Ultrafine coal classification using 150 mm gMax cyclone circuits
Energy Technology Data Exchange (ETDEWEB)
Honaker, R.Q.; Boaten, F.; Luttrell, G.H. [University of Kentucky, Lexington, KY (United States). Dept. of Mineral Engineering
2007-11-15
A two-stage classification circuit using 150 mm diameter gMax cyclones was installed and evaluated in a coal preparation plant in an effort to achieve a clean coal product without the use of froth flotation. Particle size separations of around 37 {mu}m were achieved while limiting ultrafine bypass to less than 10% in the circuit underflow stream. As a result, approximately 81% of the ash-bearing material in the circuit feed was rejected to the circuit overflow stream. The feed ash content was reduced from around 50% to values in the range of 22-30% in the circuit underflow stream with a mass recovery of about 30%. Further reductions in the coarse product ash content were limited due to the particle density effect and the remaining presence of a significant quantity of high-ash slime material in the coarse product. The typical D{sub 50} for the coal particles was 40 {mu} m while the estimated value for mineral matter was 17 {mu} m. Based on the findings of the study, the use of classification to recover a low-ash, coarse fraction in the feed of a fine coal circuit is limited by the density effect regardless of the ability to eliminate ultrafine bypass.
Griebeler, Eva Maria; Werner, Jan
2018-01-01
In his 2016 paper, Myhrvold criticized ours from 2014 on maximum growth rates (Gmax, maximum gain in body mass observed within a time unit throughout an individual's ontogeny) and thermoregulation strategies (ectothermy, endothermy) of 17 dinosaurs. In our paper, we showed that Gmax values of similar-sized extant ectothermic and endothermic vertebrates overlap. This strongly questions a correct assignment of a thermoregulation strategy to a dinosaur only based on its Gmax and (adult) body mass (M). Contrary, Gmax separated similar-sized extant reptiles and birds (Sauropsida) and Gmax values of our studied dinosaurs were similar to those seen in extant similar-sized (if necessary scaled-up) fast growing ectothermic reptiles. Myhrvold examined two hypotheses (H1 and H2) regarding our study. However, we did neither infer dinosaurian thermoregulation strategies from group-wide averages (H1) nor were our results based on that Gmax and metabolic rate (MR) are related (H2). In order to assess whether single dinosaurian Gmax values fit to those of extant endotherms (birds) or of ectotherms (reptiles), we already used a method suggested by Myhrvold to avoid H1, and we only discussed pros and cons of a relation between Gmax and MR and did not apply it (H2). We appreciate Myhrvold's efforts in eliminating the correlation between Gmax and M in order to statistically improve vertebrate scaling regressions on maximum gain in body mass. However, we show here that his mass-specific maximum growth rate (kC) replacing Gmax (= MkC) does not model the expected higher mass gain in larger than in smaller species for any set of species. We also comment on, why we considered extant reptiles and birds as reference models for extinct dinosaurs and why we used phylogenetically-informed regression analysis throughout our study. Finally, we question several arguments given in Myhrvold in order to support his results.
Choo, Hyunwook; Nam, Hongyeop; Lee, Woojin
2017-12-01
The composition of naturally cemented deposits is very complicated; thus, estimating the maximum shear modulus (Gmax, or shear modulus at very small strains) of cemented sands using the previous empirical formulas is very difficult. The purpose of this experimental investigation is to evaluate the effects of particle size and cement type on the Gmax and unconfined compressive strength (qucs) of cemented sands, with the ultimate goal of estimating Gmax of cemented sands using qucs. Two sands were artificially cemented using Portland cement or gypsum under varying cement contents (2%-9%) and relative densities (30%-80%). Unconfined compression tests and bender element tests were performed, and the results from previous studies of two cemented sands were incorporated in this study. The results of this study demonstrate that the effect of particle size on the qucs and Gmax of four cemented sands is insignificant, and the variation of qucs and Gmax can be captured by the ratio between volume of void and volume of cement. qucs and Gmax of sand cemented with Portland cement are greater than those of sand cemented with gypsum. However, the relationship between qucs and Gmax of the cemented sand is not affected by the void ratio, cement type and cement content, revealing that Gmax of the complex naturally cemented soils with unknown in-situ void ratio, cement type and cement content can be estimated using qucs.
Genetics of body shape and armour variation in threespine sticklebacks.
Leinonen, T; Cano, J M; Merilä, J
2011-01-01
Patterns of genetic variation and covariation can influence the rate and direction of phenotypic evolution. We explored the possibility that the parallel morphological evolution seen in threespine stickleback (Gasterosteus aculeatus) populations colonizing freshwater environments is facilitated by patterns of genetic variation and covariation in the ancestral (marine) population. We estimated the genetic (G) and phenotypic (P) covariance matrices and directions of maximum additive genetic (g(max) ) and phenotypic (p(max) ) covariances of body shape and armour traits. Our results suggest a role for the ancestral G in explaining parallel morphological evolution in freshwater populations. We also found evidence of genetic constraints owing to the lack of variance in the ancestral G. Furthermore, strong genetic covariances and correlations among traits revealed that selective factors responsible for threespine stickleback body shape and armour divergence may be difficult to disentangle. The directions of g(max) and p(max) were correlated, but the correlations were not high enough to imply that phenotypic patterns of trait variation and covariation within populations are very informative of underlying genetic patterns. © 2010 The Authors. Journal of Evolutionary Biology © 2010 European Society For Evolutionary Biology.
Internal coordination between hydraulics and stomatal control in leaves.
Brodribb, Tim J; Jordan, Gregory J
2008-11-01
The stomatal response to changing leaf-atmospheric vapour pressure gradient (D(l)) is a crucial yet enigmatic process that defines the daily course of leaf gas exchange. Changes in the hydration of epidermal cells are thought to drive this response, mediated by the transpiration rate and hydraulic conductance of the leaf. Here, we examine whether species-specific variation in the sensitivity of leaves to perturbation of D(l) is related to the efficiency of water transport in the leaf (leaf hydraulic conductivity, K(leaf)). We found good correlation between maximum liquid (K(leaf)) and gas phase conductances (g(max)) in leaves, but there was no direct correlation between normalized D(l) sensitivity and K(leaf). The impact of K(leaf) on D(l) sensitivity in our diverse sample of eight species was important only after accounting for the strong relationship between K(leaf) and g(max). Thus, the ratio of g(max)/K(leaf) was strongly correlated with stomatal sensitivity to D(l). This ratio is an index of the degree of hydraulic buffering of the stomata against changes in D(l), and species with high g(max) relative to K(leaf) were the most sensitive to D(l) perturbation. Despite the potentially high adaptive significance of this phenomenon, we found no significant phylogenetic or ecological trend in our species.
Franettovich Smith, Melinda M; Bonacci, Jason; Mendis, M Dilani; Christie, Craig; Rotstein, Andrew; Hides, Julie A
2017-02-01
To investigate if size and activation of the gluteal muscles is a risk factor for hamstring injuries in elite AFL players. Prospective cohort study. Twenty-six elite male footballers from a professional Australian Football League (AFL) club participated in the study. At the beginning of the season bilateral gluteus medius (GMED) and gluteus maximus (GMAX) muscle volume was measured from magnetic resonance images and electromyographic recordings of the same muscles were obtained during running. History of hamstring injury in the pre-season and incidence of hamstring injury during the season were determined from club medical data. Nine players (35%) incurred a hamstring injury during the season. History of hamstring injury was comparable between those players who incurred a season hamstring injury (2/9 players; 22%) and those who did not (3/17 players; 18%). Higher GMED muscle activity during running was a risk factor for hamstring injury (p=0.03, effect sizes 1.1-1.5). There were no statistically significant differences observed for GMED volume, GMAX volume and GMAX activation (P>0.05). This study identified higher activation of the GMED muscle during running in players who sustained a season hamstring injury. Whilst further research is required to understand the mechanism of altered muscle control, the results of this study contribute to the developing body of evidence that the lumbo-pelvic muscles may be important to consider in hamstring injury prevention and management. Copyright © 2016 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.
Functional Maximum Autocorrelation Factors
DEFF Research Database (Denmark)
Larsen, Rasmus; Nielsen, Allan Aasbjerg
2005-01-01
MAF outperforms the functional PCA in concentrating the interesting' spectra/shape variation in one end of the eigenvalue spectrum and allows for easier interpretation of effects. Conclusions. Functional MAF analysis is a useful methods for extracting low dimensional models of temporally or spatially......Purpose. We aim at data where samples of an underlying function are observed in a spatial or temporal layout. Examples of underlying functions are reflectance spectra and biological shapes. We apply functional models based on smoothing splines and generalize the functional PCA in......\\verb+~+\\$\\backslash\\$cite{ramsay97} to functional maximum autocorrelation factors (MAF)\\verb+~+\\$\\backslash\\$cite{switzer85,larsen2001d}. We apply the method to biological shapes as well as reflectance spectra. {\\$\\backslash\\$bf Methods}. MAF seeks linear combination of the original variables that maximize autocorrelation between...
Contrast and stability of the axon diameter index from microstructure imaging with diffusion MRI
DEFF Research Database (Denmark)
Dyrby, Tim B; Søgaard, Lise V; Hall, Matt G
2013-01-01
(max) ) on a scanner influence the sensitivity to a range of axon diameters. Multishell high-angular-diffusion-imaging (HARDI) protocols for G(max) of 60, 140, 200, and 300 mT/m were optimized for the pulsed-gradient-spin-echo (PGSE) sequence. Data were acquired on a fixed monkey brain and Monte-Carlo simulations......(max) for enhancing contrast between axon diameter distributions and are, therefore, relevant in general for microstructure imaging methods and highlight the need for increased G(max) on future commercial systems. Magn Reson Med, 2012. © 2012 Wiley Periodicals, Inc....
A superconducting magnet for g-factor studies at JOSEF
International Nuclear Information System (INIS)
Borgs, J.W.; Chatzipetros, J.; Lawin, H.; Menzen, G.; Sistemich, K.; Wolf, A.
1987-01-01
A superconducting magnet has been constructed for the determination of excited-state g-factors of fission products through perturbed angular correlation measurements at the separator JOSEF. The system contains a channel at room temperature which allows the rapid transport of radioactive samples with a tape device into the centre of the magnet. Thus experiments on the γ radiation from short-lived β/sup -/ decaying nuclei are possible. The coils of the magnet have been built by Oxford Instruments Ltd while the cryostat has been designed and manufactured in the central workshop of the Kernforschungsanlage Julich. The maximum field strength is 6.54 T at a current of 59 A and the homogeneity is better than one percent for an area with a radius of 0.5 cm at the centre of the magnet. The liquid helium consumption is only 0.3 1/h. The magnet has been used for the determination of the g-factors of the 2/sub 1//sup +/ states in /sup 102/Mo and /sup 104/Mo
Gypsophila bermejoi G. López: A possible case of speciation repressed by bioclimatic factors.
de Luis, Miguel; Bartolomé, Carmen; García Cardo, Óscar; Álvarez-Jiménez, Julio
2018-01-01
Gypsophila bermejoi G. López is an allopolyploid species derived from the parental G. struthium L. subsp. struthium and G. tomentosa L. All these plants are gypsophytes endemic to the Iberian Peninsula of particular ecological, evolutionary and biochemical interest. In this study, we present evidence of a possible repression on the process of G. bermejoi speciation by climatic factors. We modelled the ecological niches of the three taxa considered here using a maximum entropy approach and employing a series of bioclimatic variables. Subsequently, we projected these models onto the geographical space of the Iberian Peninsula in the present age and at two past ages: the Last Glacial Maximum and the mid-Holocene period. Furthermore, we compared these niches using the statistical method devised by Warren to calculate their degree of overlap. We also evaluated the evolution of the bioclimatic habitat suitability at those sites were the soil favors the growth of these species. Both the maximum entropy model and the degree of overlap indicated that the ecological behavior of the hybrid differs notably from that of the parental species. During the Last Glacial Maximum, the two parental species appear to take refuge in the western coastal strip of the Peninsula, a region in which there are virtually no sites where G. bermejoi could potentially be found. However, in the mid-Holocene period the suitability of G. bermejoi to sites with favorable soils shifts from almost null to a strong adaptation, a clear change in this tendency. These results suggest that the ecological niches of hybrid allopolyploids can be considerably different to those of their parental species, which may have evolutionary and ecologically relevant consequences. The data obtained indicate that certain bioclimatic variables may possibly repress the processes by which new species are formed. The difference in the ecological niche of G. bermejoi with respect to its parental species prevented it from
Flynn, Kevin J; Skibinski, David O F; Lindemann, Christian
2018-04-01
Nutrient acquisition is a critical determinant for the competitive advantage for auto- and osmohetero- trophs alike. Nutrient limited growth is commonly described on a whole cell basis through reference to a maximum growth rate (Gmax) and a half-saturation constant (KG). This empirical application of a Michaelis-Menten like description ignores the multiple underlying feedbacks between physiology contributing to growth, cell size, elemental stoichiometry and cell motion. Here we explore these relationships with reference to the kinetics of the nutrient transporter protein, the transporter rate density at the cell surface (TRD; potential transport rate per unit plasma-membrane area), and diffusion gradients. While the half saturation value for the limiting nutrient increases rapidly with cell size, significant mitigation is afforded by cell motion (swimming or sedimentation), and by decreasing the cellular carbon density. There is thus potential for high vacuolation and high sedimentation rates in diatoms to significantly decrease KG and increase species competitive advantage. Our results also suggest that Gmax for larger non-diatom protists may be constrained by rates of nutrient transport. For a given carbon density, cell size and TRD, the value of Gmax/KG remains constant. This implies that species or strains with a lower Gmax might coincidentally have a competitive advantage under nutrient limited conditions as they also express lower values of KG. The ability of cells to modulate the TRD according to their nutritional status, and hence change the instantaneous maximum transport rate, has a very marked effect upon transport and growth kinetics. Analyses and dynamic models that do not consider such modulation will inevitably fail to properly reflect competitive advantage in nutrient acquisition. This has important implications for the accurate representation and predictive capabilities of model applications, in particular in a changing environment.
g-Factors in the (sdg) boson model
Morrison, I.
1986-07-01
The role of the g-boson in producing first-order variations in the g-factors of states in rotational nuclei is investigated. It is shown that the g-boson is unlikely to contribute directly to any observed g-factor variations in the ground-state band.
G-factors in the (sdg) boson model
Energy Technology Data Exchange (ETDEWEB)
Morrison, I.
1986-07-24
The role of the g-boson in producing first-order variations in the g-factors of states in rotational nuclei is investigated. It is shown that the g-boson is unlikely to contribute directly to any observed g-factor variations in the ground-state band.
Germination Response of Four Alien Congeneric Amaranthus Species to Environmental Factors.
Hao, Jian-Hua; Lv, Shuang-Shuang; Bhattacharya, Saurav; Fu, Jian-Guo
2017-01-01
Seed germination is the key step for successful establishment, growth and further expansion of population especially for alien plants with annual life cycle. Traits like better adaptability and germination response were thought to be associated with plant invasion. However, there are not enough empirical studies correlating adaptation to environmental factors with germination response of alien invasive plants. In this study, we conducted congeneric comparisons of germination response to different environmental factors such as light, pH, NaCl, osmotic and soil burials among four alien amaranths that differ in invasiveness and have sympatric distribution in Jiangsu Province, China. The data were used to create three-parameter sigmoid and exponential decay models, which were fitted to cumulative germination and emergence curves. The results showed higher maximum Germination (Gmax), shorter time for 50% germination (G50) and the rapid slope (Grate) for Amaranthus blitum (low-invasive) and A. retroflexus (high-invasive) compare to intermediately invasive A. spinosus and A. viridis in all experimental regimes. It indicated that germination potential does not necessarily constitute a trait that can efficiently distinguish highly invasive and low invasive congeners in four Amaranthus species. However, it was showed that the germination performances of four amaranth species were more or less correlated with their worldwide distribution area. Therefore, the germination performance can be used as a reference indicator, but not an absolute trait for invasiveness. Our results also confirmed that superior germination performance in wide environmental conditions supplementing high seed productivity in highly invasive A. retroflexus might be one of the reasons for its prolific growth and wide distribution. These findings lay the foundation to develop more efficient weed management practice like deep burial of seeds by turning over soil and use of tillage agriculture to control
Van Gelder, Leonard H; Hoogenboom, Barbara J; Alonzo, Bryan; Briggs, Dayna; Hatzel, Brian
2015-11-01
Kettlebell (KB) swing exercises have been proposed as a possible method to improve hip and spinal motor control as well as improve power, strength, and endurance. To describe electromyographic (EMG) and sagittal plane kinematics during two KB exercises: the two-handed KB swing (THKS) and the single-handed KB swing (SHKS). In addition, the authors sought to investigate whether or not hip flexor length related to the muscular activity or the kinematics of the exercise. Twenty-three healthy college age subjects participated in this study. Demographic information and passive hip flexor length were recorded for each subject. A maximum voluntary isometric contraction (MVIC) of bilateral gluteus maximus (GMAX), gluteus medius (GMED), and biceps femoris (BF) muscles was recorded. EMG activity and sagittal plane video was recorded during both the THKS and SHKS in a randomized order. Normalized muscular activation of the three studied muscles was calculated from EMG data. During both SHKS and THKS, the average percent of peak MVIC for GMAX was 75.02% ± 55.38, GMED 55.47% ± 26.33, and BF 78.95% ± 53.29. Comparisons of the mean time to peak activation (TTP) for each muscle showed that the biceps femoris was the first muscle to activate during the swings. Statistically significant (p < .05), moderately positive correlations (r = .483 and .417) were found between passive hip flexor length and % MVIC for the GMax during the SHKS and THKS, respectively. The THKS and SHKS provide sufficient muscular recruitment for strengthening of all of the muscles explored. This is the first study to show significant correlations between passive hip flexor length and muscular activation of hip extensors, particularly the GMax. Finally, the BF consistently reached peak activity before the GMax and GMed during the SHKS. Level 3.
Radioimmunoassay of IgG and IgM rheumatoid factors reacting with human IgG
International Nuclear Information System (INIS)
Carson, D.A.; Lawrance, S.; Catalano, M.A.; Vaughan, J.H.; Abraham, G.
1977-01-01
Although IgG rheumatoid factor may play a central role in the pathogenesis of rheumatoid arthritis, previously there have been no precise methods for its specific measurement in serum and synovial fluid. This paper describes a solid phase radioimmunoassay for the independent quantification of IgM and IgG rheumatoid factor reacting with the Fc fragment of human IgG. As measured by this assay, serum IgG rheumatoid factor levels differed significantly between patients with seropositive and seronegative rheumatoid arthritis and normal control subjects. In addition, several sera and joint fluids from patients with seropositive rheumatoid arthritis, even without vasculitis, were shown by gel chromatography to have acid-dissociable complexes of IgG rheumatoid factor suggestive of IgG-IgG dimer or trimer formation
Sundquist, Kristina; Wang, Xiao; Svensson, Peter J; Sundquist, Jan; Hedelius, Anna; Larsson Lönn, Sara; Zöller, Bengt; Memon, Ashfaque A
2015-11-25
Plasminogen-activator inhibitor (PAI)-1 is an important inhibitor of the plasminogen/plasmin system. PAI-1 levels are influenced by the 4G/5G polymorphism in the PAI-1 promoter. We investigated the relationship between the PAI-1 polymorphism and VTE recurrence, and its possible modification by factor V Leiden (FVL) and prothrombin (PTM) mutations. Patients (n=1,069) from the Malmö Thrombophilia Study were followed from discontinuation of anticoagulant treatment until diagnosis of VTE recurrence or the end of the study (maximum follow-up 9.8 years). One hundred twenty-seven patients (11.9 %) had VTE recurrence. PAI-1 was genotyped by TaqMan PCR. Cox regression analysis adjusted for age, sex and acquired risk factors of VTE showed no evidence of an association between PAI-1 genotype and risk of VTE recurrence in the study population as a whole. However, by including an interaction term in the analysis we showed that FVL but not PTM modified the effect of PAI-1 genotype: patients with the 4G allele plus FVL had a higher risk of VTE recurrence [hazard ratio (HR) =2.3, 95 % confidence interval (CI) =1.5-3.3] compared to patients with the 4G allele but no FVL (reference group) or FVL irrespective of PAI-1 genotype (HR=1.8, 95 % CI=1.3-2.5). Compared to reference group, 5G allele irrespective of FVL was associated with lower risk of VTE recurrence only when compared with 4G allele together with FVL. In conclusion, FVL has a modifying effect on PAI-1 polymorphism in relation to risk of VTE recurrence. The role of PAI-1 polymorphism as a risk factor of recurrent VTE may be FVL dependent.
Maximum entropy analysis of liquid diffraction data
International Nuclear Information System (INIS)
Root, J.H.; Egelstaff, P.A.; Nickel, B.G.
1986-01-01
A maximum entropy method for reducing truncation effects in the inverse Fourier transform of structure factor, S(q), to pair correlation function, g(r), is described. The advantages and limitations of the method are explored with the PY hard sphere structure factor as model input data. An example using real data on liquid chlorine, is then presented. It is seen that spurious structure is greatly reduced in comparison to traditional Fourier transform methods. (author)
Maximum Likelihood Dynamic Factor Modeling for Arbitrary "N" and "T" Using SEM
Voelkle, Manuel C.; Oud, Johan H. L.; von Oertzen, Timo; Lindenberger, Ulman
2012-01-01
This article has 3 objectives that build on each other. First, we demonstrate how to obtain maximum likelihood estimates for dynamic factor models (the direct autoregressive factor score model) with arbitrary "T" and "N" by means of structural equation modeling (SEM) and compare the approach to existing methods. Second, we go beyond standard time…
International Nuclear Information System (INIS)
Maruyama, Soh; Yamashita, Kiyonobu; Fujimoto, Nozomu; Murata, Isao; Shindo, Ryuichi; Sudo, Yukio
1988-12-01
The Japan Atomic Energy Research Institute (JAERI) has been designing the High Temperature Engineering Test Reactor (HTTR), which is 30 MW in thermal power, 950deg C in reactor outlet coolant temperature and 40 kg/cm 2 G in primary coolant pressure. This report summarizes the hot spot factors and their estimated values used in the evaluation of the maximum fuel temperature which is one of the major items in the core thermal and hydraulic design of the HTTR. The hot spot factors consist of systematic factors and random factors. They were identified and their values adopted in the thermal and hydraulic design were determined considering the features of the HTTR. (author)
International Nuclear Information System (INIS)
Xia Dechang; Liu Chao
2012-01-01
On the basis of discussing the influence of single factor on maximum uranium concentration in digestion solution,the influence degree of some factors such as U content, H 2 O content, mass ratio of P and U was compared and analyzed. The results indicate that the relationship between U content and maximum uranium concentration in digestion solution was direct ratio, while the U content increases by 1%, the maximum uranium concentration in digestion solution increases by 4.8%-5.7%. The relationship between H 2 O content and maximum uranium concentration in digestion solution was inverse ratio, the maximum uranium concentration in digestion solution decreases by 46.1-55.2 g/L while H 2 O content increases by 1%. The relationship between mass ratio of P and U and maximum uranium concentration in digestion solution was inverse ratio, the maximum uranium concentration in digestion solution decreases by 116.0-181.0 g/L while the mass ratio of P and U increase 0.1%. When U content equals 62.5% and the influence of mass ratio of P and U is no considered, the maximum uranium concentration in digestion solution equals 1 578 g/L; while mass ratio of P and U equals 0.35%, the maximum uranium concentration decreases to 716 g/L, the decreased rate is 54.6%, so the mass ratio of P and U in U 3 O 8 type uranium ore concentrate is the main controlling factor. (authors)
Weighted Maximum-Clique Transversal Sets of Graphs
Chuan-Min Lee
2011-01-01
A maximum-clique transversal set of a graph G is a subset of vertices intersecting all maximum cliques of G. The maximum-clique transversal set problem is to find a maximum-clique transversal set of G of minimum cardinality. Motivated by the placement of transmitters for cellular telephones, Chang, Kloks, and Lee introduced the concept of maximum-clique transversal sets on graphs in 2001. In this paper, we study the weighted version of the maximum-clique transversal set problem for split grap...
International Nuclear Information System (INIS)
Porras-Montenegro, N; Duque, C A; Oliveira, L E; Reyes-Gomez, E
2008-01-01
The hydrostatic-pressure effects on the electron-effective Lande g || factor and g-factor anisotropy in semiconductor GaAs-Ga 1-x Al x As quantum wells under magnetic fields are studied. The g || factor is computed by considering the non-parabolicity and anisotropy of the conduction band through the Ogg-McCombe effective Hamiltonian, and numerical results are displayed as functions of the applied hydrostatic pressure, magnetic fields, and quantum-well widths. Good agreement between theoretical results and experimental measurements in GaAs-(Ga, Al)As quantum wells for the electron g factor and g-factor anisotropy at low values of the applied magnetic field and in the absence of hydrostatic pressure is obtained. Present results open up new possibilities for manipulating the electron-effective g factor in semiconductor heterostructures.
METHOD FOR DETERMINING THE MAXIMUM ARRANGEMENT FACTOR OF FOOTWEAR PARTS
Directory of Open Access Journals (Sweden)
DRIŞCU Mariana
2014-05-01
Full Text Available By classic methodology, designing footwear is a very complex and laborious activity. That is because classic methodology requires many graphic executions using manual means, which consume a lot of the producer’s time. Moreover, the results of this classical methodology may contain many inaccuracies with the most unpleasant consequences for the footwear producer. Thus, the costumer that buys a footwear product by taking into consideration the characteristics written on the product (size, width can notice after a period that the product has flaws because of the inadequate design. In order to avoid this kind of situations, the strictest scientific criteria must be followed when one designs a footwear product. The decisive step in this way has been made some time ago, when, as a result of powerful technical development and massive implementation of electronical calculus systems and informatics, This paper presents a product software for determining all possible arrangements of a footwear product’s reference points, in order to automatically acquire the maximum arrangement factor. The user multiplies the pattern in order to find the economic arrangement for the reference points. In this purpose, the user must probe few arrangement variants, in the translation and rotate-translation system. The same process is used in establishing the arrangement factor for the two points of reference of the designed footwear product. After probing several variants of arrangement in the translation and rotation and translation systems, the maximum arrangement factors are chosen. This allows the user to estimate the material wastes.
The maximum possible stress intensity factor for a crack in an unknown residual stress field
International Nuclear Information System (INIS)
Coules, H.E.; Smith, D.J.
2015-01-01
Residual and thermal stress fields in engineering components can act on cracks and structural flaws, promoting or inhibiting fracture. However, these stresses are limited in magnitude by the ability of materials to sustain them elastically. As a consequence, the stress intensity factor which can be applied to a given defect by a self-equilibrating stress field is also limited. We propose a simple weight function method for determining the maximum stress intensity factor which can occur for a given crack or defect in a one-dimensional self-equilibrating stress field, i.e. an upper bound for the residual stress contribution to K I . This can be used for analysing structures containing defects and subject to residual stress without any information about the actual stress field which exists in the structure being analysed. A number of examples are given, including long radial cracks and fully-circumferential cracks in thick-walled hollow cylinders containing self-equilibrating stresses. - Highlights: • An upper limit to the contribution of residual stress to stress intensity factor. • The maximum K I for self-equilibrating stresses in several geometries is calculated. • A weight function method can determine this maximum for 1-dimensional stress fields. • Simple MATLAB scripts for calculating maximum K I provided as supplementary material.
Jusić, Amela; Balić, Devleta; Avdić, Aldijana; Pođanin, Maja; Balić, Adem
2018-08-01
Aim To investigate association of factor V Leiden, prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms with recurrent pregnancy loss in Bosnian women. Methods A total of 60 women with two or more consecutive miscarriages before 20 weeks of gestation with the same partners and without history of known causes or recurrent pregnancy loss were included. A control group included 80 healthy women who had one or more successful pregnancies without history of any complication which could be associated with miscarriages. Genotyping of factor V Leiden, prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms were performed by polymerase chain reaction/restriction fragments length polymorphism method (PCR/RFLP). Results Both factor V Leiden and MTHFR C677T polymorphisms were significantly associated with recurrent pregnancy loss (RPL) in Bosnian women while prothrombin G20210A and PAI-1 4G/5G polymorphisms did not show strongly significant association. Conclusion The presence of thrombophilic polymorphisms may predispose women to recurrent pregnancy loss. Future investigation should be addressed in order to find when carriers of those mutations, polymorphisms should be treated with anticoagulant therapy. Copyright© by the Medical Assotiation of Zenica-Doboj Canton.
Reliability and fatigue characteristics of a standing hip isometric endurance protocol.
Mutchler, Jessica A; Weinhandl, Joshua T; Hoch, Matthew C; Van Lunen, Bonnie L
2015-08-01
Muscle fatigue is a common consideration when evaluating and rehabilitating athletic injuries. The presence of muscular fatigue has been previously determined by quantifying median frequency (MF) through a power spectral analysis on EMG signals collected throughout an endurance task. Research has not yet determined if a prolonged isometric test in a standing position generates muscular fatigue of the hip. The purpose of this study was to determine the reliability and fatigue characteristics of a standing hip isometric endurance test. Twenty healthy participants completed one 60-s Maximum Voluntary Isometric Contraction of standing hip flexion, extension, adduction, and abduction. MF of the participants' dominant limb rectus femoris (RF), biceps femoris (BF), gluteus maximus (GMax), gluteus medius (GMed) and adductor longus (ADD) was determined via surface electromyography during two sessions, 30-min apart. Reliability values (ICC2,1) were moderate-to-excellent for all time intervals of each action (FlexionRF: >0.80; ExtensionBF: >0.89; ExtensionGMax: >0.60; AdductionADD: >0.78; AbductionGMed: >0.60) and MF significantly decreased over time for all actions. Results suggest the endurance test is a reliable technique to generate muscular fatigue for hip flexion, extension, adduction and abduction. It can be used as a time efficient fatigue protocol specific to the RF, BF, GMax, ADD and GMed. Copyright © 2015 Elsevier Ltd. All rights reserved.
g-factor of the ground state of 73Se
International Nuclear Information System (INIS)
Nishimura, Katsuhiko; Ohya, Susumu; Mutsuro, Naoshi
1987-01-01
Nuclear magnetic resonance on oriented 73 Se in an iron host has been observed at about 7mK. From resonance-shift measurement, the magnetic hyperfine-splitting frequency μ M , g-factor and magnetic hyperfine field were derived as μ M =102.61(3)MH z , |g(9/2 + )|=0.188(16) and B HF ( 73 SeFe)=716(81)kG. The experimental values of the g-factors of the g 9/2 neutron states, in the neighborhood of the neutron number 40, are compared with the theoretical values based on the core-polarization model. (author)
Determination of Cerium (IV) Using Rhodamine 6G Fluorescence Quenching
Zhao, Zh.; Sheng, L.; Su, B.; Tao, C.; Jing, W.
2017-11-01
The interaction between rhodamine 6G (Rh6G) and cerium sulfate was studied by the fluorescence quenching method. In a sulfuric acid medium, the interaction of Ce(IV) with Rh6G results in Rh6G fluorescence quenching. The maximum excitation wavelength (λex) and the maximum emission wavelength (λem) are 530 nm and 555 nm, respectively. A good linearity between the relative fl uorescence intensity (ΔF) and Ce(IV) was observed in the range 0.12-1.08 μg/mL. The detection limit was 1.4 × 10-3 μg/mL. The optimum reaction conditions, influencing factors, and effect of coexisting substances were investigated in the experiment. We found that the concentration of Rh6G was 3.2 × 10-6 mol/L, and the fl uorescence intensity was maximum.
g-Factors of magnetic-rotational states in {sup 85}Zr
Energy Technology Data Exchange (ETDEWEB)
Yuan Daqing; Zheng Yongnan; Zhou Dongmei; Zuo Yi; Fan Ping; Liu Meng; Wu Xiaoguang; Zhu Lihua; Li Guangsheng; Xu Guoji; Fan Qiewen; Zhang Xizhen; Zhu Shengyun, E-mail: zhusy@ciae.ac.cn [China Institute of Atomic Energy (China)
2007-11-15
The g-factors of the magnetic-rotational intra-band states in {sup 85}Zr have been measured by the TMF-IMPAD method for the first time. The configuration {pi} (g{sub 9/2}){sub 8}{sup 2} x {nu} ( f{sub 7/2}) is established for the band. The measured g-factors are in good agreement with those calculated by the semi-classical model. The decrease of both g-factors and shears angles along the band shows that the total angular momentum is generated by the sheras effect of a step-by-step alignment of the valence protons and neutrons. The rapid neutron alignment leads to a decrease of g-factors along the band. The shears angle of the band-head is great than 90{sup o}, which implies that the spin-dependent interaction as well as the residul interaction might be involved in the shears mechanism in {sup 85}Zr.
Stark shift and g-factor tuning in nanowires with Rashba effect
International Nuclear Information System (INIS)
Alhaddad, Iman; Habanjar, Khulud; Sakr, M.R.
2015-01-01
We report on the Stark shift of the energy subbands and the possibility of tuning the g-factor of electrons in nanowires subjected to external magnetic field. The electric field is applied along the direction of quantum confinement. Our analysis is based on numerical and perturbation calculations in the weak Rashba regime. For in-plane magnetic fields, the Stark shift is rigid and depends on the square of the electric field. Such rigid shift results in a field independent g-factor. Perpendicular magnetic fields induce a similar Stark shift accompanied by a lateral displacement of the energy spectra that is linear in the electric field. In this case, the g-factor shows square dependence on weak electric fields that varies with the subband index. However, in strong electric fields, the g-factor becomes subband independent and varies linearly with the field. - Highlights: • Energy spectra of electrons in nanowires are calculated in the weak Rashba regime. • For in-plane magnetic field, the Stark shift is rigid and the g-factor cannot be tuned. • Perpendicular magnetic fields add lateral displacement to the Stark shift. • The g-factor can be tuned by external electric field in this case. • The tuning of the g-factor is linear and unique for all subbands at high fields
Stark shift and g-factor tuning in nanowires with Rashba effect
Energy Technology Data Exchange (ETDEWEB)
Alhaddad, Iman; Habanjar, Khulud [Department of Physics, Faculty of Science, Beirut Arab University, P.O. Box 11, 5020 Riad El Solh, 11072809 - Beirut (Lebanon); Sakr, M.R., E-mail: msakr@alexu.edu.eg [Department of Physics, Faculty of Science, Beirut Arab University, P.O. Box 11, 5020 Riad El Solh, 11072809 - Beirut (Lebanon); Department of Physics, Faculty of Science, Alexandria University, Moharram Bek, Alexandria 21511 (Egypt)
2015-10-15
We report on the Stark shift of the energy subbands and the possibility of tuning the g-factor of electrons in nanowires subjected to external magnetic field. The electric field is applied along the direction of quantum confinement. Our analysis is based on numerical and perturbation calculations in the weak Rashba regime. For in-plane magnetic fields, the Stark shift is rigid and depends on the square of the electric field. Such rigid shift results in a field independent g-factor. Perpendicular magnetic fields induce a similar Stark shift accompanied by a lateral displacement of the energy spectra that is linear in the electric field. In this case, the g-factor shows square dependence on weak electric fields that varies with the subband index. However, in strong electric fields, the g-factor becomes subband independent and varies linearly with the field. - Highlights: • Energy spectra of electrons in nanowires are calculated in the weak Rashba regime. • For in-plane magnetic field, the Stark shift is rigid and the g-factor cannot be tuned. • Perpendicular magnetic fields add lateral displacement to the Stark shift. • The g-factor can be tuned by external electric field in this case. • The tuning of the g-factor is linear and unique for all subbands at high fields.
Estimation of Financial Agent-Based Models with Simulated Maximum Likelihood
Czech Academy of Sciences Publication Activity Database
Kukačka, Jiří; Baruník, Jozef
2017-01-01
Roč. 85, č. 1 (2017), s. 21-45 ISSN 0165-1889 R&D Projects: GA ČR(CZ) GBP402/12/G097 Institutional support: RVO:67985556 Keywords : heterogeneous agent model, * simulated maximum likelihood * switching Subject RIV: AH - Economics OBOR OECD: Finance Impact factor: 1.000, year: 2016 http://library.utia.cas.cz/separaty/2017/E/kukacka-0478481.pdf
Radiation pressure acceleration: The factors limiting maximum attainable ion energy
Energy Technology Data Exchange (ETDEWEB)
Bulanov, S. S.; Esarey, E.; Schroeder, C. B. [Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States); Bulanov, S. V. [KPSI, National Institutes for Quantum and Radiological Science and Technology, Kizugawa, Kyoto 619-0215 (Japan); A. M. Prokhorov Institute of General Physics RAS, Moscow 119991 (Russian Federation); Esirkepov, T. Zh.; Kando, M. [KPSI, National Institutes for Quantum and Radiological Science and Technology, Kizugawa, Kyoto 619-0215 (Japan); Pegoraro, F. [Physics Department, University of Pisa and Istituto Nazionale di Ottica, CNR, Pisa 56127 (Italy); Leemans, W. P. [Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States); Physics Department, University of California, Berkeley, California 94720 (United States)
2016-05-15
Radiation pressure acceleration (RPA) is a highly efficient mechanism of laser-driven ion acceleration, with near complete transfer of the laser energy to the ions in the relativistic regime. However, there is a fundamental limit on the maximum attainable ion energy, which is determined by the group velocity of the laser. The tightly focused laser pulses have group velocities smaller than the vacuum light speed, and, since they offer the high intensity needed for the RPA regime, it is plausible that group velocity effects would manifest themselves in the experiments involving tightly focused pulses and thin foils. However, in this case, finite spot size effects are important, and another limiting factor, the transverse expansion of the target, may dominate over the group velocity effect. As the laser pulse diffracts after passing the focus, the target expands accordingly due to the transverse intensity profile of the laser. Due to this expansion, the areal density of the target decreases, making it transparent for radiation and effectively terminating the acceleration. The off-normal incidence of the laser on the target, due either to the experimental setup, or to the deformation of the target, will also lead to establishing a limit on maximum ion energy.
In beam test of a transient magnetic field based g factor setup
International Nuclear Information System (INIS)
Saxena, Mansi; Mandal, S.; Siwal, Davinder; Kumar, Chandan; Goyal, Savi; Garg, Ritika; Khushboo; Rohilla, Aman; Kumar, Naveen; Kumar, S.; Chamoli, S.; Mandal, A.; Kumar, Rajesh; Barua, P.; Kumar, R.; Gujjar, R.; Bala, Indu; Singh, R.P.; Muralithar, S.; Rehman, Anisur; Roy, Minakshi
2012-01-01
Magnetic moments or g factors provide substantial information on the microscopic structure of the nuclei. Since the g factor is very different in sign and magnitude for neutrons and protons, therefore they can serve as a good indicator as to which nucleon contributes most to the wave function of that state. There are different techniques available for measuring g factors depending on the lifetime of the state involved. Using transient field technique we can measure the g factor of nuclei having a lifetime of the order of several hundreds of femto seconds. To measure the g factor of such low lifetime states we have designed and fabricated a setup based on the Transient Field Technique Measurement
The G-factor in molecular nitrogen, oxygen and air
International Nuclear Information System (INIS)
Mentzoni, M.
1987-06-01
The electron energy relaxation in molecular nitrogen and oxygen is found experimentally using the methods of microwave cross-modulation, transport coeffisients, and flowing afterglows. On the basis of these results the excess electron energy loss factor, the G-factor, has been computed for nitrogen, oxygen and air as a function of electron temperature for various published effective electron collision frequencies. It is shown that the lack of a definitive theory for rotational excitation of O 2 , and very conflicting experimental results for this gas, yield a G-factor in air with a large degree of uncertainty. In spite of this uncertanty it is shown that the formula G = 18.9xT -1.5 , with T being the electron temperature in deg. K, agrees within 15% of the results obtained from swarm data and microwave cross-modulation
Computing the stretch factor and maximum detour of paths, trees, and cycles in the normed space
DEFF Research Database (Denmark)
Wulff-Nilsen, Christian; Grüne, Ansgar; Klein, Rolf
2012-01-01
(n log n) in the algebraic computation tree model and describe a worst-case O(σn log 2 n) time algorithm for computing the stretch factor or maximum detour of a path embedded in the plane with a weighted fixed orientation metric defined by σ time algorithm to d...... time. We also obtain an optimal O(n) time algorithm for computing the maximum detour of a monotone rectilinear path in L 1 plane....
Is G a conversion factor or a fundamental unit?
Fiorentini, G.; Okun, L.; Vysotsky, M.
2001-01-01
By using fundamental units c, h, G as conversion factors one can easily transform the dimensions of all observables. In particular one can make them all ``geometrical'', or dimensionless. However this has no impact on the fact that there are three fundamental units, G being one of them. Only experiment can tell us whether G is basically fundamental.
Gray Matter and Intelligence Factors: Is There a Neuro-g?
Haier, Richard J.; Colom, Roberto; Schroeder, David H.; Condon, Christopher A.; Tang, Cheuk; Eaves, Emily; Head, Kevin
2009-01-01
Heterogeneous results among neuro-imaging studies using psychometric intelligence measures may result from the variety of tests used. The g-factor may provide a common metric across studies. Here we derived a g-factor from a battery of eight cognitive tests completed by 6929 young adults, 40 of whom also completed structural MRI scans. Regional…
Δg: The new aromaticity index based on g-factor calculation applied for polycyclic benzene rings
Ucun, Fatih; Tokatlı, Ahmet
2015-02-01
In this work, the aromaticity of polycyclic benzene rings was evaluated by the calculation of g-factor for a hydrogen placed perpendicularly at geometrical center of related ring plane at a distance of 1.2 Å. The results have compared with the other commonly used aromatic indices, such as HOMA, NICSs, PDI, FLU, MCI, CTED and, generally been found to be in agreement with them. So, it was proposed that the calculation of the average g-factor as Δg could be applied to study the aromaticity of polycyclic benzene rings without any restriction in the number of benzene rings as a new magnetic-based aromaticity index.
Stomatal structure and physiology do not explain differences in water use among montane eucalypts.
Gharun, Mana; Turnbull, Tarryn L; Pfautsch, Sebastian; Adams, Mark A
2015-04-01
Understanding the regulation of water use at the whole-tree scale is critical to advancing the utility of physiological ecology, for example in its role in predictive hydrology of forested catchments. For three eucalypt species that dominate high-elevation catchments in south-eastern Australia, we examined if whole-tree water use could be related to three widely discussed regulators of water use: stomatal anatomy, sensitivity of stomata [i.e. stomatal conductance (g(s))] to environmental influences, and sapwood area. While daily tree water use varied sixfold among species, sap velocity and sapwood area varied in parallel. Combined, stomatal structure and physiology could not explain differences in species-specific water use. Species which exhibited the fastest (Eucalyptus delegatensis) and slowest (Eucalyptus pauciflora) rates of water use both exhibited greater capacity for physiological control of g(s) [indicated by sensitivity to vapour pressure deficit (VPD)] and a reduced capacity to limit g(s) anatomically [indicated by greater potential g(s) (g(max))]. Conversely, g(s) was insensitive to VPD and g(max) was lowest for Eucalyptus radiata, the species showing intermediate rates of water use. Improved knowledge of stomatal anatomy will help us to understand the capacity of species to regulate leaf-level water loss, but seems likely to remain of limited use for explaining rates of whole-tree water use in montane eucalypts at the catchment scale.
Ziebart, Christina; Giangregorio, Lora M; Gibbs, Jenna C; Levine, Iris C; Tung, James; Laing, Andrew C
2017-06-14
A wide variety of accelerometer systems, with differing sensor characteristics, are used to detect impact loading during physical activities. The study examined the effects of system characteristics on measured peak impact loading during a variety of activities by comparing outputs from three separate accelerometer systems, and by assessing the influence of simulated reductions in operating range and sampling rate. Twelve healthy young adults performed seven tasks (vertical jump, box drop, heel drop, and bilateral single leg and lateral jumps) while simultaneously wearing three tri-axial accelerometers including a criterion standard laboratory-grade unit (Endevco 7267A) and two systems primarily used for activity-monitoring (ActiGraph GT3X+, GCDC X6-2mini). Peak acceleration (gmax) was compared across accelerometers, and errors resulting from down-sampling (from 640 to 100Hz) and range-limiting (to ±6g) the criterion standard output were characterized. The Actigraph activity-monitoring accelerometer underestimated gmax by an average of 30.2%; underestimation by the X6-2mini was not significant. Underestimation error was greater for tasks with greater impact magnitudes. gmax was underestimated when the criterion standard signal was down-sampled (by an average of 11%), range limited (by 11%), and by combined down-sampling and range-limiting (by 18%). These effects explained 89% of the variance in gmax error for the Actigraph system. This study illustrates that both the type and intensity of activity should be considered when selecting an accelerometer for characterizing impact events. In addition, caution may be warranted when comparing impact magnitudes from studies that use different accelerometers, and when comparing accelerometer outputs to osteogenic impact thresholds proposed in literature. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.
Purification and some properties of G-factor from the silk gland of silkworm
International Nuclear Information System (INIS)
Taira, Hideharu; Ejiri, Shin-ichiro; Shimura, Kensuke
1972-01-01
Purification of G-factor from the silk gland of silkworms and some of its properties have been studied in comparison with the G-factor from E. coli and rat liver transferase II. In the experiment, GTP-γ- 32 P was prepared from GDP and 32 Pi by photophosphorylation with spinach chloroplasts, and purified by Dowex-1 chromatography. The purified G-factor was homogeneous on disc gel electrophoresis. Molecular weight of 80,000 was estimated from a calibrated Sephadex G-200 column. The purified G-factor exhibited uncoupled ribosome-dependent GTPase activity, and was inhibited by fusidic acid, SH inhibitor, and diphtheria toxin plus NAD. The G-factor from E. coli and that from the silk gland were not interchangeable in GTPase reaction. (Yamanoto, Y.)
Purification and some properties of G-factor from the silk gland of silkworm
Energy Technology Data Exchange (ETDEWEB)
Taira, H; Ejiri, S I; Shimura, K [Tohoku Univ., Sendai (Japan). Faculty of Agriculture
1972-12-01
Purification of G-factor from the silk gland of silkworms and some of its properties have been studied in comparison with the G-factor from E. coli and rat liver transferase II. In the experiment, GTP-..gamma..-/sup 32/P was prepared from GDP and /sup 32/Pi by photophosphorylation with spinach chloroplasts, and purified by Dowex-1 chromatography. The purified G-factor was homogeneous on disc gel electrophoresis. Molecular weight of 80,000 was estimated from a calibrated Sephadex G-200 column. The purified G-factor exhibited uncoupled ribosome-dependent GTPase activity, and was inhibited by fusidic acid, SH inhibitor, and diphtheria toxin plus NAD. The G-factor from E. coli and that from the silk gland were not interchangeable in GTPase reaction.
International Nuclear Information System (INIS)
Vanhaelewyn, G.; Callens, F.; Gruen, R.
2000-01-01
In order to determine the components which give rise to the EPR spectrum around g = 2 we have applied Maximum Likelihood Common Factor Analysis (MLCFA) on the EPR spectra of enamel sample 1126 which has previously been analysed by continuous wave and pulsed EPR as well as EPR microscopy. MLCFA yielded agreeing results on three sets of X-band spectra and the following components were identified: an orthorhombic component attributed to CO - 2 , an axial component CO 3- 3 , as well as four isotropic components, three of which could be attributed to SO - 2 , a tumbling CO - 2 and a central line of a dimethyl radical. The X-band results were confirmed by analysis of Q-band spectra where three additional isotropic lines were found, however, these three components could not be attributed to known radicals. The orthorhombic component was used to establish dose response curves for the assessment of the past radiation dose, D E . The results appear to be more reliable than those based on conventional peak-to-peak EPR intensity measurements or simple Gaussian deconvolution methods
Fan, Zhisong; Li, Yong; Zhao, Qun; Fan, Liqiao; Tan, Bibo; Zuo, Jing; Hua, Kelei; Ji, Qiang
2018-03-23
BACKGROUND Chemotherapy for advanced gastric cancer (GC) patients has been the mainstay of therapy for many years. Although adding anti-angiogenic drugs to chemotherapy improves patient survival slightly, identifying anti-angiogenic therapy-sensitive patients remains challenging for oncologists. Granulocyte colony-stimulating factor (G-CSF) promotes tumor growth and angiogenesis, which can be minimized with the anti-G-CSF antibody. Thus, G-CSF might be a potential tumor marker. However, the effects of G-CSF and G-CSFR expression on GC patient survival remain unclear. MATERIAL AND METHODS Seventy GC tissue samples were collected for G-CSF and G-CSFR detection by immunohistochemistry. A total of 40 paired GC tissues and matched adjacent mucosa were used to measure the G-CSF and G-CSFR levels by ELISA. Correlations between G-CSF/G-CSFR and clinical characteristics, VEGF-A levels and overall survival were analyzed. Biological function and underlying mechanistic investigations were carried out using SGC7901 cell lines, and the effects of G-CSF on tumor proliferation, migration, and tube formation were examined. RESULTS The levels of G-CSFR were upregulated in GC tissues compared to normal mucosa tissues. Higher G-CSF expression was associated with later tumor stages and higher tumor VEGF-A and serum CA724 levels, whereas higher G-CSFR expression was associated with lymph node metastasis. Patients with higher G-CSF expression had shorter overall survival times. In vitro, G-CSF stimulated SGC7901 proliferation and migration through the JAK2/STAT3 pathway and accelerated HUVEC tube formation. CONCLUSIONS These data suggest that increased G-CSF and G-CSFR in tumors leads to unfavorable outcomes for GC patients by stimulating tumor proliferation, migration, and angiogenesis, indicating that these factors are potential tumor targets for cancer treatment.
Energy Technology Data Exchange (ETDEWEB)
Ketterling, R.P.; Vielhaber, E.; Sommer, S.S. (Mayo Clinic/Foundation, Rochester, MN (United States))
1994-05-01
The authors have identified eight independent transversions at CpG in 290 consecutive families with hemophilia B. These eight transversions account for 16.3% of all independent transversions in the sample, yet the expected frequency of CpG transversions at random in the factor IX gene is only 2.6% (P<0.1). The aggregate data suggest that the two types of CpG transversions (G:C[yields]T:A and G:C[yields]C:G) possess similar mutation rates (24.8 [times] 10[sup [minus]10] and 20.6 [times] 10[sup [minus]10], respectively), which are about fivefold greater than the comparable rates for transversions at non-CpG dinucleotides. The enhancement of transversions at CpG suggest that the model by which mutations occur at CpG may need to be reevaluated. The relationship, if any, between deamination of 5-methyl cytosine and enhancement of transversions at CpG remains to be defined. 28 refs., 2 tabs.
International Nuclear Information System (INIS)
Stuchbery, A.E.; Lampard, G.J.; Bolotin, H.H.
1991-01-01
Transient field processions were measured simultaneously for levels in the nuclei 182,184,186 W and 194,196,198 Pt as their ions traversed polarized Gd hosts. These results allow a critical evaluation of conflicting g-factor values reported previously for the even Pt isotopes. Mass variations of g(2 1 + ) in the even W, Os, Pt nuclei are examined using the proton-neutron interacting boson model (IBM-2). The measured g-factors depart from the simplest IBM-2 description perhaps due to subshell effects and/or small contributions from non-collective configurations which cause the neutron-boson g-factor to vary with mass. 46 refs., 5 tabs., 7 figs
The Issue of Power in the Identification of "g" with Lower-Order Factors
Matzke, Dora; Dolan, Conor V.; Molenaar, Dylan
2010-01-01
In higher order factor models, general intelligence (g) is often found to correlate perfectly with lower-order common factors, suggesting that g and some well-defined cognitive ability, such as working memory, may be identical. However, the results of studies that addressed the equivalence of g and lower-order factors are inconsistent. We suggest…
The g-factor of the K=25 isomer in sup 182 Os
Energy Technology Data Exchange (ETDEWEB)
Alderson, A.; Fallon, P.; Goldring, G.; Roberts, J.; Sharpey-Schafer, J.; Twin P. (Liverpool Univ. (UK). Oliver Lodge Lab.); Bentley, M.; Bruce, A. (Science and Engineering Research Council, Daresbury (UK). Daresbury Lab.); Broude, C. (Weizmann Inst. of Science, Rehovoth (Israel). Dept. of Nuclear Physics); Dafni, E. (Rochester Univ., NY (USA). Nuclear Structure Research Lab.); Hass, M. (Argonne National Lab. (USA)); Nyberg, J.; Sletten, G. (Niels Bohr Inst., Roskilde (Denmark))
1989-09-28
The g-factor of the K=I=25 isomer in {sup 182}Os has been measured by observing the angular precession of the decay {gamma}-ray angular distribution in an external magnetic field as g=+0.425(8). This result is compared with predictions based on experimental g-factors of single-particle Nilsson orbitals in this mass region. (orig.).
The g-factor of the bound electron in hydrogenic ions
International Nuclear Information System (INIS)
Quint, Wolfgang
2001-01-01
We report on the measurement of the g-factor of the electron bound in an atomic ion. A single hydrogenic ion ( 12 C 5+ ) is stored in a Penning trap. The electronic spin state of the ion is monitored via the continuous Stern-Gerlach effect in a quantum non-demolition measurement. Quantum jumps between the two spin states (spin up and spin down) are induced by a microwave field at the spin precession frequency of the bound electron. The g-factor of the bound electron is obtained by varying the microwave frequency and counting the number of spin flips for a fixed time interval. Applications of the continuous Stern-Gerlach effect include high-accuracy tests of bound-state quantum electrodynamics (QED), the measurement of the atomic mass of the electron, the determination of the fine structure constant α, and the measurement of nuclear g-factors
Computing the Maximum Detour of a Plane Graph in Subquadratic Time
DEFF Research Database (Denmark)
Wulff-Nilsen, Christian
2008-01-01
Let G be a plane graph where each edge is a line segment. We consider the problem of computing the maximum detour of G, defined as the maximum over all pairs of distinct points p and q of G of the ratio between the distance between p and q in G and the distance |pq|. The fastest known algorithm...
Computing the Maximum Detour of a Plane Graph in Subquadratic Time
DEFF Research Database (Denmark)
Wulff-Nilsen, Christian
Let G be a plane graph where each edge is a line segment. We consider the problem of computing the maximum detour of G, defined as the maximum over all pairs of distinct points p and q of G of the ratio between the distance between p and q in G and the distance |pq|. The fastest known algorithm f...... for this problem has O(n^2) running time. We show how to obtain O(n^{3/2}*(log n)^3) expected running time. We also show that if G has bounded treewidth, its maximum detour can be computed in O(n*(log n)^3) expected time....
Probing the N = 14 subshell closure: g factor of the 26Mg (21+) state
McCormick, B. P.; Stuchbery, A. E.; Kibédi, T.; Lane, G. J.; Reed, M. W.; Eriksen, T. K.; Hota, S. S.; Lee, B. Q.; Palalani, N.
2018-04-01
The first-excited state g factor of 26Mg has been measured relative to the g factor of the 24Mg (21+) state using the high-velocity transient-field technique, giving g = + 0.86 ± 0.10. This new measurement is in strong disagreement with the currently adopted value, but in agreement with the sd-shell model using the USDB interaction. The newly measured g factor, along with E (21+) and B (E 2) systematics, signal the closure of the νd5/2 subshell at N = 14. The possibility that precise g-factor measurements may indicate the onset of neutron pf admixtures in first-excited state even-even magnesium isotopes below 32Mg is discussed and the importance of precise excited-state g-factor measurements on sd shell nuclei with N ≠ Z to test shell-model wavefunctions is noted.
Electrically Tunable g Factors in Quantum Dot Molecular Spin States
Doty, M. F.; Scheibner, M.; Ponomarev, I. V.; Stinaff, E. A.; Bracker, A. S.; Korenev, V. L.; Reinecke, T. L.; Gammon, D.
2006-11-01
We present a magnetophotoluminescence study of individual vertically stacked InAs/GaAs quantum dot pairs separated by thin tunnel barriers. As an applied electric field tunes the relative energies of the two dots, we observe a strong resonant increase or decrease in the g factors of different spin states that have molecular wave functions distributed over both quantum dots. We propose a phenomenological model for the change in g factor based on resonant changes in the amplitude of the wave function in the barrier due to the formation of bonding and antibonding orbitals.
Energy Technology Data Exchange (ETDEWEB)
Setyawan, Daddy, E-mail: d.setyawan@bapeten.go.id [Center for Assessment of Regulatory System and Technology for Nuclear Installations and Materials, Indonesian Nuclear Energy Regulatory Agency (BAPETEN), Jl. Gajah Mada No. 8 Jakarta 10120 (Indonesia); Rohman, Budi [Licensing Directorate for Nuclear Installations and Materials, Indonesian Nuclear Energy Regulatory Agency (BAPETEN), Jl. Gajah Mada No. 8 Jakarta 10120 (Indonesia)
2014-09-30
Verification of Maximum Radial Power Peaking Factor due to insertion of FPM-LEU target in the core of RSG-GAS Reactor. Radial Power Peaking Factor in RSG-GAS Reactor is a very important parameter for the safety of RSG-GAS reactor during operation. Data of radial power peaking factor due to the insertion of Fission Product Molybdenum with Low Enriched Uranium (FPM-LEU) was reported by PRSG to BAPETEN through the Safety Analysis Report RSG-GAS for FPM-LEU target irradiation. In order to support the evaluation of the Safety Analysis Report incorporated in the submission, the assessment unit of BAPETEN is carrying out independent assessment in order to verify safety related parameters in the SAR including neutronic aspect. The work includes verification to the maximum radial power peaking factor change due to the insertion of FPM-LEU target in RSG-GAS Reactor by computational method using MCNP5and ORIGEN2. From the results of calculations, the new maximum value of the radial power peaking factor due to the insertion of FPM-LEU target is 1.27. The results of calculations in this study showed a smaller value than 1.4 the limit allowed in the SAR.
g-factor of the 7/2+ isomeric bandhead in 175 W
International Nuclear Information System (INIS)
Ionescu-Bujor, M.; Iordachescu, A.; Marginean, N.; Brandolini, F.; Pavan, P.; Lenzi, S.M.; De Poli, M.; Gadea, A.; Martinez, T.; Medina, N.H.; Ribas, R.V.; Podolyak, Zs.
2000-01-01
Considerable effort is presently devoted to the investigation of the high-K isomers of multi-quasiparticle intrinsic structure systematically found in the deformed nuclei with Z=72-76 of the A ≅ 180 mass region. The configuration assignments for these isomers are based on measured static moments, as well as, on experimental branching ratios in the associated bands, from which (g K - g R )/Q 0 are derived. In the multi-quasiparticle state g-factor calculations, values taken from neighbouring odd-mass nuclei are generally used for the proton and neutron deformed single-particle g-factors. A good knowledge of these quantities is required for reliable high-K state g-factor evaluations. In the present work we report on the g-factor measurement for the low-lying J π = 7/2 + isomer bandhead in 175 W described by the neutron 7/2 + [633] Nilsson orbital. The isomeric state was populated in the 164 Dy( 16 O,5n) 175 W reaction using the 83 MeV pulsed 16 O beam (pulse width 1.5 ns, repetition period 800 ns) delivered by the LNL XTU-Tandem. The target consisted of 0.5 mg/cm 2 metallic 164 Dy on thick Pb backing which stopped the recoiling 175 W nuclei and the 16 O beam. The target was placed in an external magnetic field of 27.2(6) kG whose direction was periodically reversed. The 7/2 + isomeric state with T 1/2 = 216(6) ns and E x =234.9 keV de-excites by a dipole transition of 130.9 keV to the 5/2 - level. The angular distribution of the 130.9 keV gamma-ray has been observed time-differentially by using two planar Ge detectors placed at ± 135 angle with respect to the beam direction. The background corrected time spectra I(t,θ) obtained for the magnetic field direction up and down were used to form the experimental modulation ratio R exp (t)=[I↑(t,θ) - I ↓ (t,θ)]/[I↑(t,θ) + I ↓ (t,θ)]. The modulation pattern revealed Larmor oscillations with an amplitude strongly attenuated in time. The observed damping of the anisotropy has been attributed to quadrupole
Directory of Open Access Journals (Sweden)
Larissa Rodrigues Fabris
2010-09-01
Full Text Available The sanitary quality of 26 lots commercial seeds of tropical forages, produced in different regions (2004-05 and 2005-06 was analyzed. The lots were composed of seeds of Panicum maximum ('Massai', 'Mombaça' e 'Tanzânia' and stylo ('Estilosantes Campo Grande' - ECG. Additionally, seeds of two lots of P. maximum for exportation were analyzed. The blotter test was used, at 20ºC under alternating light and darkness in a 12 h photoperiod, for seven days. The Aspergillus, Cladosporium and Rhizopus genus consisted the secondary or saprophytes fungi (FSS with greatest frequency in P. maximum lots. In general, there was low incidence of these fungus in the seeds. In relation to pathogenic fungi (FP, it was detected high frequency of contaminated lots by Bipolaris, Curvularia, Fusarium and Phoma genus. Generally, there was high incidence of FP in P. maximum seeds. The occurrence of Phoma sp. was hight, because in 81% of the lots showed incidence superior to 50%. In 'ECG' seeds it was detected FSS (Aspergillus, Cladosporium, and Penicillium genus and FP (Bipolaris, Curvularia, Fusarium and Phoma genus, usually, in low incidence. FSS and FP were associated to P. maximum seeds for exportation, with significant incidence in some cases. The results indicated that there was a limiting factor in all producer regions regarding sanitary quality of the seeds.Sementes comerciais de forrageiras tropicais, pertencente a 26 lotes produzidos em diferentes regiões (safras 2004-05 e 2005-06, foram avaliadas quanto à sanidade. Foram analisadas sementes de cultivares de Panicum maximum (Massai, Mombaça e Tanzânia e de estilosantes (Estilosantes Campo Grande – ECG. Adicionalmente, avaliou-se a qualidade sanitária de dois lotes de sementes de P. maximum destinados à exportação. Para isso, as sementes foram submetidas ao teste de papel de filtro em gerbox, os quais foram incubados a 20ºC, com fotoperíodo de 12 h, durante sete dias. Os fungos saprófitos ou
Liu, Jianzhong; Kern, Petra S.; Gerberick, G. Frank; Santos-Filho, Osvaldo A.; Esposito, Emilio X.; Hopfinger, Anton J.; Tseng, Yufeng J.
2008-06-01
In previous studies we have developed categorical QSAR models for predicting skin-sensitization potency based on 4D-fingerprint (4D-FP) descriptors and in vivo murine local lymph node assay (LLNA) measures. Only 4D-FP derived from the ground state (GMAX) structures of the molecules were used to build the QSAR models. In this study we have generated 4D-FP descriptors from the first excited state (EMAX) structures of the molecules. The GMAX, EMAX and the combined ground and excited state 4D-FP descriptors (GEMAX) were employed in building categorical QSAR models. Logistic regression (LR) and partial least square coupled logistic regression (PLS-CLR), found to be effective model building for the LLNA skin-sensitization measures in our previous studies, were used again in this study. This also permitted comparison of the prior ground state models to those involving first excited state 4D-FP descriptors. Three types of categorical QSAR models were constructed for each of the GMAX, EMAX and GEMAX datasets: a binary model (2-state), an ordinal model (3-state) and a binary-binary model (two-2-state). No significant differences exist among the LR 2-state model constructed for each of the three datasets. However, the PLS-CLR 3-state and 2-state models based on the EMAX and GEMAX datasets have higher predictivity than those constructed using only the GMAX dataset. These EMAX and GMAX categorical models are also more significant and predictive than corresponding models built in our previous QSAR studies of LLNA skin-sensitization measures.
Lifetime and g-factor measurements in 44Sc
International Nuclear Information System (INIS)
Chevallier, A.; Chavallier, J.; Gross, J.L.; Haas, B.; Schulz, N.; Styczen, J.; Toulemonde, M.
1975-01-01
The lifetimes of the 235 keV, 2 - state and 350 keV, 4 + state in 44 Sc have been measured via the 44 Ca(p, n) 44 Sc reaction with a pulsed proton beam. The time integral perturbed angular distribution technique with an external field was used to measure the precession angles of the 2 - and 4 + states populated by the 30 Si( 16 O, pnγ) 44 Sc reaction. The following values for the mean-lives and g-factors were obtained: π(2 - ) = 8.83(33) ns, g(2 - ) = 0.30(13) and π(4 + ) = 4.52(27)ns, g(4 + ) = 0.90(12). The results for the 2 - state support a rotational description of the negative parity states in 44 Sc. The magnetic moment of the 4 + state is compared to shell model predictions. (orig.) [de
Directory of Open Access Journals (Sweden)
Emel Okulu
2011-09-01
Full Text Available Objective: To increase our understanding of the etiology of idiopathic thrombocytopenic purpura (ITP some cytokine gene polymorphisms were analyzed for susceptibility to the disease. The aim of this study was to investigate the role of tumor necrosis factor-alpha (TNF-α -308 G/A and transforming growth factor-beta 1 (TGF-β1 –915 G/C polymorphisms in the development and clinical progression of childhood ITP.Materials and Methods: In all, 50 pediatric patients with ITP (25 with acute ITP and 25 with chronic ITP and 48 healthy controls were investigated via LightCycler® PCR analysis for TNF-α -308 G/A and TGF-β1 -915 G/C polymorphisms.Results: The frequency of TNF-α -308 G/A polymorphism was 20%, 16%, and 22.9% in the acute ITP patients, chronic ITP patients, and controls, respectively (p>0.05. The frequency of TGF-β1 -915 G/C polymorphism was 16%, 8%, and 8.3% in the acute ITP patients, chronic ITP patients, and controls, respectively (p>0.05. The risk of developing ITP and clinical progression were not associated with TNF-α -308 G/A (OR: 0.738, 95% CI: 0.275-1.981, and OR: 0.762, 95% CI: 0.179-3.249 or TGF-β1 -915 G/C (OR: 1.5, 95% CI: 0.396-5.685, and OR: 0.457, 95% CI: 0.076-2.755 polymorphisms. Conclusion: The frequency of TNF-α -308 G/A and TGF-β1 -915 G/C polymorphisms did not differ between pediatric ITP patients and healthy controls, and these polymorphisms were not associated with susceptibility to the development and clinical progression of the disease.
Studies of the g factors and the superhyperfine parameters for Ni3+ ...
Indian Academy of Sciences (India)
the g factors and the hyperfine structure constants of central metal ions. How- .... and extended X-ray absorption fine structure (EXAFS) measurements have ver- ified that the ..... [9] S R Zhang, H G Liu, G Q Qu and W C Zheng, Phys. Stat.
Autism-specific covariation in perceptual performances: "g" or "p" factor?
Meilleur, Andrée-Anne S; Berthiaume, Claude; Bertone, Armando; Mottron, Laurent
2014-01-01
Autistic perception is characterized by atypical and sometimes exceptional performance in several low- (e.g., discrimination) and mid-level (e.g., pattern matching) tasks in both visual and auditory domains. A factor that specifically affects perceptive abilities in autistic individuals should manifest as an autism-specific association between perceptual tasks. The first purpose of this study was to explore how perceptual performances are associated within or across processing levels and/or modalities. The second purpose was to determine if general intelligence, the major factor that accounts for covariation in task performances in non-autistic individuals, equally controls perceptual abilities in autistic individuals. We asked 46 autistic individuals and 46 typically developing controls to perform four tasks measuring low- or mid-level visual or auditory processing. Intelligence was measured with the Wechsler's Intelligence Scale (FSIQ) and Raven Progressive Matrices (RPM). We conducted linear regression models to compare task performances between groups and patterns of covariation between tasks. The addition of either Wechsler's FSIQ or RPM in the regression models controlled for the effects of intelligence. In typically developing individuals, most perceptual tasks were associated with intelligence measured either by RPM or Wechsler FSIQ. The residual covariation between unimodal tasks, i.e. covariation not explained by intelligence, could be explained by a modality-specific factor. In the autistic group, residual covariation revealed the presence of a plurimodal factor specific to autism. Autistic individuals show exceptional performance in some perceptual tasks. Here, we demonstrate the existence of specific, plurimodal covariation that does not dependent on general intelligence (or "g" factor). Instead, this residual covariation is accounted for by a common perceptual process (or "p" factor), which may drive perceptual abilities differently in autistic and
Autism-specific covariation in perceptual performances: "g" or "p" factor?
Directory of Open Access Journals (Sweden)
Andrée-Anne S Meilleur
Full Text Available Autistic perception is characterized by atypical and sometimes exceptional performance in several low- (e.g., discrimination and mid-level (e.g., pattern matching tasks in both visual and auditory domains. A factor that specifically affects perceptive abilities in autistic individuals should manifest as an autism-specific association between perceptual tasks. The first purpose of this study was to explore how perceptual performances are associated within or across processing levels and/or modalities. The second purpose was to determine if general intelligence, the major factor that accounts for covariation in task performances in non-autistic individuals, equally controls perceptual abilities in autistic individuals.We asked 46 autistic individuals and 46 typically developing controls to perform four tasks measuring low- or mid-level visual or auditory processing. Intelligence was measured with the Wechsler's Intelligence Scale (FSIQ and Raven Progressive Matrices (RPM. We conducted linear regression models to compare task performances between groups and patterns of covariation between tasks. The addition of either Wechsler's FSIQ or RPM in the regression models controlled for the effects of intelligence.In typically developing individuals, most perceptual tasks were associated with intelligence measured either by RPM or Wechsler FSIQ. The residual covariation between unimodal tasks, i.e. covariation not explained by intelligence, could be explained by a modality-specific factor. In the autistic group, residual covariation revealed the presence of a plurimodal factor specific to autism.Autistic individuals show exceptional performance in some perceptual tasks. Here, we demonstrate the existence of specific, plurimodal covariation that does not dependent on general intelligence (or "g" factor. Instead, this residual covariation is accounted for by a common perceptual process (or "p" factor, which may drive perceptual abilities differently in
Experimental study on the determination of small strain-shear modulus of loess soil
Directory of Open Access Journals (Sweden)
Mona El Mosallamy
2016-08-01
Test results also show that (Gmax increases with the increase of confining pressure and relative density. The change in damping properties is not significant under the effect of silt content and water content, and it reduces slightly with the increase of confining pressure and relative density. Empirical equations based on the results of the experimental work were proposed to predict (Gmax with respect to (Cp, voids ratio and applied pressure.
Systematics of first 2+ state g factors around mass 80
International Nuclear Information System (INIS)
Mertzimekis, T.J.; Stuchbery, A.E.; Benczer-Koller, N.; Taylor, M.J.
2003-01-01
The systematics of the first 2 + state g factors in the mass 80 region are investigated in terms of an IBM-II analysis, a pairing-corrected geometrical model, and a shell-model approach. Subshell closure effects at N=38 and overall trends were examined using IBM-II. A large-space shell-model calculation was successful in describing the behavior for N=48 and N=50 nuclei, where single-particle features are prominent. A schematic truncated-space calculation was applied to the lighter isotopes. The variations of the effective boson g factors are discussed in connection with the role of F-spin breaking, and comparisons are made between the mass 80 and mass 180 regions
Influence of maximum bite force on jaw movement during gummy jelly mastication.
Kuninori, T; Tomonari, H; Uehara, S; Kitashima, F; Yagi, T; Miyawaki, S
2014-05-01
It is known that maximum bite force has various influences on chewing function; however, there have not been studies in which the relationships between maximum bite force and masticatory jaw movement have been clarified. The aim of this study was to investigate the effect of maximum bite force on masticatory jaw movement in subjects with normal occlusion. Thirty young adults (22 men and 8 women; mean age, 22.6 years) with good occlusion were divided into two groups based on whether they had a relatively high or low maximum bite force according to the median. The maximum bite force was determined according to the Dental Prescale System using pressure-sensitive sheets. Jaw movement during mastication of hard gummy jelly (each 5.5 g) on the preferred chewing side was recorded using a six degrees of freedom jaw movement recording system. The motion of the lower incisal point of the mandible was computed, and the mean values of 10 cycles (cycles 2-11) were calculated. A masticatory performance test was conducted using gummy jelly. Subjects with a lower maximum bite force showed increased maximum lateral amplitude, closing distance, width and closing angle; wider masticatory jaw movement; and significantly lower masticatory performance. However, no differences in the maximum vertical or maximum anteroposterior amplitudes were observed between the groups. Although other factors, such as individual morphology, may influence masticatory jaw movement, our results suggest that subjects with a lower maximum bite force show increased lateral jaw motion during mastication. © 2014 John Wiley & Sons Ltd.
A direct measurement of g-factors in II-VI and III-V core-shell nanocrystals
Fradkin, L.; Langof, L.; Lifshitz, E.; Gaponik, N.; Rogach, A.; Eychmüller, A.; Weller, H.; Micic, O. I.; Nozik, A. J.
2005-02-01
This study describes a direct measurement of spectroscopic g-factors of photo-generated carriers in InP/ZnS and HgTe/Hg xCd 1-xTe(S) core-shell nanocrystals. The g-factor of trapped electrons and their spin-lattice versus radiative relaxation ratio ( T1/ τ) were measured by the use of continuous-wave and time-resolved optically detected magnetic resonance (ODMR) spectroscopy. The g-factors of excitons and donor-hole pairs were derived by the use of field-induced circular-polarized photoluminescence (CP-PL) spectroscopy. The combined information enabled to determine the g-factors of the individual band-edge electrons and holes. The results suggested an increase of the g-factor of the exciton and conduction electron with a decrease of the nanocrystal size.
Tutte sets in graphs II: The complexity of finding maximum Tutte sets
Bauer, D.; Broersma, Haitze J.; Kahl, N.; Morgana, A.; Schmeichel, E.; Surowiec, T.
2007-01-01
A well-known formula of Tutte and Berge expresses the size of a maximum matching in a graph $G$ in terms of what is usually called the deficiency. A subset $X$ of $V(G)$ for which this deficiency is attained is called a Tutte set of $G$. While much is known about maximum matchings, less is known
Stationary neutrino radiation transport by maximum entropy closure
International Nuclear Information System (INIS)
Bludman, S.A.
1994-11-01
The authors obtain the angular distributions that maximize the entropy functional for Maxwell-Boltzmann (classical), Bose-Einstein, and Fermi-Dirac radiation. In the low and high occupancy limits, the maximum entropy closure is bounded by previously known variable Eddington factors that depend only on the flux. For intermediate occupancy, the maximum entropy closure depends on both the occupation density and the flux. The Fermi-Dirac maximum entropy variable Eddington factor shows a scale invariance, which leads to a simple, exact analytic closure for fermions. This two-dimensional variable Eddington factor gives results that agree well with exact (Monte Carlo) neutrino transport calculations out of a collapse residue during early phases of hydrostatic neutron star formation
Pushing the limits of excited-state g-factor measurements
Stuchbery, Andrew E.; McCormick, Brendan P.; Gray, Timothy J.; Coombes, Ben J.
2018-05-01
Current developments in excited-state g-factor measurements are discussed with an emphasis on cases where the experimental methodology is being extended into new regimes. The transient-field technique, the recoil in vacuum method, and moment measurements with LaBr3 detectors are discussed.
In-plane g factor of low-density two-dimensional holes in a Ge quantum well.
Energy Technology Data Exchange (ETDEWEB)
Lu, Tzu-Ming [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Harris, Charles Thomas [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Huang, Shih-Hsien [National Taiwan Univ., Taipei (Taiwan); Chuang, Yen [National Taiwan Univ., Taipei (Taiwan); Li, Jiun-Yun [National Taiwan Univ., Taipei (Taiwan); Liu, CheeWee [National Taiwan Univ., Taipei (Taiwan)
2017-12-01
High-mobility two-dimensional (2D) holes residing in a Ge quantum well are a new electronic system with potentials in quantum computing and spintronics. Since for any electronic material, the effective mass and the g factor are two fundamental material parameters that determine the material response to electric and magnetic fields, measuring these two parameters in this material system is thus an important task that needs to be completed urgently. Because of the quantum confinement in the crystal growth direction (z), the biaxial strain of epitaxial Ge on SiGe, and the valance band nature, both the effective mass and the g factor can show very strong anisotropy. In particular, the in-plane g factor (gip) can be vanishingly small while the perpendicular g factor (gz) can be much larger than 2. Here we report the measurement of gip at very low hole densities using in-plane magneto-resistance measurement performed at the NHMFL.
Nuclear-polarization correction to the bound-electron g factor in heavy hydrogenlike ions
Nefiodov, A. V.; Plunien, G.; Soff, G.
2002-01-01
The influence of nuclear polarization on the bound-electron $g$ factor in heavy hydrogenlike ions is investigated. Numerical calculations are performed for the K- and L-shell electrons taking into account the dominant virtual nuclear excitations. This determines the ultimate limit for tests of QED utilizing measurements of the bound-electron $g$ factor in highly charged ions.
Nuclear-polarization correction to the bound-electron g factor in heavy hydrogenlike ions.
Nefiodov, A V; Plunien, G; Soff, G
2002-08-19
The influence of nuclear polarization on the bound-electron g factor in heavy hydrogenlike ions is investigated. Numerical calculations are performed for the K- and L-shell electrons taking into account the dominant virtual nuclear excitations. This determines the ultimate limit for tests of QED utilizing measurements of the bound-electron g factor in highly charged ions.
g-factor of the 9/2+ isomeric state in 65Ni from transfer reaction
International Nuclear Information System (INIS)
Georgiev, G.; Matea, I.; Balabanski, D.L.; Daugas, J.M.; Meot, V.; Morel, P.; Oliveira Santos, F. de; Lewitowicz, M.; Franchoo, S.; Ibrahim, F.; Le Blanc, F.; Sorlin, O.; Stanoiu, M.; Verney, D.; Lo Bianco, G.; Saltarelli, A.; Lukyanov, S.; Penionzhkevich, Yu.E.; Neyens, G.; Vermeulen, N.; Yordanov, D.; Tarisien, M.
2006-01-01
We report a measurement of the g-factor of the I π =9/2 + , t 1/2 =22 ns isomer in 65 Ni. The state of interest was populated and spin-oriented using a single-neutron transfer on an enriched 64 Ni target. The value, which was obtained, g(9/2 + , 65m Ni)=-0.296(3) is well in agreement with the g-factors of the other 9/2 + states in the region and with large-basis shell model calculations. The known g-factor of the 9/2 + isomer in 63 Ni was used in order to verify the strength of the hyperfine field of Ni(Ni) at room temperature. (orig.)
Hagino, K.; Balantekin, A. B.; Lwin, N. W.; Thein, Ei Shwe Zin
2018-03-01
The hindrance phenomenon of heavy-ion fusion cross sections at deep subbarrier energies often accompanies a maximum of an astrophysical S factor at a threshold energy for fusion hindrance. We argue that this phenomenon can naturally be explained when the fusion excitation function is fitted with two potentials, with a larger (smaller) logarithmic slope at energies lower (higher) than the threshold energy. This analysis clearly suggests that the astrophysical S factor provides a convenient tool to analyze the deep subbarrier hindrance phenomenon, even though the S factor may have a strong energy dependence for heavy-ion systems unlike that for astrophysical reactions.
Yaroglu Kazanci, Selcen; Yesilbas, Osman; Ersoy, Melike; Kihtir, Hasan Serdar; Yildirim, Hamdi Murat; Sevketoglu, Esra
2015-09-01
Cerebral infarction is one of the serious neurological complications of diabetic ketoacidosis (DKA). Especially in patients who are genetically prone to thrombosis, cerebral infarction may develop due to inflammation, dehydration, and hyperviscocity secondary to DKA. A 6-year-old child with DKA is diagnosed with cerebral infarction after respiratory insufficiency, convulsion, and altered level of consciousness. Femoral and external iliac venous thrombosis also developed in a few hours after central femoral catheter had been inserted. Heterozygous type of factor V Leiden and PAI-14G/5G mutation were detected. In patients with DKA, cerebral infarction may be suspected other than cerebral edema when altered level of consciousness, convulsion, and respiratory insufficiency develop and once cerebral infarction occurs the patients should also be evaluated for factor V Leiden and PAI-14G/5G mutation analysis in addition to the other prothrombotic risk factors.
New radioimmunoassay for IgM and IgG rheumatoid factors, based on a double antibody method
Energy Technology Data Exchange (ETDEWEB)
Nordfang, O. (Rigshospitalet, Copenhagen (Denmark)); Hoeier-Madsen, M.; Lieberkind, J. (Statens Seruminstitut, Copenhagen (Denmark)); Halberg, P. (Medical Department, Division of Rheumatology, Hvidovre Hospital, Hvidovre, Denmark)
1981-11-30
A new radioimmunoassay has been developed for measuring IgM and IgG rheumatoid factors. Diluted sera from donors and patients were incubated with immunoprecipitates prepared from sheep serum and rabbit anti-sheep IgG antiserum. The precipitates were washed, and radioiodinated rabbit F(ab')/sub 2/ fragments specific for human IgM or IgG were added. The precipitates were isolated by filtration and measured in a gamma counter. With this assay IgM rheumatoid factors were detected in sera from all patients with seropositive rheumatoid arthritis and in sera from 40% of patients with seronegative rheumatoid arthritis. IgG rheumatoid factors were found in sera from 68% of the seropositive and 40% of the seronegative patients. Gel filtration experiments demonstrated that it is possible to detect monomeric IgG rheumatoid factors and IgM rheumatoid factors of molecular weight smaller than pentameric IgM. Furthermore it has been shown that IgG rheumatoid factor activity is still present after reduction of IgM rheumatoid factors with dithiotreitol.
Kato, Maki; Shimodaira, Yoshie; Sato, Takeshi; Iida, Hiromi
2014-01-01
Protecting children from injuries caused by fall accidents from playground equipment is important. Therefore, measures toward minimizing the risk of fall accident injuries are required. The risk of injury can be evaluated using ASTM F1292. In this test, G-max and the HIC are used to estimate the risk of injury. However, the measurement procedure is too complicated for application to a large number of installed equipment. F1292 requires simplified by reducing the number of phases, even with a small risk of loss in accuracy. With this in mind, this study proposes a shortened measurement procedure and a transformation equation to estimate the risk as same as F1292. As the result of experiments, it was revealed that G-max and the HIC values for both procedures linearly increase with drop height. The differences in outcomes between the regression equations of the standardized procedure and those of the shortened procedure can be used as a correction value. They can be added to the value measured by the shortened procedure. This suggests that the combination of the shortened procedure and transformation equation would be equivalent to F1292, with the advantage of being more easily and efficiently applied to the evaluation of installed playground equipment.
A maximum power point tracking for photovoltaic-SPE system using a maximum current controller
Energy Technology Data Exchange (ETDEWEB)
Muhida, Riza [Osaka Univ., Dept. of Physical Science, Toyonaka, Osaka (Japan); Osaka Univ., Dept. of Electrical Engineering, Suita, Osaka (Japan); Park, Minwon; Dakkak, Mohammed; Matsuura, Kenji [Osaka Univ., Dept. of Electrical Engineering, Suita, Osaka (Japan); Tsuyoshi, Akira; Michira, Masakazu [Kobe City College of Technology, Nishi-ku, Kobe (Japan)
2003-02-01
Processes to produce hydrogen from solar photovoltaic (PV)-powered water electrolysis using solid polymer electrolysis (SPE) are reported. An alternative control of maximum power point tracking (MPPT) in the PV-SPE system based on the maximum current searching methods has been designed and implemented. Based on the characteristics of voltage-current and theoretical analysis of SPE, it can be shown that the tracking of the maximum current output of DC-DC converter in SPE side will track the MPPT of photovoltaic panel simultaneously. This method uses a proportional integrator controller to control the duty factor of DC-DC converter with pulse-width modulator (PWM). The MPPT performance and hydrogen production performance of this method have been evaluated and discussed based on the results of the experiment. (Author)
Risk Factors for Invasive Candidiasis in Infants >1500 g Birth Weight
Lee, Jan Hau; Hornik, Christoph P.; Benjamin, Daniel K.; Herring, Amy H.; Clark, Reese H.; Cohen-Wolkowiez, Michael; Smith, P. Brian
2012-01-01
Background We describe the incidence, risk factors, and outcomes of invasive candidiasis in infants >1500 g birth weight. Methods We conducted a retrospective cohort study of infants >1500 g birth weight discharged from 305 NICUs in the Pediatrix Medical Group from 2001–2010. Using multivariable logistic regression, we identified risk factors for invasive candidiasis. Results Invasive candidiasis occurred in 330/530,162 (0.06%) infants. These were documented from positive cultures from ≥1 of these sources: blood (n=323), cerebrospinal fluid (n=6), or urine from catheterization (n=19). Risk factors included day of life >7 (OR 25.2; 95% CI 14.6–43.3), vaginal birth (OR 1.6 [1.2–2.3]), exposure to broad-spectrum antibiotics (OR 1.6 [1.1–2.4]), central venous line (OR 1.8 [1.3–2.6]), and platelet count candidiasis had increased mortality (OR 2.2 [1.3–3.6]). Conclusions Invasive candidiasis is uncommon in infants >1500 g birth weight. Infants at greatest risk are those exposed to broad-spectrum antibiotics and with platelet counts of <50,000/mm3. PMID:23042050
Ryan, E.; Ogle, K.; Peltier, D.; Williams, D. G.; Pendall, E.
2014-12-01
The goal of this study was to quantify interannual variation of gross primary production (GPP) and evaluate potential drivers of GPP with global change using the Prairie Heating and CO2 Enrichment (PHACE) experiment in semiarid grassland in southeastern Wyoming. PHACE consists of the treatments: control, warming only, elevated CO2 (eCO2) only, eCO2 and warming, and irrigation only. We expected that GPP would be most strongly influenced by interannual variability in precipitation under all PHACE treatments, soil water availability under eCO2, and nitrogen availability. GPP data were obtained from paired measurements of net ecosystem exchange (NEE) and ecosystem respiration (Reco; GPP = Reco - NEE) made on 2-4 week intervals over six growing seasons (2007-2012). Soil temperature (T), soil water content (SWC), vapor pressure deficit (VPD), and photosynthetically active radiation (PAR) were continuously recorded at the plot (T, SWC) and site (VPD, PAR) scales. Annual, plot-level aboveground plant nitrogen content (N) was measured during peak biomass. We fit a non-linear light-response model to the GPP data within a Bayesian framework, and modeled the maximum GPP rate (Gmax) and canopy light-use efficiency (Q) as functions of N and current and antecedent SWC, T, and VPD. The model fit the GPP data well (R2 = 0.64), and regardless of the PHACE treatment the most important drivers of GPP were N (for Gmax), VPD (Gmax and Q), antecedent T (Gmax), and antecedent VPD (Q). Model simulations predicted that annual GPP increased on average by about 16% with eCO2, 14% with warming, 12% with eCO2 and warming, and 23% with irrigation. For four of the six years, annual GPP was significantly affected by either eCO2 alone or when combined with warming. The increase in annual GPP under irrigation was similar to the increase under eCO2 during a dry year (2012), but irrigation stimulated GPP to a greater degree than eCO2 during wet years (2008, 2009). Hence, increases in GPP under eCO2
Load Absorption Characteristics of Tyre Production Waste Rubber for Playground Floor Systems
Directory of Open Access Journals (Sweden)
Abdul Ghani A.N.
2014-01-01
Full Text Available The floor surfaces where slides and swings are placed in parks and playrooms should be soft and thick to ensure that whenever a child falls, the surface can withstand the impact and minimize injuries to the child. Shredded tyres from waste tyres or waste rubber from tyre manufacturing could become beneficial as shock absorber material which can be used as a playground floor. In this study, rubber cubes and rubber pads with 5%, 8% and 10% SBR mixes were prepared for mechanical testing. Two types of floor design surfaces with and without plywood on the surface were assembled for the shock test. Gmax and HIC of this waste rubber flooring system were investigated using the compression test for the rubber cube and the drop test for the rubber pad. The criteria of general protection standards are 200g for optimum acceleration and 1000 for HIC. The Gmax and HIC results indicated that the material and system could ensure a safe fall from up to 1.0m height.
Maximum allowable load on wheeled mobile manipulators
International Nuclear Information System (INIS)
Habibnejad Korayem, M.; Ghariblu, H.
2003-01-01
This paper develops a computational technique for finding the maximum allowable load of mobile manipulator during a given trajectory. The maximum allowable loads which can be achieved by a mobile manipulator during a given trajectory are limited by the number of factors; probably the dynamic properties of mobile base and mounted manipulator, their actuator limitations and additional constraints applied to resolving the redundancy are the most important factors. To resolve extra D.O.F introduced by the base mobility, additional constraint functions are proposed directly in the task space of mobile manipulator. Finally, in two numerical examples involving a two-link planar manipulator mounted on a differentially driven mobile base, application of the method to determining maximum allowable load is verified. The simulation results demonstrates the maximum allowable load on a desired trajectory has not a unique value and directly depends on the additional constraint functions which applies to resolve the motion redundancy
g-factor of the Kπ = 14+ isomer in 176 W
International Nuclear Information System (INIS)
Ionescu-Bujor, M.; Iordachescu, A.; Marginean, N.; Brandolini, F.; Pavan, P.; Lenzi, S.M.; De Poli, M.; Gadea, A.; Martinez, T.; Medina, N.H.; Ribas, R.V.; Podolyak, Zs.
2000-01-01
In the deformed A ≅ 180 nuclei with β 2 ≅ 0.25 multi-quasiparticle intrinsic states are able to compete with rotational structures as both proton and neutron Fermi surfaces are close to nucleon orbits with large projections Ω on the prolate symmetry axis. Due to the approximate conservation of the K quantum number, these states often have hindered decays with half-lives ranging from nanoseconds to years. The decay characteristics of the high-K isomers, as well as the properties of the collective bands built on them, were subject of detailed experimental studies over the last decade. Particular attention has been devoted to the apparent breakdown of the K-selection rule observed experimentally in the decay of several high-spin isomeric states of the A ≅ 180 region. A very interesting high-K isomer showing in its decay a severe violation of the K-selection rule has been recently found in 176 W. The isomeric state, with K π = 14 + , T 1/2 = 35(10) ns and E x =3746 keV, de-excites predominantly to states with K=0, bypassing available levels of intermediate K. To elucidate the isomer underlying structure, an experiment to determine its the g-factor has been performed at the LNL XTU-tandem, by applying the time-differential perturbed angular distribution (TDPAD) method in an external magnetic field. The isomer was populated in the 164 Dy( 16 O,4n) 176 W reaction at a bombarding energy of 83 MeV. The 16 O beam has been pulsed with a pulse width of 1.5 ns at a repetition period of 800 ns. In view of the very low isomer population (about 2% of the 4n channel), a high suppression of the continuous beam in-between the beam bursts was necessary for a proper observation of the isomeric decay γ-lines. The target consisted of 0.5 mg/cm 2 metallic 164 Dy on thick Pb backing in which both the recoiling 176 W nuclei and the projectiles were stopped. Two planar Ge detectors and two Ge detectors of 25% efficiency placed at the angles ± 135 angle and ± 45 angle with respect
Limitations of a hemolytic plaque assay for IgG-anti-IgG rheumatoid factor-producing cells.
Venn, A J; Dresser, D W
1987-09-24
An attempt has been made to develop a hemolytic plaque assay capable of detecting homophile IgG rheumatoid factor (RF)-producing cells. Anti-immunoglobulin allotype-developing reagents were used to distinguish between target and effector IgG. The hemolytic assay has been used to demonstrate an apparently high level of homophile IgM and IgG RF-producing cells in the spleens and lymph nodes of mice stimulated by LPS. However, it appears that a large proportion of the plaques obtained in these assays are due to an artefact resulting from cross-linking of target and effector molecules by the developing reagents. In the case of IgM RF the artefact depends on the presence of a small contamination of the target IgG by IgM, allowing cross-linking of target and effector IgM by the anti-mu-specific developing reagent. With the IgG RF, cross-reactivity of the rabbit anti-Ighb allotype-developing serum for the 'wrong' (Igha) allotype, normally undetectable, becomes sufficient to be biologically relevant when the developing antibody is complexed by being bound to its target (Ighb) allotype. Nevertheless anti-allotype reagents may afford an accurate means of detecting homophile IgG RF producing cells using other assay systems.
Directory of Open Access Journals (Sweden)
Taeseong Woo
2017-05-01
Full Text Available A quantitative diagnosis using magnetic resonance imaging (MRI can be disturbed by radiofrequency (RF field inhomogeneity induced by the conductive implants. This inhomogeneity causes a local decrease of the signal intensity around the conductor, resulting in a deterioration of the accurate quantification. In a previous study, we developed an MRI imaging method using a two-dimensional selective excitation pulse (2D pulse to mitigate signal inhomogeneity induced by metallic implants. In this paper, the effect of 2D pulse was evaluated quantitatively by numerical simulation and MRI experiments. We introduced two factors for evaluation, spatial resolution and maximum compensation factor. Numerical simulations were performed with two groups. One group was composed of four models with different signal loss width, to evaluate the spatial resolution of the 2D pulse. The other group is also composed of four models with different amounts of signal loss for evaluating maximum compensation factor. In MRI experiments, we prepared phantoms containing conductors, which have different electrical conductivities related with the amounts of signal intensity decrease. The recovery of signal intensity was observed by 2D pulses, in both numerical simulations and experiments.
Chang, Horng-Rong; Yang, Shun-Fa; Tsai, Jen-Pi; Hsieh, Ming-Chia; Wu, Sheng-Wen; Tsai, Hui-Ching; Hung, Tung-Wei; Huang, Jun-Huang; Lian, Jong-Da
2011-01-30
Plasminogen activator inhibitor 1 (PAI-1) is thought to play a role in the pathogenesis of obesity and insulin resistance. A connection between gestational diabetes mellitus and the functional -675 PAI-1 genotype has been reported. Therefore, we examined the role of the PAI-1 gene polymorphism in kidney transplant recipients. A total of 376 kidney transplant recipients were prospectively screened for posttransplant diabetes mellitus (PTDM). Eighty-one (21.5%) patients were diagnosed with PTDM and the other 295 patients were non-diabetic following kidney transplantation. DNA samples were isolated from the sera and analyzed for the functional -675 4G/5G promoter polymorphisms of the PAI-1 gene. Kidney transplant recipients with PTDM were significantly associated with tacrolimus use (p=0.03), older age (p=0.036), and higher body mass index (p=0.001). The genotype distribution was significantly different between the patients with PTDM (genotype 4G/4G:4G/5G:5G/5G=33.3%:60.5%:6.2%) and those without PTDM (genotype 4G/4G:4G/5G:5G/5G=36.9%:44.1%:19.0%) (p=0.018). Patients with homozygosity for 5G had a significantly lower rate of PTDM (aOR, 0.286, p=0.022) and higher cumulative event-free probability of time to PTDM (log rank test, p=0.0058). Homozygosity for the 5G allele of the PAI-1 gene constitutes a protecting factor for the development of PTDM. Our findings are similar to a previous study on gestational diabetes mellitus, and strongly support a possible genetic role of PAI-1 in the development of PTDM. Copyright © 2010 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Papoular, R
1997-07-01
The Fourier Transform is of central importance to Crystallography since it allows the visualization in real space of tridimensional scattering densities pertaining to physical systems from diffraction data (powder or single-crystal diffraction, using x-rays, neutrons, electrons or else). In turn, this visualization makes it possible to model and parametrize these systems, the crystal structures of which are eventually refined by Least-Squares techniques (e.g., the Rietveld method in the case of Powder Diffraction). The Maximum Entropy Method (sometimes called MEM or MaxEnt) is a general imaging technique, related to solving ill-conditioned inverse problems. It is ideally suited for tackling undetermined systems of linear questions (for which the number of variables is much larger than the number of equations). It is already being applied successfully in Astronomy, Radioastronomy and Medical Imaging. The advantages of using MAXIMUM Entropy over conventional Fourier and `difference Fourier` syntheses stem from the following facts: MaxEnt takes the experimental error bars into account; MaxEnt incorporate Prior Knowledge (e.g., the positivity of the scattering density in some instances); MaxEnt allows density reconstructions from incompletely phased data, as well as from overlapping Bragg reflections; MaxEnt substantially reduces truncation errors to which conventional experimental Fourier reconstructions are usually prone. The principles of Maximum Entropy imaging as applied to Crystallography are first presented. The method is then illustrated by a detailed example specific to Neutron Diffraction: the search for proton in solids. (author). 17 refs.
Thermal neutron capture cross sections resonance integrals and g-factors
International Nuclear Information System (INIS)
Mughabghab, S.F.
2003-02-01
The thermal radiative capture cross sections and resonance integrals of elements and isotopes with atomic numbers from 1 to 83 (as well as 232 Th and 238 U) have been re-evaluated by taking into consideration all known pertinent data published since 1979. This work has been undertaken as part of an IAEA co-ordinated research project on 'Prompt capture gamma-ray activation analysis'. Westcott g-factors for radiative capture cross sections at a temperature of 300K were computed by utilizing the INTER code and ENDF-B/VI (Release 8) library files. The temperature dependence of the Westcott g-factor is illustrated for 113 Cd, 124 Xe and 157 Gd at temperatures of 150, 294 and 400K. Comparisons have also been made of the newly evaluated capture cross sections of 6 Li, 7 Li, 12 C and 207 Pb with those determined by the k 0 method. (author)
Maximum entropy analysis of EGRET data
DEFF Research Database (Denmark)
Pohl, M.; Strong, A.W.
1997-01-01
EGRET data are usually analysed on the basis of the Maximum-Likelihood method \\cite{ma96} in a search for point sources in excess to a model for the background radiation (e.g. \\cite{hu97}). This method depends strongly on the quality of the background model, and thus may have high systematic unce...... uncertainties in region of strong and uncertain background like the Galactic Center region. Here we show images of such regions obtained by the quantified Maximum-Entropy method. We also discuss a possible further use of MEM in the analysis of problematic regions of the sky....
g-factor of the 7- isomeric state in 128Ba
International Nuclear Information System (INIS)
Kaur, J.; Bansal, N.; Bhati, A.K.; Sharma, V.R.; Kumar, H.; Kumar, R.; Bhowmik, R.K.; Kumar, V.
2014-01-01
The time differential perturbed angular distribution technique (TDPAD) has been used to measure the g-factor of the 2396 keV, 7 - isomeric state in 128 Ba. The measured value of g(7 - ) is 1.21 ± 0.01. This value is about 80% higher than the value for the expected configuration of the state and also different in sign. This clearly shows that the configuration of the state does not correspond to the pure two quasineutron configuration that was assigned to it through previous results of in-beam γ-ray spectroscopy
A Rasch and factor analysis of the Functional Assessment of Cancer Therapy-General (FACT-G
Directory of Open Access Journals (Sweden)
Selby Peter J
2007-04-01
Full Text Available Abstract Background Although the Functional Assessment of Cancer Therapy – General questionnaire (FACT-G has been validated few studies have explored the factor structure of the instrument, in particular using non-sample dependent measurement techniques, such as Rasch Models. Furthermore, few studies have explored the relationship between item fit to the Rasch Model and clinical utility. The aim of this study was to investigate the dimensionality and measurement properties of the FACT-G with Rasch Models and Factor analysis. Methods A factor analysis and Rasch analysis (Partial Credit Model was carried out on the FACT-G completed by a heterogeneous sample of cancer patients (n = 465. For the Rasch analysis item fit (infit mean squares ≥ 1.30, dimensionality and item invariance were assessed. The impact of removing misfitting items on the clinical utility of the subscales and FACT-G total scale was also assessed. Results The factor analysis demonstrated a four factor structure of the FACT-G which broadly corresponded to the four subscales of the instrument. Internal consistency for these four scales was very good (Cronbach's alpha 0.72 – 0.85. The Rasch analysis demonstrated that each of the subscales and the FACT-G total scale had misfitting items (infit means square ≥ 1.30. All these scales with the exception of the Social & Family Well-being Scale (SFWB were unidimensional. When misfitting items were removed, the effect sizes and the clinical utility of the instrument were maintained for the subscales and the total FACT-G scores. Conclusion The results of the traditional factor analysis and Rasch analysis of the FACT-G broadly agreed. Caution should be exercised when utilising the Social & Family Well-being scale and further work is required to determine whether this scale is best represented by two factors. Additionally, removing misfitting items from scales should be performed alongside an assessment of the impact on clinical utility.
Factor V G1691A (Leiden is a major etiological factor in Egyptian Budd-Chiari syndrome patients
Directory of Open Access Journals (Sweden)
Tawhida Y. Abdel Ghaffar
2011-12-01
Full Text Available Objective: Budd-Chiari syndrome is a multifactorial disease in which several prothrombotic disorders may predispose patients to the development of thrombosis at this uncommon location (hepatic veins. The aim of this study was to determine the prevalence and characteristics of inherited thrombophilia in Egyptian Budd-Chiari syndrome patients.Materials and Methods: The study included 47 Budd-Chiari syndrome patients (20 children and 27 adults. Genotyping of Factor V G1691A (Leiden, prothrombin G20210A (PT, and methylenetetrahydrofolate reductase C677T were performed using real-time PCR and fluorescence melting curve detection analysis.Results: Factor V Leiden was observed in 29 patients (61.7%. It is the only factor that caused Budd-Chiari syndrome in 18 of the patients and in 5 of the patients with inferior vena cava involvement. Myeloproliferative disease was noted in 12 (25.5% patients, antiphospholipid syndrome in 5 (10.6%, and Behcet’s disease in 3 (6.4%. Interestingly, 3 of the children with Budd-Chiari syndrome had lipid storage disease.Conclusion: Factor V Leiden was a major etiological factor in Egyptian Budd-Chiari syndrome patients, which may have been related to the high frequency of this mutation in the study region. Factor V Leiden was also a strong thrombophilic factor and the leading cause of inferior vena cava thrombosis in these patients. Lipid storage disease should be included as a risk factor for Budd-Chiari syndrome.
The crystal structure of elongation factor G complexed with GDP, at 2.7 A resolution.
Czworkowski, J; Wang, J; Steitz, T A; Moore, P B
1994-01-01
Elongation factor G (EF-G) catalyzes the translocation step of protein synthesis in bacteria, and like the other bacterial elongation factor, EF-Tu--whose structure is already known--it is a member of the GTPase superfamily. We have determined the crystal structure of EF-G--GDP from Thermus thermophilus. It is an elongated molecule whose large, N-terminal domain resembles the G domain of EF-Tu, except for a 90 residue insert, which covers a surface that is involved in nucleotide exchange in E...
Maximum power per VA control of vector controlled interior ...
Indian Academy of Sciences (India)
Thakur Sumeet Singh
2018-04-11
Apr 11, 2018 ... Department of Electrical Engineering, Indian Institute of Technology Delhi, New ... The MPVA operation allows maximum-utilization of the drive-system. ... Permanent magnet motor; unity power factor; maximum VA utilization; ...
Lande gJ factors for even-parity electronic levels in the holmium atom
Stefanska, D.; Werbowy, S.; Krzykowski, A.; Furmann, B.
2018-05-01
In this work the hyperfine structure of the Zeeman splitting for 18 even-parity levels in the holmium atom was investigated. The experimental method applied was laser induced fluorescence in a hollow cathode discharge lamp. 20 spectral lines were investigated involving odd-parity levels from the ground multiplet, for which Lande gJ factors are known with high precision, as the lower levels; this greatly facilitated the evaluation of gJ factors for the upper levels. The gJ values for the even-parity levels considered are reported for the first time. They proved to compare fairly well with the values obtained recently in a semi-empirical analysis for the even-parity level system of Ho I.
Energy levels and electron g-factor of spherical quantum dots with Rashba spin-orbit interaction
International Nuclear Information System (INIS)
Vaseghi, B.; Rezaei, G.; Malian, M.
2011-01-01
We have studied simultaneous effects of Rashba spin-orbit interaction and external electric and magnetic fields on the subbands energy levels and electron g-factor of spherical quantum dots. It is shown that energy eigenvalues strongly depend on the combined effects of external electric and magnetic fields and spin-orbit interaction strength. The more the spin-orbit interaction strength increase, the more the energy eigenvalues increase. Also, we found that the electron g-factor sensitively differers from the bulk value due to the confinement effects. Furthermore, external fields and spin-orbit interaction have a great influence on this important quantity. -- Highlights: → Energy of spherical quantum dots depends on the spin-orbit interaction strength in external electric and magnetic fields. → Spin-orbit interaction shifts the energy levels. → Electron g-factor differs from the bulk value in spherical quantum dots due to the confinement effects. → Electron g-factor strongly depends on the spin-orbit interaction strength in external electric and magnetic fields.
Directory of Open Access Journals (Sweden)
Tajinder Kumar Parpugga
2015-01-01
Full Text Available Objective. Data on the impact of PAI-1-675 4G/5G genotype for fibrinolysis during myocardial infarction are inconsistent. The aim of our study was to evaluate the association of clinical and genetic (PAI-1-675 4G/5G polymorphism factors with coronary artery occlusion in patients with myocardial infarction. Materials and Methods. PAI-1-675 4G/5G detection was achieved by using Sanger sequencing in a sample of patients hospitalized for stent implantation due to myocardial infarction. We categorized the patients into two groups: patients with coronary artery occlusion and patients without coronary artery occlusion according to angiographic evaluation. Results. We identified n=122 (32.4% 4G/4G, n=186 (49.5% 4G/5G, and n=68 (18.1% 5G/5G PAI-1 genotype carriers. Univariate and multivariate analysis showed that only the 4G/5G genotype was associated with coronary artery occlusion (OR: 1.656 and 95% CI: 1.009–2.718, p=0.046. Conclusions. Our results showed that carriers of PAI-1 4G/5G genotype with myocardial infarction have increased odds of coronary artery occlusion more than 1.6 times in comparison to the carriers of homozygous genotypes.
Parpugga, Tajinder Kumar; Tatarunas, Vacis; Skipskis, Vilius; Kupstyte, Nora; Zaliaduonyte-Peksiene, Diana; Lesauskaite, Vaiva
2015-01-01
Data on the impact of PAI-1-675 4G/5G genotype for fibrinolysis during myocardial infarction are inconsistent. The aim of our study was to evaluate the association of clinical and genetic (PAI-1-675 4G/5G polymorphism) factors with coronary artery occlusion in patients with myocardial infarction. PAI-1-675 4G/5G detection was achieved by using Sanger sequencing in a sample of patients hospitalized for stent implantation due to myocardial infarction. We categorized the patients into two groups: patients with coronary artery occlusion and patients without coronary artery occlusion according to angiographic evaluation. We identified n = 122 (32.4%) 4G/4G, n = 186 (49.5%) 4G/5G, and n = 68 (18.1%) 5G/5G PAI-1 genotype carriers. Univariate and multivariate analysis showed that only the 4G/5G genotype was associated with coronary artery occlusion (OR: 1.656 and 95% CI: 1.009-2.718, p = 0.046). Our results showed that carriers of PAI-1 4G/5G genotype with myocardial infarction have increased odds of coronary artery occlusion more than 1.6 times in comparison to the carriers of homozygous genotypes.
Factores pronósticos de irresecabilidad en el adenocarcinoma gástrico
Directory of Open Access Journals (Sweden)
Erian Jesús Domínguez González
2016-10-01
Full Text Available Introducción: el cáncer gástrico es un problema de salud a nivel mundial, su tratamiento curativo es eminentemente quirúrgico, pero el diagnóstico tardío unido a una serie de factores hacen imposible la resección tumoral en ocasiones. Objetivo: identificar los factores pronósticos de irresecabilidad en el adenocarcinoma gástrico. Métodos: se realizó un estudio descriptivo, analítico de cohorte en el Servicio de Cirugía General del Hospital Provincial “Saturnino Lora”, durante el periodo comprendido desde enero de 2012 hasta diciembre de 2015. Se seleccionó una muestra de 124 pacientes operados por adenocarcinoma gástrico que fueron divididos en dos cohortes de enfermos (66 que tuvieron tratamiento resecativo y 58 con tumor irresecable. La identificación de los factores pronósticos de irresecabilidad se llevó a cabo a través de la construcción de un modelo de regresión logística multivariable. Resultados: predominaron los pacientes del sexo masculino y con edades superiores a los 60 años. Los tumores del tercio medio e inferior del estómago, con tamaño menor de 5, ulcerados, tipo intestinal y moderadamente diferenciados fueron los más frecuentes. Los factores pronósticos de irresecabilidad identificados que conformaron el modelo fueron: localización mixta y tamaño mayor a 6 cm del tumor, diagnóstico preoperatorio de metástasis hepática, Borrmann IV (lesión infiltrante, adenocarcinoma pobremente diferenciado e indiferenciado y diagnóstico preoperatorio de invasión a ganglios linfáticos. Se estimó una sensibilidad de 87,9 y especificidad de 89.7 Conclusiones: fue posible la identificación de factores que inciden de manera significativa en la irresecabilidad del adenocarcinoma gástrico.
The relation between the photonuclear E1 sum rule and the effective orbital g-factor
Energy Technology Data Exchange (ETDEWEB)
Bentz, Wolfgang E-mail: bentz@keyaki.cc.u-tokai.ac.jp; Arima, Akito
2004-05-17
The connection between the enhancement factor (1+{kappa}) of the photonuclear E1 sum rule and the orbital angular momentum g-factor (g{sub l}) of a bound nucleon is investigated in the framework of the Landau-Migdal theory for isospin asymmetric nuclear matter. Special emphasis is put on the role of gauge invariance to establish the {kappa}-g{sub l} relation. By identifying the physical processes which are taken into account in {kappa} and g{sub l}, the validity and limitations of this relation will be discussed. The connections to the collective excitations and to nuclear Compton scattering are also shown.
Verification of maximum impact force for interim storage cask for the Fast Flux Testing Facility
International Nuclear Information System (INIS)
Chen, W.W.; Chang, S.J.
1996-01-01
The objective of this paper is to perform an impact analysis of the Interim Storage Cask (ISC) of the Fast Flux Test Facility (FFTF) for a 4-ft end drop. The ISC is a concrete cask used to store spent nuclear fuels. The analysis is to justify the impact force calculated by General Atomics (General Atomics, 1994) using the ILMOD computer code. ILMOD determines the maximum force developed by the concrete crushing which occurs when the drop energy has been absorbed. The maximum force, multiplied by the dynamic load factor (DLF), was used to determine the maximum g-level on the cask during a 4-ft end drop accident onto the heavily reinforced FFTF Reactor Service Building's concrete surface. For the analysis, this surface was assumed to be unyielding and the cask absorbed all the drop energy. This conservative assumption simplified the modeling used to qualify the cask's structural integrity for this accident condition
g-factor of the KeV 5/2- state in 197Pt measured by the TDPAC method
International Nuclear Information System (INIS)
Saxena, R.N.; Soares, J.C.
1981-09-01
The g-factor of the 53 keV state in 197 Pt has been measured using the gamma-gamma time differential perturbed angular correlation (TDPAC) method in an external magnetic field of 25.1 kG. The measurements were performed by utilizing the 346-53 keV gamma cascade in the decay of 95.4 min 197 Pt. The value of the g-factor was obtained to be + 0.335 +- 0.010. This result is compared with the g-factors of similar states in 195 Pt and sup(197,199)Hg. (Author) [pt
g-factor calculations from the generalized seniority approach
Maheshwari, Bhoomika; Jain, Ashok Kumar
2018-05-01
The generalized seniority approach proposed by us to understand the B(E1)/B(E2)/B(E3) properties of semi-magic nuclei has been widely successful in the explanation of the same and has led to an expansion in the scope of seniority isomers. In the present paper, we apply the generalized seniority scheme to understand the behavior of g-factors in semi-magic nuclei. We find that the magnetic moment and the gfactors do show a particle number independent behavior as expected and the understanding is consistent with the explanation of transition probabilities.
The impact of soil suction variation on earthquake intensity indices
Directory of Open Access Journals (Sweden)
Biglari Mahnoosh
2016-01-01
Full Text Available Soil properties can completely change the ground motion characteristics as they travel from the bedrock to the surface because, soil as a low-pass filter, may amplify or deamplify seismic motions in some frequencies on the wave travelling path. Recent studies about the advanced unsaturated soil mechanics clearly shows that dynamic properties of soils, including small-strain shear modulus (Gmax, shear modulus reduction (G/Gmax, and damping ratio (D curves are affected by changes in the soil suction level. The current study present nonlinear time-dependent analysis of three different unsaturated soils available in the literature with different ranges of nonlinear behaviour that earlier have been studied on unsaturated dynamic models. Since, the earthquake intensity parameters can be used to describe the damage potential of an earthquake, the focus of this paper is to evaluate the impact of the suction variation on the engineering ground motion parameters, including peak values of strong motion, Vmax/Amax, root-mean-square acceleration, Arias intensity, characteristic intensity, cumulative absolute velocity, acceleration spectrum intensity, effective design acceleration, A95 parameter and predominant period separately under the near-field and the far-field seismicity categories.
Dispersion of the electron g factor anisotropy in InAs/InP self-assembled quantum dots
Energy Technology Data Exchange (ETDEWEB)
Belykh, V. V., E-mail: vasilii.belykh@tu-dortmund.de [Experimentelle Physik 2, Technische Universität Dortmund, D-44221 Dortmund (Germany); P.N. Lebedev Physical Institute of the Russian Academy of Sciences, Moscow 119991 (Russian Federation); Yakovlev, D. R.; Bayer, M. [Experimentelle Physik 2, Technische Universität Dortmund, D-44221 Dortmund (Germany); Ioffe Institute, Russian Academy of Sciences, 194021 St. Petersburg (Russian Federation); Schindler, J. J. [Experimentelle Physik 2, Technische Universität Dortmund, D-44221 Dortmund (Germany); Bree, J. van; Koenraad, P. M.; Silov, A. Yu., E-mail: A.Y.Silov@tue.nl [Department of Applied Physics and COBRA Research Institute, Eindhoven University of Technology, P.O. Box 513, 5600 MB Eindhoven (Netherlands); Averkiev, N. S. [Ioffe Institute, Russian Academy of Sciences, 194021 St. Petersburg (Russian Federation)
2016-08-28
The electron g factor in an ensemble of InAs/InP quantum dots with emission wavelengths around 1.4 μm is measured using time-resolved pump-probe Faraday rotation spectroscopy in different magnetic field orientations. Thereby, we can extend recent single dot photoluminescence measurements significantly towards lower optical transition energies through 0.86 eV. This allows us to obtain detailed insight into the dispersion of the recently discovered g factor anisotropy in these infrared emitting quantum dots. We find with decreasing transition energy over a range of 50 meV a strong enhancement of the g factor difference between magnetic field normal and along the dot growth axis, namely, from 1 to 1.7. We argue that the g factor cannot be solely determined by the confinement energy, but the dot asymmetry underlying this anisotropy therefore has to increase with increasing dot size.
Application of maximum entropy to neutron tunneling spectroscopy
International Nuclear Information System (INIS)
Mukhopadhyay, R.; Silver, R.N.
1990-01-01
We demonstrate the maximum entropy method for the deconvolution of high resolution tunneling data acquired with a quasielastic spectrometer. Given a precise characterization of the instrument resolution function, a maximum entropy analysis of lutidine data obtained with the IRIS spectrometer at ISIS results in an effective factor of three improvement in resolution. 7 refs., 4 figs
Effect of the anisotropy of the electron g-factor in spin polarization
Energy Technology Data Exchange (ETDEWEB)
Miah, M. Idrish, E-mail: m.miah@griffith.edu.au [Queensland Micro- and Nanotechnology Centre, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); School of Biomolecular and Physical Sciences, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); Department of Physics, University of Chittagong, Chittagong, Chittagong 4331 (Bangladesh); Gray, E. MacA. [Queensland Micro- and Nanotechnology Centre, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); School of Biomolecular and Physical Sciences, Griffith University, Nathan, Brisbane, QLD 4111 (Australia)
2010-02-15
Spin polarization in the presence of an external magnetic field and electric bias in quantum confined semiconductor structures has been studied by time- and polarization-resolved spectrometry. From measurements with angular variations of the magnetic field from the Voigt configuration (VC) it was found that both the frequency ({Omega}) and decay rate ({beta}) of the oscillatory component of the polarization increase with variation of the angle from the VC. Their dependences are discussed based on the electron spin dephasing related to the spread of the electron g-factor (g{sub e}) (i.e. unequal values of the longitudinal (g{sub e||}) and transverse (g{sub e}-perpendicular) components of g{sub e}) and the exchange interaction between the electron and hole spins. It is demonstrated that the increase in {Omega} upon deviation of the magnetic field from the VC relates to the anisotropy of g{sub e} (g{sub e||} and g{sub e}-perpendicular) resulting from the quantum confinement effect. However, the angular dependence on {beta} is related to the residual exchange interaction between the electron spin and rapidly relaxing hole spin.
A Brooks type theorem for the maximum local edge connectivity
DEFF Research Database (Denmark)
Stiebitz, Michael; Toft, Bjarne
2018-01-01
For a graph $G$, let $\\cn(G)$ and $\\la(G)$ denote the chromatic number of $G$ and the maximum local edge connectivity of $G$, respectively. A result of Dirac \\cite{Dirac53} implies that every graph $G$ satisfies $\\cn(G)\\leq \\la(G)+1$. In this paper we characterize the graphs $G$ for which $\\cn......(G)=\\la(G)+1$. The case $\\la(G)=3$ was already solved by Alboulker {\\em et al.\\,} \\cite{AlboukerV2016}. We show that a graph $G$ with $\\la(G)=k\\geq 4$ satisfies $\\cn(G)=k+1$ if and only if $G$ contains a block which can be obtained from copies of $K_{k+1}$ by repeated applications of the Haj\\'os join....
Directory of Open Access Journals (Sweden)
George N Cox
Full Text Available Previously we showed that granulocyte colony-stimulating factor (G-CSF in vitro bioactivity is preserved when the protein is joined via a flexible 7 amino acid linker to an immunoglobulin-1 (IgG1-Fc domain and that the G-CSF/IgG1-Fc fusion protein possessed a longer circulating half-life and improved hematopoietic properties compared to G-CSF in normal rats. We have extended this analysis by comparing the relative hematopoietic potencies of G-CSF/IgG1-Fc to G-CSF in normal mice and to G-CSF and polyethylene glycol (PEG -modified G-CSF in neutropenic rats. Mice were treated for 5 days using different doses and dosing regimens of G-CSF/IgG1-Fc or G-CSF and circulating neutrophil levels in the animals measured on Day 6. G-CSF/IgG1-Fc stimulated greater increases in blood neutrophils than comparable doses of G-CSF when administered using daily, every other day or every third day dosing regimens. In rats made neutropenic with cyclophosphamide, G-CSF/IgG1-Fc accelerated recovery of blood neutrophils to normal levels (from Day 9 to Day 5 when administered as 5 daily injections or as a single injection on Day 1. By contrast, G-CSF accelerated neutrophil recovery when administered as 5 daily injections, but not when administered as a single injection. G-CSF/IgG1-Fc was as effective as PEG-G-CSF at accelerating neutrophil recovery following a single injection in neutropenic rats. G-CSF/IgG1-Fc and G-CSF/IgG4-Fc fusion proteins in which the 7 amino acid linker was deleted also were effective at accelerating neutrophil recovery following a single injection in neutropenic rats. These studies confirm the enhanced in vivo hematopoietic properties of G-CSF/IgG-Fc fusion proteins.
Maximum β limited by ideal MHD ballooning instabilites in JT-60
International Nuclear Information System (INIS)
Seki, Shogo; Azumi, Masashi
1986-03-01
Maximum β limited by ideal MHD ballooning instabilities is investigated on divertor configurations in JT-60. Maximum β against ballooning modes in JT-60 has strong dependecy on the distribution of the safety factor over the magnetic surfaces. Maximum β is ∼ 2 % for q 0 = 1.0, while more than 3 % for q 0 = 1.5. These results suggest that the profile control of the safety factor, especially on the magnetic axis, is attractive to the higher β operation in JT-60. (author)
48 CFR 852.219-72 - Evaluation factor for participation in the VA mentor-protégé program.
2010-10-01
... participation in the VA mentor-protégé program. 852.219-72 Section 852.219-72 Federal Acquisition Regulations... Texts of Provisions and Clauses 852.219-72 Evaluation factor for participation in the VA mentor-protégé... the VA Mentor-Protégé Program (DEC2009) This solicitation contains an evaluation factor or sub-factor...
An absorption maximum was observed at 4.9 microns in infrared spectra of human parotid saliva. The factor causing this absorbance was found to be a...nitrate, and heat stability. Thiocyanate was then determined in 16 parotid saliva samples by a spectrophotometric method, which involved formation of
Russia in G20: Factors of Success and Objectives for the Future
Directory of Open Access Journals (Sweden)
Marina Vladimirovna Larionova
2017-12-01
Full Text Available Globalization and technological changes of the recent decade led to powerful transformations in the society, creating huge opportunities for economic and social development. Simultaneously these political, economic, social and technological shifts bring new challenges: enhanced mutual vulnerability of states; growing inequality; macroeconomic and financial instability; rise of terrorism; unbalanced growth of population and employment; waves of migration; increased rate of pandemic diseases diffusion; climate change and growing competition for resources. To prevent and manage the threats it is vital to ensure efficiency of the global governance system. Though lacking in legitimacy G20, set up in response to the global economic and financial crisis, has proved its efficiency in crafting and implementing consensus based decisions with a catalytic impact for global governance. Russia has a very strong track record in the G20 and it is vital to build on the success. The article reviews the G20 role in the global governance system and examines the factors of Russia’s success in the G20. Looking into the future, the author outlines G20 future agenda; proposes a strategy and a set of measures which would maximize G20 utility for Russia. Content analysis of the G20 documents, Russia’s national G20-related documents, interviews and statements is carried out to track whether Russia’ priorities in G20 have been achieved. Historical overview of G20 performance and Russia’s work in the G20 is undertaken to identify success factors. The G20 SWOT analysis is applied to reveal G20 strengths and opportunities and identify weaknesses and threats. Results of the SWOT analysis are used to develop a proposal for Russia’s strategy with regard to the G20. Drawing on the long-term forecasts, assessment of the G20 performance so far and its engagement with the other international organizations, the author makes an assertion that G20 agenda will deepen in the
Effective Mass and g Factor of Four-Flux-Quanta Composite Fermions
International Nuclear Information System (INIS)
Yeh, A.S.; Tsui, D.C.; Stormer, H.L.; Pfeiffer, L.N.; Baldwin, K.W.; West, K.W.; Stormer, H.L.; Tsui, D.C.
1999-01-01
We investigate the properties of composite fermions with four attached flux quanta through tilted-field experiments near Landau level filling factor ν=3/4 . The observed collapse of fractional quantum Hall gaps in the vicinity of this quarter-filling state can be comprehensively understood in terms of composite fermions with mass and spin. Remarkably, the effective mass and g factor of these four-flux-quanta composite fermions around ν=3/4 are very similar to those of two-flux-quanta composite fermions around ν=3/2 . copyright 1999 The American Physical Society
The maximum-entropy method in superspace
Czech Academy of Sciences Publication Activity Database
van Smaalen, S.; Palatinus, Lukáš; Schneider, M.
2003-01-01
Roč. 59, - (2003), s. 459-469 ISSN 0108-7673 Grant - others:DFG(DE) XX Institutional research plan: CEZ:AV0Z1010914 Keywords : maximum-entropy method, * aperiodic crystals * electron density Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.558, year: 2003
Directory of Open Access Journals (Sweden)
Min Chen
Full Text Available Conflicting data have been reported on the association between tumor necrosis factor (TNF -308G>A and nitric oxide synthase 3 (NOS3 +894G>T polymorphisms and migraine. We performed a meta-analysis of case-control studies to evaluate whether the TNF -308G>A and NOS3 +894G>T polymorphisms confer genetic susceptibility to migraine.We performed an updated meta-analysis for TNF -308G>A and a meta-analysis for NOS3 +894G>T based on studies published up to July 2014. We calculated study specific odds ratios (OR and 95% confidence intervals (95% CI assuming allele contrast, dominant model, recessive model, and co-dominant model as pooled effect estimates.Eleven studies in 6682 migraineurs and 22591 controls for TNF -308G>A and six studies in 1055 migraineurs and 877 controls for NOS3 +894G>T were included in the analysis. Neither indicated overall associations between gene polymorphisms and migraine risk. Subgroup analyses suggested that the "A" allele of the TNF -308G>A variant increases the risk of migraine among non-Caucasians (dominant model: pooled OR = 1.82; 95% CI 1.15 - 2.87. The risk of migraine with aura (MA was increased among both Caucasians and non-Caucasians. Subgroup analyses suggested that the "T" allele of the NOS3 +894G>T variant increases the risk of migraine among non-Caucasians (co-dominant model: pooled OR = 2.10; 95% CI 1.14 - 3.88.Our findings appear to support the hypothesis that the TNF -308G>A polymorphism may act as a genetic susceptibility factor for migraine among non-Caucasians and that the NOS3 +894G>T polymorphism may modulate the risk of migraine among non-Caucasians.
Finite-lattice-spacing corrections to masses and g factors on a lattice
International Nuclear Information System (INIS)
Roskies, R.; Wu, J.C.
1986-01-01
We suggest an alternative method for extracting masses and g factors from lattice calculations. Our method takes account of more of the infrared and ultraviolet lattice effects. It leads to more reasonable results in simulations of QED on a lattice
Upper-stratospheric glider flights for low-g experimentation
Loesch, Adam
Near Space Corporation's fully-operational High Altitude Shuttle System (HASS) consists of a glider carried to 100,000ft by a high altitude balloon. Originally intended to safely return sensitive instrumentation from altitude back to Earth, the glider provides the opportunity to fly ultra-smooth "parabolas" for low-g experimentation. This work models the dynamic behavior of the glider using aerodynamic parameters of a scaled F-4 Phantom to determine the optimal flight path during descent. Low-g parabola and pull-up pairs are flown until the altitude drops below 18km, approaching the maximum altitude of controlled airspace. With this model, it was found that eleven low-g parabolas can be flown to yield 137 seconds of total test time at an average RMS g-loading of 4.9x10 -2. By changing the weighting factor of the merit function, a tradeoff can be made to increase total test time at the expense of increasing g-loading, or vice-versa. A preliminary design exercise for an improved glider is conducted based on lessons learned from the scaled F-4 flight results.
44 CFR 208.12 - Maximum Pay Rate Table.
2010-10-01
...) Physicians. DHS uses the latest Special Salary Rate Table Number 0290 for Medical Officers (Clinical... Personnel, in which case the Maximum Pay Rate Table would not apply. (3) Compensation for Sponsoring Agency... organizations, e.g., HMOs or medical or engineering professional associations, under the revised definition of...
Factors associated with higher oxytocin requirements in labor.
Frey, Heather A; Tuuli, Methodius G; England, Sarah K; Roehl, Kimberly A; Odibo, Anthony O; Macones, George A; Cahill, Alison G
2015-09-01
To identify clinical characteristics associated with high maximum oxytocin doses in women who achieve complete cervical dilation. A retrospective nested case-control study was performed within a cohort of all term women at a single center between 2004 and 2008 who reached the second stage of labor. Cases were defined as women who had a maximum oxytocin dose during labor >20 mu/min, while women in the control group had a maximum oxytocin dose during labor of ≤20 mu/min. Exclusion criteria included no oxytocin administration during labor, multiple gestations, major fetal anomalies, nonvertex presentation, and prior cesarean delivery. Multiple maternal, fetal, and labor factors were evaluated with univariable analysis and multivariable logistic regression. Maximum oxytocin doses >20 mu/min were administered to 108 women (3.6%), while 2864 women received doses ≤20 mu/min. Factors associated with higher maximum oxytocin dose after adjusting for relevant confounders included maternal diabetes, birthweight >4000 g, intrapartum fever, administration of magnesium, and induction of labor. Few women who achieve complete cervical dilation require high doses of oxytocin. We identified maternal, fetal and labor factors that characterize this group of parturients.
Directory of Open Access Journals (Sweden)
Xiao-Fei Ma
2017-05-01
Full Text Available Objective: To study the effect of lycium barbarum polysaccharides (LBP on high glucoseinduced retinal ganglion cell apoptosis, gene expression and delayed rectifier potassium current. Methods: RGC-5 retinal ganglion cell lines were cultured and divided into control group, high glucose group and LBP group that were treated with normal DMEM, highglucose DMEM as well as high-glucose DMEM containing 500 ng/mL LBP respectively. After treatment, the Annexin V-FITC/PI kits were used to measure the number of apoptotic cells, fluorescence quantitative PCR kits were used to determine the expression of apoptosis genes and antioxidant genes, and patch clamp was used to test delayed rectifier potassium current. Results: 12, 24, 36 and 48 h after intervention, the number of apoptotic cells of high glucose group was significantly higher than that of control group, and the number of apoptotic cells of LBP group was significantly lower than that of high glucose group (P<0.05; 24 and 48 h after intervention, c-fos, c-jun, caspase-3, caspase-9, Nrf-2, NQO1 and HO-1 mRNA expression as well as potassium current amplitude (IK and maximum conductance (Gmax of high glucose group were significantly higher than those of control group while half maximum activation voltage (V1/2 was significantly lower than that of control group (P<0.05; c-fos, c-jun, caspase-3 and caspase-9 mRNA expression as well as IK and Gmax of LBP group were significantly lower than those of high glucose group, while Nrf-2, NQO1 and HO-1 mRNA expression as well as V1/2 of LBP group were significantly higher than those of high glucose group (P<0.05. Conclusions: LBP can reduce the high glucose-induced retinal ganglion cell apoptosis and inhibit the delayed rectifier potassium current amplitude.
G-factor for the K-6, Jsup(π) = 6+ isomer in 178Hf
International Nuclear Information System (INIS)
Faestermann, T.; Haeusser, O.; Ward, D.; Andrews, H.R.; Alexander, T.K.; Horn, D.
1978-01-01
High-K isomers are prevalent towards the end of the rare-earth region of deformed nuclei where the valence particles fill high Ω orbitals. Very little is known about the g-factors for these isomers mainly because in the half-life range encountered, 50 ns-50 μs, quadrupole and paramagnetic relaxation effects can destroy the nuclear alignment very rapidly. In 178 Hf a Isub(π)K=6 + 6 isomer with a half-life of 78 ns has recently been found. It decays predominantly to the ground band (K=O) 6 + and 4 + levels with gamma rays of 921.8 keV and 1247.3 keV respectively. The authors have measured the g-factor of this isomer with the method of perturbed angular distributions. (Auth.)
G-factors and diamagnetic coefficients of electrons, holes, and excitons in InAs/InP quantum dots
Bree, van J.; Silov, A.Yu.; Koenraad, P.M.; Flatté, M.E.; Pryor, C.E.
2012-01-01
The electron, hole, and exciton g factors and diamagnetic coefficients have been calculated using envelope-function theory for cylindrical InAs/InP quantum dots in the presence of a magnetic field parallel to the dot symmetry axis. A clear connection is established between the electron g factor and
Morita, Tsuyoshi; Hayashi, Ken'ichiro
2013-08-02
Myocardin-related transcription factors (MRTFs) are robust coactivators of serum response factor (SRF). MRTFs contain three copies of the RPEL motif at their N-terminus, and they bind to monomeric globular actin (G-actin). Previous studies illustrate that G-actin binding inhibits MRTF activity by preventing the MRTFs nuclear accumulation. In the living cells, the majority of G-actin is sequestered by G-actin binding proteins that prevent spontaneous actin polymerization. Here, we demonstrate that the most abundant G-actin sequestering protein thymosin-β4 (Tβ4) was involved in the regulation of subcellular localization and activity of MRTF-A. Tβ4 competed with MRTF-A for G-actin binding; thus, interfering with G-actin-MRTF-A complex formation. Tβ4 overexpression induced the MRTF-A nuclear accumulation and activation of MRTF-SRF signaling. The activation rate of MRTF-A by the Tβ4 mutant L17A, whose affinity for G-actin is very low, was lower than that by wild-type Tβ4. In contrast, the β-actin mutant 3DA, which has a lower affinity for Tβ4, more effectively suppressed MRTF-A activity than wild-type β-actin. Furthermore, ectopic Tβ4 increased the endogenous expression of SRF-dependent actin cytoskeletal genes. Thus, Tβ4 is an important MRTF regulator that controls the G-actin-MRTFs interaction. Copyright © 2013 Elsevier Inc. All rights reserved.
[Therapeutic use of hematopoietic growth factors. II. GM-CSF and G-CSF].
Royer, B; Arock, M
1998-01-01
The second part of this review on haematopoietic growth factors is focused on the therapeutic use of GM-CSF and G-CSF. Such therapeutic applications have raised very great hopes for clinical haematology. However, it should not be forgotten that these haematopoietic growth factors, which are very costly, are powerful two-edged weapons capable of triggering a cascade of reactions, and have a field of activity that often goes beyond the single highly specific property which it is hoped they possess. The risks and costs of their use are currently being evaluated. Waited developments concerning these molecules focus on three axes: a best use of factors already commercialized, especially concerning adaptation of posologies and new indications, the development of hybrid molecules from already known haematopoietic growth factors, possessing the advantages of respective factors, but not their disadvantages, the discovery of new haematopoietic growth factors with potential therapeutic application.
Mass mortality of the vermetid gastropod Ceraesignum maximum
Brown, A. L.; Frazer, T. K.; Shima, J. S.; Osenberg, C. W.
2016-09-01
Ceraesignum maximum (G.B. Sowerby I, 1825), formerly Dendropoma maximum, was subject to a sudden, massive die-off in the Society Islands, French Polynesia, in 2015. On Mo'orea, where we have detailed documentation of the die-off, these gastropods were previously found in densities up to 165 m-2. In July 2015, we surveyed shallow back reefs of Mo'orea before, during and after the die-off, documenting their swift decline. All censused populations incurred 100% mortality. Additional surveys and observations from Mo'orea, Tahiti, Bora Bora, and Huahine (but not Taha'a) suggested a similar, and approximately simultaneous, die-off. The cause(s) of this cataclysmic mass mortality are currently unknown. Given the previously documented negative effects of C. maximum on corals, we expect the die-off will have cascading effects on the reef community.
The Evaluation of the Initial Shear Modulus of Selected Cohesive Soils
Gabryś, Katarzyna; Szymański, Alojzy
2015-06-01
The paper concerns the evaluation of the initial stiffness of selected cohesive soils based on laboratory tests. The research materials used in this study were clayey soils taken from the area of the road embankment No. WD-18, on the 464th km of the S2 express-way, Konotopa-Airport route, Warsaw. The initial stiffness is represented here by the shear modulus (Gmax) determined during resonant column tests. In the article, a number of literature empirical formulas for defining initial value of the shear modulus of soils being examined were adopted from the literature in order to analyze the data set. However, a large discrepancy between laboratory test results and the values of Gmax calculated from empirical relationships resulted in the rejection of these proposals. They are inaccurate and do not allow for an exact evaluation of soil stiffness for selected cohesive soils. Hence, the authors proposed their own empirical formula that enables the evaluation of the test soils' Gmax in an easy and uncomplicated way. This unique formula describes mathematically the effect of certain soil parameters, namely mean effective stress ( p') and void ratio (e), on the initial soil stiffness.
International Nuclear Information System (INIS)
Benczer-Koller, N.; Kumbartzki, G.; Gurdal, G; Gross, Carl J; Krieger, B; Hatarik, Robert; O'Malley, Patrick; Pain, S. D.; Segen, L.; Baktash, Cyrus; Bingham, C. R.; Danchev, M.; Grzywacz, R.; Mazzocchi, C.
2008-01-01
The g factor of the 2 1 + state in 52 132 Te, E(2 1 + ) = 0.9739 MeV, r = 2.6 ps, was measured by the transient field technique applied to a radioactive beam. The development of an experimental approach necessary for work in radioactive beam environments is described. The result g = 0.28(15) agrees with the previous measurement by the recoil-in-vacuum technique, but here the sign of the g factor is measured as well
CI+MBPT calculations of Ar I energies, g factors, and transition line strengths
Savukov, I. M.
2018-03-01
Excited states of noble gas atoms present certain challenges to atomic theory for several reasons: first, relativistic effects are important and LS coupling is not optimal; second, energy intervals can be quite small, leading to strong mixing of states; third, many-body perturbation theory for hole states does not converge well. Previously, some attempts were made to solve this problem, using for example the all-order coupled-cluster approach and particle-hole configuration-interaction many-body perturbation theory (CI-MBPT) with modified denominators. However, while these approaches were promising, the accuracy was still limited. In this paper, we calculate Ar I energies, g factors, and transition amplitudes using ab initio CI-MBPT with eight valence electrons to avoid the problem of slow convergence of MBPT due to strong interaction between 3p and 3s states. We also included in CI many dominant states obtained by double excitations of the ground state configuration. Thus perturbation corrections were needed only for 1s, 2s, 2p core electrons non-included in valence-valence CI, which are quite small. We found that energy, g factors, and electric dipole matrix elements are in reasonable agreement with experiments. It is noteworthy that the theory agreed well with accurately measured g factors. Experimental oscillator strengths have large uncertainty, so in some cases we made a comparison with average values.
Chen, Min; Tang, Wenjing; Hou, Lei; Liu, Ruozhuo; Dong, Zhao; Han, Xun; Zhang, Xiaofei; Wan, Dongjun; Yu, Shengyuan
2015-01-01
Background and Objective Conflicting data have been reported on the association between tumor necrosis factor (TNF) –308G>A and nitric oxide synthase 3 (NOS3) +894G>T polymorphisms and migraine. We performed a meta-analysis of case-control studies to evaluate whether the TNF –308G>A and NOS3 +894G>T polymorphisms confer genetic susceptibility to migraine. Method We performed an updated meta-analysis for TNF –308G>A and a meta-analysis for NOS3 +894G>T based on studies published up to July 2014. We calculated study specific odds ratios (OR) and 95% confidence intervals (95% CI) assuming allele contrast, dominant model, recessive model, and co-dominant model as pooled effect estimates. Results Eleven studies in 6682 migraineurs and 22591 controls for TNF –308G>A and six studies in 1055 migraineurs and 877 controls for NOS3 +894G>T were included in the analysis. Neither indicated overall associations between gene polymorphisms and migraine risk. Subgroup analyses suggested that the “A” allele of the TNF –308G>A variant increases the risk of migraine among non-Caucasians (dominant model: pooled OR = 1.82; 95% CI 1.15 – 2.87). The risk of migraine with aura (MA) was increased among both Caucasians and non-Caucasians. Subgroup analyses suggested that the “T” allele of the NOS3 +894G>T variant increases the risk of migraine among non-Caucasians (co-dominant model: pooled OR = 2.10; 95% CI 1.14 – 3.88). Conclusions Our findings appear to support the hypothesis that the TNF –308G>A polymorphism may act as a genetic susceptibility factor for migraine among non-Caucasians and that the NOS3 +894G>T polymorphism may modulate the risk of migraine among non-Caucasians. PMID:26098763
Exchange enhancement of the electron g-factor in a two-dimensional semimetal in HgTe quantum wells
Energy Technology Data Exchange (ETDEWEB)
Bovkun, L. S., E-mail: bovkun@ipmras.ru; Krishtopenko, S. S.; Zholudev, M. S.; Ikonnikov, A. V.; Spirin, K. E. [Russian Academy of Sciences, Institute for Physics of Microstructures (Russian Federation); Dvoretsky, S. A.; Mikhailov, N. N. [Russian Academy of Sciences, Rzhanov Institute of Semiconductor Physics, Siberian Branch (Russian Federation); Teppe, F.; Knap, W. [Universite Montpellier II, Laboratoire Charles Coulomb (L2C), UMR CNRS 5221, GIS-TERALAB (France); Gavrilenko, V. I. [Russian Academy of Sciences, Institute for Physics of Microstructures (Russian Federation)
2015-12-15
The exchange enhancement of the electron g-factor in perpendicular magnetic fields to 12 T in HgTe/CdHgTe quantum wells 20 nm wide with a semimetal band structure is studied. The electron effective mass and g-factor at the Fermi level are determined by analyzing the temperature dependence of the amplitude of Shubnikov–de Haas oscillation in weak fields and near odd Landau-level filling factors ν ≤ 9. The experimental values are compared with theoretical calculations performed in the one-electron approximation using the eight-band kp Hamiltonian. The found dependence of g-factor enhancement on the electron concentration is explained by changes in the contributions of hole- and electron-like states to exchange corrections to the Landau-level energies in the conduction band.
A New V2G Control Strategy for Load Factor Improvement Using Smoothing Technique
Directory of Open Access Journals (Sweden)
CHANHOM, P.
2017-08-01
Full Text Available This paper proposes a new vehicle-to-grid (V2G control strategy for improving the load factor in the power network. To operate the proposed strategy, the available storage capacity of the PEVs’ batteries is considered as a battery energy storage system (BESS for charging and discharging an amount of power corresponding to the V2G power command. Due to the remarkable advantages of the technique so-called simple moving average, it is selected for applying in the proposed V2G control strategy. In this research, for investigating the load factor improvement, the essential data including the daily-load profiles with 7-day and 14-day periods are used for the 3 studied cases. These 3 studied cases present the power network with variation of the PEVs locations for describing the PEVs usage and charging or discharging behavior. The performance of the proposed strategy is simulated and verified by the MATPOWER software. The simulation results show that the load factors of the 3 studied cases are improved. Moreover, the encouragement of energy arbitrage for the PEVs owners is also discussed in this paper.
International Nuclear Information System (INIS)
Fujimoto, Nozomu; Maruyama, Soh; Sudo, Yukio; Fujii, Sadao; Niguma, Yoshinori.
1988-10-01
This report presents the results of quantitative evaluation on the effects of the dominant parameters on the maximum fuel temperature in the core thermal hydraulic design of the High Temperature Engineering Test Reactor(HTTR) of 30 MW in thermal power, 950 deg C in reactor outlet coolant temperature and 40 kg/cm 2 G in coolant pressure. The dominant parameters investigated are 1) Gap conductance. 2) Effect of eccertricity of fuel compacts in graphite sleeve. 3) Effect of spacer ribs on heat transfer coefficients. 4) Contact probability of fuel compact and graphite sleeve. 5) Validity of uniform radial power density in the fuel compacts. 6) Effect of impurity gas on gap conductance. 7) Effect of FP gas on gap conductance. The effects of these items on the maximum fuel temperature were quantitalively identified as hot spot factors. A probability of the appearance of the maximum fuel temperature was also evaluated in this report. (author)
The radial distribution of cosmic rays in the heliosphere at solar maximum
McDonald, F. B.; Fujii, Z.; Heikkila, B.; Lal, N.
2003-08-01
To obtain a more detailed profile of the radial distribution of galactic (GCRs) and anomalous (ACRs) cosmic rays, a unique time in the 11-year solar activity cycle has been selected - that of solar maximum. At this time of minimum cosmic ray intensity a simple, straight-forward normalization technique has been found that allows the cosmic ray data from IMP 8, Pioneer 10 (P-10) and Voyagers 1 and 2 (V1, V2) to be combined for the solar maxima of cycles 21, 22 and 23. This combined distribution reveals a functional form of the radial gradient that varies as G 0/r with G 0 being constant and relatively small in the inner heliosphere. After a transition region between ˜10 and 20 AU, G 0 increases to a much larger value that remains constant between ˜25 and 82 AU. This implies that at solar maximum the changes that produce the 11-year modulation cycle are mainly occurring in the outer heliosphere between ˜15 AU and the termination shock. These observations are not inconsistent with the concept that Global Merged Interaction. regions (GMIRs) are the principal agent of modulation between solar minimum and solar maximum. There does not appear to be a significant change in the amount of heliosheath modulation occurring between the 1997 solar minimum and the cycle 23 solar maximum.
Basso, Lilian; Lapointe, Tamia K; Iftinca, Mircea; Marsters, Candace; Hollenberg, Morley D; Kurrasch, Deborah M; Altier, Christophe
2017-10-17
Pain is a main symptom of inflammatory diseases and often persists beyond clinical remission. Although we have a good understanding of the mechanisms of sensitization at the periphery during inflammation, little is known about the mediators that drive central sensitization. Recent reports have identified hematopoietic colony-stimulating factors as important regulators of tumor- and nerve injury-associated pain. Using a mouse model of colitis, we identify the proinflammatory cytokine granulocyte-colony-stimulating factor (G-CSF or Csf-3) as a key mediator of visceral sensitization. We report that G-CSF is specifically up-regulated in the thoracolumbar spinal cord of colitis-affected mice. Our results show that resident spinal microglia express the G-CSF receptor and that G-CSF signaling mediates microglial activation following colitis. Furthermore, healthy mice subjected to intrathecal injection of G-CSF exhibit pronounced visceral hypersensitivity, an effect that is abolished by microglial depletion. Mechanistically, we demonstrate that G-CSF injection increases Cathepsin S activity in spinal cord tissues. When cocultured with microglia BV-2 cells exposed to G-CSF, dorsal root ganglion (DRG) nociceptors become hyperexcitable. Blocking CX3CR1 or nitric oxide production during G-CSF treatment reduces excitability and G-CSF-induced visceral pain in vivo. Finally, administration of G-CSF-neutralizing antibody can prevent the establishment of persistent visceral pain postcolitis. Overall, our work uncovers a DRG neuron-microglia interaction that responds to G-CSF by engaging Cathepsin S-CX3CR1-inducible NOS signaling. This interaction represents a central step in visceral sensitization following colonic inflammation, thereby identifying spinal G-CSF as a target for treating chronic abdominal pain.
INTER, ENDF/B Thermal Cross-Sections, Resonance Integrals, G-Factors Calculation
International Nuclear Information System (INIS)
Dunford, Charles L.
2007-01-01
1 - Description of program or function: INTER calculates thermal cross sections, g-factors, resonance integrals, fission spectrum averaged cross sections and 14.0 MeV (or other energy) cross sections for major reactions in an ENDF-6 or ENDF-5 format data file. Version 7.01 (Jan 2005): set success flag after return from beginning. 2 - Method of solution: INTER performs integrations by using the trapezoidal rule
Maximum spectral demands in the near-fault region
Huang, Yin-Nan; Whittaker, Andrew S.; Luco, Nicolas
2008-01-01
The Next Generation Attenuation (NGA) relationships for shallow crustal earthquakes in the western United States predict a rotated geometric mean of horizontal spectral demand, termed GMRotI50, and not maximum spectral demand. Differences between strike-normal, strike-parallel, geometric-mean, and maximum spectral demands in the near-fault region are investigated using 147 pairs of records selected from the NGA strong motion database. The selected records are for earthquakes with moment magnitude greater than 6.5 and for closest site-to-fault distance less than 15 km. Ratios of maximum spectral demand to NGA-predicted GMRotI50 for each pair of ground motions are presented. The ratio shows a clear dependence on period and the Somerville directivity parameters. Maximum demands can substantially exceed NGA-predicted GMRotI50 demands in the near-fault region, which has significant implications for seismic design, seismic performance assessment, and the next-generation seismic design maps. Strike-normal spectral demands are a significantly unconservative surrogate for maximum spectral demands for closest distance greater than 3 to 5 km. Scale factors that transform NGA-predicted GMRotI50 to a maximum spectral demand in the near-fault region are proposed.
International Nuclear Information System (INIS)
Morita, Tsuyoshi; Hayashi, Ken’ichiro
2013-01-01
Highlights: •Tβ4 competed with MRTF-A for G-actin binding. •Tβ4 activated the MRTF–SRF signaling pathway. •Tβ4 increased the endogenous expression of SRF-dependent genes. -- Abstract: Myocardin-related transcription factors (MRTFs) are robust coactivators of serum response factor (SRF). MRTFs contain three copies of the RPEL motif at their N-terminus, and they bind to monomeric globular actin (G-actin). Previous studies illustrate that G-actin binding inhibits MRTF activity by preventing the MRTFs nuclear accumulation. In the living cells, the majority of G-actin is sequestered by G-actin binding proteins that prevent spontaneous actin polymerization. Here, we demonstrate that the most abundant G-actin sequestering protein thymosin-β4 (Tβ4) was involved in the regulation of subcellular localization and activity of MRTF-A. Tβ4 competed with MRTF-A for G-actin binding; thus, interfering with G-actin–MRTF-A complex formation. Tβ4 overexpression induced the MRTF-A nuclear accumulation and activation of MRTF–SRF signaling. The activation rate of MRTF-A by the Tβ4 mutant L17A, whose affinity for G-actin is very low, was lower than that by wild-type Tβ4. In contrast, the β-actin mutant 3DA, which has a lower affinity for Tβ4, more effectively suppressed MRTF-A activity than wild-type β-actin. Furthermore, ectopic Tβ4 increased the endogenous expression of SRF-dependent actin cytoskeletal genes. Thus, Tβ4 is an important MRTF regulator that controls the G-actin–MRTFs interaction
Energy Technology Data Exchange (ETDEWEB)
Morita, Tsuyoshi, E-mail: tsuyo@nbiochem.med.osaka-u.ac.jp; Hayashi, Ken’ichiro
2013-08-02
Highlights: •Tβ4 competed with MRTF-A for G-actin binding. •Tβ4 activated the MRTF–SRF signaling pathway. •Tβ4 increased the endogenous expression of SRF-dependent genes. -- Abstract: Myocardin-related transcription factors (MRTFs) are robust coactivators of serum response factor (SRF). MRTFs contain three copies of the RPEL motif at their N-terminus, and they bind to monomeric globular actin (G-actin). Previous studies illustrate that G-actin binding inhibits MRTF activity by preventing the MRTFs nuclear accumulation. In the living cells, the majority of G-actin is sequestered by G-actin binding proteins that prevent spontaneous actin polymerization. Here, we demonstrate that the most abundant G-actin sequestering protein thymosin-β4 (Tβ4) was involved in the regulation of subcellular localization and activity of MRTF-A. Tβ4 competed with MRTF-A for G-actin binding; thus, interfering with G-actin–MRTF-A complex formation. Tβ4 overexpression induced the MRTF-A nuclear accumulation and activation of MRTF–SRF signaling. The activation rate of MRTF-A by the Tβ4 mutant L17A, whose affinity for G-actin is very low, was lower than that by wild-type Tβ4. In contrast, the β-actin mutant 3DA, which has a lower affinity for Tβ4, more effectively suppressed MRTF-A activity than wild-type β-actin. Furthermore, ectopic Tβ4 increased the endogenous expression of SRF-dependent actin cytoskeletal genes. Thus, Tβ4 is an important MRTF regulator that controls the G-actin–MRTFs interaction.
Computing the Stretch Factor of Paths, Trees, and Cycles in Weighted Fixed Orientation Metrics
DEFF Research Database (Denmark)
Wulff-Nilsen, Christian
2008-01-01
Let G be a graph embedded in the L_1-plane. The stretch factor of G is the maximum over all pairs of distinct vertices p and q of G of the ratio L_1^G(p,q)/L_1(p,q), where L_1^G(p,q) is the L_1-distance in G between p and q. We show how to compute the stretch factor of an n-vertex path in O(n*(log...... n)^2) worst-case time and O(n) space and we mention generalizations to trees and cycles, to general weighted fixed orientation metrics, and to higher dimensions....
International Nuclear Information System (INIS)
Kassemi, M.
1990-01-01
In this paper a new numerical method is presented for the analysis of combined natural convection and radiation heat transfer which has application in many engineering situations such as materials processing, combustion and fire research. Because of the recent interest in the performance of these engineering processes in the low-gravity environment of space, attention is devoted to both 1-g and low-g applications. The numerical study is based on a two-dimensional mathematical model represented by a set of coupled nonlinear partial differential equations for conservation of mass, momentum, and energy and the integro-differential equations which describe radiative heat transfer. Radiative exchange is formulated using the discrete exchange factor method (DEF). This method considers point to point exchange and provides accurate results over a wide range of radiation parameters. The desirable features of DEF are briefly described. Our numerical results show that radiation significantly influences the flow and heat transfer in the enclosure. In both low-g and 1-g applications, radiation modifies the temperature profiles and enhances the convective heat transfer at the cold wall. In a low-g environment, convection is weak, and radiation can easily become the dominant heat transfer mode. It is also shown that in the top-heated enclosure, volumetric heating by radiation gives rise to an intricate cell pattern in the cavity
Proton form factor ratio, μpGEP/GMP from double spin asymmetry
Energy Technology Data Exchange (ETDEWEB)
Habarakada Liyanage, Anusha Pushpakumari [Hampton Univ., Hampton, VA (United States)
2013-08-01
The form factors are fundamental properties of the nucleon representing the effect of its structure on its response to electromagnetic probes such as electrons. They are functions of the four-momentum transfer squared Q2 between the electron and the proton. This thesis reports the results of a new measurement of the ratio of the electric and magnetic form factors of the proton up to Q2 = 5.66 (GeV/c)2 using the double spin asymmetry with a polarized beam and target. Experiment E07-003 (SANE, Spin Asymmetries of the Nucleon Experiment) was carried out in Hall C at Jefferson Lab in 2009 to study the proton spin structure functions with a dynamically polarized ammonia target and longitudinally polarized electron beam. By detecting elastically scattered protons in the High-Momentum Spectrometer (HMS) in coincidence with the electrons in the Big Electron Telescope Array (BETA), elastic measurements were carried out in parallel. The elastic double spin asymmetry allows one to extract the proton electric to magnetic form factor ratio GpE/GpM at high-momentum transfer, Q2= 5.66 (GeV/c)2. In addition to the coincidence data, inclusively scattered electrons from the polarized ammonia target were detected by HMS, which allows to measure the beam-target asymmetry in the elastic region with the target spin nearly perpendicular to the momentum transfer, and to extract GpE/GpM at low Q2= 2.06 (GeV/c)2. This alternative measurement of GpE/GpM has verified and confirmed the dramatic discrepancy at high Q2 between the Rosenbluth and the recoil-polarization-transfer iv method with a different measurement technique and systematic uncertainties uncorrelated to those of the recoil-polarization measurements. The measurement of the form factor ratio at Q2 = 2
International Nuclear Information System (INIS)
Tandon, P.N.; Speidel, K.H.; Mertens, V.; Trolenberg, W.; Kumbartzki, G.S.; Ayres de Campos, N.; Goldberg, M.B.; Gerber, J.; Toulemonde, M.
1981-01-01
The g-factor of the 4 + state in 20 Ne at 4.25 MeV has been obtained to be g = +0.08(20) from transient field precession measurements in Gd in agreement with the present authors' earlier reported value of g =- 0.10(19) (1980). The significant reduction in the value of the g- factor, g = -0.01(14), relative to that of the 2 + state (g = + 0.54(4))(1975) is in complete disagreement with theory. In addition the life time of the 4 + state has been measured to be tau = 95(13) fs. (author)
Inhibition by Siomycin and Thiostrepton of Both Aminoacyl-tRNA and Factor G Binding to Ribosomes
Ll, Juan Modole; Cabrer, Bartolomé; Parmeggiani, Andrea; Azquez, David V
1971-01-01
Siomycin, a peptide antibiotic that interacts with the 50S ribosomal subunit and inhibits binding of factor G, is shown also to inhibit binding of aminoacyl-tRNA; however, it does not impair binding of fMet-tRNA and completion of the initiation complex. Moreover, unlike other inhibitors of aminoacyl-tRNA binding (tetracycline, sparsomycin, and streptogramin A), siomycin completely abolishes the GTPase activity associated with the binding of aminoacyl-tRNA catalyzed by factor Tu. A single-site interaction of siomycin appears to be responsible for its effect on both the binding of the aminoacyl-tRNA-Tu-GTP complex and that of factor G. PMID:4331558
Stimulation of LDL receptor activity in Hep-G2 cells by a serum factor(s)
International Nuclear Information System (INIS)
Ellsworth, J.L.; Brown, C.; Cooper, A.D.
1988-01-01
The regulation of low-density lipoprotein (LDL) receptor activity in the human hepatoma cell line Hep-G2 by serum components was examined. Incubation of dense monolayers of Hep-G2 cells with fresh medium containing 10% fetal calf serum (FM) produced a time-dependent increase in LDL receptor activity. Uptake and degradation of 125I-LDL was stimulated two- to four-fold, as compared with that of Hep-G2 cells cultured in the same media in which they had been grown to confluence (CM); the maximal 125I-LDL uptake plus degradation increased from 0.2 microgram/mg cell protein/4 h to 0.8 microgram/mg cell protein/4 h. In addition, a two-fold increase in cell surface binding of 125I-LDL to Hep-G2 cells was observed when binding was measured at 4 degrees C. There was no change in the apparent Kd. The stimulation of LDL receptor activity was suppressed in a concentration-dependent manner by the addition of cholesterol, as LDL, to the cell medium. In contrast to the stimulation of LDL receptor activity, FM did not affect the uptake or degradation of 125I-asialoorosomucoid. Addition of FM increased the protein content per dish, and DNA synthesis was stimulated approximately five-fold, as measured by [3H]thymidine incorporation into DNA; however, the cell number did not change. Cellular cholesterol biosynthesis was also stimulated by FM; [14C]acetate incorporation into unesterified and esterified cholesterol was increased approximately five-fold. Incubation of Hep-G2 cells with high-density lipoproteins (200 micrograms protein/ml) or albumin (8.0 mg/ml) in the absence of the serum factor did not significantly increase the total processed 125I-LDL. Stimulation of LDL receptor activity was dependent on a heat-stable, nondialyzable serum component that eluted in the inclusion volume of a Sephadex G-75 column
Directory of Open Access Journals (Sweden)
I Made Oka Adi Parwata
2016-09-01
Full Text Available Background: Oxidative stress occurs due to an imbalance of the number of free radicals by the number of endogenous antioxidant produced by the body i.e. Superoxide Dismutase (SOD, Gluthathione Peroxidase (GPx, and Catalase. The imbalance between the number of free radicals and antioxidants can be overcome with the endogenous antioxidant intake that exogenous oxidative stress can be reduced. One of exogenous antioxidants is natural Gaharu leaf water extract. Objective: This research focus on the effect of Gaharu leaf water extract in reducing MDA and 8-OHdG and increase the activity of SOD and Catalase. Methods: This study was an experimental with post only controls group design. Experiment was divided into 5 groups of wistar rats, each consisting of 5 animals, i.e. negative control group without extract [K (-], treatment 1 treated 50 mg/kg BW/day of the extract (T1, treatment 2 treated 100 mg/kg BW/day of the extract (T2, treatment 3 treated 200 mg/ kg BW/day of the extract (T3, and positive control group [K (+] treated with vitamin Cat a dose 50 mg/kg BW/day. All groups treated for 10 weeks. Every day, before treatment, each group was given a maximum swimming activity for 1.5 hours for 10 weeks. ELISA was used to measure MDA, 8-OHdG, SOD, and Catalase activities. Result: The research results showed that treatment of extract of leaves of Gaharu with an higher dose from 50 mg/kg BW up to 200 mg/ kg BW significantly decline (p <0.05 levels of MDA with the average ranging from 6.37±0.23, 5,56±0.27 and 4.32±0.27, 8-OHdG with a mean of 1.64±0.11, 1.26±0.46, and 1.09±0.17. On the other hand the treatment also increase SOD activity with less ranging from 12.15±1.04, 15.70±2.02, and 18.84±1.51, and Catalase ranging from 6,68±0.63, 8.20±1.14 and 9.29±0,79 in the blood of Wistar rats were given a maximum activity compared to the negative control group. This is probably higher phenol compounds (bioflavonoids quantity content of the extract
Electrical Control of g-Factor in a Few-Hole Silicon Nanowire MOSFET.
Voisin, B; Maurand, R; Barraud, S; Vinet, M; Jehl, X; Sanquer, M; Renard, J; De Franceschi, S
2016-01-13
Hole spins in silicon represent a promising yet barely explored direction for solid-state quantum computation, possibly combining long spin coherence, resulting from a reduced hyperfine interaction, and fast electrically driven qubit manipulation. Here we show that a silicon-nanowire field-effect transistor based on state-of-the-art silicon-on-insulator technology can be operated as a few-hole quantum dot. A detailed magnetotransport study of the first accessible hole reveals a g-factor with unexpectedly strong anisotropy and gate dependence. We infer that these two characteristics could enable an electrically driven g-tensor-modulation spin resonance with Rabi frequencies exceeding several hundred mega-Hertz.
Maximum mass-particle velocities in Kantor's information mechanics
International Nuclear Information System (INIS)
Sverdlik, D.I.
1989-01-01
Kantor's information mechanics links phenomena previously regarded as not treatable by a single theory. It is used here to calculate the maximum velocities υ m of single particles. For the electron, υ m /c ∼ 1 - 1.253814 x 10 -77 . The maximum υ m corresponds to υ m /c ∼ 1 -1.097864 x 10 -122 for a single mass particle with a rest mass of 3.078496 x 10 -5 g. This is the fastest that matter can move. Either information mechanics or classical mechanics can be used to show that υ m is less for heavier particles. That υ m is less for lighter particles can be deduced from an information mechanics argument alone
Granulocyte-Colony Stimulating Factor (G-CSF) for stroke: an individual patient data meta-analysis
England, Timothy J.; Sprigg, Nikola; Alasheev, Andrey M.; Belkin, Andrey A.; Kumar, Amit; Prasad, Kameshwar; Bath, Philip M.
2016-01-01
Granulocyte colony stimulating factor (G-CSF) may enhance recovery from stroke through neuroprotective mechanisms if administered early, or neurorepair if given later. Several small trials suggest administration is safe but effects on efficacy are unclear. We searched for randomised controlled trials (RCT) assessing G-CSF in patients with hyperacute, acute, subacute or chronic stroke, and asked Investigators to share individual patient data on baseline characteristics, stroke severity and typ...
Determination of the maximum-depth to potential field sources by a maximum structural index method
Fedi, M.; Florio, G.
2013-01-01
A simple and fast determination of the limiting depth to the sources may represent a significant help to the data interpretation. To this end we explore the possibility of determining those source parameters shared by all the classes of models fitting the data. One approach is to determine the maximum depth-to-source compatible with the measured data, by using for example the well-known Bott-Smith rules. These rules involve only the knowledge of the field and its horizontal gradient maxima, and are independent from the density contrast. Thanks to the direct relationship between structural index and depth to sources we work out a simple and fast strategy to obtain the maximum depth by using the semi-automated methods, such as Euler deconvolution or depth-from-extreme-points method (DEXP). The proposed method consists in estimating the maximum depth as the one obtained for the highest allowable value of the structural index (Nmax). Nmax may be easily determined, since it depends only on the dimensionality of the problem (2D/3D) and on the nature of the analyzed field (e.g., gravity field or magnetic field). We tested our approach on synthetic models against the results obtained by the classical Bott-Smith formulas and the results are in fact very similar, confirming the validity of this method. However, while Bott-Smith formulas are restricted to the gravity field only, our method is applicable also to the magnetic field and to any derivative of the gravity and magnetic field. Our method yields a useful criterion to assess the source model based on the (∂f/∂x)max/fmax ratio. The usefulness of the method in real cases is demonstrated for a salt wall in the Mississippi basin, where the estimation of the maximum depth agrees with the seismic information.
Wingeyer, Silvia D Perés; Graffigna, Mabel N; Belli, Susana H; Benetucci, Jorge; de Larrañaga, Gabriela F
2012-05-01
Plasminogen activator inhibitor-1 (PAI-1) and tumor necrosis factor-α (TNF-α) are increased in the circulation of obese persons. Because a direct link between PAI-1 and TNF-α in obesity has been observed, they are candidate genes for the development of obesity. We sought to evaluate the relation between the genotypic and allelic frequencies of the -675 4G/5G PAI-1 and -308 G/A TNF-α polymorphisms and their association with the risk for obesity in an Argentinean population. A group of 110 consecutive obese persons and a group of 111 lean controls were recruited. Polymerase chain reaction was used to determine the frequency of PAI-1 and TNF-α polymorphisms; serum fasting glucose, insulin, and lipid levels were measured by standard methods. Insulin sensitivity was evaluated by using homeostasis model assessment. The -308 TNF-α and -675 4G/5G PAI-1 genotype distribution did not significantly differ between the groups (p=0.544 and p=0.327, respectively). Homeostasis model assessment was the only positive independent determinant of body mass index (R(2)=0.493; p<0.001). The -675 4G/5G PAI-1 and the -308 TNF-α polymorphism variants tested in this study, individually or combined, were not associated with obesity in an Argentinean population.
Malik, Manzoor Ahmad; Shukla, Swati; Azad, Shorya Vardhan; Kaur, Jasbir
2014-01-01
Purpose Vascular endothelial growth factor polymorphism (VEGF-634G/C, rs 2010963) has been considered a risk factor for the development of retinopathy of prematurity (ROP). However, the results remain controversial. Therefore, the aim of the present meta-analysis was to determine the association between VEGF-634G/C polymorphism and ROP risk. Methods Published literature from PubMed and other databases were retrieved. All studies evaluating the association between VEGF-634G/C polymorphism and ROP risk were included. Pooled odds ratio (OR) and 95% confidence interval (CI) were calculated using random or fixed effects model. A total of six case-control studies including 355 cases and 471 controls were included. Results By pooling all the studies, we found that VEGF-634G/C polymorphism was not associated with ROP risk at co-dominant and allele levels and no association was also found in dominant and recessive models. While stratifying on ethnicity level no association was observed in Caucasian and Asian population. Discussion This meta-analysis suggests that VEGF-634G/C polymorphism may not be associated with ROP risk, the association between single VEGF-634G/C polymorphism and ROP risk awaits further investigation. PMID:25473347
Optimal operating conditions for maximum biogas production in anaerobic bioreactors
International Nuclear Information System (INIS)
Balmant, W.; Oliveira, B.H.; Mitchell, D.A.; Vargas, J.V.C.; Ordonez, J.C.
2014-01-01
The objective of this paper is to demonstrate the existence of optimal residence time and substrate inlet mass flow rate for maximum methane production through numerical simulations performed with a general transient mathematical model of an anaerobic biodigester introduced in this study. It is herein suggested a simplified model with only the most important reaction steps which are carried out by a single type of microorganisms following Monod kinetics. The mathematical model was developed for a well mixed reactor (CSTR – Continuous Stirred-Tank Reactor), considering three main reaction steps: acidogenesis, with a μ max of 8.64 day −1 and a K S of 250 mg/L, acetogenesis, with a μ max of 2.64 day −1 and a K S of 32 mg/L, and methanogenesis, with a μ max of 1.392 day −1 and a K S of 100 mg/L. The yield coefficients were 0.1-g-dry-cells/g-pollymeric compound for acidogenesis, 0.1-g-dry-cells/g-propionic acid and 0.1-g-dry-cells/g-butyric acid for acetogenesis and 0.1 g-dry-cells/g-acetic acid for methanogenesis. The model describes both the transient and the steady-state regime for several different biodigester design and operating conditions. After model experimental validation, a parametric analysis was performed. It was found that biogas production is strongly dependent on the input polymeric substrate and fermentable monomer concentrations, but fairly independent of the input propionic, acetic and butyric acid concentrations. An optimisation study was then conducted and optimal residence time and substrate inlet mass flow rate were found for maximum methane production. The optima found were very sharp, showing a sudden drop of methane mass flow rate variation from the observed maximum to zero, within a 20% range around the optimal operating parameters, which stresses the importance of their identification, no matter how complex the actual bioreactor design may be. The model is therefore expected to be a useful tool for simulation, design, control and
Sobolewski, Ł. M.; Windholz, L.; Kwela, J.
2017-11-01
Laser Induced Fluorescence Spectroscopy (LIF) and Optogalvanic Spectroscopy (OG) were used for the investigation of the Zeeman hyperfine structures of 26 spectral lines of La I in the wavelength range between 569.7 and 665.4 nm. As a source of free La atoms a hollow cathode discharge lamp was used. The spectra were recorded in the presence of a magnetic field of about 800G produced by a permanent magnet for two linear polarizations of the exciting laser light. As a result of the study, we determined for the first time the Landé gJ- factors of 20 levels of La I. For several other levels the Landé gJ- factors were re-investigated and determined with higher precision.
Journy, N; Sinno-Tellier, S; Maccia, C; Le Tertre, A; Pirard, P; Pagès, P; Eilstein, D; Donadieu, J; Bar, O
2012-01-01
Objective The study aimed to characterise the factors related to the X-ray dose delivered to the patient's skin during interventional cardiology procedures. Methods We studied 177 coronary angiographies (CAs) and/or percutaneous transluminal coronary angioplasties (PTCAs) carried out in a French clinic on the same radiography table. The clinical and therapeutic characteristics, and the technical parameters of the procedures, were collected. The dose area product (DAP) and the maximum skin dose (MSD) were measured by an ionisation chamber (Diamentor; Philips, Amsterdam, The Netherlands) and radiosensitive film (Gafchromic; International Specialty Products Advanced Materials Group, Wayne, NJ). Multivariate analyses were used to assess the effects of the factors of interest on dose. Results The mean MSD and DAP were respectively 389 mGy and 65 Gy cm−2 for CAs, and 916 mGy and 69 Gy cm−2 for PTCAs. For 8% of the procedures, the MSD exceeded 2 Gy. Although a linear relationship between the MSD and the DAP was observed for CAs (r=0.93), a simple extrapolation of such a model to PTCAs would lead to an inadequate assessment of the risk, especially for the highest dose values. For PTCAs, the body mass index, the therapeutic complexity, the fluoroscopy time and the number of cine frames were independent explanatory factors of the MSD, whoever the practitioner was. Moreover, the effect of technical factors such as collimation, cinematography settings and X-ray tube orientations on the DAP was shown. Conclusion Optimising the technical options for interventional procedures and training staff on radiation protection might notably reduce the dose and ultimately avoid patient skin lesions. PMID:22457404
A conductance maximum observed in an inward-rectifier potassium channel
1994-01-01
One prediction of a multi-ion pore is that its conductance should reach a maximum and then begin to decrease as the concentration of permeant ion is raised equally on both sides of the membrane. A conductance maximum has been observed at the single-channel level in gramicidin and in a Ca(2+)-activated K+ channel at extremely high ion concentration (> 1,000 mM) (Hladky, S. B., and D. A. Haydon. 1972. Biochimica et Biophysica Acta. 274:294-312; Eisenmam, G., J. Sandblom, and E. Neher. 1977. In ...
Anti-nutrient components of guinea grass ( Panicum maximum ...
African Journals Online (AJOL)
Yomi
2012-01-31
Jan 31, 2012 ... A true measure of forage quality is animal ... The anti-nutritional contents of a pasture could be ... nutrient factors in P. maximum; (2) assess the effect of nitrogen ..... 3. http://www.clemson.edu/Fairfield/local/news/quality.
Human IgG4 binds to IgG4 and conformationally altered IgG1 via Fc-Fc interactions
Rispens, Theo; Ooievaar-de Heer, Pleuni; Vermeulen, Ellen; Schuurman, Janine; van der Neut Kolfschoten, Marijn; Aalberse, Rob C.
2009-01-01
The Fc fragment of IgG4 can interact with the Fc fragment of another IgG molecule. This interaction is a confounding factor when measuring IgG4 rheumatoid factor levels. Recently, we demonstrated that half-molecules of IgG4 can exchange to form a bispecific Ab. We expected these two phenomena to be
Muñoz, Sebastián Andrés; Aranda, Federico; Allievi, Alberto; Orden, Alberto Omar; Perés Wingeyer, Silvia; Trobo, Rosana; Alvarez, Analía; Eimon, Alicia; Barreira, Juan Carlos; Schneeberger, Emilce; Dal Pra, Fernando; Sarano, Judith; Hofman, Julio; Chamorro, Julián; de Larrañaga, Gabriela
2014-02-01
We investigated the relationship between the 4G/5G plasminogen activator inhibitor (PAI-1) and -308 A/G tumor necrosis factor-α (TNF-α) polymorphisms and the clinical and biochemical features of systemic lupus erythematosus (SLE) in an Argentinean patient cohort. A total of 402 patients were studied, including 179 SLE patients and 223 healthy individuals. PCR-RLFP was used to determine the genotypes of the 4G/5G PAI-1 and -308 A/G TNF-α polymorphisms. SLE patients with lupus nephritis (LN) (n = 86) were compared with patients without LN (n = 93). Additionally, LN patients were divided into proliferative LN and non-proliferative LN groups according to the results of the renal biopsies. No significant differences were noted in the genotype distributions or allele frequencies of these TNF-α and PAI-1 polymorphisms between SLE patients and controls. There were higher numbers of criteria for SLE, more lupus flares and higher damage scores in LN patients, but there were similar frequencies of anti-phospholipid antibody (APA) positivity and anti-phospholipid syndrome. No significant difference was noted for any studied variable between the proliferative LN and non-proliferative LN groups except for the presence of APA. We found no significant differences in the TNF-α and PAI-1 genotype distributions or allele frequencies between groups. We found that the -308 A/G TNF-α and 4G/5G PAI-1 polymorphisms are not associated with susceptibility to SLE in an Argentinean population. We also did not find any association between the presence of any specific allele or genotype and the development of LN in SLE patients. Finally, no association was noted between either of the two polymorphisms and the severity of renal disease.
Automatic maximum entropy spectral reconstruction in NMR
International Nuclear Information System (INIS)
Mobli, Mehdi; Maciejewski, Mark W.; Gryk, Michael R.; Hoch, Jeffrey C.
2007-01-01
Developments in superconducting magnets, cryogenic probes, isotope labeling strategies, and sophisticated pulse sequences together have enabled the application, in principle, of high-resolution NMR spectroscopy to biomolecular systems approaching 1 megadalton. In practice, however, conventional approaches to NMR that utilize the fast Fourier transform, which require data collected at uniform time intervals, result in prohibitively lengthy data collection times in order to achieve the full resolution afforded by high field magnets. A variety of approaches that involve nonuniform sampling have been proposed, each utilizing a non-Fourier method of spectrum analysis. A very general non-Fourier method that is capable of utilizing data collected using any of the proposed nonuniform sampling strategies is maximum entropy reconstruction. A limiting factor in the adoption of maximum entropy reconstruction in NMR has been the need to specify non-intuitive parameters. Here we describe a fully automated system for maximum entropy reconstruction that requires no user-specified parameters. A web-accessible script generator provides the user interface to the system
Human Granulocyte Colony-Stimulating Factor (hG-CSF) Expression in Plastids of Lactuca sativa
Sharifi Tabar, Mehdi; Habashi, Ali Akbar; Rajabi Memari, Hamid
2013-01-01
Background: Human granulocyte colony-stimulating factor (hG-CSF) can serve as valuable biopharmaceutical for research and treatment of the human blood cancer. Transplastomic plants have been emerged as a new and high potential candidate for production of recombinant biopharmaceutical proteins in comparison with transgenic plants due to extremely high level expression, biosafety and many other advantages. Methods: hG-CSF gene was cloned into pCL vector between prrn16S promoter and TpsbA ter...
Detection and determination of Oxytetracycline and Penicillin G ...
African Journals Online (AJOL)
Concentrations of oxytetracycline and penicillin G in all samples were between ranges of 45 -192 μg/l and 0-28 μg/l, respectively. The antibiotic residue positive samples which showed residues of oxytetracycline above the WTO/FAO/ CAC established maximum residue limit of 100μg/l were 40 (83.33%). For penicillin G, the ...
Approximate maximum parsimony and ancestral maximum likelihood.
Alon, Noga; Chor, Benny; Pardi, Fabio; Rapoport, Anat
2010-01-01
We explore the maximum parsimony (MP) and ancestral maximum likelihood (AML) criteria in phylogenetic tree reconstruction. Both problems are NP-hard, so we seek approximate solutions. We formulate the two problems as Steiner tree problems under appropriate distances. The gist of our approach is the succinct characterization of Steiner trees for a small number of leaves for the two distances. This enables the use of known Steiner tree approximation algorithms. The approach leads to a 16/9 approximation ratio for AML and asymptotically to a 1.55 approximation ratio for MP.
ON THE MAXIMUM MASS OF STELLAR BLACK HOLES
International Nuclear Information System (INIS)
Belczynski, Krzysztof; Fryer, Chris L.; Bulik, Tomasz; Ruiter, Ashley; Valsecchi, Francesca; Vink, Jorick S.; Hurley, Jarrod R.
2010-01-01
We present the spectrum of compact object masses: neutron stars and black holes (BHs) that originate from single stars in different environments. In particular, we calculate the dependence of maximum BH mass on metallicity and on some specific wind mass loss rates (e.g., Hurley et al. and Vink et al.). Our calculations show that the highest mass BHs observed in the Galaxy M bh ∼ 15 M sun in the high metallicity environment (Z = Z sun = 0.02) can be explained with stellar models and the wind mass loss rates adopted here. To reach this result we had to set luminous blue variable mass loss rates at the level of ∼10 -4 M sun yr -1 and to employ metallicity-dependent Wolf-Rayet winds. With such winds, calibrated on Galactic BH mass measurements, the maximum BH mass obtained for moderate metallicity (Z = 0.3 Z sun = 0.006) is M bh,max = 30 M sun . This is a rather striking finding as the mass of the most massive known stellar BH is M bh = 23-34 M sun and, in fact, it is located in a small star-forming galaxy with moderate metallicity. We find that in the very low (globular cluster-like) metallicity environment the maximum BH mass can be as high as M bh,max = 80 M sun (Z = 0.01 Z sun = 0.0002). It is interesting to note that X-ray luminosity from Eddington-limited accretion onto an 80 M sun BH is of the order of ∼10 40 erg s -1 and is comparable to luminosities of some known ultra-luminous X-ray sources. We emphasize that our results were obtained for single stars only and that binary interactions may alter these maximum BH masses (e.g., accretion from a close companion). This is strictly a proof-of-principle study which demonstrates that stellar models can naturally explain even the most massive known stellar BHs.
The g-factor and the electric quadrupole moment of the 7/2+ isomer in 125Xe
International Nuclear Information System (INIS)
Alber, D.; Bertschat, H.H.; Grawe, H.; Haas, H.; Mahnke, H.E.; Menningen, M.; Semmler, W.; Sielemann, R.; Zeitz, W.D.; Freie Univ. Berlin
1983-01-01
The time differential perturbed angular distribution method (PAD) was used to measure the g-factor and the electric quadrupole interaction in a Cd single crystal for the tsub(1/2)=140 ns, Isup(π)=7/2 + isomer in 125 Xe. The g-factor is g=+0.264(10) and the quadrupole coupling constant e 2 Qq/h=122.1(6) MHz at 552 K. The lifetime of the Isup(π)=11/2 + state was measured to be tau=11.3(1.1) ps by the recoil distance method (RDM). From an analysis of the spectroscopic data using the triaxial-rotor-pulse-particle (TRPP) model the quadrupole moment of the 7/2 + isomer is deduced to be Q=1.40(15) b yielding an electric field gradient (efg) eq=3.6(4)x10 17 V/cm 2 for Xe Cd. (orig.)
The g-factor and the electric quadrupole moment of the 7/2+ isomer in 125Xe
International Nuclear Information System (INIS)
Alber, D.; Bertschat, H.H.; Grawe, H.; Haas, H.; Mahnke, H.E.; Menningen, M.; Semmler, W.; Sielemann, R.; Zeitz, W.D.
1983-01-01
The time differential perturbed angular distribution method (PAD) was used to measure the g-factor and the electric quadrupole interaction in a Cd single crystal for the tsub(1/2) = 140 ns, Isup(π) = 7/2 + isomer in 125 Xe. The g-factor is g = +0.264(10) and the quadrupole coupling constant e 2 Qq/h = 122.1(6) MHz at 552 K. The lifetime of the Isup(π) = 11/2 + state was measured to be tau = 11.3(1.1) ps by the recoil distance method (RDM). From an analysis of the spectroscopic data using the triaxial-rotor-plus-particle (TRPP) model the quadrupole moment of the 7/2 + isomer is deduced to be Q = 1.40(15) b yielding an electric field gradient (efg) eq = 3.6(4)x10 17 V/cm 2 for Xe Cd. (orig.)
Applications of the Maximum Entropy Method in superspace
Czech Academy of Sciences Publication Activity Database
van Smaalen, S.; Palatinus, Lukáš
2004-01-01
Roč. 305, - (2004), s. 57-62 ISSN 0015-0193 Grant - others:DFG and FCI(DE) XX Institutional research plan: CEZ:AV0Z1010914 Keywords : Maximum Entropy Method * modulated structures * charge density Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.517, year: 2004
Murray, Aja Louise; Booth, Tom; Eisner, Manuel; Obsuth, Ingrid; Ribeaud, Denis
2018-05-22
Whether or not importance should be placed on an all-encompassing general factor of psychopathology (or p factor) in classifying, researching, diagnosing, and treating psychiatric disorders depends (among other issues) on the extent to which comorbidity is symptom-general rather than staying largely within the confines of narrower transdiagnostic factors such as internalizing and externalizing. In this study, we compared three methods of estimating p factor strength. We compared omega hierarchical and explained common variance calculated from confirmatory factor analysis (CFA) bifactor models with maximum likelihood (ML) estimation, from exploratory structural equation modeling/exploratory factor analysis models with a bifactor rotation, and from Bayesian structural equation modeling (BSEM) bifactor models. Our simulation results suggested that BSEM with small variance priors on secondary loadings might be the preferred option. However, CFA with ML also performed well provided secondary loadings were modeled. We provide two empirical examples of applying the three methodologies using a normative sample of youth (z-proso, n = 1,286) and a university counseling sample (n = 359).
Remarks on the maximum luminosity
Cardoso, Vitor; Ikeda, Taishi; Moore, Christopher J.; Yoo, Chul-Moon
2018-04-01
The quest for fundamental limitations on physical processes is old and venerable. Here, we investigate the maximum possible power, or luminosity, that any event can produce. We show, via full nonlinear simulations of Einstein's equations, that there exist initial conditions which give rise to arbitrarily large luminosities. However, the requirement that there is no past horizon in the spacetime seems to limit the luminosity to below the Planck value, LP=c5/G . Numerical relativity simulations of critical collapse yield the largest luminosities observed to date, ≈ 0.2 LP . We also present an analytic solution to the Einstein equations which seems to give an unboundedly large luminosity; this will guide future numerical efforts to investigate super-Planckian luminosities.
ORIGINAL ARTICLES Surgical practice in a maximum security prison
African Journals Online (AJOL)
Prison Clinic, Mangaung Maximum Security Prison, Bloemfontein. F Kleinhans, BA (Cur) .... HIV positivity rate and the use of the rectum to store foreign objects. ... fruit in sunlight. Other positive health-promoting factors may also play a role,.
Honorio, Jacqueline Ferandin; Veit, Márcia Teresinha; Gonçalves, Gilberto da Cunha; de Campos, Élvio Antonio; Fagundes-Klen, Márcia Regina
2016-01-01
The textile industry is known for the high use of chemicals, such as dyes, and large volumes of effluent that contaminate waters, a fact that has encouraged research and improved treatment techniques. In this study, we used unprocessed soybean hulls for the removal of reactive blue BF-5G dye. The point of zero charge of soybean hulls was 6.76. Regarding the speed of agitation in the adsorption process, the resistance to mass transfer that occurs in the boundary layer was eliminated at 100 rpm. Kinetics showed an experimental amount of dye adsorbed at equilibrium of 57.473 mg g(-1) obtained under the following conditions: dye initial concentration = 400 mg L(-1); diameter of particle = 0.725 mm; dosage = 6 g L(-1); pH 2; 100 rpm; temperature = 30 °C; and duration of 24 hours. The pseudo-second order best showed the dye removal kinetics. The adsorption isotherms performed at different temperatures (20, 30, 40 and 50 °C) showed little variation in the concentration range assessed, being properly adjusted by the Langmuir isotherm model. The maximum capacity of dye adsorption was 72.427 mg g(-1) at 30 °C. Since soybean hull is a low-cost industrial byproduct, it proved to be a potential adsorbent for the removal of the textile dye assessed.
Henriet, Simon; Mercenne, Gaëlle; Bernacchi, Serena; Paillart, Jean-Christophe; Marquet, Roland
2009-06-01
The viral infectivity factor (Vif) is dispensable for human immunodeficiency virus type 1 (HIV-1) replication in so-called permissive cells but is required for replication in nonpermissive cell lines and for pathogenesis. Virions produced in the absence of Vif have an aberrant morphology and an unstable core and are unable to complete reverse transcription. Recent studies demonstrated that human APOBEC-3G (hA3G) and APOBEC-3F (hA3F), which are selectively expressed in nonpermissive cells, possess strong anti-HIV-1 activity and are sufficient to confer a nonpermissive phenotype. Vif induces the degradation of hA3G and hA3F, suggesting that its main function is to counteract these cellular factors. Most studies focused on the hypermutation induced by the cytidine deaminase activity of hA3G and hA3F and on their Vif-induced degradation by the proteasome. However, recent studies suggested that several mechanisms are involved both in the antiviral activity of hA3G and hA3F and in the way Vif counteracts these antiviral factors. Attempts to reconcile the studies involving Vif in virus assembly and stability with these recent findings suggest that hA3G and hA3F partially exert their antiviral activity independently of their catalytic activity by destabilizing the viral core and the reverse transcription complex, possibly by interfering with the assembly and/or maturation of the viral particles. Vif could then counteract hA3G and hA3F by excluding them from the viral assembly intermediates through competition for the viral genomic RNA, by regulating the proteolytic processing of Pr55(Gag), by enhancing the efficiency of the reverse transcription process, and by inhibiting the enzymatic activities of hA3G and hA3F.
Directory of Open Access Journals (Sweden)
Krüger Carola
2008-03-01
Full Text Available Abstract Background Granulocyte colony-stimulating (G-CSF factor is a well-known hematopoietic growth factor stimulating the proliferation and differentiation of myeloid progenitors. Recently, we uncovered that G-CSF acts also as a neuronal growth factor in the brain, which promotes adult neural precursor differentiation and enhances regeneration of the brain after insults. In adults, the receptor for G-CSF is predominantly expressed in neurons in many brain areas. We also described expression in neurogenic regions of the adult brain, such as the subventricular zone and the subgranular layer of the dentate gyrus. In addition, we found close co-localization of the G-CSF receptor and its ligand G-CSF. Here we have conducted a systematic expression analysis of G-CSF receptor and its ligand in the developing embryo. Results Outside the central nervous system (CNS we found G-CSF receptor expression in blood vessels, muscles and their respective precursors and neurons. The expression of the G-CSF receptor in the developing CNS was most prominent in radial glia cells. Conclusion Our data imply that in addition to the function of G-CSF and its receptor in adult neurogenesis, this system also has a role in embryonic neurogenesis and nervous system development.
Downlink power distributions for 2G and 3G mobile communication networks.
Colombi, Davide; Thors, Björn; Persson, Tomas; Wirén, Niklas; Larsson, Lars-Eric; Jonsson, Mikael; Törnevik, Christer
2013-12-01
Knowledge of realistic power levels is key when conducting accurate EMF exposure assessments. In this study, downlink output power distributions for radio base stations in 2G and 3G mobile communication networks have been assessed. The distributions were obtained from network measurement data collected from the Operations Support System, which normally is used for network monitoring and management. Significant amounts of data were gathered simultaneously for large sets of radio base stations covering wide geographical areas and different environments. The method was validated with in situ measurements. For the 3G network, the 90th percentile of the averaged output power during high traffic hours was found to be 43 % of the maximum available power. The corresponding number for 2G, with two or more transceivers installed, was 65 % or below.
Molecular Evolution and Genetic Variation of G2-Like Transcription Factor Genes in Maize.
Directory of Open Access Journals (Sweden)
Fang Liu
Full Text Available The productivity of maize (Zea mays L. depends on the development of chloroplasts, and G2-like transcription factors play a central role in regulating chloroplast development. In this study, we identified 59 G2-like genes in the B73 maize genome and systematically analyzed these genes at the molecular and evolutionary levels. Based on gene structure character, motif compositions and phylogenetic analysis, maize G2-like genes (ZmG1- ZmG59 were divided into seven groups (I-VII. By synteny analysis, 18 collinear gene pairs and strongly conserved microsyntny among regions hosting G2-like genes across maize and sorghum were found. Here, we showed that the vast majority of ZmG gene duplications resulted from whole genome duplication events rather than tandem duplications. After gene duplication events, some ZmG genes were silenced. The functions of G2-like genes were multifarious and most genes that are expressed in green tissues may relate to maize photosynthesis. The qRT-PCR showed that the expression of these genes was sensitive to low temperature and drought. Furthermore, we analyzed differences of ZmGs specific to cultivars in temperate and tropical regions at the population level. Interestingly, the single nucleotide polymorphism (SNP analysis revealed that nucleotide polymorphism associated with different temperature zones. Above all, G2-like genes were highly conserved during evolution, but polymorphism could be caused due to a different geographical location. Moreover, G2-like genes might be related to cold and drought stresses.
Directory of Open Access Journals (Sweden)
Yoshinari Yamamoto
2017-08-01
Full Text Available Sepsis is a life-threatening, overwhelming immune response to infection with high morbidity and mortality. Inflammatory response and blood clotting are caused by sepsis, which induces serious organ damage and death from shock. As a mechanism of pathogenesis, platelet-activating factor (PAF induces excessive inflammatory responses and blood clotting. In this study, we demonstrate that a Class A CpG oligodeoxynucleotide (CpG-A1585 strongly induced PAF acetylhydrolase, which generates lyso-PAF. CpG-A1585 rescued mice from acute lethal shock and decreased fibrin deposition, a hallmark of PAF-induced disseminated intravascular coagulation. Furthermore, CpG-A1585 improved endotoxin shock induced by lipopolysaccharide, which comprises the cell wall of Gram-negative bacteria and inhibits inflammatory responses induced by cytokines such as interleukin-6 and tumor necrosis factor-α. These results suggest that CpG-A1585 is a potential therapeutic target to prevent sepsis-related induction of PAF.
g-factors in deformed nuclei: Annual report, September 1, 1983-August 31, 1984
International Nuclear Information System (INIS)
Krane, K.S.
1984-01-01
This report describes work performed for the period September 1, 1983 to August 31, 1984 under the contract DE-AT06-83ER40109, /open quotes/g-Factors in Deformed Nuclei./close quotes/ The literature survey has been completed and the first stage of the raw data analysis has been accomplished. A preliminary data summary prepared for publication is attached
Factores de riesgo y consecuencias de la violencia de género en Colombia
Molina Giraldo, Estefanía
2016-01-01
Trabajo de grado (Comunicación Social y Periodismo). Universidad de Manizales. Facultad de Ciencias Sociales y Humanas, 2016 Artículo de revisión centrado en los factores de riesgo y las consecuencias de la violencia de género. Se revisaron y estudiaron 55 artículos producto de investigación bajo la técnica de análisis de contenido. Los resultados arrojaron factores de riesgo sociales, culturales y vinculares como consumo de alcohol, sustancias alucinógenas, desempleo, dificultades laboral...
Comparison of tomography reconstruction by maximum entropy and filtered retro projection
International Nuclear Information System (INIS)
Abdala, F.J.P.; Simpson, D.M.; Roberty, N.C.
1992-01-01
The tomographic reconstruction with few projections is studied, comparing the maximum entropy method with filtered retro projection. Simulations with and without the presence of noise and also with the presence of an object of high density inside of the skull are showed. (C.G.C.)
Risk factors for bronchopulmonary dysplasia in neonates born at ≤ 1500 g (1999-2009).
Zhang, Hongshan; Fang, Jianpei; Su, Haobin; Chen, Miao
2011-12-01
Advances in perinatal care have improved the survival rate for very low-birthweight (VLBW) infants in China. The incidence of bronchopulmonary dysplasia (BPD), however, has not been reduced. The objective of the present study was to identify the perinatal risk factors for BPD in neonates born at ≤ 1500 g. A retrospective analysis of data for neonates born at ≤ 1500 g between 1999 and 2009 in the neonatal intensive care unit (NICU) of Second Affiliated Hospital of Sun Yat-Sen University, Guangzhou city, China, was carried out. Out of a total of 11,506 live births, 3538 infants were admitted to level II nursery and NICU (level III nursery). Among 149 preterm infants born at ≤ 1500 g, 77.8% survived until day 28, and the incidence of BPD was 48.3%. Logistic regression analysis showed that gestational age (GA) ≤ 30 weeks (odds ratio [OR], 9.507; 95% confidence intervals [95%CI]: 2.604-34.707), maternal chorioamnionitis (OR, 41.987; 95%CI: 6.048-291.492), ventilation-associated pneumonia (OR, 11.600; 95%CI: 2.847-47.268), and more than three blood transfusions (OR, 10.214; 95%CI: 2.191-47.623) were associated with the development of BPD. Clinical evidence has been provided for possibly significant risk factors associated with BPD in neonates born at ≤ 1500 g, which can provide useful information for further research to improve survival of VLBW infants and decrease the incidence of BPD. © 2011 The Authors. Pediatrics International © 2011 Japan Pediatric Society.
International Nuclear Information System (INIS)
Anon.
1979-01-01
This chapter presents a historic overview of the establishment of radiation guidelines by various national and international agencies. The use of maximum permissible dose and maximum permissible body burden limits to derive working standards is discussed
Vagnini, Laura D.; Nascimento, Adriana M.; Canas, Maria do Carmo T.; Renzi, Adriana; Oliveira-Pelegrin, Gabriela R.; Petersen, Claudia G.; Mauri, Ana L.; Oliveira, João Batista A.; Baruffi, Ricardo L.R.; Cavagna, Mario; Franco, José G.
2015-01-01
Objective The aim of this study was to investigate the relationship between herpesvirus-associated ubiquitin-specific protease (HAUSP A/G, rs1529916), tumor protein p53 (TP53 Arg/Pro, rs1042522), leukemia inhibitory factor (LIF G/T, rs929271), glycoprotein 130 (gp130 A/T, rs1900173) and vascular endothelial growth factor (VEGF G/A, rs1570360) polymorphisms and recurrent implantation failure (RIF) in Brazilian women. Subjects and Methods A total of 120 women with RIF (i.e. those with ≥5 cleaved embryos transferred and a minimum of 2 failed in vitro fertilization/intracytoplasmic sperm injection attempts) were included. The control group involved 89 women who had experienced at least 1 live birth (without any infertility treatment). DNA was extracted from the peripheral blood of all participants, and the abovementioned single-nucleotide polymorphisms (SNPs) were genotyped by real-time polymerase chain reaction. The data were evaluated using Fisher's test. Results A significant difference between the RIF and control groups was found in the VEGF gene where the GG genotype showed a 2.1-fold increased chance of not being included in the RIF group, while the presence of an A allele increased this risk 1.6-fold. No significant differences were found for the other polymorphisms. Conclusion This study showed an association between the VEGF -1154G/A polymorphism and RIF in Brazilian women. PMID:26305668
Structure of Os - Pt nuclei and g factors of 186-192Os isotopes at low spins
International Nuclear Information System (INIS)
Ansari, A.
1987-10-01
Employing a pairing + quadrupole model interaction, especially suitable for the Os - Pt region, the ground state structure of these nuclei is investigated following a selfconsistent Hartree-Fock-Bogolyubov (HFB) approach. Effects of the inclusion of hexadecapole degrees of freedom in the Hamiltonian are also studied. All the osmium isotopes considered here come out to be prolate in shape in the ground state. 186 Pt is triaxial with γ=12 deg. and with the increasing mass number they gradually go over to the oblate shape at A=190 itself. In view of recent experimental data on g factors of osmium isotopes which show interesting variations as a function of mass number as well as spin, we have calculated these following the methods of variation after exact angular momentum projection of axial HFB wave functions and the cranked HFB theory. The observed trend of the variation of g factor at I=2 with the mass number is reproduced with very minor adjustments of the force constants of the Hamiltonian in both the approaches. However, the variation of g factor with spin, which is sensitive to the interplay between collective and the single particle degrees of freedom, can be understood only in the cranking approach. (author). 52 refs, 8 figs, 6 tabs
Wittmann, J. J.; Can, T. V.; Eckardt, M.; Harneit, W.; Griffin, R. G.; Corzilius, B.
2018-05-01
The electronic g factor carries highly useful information about the electronic structure of a paramagnetic species, such as spin-orbit coupling and dia- or paramagnetic (de-)shielding due to local fields of surrounding electron pairs. However, in many cases, a near "spin-only" case is observed, in particular for light elements, necessitating accurate and precise measurement of the g factors. Such measurement is typically impeded by a "chicken and egg situation": internal or external reference standards are used for relative comparison of electron paramagnetic resonance (EPR) Larmor frequencies. However, the g factor of the standard itself usually is subject to a significant uncertainty which directly limits the precision and/or accuracy of the sought after sample g factor. Here, we apply an EPR reference-free approach for determining the g factor of atomic nitrogen trapped within the endohedral fullerene C60:N@C60 in its polycrystalline state by measuring the 1H NMR resonance frequency of dispersing toluene at room temperature. We found a value of g = 2.00204 (4) with a finally reached relative precision of ∼20 ppm. This accurate measurement allows us to directly compare the electronic properties of N@C60 to those found in atomic nitrogen in the gas phase or trapped in other solid matrices at liquid helium temperature. We conclude that spin-orbit coupling in N@C60 at room temperature is very similar in magnitude and of same sign as found in other inert solid matrices and that interactions between the quartet spin system and the C60 molecular orbitals are thus negligible.
International Nuclear Information System (INIS)
Watanabe, H.; Asahi, K.; Kishida, T.; Ueno, H.; Sato, W.; Yoshimi, A.; Kobayashi, Y.; Kameda, D.; Miyoshi, H.; Fukuchi, T.; Wakabayashi, Y.; Sasaki, T.; Kibe, M.; Hokoiwa, N.; Odahara, A.; Cederwall, B.; Lagergren, K.; Podolyak, Zs.; Ishihara, M.; Gono, Y.
2004-01-01
A technique for providing high-spin isomers as probes of the fusion reaction and the measurement of g-factor has been worked out at RIKEN. In the study of the fusion reaction 12 C( 145m Sm,xn) 157-x Er, the γ rays emitted from the fusion-evaporation residue 154 Er have been successfully observed. The nuclear g-factor of the T 1/2 = 28 ns high-spin isomer in 149 Dy has been measured with the γ-ray TDPAD method
Johnston, T P
1996-01-01
The adsorption of recombinant-derived proteins to glass and polymeric materials used in their packaging and delivery remains a problem. Loss of these very expensive proteins to surface adsorption not only results in reduced yields during purification and scale-up, but also to decreased therapeutic efficacy. The purpose of the present investigation was to inhibit/minimize adsorption of a model protein, namely, recombinant human granulocyte colony stimulating factor (rhG-CSF) to glass, polyvinyl chloride (PVC), and polypropylene by inclusion of select solvent additives. Solvent additives used to inhibit/minimize surface adsorption included glycerin, U.S.P. (0.5%, 1%, 5%, and 25% v/v), Pluronic F-127 (0.005%, 0.05%, and 0.5% w/w), Pluronic F-68 (0.005%, 0.05%, and 0.5% w/w), Tween 80 (0.005% and 0.05% w/w) and Tween 20 (0.005%, 0.05%, and 0.5% w/w). Over the rhG-CSF concentration range of 0.0 ng/ml to 300 ng/ml, the amount of rhG-CSF bound per cm2 of PVC increased with an increase in the rhG-CSF concentration tested. At rhG-CSF equilibrium concentrations of 262 +/- 3.7 ng/ml and 136 +/- 1.9 ng/ml, the rhG-CSF bound/cm2 of PVC at 22 degrees C and 45 degrees C reached a maximum of 37.6 +/- 9.8 ng/cm2 and 165.2 +/- 11.7 ng/cm2, respectively. The adsorption isotherms determined at each temperature were described by the classic Freundlich equation. Moreover, the rate of adsorption of rhG-CSF to PVC was extremely rapid. The mean values of the percent of rhG-CSF bound to PVC after only 10 minutes of equilibration at 22 degrees C and 45 degrees C were 92.8 +/- 9.2 percent and 97.3 +/- 17.9 percent, respectively. The mean values of the percent of rhG-CSF bound to PVC at 22 degrees C and 45 degrees C after 24 hours were 52.4 +/- 10.9% and 70.0 +/- 9.7%, respectively, indicating that some desorption of rhG-CSF does occur during 24 hr. However, surface adsorption of rhG-CSF to PVC was shown to be irreversible over a 1 hr time period. Using viscometry, an estimate of the thickness
Development of an experiment for ultrahigh-precision g-factor measurements in a Penning-trap setup
Energy Technology Data Exchange (ETDEWEB)
Alonso Otamendi, J.
2007-07-13
This thesis is concerned with the design and construction of an experimental setup aiming to perform ultrahigh-precision g-factor measurements on a bound electron in highly-charged ions. The g-factor of a particle is a dimensionless constant which determines the strength of its interaction with a magnetic field. In the case of an electron bound to a highly-charged ion, it serves as one of the most stringent tests of bound-state quantum electrodynamics (BS-QED). The measurement is based on a triple-Penning-trap system and the continuous Stern-Gerlach effect. The first part of the thesis is devoted to the current knowledge on magnetic moments and motivates the techniques and experimental setup used during the work described. As a major challenge to overcome, the charge breeding of the ions is dealt with in detail, along with the solution found, based on a field-emission-point array. The tools included allow for the measurement of ionization cross-sections by electron impact. The last part of the thesis is dedicated to the design and operation of the triple-Penning-trap setup and the detection schemes implemented. At present, all the experimental setup for the production of highly-charged ions and the corresponding g-factor measurement is completely finalized, including the control system needed for the first measurement stages, so the ion-creation and charge-breeding processes will be the next steps to be taken. (orig.)
Development of an experiment for ultrahigh-precision g-factor measurements in a Penning-trap setup
International Nuclear Information System (INIS)
Alonso Otamendi, J.
2007-01-01
This thesis is concerned with the design and construction of an experimental setup aiming to perform ultrahigh-precision g-factor measurements on a bound electron in highly-charged ions. The g-factor of a particle is a dimensionless constant which determines the strength of its interaction with a magnetic field. In the case of an electron bound to a highly-charged ion, it serves as one of the most stringent tests of bound-state quantum electrodynamics (BS-QED). The measurement is based on a triple-Penning-trap system and the continuous Stern-Gerlach effect. The first part of the thesis is devoted to the current knowledge on magnetic moments and motivates the techniques and experimental setup used during the work described. As a major challenge to overcome, the charge breeding of the ions is dealt with in detail, along with the solution found, based on a field-emission-point array. The tools included allow for the measurement of ionization cross-sections by electron impact. The last part of the thesis is dedicated to the design and operation of the triple-Penning-trap setup and the detection schemes implemented. At present, all the experimental setup for the production of highly-charged ions and the corresponding g-factor measurement is completely finalized, including the control system needed for the first measurement stages, so the ion-creation and charge-breeding processes will be the next steps to be taken. (orig.)
International Nuclear Information System (INIS)
Hutchinson, Thomas H.; Boegi, Christian; Winter, Matthew J.; Owens, J. Willie
2009-01-01
There is increasing recognition of the need to identify specific sublethal effects of chemicals, such as reproductive toxicity, and specific modes of actions of the chemicals, such as interference with the endocrine system. To achieve these aims requires criteria which provide a basis to interpret study findings so as to separate these specific toxicities and modes of action from not only acute lethality per se but also from severe inanition and malaise that non-specifically compromise reproductive capacity and the response of endocrine endpoints. Mammalian toxicologists have recognized that very high dose levels are sometimes required to elicit both specific adverse effects and present the potential of non-specific 'systemic toxicity'. Mammalian toxicologists have developed the concept of a maximum tolerated dose (MTD) beyond which a specific toxicity or action cannot be attributed to a test substance due to the compromised state of the organism. Ecotoxicologists are now confronted by a similar challenge and must develop an analogous concept of a MTD and the respective criteria. As examples of this conundrum, we note recent developments in efforts to validate protocols for fish reproductive toxicity and endocrine screens (e.g. some chemicals originally selected as 'negatives' elicited decreases in fecundity or changes in endpoints intended to be biomarkers for endocrine modes of action). Unless analogous criteria can be developed, the potentially confounding effects of systemic toxicity may then undermine the reliable assessment of specific reproductive effects or biomarkers such as vitellogenin or spiggin. The same issue confronts other areas of aquatic toxicology (e.g., genotoxicity) and the use of aquatic animals for preclinical assessments of drugs (e.g., use of zebrafish for drug safety assessment). We propose that there are benefits to adopting the concept of an MTD for toxicology and pharmacology studies using fish and other aquatic organisms and the
Measurement of the Depth of Maximum of Extensive Air Showers above 10^18 eV
Energy Technology Data Exchange (ETDEWEB)
Abraham, J.; /Buenos Aires, CONICET; Abreu, P.; /Lisbon, IST; Aglietta, M.; /Turin U. /INFN, Turin; Ahn, E.J.; /Fermilab; Allard, D.; /APC, Paris; Allekotte, I.; /Centro Atomico Bariloche /Buenos Aires, CONICET; Allen, J.; /New York U.; Alvarez-Muniz, J.; /Santiago de Compostela U.; Ambrosio, M.; /Naples U.; Anchordoqui, L.; /Wisconsin U., Milwaukee; Andringa, S.; /Lisbon, IST /Boskovic Inst., Zagreb
2010-02-01
We describe the measurement of the depth of maximum, X{sub max}, of the longitudinal development of air showers induced by cosmic rays. Almost 4000 events above 10{sup 18} eV observed by the fluorescence detector of the Pierre Auger Observatory in coincidence with at least one surface detector station are selected for the analysis. The average shower maximum was found to evolve with energy at a rate of (106{sub -21}{sup +35}) g/cm{sup 2}/decade below 10{sup 18.24 {+-} 0.05}eV, and (24 {+-} 3) g/cm{sup 2}/decade above this energy. The measured shower-to-shower fluctuations decrease from about 55 to 26 g/cm{sup 2}. The interpretation of these results in terms of the cosmic ray mass composition is briefly discussed.
Bernard, J; Beldame, J; Van Driessche, S; Brunel, H; Poirier, T; Guiffault, P; Matsoukis, J; Billuart, F
2017-11-01
Minimally invasive total hip arthroplasty (THA) is presumed to provide functional and clinical benefits, whereas in fact the literature reveals that gait and posturographic parameters following THA do not recover values found in the general population. There is a significant disturbance of postural sway in THA patients, regardless of the surgical approach, although with some differences between approaches compared to controls: the anterior and anterolateral minimally invasive approaches seem to be more disruptive of postural parameters than the posterior approach. Electromyographic (EMG) study of the hip muscles involved in surgery [gluteus maximus (GMax), gluteus medius (GMed), tensor fasciae latae (TFL), and sartorius (S)] could shed light, the relevant literature involves discordant methodologies. We developed a methodology to assess EMG activity during maximal voluntary contraction (MVC) of the GMax, GMed, TFL and sartorius muscles as a reference for normalization. A prospective study aimed to assess whether hip joint positioning and the learning curve on an MVC test affect the EMG signal during a maximal voluntary contraction. Hip positioning and the learning curve on an MVC test affect EMG signal during MVC of GMax, GMed, TFL and S. Thirty young asymptomatic subjects participated in the study. Each performed 8 hip muscle MVCs in various joint positions recorded with surface EMG sensors. Each MVC was performed 3 times in 1 week, with the same schedule every day, controlling for activity levels in the preceding 24h. EMG activity during MVC was expressed as a ratio of EMG activity during unipedal stance. Non-parametric tests were applied. Statistical analysis showed no difference according to hip position for abductors or flexors in assessing EMG signal during MVC over the 3 sessions. Hip abductors showed no difference between abduction in lateral decubitus with hip straight versus hip flexed: GMax (19.8±13.7 vs. 14.5±7.8, P=0.78), GMed (13.4±9.0 vs. 9.9±6
Down-link power distributions for 2G and 3G mobile communication networks
International Nuclear Information System (INIS)
Colombi, D.; Thors, B.; Persson, T.; Wiren, N.; Larsson, L. E.; Jonsson, M.; Toernevik, C.
2013-01-01
Knowledge of realistic power levels is key when conducting accurate EMF exposure assessments. In this study, down-link output power distributions for radio base stations in 2G and 3G mobile communication networks have been assessed. The distributions were obtained from network measurement data collected from the Operations Support System, which normally is used for network monitoring and management. Significant amounts of data were gathered simultaneously for large sets of radio base stations covering wide geographical areas and different environments. The method was validated with in situ measurements. For the 3G network, the 90. percentile of the averaged output power during high traffic hours was found to be 43 % of the maximum available power. The corresponding number for 2G, with two or more transceivers installed, was 65 % or below. (authors)
International Nuclear Information System (INIS)
Sun, Yang; Zhang, Jing-ye; Guidry, Mike
2001-01-01
Interplay of collective and single-particle degrees of freedom is a common phenomenon in strongly correlated many-body systems. Despite many successful efforts in the study of superdeformed nuclei, there is still unexplored physics that can be best understood only through the nuclear magnetic properties. We point out that study of the gyromagnetic factor (g factor) may open a unique opportunity for understanding superdeformed structure. Our calculations suggest that investigation of the g-factor dependence on spin and particle number can provide important information on single-particle structure and its interplay with collective motion in the superdeformed mass-190 nuclei. Modern experimental techniques combined with the new generation of sensitive detectors should be capable of testing our predictions
Factores de riesgo cardiovascular desde la perspectiva de sexo y género
Directory of Open Access Journals (Sweden)
Mariana García
2018-01-01
Full Text Available Resumen: Los diferentes procesos biológicos entre hombres y mujeres se denominan diferencias de sexo y con frecuencia estos reproducibles en modelos animales. En cuanto a enfermedades cardiovasculares, diferencias hormonales que por ende tienen impacto en la expresión y función génica en los cromosomas sexuales, dan como resultado ciertas variaciones respecto a la prevalencia y presentación de condiciones cardiovasculares, incluyendo aquellas asociadas con regulación autonómica, hipertensión, diabetes, remodelación vascular y cardiaca. En contraste, las diferencias de género son únicas para el ser humano y surgen de prácticas socioculturales (medio ambiente, estilo de vida, nutrición. Con el fin de incrementar la calidad en el cuidado clínico desde la perspectiva de las enfermedades cardiovasculares en las mujeres, este capítulo examinará aquellos factores de riesgo cardiovasculares, tanto tradicionales como aquellos únicos y emergentes en la mujer. Abstract: The different biological processes between men and women are termed sex differences, and are frequently reproducible in animal models. With regard to cardiovascular diseases, hormonal differences, which ultimately have an impact on gene expression and function in the sex chromosomes, produce certain variations in the prevalence and presentation of cardiovascular conditions, including those associated with autonomic regulation, hypertension, diabetes and vascular and cardiac remodeling. In contrast, gender differences are unique to human beings and arise from sociocultural practices (environment, lifestyle, nutrition. In order to increase the quality of clinical care from a women's cardiovascular disease perspective, this chapter will examine cardiovascular risk factors, both the traditional ones as well as those that are unique to, and emerging in, women. Palabras clave: Factores de riesgo cardiovascular, Mujer, Enfermedad cardiovascular, Keywords: Cardiovascular risk
Arora, Satyam; Doda, Veena; Kotwal, Urvershi; Dogra, Mitu
2016-02-01
Platelet derived biomaterials represent a key source of cytokines and growth factors extensively used for tissue regeneration; wound healing and tissue repair. Our study was to quantify platelets and growth factors released by PRP when prepared at different centrifugal force (g) and time. Our study was approved by the institutional ethical committee. One hundred millilitres of whole blood (WB) was collected in bag with CPDA as the anticoagulant(AC); (14 mL for 100 mL WB ratio). Nine aliquots of 10 mL each were made from the bag and set of three aliquots were made a group. PRP was prepared at varying centrifugal force (group A: -110 g, group B: -208 g & group C: -440 g) & time (1: -5 min, 2: -10 min & 3: -20 min). Contents of each PRP prepared were analysed. Commercial sandwich ELISA kits were used to quantify the concentrations of CD62P (Diaclone SAS; France), Platelet derived growth factors-AB (Qayee-Bio; China), transforming growth factor-β1 (DRG; Germany) and vascular endothelial growth factor (Boster Immuno Leader; USA) released in each PRP prepared. Eight volunteers were enrolled in the study (24-30 years). The baseline blood counts of all the volunteers were comparable (p ≥ 0.05). Mean ± SD of platelet yield of all nine groups ranged from 17.2 ± 4.2% to 78.7 ± 5.7%. Each PRP was activated with calcified thromboplastin to quantify the growth factors released by them. Significantly higher (p < 0.05) transforming growth factor-β1 and vascular endothelial growth factor were released compared to the baseline. Our study highlights the variation in both force (g) and time results in changes at cellular level and growth factor concentrations. Copyright © 2016 Elsevier Ltd. All rights reserved.
The maximum sizes of large scale structures in alternative theories of gravity
Energy Technology Data Exchange (ETDEWEB)
Bhattacharya, Sourav [IUCAA, Pune University Campus, Post Bag 4, Ganeshkhind, Pune, 411 007 India (India); Dialektopoulos, Konstantinos F. [Dipartimento di Fisica, Università di Napoli ' Federico II' , Complesso Universitario di Monte S. Angelo, Edificio G, Via Cinthia, Napoli, I-80126 Italy (Italy); Romano, Antonio Enea [Instituto de Física, Universidad de Antioquia, Calle 70 No. 52–21, Medellín (Colombia); Skordis, Constantinos [Department of Physics, University of Cyprus, 1 Panepistimiou Street, Nicosia, 2109 Cyprus (Cyprus); Tomaras, Theodore N., E-mail: sbhatta@iitrpr.ac.in, E-mail: kdialekt@gmail.com, E-mail: aer@phys.ntu.edu.tw, E-mail: skordis@ucy.ac.cy, E-mail: tomaras@physics.uoc.gr [Institute of Theoretical and Computational Physics and Department of Physics, University of Crete, 70013 Heraklion (Greece)
2017-07-01
The maximum size of a cosmic structure is given by the maximum turnaround radius—the scale where the attraction due to its mass is balanced by the repulsion due to dark energy. We derive generic formulae for the estimation of the maximum turnaround radius in any theory of gravity obeying the Einstein equivalence principle, in two situations: on a spherically symmetric spacetime and on a perturbed Friedman-Robertson-Walker spacetime. We show that the two formulae agree. As an application of our formula, we calculate the maximum turnaround radius in the case of the Brans-Dicke theory of gravity. We find that for this theory, such maximum sizes always lie above the ΛCDM value, by a factor 1 + 1/3ω, where ω>> 1 is the Brans-Dicke parameter, implying consistency of the theory with current data.
Smart Global Maximum Power Point Tracking Controller of Photovoltaic Module Arrays
Directory of Open Access Journals (Sweden)
Long-Yi Chang
2018-03-01
Full Text Available This study first explored the effect of shading on the output characteristics of modules in a photovoltaic module array. Next, a modified particle swarm optimization (PSO method was employed to track the maximum power point of the multiple-peak characteristic curve of the array. Through the optimization method, the weighting value and cognition learning factor decreased with an increasing number of iterations, whereas the social learning factor increased, thereby enhancing the tracking capability of a maximum power point tracker. In addition, the weighting value was slightly modified on the basis of the changes in the slope and power of the characteristic curve to increase the tracking speed and stability of the tracker. Finally, a PIC18F8720 microcontroller was coordinated with peripheral hardware circuits to realize the proposed PSO method, which was then adopted to track the maximum power point of the power–voltage (P–V output characteristic curve of the photovoltaic module array under shading. Subsequently, tests were conducted to verify that the modified PSO method exhibited favorable tracking speed and accuracy.
Studies of the g factors of the ground 4A2 and the first excited 2E state of Cr 3+ ions in emerald
Wei, Qun; Guo, Li-Xin; Yang, Zi-Yuan; Wei, Bing
2011-09-01
By using complete diagonalization method, the zero-field splitting and g factors of the ground 4A2 and the first excited 2E states of Cr 3+ ions in emerald are calculated. The theoretical results are in good agreement with the experimental data. The dependencies of the g factors on the crystal field parameters, including Dq, v, and v', have been studied. It is shown that, the g factors of the ground state varied with the crystal field parameters approximately in a linear way, but the g factors of the first excited state varied nonlinearly with these parameters.
The prior-derived F constraints in the maximum-entropy method
Czech Academy of Sciences Publication Activity Database
Palatinus, Lukáš; van Smaalen, S.
2005-01-01
Roč. 61, - (2005), s. 363-372 ISSN 0108-7673 Institutional research plan: CEZ:AV0Z10100521 Keywords : charge density * maximum-entropy method * sodium nitrite Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.791, year: 2005
Konishi, Haruhisa; Takehara, Kazuhiro; Kojima, Atsumi; Okame, Shinichi; Yamamoto, Yasuko; Shiroyama, Yuko; Yokoyama, Takashi; Nogawa, Takayoshi; Sugawara, Yoshifumi
2014-09-01
Fluorodeoxyglucose positron emission tomography/computed tomography (FDG-PET/CT) is useful for diagnosing malignant tumors. Intracellular FDG uptake is measured as the standardized uptake value (SUV), which differs depending on tumor characteristics. This study investigated differences in maximum SUV (SUVmax) according to histologic type in ovarian epithelial cancer and the relationship of SUVmax with prognosis. This study included 80 patients with ovarian epithelial cancer based on histopathologic findings at surgery and who had undergone PET/CT before treatment. Maximum SUV on PET/CT of primary lesions and histopathology were compared based on histologic type, and the prognosis associated with different SUVmax was evaluated. Clinical tumor stage was I in 35 patients, II in 8, III in 25, and IV in 12. Histologic type was serous adenocarcinoma (AC) in 33 patients, clear cell AC in 27, endometrioid AC in 15, and mucinous AC in 5. Median SUVmax was lower in mucinous AC (2.76) and clear cell AC (4.9) than in serous AC (11.4) or endometrioid AC (11.4). Overall, median SUVmax was lower in clinical stage I (5.37) than in clinical stage ≥II (10.3). However, in both clear cell AC and endometrioid AC, when histologic evaluation was possible, no difference was seen between stage I and stage ≥II. Moreover, in clear cell AC, the 5-year survival rate was significantly higher in the low-SUVmax group (100%) than in the high-SUVmax group (43.0%, P = 0.009). Maximum SUV on preoperative FDG-PET/CT in ovarian epithelial cancer differs according to histologic type. In clear cell AC, SUVmax may represent a prognostic factor.
An investigation of rugby scrimmaging posture and individual maximum pushing force.
Wu, Wen-Lan; Chang, Jyh-Jong; Wu, Jia-Hroung; Guo, Lan-Yuen
2007-02-01
Although rugby is a popular contact sport and the isokinetic muscle torque assessment has recently found widespread application in the field of sports medicine, little research has examined the factors associated with the performance of game-specific skills directly by using the isokinetic-type rugby scrimmaging machine. This study is designed to (a) measure and observe the differences in the maximum individual pushing forward force produced by scrimmaging in different body postures (3 body heights x 2 foot positions) with a self-developed rugby scrimmaging machine and (b) observe the variations in hip, knee, and ankle angles at different body postures and explore the relationship between these angle values and the individual maximum pushing force. Ten national rugby players were invited to participate in the examination. The experimental equipment included a self-developed rugby scrimmaging machine and a 3-dimensional motion analysis system. Our results showed that the foot positions (parallel and nonparallel foot positions) do not affect the maximum pushing force; however, the maximum pushing force was significantly lower in posture I (36% body height) than in posture II (38%) and posture III (40%). The maximum forward force in posture III (40% body height) was also slightly greater than for the scrum in posture II (38% body height). In addition, it was determined that hip, knee, and ankle angles under parallel feet positioning are factors that are closely negatively related in terms of affecting maximum pushing force in scrimmaging. In cross-feet postures, there was a positive correlation between individual forward force and hip angle of the rear leg. From our results, we can conclude that if the player stands in an appropriate starting position at the early stage of scrimmaging, it will benefit the forward force production.
Individual Module Maximum Power Point Tracking for a Thermoelectric Generator Systems
DEFF Research Database (Denmark)
Vadstrup, Casper; Chen, Min; Schaltz, Erik
Thermo Electric Generator (TEG) modules are often connected in a series and/or parallel system in order to match the TEG system voltage with the load voltage. However, in order to be able to control the power production of the TEG system a DC/DC converter is inserted between the TEG system...... and the load. The DC/DC converter is under the control of a Maximum Power Point Tracker (MPPT) which insures that the TEG system produces the maximum possible power to the load. However, if the conditions, e.g. temperature, health, etc., of the TEG modules are different each TEG module will not produce its...
Maximum Solutions of Normalized Ricci Flow on 4-Manifolds
Fang, Fuquan; Zhang, Yuguang; Zhang, Zhenlei
2008-10-01
We consider the maximum solution g( t), t ∈ [0, + ∞), to the normalized Ricci flow. Among other things, we prove that, if ( M, ω) is a smooth compact symplectic 4-manifold such that {b_2^+(M) > 1} and let g( t), t ∈ [0, ∞), be a solution to (1.3) on M whose Ricci curvature satisfies that |Ric( g( t))| ≤ 3 and additionally χ( M) = 3τ ( M) > 0, then there exists an {min mathbb{N}} , and a sequence of points { x j, k ∈ M}, j = 1, . . . , m, satisfying that, by passing to a subsequence, {{(M, g(tk+t), x_{1,k},ldots, x_{m,k})stackrel{d_{GH}}longrightarrow ({\\coprod limitsm_{j=1}} N_j , g_{infty}, x_{1,infty}, ldots, x_{m,infty}),}} t ∈ [0, ∞), in the m-pointed Gromov-Hausdorff sense for any sequence t k → ∞, where ( N j , g ∞), j = 1, . . . , m, are complete complex hyperbolic orbifolds of complex dimension 2 with at most finitely many isolated orbifold points. Moreover, the convergence is C ∞ in the non-singular part of {\\coprod _1^m Nj} and {text{Vol}_{g0}(M)=sum_{j=1}mtext{Vol}_{g_{infty}}(Nj)} , where χ( M) (resp. τ( M)) is the Euler characteristic (resp. signature) of M.
Kirk, David G.; Zhang, Zhen; Korkeala, Hannu; Lindström, Miia
2014-01-01
Clostridium botulinum produces heat-resistant endospores that may germinate and outgrow into neurotoxic cultures in foods. Sporulation is regulated by the transcription factor Spo0A and the alternative sigma factors SigF, SigE, SigG, and SigK in most spore formers studied to date. We constructed mutants of sigF, sigE, and sigG in C. botulinum ATCC 3502 and used quantitative reverse transcriptase PCR and electron microscopy to assess their expression of the sporulation pathway on transcription...
On a Weak Discrete Maximum Principle for hp-FEM
Czech Academy of Sciences Publication Activity Database
Šolín, Pavel; Vejchodský, Tomáš
-, č. 209 (2007), s. 54-65 ISSN 0377-0427 R&D Projects: GA ČR(CZ) GA102/05/0629 Institutional research plan: CEZ:AV0Z20570509; CEZ:AV0Z10190503 Keywords : discrete maximum principle * hp-FEM Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 0.943, year: 2007
Vinogradov, Alexander E
2005-12-01
In this article, I show that, in the human genome, the GC content in genes (but not the CpG island in the promoter) is related to the maximum level of gene expression among tissues, whereas the promoter CpG island and gene CpG level are more strongly related to the breadth of expression among tissues. The relevance of gene GC content to expression cannot be a consequence (i.e. a byproduct) of transcription because it does not correlate with expression in the germline. The variation of GC content and CpG level can determine the characteristics of gene expression in a synergistic interplay with transcription-factor-binding sites (mediated by chromatin condensation).
International Nuclear Information System (INIS)
Danchev, M.; Pavan, J.; Stone, N.J.; Stuchbery, A.E.; Baktash, C.; Beene, J.; Benczer-Koller, N.; Bingham, C.R.; Dupak, J.; Galindo-Uribarri, A.; Gross, C.J.; Kumbartzki, G.; Radford, D.C.; Stone, J.R.; Timlin, C.L.; Yu, C.-H.; Zamfir, N.V.
2005-01-01
We demonstrate that the recoil-in-vacuum (RIV) method can be used to determine the g-factor of the Coulumb excited first 2 + state of 132 Te. This was possible owing to advantages provided by CLARION (ORNL clover multi-detector array) and the segmented charged particle detector HyBall. Calibratory experiments were performed with 122,126,13 Te and a g-factor of 132 Te was deduced g = (+)0.35(5)
Human granulocyte colony-stimulating factor (hG-CSF) expression in plastids of Lactuca sativa.
Sharifi Tabar, Mehdi; Habashi, Ali Akbar; Rajabi Memari, Hamid
2013-01-01
Human granulocyte colony-stimulating factor (hG-CSF) can serve as valuable biopharmaceutical for research and treatment of the human blood cancer. Transplastomic plants have been emerged as a new and high potential candidate for production of recombinant biopharmaceutical proteins in comparison with transgenic plants due to extremely high level expression, biosafety and many other advantages. hG-CSF gene was cloned into pCL vector between prrn16S promoter and TpsbA terminator. The recombinant vector was coated on nanogold particles and transformed to lettuce chloroplasts through biolistic method. Callogenesis and regeneration of cotyledonary explants were obtained by Murashige and Skoog media containing 6-benzylaminopurine and 1-naphthaleneacetic acid hormones. The presence of hG-CSF gene in plastome was studied with four specific PCR primers and expression by Western immunoblotting. hG-CSF gene cloning was confirmed by digestion and sequencing. Transplastomic lettuce lines were regenerated and subjected to molecular analysis. The presence of hG-CSF in plastome was confirmed by PCR using specific primers designed from the plastid genome. Western immunoblotting of extracted protein from transplastomic plants showed a 20-kDa band, which verified the expression of recombinant protein in lettuce chloroplasts. This study is the first report that successfully express hG-CSF gene in lettuce chloroplast. The lettuce plastome can provide a cheap and safe expression platform for producing valuable biopharmaceuticals for research and treatment.
Schellart, W. P.; Rawlinson, N.
2013-01-01
The maximum earthquake magnitude recorded for subduction zone plate boundaries varies considerably on Earth, with some subduction zone segments producing giant subduction zone thrust earthquakes (e.g. Chile, Alaska, Sumatra-Andaman, Japan) and others producing relatively small earthquakes (e.g.
Directory of Open Access Journals (Sweden)
Saray Sánchez
2007-09-01
Full Text Available Se realizó un estudio en la Estación Experimental de Pastos y Forrajes "Indio Hatuey", Matanzas, Cuba, con el objetivo de determinar la acumulación de la hojarasca en un pastizal de Panicum maximum Jacq cv. Likoni y en un sistema silvopastoril de Panicum maximum y Leucaena leucocephala (Lam de Wit cv. Cunningham. En los pastizales de P. maximum de ambos sistemas se determinó la acumulación de la hojarasca según la técnica propuesta por Bruce y Ebershon (1982, mientras que la hojarasca de L. leucocephala acumulada en el sistema silvopastoril se determinó según Santa Regina et al. (1997. De forma general, los resultados demostraron que en ambos pastizales la guinea acumuló una menor cantidad de hojarasca durante el período junio-diciembre, etapa en la que se produce su mayor desarrollo vegetativo. En la leucaena la mayor producción de hojarasca ocurrió en el período de diciembre a enero, asociada con la caída natural de sus hojas que se produce por efecto de las temperaturas más bajas y la escasa humedad en el suelo. En el sistema silvopastoril la hojarasca de leucaena representó el mayor porcentaje de peso dentro de la producción total, con un contenido más alto de nitrógeno y de calcio que el de la hojarasca del estrato herbáceo. En la guinea la lluvia fue el factor climático que mayor correlación negativa presentó con la producción de hojarasca en ambos sistemas, y en la leucaena la mayor correlación negativa se encontró con la temperatura mínima.A study was carried out at the Experimental Station of Pastures and Forages "Indio Hatuey", Matanzas, Cuba, with the objective of determining the litter accumulation in a pastureland of Panicum maximum Jacq cv. Likoni and in a silvopastoral system of Panicum maximum and Leucaena leucocephala (Lam de Wit cv. Cunningham. In the P. maximum pasturelands of both systems the litter accumulation was determined by means of the technique proposed by Bruce and Ebershon (1982, while
Maximum temperature accounts for annual soil CO2 efflux in temperate forests of Northern China
Zhou, Zhiyong; Xu, Meili; Kang, Fengfeng; Jianxin Sun, Osbert
2015-01-01
It will help understand the representation legality of soil temperature to explore the correlations of soil respiration with variant properties of soil temperature. Soil temperature at 10 cm depth was hourly logged through twelve months. Basing on the measured soil temperature, soil respiration at different temporal scales were calculated using empirical functions for temperate forests. On monthly scale, soil respiration significantly correlated with maximum, minimum, mean and accumulated effective soil temperatures. Annual soil respiration varied from 409 g C m−2 in coniferous forest to 570 g C m−2 in mixed forest and to 692 g C m−2 in broadleaved forest, and was markedly explained by mean soil temperatures of the warmest day, July and summer, separately. These three soil temperatures reflected the maximum values on diurnal, monthly and annual scales. In accordance with their higher temperatures, summer soil respiration accounted for 51% of annual soil respiration across forest types, and broadleaved forest also had higher soil organic carbon content (SOC) and soil microbial biomass carbon content (SMBC), but a lower contribution of SMBC to SOC. This added proof to the findings that maximum soil temperature may accelerate the transformation of SOC to CO2-C via stimulating activities of soil microorganisms. PMID:26179467
Directory of Open Access Journals (Sweden)
M. Girotto
2012-06-01
Full Text Available Esta pesquisa teve como objetivo avaliar a velocidade e intensidade de ação do hexazinone isolado e em mistura com outros inibidores do fotossistema II, através da eficiência fotossintética de Panicum maximum em pós-emergência. O ensaio foi constituído de seis tratamentos: hexazinone (250 g ha-1, tebuthiuron (1,0 kg ha-1, hexazinone + tebuthiuron (125 g ha-1 + 0,5 kg ha-1, diuron (2.400 g ha-1, hexazinone + diuron (125 + 1.200 g ha-1, metribuzin (1.440 g ha-1, hexazinone + metribuzin (125 + 720 g ha-1 e uma testemunha. O experimento foi instalado em delineamento inteiramente casualizado, com quatro repetições. Após a aplicação dos tratamentos, as plantas foram transportadas para casa de vegetação sob condições controladas de temperatura e umidade, onde ficaram durante o período experimental, sendo realizadas as seguintes avaliações: taxa de transporte de elétrons e análise visual de intoxicação. A avaliação com o fluorômetro foi realizada nos intervalos de 1, 2, 6, 24, 48, 72, 120 e 168 horas após a aplicação, e as avaliações visuais, aos três e sete dias após a aplicação. Os resultados demonstraram diferença nos tratamentos, enfatizando a aplicação do diuron, que reduziu lentamente o transporte de elétrons comparado com os outros herbicidas e, em mistura com hexazinone, apresentou efeito sinérgico. Verificou-se com o uso do fluorômetro a intoxicação antecipada em plantas de P. maximum após a aplicação de herbicidas inibidores do fotossistema II de forma isolada e em mistura.This work aimed to evaluate the speed and intensity of action of hexazinone applied alone and in combination with other photo-system II inhibitors on the photosynthetic efficiency of Panicum maximum in post-emergence. The assay consisted of six treatments: hexazinone (250 g ha-1, tebuthiuron (1.0 kg ha-1, hexazinone + tebuthiuron (125 g ha-1+ 0.5 kg ha-1, diuron (2,400 g ha-1, hexazinone + diuron (125 + 1,200 g ha-1, metribuzin
Sur les estimateurs du maximum de vraisemblance dans les mod& ...
African Journals Online (AJOL)
Abstract. We are interested in the existence and uniqueness of maximum likelihood estimators of parameters in the two multiplicative regression models, with Poisson or negative binomial probability distributions. Following its work on the multiplicative Poisson model with two factors without repeated measures, Haberman ...
G+K 1Σ+/sub g/ double-minimum excited state of H2
International Nuclear Information System (INIS)
Glover, R.M.; Weinhold, F.
1977-01-01
We have obtained a Born--Oppenheimer potential curve for the previously uncharacterized third 1 Σ + /sub g/ state of H 2 , using a correlated 20-term wavefunction of generalized James--Coolidge type. We find this potential curve to have a double-minimum character, with the inner (Rydberg-like) and outer (''ionic'') wells having minima at about 1.99 and 3.30 bohr, respectively, and an intervening maximum at 2.76 bohr. Unlike the extensively studied E+F double-minimum state, the outer well here appears to be the deeper, by some 450 cm -1 in our calculation. The inner and outer minima can apparently be associated with spectral lines that in experimental tables have previously been attributed to distinct G and K electronic states. The appropriate spectroscopic term symbol of this combined state is accordingly G+K 1 Σ + /sub g/ (1ssigma3dsigma+2pπ 2 )
Multilevel maximum likelihood estimation with application to covariance matrices
Czech Academy of Sciences Publication Activity Database
Turčičová, Marie; Mandel, J.; Eben, Kryštof
Published online: 23 January ( 2018 ) ISSN 0361-0926 R&D Projects: GA ČR GA13-34856S Institutional support: RVO:67985807 Keywords : Fisher information * High dimension * Hierarchical maximum likelihood * Nested parameter spaces * Spectral diagonal covariance model * Sparse inverse covariance model Subject RIV: BB - Applied Statistics, Operational Research Impact factor: 0.311, year: 2016
International Nuclear Information System (INIS)
Maier, K.H.; Decman, D.J.; Grawe, H.; Kluge, H.
1981-01-01
The g-factor measurements of the ground state and an isomeric level in 217 Ac using the DPAD method with α-decay are described in this work. The results of γ-ray g-factor measurements for the isomer and a tentative decay scheme produced by α-γ and γ-γ coincidence experiments are also presented. An analysis of the α-particle angular distributions suggests that nuclear deformation affects the observed anisotropy. (orig.)
Khoshdel, Abolfazl; Kheiri, Soleiman; Omidvari, Peyman; Moradi, Fahimeh; Hamidi, Majid; Teimori, Hossein
2017-01-01
Cytokine polymorphisms may contribute to the prevalence of respiratory distress syndrome. The present study was done to investigate the frequency of interleukin- (IL-) 10 and tumor necrosis factor- (TNF-) α gene polymorphisms and their association with the risk of RDS in preterm infants. One-hundred and nineteen patients with RDS and 119 healthy preterm infants were enrolled. PCR restriction fragment length polymorphism was used to determine the frequency of IL-10 and TNF- α genotypes at -1082 A and -308 A, respectively. One-hundred and nineteen out of 238 infants had RDS (50%). The age of the mothers and gestational age ranged 17-45 (mean: 28.6 ± 5.3) years and 24-34 (mean: 34.3 ± 2.38) weeks, respectively. Totally, 23 deaths were recorded in the RDS group. Incidence of TNF- α -308 A/A and TNF- α -308 G/A was 84% and 16%, respectively. TNF-a-308 G/G was not found in both groups. Prevalence of IL-10-1082 G/G and IL-10-1082 G/A variants was 65.5% and 34.5%, respectively. IL-10-1082 A/A was not found in both groups. The incidence of the allele G in the IL-10-1082 polymorphism was lower in RDS group ( P < 0.05). We found that the risk of RDS was correlated to sex, gestational age, and IL-10-1082.
Unified calculations of the optical band positions and EPR g factors for NaCrS2 crystal
International Nuclear Information System (INIS)
Mei, Yang; Zheng, Wen-Chen; Zhang, Lin
2014-01-01
Six optical band positions and EPR g factors g || , g ⊥ for the trigonal Cr 3+ octahedral clusters in NaCrS 2 crystal are calculated together through the complete diagonalization (of energy matrix) method based on the two-spin–orbit-parameter model, where besides the contribution due to the spin–orbit parameter of central d n ion in the conventional crystal-field theory, the contribution due to the spin–orbit parameter of ligand ion via the covalence effect is also considered. In the calculations, the crystal-field parameters B kl are obtained from the superposition model with the structural data of Cr 3+ octahedral clusters in NaCrS 2 crystal measured exactly by the X-ray diffraction method. The calculated optical and EPR spectral data are in a reasonable agreement with the observed values. So, the reliability of the superposition model in the studies of crystal-field parameters for d n ions in crystals is confirmed, and the complete diagonalization (of energy matrix) method based on the two-spin–orbit-model is effective in the unified calculations of optical and EPR spectral data for d n ions in crystals. - Highlights: • Six optical band positions and g factors g || , g ⊥ of NaCrS 2 are calculated together. • Calculation is using the complete diagonalization (of energy matrix) method. • The diagonalization method is based on the two-spin–orbit-parameter model. • Reliability of superposition model in the studies of CF parameters is confirmed
Maximum warming occurs about one decade after a carbon dioxide emission
International Nuclear Information System (INIS)
Ricke, Katharine L; Caldeira, Ken
2014-01-01
It is known that carbon dioxide emissions cause the Earth to warm, but no previous study has focused on examining how long it takes to reach maximum warming following a particular CO 2 emission. Using conjoined results of carbon-cycle and physical-climate model intercomparison projects (Taylor et al 2012, Joos et al 2013), we find the median time between an emission and maximum warming is 10.1 years, with a 90% probability range of 6.6–30.7 years. We evaluate uncertainties in timing and amount of warming, partitioning them into three contributing factors: carbon cycle, climate sensitivity and ocean thermal inertia. If uncertainty in any one factor is reduced to zero without reducing uncertainty in the other factors, the majority of overall uncertainty remains. Thus, narrowing uncertainty in century-scale warming depends on narrowing uncertainty in all contributing factors. Our results indicate that benefit from avoided climate damage from avoided CO 2 emissions will be manifested within the lifetimes of people who acted to avoid that emission. While such avoidance could be expected to benefit future generations, there is potential for emissions avoidance to provide substantial benefit to current generations. (letter)
Maximum warming occurs about one decade after a carbon dioxide emission
Ricke, Katharine L.; Caldeira, Ken
2014-12-01
It is known that carbon dioxide emissions cause the Earth to warm, but no previous study has focused on examining how long it takes to reach maximum warming following a particular CO2 emission. Using conjoined results of carbon-cycle and physical-climate model intercomparison projects (Taylor et al 2012, Joos et al 2013), we find the median time between an emission and maximum warming is 10.1 years, with a 90% probability range of 6.6-30.7 years. We evaluate uncertainties in timing and amount of warming, partitioning them into three contributing factors: carbon cycle, climate sensitivity and ocean thermal inertia. If uncertainty in any one factor is reduced to zero without reducing uncertainty in the other factors, the majority of overall uncertainty remains. Thus, narrowing uncertainty in century-scale warming depends on narrowing uncertainty in all contributing factors. Our results indicate that benefit from avoided climate damage from avoided CO2 emissions will be manifested within the lifetimes of people who acted to avoid that emission. While such avoidance could be expected to benefit future generations, there is potential for emissions avoidance to provide substantial benefit to current generations.
DEFF Research Database (Denmark)
Nielsen, H
1993-01-01
After 10 weeks of treatment with clozapine, severe agranulocytosis was diagnosed in a 33-year-old female. The patient was treated with filgrastim (granulocyte colony-stimulating factor [G-CSF]) 5 micrograms kg-1 day-1. The neutrophil count was 0.234 x 10(9) l-1 on admission, with a further decrease...
The maximum economic depth of groundwater abstraction for irrigation
Bierkens, M. F.; Van Beek, L. P.; de Graaf, I. E. M.; Gleeson, T. P.
2017-12-01
Over recent decades, groundwater has become increasingly important for agriculture. Irrigation accounts for 40% of the global food production and its importance is expected to grow further in the near future. Already, about 70% of the globally abstracted water is used for irrigation, and nearly half of that is pumped groundwater. In many irrigated areas where groundwater is the primary source of irrigation water, groundwater abstraction is larger than recharge and we see massive groundwater head decline in these areas. An important question then is: to what maximum depth can groundwater be pumped for it to be still economically recoverable? The objective of this study is therefore to create a global map of the maximum depth of economically recoverable groundwater when used for irrigation. The maximum economic depth is the maximum depth at which revenues are still larger than pumping costs or the maximum depth at which initial investments become too large compared to yearly revenues. To this end we set up a simple economic model where costs of well drilling and the energy costs of pumping, which are a function of well depth and static head depth respectively, are compared with the revenues obtained for the irrigated crops. Parameters for the cost sub-model are obtained from several US-based studies and applied to other countries based on GDP/capita as an index of labour costs. The revenue sub-model is based on gross irrigation water demand calculated with a global hydrological and water resources model, areal coverage of crop types from MIRCA2000 and FAO-based statistics on crop yield and market price. We applied our method to irrigated areas in the world overlying productive aquifers. Estimated maximum economic depths range between 50 and 500 m. Most important factors explaining the maximum economic depth are the dominant crop type in the area and whether or not initial investments in well infrastructure are limiting. In subsequent research, our estimates of
Essential Oil of Amomum maximum Roxb. and Its Bioactivities against Two Stored-Product Insects.
Guo, Shan-Shan; You, Chun-Xue; Liang, Jun-Yu; Zhang, Wen-Juan; Yang, Kai; Geng, Zhu-Feng; Wang, Cheng-Fang; Du, Shu-Shan; Lei, Ning
2015-01-01
Amomum maximum Roxb. is a perennial herb distributed in South China and Southeast Asia. The objective of this work was to analyze the chemical constituents and assess insecticidal and repellent activities of the essential oil from Amomum maximum fruits against Tribolium castaneum (Herbst) and Liposcelis bostrychophila (Badonnel). The essential oil was obtained by hydrodistillation and analyzed by gas chromatography-flame ionization detector and gas chromatography-mass spectrometry. The main components of the essential oil were identified to be β-pinene (23.39%), β-caryophyllene (16.43%), α-pinene (7.55%), sylvestrene (6.61%) and ç-cadinene (4.19%). It was found that the essential oil of A. maximum fruits possessed contact and fumigant toxicities against T. castaneum adults (LD50 = 29.57 μg/adult and LC(50) = 23.09 mg/L air, respectively) and showed contact toxicity against L. bostrychophila (LD(50) = 67.46 μg/cm(2)). Repellency of the crude oil was also evaluated. After 2 h treatment, the essential oil possessed 100% repellency at 78.63 nL/cm(2) against T. castaneum and 84% repellency at 63.17 nL/cm(2) against L. bostrychophila. The results indicated that the essential oil of A. maximum fruits had the potential to be developed as a natural insecticide and repellent for control of T. castaneum and L. bostrychophila.
DEFF Research Database (Denmark)
Kjaerulff, Søren; Andersen, Nicoline Resen; Borup, Mia Trolle
2007-01-01
Eukaryotic cells normally differentiate from G(1); here we investigate the mechanism preventing expression of differentiation-specific genes outside G(1). In fission yeast, induction of the transcription factor Ste11 triggers sexual differentiation. We find that Ste11 is only active in G(1) when...... Cdk activity is low. In the remaining part of the cell cycle, Ste11 becomes Cdk-phosphorylated at Thr 82 (T82), which inhibits its DNA-binding activity. Since the ste11 gene is autoregulated and the Ste11 protein is highly unstable, this Cdk switch rapidly extinguishes Ste11 activity when cells enter...... S phase. When we mutated T82 to aspartic acid, mimicking constant phosphorylation, cells no longer underwent differentiation. Conversely, changing T82 to alanine rendered Ste11-controlled transcription constitutive through the cell cycle, and allowed mating from S phase with increased frequency...
Measuring the performance of G2G services in Iran
Zarei, Behrouz; Safdari, Maryam
To highlight the growth of e-government and the importance of its services it is essential to evaluate the performance of the service delivery to customers. Research indicates that traditional performance indexes are not suitable for this evaluation; moreover, it is noticeable that the e-government services are intangible and invisible. Among different e-government services, measurement of quality government to government (G2G) services has been less attractive for researchers while crucial for government policy-makers. This calls for a better understanding of the specific needs of users of these services in order to provide appropriate type and level of services that meets those needs. In this paper, the performance of the G2G services is measured in the Iranian context. For this purpose, SERVQUAL, which is a well-known method for assessing service quality, is employed. This study proposes and tests a five-factor of SERVQUAL instrument to explain user satisfaction and gap analysis, between expectations and perceptions of its customers, consisting thirty ministries and main governmental organizations. Based on a Chi-square test, factor analysis, gap analysis and correlations, it is concluded the gap between expectations and perceptions of G2G customers is significant and customer satisfaction of G2G services is at low level.
STUDY ON MAXIMUM SPECIFIC SLUDGE ACIVITY OF DIFFERENT ANAEROBIC GRANULAR SLUDGE BY BATCH TESTS
Institute of Scientific and Technical Information of China (English)
无
2001-01-01
The maximum specific sludge activity of granular sludge from large-scale UASB, IC and Biobed anaerobic reactors were investigated by batch tests. The limitation factors related to maximum specific sludge activity (diffusion, substrate sort, substrate concentration and granular size) were studied. The general principle and procedure for the precise measurement of maximum specific sludge activity were suggested. The potential capacity of loading rate of the IC and Biobed anaerobic reactors were analyzed and compared by use of the batch tests results.
Well-covered graphs and factors
DEFF Research Database (Denmark)
Randerath, Bert; Vestergaard, Preben D.
2006-01-01
A maximum independent set of vertices in a graph is a set of pairwise nonadjacent vertices of largest cardinality α. Plummer defined a graph to be well-covered, if every independent set is contained in a maximum independent set of G. Every well-covered graph G without isolated vertices has a perf...
A hyperactive transcriptional state marks genome reactivation at the mitosis–G1 transition
Hsiung, Chris C.-S.; Bartman, Caroline R.; Huang, Peng; Ginart, Paul; Stonestrom, Aaron J.; Keller, Cheryl A.; Face, Carolyne; Jahn, Kristen S.; Evans, Perry; Sankaranarayanan, Laavanya; Giardine, Belinda; Hardison, Ross C.; Raj, Arjun; Blobel, Gerd A.
2016-01-01
During mitosis, RNA polymerase II (Pol II) and many transcription factors dissociate from chromatin, and transcription ceases globally. Transcription is known to restart in bulk by telophase, but whether de novo transcription at the mitosis–G1 transition is in any way distinct from later in interphase remains unknown. We tracked Pol II occupancy genome-wide in mammalian cells progressing from mitosis through late G1. Unexpectedly, during the earliest rounds of transcription at the mitosis–G1 transition, ∼50% of active genes and distal enhancers exhibit a spike in transcription, exceeding levels observed later in G1 phase. Enhancer–promoter chromatin contacts are depleted during mitosis and restored rapidly upon G1 entry but do not spike. Of the chromatin-associated features examined, histone H3 Lys27 acetylation levels at individual loci in mitosis best predict the mitosis–G1 transcriptional spike. Single-molecule RNA imaging supports that the mitosis–G1 transcriptional spike can constitute the maximum transcriptional activity per DNA copy throughout the cell division cycle. The transcriptional spike occurs heterogeneously and propagates to cell-to-cell differences in mature mRNA expression. Our results raise the possibility that passage through the mitosis–G1 transition might predispose cells to diverge in gene expression states. PMID:27340175
Lother, Sylvain A; Demczuk, Walter; Martin, Irene; Mulvey, Michael; Dufault, Brenden; Lagacé-Wiens, Philippe; Keynan, Yoav
2017-07-01
The incidence of group C and G Streptococcus (GCGS) bacteremia, which is associated with severe disease and death, is increasing. We characterized clinical features, outcomes, and genetic determinants of GCGS bacteremia for 89 patients in Winnipeg, Manitoba, Canada, who had GCGS bacteremia during 2012-2014. Of the 89 patients, 51% had bacteremia from skin and soft tissue, 70% had severe disease features, and 20% died. Whole-genome sequencing analysis was performed on isolates derived from 89 blood samples and 33 respiratory sample controls: 5 closely related genetic lineages were identified as being more likely to cause invasive disease than non-clade isolates (83% vs. 57%, p = 0.002). Virulence factors cbp, fbp, speG, sicG, gfbA, and bca clustered clonally into these clades. A clonal distribution of virulence factors may account for severe and fatal cases of bacteremia caused by invasive GCGS.
A maximum modulus theorem for the Oseen problem
Czech Academy of Sciences Publication Activity Database
Kračmar, S.; Medková, Dagmar; Nečasová, Šárka; Varnhorn, W.
2013-01-01
Roč. 192, č. 6 (2013), s. 1059-1076 ISSN 0373-3114 R&D Projects: GA ČR(CZ) GAP201/11/1304; GA MŠk LC06052 Institutional research plan: CEZ:AV0Z10190503 Keywords : Oseen problem * maximum modulus theorem * Oseen potentials Subject RIV: BA - General Mathematics Impact factor: 0.909, year: 2013 http://link.springer.com/article/10.1007%2Fs10231-012-0258-x
Cosmic shear measurement with maximum likelihood and maximum a posteriori inference
Hall, Alex; Taylor, Andy
2017-06-01
We investigate the problem of noise bias in maximum likelihood and maximum a posteriori estimators for cosmic shear. We derive the leading and next-to-leading order biases and compute them in the context of galaxy ellipticity measurements, extending previous work on maximum likelihood inference for weak lensing. We show that a large part of the bias on these point estimators can be removed using information already contained in the likelihood when a galaxy model is specified, without the need for external calibration. We test these bias-corrected estimators on simulated galaxy images similar to those expected from planned space-based weak lensing surveys, with promising results. We find that the introduction of an intrinsic shape prior can help with mitigation of noise bias, such that the maximum a posteriori estimate can be made less biased than the maximum likelihood estimate. Second-order terms offer a check on the convergence of the estimators, but are largely subdominant. We show how biases propagate to shear estimates, demonstrating in our simple set-up that shear biases can be reduced by orders of magnitude and potentially to within the requirements of planned space-based surveys at mild signal-to-noise ratio. We find that second-order terms can exhibit significant cancellations at low signal-to-noise ratio when Gaussian noise is assumed, which has implications for inferring the performance of shear-measurement algorithms from simplified simulations. We discuss the viability of our point estimators as tools for lensing inference, arguing that they allow for the robust measurement of ellipticity and shear.
Lepton Flavor Violation in the Two Higgs Doublet Model using g-2 muon factor
International Nuclear Information System (INIS)
Diaz, Rodolfo A.; Martinez, R.; Rodriguez, J.-Alexis; Tuiran, E.
2002-01-01
Current experimental data from the g-2 muon factor, seems to show the necessity of physics beyond the Standard Model (SM), since the difference between SM and experimental predictions is approximately 2.6σ. In the framework of the General Two Higgs Doublet Model (2HDM), we calculate the muon anomalous magnetic moment to get lower and upper bounds for the Flavour Changing (FC) Yukawa couplings in the leptonic sector
A tropospheric ozone maximum over the equatorial Southern Indian Ocean
Directory of Open Access Journals (Sweden)
L. Zhang
2012-05-01
Full Text Available We examine the distribution of tropical tropospheric ozone (O3 from the Microwave Limb Sounder (MLS and the Tropospheric Emission Spectrometer (TES by using a global three-dimensional model of tropospheric chemistry (GEOS-Chem. MLS and TES observations of tropospheric O3 during 2005 to 2009 reveal a distinct, persistent O3 maximum, both in mixing ratio and tropospheric column, in May over the Equatorial Southern Indian Ocean (ESIO. The maximum is most pronounced in 2006 and 2008 and less evident in the other three years. This feature is also consistent with the total column O3 observations from the Ozone Mapping Instrument (OMI and the Atmospheric Infrared Sounder (AIRS. Model results reproduce the observed May O3 maximum and the associated interannual variability. The origin of the maximum reflects a complex interplay of chemical and dynamic factors. The O3 maximum is dominated by the O3 production driven by lightning nitrogen oxides (NOx emissions, which accounts for 62% of the tropospheric column O3 in May 2006. We find the contribution from biomass burning, soil, anthropogenic and biogenic sources to the O3 maximum are rather small. The O3 productions in the lightning outflow from Central Africa and South America both peak in May and are directly responsible for the O3 maximum over the western ESIO. The lightning outflow from Equatorial Asia dominates over the eastern ESIO. The interannual variability of the O3 maximum is driven largely by the anomalous anti-cyclones over the southern Indian Ocean in May 2006 and 2008. The lightning outflow from Central Africa and South America is effectively entrained by the anti-cyclones followed by northward transport to the ESIO.
Wang, Yufei; Bergmeier, Lesley A; Stebbings, Richard; Seidl, Thomas; Whittall, Trevor; Singh, Mahavir; Berry, Neil; Almond, Neil; Lehner, Thomas
2009-02-05
APOBEC3G is an innate intracellular anti-viral factor which deaminates retroviral cytidine to uridine. In vivo studies of APOBEC3G (A3G) were carried out in rhesus macaques, following mucosal immunization with SIV antigens and CCR5 peptides, linked to the 70kDa heat shock protein. A progressive increase in A3G mRNA was elicited in PBMC after each immunization (p<0.0002 to p< or =0.02), which was maintained for at least 17 weeks. Analysis of memory T cells showed a significant increase in A3G mRNA and protein in CD4(+)CCR5(+) memory T cells in circulating (p=0.0001), splenic (p=0.0001), iliac lymph nodes (p=0.002) and rectal (p=0.01) cells of the immunized compared with unimmunized macaques. Mucosal challenge with SIVmac 251 showed a significant increase in A3G mRNA in the CD4(+)CCR5(+) circulating cells (p<0.01) and the draining iliac lymph node cells (p<0.05) in the immunized uninfected macaques, consistent with a protective effect exerted by A3G. The results suggest that mucosal immunization in a non-human primate can induce features of a memory response to an innate anti-viral factor in CCR5(+)CD4(+) memory and CD4(+)CD95(+)CCR7(-) effector memory T cells.
A relation between the rotational g-factor and the electric dipole moment of a diatomic molecule
DEFF Research Database (Denmark)
Sauer, Stephan P. A.
1998-01-01
The relation between the rotational g-factor and the electric dipole moment of a diatomic molecule is investigated. An explicit expression for the irreducible nonadiabatic contribution in terms of excited electronic states is derived. The importance of this expression for the analysis of vibration...
Directory of Open Access Journals (Sweden)
Abolfazl Khoshdel
2017-01-01
Full Text Available Cytokine polymorphisms may contribute to the prevalence of respiratory distress syndrome. The present study was done to investigate the frequency of interleukin- (IL- 10 and tumor necrosis factor- (TNF- α gene polymorphisms and their association with the risk of RDS in preterm infants. One-hundred and nineteen patients with RDS and 119 healthy preterm infants were enrolled. PCR restriction fragment length polymorphism was used to determine the frequency of IL-10 and TNF-α genotypes at -1082 A and -308 A, respectively. One-hundred and nineteen out of 238 infants had RDS (50%. The age of the mothers and gestational age ranged 17–45 (mean: 28.6±5.3 years and 24–34 (mean: 34.3±2.38 weeks, respectively. Totally, 23 deaths were recorded in the RDS group. Incidence of TNF-α-308 A/A and TNF-α-308 G/A was 84% and 16%, respectively. TNF-a-308 G/G was not found in both groups. Prevalence of IL-10-1082 G/G and IL-10-1082 G/A variants was 65.5% and 34.5%, respectively. IL-10-1082 A/A was not found in both groups. The incidence of the allele G in the IL-10-1082 polymorphism was lower in RDS group (P<0.05. We found that the risk of RDS was correlated to sex, gestational age, and IL-10-1082.
Maximum solid concentrations of coal water slurries predicted by neural network models
Energy Technology Data Exchange (ETDEWEB)
Cheng, Jun; Li, Yanchang; Zhou, Junhu; Liu, Jianzhong; Cen, Kefa
2010-12-15
The nonlinear back-propagation (BP) neural network models were developed to predict the maximum solid concentration of coal water slurry (CWS) which is a substitute for oil fuel, based on physicochemical properties of 37 typical Chinese coals. The Levenberg-Marquardt algorithm was used to train five BP neural network models with different input factors. The data pretreatment method, learning rate and hidden neuron number were optimized by training models. It is found that the Hardgrove grindability index (HGI), moisture and coalification degree of parent coal are 3 indispensable factors for the prediction of CWS maximum solid concentration. Each BP neural network model gives a more accurate prediction result than the traditional polynomial regression equation. The BP neural network model with 3 input factors of HGI, moisture and oxygen/carbon ratio gives the smallest mean absolute error of 0.40%, which is much lower than that of 1.15% given by the traditional polynomial regression equation. (author)
Directory of Open Access Journals (Sweden)
Zhong-jun Zhang
2015-01-01
Full Text Available Treatment for optic nerve injury by brain-derived neurotrophic factor or the transplantation of human umbilical cord blood stem cells has gained progress, but analysis by biomechanical indicators is rare. Rabbit models of optic nerve injury were established by a clamp. At 7 days after injury, the vitreous body received a one-time injection of 50 μg brain-derived neurotrophic factor or 1 × 10 6 human umbilical cord blood stem cells. After 30 days, the maximum load, maximum stress, maximum strain, elastic limit load, elastic limit stress, and elastic limit strain had clearly improved in rabbit models of optical nerve injury after treatment with brain-derived neurotrophic factor or human umbilical cord blood stem cells. The damage to the ultrastructure of the optic nerve had also been reduced. These findings suggest that human umbilical cord blood stem cells and brain-derived neurotrophic factor effectively repair the injured optical nerve, improve biomechanical properties, and contribute to the recovery after injury.
The TCP4 transcription factor of Arabidopsis blocks cell division in yeast at G1 → S transition
International Nuclear Information System (INIS)
Aggarwal, Pooja; Padmanabhan, Bhavna; Bhat, Abhay; Sarvepalli, Kavitha; Sadhale, Parag P.; Nath, Utpal
2011-01-01
Highlights: → TCP4 is a class II TCP transcription factor, that represses cell division in Arabidopsis. → TCP4 expression in yeast retards cell division by blocking G1 → S transition. → Genome-wide expression studies and Western analysis reveals stabilization of cell cycle inhibitor Sic1, as possible mechanism. -- Abstract: The TCP transcription factors control important aspects of plant development. Members of class I TCP proteins promote cell cycle by regulating genes directly involved in cell proliferation. In contrast, members of class II TCP proteins repress cell division. While it has been postulated that class II proteins induce differentiation signal, their exact role on cell cycle has not been studied. Here, we report that TCP4, a class II TCP protein from Arabidopsis that repress cell proliferation in developing leaves, inhibits cell division by blocking G1 → S transition in budding yeast. Cells expressing TCP4 protein with increased transcriptional activity fail to progress beyond G1 phase. By analyzing global transcriptional status of these cells, we show that expression of a number of cell cycle genes is altered. The possible mechanism of G1 → S arrest is discussed.
Energy Technology Data Exchange (ETDEWEB)
Zhang Huaming, E-mail: huamingzhang66@gmail.com [Key Laboratory of Nondestructive Testing, Ministry of Education, Nanchang Hangkong University, Nanchang 330063 (China); Wan Xiong; Zhang Zhimin [Key Laboratory of Nondestructive Testing, Ministry of Education, Nanchang Hangkong University, Nanchang 330063 (China)
2012-06-15
The local structure and the g factor (g{sub x}, g{sub y}, and g{sub z}) of the Ni{sup +} center in KTaO{sub 3} are theoretically studied using the perturbation formulas of the g factors for a 3d{sup 9} ion in orthorhombically elongated octahedra. The orthorhombic field parameters are determined from the superposition model and the local geometry of the system. In view of the covalency, the contributions from the ligand orbital and spin-orbit coupling interactions are taken into account from the cluster approach. In the calculations, the orthorhombic center is attributed to Ni{sup +} occupying the host Ta{sup 5+} site, associated with the nearest-neighboring oxygen vacancy V{sub O} along the c-axis. Furthermore, the planar Ni{sup +}-O{sup 2-} bonds are found to experience the relative variation {Delta}R (Almost-Equal-To 0.076 A) along the a- and b-axis, respectively, due to the Jahn-Teller effect and the size mismatching substitution of Ta{sup 5+} by Ni{sup +}. Meanwhile, the effectively positive V{sub O} can make the central Ni{sup +} displace away from V{sub O} along the c-axis by about 0.20 A. The calculated g factors based on the above local distortions show good agreement with the experimental data.
Directory of Open Access Journals (Sweden)
Shuai Yang
2017-03-01
Full Text Available The AKT (protein kinase B, PKB family has been shown to participate in diverse cellular processes, including apoptosis. Previous studies demonstrated that protein kinase B2 (AKT2−/− mice heart was sensitized to apoptosis in response to ischemic injury. However, little is known about the mechanism and apoptotic signaling pathway. Here, we show that AKT2 inhibition does not affect the development of cardiomyocytes but increases cell death during cardiomyocyte ischemia. Caspase-dependent apoptosis of both the extrinsic and intrinsic pathway was inactivated in cardiomyocytes with AKT2 inhibition during ischemia, while significant mitochondrial disruption was observed as well as intracytosolic translocation of cytochrome C (Cyto C together with apoptosis-inducing factor (AIF and endonuclease G (EndoG, both of which are proven to conduct DNA degradation in a range of cell death stimuli. Therefore, mitochondria-dependent cell death was investigated and the results suggested that AIF and EndoG nucleus translocation causes cardiomyocyte DNA degradation during ischemia when AKT2 is blocked. These data are the first to show a previous unrecognized function and mechanism of AKT2 in regulating cardiomyocyte survival during ischemia by inducing a unique mitochondrial-dependent DNA degradation pathway when it is inhibited.
Bos, W. H.; Bartelds, G. M.; Vis, M.; van der Horst, A. R.; Wolbink, G. J.; van de Stadt, R. J.; van Schaardenburg, D.; Dijkmans, B. A. C.; Lems, W. F.; Nurmohamed, M. T.; Aarden, L.; Hamann, D.
2009-01-01
To investigate the dynamics of IgG1 and IgG4 anti-citrullinated protein antibody (ACPA) subclasses during anti-tumour necrosis factor (TNF) treatment in patients with rheumatoid arthritis (RA). IgG, IgG1 and IgG4 ACPA levels were determined by ELISA on anti-citrullinated fibrinogen (ACF) and IgG1 :
Maximum Acceleration Recording Circuit
Bozeman, Richard J., Jr.
1995-01-01
Coarsely digitized maximum levels recorded in blown fuses. Circuit feeds power to accelerometer and makes nonvolatile record of maximum level to which output of accelerometer rises during measurement interval. In comparison with inertia-type single-preset-trip-point mechanical maximum-acceleration-recording devices, circuit weighs less, occupies less space, and records accelerations within narrower bands of uncertainty. In comparison with prior electronic data-acquisition systems designed for same purpose, circuit simpler, less bulky, consumes less power, costs and analysis of data recorded in magnetic or electronic memory devices. Circuit used, for example, to record accelerations to which commodities subjected during transportation on trucks.
Multiperiod Maximum Loss is time unit invariant.
Kovacevic, Raimund M; Breuer, Thomas
2016-01-01
Time unit invariance is introduced as an additional requirement for multiperiod risk measures: for a constant portfolio under an i.i.d. risk factor process, the multiperiod risk should equal the one period risk of the aggregated loss, for an appropriate choice of parameters and independent of the portfolio and its distribution. Multiperiod Maximum Loss over a sequence of Kullback-Leibler balls is time unit invariant. This is also the case for the entropic risk measure. On the other hand, multiperiod Value at Risk and multiperiod Expected Shortfall are not time unit invariant.
Neutron spectra unfolding with maximum entropy and maximum likelihood
International Nuclear Information System (INIS)
Itoh, Shikoh; Tsunoda, Toshiharu
1989-01-01
A new unfolding theory has been established on the basis of the maximum entropy principle and the maximum likelihood method. This theory correctly embodies the Poisson statistics of neutron detection, and always brings a positive solution over the whole energy range. Moreover, the theory unifies both problems of overdetermined and of underdetermined. For the latter, the ambiguity in assigning a prior probability, i.e. the initial guess in the Bayesian sense, has become extinct by virtue of the principle. An approximate expression of the covariance matrix for the resultant spectra is also presented. An efficient algorithm to solve the nonlinear system, which appears in the present study, has been established. Results of computer simulation showed the effectiveness of the present theory. (author)
Maximum Power from a Solar Panel
Directory of Open Access Journals (Sweden)
Michael Miller
2010-01-01
Full Text Available Solar energy has become a promising alternative to conventional fossil fuel sources. Solar panels are used to collect solar radiation and convert it into electricity. One of the techniques used to maximize the effectiveness of this energy alternative is to maximize the power output of the solar collector. In this project the maximum power is calculated by determining the voltage and the current of maximum power. These quantities are determined by finding the maximum value for the equation for power using differentiation. After the maximum values are found for each time of day, each individual quantity, voltage of maximum power, current of maximum power, and maximum power is plotted as a function of the time of day.
The tumor necrosis factor alpha - 308G>A polymorphism is associated with dementia in the oldest-old
DEFF Research Database (Denmark)
Bruunsgaard, Helle; Benfield, Thomas L; Andersen-Ranberg, Karen
2004-01-01
OBJECTIVES: To test the hypothesis that the tumor necrosis factor (TNF) -308 G>A promoter gene polymorphism is a risk factor in age-related dementia and longevity. DESIGN: A cross-sectional and a longitudinal study. SETTING: A population-based sample of Danish centenarians. PARTICIPANTS: One...... was investigated (Fischer exact test). Furthermore, whether the TNF -308 G>A polymorphism was associated with the prevalence of dementia (logistic regression analysis), the plasma level of TNF-alpha (analysis of variance), and mortality in the following 5 years (Cox regression analysis) within the cohort...... higher plasma levels of TNF-alpha, but the significance was questionable due to a low number of subjects with this genotype. CONCLUSION: It is possible that the TNF -308 A allele is maintained during aging because subjects who are heterozygous for this polymorphism possess the optimal inflammatory...
Bos, W.H.; Bartelds, G.M.; Vis, M.; van der Horst, A.R.; Wolbink, G.J.; van de Stadt, R.J.; van Schaardenburg, D.; Dijkmans, B.A.C.; Lems, W.F.; Nurmohamed, M.T.; Aarden, L.; Hamann, D.
2009-01-01
Objective: To investigate the dynamics of IgG1 and IgG4 anti-citrullinated protein antibody ( ACPA) subclasses during anti-tumour necrosis factor (TNF) treatment in patients with rheumatoid arthritis ( RA). Methods: IgG, IgG1 and IgG4 ACPA levels were determined by ELISA on anti-citrullinated
Bos, W.H.; Bartelds, G.M.; Vis, M.; Horst, A.; Wolbink, G.; van de Stadt, R.J.; van Schaardenburg, D.; Dijkmans, B.A.C.; Lems, W.F.; Nurmohamed, M.T.; Aarden, L.; Hamann, D.
2009-01-01
Objective: To investigate the dynamics of IgG1 and IgG4 anti-citrullinated protein antibody (ACPA) subclasses during anti-tumour necrosis factor (TNF) treatment in patients with rheumatoid arthritis (RA). Methods: IgG, IgG1 and IgG4 ACPA levels were determined by ELISA on anti-citrullinated
Maximum Work of Free-Piston Stirling Engine Generators
Kojima, Shinji
2017-04-01
Using the method of adjoint equations described in Ref. [1], we have calculated the maximum thermal efficiencies that are theoretically attainable by free-piston Stirling and Carnot engine generators by considering the work loss due to friction and Joule heat. The net work done by the Carnot cycle is negative even when the duration of heat addition is optimized to give the maximum amount of heat addition, which is the same situation for the Brayton cycle described in our previous paper. For the Stirling cycle, the net work done is positive, and the thermal efficiency is greater than that of the Otto cycle described in our previous paper by a factor of about 2.7-1.4 for compression ratios of 5-30. The Stirling cycle is much better than the Otto, Brayton, and Carnot cycles. We have found that the optimized piston trajectories of the isothermal, isobaric, and adiabatic processes are the same when the compression ratio and the maximum volume of the same working fluid of the three processes are the same, which has facilitated the present analysis because the optimized piston trajectories of the Carnot and Stirling cycles are the same as those of the Brayton and Otto cycles, respectively.
Lee, Chieh-Han; Yu, Hwa-Lung; Chien, Lung-Chang
2014-05-01
Dengue fever has been identified as one of the most widespread vector-borne diseases in tropical and sub-tropical. In the last decade, dengue is an emerging infectious disease epidemic in Taiwan especially in the southern area where have annually high incidences. For the purpose of disease prevention and control, an early warning system is urgently needed. Previous studies have showed significant relationships between climate variables, in particular, rainfall and temperature, and the temporal epidemic patterns of dengue cases. However, the transmission of the dengue fever is a complex interactive process that mostly understated the composite space-time effects of dengue fever. This study proposes developing a one-week ahead warning system of dengue fever epidemics in the southern Taiwan that considered nonlinear associations between weekly dengue cases and meteorological factors across space and time. The early warning system based on an integration of distributed lag nonlinear model (DLNM) and stochastic Bayesian Maximum Entropy (BME) analysis. The study identified the most significant meteorological measures including weekly minimum temperature and maximum 24-hour rainfall with continuous 15-week lagged time to dengue cases variation under condition of uncertainty. Subsequently, the combination of nonlinear lagged effects of climate variables and space-time dependence function is implemented via a Bayesian framework to predict dengue fever occurrences in the southern Taiwan during 2012. The result shows the early warning system is useful for providing potential outbreak spatio-temporal prediction of dengue fever distribution. In conclusion, the proposed approach can provide a practical disease control tool for environmental regulators seeking more effective strategies for dengue fever prevention.
Incommensurate modulations made visible by the Maximum Entropy Method in superspace
Czech Academy of Sciences Publication Activity Database
Palatinus, Lukáš; van Smaalen, S.
2004-01-01
Roč. 219, - (2004), s. 719-729 ISSN 0044-2968 Grant - others:DFG(DE) XX Institutional research plan: CEZ:AV0Z1010914 Keywords : Maximum Entropy Method * modulated structures * charge density Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.390, year: 2004
Effect of granulocyte colony stimulating factor (G-CSF on IVF outcomes in infertile women: An RCT
Directory of Open Access Journals (Sweden)
Maryam Eftekhar
2016-05-01
Full Text Available Background: Despite major advances in assisted reproductive techniques, the implantation rates remain relatively low. Some studies have demonstrated that intrauterine infusion of granulocyte colony stimulating factor (G-CSF improves implantation in infertile women. Objective: To assess the G-CSF effects on IVF outcomes in women with normal endometrial thickness. Materials and methods: In this randomized controlled clinical trial, 100 infertile women with normal endometrial thickness who were candidate for IVF were evaluated in two groups. Exclusion criteria were positive history of repeated implantation failure (RIF, endocrine disorders, severe endometriosis, congenital or acquired uterine anomaly and contraindication for G-CSF (renal disease, sickle cell disease, or malignancy. In G-CSF group (n=50, 300 μg trans cervical intrauterine of G-CSF was administered at the oocyte retrieval day. Controls (n=50 were treated with standard protocol. Chemical, clinical and ongoing pregnancy rates, implantation rate, and miscarriage rate were compared between groups. Results: Number of total and mature oocytes (MII, two pronuclei (2PN, total embryos, transferred embryos, quality of transferred embryos, and fertilization rate did not differ significantly between two groups. So there were no significant differences between groups in chemical, clinical and ongoing pregnancy rate, implantation rate, and miscarriage rate Conclusion: our result showed in normal IVF patients with normal endometrial thickness, the intrauterine infusion of G-CSF did not improve pregnancy outcomes.
Effect of the moment of inertia of an electron shell on the rotational g factor of a molecule
International Nuclear Information System (INIS)
Rebane, T.K.
1988-01-01
It is noted that electron currents induced by the rotation of a molecule make a contribution not only to the magnetic moment, but also to the angular momentum of a molecule and to its moment of inertia. An improved equation for the rotational g factor of a molecule, allowing for the contribution of electrons to the moment of inertia, is given. The B 1 summation + /sub u/ excited electronic state of the hydrogen molecule is used as an example to show that the electronic contribution to the moment of inertia amounts to 0.3 to 0.5% (for H 2 and D 2 molecules, respectively) of the value of the nuclear contribution, and its consideration in calculations of g factors is obligatory
Neutronic Analysis of the RSG-GAS Compact Core without CIP Silicide 3.55 g U/cc and 4.8 g U/cc
International Nuclear Information System (INIS)
Jati S; Lily S; Tukiran S
2004-01-01
Fuel conversion from U 3 O 8 -Al to U 3 Si 2 -Al 2.96 g U/cc density in the RSG-GAS core had done successfully step by step since 36 th core until 44 th core. So that, since the 45 th core until now (48 th core) had been using full of silicide 2.96 g U/cc. Even though utilization program of silicide fuel with high density (3.55 g U/cc and 4.8 g U/cc) and optimize operation of RSG-GAS core under research. Optimalitation of core with increasing operation cycle have been analyzing about compact core. The mean of compact core is the RSG-GAS core with decrease number of IP or CIP position irradiation. In this research, the neutronic calculation to cover RSG-GAS core and RSG-GAS core without CIP that are using U 3 Si 2 -Al 2.96 g U/cc, 3.55 g U/cc and 4.8 g U/cc had done. Two core calculation done at 15 MW power using SRAC-ASMBURN code. The calculation result show that fuel conversion from 2.96 g U/cc density to 3.55 g U/cc and 4.8 g U/cc will increasing cycle length for both RSG-GAS core and RSG-GAS compact core without CIP. However, increasing of excess reactivity exceeded from nominal value of first design that 9.2%. Change of power peaking factor is not show significant value and still less than 1.4. Core fuelled with U 3 Si 2 -Al 4.8 g U/cc density have maximum discharge burn-up which exceeded from licensing value (70%). RSG-GAS compact core without CIP fuelled U 3 Si 2 -Al 2.96 g U/cc have longer cycle operation then RSG-GAS core and fulfil limitation neutronic parameter at the first design value. (author)
Directory of Open Access Journals (Sweden)
Harald Schrem
Full Text Available The aim of this study is to identify independent pre-transplant cancer risk factors after kidney transplantation and to assess the utility of G-chart analysis for clinical process control. This may contribute to the improvement of cancer surveillance processes in individual transplant centers.1655 patients after kidney transplantation at our institution with a total of 9,425 person-years of follow-up were compared retrospectively to the general German population using site-specific standardized-incidence-ratios (SIRs of observed malignancies. Risk-adjusted multivariable Cox regression was used to identify independent pre-transplant cancer risk factors. G-chart analysis was applied to determine relevant differences in the frequency of cancer occurrences.Cancer incidence rates were almost three times higher as compared to the matched general population (SIR = 2.75; 95%-CI: 2.33-3.21. Significantly increased SIRs were observed for renal cell carcinoma (SIR = 22.46, post-transplant lymphoproliferative disorder (SIR = 8.36, prostate cancer (SIR = 2.22, bladder cancer (SIR = 3.24, thyroid cancer (SIR = 10.13 and melanoma (SIR = 3.08. Independent pre-transplant risk factors for cancer-free survival were age 62.6 years (p = 0.001, HR: 1.29, polycystic kidney disease other than autosomal dominant polycystic kidney disease (ADPKD (p = 0.001, HR: 0.68, high body mass index in kg/m2 (p<0.001, HR: 1.04, ADPKD (p = 0.008, HR: 1.26 and diabetic nephropathy (p = 0.004, HR = 1.51. G-chart analysis identified relevant changes in the detection rates of cancer during aftercare with no significant relation to identified risk factors for cancer-free survival (p<0.05.Risk-adapted cancer surveillance combined with prospective G-chart analysis likely improves cancer surveillance schemes by adapting processes to identified risk factors and by using G-chart alarm signals to trigger Kaizen events and audits for root-cause analysis of relevant detection rate changes
Relativistic and QED corrections to the g factor of Li-like ions
International Nuclear Information System (INIS)
Glazov, D.A.; Shabaev, V.M.; Volotka, A.V.; Tupitsyn, I.I.; Yerokhin, V.A.; Plunien, G.; Soff, G.
2004-01-01
Calculations of various corrections to the g factor of Li-like ions are presented, which result in a significant improvement of the theoretical accuracy in the region Z=6-92. The configuration-interaction Dirac-Fock method is employed for the evaluation of the interelectronic-interaction correction of order 1/Z 2 and higher. This correction is combined with the 1/Z interelectronic-interaction term derived within a rigorous QED approach. The one-electron QED correction of first order in α is obtained by employing our recent results for the self-energy term and by evaluating the vacuum-polarization contribution. The screening of QED corrections is taken into account to the leading orders in αZ and 1/Z
Maximum mass of magnetic white dwarfs
International Nuclear Information System (INIS)
Paret, Daryel Manreza; Horvath, Jorge Ernesto; Martínez, Aurora Perez
2015-01-01
We revisit the problem of the maximum masses of magnetized white dwarfs (WDs). The impact of a strong magnetic field on the structure equations is addressed. The pressures become anisotropic due to the presence of the magnetic field and split into parallel and perpendicular components. We first construct stable solutions of the Tolman-Oppenheimer-Volkoff equations for parallel pressures and find that physical solutions vanish for the perpendicular pressure when B ≳ 10 13 G. This fact establishes an upper bound for a magnetic field and the stability of the configurations in the (quasi) spherical approximation. Our findings also indicate that it is not possible to obtain stable magnetized WDs with super-Chandrasekhar masses because the values of the magnetic field needed for them are higher than this bound. To proceed into the anisotropic regime, we can apply results for structure equations appropriate for a cylindrical metric with anisotropic pressures that were derived in our previous work. From the solutions of the structure equations in cylindrical symmetry we have confirmed the same bound for B ∼ 10 13 G, since beyond this value no physical solutions are possible. Our tentative conclusion is that massive WDs with masses well beyond the Chandrasekhar limit do not constitute stable solutions and should not exist. (paper)
A hyperactive transcriptional state marks genome reactivation at the mitosis-G1 transition.
Hsiung, Chris C-S; Bartman, Caroline R; Huang, Peng; Ginart, Paul; Stonestrom, Aaron J; Keller, Cheryl A; Face, Carolyne; Jahn, Kristen S; Evans, Perry; Sankaranarayanan, Laavanya; Giardine, Belinda; Hardison, Ross C; Raj, Arjun; Blobel, Gerd A
2016-06-15
During mitosis, RNA polymerase II (Pol II) and many transcription factors dissociate from chromatin, and transcription ceases globally. Transcription is known to restart in bulk by telophase, but whether de novo transcription at the mitosis-G1 transition is in any way distinct from later in interphase remains unknown. We tracked Pol II occupancy genome-wide in mammalian cells progressing from mitosis through late G1. Unexpectedly, during the earliest rounds of transcription at the mitosis-G1 transition, ∼50% of active genes and distal enhancers exhibit a spike in transcription, exceeding levels observed later in G1 phase. Enhancer-promoter chromatin contacts are depleted during mitosis and restored rapidly upon G1 entry but do not spike. Of the chromatin-associated features examined, histone H3 Lys27 acetylation levels at individual loci in mitosis best predict the mitosis-G1 transcriptional spike. Single-molecule RNA imaging supports that the mitosis-G1 transcriptional spike can constitute the maximum transcriptional activity per DNA copy throughout the cell division cycle. The transcriptional spike occurs heterogeneously and propagates to cell-to-cell differences in mature mRNA expression. Our results raise the possibility that passage through the mitosis-G1 transition might predispose cells to diverge in gene expression states. © 2016 Hsiung et al.; Published by Cold Spring Harbor Laboratory Press.
Maximum a posteriori covariance estimation using a power inverse wishart prior
DEFF Research Database (Denmark)
Nielsen, Søren Feodor; Sporring, Jon
2012-01-01
The estimation of the covariance matrix is an initial step in many multivariate statistical methods such as principal components analysis and factor analysis, but in many practical applications the dimensionality of the sample space is large compared to the number of samples, and the usual maximum...
Robson, Philip M; Grant, Aaron K; Madhuranthakam, Ananth J; Lattanzi, Riccardo; Sodickson, Daniel K; McKenzie, Charles A
2008-10-01
Parallel imaging reconstructions result in spatially varying noise amplification characterized by the g-factor, precluding conventional measurements of noise from the final image. A simple Monte Carlo based method is proposed for all linear image reconstruction algorithms, which allows measurement of signal-to-noise ratio and g-factor and is demonstrated for SENSE and GRAPPA reconstructions for accelerated acquisitions that have not previously been amenable to such assessment. Only a simple "prescan" measurement of noise amplitude and correlation in the phased-array receiver, and a single accelerated image acquisition are required, allowing robust assessment of signal-to-noise ratio and g-factor. The "pseudo multiple replica" method has been rigorously validated in phantoms and in vivo, showing excellent agreement with true multiple replica and analytical methods. This method is universally applicable to the parallel imaging reconstruction techniques used in clinical applications and will allow pixel-by-pixel image noise measurements for all parallel imaging strategies, allowing quantitative comparison between arbitrary k-space trajectories, image reconstruction, or noise conditioning techniques. (c) 2008 Wiley-Liss, Inc.
DeWeber, Jefferson T.; Wagner, Tyler
2018-01-01
Predictions of the projected changes in species distributions and potential adaptation action benefits can help guide conservation actions. There is substantial uncertainty in projecting species distributions into an unknown future, however, which can undermine confidence in predictions or misdirect conservation actions if not properly considered. Recent studies have shown that the selection of alternative climate metrics describing very different climatic aspects (e.g., mean air temperature vs. mean precipitation) can be a substantial source of projection uncertainty. It is unclear, however, how much projection uncertainty might stem from selecting among highly correlated, ecologically similar climate metrics (e.g., maximum temperature in July, maximum 30‐day temperature) describing the same climatic aspect (e.g., maximum temperatures) known to limit a species’ distribution. It is also unclear how projection uncertainty might propagate into predictions of the potential benefits of adaptation actions that might lessen climate change effects. We provide probabilistic measures of climate change vulnerability, adaptation action benefits, and related uncertainty stemming from the selection of four maximum temperature metrics for brook trout (Salvelinus fontinalis), a cold‐water salmonid of conservation concern in the eastern United States. Projected losses in suitable stream length varied by as much as 20% among alternative maximum temperature metrics for mid‐century climate projections, which was similar to variation among three climate models. Similarly, the regional average predicted increase in brook trout occurrence probability under an adaptation action scenario of full riparian forest restoration varied by as much as .2 among metrics. Our use of Bayesian inference provides probabilistic measures of vulnerability and adaptation action benefits for individual stream reaches that properly address statistical uncertainty and can help guide conservation
DeWeber, Jefferson T; Wagner, Tyler
2018-06-01
Predictions of the projected changes in species distributions and potential adaptation action benefits can help guide conservation actions. There is substantial uncertainty in projecting species distributions into an unknown future, however, which can undermine confidence in predictions or misdirect conservation actions if not properly considered. Recent studies have shown that the selection of alternative climate metrics describing very different climatic aspects (e.g., mean air temperature vs. mean precipitation) can be a substantial source of projection uncertainty. It is unclear, however, how much projection uncertainty might stem from selecting among highly correlated, ecologically similar climate metrics (e.g., maximum temperature in July, maximum 30-day temperature) describing the same climatic aspect (e.g., maximum temperatures) known to limit a species' distribution. It is also unclear how projection uncertainty might propagate into predictions of the potential benefits of adaptation actions that might lessen climate change effects. We provide probabilistic measures of climate change vulnerability, adaptation action benefits, and related uncertainty stemming from the selection of four maximum temperature metrics for brook trout (Salvelinus fontinalis), a cold-water salmonid of conservation concern in the eastern United States. Projected losses in suitable stream length varied by as much as 20% among alternative maximum temperature metrics for mid-century climate projections, which was similar to variation among three climate models. Similarly, the regional average predicted increase in brook trout occurrence probability under an adaptation action scenario of full riparian forest restoration varied by as much as .2 among metrics. Our use of Bayesian inference provides probabilistic measures of vulnerability and adaptation action benefits for individual stream reaches that properly address statistical uncertainty and can help guide conservation actions. Our
Oort, van I.M.; Witjes, J.A.; Kok, D.E.G.; Kiemeney, L.A.; Hulsbergen-van de Kaa, C.A.
2008-01-01
Previous studies suggest that maximum tumor diameter (MTD) is a predictor of recurrence in prostate cancer (PC). This study investigates the prognostic value of MTD for biochemical recurrence (BCR) in patients with PC, after radical prostatectomy (RP), with emphasis on high-risk localized prostate
Analysis of the maximum discharge of karst springs
Bonacci, Ognjen
2001-07-01
Analyses are presented of the conditions that limit the discharge of some karst springs. The large number of springs studied show that, under conditions of extremely intense precipitation, a maximum value exists for the discharge of the main springs in a catchment, independent of catchment size and the amount of precipitation. Outflow modelling of karst-spring discharge is not easily generalized and schematized due to numerous specific characteristics of karst-flow systems. A detailed examination of the published data on four karst springs identified the possible reasons for the limitation on the maximum flow rate: (1) limited size of the karst conduit; (2) pressure flow; (3) intercatchment overflow; (4) overflow from the main spring-flow system to intermittent springs within the same catchment; (5) water storage in the zone above the karst aquifer or epikarstic zone of the catchment; and (6) factors such as climate, soil and vegetation cover, and altitude and geology of the catchment area. The phenomenon of limited maximum-discharge capacity of karst springs is not included in rainfall-runoff process modelling, which is probably one of the main reasons for the present poor quality of karst hydrological modelling. Résumé. Les conditions qui limitent le débit de certaines sources karstiques sont présentées. Un grand nombre de sources étudiées montrent que, sous certaines conditions de précipitations extrêmement intenses, il existe une valeur maximale pour le débit des sources principales d'un bassin, indépendante des dimensions de ce bassin et de la hauteur de précipitation. La modélisation des débits d'exhaure d'une source karstique n'est pas facilement généralisable, ni schématisable, à cause des nombreuses caractéristiques spécifiques des écoulements souterrains karstiques. Un examen détaillé des données publiées concernant quatre sources karstiques permet d'identifier les raisons possibles de la limitation de l'écoulement maximal: (1
Prevalencia de los factores de riesgo para cáncer gástrico en universitarios
Directory of Open Access Journals (Sweden)
Gloria Esperanza Zambrano-Plata
2014-06-01
Full Text Available Objetivo: determinar cuáles son los factores de riesgo prevalentes para el cáncer gástrico en los estudiantes de una universidad pública en Cúcuta, Norte de Santander, desde marzo de 2012 a julio de 2013. Materiales y Métodos: estudio cuantitativo con diseño descriptivo de corte trasversal, se obtuvo la información a través de un cuestionario diseñado por los investigadores autoadministrado por los estudiantes matriculados en pregrado, jornada diurna. La población estuvo conformada por 15.843 universitarios, se realizó muestreo polietápico estratificado proporcional por facultad, lo que indicó una muestra de 637 estudiantes. Resultados: se encontró predominancia en el género femenino, con rango de edades de 16 a 20 años y estrato socioeconómico 2. En los factores endógenos se halló prevalencia para herencia familiar de cáncer con un 36% y gastritis como sensación de ardor y dolor constante en la boca del estómago, acompañado de náuseas con 47%; la infección por Helicobacter Pylori soportada por medios diagnósticos, se presentó en menor porcentaje con el 2%. En cuanto a los factores exógenos, se identificaron como prevalentes el sedentarismo con 63,10%, hábitos alimentarios no saludables con 58%, el estrés con 57%, hábitos farmacológicos inadecuados con 49% y consumo de alcohol con un 29,2%. Los factores Índice de masa corporal (obesidad y consumo de tabaco presentan una menor prevalencia con 6% y 16%, respectivamente. Conclusiones: predominan los factores de riesgo exógenos, que son modificables y prevenibles para aquellos que aún no los tienen, de ahí la importancia de intervenirlos a tiempo, contribuyendo en la formación integral del joven.
Directory of Open Access Journals (Sweden)
Bernadett Farago
2010-01-01
Full Text Available Controversial observations have been published on the association of the cytotoxic T lymphocyte associated antigen gene's variants with rheumatoid arthritis (RA. After genotyping 428 patients and 230 matched controls, the prevalence of the CT60∗G allele was more frequent in RF- and/or anti-CCP-seropositive RApatients, compared to the healthy controls (P<.001. Regression analysis revealed that the CT60∗G allele is a possible predisposing factor for RA in these subgroups. No accumulation of the +49∗G allele was found among patients, and this variant was not found to correlate with RA. Assaying the possible genotype variations, the +49∗G-CT60∗G allelic combination was accumulated in seropositive RA-subtypes, and was associated with the risk of RA (OR=1.73, P=.001 for the whole RA-population. Although the +49∗G allele did not mean a predisposition to RA alone, in combination with CT60∗G it, also conferred risk, suggesting that the +49A/G variant is associated with the risk of RA only in certain haplotypes.
Effects of variability in probable maximum precipitation patterns on flood losses
Zischg, Andreas Paul; Felder, Guido; Weingartner, Rolf; Quinn, Niall; Coxon, Gemma; Neal, Jeffrey; Freer, Jim; Bates, Paul
2018-05-01
The assessment of the impacts of extreme floods is important for dealing with residual risk, particularly for critical infrastructure management and for insurance purposes. Thus, modelling of the probable maximum flood (PMF) from probable maximum precipitation (PMP) by coupling hydrological and hydraulic models has gained interest in recent years. Herein, we examine whether variability in precipitation patterns exceeds or is below selected uncertainty factors in flood loss estimation and if the flood losses within a river basin are related to the probable maximum discharge at the basin outlet. We developed a model experiment with an ensemble of probable maximum precipitation scenarios created by Monte Carlo simulations. For each rainfall pattern, we computed the flood losses with a model chain and benchmarked the effects of variability in rainfall distribution with other model uncertainties. The results show that flood losses vary considerably within the river basin and depend on the timing and superimposition of the flood peaks from the basin's sub-catchments. In addition to the flood hazard component, the other components of flood risk, exposure, and vulnerability contribute remarkably to the overall variability. This leads to the conclusion that the estimation of the probable maximum expectable flood losses in a river basin should not be based exclusively on the PMF. Consequently, the basin-specific sensitivities to different precipitation patterns and the spatial organization of the settlements within the river basin need to be considered in the analyses of probable maximum flood losses.
Gao, Quangen; Zhang, Peijin; Wang, Wei; Ma, He; Tong, Yue; Zhang, Jing; Lu, Zhaojun
2016-10-01
Venous thromboembolism is a common complex disorder, being the resultant of gene-gene and gene-environment interactions. Tumor necrosis factor-alpha is a proinflammatory cytokine which has been implicated in venous thromboembolism risk. A promoter 308G/A polymorphism in the tumor necrosis factor-alpha gene has been suggested to modulate the risk for venous thromboembolism. However, the published findings remain inconsistent. In this study, we conducted a meta-analysis of all available data regarding this issue. Eligible studies were identified through search of Pubmed, EBSCO Medline, Web of Science, and China National Knowledge Infrastructure (CNKI, Chinese) databases up to June 2014. Pooled Odd ratios (ORs) with 95% confidence intervals were applied to estimating the strength of the genetic association in the random-effects model or fixed-effects model. A total of 10 studies involving 1999 venous thromboembolism cases and 2166 controls were included in this meta-analysis to evaluate the association between tumor necrosis factor-alpha-308G/A polymorphism and venous thromboembolism risk. Overall, no significantly increased risk venous thromboembolism was observed in all comparison models when all studies were pooled into the meta-analysis. However, in stratified analyses by ethnicity, there was a pronounced association with venous thromboembolism risk among West Asians in three genetic models (A vs. G: OR = 1.82, 95%CI = 1.13-2.94; GA vs. GG: OR = 1.82, 95%CI = 1.08-3.06; AA/GA vs. GG: OR = 1.88, 95%CI = 1.12-3.16). When stratifying by source of controls, no significant result was detected in all genetic models. This meta-analysis demonstrates that tumor necrosis factor-alpha 308G/A polymorphism may contribute to susceptibility to venous thromboembolism among West Asians. Studies are needed to ascertain these findings in larger samples and different racial groups. © The Author(s) 2015.
A g-factor metric for k-t SENSE and k-t PCA based parallel imaging.
Binter, Christian; Ramb, Rebecca; Jung, Bernd; Kozerke, Sebastian
2016-02-01
To propose and validate a g-factor formalism for k-t SENSE, k-t PCA and related k-t methods for assessing SNR and temporal fidelity. An analytical gxf -factor formulation in the spatiotemporal frequency domain is derived, enabling assessment of noise and depiction fidelity in both the spatial and frequency domain. Using pseudoreplica analysis of cardiac cine data the gxf -factor description is validated and example data are used to analyze the performance of k-t methods for various parameter settings. Analytical gxf -factor maps were found to agree well with pseudoreplica analysis for 3x, 5x, and 7x k-t SENSE and k-t PCA. While k-t SENSE resulted in lower average gxf values (gx (avg) ) in static regions when compared with k-t PCA, k-t PCA yielded lower gx (avg) values in dynamic regions. Temporal transfer was better preserved with k-t PCA for increasing undersampling factors. The proposed gxf -factor and temporal transfer formalism allows assessing noise performance and temporal depiction fidelity of k-t methods including k-t SENSE and k-t PCA. The framework enables quantitative comparison of different k-t methods relative to frame-by-frame parallel imaging reconstruction. © 2015 Wiley Periodicals, Inc.
Parametric characteristics of a solar thermophotovoltaic system at the maximum efficiency
International Nuclear Information System (INIS)
Liao, Tianjun; Chen, Xiaohang; Yang, Zhimin; Lin, Bihong; Chen, Jincan
2016-01-01
Graphical abstract: A model of the far-field TPVC driven by solar energy, which consists of an optical concentrator, an absorber, an emitter, and a PV cell and is simply referred as to the far-field STPVS. - Highlights: • A model of the far-field solar thermophotovoltaic system (STPVS) is established. • External and internal irreversible losses are considered. • The maximum efficiency of the STPVS is calculated. • Optimal values of key parameters at the maximum efficiency are determined. • Effects of the concentrator factor on the performance of the system are discussed. - Abstract: A model of the solar thermophotovoltaic system (STPVS) consisting of an optical concentrator, a thermal absorber, an emitter, and a photovoltaic (PV) cell is proposed, where the far-field thermal emission between the emitter and the PV cell, the radiation losses from the absorber and emitter to the environment, the reflected loss from the absorber, and the finite-rate heat exchange between the PV cell and the environment are taken into account. Analytical expressions for the power output of and overall efficiency of the STPVS are derived. By solving thermal equilibrium equations, the operating temperatures of the emitter and PV cell are determined and the maximum efficiency of the system is calculated numerically for given values of the output voltage of the PV cell and the ratio of the front surface area of the absorber to that of the emitter. For different bandgaps, the maximum efficiencies of the system are calculated and the corresponding optimum values of several operating parameters are obtained. The effects of the concentrator factor on the optimum performance of the system are also discussed.
Relationship between oral status and maximum bite force in preschool children
Directory of Open Access Journals (Sweden)
Ching-Ming Su
2009-03-01
Conclusion: By combining the results of this study, it was concluded that associations of bite force with factors like age, maximum mouth opening and the number of teeth in contact were clearer than for other variables such as body height, body weight, occlusal pattern, and tooth decay or fillings.
Energy-Efficient Algorithm for Sensor Networks with Non-Uniform Maximum Transmission Range
Directory of Open Access Journals (Sweden)
Yimin Yu
2011-06-01
Full Text Available In wireless sensor networks (WSNs, the energy hole problem is a key factor affecting the network lifetime. In a circular multi-hop sensor network (modeled as concentric coronas, the optimal transmission ranges of all coronas can effectively improve network lifetime. In this paper, we investigate WSNs with non-uniform maximum transmission ranges, where sensor nodes deployed in different regions may differ in their maximum transmission range. Then, we propose an Energy-efficient algorithm for Non-uniform Maximum Transmission range (ENMT, which can search approximate optimal transmission ranges of all coronas in order to prolong network lifetime. Furthermore, the simulation results indicate that ENMT performs better than other algorithms.
Energy Technology Data Exchange (ETDEWEB)
Roullier, F; Schmitt, A P [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1957-07-01
The thermal utilisation factor of the lattice of the reactor G1 has been measured by applying the autoradiographic technique to thin detectors irradiated in the cell. The experimental apparatus is described, and the results compared with those obtained by calculation based on various formulae. The results of the study of the thermal flux distribution in a cell containing a thorium rod of the same diameter as the uranium rods in the lattice are also given. The precision of the measurements is discussed. Value found: f diameter 26 = 0.8949 {+-} 0,005. (author) [French] Le facteur d'utilisation thermique du reseau du reacteur G1 a ete mesure en appliquant la technique de l'autoradiographie a des detecteurs minces irradies dans la cellule. Les dispositifs experimentaux sont decrits et les resultats sont compares a ceux obtenus par le calcul a partir de diverses formules. Les resultats de l'etude de la distribution du flux thermique dans une cellule contenant une barre de thorium de meme diametre que les barres d'uranium du reseau sont egalement indiques. La precision des mesures est discutee. Valeur trouvee: f diametre 26 = 0,8949 {+-} 0,005. (author)
Precision measurement of the RaE shape factor
International Nuclear Information System (INIS)
Grau, C.A.; Grau, M.A.
1996-01-01
We apply to RaE a new method to determine the shape factor coefficients of pure beta transitions with energies over the Cherenkov threshold of water. This method is based on the precision measurement of one observable, the ft-value, and two quasi-observables, the Cherenkov counting efficiency and the position of the maximum point of the liquid-scintillation logarithmic pulse-height spectrum. We found for the revised shape factor function that the ground state wave function vertical stroke 210 Bi, 1 - right angle is the combination of the three wave functions vertical stroke 1h 9/2 2g 9/2 right angle, vertical stroke 1h 9/2 1i 11/2 right angle and vertical stroke 1h 9/2 2g 7/2 right angle. This result is also confirmed by the excellent agreement we obtain with experiment for the longitudinal electron polarization. (orig.)
Dang, Cuong Cao; Lefort, Vincent; Le, Vinh Sy; Le, Quang Si; Gascuel, Olivier
2011-10-01
Amino acid replacement rate matrices are an essential basis of protein studies (e.g. in phylogenetics and alignment). A number of general purpose matrices have been proposed (e.g. JTT, WAG, LG) since the seminal work of Margaret Dayhoff and co-workers. However, it has been shown that matrices specific to certain protein groups (e.g. mitochondrial) or life domains (e.g. viruses) differ significantly from general average matrices, and thus perform better when applied to the data to which they are dedicated. This Web server implements the maximum-likelihood estimation procedure that was used to estimate LG, and provides a number of tools and facilities. Users upload a set of multiple protein alignments from their domain of interest and receive the resulting matrix by email, along with statistics and comparisons with other matrices. A non-parametric bootstrap is performed optionally to assess the variability of replacement rate estimates. Maximum-likelihood trees, inferred using the estimated rate matrix, are also computed optionally for each input alignment. Finely tuned procedures and up-to-date ML software (PhyML 3.0, XRATE) are combined to perform all these heavy calculations on our clusters. http://www.atgc-montpellier.fr/ReplacementMatrix/ olivier.gascuel@lirmm.fr Supplementary data are available at http://www.atgc-montpellier.fr/ReplacementMatrix/
Towards converged 5G mobile networks-challenges and current trends
DEFF Research Database (Denmark)
Zakrzewska, Anna; Ruepp, Sarah Renée; Berger, Michael Stübert
2014-01-01
With the rapid development of wireless technologies, the concept of the Fifth Generation (5G) wireless communication system started to emerge and it is foreseen that it will be a result of standards convergence. The expectations towards 5G are set much higher in terms of capacity and maximum thro...
Directory of Open Access Journals (Sweden)
Tanjew Dittgen
Full Text Available Granulocyte-colony stimulating factor (G-CSF improves outcome after experimental SCI by counteracting apoptosis, and enhancing connectivity in the injured spinal cord. Previously we have employed the mouse hemisection SCI model and studied motor function after subcutaneous or transgenic delivery of the protein. To further broaden confidence in animal efficacy data we sought to determine efficacy in a different model and a different species. Here we investigated the effects of G-CSF in Wistar rats using the New York University Impactor. In this model, corroborating our previous data, rats treated subcutaneously with G-CSF over 2 weeks show significant improvement of motor function.
Peng, Zong-Gen; Zhao, Zhi-Yun; Li, Yan-Ping; Wang, Yu-Ping; Hao, Lan-Hu; Fan, Bo; Li, Yu-Huan; Wang, Yue-Ming; Shan, Yong-Qiang; Han, Yan-Xing; Zhu, Yan-Ping; Li, Jian-Rui; You, Xue-Fu; Li, Zhuo-Rong; Jiang, Jian-Dong
2011-04-01
Host cellular factor apolipoprotein B messenger RNA (mRNA)-editing enzyme catalytic polypeptide-like 3G (hA3G) is a cytidine deaminase that inhibits a group of viruses including human immunodeficiency virus-1 (HIV-1). In the continuation of our research on hA3G, we found that hA3G stabilizing compounds significantly inhibited hepatitis C virus (HCV) replication. Therefore, this study investigated the role of hA3G in HCV replication. Introduction of external hA3G into HCV-infected Huh7.5 human hepatocytes inhibited HCV replication; knockdown of endogenous hA3G enhanced HCV replication. Exogenous HIV-1 virion infectivity factor (Vif) decreased intracellular hA3G and therefore enhanced HCV proliferation, suggesting that the presence of Vif might be an explanation for the HIV-1/HCV coinfection often observed in HIV-1(+) individuals. Treatment of the HCV-infected Huh7.5 cells with RN-5 or IMB-26, two known hA3G stabilizing compounds, increased intracellular hA3G and accordingly inhibited HCV replication. The compounds inhibit HCV through increasing the level of hA3G incorporated into HCV particles, but not through inhibiting HCV enzymes. However, G/A hypermutation in the HCV genome were not detected, suggesting a new antiviral mechanism of hA3G in HCV, different from that in HIV-1. Stabilization of hA3G by RN-5 was safe in vivo. hA3G appears to be a cellular restrict factor against HCV and could be a potential target for drug discovery. 2011 American Association for the Study of Liver Diseases.
Behaviour of Soil Subjected to Dynamic Loads
DEFF Research Database (Denmark)
Bødker, L.
1998-01-01
foundations, and hence it is necessary to know the deformation properties for the soil at very low strain level. The main topic of the project is to increase the knowledge of the behaviour of Danish soils at small strain levels and to extend the laboratory facilities to deal with testing at small strains....... The soil behaviour at very small strain levels is non-linear, and the most common testing technique for this situation is the resonant column technique. One of the aims of this project is to install, check, get familiar with and perform tests on different kinds of Danish soils in a new Drnevich...... Longitudinal-Torsional Resonant Column apparatus placed at the Soil Mechanics Laboratory at Aalborg University. Another, but quite new technique for small strain testing to determine the maximum shear modulus, Gmax, is the bender element technique, and as part of the project this technique has also been...
Rosewarne, P J; Wilson, J M; Svendsen, J C
2016-01-01
Metabolic rate is one of the most widely measured physiological traits in animals and may be influenced by both endogenous (e.g. body mass) and exogenous factors (e.g. oxygen availability and temperature). Standard metabolic rate (SMR) and maximum metabolic rate (MMR) are two fundamental physiological variables providing the floor and ceiling in aerobic energy metabolism. The total amount of energy available between these two variables constitutes the aerobic metabolic scope (AMS). A laboratory exercise aimed at an undergraduate level physiology class, which details the appropriate data acquisition methods and calculations to measure oxygen consumption rates in rainbow trout Oncorhynchus mykiss, is presented here. Specifically, the teaching exercise employs intermittent flow respirometry to measure SMR and MMR, derives AMS from the measurements and demonstrates how AMS is affected by environmental oxygen. Students' results typically reveal a decline in AMS in response to environmental hypoxia. The same techniques can be applied to investigate the influence of other key factors on metabolic rate (e.g. temperature and body mass). Discussion of the results develops students' understanding of the mechanisms underlying these fundamental physiological traits and the influence of exogenous factors. More generally, the teaching exercise outlines essential laboratory concepts in addition to metabolic rate calculations, data acquisition and unit conversions that enhance competency in quantitative analysis and reasoning. Finally, the described procedures are generally applicable to other fish species or aquatic breathers such as crustaceans (e.g. crayfish) and provide an alternative to using higher (or more derived) animals to investigate questions related to metabolic physiology. © 2016 The Fisheries Society of the British Isles.
International Nuclear Information System (INIS)
1991-01-01
The meaning of the term 'maximum concentration at work' in regard of various pollutants is discussed. Specifically, a number of dusts and smokes are dealt with. The valuation criteria for maximum biologically tolerable concentrations for working materials are indicated. The working materials in question are corcinogeneous substances or substances liable to cause allergies or mutate the genome. (VT) [de
Factores de riesgos psicosociales en el trabajo: género y enfermería
Ceballos Vásquez, Paula; Valenzuela Suazo, Sandra; Paravic Klijn, Tatiana
2014-01-01
Este trabajo tiene como objetivo reflexionar sobre los aspectos teóricos relacionados con los riesgos psicosociales a nivel laboral, analizar con enfoque de género las desigualdades en relación con los riesgos y vincular la enfermería con los riesgos psicosociales. Se presentan los aspectos teóricos, asociados con los factores de riesgos psicosociales y se visibilizan algunas desigualdades presentes en los lugares de trabajo entre hombres y mujeres; además, el personal sanitario es uno de los...
Mid-depth temperature maximum in an estuarine lake
Stepanenko, V. M.; Repina, I. A.; Artamonov, A. Yu; Gorin, S. L.; Lykossov, V. N.; Kulyamin, D. V.
2018-03-01
The mid-depth temperature maximum (TeM) was measured in an estuarine Bol’shoi Vilyui Lake (Kamchatka peninsula, Russia) in summer 2015. We applied 1D k-ɛ model LAKE to the case, and found it successfully simulating the phenomenon. We argue that the main prerequisite for mid-depth TeM development is a salinity increase below the freshwater mixed layer, sharp enough in order to increase the temperature with depth not to cause convective mixing and double diffusion there. Given that this condition is satisfied, the TeM magnitude is controlled by physical factors which we identified as: radiation absorption below the mixed layer, mixed-layer temperature dynamics, vertical heat conduction and water-sediments heat exchange. In addition to these, we formulate the mechanism of temperature maximum ‘pumping’, resulting from the phase shift between diurnal cycles of mixed-layer depth and temperature maximum magnitude. Based on the LAKE model results we quantify the contribution of the above listed mechanisms and find their individual significance highly sensitive to water turbidity. Relying on physical mechanisms identified we define environmental conditions favouring the summertime TeM development in salinity-stratified lakes as: small-mixed layer depth (roughly, ~wind and cloudless weather. We exemplify the effect of mixed-layer depth on TeM by a set of selected lakes.
2010-07-01
... cylinders having an internal diameter of 13.0 cm and a 15.5 cm stroke length, the rounded displacement would... 40 Protection of Environment 32 2010-07-01 2010-07-01 false Maximum engine power, displacement... Maximum engine power, displacement, power density, and maximum in-use engine speed. This section describes...
Usuda, Katsuo; Funasaki, Aika; Sekimura, Atsushi; Motono, Nozomu; Matoba, Munetaka; Doai, Mariko; Yamada, Sohsuke; Ueda, Yoshimichi; Uramoto, Hidetaka
2018-04-09
Diffusion-weighted magnetic resonance imaging (DWI) is useful for detecting malignant tumors and the assessment of lymph nodes, as FDG-PET/CT is. But it is not clear how DWI influences the prognosis of lung cancer patients. The focus of this study is to evaluate the correlations between maximum standardized uptake value (SUVmax) of FDG-PET/CT and apparent diffusion coefficient (ADC) value of DWI with known prognostic factors in resected lung cancer. A total of 227 patients with resected lung cancers were enrolled in this study. FEG-PET/CT and DWI were performed in each patient before surgery. There were 168 patients with adenocarcinoma, 44 patients with squamous cell carcinoma, and 15 patients with other cell types. SUVmax was a factor that was correlated to T factor, N factor, or cell differentiation. ADC of lung cancer was a factor that was not correlated to T factor, or N factor. There was a significantly weak inverse relationship between SUVmax and ADC (Correlation coefficient r = - 0.227). In analysis of survival, there were significant differences between the categories of sex, age, pT factor, pN factor, cell differentiation, cell type, and SUVmax. Univariate analysis revealed that SUVmax, pN factor, age, cell differentiation, cell type, sex, and pT factor were significant factors. Multivariate analysis revealed that SUVmax and pN factor were independent significant prognostic factors. SUVmax was a significant prognostic factor that is correlated to T factor, N factor, or cell differentiation, but ADC was not. SUVmax may be more useful for predicting the prognosis of lung cancer than ADC values.
Credal Networks under Maximum Entropy
Lukasiewicz, Thomas
2013-01-01
We apply the principle of maximum entropy to select a unique joint probability distribution from the set of all joint probability distributions specified by a credal network. In detail, we start by showing that the unique joint distribution of a Bayesian tree coincides with the maximum entropy model of its conditional distributions. This result, however, does not hold anymore for general Bayesian networks. We thus present a new kind of maximum entropy models, which are computed sequentially. ...
The discrete maximum principle for Galerkin solutions of elliptic problems
Czech Academy of Sciences Publication Activity Database
Vejchodský, Tomáš
2012-01-01
Roč. 10, č. 1 (2012), s. 25-43 ISSN 1895-1074 R&D Projects: GA AV ČR IAA100760702 Institutional research plan: CEZ:AV0Z10190503 Keywords : discrete maximum principle * monotone methods * Galerkin solution Subject RIV: BA - General Mathematics Impact factor: 0.405, year: 2012 http://www.springerlink.com/content/x73624wm23x4wj26
Ding, Chang-Chun; Wu, Shao-Yi; Xu, Yong-Qiang; Wu, Li-Na; Zhang, Li-Juan
2018-05-01
This work presents a systematic density functional theory (DFT) study for geometrical and electronic structures, g factors and UV-vis spectra of three Cu(II) coordination polymers (CPs) [Cu(XL)(NO3)2]n (1), {[Cu(XL)(4,4‧-bpy)(NO3)2]•CH3CN}n (2) and {[Cu(XL)3](NO3)2·3.5H2O}n (3) based on the ligand N,N‧-bicyclo[2.2.2]oct-7-ene-2,3,5,6-tetracarboxdiimide bi(1,2,4-triazole) (XL) with the linker triazole coordinated with copper to construct the CPs. For three CPs with distinct ligands, the optimized molecular structures with PBE0 hybrid functional and the 6-311g basis set agree well with the corresponding XRD data. Meanwhile, the electronic properties are also analyzed for all the systems. The calculated g factors are found sensitive to the (Hartree-Fock) HF character due to the significant hybridization between copper and ligand orbitals. The calculated UV-visible spectra reveal that the main electronic transitions for CP 1 contain d-d and CT transitions, while those for CPs 2 and 3 largely belong to CT ones. The present CPs seem difficult to adsorb small molecules, e.g., CP 1 with H2O and NO2 exhibit unfavorable adsorption and deformation structures near the Cu2+ site.
Maximum Entropy in Drug Discovery
Directory of Open Access Journals (Sweden)
Chih-Yuan Tseng
2014-07-01
Full Text Available Drug discovery applies multidisciplinary approaches either experimentally, computationally or both ways to identify lead compounds to treat various diseases. While conventional approaches have yielded many US Food and Drug Administration (FDA-approved drugs, researchers continue investigating and designing better approaches to increase the success rate in the discovery process. In this article, we provide an overview of the current strategies and point out where and how the method of maximum entropy has been introduced in this area. The maximum entropy principle has its root in thermodynamics, yet since Jaynes’ pioneering work in the 1950s, the maximum entropy principle has not only been used as a physics law, but also as a reasoning tool that allows us to process information in hand with the least bias. Its applicability in various disciplines has been abundantly demonstrated. We give several examples of applications of maximum entropy in different stages of drug discovery. Finally, we discuss a promising new direction in drug discovery that is likely to hinge on the ways of utilizing maximum entropy.
Maximum Quantum Entropy Method
Sim, Jae-Hoon; Han, Myung Joon
2018-01-01
Maximum entropy method for analytic continuation is extended by introducing quantum relative entropy. This new method is formulated in terms of matrix-valued functions and therefore invariant under arbitrary unitary transformation of input matrix. As a result, the continuation of off-diagonal elements becomes straightforward. Without introducing any further ambiguity, the Bayesian probabilistic interpretation is maintained just as in the conventional maximum entropy method. The applications o...
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Maximum-likelihood fitting of data dominated by Poisson statistical uncertainties
International Nuclear Information System (INIS)
Stoneking, M.R.; Den Hartog, D.J.
1996-06-01
The fitting of data by χ 2 -minimization is valid only when the uncertainties in the data are normally distributed. When analyzing spectroscopic or particle counting data at very low signal level (e.g., a Thomson scattering diagnostic), the uncertainties are distributed with a Poisson distribution. The authors have developed a maximum-likelihood method for fitting data that correctly treats the Poisson statistical character of the uncertainties. This method maximizes the total probability that the observed data are drawn from the assumed fit function using the Poisson probability function to determine the probability for each data point. The algorithm also returns uncertainty estimates for the fit parameters. They compare this method with a χ 2 -minimization routine applied to both simulated and real data. Differences in the returned fits are greater at low signal level (less than ∼20 counts per measurement). the maximum-likelihood method is found to be more accurate and robust, returning a narrower distribution of values for the fit parameters with fewer outliers
Gonzalez-Fuentes, C.; Dumas, R. K.; García, C.
2018-01-01
A theoretical and experimental study of the influence of small offsets of the magnetic field (δH) on the measurement accuracy of the spectroscopic g-factor (g) and saturation magnetization (Ms) obtained by broadband ferromagnetic resonance (FMR) measurements is presented. The random nature of δH generates systematic and opposite sign deviations of the values of g and Ms with respect to their true values. A δH on the order of a few Oe leads to a ˜10% error of g and Ms for a typical range of frequencies employed in broadband FMR experiments. We propose a simple experimental methodology to significantly minimize the effect of δH on the fitted values of g and Ms, eliminating their apparent dependence in the range of frequencies employed. Our method was successfully tested using broadband FMR measurements on a 5 nm thick Ni80Fe20 film for frequencies ranging between 3 and 17 GHz.
The advanced progress of precoding technology in 5g system
An, Chenyi
2017-09-01
With the development of technology, people began to put forward higher requirements for the mobile system, the emergence of the 5G subvert the track of the development of mobile communication technology. In the research of the core technology of 5G mobile communication, large scale MIMO, and precoding technology is a research hotspot. At present, the research on precoding technology in 5G system analyzes the various methods of linear precoding, the maximum ratio transmission (MRT) precoding algorithm, zero forcing (ZF) precoding algorithm, minimum mean square error (MMSE) precoding algorithm based on maximum signal to leakage and noise ratio (SLNR). Precoding algorithms are analyzed and summarized in detail. At the same time, we also do some research on nonlinear precoding methods, such as dirty paper precoding, THP precoding algorithm and so on. Through these analysis, we can find the advantages and disadvantages of each algorithm, as well as the development trend of each algorithm, grasp the development of the current 5G system precoding technology. Therefore, the research results and data of this paper can be used as reference for the development of precoding technology in 5G system.
Mechanical limits to maximum weapon size in a giant rhinoceros beetle.
McCullough, Erin L
2014-07-07
The horns of giant rhinoceros beetles are a classic example of the elaborate morphologies that can result from sexual selection. Theory predicts that sexual traits will evolve to be increasingly exaggerated until survival costs balance the reproductive benefits of further trait elaboration. In Trypoxylus dichotomus, long horns confer a competitive advantage to males, yet previous studies have found that they do not incur survival costs. It is therefore unlikely that horn size is limited by the theoretical cost-benefit equilibrium. However, males sometimes fight vigorously enough to break their horns, so mechanical limits may set an upper bound on horn size. Here, I tested this mechanical limit hypothesis by measuring safety factors across the full range of horn sizes. Safety factors were calculated as the ratio between the force required to break a horn and the maximum force exerted on a horn during a typical fight. I found that safety factors decrease with increasing horn length, indicating that the risk of breakage is indeed highest for the longest horns. Structural failure of oversized horns may therefore oppose the continued exaggeration of horn length driven by male-male competition and set a mechanical limit on the maximum size of rhinoceros beetle horns. © 2014 The Author(s) Published by the Royal Society. All rights reserved.
Directory of Open Access Journals (Sweden)
Saray Sánchez
2009-12-01
Full Text Available Con el objetivo de determinar la descomposición de la hojarasca en un sistema silvopastoril de Panicum maximum y Leucaena leucocephala y su relación con algunos factores del clima, se realizó este experimento en la EEPF «Indio Hatuey». La descomposición de la hojarasca se determinó como la pérdida de biomasa a través del tiempo, con relación al peso inicial. Para el estudio de la dinámica de la descomposición se utilizó el método de bolsas de hojarasca (litter bags; se registró diariamente el comportamiento de la temperatura media, la humedad relativa, la precipitación y los días con lluvias, en la estación metereológica situada a 1 km del área experimental. Se utilizó el análisis de correlación y regresión para conocer la interrelación entre las variables y los modelos de mejor ajuste. Se consideró, como variables independientes, los factores climáticos estudiados, y como variable dependiente el porcentaje de biomasa perdida. De forma general, los resultados demostraron que el comportamiento de la descomposición de la hojarasca, tanto en la guinea como en la leucaena, estuvo relacionado con los factores climáticos que prevalecieron durante el período experimental y, por tanto, es posible explicar este proceso en ambos pastizales a partir de la acción conjunta de la temperatura, la humedad relativa y la precipitación.With the objective of determining the litter decomposition in a silvopastoral system of Panicum maximum and Leucaena leucocephala and its relationship to some climate factors, this trial was conducted at the EEPF «Indio Hatuey». Litter decomposition was determined as the loss of biomass through time, with regards to initial weight. For studying the decomposition dynamics the method of litter bags was used; the performance of mean temperature, relative humidity, rainfall and days with rain, was daily recorded at the meteorological station located 1 km away from the experimental area. . The
Trivigno, Catherine; Haerry, Theodor E
2011-02-25
Mutations in the human mitochondrial elongation factor G1 (EF-G1) are recessive lethal and cause death shortly after birth. We have isolated mutations in iconoclast (ico), which encodes the highly conserved Drosophila orthologue of EF-G1. We find that EF-G1 is essential during fly development, but its function is not required in every tissue. In contrast to null mutations, missense mutations exhibit stronger, possibly neomorphic phenotypes that lead to premature death during embryogenesis. Our experiments show that EF-G1 contains a secondary C-terminal nuclear localization signal. Expression of missense mutant forms of EF-G1 can accumulate in the nucleus and cause growth and patterning defects and animal lethality. We find that transgenes that encode mutant human EF-G1 proteins can rescue ico mutants, indicating that the underlying problem of the human disease is not just the loss of enzymatic activity. Our results are consistent with a model where EF-G1 acts as a retrograde signal from mitochondria to the nucleus to slow down cell proliferation if mitochondrial energy output is low.
Kusoglu, A; Georgiev, G; Brown, B A; Goasduff, A; Atanasova, L; Balabanski, D L; Bostan, M; Danchev, M; Detistov, P; Gladnishki, K A; Ljungvall, J; Matea, I; Radeck, D; Sotty, C; Stefan, I; Verney, D; Yordanov, D T
2015-01-01
A precise measurement of the g factor of the first-excited state in the self-conjugate (N=Z) nucleus Mg24 is performed by a new time-differential recoil-in-vacuum method based on the hyperfine field of hydrogenlike ions. Theory predicts that the g factors of such states, in which protons and neutrons occupy the same orbits, should depart from 0.5 by a few percent due to configuration mixing and meson-exchange effects. The experimental result, g=0.538±0.013, is in excellent agreement with recent shell-model calculations and shows a departure from 0.5 by almost 3 standard deviations, thus achieving, for the first time, the precision and accuracy needed to test theory. Proof of the new method opens the way for wide applications including measurements of the magnetism of excited states of exotic nuclei produced as radioactive beams.
International Nuclear Information System (INIS)
Biondi, L.
1998-01-01
The charging for a service is a supplier's remuneration for the expenses incurred in providing it. There are currently two charges for electricity: consumption and maximum demand. While no problem arises about the former, the issue is more complicated for the latter and the analysis in this article tends to show that the annual charge for maximum demand arbitrarily discriminates among consumer groups, to the disadvantage of some [it
Directory of Open Access Journals (Sweden)
Carolina Tamayo Múnera
2006-04-01
Full Text Available The Necrotizing enterocolitis (NEC is a serious illness of the newborn that affects mainly the preterm infant. It corresponds to a diffuse intestinal necrosis with more affection of the ileocecal region. The pathophysiology is complex and multiple risk factors can cause the illness in a susceptible infant. Among the different theories about their appearance is observed that prematurity, intestinal isquemia, bacterial colonization and enteral feeding are the main risk factors, which can be favored by prenatal, perinatal or postnatal conditions. The aim of this article is to review the pathophysiology and the risk factors described in the current evidence. La enterocolitis necrosante (ECN es una grave enfermedad propia del recién nacido (RN que afecta principalmente a los RN pretérmino (RNPT. Corresponde a una necrosis isquémica de la mucosa intestinal con mayor afección de la región ileocecal. La fisiopatología es compleja y en ella participan múltiples factores de riesgo que pueden ocasionar la enfermedad en un RN susceptible. Entre las diferentes teorías acerca de su aparición se observa reiteradamente que la prematuridad, la isquemia intestinal, la colonización bacteriana y la alimentación enteral se repiten como los factores de riesgo principales, los cuales pueden ser favorecidos por condiciones prenatales, perinatales o posnatales. Se revisan la fisiopatología y los factores de riesgo implicados en la génesis de esta enfermedad.
A New Maximum Length Record of the Bluefish (Pomatomus saltatrix Linnaeus, 1766) for Turkey Seas
Cengiz, Özgür
2014-01-01
One specimen of the bluefish (Pomatomus saltatrix Linnaeus, 1766) with 76.5 cm in total length and 4800.0 g in total weight was photographed in the Çanakkale Fish Market. The given length is second maximum length record of the bluefish for Turkish waters
On the maximum and minimum of two modified Gamma-Gamma variates with applications
Al-Quwaiee, Hessa
2014-04-01
In this work, we derive the statistical characteristics of the maximum and the minimum of two modified1 Gamma-Gamma variates in closed-form in terms of Meijer\\'s G-function and the extended generalized bivariate Meijer\\'s G-function. Then, we rely on these new results to present the performance analysis of (i) a dual-branch free-space optical selection combining diversity undergoing independent but not necessarily identically distributed Gamma-Gamma fading under the impact of pointing errors and of (ii) a dual-hop free-space optical relay transmission system. Computer-based Monte-Carlo simulations verify our new analytical results.
Extending the maximum operation time of the MNSR reactor.
Dawahra, S; Khattab, K; Saba, G
2016-09-01
An effective modification to extend the maximum operation time of the Miniature Neutron Source Reactor (MNSR) to enhance the utilization of the reactor has been tested using the MCNP4C code. This modification consisted of inserting manually in each of the reactor inner irradiation tube a chain of three polyethylene-connected containers filled of water. The total height of the chain was 11.5cm. The replacement of the actual cadmium absorber with B(10) absorber was needed as well. The rest of the core structure materials and dimensions remained unchanged. A 3-D neutronic model with the new modifications was developed to compare the neutronic parameters of the old and modified cores. The results of the old and modified core excess reactivities (ρex) were: 3.954, 6.241 mk respectively. The maximum reactor operation times were: 428, 1025min and the safety reactivity factors were: 1.654 and 1.595 respectively. Therefore, a 139% increase in the maximum reactor operation time was noticed for the modified core. This increase enhanced the utilization of the MNSR reactor to conduct a long time irradiation of the unknown samples using the NAA technique and increase the amount of radioisotope production in the reactor. Copyright © 2016 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Yin, Chukai; Su, Bingjing
2001-01-01
The Minerbo's maximum entropy Eddington factor (MEEF) method was proposed as a low-order approximation to transport theory, in which the first two moment equations are closed for the scalar flux f and the current F through a statistically derived nonlinear Eddington factor f. This closure has the ability to handle various degrees of anisotropy of angular flux and is well justified both numerically and theoretically. Thus, a lot of efforts have been made to use this approximation in transport computations, especially in the radiative transfer and astrophysics communities. However, the method suffers numerical instability and may lead to anomalous solutions if the equations are solved by certain commonly used (implicit) mesh schemes. Studies on numerical stability in one-dimensional cases show that the MEEF equations can be solved satisfactorily by an implicit scheme (of treating δΦ/δx) if the angular flux is not too anisotropic so that f 32 , the classic diffusion solution P 1 , the MEEF solution f M obtained by Riemann solvers, and the NFLD solution D M for the two problems, respectively. In Fig. 1, NFLD and MEEF quantitatively predict very close results. However, the NFLD solution is qualitatively better because it is continuous while MEEF predicts unphysical jumps near the middle of the slab. In Fig. 2, the NFLD and MEEF solutions are almost identical, except near the material interface. In summary, the flux-limited diffusion theory derived from the MEEF description is quantitatively as accurate as the MEEF method. However, it is more qualitatively correct and user-friendly than the MEEF method and can be applied efficiently to various steady-state problems. Numerical tests show that this method is widely valid and overall predicts better results than other low-order approximations for various kinds of problems, including eigenvalue problems. Thus, it is an appealing approximate solution technique that is fast computationally and yet is accurate enough for a
Association of the polymorphism 12109g>A from the REN gene as a risk factor for preterm birth
Directory of Open Access Journals (Sweden)
Irám P Rodríguez-Sánchez
2016-11-01
Full Text Available Introduction: Preterm birth is the most important cause of neonatal mortality and morbidity. It is a multifactorial disease with different etiologies, including genetic factors. Genetic variability is represented by single nucleotide polymorphisms (SNPs in genes of proteins involved in the contractile activity. We determine the association between SNP 12109G> A in REN associated with preterm birth and premature rupture of membrane. Materials and methods: A study of cases (N=112, 22–36 weeks of gestation; mean: 31, 95% confidence interval 30.7–32.2 and controls (N=66; 38–40 weeks of gestation from the last menstrual period; mean: 39.8, 95% confidence interval 38.9–39.4 was performed. Genomic DNA was isolated in all patients from peripheral blood. The SNP 12109G> A (Mbo I in REN was typified by PCR-restriction fragment length polymorphism. Results: A significant difference in the case group for the SNP 12109G>A was observed. The A allele was increased in women with preterm birth (81% cases vs. 15% control, p A has odds ratio 6.62 (95% confidence interval 3.14–14.15, which means a high risk of preterm birth/premature rupture of membrane in presence of allele A, both in homozygotes and in heterozygotes. Conclusion: Allelic frequency of A of SNP 12109G>A was higher in women with preterm birth than in women with normal vaginal delivery and could be considered a risk factor.
The opto-mechanical design of the GMT-consortium large earth finder (G-CLEF)
Mueller, Mark; Baldwin, Daniel; Bean, Jacob; Bergner, Henry; Bigelow, Bruce; Chun, Moo-Young; Crane, Jeffrey; Foster, Jeff; Fżrész, Gabor; Gauron, Thomas; Guzman, Dani; Hertz, Edward; Jordán, Andrés.; Kim, Kang-Min; McCracken, Kenneth; Norton, Timothy; Ordway, Mark; Park, Chan; Park, Sang; Podgorski, William A.; Szentgyorgyi, Andrew; Uomoto, Alan; Yuk, In-Soo
2014-08-01
The GMT-Consortium Large Earth Finder (G-CLEF) is a fiber fed, optical echelle spectrograph that has been selected as a first light instrument for the Giant Magellan Telescope (GMT) currently under construction at the Las Campanas Observatory in Chile's Atacama desert region. We designed G-CLEF as a general-purpose echelle spectrograph with precision radial velocity (PRV) capability used for exoplanet detection. The radial velocity (RV) precision goal of GCLEF is 10 cm/sec, necessary for detection of Earth-sized planets orbiting stars like our Sun in the habitable zone. This goal imposes challenging stability requirements on the optical mounts and the overall spectrograph support structures. Stability in instruments of this type is typically affected by changes in temperature, orientation, and air pressure as well as vibrations caused by telescope tracking. For these reasons, we have chosen to enclose G-CLEF's spectrograph in a thermally insulated, vibration isolated vacuum chamber and place it at a gravity invariant location on GMT's azimuth platform. Additional design constraints posed by the GMT telescope include: a limited space envelope, a thermal emission ceiling, and a maximum weight allowance. Other factors, such as manufacturability, serviceability, available technology and budget are also significant design drivers. All of the previously listed considerations must be managed while ensuring that performance requirements are achieved. In this paper, we discuss the design of G-CLEF's optical mounts and support structures including technical choices made to minimize the system's sensitivity to thermal gradients. A more general treatment of the properties of G-CLEF can be found elsewhere in these proceedings1. We discuss the design of the vacuum chamber which houses the irregularly shaped optical bench and optics while conforming to a challenging space envelope on GMT's azimuth platform. We also discuss the design of G-CLEF's insulated enclosure and thermal
Discrete Maximum Principle for Higher-Order Finite Elements in 1D
Czech Academy of Sciences Publication Activity Database
Vejchodský, Tomáš; Šolín, Pavel
2007-01-01
Roč. 76, č. 260 (2007), s. 1833-1846 ISSN 0025-5718 R&D Projects: GA ČR GP201/04/P021 Institutional research plan: CEZ:AV0Z10190503; CEZ:AV0Z20760514 Keywords : discrete maximum principle * discrete Grren´s function * higher-order elements Subject RIV: BA - General Mathematics Impact factor: 1.230, year: 2007
Study of forecasting maximum demand of electric power
Energy Technology Data Exchange (ETDEWEB)
Yoo, B.C.; Hwang, Y.J. [Korea Energy Economics Institute, Euiwang (Korea, Republic of)
1997-08-01
As far as the past performances of power supply and demand in Korea is concerned, one of the striking phenomena is that there have been repeated periodic surpluses and shortages of power generation facilities. Precise assumption and prediction of power demands is the basic work in establishing a supply plan and carrying out the right policy since facilities investment of the power generation industry requires a tremendous amount of capital and a long construction period. The purpose of this study is to study a model for the inference and prediction of a more precise maximum demand under these backgrounds. The non-parametric model considered in this study, paying attention to meteorological factors such as temperature and humidity, does not have a simple proportionate relationship with the maximum power demand, but affects it through mutual complicated nonlinear interaction. I used the non-parametric inference technique by introducing meteorological effects without importing any literal assumption on the interaction of temperature and humidity preliminarily. According to the analysis result, it is found that the non-parametric model that introduces the number of tropical nights which shows the continuity of the meteorological effect has better prediction power than the linear model. The non- parametric model that considers both the number of tropical nights and the number of cooling days at the same time is a model for predicting maximum demand. 7 refs., 6 figs., 9 tabs.
Novel methods for estimating lithium-ion battery state of energy and maximum available energy
International Nuclear Information System (INIS)
Zheng, Linfeng; Zhu, Jianguo; Wang, Guoxiu; He, Tingting; Wei, Yiying
2016-01-01
Highlights: • Study on temperature, current, aging dependencies of maximum available energy. • Study on the various factors dependencies of relationships between SOE and SOC. • A quantitative relationship between SOE and SOC is proposed for SOE estimation. • Estimate maximum available energy by means of moving-window energy-integral. • The robustness and feasibility of the proposed approaches are systematic evaluated. - Abstract: The battery state of energy (SOE) allows a direct determination of the ratio between the remaining and maximum available energy of a battery, which is critical for energy optimization and management in energy storage systems. In this paper, the ambient temperature, battery discharge/charge current rate and cell aging level dependencies of battery maximum available energy and SOE are comprehensively analyzed. An explicit quantitative relationship between SOE and state of charge (SOC) for LiMn_2O_4 battery cells is proposed for SOE estimation, and a moving-window energy-integral technique is incorporated to estimate battery maximum available energy. Experimental results show that the proposed approaches can estimate battery maximum available energy and SOE with high precision. The robustness of the proposed approaches against various operation conditions and cell aging levels is systematically evaluated.
Maximum entropy estimation of a Benzene contaminated plume using ecotoxicological assays
International Nuclear Information System (INIS)
Wahyudi, Agung; Bartzke, Mariana; Küster, Eberhard; Bogaert, Patrick
2013-01-01
Ecotoxicological bioassays, e.g. based on Danio rerio teratogenicity (DarT) or the acute luminescence inhibition with Vibrio fischeri, could potentially lead to significant benefits for detecting on site contaminations on qualitative or semi-quantitative bases. The aim was to use the observed effects of two ecotoxicological assays for estimating the extent of a Benzene groundwater contamination plume. We used a Maximum Entropy (MaxEnt) method to rebuild a bivariate probability table that links the observed toxicity from the bioassays with Benzene concentrations. Compared with direct mapping of the contamination plume as obtained from groundwater samples, the MaxEnt concentration map exhibits on average slightly higher concentrations though the global pattern is close to it. This suggest MaxEnt is a valuable method to build a relationship between quantitative data, e.g. contaminant concentrations, and more qualitative or indirect measurements, in a spatial mapping framework, which is especially useful when clear quantitative relation is not at hand. - Highlights: ► Ecotoxicological shows significant benefits for detecting on site contaminations. ► MaxEnt to rebuild qualitative link on concentration and ecotoxicological assays. ► MaxEnt shows similar pattern when compared with concentrations map of groundwater. ► MaxEnt is a valuable method especially when quantitative relation is not at hand. - A Maximum Entropy method to rebuild qualitative relationships between Benzene groundwater concentrations and their ecotoxicological effect.
Emf, maximum power and efficiency of fuel cells
International Nuclear Information System (INIS)
Gaggioli, R.A.; Dunbar, W.R.
1990-01-01
This paper discusses the ideal voltage of steady-flow fuel cells usually expressed by Emf = -ΔG/nF where ΔG is the Gibbs free energy of reaction for the oxidation of the fuel at the supposed temperature of operation of the cell. Furthermore, the ideal power of the cell is expressed as the product of the fuel flow rate with this emf, and the efficiency of a real fuel cell, sometimes called the Gibbs efficiency, is defined as the ratio of the actual power output to this ideal power. Such viewpoints are flawed in several respects. While it is true that if a cell operates isothermally the maximum conceivable work output is equal to the difference between the Gibbs free energy of the incoming reactants and that of the leaving products, nevertheless, even if the cell operates isothermally, the use of the conventional ΔG of reaction assumes that the products of reaction leave separately from one another (and from any unused fuel), and when ΔS of reaction is positive it assumes that a free heat source exists at the operating temperature, whereas if ΔS is negative it neglects the potential power which theoretically could be obtained form the heat released during oxidation. Moreover, the usual cell does not operate isothermally but (virtually) adiabatically
International Nuclear Information System (INIS)
Gilai, D.
1976-01-01
The Maximum Principle deals with optimization problems of systems, which are governed by ordinary differential equations, and which include constraints on the state and control variables. The development of nuclear engineering confronted the designers of reactors, shielding and other nuclear devices with many requests of optimization and savings and it was straight forward to use the Maximum Principle for solving optimization problems in nuclear engineering, in fact, it was widely used both structural concept design and dynamic control of nuclear systems. The main disadvantage of the Maximum Principle is that it is suitable only for systems which may be described by ordinary differential equations, e.g. one dimensional systems. In the present work, starting from the variational approach, the original Maximum Principle is extended to multidimensional systems, and the principle which has been derived, is of a more general form and is applicable to any system which can be defined by linear partial differential equations of any order. To check out the applicability of the extended principle, two examples are solved: the first in nuclear shield design, where the goal is to construct a shield around a neutron emitting source, using given materials, so that the total dose outside of the shielding boundaries is minimized, the second in material distribution design in the core of a power reactor, so that the power peak is minimised. For the second problem, an iterative method was developed. (B.G.)
Directory of Open Access Journals (Sweden)
Catherine Trivigno
2011-02-01
Full Text Available Mutations in the human mitochondrial elongation factor G1 (EF-G1 are recessive lethal and cause death shortly after birth. We have isolated mutations in iconoclast (ico, which encodes the highly conserved Drosophila orthologue of EF-G1. We find that EF-G1 is essential during fly development, but its function is not required in every tissue. In contrast to null mutations, missense mutations exhibit stronger, possibly neomorphic phenotypes that lead to premature death during embryogenesis. Our experiments show that EF-G1 contains a secondary C-terminal nuclear localization signal. Expression of missense mutant forms of EF-G1 can accumulate in the nucleus and cause growth and patterning defects and animal lethality. We find that transgenes that encode mutant human EF-G1 proteins can rescue ico mutants, indicating that the underlying problem of the human disease is not just the loss of enzymatic activity. Our results are consistent with a model where EF-G1 acts as a retrograde signal from mitochondria to the nucleus to slow down cell proliferation if mitochondrial energy output is low.
49 CFR 230.24 - Maximum allowable stress.
2010-10-01
... 49 Transportation 4 2010-10-01 2010-10-01 false Maximum allowable stress. 230.24 Section 230.24... Allowable Stress § 230.24 Maximum allowable stress. (a) Maximum allowable stress value. The maximum allowable stress value on any component of a steam locomotive boiler shall not exceed 1/4 of the ultimate...
Lifetime and g-factor of a new isomer in 130 La
International Nuclear Information System (INIS)
Ionescu-Bujor, M.; Iordachescu, A.; Brandolini, F.; Pavan, P.; Rossi Alvarez, C.; De Poli, M.; Medina, N.H.; Rao, M.N.
1999-01-01
Pulsed-beam measurements have been recently performed at the XTU-tandem of the National Laboratory of Legnaro with the aim to investigate short-lived isomeric states in neutron-deficient nuclei of the A∼130 region. Isotopically enriched tin targets were irradiated with a 70 MeV 16 O beam (pulse width of 3 ns at a repetition rate of 800 ns) and the γ-ray angular distributions perturbed in magnetic or electric interaction were observed time-differentially. Static electromagnetic moments were thus determined for several known short-lived isomers in 129,130,131 Ce and 129 Ba. In these experiments a new isomeric decay has been also identified and its properties are reported in the present work. The isomer has been observed on a target containing 116 Sn (87%), 117 Sn (8%) and 118 Sn (5%). The tin target of 0.6 mg/cm 2 thickness evaporated on a Pb foil was placed in an external magnetic field of 32 kG whose orientation was periodically reversed. Two planar HPGe detectors positioned at ±135 deg. with respect to the beam direction were used for the γ-ray detection. In the delayed spectra a γ-ray of 105.2 keV has been observed and a half-life of 32(5)ns has been determined for it. The experimental and calculated R(t) modulation ratios of the 105.2 keV γ-ray in the external magnetic field are given. From the derived Larmor frequency a value g = + 0.48(3) has been determined for the isomeric state g-factor. A dipole character has been established for the delayed 105.2 keV γ-transition based on the determined negative A 2 coefficient. The new isomer was tentatively assigned to the odd-odd 130 La populated in the 116,117,118 Sn ( 16 O,pxn) reaction. In this nucleus a state at (150.3 + x) keV de-excited by a 105.2 keV transition is known and it was identified with the isomer. Further experiments are in progress for the definite assignment and the elucidation of the isomer configuration. (authors)
Pa2G4 is a novel Six1 co-factor that is required for neural crest and otic development☆
Neilson, Karen M.; Abbruzzesse, Genevieve; Kenyon, Kristy; Bartolo, Vanessa; Krohn, Patrick; Alfandari, Dominique; Moody, Sally A.
2016-01-01
Mutations in SIX1 and in its co-factor, EYA1, underlie Branchiootorenal Spectrum disorder (BOS), which is characterized by variable branchial arch, otic and kidney malformations. However, mutations in these two genes are identified in only half of patients. We screened for other potential co-factors, and herein characterize one of them, Pa2G4 (aka Ebp1/Plfap). In human embryonic kidney cells, Pa2G4 binds to Six1 and interferes with the Six1-Eya1 complex. In Xenopus embryos, knock-down of Pa2G4 leads to down-regulation of neural border zone, neural crest and cranial placode genes, and concomitant expansion of neural plate genes. Gain-of-function leads to a broader neural border zone, expanded neural crest and altered cranial placode domains. In loss-of-function assays, the later developing otocyst is reduced in size, which impacts gene expression. In contrast, the size of the otocyst in gain-of-function assays is not changed but the expression domains of several otocyst genes are reduced. Together these findings establish an interaction between Pa2G4 and Six1, and demonstrate that it has an important role in the development of tissues affected in BOS. Thereby, we suggest that pa2g4 is a potential candidate gene for BOS. PMID:27940157
DEFF Research Database (Denmark)
Ding, Tao; Kou, Yu; Yang, Yongheng
2017-01-01
. However, the intermittency of solar PV energy (e.g., due to passing clouds) may affect the PV generation in the district distribution network. To address this issue, the voltage magnitude constraints under the cloud shading conditions should be taken into account in the optimization model, which can......As photovoltaic (PV) integration increases in distribution systems, to investigate the maximum allowable PV integration capacity for a district distribution system becomes necessary in the planning phase, an optimization model is thus proposed to evaluate the maximum PV integration capacity while...
Directory of Open Access Journals (Sweden)
Dietz Gunnar PH
2009-05-01
Full Text Available Abstract Background The hematopoietic Granulocyte-Colony Stimulating Factor (G-CSF plays a crucial role in controlling the number of neutrophil progenitor cells. Its function is mediated via the G-CSF receptor, which was recently found to be expressed also in the central nervous system. In addition, G-CSF provided neuroprotection in models of neuronal cell death. Here we used the retinal ganglion cell (RGC axotomy model to compare effects of local and systemic application of neuroprotective molecules. Results We found that the G-CSF receptor is robustly expressed by RGCs in vivo and in vitro. We thus evaluated G-CSF as a neuroprotectant for RGCs and found a dose-dependent neuroprotective effect of G-CSF on axotomized RGCs when given subcutaneously. As stem stell mobilization had previously been discussed as a possible contributor to the neuroprotective effects of G-CSF, we compared the local treatment of RGCs by injection of G-CSF into the vitreous body with systemic delivery by subcutaneous application. Both routes of application reduced retinal ganglion cell death to a comparable extent. Moreover, G-CSF enhanced the survival of immunopurified RGCs in vitro. Conclusion We thus show that G-CSF neuroprotection is at least partially independent of potential systemic effects and provide further evidence that the clinically applicable G-CSF could become a treatment option for both neurodegenerative diseases and glaucoma.
International Nuclear Information System (INIS)
Yu, Shanshan; Drouin, Brian J.; Miller, Charles E.
2014-01-01
We have updated the isotopically invariant Dunham fit of O 2 with newly reported literature transitions to derive (1) the energy levels, partition sums, band-by-band molecular constants, and RKR potentials for the X 3 Σ g − , a 1 Δ g , and b 1 Σ g + states of the six O 2 isotopologues: 16 O 16 O, 16 O 17 O, 16 O 18 O, 17 O 17 O, 17 O 18 O, and 18 O 18 O; (2) Franck-Condon factors for their a 1 Δ g −X 3 Σ g − , b 1 Σ g + −X 3 Σ g − , and a 1 Δ g −b 1 Σ g + band systems. This new spectroscopic parameterization characterizes all known transitions within and between the X 3 Σ g − , a 1 Δ g , and b 1 Σ g + states within experimental uncertainty and can be used for accurate predictions of as yet unmeasured transitions. All of these results are necessary to provide a consistent linelist of all transitions which will be reported in a followup paper
International Nuclear Information System (INIS)
Zhu Shengyun; Li Anli; Gou Zhenghui; Zheng Shengnan; Li Guangsheng
1994-01-01
The g-factor hence the magnetic moment, of the isomeric state 43 Sc(19/2 - , 3.1232 MeV) has been measured by the time differential perturbed angular distribution method. The measured values are g = 0.3279(19) and μ/μN = 3.108(18) nm
Martínez-García, Roberto; Ubeda-Sansano, Maria Isabel; Díez-Domingo, Javier; Pérez-Hoyos, Santiago; Gil-Salom, Manuel
2014-09-01
There is an agreement to use simple formulae (expected bladder capacity and other age based linear formulae) as bladder capacity benchmark. But real normal child's bladder capacity is unknown. To offer a systematic review of children's normal bladder capacity, to measure children's normal maximum voided volumes (MVVs), to construct models of MVVs and to compare them with the usual formulae. Computerized, manual and grey literature were reviewed until February 2013. Epidemiological, observational, transversal, multicenter study. A consecutive sample of healthy children aged 5-14 years, attending Primary Care centres with no urologic abnormality were selected. Participants filled-in a 3-day frequency-volume chart. Variables were MVVs: maximum of 24 hr, nocturnal, and daytime maximum voided volumes. diuresis and its daytime and nighttime fractions; body-measure data; and gender. The consecutive steps method was used in a multivariate regression model. Twelve articles accomplished systematic review's criteria. Five hundred and fourteen cases were analysed. Three models, one for each of the MVVs, were built. All of them were better adjusted to exponential equations. Diuresis (not age) was the most significant factor. There was poor agreement between MVVs and usual formulae. Nocturnal and daytime maximum voided volumes depend on several factors and are different. Nocturnal and daytime maximum voided volumes should be used with different meanings in clinical setting. Diuresis is the main factor for bladder capacity. This is the first model for benchmarking normal MVVs with diuresis as its main factor. Current formulae are not suitable for clinical use. © 2013 Wiley Periodicals, Inc.
Khan, M.I.; Micheal, S.; Rana, N.; Akhtar, F.; Hollander, A.I. den; Ahmed, A.; Qamar, R.
2009-01-01
PURPOSE: The purpose of the present study was to determine the role of the tumor necrosis factor alpha (TNF-alpha) gene polymorphism G-308A and total serum immunoglobulin E (TsIgE) levels in the onset of pseudoexfoliation glaucoma (PEXG) in Pakistani patients. METHODS: The TNF-alpha polymorphism
Maximum Available Accuracy of FM-CW Radars
Directory of Open Access Journals (Sweden)
V. Ricny
2009-12-01
Full Text Available This article deals with the principles and above all with the maximum available measuring accuracy analyse of FM-CW (Frequency Modulated Continuous Wave radars, which are usually employed for distance and velocity measurements of moving objects in road traffic, as well as air traffic and in other applications. These radars often form an important part of the active safety equipment of high-end cars – the so-called anticollision systems. They usually work in the frequency bands of mm waves (24, 35, 77 GHz. Function principles and analyses of factors, that dominantly influence the distance measurement accuracy of these equipments especially in the modulation and demodulation part, are shown in the paper.
Czech Academy of Sciences Publication Activity Database
Fiedler, Miroslav; Hall, F.J.
2012-01-01
Roč. 436, č. 3 (2012), s. 731-741 ISSN 0024-3795 Institutional research plan: CEZ:AV0Z10300504 Keywords : G-matrix * Cauchy matrix * sign pattern matrix * potentially orthogonal sign pattern Subject RIV: BA - General Mathematics Impact factor: 0.968, year: 2012
Maier, K H; Grawe, H; Kluge, H
1981-01-01
The g-factor measurements of the ground state and an isomeric level in /sup 217/Ac using the DPAD method with alpha -decay are described. The results of gamma -ray g-factor measurements for the isomer and a tentative decay scheme produced by alpha - gamma and gamma - gamma coincidence experiments are also presented. An analysis of the alpha - particle angular distributions suggests that nuclear deformation affects the observed anisotropy. (13 refs).
Lake Basin Fetch and Maximum Length/Width
Minnesota Department of Natural Resources — Linear features representing the Fetch, Maximum Length and Maximum Width of a lake basin. Fetch, maximum length and average width are calcuated from the lake polygon...
Maximum permissible voltage of YBCO coated conductors
Energy Technology Data Exchange (ETDEWEB)
Wen, J.; Lin, B.; Sheng, J.; Xu, J.; Jin, Z. [Department of Electrical Engineering, Shanghai Jiao Tong University, Shanghai (China); Hong, Z., E-mail: zhiyong.hong@sjtu.edu.cn [Department of Electrical Engineering, Shanghai Jiao Tong University, Shanghai (China); Wang, D.; Zhou, H.; Shen, X.; Shen, C. [Qingpu Power Supply Company, State Grid Shanghai Municipal Electric Power Company, Shanghai (China)
2014-06-15
Highlights: • We examine three kinds of tapes’ maximum permissible voltage. • We examine the relationship between quenching duration and maximum permissible voltage. • Continuous I{sub c} degradations under repetitive quenching where tapes reaching maximum permissible voltage. • The relationship between maximum permissible voltage and resistance, temperature. - Abstract: Superconducting fault current limiter (SFCL) could reduce short circuit currents in electrical power system. One of the most important thing in developing SFCL is to find out the maximum permissible voltage of each limiting element. The maximum permissible voltage is defined as the maximum voltage per unit length at which the YBCO coated conductors (CC) do not suffer from critical current (I{sub c}) degradation or burnout. In this research, the time of quenching process is changed and voltage is raised until the I{sub c} degradation or burnout happens. YBCO coated conductors test in the experiment are from American superconductor (AMSC) and Shanghai Jiao Tong University (SJTU). Along with the quenching duration increasing, the maximum permissible voltage of CC decreases. When quenching duration is 100 ms, the maximum permissible of SJTU CC, 12 mm AMSC CC and 4 mm AMSC CC are 0.72 V/cm, 0.52 V/cm and 1.2 V/cm respectively. Based on the results of samples, the whole length of CCs used in the design of a SFCL can be determined.
van Ess, Eleanne F.; Ouburg, Sander; Spaargaren, Joke; Land, Jolande A.; Morre, Servaas A.
2017-01-01
There is a need for more accurate Chlamydia trachomatis (CT) IgG antibody tests for tubal factor infertility (TFI) diagnostics. We evaluated the predictive value for TFI of Medac ELISA plus (MOMP) and multitarget Mikrogen ELISA (MOMP-CPAF-TARP). Based on Medac ELISA plus results, 183 subfertile
Potential role of motion for enhancing maximum output energy of triboelectric nanogenerator
Byun, Kyung-Eun; Lee, Min-Hyun; Cho, Yeonchoo; Nam, Seung-Geol; Shin, Hyeon-Jin; Park, Seongjun
2017-07-01
Although triboelectric nanogenerator (TENG) has been explored as one of the possible candidates for the auxiliary power source of portable and wearable devices, the output energy of a TENG is still insufficient to charge the devices with daily motion. Moreover, the fundamental aspects of the maximum possible energy of a TENG related with human motion are not understood systematically. Here, we confirmed the possibility of charging commercialized portable and wearable devices such as smart phones and smart watches by utilizing the mechanical energy generated by human motion. We confirmed by theoretical extraction that the maximum possible energy is related with specific form factors of a TENG. Furthermore, we experimentally demonstrated the effect of human motion in an aspect of the kinetic energy and impulse using varying velocity and elasticity, and clarified how to improve the maximum possible energy of a TENG. This study gives insight into design of a TENG to obtain a large amount of energy in a limited space.
Potential role of motion for enhancing maximum output energy of triboelectric nanogenerator
Directory of Open Access Journals (Sweden)
Kyung-Eun Byun
2017-07-01
Full Text Available Although triboelectric nanogenerator (TENG has been explored as one of the possible candidates for the auxiliary power source of portable and wearable devices, the output energy of a TENG is still insufficient to charge the devices with daily motion. Moreover, the fundamental aspects of the maximum possible energy of a TENG related with human motion are not understood systematically. Here, we confirmed the possibility of charging commercialized portable and wearable devices such as smart phones and smart watches by utilizing the mechanical energy generated by human motion. We confirmed by theoretical extraction that the maximum possible energy is related with specific form factors of a TENG. Furthermore, we experimentally demonstrated the effect of human motion in an aspect of the kinetic energy and impulse using varying velocity and elasticity, and clarified how to improve the maximum possible energy of a TENG. This study gives insight into design of a TENG to obtain a large amount of energy in a limited space.
Influence of epoxy resin as encapsulation material of silicon photovoltaic cells on maximum current
Directory of Open Access Journals (Sweden)
Acevedo-Gómez David
2017-01-01
Full Text Available This work presents an analysis about how the performance of silicon photovoltaic cells is influenced by the use of epoxy resin as encapsulation material with flat roughness. The effect of encapsulation on current at maximum power of mono-crystalline cell was tested indoor in a solar simulator bench at 1000 w/m² and AM1.5G. The results show that implementation of flat roughness layer onto cell surface reduces the maximum current inducing on average 2.7% less power with respect to a cell before any encapsulation. The losses of power and, in consequence, the less production of energy are explained by resin light absorption, reflection and partially neutralization of non-reflective coating.
Wang, Jin-Yu; Wang, Xin-Ting; Wang, Lin-Lin; Jia, Cun-Xian
2015-01-01
Suicide is an important public problem, the mechanism of which has not been clarified. Many studies have focused on the molecular, biological and genetic mechanisms of suicide. Brain-derived neurotrophic factor (BDNF) G196A is one of the most leading loci in recent studies, but the results are inconsistent. We conducted a 1:1 age- and sex-matched case-control study in rural areas of Shandong Province, China. A total of 365 pairs of cases and controls were finally recruited into our study. The adjusted odds ratios (AORs) of BDNF 196G/G and their 95% confidence intervals (CIs) were calculated by multivariate conditional logistic regression models. No association between BDNF polymorphisms and attempted suicide was found in the overall population. However, the BDNF 196G/G genotype was significantly related to attempted suicide in the elderly population (AOR = 7.85, 95% CI: 1.12-54.90, p = 0.038), while the associations were not significant in young and middle-aged groups. Our study suggests that the BDNF 196G/G genotype increases the risk of attempted suicide in elderly people. © 2015 S. Karger AG, Basel.
Application of the Method of Maximum Likelihood to Identification of Bipedal Walking Robots
Czech Academy of Sciences Publication Activity Database
Dolinský, Kamil; Čelikovský, Sergej
(2017) ISSN 1063-6536 R&D Projects: GA ČR(CZ) GA17-04682S Institutional support: RVO:67985556 Keywords : Control * identification * maximum likelihood (ML) * walking robots Subject RIV: BC - Control Systems Theory Impact factor: 3.882, year: 2016 http://ieeexplore.ieee.org/document/7954032/
Receiver function estimated by maximum entropy deconvolution
Institute of Scientific and Technical Information of China (English)
吴庆举; 田小波; 张乃铃; 李卫平; 曾融生
2003-01-01
Maximum entropy deconvolution is presented to estimate receiver function, with the maximum entropy as the rule to determine auto-correlation and cross-correlation functions. The Toeplitz equation and Levinson algorithm are used to calculate the iterative formula of error-predicting filter, and receiver function is then estimated. During extrapolation, reflective coefficient is always less than 1, which keeps maximum entropy deconvolution stable. The maximum entropy of the data outside window increases the resolution of receiver function. Both synthetic and real seismograms show that maximum entropy deconvolution is an effective method to measure receiver function in time-domain.
4G/5G polymorphism modulates PAI-1 circulating levels in obese women.
Fernandes, Karla S; Sandrim, Valéria C
2012-05-01
The increase in plasminogen activator inhibitor type 1 (PAI-1) has been described as a risk factor to thrombosis-related diseases. In addition, it has been demonstrated that the variant 4G of polymorphism 4G/5G located in promoter region of PAI-1 gene is associated with higher PAI-1 levels. We investigate the role of this polymorphism on circulating PAI-1 concentration in a population of 57 obese women (23%, 4G/4G; 49%, 4G/5G and 28%, 5G/5G genotypes). Our results demonstrate a genotype-specific modulation on PAI-1 levels in obese women, thus 5G/5G genotype presented significantly lower levels of plasma PAI-1 when compared to 4G/4G group (46 ± 19 ng/mL vs. 63 ± 13 ng/mL, respectively). Our findings indicate that obese carriers of 4G/4G genotype may have increased risk to develop thrombotic diseases.
The Immunobiology of Immunoglobulin G4
Lighaam, Laura C.; Rispens, Theo
2016-01-01
Human immunoglobulin G4 (IgG4) antibodies are in many ways unusual. In this review, an overview is given of the structural and functional aspects of IgG4 antibodies, the consequences of IgG4 antibody formation in various disease settings, and the factors involved in the regulation of IgG4 responses.
Electron fluence correction factors for various materials in clinical electron beams
International Nuclear Information System (INIS)
Olivares, M.; Blois, F. de; Podgorsak, E.B.; Seuntjens, J.P.
2001-01-01
Relative to solid water, electron fluence correction factors at the depth of dose maximum in bone, lung, aluminum, and copper for nominal electron beam energies of 9 MeV and 15 MeV of the Clinac 18 accelerator have been determined experimentally and by Monte Carlo calculation. Thermoluminescent dosimeters were used to measure depth doses in these materials. The measured relative dose at d max in the various materials versus that of solid water, when irradiated with the same number of monitor units, has been used to calculate the ratio of electron fluence for the various materials to that of solid water. The beams of the Clinac 18 were fully characterized using the EGS4/BEAM system. EGSnrc with the relativistic spin option turned on was used to optimize the primary electron energy at the exit window, and to calculate depth doses in the five phantom materials using the optimized phase-space data. Normalizing all depth doses to the dose maximum in solid water stopping power ratio corrected, measured depth doses and calculated depth doses differ by less than ±1% at the depth of dose maximum and by less than 4% elsewhere. Monte Carlo calculated ratios of doses in each material to dose in LiF were used to convert the TLD measurements at the dose maximum into dose at the center of the TLD in the phantom material. Fluence perturbation correction factors for a LiF TLD at the depth of dose maximum deduced from these calculations amount to less than 1% for 0.15 mm thick TLDs in low Z materials and are between 1% and 3% for TLDs in Al and Cu phantoms. Electron fluence ratios of the studied materials relative to solid water vary between 0.83±0.01 and 1.55±0.02 for materials varying in density from 0.27 g/cm3 (lung) to 8.96 g/cm3 (Cu). The difference in electron fluence ratios derived from measurements and calculations ranges from -1.6% to +0.2% at 9 MeV and from -1.9% to +0.2% at 15 MeV and is not significant at the 1σ level. Excluding the data for Cu, electron fluence
International Nuclear Information System (INIS)
Castillejo, Adela; Guillén-Ponce, Carmen; Carrato, Alfredo; Soto, José-Luís; Mata-Balaguer, Trinidad; Guarinos, Carla; Castillejo, María-Isabel; Martínez-Cantó, Ana; Barberá, Víctor-Manuel; Montenegro, Paola; Ochoa, Enrique; Lázaro, Rafael
2009-01-01
The Int7G24A variant of transforming growth factor-beta receptor type I (TGFBR1) has been shown to increase the risk for kidney, ovarian, bladder, lung and breast cancers. Its role in colorectal cancer (CRC) has not been established. The aims of this study were to assess the association of TGFBR1*Int7G24A variant with CRC occurrence, patient age, gender, tumour location and stage. We performed a case-control study with 504 cases of sporadic CRC; and 504 non-cancerous age, gender and ethnically matched controls. Genotyping analysis was performed using allelic discrimination assay by real time PCR. The Int7G24A variant was associated with increased CRC incidence in an additive model of inheritance (P for trend = 0.005). No significant differences were found between Int7G24A genotypes and tumour location or stage. Interestingly, the association of the Int7G24A variant with CRC risk was significant in men (odds ratio 4.10 with 95% confidence intervals 1.41-11.85 for homozygous individuals; P for trend = 0.00023), but not in women. We also observed an increase in susceptibility to CRC for individuals aged less than 70 years. Our data suggest that the Int7G24A variant represents a risk factor for CRC in the male Spanish population
Detection and determination of Oxytetracycline and Penicillin G ...
African Journals Online (AJOL)
Antibiotic residues are small amounts of drugs or their active metabolites ... able daily intake and maximum residue limits in foods (FAO and WHO, 1995). Regulatory limits for antibiotic residues have been imposed on the dairy in- dustry in many ... Methods for oxytetracycline and penicillin G residue analysis. The milk ...
Stem Cell Mobilization with G-CSF versus Cyclophosphamide plus G-CSF in Mexican Children
Meraz, Jos? Eugenio V?zquez; Arellano-Galindo, Jos?; Avalos, Armando Mart?nez; Mendoza-Garc?a, Emma; Jim?nez-Hern?ndez, Elva
2016-01-01
Fifty-six aphaereses were performed in 23 pediatric patients with malignant hematological and solid tumors, following three different protocols for PBPC mobilization and distributed as follows: A: seventeen mobilized with 4?g/m2 of cyclophosphamide (CFA) and 10??g/kg/day of granulocyte colony stimulating factor (G-CSF), B: nineteen with CFA + G-CSF, and C: twenty only with G-CSF when the WBC count exceeded 10 ? 109/L. The average number of MNC/kg body weight (BW)/aphaeresis was 0.4 ? 108 (0.1...
Societal Consequences of the g Factor in Employment.
Gottfredson, Linda S.
1986-01-01
Reviews and rebuts seven common arguments that intelligence (g) is of little or no practical importance in employment. Illustrates in several ways the profound effect that differences in intelligence in a work force may have on the structure and functioning of whole societies. (Author/ABB)
International Nuclear Information System (INIS)
Luecke-Huhle, C.; Hieber, L.; Wegner, R.D.
1983-01-01
Severe and partly irreversible G2 arrest caused by americium-241 alpha-particles in Chinese hamster V79 cells acted as a competing process to the yield of detectable aberrant mitoses at metaphase. With increasing dose of alpha-radiation an increasing fraction of cells was irreversibly arrested in G2 with the consequence of interphase death before the first post-irradiation mitosis. This irreversible G2 arrest (demonstrated by flow cytofluorometry and mitotic indices) could be overcome by adding caffeine 8 hours after irradiation, the time point of maximum G2 arrest (80-90 per cent of all cells). Within 3.5 hours the number of aberrant mitoses increased by this treatment from 54 to 96 per cent and from 65 to 99.9 per cent for doses of 1.75 and 4.38 Gy of alpha-particles, respectively. The aberration frequency per mitotic cell, scored as chromatid and isochromatid breaks, rings, interchanges and dicentrics increased by a factor of about 3 after releasing G2 arrested cells. The frequency distribution of aberrations per cell revealed that, after 4.38 Gy, 58 per cent of the formerly G2-arrested cells had more than five aberrations per cell compared to only 8 per cent without the interaction of caffeine. (author)
THE INDIVIDUAL DIFFERENCE OF ABILITY BINDING BRAIN TUMOR CELLS WITH IMMUNOGLOBULIN G
O. V. Ostreiko; S. V. Mozhaev; V. E. Olushin; R. A. Pantina; M. V. Filatov
2008-01-01
Abstract. Were researched IgG on the surface cells of different histological types tumors of cerebrum, using fluorescing staphylococcus A-protein. The study of target IgG shows divers intensive of microscopic fluorescent illumination. This results associate related with level amount IgG. The maximum concentrate of surface’s IgG was on the cells of malignant tumors and there was direct correlate with aggressive manner and quickly recurrence of tumor’s growth, and shot survival. The fraction of...
Is the maximum permissible radiation burden for the population indeed permissible
International Nuclear Information System (INIS)
Renesse, R.L. van.
1975-01-01
It is argued that legislation based on the ICRP doses will, under economical influences, lead to a situation where the population is exposed to radiation doses near the maximum permissible dose. Due to cumulative radiation effects, this will introduce unacceptable health risks. Therefore, it will be necessary to lower the legal dose limit of 170 millrem per year per person by a factor 10 to 20
Directory of Open Access Journals (Sweden)
Yunfeng Shan
2008-01-01
Full Text Available Genomes and genes diversify during evolution; however, it is unclear to what extent genes still retain the relationship among species. Model species for molecular phylogenetic studies include yeasts and viruses whose genomes were sequenced as well as plants that have the fossil-supported true phylogenetic trees available. In this study, we generated single gene trees of seven yeast species as well as single gene trees of nine baculovirus species using all the orthologous genes among the species compared. Homologous genes among seven known plants were used for validation of the finding. Four algorithms—maximum parsimony (MP, minimum evolution (ME, maximum likelihood (ML, and neighbor-joining (NJ—were used. Trees were reconstructed before and after weighting the DNA and protein sequence lengths among genes. Rarely a gene can always generate the “true tree” by all the four algorithms. However, the most frequent gene tree, termed “maximum gene-support tree” (MGS tree, or WMGS tree for the weighted one, in yeasts, baculoviruses, or plants was consistently found to be the “true tree” among the species. The results provide insights into the overall degree of divergence of orthologous genes of the genomes analyzed and suggest the following: 1 The true tree relationship among the species studied is still maintained by the largest group of orthologous genes; 2 There are usually more orthologous genes with higher similarities between genetically closer species than between genetically more distant ones; and 3 The maximum gene-support tree reflects the phylogenetic relationship among species in comparison.
A resonant magnetic field microsensor with high quality factor at atmospheric pressure
International Nuclear Information System (INIS)
Herrera-May, A L; García-Ramírez, P J; Martínez-Castillo, J; Sauceda-Carvajal, A; García-González, L; Aguilera-Cortés, L A; Figueras-Costa, E
2009-01-01
A resonant magnetic field microsensor with a high quality factor at atmospheric pressure has been designed, fabricated and tested. This microsensor does not require vacuum packaging to operate efficiently and presents a compact and simple geometrical configuration of silicon. This geometry permits us to decrease the size of the structure and facilities its fabrication and operation. It is constructed of a seesaw plate (400 × 150 × 15 µm 3 ), two torsional beams (60 × 40 × 15 µm 3 ), four flexural beams (130 × 12 × 15 µm 3 ) and a Wheatstone bridge with four p-type piezoresistors. The resonant device exploits the Lorentz force principle and operates at its first resonant frequency (136.52 kHz). A sinusoidal excitation current of 22.0 mA with a frequency of 136.52 kHz and magnetic fields from 1 to 400 G are considered. The mechanical response of the microsensor is modeled with the finite element method (FEM). The structure of the microsensor registered a maximum von Mises stress of 53.8 MPa between the flexural and the torsional beams. Additionally, a maximum deflection (372.5 nm) is obtained at the extreme end of the plate. The proposed microsensor has the maximum magnetic sensitivity of 40.3 µV G −1 (magnetic fields −1/2 , theoretical resolution of 1.43 mG Hz −1/2 and power consumption less than 10.0 mW
Directory of Open Access Journals (Sweden)
Nagorni-Obradović Ljudmila
2014-01-01
Full Text Available Physicians usually do not suspect pulmonary thromboembolism in younger patients except in those who have thrombophilia. In those latter patients some special conditions such as trauma or surgery may provoke the disease. In some adult persons, thrombophilia may still remain unrecognized, until appearance of additional conditions influence development of thrombosis. A 55-year-old Caucasian female, non-smoker, experienced sudden chest pain and hemoptysis without chest trauma. History taking revealed type 2 diabetes mellitus and hypothyroidism. She was overweight with body mass index 29.0. The review of the family history revealed that her father and mother died of brain infarction, while her 22-year-old son and 24-year-old daughter were healthy. Due to suspicion for thrombosis, multi-slice computerized tomography thorax scan was done and pulmonary embolism was diagnosed. Although without clear risk factor for thrombosis in our patient, we performed laboratory investigation for congenital thrombophilia. Genetic analysis showed double heterozygous for factor V Leiden and prothrombin 20210 G>A mutations. Congenital thrombophilia was risk factor for thrombosis in our patient but haemostatic imbalance was not previously clinically recognized. She had two pregnancies without complications. Appearance of other associative factors such as endocrine disorders - hypothyroidism and metabolic syndrome with diabetes type 2, and overweigh were additional potential triggers for clinical manifestation of pulmonary thromboembolism in her adult age. Her children underwent genetic analysis, too. The son was also double heterozygous for factor V Leiden and prothrombin 20210 G>A mutations, while daughter was heterozygous for factor V Leiden, and none had clinical signs of thrombosis. [Projekat Ministarstva nauke Republike Srbije, br. ON175081 i br. ON 175091
Recent G8, G20 Inclusive Multilevel Food Governance
Directory of Open Access Journals (Sweden)
John Kirton
2014-11-01
Full Text Available Innovative, integrative, local, and business-inclusive governance for food, agriculture, nutrition, health and wealth can be strengthened through informal global institutions led by the Group of Eight (G8 and the Group of Twenty (G20. Their regular summits include the most important countries’ leaders and have a comprehensive, synergistic agenda, and impulse, as well as the flexibility and authority to link issues, factors, and actors in new ways. The G8 has increasingly addressed food, agriculture, nutrition, health, and the link among them, involved business, civil society, and low-income countries, and made decisions intended to affect the lives of the poor in many locales. The G20 has contributed to some degree in such ways too. Of particular promise is the G8’s New Alliance on Food Security and Nutrition, launched in May 2012, and the G20’s AgResults program built on commitments made in June 2010. Yet there remains much that both institutions can and should do to meet the combined, complex, food-health-wealth challenge now confronting the global community, before the next food crisis comes.
International Nuclear Information System (INIS)
Bertho, Jean-Marc; Frick, Johanna; Prat, Marie; Demarquay, Christelle; Dudoignon, Nicolas; Trompier, Francois; Gorin, Norbert-Claude; Thierry, Dominique; Gourmelon, Patrick
2005-01-01
Purpose: To compare the efficacy of autologous cell therapy after irradiation combined with granulocyte-colony stimulating factor (G-CSF) injections with G-CSF treatment alone in a heterogeneous model of irradiation representative of an accidental situation. Material and Methods: Non-human primates were irradiated at 8.7 Gy whole-body dose with the right arm shielded to receive 4.8 Gy. The first group of animals received G-CSF (lenograstim) injections starting 6 h after irradiation, and a second group received a combination of G-CSF (lenograstim) injections and autologous expanded hematopoietic cells. Animals were followed up for blood cell counts, circulating progenitors, and bone marrow cellularity. Results: No significant differences were seen between the two treatment groups, whatever the parameter observed: time to leukocyte or platelet recovery and duration and severity of aplasia. Conclusion: Our results indicated that identical recovery kinetic was observed when irradiated animals are treated with G-CSF independently of the reinjection of ex vivo expanded autologous hematopoietic cells. Thus G-CSF injections might be chosen as a first-line therapeutic strategy in the treatment of accidental acute radiation victims
International Nuclear Information System (INIS)
Singh, Parjit S.; Singh, Tejbir; Kaur, Paramjeet
2008-01-01
G.P. fitting method has been used to compute energy absorption buildup factor of some commonly used solvents such as acetonitrile (C 4 H 3 N), butanol (C 4 H 9 OH), chlorobenzene (C 6 H 5 Cl), diethyl ether (C 4 H 10 O), ethanol (C 2 H 5 OH), methanol (CH 3 OH), propanol (C 3 H 7 OH) and water (H 2 O) for the wide energy range (0.015-15.0 MeV) up to the penetration depth of 10 mean free path. The variation of energy absorption buildup factor with chemical composition as well as incident photon energy for the selected solvents has been studied. It has been observed that the maximum value of energy absorption buildup factors shifts to the slightly higher incident photon energy with the increase in equivalent atomic number of the solvent and the solvent with least equivalent atomic number possesses the maximum value of energy absorption buildup factor
Maximum neutron flux in thermal reactors
International Nuclear Information System (INIS)
Strugar, P.V.
1968-12-01
Direct approach to the problem is to calculate spatial distribution of fuel concentration if the reactor core directly using the condition of maximum neutron flux and comply with thermal limitations. This paper proved that the problem can be solved by applying the variational calculus, i.e. by using the maximum principle of Pontryagin. Mathematical model of reactor core is based on the two-group neutron diffusion theory with some simplifications which make it appropriate from maximum principle point of view. Here applied theory of maximum principle are suitable for application. The solution of optimum distribution of fuel concentration in the reactor core is obtained in explicit analytical form. The reactor critical dimensions are roots of a system of nonlinear equations and verification of optimum conditions can be done only for specific examples
Psychophysical basis for maximum pushing and pulling forces: A review and recommendations.
Garg, Arun; Waters, Thomas; Kapellusch, Jay; Karwowski, Waldemar
2014-03-01
The objective of this paper was to perform a comprehensive review of psychophysically determined maximum acceptable pushing and pulling forces. Factors affecting pushing and pulling forces are identified and discussed. Recent studies show a significant decrease (compared to previous studies) in maximum acceptable forces for males but not for females when pushing and pulling on a treadmill. A comparison of pushing and pulling forces measured using a high inertia cart with those measured on a treadmill shows that the pushing and pulling forces using high inertia cart are higher for males but are about the same for females. It is concluded that the recommendations of Snook and Ciriello (1991) for pushing and pulling forces are still valid and provide reasonable recommendations for ergonomics practitioners. Regression equations as a function of handle height, frequency of exertion and pushing/pulling distance are provided to estimate maximum initial and sustained forces for pushing and pulling acceptable to 75% male and female workers. At present it is not clear whether pushing or pulling should be favored. Similarly, it is not clear what handle heights would be optimal for pushing and pulling. Epidemiological studies are needed to determine relationships between psychophysically determined maximum acceptable pushing and pulling forces and risk of musculoskeletal injuries, in particular to low back and shoulders.
The worst case complexity of maximum parsimony.
Carmel, Amir; Musa-Lempel, Noa; Tsur, Dekel; Ziv-Ukelson, Michal
2014-11-01
One of the core classical problems in computational biology is that of constructing the most parsimonious phylogenetic tree interpreting an input set of sequences from the genomes of evolutionarily related organisms. We reexamine the classical maximum parsimony (MP) optimization problem for the general (asymmetric) scoring matrix case, where rooted phylogenies are implied, and analyze the worst case bounds of three approaches to MP: The approach of Cavalli-Sforza and Edwards, the approach of Hendy and Penny, and a new agglomerative, "bottom-up" approach we present in this article. We show that the second and third approaches are faster than the first one by a factor of Θ(√n) and Θ(n), respectively, where n is the number of species.
2010-07-27
...-17530; Notice No. 2] RIN 2130-ZA03 Inflation Adjustment of the Ordinary Maximum and Aggravated Maximum... remains at $250. These adjustments are required by the Federal Civil Penalties Inflation Adjustment Act [email protected] . SUPPLEMENTARY INFORMATION: The Federal Civil Penalties Inflation Adjustment Act of 1990...
Half-width at half-maximum, full-width at half-maximum analysis
Indian Academy of Sciences (India)
addition to the well-defined parameter full-width at half-maximum (FWHM). The distribution of ... optical side-lobes in the diffraction pattern resulting in steep central maxima [6], reduc- tion of effects of ... and broad central peak. The idea of.
Classification of Unknown Thermocouple Types Using Similarity Factor Measurement
Directory of Open Access Journals (Sweden)
Seshu K. DAMARLA
2011-01-01
Full Text Available In contrast to classification using PCA method, a new methodology is proposed for type identification of unknown thermocouple. The new methodology is based on calculating the degree of similarity between two multivariate datasets using two types of similarity factors. One similarity factor is based on principle component analysis and the angles between the principle component subspaces while the other is based on the Mahalanobis distance between the datasets. Datasets containing thermo-emfs against given temperature ranges are formed for each type of thermocouple (e.g. J, K, S, T, R, E, B and N type by experimentation are considered as reference datasets. Datasets corresponding to unknown type are captured. Similarity factor between the datasets one of which being the unknown type and the other being each known type are compared. When maximum similarity factor occurs, then the class of unknown type is allocated to that of known type.
Two-dimensional maximum entropy image restoration
International Nuclear Information System (INIS)
Brolley, J.E.; Lazarus, R.B.; Suydam, B.R.; Trussell, H.J.
1977-07-01
An optical check problem was constructed to test P LOG P maximum entropy restoration of an extremely distorted image. Useful recovery of the original image was obtained. Comparison with maximum a posteriori restoration is made. 7 figures
Czech Academy of Sciences Publication Activity Database
Palatinus, Lukáš; Amami, M.; van Smaalen, S.
2004-01-01
Roč. 60, - (2004), s. 127-137 ISSN 0108-7681 Grant - others:DFG(DE) XX Institutional research plan: CEZ:AV0Z1010914 Keywords : incommensurate modulation * superspace * maximum entropy method Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 5.418, year: 2004
Directory of Open Access Journals (Sweden)
Lázaro Rafael
2009-11-01
Full Text Available Abstract Background The Int7G24A variant of transforming growth factor-beta receptor type I (TGFBR1 has been shown to increase the risk for kidney, ovarian, bladder, lung and breast cancers. Its role in colorectal cancer (CRC has not been established. The aims of this study were to assess the association of TGFBR1*Int7G24A variant with CRC occurrence, patient age, gender, tumour location and stage. Methods We performed a case-control study with 504 cases of sporadic CRC; and 504 non-cancerous age, gender and ethnically matched controls. Genotyping analysis was performed using allelic discrimination assay by real time PCR. Results The Int7G24A variant was associated with increased CRC incidence in an additive model of inheritance (P for trend = 0.005. No significant differences were found between Int7G24A genotypes and tumour location or stage. Interestingly, the association of the Int7G24A variant with CRC risk was significant in men (odds ratio 4.10 with 95% confidence intervals 1.41-11.85 for homozygous individuals; P for trend = 0.00023, but not in women. We also observed an increase in susceptibility to CRC for individuals aged less than 70 years. Conclusion Our data suggest that the Int7G24A variant represents a risk factor for CRC in the male Spanish population.
International Nuclear Information System (INIS)
Enslin, J.H.R.
1990-01-01
A well engineered renewable remote energy system, utilizing the principal of Maximum Power Point Tracking can be m ore cost effective, has a higher reliability and can improve the quality of life in remote areas. This paper reports that a high-efficient power electronic converter, for converting the output voltage of a solar panel, or wind generator, to the required DC battery bus voltage has been realized. The converter is controlled to track the maximum power point of the input source under varying input and output parameters. Maximum power point tracking for relative small systems is achieved by maximization of the output current in a battery charging regulator, using an optimized hill-climbing, inexpensive microprocessor based algorithm. Through practical field measurements it is shown that a minimum input source saving of 15% on 3-5 kWh/day systems can easily be achieved. A total cost saving of at least 10-15% on the capital cost of these systems are achievable for relative small rating Remote Area Power Supply systems. The advantages at larger temperature variations and larger power rated systems are much higher. Other advantages include optimal sizing and system monitor and control
7 CFR 3565.210 - Maximum interest rate.
2010-01-01
... 7 Agriculture 15 2010-01-01 2010-01-01 false Maximum interest rate. 3565.210 Section 3565.210... AGRICULTURE GUARANTEED RURAL RENTAL HOUSING PROGRAM Loan Requirements § 3565.210 Maximum interest rate. The interest rate for a guaranteed loan must not exceed the maximum allowable rate specified by the Agency in...
Strange vector form factors in the context of the SAMPLE, A4, HAPPEX and G0 experiments
Energy Technology Data Exchange (ETDEWEB)
Silva, Antonio; Kim, Hyu-Chul; Goeke, Klaus
2003-06-30
We present the recent results of the strange vector form factors of the nucleon within the framework of the SU(3) chiral quark-soliton model. We compare our results with the recent experimental data of the SAMPLE and HAPPEX collaborations and find that they are in a good agreement with the data. We also predict the future experiments of the A4, HAPPEX-II and G0 collaborations.
Strange vector form factors in the context of the SAMPLE, A4, HAPPEX and G0 experiments
International Nuclear Information System (INIS)
Silva, Antonio; Kim, Hyu-Chul; Goeke, Klaus
2003-01-01
We present the recent results of the strange vector form factors of the nucleon within the framework of the SU(3) chiral quark-soliton model. We compare our results with the recent experimental data of the SAMPLE and HAPPEX collaborations and find that they are in a good agreement with the data. We also predict the future experiments of the A4, HAPPEX-II and G0 collaborations
Nascimento, Alex Favaro; Pires, Fábio Ribeiro; Chagas, Kristhiano; de Oliveira Procópio, Sergio; Oliveira, Marcelo Antonio; Cargnelutti Filho, Alberto; Belo, Alessandra Ferreira; Egreja Filho, Fernando Barboza
2015-01-01
This study aimed to evaluate the herbicidal activity of picloram on the biomass of the remediation plants Eleusine coracana and Panicum maximum after cultivation in a soil contaminated with this herbicide. These species were grown in three soils, differentiated based on texture (clayish, middle, and sandy, with 460, 250, and 40 g kg(-1) of the clay, respectively), previously contaminated with picloram (0, 80, and 160 g ha(-1)). After 90 days, the plants were harvested and an extract was produced by maceration of leaves and stems of these plants. It was applied to pots containing washed sand, comprising a bioassay in a growth chamber using soybean as a bioindicator for picloram. Soil and plant samples were analyzed by HPLC. The results showed the presence of picloram or metabolites with herbicidal activity in the shoots of E. coracana and P. maximum at phytotoxic levels with regard to soybean plants, indicating that they work only as phytoextractors and that the presence of straw on the soil surface can promote recontamination within the area. It is not recommended to cultivate species susceptible to picloram in areas where it was reported remediation by E. indica and P. maximum and still present residues of these species.
Testing and analysis on total protein, albumin and A/G of salivary in radiation exposure persons
International Nuclear Information System (INIS)
Wang Jun; Zhang Yan; Li Guangwen; Li Gang; Guo Jing; Li Hui; Wang Yuxin; Li Cuixia
2012-01-01
Objective: To study the oral health effect of long term low dose radiation on exposure personnel and to provide a basis for further improving the protection ability. Methods: Testing method, which was based on APT and HSA interactions induced by synchronous fluorescence specific changes, and intensity and concentrations of HSA in the solution in the system of synchronous fluorescence showed a good linear relations. the establishment of a APT as a molecular probe was used to test concentration of salivary total protein (TP), albumin (ALB), globulin (GLO) and albumin by synchronous fluorescence spectrum analysis. The information was analyzed in Foxpro 6.0 and SPSS 16.0 software. Result: Protein (TP) Mean Value was 3.904 ±1.369 g/L, Minimum Value was 0.30 g/L and Maximum Value was 7.50 g/L. Albumin (ALB) Mean Value was 0.965±0.665 g/L, Minimum Value was 0.09 g/L and Maximum Value was 3.98 g/L. Globulin (GLO) Mean Value was 2.895±0.947 g/L, Minimum Value was 0.01 g/L and Maximum Value was 5.81 g/L. A/G Mean Value was 0.327. Conclusion: Long term and low dose of radiation would break the chronic physiological balance and concentration of salivary total protein (TP), albumin (ALB), globulin (GLO) and albumin and globulin ratio (A/G) changed obviously. It was necessary to do more special oral health care, further improve the individual protection consciousness, strengthen the radiation monitoring and protection measures, improve the regulation system, and reduce radiation damage on special personnel health significantly. (authors)
The NBA’s Maximum Player Salary and the Distribution of Player Rents
Directory of Open Access Journals (Sweden)
Kelly M. Hastings
2015-03-01
Full Text Available The NBA’s 1999 Collective Bargaining Agreement (CBA included provisions capping individual player pay in addition to team payrolls. This study examines the effect the NBA’s maximum player salary on player rents by comparing player pay from the 1997–1998 and 2003–2004 seasons while controlling for player productivity and other factors related to player pay. The results indicate a large increase in the pay received by teams’ second highest and, to a lesser extent, third highest paid players. We interpret this result as evidence that the adoption of the maximum player salary shifted rents from stars to complementary players. We also show that the 1999 CBA’s rookie contract provisions reduced salaries of early career players.
Energy Technology Data Exchange (ETDEWEB)
Houndjo, M.J.S. [Faculte des Sciences et Techniques de Natitingou, Natitingou (Benin); Institut de Mathematiques et de Sciences Physiques, Porto-Novo (Benin)
2017-09-15
In this paper we study a modified version of unimodular general relativity in the context of f(G), G denoting the Gauss-Bonnet invariant. We focus on Bianchi-type I and Friendmann-Robertson-Walker universes and search for unimodular f(G) models according to the de Sitter and power-law solutions. Assuming unimodular f(G) gravity as a perfect fluid and making use of the slow-roll parameters, the inflationary model has been reconstructed in concordance with the Planck observational data. Moreover, we investigate the realization of the bounce and loop quantum cosmological ekpyrotic paradigms. Assuming suitable and appropriate scale factors, unimodular f(G) models able to reproduce superbounce and ekpyrotic scenarios have been reconstructed. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Rodier, J; Chassany, J; Guillermin, P [Commissariat a l' Energie Atomique, Centre de Production de Plutonium, Marcoule (France). Centre d' Etudes Nucleaires
1965-07-01
During this work and its preparation, which took place first at G. 2 and then at G. 3 over a period of 11 months, 15000 measurement results were obtained. Their analysis, together with a consideration of the organisation on the site and of the conclusions drawn from the experiment, shows the various factors which determine the importance of the radio-active dangers. (authors) [French] Au cours de ces travaux et de leur preparation, qui ont eu lieu successivement a G. 3 puis a G. 2, pendant 11 mois, 15 000 resultats de mesures ont ete obtenus. Leur etude, mise en parallele avec l'organisation du chantier et les enseignements tires de l'experience, met en evidence les divers facteurs conditionnant les niveaux de risques radioactifs. (auteurs)
Martin, Elizabeth M.; Fry, Rebecca C.
2016-01-01
Abstract A biological mechanism by which exposure to environmental contaminants results in gene-specific CpG methylation patterning is currently unknown. We hypothesize that gene-specific CpG methylation is related to environmentally perturbed transcription factor occupancy. To test this hypothesis, a database of 396 genes with altered CpG methylation either in cord blood leukocytes or placental tissue was compiled from 14 studies representing assessments of six environmental contaminants. Subsequently, an in silico approach was used to identify transcription factor binding sites enriched among the genes with altered CpG methylation in relationship to the suite of environmental contaminants. For each study, the sequences of the promoter regions (representing −1000 to +500 bp from the transcription start site) of all genes with altered CpG methylation were analyzed for enrichment of transcription factor binding sites. Binding sites for a total of 56 unique transcription factors were identified to be enriched within the promoter regions of the genes. Binding sites for the Kidney-Enriched Krupple-like Factor 15, a known responder to endogenous stress, were enriched ( P contaminants. These data support the transcription factor occupancy theory as a potential mechanism underlying environmentally-induced gene-specific CpG methylation. PMID:27066266
Synchronization and NRZ-to-RZ format conversion of 10 G Ethernet packet based on a time lens
DEFF Research Database (Denmark)
Hu, Hao; Laguardia Areal, Janaina; Palushani, Evarist
2010-01-01
10 G Ethernet packet with maximum frame size of 1518 bytes is synchronized to a global clock using a time lens. The 10 Gb/s NRZ signal is converted into RZ signal at the same time.......10 G Ethernet packet with maximum frame size of 1518 bytes is synchronized to a global clock using a time lens. The 10 Gb/s NRZ signal is converted into RZ signal at the same time....
The generalized F constraint in the maximum-entropy method - a study on simulated data
Czech Academy of Sciences Publication Activity Database
Palatinus, Lukáš; van Smaalen, S.
2002-01-01
Roč. 58, - (2002), s. 559-567 ISSN 0108-7673 Grant - others:DFG(DE) XX Institutional research plan: CEZ:AV0Z1010914 Keywords : maximum-entropy method * electron density * oxalic acid Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.417, year: 2002
Nakano, Shin-ichi; Nakamura, Katsuyuki; Teramoto, Naomi; Yamanouchi, Keitaro; Nishihara, Masugi
2016-01-01
Intramuscular adipose tissue (IMAT) formation is a hallmark of marbling in cattle. IMAT is considered to originate from skeletal muscle progenitor cells with adipogenic potential. However, the mechanism involved in IMAT formation from these progenitor cells in vivo remains unclear. In the present study, among the growth factors tested, which were known to be expressed in skeletal muscle, we found only basic fibroblast growth factor (bFGF) has a pro-adipogenic effect on skeletal muscle derived adipogenic progenitor clone, 2G11 cells. Pre-exposure of 2G11 cells to bFGF did not affect initial gene expressions of CCAAT/enhancer-binding protein (C/EBP)β and C/EBPδ, while resulting in an enhancement of subsequent expressions of C/EBPα and proliferator-activated receptor gamma (PPARγ) during adipogenesis, indicating that bFGF is acting on the transcriptional regulation of C/EBPα and PPARγ. In addition, the effect of bFGF is mediated via two types of FGF receptor (FGFR) isoforms: FGFR1 and FGFR2 IIIc, and both receptors are prerequisite for bFGF to express its pro-adipogenic effect. These results suggest that bFGF plays an important role as a key trigger of IMAT formation in vivo. © 2015 Japanese Society of Animal Science.
Directory of Open Access Journals (Sweden)
Khalilah Abdul Khalil
2014-01-01
Full Text Available This study was undertaken to optimize skim milk and yeast extract concentration as a cultivation medium for optimal Bifidobacteria pseudocatenulatum G4 (G4 biomass and β-galactosidase production as well as lactose and free amino nitrogen (FAN balance after cultivation period. Optimization process in this study involved four steps: screening for significant factors using 23 full factorial design, steepest ascent, optimization using FCCD-RSM, and verification. From screening steps, skim milk and yeast extract showed significant influence on the biomass production and, based on the steepest ascent step, middle points of skim milk (6% wt/vol and yeast extract (1.89% wt/vol were obtained. A polynomial regression model in FCCD-RSM revealed that both factors were found significant and the strongest influence was given by skim milk concentration. Optimum concentrations of skim milk and yeast extract for maximum biomass G4 and β-galactosidase production meanwhile low in lactose and FAN balance after cultivation period were 5.89% (wt/vol and 2.31% (wt/vol, respectively. The validation experiments showed that the predicted and experimental values are not significantly different, indicating that the FCCD-RSM model developed is sufficient to describe the cultivation process of G4 using skim-milk-based medium with the addition of yeast extract.
Abdul Khalil, Khalilah; Mustafa, Shuhaimi; Mohammad, Rosfarizan; Bin Ariff, Arbakariya; Shaari, Yamin; Abdul Manap, Yazid; Dahalan, Farrah Aini
2014-01-01
This study was undertaken to optimize skim milk and yeast extract concentration as a cultivation medium for optimal Bifidobacteria pseudocatenulatum G4 (G4) biomass and β-galactosidase production as well as lactose and free amino nitrogen (FAN) balance after cultivation period. Optimization process in this study involved four steps: screening for significant factors using 23 full factorial design, steepest ascent, optimization using FCCD-RSM, and verification. From screening steps, skim milk and yeast extract showed significant influence on the biomass production and, based on the steepest ascent step, middle points of skim milk (6% wt/vol) and yeast extract (1.89% wt/vol) were obtained. A polynomial regression model in FCCD-RSM revealed that both factors were found significant and the strongest influence was given by skim milk concentration. Optimum concentrations of skim milk and yeast extract for maximum biomass G4 and β-galactosidase production meanwhile low in lactose and FAN balance after cultivation period were 5.89% (wt/vol) and 2.31% (wt/vol), respectively. The validation experiments showed that the predicted and experimental values are not significantly different, indicating that the FCCD-RSM model developed is sufficient to describe the cultivation process of G4 using skim-milk-based medium with the addition of yeast extract. PMID:24527457
MXLKID: a maximum likelihood parameter identifier
International Nuclear Information System (INIS)
Gavel, D.T.
1980-07-01
MXLKID (MaXimum LiKelihood IDentifier) is a computer program designed to identify unknown parameters in a nonlinear dynamic system. Using noisy measurement data from the system, the maximum likelihood identifier computes a likelihood function (LF). Identification of system parameters is accomplished by maximizing the LF with respect to the parameters. The main body of this report briefly summarizes the maximum likelihood technique and gives instructions and examples for running the MXLKID program. MXLKID is implemented LRLTRAN on the CDC7600 computer at LLNL. A detailed mathematical description of the algorithm is given in the appendices. 24 figures, 6 tables
Energy Technology Data Exchange (ETDEWEB)
Kabaya, Koji; Watanabe, Masahiko; Kusaka, Masaru; Seki, Masatoshi (Kirin Brewery Co., Ltd., Gunma (Japan). Pharmaceutical Research Laboratory); Fushiki, Masato
1994-08-01
The effect of recombinant human granulocyte colony-stimulating factor (rhG-CSF) on the recovery from neutropenia induced by fractionated whole-body irradiation was investigated in mice. Male 7-week old C3H/HeN mice received a total of ten exposures of 0.25 Gy/day from day 1 to 5 and from day 8 to 12. Peripheral neutropenia with a nadir on day 17 was caused by the fractionated irradiation. Daily subcutaneous injections of rhG-CSF at 0.25 and 2.5 [mu]g/body/day from day from day 1 to 21 promoted the recovery of neutrophils in a dose-dependent manner. The kinetics of morphologically identifiable bone marrow cells were studied to clarify the mechanism behind the promotive effect of this factor. A slight decrease in mitotic immature granulocytes, such as myeloblasts, promyelocytes and myelocytes on day 5, and a drastic decrease in metamyelocytes and marrow neutrophils on days 5, 9, and 17 were seen in the femur of irradiated mice. Treatment using rhG-CSF caused an increase in immature granulocytes of all differential stages in the femur. Microscopic findings of the femurs and spleens also reveals an increase in immature granulocytes in these organs in mice injected with rhG-CSF. These results indicate that rhG-CSF accelerates granulopoiesis in the femur and spleen, thereby promoting recovery from neutropenia induced by fractionated irradiation. (author).
International Nuclear Information System (INIS)
Kabaya, Koji; Watanabe, Masahiko; Kusaka, Masaru; Seki, Masatoshi; Fushiki, Masato.
1994-01-01
The effect of recombinant human granulocyte colony-stimulating factor (rhG-CSF) on the recovery from neutropenia induced by fractionated whole-body irradiation was investigated in mice. Male 7-week old C3H/HeN mice received a total of ten exposures of 0.25 Gy/day from day 1 to 5 and from day 8 to 12. Peripheral neutropenia with a nadir on day 17 was caused by the fractionated irradiation. Daily subcutaneous injections of rhG-CSF at 0.25 and 2.5 μg/body/day from day from day 1 to 21 promoted the recovery of neutrophils in a dose-dependent manner. The kinetics of morphologically identifiable bone marrow cells were studied to clarify the mechanism behind the promotive effect of this factor. A slight decrease in mitotic immature granulocytes, such as myeloblasts, promyelocytes and myelocytes on day 5, and a drastic decrease in metamyelocytes and marrow neutrophils on days 5, 9, and 17 were seen in the femur of irradiated mice. Treatment using rhG-CSF caused an increase in immature granulocytes of all differential stages in the femur. Microscopic findings of the femurs and spleens also reveals an increase in immature granulocytes in these organs in mice injected with rhG-CSF. These results indicate that rhG-CSF accelerates granulopoiesis in the femur and spleen, thereby promoting recovery from neutropenia induced by fractionated irradiation. (author)
Directory of Open Access Journals (Sweden)
Ruhsen Öcal
2010-12-01
Full Text Available OBJECTIVE: Migraine is an independent risk factor for ischemic stroke, but its pathophysiology is still unclear. Genetic factors that predispose patients to thrombosis have been studied in patients with migraine to highlight the pathogenesis, but the results remain controversial. In this study, the frequencies of factor V Leiden (FVL, prothrombin (Pt G20210A and methylenetetrahydrofolate reductase (MTHFR C677T mutations were investigated. METHODS: One hundred and sixty patients aged of 15 to 55 years with no history of systemic disease and who had been diagnosed as migraine according to the International Headache Society (IHS diagnostic criteria at Baskent University Hospital Neurology Outpatient Clinics were investigated for FVL, Pt G20210A and MTHFR C677T mutations from their genomic DNA, and the results were compared with those of healthy controls. RESULTS: One hundred and fifty five (96.9% of 160 migraine patients were homozygote normal, 5 (3.1% were heterozygote and none of them were homozygote mutant for FVL. The control group had 9.8% heterozygote individuals but the difference between the percentages was not statistically significant (p> 0.05. There were no homozygote mutant individuals in the Turkish population study in normal subjects like our study. Thirty nine (24.4% of 160 migraine patients were heterozygote and 8 (5% were homozygote mutant for MTHFR C677T. The control group had 37 (34.9% heterozygote and 6 (5.6% homozygote mutant individuals. The difference between the percentages was not statistically significant (p= 0.15. Three (1.9% of 160 migraine patients were heterozygote and 5 (2.9% of the control group were heterozygote mutant for Pt G20210A mutation. The control group had 37 (34.9% heterozygote and 6 (5.6% homozygote mutant individuals. The difference between the percentages was not statistically significant (p= 0.420. CONCLUSION: Our study indicates that FVL, Pt G20210A and MTHFR C677T gene mutations, which are considered
Directory of Open Access Journals (Sweden)
Ruhsen Öcal
2010-12-01
Full Text Available OBJECTIVE: Migraine is an independent risk factor for ischemic stroke, but its pathophysiology is still unclear. Genetic factors that predispose patients to thrombosis have been studied in patients with migraine to highlight the pathogenesis, but the results remain controversial. In this study, the frequencies of factor V Leiden (FVL, prothrombin (Pt G20210A and methylenetetrahydrofolate reductase (MTHFR C677T mutations were investigated. METHODS: One hundred and sixty patients aged of 15 to 55 years with no history of systemic disease and who had been diagnosed as migraine according to the International Headache Society (IHS diagnostic criteria at Baskent University Hospital Neurology Outpatient Clinics were investigated for FVL, Pt G20210A and MTHFR C677T mutations from their genomic DNA, and the results were compared with those of healthy controls. RESULTS: One hundred and fifty five (96.9% of 160 migraine patients were homozygote normal, 5 (3.1% were heterozygote and none of them were homozygote mutant for FVL. The control group had 9.8% heterozygote individuals but the difference between the percentages was not statistically significant (p> 0.05. There were no homozygote mutant individuals in the Turkish population study in normal subjects like our study. Thirty nine (24.4% of 160 migraine patients were heterozygote and 8 (5% were homozygote mutant for MTHFR C677T. The control group had 37 (34.9% heterozygote and 6 (5.6% homozygote mutant individuals. The difference between the percentages was not statistically significant (p= 0.15. Three (1.9% of 160 migraine patients were heterozygote and 5 (2.9% of the control group were heterozygote mutant for Pt G20210A mutation. The control group had 37 (34.9% heterozygote and 6 (5.6% homozygote mutant individuals. The difference between the percentages was not statistically significant (p= 0.420. CONCLUSION: Our study indicates that FVL, Pt G20210A and MTHFR C677T gene mutations, which are considered
Factors that Influence RF Breakdown in Antenna Systems
Caughman, J. B. O.; Baity, F. W.; Rasmussen, D. A.; Aghazarian, M.; Castano Giraldo, C. H.; Ruzic, David
2007-11-01
One of the main power-limiting factors in antenna systems is the maximum voltage that the antenna or vacuum transmission line can sustain before breaking down. The factors that influence RF breakdown are being studied in a resonant 1/4-wavelength section of vacuum transmission line terminated with an open circuit electrode structure. Breakdown can be initiated via electron emission by high electric fields and by plasma formation in the structure, depending on the gas pressure. Recent experiments have shown that a 1 kG magnetic field can influence plasma formation at pressures as low as 8x10-5 Torr at moderate voltage levels (LLC, for the U.S. Dept. of Energy under contract DE-AC05-00OR22725. Work supported by USDOE with grant DE-FG02-04ER54765
CytoMCS: A Multiple Maximum Common Subgraph Detection Tool for Cytoscape
DEFF Research Database (Denmark)
Larsen, Simon; Baumbach, Jan
2017-01-01
such analyses we have developed CytoMCS, a Cytoscape app for computing inexact solutions to the maximum common edge subgraph problem for two or more graphs. Our algorithm uses an iterative local search heuristic for computing conserved subgraphs, optimizing a squared edge conservation score that is able...... to detect not only fully conserved edges but also partially conserved edges. It can be applied to any set of directed or undirected, simple graphs loaded as networks into Cytoscape, e.g. protein-protein interaction networks or gene regulatory networks. CytoMCS is available as a Cytoscape app at http://apps.cytoscape.org/apps/cytomcs....
Abbas, Ash Mohammad
2012-01-01
In this paper, we describe some bounds and inequalities relating h-index, g-index, e-index, and generalized impact factor. We derive the bounds and inequalities relating these indexing parameters from their basic definitions and without assuming any continuous model to be followed by any of them. We verify the theorems using citation data for five Price Medalists. We observe that the lower bound for h-index given by Theorem 2, [formula: see text], g ≥ 1, comes out to be more accurate as compared to Schubert-Glanzel relation h is proportional to C(2/3)P(-1/3) for a proportionality constant of 1, where C is the number of citations and P is the number of papers referenced. Also, the values of h-index obtained using Theorem 2 outperform those obtained using Egghe-Liang-Rousseau power law model for the given citation data of Price Medalists. Further, we computed the values of upper bound on g-index given by Theorem 3, g ≤ (h + e), where e denotes the value of e-index. We observe that the upper bound on g-index given by Theorem 3 is reasonably tight for the given citation record of Price Medalists.
Modelling non-stationary annual maximum flood heights in the lower Limpopo River basin of Mozambique
Directory of Open Access Journals (Sweden)
Daniel Maposa
2016-05-01
Full Text Available In this article we fit a time-dependent generalised extreme value (GEV distribution to annual maximum flood heights at three sites: Chokwe, Sicacate and Combomune in the lower Limpopo River basin of Mozambique. A GEV distribution is fitted to six annual maximum time series models at each site, namely: annual daily maximum (AM1, annual 2-day maximum (AM2, annual 5-day maximum (AM5, annual 7-day maximum (AM7, annual 10-day maximum (AM10 and annual 30-day maximum (AM30. Non-stationary time-dependent GEV models with a linear trend in location and scale parameters are considered in this study. The results show lack of sufficient evidence to indicate a linear trend in the location parameter at all three sites. On the other hand, the findings in this study reveal strong evidence of the existence of a linear trend in the scale parameter at Combomune and Sicacate, whilst the scale parameter had no significant linear trend at Chokwe. Further investigation in this study also reveals that the location parameter at Sicacate can be modelled by a nonlinear quadratic trend; however, the complexity of the overall model is not worthwhile in fit over a time-homogeneous model. This study shows the importance of extending the time-homogeneous GEV model to incorporate climate change factors such as trend in the lower Limpopo River basin, particularly in this era of global warming and a changing climate. Keywords: nonstationary extremes; annual maxima; lower Limpopo River; generalised extreme value
Performance of penalized maximum likelihood in estimation of genetic covariances matrices
Directory of Open Access Journals (Sweden)
Meyer Karin
2011-11-01
Full Text Available Abstract Background Estimation of genetic covariance matrices for multivariate problems comprising more than a few traits is inherently problematic, since sampling variation increases dramatically with the number of traits. This paper investigates the efficacy of regularized estimation of covariance components in a maximum likelihood framework, imposing a penalty on the likelihood designed to reduce sampling variation. In particular, penalties that "borrow strength" from the phenotypic covariance matrix are considered. Methods An extensive simulation study was carried out to investigate the reduction in average 'loss', i.e. the deviation in estimated matrices from the population values, and the accompanying bias for a range of parameter values and sample sizes. A number of penalties are examined, penalizing either the canonical eigenvalues or the genetic covariance or correlation matrices. In addition, several strategies to determine the amount of penalization to be applied, i.e. to estimate the appropriate tuning factor, are explored. Results It is shown that substantial reductions in loss for estimates of genetic covariance can be achieved for small to moderate sample sizes. While no penalty performed best overall, penalizing the variance among the estimated canonical eigenvalues on the logarithmic scale or shrinking the genetic towards the phenotypic correlation matrix appeared most advantageous. Estimating the tuning factor using cross-validation resulted in a loss reduction 10 to 15% less than that obtained if population values were known. Applying a mild penalty, chosen so that the deviation in likelihood from the maximum was non-significant, performed as well if not better than cross-validation and can be recommended as a pragmatic strategy. Conclusions Penalized maximum likelihood estimation provides the means to 'make the most' of limited and precious data and facilitates more stable estimation for multi-dimensional analyses. It should
Maximum entropy principal for transportation
International Nuclear Information System (INIS)
Bilich, F.; Da Silva, R.
2008-01-01
In this work we deal with modeling of the transportation phenomenon for use in the transportation planning process and policy-impact studies. The model developed is based on the dependence concept, i.e., the notion that the probability of a trip starting at origin i is dependent on the probability of a trip ending at destination j given that the factors (such as travel time, cost, etc.) which affect travel between origin i and destination j assume some specific values. The derivation of the solution of the model employs the maximum entropy principle combining a priori multinomial distribution with a trip utility concept. This model is utilized to forecast trip distributions under a variety of policy changes and scenarios. The dependence coefficients are obtained from a regression equation where the functional form is derived based on conditional probability and perception of factors from experimental psychology. The dependence coefficients encode all the information that was previously encoded in the form of constraints. In addition, the dependence coefficients encode information that cannot be expressed in the form of constraints for practical reasons, namely, computational tractability. The equivalence between the standard formulation (i.e., objective function with constraints) and the dependence formulation (i.e., without constraints) is demonstrated. The parameters of the dependence-based trip-distribution model are estimated, and the model is also validated using commercial air travel data in the U.S. In addition, policy impact analyses (such as allowance of supersonic flights inside the U.S. and user surcharge at noise-impacted airports) on air travel are performed.
New factors influencing G protein coupled receptors’ system ...
African Journals Online (AJOL)
Abdelaziz Ghanemi
2012-11-24
Nov 24, 2012 ... including those related to structure/activity relationship (some aspects have ..... caveolae, whereas G(i) and G(s) target lipid rafts by default. Mol .... classification of receptors for 5-hydroxytryptamine (Serotonin). Pharmacol Rev ...
International Nuclear Information System (INIS)
Hult, J; Mayer, S
2011-01-01
A general design of a laser light sheet module with adjustable focus is presented, where the maximum sheet width is preserved over a fixed region. In contrast, conventional focusing designs are associated with a variation in maximum sheet width with focal position. A four lens design is proposed here, where the first three lenses are employed for focusing, and the last for sheet expansion. A maximum sheet width of 1100 µm was maintained over a 50 mm long distance, for focal distances ranging from 75 to 500 mm, when a 532 nm laser beam with a beam quality factor M 2 = 29 was used for illumination
Energy Technology Data Exchange (ETDEWEB)
Raghunathan, Srinivasan; Patil, Sanjaykumar; Bianchini, Federico; Reichardt, Christian L. [School of Physics, University of Melbourne, 313 David Caro building, Swanston St and Tin Alley, Parkville VIC 3010 (Australia); Baxter, Eric J. [Department of Physics and Astronomy, University of Pennsylvania, 209 S. 33rd Street, Philadelphia, PA 19104 (United States); Bleem, Lindsey E. [Argonne National Laboratory, High-Energy Physics Division, 9700 S. Cass Avenue, Argonne, IL 60439 (United States); Crawford, Thomas M. [Kavli Institute for Cosmological Physics, University of Chicago, 5640 South Ellis Avenue, Chicago, IL 60637 (United States); Holder, Gilbert P. [Department of Astronomy and Department of Physics, University of Illinois, 1002 West Green St., Urbana, IL 61801 (United States); Manzotti, Alessandro, E-mail: srinivasan.raghunathan@unimelb.edu.au, E-mail: s.patil2@student.unimelb.edu.au, E-mail: ebax@sas.upenn.edu, E-mail: federico.bianchini@unimelb.edu.au, E-mail: bleeml@uchicago.edu, E-mail: tcrawfor@kicp.uchicago.edu, E-mail: gholder@illinois.edu, E-mail: manzotti@uchicago.edu, E-mail: christian.reichardt@unimelb.edu.au [Department of Astronomy and Astrophysics, University of Chicago, 5640 South Ellis Avenue, Chicago, IL 60637 (United States)
2017-08-01
We develop a Maximum Likelihood estimator (MLE) to measure the masses of galaxy clusters through the impact of gravitational lensing on the temperature and polarization anisotropies of the cosmic microwave background (CMB). We show that, at low noise levels in temperature, this optimal estimator outperforms the standard quadratic estimator by a factor of two. For polarization, we show that the Stokes Q/U maps can be used instead of the traditional E- and B-mode maps without losing information. We test and quantify the bias in the recovered lensing mass for a comprehensive list of potential systematic errors. Using realistic simulations, we examine the cluster mass uncertainties from CMB-cluster lensing as a function of an experiment's beam size and noise level. We predict the cluster mass uncertainties will be 3 - 6% for SPT-3G, AdvACT, and Simons Array experiments with 10,000 clusters and less than 1% for the CMB-S4 experiment with a sample containing 100,000 clusters. The mass constraints from CMB polarization are very sensitive to the experimental beam size and map noise level: for a factor of three reduction in either the beam size or noise level, the lensing signal-to-noise improves by roughly a factor of two.
Discrete maximum principle for FE solutions of the diffusion-reaction problem on prismatic meshes
Czech Academy of Sciences Publication Activity Database
Hannukainen, A.; Korotov, S.; Vejchodský, Tomáš
2009-01-01
Roč. 226, č. 2 (2009), s. 275-287 ISSN 0377-0427 R&D Projects: GA AV ČR IAA100760702 Institutional research plan: CEZ:AV0Z10190503 Keywords : diffusion-reaction problem * maximum principle * prismatic finite elements Subject RIV: BA - General Mathematics Impact factor: 1.292, year: 2009
2013-02-12
... maximum penalty amount of $75,000 for each violation, except that if the violation results in death... the maximum civil penalty for a violation is $175,000 if the violation results in death, serious... Penalties for a Violation of the Hazardous Materials Transportation Laws or Regulations, Orders, Special...
A Hybrid Physical and Maximum-Entropy Landslide Susceptibility Model
Directory of Open Access Journals (Sweden)
Jerry Davis
2015-06-01
Full Text Available The clear need for accurate landslide susceptibility mapping has led to multiple approaches. Physical models are easily interpreted and have high predictive capabilities but rely on spatially explicit and accurate parameterization, which is commonly not possible. Statistical methods can include other factors influencing slope stability such as distance to roads, but rely on good landslide inventories. The maximum entropy (MaxEnt model has been widely and successfully used in species distribution mapping, because data on absence are often uncertain. Similarly, knowledge about the absence of landslides is often limited due to mapping scale or methodology. In this paper a hybrid approach is described that combines the physically-based landslide susceptibility model “Stability INdex MAPping” (SINMAP with MaxEnt. This method is tested in a coastal watershed in Pacifica, CA, USA, with a well-documented landslide history including 3 inventories of 154 scars on 1941 imagery, 142 in 1975, and 253 in 1983. Results indicate that SINMAP alone overestimated susceptibility due to insufficient data on root cohesion. Models were compared using SINMAP stability index (SI or slope alone, and SI or slope in combination with other environmental factors: curvature, a 50-m trail buffer, vegetation, and geology. For 1941 and 1975, using slope alone was similar to using SI alone; however in 1983 SI alone creates an Areas Under the receiver operator Curve (AUC of 0.785, compared with 0.749 for slope alone. In maximum-entropy models created using all environmental factors, the stability index (SI from SINMAP represented the greatest contributions in all three years (1941: 48.1%; 1975: 35.3; and 1983: 48%, with AUC of 0.795, 0822, and 0.859, respectively; however; using slope instead of SI created similar overall AUC values, likely due to the combined effect with plan curvature indicating focused hydrologic inputs and vegetation identifying the effect of root cohesion
Milessi, Thais S S; Antunes, Felipe A F; Chandel, Anuj K; Silva, Silvio S
2013-10-01
Selection of the raw material and its efficient utilization are the critical factors in economization of second generation (2G) ethanol production. Fermentation of the released sugars into ethanol by a suitable ethanol producing microorganism using cheap media ingredients is the cornerstone of the overall process. This study evaluated the potential of rice bran extract (RBE) as a cheap nitrogen source for the production of 2G ethanol by Scheffersomyces (Pichia) stipitis NRRL Y-7124 using sugarcane bagasse (SB) hemicellulosic hydrolysate. Dilute acid hydrolysis of SB showed 12.45 g/l of xylose and 0.67 g/l of glucose along with inhibitors. It was concentrated by vacuum evaporation and submitted to sequential detoxification (neutralization by calcium hydroxide and charcoal adsorption). The detoxified hydrolysate revealed the removal of furfural (81 %) and 5-hydroxymethylfurfural (61 %) leading to the final concentration of glucose (1.69 g/l) and xylose (33.03 g/l). S. stipitis was grown in three different fermentation media composed of detoxified hydrolysate as carbon source supplemented with varying nitrogen sources i.e. medium #1 (RBE + ammonium sulfate + calcium chloride), medium #2 (yeast extract + peptone) and medium #3 (yeast extract + peptone + malt extract). Medium #1 showed maximum ethanol production (8.6 g/l, yield 0.22 g/g) followed by medium #2 (8.1 g/l, yield 0.19 g/g) and medium #3 (7.4 g/l, yield 0.18 g/g).
Health physics during work on the G. 2 and G. 3 reactor exchanges
International Nuclear Information System (INIS)
Rodier, J.; Chassany, J.; Guillermin, P.
1965-01-01
During this work and its preparation, which took place first at G. 2 and then at G. 3 over a period of 11 months, 15000 measurement results were obtained. Their analysis, together with a consideration of the organisation on the site and of the conclusions drawn from the experiment, shows the various factors which determine the importance of the radio-active dangers. (authors) [fr
International Nuclear Information System (INIS)
Wang, P.-Y.; Hou, S.-S.
2005-01-01
In this paper, performance analysis and comparison based on the maximum power and maximum power density conditions have been conducted for an Atkinson cycle coupled to variable temperature heat reservoirs. The Atkinson cycle is internally reversible but externally irreversible, since there is external irreversibility of heat transfer during the processes of constant volume heat addition and constant pressure heat rejection. This study is based purely on classical thermodynamic analysis methodology. It should be especially emphasized that all the results and conclusions are based on classical thermodynamics. The power density, defined as the ratio of power output to maximum specific volume in the cycle, is taken as the optimization objective because it considers the effects of engine size as related to investment cost. The results show that an engine design based on maximum power density with constant effectiveness of the hot and cold side heat exchangers or constant inlet temperature ratio of the heat reservoirs will have smaller size but higher efficiency, compression ratio, expansion ratio and maximum temperature than one based on maximum power. From the view points of engine size and thermal efficiency, an engine design based on maximum power density is better than one based on maximum power conditions. However, due to the higher compression ratio and maximum temperature in the cycle, an engine design based on maximum power density conditions requires tougher materials for engine construction than one based on maximum power conditions
Schrem, Harald; Schneider, Valentin; Kurok, Marlene; Goldis, Alon; Dreier, Maren; Kaltenborn, Alexander; Gwinner, Wilfried; Barthold, Marc; Liebeneiner, Jan; Winny, Markus; Klempnauer, Jürgen; Kleine, Moritz
2016-01-01
The aim of this study is to identify independent pre-transplant cancer risk factors after kidney transplantation and to assess the utility of G-chart analysis for clinical process control. This may contribute to the improvement of cancer surveillance processes in individual transplant centers. 1655 patients after kidney transplantation at our institution with a total of 9,425 person-years of follow-up were compared retrospectively to the general German population using site-specific standardized-incidence-ratios (SIRs) of observed malignancies. Risk-adjusted multivariable Cox regression was used to identify independent pre-transplant cancer risk factors. G-chart analysis was applied to determine relevant differences in the frequency of cancer occurrences. Cancer incidence rates were almost three times higher as compared to the matched general population (SIR = 2.75; 95%-CI: 2.33-3.21). Significantly increased SIRs were observed for renal cell carcinoma (SIR = 22.46), post-transplant lymphoproliferative disorder (SIR = 8.36), prostate cancer (SIR = 2.22), bladder cancer (SIR = 3.24), thyroid cancer (SIR = 10.13) and melanoma (SIR = 3.08). Independent pre-transplant risk factors for cancer-free survival were age 62.6 years (p = 0.001, HR: 1.29), polycystic kidney disease other than autosomal dominant polycystic kidney disease (ADPKD) (p = 0.001, HR: 0.68), high body mass index in kg/m2 (pKaizen events and audits for root-cause analysis of relevant detection rate changes. Further, comparative G-chart analysis would enable benchmarking of cancer surveillance processes between centers.
Prenatal exposure to lead in Spain: cord blood levels and associated factors.
Llop, Sabrina; Aguinagalde, Xabier; Vioque, Jesus; Ibarluzea, Jesús; Guxens, Mònica; Casas, Maribel; Murcia, Mario; Ruiz, María; Amurrio, Ascensión; Rebagliato, Marisa; Marina, Loreto Santa; Fernandez-Somoano, Ana; Tardon, Adonina; Ballester, Ferran
2011-05-01
Lead is a known neurotoxic. Fetuses and infants are very vulnerable to lead exposure, since their blood-brain barrier is not completely formed. Hence, there is an importance for monitoring of blood lead levels prenatally and during early infancy. The aim of this study is to evaluate the prenatal exposure to lead and its association with maternal factors in four population based mother-child cohorts in Spain. The present research was carried out within the framework of the INMA project INfancia y Medio Ambiente (Environment and Childhood). A total of 1462 pregnant women were recruited between 2004 and 2008. Lead was analyzed in a sample of cord blood by thermal decomposition, amalgation, and Atomic Absorption Spectrometry. Maternal sociodemographic, lifestyle and dietary factors were obtained by questionnaires during pregnancy. A multivariate logistic regression model was constructed. The dependent variable was a dichotomous lead level variable (detected vs no detected, i.e. ≥ vs < 2μg/dL). A low percentage of cord blood samples with lead levels ≥ 2μg/dL were found (5.9%). Geometric mean and maximum were 1.06μg/dL and 19μg/dL, respectively. Smoking at the beginning of pregnancy, age, social class, weight gain during pregnancy, gravidity, and place of residence were the maternal factors associated with detectable cord blood lead levels. Mother's diet does not appear to be a determining factor of lead exposure. Nevertheless, daily intake of iron and zinc may act as a protective factor against having cord blood lead levels ≥ 2μg/dL. In the different regions of Spain taking part in this study, lead levels to which newborns are exposed are low. Mobilization of lead from bones may be the main contributor to the cord blood levels. Copyright © 2011 Elsevier B.V. All rights reserved.
Project "Convective Wind Gusts" (ConWinG)
Mohr, Susanna; Richter, Alexandra; Kunz, Michael; Ruck, Bodo
2017-04-01
Convectively-driven strong winds usually associated with thunderstorms frequently cause substantial damage to buildings and other structures in many parts of the world. Decisive for the high damage potential are the short-term wind speed maxima with duration of a few seconds, termed as gusts. Several studies have shown that convectively-driven gusts can reach even higher wind speeds compared to turbulent gusts associated with synoptic-scale weather systems. Due to the small-scale and non-stationary nature of convective wind gusts, there is a considerable lack of knowledge regarding their characteristics and statistics. Furthermore, their interaction with urban structures and their influence on buildings is not yet fully understood. For these two reasons, convective wind events are not included in the present wind load standards of buildings and structures, which so far have been based solely on the characteristics of synoptically-driven wind gusts in the near-surface boundary layer (e. g., DIN EN 1991-1-4:2010-12; ASCE7). However, convective and turbulent gusts differ considerably, e.g. concerning vertical wind-speed profiles, gust factors (i.e., maximum to mean wind speed), or exceedance probability curves. In an effort to remedy this situation, the overarching objective of the DFG-project "Convective Wind Gusts" (ConWinG) is to investigate the characteristics and statistics of convective gusts as well as their interaction with urban structures. Based on a set of 110 climate stations of the German Weather Service (DWD) between 1992 and 2014, we analyzed the temporal and spatial distribution, intensity, and occurrence probability of convective gusts. Similar to thunderstorm activity, the frequency of convective gusts decreases gradually from South to North Germany. A relation between gust intensity/probability to orography or climate conditions cannot be identified. Rather, high wind speeds, e.g., above 30 m/s, can be expected everywhere in Germany with almost
DEFF Research Database (Denmark)
Celebioglu, Hasan Ufuk; Olesen, Sita Vaag; Prehn, Kennie
2017-01-01
The present study describes the growth of the very well-known probiotic bacterium Lactobacillus acidophilus NCFM on different carbohydrates. Furthermore, recombinant production of putative moonlighting proteins elongation factor G and pyruvate kinase from this bacterium is described. For further...
Directory of Open Access Journals (Sweden)
Sylvie Callegari
Full Text Available Mitochondrial translation, essential for synthesis of the electron transport chain complexes in the mitochondria, is governed by nuclear encoded genes. Polymorphisms within these genes are increasingly being implicated in disease and may also trigger adverse drug reactions. Statins, a class of HMG-CoA reductase inhibitors used to treat hypercholesterolemia, are among the most widely prescribed drugs in the world. However, a significant proportion of users suffer side effects of varying severity that commonly affect skeletal muscle. The mitochondria are one of the molecular targets of statins, and these drugs have been known to uncover otherwise silent mitochondrial mutations. Based on yeast genetic studies, we identify the mitochondrial translation factor MEF2 as a mediator of atorvastatin toxicity. The human ortholog of MEF2 is the Elongation Factor Gene (EF-G 2, which has previously been shown to play a specific role in mitochondrial ribosome recycling. Using small interfering RNA (siRNA silencing of expression in human cell lines, we demonstrate that the EF-G2mt gene is required for cell growth on galactose medium, signifying an essential role for this gene in aerobic respiration. Furthermore, EF-G2mt silenced cell lines have increased susceptibility to cell death in the presence of atorvastatin. Using yeast as a model, conserved amino acid variants, which arise from non-synonymous single nucleotide polymorphisms (SNPs in the EF-G2mt gene, were generated in the yeast MEF2 gene. Although these mutations do not produce an obvious growth phenotype, three mutations reveal an atorvastatin-sensitive phenotype and further analysis uncovers a decreased respiratory capacity. These findings constitute the first reported phenotype associated with SNPs in the EF-G2mt gene and implicate the human EF-G2mt gene as a pharmacogenetic candidate gene for statin toxicity in humans.
DEFF Research Database (Denmark)
Saugstrup, Dan; Henten, Anders
2006-01-01
Purpose – The main purpose of this paper is to analyze which standard/technology will win the 3G mobile markets. In addition, two sub topics are examined. First, which kind of victory will it be – will one technological solution be all-dominating or is co-existence more likely? Second, which....... Originality/value – The paper is based on the understanding that a vast array of different factors in a complex dynamic environment goes into the determination of the outcome of such standardization games. However, the battle between 3G standards has already reached a level, where relatively certain...... predictions can be made. And, the paper contributes with a methodologically based discussion concerning the outcome of the battle between 3G standards....
Noise and physical limits to maximum resolution of PET images
Energy Technology Data Exchange (ETDEWEB)
Herraiz, J.L.; Espana, S. [Dpto. Fisica Atomica, Molecular y Nuclear, Facultad de Ciencias Fisicas, Universidad Complutense de Madrid, Avda. Complutense s/n, E-28040 Madrid (Spain); Vicente, E.; Vaquero, J.J.; Desco, M. [Unidad de Medicina y Cirugia Experimental, Hospital GU ' Gregorio Maranon' , E-28007 Madrid (Spain); Udias, J.M. [Dpto. Fisica Atomica, Molecular y Nuclear, Facultad de Ciencias Fisicas, Universidad Complutense de Madrid, Avda. Complutense s/n, E-28040 Madrid (Spain)], E-mail: jose@nuc2.fis.ucm.es
2007-10-01
In this work we show that there is a limit for the maximum resolution achievable with a high resolution PET scanner, as well as for the best signal-to-noise ratio, which are ultimately related to the physical effects involved in the emission and detection of the radiation and thus they cannot be overcome with any particular reconstruction method. These effects prevent the spatial high frequency components of the imaged structures to be recorded by the scanner. Therefore, the information encoded in these high frequencies cannot be recovered by any reconstruction technique. Within this framework, we have determined the maximum resolution achievable for a given acquisition as a function of data statistics and scanner parameters, like the size of the crystals or the inter-crystal scatter. In particular, the noise level in the data as a limitation factor to yield high-resolution images in tomographs with small crystal sizes is outlined. These results have implications regarding how to decide the optimal number of voxels of the reconstructed image or how to design better PET scanners.
Noise and physical limits to maximum resolution of PET images
International Nuclear Information System (INIS)
Herraiz, J.L.; Espana, S.; Vicente, E.; Vaquero, J.J.; Desco, M.; Udias, J.M.
2007-01-01
In this work we show that there is a limit for the maximum resolution achievable with a high resolution PET scanner, as well as for the best signal-to-noise ratio, which are ultimately related to the physical effects involved in the emission and detection of the radiation and thus they cannot be overcome with any particular reconstruction method. These effects prevent the spatial high frequency components of the imaged structures to be recorded by the scanner. Therefore, the information encoded in these high frequencies cannot be recovered by any reconstruction technique. Within this framework, we have determined the maximum resolution achievable for a given acquisition as a function of data statistics and scanner parameters, like the size of the crystals or the inter-crystal scatter. In particular, the noise level in the data as a limitation factor to yield high-resolution images in tomographs with small crystal sizes is outlined. These results have implications regarding how to decide the optimal number of voxels of the reconstructed image or how to design better PET scanners
Xu, Ganggang; Genton, Marc G.
2016-01-01
We propose a new class of trans-Gaussian random fields named Tukey g-and-h (TGH) random fields to model non-Gaussian spatial data. The proposed TGH random fields have extremely flexible marginal distributions, possibly skewed and/or heavy-tailed, and, therefore, have a wide range of applications. The special formulation of the TGH random field enables an automatic search for the most suitable transformation for the dataset of interest while estimating model parameters. Asymptotic properties of the maximum likelihood estimator and the probabilistic properties of the TGH random fields are investigated. An efficient estimation procedure, based on maximum approximated likelihood, is proposed and an extreme spatial outlier detection algorithm is formulated. Kriging and probabilistic prediction with TGH random fields are developed along with prediction confidence intervals. The predictive performance of TGH random fields is demonstrated through extensive simulation studies and an application to a dataset of total precipitation in the south east of the United States.
Xu, Ganggang
2016-07-15
We propose a new class of trans-Gaussian random fields named Tukey g-and-h (TGH) random fields to model non-Gaussian spatial data. The proposed TGH random fields have extremely flexible marginal distributions, possibly skewed and/or heavy-tailed, and, therefore, have a wide range of applications. The special formulation of the TGH random field enables an automatic search for the most suitable transformation for the dataset of interest while estimating model parameters. Asymptotic properties of the maximum likelihood estimator and the probabilistic properties of the TGH random fields are investigated. An efficient estimation procedure, based on maximum approximated likelihood, is proposed and an extreme spatial outlier detection algorithm is formulated. Kriging and probabilistic prediction with TGH random fields are developed along with prediction confidence intervals. The predictive performance of TGH random fields is demonstrated through extensive simulation studies and an application to a dataset of total precipitation in the south east of the United States.
Factores de riesgos psicosociales en el trabajo: género y enfermería
Directory of Open Access Journals (Sweden)
Paula Ceballos Vásquez
2014-07-01
Full Text Available Este trabajo tiene como objetivo reflexionar sobre los aspectos teóricos relacionados con los riesgos psicosociales a nivel laboral, analizar con enfoque de género las desigualdades en relación con los riesgos y vincular la enfermería con los riesgos psicosociales. Se presentan los aspectos teóricos, asociados con los factores de riesgos psicosociales y se visibilizan algunas desigualdades presentes en los lugares de trabajo entre hombres y mujeres; además, el personal sanitario es uno de los que más está expuesto a riesgos psicosociales, por lo que estas temáticas deben incorporarse a los modelos formativos de pregrado de las escuelas de enfermería y en los programas de postgrado con la finalidad de profundizar sobre los riesgos.
Energy Technology Data Exchange (ETDEWEB)
Singh, Parjit S. [Department of Physics, Punjabi University, Patiala 147 002 (India)], E-mail: dr_parjit@hotmail.com; Singh, Tejbir [Department of Physics, Lovely Professional University, Phagwara 144 402 (India); Kaur, Paramjeet [IAS and Allied Services Training Centre, Punjabi University, Patiala 147 002 (India)
2008-06-15
G.P. fitting method has been used to compute energy absorption buildup factor of some commonly used solvents such as acetonitrile (C{sub 4}H{sub 3}N), butanol (C{sub 4}H{sub 9}OH), chlorobenzene (C{sub 6}H{sub 5}Cl), diethyl ether (C{sub 4}H{sub 10}O), ethanol (C{sub 2}H{sub 5}OH), methanol (CH{sub 3}OH), propanol (C{sub 3}H{sub 7}OH) and water (H{sub 2}O) for the wide energy range (0.015-15.0 MeV) up to the penetration depth of 10 mean free path. The variation of energy absorption buildup factor with chemical composition as well as incident photon energy for the selected solvents has been studied. It has been observed that the maximum value of energy absorption buildup factors shifts to the slightly higher incident photon energy with the increase in equivalent atomic number of the solvent and the solvent with least equivalent atomic number possesses the maximum value of energy absorption buildup factor.
The use of immunomodulators is a promising area for biotherapeutic, prophylactic, and metaphylactic use to prevent and combat infectious disease, particularly during periods of peak disease incidence. Cytokines, including granulocyte colony-stimulating factor (G-CSF), are one class of compounds that...
Statistic method of research reactors maximum permissible power calculation
International Nuclear Information System (INIS)
Grosheva, N.A.; Kirsanov, G.A.; Konoplev, K.A.; Chmshkyan, D.V.
1998-01-01
The technique for calculating maximum permissible power of a research reactor at which the probability of the thermal-process accident does not exceed the specified value, is presented. The statistical method is used for the calculations. It is regarded that the determining function related to the reactor safety is the known function of the reactor power and many statistically independent values which list includes the reactor process parameters, geometrical characteristics of the reactor core and fuel elements, as well as random factors connected with the reactor specific features. Heat flux density or temperature is taken as a limiting factor. The program realization of the method discussed is briefly described. The results of calculating the PIK reactor margin coefficients for different probabilities of the thermal-process accident are considered as an example. It is shown that the probability of an accident with fuel element melting in hot zone is lower than 10 -8 1 per year for the reactor rated power [ru
Directory of Open Access Journals (Sweden)
Danho, M.
2012-01-01
Full Text Available Effect of Panicum maximum on Productivity of Primiparous Females during Reproduction Cycle in Guinea Pigs (Cavia porcellus L.. In Ivory Coast, Guinea pigs reared for meat (Cavia porcellus L. are mainly fed with Panicum maximum. To assess the effect of the latter during pregnancy and lactation (RC of these animals, primiparous dams were fed ad libitum, Panicum maximum alone during the RC (MOD1 or associated with pellets for rabbits during lactation (MOD2, or associated with pellets for rabbits during the last part of the pregnancy period and the lactation (MOD3, or associated with pellets for rabbits during the entire RC (MOD4. The number of corpora lutea per female was 1.3 ± 0.5 and 2.0 ± 0.0 respectively for MOD1 and MOD4. No pre-embryonic mortality was recorded. The mean weight of the young guinea pigs of MOD1 (54.7 ± 10. g was only 55% of that of MOD4 (98.6 ± 13.6 g. At weaning, the average weight gain of young guinea pigs of MOD1 (40.5 ± 22.2 g represented a third of those obtained with other diets that did not significantly differ. At the end of RC, the weight gain of dams was 17 ± 13.3% for MOD1 compared to 50% for MOD2, MOD3 and MOD4. Feeding Panicum maximum alone induces chronic malnutrition which in turn is responsible of the low ovulation rate and reduced growth in guinea pig breeding.
Energy Technology Data Exchange (ETDEWEB)
Huesemann, M.; Chavis, A.; Edmundson, S.; Rye, D.; Hobbs, S.; Sun, N.; Wigmosta, M.
2017-09-13
Chlorella sorokiniana (DOE 1412) emerged as one of the most promising microalgae strains from the NAABB consortium project, with a remarkable doubling time under optimal conditions of 2.57 hr-1. However, its maximum achievable annual biomass productivity in outdoor ponds in the contiguous United States remained unknown. In order to address this knowledge gap, this alga was cultured in indoor LED-lighted and temperature-controlled raceways in nutrient replete freshwater (BG-11) medium at pH 7 under conditions simulating the daily sunlight intensity and water temperature fluctuations during three seasons in Southern Florida, an optimal outdoor pond culture location for this organism identified by biomass growth modeling. Prior strain characterization indicated that the average maximum specific growth rate (µmax) at 36 ºC declined continuously with pH, with µmax corresponding to 5.92, 5.83, 4.89, and 4.21 day-1 at pH 6, 7, 8, and 9, respectively. In addition, the maximum specific growth rate declined nearly linearly with increasing salinity until no growth was observed above 35 g/L NaCl. In the climate-simulated culturing studies, the volumetric ash-free dry weight-based biomass productivities during the linear growth phase were 57, 69, and 97 mg/L-day for 30-year average light and temperature simulations for January (winter), March (spring), and July (summer), respectively, which corresponds to average areal productivities of 11.6, 14.1, and 19.9 g/m2-day at a constant pond depth of 20.5 cm. The photosynthetic efficiencies (PAR) in the three climate-simulated pond culturing experiments ranged from 4.1 to 5.1%. The annual biomass productivity was estimated as ca. 15 g/m2-day, nearly double the U.S. Department of Energy (DOE) 2015 State of Technology annual cultivation productivity of 8.5 g/m2-day, but this is still significantly below the projected 2022 target of ca. 25 g/m2-day (U.S. DOE, 2016) for economic microalgal biofuel production, indicating the need for
The variability of maximum wind gusts in the Czech Republic between 1961 and 2014
Czech Academy of Sciences Publication Activity Database
Brázdil, Rudolf; Hostýnek, J.; Řezníčková, Ladislava; Zahradníček, Pavel; Tolasz, R.; Dobrovolný, Petr; Štěpánek, Petr
2017-01-01
Roč. 37, č. 4 (2017), s. 1961-1978 ISSN 0899-8418 Institutional support: RVO:67179843 Keywords : Czech Republic * Emma wind storm * Homogenisation * Kyrill wind storm * Maximum wind gust * Spatial variability * Temporal variability * Wind measurement Subject RIV: DG - Athmosphere Sciences, Meteorology OBOR OECD: Meteorology and atmospheric sciences Impact factor: 3.760, year: 2016
LCLS Maximum Credible Beam Power
International Nuclear Information System (INIS)
Clendenin, J.
2005-01-01
The maximum credible beam power is defined as the highest credible average beam power that the accelerator can deliver to the point in question, given the laws of physics, the beam line design, and assuming all protection devices have failed. For a new accelerator project, the official maximum credible beam power is determined by project staff in consultation with the Radiation Physics Department, after examining the arguments and evidence presented by the appropriate accelerator physicist(s) and beam line engineers. The definitive parameter becomes part of the project's safety envelope. This technical note will first review the studies that were done for the Gun Test Facility (GTF) at SSRL, where a photoinjector similar to the one proposed for the LCLS is being tested. In Section 3 the maximum charge out of the gun for a single rf pulse is calculated. In Section 4, PARMELA simulations are used to track the beam from the gun to the end of the photoinjector. Finally in Section 5 the beam through the matching section and injected into Linac-1 is discussed
Multimerization rules for G-quadruplexes
Czech Academy of Sciences Publication Activity Database
Kolesnikova, Sofia; Hubálek, Martin; Bednárová, Lucie; Cvačka, Josef; Curtis, Edward A.
2017-01-01
Roč. 45, č. 15 (2017), s. 8684-8696 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : tetramolecular G-quadruplexes * RNA G-quadruplexes * circular dichroism Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/45/15/8684/4002725/Multimerization-rules-for-Gquadruplexes
Efficiency of Photovoltaic Maximum Power Point Tracking Controller Based on a Fuzzy Logic
Directory of Open Access Journals (Sweden)
Ammar Al-Gizi
2017-07-01
Full Text Available This paper examines the efficiency of a fuzzy logic control (FLC based maximum power point tracking (MPPT of a photovoltaic (PV system under variable climate conditions and connected load requirements. The PV system including a PV module BP SX150S, buck-boost DC-DC converter, MPPT, and a resistive load is modeled and simulated using Matlab/Simulink package. In order to compare the performance of FLC-based MPPT controller with the conventional perturb and observe (P&O method at different irradiation (G, temperature (T and connected load (RL variations – rising time (tr, recovering time, total average power and MPPT efficiency topics are calculated. The simulation results show that the FLC-based MPPT method can quickly track the maximum power point (MPP of the PV module at the transient state and effectively eliminates the power oscillation around the MPP of the PV module at steady state, hence more average power can be extracted, in comparison with the conventional P&O method.
Directory of Open Access Journals (Sweden)
Yusleivy Milagros López Negrín
2010-06-01
Full Text Available INTRODUCCIÓN. En el Hospital Ginecoobstétrico Docente «Ramón González Coro» no se ha estudiado la prevalencia de la anemia muy precoz de la prematuridad y los factores asociados a su aparición. Se decidió realizar esta investigación para dar respuesta a esta interrogante y proporcionar bases a las autoridades administrativas para el trazado de estrategias preventivas más eficaces, que reduzcan esta complicación y sus consecuencias. MÉTODOS. Se realizó un estudio prospectivo, de corte transversal, donde se incluyeron todos los recién nacidos (RN ≤ de 1 500 g nacidos antes de las 37 semanas y atendidos en el servicio de neonatología del hospital durante el año 2008. El universo de estudio estuvo constituido por 25 neonatos. Se determinó en cada uno la presencia o no de anemia muy precoz. Se determinó la prevalencia de esta enfermedad y los factores maternos, perinatales y posnatales asociados. RESULTADOS. Presentó anemia muy precoz el 52 % de los neonatos (13/25. La hemoglobina materna baja no se asoció a la anemia muy precoz (RP 0,62; IC 95 % 0,21-1,80. Ninguna variable perinatal se asoció a la anemia muy precoz, aunque se encontró que la prevalencia de esta enfermedad disminuye al aumentar la edad gestacional al nacer (tendencia lineal: X² 4,33; gl 1; p 0,037. Los RN con alguna morbilidad grave tuvieron 2,44 veces más probabilidad de presentar anemia muy precoz (RP 2,44; IC 95 % 1,01-5,87. La prevalencia de la anemia muy precoz se incrementó al aumentar los mililitros por kilogramo de peso de sangre extraída (tendencia lineal: X² 7,6195; gl 1; p 0,0058. Los RN con extracciones entre 5 y 10 mL/kg y > 10 mL/kg tuvieron 5,3 y 4,5 veces más probabilidad de presentar anemia (RP 5,33; IC 95 % 1,4739-19,2988 y RP4,5 ; IC 95 % 1,1254-17,9930, respectivamente. CONCLUSIONES. Un poco más de la mitad de los casos presentaron anemia muy precoz y los factores independientes asociados a su aparición fueron la presencia de
Dependence of US hurricane economic loss on maximum wind speed and storm size
International Nuclear Information System (INIS)
Zhai, Alice R; Jiang, Jonathan H
2014-01-01
Many empirical hurricane economic loss models consider only wind speed and neglect storm size. These models may be inadequate in accurately predicting the losses of super-sized storms, such as Hurricane Sandy in 2012. In this study, we examined the dependences of normalized US hurricane loss on both wind speed and storm size for 73 tropical cyclones that made landfall in the US from 1988 through 2012. A multi-variate least squares regression is used to construct a hurricane loss model using both wind speed and size as predictors. Using maximum wind speed and size together captures more variance of losses than using wind speed or size alone. It is found that normalized hurricane loss (L) approximately follows a power law relation with maximum wind speed (V max ) and size (R), L = 10 c V max a R b , with c determining an overall scaling factor and the exponents a and b generally ranging between 4–12 and 2–4 respectively. Both a and b tend to increase with stronger wind speed. Hurricane Sandy’s size was about three times of the average size of all hurricanes analyzed. Based on the bi-variate regression model that explains the most variance for hurricanes, Hurricane Sandy’s loss would be approximately 20 times smaller if its size were of the average size with maximum wind speed unchanged. It is important to revise conventional empirical hurricane loss models that are only dependent on maximum wind speed to include both maximum wind speed and size as predictors. (letters)
13 CFR 107.840 - Maximum term of Financing.
2010-01-01
... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Maximum term of Financing. 107.840... COMPANIES Financing of Small Businesses by Licensees Structuring Licensee's Financing of An Eligible Small Business: Terms and Conditions of Financing § 107.840 Maximum term of Financing. The maximum term of any...
An event- and network-level analysis of college students' maximum drinking day.
Meisel, Matthew K; DiBello, Angelo M; Balestrieri, Sara G; Ott, Miles Q; DiGuiseppi, Graham T; Clark, Melissa A; Barnett, Nancy P
2018-04-01
Heavy episodic drinking is common among college students and remains a serious public health issue. Previous event-level research among college students has examined behaviors and individual-level characteristics that drive consumption and related consequences but often ignores the social network of people with whom these heavy drinking episodes occur. The main aim of the current study was to investigate the network of social connections between drinkers on their heaviest drinking occasions. Sociocentric network methods were used to collect information from individuals in the first-year class (N=1342) at one university. Past-month drinkers (N=972) reported on the characteristics of their heaviest drinking occasion in the past month and indicated who else among their network connections was present during this occasion. Average max drinking day indegree, or the total number of times a participant was nominated as being present on another students' heaviest drinking occasion, was 2.50 (SD=2.05). Network autocorrelation models indicated that max drinking day indegree (e.g., popularity on heaviest drinking occassions) and peers' number of drinks on their own maximum drinking occasions were significantly associated with participant maximum number of drinks, after controlling for demographic variables, pregaming, and global network indegree (e.g., popularity in the entire first-year class). Being present at other peers' heaviest drinking occasions is associated with greater drinking quantities on one's own heaviest drinking occasion. These findings suggest the potential for interventions that target peer influences within close social networks of drinkers. Copyright © 2017 Elsevier Ltd. All rights reserved.
Beauducel, Andre; Herzberg, Philipp Yorck
2006-01-01
This simulation study compared maximum likelihood (ML) estimation with weighted least squares means and variance adjusted (WLSMV) estimation. The study was based on confirmatory factor analyses with 1, 2, 4, and 8 factors, based on 250, 500, 750, and 1,000 cases, and on 5, 10, 20, and 40 variables with 2, 3, 4, 5, and 6 categories. There was no…
20 CFR 226.52 - Total annuity subject to maximum.
2010-04-01
... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Total annuity subject to maximum. 226.52... COMPUTING EMPLOYEE, SPOUSE, AND DIVORCED SPOUSE ANNUITIES Railroad Retirement Family Maximum § 226.52 Total annuity subject to maximum. The total annuity amount which is compared to the maximum monthly amount to...
Hip and trunk muscles activity during nordic hamstring exercise
Narouei, Shideh; Imai, Atsushi; Akuzawa, Hiroshi; Hasebe, Kiyotaka; Kaneoka, Koji
2018-01-01
The nordic hamstring exercise (NHE) is a dynamic lengthening hamstring exercise that requires trunk and hip muscles activation. Thigh muscles activation, specifically hamstring/quadriceps contractions has been previously examined during NHE. Trunk and hip muscles activity have not been enough studied. The aim of this study was to analyze of hip and trunk muscles activity during NHE. Surface electromyography (EMG) and kinematic data were collected during NHE. Ten healthy men with the age range of 21–36 years performed two sets of two repetitions with downward and upward motions each of NHE. EMG activity of fifteen trunk and hip muscles and knee kinematic data were collected. Muscle activity levels were calculated through repeated measure analysis of variance in downward and upward motions, through Paired t-test between downward and upward motions and gluteus maximus to erector spine activity ratio (Gmax/ES ratio) using Pearson correlation analyses were evaluated. Semitendinosus and biceps femoris muscles activity levels were the greatest in both motions and back extensors and internal oblique muscles activity were greater than other muscles (Phamstrings contractions. It could be important for early assessment of subjects with hamstring injury risk. PMID:29740557
Hip and trunk muscles activity during nordic hamstring exercise.
Narouei, Shideh; Imai, Atsushi; Akuzawa, Hiroshi; Hasebe, Kiyotaka; Kaneoka, Koji
2018-04-01
The nordic hamstring exercise (NHE) is a dynamic lengthening hamstring exercise that requires trunk and hip muscles activation. Thigh muscles activation, specifically hamstring/quadriceps contractions has been previously examined during NHE. Trunk and hip muscles activity have not been enough studied. The aim of this study was to analyze of hip and trunk muscles activity during NHE. Surface electromyography (EMG) and kinematic data were collected during NHE. Ten healthy men with the age range of 21-36 years performed two sets of two repetitions with downward and upward motions each of NHE. EMG activity of fifteen trunk and hip muscles and knee kinematic data were collected. Muscle activity levels were calculated through repeated measure analysis of variance in downward and upward motions, through Paired t -test between downward and upward motions and gluteus maximus to erector spine activity ratio (Gmax/ES ratio) using Pearson correlation analyses were evaluated. Semitendinosus and biceps femoris muscles activity levels were the greatest in both motions and back extensors and internal oblique muscles activity were greater than other muscles ( P hamstrings contractions. It could be important for early assessment of subjects with hamstring injury risk.
Dose-dependent platelet stimulation and inhibition induced by anti-PIA1 IgG
International Nuclear Information System (INIS)
Ryu, T.; Davis, J.M.; Schwartz, K.A.
1990-01-01
The PIA1 antibody produces several clinically distinct and severe thrombocytopenias. Investigations have demonstrated divergent effects on platelet function; prior reports demonstrated inhibition, while a conflicting publication showed platelet activation. We have resolved this conflict using anti-PIA1 IgG produced by a patient with posttransfusion purpura. Relatively low concentrations stimulated platelet aggregation and release of adenosine triphosphate (ATP) whereas high concentrations inhibited platelet function, producing a thrombasthenia-like state. The number of molecules of platelet-associated IgG necessary to initiate aggregation and ATP release (2,086 +/- 556) or produce maximum aggregation (23,420 +/- 3,706) or complete inhibition (63,582 +/- 2654) were measured with a quantitative radiometric assay for bound anti-PIA1. Preincubation of platelets with high concentrations of PIA1 antibody inhibited platelet aggregation with 10 mumol/L adenosine diphosphate and blocked 125I-labeled fibrinogen platelet binding. Platelet activation with nonfibrinogen dependent agonist, 1 U/ml thrombin, was not inhibited by this high concentration of PIA1 IgG. In conclusion, anti-PIAI IgG produces (1) stimulation of platelet aggregation and ATP release that is initiated with 2000 molecules IgG per platelet and is associated with an increase of 125I-fibrinogen binding; (2) conversely, inhibition of platelet aggregation is observed with maximum antibody binding, 63,000 molecules IgG per platelet, and is mediated via a blockade of fibrinogen binding
Weisenberger, Daniel J; Levine, A Joan; Long, Tiffany I; Buchanan, Daniel D; Walters, Rhiannon; Clendenning, Mark; Rosty, Christophe; Joshi, Amit D; Stern, Mariana C; LeMarchand, Loic; Lindor, Noralane M; Daftary, Darshana; Gallinger, Steven; Selander, Teresa; Bapat, Bharati; Newcomb, Polly A; Campbell, Peter T; Casey, Graham; Ahnen, Dennis J; Baron, John A; Haile, Robert W; Hopper, John L; Young, Joanne P; Laird, Peter W; Siegmund, Kimberly D
2015-03-01
The CpG island methylator phenotype (CIMP) represents a subset of colorectal cancers characterized by widespread aberrant DNA hypermethylation at select CpG islands. The risk factors and environmental exposures contributing to etiologic heterogeneity between CIMP and non-CIMP tumors are not known. We measured the CIMP status of 3,119 primary population-based colorectal cancer tumors from the multinational Colon Cancer Family Registry. Etiologic heterogeneity was assessed by a case-case study comparing risk factor frequency of colorectal cancer cases with CIMP and non-CIMP tumors using logistic regression to estimate the case-case odds ratio (ccOR). We found associations between tumor CIMP status and MSI-H (ccOR = 7.6), BRAF V600E mutation (ccOR = 59.8), proximal tumor site (ccOR = 9; all P CIMP status for both males and females (P = 0.0001 and P = 0.02, respectively), use of multivitamin or calcium supplements did not. Only for female colorectal cancer was CIMP status associated with increased pack-years of smoking (Ptrend CIMP status, and the associations of smoking and obesity with tumor subtype were evident only for females. Differences in the associations of a unique DNA methylation-based subgroup of colorectal cancer with important lifestyle and environmental exposures increase understanding of the molecular pathologic epidemiology of this heavily methylated subset of colorectal cancer. Cancer Epidemiol Biomarkers Prev; 24(3); 512-9. ©2015 AACR. ©2015 American Association for Cancer Research.
Maximum likely scale estimation
DEFF Research Database (Denmark)
Loog, Marco; Pedersen, Kim Steenstrup; Markussen, Bo
2005-01-01
A maximum likelihood local scale estimation principle is presented. An actual implementation of the estimation principle uses second order moments of multiple measurements at a fixed location in the image. These measurements consist of Gaussian derivatives possibly taken at several scales and/or ...
Xavier, Luciana; Cunha, Manuel; Gonçalves, Cristina; Teixeira, Maria dos Anjos; Coutinho, Jorge; Ribeiro, António Carlos Pinto; Lima, Margarida
2003-12-01
We describe a case of a patient with CD34+, TdT+, CD13-, CD33-, MPO- undifferentiated acute leukemia who refused chemotherapy and who achieved complete hematological remission 14 months after the diagnosis, during a short course of granulocyte-colony stimulating factor (G-CSF) for neutropenia and life threatening infection. Relapse occurred approximately one year later and G-CSF was reintroduced, being maintained for 4 months, at a dose and frequency adapted to maintain normal blood counts, a complete hematological remission being achieved again. Five months after withdrawing the G-CSF therapy a second relapse was observed; G-CSF was tried again with success, resulting in a very good hematological response that was sustained by G-CSF maintenance therapy. One year latter there was the need of increasing the doses of G-CSF in order to obtain the same hematological effect, at same time blast cells acquired a more mature CD34+, TdT-, CD13+, CD33-, MPO+ myeloid phenotype. Finally, the patient developed progressive neutropenia, anemia, thrombocytopenia and acute leukemia in spite of G-CSF therapy, dying 64 months after initial diagnosis (50 months after starting G-CSF therapy) with overt G-CSF resistant acute myeloblastic leukemia (AML), after failure of conventional induction chemotherapy.
Hampp, R.; Babbick, M.
Previous microarray studies with cell cultures of Arabidopsis thaliana cv Columbia have shown responses in gene expression which were partly specific to exposure to microgravity sounding rocket experiment TEXUS In order to get access to early responses upon changes in gravitational fields we used exposure times as short as 2 min For this purpose we selected a range of genes which code for different groups of transcription factors WRKY ERF MYB MADS Samples were taken in 5-min clinorotation 2- and 3-dimensional hypergravity 8g and 2-min intervals sounding rocket experiment Amounts of transcripts were determined by quantitative RT PCR Most transcripts showed a significant transient change in content within a time frame of up to 30 min after changing the external gravitational field strength They could be grouped into 1 basic stress responses which occurred under all conditions 2 clinorotation-related effects which were either identical or opposite between 2D 60 rpm 4x10 -2 g and 3D clinorotation random positioning machine and 3 alterations specific to the microgravity exposure under sounding rocket conditions MAXUS The data are discussed in relation to gravitation-dependent signalling chains and with regard to the simulation of microgravity by means of clinorotation Supported by a grant from the Deutsches Zentrum f u r Luft- und Raumfahrt e V grant no 50 WB 0143
Maximum likelihood estimation for Cox's regression model under nested case-control sampling
DEFF Research Database (Denmark)
Scheike, Thomas Harder; Juul, Anders
2004-01-01
-like growth factor I was associated with ischemic heart disease. The study was based on a population of 3784 Danes and 231 cases of ischemic heart disease where controls were matched on age and gender. We illustrate the use of the MLE for these data and show how the maximum likelihood framework can be used......Nested case-control sampling is designed to reduce the costs of large cohort studies. It is important to estimate the parameters of interest as efficiently as possible. We present a new maximum likelihood estimator (MLE) for nested case-control sampling in the context of Cox's proportional hazards...... model. The MLE is computed by the EM-algorithm, which is easy to implement in the proportional hazards setting. Standard errors are estimated by a numerical profile likelihood approach based on EM aided differentiation. The work was motivated by a nested case-control study that hypothesized that insulin...
Maximum gravitational redshift of white dwarfs
International Nuclear Information System (INIS)
Shapiro, S.L.; Teukolsky, S.A.
1976-01-01
The stability of uniformly rotating, cold white dwarfs is examined in the framework of the Parametrized Post-Newtonian (PPN) formalism of Will and Nordtvedt. The maximum central density and gravitational redshift of a white dwarf are determined as functions of five of the nine PPN parameters (γ, β, zeta 2 , zeta 3 , and zeta 4 ), the total angular momentum J, and the composition of the star. General relativity predicts that the maximum redshifts is 571 km s -1 for nonrotating carbon and helium dwarfs, but is lower for stars composed of heavier nuclei. Uniform rotation can increase the maximum redshift to 647 km s -1 for carbon stars (the neutronization limit) and to 893 km s -1 for helium stars (the uniform rotation limit). The redshift distribution of a larger sample of white dwarfs may help determine the composition of their cores
Liu, Qingxin
2014-06-16
During Drosophila eye development, differentiation initiates in the posterior region of the eye disk and progresses anteriorly as a wave marked by the morphogenetic furrow (MF), which demarcates the boundary between anterior undifferentiated cells and posterior differentiated photoreceptors. However, the mechanism underlying the regulation of gene expression immediately before the onset of differentiation remains unclear. Here, we show that Apontic (Apt), which is an evolutionarily conserved transcription factor, is expressed in the differentiating cells posterior to the MF. Moreover, it directly induces the expression of cyclin E and is also required for the G1-to-S phase transition, which is known to be essential for the initiation of cell differentiation at the MF. These observations identify a pathway crucial for eye development, governed by a mechanism in which Cyclin E promotes the G1-to-S phase transition when regulated by Apt.
Liu, Qingxin; Wang, Xianfeng; Ikeo, Kazuho; Hirose, Susumu; Gehring, Walter Jakob; Gojobori, Takashi
2014-01-01
During Drosophila eye development, differentiation initiates in the posterior region of the eye disk and progresses anteriorly as a wave marked by the morphogenetic furrow (MF), which demarcates the boundary between anterior undifferentiated cells and posterior differentiated photoreceptors. However, the mechanism underlying the regulation of gene expression immediately before the onset of differentiation remains unclear. Here, we show that Apontic (Apt), which is an evolutionarily conserved transcription factor, is expressed in the differentiating cells posterior to the MF. Moreover, it directly induces the expression of cyclin E and is also required for the G1-to-S phase transition, which is known to be essential for the initiation of cell differentiation at the MF. These observations identify a pathway crucial for eye development, governed by a mechanism in which Cyclin E promotes the G1-to-S phase transition when regulated by Apt.
Directory of Open Access Journals (Sweden)
Colom Roberto
2001-01-01
Full Text Available La psicologia experimental ha estudiado extensivamente las características de la memoria, mientras que la psicología correlacional ha actualizado las principales propiedades de la inteligencia. El acercamiento entre ambos enfoques se basa en el análisis de las relaciones entre un concepto nuclear de la memoria -- la memoria de trabajo -- y el principal ingrediente del concepto psicométrico de inteligencia -- el factor g. Las evidencias disponibles sugieren que las diferencias individuales en g podrían ser explicadas por los conceptos cognitivos de capacidad y de velocidad asociados a la memoria de trabajo. Esas evidencias sugieren nuevos modos de mejorar la inteligencia -- y, por tanto, los correlatos asociados a ella -- a través del incremento de la capacidad del sistema para procesar información de manera eficiente.
Agarwala, Prachi; Pandey, Satyaprakash; Mapa, Koyeli; Maiti, Souvik
2013-03-05
Transforming growth factor β2 (TGFβ2) is a versatile cytokine with a prominent role in cell migration, invasion, cellular development, and immunomodulation. TGFβ2 promotes the malignancy of tumors by inducing epithelial-mesenchymal transition, angiogenesis, and immunosuppression. As it is well-documented that nucleic acid secondary structure can regulate gene expression, we assessed whether any secondary motif regulates its expression at the post-transcriptional level. Bioinformatics analysis predicts an existence of a 23-nucleotide putative G-quadruplex sequence (PG4) in the 5' untranslated region (UTR) of TGFβ2 mRNA. The ability of this stretch of sequence to form a highly stable, intramolecular parallel quadruplex was demonstrated using ultraviolet and circular dichroism spectroscopy. Footprinting studies further validated its existence in the presence of a neighboring nucleotide sequence. Following structural characterization, we evaluated the biological relevance of this secondary motif using a dual luciferase assay. Although PG4 inhibits the expression of the reporter gene, its presence in the context of the entire 5' UTR sequence interestingly enhances gene expression. Mutation or removal of the G-quadruplex sequence from the 5' UTR of the gene diminished the level of expression of this gene at the translational level. Thus, here we highlight an activating role of the G-quadruplex in modulating gene expression of TGFβ2 at the translational level and its potential to be used as a target for the development of therapeutics against cancer.
[PAL-1 5G/4G polymorphism in patients with systemic lupus erythematosus].
Savov, A; Andonova, S; Tanev, D; Robeva, R; Marincheva, Ts; Tomova, A; Kumanov, Ph; Rashkov, R; Kolarov, Zl
2014-01-01
Systemic lupus erythematosus (SLE) is a connective tissue disease affecting predominantly women that has been widely associated with obstetric complications. Inherited thrombophilias are significant risk factors for pregnancy loss, but their role in patients with SLE, and especially in those without concomitant secondary antiphospholipid syndrome (APS) has not been clarified. The aim of the present study was to study PAI-1 5G/4G polymorphism in women with lupus. A total of 103 SLE patients as well as 69 healthy volunteers were genotyped for PAI-1 5G/4G (rs1799889). No significant differences in the PAI-1 5G/4G genotype prevalence between patients and controls were found. After exclusion of the women with secondary APS, the frequency of pregnancies and spontaneous abortions, as well as the number of live births were similar in the studied patients with different PAI-1 genotype (p> 0.05). PAI-1 5G/4G polymorphism was not significantly related to any of the lupus ACR criteria or disease activity (p > 0.05), but it could influence the platelet number in the studied patients (263.52 ± 91.10 [5G/5G genotype] versus 210.12 ± 71.79 [4G/4G genotype], p = 0.023). In conclusion, our results showed that PAI-1 4G/5G polymorphism did not worsen the reproductive outcome in SLE women without secondary APS.
Targeted search for continuous gravitational waves: Bayesian versus maximum-likelihood statistics
International Nuclear Information System (INIS)
Prix, Reinhard; Krishnan, Badri
2009-01-01
We investigate the Bayesian framework for detection of continuous gravitational waves (GWs) in the context of targeted searches, where the phase evolution of the GW signal is assumed to be known, while the four amplitude parameters are unknown. We show that the orthodox maximum-likelihood statistic (known as F-statistic) can be rediscovered as a Bayes factor with an unphysical prior in amplitude parameter space. We introduce an alternative detection statistic ('B-statistic') using the Bayes factor with a more natural amplitude prior, namely an isotropic probability distribution for the orientation of GW sources. Monte Carlo simulations of targeted searches show that the resulting Bayesian B-statistic is more powerful in the Neyman-Pearson sense (i.e., has a higher expected detection probability at equal false-alarm probability) than the frequentist F-statistic.
Revealing the Maximum Strength in Nanotwinned Copper
DEFF Research Database (Denmark)
Lu, L.; Chen, X.; Huang, Xiaoxu
2009-01-01
boundary–related processes. We investigated the maximum strength of nanotwinned copper samples with different twin thicknesses. We found that the strength increases with decreasing twin thickness, reaching a maximum at 15 nanometers, followed by a softening at smaller values that is accompanied by enhanced...
49 CFR 195.406 - Maximum operating pressure.
2010-10-01
... 49 Transportation 3 2010-10-01 2010-10-01 false Maximum operating pressure. 195.406 Section 195.406 Transportation Other Regulations Relating to Transportation (Continued) PIPELINE AND HAZARDOUS... HAZARDOUS LIQUIDS BY PIPELINE Operation and Maintenance § 195.406 Maximum operating pressure. (a) Except for...
Global view of F-region electron density and temperature at solar maximum
International Nuclear Information System (INIS)
Brace, L.H.; Theis, R.F.; Hoegy, W.R.
1982-01-01
Dynamics Explorer-2 is permitting the first measurements of the global structure of the F-regions at very high levels of solar activity (S>200). Selected full orbits of Langmuir probe measurements of electron temperature, T/sub e/, and density, N/sub e/, are shown to illustrate this global structure and some of the ionospheric features that are the topic of other papers in this issue. The ionospheric thermal structure is of particular interest because T/sub e/ is a sensitive indicator of the coupling of magnetospheric energy into the upper atmosphere. A comparison of these heating effects with those observed at solar minimum shows that the magnetospheric sources are more important at solar maximum, as might have been expected. Heating at the cusp, the auroral oval and the plasma-pause is generally both greater and more variable. Electron cooling rate calculations employing low latitude measurements indicate that solar extreme ultraviolet heating of the F region at solar maximum is enhanced by a factor that is greater than the increase in solar flux. Some of this enhanced electron heating arises from the increase in electron heating efficiency at the higher N/sub e/ of solar maximum, but this appears insufficient to completely resolve the discrepancy
Unexpected Position-Dependent Effects of Ribose G-Quartets in G-Quadruplexes
Czech Academy of Sciences Publication Activity Database
Zhou, J.; Amrane, S.; Rosu, F.; Salgado, G.; Bian, Y.; Tateishi-Karimata, H.; Largy, E.; Korkut, D. N.; Bourdoncle, A.; Miyoshi, D.; Zhang, J.; Ju, H.; Wang, W.; Sugimoto, N.; Gabelica, V.; Mergny, Jean-Louis
2017-01-01
Roč. 139, č. 23 (2017), s. 7768-7779 ISSN 0002-7863 Institutional support: RVO:68081707 Keywords : human telomeric rna * electrospray mass-spectrometry * molecular crowding conditions * dna g-quadruplexes Subject RIV: BO - Biophysics OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 13.858, year: 2016
Banday, Mujeeb Zafar; Balkhi, Henah Mehraj; Hamid, Zeenat; Sameer, Aga Syed; Chowdri, Nissar A; Haq, Ehtishamul
2016-09-01
Inflammation constitutes one of the important components of colorectal cancer (CRC) pathogenesis. Tumor necrosis factor-α (TNF-α), a cytokine and an important inflammatory mediator plays a pivotal role in the malignant cellular proliferation, angiogenesis, tissue invasion and metastasis in CRC. The studies on association of various polymorphisms in human TNF-α gene including TNF-α-308G/A single nucleotide polymorphism (SNP) are limited, mixed and inconclusive. The aim of this study was to analyze the association of TNF-α-308G/A promoter SNP with colorectal cancer (CRC) susceptibility and development risk and also to evaluate the modifying effects of possible TNF-α-308G/A genotypes on different risk factors of CRC in ethnic population of Kashmir, India through a case-control setup. The genotype frequencies of TNF-α-308G/A promoter SNP were compared between 142 CRC patients and 184 individually matched healthy controls by using polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) method. The associations between the TNF-α-308G/A SNP and CRC risk were examined through conditional logistic regression models adjusted for multiple possible confounding (third) variables. Further, the associations between this SNP and various clinico-pathological parameters, demographic variables and environmental factors within the case group subjects with regard to CRC risk were also evaluated. The association between the TNF-α-308G/A SNP and the modulation of risk of CRC was not found to be significant (p value = 0.156). The effect of less common TNF-α-308A allele on the risk of colorectal cancer was also not found to be significant (p value = 0.175). The variant genotype (AA) was nonexistent in the study population. Further, we found no significant effect modulation of CRC risk by wild and heterozygous TNF-α-308G/A SNP genotypes in presence of different possible risk factors (p > 0.05). We also found no significant association of TNF-α-308
Forage yield and nutritive value of Panicum maximum genotypes in the Brazilian savannah
Directory of Open Access Journals (Sweden)
Francisco Duarte Fernandes
2014-02-01
Full Text Available The narrow genetic variability of grasslands and the incidence of new biotic and abiotic stresses have motivated the selection of new Panicum maximum genotypes for use as forage for beef cattle in the Brazilian savannah. This study aimed to evaluate forage yield and nutritive value of P. maximum genotypes including 14 accessions (PM30 to PM43, four intraspecific hybrids (PM44 to PM47 and six cultivars (Aruana, Massai, Milênio, Mombaça, Tanzania and Vencedor, examining 24 genotypes over two years (2003 and 2004. Milênio cultivar was the genotype with the highest dry matter yield (DMY in both years (18.4 t ha-1 and 20.9 t ha-1, respectively although it presented a high proportion of stems (~ 30%. Genotypes that showed higher Leaf DMY in both years were the accession PM34 (14.7 t ha-1 and the hybrid PM46 (14.0 t ha-1, while Mombaça and Tanzania yielded 12.5 and 11.0 t ha-1, respectively. Leaf organic matter digestibility and leaf DMY for PM40 and PM46 genotypes exceeded the mean (> 656 g kg-1 and > 11.7 t ha-1, respectively. For this reason, PM40 and PM46 can be considered promising P. maximum genotypes for use as forage for grazing systems in the Brazilian savannah.
Wong, Fei-Liang; Ithnin, Azlin; Othman, Ainoon; Cheah, Fook-Choe
2017-07-01
Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a recognised cause of severe neonatal hyperbilirubinaemia, and identifying which infants are at risk could optimise care and resources. In this study, we determined if G6PD enzyme activity (EA) and certain gene variants were associated with neonatal hyperbilirubinaemia requiring phototherapy during the first week after birth. Newborn infants with G6PD deficiency and a group with normal results obtained by the fluorescent spot test were selected for analyses of G6PD EA and the 10 commonly encountered G6PD mutations in this region, relating these with whether the infants required phototherapy before discharge from the hospital in the first week. A total of 222 infants with mean gestation and birth weight of 38.3 ± 1.8 weeks and 3.02 ± 0.48 kg, respectively, were enrolled. Of these, n = 121 were deficient with EA ≤6.76 U/g Hb, and approximately half (43%) received phototherapy in the first week after birth. The mean EA level was 3.7 U/g Hb. The EA had good accuracy in predicting phototherapy use, with area under the receiver-operating-characteristic curve of 0.81 ± 0.05. Infants on phototherapy more commonly displayed World Health Organization Class II mutations (deficiency in EA and mutation at c.1388G>A (adjusted odds ratio, 1.5 and 5.7; 95% confidence interval: 1.31-1.76 and 1.30-25.0, respectively) were independent risk factors for phototherapy. Low G6PD EA (G6PD gene variant, c.1388G>A, are risk factors for the need of phototherapy in newborn infants during the first week after birth. © 2017 Paediatrics and Child Health Division (The Royal Australasian College of Physicians).
Pooyan, Honari; Ahmad, Ebrahimi; Azadeh, Rakhshan
2015-01-01
Glioblastoma is a highly aggressive and malignant brain tumor. Risk factors are largely unknown however, although several biomarkers have been identified which may support development, angiogenesis and invasion of tumor cells. One of these biomarkers is PAI-1. 4G/5G and A-844G are two common polymorphisms in the gene promotor of PAI 1 that may be related to high transcription and expression of this gene. Studies have shown that the prevalence of the 4G and 844G allele is significantly higher in patients with some cancers and genetic disorders. We here assessed the association of 4G/5G and A-844G polymorphisms with glioblastoma cancer risk in Iranians in a case-control study. All 71 patients with clinically confirmed and 140 volunteers with no history and symptoms of glioblastoma as control group were screened for 4G/5G and A-844G polymorphisms of PAI-1, using ARMS-PCR. Genotype and allele frequencies of case and control groups were analyzed using the DeFinetti program. Our results showed significant associations between 4G/5G (p=0.01824) and A-844G (p=0.02012) polymorphisms of the PAI-1 gene with glioblastoma cancer risk in our Iranian population. The results of this study supporting an association of the PAI-1 4G/5G (p=0.01824) and A-844G (p=0.02012) polymorphisms with increasing glioblastoma cancer risk in Iranian patients.
Catastrophic Disruption Threshold and Maximum Deflection from Kinetic Impact
Cheng, A. F.
2017-12-01
The use of a kinetic impactor to deflect an asteroid on a collision course with Earth was described in the NASA Near-Earth Object Survey and Deflection Analysis of Alternatives (2007) as the most mature approach for asteroid deflection and mitigation. The NASA DART mission will demonstrate asteroid deflection by kinetic impact at the Potentially Hazardous Asteroid 65803 Didymos in October, 2022. The kinetic impactor approach is considered to be applicable with warning times of 10 years or more and with hazardous asteroid diameters of 400 m or less. In principle, a larger kinetic impactor bringing greater kinetic energy could cause a larger deflection, but input of excessive kinetic energy will cause catastrophic disruption of the target, leaving possibly large fragments still on collision course with Earth. Thus the catastrophic disruption threshold limits the maximum deflection from a kinetic impactor. An often-cited rule of thumb states that the maximum deflection is 0.1 times the escape velocity before the target will be disrupted. It turns out this rule of thumb does not work well. A comparison to numerical simulation results shows that a similar rule applies in the gravity limit, for large targets more than 300 m, where the maximum deflection is roughly the escape velocity at momentum enhancement factor β=2. In the gravity limit, the rule of thumb corresponds to pure momentum coupling (μ=1/3), but simulations find a slightly different scaling μ=0.43. In the smaller target size range that kinetic impactors would apply to, the catastrophic disruption limit is strength-controlled. A DART-like impactor won't disrupt any target asteroid down to significantly smaller size than the 50 m below which a hazardous object would not penetrate the atmosphere in any case unless it is unusually strong.
Robust Maximum Association Estimators
A. Alfons (Andreas); C. Croux (Christophe); P. Filzmoser (Peter)
2017-01-01
textabstractThe maximum association between two multivariate variables X and Y is defined as the maximal value that a bivariate association measure between one-dimensional projections αX and αY can attain. Taking the Pearson correlation as projection index results in the first canonical correlation
Czech Academy of Sciences Publication Activity Database
Fiedler, Miroslav; Markham, T. L.
2013-01-01
Roč. 438, č. 1 (2013), s. 231-241 ISSN 0024-3795 Institutional research plan: CEZ:AV0Z10300504 Keywords : Cauchy matrix * G-matrix * Complex orthogonal matrix Subject RIV: BA - General Mathematics Impact factor: 0.983, year: 2013
Ma, Yue; Yin, Fei; Zhang, Tao; Zhou, Xiaohua Andrew; Li, Xiaosong
2016-01-01
Spatial scan statistics are widely used in various fields. The performance of these statistics is influenced by parameters, such as maximum spatial cluster size, and can be improved by parameter selection using performance measures. Current performance measures are based on the presence of clusters and are thus inapplicable to data sets without known clusters. In this work, we propose a novel overall performance measure called maximum clustering set-proportion (MCS-P), which is based on the likelihood of the union of detected clusters and the applied dataset. MCS-P was compared with existing performance measures in a simulation study to select the maximum spatial cluster size. Results of other performance measures, such as sensitivity and misclassification, suggest that the spatial scan statistic achieves accurate results in most scenarios with the maximum spatial cluster sizes selected using MCS-P. Given that previously known clusters are not required in the proposed strategy, selection of the optimal maximum cluster size with MCS-P can improve the performance of the scan statistic in applications without identified clusters.
Savio, Andrea J; Bapat, Bharati
2017-06-03
The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located.
Multicolored spanning subgraphs in G-colorings of complete graphs
International Nuclear Information System (INIS)
Akbari, S.; Zare, S.
2007-08-01
Let G = {g 1 , ..., g n } be a finite abelian group. Consider the complete graph with the vertex set {g 1 , ..., g n }}. The G-coloring of K n is a proper edge coloring in which the color of edge {g i , g j } is g i + g j , l ≤ i ≤ j ≤ n. We prove that in the G-coloring of the complete graph K n , there exists a multicolored Hamilton path if G is not an elementary abelian 2-group. Furthermore, we show that if n is odd, then the G-coloring of K n can be decomposed into multicolored 2-factors and if l r is the number of elements of order r in G, 3 ≤ r ≤ n. then there are exactly (l r )/2 multicolored r-uniform 2-factors in this decomposition. This provides a generalization of a recent result due to Constantine which states: For any prime number p > 2, there exists a proper edge coloring of K p which is decomposable into multicolored Hamilton cycles. (author)
Maximum-Likelihood Detection Of Noncoherent CPM
Divsalar, Dariush; Simon, Marvin K.
1993-01-01
Simplified detectors proposed for use in maximum-likelihood-sequence detection of symbols in alphabet of size M transmitted by uncoded, full-response continuous phase modulation over radio channel with additive white Gaussian noise. Structures of receivers derived from particular interpretation of maximum-likelihood metrics. Receivers include front ends, structures of which depends only on M, analogous to those in receivers of coherent CPM. Parts of receivers following front ends have structures, complexity of which would depend on N.
Directory of Open Access Journals (Sweden)
F. Topsøe
2001-09-01
Full Text Available Abstract: In its modern formulation, the Maximum Entropy Principle was promoted by E.T. Jaynes, starting in the mid-fifties. The principle dictates that one should look for a distribution, consistent with available information, which maximizes the entropy. However, this principle focuses only on distributions and it appears advantageous to bring information theoretical thinking more prominently into play by also focusing on the "observer" and on coding. This view was brought forward by the second named author in the late seventies and is the view we will follow-up on here. It leads to the consideration of a certain game, the Code Length Game and, via standard game theoretical thinking, to a principle of Game Theoretical Equilibrium. This principle is more basic than the Maximum Entropy Principle in the sense that the search for one type of optimal strategies in the Code Length Game translates directly into the search for distributions with maximum entropy. In the present paper we offer a self-contained and comprehensive treatment of fundamentals of both principles mentioned, based on a study of the Code Length Game. Though new concepts and results are presented, the reading should be instructional and accessible to a rather wide audience, at least if certain mathematical details are left aside at a rst reading. The most frequently studied instance of entropy maximization pertains to the Mean Energy Model which involves a moment constraint related to a given function, here taken to represent "energy". This type of application is very well known from the literature with hundreds of applications pertaining to several different elds and will also here serve as important illustration of the theory. But our approach reaches further, especially regarding the study of continuity properties of the entropy function, and this leads to new results which allow a discussion of models with so-called entropy loss. These results have tempted us to speculate over
22 CFR 201.67 - Maximum freight charges.
2010-04-01
..., commodity rate classification, quantity, vessel flag category (U.S.-or foreign-flag), choice of ports, and... the United States. (2) Maximum charter rates. (i) USAID will not finance ocean freight under any... owner(s). (4) Maximum liner rates. USAID will not finance ocean freight for a cargo liner shipment at a...
Community Based Networks and 5G
DEFF Research Database (Denmark)
Williams, Idongesit
2016-01-01
The deployment of previous wireless standards has provided more benefits for urban dwellers than rural dwellers. 5G deployment may not be different. This paper identifies that Community Based Networks as carriers that deserve recognition as potential 5G providers may change this. The argument....... The findings indicate that 5G connectivity can be extended to rural areas by these networks, via heterogenous networks. Hence the delivery of 5G data rates delivery via Wireless WAN in rural areas can be achieved by utilizing the causal factors of the identified models for Community Based Networks....
Directory of Open Access Journals (Sweden)
Hangarter Roger P
2007-07-01
Full Text Available Abstract Background Proper development of plastids in embryo and seedling tissues is critical for plant development. During germination, plastids develop to perform many critical functions that are necessary to establish the seedling for further growth. A growing body of work has demonstrated that components of the plastid transcription and translation machinery must be present and functional to establish the organelle upon germination. Results We have identified Arabidopsis thaliana mutants in a gene that encodes a plastid-targeted elongation factor G (SCO1 that is essential for plastid development during embryogenesis since two T-DNA insertion mutations in the coding sequence (sco1-2 and sco1-3 result in an embryo-lethal phenotype. In addition, a point mutation allele (sco1-1 and an allele with a T-DNA insertion in the promoter (sco1-4 of SCO1 display conditional seedling-lethal phenotypes. Seedlings of these alleles exhibit cotyledon and hypocotyl albinism due to improper chloroplast development, and normally die shortly after germination. However, when germinated on media supplemented with sucrose, the mutant plants can produce photosynthetically-active green leaves from the apical meristem. Conclusion The developmental stage-specific phenotype of the conditional-lethal sco1 alleles reveals differences in chloroplast formation during seedling germination compared to chloroplast differentiation in cells derived from the shoot apical meristem. Our identification of embryo-lethal mutant alleles in the Arabidopsis elongation factor G indicates that SCO1 is essential for plant growth, consistent with its predicted role in chloroplast protein translation.
The Role of TPA I/D and PAI-1 4G/5G Polymorphisms in Multiple Sclerosis
Živković, Maja; Starčević Čizmarević, Nada; Lovrečić, Luca; Klupka-Sarić, Inge; Stanković, Aleksandra; Gašparović, Iva; Dinčić, Evica; Stojković, Ljiljana; Rudolf, Gorazd; Šega Jazbec, Saša; Perković, Olivio; Sinanović, Osman; Sepčić, Juraj; Kapović, Miljenko; Peterlin, Borut
2014-01-01
Background. Previous studies have shown impaired fibrinolysis in multiple sclerosis (MS) and implicated extracellular proteolytic enzymes as important factors in demyelinating neuroinflammatory disorders. Tissue-type plasminogen activator (t-PA) and its inhibitor (PAI-1) are key molecules in both fibrinolysis and extracellular proteolysis. In the present study, an association of the TPA Alu I/D and PAI-1 4G/5G polymorphisms with MS was analyzed within the Genomic Network for Multiple Sclerosis (GENoMS). Methods. The GENoMS includes four populations (Croatian, Slovenian, Serbian, and Bosnian and Herzegovinian) sharing the same geographic location and a similar ethnic background. A total of 885 patients and 656 ethnically matched healthy blood donors with no history of MS in their families were genotyped using PCR-RFLP. Results. TPA DD homozygosity was protective (OR = 0.79, 95% CI 0.63–0.99, P = 0.037) and PAI 5G5G was a risk factor for MS (OR = 1.30, 95% CI 1.01–1.66, P = 0.038). A significant effect of the genotype/carrier combination was detected in 5G5G/I carriers (OR = 1.39 95% CI 1.06–1.82, P = 0.017). Conclusions. We found a significantly harmful effect of the combination of the PAI-1 5G/5G genotype and TPA I allele on MS susceptibility, which indicates the importance of gene-gene interactions in complex diseases such as MS. PMID:24825926
Güngör, Yahya; Kayataş, Mansur; Yıldız, Gürsel; Özdemir, Öztürk; Candan, Ferhan
2011-01-01
In this study, we investigated the relationship between early arteriovenous fistula (AVF) thrombosis with angiotensin-converting enzyme (ACE) gene and thrombophilic factor gene polymorphisms. Thirty-five patients who suffered from three or more fistula thrombosis episodes in the early period after AVF operation and 33 control patients with no history of thrombosis for at least 3 years were enrolled in this study. Factor V G1691A Leiden, factor V H1299R (R2), prothrombin G20210A, factor XIIIV34L, β-fibrinogen-455 G-A, glycoprotein IIIa L33P human platelet antigens (HPA-1), methylenetetrahydrofolate reductase C677T, and methylenetetrahydrofolate reductase A1298C gene polymorphisms were similar in both groups (p > 0.05). Plasminogen activator inhibitor 1 (PAI-1) 4G/5G genotype in the study group and 4G/4G genotype in the control group were significantly higher (p = 0.014). No significant difference was detected in terms of the 5G/5G genotype. With regard to the ACE gene polymorphism, the control group showed more ID genotype (19/33, 57.6%), whereas the study group showed more DD genotype (17/35, 48.6%). II genotype was similar in both groups (x(2) = 7.40, p = 0.025). The rate of ACE inhibitor-angiotensin II receptor blockers use was 5/35 in the study group (14.3%) and 5/33 in the control group (15.2%). Individuals with PAI-1 4G/5G genotype showed 5.03 times more risk of thrombosis when compared with 4G/4G and 5G/5G genotypes [p = 0.008, OR = 5.03, 95% confidence interval (1.44:17.64)]. Individuals with ACE DD genotype showed 4.25 times more risk of thrombosis when compared with II and ID [p = 0.008, OR = 4.25, 95% confidence interval (1.404:12.83)]. PAI-1 4G/5G and ACE DD genotypes are associated with increased risk for early AVF thrombosis.
Expression of CAR in SW480 and HepG2 cells during G1 is associated with cell proliferation
International Nuclear Information System (INIS)
Osabe, Makoto; Sugatani, Junko; Takemura, Akiko; Yamazaki, Yasuhiro; Ikari, Akira; Kitamura, Naomi; Negishi, Masahiko; Miwa, Masao
2008-01-01
Constitutive androstane receptor (CAR) is a transcription factor to regulate the expression of several genes related to drug-metabolism. Here, we demonstrate that CAR protein accumulates during G1 in human SW480 and HepG2 cells. After the G1/S phase transition, CAR protein levels decreased, and CAR was hardly detected in cells by the late M phase. CAR expression in both cell lines was suppressed by RNA interference-mediated suppression of CDK4. Depletion of CAR by RNA interference in both cells and by hepatocyte growth factor treatment in HepG2 cells resulted in decreased MDM2 expression that led to p21 upregulation and repression of HepG2 cell growth. Thus, our results demonstrate that CAR expression is an early G1 event regulated by CDK4 that contributes to MDM2 expression; these findings suggest that CAR may influence the expression of genes involved in not only the metabolism of endogenous and exogenous substances but also in the cell proliferation
Lim, Young-Min; Pyun, So Young; Kang, Bong-Hui; Kim, Jimin; Kim, Kwang-Kuk
2013-08-01
To identify factors associated with plasma exchange response in neuromyelitis optica (NMO) spectrum disorders, the clinical and magnetic resonance imaging (MRI) features of 31 NMO-IgG-positive patients receiving plasma exchange for steroid-resistant exacerbations were analyzed. Functional improvement was observed in 65% of the patients. A lower baseline Expanded Disability Status Scale score was associated with favorable response (p = 0.040). Patients without cord atrophy had a higher success rate than patients with atrophy (p = 0.016). Levels of NMO-IgG did not differ between responders and non-responders before and after plasma exchange. In conclusion, a minimal pre-existing disability is the primary determinant of the effectiveness of plasma exchange.
Regulation and Selectivity of Exchange Factors for G-proteins of the Ras-family
Popovic, M.
2013-01-01
Small G-proteins are important regulators of the cellular signaling pathways. Among them, members of the Ras family of small G-proteins regulate processes such as cell differentiation, growth, migration, transport and adhesion, and their deregulation may lead to various diseases. Small G-proteins
40 CFR 141.13 - Maximum contaminant levels for turbidity.
2010-07-01
... turbidity. 141.13 Section 141.13 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER... Maximum contaminant levels for turbidity. The maximum contaminant levels for turbidity are applicable to... part. The maximum contaminant levels for turbidity in drinking water, measured at a representative...
International Nuclear Information System (INIS)
Furget, C.
2005-01-01
The G0 experiment aims to measure parity-violating asymmetries in elastic electron-proton and quasi-elastic electron-deuteron scattering. This experimental program allows to perform the separation of the electric and magnetic weak neutral and axial form factors for three different momentum transfers 0.3, 0.5 and 0.8 (GeV/c)2. The first part of the experiment has been performed in Hall C of Jefferson Laboratory with a commissioned setup. A preliminary analysis of the data has provided a first estimate of the main systematic uncertainties. The analysis to determine the actual physics asymmetries is proceeding
Modelling maximum canopy conductance and transpiration in ...
African Journals Online (AJOL)
There is much current interest in predicting the maximum amount of water that can be transpired by Eucalyptus trees. It is possible that industrial waste water may be applied as irrigation water to eucalypts and it is important to predict the maximum transpiration rates of these plantations in an attempt to dispose of this ...
Maximum power gains of radio-frequency-driven two-energy-component tokamak reactors
International Nuclear Information System (INIS)
Jassby, D.L.
1974-11-01
Two-energy-component fusion reactors in which the suprathermal component (D) is produced by harmonic cyclotron ''runaway'' of resonant ions are considered. In one ideal case, the fast hydromagnetic wave at ω = 2ω/sub cD/ produces an energy distribution f(W) approximately constant (up to W/sub max/) that includes all deuterons, which then thermalize and react with the cold tritons. In another ideal case, f(W) approximately constant is maintained by the fast wave at ω = ω/sub cD/. If one neglects (1) direct rf input to the bulk-plasma electrons and tritons, and (2) the fact that many deuterons are not resonantly accelerated, then the maximum ideal power gain is about 0.85 Q/sub m/ in the first case and 1.05 Q/sub m/ in the second case, where Q/sub m/ is the maximum fusion gain in the beam-injection scheme (e.g., Q/sub m/ = 1.9 at T/sub e/ = 10 keV). Because of nonideal effects, the cyclotron runaway phenomenon may find its most practical use in the heating of 50:50 D--T plasmas to ignition. (auth)
40 CFR 141.62 - Maximum contaminant levels for inorganic contaminants.
2010-07-01
... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Maximum contaminant levels for inorganic contaminants. 141.62 Section 141.62 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Water Regulations: Maximum Contaminant Levels and Maximum Residual Disinfectant Levels § 141.62 Maximum...
Video Quality Prediction over Wireless 4G
Lau, Chun Pong
2013-04-14
In this paper, we study the problem of video quality prediction over the wireless 4G network. Video transmission data is collected from a real 4G SCM testbed for investigating factors that affect video quality. After feature transformation and selection on video and network parameters, video quality is predicted by solving as regression problem. Experimental results show that the dominated factor on video quality is the channel attenuation and video quality can be well estimated by our models with small errors.
Video Quality Prediction over Wireless 4G
Lau, Chun Pong; Zhang, Xiangliang; Shihada, Basem
2013-01-01
In this paper, we study the problem of video quality prediction over the wireless 4G network. Video transmission data is collected from a real 4G SCM testbed for investigating factors that affect video quality. After feature transformation and selection on video and network parameters, video quality is predicted by solving as regression problem. Experimental results show that the dominated factor on video quality is the channel attenuation and video quality can be well estimated by our models with small errors.
Weak scale from the maximum entropy principle
Hamada, Yuta; Kawai, Hikaru; Kawana, Kiyoharu
2015-03-01
The theory of the multiverse and wormholes suggests that the parameters of the Standard Model (SM) are fixed in such a way that the radiation of the S3 universe at the final stage S_rad becomes maximum, which we call the maximum entropy principle. Although it is difficult to confirm this principle generally, for a few parameters of the SM, we can check whether S_rad actually becomes maximum at the observed values. In this paper, we regard S_rad at the final stage as a function of the weak scale (the Higgs expectation value) vh, and show that it becomes maximum around vh = {{O}} (300 GeV) when the dimensionless couplings in the SM, i.e., the Higgs self-coupling, the gauge couplings, and the Yukawa couplings are fixed. Roughly speaking, we find that the weak scale is given by vh ˜ T_{BBN}2 / (M_{pl}ye5), where ye is the Yukawa coupling of electron, T_BBN is the temperature at which the Big Bang nucleosynthesis starts, and M_pl is the Planck mass.
Research on network maximum flows algorithm of cascade level graph%级连层次图的网络最大流算法研究
Institute of Scientific and Technical Information of China (English)
潘荷新; 伊崇信; 李满
2011-01-01
给出一种通过构造网络级连层次图的方法,来间接求出最大网络流的算法.对于给定的有n个顶点,P条边的网络N=(G,s,t,C),该算法可在O(n2)时间内快速求出流经网络N的最大网络流及达最大流时的网络流.%This paper gives an algoritm that structures a network cascade level graph to find out maximum flow of the network indirectly.For the given network N=(G,s,t,C) that has n vetexes and e arcs,this algorithm finds out the maximum value of the network flow fast in O(n2) time that flows from the network N and the network flows when the value of the one reach maximum.
Islam, Sidra; Moinuddin; Mir, Abdul Rouf; Raghav, Alok; Habib, Safia; Alam, Khursheed; Ali, Asif
2017-09-12
Glycation and oxidation induce structural alterations in the proteins in an interdependent manner with consequent pathological implications. The published literature presents wide range of modifications in conformational characteristics of proteins by glycation and oxidation; however, there is little data that could elaborate the cumulative effect of both the processes. This study has analysed the modifications in IgG by methylglyoxal (MG) (glycative stress), hydroxyl radical ([Formula: see text]) (oxidative stress) and by their combined action i.e. [Formula: see text] treatment of MG glycated IgG (glycoxidation). It further addresses the implications of the altered structural integrity of IgG on its immunological characteristics and impact on haematological parameters in rabbits. Using circular dichroism, FTIR, SDS-PAGE analysis, thioflavin-T fluorescence assay, congo red absorbance analysis, dynamic light scattering, transmission electron microscopy, ELISA, blood cell counts and rectal temperature studies, we report that the glycoxidative modification caused maximum alteration in the IgG as compared to the glycatively and oxidatively modified protein. Far-UV CD results confirmed the highest decline in the beta-pleated sheet content of the protein by glycoxidation. The damage led to the reduced flexibility and enhanced electronic interactions in IgG as observed by near-UV CD. Modifications caused cross-linking and adduct formation in the serum protein. The electron micrograph confirmed amorphous aggregation in modified IgG. The modifications increased the hydrodynamic radius of IgG by allowing the attachment of [Formula: see text] and MG residues. The glycoxidatively modified IgG induced the maximum antibody titres that showed high specificity towards the altered IgG. The glycoxidation of IgG leads to activation of inflammatory pathways.
Directory of Open Access Journals (Sweden)
M. Shirdel
2016-09-01
potential data showed a sigmoid trend and a three-parameter logistic model was fitted to data (Equation 1. Y=Gmax/ [1+(X/X50b] where, G is the total germination (% at concentration x, Gmax is the maximum germination (%, x50 is the osmotic potential required for 50% inhibition of the maximum germination and Grate indicates the slope of the curve in x50. Statistical Analysis System (SAS was used for analyzing the data. Results and Discussion: Results showed temperature, water potential and interaction between them significantly affected germination percentage and germination rate, the time required to reach 5% (D05, 10% (D10, 50% (D50, 90%(D90 and 95% (D95 seed germination of Asian spiderflower. The results showed that by increasing the temperature to 30 °c, seed percentage and germination rate increased and then decreased. Water potential reductions declined seed germination percentage and germination rate. Comparing different models to determine seed germination cardinal temperatures, indicated that the segmented model described germination rate changes to temperature better that the others. Based on the output of this model, germination base, optimum and ceiling temperatures of the plant were 15.46, 33.21 and 39.64 0C, respectively. The result revealed that increasing the PEG concentration, increased the base temperature and decreased optimum and ceiling temperatures. The Logistic model fitted with germination percentage of seeds in different water potentials to different temperatures. Parameters of the model showed the maximum seed germination percentage occurred in the 25 to 35 0C. Highest and lowest X50 parameter (potential required for 50% inhibition of the maximum germination observed at 30 and 38 0C, respectively. The results showed that the germination ability of Asian spiderflower occurred at less potentials water in the optimum temperature range. Conclusion: The results showed that high temperatures were required for seed germination of Asian spider flower
Accurate modeling and maximum power point detection of ...
African Journals Online (AJOL)
Accurate modeling and maximum power point detection of photovoltaic ... Determination of MPP enables the PV system to deliver maximum available power. ..... adaptive artificial neural network: Proposition for a new sizing procedure.
40 CFR 141.61 - Maximum contaminant levels for organic contaminants.
2010-07-01
... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Maximum contaminant levels for organic contaminants. 141.61 Section 141.61 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER... Regulations: Maximum Contaminant Levels and Maximum Residual Disinfectant Levels § 141.61 Maximum contaminant...
The power and robustness of maximum LOD score statistics.
Yoo, Y J; Mendell, N R
2008-07-01
The maximum LOD score statistic is extremely powerful for gene mapping when calculated using the correct genetic parameter value. When the mode of genetic transmission is unknown, the maximum of the LOD scores obtained using several genetic parameter values is reported. This latter statistic requires higher critical value than the maximum LOD score statistic calculated from a single genetic parameter value. In this paper, we compare the power of maximum LOD scores based on three fixed sets of genetic parameter values with the power of the LOD score obtained after maximizing over the entire range of genetic parameter values. We simulate family data under nine generating models. For generating models with non-zero phenocopy rates, LOD scores maximized over the entire range of genetic parameters yielded greater power than maximum LOD scores for fixed sets of parameter values with zero phenocopy rates. No maximum LOD score was consistently more powerful than the others for generating models with a zero phenocopy rate. The power loss of the LOD score maximized over the entire range of genetic parameters, relative to the maximum LOD score calculated using the correct genetic parameter value, appeared to be robust to the generating models.
Critical Assessment of the Surface Tension determined by the Maximum Pressure Bubble Method
Benedetto, Franco Emmanuel; Zolotucho, Hector; Prado, Miguel Oscar
2015-01-01
The main factors that influence the value of surface tension of a liquid measured with the Maximum Pressure Bubble Method are critically evaluated. We present experimental results showing the effect of capillary diameter, capillary depth, bubble spheroidicity and liquid density at room temperature. We show that the decrease of bubble spheroidicity due to increase of capillary immersion depth is not sufficient to explain the deviations found in the measured surface tension values. Thus, we pro...
Oracle Data Guard 11gR2 administration beginner's guide
Baransel, Emre
2013-01-01
Using real-world examples and hands-on tasks, Oracle Data Guard 11gR2 Administration Beginner's Guide will give you a solid foundation in Oracle Data Guard. It has been designed to teach you everything you need to know to successfully create and operate Data Guard environments with maximum flexibility, compatibility, and effectiveness.If you are an Oracle database administrator who wants to configure and administer Data Guard configurations, then ""Oracle Data Guard 11gR2 Administration Beginner's Guide"" is for you. With a basic understanding of Oracle database administration, you'll be able
Evaluating Maximum Wind Energy Exploitation in Active Distribution Networks
DEFF Research Database (Denmark)
Siano, Pierluigi; Chen, Peiyuan; Chen, Zhe
2010-01-01
The increased spreading of distributed and renewable generation requires moving towards active management of distribution networks. In this paper, in order to evaluate maximum wind energy exploitation in active distribution networks, a method based on a multi-period optimal power flow (OPF......) analysis is proposed. Active network management schemes such as coordinated voltage control, energy curtailment and power factor control are integrated in the method in order to investigate their impacts on the maximization of wind energy exploitation. Some case studies, using real data from a Danish...... distribution system, confirmed the effectiveness of the proposed method in evaluating the optimal applications of active management schemes to increase wind energy harvesting without costly network reinforcement for the connection of wind generation....
Maximum Power Training and Plyometrics for Cross-Country Running.
Ebben, William P.
2001-01-01
Provides a rationale for maximum power training and plyometrics as conditioning strategies for cross-country runners, examining: an evaluation of training methods (strength training and maximum power training and plyometrics); biomechanic and velocity specificity (role in preventing injury); and practical application of maximum power training and…
Bakherad, Hamid; Gargari, Seyed Latif Mousavi; Sepehrizadeh, Zargham; Aghamollaei, Hossein; Taheri, Ramezan Ali; Torshabi, Maryam; Yazdi, Mojtaba Tabatabaei; Ebrahimizadeh, Walead; Setayesh, Neda
2017-09-01
It has been shown that Granulocyte colony-stimulating factor (G-CSF) has a higher expression in malignant tumors, and anti-G-CSF therapy considerably decreases tumor growth, tumor vascularization and metastasis. Thus, blocking the signaling pathway of G-CSF could be beneficial in cancer therapy. This study is aimed at designing and producing a monoclonal nanobody that could act as an antagonist of G-CSF receptor. Nanobodies are the antigen binding fragments of camelid single-chain antibodies, also known as VHH. These fragments have exceptional properties which makes them ideal for tumor imaging and therapeutic applications. We have used our previously built nanobody phage libraries to isolate specific nanobodies to the G-CSF receptor. After a series of cross-reactivity and affinity experiments, two unique nanobodies were selected for functional analysis. Proliferation assay, real-time PCR and immunofluorescence assays were used to characterize these nanobodies. Finally, VHH26 nanobody that was able to specifically bind G-CSF receptor (G-CSF-R) on the surface of NFS60 cells and efficiently block G-CSF-R downstream signaling pathway in a dose-dependent manner was selected. This nanobody could be further developed into a valuable tool in tumor therapy and it forms a basis for additional studies in preclinical animal models. Copyright © 2017. Published by Elsevier Masson SAS.
Clark, P.U.; Dyke, A.S.; Shakun, J.D.; Carlson, A.E.; Clark, J.; Wohlfarth, B.; Mitrovica, J.X.; Hostetler, S.W.; McCabe, A.M.
2009-01-01
We used 5704 14C, 10Be, and 3He ages that span the interval from 10,000 to 50,000 years ago (10 to 50 ka) to constrain the timing of the Last Glacial Maximum (LGM) in terms of global ice-sheet and mountain-glacier extent. Growth of the ice sheets to their maximum positions occurred between 33.0 and 26.5 ka in response to climate forcing from decreases in northern summer insolation, tropical Pacific sea surface temperatures, and atmospheric CO2. Nearly all ice sheets were at their LGM positions from 26.5 ka to 19 to 20 ka, corresponding to minima in these forcings. The onset of Northern Hemisphere deglaciation 19 to 20 ka was induced by an increase in northern summer insolation, providing the source for an abrupt rise in sea level. The onset of deglaciation of the West Antarctic Ice Sheet occurred between 14 and 15 ka, consistent with evidence that this was the primary source for an abrupt rise in sea level ???14.5 ka.
Maximum physical capacity testing in cancer patients undergoing chemotherapy
DEFF Research Database (Denmark)
Knutsen, L.; Quist, M; Midtgaard, J
2006-01-01
BACKGROUND: Over the past few years there has been a growing interest in the field of physical exercise in rehabilitation of cancer patients, leading to requirements for objective maximum physical capacity measurement (maximum oxygen uptake (VO(2max)) and one-repetition maximum (1RM)) to determin...... early in the treatment process. However, the patients were self-referred and thus highly motivated and as such are not necessarily representative of the whole population of cancer patients treated with chemotherapy....... in performing maximum physical capacity tests as these motivated them through self-perceived competitiveness and set a standard that served to encourage peak performance. CONCLUSION: The positive attitudes in this sample towards maximum physical capacity open the possibility of introducing physical testing...
Non-nutritional factors affecting lactation persistency in dairy ewes: a review
Directory of Open Access Journals (Sweden)
Antonello Cannas
2010-01-01
Full Text Available Milk production is largely related to the shape of the lactation curve. Key elements of the lactation pattern are peak yield, which is the maximum daily yield reached during lactation, and lactation persistency, which is the medium rate of milk yield decrease after the lactation peak. The ideal lactation curve should have a reasonably high peak and a flat trend afterwards. A more persistent lactation is desirable because it is related to better animal health and reduction of feeding costs. Effective strategies to improve lactation persistency require a deep understanding of the main factors that affect this trait, including genetics, hormonal status and administration, udder morphology, seasonal changes, management, animal health (e.g. mastitis, stress and nutrition. This review covers the effects of non-nutritional factors on lactation persistency in dairy sheep.
MAXIMUM PRINCIPLE FOR SUBSONIC FLOW WITH VARIABLE ENTROPY
Directory of Open Access Journals (Sweden)
B. Sizykh Grigory
2017-01-01
Full Text Available Maximum principle for subsonic flow is fair for stationary irrotational subsonic gas flows. According to this prin- ciple, if the value of the velocity is not constant everywhere, then its maximum is achieved on the boundary and only on the boundary of the considered domain. This property is used when designing form of an aircraft with a maximum critical val- ue of the Mach number: it is believed that if the local Mach number is less than unit in the incoming flow and on the body surface, then the Mach number is less then unit in all points of flow. The known proof of maximum principle for subsonic flow is based on the assumption that in the whole considered area of the flow the pressure is a function of density. For the ideal and perfect gas (the role of diffusion is negligible, and the Mendeleev-Clapeyron law is fulfilled, the pressure is a function of density if entropy is constant in the entire considered area of the flow. Shows an example of a stationary sub- sonic irrotational flow, in which the entropy has different values on different stream lines, and the pressure is not a function of density. The application of the maximum principle for subsonic flow with respect to such a flow would be unreasonable. This example shows the relevance of the question about the place of the points of maximum value of the velocity, if the entropy is not a constant. To clarify the regularities of the location of these points, was performed the analysis of the com- plete Euler equations (without any simplifying assumptions in 3-D case. The new proof of the maximum principle for sub- sonic flow was proposed. This proof does not rely on the assumption that the pressure is a function of density. Thus, it is shown that the maximum principle for subsonic flow is true for stationary subsonic irrotational flows of ideal perfect gas with variable entropy.
Maximum power point tracker based on fuzzy logic
International Nuclear Information System (INIS)
Daoud, A.; Midoun, A.
2006-01-01
The solar energy is used as power source in photovoltaic power systems and the need for an intelligent power management system is important to obtain the maximum power from the limited solar panels. With the changing of the sun illumination due to variation of angle of incidence of sun radiation and of the temperature of the panels, Maximum Power Point Tracker (MPPT) enables optimization of solar power generation. The MPPT is a sub-system designed to extract the maximum power from a power source. In the case of solar panels power source. the maximum power point varies as a result of changes in its electrical characteristics which in turn are functions of radiation dose, temperature, ageing and other effects. The MPPT maximum the power output from panels for a given set of conditions by detecting the best working point of the power characteristic and then controls the current through the panels or the voltage across them. Many MPPT methods have been reported in literature. These techniques of MPPT can be classified into three main categories that include: lookup table methods, hill climbing methods and computational methods. The techniques vary according to the degree of sophistication, processing time and memory requirements. The perturbation and observation algorithm (hill climbing technique) is commonly used due to its ease of implementation, and relative tracking efficiency. However, it has been shown that when the insolation changes rapidly, the perturbation and observation method is slow to track the maximum power point. In recent years, the fuzzy controllers are used for maximum power point tracking. This method only requires the linguistic control rules for maximum power point, the mathematical model is not required and therefore the implementation of this control method is easy to real control system. In this paper, we we present a simple robust MPPT using fuzzy set theory where the hardware consists of the microchip's microcontroller unit control card and
Atik, L.; Petit, P.; Sawicki, J. P.; Ternifi, Z. T.; Bachir, G.; Della, M.; Aillerie, M.
2017-02-01
Solar panels have a nonlinear voltage-current characteristic, with a distinct maximum power point (MPP), which depends on the environmental factors, such as temperature and irradiation. In order to continuously harvest maximum power from the solar panels, they have to operate at their MPP despite the inevitable changes in the environment. Various methods for maximum power point tracking (MPPT) were developed and finally implemented in solar power electronic controllers to increase the efficiency in the electricity production originate from renewables. In this paper we compare using Matlab tools Simulink, two different MPP tracking methods, which are, fuzzy logic control (FL) and sliding mode control (SMC), considering their efficiency in solar energy production.
Fine, Jo-David; Manes, Becky; Frangoul, Haydar
2015-07-01
Chronic nonhealing wounds are the norm in patients with inherited epidermolysis bullosa (EB), especially those with dystrophic EB (DEB). A possible benefit in wound healing after subcutaneous treatment with granulocyte colony-stimulating factor (G-CSF) was suggested from an anecdotal report of a patient given this during stem cell mobilization before bone-marrow transplantation. We sought to determine whether benefit in wound healing in DEB skin might result after 6 daily doses of G-CSF and to confirm its safety. Patients were assessed for changes in total body blister and erosion counts, surface areas of selected wounds, and specific symptomatology after treatment. Seven patients with DEB (recessive, 6; dominant, 1) were treated daily with subcutaneous G-CSF (10 μg/kg/dose) and reevaluated on day 7. For all patients combined, median reductions of 75.5% in lesional size and 36.6% in blister/erosion counts were observed. When only the 6 responders were considered, there were median reductions of 77.4% and 38.8% of each of these measured parameters, respectively. No adverse side effects were noted. Limitations include small patient number, more than 1 DEB subtype included, and lack of untreated age-matched control subjects. Subcutaneous G-CSF may be beneficial in promoting wound healing in some patients with DEB when conventional therapies fail. Copyright © 2015 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Ponman, T.J.
1984-01-01
For some years now two different expressions have been in use for maximum entropy image restoration and there has been some controversy over which one is appropriate for a given problem. Here two further entropies are presented and it is argued that there is no single correct algorithm. The properties of the four different methods are compared using simple 1D simulations with a view to showing how they can be used together to gain as much information as possible about the original object. (orig.)
THE INDIVIDUAL DIFFERENCE OF ABILITY BINDING BRAIN TUMOR CELLS WITH IMMUNOGLOBULIN G
Directory of Open Access Journals (Sweden)
O. V. Ostreiko
2008-01-01
Full Text Available Abstract. Were researched IgG on the surface cells of different histological types tumors of cerebrum, using fluorescing staphylococcus A-protein. The study of target IgG shows divers intensive of microscopic fluorescent illumination. This results associate related with level amount IgG. The maximum concentrate of surface’s IgG was on the cells of malignant tumors and there was direct correlate with aggressive manner and quickly recurrence of tumor’s growth, and shot survival. The fraction of IgG with specific antitumor’s antibody covers tumor’s antigens has been block this antigens for receptors of T-lymphocytes. Linked with immunological anticell’s deficit phenomenon may be one from famous reasons of malignant clinical type tumor disease. (Med. Immunol., vol. 10, N 6, pp 593-596.
Oyabu, Chikako; Ushigome, Emi; Matsumoto, Shinobu; Tanaka, Toru; Hasegawa, Goji; Nakamura, Naoto; Ohnishi, Masayoshi; Tsunoda, Sei; Ushigome, Hidetaka; Yokota, Isao; Tanaka, Muhei; Asano, Mai; Yamazaki, Masahiro; Fukui, Michiaki
2017-11-01
Maximum home systolic blood pressure has been shown to predict target organ damage. We aimed to clarify the association between maximum home systolic blood pressure and urine albumin to creatinine ratio, an indicator of early-phase diabetic nephropathy in patients with type 2 diabetes. In 1040 patients, we assessed the relationship of mean or maximum home systolic blood pressure and urine albumin to creatinine ratio, and compared the area under the receiver operating characteristic curve of mean or maximum home systolic blood pressure for diabetic nephropathy (urine albumin to creatinine ratio ⩾30 mg/g Cr). Multivariate linear regression analyses indicated that mean morning systolic blood pressure ( β = 0.010, p blood pressure ( β = 0.008, p blood pressure was 0.667 (0.634-0.700; p blood pressure, as well as mean home systolic blood pressure, was significantly associated with diabetic nephropathy in patients with type 2 diabetes.
Maximum entropy deconvolution of low count nuclear medicine images
International Nuclear Information System (INIS)
McGrath, D.M.
1998-12-01
Maximum entropy is applied to the problem of deconvolving nuclear medicine images, with special consideration for very low count data. The physics of the formation of scintigraphic images is described, illustrating the phenomena which degrade planar estimates of the tracer distribution. Various techniques which are used to restore these images are reviewed, outlining the relative merits of each. The development and theoretical justification of maximum entropy as an image processing technique is discussed. Maximum entropy is then applied to the problem of planar deconvolution, highlighting the question of the choice of error parameters for low count data. A novel iterative version of the algorithm is suggested which allows the errors to be estimated from the predicted Poisson mean values. This method is shown to produce the exact results predicted by combining Poisson statistics and a Bayesian interpretation of the maximum entropy approach. A facility for total count preservation has also been incorporated, leading to improved quantification. In order to evaluate this iterative maximum entropy technique, two comparable methods, Wiener filtering and a novel Bayesian maximum likelihood expectation maximisation technique, were implemented. The comparison of results obtained indicated that this maximum entropy approach may produce equivalent or better measures of image quality than the compared methods, depending upon the accuracy of the system model used. The novel Bayesian maximum likelihood expectation maximisation technique was shown to be preferable over many existing maximum a posteriori methods due to its simplicity of implementation. A single parameter is required to define the Bayesian prior, which suppresses noise in the solution and may reduce the processing time substantially. Finally, maximum entropy deconvolution was applied as a pre-processing step in single photon emission computed tomography reconstruction of low count data. Higher contrast results were
Maximum Principles for Discrete and Semidiscrete Reaction-Diffusion Equation
Directory of Open Access Journals (Sweden)
Petr Stehlík
2015-01-01
Full Text Available We study reaction-diffusion equations with a general reaction function f on one-dimensional lattices with continuous or discrete time ux′ (or Δtux=k(ux-1-2ux+ux+1+f(ux, x∈Z. We prove weak and strong maximum and minimum principles for corresponding initial-boundary value problems. Whereas the maximum principles in the semidiscrete case (continuous time exhibit similar features to those of fully continuous reaction-diffusion model, in the discrete case the weak maximum principle holds for a smaller class of functions and the strong maximum principle is valid in a weaker sense. We describe in detail how the validity of maximum principles depends on the nonlinearity and the time step. We illustrate our results on the Nagumo equation with the bistable nonlinearity.
van Pampus, M. G.; Wolf, H.; Koopman, M. M.; van den Ende, A.; Buller, H. R.; Reitsma, P. H.
2001-01-01
The 20210 G-A prothrombin gene variant and the Factor V Leiden mutation are mutations associated with venous thrombotic risk. The aim of our study was to assess the prevalence of these specific mutations in women with a history of preeclampsia or hemolysis elevated liver enzymes, and low platelet
Energy Technology Data Exchange (ETDEWEB)
Guevara, Z. E., E-mail: zjguevaram@unal.edu.co; Torres, D. A., E-mail: datorresg@unal.edu.co [Physics Department, Universidad Nacional de Colombia, Bogotá D.C. (Colombia)
2016-07-07
In this contribution the challenges in the use of a setup to simultaneously measure lifetimes and g-factor values will be presented. The simultaneous use of the transient field technique and the Doppler Shift Attenuation Method, to measure magnetic moments and lifetimes respectively, allows to obtain a complete characterization of the currents of nucleons and the deformation in excited states close to the ground state. The technique is at the moment limited to Coulomb excitation and alpha-transfer reactions, what opens an interesting perspective to consider this type of experiments with radioactive beams. The use of deep-inelastic and fusion-evaporation reactions will be discussed. An example of a setup that makes use of a beam of {sup 106}Cd to study excited states of {sup 110}Sn and the beam nuclei itself will be presented.
Minimal length, Friedmann equations and maximum density
Energy Technology Data Exchange (ETDEWEB)
Awad, Adel [Center for Theoretical Physics, British University of Egypt,Sherouk City 11837, P.O. Box 43 (Egypt); Department of Physics, Faculty of Science, Ain Shams University,Cairo, 11566 (Egypt); Ali, Ahmed Farag [Centre for Fundamental Physics, Zewail City of Science and Technology,Sheikh Zayed, 12588, Giza (Egypt); Department of Physics, Faculty of Science, Benha University,Benha, 13518 (Egypt)
2014-06-16
Inspired by Jacobson’s thermodynamic approach, Cai et al. have shown the emergence of Friedmann equations from the first law of thermodynamics. We extend Akbar-Cai derivation http://dx.doi.org/10.1103/PhysRevD.75.084003 of Friedmann equations to accommodate a general entropy-area law. Studying the resulted Friedmann equations using a specific entropy-area law, which is motivated by the generalized uncertainty principle (GUP), reveals the existence of a maximum energy density closed to Planck density. Allowing for a general continuous pressure p(ρ,a) leads to bounded curvature invariants and a general nonsingular evolution. In this case, the maximum energy density is reached in a finite time and there is no cosmological evolution beyond this point which leaves the big bang singularity inaccessible from a spacetime prospective. The existence of maximum energy density and a general nonsingular evolution is independent of the equation of state and the spacial curvature k. As an example we study the evolution of the equation of state p=ωρ through its phase-space diagram to show the existence of a maximum energy which is reachable in a finite time.
Maximum-Entropy Inference with a Programmable Annealer
Chancellor, Nicholas; Szoke, Szilard; Vinci, Walter; Aeppli, Gabriel; Warburton, Paul A.
2016-03-01
Optimisation problems typically involve finding the ground state (i.e. the minimum energy configuration) of a cost function with respect to many variables. If the variables are corrupted by noise then this maximises the likelihood that the solution is correct. The maximum entropy solution on the other hand takes the form of a Boltzmann distribution over the ground and excited states of the cost function to correct for noise. Here we use a programmable annealer for the information decoding problem which we simulate as a random Ising model in a field. We show experimentally that finite temperature maximum entropy decoding can give slightly better bit-error-rates than the maximum likelihood approach, confirming that useful information can be extracted from the excited states of the annealer. Furthermore we introduce a bit-by-bit analytical method which is agnostic to the specific application and use it to show that the annealer samples from a highly Boltzmann-like distribution. Machines of this kind are therefore candidates for use in a variety of machine learning applications which exploit maximum entropy inference, including language processing and image recognition.
Nielsen, Carsten H; Erlandsson, Maria; Jeppesen, Troels E; Jensen, Mette M; Kristensen, Lotte K; Madsen, Jacob; Petersen, Lars C; Kjaer, Andreas
2016-01-01
Tissue factor (TF) is upregulated in many solid tumors, and its expression is linked to tumor angiogenesis, invasion, metastasis, and prognosis. A noninvasive assessment of tumor TF expression status is therefore of obvious clinical relevance. Factor VII is the natural ligand to TF. Here we report the development of a new PET tracer for specific imaging of TF using an (18)F-labeled derivative of factor VII. Active site-inhibited factor VIIa (FVIIai) was obtained by inactivation with phenylalanine-phenylalanine-arginine-chloromethyl ketone. FVIIai was radiolabeled with N-succinimidyl 4-(18)F-fluorobenzoate and purified. The corresponding product, (18)F-FVIIai, was injected into nude mice with subcutaneous human pancreatic xenograft tumors (BxPC-3) and investigated using small-animal PET/CT imaging 1, 2, and 4 h after injection. Ex vivo biodistribution was performed after the last imaging session, and tumor tissue was preserved for molecular analysis. A blocking experiment was performed in a second set of mice. The expression pattern of TF in the tumors was visualized by immunohistochemistry and the amount of TF in tumor homogenates was measured by enzyme-linked immunosorbent assay and correlated with the uptake of (18)F-FVIIai in the tumors measured in vivo by PET imaging. The PET images showed high uptake of (18)F-FVIIai in the tumor regions, with a mean uptake of 2.5 ± 0.3 percentage injected dose per gram (%ID/g) (mean ± SEM) 4 h after injection of 7.3-9.3 MBq of (18)F-FVIIai and with an average maximum uptake in the tumors of 7.1 ± 0.7 %ID/g at 4 h. In comparison, the muscle uptake was 0.2 ± 0.01 %ID/g at 4 h. At 4 h, the tumors had the highest uptake of any organ. Blocking with FVIIai significantly reduced the uptake of (18)F-FVIIai from 2.9 ± 0.1 to 1.4 ± 0.1 %ID/g (P < 0.001). The uptake of (18)F-FVIIai measured in vivo by PET imaging correlated (r = 0.72, P < 0.02) with TF protein level measured ex vivo. (18)F-FVIIai is a promising PET tracer for
Saha, Ranajit; Pan, Sudip; Chattaraj, Pratim K
2016-11-05
The validity of the maximum hardness principle (MHP) is tested in the cases of 50 chemical reactions, most of which are organic in nature and exhibit anomeric effect. To explore the effect of the level of theory on the validity of MHP in an exothermic reaction, B3LYP/6-311++G(2df,3pd) and LC-BLYP/6-311++G(2df,3pd) (def2-QZVP for iodine and mercury) levels are employed. Different approximations like the geometric mean of hardness and combined hardness are considered in case there are multiple reactants and/or products. It is observed that, based on the geometric mean of hardness, while 82% of the studied reactions obey the MHP at the B3LYP level, 84% of the reactions follow this rule at the LC-BLYP level. Most of the reactions possess the hardest species on the product side. A 50% null hypothesis is rejected at a 1% level of significance.
Probabilistic maximum-value wind prediction for offshore environments
DEFF Research Database (Denmark)
Staid, Andrea; Pinson, Pierre; Guikema, Seth D.
2015-01-01
statistical models to predict the full distribution of the maximum-value wind speeds in a 3 h interval. We take a detailed look at the performance of linear models, generalized additive models and multivariate adaptive regression splines models using meteorological covariates such as gust speed, wind speed......, convective available potential energy, Charnock, mean sea-level pressure and temperature, as given by the European Center for Medium-Range Weather Forecasts forecasts. The models are trained to predict the mean value of maximum wind speed, and the residuals from training the models are used to develop...... the full probabilistic distribution of maximum wind speed. Knowledge of the maximum wind speed for an offshore location within a given period can inform decision-making regarding turbine operations, planned maintenance operations and power grid scheduling in order to improve safety and reliability...