevil Heterapoderopsis bicallosicollis and/or the root-feeding larvae of flea beetle Bikasha collaris. We measured leaf damage and leaves rolled by weevils, quantified beetle survival, and analyzed flavonoid and tannin concentrations in leaves and roots. AG and BG herbivores formed negative feedbacks on both native and invasive genotypes. Leaf damage by weevils and the number of beetle larvae emerging as adults were higher on invasive genotypes. Beetles reduced weevil damage and weevils reduced beetle larval emergence more strongly for invasive genotypes. Invasive genotypes had lower leaf and root tannins than native genotypes. BG beetles decreased leaf tannins of native genotypes but increased root tannins of invasive genotypes. AG herbivory increased root flavonoids of invasive genotypes while BG herbivory decreased leaf flavonoids. Invasive genotypes had lower AG and BG herbivore resistance, and negative AG-BG herbivore feedbacks were much stronger for invasive genotypes. Lower tannin concentrations explained overall better AG and BG herbivore performances on invasive genotypes. However, changes in tannins and flavonoids affected AG and BG herbivores differently. These results suggest that divergent selection on chemical production in invasive plants may be critical in regulating herbivore performances and novel AG and BG herbivore communities in new environments.
Itoh, Kazuki; Endoh, Tetsuo
2018-04-01
In this paper, we present a novel transistor layout of multi pillar-type vertical body-channel (BC) MOSFET for cascode power switches for improving the efficiency and compactness of CMOS DC–DC converters. The proposed layout features a stacked and multifingered layout to suppress the loss due to parasitic components such as diffusion resistance and contact resistance. In addition, the loss of each MOSFET, which configures cascode power switches, is analyzed, and it is revealed that the total optimum gate width and loss with the high-side (HS) n-type MOSFET topology are 27 and 16% smaller than those with the HS p-type MOSFET topology, respectively. Moreover, a circuit simulation of 2.0 to 0.8 V, 100 MHz CMOS DC–DC converters with the proposed layout is carried out by using experimentally extracted models of BSIM4 60 nm vertical BC MOSFETs. The peak efficiency of the HS n-type MOSFET converter with the proposed layout is 90.1%, which is 6.0% higher than that with the conventional layout.
Design and Testing of Boost Type DC/DC Converter for DC Motor Control Applications
Samman, Faizal Arya; Akil, Yusri Syam; Noor, Nirwan A.
2017-01-01
in The Proceeding of The 2nd International Symposium on Smart Material and Mechatronics 2015 This paper presents the design and testing of a boost type DC/DC converter circuit, which can be used for DC motor control applications. The Boost converter is designed using DC chopper and DC chopper cascade configurations. The experimental setup was made by connecting the boost converter circuit with four types of DC motor, i.e. self-excited DC motor shunt, series, compound and separately exci...
Five-Level Active-Neutral-Point-Clamped DC/DC Converter for Medium-Voltage DC Grids
DEFF Research Database (Denmark)
Liu, Dong; Deng, Fujin; Chen, Zhe
2017-01-01
This paper proposes a five-level active-neutralpoint- clamped (5L-ANPC) dc/dc converter for applications in medium voltage dc (MVDC) grids. A modulation strategy is proposed for the 5L-ANPC dc/dc converter to generate multilevel voltage waveforms, which can effectively reduce voltage change rate dv...... effectively eliminate high voltage leaps caused by the dead time effect. In addition, a capacitor voltage control strategy is proposed for the 5L-ANPC dc/dc converter to ensure the balanced flying capacitor voltage and desired five-level voltage waveforms. Finally, simulation and experimental studies...
Dawood, Mahmoud A O; Koshio, Shunsuke; Ishikawa, Manabu; Yokoyama, Saichiro
2015-07-01
Both heat-killed Lactobacillus plantarum (HK-LP) and β-glucan (BG) play important roles in growth performance, feed utilization and health status of fish. Therefore, a feeding trial was conducted to determine the interactive effects of dietary HK-LP and BG on growth performance, digestibility, oxidative status and immune response of red sea bream for 56 days. A significant interaction was found between HK-LP and BG on final body weight, total plasma protein, glucose, serum bactericidal activity (BA), total serum protein, serum alternative complement pathway (ACP) activity, protein and dry matter digestibility coefficients (P 0.05). Interestingly, fish fed with both HK-LP at (0.025 and 0.1%) in combination with BG at (0 and 0.1%) showed higher oxidative stress resistance. Under the experimental conditions, dietary HK-LP and BG had a significant interaction on enhancing the growth, digestibility and immune responses of red sea bream. Copyright © 2015 Elsevier Ltd. All rights reserved.
Villarreal, Oscar; Chen, Liao; Whetten, Robert; Yacaman, Miguel
2015-03-01
We studied the interactions of functionalized Au144 nanoparticles (NPs) in a near-physiological environment through all-atom molecular dynamics simulations. The AuNPs were coated with a homogeneous selection of 60 thiolates: 11-mercapto-1-undecanesulfonate, 5-mercapto-1-pentanesulfonate, 5-mercapto-1-pentane-amine, 4-mercapto-benzoate or 4-mercapto-benzamide. These ligands were selected to elucidate how the aggregation behavior depends on the ligands' sign of charge, length, and flexibility. Simulating the dynamics of a pair of identical AuNPs in a cell of saline of 150 mM NaCl in addition to 120 Na+/Cl- counter-ions, we computed the aggregation affinities from the potential of mean force as a function of the pair separation. We found that NPs coated with negatively charged, short ligands have the strongest affinities mediated by multiple Na+ counter-ions residing on a plane in-between the pair and forming ``salt bridges'' to both NPs. Positively charged NPs have weaker affinities, as Cl counter-ions form fewer and weaker salt bridges. The longer ligands' large fluctuations disfavor the forming of salt bridges, enable hydrophobic contact between the exposed hydrocarbon chains and interact at greater separations due to the fact that the screening effect is rather incomplete. Supported by the CONACYT, NIH, NSF and TACC.
Control of improved full-bridge three-level DC/DC converter for wind turbines in a DC grid
DEFF Research Database (Denmark)
Deng, Fujin; Chen, Zhe
2013-01-01
transformer in the IFBTL dc/dc converter. A modulation strategy, including two operation modes, is proposed for the IFBTL dc/dc converter. Then, a voltage balancing control strategy is proposed for the IFBTL dc/dc converter. Furthermore, the control of the wind turbine based on the IFBTL dc/dc converter......This paper presents an improved full-bridge three-level (IFBTL) dc/dc converter for a wind turbine in a dc grid by inserting a passive filter into the dc/dc converter to improve the performance of the converter. The passive filter can effectively reduce the voltage stress of the medium frequency...
Directory of Open Access Journals (Sweden)
M. Akherraz
1997-12-01
Full Text Available This paper presents an in-depth analytical and experimental investigation of an indirect DC-DC converter. The DC-AC conversion is a full bridge based on IGBT power modules, and the AC-DC conversion is done via a high frequency AC link and a first diode bridge. The AC link, which consists of snubbing capacitors and a variable air-gap transformer, is analytically designed to fulfill Zero Voltage commutation requirement. The proposed converter is simulated using PSPICE and a prototype is designed built and tested in the laboratory. PSPICE simulation and experimental results are presented and compared.
Three-port DC-DC converter with new integrated transformer for DC Distribution Systems
DEFF Research Database (Denmark)
Ouyang, Ziwei; Andersen, Michael A. E.
2014-01-01
A new integrated transformer for three-port dc-dc converter is proposed to overcome the power coupling effect existed in some known multiple inputs dc-dc converters. Orthogonal primary windings arrangement and in series connection of diagonal secondary Windings enables a fully power decoupling...
Carrion, Julio; Scisci, Elizabeth; Miles, Brodie; Sabino, Gregory J; Zeituni, Amir E; Gu, Ying; Bear, Adam; Genco, Caroline A; Brown, David L; Cutler, Christopher W
2012-09-15
The low-grade oral infection chronic periodontitis (CP) has been implicated in coronary artery disease risk, but the mechanisms are unclear. In this study, a pathophysiological role for blood dendritic cells (DCs) in systemic dissemination of oral mucosal pathogens to atherosclerotic plaques was investigated in humans. The frequency and microbiome of CD19(-)BDCA-1(+)DC-SIGN(+) blood myeloid DCs (mDCs) were analyzed in CP subjects with or without existing acute coronary syndrome and in healthy controls. FACS analysis revealed a significant increase in blood mDCs in the following order: healthy controls < CP < acute coronary syndrome/CP. Analysis of the blood mDC microbiome by 16S rDNA sequencing showed Porphyromonas gingivalis and other species, including (cultivable) Burkholderia cepacia. The mDC carriage rate with P. gingivalis correlated with oral carriage rate and with serologic exposure to P. gingivalis in CP subjects. Intervention (local debridement) to elicit a bacteremia increased the mDC carriage rate and frequency in vivo. In vitro studies established that P. gingivalis enhanced by 28% the differentiation of monocytes into immature mDCs; moreover, mDCs secreted high levels of matrix metalloproteinase-9 and upregulated C1q, heat shock protein 60, heat shock protein 70, CCR2, and CXCL16 transcripts in response to P. gingivalis in a fimbriae-dependent manner. Moreover, the survival of the anaerobe P. gingivalis under aerobic conditions was enhanced when within mDCs. Immunofluorescence analysis of oral mucosa and atherosclerotic plaques demonstrate infiltration with mDCs, colocalized with P. gingivalis. Our results suggest a role for blood mDCs in harboring and disseminating pathogens from oral mucosa to atherosclerosis plaques, which may provide key signals for mDC differentiation and atherogenic conversion.
Three new DC-to-DC Single-Switch Converters
Directory of Open Access Journals (Sweden)
Barry W. Williams
2017-06-01
Full Text Available This paper presents a new family of three previously unidentified dc-to-dc converters, buck, boost, and buck-boost voltage-transfer-function topologies, which offer advantageous transformer coupling features and low capacitor dc voltage stressing. The three single-switch, single-diode, converters offer the same features as basic dc-to-dc converters, such as the buck function with continuous output current and the boost function with continuous input current. Converter time-domain simulations and experimental results (including transformer coupling support and extol the dc-to-dc converter concepts and analysis presented.
Electrothermal model of choking-coils for the analysis of dc-dc converters
Energy Technology Data Exchange (ETDEWEB)
Gorecki, Krzysztof, E-mail: gorecki@am.gdynia.pl [Gdynia Maritime University, Department of Marine Electronics, Morska 83, Gdynia (Poland); Detka, Kalina [Pomeranian Higher School in Gdynia, Opata Hackiego 8-10, Gdynia (Poland)
2012-09-01
The paper concerns modelling the choking-coil for the needs of the electrothermal analysis of dc-dc converters. A new electrothermal model of the choking-coil is proposed. This model is dedicated for SPICE software and it takes into account nonlinearity of the dependences of the inductance on the current, selfheating and mutual thermal interactions between the core and the winding. The structure of this model is described in detail and its correctness is experimentally verified for the choking-coils with the ferrite and powder cores. Both the characteristics of the choking-coils and the buck converter with these choking-coils were considered. The satisfying agreement between the results of calculations and measurements is obtained.
Wind-powered asynchronous AC/DC/AC converter system. [for electric power supply regulation
Reitan, D. K.
1973-01-01
Two asynchronous ac/dc/ac systems are modelled that utilize wind power to drive a variable or constant hertz alternator. The first system employs a high power 60-hertz inverter tie to the large backup supply of the power company to either supplement them from wind energy, storage, or from a combination of both at a preset desired current; rectifier and inverter are identical and operate in either mode depending on the silicon control rectifier firing angle. The second system employs the same rectification but from a 60-hertz alternator arrangement; it provides mainly dc output, some sinusoidal 60-hertz from the wind bus and some high harmonic content 60-hertz from an 800-watt inverter.
Directory of Open Access Journals (Sweden)
Qing Zhang
2018-01-01
Full Text Available Electric force is the most popular technique for bioparticle transportation and manipulation in microfluidic systems. In this paper, the iterative dipole moment (IDM method was used to calculate the dielectrophoretic (DEP forces of particle-particle interactions in a two-dimensional DC electric field, and the Lagrangian method was used to solve the transportation of particles. It was found that the DEP properties and whether the connection line between initial positions of particles perpendicular or parallel to the electric field greatly affect the chain patterns. In addition, the dependence of the DEP particle interaction upon the particle diameters, initial particle positions, and the DEP properties have been studied in detail. The conclusions are advantageous in elelctrokinetic microfluidic systems where it may be desirable to control, manipulate, and assemble bioparticles.
Symmetry Tests in Polarized Z{sup 0} Decays to b{bar b}g
Energy Technology Data Exchange (ETDEWEB)
Muller, David
1999-07-09
Angular asymmetries have been measured in polarized Z{sup 0} decays to b{bar b}g collected by the SLD experiment at the SLC. A high purity b{bar b}g event sample is selected by utilizing B lifetime information given by the SLD CCD pixel vertex detector and the stable micron-size SLC beams, and the b- and {bar b}-jets are identified using lifetime information and momentum- weighted track charge. The forward-backward asymmetry is observed in the b-quark polar angle distribution, and the parity-violation parameter is measured to test the Standard Model. Two angular correlations between the three-jet plane and the Z{sup 0} polarization are studied. The CP-even and T-odd, and the CP-odd and T-odd, angular asymmetries are sensitive to physics beyond the Standard Model. The latter requires tagging both the b- and {bar b}-jet. We measure the expectation values of these quantities to be consistent with zero and set limits on the correlations at the 5% level.
Radiation detection from phase-locked serial dc SQUID arrays
DEFF Research Database (Denmark)
Kaplunenko, V. K.; Mygind, Jesper; Pedersen, Niels Falsig
1993-01-01
We report on synchronous operation of series arrays of inductively coupled superconducting quantum interference devices (SQUIDs). Each array consisted of N=3 or 11 dc SQUIDs with common inductances providing a strong interaction between neighboring cells. Externally shunted (betac[approximately-e......We report on synchronous operation of series arrays of inductively coupled superconducting quantum interference devices (SQUIDs). Each array consisted of N=3 or 11 dc SQUIDs with common inductances providing a strong interaction between neighboring cells. Externally shunted (betac...
2010-10-01
... Airworthiness Directives; McDonnell Douglas Corporation Model DC- 10-10, DC-10-10F, DC-10-15, DC-10-30, DC-10... adding the following new AD: 2010-20-14 McDonnell Douglas Corporation: Amendment 39-16449. Docket No. FAA... the airplanes identified in paragraphs (c)(1) and (c)(2) of this AD. (1) McDonnell Douglas Corporation...
2010-07-07
...-0672; Directorate Identifier 2010-NM-047-AD] RIN 2120-AA64 Airworthiness Directives; McDonnell Douglas...: McDonnell Douglas Corporation: Docket No. FAA-2010-0672; Directorate Identifier 2010-NM-047-AD. Comments Due... applies to McDonnell Douglas Corporation Model DC- 10-10, DC-10-10F, DC-10-30, DC-10-30F (KDC-10), DC-10...
Ac-dc converter firing error detection
International Nuclear Information System (INIS)
Gould, O.L.
1996-01-01
Each of the twelve Booster Main Magnet Power Supply modules consist of two three-phase, full-wave rectifier bridges in series to provide a 560 VDC maximum output. The harmonic contents of the twelve-pulse ac-dc converter output are multiples of the 60 Hz ac power input, with a predominant 720 Hz signal greater than 14 dB in magnitude above the closest harmonic components at maximum output. The 720 Hz harmonic is typically greater than 20 dB below the 500 VDC output signal under normal operation. Extracting specific harmonics from the rectifier output signal of a 6, 12, or 24 pulse ac-dc converter allows the detection of SCR firing angle errors or complete misfires. A bandpass filter provides the input signal to a frequency-to-voltage converter. Comparing the output of the frequency-to-voltage converter to a reference voltage level provides an indication of the magnitude of the harmonics in the ac-dc converter output signal
CDC Vital Signs: Progress on Childhood Obesity
... VitalSigns – Childhood Obesity [PSA – 0:60 seconds] VitalSigns – Obesidad en niños: [PODCAST – 1:15 minutes] Childhood Overweight ... Prevention and Control MedlinePlus – Obesity in Children MedlinePlus – Obesidad en niños Top of Page Get Email Updates ...
2010-02-08
...-0032; Directorate Identifier 2009-NM-213-AD] RIN 2120-AA64 Airworthiness Directives; McDonnell Douglas...: McDonnell Douglas Corporation: Docket No. FAA-2010-0032; Directorate Identifier 2009-NM-213-AD. Comments Due... applies to McDonnell Douglas Corporation Model DC- 10-10, DC-10-10F, DC-10-15, DC-10-30, DC-10-30F (KC-10A...
2010-10-07
... Airworthiness Directives; McDonnell Douglas Corporation Model DC- 8-31, DC-8-32, DC-8-33, DC-8-41, DC-8-42, and... to all of the McDonnell Douglas Corporation airplanes identified above. The existing AD currently... the following new airworthiness directive (AD): 2010-21-03 McDonnell Douglas Corporation: Amendment 39...
Directory of Open Access Journals (Sweden)
Aiqin Liu
Full Text Available BACKGROUND: Giardia duodenalis is a common intestinal parasite that infects humans and many other mammals, mainly distributing in some areas with poor sanitation. The proportion of the human giardiasis burden attributable to G. duodenalis of animal origin differs in different geographical areas. In Mainland China, genetic data of the gdh and bg genes of G. duodenalis from animals are only limited in dogs and cats. The aim of the study was to provide information on the genetic characterizations of animal-derived G. duodenalis isolates (from rabbits, sheep and cattle at both loci in Heilongjiang Province, Northeastern China, and to assess the potential for zoonotic transmission. METHODOLOGY/PRINCIPAL FINDINGS: 61 G. duodenalis isolates from animal feces (dairy and beef cattle, sheep and rabbits in Heilongjiang Province were characterized at the gdh and bg loci in the present study. The gdh and bg gene sequences of sheep-derived G. duodenalis assemblage AI, and the gdh sequences of rabbit-derived G. duodenalis assemblage B had 100% similarity with those from humans, respectively. Novel subtypes of G. duodenalis were identified, with one and seven subtypes for assemblages A and E at the gdh locus, and two and three subtypes for assemblages B and E at the bg locus, respectively. Three pairs of the same bg sequences of assemblage E were observed in sheep and cattle. CONCLUSIONS/SIGNIFICANCE: This is the first description of genetic characterizations of the gdh and bg genes of G. duodenalis from rabbits, sheep and cattle in Mainland China. Homology analysis of assemblages AI and B implied the possibility of zoonotic transmission. The novel subtypes of assemblages of G. duodenalis may represent the endemic genetic characteristics of G. duodenalis in Heilongjiang Province, China.
Directory of Open Access Journals (Sweden)
Lo Shih-Yen
2011-05-01
Full Text Available Abstract Background Ganoderma lucidum-derived polysaccharide (PS-G can rapidly and effectively promote the activation and maturation of immature dendritic cells (DCs, suggesting that PS-G possesses the capacity to regulate immune responses. This study aimed to clarify the immunologic effect of PS-G on monocyte-derived dendritic cells (MD-DCs from asthmatic children allergic to house dust mites. The MD-DCs were stimulated for 24 h with the related allergen, Der p 1, in the presence or absence of PS-G. Cell surface markers and phagocytic capacity were assessed by FACS analysis, and key polarizing cytokines (IL-12 p40, IL-12 p70, IL-6, IL-23, and IL-10 were quantified. The subsequent regulatory effect of pulsed MD-DCs on naïve T cells was evaluated by determining the T-cell cytokine profile. Results PS-G induced the maturation of MD-DCs and decreased phagocytic capacity, even if pulsed with Der p 1. After incubation with PS-G and Der p 1, MD-DCs produced higher amounts of IL-12 p70, IL-12 p40, IL-6, IL-23, and IL10 than Der p 1-pulsed DCs. Furthermore, type 1 helper T (Th1 cell cytokine (INF-γ production was highly increased when naïve autologous T cells were co-cultured with Der p 1-pulsed MD-DCs. Naïve T cells stimulated by MD-DCs pulsed with Der p 1 failed to produce proliferation of T-cells, whereas the addition of PS-G to Der p 1 induced a significant proliferation of T-cells similar to that observed with PS-G alone. Conclusion The presence of PS-G in an allergen pulse promoted allergic MD-DCs to produce IL-12 p70, IL-12 p40, IL-6, IL-23, and IL-10, and exerted an effect on shifting the immune balance towards Th1 in children with allergic asthma.
Wang, Qisi; Park, J T; Feng, Yu; Shen, Yao; Hao, Yiqing; Pan, Bingying; Lynn, J W; Ivanov, A; Chi, Songxue; Matsuda, M; Cao, Huibo; Birgeneau, R J; Efremov, D V; Zhao, Jun
2016-05-13
An essential step toward elucidating the mechanism of superconductivity is to determine the sign or phase of the superconducting order parameter, as it is closely related to the pairing interaction. In conventional superconductors, the electron-phonon interaction induces attraction between electrons near the Fermi energy and results in a sign-preserved s-wave pairing. For high-temperature superconductors, including cuprates and iron-based superconductors, prevalent weak coupling theories suggest that the electron pairing is mediated by spin fluctuations which lead to repulsive interactions, and therefore that a sign-reversed pairing with an s_{±} or d-wave symmetry is favored. Here, by using magnetic neutron scattering, a phase sensitive probe of the superconducting gap, we report the observation of a transition from the sign-reversed to sign-preserved Cooper-pairing symmetry with insignificant changes in T_{c} in the S-doped iron selenide superconductors K_{x}Fe_{2-y}(Se_{1-z}S_{z})_{2}. We show that a rather sharp magnetic resonant mode well below the superconducting gap (2Δ) in the undoped sample (z=0) is replaced by a broad hump structure above 2Δ under 50% S doping. These results cannot be readily explained by simple spin fluctuation-exchange pairing theories and, therefore, multiple pairing channels are required to describe superconductivity in this system. Our findings may also yield a simple explanation for the sometimes contradictory data on the sign of the superconducting order parameter in iron-based materials.
Multi Bus DC-DC Converter in Electric Hybrid Vehicles
Krithika, V.; Subramaniam, C.; Sridharan, R.; Geetha, A.
2018-04-01
This paper is cotncerned with the design, simulation and fabrication of the prototype of a Multi bus DC- DC converter operating from 42V DC and delivering 14V DC and 260V DC. As a result, three DC buses are interconnected through a single power electronic circuitry. Such a requirement is energized in the development of a hybrid electric automobile which uses the technology of fuel cell. This is implemented by using a Bidirectional DC-DC converter configuration which is ideally suitable for multiple outputs with mutual electrical isolation. For the sake of reduced size and cost of step-up transformer, selection of a high frequency switching cycle at 10 KHz was done.
DEFF Research Database (Denmark)
2015-01-01
The present invention relates to a step-up DC-DC power converter which comprises a primary side circuit and a secondary side circuit coupled through a galvanic isolation barrier. The primary side circuit comprises a positive and a negative input terminal for receipt of an input voltage and an input...... being charged from the input voltage and discharged to the output capacitor through the galvanic isolation barrier in accordance with a switch control signal to produce the converter output voltage. The step-up DC-DC power converter comprises an electrical short-circuit connection across the galvanic...
AC-DC PFC Converter Using Combination of Flyback Converter and Full-bridge DC-DC Converter
Directory of Open Access Journals (Sweden)
Moh. Zaenal Efendi
2014-06-01
Full Text Available This paper presents a combination of power factor correction converter using Flyback converter and Full-bridge dc-dc converter in series connection. Flyback converter is operated in discontinuous conduction mode so that it can serve as a power factor correction converter and meanwhile Full-bridge dc-dc converter is used for dc regulator. This converter system is designed to produce a 86 Volt of output voltage and 2 A of output current. Both simulation and experiment results show that the power factor of this converter achieves up to 0.99 and meets harmonic standard of IEC61000-3-2. Keywords: Flyback Converter, Full-bridge DC-DC Converter, Power Factor Correction.
Early Oscillation Detection for DC/DC Converter Fault Diagnosis
Wang, Bright L.
2011-01-01
The electrical power system of a spacecraft plays a very critical role for space mission success. Such a modern power system may contain numerous hybrid DC/DC converters both inside the power system electronics (PSE) units and onboard most of the flight electronics modules. One of the faulty conditions for DC/DC converter that poses serious threats to mission safety is the random occurrence of oscillation related to inherent instability characteristics of the DC/DC converters and design deficiency of the power systems. To ensure the highest reliability of the power system, oscillations in any form shall be promptly detected during part level testing, system integration tests, flight health monitoring, and on-board fault diagnosis. The popular gain/phase margin analysis method is capable of predicting stability levels of DC/DC converters, but it is limited only to verification of designs and to part-level testing on some of the models. This method has to inject noise signals into the control loop circuitry as required, thus, interrupts the DC/DC converter's normal operation and increases risks of degrading and damaging the flight unit. A novel technique to detect oscillations at early stage for flight hybrid DC/DC converters was developed.
Superconducting energy stabilizer with charging and discharging DC-DC converters
International Nuclear Information System (INIS)
Kim, S.H.; Kostecki, E.L.; DeWinkel, C.C.
1992-01-01
This patent describes a superconducting energy stabilizer having multiple load connections and employing DC-DC conversion for storing energy in a superconducting inductive energy storage device having a first end and a second end, and for releasing the stored energy from the superconducting inductive energy storage device to a load or loads or to a utility or an industrial electrical distribution system, the superconducting energy stabilizer having multiple load connections and employing DC-DC conversion. It comprises: energy storage cell means for supplying energy to the load, discharging DC-DC converter means for releasing energy from the superconducting inductive energy storage device to the energy storage cell means, the discharging DC-DC converter means having input terminals, output terminals, and a discharging control line means for carrying signals controlling the operation of the discharging DC-DC converter means, one of the input terminals of the discharging DC-DC converter means coupled to the first end of the superconducting energy storage device
dc Arc Fault Effect on Hybrid ac/dc Microgrid
Fatima, Zahra
The advent of distributed energy resources (DER) and reliability and stability problems of the conventional grid system has given rise to the wide spread deployment of microgrids. Microgrids provide many advantages by incorporating renewable energy sources and increasing the reliability of the grid by isolating from the main grid in case of an outage. AC microgrids have been installed all over the world, but dc microgrids have been gaining interest due to the advantages they provide over ac microgrids. However the entire power network backbone is still ac and dc microgrids require expensive converters to connect to the ac power network. As a result hybrid ac/dc microgrids are gaining more attention as it combines the advantages of both ac and dc microgrids such as direct integration of ac and dc systems with minimum number of conversions which increases the efficiency by reducing energy losses. Although dc electric systems offer many advantages such as no synchronization and no reactive power, successful implementation of dc systems requires appropriate protection strategies. One unique protection challenge brought by the dc systems is dc arc faults. A dc arc fault is generated when there is a gap in the conductor due to insulation degradation and current is used to bridge the gap, resulting in an arc with very high temperature. Such a fault if it goes undetected and is not extinguished can cause damage to the entire system and cause fires. The purpose of the research is to study the effect of the dc arc fault at different locations in the hybrid ac/dc microgrid and provide insight on the reliability of the grid components when it is impacted by arc faults at various locations in the grid. The impact of dc arc fault at different locations on the performance of the PV array, wind generation, and constant power loads (CPL) interfaced with dc/dc converters is studied. MATLAB/Simulink is used to model the hybrid ac/dc microgrid and arc fault.
Mclyman, C. W.
1983-01-01
Compact dc/dc inverter uses single integrated-circuit package containing six inverter gates that generate and amplify 100-kHz square-wave switching signal. Square-wave switching inverts 10-volt local power to isolated voltage at another desired level. Relatively high operating frequency reduces size of filter capacitors required, resulting in small package unit.
2010-10-14
... Airworthiness Directives; McDonnell Douglas Corporation Model DC- 10-10, DC-10-10F, DC-10-30, DC-10-30F (KDC-10... following new airworthiness directive (AD): 2010-21-13 McDonnell Douglas Corporation: Amendment 39-16473... November 18, 2010. Affected ADs (b) None. Applicability (c) This AD applies to McDonnell Douglas...
2010-11-05
...-1044; Directorate Identifier 2010-NM-033-AD] RIN 2120-AA64 Airworthiness Directives; McDonnell Douglas..., 2007) and adding the following new AD: McDonnell Douglas Corporation: Docket No. FAA-2010-1044.... Applicability (c) This AD applies to all McDonnell Douglas Corporation Model DC-10-10, DC-10-10F, DC-10-15, DC...
Overview of Multi-DC-Bus Solutions for DC Microgrids
DEFF Research Database (Denmark)
Ricchiuto, D.; Mastromauro, R.A.; Liserre, Marco
2013-01-01
DC Microgrids have recently received a lot of attention in the last years due to high penetration of renewable energy sources as well as distributed energy storage systems. In the future DC microgrids could be preferable respect to AC microgrids in terms of redundancy since multi-DC-Bus solutions...... could provide a continuative power supply to the loads. An overview of Multi-DC-Bus solutions is presented in this paper. The performances are compared on the basis of possible DC microgrid configurations, redundancy, different DC voltage levels....
Human Milk Blocks DC-SIGN-Pathogen Interaction via MUC1
Koning, Nathalie; Kessen, Sabine F M; Van Der Voorn, J Patrick; Appelmelk, Ben J; Jeurink, Prescilla V; Knippels, Leon M J; Garssen, Johan; Van Kooyk, Yvette
2015-01-01
Beneficial effects of breastfeeding are well-recognized and include both immediate neonatal protection against pathogens and long-term protection against allergies and autoimmune diseases. Although several proteins have been identified to have anti-viral or anti-bacterial effects like secretory IgA
Glycemic Variation in Tumor Patients with Total Parenteral Nutrition
Directory of Open Access Journals (Sweden)
Jin-Cheng Yang
2015-01-01
Full Text Available Background: Hyperglycemia is associated with poor clinical outcomes and mortality in several patients. However, studies evaluating hyperglycemia variation in tumor patients receiving total parenteral nutrition (TPN are scarce. The aim of this study was to assess the relationship between glycemia and tumor kinds with TPN by monitoring glycemic variation in tumor patients. Methods: This retrospective clinical trial selected 312 patients with various cancer types, whose unique nutrition treatment was TPN during the monitoring period. All patients had blood glucose (BG values assessed at least six times daily during the TPN infusion. The glycemic variation before and after TPN was set as the indicator to evaluate the factors influencing BG. Results: The clinical trial lasted 7.5 ± 3.0 days adjusted for age, gender, family cancer history and blood types. There were six cancer types: Hepatic carcinoma (HC, 21.8%, rectal carcinoma (17.3%, colon carcinoma (CC, 14.7%, gastric carcinoma (29.8%, pancreatic carcinoma (11.5%, and duodenal carcinoma (DC, 4.8%. The patients were divided into diabetes and nondiabetes groups. No statistical differences in TPN glucose content between diabetes and nondiabetes groups were found; however, the tumor types affected by BG values were obvious. With increasing BG values, DC, HC and CC were more represented than other tumor types in this sequence in diabetic individuals, as well as in the nondiabetic group. BG was inclined to be more easily influenced in the nondiabetes group. Other factors did not impact BG values, including gender, body mass index, and TPN infusion duration time. Conclusions: When tumor patients are treated with TPN, BG levels should be monitored according to different types of tumors, besides differentiating diabetes or nondiabetes patients. Special BG control is needed for DC, HC and CC in both diabetic and nondiabetic patients. If BG overtly increases, positive measurements are needed to control BG
DC to DC power converters and methods of controlling the same
Steigerwald, Robert Louis; Elasser, Ahmed; Sabate, Juan Antonio; Todorovic, Maja Harfman; Agamy, Mohammed
2012-12-11
A power generation system configured to provide direct current (DC) power to a DC link is described. The system includes a first power generation unit configured to output DC power. The system also includes a first DC to DC converter comprising an input section and an output section. The output section of the first DC to DC converter is coupled in series with the first power generation unit. The first DC to DC converter is configured to process a first portion of the DC power output by the first power generation unit and to provide an unprocessed second portion of the DC power output of the first power generation unit to the output section.
Directory of Open Access Journals (Sweden)
R. Silva-Ortigoza
2014-01-01
Full Text Available This paper presents a hierarchical controller that carries out the angular velocity trajectory tracking task for a DC motor driven by a DC/DC Buck converter. The high level control is related to the DC motor and the low level control is dedicated to the DC/DC Buck converter; both controls are designed via differential flatness. The high level control provides a desired voltage profile for the DC motor to achieve the tracking of a desired angular velocity trajectory. Then, a low level control is designed to ensure that the output voltage of the DC/DC Buck converter tracks the voltage profile imposed by the high level control. In order to experimentally verify the hierarchical controller performance, a DS1104 electronic board from dSPACE and Matlab-Simulink are used. The switched implementation of the hierarchical average controller is accomplished by means of pulse width modulation. Experimental results of the hierarchical controller for the velocity trajectory tracking task show good performance and robustness against the uncertainties associated with different system parameters.
Interaction of organophosphorus pesticides with DNA nucleotides on a Boron-doped diamond electrode
Energy Technology Data Exchange (ETDEWEB)
Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko, E-mail: gustgarb@yahoo.com.br [Universidade Estadual Paulista Julio de Mesquita Filho (UNESP), Bauru, SP (Brazil). Dept. de Quimica Analitica
2013-12-01
Diamond electrode was used to evaluate the interaction of the nucleotides guanosine monophosphate (GMP) and adenosine monophosphate (AMP) with the pesticides chlorpyrifos, methamidophos and monocrotophos. Changes were observed in the currents and peak potentials of the nucleotide voltammograms in the presence of the pesticides, with dependence on the pesticide concentration (from 5.0 Multiplication-Sign 10{sup -7} to 5.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) and the interaction time (from 1 min to 4 h). This is probably due to binding of the pesticides to the nitrogenous bases present in the nucleotides, which could lead to problems in the DNA replication and biological functions of nucleotides. The pesticides showed stronger interaction with AMP than with GMP. Studies of the interaction of 50 Micro-Sign g mL{sup -1} DNA with the pesticides (from 30 min to 4 h and from 1.0 Multiplication-Sign 10{sup -6} to 6.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) did not reveal any peaks relating to double helix opening or DNA unwinding. (author)
Liwen Pan; Chengning Zhang
2016-01-01
This paper presents an on-board vehicular battery charger that integrates bidirectional AC/DC converter and DC/DC converter to achieve high power density for application in electric vehicles (EVs). The integrated charger is able to transfer electrical energy between the battery pack and the electric traction system and to function as an AC/DC battery charger. The integrated charger topology is presented and the design of passive components is discussed. The control schemes are developed for m...
PENGGUNAAN FUZZY LOGIC UNTUK KONTROL PARALLEL CONVERTER DC-DC
Directory of Open Access Journals (Sweden)
Bambang Prio Hartono
2012-09-01
Full Text Available Abstract: Using system fuzzy logic as control technology have been used on low load dc-dc converter with combined parallel compiled dc-dc converter can obtain big load. With existence of differrence of component parameter and each parallel compiled converter can obtained different current and voltage output. Function of controller for to do adjustment, so that current which is applied to load by each converter can be obtained difference error as small as possible or same. The object of research is developing design of large signal dc-dc converter which is combined with using FLC so that obtain better performance. To get better performance have been made plant model and simulation with CDE method. The more systematic system and design is needed to overcome bigger load on dc-dc converter, so that parallel compiled current master slave control system on dc-dc converter with using fuzzy logic controller is used. Result of research showed that error or difference of current which is applied to load can handled by fuzzy logic controller. Technic of current and voltage controller co to do adjustment current and voltage distribution equally to load. Distribution of iL1,iL2 and output voltage Vo on dc-dc converter with load 2,25 until 7,875 and voltage 100 until 120 volt, load current beetwen 12 until 48, % relatif error Vo 0,4% until 0,9%.
International Nuclear Information System (INIS)
Seo, Jun Ho; Park, Jin Myung; Hong, Sang Hee
2008-01-01
The influence of DC arc jets on the flow fields in a hybrid plasma torch is numerically analyzed by an integrated direct current-radio frequency (DC-RF) plasma model based on magneto-hydrodynamic formulations. The calculated results reveal that the increase in DC arc gas flow rate raises the axial flow velocity along the central column of the DC-RF hybrid plasma together with the enhanced backflow streams in the peripheral wall region. The temperature profiles on the torch exit plane are little affected due to the reheating process of the central column by the combined RF plasma. Accordingly, the exit enthalpy emitted from the DC-RF hybrid torch can be concentrated to the central column of the plasma and controlled by adjusting the DC arc gas flow rate. The swirl in the sheath gas flow turns out to have the opposite effect on the DC arc gas flow rate. The swirling motion of the sheath gas can reduce the back flows near the induction tube wall as well as the axial velocities in the central column of the plasma. Accordingly, the swirl in the sheath gas flow can be used for the functional operation of the DC-RF hybrid plasma along with the DC arc gas flow rate to suppress the back flows at the wall region and to reduce the excessive interactions between the DC arc jet and the ambient RF plasmas. The effects of DC input current on the flow fields of hybrid plasma are similar to those of the DC arc gas flow rate, but the axial velocities for the higher current relatively quickly decay along the centerline. This is in contrast to the increase in the axial velocity remaining in proportion to the increase in the DC arc gas flow rate all the way up to the exit of the DC-RF hybrid plasma. Accordingly, the present integrated numerical analysis suggests that the hybrid plasma field profiles and the entrainment of ambient air from the torch exit are controllable by adjusting the DC arc gas flow rate, the DC input current and swirl in the sheath gas flow taking advantage of
DC8 and DC13 var genes associated with severe malaria bind avidly to diverse endothelial cells.
Directory of Open Access Journals (Sweden)
Marion Avril
Full Text Available During blood stage infection, Plasmodium falciparum infected erythrocytes (IE bind to host blood vessels. This virulence determinant enables parasites to evade spleen-dependent killing mechanisms, but paradoxically in some cases may reduce parasite fitness by killing the host. Adhesion of infected erythrocytes is mediated by P. falciparum erythrocyte membrane protein 1 (PfEMP1, a family of polymorphic adhesion proteins encoded by var genes. Whereas cerebral binding and severe malaria are associated with parasites expressing DC8 and DC13 var genes, relatively little is known about the non-brain endothelial selection on severe malaria adhesive types. In this study, we selected P. falciparum-IEs on diverse endothelial cell types and demonstrate that DC8 and DC13 var genes were consistently among the major var transcripts selected on non-brain endothelial cells (lung, heart, bone marrow. To investigate the molecular basis for this avid endothelial binding activity, recombinant proteins were expressed from the predominant upregulated DC8 transcript, IT4var19. In-depth binding comparisons revealed that multiple extracellular domains from this protein bound brain and non-brain endothelial cells, and individual domains largely did not discriminate between different endothelial cell types. Additionally, we found that recombinant DC8 and DC13 CIDR1 domains exhibited a widespread endothelial binding activity and could compete for DC8-IE binding to brain endothelial cells, suggesting they may bind the same host receptor. Our findings provide new insights into the interaction of severe malaria adhesive types and host blood vessels and support the hypothesis that parasites causing severe malaria express PfEMP1 variants with a superior ability to adhere to diverse endothelial cell types, and may therefore endow these parasites with a growth and transmission advantage.
Full range ZVS DC-DC converter
International Nuclear Information System (INIS)
Upadhyay, Rinki; Badapanda, M.K.; Hannurkar, P.R.
2011-01-01
A 500 V, 24 Amp DC-DC converter with digital signal processor (DSP) based control and protection has been designed, fabricated and tested. Its power circuit consists of IGBT based single phase inverter bridge, ferrite transformer and diode rectifier. All IGBTs in the inverter bridge are operated in zero voltage switching (ZVS) mode to minimize switching losses thereby increasing the efficiency of the converter significantly. The efficiency of this converter is measured to be greater than 97% at full load. In a conventional full bridge inverter, typically ZVS is achieved under full load condition while at light load ZVS is lost. An auxiliary LC circuit has been intentionally incorporated in this converter to achieve ZVS even at light loaded conditions. Detailed simulation of the converter circuit is carried out and crucial waveforms have been presented in this paper. Microchip make dsPIC30F2020 DSP is employed to provide phase shifted PWMs to IGBTs in the inverter bridge. All the crucial parameters are also monitored by this DSP and in case of any unfavorable conditions, the converter is tripped off. Suitable experiments were carried out in this DC-DC converter under different loaded conditions and a close match between the simulated and experimental results were obtained. Such DC-DC converters can be connected in series or parallel for the development of solid state modular power supplies for various applications. (author)
TOPOLOGICAL REVIEW AND ANALYSIS OF DC-DC BOOST CONVERTERS
Directory of Open Access Journals (Sweden)
V. INDRA GANDHI
2017-06-01
Full Text Available DC voltage boost up is essential in numerous applications; especially considering Photovoltaic (PV based renewable power generation system. The conventional DC-DC boost converter is the most admired configuration for this scheme, even if the converter efficiency is restricted at duty cycle near to maximum value. In order to find solution to the problem and improve its conversion capability, many converter configurations have been implemented so far. With this circumstance, this research work proposes to give overview of a few most imperative research works related to DC-DC boost converters. Some configurations are covered and classified basically based on the application. The major benefits and disadvantages related to the available techniques are also briefly conveyed. At last, a proper evaluation is recognized among the important types of DC-DC boost converters in terms of efficiency, number of components, and stability.
Energy Technology Data Exchange (ETDEWEB)
Polenov, Dieter
2010-01-15
The paper discusses DC/DC converters for integration of double layer condensers into the onboard power system. First, requirements on DC/DC converters are listed and compared on the basis of three exemplary applications. A DC/DC converter concept is developed for decoupling transient high-power loads like electric steering systems. Three different topologies are compared using a specially developed method in order to find the best solution for the given application. In order to establish adequate criteria for selecting the switching frequency and inductivities of storage throttles, the influence of the trottle power change on the switching characteristics of the MOSFETs and on certain ranges of EMP interference emissions is investigated. As methods of optimising the operation of the synchronous rectifiers, parallel connection of Schottky diodes and synchronous rectifiers as well as the variation of the shut-off dead times of synchronous rectifiers were investigated. Further, a concept for converter control was developed in consideration of the intended application and topology. Finally, selected aspects for implementation of the DC/DC converter concept are presented as well as the results of experimental investigations.
Tailored HIV-1 vectors for genetic modification of primary human dendritic cells and monocytes.
Durand, Stéphanie; Nguyen, Xuan-Nhi; Turpin, Jocelyn; Cordeil, Stephanie; Nazaret, Nicolas; Croze, Séverine; Mahieux, Renaud; Lachuer, Joël; Legras-Lachuer, Catherine; Cimarelli, Andrea
2013-01-01
Monocyte-derived dendritic cells (MDDCs) play a key role in the regulation of the immune system and are the target of numerous gene therapy applications. The genetic modification of MDDCs is possible with human immunodeficiency virus type 1 (HIV-1)-derived lentiviral vectors (LVs) but requires high viral doses to bypass their natural resistance to viral infection, and this in turn affects their physiological properties. To date, a single viral protein is able to counter this restrictive phenotype, Vpx, a protein derived from members of the HIV-2/simian immunodeficiency virus SM lineage that counters at least two restriction factors present in myeloid cells. By tagging Vpx with a short heterologous membrane-targeting domain, we have obtained HIV-1 LVs incorporating high levels of this protein (HIV-1-Src-Vpx). These vectors efficiently transduce differentiated MDDCs and monocytes either as previously purified populations or as populations within unsorted peripheral blood mononuclear cells (PBMCs). In addition, these vectors can be efficiently pseudotyped with receptor-specific envelopes, further restricting their cellular tropism almost uniquely to MDDCs. Compared to conventional HIV-1 LVs, these novel vectors allow for an efficient genetic modification of MDDCs and, more importantly, do not cause their maturation or affect their survival, which are unwanted side effects of the transduction process. This study describes HIV-1-Src-Vpx LVs as a novel potent tool for the genetic modification of differentiated MDDCs and of circulating monocyte precursors with strong potential for a wide range of gene therapy applications.
Chaos analysis and chaotic EMI suppression of DC-DC converters
Zhang, Bo
2014-01-01
Introduces chaos theory, its analytical methods and the means to apply chaos to the switching power supply design DC-DC converters are typical switching systems which have plenty of nonlinear behaviors, such as bifurcation and chaos. The nonlinear behaviors of DC-DC converters have been studied heavily over the past 20 years, yet researchers are still unsure of the practical application of bifurcations and chaos in switching converters. The electromagnetic interference (EMI), which resulted from the high rates of changes of voltage and current, has become a major design criterion in DC-DC co
Full wave dc-to-dc converter using energy storage transformers
Moore, E. T.; Wilson, T. G.
1969-01-01
Full wave dc-to-dc converter, for an ion thrustor, uses energy storage transformers to provide a method of dc-to-dc conversion and regulation. The converter has a high degree of physical simplicity, is lightweight and has high efficiency.
Pulsed dc self-sustained magnetron sputtering
International Nuclear Information System (INIS)
Wiatrowski, A.; Posadowski, W. M.; Radzimski, Z. J.
2008-01-01
rates were observed for both dc and pulsed dc self-sustained sputtering processes. The pulse characteristics of the voltage and current of the magnetron source during pulsed dc-SSS operation are shown. The presented results illustrate that a stable pulsed dc-SSS process can be obtained at a pulsing frequency in the range of 60-90 kHz and duty factor of 80%-90%
Pulsewidth modulated DC-to-DC power conversion circuits, dynamics, and control designs
Choi, Byungcho
2013-01-01
This is the definitive reference for anyone involved in pulsewidth modulated DC-to-DC power conversion Pulsewidth Modulated DC-to-DC Power Conversion: Circuits, Dynamics, and Control Designs provides engineers, researchers, and students in the power electronics field with comprehensive and complete guidance to understanding pulsewidth modulated (PWM) DC-to-DC power converters. Presented in three parts, the book addresses the circuitry and operation of PWM DC-to-DC converters and their dynamic characteristics, along with in-depth discussions of control design of PWM DC-to
50 mm Diameter digital DC/pulse neutron generator for subcritical reactor test
Energy Technology Data Exchange (ETDEWEB)
Li Gang; Zhang Zhongshuai [Northeast Normal University, Changchun 130024 (China); Chi Qian [Guang Hua College of Chang Chun University, Changchun 130117 (China); Liu Linmao, E-mail: ll888@nenu.edu.cn [Northeast Normal University, Changchun 130024 (China)
2012-11-01
A 50 mm diameter digital DC/pulse neutron generator was developed with 25 mm ceramic drive-in target neutron tube. It was applied in the subcritical reactor test of China Institute of Atomic Energy (CIAE). The generator can produce neutron in three modes: DC, pulse and multiple pulse. The maximum neutron yield of the generator is 1 Multiplication-Sign 10{sup 8} n/s, while the maximum pulse frequency is 10 kHz, and the minimum pulse width is 10 {mu}s. As a remote controlled generator, it is small in volume, easy to be connected and controlled. The tested results indicate that penning ion source has the feature of delay time in glow discharge, and it is easier for glow discharge to happen when switching the DC voltage of penning ion source into pulse. According to these two characteristics, the generator has been modified. This improved generator can be used in many other areas including Prompt Gamma Neutron Activation Analysis (PGNAA), neutron testing and experiment.
Role of dendritic cells infected with human herpesvirus 6 in virus transmission to CD4+ T cells
International Nuclear Information System (INIS)
Takemoto, Masaya; Imasawa, Takayoshi; Yamanishi, Koichi; Mori, Yasuko
2009-01-01
Human herpesvirus 6 (HHV-6) is a ubiquitous betaherpesvirus that predominantly infects and replicates in CD4 + T lymphocytes. However, the mechanism of HHV-6 transmission to T cells from the peripheral mucosa is unknown. Here we found that dendritic cells (DCs) can transmit HHV-6 to T cells, resulting in productive infection. In immature monocyte-derived DCs (MDDCs) infected with HHV-6, viral early and late antigens were expressed, and nucleocapsids containing a DNA core were observed, although few virions were detected in the cytoplasm by electron microscopy, indicating that the maturation of HHV-6 virions may be incomplete in MDDCs. However, HHV-6 transmission from MDDCs to stimulated CD4 + T cells occurred efficiently in coculture of these cells, but not from MDDCs culture supernatants. This transmission was partially inhibited by treating the DCs with a viral DNA synthesis blocker, indicating that viral replication in MDDCs is required for this transmission. Furthermore, myeloid DCs and plasmacytoid DCs infected with HHV-6 could also transmit the virus to stimulated T cells. Thus, DCs may be the first cell population targeted by HHV-6 and could play an important role in the virus' transmission to T cells for their further propagation
Triple voltage dc-to-dc converter and method
Su, Gui-Jia
2008-08-05
A circuit and method of providing three dc voltage buses and transforming power between a low voltage dc converter and a high voltage dc converter, by coupling a primary dc power circuit and a secondary dc power circuit through an isolation transformer; providing the gating signals to power semiconductor switches in the primary and secondary circuits to control power flow between the primary and secondary circuits and by controlling a phase shift between the primary voltage and the secondary voltage. The primary dc power circuit and the secondary dc power circuit each further comprising at least two tank capacitances arranged in series as a tank leg, at least two resonant switching devices arranged in series with each other and arranged in parallel with the tank leg, and at least one voltage source arranged in parallel with the tank leg and the resonant switching devices, said resonant switching devices including power semiconductor switches that are operated by gating signals. Additional embodiments having a center-tapped battery on the low voltage side and a plurality of modules on both the low voltage side and the high voltage side are also disclosed for the purpose of reducing ripple current and for reducing the size of the components.
Impedance-based Analysis of DC Link Control in Voltage Source Rectifiers
DEFF Research Database (Denmark)
Lu, Dapeng; Wang, Xiongfei; Blaabjerg, Frede
2018-01-01
This paper analyzes the dynamics influences of the outer dc link control in the voltage source rectifiers based on the impedance model. The ac-dc interactions are firstly presented by means of full order small signal model in dq frame, which shows the input voltage and load condition are the two...
Directory of Open Access Journals (Sweden)
Chih-Chun Yang
2015-11-01
Full Text Available The photosynthetic cyanobacterium Synechococcus elongatus PCC7942 has recently gained great attention for its ability to directly convert CO2 into renewable chemicals upon genetic engineering. Thus, it is of great interest to increase the growth speed and lower the medium requirement for cultivating this cyanobacterium. The cultivation medium of Synechococcus elongatus PCC7942 has been developed, which consists of many inorganic and metal ingredients with a specific composition, known as the BG-11 medium. In this work, we analyzed the concentration effect of each ingredient and identified the absolutely essential components in BG-11 medium for cyanobacteria growth using the concentration gradient generator chip (CGGC fabricated by MEMS technology. As shown by our results, removal of the individual component sodium nitrate, potassium phosphate, or magnesium sulfate from the BG-11 medium led to severe growth inhibition of Synechococcus elongatus PCC7942. Contrary to our expectation, increasing concentration of the crucial ingredients showed either insignificant or negative impact on cell growth. Overall, standard growth could be achieved without supplementation of ethylenediaminetetraacetic acid (EDTA disodium, sodium carbonate, or sodium citrate to the culture medium. Further improvement of the CGGC-based microfluidic system based on this preliminary study may broaden its application range to analyze more complicated correlations.
Riet, J. te; Reinieren-Beeren, I.M.J.; Figdor, C.G.; Cambi, A.
2015-01-01
The fungus Candida albicans is the most common cause of mycotic infections in immunocompromised hosts. Little is known about the initial interactions between Candida and immune cell receptors, such as the C-type lectin dendritic cell-specific intracellular cell adhesion molecule-3 (ICAM-3)-grabbing
Agamy, Mohammed; Elasser, Ahmed; Sabate, Juan Antonio; Galbraith, Anthony William; Harfman Todorovic, Maja
2014-09-09
A distributed photovoltaic (PV) power plant includes a plurality of distributed dc-dc converters. The dc-dc converters are configured to switch in coordination with one another such that at least one dc-dc converter transfers power to a common dc-bus based upon the total system power available from one or more corresponding strings of PV modules. Due to the coordinated switching of the dc-dc converters, each dc-dc converter transferring power to the common dc-bus continues to operate within its optimal efficiency range as well as to optimize the maximum power point tracking in order to increase the energy yield of the PV power plant.
COMPARISON OF ACCEPTOR PROPERTIES FOR INTERACTION ...
African Journals Online (AJOL)
Preferred Customer
general phenomenon in organic chemistry [5]. Mulliken [6] considered such ..... agents in organic chemistry, this dual influence of temperatures on their interactions with FBPs is an interesting point that has ... Streetman, B.G.; Banarjee, S. Solid State Electronic Devices in Solid State Physical. Electronics, 6th ed., Prentice ...
The performance of the DC motor by the PID controlling PWM DC-DC boost converter
Can, Erol; Sayan, Hasan Hüseyin
2017-01-01
This paper presents the PID controlling direct current (DC) to the direct current boost converter feds DC motor which has a 3.68 kW and 240 V of DC voltage input on its characteristics. What is first formed is the boost converter mathematical model at the design stage. Secondly, a mathematical model of the DC motor is created so that the boost converter with the machine can be established and modeled at the Matlab Simulink. The PID controller is considered for arranging a pulse width modulati...
On and off controlled resonant dc-dc power converter
DEFF Research Database (Denmark)
2015-01-01
The present invention relates to a resonant DC-DC power converter comprising an input side circuit comprising a positive and a negative input terminal for receipt of an input voltage or current and an output side circuit comprising positive and negative output terminals for supply of a converter...... output voltage and connection to a converter load. The resonant DC-DC power converter further comprises a rectification circuit connected between an output of a resonant network and the output side circuit. The resonant network is configured for alternatingly being charged from the input voltage...... or current and discharged through the rectification circuit by a first controllable switch arrangement in accordance with a first switch control signal. A second controllable switch arrangement of the resonant DC-DC power converter is configured to select a first impedance characteristic of the resonant...
The Topologies Research of a Soft Switching Bidirectional DC/DC Converter
DEFF Research Database (Denmark)
Zhang, Qi; Zhang, Yongping; Sun, Xiangdong
2017-01-01
A soft-switching solution implemented to the traditional bidirectional DC/DC converter is developed. The soft-switching cell, which composed of three auxiliary switches, one resonant capacitor and one resonant inductor, is equipped in the traditional bidirectional DC/DC converter to realize circuit...... circle. And the proposed topology of bidirectional soft-switching dc-dc converter(TASBC) performs ideal soft switching at boost operations. The characteristics of the proposed converter has been verified by MATLAB simulations and experimental results....
2010-05-17
... Airworthiness Directives; McDonnell Douglas Corporation Model DC- 9-30, DC-9-40, and DC-9-50 Series Airplanes... airworthiness directive (AD) for certain Model DC-9-30, DC-9-40, and DC-9-50 series airplanes. This AD requires... this AD to detect and correct the potential for an arc/spark condition to occur within the fuel boost...
Directory of Open Access Journals (Sweden)
Haojie Wang
2016-07-01
Full Text Available It is a common practice for storage batteries to be connected to DC microgrid buses through DC-DC converters for voltage support on islanded operation mode. A feed-forward control based dual-loop constant voltage PI control for three-branch interleaved DC-DC converters (TIDC is proposed for storage batteries in DC microgrids. The working principle of TIDC is analyzed, and the factors influencing the response rate based on the dual-loop constant voltage control for TIDC are discussed, and then the method of feed-forward control for TIDC is studied to improve the response rate for load changing. A prototype of the TIDC is developed and an experimental platform is built. The experiment results show that DC bus voltage sags or swells caused by load changing can be reduced and the time for voltage recovery can be decreased significantly with the proposed feed-forward control.
DEFF Research Database (Denmark)
Wang, Haojie; Han, Minxiao; Yan, Wenli
2016-01-01
It is a common practice for storage batteries to be connected to DC microgrid buses through DC-DC converters for voltage support on islanded operation mode. A feed-forward control based dual-loop constant voltage PI control for three-branch interleaved DC-DC converters (TIDC) is proposed...... for storage batteries in DC microgrids. The working principle of TIDC is analyzed, and the factors influencing the response rate based on the dual-loop constant voltage control for TIDC are discussed, and then the method of feed-forward control for TIDC is studied to improve the response rate for load...... changing. A prototype of the TIDC is developed and an experimental platform is built. The experiment results show that DC bus voltage sags or swells caused by load changing can be reduced and the time for voltage recovery can be decreased significantly with the proposed feed-forward control....
Czech Academy of Sciences Publication Activity Database
Wauters, F.; Kraev, I.; Zákoucký, Dalibor; Beck, M.; Breitenfeldt, M.; De Leebeeck, V.; Golovko, V.V.; Kozlov, V. Yu.; Phalet, T.; Roccia, S.; Soti, G.; Tandecki, M.; Towner, I. S.; Traykov, E.; Van Gorp, S.; Severijns, N.
2010-01-01
Roč. 82, č. 5 (2010), 055502/1-055502/14 ISSN 0556-2813 R&D Projects: GA MŠk LA08015 Institutional research plan: CEZ:AV0Z10480505 Keywords : NUCLEAR-MAGNETIC-RESONANCE * POSITRON DECAY * PARITY CONSERVATION Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders Impact factor: 3.416, year: 2010
Martinez-Rodrigo, Fernando; Herrero-De Lucas, Luis Carlos; de Pablo, Santiago; Rey-Boue, Alexis B.
2017-01-01
This paper examines the question of how to use project-based learning to increase student performance and satisfaction in a power electronics course addressing the topics of dc/dc and dc/ac converters, the assembly of a dc/dc converter, and the use of a commercial speed drive. A detailed presentation of the methodology is shown, and the results…
Improved Control Strategy for T-type Isolated DC/DC Converters
DEFF Research Database (Denmark)
Liu, Dong; Deng, Fujin; Wang, Yanbo
2017-01-01
T-type isolated DC/DC converters have recently attracted attention due to their numerous advantages, including few components, low cost, and symmetrical operation of transformers. This study proposes an improved control strategy for increasing the efficiency of T-type isolated DC/DC converters....... Under the proposed strategy, the primary circulating current flows through the auxiliary switches (metal–oxide–semiconductor field-effect transistors) instead of their body diodes in free-wheeling periods. Such feature can reduce conduction losses, thereby improving the efficiency of T-type isolated DC...
DEFF Research Database (Denmark)
Kaufman, J; Salomonsen, J; Skjødt, K
1990-01-01
B-G antigens are cell-surface molecules encoded by a highly polymorphic multigene family located in the chicken major histocompatibility complex (MHC). Rabbit antisera to B-G molecules immunoprecipitate 3-6 bands from iodinated erythrocytes by sodium dodecyl sulfate (SDS) gels under reducing......, which bear intrachain disulfide bonds. All 3-6 bands have different mobilities in SDS gels between different haplotypes, ranging from 30 to 55 kDa. This size polymorphism is not affected by glycosidase treatment or addition of protease inhibitors. Partial proteolysis of cell surface-iodinated B...
Papadopoulou, G.V.; Dam, N.M. van
2017-01-01
Plant-mediated interactions between belowground (BG) and aboveground (AG) herbivores have received increasing interest recently. However, the molecular mechanisms underlying ecological consequences of BG–AG interactions are not fully clear yet. Herbivore-induced plant defenses are complex and
DIFFERENCES BETWEEN AMERICAN SIGN LANGUAGE (ASL AND BRITISH SIGN LANGUAGE (BSL
Directory of Open Access Journals (Sweden)
Zora JACHOVA
2008-06-01
Full Text Available In the communication of deaf people between themselves and hearing people there are three basic aspects of interaction: gesture, finger signs and writing. The gesture is a conditionally agreed manner of communication with the help of the hands followed by face and body mimic. The gesture and the movements pre-exist the speech and they had the purpose to mark something, and later to emphasize the speech expression.Stokoe was the first linguist that realised that the signs are not a whole that can not be analysed. He analysed signs in insignificant parts that he called “chemeres”, and many linguists today call them phonemes. He created three main phoneme categories: hand position, location and movement.Sign languages as spoken languages have background from the distant past. They developed parallel with the development of spoken language and undertook many historical changes. Therefore, today they do not represent a replacement of the spoken language, but are languages themselves in the real sense of the word.Although the structures of the English language used in USA and in Great Britain is the same, still their sign languages-ASL and BSL are different.
High power density dc/dc converter: Selection of converter topology
Divan, Deepakraj M.
1990-01-01
The work involved in the identification and selection of a suitable converter topology is described. Three new dc/dc converter topologies are proposed: Phase-Shifted Single Active Bridge DC/DC Converter; Single Phase Dual Active Bridges DC/DC Converter; and Three Phase Dual Active Bridges DC/DC Converter (Topology C). The salient features of these topologies are: (1) All are minimal in structure, i.e., each consists of an input and output bridge, input and output filter and a transformer, all components essential for a high power dc/dc conversion process; (2) All devices of both the bridges can operate under near zero-voltage conditions, making possible a reduction of device switching losses and hence, an increase in switching frequency; (3) All circuits operate at a constant frequency, thus simplifying the task of the magnetic and filter elements; (4) Since, the leakage inductance of the transformer is used as the main current transfer element, problems associated with the diode reverse recovery are eliminated. Also, this mode of operation allows easy paralleling of multiple modules for extending the power capacity of the system; (5) All circuits are least sensitive to parasitic impedances, infact the parasitics are efficently utilized; and (6) The soft switching transitions, result in low electromagnetic interference. A detailed analysis of each topology was carried out. Based on the analysis, the various device and component ratings for each topology operating at an optimum point, and under the given specifications, are tabulated and discussed.
Figdor, C.G.
2003-01-01
Dendritic Cells (DC) are natural adjuvants able to elicit specific cellular interactions and priming of naive T cells at a mature stage of their differentiation. Recent genomic approaches helped defining DC or Langherans Cells (LC) in more molecular terms. DC-SIGN, the DC specific ICAM-3 grabbing
International Nuclear Information System (INIS)
Tian, Mei; Cui, Ya-Zhou; Song, Guan-Hua; Zong, Mei-Juan; Zhou, Xiao-Yan; Chen, Yu; Han, Jin-Xiang
2008-01-01
There is an urgent need to discover more sensitive and specific biomarkers to improve early diagnosis and screen high-risk patients for pancreatic ductal adenocarcinoma (PDAC). Pancreatic juice is an ideal specimen for PDAC biomarkers discovery, because it is an exceptionally rich source of proteins released from pancreatic cancer cells. To identify novel potential biomarkers for PDAC from pancreatic juice, we carried out difference gel electrophoresis (DIGE) and tandem mass spectrometry (MS/MS) to compare the pancreatic juice profiling from 9 PDAC patients and 9 cancer-free controls. Of the identified differently expressed proteins, three up-regulated proteins in pancreatic cancer juice, matrix metalloproteinase-9 (MMP-9), oncogene DJ1 (DJ-1) and alpha-1B-glycoprotein precursor (A1BG), were selected for validation by Western blot and immunohistochemistry. Serum MMP-9 levels were also detected by enzyme linked immunosorbent assay (ELISA). Fourteen proteins were up-regulated and ten proteins were down-regulated in cancerous pancreatic juice compared with cancer-free controls. Increased MMP-9, DJ-1 and A1BG expression in cancerous pancreatic juice were confirmed by Western blot. Immunohistochemical study showed MMP-9, DJ-1 and A1BG positively expressed in 82.4%, 72.5% and 86.3% of pancreatic cancer tissues, significantly higher than that in normal pancreas tissues. Up-regulation of DJ-1 was associated with better differentiation (p < 0.05). Serum MMP-9 levels were significantly higher in PDAC (255.14 ng/ml) than those in chronic pancreatitis (210.22 ng/ml, p = 0.009) and healthy control (203.77 ng/ml, p = 0.027). The present proteome analysis revealed MMP-9, DJ-1 and A1BG proteins as elevated in pancreatic juice from PDAC, which suggest their further utility in PDAC diagnosis and screening. This is the first time A1BG was identified as a potential biomarker in pancreatic cancer associated samples. The measurement of serum MMP-9 might be clinically useful for PDAC
Directory of Open Access Journals (Sweden)
Liwen Pan
2016-06-01
Full Text Available This paper presents an on-board vehicular battery charger that integrates bidirectional AC/DC converter and DC/DC converter to achieve high power density for application in electric vehicles (EVs. The integrated charger is able to transfer electrical energy between the battery pack and the electric traction system and to function as an AC/DC battery charger. The integrated charger topology is presented and the design of passive components is discussed. The control schemes are developed for motor drive system and battery-charging system with a power pulsation reduction circuit. Simulation results in MATLAB/Simulink and experiments on a 30-kW motor drive and 3.3-kW AC/DC charging prototype validate the performance of the proposed technology. In addition, power losses, efficiency comparison and thermal stress for the integrated charger are illustrated. The results of the analyses show the validity of the advanced integrated charger for electric vehicles.
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the July 2017 CDC Vital Signs report. Higher opioid prescribing puts patients at risk for addiction and overdose. Learn what can be done about this serious problem.
Think Sepsis. Time Matters. PSA (:60)
Centers for Disease Control (CDC) Podcasts
2016-08-23
This 60 second public service announcement is based on the August 2016 CDC Vital Signs report. Sepsis is a medical emergency and can happen quickly. Learn the signs of sepsis and how to prevent it. Created: 8/23/2016 by National Center for Injury Prevention and Control (NCIPC). Date Released: 8/23/2016.
Czech Academy of Sciences Publication Activity Database
Aad, G.; Abajyan, T.; Abbott, B.; Böhm, Jan; Chudoba, Jiří; Gallus, Petr; Gunther, Jaroslav; Jakoubek, Tomáš; Juránek, Vojtěch; Kepka, Oldřich; Kupčo, Alexander; Kůs, Vlastimil; Lokajíček, Miloš; Marčišovský, Michal; Mikeštíková, Marcela; Myška, Miroslav; Němeček, Stanislav; Růžička, Pavel; Schovancová, Jaroslava; Šícho, Petr; Staroba, Pavel; Svatoš, Michal; Taševský, Marek; Tic, Tomáš; Valenta, J.; Vrba, Václav; Zeman, Martin
2013-01-01
Roč. 2013, č. 4 (2013), s. 1-36 ISSN 1029-8479 R&D Projects: GA MŠk LA08032 Institutional support: RVO:68378271 Keywords : interaction * lepton * direct production * mass spectrum * dilepton * same sign * ATLAS * transverse momentum * high * CERN LHC Coll Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders Impact factor: 6.220, year: 2013
Convergence analysis of directed signed networks via an M-matrix approach
Meng, Deyuan
2018-04-01
This paper aims at solving convergence problems on directed signed networks with multiple nodes, where interactions among nodes are described by signed digraphs. The convergence analysis is achieved by matrix-theoretic and graph-theoretic tools, in which M-matrices play a central role. The fundamental digon sign-symmetry assumption upon signed digraphs can be removed with the proposed analysis approach. Furthermore, necessary and sufficient conditions are established for semi-positive and positive stabilities of Laplacian matrices of signed digraphs, respectively. A benefit of this result is that given strong connectivity, a directed signed network can achieve bipartite consensus (or state stability) if and only if the signed digraph associated with it is structurally balanced (or unbalanced). If the interactions between nodes are described by a signed digraph only with spanning trees, a directed signed network can achieve interval bipartite consensus (or state stability) if and only if the signed digraph contains a structurally balanced (or unbalanced) rooted subgraph. Simulations are given to illustrate the developed results by considering signed networks associated with digon sign-unsymmetric signed digraphs.
Energy Technology Data Exchange (ETDEWEB)
Shokri, S. [Department of Nanotechnology Engineering, Faculty of Advanced Sciences and Technologies, University of Isfahan, Isfahan 81746-73441 (Iran, Islamic Republic of); Movahedi, B., E-mail: b.movahedi@ast.ui.ac.ir [Department of Nanotechnology Engineering, Faculty of Advanced Sciences and Technologies, University of Isfahan, Isfahan 81746-73441 (Iran, Islamic Republic of); Rafieinia, M. [Biosensor Research Center, Department of Advanced Medical Technology, Isfahan University of Medical Sciences, Isfahan, 64716 (Iran, Islamic Republic of); Salehi, H. [Department of Anatomical Sciences, Isfahan University of Medical Sciences, Isfahan, 64716 (Iran, Islamic Republic of)
2015-12-01
Graphical abstract: - Highlights: • Nanocomposite scaffold was produced using a novel technique. • Bioactive glass, carbon nanotube and chitosan were used for fabrication of nanocomposite scaffold. • The compressive strength of the scaffold was near to the cancellous bone. • Biodegradability of the scaffolds in PBS shows the slow destruction. - Abstract: In the present study, bioactive glass (BG), carbon nanotube (CNT), and chitosan (Cs) were used with different ratios for the fabrication of nanocomposite scaffold for bone tissue engineering. BG was synthesized by sol–gel process and CNT was functionalized by immersing in sulfuric acid as well as nitric acid. Nanocomposite scaffold was produced using a novel technique, hot press, and salt leaching process and cross-linked by Hexamethylene diisocyanate (HDI). The optimum porosity of the scaffold with respect to the ratio of salt and precursor was kept around 70%. Mechanical properties of the scaffolds were increased by the addition of CNT and hence, the compressive strength of them with 4 wt% CNT was increased up to 5.95 ± 0.5 MPa. The nanocomposite scaffolds were characterized by FT-IR, SEM, XRD, and electrochemical analysis. Furthermore, scaffolds were immersed in PBS for evaluating the biodegradability, water absorption, and CNT release. The results indicated that water absorption of the scaffolds was increased by adding CNT to the scaffold. The amount of released CNT after 30 days was measured within 6 × 10{sup −4} and 1 × 10{sup −3} mg/ml. Attachment and proliferation of MG63 osteoblast cell line on Cs/BG/CNT scaffolds were investigated by MTT assay indicating no toxicity for this nanocomposite scaffolds. According to the results of the experiments, the nanocomposite scaffold with modified composition (Cs/BG/CNT, 80:20:2 wt%) was the best one in matters of mechanical, chemical, and cellular properties and also the most appropriate for trabecular bone tissue.
DC conductivity and magnetic properties of piezoelectric-piezomagnetic composite system
Energy Technology Data Exchange (ETDEWEB)
Hemeda, O.M., E-mail: omhemeda@yahoo.co.uk [Tanta University, Faculty of Science, Physics Department (Egypt); Taif University, Faculty of Science, Physics Department (Saudi Arabia); Tawfik, A. [Taif University, Faculty of Science, Physics Department (Saudi Arabia); A-Al-Sharif [Moata University, Faculty of Science, Physics Department (Jordan); Amer, M.A. [Taif University, Faculty of Science, Physics Department (Saudi Arabia); Kamal, B.M.; El Refaay, D.E. [Suez Canal University, Faculty of Science, Physics Department (Egypt); Bououdina, M. [Nanotechnology Centre, College of Science, University of Bahrain, PO Box 32038 (Bahrain); Department of Physics, College of Science, University of Bahrain, PO Box 32038 (Bahrain)
2012-11-15
A series of composites (1-x) (Ni{sub 0.8}Zn{sub 0.2}Fe{sub 2}O{sub 4})+x (BaTiO{sub 3}), where x=0%, 20%, 40%, 60%, 80% and 100% BT content, have been prepared by the standard ceramic technique, then sintered at 1200 Degree-Sign C for 8 h. X-ray diffraction analysis shows that the prepared composites consist of two phases, ferrimagnetic and ferroelectric. DC electrical resistivity, thermoelectric power, charge carriers concentration and charge carrier mobility have been studied at different temperatures. It was found that the DC electrical conductivity increases with increasing BT content. The values of the thermoelectric power were positive and negative for the composites indicating that there are two conduction mechanisms, hopping and band conduction, respectively. Using the values of DC electrical conductivity and thermoelectric power, the values of charge carrier mobility and the charge carrier concentration were calculated. Magnetic measurements (hysteresis loop and magnetic permeability) show that the magnetization decreases by increasing BT content. M-H loop of pure Ni{sub 0.6} Zn{sub 0.4} Fe{sub 2}O{sub 4} composite indicates that it is paramagnetic at room temperature and that the magnetization is diluted by increasing the BT content in the composite system. The value of magnetoelectric coefficient for the composites decreases by increasing BT content for all the compositions except for 40% BT content, which may be due to the low resistivity of magnetic phase compared with the BT phase that causes a leakage of induced charges on the piezoelectric phase. Since both ferroelectric and magnetic phases preserve their basic properties in the bulk composite, the present BT-NZF composite are potential candidates for applications as pollution sensors and electromagnetic waves. - Highlights: Black-Right-Pointing-Pointer Studied composite has a high magnetoelectric coefficient compared with other composites. Black-Right-Pointing-Pointer A p-n transition is observed
PID controller simulator software for DC motor of gamma scanning
International Nuclear Information System (INIS)
Arjoni Amir
2008-01-01
Mostly PID controller (Proportional-Integral-Derivative) has been used in industry. For certain applications, it can be used as a Proportional (P) model only, or as a Proportional-Integral (PI) model. The aim of this paper is to design a PID controller simulator software for DC motor which is used in gamma scanning system. A DC motor is described as a plant of SISO (Single Input Single Output) which is used for pulling down the load (detector + casing) and gamma radiation source (Co-60 + container) by using sling cable. A DC motor consist of an armature and a rotor, the equivalent circuit of DC motor is shown in a transfer function equation between output parameter (angular speed DC motor) and input parameter (voltage of DC motor). Methods used for the process of PID controller design is to arrange the PID controller parameter (Kc, Ti, Td) so that there are more PID controller transfer function model which are able to control angular speed of DC motor in stable condition, as design criteria requirement is needed. Design criteria requirement for control system are the settling time < 3 second, overshoot < 5%, rise time = 0.25 second, steady state gain = 1 and peak time < 3 second with step response reference 1 rad/second. The result of simulation gives several models of PID controller in function transfer equation which is similar with design criteria requirement in a equation of function transfer of order 2 for numerator and order 1 for denominator. (author)
RESONANT STEP-DOWN DC-DC POWER CONVERTERS
DEFF Research Database (Denmark)
2015-01-01
The present invention relates to a resonant step-down DC-DC power converter which comprises a primary side circuit and a secondary side circuit coupled through a galvanic isolation barrier. The primary side circuit comprises a positive and a negative input terminal for receipt of an input voltage...... charged from the input voltage and discharged to the output capacitor through the galvanic isolation barrier by a semiconductor switch arrangement in accordance with a switch control signal to produce the converter output voltage. The resonant step-down DC-DC power converter comprises an electrical short......-circuit connection across the galvanic isolation barrier connecting, in a first case, the second negative electrode of the output capacitor to the positive input terminal of the primary side circuit or, in a second case, connecting the second positive electrode of the output capacitor to the negative input terminal...
Brown, M A; Brown, A H; Jackson, W G; Miesner, J R
2001-07-01
Milk yield and quality were observed on 93 Angus, Brahman, and reciprocal-cross cows over 3 yr to evaluate the interactions of direct and maternal breed effects and heterosis with forage environment. Forage environments were common bermudagrass (BG), endophyte-infected tall fescue (E+), and a rotational system (ROT) of both forages, in which each forage (BG or E+) was grazed during its appropriate season, usually June through October for BG and November through May for E+. Milk yield was estimated each of 6 mo (April through September) via milking machine and converted to a 24-h basis. Milk fat, milk protein, and somatic cell count were analyzed by a commercial laboratory. Heterosis for milk yield was similar among forages, averaging 2.4 kg (P 0.30). Heterosis for somatic cell counts as percentages of purebred means was similar for BG (-68.3%) and E+ (-68.9%) and less favorable for ROT (-31.6%). Maternal breed effects for somatic cell count favored Angus on ROT (P < 0.10) with a similar nonsignificant trend on BG and E+. Direct breed effects for somatic cell count favored Brahman on ROT (P < 0.10) with similar nonsignificant trends on BG and E+. These results suggested that a rotation of cows from E+ to BG in the summer can partially alleviate negative effects of E+ on milk yield. Conclusions also indicated an advantage to crossbred cows in somatic cell count and provided evidence of both direct and maternal breed effects for this trait. The results also suggested that direct breed effects for milk yield, milk fat, and somatic cell count and heterosis for milk yield and somatic cell count (as percentages of purebred means) tended to vary with forage environment, indicating a potential for genotype x environment interaction for these traits.
Atmel Microcontroller Based Soft Switched PWM ZVS Full Bridge DC to DC Converter
Directory of Open Access Journals (Sweden)
DEEPAK KUMAR NAYAK
2010-12-01
Full Text Available This paper deals with the simulation and implementation of soft switched PWM ZVS full bridge DC to DC converter. The 48V DC is efficiently reduced to 12V DC using a DC to DC converter. This converter has advantages like reduced switching losses, stresses and EMI. Input DC is converted into high frequency AC and it is stepped down to 12V level. Later it is rectified using a full wave rectifier. Laboratory model of microcontroller based DC to DC converter is fabricated and tested. The experimental results are compared with the simulation results.
Quasi-Z-Source Half-Bridge DC-DC Converter for Photovoltaic Applications
Vinnikov, D; Chub, A; Husev, O; Zaķis, J
2015-01-01
This paper presents a novel quasi-Z-source halfbridge galvanically isolated DC-DC converter intended for the photovoltaic applications. The topology could be envisioned as an alternative to the boost half-bridge DC-DC converter but the benefit of its symmetric structure reduces the threat of transformer saturation due to the dc flux. The proposed converter features the continuous input current and could be used either with one or two input voltage sources.
Centers for Disease Control (CDC) Podcasts
2012-04-25
This 60 second PSA describes babesiosis, a preventable and treatable tickborne disease, including the signs and symptoms of infection and ways to prevent it. Created: 4/25/2012 by Center for Global Health, Division of Parasitic Diseases and Malaria. Date Released: 4/26/2012.
DC motor operation controlled from a DC/DC power converter in pulse mode with low duty cycle
Stefanov, Goce; Kukuseva, Maja; Citkuseva Dimitrovska, Biljana
2016-01-01
In this paper pulse mode of operation of DC motor controlled by DC/DC power converter is analyzed. DC motor operation with time intervals in which the motor operates without output load is of interest. In this mode it is possible the motor to restore energy. Also, in the paper are represented calculations for the amount of the restored energy in the pulse mode operation of the motor for different duty cycles.
Control of the DC-DC Converter used into Energy Generation System
International Nuclear Information System (INIS)
Bizon, Nicu; Oproescu, Mihai
2006-01-01
This paper presents an investigation of the DC-DC Converter controller used into Energy Generation System. The full bridge is used into an Energy Generation System (EGS) as second power interface between the energy source and the high DC bus. The simulation results show that the DC-DC Converter behavior can be improved using a well designed PI control surface. The used Simulink models for the EGS blocks and some design considerations are presented, too. (authors)
International Nuclear Information System (INIS)
Saeidi, Mohammadreza; Vaezzadeh, Majid; Badakhshan, Farzaneh
2011-01-01
Influence of DC electric field on carbon nanotube (CNT) growth in chemical vapor deposition is studied. Investigation of electric field effect in van der Waals interaction shows that increase in DC electric field raises the magnitude of attractive term of the Lennard-Jones potential. By using a theoretical model based on phonon vibrations of CNT on catalyst, it is shown that there is an optimum field for growth. Also it is observed that CNT under optimum electric field is longer than CNT in the absence of field. Finally, the relation between optimum DC electric field and type of catalyst is investigated and for some intervals of electric field, the best catalyst is introduced, which is very useful for experimental researches. -- Research highlights: → Influence of DC electric field on CNT growth in CVD. → Effect of electric field on van der Waals interaction between CNT and its catalyst. → Applying DC electric field increases attractive term of Lennard-Jonespotential. → There is an optimum DC field for CNT growth. → For catalyst with stronger van der Waals interaction, optimum field is smaller.
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the August 2013 CDC Vital Signs report. The rate of obesity among low-income preschoolers has declined, but one in eight is still obese. This program briefly discusses what can be done.
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the February 2015 CDC Vital Signs report. Secondhand smoke kills more than 400 infants and 41,000 adult nonsmokers every year. Learn what can be done to prevent secondhand smoke exposure.
DEFF Research Database (Denmark)
Salomonsen, J; Skjødt, K; Crone, M
1987-01-01
and affinity-purified once more. Finally, reverse-phase chromatography resulted in a pure product. The B-G antigen was identified in the various fractions by rocket immunoelectrophoresis. The final product was more than 99% pure, as estimated by SDS-PAGE analysis followed by silver stain of proteins. The yield...
Novel composite resonance DC-DC converter with voltage doubler rectifier
Kato, Hisatsugu; Matsuo, Hirohumi; Eguchi, Masaki; Sakamoto, Yukitaka; Nakaishi, Masaki
2009-01-01
This paper deals with a novel composite resonance DC-DC converter with the voltage doubler rectifier, which is developed to be applied to the power conditioner of the photovoltaic generation system. The proposed DC-DC converter has the current and voltage resonance functions. Therefore, the output voltage regulation can be achieved for the large variations of the input voltage and load. Also, this converter has the high power efficiency. The maximum power efficiency 96.1% can be realized.
Ultra-high Efficiency DC-DC Converter using GaN Devices
DEFF Research Database (Denmark)
Ramachandran, Rakesh
2016-01-01
properties of GaN devices can be utilized in power converters to make them more compact and highly efficient. This thesis entitled “Ultra-high Efficiency DC-DC Converter using GaN devices” focuses on achieving ultra-high conversion efficiency in an isolated dc-dc converter by the optimal utilization of Ga...... for many decades. However, the rate of improvement slowed as the silicon power materials asymptotically approached its theoretical bounds. Compared to Si, wideband gap materials such as Silicon Carbide (SiC) and Gallium Nitride (GaN) are promising semiconductors for power devices due to their superior...... in this thesis. Efficiency measurements from the hardware prototype of both the topologies are also presented in this thesis. Finally, the bidirectional operation of an optimized isolated dc-dc converter is presented. The optimized converter has achieved an ultra-high efficiency of 98.8% in both directions...
Frequency analysis of DC tolerant current transformers
International Nuclear Information System (INIS)
Mlejnek, P; Kaspar, P
2013-01-01
This article deals with wide frequency range behaviour of DC tolerant current transformers that are usually used in modern static energy meters. In this application current transformers must comply with European and International Standards in their accuracy and DC tolerance. Therefore, the linear DC tolerant current transformers and double core current transformers are used in this field. More details about the problems of these particular types of transformers can be found in our previous works. Although these transformers are designed mainly for power distribution network frequency (50/60 Hz), it can be interesting to understand their behaviour in wider frequency range. Based on this knowledge the new generations of energy meters with measuring quality of electric energy will be produced. This solution brings better measurement of consumption of nonlinear loads or measurement of non-sinusoidal voltage and current sources such as solar cells or fuel cells. The determination of actual power consumption in such energy meters is done using particular harmonics component of current and voltage. We measured the phase and ratio errors that are the most important parameters of current transformers, to characterize several samples of current transformers of both types
2010-10-05
... Airworthiness Directives; McDonnell Douglas Corporation Model DC- 10-30, DC-10-30F, DC-10-30F (KC-10A and KDC-10...-13 McDonnell Douglas Corporation: Amendment 39-16448; Docket No. FAA-2010-0553; Directorate.... Applicability (c) This AD applies to McDonnell Douglas Corporation Model DC- 10-30, DC-10-30F, DC-10-30F (KC-10A...
Directory of Open Access Journals (Sweden)
Sergio Ignacio Serna-Garcés
2016-03-01
Full Text Available Stand-alone power systems based on renewable energy sources are used to replace generators based on fossil fuels. Those renewable power systems also require Energy Storage Devices (ESD interfaced by a charger/discharger power converter, which consist of a bidirectional DC/DC converter, and a DC bus. This paper proposes a single sliding-mode controller (SMC for the charger/discharger DC/DC converter to provide a stable DC bus voltage in any operation condition: charging or discharging the ESD, or even without any power exchange between the ESD and the DC bus. Due to the non-linear nature of the power converter, the SMC parameters are adapted on-line to ensure global stability in any operation condition. Such stability of the adaptive SMC is mathematically demonstrated using analytical expressions for the transversality, reachability and equivalent control conditions. Moreover, a design procedure for the adaptive SMC parameters is provided in order to ensure the dynamic response required for the correct operation of the load. Finally, simulations and experimental tests validate the proposed controller and design procedure.
Design and Analysis of Two-Phase Boost DC-DC Converter
Taufik Taufik; Tadeus Gunawan; Dale Dolan; Makbul Anwari
2010-01-01
Multiphasing of dc-dc converters has been known to give technical and economical benefits to low voltage high power buck regulator modules. A major advantage of multiphasing dc-dc converters is the improvement of input and output performances in the buck converter. From this aspect, a potential use would be in renewable energy where power quality plays an important factor. This paper presents the design of a 2-phase 200W boost converter for battery charging application. Analysis of results fr...
SCM Handbooks for dc-to-dc Converters
Lee, F.; Mohmoud, M.; Yu, Y.
1984-01-01
Two documents aid in design of control modules for dc-to-dc converters. Features of SCM include: Adaptive stability, power component stress limiting, implementation of various control laws, unified design approach. Analysis and quidelines contained in handbooks enable engineer to design SCM circuit and confidently predict resulting overall performance.
Isolated step-down DC -DC converter for electric vehicles
Kukovinets, O. V.; Sidorov, K. M.; Yutt, V. E.
2018-02-01
Modern motor-vehicle industrial sector is moving rapidly now towards the electricity-driving cars production, improving their range and efficiency of components, and in particular the step-down DC/DC converter to supply the onboard circuit 12/24V of electric vehicle from the high-voltage battery. The purpose of this article - to identify the best circuitry topology to design an advanced step-down DC/DC converters with the smallest mass, volume, highest efficiency and power. And this will have a positive effect on driving distance of electric vehicle (EV). On the basis of computational research of existing and implemented circuit topologies of step-down DC/DC converters (serial resonant converter, full bridge with phase-shifting converter, LLC resonant converter) a comprehensive analysis was carried out on the following characteristics: specific volume, specific weight, power, efficiency. The data obtained was the basis for the best technical option - LLC resonant converter. The results can serve as a guide material in the process of components design of the traction equipment for electric vehicles, providing for the best technical solutions in the design and manufacturing of converting equipment, self-contained power supply systems and advanced driver assistance systems.
Self-interaction corrections applied to Mg-porphyrin, C60, and pentacene molecules
International Nuclear Information System (INIS)
Pederson, Mark R.; Baruah, Tunna; Basurto, Luis; Kao, Der-you
2016-01-01
We have applied a recently developed method to incorporate the self-interaction correction through Fermi orbitals to Mg-porphyrin, C 60 , and pentacene molecules. The Fermi-Löwdin orbitals are localized and unitarily invariant to the Kohn-Sham orbitals from which they are constructed. The self-interaction-corrected energy is obtained variationally leading to an optimum set of Fermi-Löwdin orbitals (orthonormalized Fermi orbitals) that gives the minimum energy. A Fermi orbital, by definition, is dependent on a certain point which is referred to as the descriptor position. The degree to which the initial choice of descriptor positions influences the variational approach to the minimum and the complexity of the energy landscape as a function of Fermi-orbital descriptors is examined in detail for Mg-porphyrin. The applications presented here also demonstrate that the method can be applied to larger molecular systems containing a few hundred electrons. The atomization energy of the C 60 molecule within the Fermi-Löwdin-orbital self-interaction-correction approach is significantly improved compared to local density approximation in the Perdew-Wang 92 functional and generalized gradient approximation of Perdew-Burke-Ernzerhof functionals. The eigenvalues of the highest occupied molecular orbitals show qualitative improvement.
Behera, M.; Ram, S.
2018-03-01
Fourier transform infrared and Raman bands shows a discernible enhancement in band intensity of C–H stretching, C=O stretching, C–N stretching, C–H2 bending, and C–H2 in-plane bending in PVP molecules in the presence of C60 molecules. Amplification in intensity is ascribed to microscopic interactions results when a donation of nonbonding electron (n) occurs from a “>N–C=O” entity of PVP into a lowest unoccupied molecular orbital of the C60 molecule in PVP-C60 charge transfer (CT) complex. The C=O stretching band intensity (integrated) Vs C60 content plot exhibits a peak near a critical 13.9 μM C60 value owing to percolation effect. Light emission spectra show that even a small addition of 4.63 μM C60 able to suppress the band intensity by ~23% as a result of an energy loss. The integrated band intensity also decreases through a peak near 13.9 μM when plotted against the C60-content. In correlation to the vibration spectra, the maximum effect observed both in light emission and excitation spectra suggests a percolation effect in the CT complex. Exhibition of percolation threshold in C60-PVP donor-acceptor complex will be helpful in optimizing the photovoltaic properties vital for solar cell applications.
Czech Academy of Sciences Publication Activity Database
Abazov, V. M.; Abbott, B.; Acharya, B.S.; Kupčo, Alexander; Lokajíček, Miloš
2013-01-01
Roč. 88, č. 5 (2013), "052009-1"-"052009-14" ISSN 1550-7998 R&D Projects: GA MŠk(CZ) LG12006 Institutional support: RVO:68378271 Keywords : anti-p p * interaction * neutral particle * Higgs particle * coupling * electron * muon * dilepton * same sign * final state * D0 * Fermilab Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders Impact factor: 4.864, year: 2013
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
2010-12-07
... Airworthiness Directives; McDonnell Douglas Corporation Model DC- 9-30, DC-9-40, and DC-9-50 Series Airplanes...: We are adopting a new airworthiness directive (AD) for the McDonnell Douglas Corporation airplanes... to include an airworthiness directive (AD) that would apply to certain McDonnell Douglas Model DC-9...
A Component-Reduced Zero-Voltage Switching Three-Level DC-DC Converter
DEFF Research Database (Denmark)
Qin, Zian; Pang, Ying; Wang, Huai
2016-01-01
The basic Zero-Voltage Switching (ZVS) three-level DC-DC converter has one clamping capacitor to realize the ZVS of the switches, and two clamping diodes to clamp the voltage of the clamping capacitor. In order to reduce the reverse recovery loss of the diode as well as its cost, this paper...... proposes to remove one of the clamping diodes in basic ZVS three-level DC-DC converter. With less components, the proposed converter can still have a stable clamping capacitor voltage, which is clamped at half of the dc link voltage. Moreover, the ZVS performance will be influenced by removing the clamping...
Directory of Open Access Journals (Sweden)
Patrizia Puddu
Full Text Available Lactoferrin (LF, a key element in mammalian immune system, plays pivotal roles in host defence against infection and excessive inflammation. Its protective effects range from direct antimicrobial activities against a large panel of microbes, including bacteria, viruses, fungi and parasites, to antinflammatory and anticancer activities. In this study, we show that monocyte-derived dendritic cells (MD-DCs generated in the presence of bovine LF (bLF fail to undergo activation by up-modulating CD83, co-stimulatory and major histocompatibility complex molecules, and cytokine/chemokine secretion. Moreover, these cells are weak activators of T cell proliferation and retain antigen uptake activity. Consistent with an impaired maturation, bLF-MD-DC primed T lymphocytes exhibit a functional unresponsiveness characterized by reduced expression of CD154 and impaired expression of IFN-γ and IL-2. The observed imunosuppressive effects correlate with an increased expression of molecules with negative regulatory functions (i.e. immunoglobulin-like transcript 3 and programmed death ligand 1, indoleamine 2,3-dioxygenase, and suppressor of cytokine signaling-3. Interestingly, bLF-MD-DCs produce IL-6 and exhibit constitutive signal transducer and activator of transcription 3 activation. Conversely, bLF exposure of already differentiated MD-DCs completely fails to induce IL-6, and partially inhibits Toll-like receptor (TLR agonist-induced activation. Cell-specific differences in bLF internalization likely account for the distinct response elicited by bLF in monocytes versus immature DCs, providing a mechanistic base for its multiple effects. These results indicate that bLF exerts a potent anti-inflammatory activity by skewing monocyte differentiation into DCs with impaired capacity to undergo activation and to promote Th1 responses. Overall, these bLF-mediated effects may represent a strategy to block excessive DC activation upon TLR-induced inflammation, adding
Active pre-filters for dc/dc Boost regulators
Directory of Open Access Journals (Sweden)
Carlos Andrés Ramos-Paja
2014-05-01
Full Text Available This paper proposes an active pre-filter to mitigate the current harmonics generated by classical dc/dc Boost regulators, which generate current ripples proportional to the duty cycle. Therefore, high output voltage conditions, i.e., high voltage conversion ratios, produce high current harmonics that must be filtered to avoid damage or source losses. Traditionally, these current components are filtered using electrolytic capacitors, which introduce reliability problems because of their high failure rate. The solution introduced in this paper instead uses a dc/dc converter based on the parallel connection of the Boost canonical cells to filter the current ripples generated by the Boost regulator, improving the system reliability. This solution provides the additional benefits of improving the overall efficiency and the voltage conversion ratio. Finally, the solution is validated with simulations and experimental results.
Legionnaires' Disease PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the June 2017 CDC Vital Signs report. Legionnaires' disease is a serious, often deadly lung infection. People most commonly get it by breathing in water droplets containing Legionella germs. Learn how to prevent infections from Legionella.
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the December 2017 CDC Vital Signs report. In the U.S., about 15 percent of people who have HIV don't know they have it. Learn about the importance of testing, early diagnosis, and treatment.
Laboratory manual for pulse-width modulated DC-DC power converters
Kazimierczuk, Marian K
2015-01-01
Designed to complement a range of power electronics study resources, this unique lab manual helps students to gain a deep understanding of the operation, modeling, analysis, design, and performance of pulse-width modulated (PWM) DC-DC power converters. Exercises focus on three essential areas of power electronics: open-loop power stages; small-signal modeling, design of feedback loops and PWM DC-DC converter control schemes; and semiconductor devices such as silicon, silicon carbide and gallium nitride. Meeting the standards required by industrial employers, the lab manual combines program
A Novel PPFHB Bidirectional DC-DC Converter for Supercapacitor Application
DEFF Research Database (Denmark)
Zhang, Zhe; Thomsen, Ole Cornelius; Andersen, Michael Andreas E.
2009-01-01
This paper presents a novel bidirectional DC-DC converter for the supercapacitor application. In the proposed converter, push-pull forward with half bridge (PPFHB) voltage doubler structure is used to reduce the number of the power switches and get higher voltage gain. Based on phase-shift modula......This paper presents a novel bidirectional DC-DC converter for the supercapacitor application. In the proposed converter, push-pull forward with half bridge (PPFHB) voltage doubler structure is used to reduce the number of the power switches and get higher voltage gain. Based on phase...
Decentralized Interleaving of Paralleled Dc-Dc Buck Converters: Preprint
Energy Technology Data Exchange (ETDEWEB)
Johnson, Brian B [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Rodriguez, Miguel [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Sinha, Mohit [University of Minnesota; Dhople, Sairaj [University of Minnesota; Poon, Jason [University of California at Berkeley
2017-09-01
We present a decentralized control strategy that yields switch interleaving among parallel connected dc-dc buck converters without communication. The proposed method is based on the digital implementation of the dynamics of a nonlinear oscillator circuit as the controller. Each controller is fully decentralized, i.e., it only requires the locally measured output current to synthesize the pulse width modulation (PWM) carrier waveform. By virtue of the intrinsic electrical coupling between converters, the nonlinear oscillator-based controllers converge to an interleaved state with uniform phase-spacing across PWM carriers. To the knowledge of the authors, this work represents the first fully decentralized strategy for switch interleaving of paralleled dc-dc buck converters.
Background: Bitter melon (Momordica charantia) is a commonly used food crop for management of a variety of diseases most notably for control of diabetes, a disease associated with aberrant inflammation. Purpose: To evaluate the anti-inflammatory property of BG-4, a novel bioactive peptide isolated f...
Preventing Stroke Deaths PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the July 2017 CDC Vital Signs report. Higher opioid prescribing puts patients at risk for addiction and overdose. Learn what can be done about this serious problem.
CISH is induced during DC development and regulates DC-mediated CTL activation.
Miah, Mohammad Alam; Yoon, Cheol-Hee; Kim, Joonoh; Jang, Jinah; Seong, Young-Rim; Bae, Yong-Soo
2012-01-01
The cytokine inducible SH2-domain protein (CISH) is a well-known STAT5 target gene, but its role in the immune system remains uncertain. In this study, we found that CISH is predominantly induced during dendritic cell (DC) development from mouse bone marrow (BM) cells and plays a crucial role in type 1 DC development and DC-mediated CTL activation. CISH knockdown reduced the expression of MHC class I, co-stimulatory molecules and pro-inflammatory cytokines in BMDCs. Meanwhile, the DC yield was markedly enhanced by CISH knockdown via cell-cycle activation and reduction of cell apoptosis. Down-regulation of cell proliferation at the later stage of DC development was found to be associated with CISH-mediated negative feedback regulation of STAT5 activation. In T-cell immunity, OT-1 T-cell proliferation was significantly reduced by CISH knockdown in DCs, whereas OT-2 T-cell proliferation was not affected by CISH knockdown. CTLs generated by DC vaccination were also markedly reduced by CISH knockdown, followed by significant impairment of DC-based tumor immunotherapy. Taken together, our data suggest that CISH expression at the later stage of DC development triggers the shutdown of DC progenitor cell proliferation and facilitates DC differentiation into a potent stimulator of CTLs. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Hanna Mazur
2001-09-01
Full Text Available Microcystins and nodularin are potent hepatotoxins produced by fresh and seawater cyanobacteria. The persistence of three hepatotoxins - microcystin-LR, microcystin-RR and nodularin - was investigated in sterile BG-11 medium of different salinity and in water collected from the Gulf of Gdansk. After 21 days of incubation at 17 ± 1oC and constant illumination of about 40 µmol photon m-2 s-1 the concentration of toxins decreased by about 30-37%. No significant changes in toxin concentration in the BG-11 media of different salinity were observed. When toxins were incubated in non-sterile seawater, their concentrations decreased markedly. It is likely that some strains of bacteria are responsible for the breakdown of the toxins. Nodularin turned out to be more resistant to biodegradation than the two microcystins. The influence of certain components of cyanobacteria cells on the accelerated rate of toxin degradation was also considered.
Name signs in Danish Sign Language
DEFF Research Database (Denmark)
Bakken Jepsen, Julie
2018-01-01
in spoken languages, where a person working as a blacksmith by his friends might be referred to as ‘The Blacksmith’ (‘Here comes the Blacksmith!’) instead of using the person’s first name. Name signs are found not only in Danish Sign Language (DSL) but in most, if not all, sign languages studied to date....... This article provides examples of the creativity of the users of Danish Sign Language, including some of the processes in the use of metaphors, visual motivation and influence from Danish when name signs are created.......A name sign is a personal sign assigned to deaf, hearing impaired and hearing persons who enter the deaf community. The mouth action accompanying the sign reproduces all or part of the formal first name that the person has received by baptism or naming. Name signs can be compared to nicknames...
A Bidirectional Multi-Port DC-DC Converter Integrating Voltage Equalizer
DEFF Research Database (Denmark)
Chen, Jianfei; Hou, Shiying; Deng, Fujin
2015-01-01
A novel bidirectional multi-port dc-dc converter integrating voltage equalizer based on switched-capacitor voltage accumulator (SCVA) is proposed. It has two operating modes of charging and discharging for battery modules. All battery modules are connected in series indirectly and can be equalize...... battery modules with different voltages. Simulation results has shown the feasibility of the proposed converter.......A novel bidirectional multi-port dc-dc converter integrating voltage equalizer based on switched-capacitor voltage accumulator (SCVA) is proposed. It has two operating modes of charging and discharging for battery modules. All battery modules are connected in series indirectly and can be equalized...
Asthma - What You Need to Know PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second Public Service Announcement (PSA) is based on the May, 2011 CDC Vital Signs report. Children and adults can have asthma and attacks can be frightening. To help control asthma, know the warning signs of an attack, stay away from asthma triggers, and follow your health care provider's advice.
A Current-Fed Isolated Bidirectional DC-DC Converter
DEFF Research Database (Denmark)
Sun, Xiaofeng; Wu, Xiaoying; Shen, Yanfeng
2017-01-01
This paper proposes a current-fed isolated bidirectional DC-DC converter (CF-IBDC) which has the advantages of wide input voltage range, low input current ripple, low conduction losses, and soft switching over the full operating range. Compared with conventional CF-IBDCs, the voltage spikes...
Bi-Directional DC-DC Converter for PHEV Applications
Energy Technology Data Exchange (ETDEWEB)
Abas Goodarzi
2011-01-31
Plug-In Hybrid Electric Vehicles (PHEV) require high power density energy storage system (ESS) for hybrid operation and high energy density ESS for Electric Vehicle (EV) mode range. However, ESS technologies to maximize power density and energy density simultaneously are not commercially feasible. The use of bi-directional DC-DC converter allows use of multiple energy storage, and the flexible DC-link voltages can enhance the system efficiency and reduce component sizing. This will improve fuel consumption, increase the EV mode range, reduce the total weight, reduce battery initial and life cycle cost, and provide flexibility in system design.
Search for supernova {sup 60}Fe in the Earth's microfossil record
Energy Technology Data Exchange (ETDEWEB)
Bishop, S.; Ludwig, P.; Egli, R.; Faestermann, T.; Korschinek, G.; Rugel, G. [Technische Universitaet Muenchen, James Franck Str. 1, D-85748 Garching (Germany); Department of Earth and Environmental Sciences, Ludwig-Maximilians University, Theresienstrasse 41 80333 Munich (Germany); Technische Universitaet Muenchen, James Franck Str. 1, D-85748 Garching (Germany); Helmholtz-Zentrum Dresden-Rossendorf, Bautzner Landstra. 400, D-01328 Dresden (Germany)
2012-11-12
Approximately 2.8 Myr before the present our planet was subjected to the debris of a supernova explosion. The terrestrial proxy for this event was the discovery of live atoms of {sup 60}Fe in a deep-sea ferromanganese crust. The signature for this supernova event should also reside in magnetite (Fe{sub 3}O{sub 4}) microfossils produced by magnetotactic bacteria extant at the time of the Earth-supernova interaction, provided the bacteria preferentially uptake iron from fine-grained iron oxides and ferric hydroxides. Using empirically derived microfossil concentrations in a deep-sea drill core, we deduce a conservative estimate of the {sup 60}Fe fraction as {sup 60}Fe/Fe Almost-Equal-To 3.6 Multiplication-Sign 10{sup -15}. This value sits comfortably within the sensitivity limit of present accelerator mass spectrometry capabilities.
Arthritis in America PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the March 2017 CDC Vital Signs report. Many adults in the United States have arthritis. Learn how to reduce the pain of arthritis, as well as manage the condition.
Determination of input/output characteristics of full-bridge AC/DC/DC converter for arc welding
Stefanov, Goce; Karadzinov, Ljupco; Sarac, Vasilija; Cingoski, Vlatko; Gelev, Saso
2016-01-01
This paper describes the design and practical implementation of AC/DC/DC converter in mode of arc welding. An analysis of the operation of AC/DC/DC converter and its input/output characteristics are determined with computer simulations. The practical part is consisted of AC/DC/DC converter prototype for arc welding with output power of 3 kW and switching frequency of 64 kHz. The operation of AC/DC/DC converter is validated with experimental measurements.
ITAR Free Commercial-of-the-Shelf DC/DC Converter
Denzinger, Wolfgang; Hintze, Thomas
2014-08-01
A commercial-of-the-shelf (COTS) DC/DC converter for digital space equipment has been developed by ASP under ESA contract with special emphasis on low cost, no use of ITAR listed EEE parts like Mosfets, minimum number of rad-hard digital IC's and a design tolerance against single event effects by appropriate filtering. However, the intention to qualify this discrete converter design for a low cost FM series production was difficult due to the high up-sceening cost of EEE-parts with one lot guarantee and minimum-by. To overcome this problem, in a next step a redesign of the DC/DC converter was performed with all semiconductors like bipolar transistors, rectifiers and zener diodes packaged into hybrids. With this approach it was possible to buy a high number of less expensive wafers or dies from one lot, to perform a lot acceptance test and to integrate the dies into hybrid packages with further up- screening for FM use. The semiconductors have been packaged into three signal hybrids with 44 pins and one power hybrid with 24 pins for the dissipating transistors and rectifiers. The design of the hybrids is such, that all integrated semiconductors can be tested individually. The qualification of four EQM DC/DC converters with different combinations of output voltages has been successfully performed and two FM's have been manufactured and tested.
Vesel, J.; Hurdich, J.
2014-12-01
TERC and Vcom3D used the SigningAvatar® accessibility software to research and develop a Signing Earth Science Dictionary (SESD) of approximately 750 standards-based Earth science terms for high school students who are deaf and hard of hearing and whose first language is sign. The partners also evaluated the extent to which use of the SESD furthers understanding of Earth science content, command of the language of Earth science, and the ability to study Earth science independently. Disseminated as a Web-based version and App, the SESD is intended to serve the ~36,000 grade 9-12 students who are deaf or hard of hearing and whose first language is sign, the majority of whom leave high school reading at the fifth grade or below. It is also intended for teachers and interpreters who interact with members of this population and professionals working with Earth science education programs during field trips, internships etc. The signed SESD terms have been incorporated into a Mobile Communication App (MCA). This App for Androids is intended to facilitate communication between English speakers and persons who communicate in American Sign Language (ASL) or Signed English. It can translate words, phrases, or whole sentences from written or spoken English to animated signing. It can also fingerspell proper names and other words for which there are no signs. For our presentation, we will demonstrate the interactive features of the SigningAvatar® accessibility software that support the three principles of Universal Design for Learning (UDL) and have been incorporated into the SESD and MCA. Results from national field-tests will provide insight into the SESD's and MCA's potential applicability beyond grade 12 as accommodations that can be used for accessing the vocabulary deaf and hard of hearing students need for study of the geosciences and for facilitating communication about content. This work was funded in part by grants from NSF and the U.S. Department of Education.
Directory of Open Access Journals (Sweden)
Laura Mejía-Teniente
2015-11-01
Full Text Available Germin-like proteins (GLPs are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.
Mejía-Teniente, Laura; Joaquin-Ramos, Ahuizolt de Jesús; Torres-Pacheco, Irineo; Rivera-Bustamante, Rafael F; Guevara-Olvera, Lorenzo; Rico-García, Enrique; Guevara-Gonzalez, Ramon G
2015-11-25
Germin-like proteins (GLPs) are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the July 2015 CDC Vital Signs report. Heroin use and heroin-related overdose deaths are increasing. Most people are using it with other drugs, especially prescription opioid painkillers. Learn what can be done to prevent and treat the problem.
Schwab, J. R.
1979-01-01
Performance data obtained through experimental testing of a 22.4 kW traction motor using two types of excitation are presented. Ripple free dc from a motor-generator set for baseline data and pulse width modulated dc as supplied by a battery pack and chopper controller were used for excitation. For the same average values of input voltage and current, the motor power output was independent of the type of excitation. However, at the same speeds, the motor efficiency at low power output (corresponding to low duty cycle of the controller) was 5 to 10 percentage points lower on chopped dc than on ripple free dc. The chopped dc locked-rotor torque was approximately 1 to 3 percent greater than the ripple free dc torque for the same average current.
Preventing Norovirus Outbreaks PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the June 2014 CDC Vital Signs report. Norovirus infects about 20 million Americans each year. Learn how to protect yourself and your family from this very contagious, potentially serious illness.
On the System of Person-Denoting Signs in Estonian Sign Language: Estonian Name Signs
Paales, Liina
2010-01-01
This article discusses Estonian personal name signs. According to study there are four personal name sign categories in Estonian Sign Language: (1) arbitrary name signs; (2) descriptive name signs; (3) initialized-descriptive name signs; (4) loan/borrowed name signs. Mostly there are represented descriptive and borrowed personal name signs among…
CSIR Research Space (South Africa)
Grobler, Inus
2013-09-01
Full Text Available . The military specified DC-DC converters are applicable, spanning from 100 W handheld power managers up to 2 kW DC-DC battery chargers. Circuit layout high frequency effects as well as high frequency impedances of the power components were characterised...
A New Sliding Mode Controller for DC/DC Converters in Photovoltaic Systems
Directory of Open Access Journals (Sweden)
M. Sarvi
2013-01-01
Full Text Available DC/DC converters are widely used in many industrial and electrical systems. As DC/DC converters are nonlinear and time-variant systems, the application of linear control techniques for the control of these converters is not suitable. In this paper, a new sliding mode controller is proposed as the indirect control method and compared to a simple direct control method in order to control a buck converter in photovoltaic applications. The solar arrays are dependent power sources with nonlinear voltage-current characteristics under different environmental conditions (insolation and temperature. From this point of view, the DC/DC converter is particularly suitable for the application of the sliding mode control in photovoltaic application, because of its controllable states. Simulations are performed in Matlab/Simulink software. The simulation results are presented for a step change in reference voltage and input voltage as well as step load variations. The simulations results of proposed method are compared with the conventional PID controller. The results show the good performance of the proposed sliding mode controller. The proposed method can be used for the other DC/DC converter.
Energy Technology Data Exchange (ETDEWEB)
Morita, M.; Tokunaga, Y. [Nippon Steel Corporation, Tokyo (Japan); Miura, D.; Ito, D. [Tokyo Metroporitan University, Tokyo (Japan)
1999-11-25
The V-I properties of YBCO bulk superconductor (QMG(reg sign) :YBa{sub 2}Cu{sub 3}O{sub 7-x} single-crystal containing Y{sub 2}BaCuO{sub 5} particles) were measured using a single rectangular pule current at 77 and 87 K to obtain basic data for super-normal transition. Because of its high J{sub c} property, QMG is a promising bulk material for resistive-type HTC-FCL application. I-shaped QMG rods having cross sections of 0.5 x 1.0 mm were prepared to measure voltage due to pule current. The plots of ln V vs ln I yielded a straight line with a gradient ranging from 5 to 7. By changing the amplitude and length of pulses, the time from the start of sending electricity till the occurrence of quenching was obtained for various amplitudes of pulse current. In this experiment, it is considered that quenching did not occur in the whole rod but only in a small part of it. (author)
Very High Frequency Half Bridge DC/DC Converter
DEFF Research Database (Denmark)
Madsen, Mickey Pierre; Knott, Arnold; Andersen, Michael A. E.
2014-01-01
This paper presents the first, off chip, class DE (resonant half bridge) converter working in the Very High Frequency (VHF) range. The benefits of using half bridge circuits both in the inverter and rectifier part of a VHF resonant dc/dc converter are analyzed and design equations for all...
Sheppard-Taylor Isolated High Boost DC-DC Converter
DEFF Research Database (Denmark)
Chub, Andrii; Siwakoti, Yam Prasad; Vinnikov, Dmitri
2017-01-01
This paper presents a new galvanically isolated step-up dc-dc converter intended for low-power but high step-up applications. The proposed converter is capable of regulating output voltage within a wide range of the input voltage or load variations. In contrast to competitors, the converter can...
Microwave Instrument for Human Vital Signs Detection and Monitoring
DEFF Research Database (Denmark)
Jensen, Brian Sveistrup
problems with homodyne systems, i.e. channel mismatches and DC offsets resulting from hardware imperfections. To verify the theory, a new VSD radar system called the DTU-VISDAM (VItalSigns Detection And Monitoring) has been designed and build. The system together with the implemented signal processing...... front-end was initiated. With financial support from the Danish fund H. C. Ørsteds Fonden, the IC was fabricated in the SG25H3 SiGe:C BiCMOS technology from Innovations for High Performance microelectronics (IHP) GmbH in Germany. The radar transceiver has been measured and altough some adjustments could...
Zheng, Jia; Xiao, Xinhua; Zhang, Qian; Yu, Miao; Xu, Jianping; Qi, Cuijuan; Wang, Tong
2016-01-01
Substantial studies demonstrated that maternal nutrition can significantly determine the susceptibility to developing some metabolic diseases in offspring. However, investigations into the later-life effects of these diets on gut microbiota in the offspring are limited. Our objective was to explore the effects of maternal and post-weaning diet interaction on offspring's gut microbiota and glucose metabolism in later life. The male offspring of dams fed on either a high-fat (HF) diet or control (C) diet and then weaned to either a HF or C diet, generating four groups: C–C, HF–C, C–HF and HF–HF (n=8 in each group). The C–C offspring had lower body weight than C–HF group at 16 weeks of age (Pblood glucose (BG) levels of the male offspring from the C and HF dams weaned HF diet were significantly higher at 30 min, 60 min and 120 min (Pglucose administration compared with those of the C–C group. The C–HF group had higher BG at 30 min than HF–HF group (Pcurve (AUC) in C–HF and HF–HF groups was also significantly larger than C–C group (Pglucose response to a glucose load (Pglucose metabolism and alterations of gut microbiota in later life. Our study is novel in focusing on the effects of maternal and post-weaning diet interaction on offspring gut microbiota and glucose metabolism in later life. PMID:27129301
A DC-DC Conversion Powering Scheme for the CMS Phase-1 Pixel Upgrade
Feld, Lutz Werner; Marcel Friedrichs; Richard Hensch; Karpinski, Waclaw; Klein, Katja; Sammet, Jan Domenik; Wlochal, Michael
2012-01-01
The powering scheme of the CMS pixel detector will be described, and the performance of prototype DC-DC buck converters will be presented, including power efficiency, system tests with DC-DC converters and pixel modules, thermal management, reliability at low temperature, and studies of potential frequency locking betwe...
Study on the Control Algorithm of Two-Stage DC-DC Converter for Electric Vehicles
Directory of Open Access Journals (Sweden)
Changhao Piao
2014-01-01
Full Text Available The fast response, high efficiency, and good reliability are very important characteristics to electric vehicles (EVs dc/dc converters. Two-stage dc-dc converter is a kind of dc-dc topologies that can offer those characteristics to EVs. Presently, nonlinear control is an active area of research in the field of the control algorithm of dc-dc converters. However, very few papers research on two-stage converter for EVs. In this paper, a fixed switching frequency sliding mode (FSFSM controller and double-integral sliding mode (DISM controller for two-stage dc-dc converter are proposed. And a conventional linear control (lag is chosen as the comparison. The performances of the proposed FSFSM controller are compared with those obtained by the lag controller. In consequence, the satisfactory simulation and experiment results show that the FSFSM controller is capable of offering good large-signal operations with fast dynamical responses to the converter. At last, some other simulation results are presented to prove that the DISM controller is a promising method for the converter to eliminate the steady-state error.
Regulation of DC development and DC-mediated T-cell immunity via CISH
Miah, Mohammad Alam; Bae, Yong-Soo
2013-01-01
Cytokine inducible SH2-containing protein (CISH) plays a crucial role in type 1 dendritic cell (DC) development as well as in the DC-mediated activation of cytotoxic T lymphocytes (CTLs). CISH expression at late DC developmental stages shuts down the proliferation of DC progenitors by negatively regulating signal transducer and activator of transcription 5 (STAT5) and facilitates the differentiation of DCs into potent stimulators of CTLs.
Regulation of DC development and DC-mediated T-cell immunity via CISH.
Miah, Mohammad Alam; Bae, Yong-Soo
2013-03-01
Cytokine inducible SH2-containing protein (CISH) plays a crucial role in type 1 dendritic cell (DC) development as well as in the DC-mediated activation of cytotoxic T lymphocytes (CTLs). CISH expression at late DC developmental stages shuts down the proliferation of DC progenitors by negatively regulating signal transducer and activator of transcription 5 (STAT5) and facilitates the differentiation of DCs into potent stimulators of CTLs.
Controlling DC-DC converters by chaos-based pulse width modulation to reduce EMI
International Nuclear Information System (INIS)
Li Hong; Zhang Bo; Li Zhong; Halang, Wolfgang A.; Chen Guanrong
2009-01-01
In this paper, periodic and chaotic behaviors of DC-DC converters under certain parametric conditions are simulated, experimentally verified, and analyzed. Motivated by the work of J.H.B. Deane and D.C. Hamill in 1996, where chaotic phenomena are useful in suppressing electromagnetic interference (EMI) by adjusting the parameters of the DC-DC converter and making it operate in chaos, a chaos-based pulse width modulation (CPWM) is proposed to distribute the harmonics of the DC-DC converters continuously and evenly over a wide frequency range, thereby reducing the EMI. The output waves and spectral properties of the EMI are simulated and analyzed as the carrier frequency or amplitude changes with regard to different chaotic maps. Simulation and experimental results are given to illustrate the effectiveness of the proposed CPWM, which provides a good example of applying chaos theory in engineering practice.
Self-interaction corrections applied to Mg-porphyrin, C{sub 60}, and pentacene molecules
Energy Technology Data Exchange (ETDEWEB)
Pederson, Mark R. [Department of Chemistry, Johns Hopkins University, Baltimore, Maryland 21218 (United States); Baruah, Tunna; Basurto, Luis [Department of Physics, The University of Texas at El Paso, El Paso, Texas 79968 (United States); Kao, Der-you [Department of Mechanical and Aerospace Engineering, George Washington University, Washington, DC 20052 (United States)
2016-04-28
We have applied a recently developed method to incorporate the self-interaction correction through Fermi orbitals to Mg-porphyrin, C{sub 60}, and pentacene molecules. The Fermi-Löwdin orbitals are localized and unitarily invariant to the Kohn-Sham orbitals from which they are constructed. The self-interaction-corrected energy is obtained variationally leading to an optimum set of Fermi-Löwdin orbitals (orthonormalized Fermi orbitals) that gives the minimum energy. A Fermi orbital, by definition, is dependent on a certain point which is referred to as the descriptor position. The degree to which the initial choice of descriptor positions influences the variational approach to the minimum and the complexity of the energy landscape as a function of Fermi-orbital descriptors is examined in detail for Mg-porphyrin. The applications presented here also demonstrate that the method can be applied to larger molecular systems containing a few hundred electrons. The atomization energy of the C{sub 60} molecule within the Fermi-Löwdin-orbital self-interaction-correction approach is significantly improved compared to local density approximation in the Perdew-Wang 92 functional and generalized gradient approximation of Perdew-Burke-Ernzerhof functionals. The eigenvalues of the highest occupied molecular orbitals show qualitative improvement.
Alcohol Poisoning Deaths PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second Public Service Announcement is based on the January 2015 CDC Vital Signs report. In the United States, an average of six people die every day from alcohol poisoning. Learn what you can do to prevent binge drinking and alcohol poisoning.
Studies on first wall and plasma wall interaction in JT-60
International Nuclear Information System (INIS)
Nakamura, Hiroo
1988-12-01
This paper describes studies on first wall and plasma wall interaction in JT-60. Main results are as follows; (1) To select JT-60 first wall material, various RandD were done in FY1975 ∼ 1976. Mo was selected as first wall materials of limiters and divertor plates because of its reliability under a high heat flux condition. (2) Development of low-Z material has been done to reduce impurity problem of Mo first wall. As a result, titanium carbide (TiC) was selected as a coating material on the Mo. High heat load testing has been done for TiC coated Mo limiter same as JT-60. This material can survive under the condition of 1 kW/cm 2 x 10 s, expected in JT-60 limiter design. (3) To reduce high heat load on the divertor plate, separatrix swing is proposed. Optimum frequency of the sweeping is evaluated to be 2 Hz in JT-60. For a discharge with heating power of 30 MW and duration time of 10 s, in addition to the separatrix swing, remote radiative cooling in the divertor region is necessary. Moreover, calculations of erosion thickness have been done for stainless steel, Mo, graphite, TiC and silicon caibide under high heat flux during plasma disruption. (4) In divertor experiments in JT-60, divertor functions on particle, heat load and impurity controls have been demonstrated. In elctron density of 6 x 10 19 m -3 , particle fueling rate of 20 MW NB heating (3 Pa m 3 /s) can be exhausted by divertor pumping system. Effectiveness of remote radiative cooling is demonstrated under the condition of 20 MW NB heating power. Also, separatrix swing is demonstrated to reduce heat load on the divertor plate. Total radiation in main plasma is 5 ∼ 10% of total absorbed power. (author) 120 refs
Motor Vehicle Crash Injuries PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second Public Service Announcement is based on the October 2014 CDC Vital Signs report. Motor vehicle crashes are costly and preventable. Learn what can be done to help prevent motor vehicle injuries.
Agudelo, Marisela; Figueroa, Gloria; Parira, Tiyash; Yndart, Adriana; Muñoz, Karla; Atluri, Venkata; Samikkannu, Thangavel; Nair, Madhavan P
2016-01-01
Epigenetic mechanisms have been shown to play a role in alcohol use disorders (AUDs) and may prove to be valuable therapeutic targets. However, the involvement of histone deacetylases (HDACs) on alcohol-induced oxidative stress of human primary monocyte-derived dendritic cells (MDDCs) has not been elucidated. In the current study, we took a novel approach combining ex vivo, in vitro and in silico analyses to elucidate the mechanisms of alcohol-induced oxidative stress and role of HDACs in the periphery. ex vivo and in vitro analyses of alcohol-modulation of class I HDACs and activity by MDDCs from self-reported alcohol users and non-alcohol users was performed. Additionally, MDDCs treated with alcohol were assessed using qRT-PCR, western blot, and fluorometric assay. The functional effects of alcohol-induce oxidative stress were measured in vitro using PCR array and in silico using gene expression network analysis. Our findings show, for the first time, that MDDCs from self-reported alcohol users have higher levels of class I HDACs compare to controls and alcohol treatment in vitro differentially modulates HDACs expression. Further, HDAC inhibitors (HDACi) blocked alcohol-induction of class I HDACs and modulated alcohol-induced oxidative stress related genes expressed by MDDCs. In silico analysis revealed new target genes and pathways on the mode of action of alcohol and HDACi. Findings elucidating the ability of alcohol to modulate class I HDACs may be useful for the treatment of alcohol-induced oxidative damage and may delineate new potential immune-modulatory mechanisms.
Elimination of output voltage oscillations in DC-DC converter using PWM with PI controller
Directory of Open Access Journals (Sweden)
Sreenivasappa Veeranna Bhupasandra
2010-01-01
Full Text Available In this paper the SIMULINK model of a PWM controlled DC-DC converter is modeled using switching function concept to control the speed of the DC motor. The presence of the voltage oscillation cycles due to higher switching frequency in the DC-DC converter is identified. The effect of these oscillations on the output voltage of the converter, Armature current, Developed torque and Speed of the DC motor is analyzed. In order to minimize the oscillation cycles the PI controller is proposed in the PWM controller.
Analysis of high voltage step-up nonisolated DC-DC boost converters
Alisson Alencar Freitas, Antônio; Lessa Tofoli, Fernando; Junior, Edilson Mineiro Sá; Daher, Sergio; Antunes, Fernando Luiz Marcelo
2016-05-01
A high voltage step-up nonisolated DC-DC converter based on coupled inductors suitable to photovoltaic (PV) systems applications is proposed in this paper. Considering that numerous approaches exist to extend the voltage conversion ratio of DC-DC converters that do not use transformers, a detailed comparison is also presented among the proposed converter and other popular topologies such as the conventional boost converter and the quadratic boost converter. The qualitative analysis of the coupled-inductor-based topology is developed so that a design procedure can be obtained, from which an experimental prototype is implemented to validate the theoretical assumptions.
Common mode noise in three-level DC-DC converters
CSIR Research Space (South Africa)
Grobler, Inus
2009-09-01
Full Text Available that three-level buck DC-DC converters in general generate much lower common mode currents than conventional two-level buck converters. Further, reductions in common mode currents are achieved by using the improved three-level topologies that have been...
Adult Sail Sign: Radiographic and Computed Tomographic Features
Energy Technology Data Exchange (ETDEWEB)
Lee, Yu-Jin; Han, Daehee; Koh, Young Hwan; Zo, Joo Hee; Kim, Sang-Hyun; Kim, Deog Kyeom; Lee, Jeong Sang; Moon, Hyeon Jong; Kim, Jong Seung; Chun, Eun Ju; Youn, Byung Jae; Lee, Chang Hyun; Kim, Sam Soo (Dept. of Radiology, Cheil General Hospital, Kwandong Univ. College of Medicine, Seoul (KR))
2008-02-15
Background: The sail sign is a well-known radiographic feature of the pediatric chest. This sign can be observed in an adult population as well, but for a different reason. Purpose: To investigate the sail sign appearing in adult chest radiography. Material and Methods: Based on two anecdotal adult cases in which frontal chest radiographs showed the sail sign, we prospectively screened radiographs of 10,238 patients to determine the incidence of the sail sign found in adults in their 40s or older. The cause of the sail sign was assessed using computed tomography (CT). Results: The sail sign was revealed in 10 (seven males, three females; median age 60.6 years) of 10,238 patients. Of these 10 patients with a sail sign on frontal radiographs, eight underwent CT. The frontal radiographs of these 10 patients showed a concave superior margin toward the lung in nine patients, a concave inferior margin in five, and a double-lined inferior margin in three. Lateral radiographs disclosed a focal opacity over the minor fissure in five of six patients, which was either fuzzy (n = 4) or sharp (n = 1) in its upper margin, and was sometimes double lined in the inferior margin (n = 3). CT revealed the anterior mediastinal fat to be the cause of the radiographic sail sign, which stretched laterally from the mediastinum to insinuate into the minor fissure. Conclusion: The incidence of sail sign on adult chest radiographs is about 0.1%. The sign is specific enough to eliminate the need for more sophisticated imaging
Adult Sail Sign: Radiographic and Computed Tomographic Features
International Nuclear Information System (INIS)
Lee, Yu-Jin; Han, Daehee; Koh, Young Hwan; Zo, Joo Hee; Kim, Sang-Hyun; Kim, Deog Kyeom; Lee, Jeong Sang; Moon, Hyeon Jong; Kim, Jong Seung; Chun, Eun Ju; Y oun, Byung Jae; Lee, Chang Hyun; Kim, Sam Soo
2008-01-01
Background: The sail sign is a well-known radiographic feature of the pediatric chest. This sign can be observed in an adult population as well, but for a different reason. Purpose: To investigate the sail sign appearing in adult chest radiography. Material and Methods: Based on two anecdotal adult cases in which frontal chest radiographs showed the sail sign, we prospectively screened radiographs of 10,238 patients to determine the incidence of the sail sign found in adults in their 40s or older. The cause of the sail sign was assessed using computed tomography (CT). Results: The sail sign was revealed in 10 (seven males, three females; median age 60.6 years) of 10,238 patients. Of these 10 patients with a sail sign on frontal radiographs, eight underwent CT. The frontal radiographs of these 10 patients showed a concave superior margin toward the lung in nine patients, a concave inferior margin in five, and a double-lined inferior margin in three. Lateral radiographs disclosed a focal opacity over the minor fissure in five of six patients, which was either fuzzy (n = 4) or sharp (n = 1) in its upper margin, and was sometimes double lined in the inferior margin (n = 3). CT revealed the anterior mediastinal fat to be the cause of the radiographic sail sign, which stretched laterally from the mediastinum to insinuate into the minor fissure. Conclusion: The incidence of sail sign on adult chest radiographs is about 0.1%. The sign is specific enough to eliminate the need for more sophisticated imaging
Adult sail sign: radiographic and computed tomographic features.
Lee, Yu-Jin; Han, Daehee; Koh, Young Hwan; Zo, Joo Hee; Kim, Sang-Hyun; Kim, Deog Kyeom; Lee, Jeong Sang; Moon, Hyeon Jong; Kim, Jong Seung; Chun, Eun Ju; Youn, Byung Jae; Lee, Chang Hyun; Kim, Sam Soo
2008-02-01
The sail sign is a well-known radiographic feature of the pediatric chest. This sign can be observed in an adult population as well, but for a different reason. To investigate the sail sign appearing in adult chest radiography. Based on two anecdotal adult cases in which frontal chest radiographs showed the sail sign, we prospectively screened radiographs of 10,238 patients to determine the incidence of the sail sign found in adults in their 40s or older. The cause of the sail sign was assessed using computed tomography (CT). The sail sign was revealed in 10 (seven males, three females; median age 60.6 years) of 10,238 patients. Of these 10 patients with a sail sign on frontal radiographs, eight underwent CT. The frontal radiographs of these 10 patients showed a concave superior margin toward the lung in nine patients, a concave inferior margin in five, and a double-lined inferior margin in three. Lateral radiographs disclosed a focal opacity over the minor fissure in five of six patients, which was either fuzzy (n = 4) or sharp (n = 1) in its upper margin, and was sometimes double lined in the inferior margin (n = 3). CT revealed the anterior mediastinal fat to be the cause of the radiographic sail sign, which stretched laterally from the mediastinum to insinuate into the minor fissure. The incidence of sail sign on adult chest radiographs is about 0.1%. The sign is specific enough to eliminate the need for more sophisticated imaging.
DEFF Research Database (Denmark)
Zhang, Zhe; Thomsen, Ole Cornelius; Andersen, Michael A. E.
2009-01-01
Abstract-In this paper, an extended run time DC UPS system structure with fuel cell and supercapacitor is investigated. A wide input range bi-directional dc-dc converter is described along with the phase-shift modulation scheme and phase-shift with duty cycle control, in different modes. The deli......Abstract-In this paper, an extended run time DC UPS system structure with fuel cell and supercapacitor is investigated. A wide input range bi-directional dc-dc converter is described along with the phase-shift modulation scheme and phase-shift with duty cycle control, in different modes...
Zara, Chiara; Severino, Anna; Flego, Davide; Ruggio, Aureliano; Pedicino, Daniela; Giglio, Ada Francesca; Trotta, Francesco; Lucci, Claudia; D'Amario, Domenico; Vinci, Ramona; Pisano, Eugenia; La Rosa, Giulio; Biasucci, Luigi Marzio; Crea, Filippo; Liuzzo, Giovanna
2017-12-26
Atherosclerosis is a chronic inflammatory disease characterized by a complex interplay between innate and adaptive immunity. Dendritic cells (DCs) play a key role in T-cell activation and regulation by promoting a tolerogenic environment through the expression of the immunosuppressive enzyme indoleamine 2,3-dioxygenase (IDO), an intracellular enzyme involved in tryptophan catabolism. IDO expression and activity was analyzed in monocytes derived DCs (MDDCs) from non-ST segment elevation myocardial infarction (NSTEMI) patients, stable angina (SA) patients and healthy controls (HC) by real-time quantitative polymerase chain reaction (RT-qPCR) before and after in vitro maturation with lipopolysaccharide (LPS). The amount of tryptophan catabolite; kynurenine; was evaluated in the culture supernatants of mature-MDDCs by ELISA assay. Autologous mixed lymphocyte reaction (MLR) between mature-MDDCs and naïve T-cells was carried out to study the differentiation towards T-helper 1 (Th1) and induced regulatory T-cells (iTreg). Analysis of IDO mRNA transcripts in mature-MDDCs revealed a significant reduction in cells isolated from NSTEMI (625.0 ± 128.2; mean ± SEM) as compared with those from SA (958.5 ± 218.3; p = 0.041) and from HC (1183.6 ± 231.6; p = 0.034). Furthermore; the concentration of kynurenine was lower in NSTEMI patients (2.78 ± 0.2) and SA (2.98 ± 0.25) as compared with HC (5.1 ± 0.69 ng/mL; p = 0.002 and p = 0.016; respectively). When IDO-competent mature-MDDCs were co-cultured with allogeneic naïve T-cells, the ratio between the percentage of generated Th1 and iTreg was higher in NSTEMI (4.4 ± 2.9) than in SA (1.8 ± 0.6; p = 0.056) and HC (0.9 ± 0.3; p = 0.008). In NSTEMI, the tolerogenic mechanism of the immune response related to IDO production by activated MDDCs is altered, supporting their role in T-cell dysregulation.
Directory of Open Access Journals (Sweden)
Chiara Zara
2017-12-01
Full Text Available Atherosclerosis is a chronic inflammatory disease characterized by a complex interplay between innate and adaptive immunity. Dendritic cells (DCs play a key role in T-cell activation and regulation by promoting a tolerogenic environment through the expression of the immunosuppressive enzyme indoleamine 2,3-dioxygenase (IDO, an intracellular enzyme involved in tryptophan catabolism. IDO expression and activity was analyzed in monocytes derived DCs (MDDCs from non-ST segment elevation myocardial infarction (NSTEMI patients, stable angina (SA patients and healthy controls (HC by real-time quantitative polymerase chain reaction (RT-qPCR before and after in vitro maturation with lipopolysaccharide (LPS. The amount of tryptophan catabolite; kynurenine; was evaluated in the culture supernatants of mature-MDDCs by ELISA assay. Autologous mixed lymphocyte reaction (MLR between mature-MDDCs and naïve T-cells was carried out to study the differentiation towards T-helper 1 (Th1 and induced regulatory T-cells (iTreg. Analysis of IDO mRNA transcripts in mature-MDDCs revealed a significant reduction in cells isolated from NSTEMI (625.0 ± 128.2; mean ± SEM as compared with those from SA (958.5 ± 218.3; p = 0.041 and from HC (1183.6 ± 231.6; p = 0.034. Furthermore; the concentration of kynurenine was lower in NSTEMI patients (2.78 ± 0.2 and SA (2.98 ± 0.25 as compared with HC (5.1 ± 0.69 ng/mL; p = 0.002 and p = 0.016; respectively. When IDO-competent mature-MDDCs were co-cultured with allogeneic naïve T-cells, the ratio between the percentage of generated Th1 and iTreg was higher in NSTEMI (4.4 ± 2.9 than in SA (1.8 ± 0.6; p = 0.056 and HC (0.9 ± 0.3; p = 0.008. In NSTEMI, the tolerogenic mechanism of the immune response related to IDO production by activated MDDCs is altered, supporting their role in T-cell dysregulation.
DC-DC power converter research for Orbiter/Station power exchange
Ehsani, M.
1993-01-01
This project was to produce innovative DC-DC power converter concepts which are appropriate for the power exchange between the Orbiter and the Space Station Freedom (SSF). The new converters must interface three regulated power buses on SSF, which are at different voltages, with three fuel cell power buses on the Orbiter which can be at different voltages and should be tracked independently. Power exchange is to be bi-directional between the SSF and the Orbiter. The new converters must satisfy the above operational requirements with better weight, volume, efficiency, and reliability than is available from the present conventional technology. Two families of zero current DC-DC converters were developed and successfully adapted to this application. Most of the converters developed are new and are presented.
DEFF Research Database (Denmark)
Kwon, Jun Bum; Wang, Xiongfei; Blaabjerg, Frede
2017-01-01
For the efficiency and simplicity of electric systems, the dc power electronic systems are widely used in a variety of applications such as electric vehicles, ships, aircraft and also in homes. In these systems, there could be a number of dynamic interactions and frequency coupling between network...... with different switching frequency or harmonics from ac-dc converters makes that harmonics and frequency coupling are both problems of ac system and challenges of dc system. This paper presents a modeling and simulation method for a large dc power electronic system by using Harmonic State Space (HSS) modeling...
Preventing Repeat Teen Births PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the April 2013 CDC Vital Signs report, which discusses repeat teen births and ways teens, parents and guardians, health care providers, and communities can help prevent them.
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the June 2015 CDC Vital Signs report. Skin cancer is the most common form of cancer in the U.S. In 2011, there were more than 65,000 cases of melanoma, the most deadly form of skin cancer. Learn how everyone can help prevent skin cancer.
Sliding-mode control of single input multiple output DC-DC converter
Zhang, Libo; Sun, Yihan; Luo, Tiejian; Wan, Qiyang
2016-10-01
Various voltage levels are required in the vehicle mounted power system. A conventional solution is to utilize an independent multiple output DC-DC converter whose cost is high and control scheme is complicated. In this paper, we design a novel SIMO DC-DC converter with sliding mode controller. The proposed converter can boost the voltage of a low-voltage input power source to a controllable high-voltage DC bus and middle-voltage output terminals, which endow the converter with characteristics of simple structure, low cost, and convenient control. In addition, the sliding mode control (SMC) technique applied in our converter can enhance the performances of a certain SIMO DC-DC converter topology. The high-voltage DC bus can be regarded as the main power source to the high-voltage facility of the vehicle mounted power system, and the middle-voltage output terminals can supply power to the low-voltage equipment on an automobile. In the respect of control algorithm, it is the first time to propose the SMC-PID (Proportion Integration Differentiation) control algorithm, in which the SMC algorithm is utilized and the PID control is attended to the conventional SMC algorithm. The PID control increases the dynamic ability of the SMC algorithm by establishing the corresponding SMC surface and introducing the attached integral of voltage error, which endow the sliding-control system with excellent dynamic performance. At last, we established the MATLAB/SIMULINK simulation model, tested performance of the system, and built the hardware prototype based on Digital Signal Processor (DSP). Results show that the sliding mode control is able to track a required trajectory, which has robustness against the uncertainties and disturbances.
Miguelez, Cristina; Morera-Herreras, Teresa; Torrecilla, Maria; Ruiz-Ortega, Jose A; Ugedo, Luisa
2014-01-01
The neurotransmitter serotonin (5-HT) has a multifaceted function in the modulation of information processing through the activation of multiple receptor families, including G-protein-coupled receptor subtypes (5-HT1, 5-HT2, 5-HT4-7) and ligand-gated ion channels (5-HT3). The largest population of serotonergic neurons is located in the midbrain, specifically in the raphe nuclei. Although the medial and dorsal raphe nucleus (DRN) share common projecting areas, in the basal ganglia (BG) nuclei serotonergic innervations come mainly from the DRN. The BG are a highly organized network of subcortical nuclei composed of the striatum (caudate and putamen), subthalamic nucleus (STN), internal and external globus pallidus (or entopeduncular nucleus in rodents, GPi/EP and GPe) and substantia nigra (pars compacta, SNc, and pars reticulata, SNr). The BG are part of the cortico-BG-thalamic circuits, which play a role in many functions like motor control, emotion, and cognition and are critically involved in diseases such as Parkinson's disease (PD). This review provides an overview of serotonergic modulation of the BG at the functional level and a discussion of how this interaction may be relevant to treating PD and the motor complications induced by chronic treatment with L-DOPA.
Y-Source Boost DC/DC Converter for Distributed Generation
DEFF Research Database (Denmark)
Siwakoti, Yam P.; Loh, Poh Chiang; Blaabjerg, Frede
2015-01-01
This paper introduces a versatile Y-source boost dc/dc converter intended for distributed power generation, where high gain is often demanded. The proposed converter uses a Y-source impedance network realized with a tightly coupled three-winding inductor for high voltage boosting that is presently...
SUBCONTRACT REPORT: DC-DC Converter for Fuel Cell and Hybrid Vehicles
Energy Technology Data Exchange (ETDEWEB)
Marlino, Laura D [ORNL; Zhu, Lizhi [Ballard Power Systems/Siemens VDO
2007-07-01
The goal of this project is to develop and fabricate a 5kW dc-dc converter with a baseline 14V output capability for fuel cell and hybrid vehicles. The major objectives for this dc-dc converter technology are to meet: Higher efficiency (92%); High coolant temperature,e capability (105 C); High reliability (15 Years/150,000miles); Smaller volume (5L); Lower weight (6kg); and Lower cost ($75/kW). The key technical challenge for these converters is the 105 C coolant temperatures. The power switches and magnetics must be designed to sustain these operating temperatures reliably, without a large cost/mass/volume penalty.
Multi-level cascaded DC/DC converters for PV applications
Directory of Open Access Journals (Sweden)
Ahmed A.A. Hafez
2015-12-01
Full Text Available A robust multi-level cascaded DC/DC system for Photovoltaic (PV application is advised in this article. There are three PV generators, each is coupled to a half-bridge buck cell. Each PV-generator–buck-converter channel is controlled such that maximum power is captured independently under different irradiation and temperature levels. The system operation under normal and abnormal conditions was comprehensively investigated. Internal Model Control (IMC technique was adopted for tuning the controllers. An elaborate switching modulation strategy was used to reduce the current ripple and inductor size, while maintaining high efficiency. Annotative, simple and robust remedial strategies were proposed to mitigate different anticipated faults. Comprehensive simulation results in Matlab environment were illustrated for corroborating the performance of the advised cascaded DC/DC system under normal/abnormal conditions. The proposed system enjoys the merits of independency, reduced volumetric dimensions and improved efficiency. Furthermore, the system is inherently fault-tolerant.
Brown, M A; Brown, A H; Jackson, W G; Miesner, J R
2000-03-01
Reproductive and preweaning data on 190 Angus (A x A), Brahman (B x B), and reciprocal-cross cows (A x B and B x A) and 434 two- and three-breed-cross calves managed on common bermudagrass (BG), endophyte-infected tall fescue (E+), or a combination of both forages (ROT) were used to evaluate the interaction of forage type with individual and maternal heterosis and maternal and grandmaternal breed effects. Cows were born from 1988 to 1991, and calves sired by 13 Polled Hereford bulls were born from 1995 to 1997. Heterosis for calving rate was larger on E+ than on BG or ROT (P < .05), whereas maternal effects were larger on BG than on ROT (P < .10). Maternal heterosis for birth weight was negative on BG (P < .11) but positive on E+ and ROT (P < .10). Grandmaternal effects were evident on BG (P < .10) and E+ (P < .01) but not on ROT. Forage effects were generally substantial for 205-d weight, calf weaning hip height, and calf weaning weight:height ratio; BG was highest, ROT was intermediate, and E+ was lowest. Maternal heterosis for these traits was generally greater on E+ than on BG (P < .10). Grandmaternal effects for 205-d weight, hip height, and weight:height ratio were not important on any forage. Heterosis for weaning weight per cow exposed was substantial on all forages (P < .01) and was significantly greater on E+ (P < .01) than on BG or ROT, but maternal effects were not significant. Thus, we observed more advantage to Brahman-cross cows over purebreds on E+ than on BG. We also observed that moving cows and calves from E+ to BG in the summer will alleviate some, but not all, of the deleterious effects of E+ on calf growth, although it may be more beneficial for reproductive traits in purebred cows.
Fels, Deborah I.; Richards, Jan; Hardman, Jim; Lee, Daniel G.
2006-01-01
The World Wide Web has changed the way people interact. It has also become an important equalizer of information access for many social sectors. However, for many people, including some sign language users, Web accessing can be difficult. For some, it not only presents another barrier to overcome but has left them without cultural equality. The…
Development of a DC-DC conversion powering scheme for the CMS Phase-1 pixel upgrade
Feld, Lutz Werner; Karpinski, Waclaw; Klein, Katja; Lipinski, Martin; Preuten, Marius; Max Rauch; Rittich, David Michael; Sammet, Jan Domenik; Wlochal, Michael
2014-01-01
A novel powering scheme based on the DC-DC conversion technique will be exploited to power the CMS Phase-1 pixel detector. DC-DC buck converters for the CMS pixel project have been developed, based on the AMIS5 ASIC designed by CERN. The powering system of the Phase-1 pixel detector is described and the performance of the converter prototypes is detailed, including power efficiency, stability of the output voltage, shielding, and thermal management. Results from a test of the magnetic field tolerance of the DC-DC converters are reported. System tests with pixel modules using many components of the future pixel barrel system are summarized. Finally first impressions from a pre-series of 200 DC-DC converters are presented.
Bene, Krisztián P; Kavanaugh, Devon W; Leclaire, Charlotte; Gunning, Allan P; MacKenzie, Donald A; Wittmann, Alexandra; Young, Ian D; Kawasaki, Norihito; Rajnavolgyi, Eva; Juge, Nathalie
2017-01-01
The vertebrate gut symbiont Lactobacillus reuteri exhibits strain-specific adhesion and health-promoting properties. Here, we investigated the role of the mucus adhesins, CmbA and MUB, upon interaction of L. reuteri ATCC PTA 6475 and ATCC 53608 strains with human monocyte-derived dendritic cells (moDCs). We showed that mucus adhesins increased the capacity of L. reuteri strains to interact with moDCs and promoted phagocytosis. Our data also indicated that mucus adhesins mediate anti- and pro-inflammatory effects by the induction of interleukin-10 (IL-10), tumor necrosis factor alpha (TNF-α), IL-1β, IL-6, and IL-12 cytokines. L. reuteri ATCC PTA 6475 and ATCC 53608 were exclusively able to induce moDC-mediated Th1 and Th17 immune responses. We further showed that purified MUB activates moDCs and induces Th1 polarized immune responses associated with increased IFNγ production. MUB appeared to mediate these effects via binding to C-type lectin receptors (CLRs), as shown using cell reporter assays. Blocking moDCs with antibodies against DC-specific intercellular adhesion molecule 3-grabbing non-integrin (DC-SIGN) or Dectin-2 did not affect the uptake of the MUB-expressing strain, but reduced the production of TNF-α and IL-6 by moDCs significantly, in line with the Th1 polarizing capacity of moDCs. The direct interaction between MUB and CLRs was further confirmed by atomic force spectroscopy. Taken together these data suggest that mucus adhesins expressed at the cell surface of L. reuteri strains may exert immunoregulatory effects in the gut through modulating the Th1-promoting capacity of DCs upon interaction with C-type lectins.
Making Health Care Safer PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the March 2013 CDC Vital Signs report, which discusses lethal infections from carbapenem-resistant Enterobacteriaceae, or CRE, germs and ways health care providers can help stop CRE infections.
Low-frequency nuclear quadrupole resonance with a dc SQUID
International Nuclear Information System (INIS)
Chang, J.W.
1991-07-01
Conventional pure nuclear quadrupole resonance (NQR) is a technique well suited for the study of very large quadrupolar interactions. Numerous nuclear magnetic resonance (NMR) techniques have been developed for the study of smaller quadrupolar interactions. However, there are many nuclei which have quadrupolar interactions of intermediate strength. Quadrupolar interactions in this region have traditionally been difficult or unfeasible to detect. This work describes the development and application of a SQUID NQR technique which is capable of measuring intermediate strength quadrupolar interactions, in the range of a few hundred kilohertz to several megahertz. In this technique, a dc SQUID (Superconducting QUantum Interference Device) is used to monitor the longitudinal sample magnetization, as opposed to the transverse magnetization, as a rf field is swept in frequency. This allows the detection of low-frequency nuclear quadrupole resonances over a very wide frequency range with high sensitivity. The theory of this NQR technique is discussed and a description of the dc SQUID system is given. In the following chapters, the spectrometer is discussed along with its application to the study of samples containing half-odd-integer spin quadrupolar nuclei, in particular boron-11 and aluminum-27. The feasibility of applying this NQR technique in the study of samples containing integer spin nuclei is discussed in the last chapter. 140 refs., 46 figs., 6 tabs
Auxiliary resonant DC tank converter
Peng, Fang Z.
2000-01-01
An auxiliary resonant dc tank (ARDCT) converter is provided for achieving soft-switching in a power converter. An ARDCT circuit is coupled directly across a dc bus to the inverter to generate a resonant dc bus voltage, including upper and lower resonant capacitors connected in series as a resonant leg, first and second dc tank capacitors connected in series as a tank leg, and an auxiliary resonant circuit comprising a series combination of a resonant inductor and a pair of auxiliary switching devices. The ARDCT circuit further includes first clamping means for holding the resonant dc bus voltage to the dc tank voltage of the tank leg, and second clamping means for clamping the resonant dc bus voltage to zero during a resonant period. The ARDCT circuit resonantly brings the dc bus voltage to zero in order to provide a zero-voltage switching opportunity for the inverter, then quickly rebounds the dc bus voltage back to the dc tank voltage after the inverter changes state. The auxiliary switching devices are turned on and off under zero-current conditions. The ARDCT circuit only absorbs ripples of the inverter dc bus current, thus having less current stress. In addition, since the ARDCT circuit is coupled in parallel with the dc power supply and the inverter for merely assisting soft-switching of the inverter without participating in real dc power transmission and power conversion, malfunction and failure of the tank circuit will not affect the functional operation of the inverter; thus a highly reliable converter system is expected.
Energy Technology Data Exchange (ETDEWEB)
Wolfe, Lothar PhD
2000-03-01
The DOE-Utility Nuclear Power Engineering Education Matching Grant Program has been established to support the education of students in Nuclear Engineering Programs to maintain a knowledgeable workforce in the United States in order to keep nuclear power as a viable component in a mix of energy sources for the country. The involvement of the utility industry ensures that this grant program satisfies the needs and requirements of local nuclear energy producers and at the same time establishes a strong linkage between education and day-to-day nuclear power generation. As of 1997, seventeen pairs of university-utility partners existed. UMCP was never a member of that group of universities, but applied for the first time with a proposal to Baltimore Gas and Electric Company in January 1999 [1]. This proposal was generously granted by BG&E [2,3] in the form of a gift in the amount of $25,000 from BG&E's Corporate Contribution Program. Upon the arrival of a newly appointed Director of Administration in the Department of Materials and Nuclear Engineering, the BG&E check was deposited into the University's Maryland Foundation Fund. The receipt of the letter and the check enabled UMCP to apply for DOE's matching funds in the same amount by a proposal.
Marvel and DC Characters Inspired by Arachnids
Directory of Open Access Journals (Sweden)
Elidiomar Ribeiro Da-Silva
2014-12-01
Full Text Available This article compares arachnid-based Marvel and DC comics characters. The composition of a comic book character often has interesting ‘real-life’ influences. Given the strong connection between arachnids (especially spiders, scorpions and mites, all belonging to the zoological class 'Arachnida' and human beings it is not surprising that they have inspired many fictional characters. We recorded 84 Marvel Comics characters and 40 DC Comics characters, detailed in the dataset that accompanies the article (Da-Silva 2014. Most characters have been created recently, since the 1990s. Marvel has significantly more arachnid characters than DC. As for taxonomic classification, the characters were based mostly on spiders (zoological order 'Araneae'. Of the total characters, the majority are human beings, but an overwhelming number have at least some typical arachnid features. Villains (60.91% of total are significantly more numerous, considering the sum of the two publishers. Arachnids have bad reputation for being dangerous (Thorp and Woodson 1976; Ruppert and Barnes 1996. Since the public usually considers spiders, scorpions and mites “harmful” in general, we expected a larger contingent of villains. However, there was no statistical difference between the amount of villains and heroes in Marvel characters. It did not happen probably due to the success of one character: the Amazing Spider-Man.
Dc-To-Dc Converter Uses Reverse Conduction Of MOSFET's
Gruber, Robert P.; Gott, Robert W.
1991-01-01
In modified high-power, phase-controlled, full-bridge, pulse-width-modulated dc-to-dc converters, switching devices power metal oxide/semiconductor field-effect transistors (MOSFET's). Decreases dissipation of power during switching by eliminating approximately 0.7-V forward voltage drop in anti-parallel diodes. Energy-conversion efficiency increased.
Prescription Painkiller Overdoses PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the July 2013 CDC Vital Signs report. Prescription painkiller overdoses are an under-recognized and growing problem among women. This program includes things that women and health care providers can do to reduce the risk of overdose.
Raccoon Roundworm Infection PSA (:60)
Centers for Disease Control (CDC) Podcasts
2012-08-27
This 60 second PSA describes the signs and symptoms of and ways to prevent Baylisascaris infection, a parasitic roundworm infection that is spread through raccoon feces. Created: 8/27/2012 by Centers for Disease Control and Prevention (CDC). Date Released: 8/28/2012.
Development of a green mode DC/DC converter available to portable nuclear instrument
International Nuclear Information System (INIS)
Gao Feiyan; Wu Longxiong; Tan Wei; Tang Yaogeng
2010-01-01
A green mode DC/DC converter was developed which suitable to the portable nuclear instrument which is powered by battery and is sometime at stand-by mode. Some updated control approaches such as pseudo-resonant type power supply control and synchronous rectification were adopted to makethe DC/DC converter operate with low power consumption and high efficiency. The test results the battery can be prolonged with this converter. (authors)
Biere, A.; Goverse, A.
2016-01-01
Plants are important mediators of interactions between aboveground (AG) and belowground (BG) pathogens, arthropod herbivores, and nematodes (phytophages). We highlight recent progress in our understanding of within- and cross-compartment plant responses to these groups of phytophages in terms of
Biere, A.; Goverse, Aska
2016-01-01
Plants are important mediators of interactions between aboveground (AG) and belowground (BG) pathogens, arthropod herbivores, and nematodes (phytophages). We highlight recent progress in our understanding of within and cross-compartment plant responses to these groups of phytophages in terms of
Centers for Disease Control (CDC) Podcasts
2017-07-06
This 60 second public service announcement is based on the July 2017 CDC Vital Signs report. Higher opioid prescribing puts patients at risk for addiction and overdose. Learn what can be done about this serious problem. Created: 7/6/2017 by Centers for Disease Control and Prevention (CDC). Date Released: 7/6/2017.
Alcohol Screening and Counseling PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the January 2014 CDC Vital Signs report. Millions of Americans drink too much, a dangerous behavior that can lead to serious health problems. Alcohol screening and counseling can help.
Energy Technology Data Exchange (ETDEWEB)
Fischer, P. [Servicebereich Standort- und Geodienste der Deutschen Steinkohle AG, Herne (Germany); Sackel, M.; Pektas, E. [Sackel Ingenieure, Dortmund (Germany)
2007-06-15
In accordance to the improvement to the ''New DSK'', the department KG B turns more and more into a competent service partner. This challenge will be enduringly supported by the implementation of a Qualitymanagementsystem according to DIN EN ISO 9001. The implementation of a Qualitymanagementsystem is a multiple process. The integration during the regular business process forces experienced coaching. In this article, the basics of the QM-Standards will be explained and the implementation in department BG B will be introduced by certain examples. (orig.)
Directory of Open Access Journals (Sweden)
Irene Tirado-González
Full Text Available Dendritic cell (DC and natural killer (NK cell interactions are important for the regulation of innate and adaptive immunity, but their relevance during early pregnancy remains elusive. Using two different strategies to manipulate the frequency of NK cells and DC during gestation, we investigated their relative impact on the decidualization process and on angiogenic responses that characterize murine implantation. Manipulation of the frequency of NK cells, DC or both lead to a defective decidual response characterized by decreased proliferation and differentiation of stromal cells. Whereas no detrimental effects were evident upon expansion of DC, NK cell ablation in such expanded DC mice severely compromised decidual development and led to early pregnancy loss. Pregnancy failure in these mice was associated with an unbalanced production of anti-angiogenic signals and most notably, with increased expression of genes related to inflammation and immunogenic activation of DC. Thus, NK cells appear to play an important role counteracting potential anomalies raised by DC expansion and overactivity in the decidua, becoming critical for normal pregnancy progression.
Tirado-González, Irene; González, Irene Tirado; Barrientos, Gabriela; Freitag, Nancy; Otto, Teresa; Thijssen, Victor L J L; Moschansky, Petra; von Kwiatkowski, Petra; Klapp, Burghard F; Winterhager, Elke; Bauersachs, Stefan; Blois, Sandra M
2012-01-01
Dendritic cell (DC) and natural killer (NK) cell interactions are important for the regulation of innate and adaptive immunity, but their relevance during early pregnancy remains elusive. Using two different strategies to manipulate the frequency of NK cells and DC during gestation, we investigated their relative impact on the decidualization process and on angiogenic responses that characterize murine implantation. Manipulation of the frequency of NK cells, DC or both lead to a defective decidual response characterized by decreased proliferation and differentiation of stromal cells. Whereas no detrimental effects were evident upon expansion of DC, NK cell ablation in such expanded DC mice severely compromised decidual development and led to early pregnancy loss. Pregnancy failure in these mice was associated with an unbalanced production of anti-angiogenic signals and most notably, with increased expression of genes related to inflammation and immunogenic activation of DC. Thus, NK cells appear to play an important role counteracting potential anomalies raised by DC expansion and overactivity in the decidua, becoming critical for normal pregnancy progression.
Waveletový rozklad seismologických signálů
Czech Academy of Sciences Publication Activity Database
Častová, N.; Kaláb, Zdeněk
2003-01-01
Roč. 3, č. 2 (2003), s. 51-60 ISSN 1213-1962. [New results of the seismological, geophysical and geotechnical research/12./. Ostrava, 01.04.2003-03.04.2003] R&D Projects: GA AV ČR KSK3012103 Institutional research plan: CEZ:AV0Z3086906 Keywords : seismology * wavelet transform Subject RIV: DC - Siesmology, Volcanology, Earth Structure
A Dual-Buck–Boost AC/DC Converter for DC Nanogrid With Three Terminal Outputs
DEFF Research Database (Denmark)
Wu, Weimin; Wang, Houqing; Liu, Yuan
2017-01-01
Due to the widely used dc characterized loads and more distributed power generation sources, the dc nanogrid becomes more and more popular, and it is seen as an alternative to the ac grid. For safety considerations, the dc nanogrid should provide reliable grounding for the residential loads...... such as the low-voltage ac power system. There are three typical grounding configurations for a dc nanogrid: the united grounding, the unidirectional grounding, and the virtual isolated grounding. Each grounding configuration has its own specifications to ac/dc converters. In this paper, a dual-buck-boost ac/dc...... converter for use in the united-grounding-configuration-based dc nanogrid with three terminal outputs is proposed. The working principle of this converter is presented in detail through analyzing the equivalent circuits. Experiments are carried out to verify the theoretical analysis....
DESIGN OPTIMIZATION OF RESONANT DC-DC CONVERTERS
Belqasem Aljafari
2016-01-01
Resonant DC/DC converters are the class of converters, which have L-C resonant tank serving as a major part of the power conversion process. The fundamental concept of the resonant converter is that the circulating energy in an L-C resonant circuit is manageable by changing the operating frequency, and therefore the converter can condition the input power to the desired output voltage. The development in power conversion technology is steady demand for high power efficiency and high power den...
High Voltage Coil Current Sensor for DC-DC Converters Employing DDCC
Directory of Open Access Journals (Sweden)
M. Drinovsky
2015-12-01
Full Text Available Current sensor is an integral part of every switching converter. It is used for over-current protection, regulation and in case of multiphase converters for balancing. A new high voltage current sensor for coil-based current sensing in DC-DC converters is presented. The sensor employs DDCC with high voltage input stage and gain trimming. The circuit has been simulated and implemented in 0.35 um BCD technology as part of a multiphase DC-DC converter where its function has been verified. The circuit is able to sustain common mode voltage on the input up to 40 V, it occupies 0.387*0.345 mm2 and consumes 3.2 mW typically.
Common signs and symptoms in hypothyroidism in central part of iran
International Nuclear Information System (INIS)
Jabbari, A.; Besharat, S.; Razavianzadeh, N.; Moetabar, M.
2008-01-01
This study was designed to evaluate the common signs and symptoms of hypothyroidism in persons with clinical diagnosis of hypothyroidism that was confirmed with laboratory tests. This descriptive cross-sectional study was done during 13 months in medical centers of Shahrood city, in central part of Iran. All cases with probable diagnosis of hypothyroidism based on the signs and symptoms, referred to health care services were included in the study. Radioimmunoassay tests and thyroid hormones evaluation were done. Demographic data and signs were recorded through interview. Data were entered in the computer and analyzed by SPSS software. Patients who completed questionnaires (n=50) were interviewed three times during this period. Female/male ratio was 6/1. The most common signs were cold intolerance (95%), weight gain and menorrhagia. The most common symptoms were edema (80%) and pallor (60%). The severe disease was seen in 4%. Mild type was the most common presentation of hypothyroidism (60%). The most common signs and symptoms of hypothyroidism in the central part of Iran (Shahrood city), that is one of the iodine deficient areas in Iran; were different from other studies. Socio-demographic and nutritional status, illiteracy level and personal self-care are among the probable causes. Unfortunately, concomitance of some of the signs and symptoms are not diagnostic for hypothyroidism. It seems that strong clinical suspicious and laboratory confirmation are the only reliable methods for hypothyroidism diagnosis. (author)
Power, Christopher; Tsourlos, Panagiotis; Ramasamy, Murugan; Nivorlis, Aristeidis; Mkandawire, Martin
2018-03-01
Mine waste rock piles (WRPs) can contain sulfidic minerals whose interaction with oxygen and water can generate acid mine drainage (AMD). Thus, WRPs can be a long-term source of environmental pollution. Since the generation of AMD and its release into the environment is dependent on the net volume and bulk composition of waste rock, effective characterization of WRPs is necessary for successful remedial design and monitoring. In this study, a combined DC resistivity and induced polarization (DC-IP) approach was employed to characterize an AMD-generating WRP in the Sydney Coalfield, Nova Scotia, Canada. Two-dimensional (2D) DC-IP imaging with 6 survey lines was performed to capture the full WRP landform. 2D DC results indicated a highly heterogeneous and moderately conductive waste rock underlain by a resistive bedrock containing numerous fractures. 2D IP (chargeability) results identified several highly-chargeable regions within the waste, with normalized chargeability delineating regions specific to waste mineralogy only. Three-dimensional (3D) DC-IP imaging, using 17 parallel lines on the plateau of the pile, was then used to focus on the composition of the waste rock. The full 3D inverted DC-IP distributions were used to identify coincident and continuous zones (isosurfaces) of low resistivity (0.4 mS/m) that were inferred as generated AMD (leachate) and stored AMD (sulfides), respectively. Integrated geological, hydrogeological and geochemical data increased confidence in the geoelectrical interpretations. Knowledge on the location of potentially more reactive waste material is extremely valuable for improved long-term AMD monitoring at the WRP.
Cancer and Tobacco Use PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the November 2016 CDC Vital Signs report. There is a long list of cancers linked to tobacco use, the leading preventable cause of cancer and cancer deaths. Learn more here.
Directory of Open Access Journals (Sweden)
Cristina eMiguelez
2014-03-01
Full Text Available The neurotransmitter serotonin (5-HT has a multifaceted function in the modulation of information processing through the activation of multiple receptor families, including G-protein-coupled receptor subtypes (5-HT1, 5-HT2, 5-HT4-7 and ligand-gated ion channels (5-HT3. The largest population of serotonergic neurons is located in the midbrain, specifically in the raphe nuclei. Although the medial and dorsal raphe nucleus (DRN share common projecting areas, in the basal ganglia (BG nuclei serotonergic innervations come mainly from the DRN. The BG are a highly organized network of subcortical nuclei composed of the striatum (caudate and putamen, subthalamic nucleus (STN, internal and external globus pallidus (or entopeduncular nucleus in rodents, GPi/EP and GPe and substantia nigra (pars compacta, SNc, and pars reticulata, SNr. The BG are part of the cortico-BG-thalamic circuits, which play a role in many functions like motor control, emotion, and cognition and are critically involved in diseases such as Parkinson’s disease. This review provides an overview of serotonergic modulation of the BG at the functional level and a discussion of how this interaction may be relevant to treating Parkinson’s disease and the motor complications induced by chronic treatment with L-DOPA.
Modeling and Simulation of DC Power Electronics Systems Using Harmonic State Space (HSS) Method
DEFF Research Database (Denmark)
Kwon, Jun Bum; Wang, Xiongfei; Bak, Claus Leth
2015-01-01
based on the state-space averaging and generalized averaging, these also have limitations to show the same results as with the non-linear time domain simulations. This paper presents a modeling and simulation method for a large dc power electronic system by using Harmonic State Space (HSS) modeling......For the efficiency and simplicity of electric systems, the dc based power electronics systems are widely used in variety applications such as electric vehicles, ships, aircrafts and also in homes. In these systems, there could be a number of dynamic interactions between loads and other dc-dc....... Through this method, the required computation time and CPU memory for large dc power electronics systems can be reduced. Besides, the achieved results show the same results as with the non-linear time domain simulation, but with the faster simulation time which is beneficial in a large network....
On the modelling of linear-assisted DC-DC voltage regulators for photovoltaic solar energy systems
Martínez-García, Herminio; García-Vílchez, Encarna
2017-11-01
This paper shows the modelling of linear-assisted or hybrid (linear & switching) DC/DC voltage regulators. In this kind of regulators, an auxiliary linear regulator is used, which objective is to cancel the ripple at the output voltage and provide fast responses for load variations. On the other hand, a switching DC/DC converter, connected in parallel with the linear regulator, allows to supply almost the whole output current demanded by the load. The objective of this topology is to take advantage of the suitable regulation characteristics that series linear voltage regulators have, but almost achieving the high efficiency that switching DC/DC converters provide. Linear-assisted DC/DC regulators are feedback systems with potential instability. Therefore, their modelling is mandatory in order to obtain design guidelines and assure stability of the implemented power supply system.
Attention-getting skills of deaf children using American Sign Language in a preschool classroom.
Lieberman, Amy M
2015-07-01
Visual attention is a necessary prerequisite to successful communication in sign language. The current study investigated the development of attention-getting skills in deaf native-signing children during interactions with peers and teachers. Seven deaf children (aged 21-39 months) and five adults were videotaped during classroom activities for approximately 30 hr. Interactions were analyzed in depth to determine how children obtained and maintained attention. Contrary to previous reports, children were found to possess a high level of communicative competence from an early age. Analysis of peer interactions revealed that children used a range of behaviors to obtain attention with peers, including taps, waves, objects, and signs. Initiations were successful approximately 65% of the time. Children followed up failed initiation attempts by repeating the initiation, using a new initiation, or terminating the interaction. Older children engaged in longer and more complex interactions than younger children. Children's early exposure to and proficiency in American Sign Language is proposed as a likely mechanism that facilitated their communicative competence.
JT-60SA vacuum vessel manufacturing and assembly
Energy Technology Data Exchange (ETDEWEB)
Masaki, Kei, E-mail: masaki.kei@jaea.go.jp [Japan Atomic Energy Agency, Naka, Ibaraki-ken 311-0193 (Japan); Shibama, Yusuke K.; Sakurai, Shinji; Shibanuma, Kiyoshi; Sakasai, Akira [Japan Atomic Energy Agency, Naka, Ibaraki-ken 311-0193 (Japan)
2012-08-15
Highlights: Black-Right-Pointing-Pointer The design of the JT-60SA vacuum vessel body was completed with the demonstration of manufacturing procedure by the mock-up fabrication of the 20 Degree-Sign upper half of VV. Black-Right-Pointing-Pointer The actual VV manufacturing has started since November 2009. Black-Right-Pointing-Pointer The first product of the VV 40 Degree-Sign sector was completed in May 2011. Black-Right-Pointing-Pointer A basic VV assembly scenario and procedure were studied to complete the 360 Degree-Sign VV including positioning method and joint welding. - Abstract: The JT-60SA vacuum vessel (VV) has a D-shaped poloidal cross section and a toroidal configuration with 10 Degree-Sign segmented facets. A double wall structure is adopted to ensure high rigidity at operational load and high toroidal one-turn resistance. The material is 316L stainless steel with low cobalt content (<0.05%). The design temperatures of the VV at plasma operation and baking are 50 Degree-Sign C and 200 Degree-Sign C, respectively. In the double wall, boric-acid water is circulated at plasma operation to reduce the nuclear heating of the superconducting magnets. For baking, nitrogen gas is circulated in the double wall after draining of the boric-acid water. The manufacturing of the VV started in November 2009 after a fundamental welding R and D and a trial manufacturing of 20 Degree-Sign upper half mock-up. The manufacturing of the first VV 40 Degree-Sign sector was completed in May 2011. A basic concept and required jigs of the VV assembly were studied. This paper describes the design and manufacturing of the vacuum vessel. A plan of VV assembly in torus hall is also presented.
Child Passenger Safety PSA (:60)
Centers for Disease Control (CDC) Podcasts
2014-02-04
This 60 second public service announcement, based on the February 2014 Vital Signs release, discusses the importance of buckling up to reduce injuries and save lives. Created: 2/4/2014 by National Center for Injury Prevention and Control (NCIPC). Date Released: 2/4/2014.
A Feedback Passivation Design for DC Microgrid and Its DC/DC Converters
Directory of Open Access Journals (Sweden)
Feifan Ji
2016-12-01
Full Text Available There are difficulties in analyzing the stability of microgrids since they are located on various network structures. However, considering that the network often consists of passive elements, the passivity theory is applied in this paper to solve the above-mentioned problem. It has been formerly shown that when the network is weakly strictly positive real (WSPR, the DC microgrid is stable if all interfaces between the microgrid and converters are made to be passive, which is called interface passivity. Then, the feedback passivation method is proposed for the controller design of various DC–DC converters to achieve the interface passivity. The interface passivity is different from the passivity of closed-loop systems on which the passivity based control (PBC concentrates. The feedback passivation design is detailed for typical buck converters and boost converters in terms of conditions that the controller parameters should satisfy. The theoretical results are verified by a hardware-in-loop real-time labotray (RTLab simulation of a DC microgrid with four generators.
Surfactant Protein D modulates HIV infection of both T-cells and dendritic cells.
Directory of Open Access Journals (Sweden)
Jens Madsen
Full Text Available Surfactant Protein D (SP-D is an oligomerized C-type lectin molecule with immunomodulatory properties and involvement in lung surfactant homeostasis in the respiratory tract. SP-D binds to the enveloped viruses, influenza A virus and respiratory syncytial virus and inhibits their replication in vitro and in vivo. SP-D has been shown to bind to HIV via the HIV envelope protein gp120 and inhibit infectivity in vitro. Here we show that SP-D binds to different strains of HIV (BaL and IIIB and the binding occurs at both pH 7.4 and 5.0 resembling physiological relevant pH values found in the body and the female urogenital tract, respectively. The binding of SP-D to HIV particles and gp120 was inhibited by the presence of several hexoses with mannose found to be the strongest inhibitor. Competition studies showed that soluble CD4 and CVN did not interfere with the interaction between SP-D and gp120. However, soluble recombinant DC-SIGN was shown to inhibit the binding between SP-D and gp120. SP-D agglutinated HIV and gp120 in a calcium dependent manner. SP-D inhibited the infectivity of HIV strains at both pH values of 7.4 and 5.0 in a concentration dependent manner. The inhibition of the infectivity was abolished by the presence of mannose. SP-D enhanced the binding of HIV to immature monocyte derived dendritic cells (iMDDCs and was also found to enhance HIV capture and transfer to the T-cell like line PM1. These results suggest that SP-D can bind to and inhibit direct infection of T-cells by HIV but also enhance the transfer of infectious HIV particles from DCs to T-cells in vivo.
DC Characterization of Different Advanced MOSFET Architectures
International Nuclear Information System (INIS)
Jomaah, J.; Fadlallah, M.; Ghibaudo, G.
2011-01-01
A review of recent results concerning the DC characterization of FD- and Double Gate SOI MOSFET's and FinFETs in modern CMOS technologies is given. By proper extraction techniques, distinction between the different interaction mechanisms is done. Parameter extraction conducted at room and low temperature clearly indicates that the mobility is directly impacted by shrinking the gate length in sub 100nm architectures. (author)
More Adults Are Walking PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second PSA is based on the August 2012 CDC Vital Signs report. While more adults are walking, only half get the recommended amount of physical activity. Listen to learn how communities, employers, and individuals may help increase walking.
Safe Sleep for Babies PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the January 2018 CDC Vital Signs report. Every year, there are about 3,500 sleep-related deaths among U.S. babies. Learn how to create a safe sleep environment for babies.
Test Results of Selected Commercial DC/DC Converters under Cryogenic Temperatures - A Digest
Patterson, Richard; Hammoud, Ahmad
2010-01-01
DC/DC converters are widely used in space power systems in the areas of power management and distribution, signal conditioning, and motor control. Design of DC/DC converters to survive cryogenic temperatures will improve the power system performance, simplify design, and reduce development and launch costs. In this work, the performance of nine COTS modular, low-tomedium power DC/DC converters was investigated under cryogenic temperatures. The converters were evaluated in terms of their output regulation, efficiency, and input and output currents. At a given temperature, these properties were obtained at various input voltages and at different load levels. A summary on the performance of the tested converters was given. More comprehensive testing and in-depth analysis of performance under long-term exposure to extreme temperatures are deemed necessary to establish the suitability of these and other devices for use in the harsh environment of space exploration missions.
A Bidirectional Resonant DC-DC Converter Suitable for Wide Voltage Gain Range
DEFF Research Database (Denmark)
Shen, Yanfeng; Wang, Huai; Al-Durra, Ahmed
2018-01-01
This paper proposes a new bidirectional resonant dc-dc converter suitable for wide voltage gain range applications (e.g., energy storage systems). The proposed converter overcomes the narrow voltage gain range of conventional resonant dc-dc converters, and meanwhile achieves high efficiency...... losses. The operation principles and characteristics of the proposed converter are firstly analyzed in this paper. Then the analytical solutions for the voltage gain, soft-switching, and rms currents are derived, which facilitates the parameters design and optimization. Finally, the proposed topology...... and analysis are verified with experimental results obtained from a 1-kW converter prototype....
ASL-LEX: A lexical database of American Sign Language.
Caselli, Naomi K; Sehyr, Zed Sevcikova; Cohen-Goldberg, Ariel M; Emmorey, Karen
2017-04-01
ASL-LEX is a lexical database that catalogues information about nearly 1,000 signs in American Sign Language (ASL). It includes the following information: subjective frequency ratings from 25-31 deaf signers, iconicity ratings from 21-37 hearing non-signers, videoclip duration, sign length (onset and offset), grammatical class, and whether the sign is initialized, a fingerspelled loan sign, or a compound. Information about English translations is available for a subset of signs (e.g., alternate translations, translation consistency). In addition, phonological properties (sign type, selected fingers, flexion, major and minor location, and movement) were coded and used to generate sub-lexical frequency and neighborhood density estimates. ASL-LEX is intended for use by researchers, educators, and students who are interested in the properties of the ASL lexicon. An interactive website where the database can be browsed and downloaded is available at http://asl-lex.org .
Asano, Hiroki; Hirose, Tetsuya; Kojima, Yuta; Kuroki, Nobutaka; Numa, Masahiro
2018-04-01
In this paper, we present a wide-load-range switched-capacitor DC-DC buck converter with an adaptive bias comparator for ultra-low-power power management integrated circuit. The proposed converter is based on a conventional one and modified to operate in a wide load range by developing a load current monitor used in an adaptive bias comparator. Measurement results demonstrated that our proposed converter generates a 1.0 V output voltage from a 3.0 V input voltage at a load of up to 100 µA, which is 20 times higher than that of the conventional one. The power conversion efficiency was higher than 60% in the load range from 0.8 to 100 µA.
Cabanillas, Beatriz; Maleki, Soheila J; Cheng, Hsiaopo; Novak, Natalija
2018-06-07
Roasting has been implicated in the increase of peanut allergenicity due to the chemical reactions that occur during the process. However, this increase is not fully understood, and little information is available regarding the role of roasted peanut allergens in the initial phase of allergy, where dendritic cells (DCs) play a key role. We sought to analyze differences in the internalization of Ara h 3 from raw and roasted peanut by immature monocyte-derived DCs (MDDCs) and the implication of the mannose receptor in the uptake. Ara h 3 was purified from raw and roasted peanut (Ara h 3-raw and Ara h 3-roas) and labeled with a fluorescent dye. The labeled allergens were added to MDDCs obtained from 7 donors and internalization was analyzed after 10, 30, and 120 min by flow cytometry. In parallel, mannan, which blocks the mannose receptor, was added 30 min before adding the labeled allergens. Results showed that the internalization of Ara h 3-roas by MDDCs was significantly increased at every time point. However, the increase in the internalization of Ara h 3-raw was only significant after 2 h of incubation. Ara h 3-roas had an enhanced capacity to be internalized by MDDCs in comparison with Ara h 3-raw at every time point. Blocking the mannose receptor decreased the internalization of Ara h 3-roas but not Ara h 3-raw. In conclusion, the internalization of Ara h 3-roas by the MDDCs is enhanced when compared to Ara h 3-raw, and the mannose receptor might be implicated in this enhancement. © 2018 S. Karger AG, Basel.
Recognition of Indian Sign Language in Live Video
Singha, Joyeeta; Das, Karen
2013-05-01
Sign Language Recognition has emerged as one of the important area of research in Computer Vision. The difficulty faced by the researchers is that the instances of signs vary with both motion and appearance. Thus, in this paper a novel approach for recognizing various alphabets of Indian Sign Language is proposed where continuous video sequences of the signs have been considered. The proposed system comprises of three stages: Preprocessing stage, Feature Extraction and Classification. Preprocessing stage includes skin filtering, histogram matching. Eigen values and Eigen Vectors were considered for feature extraction stage and finally Eigen value weighted Euclidean distance is used to recognize the sign. It deals with bare hands, thus allowing the user to interact with the system in natural way. We have considered 24 different alphabets in the video sequences and attained a success rate of 96.25%.
Summary of electric vehicle dc motor-controller tests
Mcbrien, E. F.; Tryon, H. B.
1982-01-01
The differences in the performance of dc motors are evaluated when operating with chopper type controllers, and when operating on direct current. The interactions between the motor and the controller which cause these differences are investigated. Motor-controlled tests provided some of the data the quantified motor efficiency variations for both ripple free and chopper modes of operation.
Y-source impedance-network-based isolated boost DC/DC converter
DEFF Research Database (Denmark)
Siwakoti, Yam P.; Town, Graham; Loh, Poh Chiang
2014-01-01
A dc-dc converter with very high voltage gain is proposed in this paper for any medium-power application requiring a high voltage boost with galvanic isolation. The proposed converter topology can be realized using only two switches. With this topology a very high voltage boost can be achieved even...... with a relatively low duty cycle of the switches, and the gain obtainable is presently not matched by any existing impedance network based converter operated at the same duty ratio. The proposed converter has a Y-source impedance network to boost the voltage at the intermediate dc-link side and a push......-pull transformer for square-wave AC inversion and isolation. The voltage-doubler rectifier provides a constant dc voltage at the output stage. A theoretical analysis of the converter is presented, supported by simulation and experimental results. A 250 W down-scaled prototype was implemented in the laboratory...
Directory of Open Access Journals (Sweden)
Rao Mahendra S
2009-06-01
Full Text Available Abstract Background A unique and essential property of embryonic stem cells is the ability to self-renew and differentiate into multiple cell lineages. However, the possible differences in proliferation and differentiation capabilities among independently-derived human embryonic stem cells (hESCs are not well known because of insufficient characterization. To address this question, a side-by-side comparison of 1 the ability to maintain an undifferentiated state and to self-renew under standard conditions; 2 the ability to spontaneously differentiate into three primary embryonic germ lineages in differentiating embryoid bodies; and 3 the responses to directed neural differentiation was made between three NIH registered hES cell lines I3 (TE03, I6 (TE06 and BG01V. Lines I3 and I6 possess normal XX and a normal XY karyotype while BG01V is a variant cell line with an abnormal karyotype derived from the karyotypically normal cell line BG01. Results Using immunocytochemistry, flow cytometry, qRT-PCR and MPSS, we found that all three cell lines actively proliferated and expressed similar "stemness" markers including transcription factors POU5F1/Oct3/4 and NANOG, glycolipids SSEA4 and TRA-1-81, and alkaline phosphatase activity. All cell lines differentiated into three embryonic germ lineages in embryoid bodies and into neural cell lineages when cultured in neural differentiation medium. However, a profound variation in colony morphology, growth rate, BrdU incorporation, and relative abundance of gene expression in undifferentiated and differentiated states of the cell lines was observed. Undifferentiated I3 cells grew significantly slower but their differentiation potential was greater than I6 and BG01V. Under the same neural differentiation-promoting conditions, the ability of each cell line to differentiate into neural progenitors varied. Conclusion Our comparative analysis provides further evidence for similarities and differences between three h
Su, Gui-Jia
2003-06-10
A multilevel DC link inverter and method for improving torque response and current regulation in permanent magnet motors and switched reluctance motors having a low inductance includes a plurality of voltage controlled cells connected in series for applying a resulting dc voltage comprised of one or more incremental dc voltages. The cells are provided with switches for increasing the resulting applied dc voltage as speed and back EMF increase, while limiting the voltage that is applied to the commutation switches to perform PWM or dc voltage stepping functions, so as to limit current ripple in the stator windings below an acceptable level, typically 5%. Several embodiments are disclosed including inverters using IGBT's, inverters using thyristors. All of the inverters are operable in both motoring and regenerating modes.
Astrological birth signs in suicide: hypothesis or speculation?
Salib, Emad
2003-04-01
Astrology is no longer regarded as a science by many, because its claims are almost impossible to test empirically in controlled laboratory conditions and it can not meet the scientific need to be reproducible. However, the majority of those who read their 'star signs' can identify aspects of their personality in what they read and it is possible that this may influence their attitudes and actions. The literature has neglected astrological signs as a possible predictor of suicide ideation. To see whether astrological birth signs are associated with suicide and the method used, data was collected from the Public Health Department in North Cheshire representing all the Cheshire Coroner's verdicts of suicide, and open verdicts, in all deceased aged 60 and above between 1989 and 2000. The observed occurrence of deaths due to natural causes, and suicide, in relation to birth signs did not differ significantly from what would be expected from chance. However, the distribution of suicide by hanging appeared significantly higher in those with a birth sign of Virgo and lowest in Sagittarius and Scorpio. The distribution of violent and non-violent suicides in relation to star signs showed higher occurences of violent death in persons born in the summer months.
Bg1II polymorphism of the epidermal growth factor receptor (EGF-R) gene
Energy Technology Data Exchange (ETDEWEB)
Biunno, I; Pozzi, M R; Radice, P; Mondini, P; Pierotti, M A; Porta, G D [Istituto Nazionale Tumori, Milan (Italy); Haley, J; Waterfield, M D [Ludwig Institute for Cancer Research, London (England)
1988-08-11
A 770 bp cDNA fragment was derived from the cytoplasmic portion of the EGF-R (ref. Libermann et al., 1985). Bg1II identifies 4 invariant bands of 7.0, 5.0, 3.5 and 1.2 kb and a two allele polymorphism with a band of either 10.6 kb (lane 1) or 9.4 kb (lane 3). An heterozygote individual is represented. The frequency was analyzed in 78 unrelated European Caucasians. Its chromosomal location was determined. Co-dominant segregation was demonstrated in three families of 12 individuals. A rare variant of 8.3 kb was seen in one chromosome out of the 144 examined. This allelic form has not yet been fully characterized.
DEFF Research Database (Denmark)
Salomonsen, J; Dunon, D; Skjødt, K
1991-01-01
B-G antigens are a polymorphic multigene family of cell surface molecules encoded by the chicken major histocompatibility complex (MHC). They have previously been described only on cells of the erythroid lineage. By using flow cytometry, section staining, and immunoprecipitation with monoclonal a...
Nuclear lattice simulations using symmetry-sign extrapolation
Energy Technology Data Exchange (ETDEWEB)
Laehde, Timo A.; Luu, Thomas [Forschungszentrum Juelich, Institute for Advanced Simulation, Institut fuer Kernphysik, and Juelich Center for Hadron Physics, Juelich (Germany); Lee, Dean [North Carolina State University, Department of Physics, Raleigh, NC (United States); Meissner, Ulf G. [Universitaet Bonn, Helmholtz-Institut fuer Strahlen- und Kernphysik and Bethe Center for Theoretical Physics, Bonn (Germany); Forschungszentrum Juelich, Institute for Advanced Simulation, Institut fuer Kernphysik, and Juelich Center for Hadron Physics, Juelich (Germany); Forschungszentrum Juelich, JARA - High Performance Computing, Juelich (Germany); Epelbaum, Evgeny; Krebs, Hermann [Ruhr-Universitaet Bochum, Institut fuer Theoretische Physik II, Bochum (Germany); Rupak, Gautam [Mississippi State University, Department of Physics and Astronomy, Mississippi State, MS (United States)
2015-07-15
Projection Monte Carlo calculations of lattice Chiral Effective Field Theory suffer from sign oscillations to a varying degree dependent on the number of protons and neutrons. Hence, such studies have hitherto been concentrated on nuclei with equal numbers of protons and neutrons, and especially on the alpha nuclei where the sign oscillations are smallest. Here, we introduce the ''symmetry-sign extrapolation'' method, which allows us to use the approximate Wigner SU(4) symmetry of the nuclear interaction to systematically extend the Projection Monte Carlo calculations to nuclear systems where the sign problem is severe. We benchmark this method by calculating the ground-state energies of the {sup 12}C, {sup 6}He and {sup 6}Be nuclei, and discuss its potential for studies of neutron-rich halo nuclei and asymmetric nuclear matter. (orig.)
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the October 2017 CDC Vital Signs report. Obesity is a leading cancer risk factor. Unfortunately, two out of three U.S. adults weigh more than recommended. Find out what can be done to help people get to and keep a healthy weight.
2010-04-01
... THE TREASURY LIQUORS LABELING AND ADVERTISING OF WINE Advertising of Wine § 4.60 Application. No... disseminated by radio or television broadcast, or in any newspaper, periodical, or any publication, by any sign... advertising is in, or is calculated to induce sale in, interstate or foreign commerce, or is disseminated by...
Preventing Teen Pregnancy PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the April 2015 CDC Vital Signs report. Teen births in the U.S. have declined, but still, more than 273,000 infants were born to teens ages 15 to 19 in 2013. Learn about the most effective types of birth control.
Centers for Disease Control (CDC) Podcasts
2013-08-06
This 60 second public service announcement is based on the August 2013 CDC Vital Signs report. The rate of obesity among low-income preschoolers has declined, but one in eight is still obese. This program briefly discusses what can be done. Created: 8/6/2013 by Centers for Disease Control and Prevention (CDC). Date Released: 8/6/2013.
Digitally intensive DC-DC converter for extreme space environments, Phase II
National Aeronautics and Space Administration — The Space Micro-Arizona State University (ASU) team will develop an all-digitally controlled, wide temperature range point-of-load switch-mode DC-DC regulator core...
Zero-voltage DC/DC converter with asymmetric pulse-width modulation for DC micro-grid system
Lin, Bor-Ren
2018-04-01
This paper presents a zero-voltage switching DC/DC converter for DC micro-grid system applications. The proposed circuit includes three half-bridge circuit cells connected in primary-series and secondary-parallel in order to lessen the voltage rating of power switches and current rating of rectifier diodes. Thus, low voltage stress of power MOSFETs can be adopted for high-voltage input applications with high switching frequency operation. In order to achieve low switching losses and high circuit efficiency, asymmetric pulse-width modulation is used to turn on power switches at zero voltage. Flying capacitors are used between each circuit cell to automatically balance input split voltages. Therefore, the voltage stress of each power switch is limited at Vin/3. Finally, a prototype is constructed and experiments are provided to demonstrate the circuit performance.
A Fixed-Frequency Bidirectional Resonant DC-DC Converter Suitable for Wide Voltage Gain Range
DEFF Research Database (Denmark)
Shen, Yanfeng; Wang, Huai; Blaabjerg, Frede
2017-01-01
This paper proposes a new bidirectional resonant dc-dc converter suitable for wide voltage gain range applications (e.g., energy storage systems). The proposed converter overcomes the narrow voltage gain range of conventional resonant DC-DC converters, and meanwhile achieves high efficiency...... and characteristics of the proposed converter are analyzed. Finally, a 1-kW converter prototype is built and the experimental results verify the theoretical analyses....
Pulse-width modulated DC-DC power converters
Kazimierczuk, Marian K
2008-01-01
This book studies switch-mode power supplies (SMPS) in great detail. This type of converter changes an unregulated DC voltage into a high-frequency pulse-width modulated (PWM) voltage controlled by varying the duty cycle, then changes the PWM AC voltage to a regulated DC voltage at a high efficiency by rectification and filtering. Used to supply electronic circuits, this converter saves energy and space in the overall system. With concept-orientated explanations, this book offers state-of-the-art SMPS technology and promotes an understanding of the principle operations of PWM converters,
Communication Can Save Lives PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement (PSA) is based on the August 2015 CDC Vital Signs report. Antibiotic-resistant germs cause at least 23,000 deaths each year. Learn how public health authorities and health care facilities can work together to save lives.
Digitally intensive DC-DC converter for extreme space environments, Phase I
National Aeronautics and Space Administration — The Space Micro Arizona State University (ASU) team will develop an all-digitally controlled, wide temperature range point-of-load switch-mode DC-DC regulator core...
DC Voltage Droop Control Implementation in the AC/DC Power Flow Algorithm: Combinational Approach
DEFF Research Database (Denmark)
Akhter, F.; Macpherson, D.E.; Harrison, G.P.
2015-01-01
of operational flexibility, as more than one VSC station controls the DC link voltage of the MTDC system. This model enables the study of the effects of DC droop control on the power flows of the combined AC/DC system for steady state studies after VSC station outages or transient conditions without needing...... to use its complete dynamic model. Further, the proposed approach can be extended to include multiple AC and DC grids for combined AC/DC power flow analysis. The algorithm is implemented by modifying the MATPOWER based MATACDC program and the results shows that the algorithm works efficiently....
Zhu, Peijuan; Ding, Wei; Tong, Wei; Ghosal, Anima; Alton, Kevin; Chowdhury, Swapan
2009-06-01
A retention-time-shift-tolerant background subtraction and noise reduction algorithm (BgS-NoRA) is implemented using the statistical programming language R to remove non-drug-related ion signals from accurate mass liquid chromatography/mass spectrometry (LC/MS) data. The background-subtraction part of the algorithm is similar to a previously published procedure (Zhang H and Yang Y. J. Mass Spectrom. 2008, 43: 1181-1190). The noise reduction algorithm (NoRA) is an add-on feature to help further clean up the residual matrix ion noises after background subtraction. It functions by removing ion signals that are not consistent across many adjacent scans. The effectiveness of BgS-NoRA was examined in biological matrices by spiking blank plasma extract, bile and urine with diclofenac and ibuprofen that have been pre-metabolized by microsomal incubation. Efficient removal of background ions permitted the detection of drug-related ions in in vivo samples (plasma, bile, urine and feces) obtained from rats orally dosed with (14)C-loratadine with minimal interference. Results from these experiments demonstrate that BgS-NoRA is more effective in removing analyte-unrelated ions than background subtraction alone. NoRA is shown to be particularly effective in the early retention region for urine samples and middle retention region for bile samples, where the matrix ion signals still dominate the total ion chromatograms (TICs) after background subtraction. In most cases, the TICs after BgS-NoRA are in excellent qualitative correlation to the radiochromatograms. BgS-NoRA will be a very useful tool in metabolite detection and identification work, especially in first-in-human (FIH) studies and multiple dose toxicology studies where non-radio-labeled drugs are administered. Data from these types of studies are critical to meet the latest FDA guidance on Metabolite in Safety Testing (MIST). Copyright (c) 2009 John Wiley & Sons, Ltd.
High-Voltage DC-DC Converter Topology for PV Energy Utilization - Investigation and Implementation
DEFF Research Database (Denmark)
Sanjeevikumar, Padmanaban; Blaabjerg, Frede; Wheeler, Patrick
2017-01-01
This paper exploited the utilization of photovoltaic (PV) energy system with high-voltage (HV) output DC-DC converter. Classical boost converters are used for both renewable energy integration and HV applications, but limited by reducing output/efficiency in performance. Moreover, as parasitic...... elements suppress the power transfer ratio, converter needs to maximize the PV energy utilization. This investigation study focused to include additional parasitic elements (voltage-lift technique) to a standard DC-DC buck converter and to overcome all the above drawbacks to maximize the PV power...
Computer Simulation of Phase Shifted Series Resonant DC to DC Converter
Directory of Open Access Journals (Sweden)
P. PARVATHY
2016-01-01
Full Text Available This paper deals with digital simulation of phase shifted series resonant DC to DC converter using Matlab Simulink. The Simulink models for open loop and closed loop systems are developed and they are used for simulation studies. This converter is capable of producing ripple free DC output. Switching losses and switching stresses are reduced by using soft switching. This converter has advantages like high power density and low switching losses. Theoretical predictions are well supported by the simulation results.
Power flow analysis for DC voltage droop controlled DC microgrids
DEFF Research Database (Denmark)
Li, Chendan; Chaudhary, Sanjay; Dragicevic, Tomislav
2014-01-01
This paper proposes a new algorithm for power flow analysis in droop controlled DC microgrids. By considering the droop control in the power flow analysis for the DC microgrid, when compared with traditional methods, more accurate analysis results can be obtained. The algorithm verification is ca...
Identifying semiconductors by d.c. ionization conductivity
International Nuclear Information System (INIS)
Derenzo, Stephen E.; Bourret-Courchesne, Edith; James, Floyd J.; Klintenberg, Mattias K.; Porter-Chapman, Yetta; Wang, Jie; Weber, Marvin J.
2006-01-01
We describe a method for identifying semiconductor radiation detector materials based on the mobility of internally generated electrons and holes. It was designed for the early stages of exploration, when samples are not available as single crystals, but as crystalline powders. Samples are confined under pressure in an electric field and the increase in current resulting from exposure to a high-intensity source of 60Co gamma rays (i.e. the ionization current) is measured. We find that for known semiconductors the d.c. ionization current depends on voltage according to the Hecht equation, and for known insulators the d.c. ionization current is below our detection limits. This shows that the method can identify semiconductors in spite of significant carrier trapping. Using this method, we have determined that BiOI, PbIF,BiPbO2Cl, BiPbO2Br, BiPbO2I, Bi2GdO4Cl, Pb3O2I2, and Pb5O4I2 are semiconductors
Light weight, high power, high voltage dc/dc converter technologies
Kraus, Robert; Myers, Ira; Baumann, Eric
1990-01-01
Power-conditioning weight reductions by orders of magnitude will be required to enable the megawatt-power-level space systems envisioned by the Strategic Defense Initiative, the Air Force, and NASA. An interagency program has been initiated to develop an 0.1-kg/kW dc/dc converter technology base for these future space applications. Three contractors are in the first phase of a competitive program to develop a megawatt dc/dc converter. Researchers at NASA Lewis Research Center are investigating innovative converter topology control. Three different converter subsystems based on square wave, resonant, and super-resonant topologies are being designed. The components required for the converter designs cover a wide array of technologies. Two different switches, one semiconductor and the other gas, are under development. Issues related to thermal management and material reliability for inductors, transformers, and capacitors are being investigated in order to maximize power density. A brief description of each of the concepts proposed to meet the goals of this program is presented.
Space-DRUMS trade mark sign experimental development using parabolic reduced gravity flights
International Nuclear Information System (INIS)
Guigne, J.Y.; Millan, D.; Davidson, R.
2000-01-01
Space-DRUMS trade mark sign is a microgravity containerless-processing facility that uses acoustic beams to position large diameter liquid or solid samples within a gas-filled chamber. Its capacity to control the position of large diameter (6 cm) low density solid materials was successfully demonstrated on NASA's DC-9 parabolic aircraft in July 1996; two subsequent flights occurred in 1998 using the KC-135 and A-300 aircraft to further refine the technology used in the system. The working environment for the Space-DRUMS trade mark sign facility is the Space Shuttle/Space Station where long duration microgravity experimentation can take place. Since the reduced gravity environment of an A-300 or a KC-135 parabolic flight is much harsher than that of the Space Shuttle in terms of residual acceleration magnitudes experienced by the samples to be held in position; this more extreme environment allows for most Space-DRUMS trade mark sign technical payload functionality tests to be conducted. In addition to flight hardware shakedowns, parabolic flights continue to be extensively used to study and evaluate the behavior of candidate-advanced materials proposed for ISS Space-DRUMS trade mark sign campaigns. The first samples to be processed in 2001 involve combustion synthesis (also known as SHS - Self-propagating High Temperature Synthesis) of large glass-ceramic and of porous ceramic spheres. Upmassing Space-DRUMS trade mark sign for the International Space Station is scheduled for early 2001
African American Health PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the May 2017 CDC Vital Signs report. The life expectancy of African Americans has improved, but it's still an average of four years less than whites. Learn what can be done so all Americans can have the opportunity to pursue a healthy lifestyle.
Digital peak current mode control with adaptive slope compensation for DC-DC converters
DEFF Research Database (Denmark)
Andersen, Karsten Holm; Nymand, Morten
2017-01-01
performance and stability of current mode control. The presented method adapt to DC-DC converter operating conditions by estimating the rising and falling inductor current slopes, to apply a current slope compensation value to obtain a constant quality factor. The experimental results verifies the theoretical......This paper presents an adaptive slope compensation method for peak current mode control of digital controlled DC-DC converters, which controls the quality factor of the complex conjugated poles at half the switching frequency. Using quality factor control enables optimization of the dynamic...
DC-Link Compensation Method for Slim DC Link Drives Fed by Soft Grid
DEFF Research Database (Denmark)
Mathe, Laszlo; Rosendahl Andersen, Henrik; Lazar, Radu
2010-01-01
Slim DC-link PWM (AC) drives for lowperformance applications are emerging on the market. Such drives equipped with a small DC-link capacitance exhibit instability tendencies, if installed on a soft line, giving a degraded performance. The total harmonic distortion (THD) and the partially weighted...... harmonic distortion (PWHD) of the line current are degraded, if resonance between the line impedance and the DC-link capacitance occurs. Likewise, the motor performance is affected negatively giving extra torque ripple, vibration and acoustic-noise emission. This paper proposes a novel DC-link compensation...
High-power three-port three-phase bidirectional DC-DC converter
Tao, H.; Duarte, J.L.; Hendrix, M.A.M.
2007-01-01
This paper proposes a three-port three-phase bidirectional dc-dc converter suitable for high-power applications. The converter combines a slow primary source and a fast storage to power a common load (e.g., an inverter). Since this type of system is gaining popularity in sustainable energy
Lau, James Siu Ki; Yuen, Chi Kit; Mok, Ka Leung; Yan, Wing Wa; Kan, Pui Gay
2017-11-15
This study is to present the diagnostic values of the novel sonographic visualization of the inferoposterior thoracic wall (VIP) and boomerang signs in detecting right pleural effusion by sonologists with little to no experience in ultrasound. A prospective analysis of a convenience sample of patients who were assessed by junior intensive care physicians was performed. The patients all underwent computed tomography (CT) of the chest or abdomen with lung bases as part of their care regardless of indication; the results were interpreted by radiologists and were considered the gold standard. Sonography was performed to assess for the presence of the VIP and boomerang signs. Sonographic and chest radiographic findings were compared against CT results. 73 patients were enrolled. The sensitivity and specificity for the VIP sign were 0.85 (95% confidence interval [CI], 0.67-0.94) and 0.86 (95% CI, 0.70-0.95). The sensitivity and specificity for the boomerang sign were 0.78 (95% CI, 0.60-0.90) and 0.87 (95% CI, 0.71-0.95). However, the sensitivity and specificity for the traditional approach of detecting an anechoic collection above the diaphragm to indicate pleural effusion were only 0.54 (95% CI, 0.37-0.71) and 0.86 (95% CI, 0.80-0.99). Despite inexperience in sonography, the novel VIP and boomerang signs show high diagnostic values in detecting right pleural effusion compared to the traditional methods. Copyright © 2017 Elsevier Inc. All rights reserved.
Tian, Zhang; Yanfeng, Gong
2017-05-01
In order to solve the contradiction between demand and distribution range of primary energy resource, Ultra High Voltage (UHV) power grids should be developed rapidly to meet development of energy bases and accessing of large-scale renewable energy. This paper reviewed the latest research processes of AC/DC transmission technologies, summarized the characteristics of AC/DC power grids, concluded that China’s power grids certainly enter a new period of large -scale hybrid UHV AC/DC power grids and characteristics of “strong DC and weak AC” becomes increasingly pro minent; possible problems in operation of AC/DC power grids was discussed, and interaction or effect between AC/DC power grids was made an intensive study of; according to above problems in operation of power grids, preliminary scheme is summarized as fo llows: strengthening backbone structures, enhancing AC/DC transmission technologies, promoting protection measures of clean energ y accessing grids, and taking actions to solve stability problems of voltage and frequency etc. It’s valuable for making hybrid UHV AC/DC power grids adapt to operating mode of large power grids, thus guaranteeing security and stability of power system.
Precharge strategies for isolated modular DC-DC converters under two different start-up conditions
DEFF Research Database (Denmark)
Zhang, Yi; Wang, Huai; Li, Binbin
2017-01-01
The isolated modular DC-DC converter (IMDCC) is a new topology designed to connect high-voltage direct current (HVDC) lines with different voltage levels, which ties two DC grids by using two modular multilevel converters (MMCs) via a medium-frequency transformer. Due to the large value of capaci......The isolated modular DC-DC converter (IMDCC) is a new topology designed to connect high-voltage direct current (HVDC) lines with different voltage levels, which ties two DC grids by using two modular multilevel converters (MMCs) via a medium-frequency transformer. Due to the large value...... of capacitance in the IMDCC, proper precharge strategies before the start-up are significant for the safety and reliability of the whole system. This paper presents two closed-loop precharge control strategies to fully charge the sub-module (SM) capacitors of the IMDCC, considering two different start...
Safer Food Saves Lives PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second PSA is based on the November 2015 CDC Vital Signs report. Contaminated food sent to several states can cause multistate outbreaks of foodborne illness and make a lot of people seriously ill. Learn what can be done to prevent and stop outbreaks.
Stop C. difficile Infections PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second PSA is based on the March 2012 CDC Vital Signs report. C. difficile is a germ that causes diarrhea linked to 14,000 deaths in the US each year. This podcast helps health care professionals learn how to prevent C. difficile infections.
Modeling and analysis of fractional order DC-DC converter.
Radwan, Ahmed G; Emira, Ahmed A; AbdelAty, Amr M; Azar, Ahmad Taher
2017-07-11
Due to the non-idealities of commercial inductors, the demand for a better model that accurately describe their dynamic response is elevated. So, the fractional order models of Buck, Boost and Buck-Boost DC-DC converters are presented in this paper. The detailed analysis is made for the two most common modes of converter operation: Continuous Conduction Mode (CCM) and Discontinuous Conduction Mode (DCM). Closed form time domain expressions are derived for inductor currents, voltage gain, average current, conduction time and power efficiency where the effect of the fractional order inductor is found to be strongly present. For example, the peak inductor current at steady state increases with decreasing the inductor order. Advanced Design Systems (ADS) circuit simulations are used to verify the derived formulas, where the fractional order inductor is simulated using Valsa Constant Phase Element (CPE) approximation and Generalized Impedance Converter (GIC). Different simulation results are introduced with good matching to the theoretical formulas for the three DC-DC converter topologies under different fractional orders. A comprehensive comparison with the recently published literature is presented to show the advantages and disadvantages of each approach. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.
A kinect game in the VirtualSign project: training and learning with gestures
Escudeiro, Paula; Escudeiro, Nuno; Reis, Rosa; Baltazar, Ana Bela; Rodrigues, Pedro; Lopes, Jorge; Norberto, Marcelo; Barbosa, Maciel; Bidarra, José
2015-01-01
Comunicação apresentada na 7ª Conferência Internacional de Arte Digital realizada em Óbidos de 19-20 de março de 2015 This paper presents the development of a game aimed at making the process of learning sign language enjoyable and interactive, using the VirtualSign Translator. In this game the player controls a character that interacts with various objects and non-player characters with the aim of collecting several gestures from the Portuguese Sign Language. Through the connection with V...
Data visualization, bar naked: A free tool for creating interactive graphics.
Weissgerber, Tracey L; Savic, Marko; Winham, Stacey J; Stanisavljevic, Dejana; Garovic, Vesna D; Milic, Natasa M
2017-12-15
Although bar graphs are designed for categorical data, they are routinely used to present continuous data in studies that have small sample sizes. This presentation is problematic, as many data distributions can lead to the same bar graph, and the actual data may suggest different conclusions from the summary statistics. To address this problem, many journals have implemented new policies that require authors to show the data distribution. This paper introduces a free, web-based tool for creating an interactive alternative to the bar graph (http://statistika.mfub.bg.ac.rs/interactive-dotplot/). This tool allows authors with no programming expertise to create customized interactive graphics, including univariate scatterplots, box plots, and violin plots, for comparing values of a continuous variable across different study groups. Individual data points may be overlaid on the graphs. Additional features facilitate visualization of subgroups or clusters of non-independent data. A second tool enables authors to create interactive graphics from data obtained with repeated independent experiments (http://statistika.mfub.bg.ac.rs/interactive-repeated-experiments-dotplot/). These tools are designed to encourage exploration and critical evaluation of the data behind the summary statistics and may be valuable for promoting transparency, reproducibility, and open science in basic biomedical research. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Magnetically coupled high-gain Y-source isolated DC/DC converter
DEFF Research Database (Denmark)
Siwakoti, Yam P.; Loh, Poh Chiang; Blaabjerg, Frede
2014-01-01
A new form of magnetically coupled DC/DC converter is proposed for medium power applications (250 W to 2 kW), requiring a high-voltage gain, short inductive charging time and galvanic isolation. The proposed converter can be realised using a unique Y-source impedance network and a two-switch push...
A high voltage ratio and low ripple interleaved DC-DC converter for fuel cell applications.
Chang, Long-Yi; Chao, Kuei-Hsiang; Chang, Tsang-Chih
2012-01-01
This paper proposes a high voltage ratio and low ripple interleaved boost DC-DC converter, which can be used to reduce the output voltage ripple. This converter transfers the low DC voltage of fuel cell to high DC voltage in DC link. The structure of the converter is parallel with two voltage-doubler boost converters by interleaving their output voltages to reduce the voltage ripple ratio. Besides, it can lower the current stress for the switches and inductors in the system. First, the PSIM software was used to establish a proton exchange membrane fuel cell and a converter circuit model. The simulated and measured results of the fuel cell output characteristic curve are made to verify the correctness of the established simulation model. In addition, some experimental results are made to validate the effectiveness in improving output voltage ripple of the proposed high voltage ratio interleaved boost DC-DC converters.
Polymerization of solid C60 under C60 cluster ion bombardment
Czech Academy of Sciences Publication Activity Database
Lavrentiev, Vasyl; Vacík, Jiří; Naramoto, H.; Narumi, K.
2009-01-01
Roč. 95, - (2009), s. 867-873 ISSN 0947-8396 R&D Projects: GA AV ČR(CZ) KAN400480701; GA MŠk(CZ) LC06041 Institutional research plan: CEZ:AV0Z10480505 Keywords : fulleren * cluster * bombardment * polymerization Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders Impact factor: 1.595, year: 2009 http://www.springerlink.com/content/0947-8396
Parental Perception of a Baby Sign Workshop on Stress and Parent-Child Interaction
Mueller, Vannesa; Sepulveda, Amanda
2014-01-01
Introduction: Baby sign language is gaining in popularity. However, research has indicated a lack of empirical research supporting its use. In addition, research suggests that baby sign training may increase stress levels in parents. Methods: Nine families with children ranging in age from six months to two years; five months participated in a…
DC Rocks! Using Place-Based Learning to Introduce Washington DC's K-12 Students to the Geosciences
Mayberry, G. C.; Mattietti, G. K.
2017-12-01
The Washington DC area has interesting geology and a multitude of agencies that deal with the geosciences, yet K-12 public school students in DC, most of whom are minorities, have limited exposure to the geosciences. Geoscience agencies in the DC area have a unique opportunity to address this by introducing the geosciences to local students who otherwise may not have such an opportunity, by highlighting the geology in the students' "backyard," and by leveraging partnerships among DC-based geoscience-related agencies. The USGS and George Mason University are developing a project called DC Rocks, which will give DC's students an exciting introduction into the world of geoscience with place-based learning opportunities that will make geoscience relevant to their lives and their futures. Both the need in DC and the potential for lasting impact are great; the geosciences have the lowest racial diversity of all the science, technology, engineering, and math (STEM) fields, 89% of students in DC public schools are minorities, and there is no dedicated geoscience curriculum in DC. DC Rocks aims to give these students early exposure to the earth sciences, and encourage them to consider careers in the profession. DC Rocks will work with partner agencies to apply several methods that are recommended by researchers to increase the participation of minority students in the geosciences, including providing profoundly positive experiences that spark interest in the geosciences (Levine et al., 2007); increasing students' sense of belonging in the geosciences (Huntoon, et al, 2016); and place-based teaching practices that emphasize the study of local sites (Semken, 2005), such as DC's Rock Creek Park. DC Rocks will apply these methods by coordinating local geoscientists and resources to provide real-world examples of the geosciences' impact on students' lives. Through the DC Rocks website, educators will be able to request geoscience-related resources such as class presentations by
Centers for Disease Control (CDC) Podcasts
2015-02-03
This 60 second public service announcement is based on the February 2015 CDC Vital Signs report. Secondhand smoke kills more than 400 infants and 41,000 adult nonsmokers every year. Learn what can be done to prevent secondhand smoke exposure. Created: 2/3/2015 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP). Date Released: 2/3/2015.
Centers for Disease Control (CDC) Podcasts
2017-11-28
This 60 second public service announcement is based on the December 2017 CDC Vital Signs report. In the U.S., about 15 percent of people who have HIV don't know they have it. Learn about the importance of testing, early diagnosis, and treatment. Created: 11/28/2017 by Centers for Disease Control and Prevention (CDC). Date Released: 11/28/2017.
Radiated electromagnetic emissions of DC-DC converters
International Nuclear Information System (INIS)
Feld, L; Jussen, R; Karpinski, W; Klein, K; Sammet, J; Wlochal, M
2010-01-01
For the CMS tracker at SLHC a new powering scheme is considered to be mandatory to allow the detector to provide at least the same performance as today at the LHC. The baseline solution of CMS foresees the use of DC-DC converters to provide larger currents with smaller losses. An important component of most converters are inductors which, however, tend to radiate the switching noise generated by the converter. The emissions of different inductors have been measured and simulated, the coil design has been optimized and noise susceptibility measurements, with present CMS hardware, have been performed. This article summarizes the results.
Modeling, Analysis and Control of Different DC-DC Converter Topologies for Photo Voltaic Emulator
Directory of Open Access Journals (Sweden)
Mohammad Tauquir Iqbal
2016-05-01
Full Text Available This paper presents the modeling, analysis and control of different DC-DC converter topologies to emulate the photovoltaic (PV system. A PV emulator is basically a DC-DC converter having same electrical characteristics that of solar PV panel. The emulator helps to achieve real characteristics of PV system in a better way in an environment where using actual PV systems can produce inconsistent results due to variation in weather conditions. The paper describes different types of DC-DC converters like buck, Resonant and Quasi Resonant Converter. The complete system is modelled in MATLAB® Simulink SimPowerSystem software package. The Simulation results obtained from the MATLAB® Simulink SimPowerSystem software package for different topologies under steady and dynamic conditions are analyzed and presented. An evaluation table is also presented at the end of the paper, presenting the effectiveness of each topology.
1985-10-01
Dental Corps, Malaysian Armed Forces; MAJ Johan van Geyzel, Malaysian Embassy, Washington, DC 7 March - BG Dato Chen Kwee Fong, Chief of Engineers... Malaysian Armed Forces; MAJ Johan van Geyzel, Malaysian Embassy, MAJ Tairobi bin Abdul Razak, Malaysian Army 2 July - BG William 0. Rodgers, Australian Army...and Diets for Culturing and Testing with Daphnia magna." Paper presented at the Ninth Symposium of Aquatic Toxicology and Environmental Fate sponsored
Controlling DC permeability in cast steels
Energy Technology Data Exchange (ETDEWEB)
Sumner, Aaran, E-mail: aaran.sumner@nottingham.ac.uk [University of Nottingham, Nottingham University Park Campus, Nottingham NG7 2RD, England (United Kingdom); Gerada, Chris, E-mail: chris.gerada@nottingham.ac.uk [Electrical Machines, University of Nottingham, Tower Building, Nottingham NG7 2RD, England (United Kingdom); Brown, Neil, E-mail: neil.brown@cummins.com [Advanced Electrical Machines Research and Technology at Cummins Power Generation, Peterborough PE2 6FZ, England (United Kingdom); Clare, Adam, E-mail: adam.clare@nottingham.ac.uk [Advanced Manufacturing, University of Nottingham, University Park Campus, Nottingham NG7 2RD, England (United Kingdom)
2017-05-01
Annealing (at multiple cooling rates) and quenching (with tempering) was performed on specimens of cast steel of varying composition. The aim was to devise a method for selecting the steel with the highest permeability, from any given range of steels, and then increasing the permeability by heat treatment. Metallographic samples were imaged using optical microscopy to show the effect of the applied heat treatments on the microstructure. Commonly cast steels can have DC permeability altered by the careful selection of a heat treatment. Increases of up to 381% were achieved by annealing using a cooling rate of 6.0 °C/min. Annealing was found to cause the carbon present in the steel to migrate from grain boundaries and from within ferrite crystals into adjacent pearlite crystals. The migration of the carbon resulted in less carbon at grain boundaries and within ferrite crystals reducing the number of pinning sites between magnetic domains. This gives rise to a higher permeability. Quenching then tempering was found to cause the formation of small ferrite crystals with the carbon content of the steel predominately held in the martensitic crystal structures. The results show that with any given range of steel compositions the highest baseline DC permeability will be found with the steel that has the highest iron content and the lowest carbon content. For the samples tested in this paper a cooling rate of 4.5 °C/min resulted in the relative permeability of the sample with the highest baseline permeability, AS4, increasing from 783 to 1479 at 0.5 T. This paper shows how heat treatments commonly applied to hypoeutectoid cast steels, to improve their mechanical performance, can be used to also enhance electromagnetic properties of these alloys. The use of cast steels allows the creation of DC components for electrical machines not possible by the widely used method of stacking of electrical grade sheet steels. - Highlights: • A range of structural steels had their
Controlling DC permeability in cast steels
International Nuclear Information System (INIS)
Sumner, Aaran; Gerada, Chris; Brown, Neil; Clare, Adam
2017-01-01
Annealing (at multiple cooling rates) and quenching (with tempering) was performed on specimens of cast steel of varying composition. The aim was to devise a method for selecting the steel with the highest permeability, from any given range of steels, and then increasing the permeability by heat treatment. Metallographic samples were imaged using optical microscopy to show the effect of the applied heat treatments on the microstructure. Commonly cast steels can have DC permeability altered by the careful selection of a heat treatment. Increases of up to 381% were achieved by annealing using a cooling rate of 6.0 °C/min. Annealing was found to cause the carbon present in the steel to migrate from grain boundaries and from within ferrite crystals into adjacent pearlite crystals. The migration of the carbon resulted in less carbon at grain boundaries and within ferrite crystals reducing the number of pinning sites between magnetic domains. This gives rise to a higher permeability. Quenching then tempering was found to cause the formation of small ferrite crystals with the carbon content of the steel predominately held in the martensitic crystal structures. The results show that with any given range of steel compositions the highest baseline DC permeability will be found with the steel that has the highest iron content and the lowest carbon content. For the samples tested in this paper a cooling rate of 4.5 °C/min resulted in the relative permeability of the sample with the highest baseline permeability, AS4, increasing from 783 to 1479 at 0.5 T. This paper shows how heat treatments commonly applied to hypoeutectoid cast steels, to improve their mechanical performance, can be used to also enhance electromagnetic properties of these alloys. The use of cast steels allows the creation of DC components for electrical machines not possible by the widely used method of stacking of electrical grade sheet steels. - Highlights: • A range of structural steels had their
Asthma - What You Need to Know PSA (:60)
Centers for Disease Control (CDC) Podcasts
2011-05-03
This 60 second Public Service Announcement (PSA) is based on the May, 2011 CDC Vital Signs report. Children and adults can have asthma and attacks can be frightening. To help control asthma, know the warning signs of an attack, stay away from asthma triggers, and follow your health care provider's advice. Created: 5/3/2011 by Centers for Disease Control and Prevention (CDC). Date Released: 5/3/2011.
Sign Lowering and Phonetic Reduction in American Sign Language.
Tyrone, Martha E; Mauk, Claude E
2010-04-01
This study examines sign lowering as a form of phonetic reduction in American Sign Language. Phonetic reduction occurs in the course of normal language production, when instead of producing a carefully articulated form of a word, the language user produces a less clearly articulated form. When signs are produced in context by native signers, they often differ from the citation forms of signs. In some cases, phonetic reduction is manifested as a sign being produced at a lower location than in the citation form. Sign lowering has been documented previously, but this is the first study to examine it in phonetic detail. The data presented here are tokens of the sign WONDER, as produced by six native signers, in two phonetic contexts and at three signing rates, which were captured by optoelectronic motion capture. The results indicate that sign lowering occurred for all signers, according to the factors we manipulated. Sign production was affected by several phonetic factors that also influence speech production, namely, production rate, phonetic context, and position within an utterance. In addition, we have discovered interesting variations in sign production, which could underlie distinctions in signing style, analogous to accent or voice quality in speech.
Preventing Prescription Drug Overdose PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the July 2014 CDC Vital Signs report. Every day, 46 people in the U.S. die from an overdose of prescription opioid painkillers. Learn what can be done to make painkiller prescribing safer and help prevent overdoses.
Polarization Affects Airway Epithelial Conditioning of Monocyte-Derived Dendritic Cells
DEFF Research Database (Denmark)
Papazian, Dick; Chhoden, Tashi; Arge, Maria
2015-01-01
were allowed to polarize on filter inserts, and MDDCs were allowed to adhere to the epithelial basal side. In an optimized setup, the cell application was reversed, and the culture conditions were modified to preserve cellular polarization and integrity. These two parameters were crucial for the MDDCs....... In conclusion, we determined that AEC conditioning favoring cellular integrity leads to a tolerogenic MDDC phenotype, which is likely to be important in regulating immune responses against commonly inhaled allergens....
Crapo, Alan D.; Lloyd, Jerry D.
1991-03-01
Two motors have been designed and built for use with high-temperature superconductor (HTSC) materials. They are a homopolar dc motor that uses HTSC field windings and a brushless dc motor that uses bulk HTSC materials to trap flux in steel rotor poles. The HTSC field windings of the homopolar dc motor are designed to operate at 1000 A/sq cm in a 0.010-T field. In order to maximize torque in the homopolar dc motor, an iron magnetic circuit with small air gaps gives maximum flux for minimum Ampere turns in the field. A copper field winding version of the homopolar dc motor has been tested while waiting for 575 A turn HTSC coils. The trapped flux brushless dc motor has been built and is ready to test melt textured bulk HTSC rings that are currently being prepared. The stator of the trapped flux motor will impress a magnetic field in the steel rotor poles with warm HTSC bulk rings. The rings are then cooled to 77 K to trap the flux in the rotor. The motor can then operate as a brushless dc motor.
A preliminary study of the structure of b anti bg events using Z0 decays
International Nuclear Information System (INIS)
Abe, K.; Abe, K.; Abe, T.
1998-06-01
The structure of three-jet b anti bg events has been studied using hadronic Z 0 decays recorded in the SLD experiment at SLAC. Three-jet final states were selected and the CCD-based vertex detector was used to identify two of the jets as a b or anti b. The distributions of the gluon energy and polar angle with respect to the electron beam were examined and were compared with perturbative QCD predictions. These distributions are potentially sensitive to an anomalous b chromomagnetic moment κ. The authors measure κ consistent with zero and set limits on its value
Yuan, Hong; Frank, Jonathan E; Merrill, Joseph R; Hillesheim, Daniel A; Khachaturian, Mark H; Anzellotti, Atilio I
2016-01-01
The hypoxia PET tracer, 1-[18F]fluoro-3-(2-nitro-1Himidazol- 1-yl)-propan-2-ol ([18F]FMISO) is the first radiotracer developed for hypoxia PET imaging and has shown promising for cancer diagnosis and prognosis. However, access to [18F]FMISO radiotracer is limited due to the needed cyclotron and radiochemistry expertise. The study aimed to develop the automated production method on the [18F]FMISO radiotracer with the novel fully automated platform of the BG75 system and validate its usage on animal tumor models. [18F]FMISO was produced with the dose synthesis cartridge automatically on the BG75 system. Validation of [18F]FMISO hypoxia imaging functionality was conducted on two tumor mouse models (FaDu/U87 tumor). The distribution of [18F]FMISO within tumor was further validated by the standard hypoxia marker EF5. The average radiochemical purity was (99±1) % and the average pH was 5.5±0.2 with other quality attributes passing standard criteria (n=12). Overall biodistribution for [18F]FMISO in both tumor models was consistent with reported studies where bladder and large intestines presented highest activity at 90 min post injection. High spatial correlation was found between [18F]FMISO autoradiography and EF5 hypoxia staining, indicating high hypoxia specificity of [18MF]FMISO. This study shows that qualified [18F]FMISO can be efficiently produced on the BG75 system in an automated "dose-on-demand" mode using single dose disposable cards. The possibilities of having a low-cost, automated system manufacturing ([18F]Fluoride production + synthesis + QC) different radiotracers will greatly enhance the potential for PET technology to reach new geographical areas and underserved patient populations. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Differential Mode EMI Filter Design for Isolated DC-DC Boost Converter
DEFF Research Database (Denmark)
Makda, Ishtiyaq Ahmed; Nymand, Morten
2014-01-01
A Differential Mode EMI filter for a low input voltage high-current isolated dc-dc boost converter is designed and presented in this paper. The primary side Differential Mode noise voltage is low due to the high transformer turn ratio, however, the input current is very high and since the EMI limit...... also does not change for such converters, it requires greatly optimized design approach for the filter including the correct sizing of the filter components. A complete analytical filter design process is carried out such a way that the Differential Mode noise voltage source in the converter...... is identified first. The DM noise model is then established and based on the harmonic analysis of the noise source voltage waveform, the complete Differential Mode EMI filter, including the filter resonance damping branch, is designed for a 3kW isolated dc-dc boost converter. The noise model and its theoretical...
Current Mode Control for LLC Series Resonant DC-to-DC Converters
Directory of Open Access Journals (Sweden)
Jinhaeng Jang
2015-06-01
Full Text Available Conventional voltage mode control only offers limited performance for LLC series resonant DC-to-DC converters experiencing wide variations in operational conditions. When the existing voltage mode control is employed, the closed-loop performance of the converter is directly affected by unavoidable changes in power stage dynamics. Thus, a specific control design optimized at one particular operating point could become unacceptable when the operational condition is varied. This paper presents a new current mode control scheme which could consistently provide good closed-loop performance for LLC resonant converters for the entire operational range. The proposed control scheme employs an additional feedback from the current of the resonant tank network to overcome the limitation of the existing voltage mode control. The superiority of the proposed current mode control over the conventional voltage mode control is verified using an experimental 150 W LLC series resonant DC-to-DC converter.
Application handbook for a Standardized Control Module (SCM) for DC-DC converters, volume 1
Lee, F. C.; Mahmoud, M. F.; Yu, Y.
1980-04-01
The standardized control module (SCM) was developed for application in the buck, boost and buck/boost DC-DC converters. The SCM used multiple feedback loops to provide improved input line and output load regulation, stable feedback control system, good dynamic transient response and adaptive compensation of the control loop for changes in open loop gain and output filter time constraints. The necessary modeling and analysis tools to aid the design engineer in the application of the SCM to DC-DC Converters were developed. The SCM functional block diagram and the different analysis techniques were examined. The average time domain analysis technique was chosen as the basic analytical tool. The power stage transfer functions were developed for the buck, boost and buck/boost converters. The analog signal and digital signal processor transfer functions were developed for the three DC-DC Converter types using the constant on time, constant off time and constant frequency control laws.
Application handbook for a Standardized Control Module (SCM) for DC-DC converters, volume 1
Lee, F. C.; Mahmoud, M. F.; Yu, Y.
1980-01-01
The standardized control module (SCM) was developed for application in the buck, boost and buck/boost DC-DC converters. The SCM used multiple feedback loops to provide improved input line and output load regulation, stable feedback control system, good dynamic transient response and adaptive compensation of the control loop for changes in open loop gain and output filter time constraints. The necessary modeling and analysis tools to aid the design engineer in the application of the SCM to DC-DC Converters were developed. The SCM functional block diagram and the different analysis techniques were examined. The average time domain analysis technique was chosen as the basic analytical tool. The power stage transfer functions were developed for the buck, boost and buck/boost converters. The analog signal and digital signal processor transfer functions were developed for the three DC-DC Converter types using the constant on time, constant off time and constant frequency control laws.
Preventing Stroke Deaths PSA (:60)
Centers for Disease Control (CDC) Podcasts
2017-09-06
This 60 second public service announcement is based on the July 2017 CDC Vital Signs report. Higher opioid prescribing puts patients at risk for addiction and overdose. Learn what can be done about this serious problem. Created: 9/6/2017 by Centers for Disease Control and Prevention (CDC). Date Released: 9/6/2017.
Geetha, A.; Subramani, C.; Thamizh Thentral, T. M.; Krithika, V.; Usha, S.
2018-04-01
Non isolated Bidirectional DC-DC Converter (NIBDDC) is a good interface between DC source and inverter Fed induction motor drive. This paper deals with comparison between open loop and PI controlled Bidirectional DC to DC Converter Inverter System (BDDCIS). The modelling and control of BDDC is becomes an important issue. Open loop BDDCIS and closed loop PI controlled BDDCIS are designed, modelled and simulated using Matlab- simulink and their results are presented. The investigations indicate superior performance of PI controlled BDDCIS. The proposed BDDCIS has advantages like bidirectional power transfer ability, reduced hardware count and improved dynamic response.
Microwave and dc response of an Abrikosov vortex lattice in ferromagnetic superconductors
Energy Technology Data Exchange (ETDEWEB)
Bespalov, A.A., E-mail: bespalovaa@gmail.com [Institute for Physics of Microstructures, Russian Academy of Sciences, GSP-105, 603950 Nizhny Novgorod (Russian Federation); Université Bordeaux, CNRS, LOMA, UMR 5798, F-33400 Talence (France); Mel’nikov, A.S. [Institute for Physics of Microstructures, Russian Academy of Sciences, GSP-105, 603950 Nizhny Novgorod (Russian Federation); Nizhny Novgorod State University, 22 Gagarin av., 603950 Nizhny Novgorod (Russian Federation); Buzdin, A.I. [Université Bordeaux, CNRS, LOMA, UMR 5798, F-33400 Talence (France)
2014-08-15
Highlights: • We study the ac and dc responses of vortices in ferromagnetic superconductors. • Abrikosov vortex motion is damped due to radiation of magnons. • A frequency and vortex velocity threshold for magnon generation exists. • Magnon generation leads to resonant behavior of the surface impedance. • Resonances also appear on the I–V curve of the ferromagnetic superconductor. - Abstract: In magnetic superconductors the magnetic flux dynamics is influenced by the interaction of vortices with the magnetization. This interaction leads to the appearance of an additional damping force acting on the vortices. By solving the London and Landau–Lifshitz–Gilbert equations we analyze the ac and dc responses of a ferromagnetic superconductor in the mixed state. If the vortices are driven by an ac force, their viscosity is enhanced due to the generation of magnons. This viscosity enhancement affects the surface impedance of the sample. In the case of a dc driving current vortices start to radiate magnons when their velocity exceeds a threshold value. As a result, either a step-like feature or a series of peaks appear on the I–V curve.
Microwave and dc response of an Abrikosov vortex lattice in ferromagnetic superconductors
International Nuclear Information System (INIS)
Bespalov, A.A.; Mel’nikov, A.S.; Buzdin, A.I.
2014-01-01
Highlights: • We study the ac and dc responses of vortices in ferromagnetic superconductors. • Abrikosov vortex motion is damped due to radiation of magnons. • A frequency and vortex velocity threshold for magnon generation exists. • Magnon generation leads to resonant behavior of the surface impedance. • Resonances also appear on the I–V curve of the ferromagnetic superconductor. - Abstract: In magnetic superconductors the magnetic flux dynamics is influenced by the interaction of vortices with the magnetization. This interaction leads to the appearance of an additional damping force acting on the vortices. By solving the London and Landau–Lifshitz–Gilbert equations we analyze the ac and dc responses of a ferromagnetic superconductor in the mixed state. If the vortices are driven by an ac force, their viscosity is enhanced due to the generation of magnons. This viscosity enhancement affects the surface impedance of the sample. In the case of a dc driving current vortices start to radiate magnons when their velocity exceeds a threshold value. As a result, either a step-like feature or a series of peaks appear on the I–V curve
Collective attraction of equal-sign charged grains in plasmas
International Nuclear Information System (INIS)
Tsytovich, V.N.; Morfill, G.E.
2002-01-01
It is shown that, in the presence of many grains embedded in a plasma, any two grains with the same charge sign can attract each other. The attraction is caused by collective effects. Both the strength of attraction and the distance at which the attraction is located depend on the average dust density. In the limit of strong collective interaction, the potential energy of interaction is found to be equal to the Coulomb interaction with an amplitude periodically changing its sign at a sequence of interdust distances. The condition for collective effects to dominate lead to a threshold condition that is fulfilled in existing experiments. The effect of collective attraction is applied for the physical interpretation of the observed phenomenon of the formation of dust crystals in laboratory experiments
Application of Distributed DC/DC Electronics in Photovoltaic Systems
Kabala, Michael
In a typical residential, commercial or utility grade photovoltaic (PV) system, PV modules are connected in series and in parallel to form an array that is connected to a standard DC/AC inverter, which is then connected directly to the grid. This type of standard installation; however, does very little to maximize the energy output of the solar array if certain conditions exist. These conditions could include age, temperature, irradiance and other factors that can cause mismatch between PV modules in an array that severely cripple the output power of the system. Since PV modules are typically connected in series to form a string, the output of the entire string is limited by the efficiency of the weakest module. With PV module efficiencies already relatively low, it is critical to extract the maximum power out of each module in order to make solar energy an economically viable competitor to oil and gas. Module level DC/DC electronics with maximum power point (MPP) tracking solves this issue by decoupling each module from the string in order for the module to operate independently of the geometry and complexity of the surrounding system. This allows each PV module to work at its maximum power point by transferring the maximum power the module is able to deliver directly to the load by either boosting (stepping up) the voltage or bucking (stepping down) the voltage. The goal of this thesis is to discuss the development of a per-module DC/DC converter in order to maximize the energy output of a PV module and reduce the overall cost of the system by increasing the energy harvest.
Quasiperiodicity and Torus Breakdown in a Power Electronic DC/DC Converter
DEFF Research Database (Denmark)
Zhusubaliyev, Zhanybai; Soukhoterin, Evgeniy; Mosekilde, Erik
2007-01-01
This paper discusses the mechanisms of torus formation and torus destruction in a dc/dc converter with relay control and hysteresis. We establish a chart of the dynamical modes in the input voltage versus load resistance parameter plane. This chart displays several different torus bifurcations...
DC Distribution Systems and Microgrids
DEFF Research Database (Denmark)
Dragicevic, Tomislav; Anvari-Moghaddam, Amjad; Quintero, Juan Carlos Vasquez
2017-01-01
summarized. Due to its attractive characteristics in terms of compliance with modern generation, storage and electronic load technologies, high reliability and current carrying capacity, as well as simple control, DC systems are already an indispensable part of power systems. Moreover, the existing......A qualitative overview of different hardware topologies and control systems for DC MGs has been presented in this chapter. Some challenges and design considerations of DC protections systems have also been discussed. Finally, applications of DC MGs in emerging smart grid applications have been...... challenges such as protection issues will be effectively resolved in the near future due to fast progress of semiconductor technology which is a key enabler cheap and reliable future DC solid-state protection systems. Therefore, it is the view of the author that more and more DC systems will appear...
Visual ergonomic evaluations on four different designs of LED traffic signs
Chen, Yi-Chun; Huang, Ting-Yuan; Lee, Tsung-Xian; Sun, Ching-Cherng
2017-08-01
To investigate the legibility and visual comfort of LED traffic signs, an ergonomic experiment is performed on four custom-designed LED traffic signs, including three self-luminous ones as LED lightbox, LED backlight and regional LED backlight, and one non-self-luminous sign with external LED lighting. The four signs are hanged side-by-side and evaluated by observers through questionnaires. The signage dimension is one-sixth of the real freeway traffic signs, and the observation distance is 25 m. The luminance of three self-luminous signs is 216 cd/m2. The illuminance of external LED lighting is 400 lux on the traffic sign. The ambient illuminance is 2.8 and 6.0 lux in two rounds. The results show that self-luminous traffic signs provide superior legibility, visual comfort and user preference than the non-self-luminous one. Among the three self-luminous signs, regional LED backlight is most susceptible to the ambient illumination. LED lightbox has significantly better preference score than LED backlight under darker ambient lighting. Only LED lightbox has significantly better visual comfort than external LED lighting in the brighter environment. Based on the four LED traffic signs evaluated in this study, we suggest LED lightbox as the prior choice. Further investigations on the effect of ambient illumination and other designs of self-luminous traffic signs are in progress.
Analysis of the Coupling Behavior of PEM Fuel Cells and DC-DC Converters
Directory of Open Access Journals (Sweden)
Achim Kienle
2009-03-01
Full Text Available The connection between PEM fuel cells and common DC-DC converters is examined. The analysis is model-based and done for boost, buck and buck-boost converters. In a first step, the effect of the converter ripples upon the PEM fuel cell is shown. They introduce oscillations in the fuel cell. Their appearance is explained, discussed and possibilities for their suppression are given. After that, the overall behaviors of the coupled fuel cell-converter systems are analyzed. It is shown, that neither stationary multiplicities nor oscillations can be introduced by the couplings and therefore separate control approaches for both the PEMFC and the DC-DC converters are applicable.
International Nuclear Information System (INIS)
Park, Min-Ah; Hwang, Kyung-A; Lee, Hye-Rim; Yi, Bo-Rim; Jeung, Eui-Bae; Choi, Kyung-Chul
2013-01-01
Highlights: ► BP-1 induced cell growth was reversed by an ER antagonist in BG-1 cells. ► BP-1 up-regulated the mRNA expression of cyclin D1. ► Up-regulation of cyclin D1 by BP-1 was reversed by an ER antagonist. ► BP-1 is a potential endocrine disruptor that exerts estrogenic effects. - Abstract: 2,4-Dihydroxybenzophenone (benzophenone-1; BP-1) is an UV stabilizer primarily used to prevent polymer degradation and deterioration in quality due to UV irradiation. Recently, BP-1 has been reported to bioaccumulate in human bodies by absorption through the skin and has the potential to induce health problems including endocrine disruption. In the present study, we examined the xenoestrogenic effect of BP-1 on BG-1 human ovarian cancer cells expressing estrogen receptors (ERs) and relevant xenografted animal models in comparison with 17-β estradiol (E2). In in vitro cell viability assay, BP-1 (10 −8 –10 −5 M) significantly increased BG-1 cell growth the way E2 did. The mechanism underlying the BG-1 cell proliferation was proved to be related with the up-regulation of cyclin D1, a cell cycle progressor, by E2 or BP-1. Both BP-1 and E2 induced cell growth and up-regulation of cyclin D1 were reversed by co-treatment with ICI 182,780, an ER antagonist, suggesting that BP-1 may mediate the cancer cell proliferation via an ER-dependent pathway like E2. On the other hand, the expression of p21, a regulator of cell cycle progression at G 1 phase, was not altered by BP-1 though it was down-regulated by E2. In xenograft mouse models transplanted with BG-1 cells, BP-1 or E2 treatment significantly increased the tumor mass formation compared to a vehicle (corn oil) within 8 weeks. In histopathological analysis, the tumor sections of E2 or BP-1 group displayed extensive cell formations with high density and disordered arrangement, which were supported by the increased number of BrdUrd positive nuclei and the over-expression of cyclin D1 protein. Taken together, these
Too Loud for Too Long! PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the February 2017 CDC Vital Signs report. Being around too much loud noise-like a leaf blower or rock concert-can cause permanent hearing loss. Learn how to prevent hearing loss.
When Food Bites Back PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the June 2013 CDC Vital Signs report. It discusses food poisoning and specifically, Listeria. If you're 65 or older, have a weakened immune system, or are pregnant, you must be especially careful when selecting, preparing, and storing food.
Directory of Open Access Journals (Sweden)
Renata Antonaci Gama
2013-09-01
Full Text Available Although the human-landing catch (HLC method is the most effective for collecting anthropophilic anophelines, it has been increasingly abandoned, primarily for ethical considerations. The objective of the present study was to develop a new trap for the collection of Anopheles darlingi . The initial trials were conducted using the BG-Sentinel trap as a standard for further trap development based on colour, airflow direction and illumination. The performance of the trap was then compared with those of the CDC, Fay-Prince, counterflow geometry trap (CFG and HLC. All trials were conducted outdoors between 06:00 pm-08:00 pm. Female specimens of An. darlingi were dissected to determine their parity. A total of 8,334 anophelines were captured, of which 4,945 were identified as An. darlingi . The best trap configuration was an all-white version, with an upward airflow and no required light source. This configuration was subsequently named BG-Malaria (BGM. The BGM captured significantly more anophelines than any of the other traps tested and was similar to HLC with respect to the number and parity of anophelines. The BGM trap can be used as an alternative to HLC for collecting anophelines.
Deuterated-decaborane using boronization on JT-60U
Energy Technology Data Exchange (ETDEWEB)
Yagyu, Jun-ichi; Arai, Takashi; Kaminaga, Atsushi; Miyata, Katsuyuki [Japan Atomic Energy Research Inst., Naka, Ibaraki (Japan). Naka Fusion Research Establishment; Arai, Masaru [Kaihatsu Denki Co., Ltd., Tokyo (Japan)
2001-03-01
In JT-60U, boronization using hydride-decaborane (B{sub 10}H{sub 14}) vaporization has been conducted for the first wall conditioning. Compared to other discharge cleaning (DC), boronization is claimed to be efficient in reduction of oxygen impurities and hydrogen recycling in plasma. However, there are some problems in reduction of hydrogen included in boron film and stabilization of DC glow discharge during the boronization. To solve these problems, a new boronization method using deuterated-decaborane (B{sub 10}D{sub 14}) was adopted instead of the conventional hydride-decaborane. As a result, hydrogen content in the boron film decreased clearly and discharge conditioning shots, for decreasing hydrogen content in plasmas, after the boronization were reduced to 1/10 in comparison to the conventional process. Furthermore, DC glow discharge became stable, with only helium carrier gas, and it was possible to save 30 hours in maximum of the time necessary to boronization. It is shown that the boronization using deuterated-decaborane is very efficient and effective method for the first wall conditioning. (author)
Relationship between clinical signs and symptoms of convergence insufficiency.
Bade, Annette; Boas, Mark; Gallaway, Michael; Mitchell, G Lynn; Scheiman, Mitchell; Kulp, Marjean T; Cotter, Susan A; Rouse, Michael
2013-09-01
The percentage of children who are symptomatic has been shown to increase with the number of signs of convergence insufficiency (CI). Our goal was to investigate whether there is a relationship between the severity of the clinical signs of CI and symptom level reported in children with a three-sign symptomatic CI. The Convergence Insufficiency Treatment Trial enrolled 221 children with symptomatic CI from ages 9 to 17 years. Inclusion criteria included the following three signs of CI: (1) exophoria at near at least 4Δ greater than at distance, (2) insufficient positive fusional vergence (PFV) at near, and (3) a receded near point of convergence (NPC) of 6 cm break or greater. The relationships between the severity of each sign of CI (mild, moderate, and severe) and the level of symptoms as measured by the Convergence Insufficiency Symptom Survey (CISS) at baseline were evaluated. Mean CISS scores were not significantly different between mild, moderate, and severe exophoria (p = 0.60), PFV blur (p = 0.99), Sheard's criterion (p = 0.89), or NPC break (p = 0.84). There was also no difference between the frequency of subjects scoring at mild, moderate, or severe levels on the CISS and the severity of each sign of CI. Correlations between individual clinical signs and the CISS score were very low and not statistically significant. Among symptomatic children with a CISS score of 16 or higher and three clinical signs of CI, there is no further association between the severity of the clinical signs and their level of symptoms.
Single Event Burnout in DC-DC Converters for the LHC Experiments
Energy Technology Data Exchange (ETDEWEB)
Claudio H. Rivetta et al.
2001-09-24
High voltage transistors in DC-DC converters are prone to catastrophic Single Event Burnout in the LHC radiation environment. This paper presents a systematic methodology to analyze single event effects sensitivity in converters and proposes solutions based on de-rating input voltage and output current or voltage.
Area-Efficiency Trade-Offs in Integrated Switched-Capacitor DC-DC Converters
DEFF Research Database (Denmark)
Spliid, Frederik Monrad; Larsen, Dennis Øland; Knott, Arnold
2016-01-01
This paper analyzes the relationship between efficiency and chip area in a fully integrated switched capacitor voltage divider dc-dc converter implemented in 180nm-technology and a 1/2 topology. A numerical algorithm for choosing the optimal sizes of individual components, in terms of power loss...
Centers for Disease Control (CDC) Podcasts
2015-07-07
This 60 second public service announcement is based on the July 2015 CDC Vital Signs report. Heroin use and heroin-related overdose deaths are increasing. Most people are using it with other drugs, especially prescription opioid painkillers. Learn what can be done to prevent and treat the problem. Created: 7/7/2015 by National Center for Injury Prevention and Control (NCIPC). Date Released: 7/7/2015.
Egr2 induced during DC development acts as an intrinsic negative regulator of DC immunogenicity.
Miah, Mohammad Alam; Byeon, Se Eun; Ahmed, Md Selim; Yoon, Cheol-Hee; Ha, Sang-Jun; Bae, Yong-Soo
2013-09-01
Early growth response gene 2 (Egr2), which encodes a zinc finger transcription factor, is rapidly and transiently induced in various cell types independently of de novo protein synthesis. Although a role for Egr2 is well established in T-cell development, Egr2 expression and its biological function in dendritic cells (DCs) have not yet been described. Here, we demonstrate Egr2 expression during DC development, and its role in DC-mediated immune responses. Egr2 is expressed in the later stage of DC development from BM precursor cells. Even at steady state, Egr2 is highly expressed in mouse splenic DCs. Egr2-knockdown (Egr2-KD) DCs showed increased levels of major histocompatability complex (MHC) class I and II and co-stimulatory molecules, and enhanced antigen uptake and migratory capacities. Furthermore, Egr2-KD abolished SOCS1 expression and signal transducer and activator of transcription 5 (STAT5) activation during DC development, probably resulting in the enhancement of IL-12 expression and Th1 immunogenicity of a DC vaccine. DC-mediated cytotoxic T lymphocyte (CTL) activation and antitumor immunity were significantly enhanced by Egr2-KD, and impaired by Egr2 overexpression in antigen-pulsed DC vaccines. These data suggest that Egr2 acts as an intrinsic negative regulator of DC immunogenicity and can be an attractive molecular target for DC vaccine development. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Impact of DC link control strategies on the power-flow convergence of integrated AC–DC systems
Directory of Open Access Journals (Sweden)
Shagufta Khan
2016-03-01
Full Text Available For the power-flow solution of integrated AC–DC systems, five quantities are required to be solved per converter, against three independent equations available. These three equations consist of two basic converter equations and one DC network equation, corresponding to each converter. Thus, for solution, two additional equations are required. These two equations are derived from the control specifications adopted for the DC link. Depending on the application, several combinations of valid control specifications are possible. A set of valid control specifications constitutes a control strategy. It is observed that the control strategy adopted for the DC link strongly affects the power-flow convergence of integrated AC–DC systems. This paper investigates how different control strategies affect the power flow convergence of integrated AC–DC systems. Sequential method is used to solve the DC variables in the Newton Raphson (NR power flow model. Seven typical control strategies have been taken into consideration. This is validated by numerous case studies carried out with multiple DC links incorporated in the IEEE 118-bus and 300-bus test systems.
Investigation of DC-DC Boost Converter for Reliability of Operational Planning
DEFF Research Database (Denmark)
Khazraj, Hesam; Ashouri, Mani; Silva, Filipe Miguel Faria da
2018-01-01
of the interests related to reliability is the power semiconductor switches, which are the most vulnerable elements. The failure of one-power switches can reduce the system reliability. Interleaved technique for DC-DC converters is a redundant strategy to improve the reliability, but at the cost of increasing...
Comparison of solar panel cooling system by using dc brushless fan and dc water
International Nuclear Information System (INIS)
Irwan, Y M; Leow, W Z; Irwanto, M; M, Fareq; Hassan, S I S; Amelia, A R; Safwati, I
2015-01-01
The purpose of this article is to discuss comparison of solar panel cooling system by using DC brushless fan and DC water pump. Solar photovoltaic (PV) power generation is an interesting technique to reduce non-renewable energy consumption and as a renewable energy. The temperature of PV modules increases when it absorbs solar radiation, causing a decrease in efficiency. A solar cooling system is design, construct and experimentally researched within this work. To make an effort to cool the PV module, Direct Current (DC) brushless fan and DC water pump with inlet/outlet manifold are designed for constant air movement and water flow circulation at the back side and front side of PV module representatively. Temperature sensors were installed on the PV module to detect temperature of PV. PIC microcontroller was used to control the DC brushless fan and water pump for switch ON or OFF depend on the temperature of PV module automatically. The performance with and without cooling system are shown in this experiment. The PV module with DC water pump cooling system increase 3.52%, 36.27%, 38.98%in term of output voltage, output current, output power respectively. It decrease 6.36 °C compare than to PV module without DC water pump cooling system. While DC brushless fan cooling system increase 3.47%, 29.55%, 32.23%in term of output voltage, output current, and output power respectively. It decrease 6.1 °C compare than to PV module without DC brushless fan cooling system. The efficiency of PV module with cooling system was increasing compared to PV module without cooling system; this is because the ambient temperature dropped significantly. The higher efficiency of PV cell, the payback period of the system can be shorted and the lifespan of PV module can also be longer. (paper)
Dental Sealants Prevent Cavities PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the October 2016 CDC Vital Signs report. Dental sealants, applied soon after a child's permanent molars come in, can protect against cavities for up to nine years. Applying sealants in schools for low-income children could save millions in dental treatment costs.
HIV and Injection Drug Use PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the December 2016 CDC Vital Signs report. Sharing needles, syringes, and other injection equipment puts you at risk for getting HIV and other infections, including hepatitis. Learn how to reduce your HIV risk.
2010-08-05
... Airworthiness Directives; McDonnell Douglas Corporation Model DC- 9-10 Series Airplanes, DC-9-30 Series... existing airworthiness directive (AD), which applies to all McDonnell Douglas Model DC-9-10 series..., 2010). That AD applies to all McDonnell Douglas Corporation Model DC-9-10 series airplanes, DC-9-30...
A Novel Single Switch Transformerless Quadratic DC/DC Buck-Boost Converter
DEFF Research Database (Denmark)
Mostaan, Ali; A. Gorji, Saman; N. Soltani, Mohsen
2017-01-01
A novel quadratic buck-boost DC/DC converter is presented in this study. The proposed converter utilizes only one active switch and can step-up/down the input voltage, while the existing single switch quadratic buck/boost converters can only work in step-up or step-down mode. First, the proposed ...
Lupus and Depression: Know the Signs and How to Get Help
... Donate Share on Twitter Facebook Pinterest Email Print Lupus and depression: Know the signs and how to ... free of lupus. Facts about clinical depression and lupus Between 15 and 60 percent of people with ...
Artificial noise due to DC electric trains
International Nuclear Information System (INIS)
Senanayake, W.E.
1987-08-01
The current distribution in a DC railway and the resulting magnetic effects have been modelled using the parameters of the DC railway networks in Italy. The results show that the magnetic perturbations are substantially high in the vicinity of electrified railway lines. The order of magnitude of the induced field can be as significant as ∼ 40nT at a distance of ≅ 2km from the railway line indicating that geophysical techniques that employ natural magnetic anomalies can be badly effected, within this range. The magnetic effects rapidly decay with increasing distance, but the noise level could be significant even at a range of ∼ 10km. Also, these induced anomalies vary significantly with the conductivity of the ground. When the conductivity is high it is possible that the railway currents dispersed through the ground interact with those induced in the earth, causing a severe disruption to the telluric measurements. (author). 11 refs, 10 figs, 1 tab
Drilling history core hole DC-8
International Nuclear Information System (INIS)
1978-10-01
Core hole DC-8 was completed in August, 1978 by Boyles Brothers Drilling Company, Spokane, Washington, under subcontract to Fenix and Scission, Inc. The hole was cored for the US Department of Energy and the Rockwell Hanford Operations' Basalt Waste Isolation Program. Fenix and Scisson, Inc. furnished the engineering, daily supervision of the core drilling activities, and geologic core logging for hole DC-8. Core hole DC-8 is located on the Hanford Site near the Wye Barricade and 50 feet northwest of rotary hole DC-7. The Hanford Site vation coordinates for DC-8 are North 14,955.94 feet and West 14,861.92 coordinates for DC-8 are North 14,955.94 feet and West 14,861.92 mean sea level. The purpose of core hole DC-8 was to core drill vertically through the basalt and interbed units for stratigraphic depth determination and core collection, and to provide a borehole for hydrologic testing and cross-hole seismic shear and pressure wave velocity studies with rotary hole DC-7. The total depth of core hole DC-8 was 4100.5 feet. Core recovery exceeded 97 percent of the total footage cored
Drilling history core hole DC-8
Energy Technology Data Exchange (ETDEWEB)
1978-10-01
Core hole DC-8 was completed in August, 1978 by Boyles Brothers Drilling Company, Spokane, Washington, under subcontract to Fenix and Scission, Inc. The hole was cored for the US Department of Energy and the Rockwell Hanford Operations' Basalt Waste Isolation Program. Fenix and Scisson, Inc. furnished the engineering, daily supervision of the core drilling activities, and geologic core logging for hole DC-8. Core hole DC-8 is located on the Hanford Site near the Wye Barricade and 50 feet northwest of rotary hole DC-7. The Hanford Site vation coordinates for DC-8 are North 14,955.94 feet and West 14,861.92 coordinates for DC-8 are North 14,955.94 feet and West 14,861.92 mean sea level. The purpose of core hole DC-8 was to core drill vertically through the basalt and interbed units for stratigraphic depth determination and core collection, and to provide a borehole for hydrologic testing and cross-hole seismic shear and pressure wave velocity studies with rotary hole DC-7. The total depth of core hole DC-8 was 4100.5 feet. Core recovery exceeded 97 percent of the total footage cored.
Arthritis in America PSA (:60)
Centers for Disease Control (CDC) Podcasts
2017-03-07
This 60 second public service announcement is based on the March 2017 CDC Vital Signs report. Many adults in the United States have arthritis. Learn how to reduce the pain of arthritis, as well as manage the condition. Created: 3/7/2017 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP). Date Released: 3/7/2017.
Preventing Norovirus Outbreaks PSA (:60)
Centers for Disease Control (CDC) Podcasts
2014-06-03
This 60 second public service announcement is based on the June 2014 CDC Vital Signs report. Norovirus infects about 20 million Americans each year. Learn how to protect yourself and your family from this very contagious, potentially serious illness. Created: 6/3/2014 by National Center for Immunization and Respiratory Diseases (NCIRD). Date Released: 6/3/2014.
Characterization of diode valve in medium voltage dc/dc converter for wind turbines
DEFF Research Database (Denmark)
Dincan, Catalin Gabriel; Kjær, Philip Carne
2016-01-01
This paper proposes a methodology for characterization of medium voltage (MV), medium frequency (MF) rectifier diode valve. The intended application is for 10MW dc/dc converters used in DC offshore wind turbines. Sensitivity to semiconductor component parameter variation, snubber component tolera...... tolerance, influence of temperature and stray capacitance are analyzed. It is concluded that the largest impact on sensitivity is given by reverse recovery charge variation and differences of temperature between adjacent devices....
Operation and control of a DC-grid offshore wind farm under DC transmission system faults
DEFF Research Database (Denmark)
Deng, Fujin; Chen, Zhe
2013-01-01
. Consequently, the protection and control strategies of dc systems need to be established. This paper studies a dc-grid offshore wind farm, where the wind power collection system and power transmission system adopt dc technology. In this paper, the redundancy of the HVDC transmission system under faults...... is studied, and a fault ridethrough strategy for the dc-grid offshore wind farm is proposed. The proposed strategy can effectively minimize the impacts of the power transmission system disturbance on the offshore wind farm, and on the ac grid. A dc-grid offshore wind farm example is simulated with PSCAD....../EMTDC, and the results validate the feasibility of the presented redundancy configuration and operation approach, and the fault ridethrough control strategy....
Effects of non-ionic surfactants on the interactions between cellulases and tannic acid
DEFF Research Database (Denmark)
Olsen, Søren Nymand; Bohlin, Christina Helena; Murphy, Leigh
2011-01-01
of cellulases to lignin. In the current work we address this hypothesis using tannic acid (TAN) as a general poly-phenolic model compound (for lignin and soluble phenolics) and measure the mutual interactions of cellulases (CBHI, CBHII, EGI, EGII and BG), TAN and NIS (Triton X-100) using isothermal titration...
Energy Technology Data Exchange (ETDEWEB)
Lü, Xiaoling [School of Materials Science and Engineering, Changchun University of Science and Technology, Changchun 130022 (China); Jiang, Liwei [National Laboratory of Superhard Materials, Department of Physics, Jilin University, Changchun 130012 (China); Zheng, Yisong, E-mail: zhengys@jlu.edu.cn [National Laboratory of Superhard Materials, Department of Physics, Jilin University, Changchun 130012 (China)
2016-04-22
Graphene has intrinsic edge states localized at zigzag edge or lattice defect. Helical boundary states can also be established in such a two-dimensional carbon material at the boundary of topological insulator (TI) phase realized by the extrinsic Rashba spin–orbital coupling (SOC) in gated bilayer graphene. We theoretically investigate the interaction between these two kinds of edge (boundary) states when they coexist in a bilayer graphene. We find that this interaction gives rise to some very interesting results. In a zigzag edged nanoribbon of bilayer graphene, it is possible that the TI helical state does not localize at the TI phase boundary. Instead it moves to the nanoribbon edge even though the SOC is absent therein. In a bulk lattice of bilayer graphene embedded with two line defects, the numbers of helical state subbands at the two line defects are not equal to each other. In such a case, the backscattering lacking is still forbidden since the Kramers pairs are valley polarized. - Highlights: • The TI helical state moves to nanoribbon edge in a gated ZENR-BG. • The gapless modes of LD-BG at the two line defects are not equal to each other. • The Kramers pairs are still valley polarized in a gated LD-BG.
Open- and Short-Circuit Fault Identification for a Boost dc/dc Converter in PV MPPT Systems
Directory of Open Access Journals (Sweden)
Diego R. Espinoza Trejo
2018-03-01
Full Text Available This paper proposes a fault identification system for short and open-circuit switch faults (SOCSF for a dc/dc converter acting as a Maximum Power Point Tracker (MPPT in Photovoltaic (PV systems. A closed-loop operation is assumed for the boost dc/dc converter. A linearizing control plus a Proportional-Derivative (PD controller is suggested for PV voltage regulation at the maximum power point (MPP. In this study, the SOCSF are modeled by using an additive fault representation and the fault identification (FI system is synthesized departing from a Luenberger observer. Hence, an FI signal is obtained, which is insensitive to irradiance and load current changes, but affected by the SOCSF. For FI purposes, only the sensors used in the control system are needed. Finally, an experimental evaluation is presented by using a solar array simulator dc power supply and a boost dc/dc converter of 175 W in order to validate the ideas this study exposes.
DEFF Research Database (Denmark)
Yang, Xi-jun; Qu, Hao; Yao, Chen
2014-01-01
As for high power plasma power supply, due to high efficiency and flexibility, multi-channel interleaved multi-stage paralleled Buck DC-DC Converter becomes the first choice. In the paper, two-channel interleaved two- stage paralleled Buck DC-DC Converter powered by three-phase AC power supply...
Indonesian Sign Language Number Recognition using SIFT Algorithm
Mahfudi, Isa; Sarosa, Moechammad; Andrie Asmara, Rosa; Azrino Gustalika, M.
2018-04-01
Indonesian sign language (ISL) is generally used for deaf individuals and poor people communication in communicating. They use sign language as their primary language which consists of 2 types of action: sign and finger spelling. However, not all people understand their sign language so that this becomes a problem for them to communicate with normal people. this problem also becomes a factor they are isolated feel from the social life. It needs a solution that can help them to be able to interacting with normal people. Many research that offers a variety of methods in solving the problem of sign language recognition based on image processing. SIFT (Scale Invariant Feature Transform) algorithm is one of the methods that can be used to identify an object. SIFT is claimed very resistant to scaling, rotation, illumination and noise. Using SIFT algorithm for Indonesian sign language recognition number result rate recognition to 82% with the use of a total of 100 samples image dataset consisting 50 sample for training data and 50 sample images for testing data. Change threshold value get affect the result of the recognition. The best value threshold is 0.45 with rate recognition of 94%.
[Study on the interaction of doxycycline with human serum albumin].
Hu, Tao-Ying; Chen, Lin; Liu, Ying
2014-05-01
The present study was designed to investigate the interaction of doxycycline (DC) with human serum albumin (HSA) by the inner filter effects, displacement experiments and molecular docking methods, based on classic multi-spectroscopy. With fluorescence quenching method at 298 and 310 K, the binding constants Ka, were determined to be 2. 73 X 10(5) and 0. 74X 10(5) L mol-1, respectively, and there was one binding site between DC and HSA, indicating that the binding of DC to HSA was strong, and the quenching mechanism was a static quenching. The thermodynamic parameters (enthalpy change, AH and enthropy change, delta S) were calculated to be -83. 55 kJ mol-1 and -176. 31 J mol-1 K-1 via the Vant' Hoff equation, which indicated that the interaction of DC with HSA was driven mainly by hydrogen bonding and van der Waals forces. Based on the Föster's theory of non-radiation energy transfer, the specific binding distance between Trp-214 (acceptor) and DC (donor) was 4. 98 nm, which was similar to the result confirmed by molecular docking. Through displacement experiments, sub-domain IIA of HSA was assigned to possess the high-affinity binding site of DC. Three-dimensional fluorescence spectra indicated that the binding of DC to HSA induced the conformation change of HSA and increased the disclosure of some part of hydrophobic regions that had been buried before. The results of FTIR spectroscopy showed that DC bound to HSA led to the slight unfolding of the polypeptide chain of HSA. Furthermore, the binding details between DC and HSA were further confirmed by molecular docking methods, which revealed that DC was bound at sub-domain IIA through multiple interactions, such as hydrophobic effect, polar forces and pi-pi interactions. The experimental results provide theoretical basis and reliable data for the study of the interaction between small drug molecule and human serum albumin
Using virtual reality to determine how emergency signs facilitate way-finding.
Tang, Chieh-Hsin; Wu, Wu-Tai; Lin, Ching-Yuan
2009-07-01
In this study, virtual reality was the tool used to construct an experimental space. Three scenarios - one without emergency signs, another with an old-version emergency sign, and the third with a new-version emergency sign - were created, after which 107 subjects, divided into three groups, engaged in an emergency escape game to determine if and how various emergency signs aid in way-finding in the event of an emergency. Under the presupposition that the minimum time needed for an emergency escape without any mistake occurring was 40s, we found that the average way-finding time in the scenario without any emergency signs was 123.8s, for the scenario with the new-version signs 84.8s, and for the scenario with the old-version signs 75.6s; statistically, this demonstrated that the absence of signs results in slower escape than either old signs (p=0.001) or new signs (p=0.005). These findings indicate that signs do help way-finding greatly. Males were found to exhibit better way-finding skills than females (pConstruction workers and fire safety personnel, as a combined group, did not fare better than others with less presumed prior experience with building plans or emergency exit procedures. In addition, when faced with both an emergency direction sign and an exit door, almost half of the subjects (42% of the participants) were chosen to take the door instead of following the direction posted on the sign. Finally, we found that, at T-intersections, the majority of participants (60%) chose to turn left versus right.
DC injection into low voltage AC networks
Energy Technology Data Exchange (ETDEWEB)
NONE
2005-07-01
This report summarises the results of a study investigating the impact of levels of injected DC current injections on a low voltage AC distribution network systems in order to recommend acceptable limits of DC from microgeneration. Relevant literature is reviewed, and the impact of DC levels in distribution transformers, transformer modelling, and instrumental transformers are discussed. The impact of DC in residual current devices (RCD) and in domestic electricity watt hour meters is examined along with DC enhanced corrosion, corrosion failure, and the measurement of DC current injection. Sources of DC injection outlined include DC from computer power supplies, network faults, geomagnetic phenomena, lighting circuits/dimmers, and embedded generators.
Transition towards DC micro grids: From an AC to a hybrid AC and DC energy infrastructure
Directory of Open Access Journals (Sweden)
Evi Ploumpidou
2017-12-01
Full Text Available Our electricity is predominantly powered by alternating current (AC, ever since the War of Currents ended in the favor of Nicola Tesla at the end of the 19th century. However, lots of the appliances we use, such as electronics and lights with light-emitting diode (LED technology, work internally on direct current (DC and it is projected that the number of these appliances will increase in the near future. Another contributor to the increase in DC consumption is the ongoing electrification of mobility (Electric Vehicles (EVs. At the same time, photovoltaics (PV generate DC voltages, while the most common storage technologies also use DC. In order to integrate all these appliances and technologies to the existing AC grid, there is a need for converters which introduce power losses. By distributing DC power to DC devices instead of converting it to AC first, it is possible to avoid substantial energy losses that occur every time electricity is converted. This situation initiated the concept for the implementation of the DC-Flexhouse project. A prototype DC installation will be developed and tested in one of the buildings of the developing living lab area called the District of Tomorrow (De Wijk van Morgen which is located in Heerlen, the Netherlands. A neighborhood cooperative (Vrieheide cooperatie is also part of the consortium in order to address the aspect of social acceptance. Although DC seems to be a promising solution for a more sustainable energy system, the business case is still debatable due to both technology- and market-related challenges. The current energy infrastructure is predominantly based on AC, manufacturers produce devices based on AC standards and people are using many AC products across a long life span. This Smart Energy Buildings & Cities (SEB&C PDEng project is a contribution to the DC-Flexhouse project. The aim is to analyze the challenges in the transition to DC micro grids, assess the market potential of DC
Energy Technology Data Exchange (ETDEWEB)
Kylkisalo, T.; Alanen, R.
2007-09-15
This study deals with the utilization of DC distribution power systems and energy storages in urban areas. The properties and the components, that make the DC distribution power systems possible, are specifically examined from the perspective of the power system's control topology. The role of the energy storages as a part of the DC distribution power system and a tool of power quality control was also discussed. Using PSCAD/EMTDC simulation program two different concepts of the DC distribution power systems were simulated. Both low and medium voltage networks were designed as microgrids, which were capable operation without medium voltage feeder from the outside network as the entity of energy storages, auxiliary power source and loads. It emerged from the simulation that DC distribution power systems are capable to provide an uninterruptible delivery of current. In addition the effects on energy management of the DC distribution power systems, which include energy storages, were studied. Also a hierarchical principle was brought out, which could make an efficient interaction between electricity market and distributed power systems. Economical studies of the simplified 10 kV distribution system were done and the costs of AC and DC networks were compared. At 10 kV level AC system was found to be more economically efficient but DC network is more energy efficient because of remarkable smaller losses. Based on this study it can be said, that if the investment costs of the DC power systems can be reduced it could be a strong competitor to conventional AC power systems. (orig.)
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the September 2015 CDC Vital Signs report. Your heart age is the age of your heart and blood vessels as a result of your risk factors for heart attack and stroke. If you smoke or have high blood pressure, your heart age will be much higher than your actual age. Learn what you can do to lower your heart age and keep it low.
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the May 2015 CDC Vital Signs report. About one in six people living in the U.S. are Hispanic. The two leading causes of death in this group are heart disease and cancer, accounting for two out of five deaths. Unfortunately, many Hispanics face considerable barriers to getting high quality health care, including language and low income. Learn what can be done to reduce the barriers.
Li, Ruili; Yang, Mingfei
2017-01-01
Hematoma expansion (HE) is a major determinant of a poor outcome in patients with a spontaneous intracerebral hemorrhage (sICH). The blend sign and the black hole sign are distinguished from non-contrast CT (NCCT) in patients with sICH, and both are independent neuroimaging predictors of HE. The purpose of the current study was to compare the value of the two signs in the prediction of HE. We retrospectively analyzed clinical and neuroimaging data from 228 patients with sICH who were treated at our hospital between August 2015 and September 2017. NCCT of the brain was performed upon admission (within 6 h of the onset of symptoms) to identify the blend sign and the black hole sign. HE was determined based on CT during a follow-up 24 h later. The sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) with which the blend sign and the black hole sign predicted HE were calculated. Receiver operating characteristic (ROC) curve analysis was performed in order to compare the accuracy of the two signs in predicting HE. The blend sign was identified in 46 patients (20.2%) and the black hole sign was identified in 38 (16.7%) based on NCCT of the brain upon admission. Of the 65 patients with HE, the blend sign was noted in 28 and the black hole sign was noted in 22. The blend sign had a sensitivity of predicting HE of 43.1%, a specificity of 89.0%, a PPV of 60.9%, and an NPV of 79.7%. In contrast, the black hole sign had a sensitivity of predicting HE of 33.9%, a specificity of 90.2%, a PPV of 57.9%, and an NPV of 77.4%. The area under the ROC curve was 0.660 for the blend sign and 0.620 for the black hole sign (p = 0.516). In conclusion, the blend sign and the black hole sign on CT are both good predictors of HE in patients with sICH, though the blend sign seems to have a higher level of accuracy.
The BG18, a B(U)F type package used for the transport of irradiated fuel rods - return of experience
Energy Technology Data Exchange (ETDEWEB)
Juergen, S.; Herman, S. [Transnubel, Dessel (Belgium)
2004-07-01
The purpose of this presentation is to share the return of experience of Transnubel after a period of nearly 3 years operation of the BG18 package in several nuclear power plants and hot cell facilities. This package has been used mainly for the shipment of full scale as well as samples of irradiated fuel rods - UOX or MOX, PWR or BWR.
The BG18, a B(U)F type package used for the transport of irradiated fuel rods - return of experience
International Nuclear Information System (INIS)
Juergen, S.; Herman, S.
2004-01-01
The purpose of this presentation is to share the return of experience of Transnubel after a period of nearly 3 years operation of the BG18 package in several nuclear power plants and hot cell facilities. This package has been used mainly for the shipment of full scale as well as samples of irradiated fuel rods - UOX or MOX, PWR or BWR
DC-Compensated Current Transformer.
Ripka, Pavel; Draxler, Karel; Styblíková, Renata
2016-01-20
Instrument current transformers (CTs) measure AC currents. The DC component in the measured current can saturate the transformer and cause gross error. We use fluxgate detection and digital feedback compensation of the DC flux to suppress the overall error to 0.15%. This concept can be used not only for high-end CTs with a nanocrystalline core, but it also works for low-cost CTs with FeSi cores. The method described here allows simultaneous measurements of the DC current component.
Energy Technology Data Exchange (ETDEWEB)
Bjustrom, B
1965-12-01
How stress distribution in dc cables varies with temperature and stress level, influence of polarity reversals and space charges, and different types of overvoltage to which dc cable may be subjected are discussed. Design problems, especially as related to corrosion protection and to mechanical stress caused by wire armoring during manufacturing and laying, accessories and work done on test methods, and the possibility of designing 400 to 600 kV dc cables for transmitting 2000 to 4000 MW are described.
Children Need More Fruits and Vegetables! PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the August 2014 CDC Vital Signs report. Children in the U.S. aren't eating enough fruits and vegetables. Learn what you can do to impact this problem.
Opioid Overdoses Treated in Emergency Departments PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the March 2018 CDC Vital Signs report. Opioid overdoses continue to increase in the United States. Learn what can be done to help prevent opioid overdose and death.
From Static to Interactive: Transforming Data Visualization to Improve Transparency.
Directory of Open Access Journals (Sweden)
Tracey L Weissgerber
2016-06-01
Full Text Available Data presentation for scientific publications in small sample size studies has not changed substantially in decades. It relies on static figures and tables that may not provide sufficient information for critical evaluation, particularly of the results from small sample size studies. Interactive graphics have the potential to transform scientific publications from static reports of experiments into interactive datasets. We designed an interactive line graph that demonstrates how dynamic alternatives to static graphics for small sample size studies allow for additional exploration of empirical datasets. This simple, free, web-based tool (http://statistika.mfub.bg.ac.rs/interactive-graph/ demonstrates the overall concept and may promote widespread use of interactive graphics.
Parton, Becky Sue
2006-01-01
In recent years, research has progressed steadily in regard to the use of computers to recognize and render sign language. This paper reviews significant projects in the field beginning with finger-spelling hands such as "Ralph" (robotics), CyberGloves (virtual reality sensors to capture isolated and continuous signs), camera-based projects such as the CopyCat interactive American Sign Language game (computer vision), and sign recognition software (Hidden Markov Modeling and neural network systems). Avatars such as "Tessa" (Text and Sign Support Assistant; three-dimensional imaging) and spoken language to sign language translation systems such as Poland's project entitled "THETOS" (Text into Sign Language Automatic Translator, which operates in Polish; natural language processing) are addressed. The application of this research to education is also explored. The "ICICLE" (Interactive Computer Identification and Correction of Language Errors) project, for example, uses intelligent computer-aided instruction to build a tutorial system for deaf or hard-of-hearing children that analyzes their English writing and makes tailored lessons and recommendations. Finally, the article considers synthesized sign, which is being added to educational material and has the potential to be developed by students themselves.
Comparative evaluation of bidirectional dual active bridge DC-DC converter variants
Sfakianakis, G.; Everts, J.; Huisman, H.; Lomonova, E.A.
2016-01-01
For the realization of DC-DC converters in automotive industry, the Dual Active Bridge (DAB) converter seems to be a promising choice because of its soft-switching and high-power-density capability. Contrary to the traditional 3 level - 3 level (3-3L) DAB, a 3 level - 5 level (3-5L) DAB can operate
Improvement of burst-mode control of piezoelectric transformer based DC/DC converter
International Nuclear Information System (INIS)
Vasic, Dejan; Liu, Yuan-Ping; Costa, François; Schwander, Denis; Wu, Wen-Jong
2013-01-01
Burst-mode operation is adopted sometimes in piezoelectric transformer based converters for two major purposes: (1) to achieve voltage regulation in DC/DC converters and (2) to achieve dimming control in backlight inverters. Burst-mode control enables the converter to operate at a constant switching frequency as well as to maintain good efficiency at light load conditions. However, in practice, the piezoelectric transformer cannot instantly stop vibrating in the burst-mode due to its high quality factor. The delay in the output voltage change resulting from this behavior influences the accuracy of the regulation. This paper proposes a control strategy to make the piezoelectric transformer stop more quickly so as to enhance the accuracy of burst-mode control. The proposed method only modifies the control signal of the burst-mode driving circuit. The proposed control strategy is verified by experiments in a step-down 9 W DC/DC converter. (paper)
An Attempt to Shorten Loading Time of Epirubicin into DC Beads® Using Vibration and a Sieve
International Nuclear Information System (INIS)
Sonoda, Akinaga; Nitta, Norihisa; Yamamoto, Takefumi; Tomozawa, Yuki; Ohta, Shinichi; Watanabe, Shobu; Murata, Kiyoshi
2017-01-01
PurposeWe investigated the possibility of shortening the time required for loading epirubicin into calibrated polyvinyl alcohol-based hydrogel beads (DC Beads ® ) to be used for transarterial chemoembolization.MethodAfter separating the beads suspended in phosphate-buffered saline (PBS) solution by the use of a sieve (clearance 75 µm), epirubicin hydrochloride (EH) was loaded for 20, 30, or 60 s under vibration into DC beads. The EH loading rate into conventionally prepared (control) beads, i.e., beads loaded for 30 min without vibration, and vibration-loaded beads were calculated from the residual EH concentration in the bead-depleted EH solution. The amount of EH eluted from conventionally and vibration-loaded samples into a PBS solution (pH 7.0) was measured at 15 and 30 min and 1, 2, 6, 12, and 24 h. We also recorded the inhibitory effect of the PBS solution on the loading time. Using frozen sections, the EH load in the beads was evaluated visually under a fluorescence microscope.ResultsSpectrophotometry (495 nm) showed that the loading rate was 98.98 ± 0.34, 99.02 ± 0.32, and 99.50 ± 0.11 % with 20-, 30-, and 60-s vibration, respectively. The eluted rate was statistically similar between vibration- and statically loaded (control) beads. The PBS solution hampered EH loading into the beads. Visually, the distribution of EH in conventionally and vibration-loaded DC beads was similar.DiscussionThe use of vibration and the removal of PBS solution when epirubicin hydrochloride was loaded into DC beads dramatically shortened the loading time of epirubicin hydrochloride into DC beads.
Electronic structure of Pa at sign C28
International Nuclear Information System (INIS)
Zhao, Ke; Pitzer, R.M.
1995-01-01
The electronic structure of the endohedral complex Pa at sign C 28 was studied using ab initio quantum chemical methods including relativistic core potentials, gaussian double zeta basis sets, and spin-orbit configuration interaction calculations. As in U at sign C 28 , the self consistent field population analysis shows extensive mixing of Pa 6d and 5f orbitals with C π orbitals, indicating strong binding. The energy of the C 28 cage π* orbitals (e symmetry) is lower than that of the Pa 5f orbitals. The ground state has an e 1 configuration at both the SCF and CI level calculations. The lowest f 1 state is 1.68 eV and 1.70 eV above the ground state from SCF and CI calculations respectively. Previous calculations on U at sign C 28 showed that the ground state of U at sign C 28 is a π*f state instead of an f 2 state. The results for Pa at sign C 28 support that finding
Modular Power System Configured with Standard Product Hybrid DC-DC Converters, Phase II
National Aeronautics and Space Administration — VPT proposes an innovative concept whereby complex NASA space power electronic systems can be configured using a small number of qualified hybrid DC-DC converter and...
National Aeronautics and Space Administration — Studying and analyzing the ageing mechanisms of electronic components avionics in systems such as the GPS and INAV are of critical importance. In DC-DC power...
Simulating and Testing a DC-DC Half-Bridge SLR Converter
2013-06-01
future pulse power demands with ship power, a large bank of capacitors or similar rapid discharge source is required. If capacitors are charged...Single Pulsed Avalanche Energy (j) I" Avalanche Current (i) E,, Repetilive Avalanche Energy (i) dv/dt Peak Diode Recovery dv/dt ® Po Total Power...SLR), battery charging, DC-DC, pulse power, power electronics, SLR converter 15. NUMBER OF PAGES 119 16. PRICE CODE 17. SECURITY CLASSIFICATION
2015-03-01
COMPARISON OF BG-SENTINELH TRAP AND OVIPOSITION CUPS FOR AEDES AEGYPTI AND AEDES ALBOPICTUS SURVEILLANCE IN JACKSONVILLE, FLORIDA, USA JENNIFER A...trap and oviposition cups (OCs) have both proven effective in the surveillance of Aedes species. This study aimed to determine which of the 2 traps could...best characterize the relative population sizes of Aedes albopictus and Aedes aegypti in an urban section of Jacksonville, FL. Until 1986, Ae
Efficient Visible Light Communication Transmitters Based on Switching-Mode dc-dc Converters
2018-01-01
Visible light communication (VLC) based on solid-state lighting (SSL) is a promising option either to supplement or to substitute existing radio frequency (RF) wireless communication in indoor environments. VLC systems take advantage of the fast modulation of the visible light that light emitting diodes (LEDs) enable. The switching-mode dc-to-dc converter (SMCdc-dc) must be the cornerstone of the LED driver of VLC transmitters in order to incorporate the communication functionality into LED lighting, keeping high power efficiency. However, the new requirements related to the communication, especially the high bandwidth that the LED driver must achieve, converts the design of the SMCdc-dc into a very challenging task. In this work, three different methods for achieving such a high bandwidth with an SMCdc-dc are presented: increasing the order of the SMCdc-dc output filter, increasing the number of voltage inputs, and increasing the number of phases. These three strategies are combinable and the optimum design depends on the particular VLC application, which determines the requirements of the VLC transmitter. As an example, an experimental VLC transmitter based on a two-phase buck converter with a fourth-order output filter will demonstrate that a bandwidth of several hundred kilohertz (kHz) can be achieved with output power levels close to 10 W and power efficiencies between 85% and 90%. In conclusion, the design strategy presented allows us to incorporate VLC into SSL, achieving high bit rates without damaging the power efficiency of LED lighting. PMID:29642455
Energy Technology Data Exchange (ETDEWEB)
Majidi, Roya, E-mail: royamajidi@gmail.com [Department of Physics, Shahid Rajaee Teacher Training University, Lavizan, 16788-15811 Tehran (Iran, Islamic Republic of)
2012-10-01
In the present work, we have compared the resistance of the 90 Degree-Sign , 180 Degree-Sign , and 360 Degree-Sign domain walls in the presence of external magnetic field. The calculations are based on the Boltzmann transport equation within the relaxation time approximation. One-dimensional Neel-type domain walls between two domains whose magnetization differs by angle of 90 Degree-Sign , 180 Degree-Sign , and 360 Degree-Sign are considered. The results indicate that the resistance of the 360 Degree-Sign DW is more considerable than that of the 90 Degree-Sign and 180 Degree-Sign DWs. It is also found that the domain wall resistance can be controlled by applying transverse magnetic field. Increasing the strength of the external magnetic field enhances the domain wall resistance. In providing spintronic devices based on magnetic nanomaterials, considering and controlling the effect of domain wall on resistivity are essential.
DEFF Research Database (Denmark)
Liu, Changjin; Xu, Dehong; Zhu, Nan
2013-01-01
Unbalanced grid voltage causes a large second-order harmonic current in the dc-link capacitors as well as dc-voltage fluctuation, which potentially will degrade the lifespan and reliability of the capacitors in voltage source converters. This paper proposes a novel dc-capacitor current control...... method for a grid-side converter (GSC) to eliminate the negative impact of unbalanced grid voltage on the dc-capacitors. In this method, a dc-capacitor current control loop, where a negative-sequence resonant controller is used to increase the loop gain, is added to the conventional GSC current control...... loop. The rejection capability to the unbalanced grid voltage and the stability of the proposed control system are discussed. The second-order harmonic current in the dc capacitor as well as dc-voltage fluctuation is very well eliminated. Hence, the dc capacitors will be more reliable under unbalanced...
NK cell-derived IL-10 is critical for DC-NK cell dialogue at the maternal-fetal interface.
Blois, Sandra M; Freitag, Nancy; Tirado-González, Irene; Cheng, Shi-Bin; Heimesaat, Markus M; Bereswill, Stefan; Rose, Matthias; Conrad, Melanie L; Barrientos, Gabriela; Sharma, Surendra
2017-05-19
DC-NK cell interactions are thought to influence the development of maternal tolerance and de novo angiogenesis during early gestation. However, it is unclear which mechanism ensures the cooperative dialogue between DC and NK cells at the feto-maternal interface. In this article, we show that uterine NK cells are the key source of IL-10 that is required to regulate DC phenotype and pregnancy success. Upon in vivo expansion of DC during early gestation, NK cells expressed increased levels of IL-10. Exogenous administration of IL-10 was sufficient to overcome early pregnancy failure in dams treated to achieve simultaneous DC expansion and NK cell depletion. Remarkably, DC expansion in IL-10 -/- dams provoked pregnancy loss, which could be abrogated by the adoptive transfer of IL-10 +/+ NK cells and not by IL-10 -/- NK cells. Furthermore, the IL-10 expressing NK cells markedly enhanced angiogenic responses and placental development in DC expanded IL-10 -/- dams. Thus, the capacity of NK cells to secrete IL-10 plays a unique role facilitating the DC-NK cell dialogue during the establishment of a healthy gestation.
Native Americans With Diabetes PSA (:60)
Centers for Disease Control (CDC) Podcasts
This 60 second public service announcement is based on the January 2017 CDC Vital Signs report. Diabetes is the leading cause of kidney failure and Native Americans have a greater chance of having diabetes than any other racial group in the U.S. Learn how to manage your diabetes to delay or prevent kidney failure.
Directory of Open Access Journals (Sweden)
Rui Li
2016-12-01
Full Text Available The AC voltage control of a DC/DC converter based on the modular multilevel converter (MMC is considered under normal operation and during a local DC fault. By actively setting the AC voltage according to the two DC voltages of the DC/DC converter, the modulation index can be near unity, and the DC voltage is effectively utilized to output higher AC voltage. This significantly decreases submodule (SM capacitance and conduction losses of the DC/DC converter, yielding reduced capital cost, volume, and higher efficiency. Additionally, the AC voltage is limited in the controllable range of both the MMCs in the DC/DC converter; thus, over-modulation and uncontrolled currents are actively avoided. The AC voltage control of the DC/DC converter during local DC faults, i.e., standby operation, is also proposed, where only the MMC connected on the faulty cable is blocked, while the other MMC remains operational with zero AC voltage output. Thus, the capacitor voltages can be regulated at the rated value and the decrease of the SM capacitor voltages after the blocking of the DC/DC converter is avoided. Moreover, the fault can still be isolated as quickly as the conventional approach, where both MMCs are blocked and the DC/DC converter is not exposed to the risk of overcurrent. The proposed AC voltage control strategy is assessed in a three-terminal high-voltage direct current (HVDC system incorporating a DC/DC converter, and the simulation results confirm its feasibility.
Neurological soft signs discriminating mood disorders from first episode schizophrenia
Boks, MPM; Liddle, PF; Burgerhof, JGM; Knegtering, R; Bosch, RJ
Objective: To investigate the specificity of neurological soft signs (NSS) for first episode schizophrenia compared with mood disorders. Method: We assessed NSS in a sample of 60 healthy controls, 191 first episode psychosis patients and 81 mood disorder patients. We used a principle component
Alcohol Poisoning Deaths PSA (:60)
Centers for Disease Control (CDC) Podcasts
2015-01-06
This 60 second Public Service Announcement is based on the January 2015 CDC Vital Signs report. In the United States, an average of six people die every day from alcohol poisoning. Learn what you can do to prevent binge drinking and alcohol poisoning. Created: 1/6/2015 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP). Date Released: 1/6/2015.
Prescription Painkiller Overdoses PSA (:60)
Centers for Disease Control (CDC) Podcasts
2013-07-02
This 60 second public service announcement is based on the July 2013 CDC Vital Signs report. Prescription painkiller overdoses are an under-recognized and growing problem among women. This program includes things that women and health care providers can do to reduce the risk of overdose. Created: 7/2/2013 by Centers for Disease Control and Prevention (CDC). Date Released: 7/2/2013.
Centers for Disease Control (CDC) Podcasts
This 60 second PSA is based on the February 2012 CDC Vital Signs report. Ninety percent of Americans age two and older eat too much sodium which can increase your risk for high blood pressure and often leads to heart disease and stroke, two leading causes of death in the US. Learn several small steps you can take to reduce the amount of sodium in your diet.
Feld, Lutz Werner; Karpinski, Waclaw; Klein, Katja; Lipinski, Martin; Pauls, Alexander Josef; Preuten, Marius; Rauch, Max Philip; Wangelik, Frederik; Wlochal, Michael
2017-01-01
The 2S silicon strip modules for the CMS Phase-2 tracker upgrade will require two operating voltages. These will be provided via a two-step DC-DC conversion powering scheme, in which one DC-DC converter delivers 2.5\\,V while the second DC-DC converter receives 2.5\\,V at its input and converts it to 1.2\\,V. The DC-DC converters will be mounted on a flex PCB, the service hybrid, together with an opto-electrical converter module (VTRx+) and a serializer (LP-GBT). The service hybrid will be mounted directly on the 2S module. A prototype service hybrid has been developed and its performance has been evaluated, including radiative and conductive noise emissions, and efficiency. In addition system tests with a prototype module have been performed. In this report the service hybrid will be described and the test results will be summarized.
A suitable model plant for control of the set fuel cell-DC/DC converter
Energy Technology Data Exchange (ETDEWEB)
Andujar, J.M.; Segura, F.; Vasallo, M.J. [Departamento de Ingenieria Electronica, Sistemas Informaticos y Automatica, E.P.S. La Rabida, Universidad de Huelva, Ctra. Huelva - Palos de la Frontera, S/N, 21819 La Rabida - Palos de la Frontera Huelva (Spain)
2008-04-15
In this work a state and transfer function model of the set made up of a proton exchange membrane (PEM) fuel cell and a DC/DC converter is developed. The set is modelled as a plant controlled by the converter duty cycle. In addition to allow setting the plant operating point at any point of its characteristic curve (two interesting points are maximum efficiency and maximum power points), this approach also allows the connection of the fuel cell to other energy generation and storage devices, given that, as they all usually share a single DC bus, a thorough control of the interconnected devices is required. First, the state and transfer function models of the fuel cell and the converter are obtained. Then, both models are related in order to achieve the fuel cell+DC/DC converter set (plant) model. The results of the theoretical developments are validated by simulation on a real fuel cell model. (author)
Directory of Open Access Journals (Sweden)
Furtado HL
2015-04-01
Full Text Available Hélio L Furtado,1 Nelson Sousa,2 Roberto Simão,3 Fabio Dutra Pereira,1 José Vilaça-Alves2 1Castelo Branco University, Rio de Janeiro, Brazil; 2Research Center for Sport, Health, and Human Development, University of Trás-os-Montes and Alto Douro, Vila Real, Portugal; 3School of Physical Education and Sports, Rio de Janeiro Federal University, Rio de Janeiro, Brazil Purpose: To compare functional fitness (FF levels among independent-living (IL and day care (DC elderly women of different age groups and to analyze changes in FF after 8 months of participation in an exercise program intervention for the IL elderly women. Materials and methods: A total of 674 elderly women were divided into four IL groups with age in the range of 60–64 years (IL60–64, n=149, 65–69 years (IL65–69, n=138, 70–74 years (IL70–74, n=135, and 75–79 years (IL75–79, n=83, and four DC groups with age in the range of 60–64 years (DC60–64, n=35, 65–69 years (DC65–69, n=34, 70–74 years (DC70–74, n=47, and 75–79 years (DC75–79, n=53. The intervention consisted of a multimodal exercise training, 3 days per week for 8 months. Senior Fitness Test battery performances were obtained at baseline and after 8-month intervention. Results: Significant differences were identified between all IL groups and DC groups in all FF tests (P<0.001, except between IL70–74 and DC70–74 in the chair sit-and-reach. Analysis of covariance (ANCOVA identified significant improvements in all FF tests between pre- and posttests in the IL groups (P<0.001, except in the chair sit-and-reach for the IL70–74. ANCOVA also showed a significant declining performance in all FF tests for DC groups (P<0.001, except in the chair sit-and-reach for the DC70–74 and DC75–79. Conclusion: IL women are more fit than institutionalized DC elderly women. The multimodal training was effective in improving all FF components related to daily living activities, in all age groups
Research of digital controlled DC/DC converter based on STC12C5410AD
Chen, Dan-Jiang; Jin, Xin; Xiao, Zhi-Hong
2010-02-01
In order to study application of digital control technology on DC/DC converter, principle of increment mode PID control algorithm was analyzed in the paper. Then, a SCM named STC12C5410AD was introduced with its internal resources and characteristics. The PID control algorithm can be implemented easily based on it. The output of PID control was used to change the value of a variable that is 255 times than duty cycle, and this reduced the error of calculation. The valid of the presented algorithm was verified by an experiment for a BUCK DC/DC converter. The experimental results indicated that output voltage of the BUCK converter is stable with low ripple.
Directory of Open Access Journals (Sweden)
Noroozian
2009-06-01
Full Text Available This paper presents the modeling and simulation of a proton exchange membrane fuel cell (PEMFC generation system for off-grid and on-grid operation and configuration. A fuel cell DG system consists of a fuel cell power plant, a DC/DC converter and a DC/AC inverter. The dynamic model for fuel cell array and its power electronic interfacing are presented also a multi-input single output (MISO DC/DC converter and its control scheme is proposed and analyzed. This DC/DC converter is capable of interfacing fuel cell arrays to the DC/AC inverter. Also the mathematical model of the inverter is obtained by using average technique. Then the novel control strategy of DC/AC inverter for different operating conditions is demonstrated. The simulation results show the effectiveness of the suggested control systems under both on-grid and off-grid operation modes.
Centers for Disease Control (CDC) Podcasts
2015-06-02
This 60 second public service announcement is based on the June 2015 CDC Vital Signs report. Skin cancer is the most common form of cancer in the U.S. In 2011, there were more than 65,000 cases of melanoma, the most deadly form of skin cancer. Learn how everyone can help prevent skin cancer. Created: 6/2/2015 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP). Date Released: 6/2/2015.
Language and Literacy Acquisition through Parental Mediation in American Sign Language
Bailes, Cynthia Neese; Erting, Lynne C.; Thumann-Prezioso, Carlene; Erting, Carol J.
2009-01-01
This longitudinal case study examined the language and literacy acquisition of a Deaf child as mediated by her signing Deaf parents during her first three years of life. Results indicate that the parents' interactions with their child were guided by linguistic and cultural knowledge that produced an intuitive use of child-directed signing (CDSi)…
Motor Vehicle Crash Injuries PSA (:60)
Centers for Disease Control (CDC) Podcasts
2014-10-07
This 60 second Public Service Announcement is based on the October 2014 CDC Vital Signs report. Motor vehicle crashes are costly and preventable. Learn what can be done to help prevent motor vehicle injuries. Created: 10/7/2014 by National Center for Injury Prevention and Control (NCIPC). Date Released: 10/7/2014.
Alcohol Screening and Counseling PSA (:60)
Centers for Disease Control (CDC) Podcasts
2014-01-07
This 60 second public service announcement is based on the January 2014 CDC Vital Signs report. Millions of Americans drink too much, a dangerous behavior that can lead to serious health problems. Alcohol screening and counseling can help. Created: 1/7/2014 by Centers for Disease Control and Prevention (CDC). Date Released: 1/7/2014.