WorldWideScience

Sample records for markers internal transcribed

  1. (ISSR) and internal transcribed spacer

    African Journals Online (AJOL)

    Cladistic relationships within the genus Cinnamomum (Lauraceae) in Taiwan based on analysis of leaf morphology and inter-simple sequence repeat (ISSR) and internal transcribed spacer (ITS) molecular markers.

  2. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi.

    Science.gov (United States)

    Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen

    2012-04-17

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.

  3. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

    Science.gov (United States)

    Six DNA regions were evaluated in a multi-national, multi-laboratory consortium as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it...

  4. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

    NARCIS (Netherlands)

    Schoch, C.L.; Seifert, K.A.; Huhndorf, S.; Robert, V.; Spouge, J.L.; Levesque, C.A.; Chen, W.; Crous, P.W.; Boekhout, T.; Damm, U.; Hoog, de G.S.; Eberhardt, U.; Groenewald, J.Z.; Groenewald, M.; Hagen, F.; Houbraken, J.; Quaedvlieg, W.; Stielow, B.; Vu, T.D.; Walther, G.

    2012-01-01

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it

  5. Nuclear internal transcribed spacer-1 as a sensitive genetic marker for environmental DNA studies in common carp Cyprinus carpio.

    Science.gov (United States)

    Minamoto, Toshifumi; Uchii, Kimiko; Takahara, Teruhiko; Kitayoshi, Takumi; Tsuji, Satsuki; Yamanaka, Hiroki; Doi, Hideyuki

    2017-03-01

    The recently developed environmental DNA (eDNA) analysis has been used to estimate the distribution of aquatic vertebrates by using mitochondrial DNA (mtDNA) as a genetic marker. However, mtDNA markers have certain drawbacks such as variable copy number and maternal inheritance. In this study, we investigated the potential of using nuclear DNA (ncDNA) as a more reliable genetic marker for eDNA analysis by using common carp (Cyprinus carpio). We measured the copy numbers of cytochrome b (CytB) gene region of mtDNA and internal transcribed spacer 1 (ITS1) region of ribosomal DNA of ncDNA in various carp tissues and then compared the detectability of these markers in eDNA samples. In the DNA extracted from the brain and gill tissues and intestinal contents, CytB was detected at 95.1 ± 10.7 (mean ± 1 standard error), 29.7 ± 1.59 and 24.0 ± 4.33 copies per cell, respectively, and ITS1 was detected at 1760 ± 343, 2880 ± 503 and 1910 ± 352 copies per cell, respectively. In the eDNA samples from mesocosm, pond and lake water, the copy numbers of ITS1 were about 160, 300 and 150 times higher than those of CytB, respectively. The minimum volume of pond water required for quantification was 33 and 100 mL for ITS1 and CytB, respectively. These results suggested that ITS1 is a more sensitive genetic marker for eDNA studies of C. carpio. © 2016 John Wiley & Sons Ltd.

  6. 16S partial gene mitochondrial DNA and internal transcribed spacers ribosomal DNA as differential markers of Trichuris discolor populations.

    Science.gov (United States)

    Callejón, R; Halajian, A; de Rojas, M; Marrugal, A; Guevara, D; Cutillas, C

    2012-05-25

    Comparative morphological, biometrical and molecular studies of Trichuris discolor isolated from Bos taurus from Spain and Iran was carried out. Furthermore, Trichuris ovis isolated from B. taurus and Capra hircus from Spain has been, molecularly, analyzed. Morphological studies revealed clear differences between T. ovis and T. discolor isolated from B. taurus but differences were not observed between populations of T. discolor isolated from different geographical regions. Nevertheless, the molecular studies based on the amplification and sequencing of the internal transcribed spacers 1 and 2 ribosomal DNA and 16S partial gene mitochondrial DNA showed clear differences between both populations of T. discolor from Spain and Iran suggesting two cryptic species. Phylogenetic studies corroborated these data. Thus, phylogenetic trees based on ITS1, ITS2 and 16S partial gene sequences showed that individuals of T. discolor from B. taurus from Iran clustered together and separated, with high bootstrap values, of T. discolor isolated from B. taurus from Spain, while populations of T. ovis from B. taurus and C. hircus from Spain clustered together but separated with high bootstrap values of both populations of T. discolor. Furthermore, a comparative phylogenetic study has been carried out with the ITS1and ITS2 sequences of Trichuris species from different hosts. Three clades were observed: the first clustered all the species of Trichuris parasitizing herbivores (T. discolor, T. ovis, Trichuris leporis and Trichuris skrjabini), the second clustered all the species of Trichuris parasitizing omnivores (Trichuris trichiura and Trichuris suis) and finally, the third clustered species of Trichuris parasitizing carnivores (Trichuris muris, Trichuris arvicolae and Trichuris vulpis). Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Ribosomal DNA internal transcribed spacer 1 and internal ...

    African Journals Online (AJOL)

    USER

    2010-07-26

    Jul 26, 2010 ... in some East Asian countries such as China, Korea and. *Corresponding author. E-mail: soonkwan@kangwon.ac.kr. Tel: +82 33 250 6476. Fax: +82 33 250 6470. Abbreviations: nrDNA, Nuclear ribosomal DNA; ITS, internal transcribed spacer; PCR, polymerase chain reaction; BLAST, basic local alignment ...

  8. PCR-Internal Transcribed Spacer (ITS) genes sequencing and ...

    African Journals Online (AJOL)

    Methods: DNA extraction, purification, amplification and sequencing of Internal Transcribed Spacer (ITS) genes were per- formed using ... Keywords: Internal transcribed spacer genes, phylogenetic, genetic relationship, clinical and environmental fungi, HIV-TB. ... Nigeria. An Ethical clearance was obtained from the Eth-.

  9. Employing 454 amplicon pyrosequencing to reveal intragenomic divergence in the internal transcribed spacer rDNA region in fungi

    Science.gov (United States)

    Daniel L. Lindner; Tor Carlsen; Henrik Nilsson; Marie Davey; Trond Schumacher; Havard. Kauserud

    2013-01-01

    The rDNA internal transcribed spacer (ITS) region has been accepted as a DNA barcoding marker for fungi and is widely used in phylogenetic studies; however, intragenomic ITS variability has been observed in a broad range of taxa, including prokaryotes, plants, animals, and fungi, and this variability has the potential to inflate species richness estimates in molecular...

  10. The internal transcribed spacer rDNA specific markers for ...

    African Journals Online (AJOL)

    GREGORY

    2010-09-13

    Sep 13, 2010 ... amplified efficiently when paired with universal primer ITS4 in Z. piperitum, but not in Z. schinifolium. ..... generation of protein database search programs. ... Dillon SL, Lawrence PK, Henry RJ, Ross L, Price HJ, Johnston JS.

  11. Internal Transcribed Spacer 1 (ITS1 based sequence typing reveals phylogenetically distinct Ascaris population

    Directory of Open Access Journals (Sweden)

    Koushik Das

    2015-01-01

    Full Text Available Taxonomic differentiation among morphologically identical Ascaris species is a debatable scientific issue in the context of Ascariasis epidemiology. To explain the disease epidemiology and also the taxonomic position of different Ascaris species, genome information of infecting strains from endemic areas throughout the world is certainly crucial. Ascaris population from human has been genetically characterized based on the widely used genetic marker, internal transcribed spacer1 (ITS1. Along with previously reported and prevalent genotype G1, 8 new sequence variants of ITS1 have been identified. Genotype G1 was significantly present among female patients aged between 10 to 15 years. Intragenic linkage disequilibrium (LD analysis at target locus within our study population has identified an incomplete LD value with potential recombination events. A separate cluster of Indian isolates with high bootstrap value indicate their distinct phylogenetic position in comparison to the global Ascaris population. Genetic shuffling through recombination could be a possible reason for high population diversity and frequent emergence of new sequence variants, identified in present and other previous studies. This study explores the genetic organization of Indian Ascaris population for the first time which certainly includes some fundamental information on the molecular epidemiology of Ascariasis.

  12. INTERNAL TRANSCRIBED SPACER (ITS), AN IDEAL DNA BARCODE FOR SPECIES DISCRIMINATION IN CRAWFURDIA WALL. (GENTIANACEAE).

    Science.gov (United States)

    Zhang, Dequan; Jiang, Bei; Duan, Lizhen; Zhou, Nong

    2016-01-01

    DNA barcoding is a technique used to identify species based on species-specific differences in short regions of their DNA. It is widely used in species discrimination of medicinal plants and traditional medicines. In the present study, four potential DNA barcodes, namely rbcL , matK , trnH-psbA and ITS (nuclear ribosomal internal transcribed spacer) were adopted for species discrimination in Crawfurdia Wall (Genetiaceae). Identification ability of these DNA barcodes and combinations were evaluated using three classic methods (Distance, Blast and Tree-Building). As a result, ITS, trnH-psbA and rbcL regions showed great universality for a success rate of 100%; whereas matK was disappointing for which only 65% samples gained useful DNA sequences. ITS region, which could clearly and effectively identify the five species in Crawfurdia , performed very well in this study. On the contrary, trnH-psbA and rbcL performed poorly in discrimination among these species. ITS marker was an ideal DNA barcode in Crawfurdia and it should be incorporated into one of the core barcodes for seed plants.

  13. Phylogenetic relationships of the genus Phanerochaete inferred from the internal transcribed spacer region

    Science.gov (United States)

    Theodorus H. de Koker; Karen K. Nakasone; Jacques Haarhof; Harold H. Burdsall; Bernard J.H. Janse

    2003-01-01

    Phanerochaete is a genus of resupinate homobasidiomycetes that are saprophytic on woody debris and logs. Morphological studies in the past indicated that Phanerochaete is a heterogeneous assemblage of species. In this study the internal transcribed spacer (ITS) region of the nuclear ribosomal DNA was used to test the monophyly of the genus Phanerochaete and to infer...

  14. Metagenomic data of fungal internal transcribed spacer from serofluid dish, a traditional Chinese fermented food

    Directory of Open Access Journals (Sweden)

    Peng Chen

    2016-03-01

    Full Text Available Serofluid dish (or Jiangshui, in Chinese, a traditional food in the Chinese culture for thousands of years, is made from vegetables by fermentation. In this work, microorganism community of the fermented serofluid dish was investigated by the culture-independent method. The metagenomic data in this article contains the sequences of fungal internal transcribed spacer (ITS regions of rRNA genes from 12 different serofluid dish samples. The metagenome comprised of 50,865 average raw reads with an average of 8,958,220 bp and G + C content is 45.62%. This is the first report on metagenomic data of fungal ITS from serofluid dish employing Illumina platform to profile the fungal communities of this little known fermented food from Gansu Province, China. The Metagenomic data of fungal internal transcribed spacer can be accessed at NCBI, SRA database accession no. SRP067411. Keywords: Serofluid dish, Jiangshui, Fungal ITS, Cultivation-independent, Microbial diversity

  15. TriMEDB: A database to integrate transcribed markers and facilitate genetic studies of the tribe Triticeae

    Directory of Open Access Journals (Sweden)

    Yoshida Takuhiro

    2008-06-01

    assembled to form 2737 unique marker groups as contigs. These contigs were applied for pairwise comparison among linkage maps obtained from different EST map resources. Conclusion TriMEDB provides information regarding transcribed genetic markers and functions as a semantic knowledgebase offering an informatics facility for the acceleration of QTL analysis and for population genetics studies of Triticeae.

  16. Differences in the second internal transcribed spacer of four species of Nematodirus (Nematoda: Molineidae).

    Science.gov (United States)

    Newton, L A; Chilton, N B; Beveridge, I; Gasser, R B

    1998-02-01

    Genetic differences among Nematodirus spathiger, Nematodirus filicollis, Nematodirus helvetianus and Nematodirus battus in the nucleotide sequence of the second internal transcribed spacer (ITS-2) of ribosomal DNA ranged from 3.9 to 24.7%. Pairwise comparisons of their ITS-2 sequences indicated that the most genetically similar species were N. spathiger and N. helvetianus. N. battus was the most genetically distinct species, with differences ranging from 22.8 to 24.7% with respect to the other three species. Some of the nucleotide differences among species provided different endonuclease restriction sites that could be used in restriction fragment length polymorphism studies. The ITS-2 sequence data may prove useful in studies of the systematics of molineid nematodes.

  17. Assessment of phylogenetic relationship of rare plant species collected from Saudi Arabia using internal transcribed spacer sequences of nuclear ribosomal DNA.

    Science.gov (United States)

    Al-Qurainy, F; Khan, S; Nadeem, M; Tarroum, M; Alaklabi, A

    2013-03-11

    The rare and endangered plants of any country are important genetic resources that often require urgent conservation measures. Assessment of phylogenetic relationships and evaluation of genetic diversity is very important prior to implementation of conservation strategies for saving rare and endangered plant species. We used internal transcribed spacer sequences of nuclear ribosomal DNA for the evaluation of sequence identity from the available taxa in the GenBank database by using the Basic Local Alignment Search Tool (BLAST). Two rare plant species viz, Heliotropium strigosum claded with H. pilosum (98% branch support) and Pancratium tortuosum claded with P. tenuifolium (61% branch support) clearly. However, some species, viz Scadoxus multiflorus, Commiphora myrrha and Senecio hadiensis showed close relationships with more than one species. We conclude that nuclear ribosomal internal transcribed spacer sequences are useful markers for phylogenetic study of these rare plant species in Saudi Arabia.

  18. Kekerabatan Genetik Caplak Rhiphicephalus (Boophilus microplus Asal IndonesiaBerdasarkan Sekuen Internal Transcribed Spacer-2 (GENETIC RELATIONSHIP INDONESIAN RHIPHICEPHALUS (BOOPHILUS MICROPLUS TICK BASED ON INTERNAL TRANSCRIBED SPACER-2 SEQUENSE

    Directory of Open Access Journals (Sweden)

    Ana Sahara

    2015-10-01

    Full Text Available Rhiphicephalus (Boophilus microplus is important obligatory blood feeding ectoparasites transmittingmany different viral, bacterial and protozoan and plays a role as a vector of Babesia sp., The leria sp. andAnaplasma sp. in cattle. The accuracy in identifying and distinguishing interspecies and intraspeciesdiversity among parasites is needed to understand the epidemiology, biology and capacity as a vector.Variations in the DNA base sequence of the internal transcribed spacer region2 (ITS 2 has been used asa molecular marker for identification in an effort to determine phylogenetic relationships. The aim of thisstudy was to determine the ITS 2 gene nucleotide sequence of R. microplus, which was expected to beuseful for accurate identification the parasite diversity and phylogenetic relationship among many differentspecies. DNA amplification was conducted using BOO2 forward dan BOO2 reverse primers. The DNAsamples containing ITS2 region fragment of 1099 nt were derived from the nucleotide sequence multiplealignments of R.microplus and other ticks genes obtained from Gene bank using Clustal W software, andthen analyzed using the MEGA program version 6. Genetic distances based on nucleotide sequence weredetermined with Kimura 2-parameter method producing the smallest genetic distance of 0 % and 1.2 %.Construction of phylogenetic trees using the Neighbor joining method showed that ticks from variousregions in Indonesia was species complex which have a closer with R.microplus isolates from India, Laos,South Africa, China and Australia R.australis origin.

  19. Internal transcribed spacer 2 barcode: A good tool for identifying Acanthopanacis cortex

    Directory of Open Access Journals (Sweden)

    Sha eZhao

    2015-10-01

    Full Text Available Acanthopanacis cortex has been used in clinical applications for a long time. Considering some historical and geographical factors, Acanthopanacis cortex is easily confused with other herbs in medicine markets, thereby causing potential safety issues. In this study, we used the internal transcribed spacer 2 (ITS2 barcode to identify 69 samples belonging to six species, including Acanthopanacis cortex and its adulterants. The nearest distance, single-nucleotide polymorphisms (SNPs, and neighbor-joining (NJ tree methods were used to evaluate the identification ability of the ITS2 barcode. According to the kimura-2-parameter model, the intraspecific distance of Eleutherococcus nodiflorus ITS2 sequences ranged from 0 to 0.0132. The minimum interspecific distance between E. nodiflorus and E. giraldii was 0.0221, which was larger than the maximum intraspecific distance of E. nodiflorus. Three stable SNPs in ITS2 can be used to distinguish Acanthopanacis cortex and its closely related species. The NJ tree indicated that the Acanthopanacis cortex samples clustered into one clade, which can be distinguished clearly from the adulterants of this herb. A secondary structure of ITS2 provided another dimensionality to identify species. In conclusion, the ITS2 barcode effectively identifies Acanthopanacis cortex, and DNA barcoding is a convenient tool for medicine market supervision.

  20. Identification of Clinical Staphylococcal Isolates from Humans by Internal Transcribed Spacer PCR

    Science.gov (United States)

    Couto, Isabel; Pereira, Sandro; Miragaia, Maria; Sanches, Ilda Santos; de Lencastre, Hermínia

    2001-01-01

    The emergence of coagulase-negative staphylococci not only as human pathogens but also as reservoirs of antibiotic resistance determinants requires the deployment and development of methods for their rapid and reliable identification. Internal transcribed spacer-PCR (ITS-PCR) was used to identify a collection of 617 clinical staphylococcal isolates. The amplicons were resolved in high-resolution agarose gels and visually compared with the patterns obtained for the control strains of 29 staphylococcal species. Of the 617 isolates studied, 592 (95.95%) were identified by ITS-PCR and included 11 species: 302 isolates of Staphylococcus epidermidis, 157 of S. haemolyticus, 79 of S. aureus, 21 of S. hominis, 14 of S. saprophyticus, 8 of S. warneri, 6 of S. simulans, 2 of S. lugdunensis, and 1 each of S. caprae, S. carnosus, and S. cohnii. All species analyzed had unique ITS-PCR patterns, although some were very similar, namely, the group S. saprophyticus, S. cohnii, S. gallinarum, S. xylosus, S. lentus, S. equorum, and S. chromogenes, the pair S. schleiferi and S. vitulus, and the pair S. piscifermentans and S. carnosus. Four species, S. aureus, S. caprae, S. haemolyticus, and S. lugdunensis, showed polymorphisms on their ITS-PCR patterns. ITS-PCR proved to be a valuable alternative for the identification of staphylococci, offering, within the same response time and at lower cost, higher reliability than the currently available commercial systems. PMID:11526135

  1. Definition of Eight Mulberry Species in the Genus Morus by Internal Transcribed Spacer-Based Phylogeny.

    Directory of Open Access Journals (Sweden)

    Qiwei Zeng

    Full Text Available Mulberry, belonging to the order Rosales, family Moraceae, and genus Morus, has received attention because of both its economic and medicinal value, as well as for its important ecological function. The genus Morus has a worldwide distribution, however, its taxonomy remains complex and disputed. Many studies have attempted to classify Morus species, resulting in varied numbers of designated Morus spp. To address this issue, we used information from internal transcribed spacer (ITS genetic sequences to study the taxonomy of all the members of generally accepted genus Morus. We found that intraspecific 5.8S rRNA sequences were identical but that interspecific 5.8S sequences were diverse. M. alba and M. notabilis showed the shortest (215 bp and the longest (233 bp ITS1 sequence length, respectively. With the completion of the mulberry genome, we could identify single nucleotide polymorphisms within the ITS locus in the M. notabilis genome. From reconstruction of a phylogenetic tree based on the complete ITS data, we propose that the Morus genus should be classified into eight species, including M. alba, M. nigra, M. notabilis, M. serrata, M. celtidifolia, M. insignis, M. rubra, and M. mesozygia. Furthermore, the classification of the ITS sequences of known interspecific hybrid clones into both paternal and maternal clades indicated that ITS variation was sufficient to distinguish interspecific hybrids in the genus Morus.

  2. Definition of Eight Mulberry Species in the Genus Morus by Internal Transcribed Spacer-Based Phylogeny.

    Science.gov (United States)

    Zeng, Qiwei; Chen, Hongyu; Zhang, Chao; Han, Minjing; Li, Tian; Qi, Xiwu; Xiang, Zhonghuai; He, Ningjia

    2015-01-01

    Mulberry, belonging to the order Rosales, family Moraceae, and genus Morus, has received attention because of both its economic and medicinal value, as well as for its important ecological function. The genus Morus has a worldwide distribution, however, its taxonomy remains complex and disputed. Many studies have attempted to classify Morus species, resulting in varied numbers of designated Morus spp. To address this issue, we used information from internal transcribed spacer (ITS) genetic sequences to study the taxonomy of all the members of generally accepted genus Morus. We found that intraspecific 5.8S rRNA sequences were identical but that interspecific 5.8S sequences were diverse. M. alba and M. notabilis showed the shortest (215 bp) and the longest (233 bp) ITS1 sequence length, respectively. With the completion of the mulberry genome, we could identify single nucleotide polymorphisms within the ITS locus in the M. notabilis genome. From reconstruction of a phylogenetic tree based on the complete ITS data, we propose that the Morus genus should be classified into eight species, including M. alba, M. nigra, M. notabilis, M. serrata, M. celtidifolia, M. insignis, M. rubra, and M. mesozygia. Furthermore, the classification of the ITS sequences of known interspecific hybrid clones into both paternal and maternal clades indicated that ITS variation was sufficient to distinguish interspecific hybrids in the genus Morus.

  3. Intra-Genomic Internal Transcribed Spacer Region Sequence Heterogeneity and Molecular Diagnosis in Clinical Microbiology.

    Science.gov (United States)

    Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Cheng, Jingwei; Xu, Yingchun; Lau, Susanna K P; Woo, Patrick C Y

    2015-10-22

    Internal transcribed spacer region (ITS) sequencing is the most extensively used technology for accurate molecular identification of fungal pathogens in clinical microbiology laboratories. Intra-genomic ITS sequence heterogeneity, which makes fungal identification based on direct sequencing of PCR products difficult, has rarely been reported in pathogenic fungi. During the process of performing ITS sequencing on 71 yeast strains isolated from various clinical specimens, direct sequencing of the PCR products showed ambiguous sequences in six of them. After cloning the PCR products into plasmids for sequencing, interpretable sequencing electropherograms could be obtained. For each of the six isolates, 10-49 clones were selected for sequencing and two to seven intra-genomic ITS copies were detected. The identities of these six isolates were confirmed to be Candida glabrata (n=2), Pichia (Candida) norvegensis (n=2), Candida tropicalis (n=1) and Saccharomyces cerevisiae (n=1). Multiple sequence alignment revealed that one to four intra-genomic ITS polymorphic sites were present in the six isolates, and all these polymorphic sites were located in the ITS1 and/or ITS2 regions. We report and describe the first evidence of intra-genomic ITS sequence heterogeneity in four different pathogenic yeasts, which occurred exclusively in the ITS1 and ITS2 spacer regions for the six isolates in this study.

  4. Definition of Eight Mulberry Species in the Genus Morus by Internal Transcribed Spacer-Based Phylogeny

    Science.gov (United States)

    Zeng, Qiwei; Chen, Hongyu; Zhang, Chao; Han, Minjing; Li, Tian; Qi, Xiwu; Xiang, Zhonghuai; He, Ningjia

    2015-01-01

    Mulberry, belonging to the order Rosales, family Moraceae, and genus Morus, has received attention because of both its economic and medicinal value, as well as for its important ecological function. The genus Morus has a worldwide distribution, however, its taxonomy remains complex and disputed. Many studies have attempted to classify Morus species, resulting in varied numbers of designated Morus spp. To address this issue, we used information from internal transcribed spacer (ITS) genetic sequences to study the taxonomy of all the members of generally accepted genus Morus. We found that intraspecific 5.8S rRNA sequences were identical but that interspecific 5.8S sequences were diverse. M. alba and M. notabilis showed the shortest (215 bp) and the longest (233 bp) ITS1 sequence length, respectively. With the completion of the mulberry genome, we could identify single nucleotide polymorphisms within the ITS locus in the M. notabilis genome. From reconstruction of a phylogenetic tree based on the complete ITS data, we propose that the Morus genus should be classified into eight species, including M. alba, M. nigra, M. notabilis, M. serrata, M. celtidifolia, M. insignis, M. rubra, and M. mesozygia. Furthermore, the classification of the ITS sequences of known interspecific hybrid clones into both paternal and maternal clades indicated that ITS variation was sufficient to distinguish interspecific hybrids in the genus Morus. PMID:26266951

  5. Identification of clinical staphylococcal isolates from humans by internal transcribed spacer PCR.

    Science.gov (United States)

    Couto, I; Pereira, S; Miragaia, M; Sanches, I S; de Lencastre, H

    2001-09-01

    The emergence of coagulase-negative staphylococci not only as human pathogens but also as reservoirs of antibiotic resistance determinants requires the deployment and development of methods for their rapid and reliable identification. Internal transcribed spacer-PCR (ITS-PCR) was used to identify a collection of 617 clinical staphylococcal isolates. The amplicons were resolved in high-resolution agarose gels and visually compared with the patterns obtained for the control strains of 29 staphylococcal species. Of the 617 isolates studied, 592 (95.95%) were identified by ITS-PCR and included 11 species: 302 isolates of Staphylococcus epidermidis, 157 of S. haemolyticus, 79 of S. aureus, 21 of S. hominis, 14 of S. saprophyticus, 8 of S. warneri, 6 of S. simulans, 2 of S. lugdunensis, and 1 each of S. caprae, S. carnosus, and S. cohnii. All species analyzed had unique ITS-PCR patterns, although some were very similar, namely, the group S. saprophyticus, S. cohnii, S. gallinarum, S. xylosus, S. lentus, S. equorum, and S. chromogenes, the pair S. schleiferi and S. vitulus, and the pair S. piscifermentans and S. carnosus. Four species, S. aureus, S. caprae, S. haemolyticus, and S. lugdunensis, showed polymorphisms on their ITS-PCR patterns. ITS-PCR proved to be a valuable alternative for the identification of staphylococci, offering, within the same response time and at lower cost, higher reliability than the currently available commercial systems.

  6. Analysis of sequence diversity through internal transcribed spacers and simple sequence repeats to identify Dendrobium species.

    Science.gov (United States)

    Liu, Y T; Chen, R K; Lin, S J; Chen, Y C; Chin, S W; Chen, F C; Lee, C Y

    2014-04-08

    The Orchidaceae is one of the largest and most diverse families of flowering plants. The Dendrobium genus has high economic potential as ornamental plants and for medicinal purposes. In addition, the species of this genus are able to produce large crops. However, many Dendrobium varieties are very similar in outward appearance, making it difficult to distinguish one species from another. This study demonstrated that the 12 Dendrobium species used in this study may be divided into 2 groups by internal transcribed spacer (ITS) sequence analysis. Red and yellow flowers may also be used to separate these species into 2 main groups. In particular, the deciduous characteristic is associated with the ITS genetic diversity of the A group. Of 53 designed simple sequence repeat (SSR) primer pairs, 7 pairs were polymorphic for polymerase chain reaction products that were amplified from a specific band. The results of this study demonstrate that these 7 SSR primer pairs may potentially be used to identify Dendrobium species and their progeny in future studies.

  7. Molecular Phylogenetic Screening of Withania somnifera Relative From Indonesia Based on Internal Transcribed Spacer Region

    Directory of Open Access Journals (Sweden)

    Topik Hidayat

    2016-04-01

    Full Text Available Withania somnifera (family Solanaceae, known commonly as Ashwaganda, is one of the important medicinal plants, and recent studies reported that Withanone, one of the chemical components in this plant, has ability to kill cancer cell. Because of endemic state of this plant to South Asia, exploring plant species under the same family which grow well in Indonesia has been of interest. The purpose of this study was to screen the Indonesian plant which has strong phylogenetic relationship with Ashwaganda. Thus, phylogenetic analysis using DNA sequences of internal transcribed spacer (ITS region was conducted. Thus, 19 species of Solanaceae and two species of Convolvulaceae as outgroup were examined. Five ITS regions of Ashwaganda retrieved from GenBank were included in the phylogenetic analysis. Parsimony analysis showed that Indonesia Solanaceae comprises seven groups which is consistent with the global Solanaceae relationship as previously reported. Furthermore, our study revealed that two species, Physalis angulata and Physalis peruviana, are relative to W. somnifera. Morphologically, they share characters of flower and fruit. This result indicated that these two species are potential to have similar chemical properties as Ashwaganda, thus we can have new variants of Withanone originated from Indonesia with similar effect.

  8. Identification of forensically important Chrysomya (Diptera: Calliphoridae) species using the second ribosomal internal transcribed spacer (ITS2).

    Science.gov (United States)

    Nelson, Leigh A; Wallman, James F; Dowton, Mark

    2008-05-20

    The identification of forensically important blowflies of the genus Chrysomya (Diptera: Calliphoridae) may be hampered by their close morphological similarities, especially as immatures. In contrast to most previous studies, the utility of a nuclear rather than mitochondrial genetic marker was investigated to solve this problem. The second internal transcribed spacer (ITS2) of ribosomal DNA (rDNA) was amplified and sequenced from all nine Chrysomya species known from Australia. Difficulties encountered with direct sequencing of ITS2 for Chrysomya flavifrons necessitated cloning prior to sequencing for this species, which revealed a low level (0-0.23%) of intraindividual variation. Five restriction enzymes (DraI, BsaXI, BciVI, AseI and HinfI) were identified that were able to differentiate most members of the genus by polymerase chain reaction (PCR) restriction fragment length polymorphism (PCR-RFLP). The PCR-RFLP analysis revealed characteristic restriction profiles for all species except the closely related species pairs Chrysomya latifrons+Chrysomya semimetallica and Chrysomya incisuralis+Chrysomya rufifacies. Ch. incisuralis and Ch. rufifacies were able to be separated using the size differences resulting from amplification of the entire ITS region. The lack of intraspecific ITS2 sequence variation among eight Ch. incisuralis specimens was verified by the identical restriction profiles generated from these specimens. A DNA-based approach, such as PCR-RFLP, has the capacity to be useful for the identification of forensic entomological evidence in cases where morphological characters are unreliable.

  9. Barcoding the Dendrobium (Orchidaceae Species and Analysis of the Intragenomic Variation Based on the Internal Transcribed Spacer 2

    Directory of Open Access Journals (Sweden)

    Xiaoyue Wang

    2017-01-01

    Full Text Available Many species belonging to the genus Dendrobium are of great commercial value. However, their difficult growth conditions and high demand have caused many of these species to become endangered. Indeed, counterfeit Dendrobium products are common, especially in medicinal markets. This study aims to assess the suitability of the internal transcribed spacer 2 (ITS2 region as a marker for identifying Dendrobium and to evaluate its intragenomic variation in Dendrobium species. In total, 29,624 ITS2 copies from 18 species were obtained using 454 pyrosequencing to evaluate intragenomic variation. In addition, 513 ITS2 sequences from 26 Dendrobium species were used to assess its identification suitability. The highest intragenomic genetic distance was observed in Dendrobium chrysotoxum (0.081. The average intraspecific genetic distances of each species ranged from 0 to 0.032. Phylogenetic trees based on ITS2 sequences showed that most Dendrobium species are monophyletic. The intragenomic and intraspecies divergence analysis showed that greater intragenomic divergence is mostly correlated with larger intraspecific variation. As a major ITS2 variant becomes more common in genome, there are fewer intraspecific variable sites in ITS2 sequences at the species level. The results demonstrated that the intragenomic multiple copies of ITS2 did not affect species identification.

  10. Barcoding the Dendrobium (Orchidaceae) Species and Analysis of the Intragenomic Variation Based on the Internal Transcribed Spacer 2.

    Science.gov (United States)

    Wang, Xiaoyue; Chen, Xiaochen; Yang, Pei; Wang, Lili; Han, Jianping

    2017-01-01

    Many species belonging to the genus Dendrobium are of great commercial value. However, their difficult growth conditions and high demand have caused many of these species to become endangered. Indeed, counterfeit Dendrobium products are common, especially in medicinal markets. This study aims to assess the suitability of the internal transcribed spacer 2 (ITS2) region as a marker for identifying Dendrobium and to evaluate its intragenomic variation in Dendrobium species. In total, 29,624 ITS2 copies from 18 species were obtained using 454 pyrosequencing to evaluate intragenomic variation. In addition, 513 ITS2 sequences from 26 Dendrobium species were used to assess its identification suitability. The highest intragenomic genetic distance was observed in Dendrobium chrysotoxum (0.081). The average intraspecific genetic distances of each species ranged from 0 to 0.032. Phylogenetic trees based on ITS2 sequences showed that most Dendrobium species are monophyletic. The intragenomic and intraspecies divergence analysis showed that greater intragenomic divergence is mostly correlated with larger intraspecific variation. As a major ITS2 variant becomes more common in genome, there are fewer intraspecific variable sites in ITS2 sequences at the species level. The results demonstrated that the intragenomic multiple copies of ITS2 did not affect species identification.

  11. Saprolegniaceae identified on amphibian eggs throughout the Pacific Northwest, USA, by internal transcribed spacer sequences and phylogenetic analysis

    Science.gov (United States)

    Jill E. Petrisko; Christopher A. Pearl; David S. Pilliod; Peter P. Sheridan; Charles F. Williams; Charles R. Peterson; R. Bruce Bury

    2008-01-01

    We assessed the diversity and phylogeny of Saprolegniaceae on amphibian eggs from the Pacific Northwest, with particular focus on Saprolegnia ferax, a species implicated in high egg mortality. We identified isolates from eggs of six amphibians with the internal transcribed spacer (ITS) and 5.8S gene regions and BLAST of the GenBank database. We...

  12. Phylogenetic analysis of cercospora and mycosphaerella based on the internal transcribed spacer region of ribosomal DNA.

    Science.gov (United States)

    Goodwin, S B; Dunkle, L D; Zismann, V L

    2001-07-01

    ABSTRACT Most of the 3,000 named species in the genus Cercospora have no known sexual stage, although a Mycosphaerella teleomorph has been identified for a few. Mycosphaerella is an extremely large and important genus of plant pathogens, with more than 1,800 named species and at least 43 associated anamorph genera. The goal of this research was to perform a large-scale phylogenetic analysis to test hypotheses about the past evolutionary history of Cercospora and Mycosphaerella. Based on the phylogenetic analysis of internal transcribed spacer (ITS) sequence data (ITS1, 5.8S rRNA gene, ITS2), the genus Mycosphaerella is monophyletic. In contrast, many anamorph genera within Mycosphaerella were polyphyletic and were not useful for grouping species. One exception was Cercospora, which formed a highly supported monophyletic group. Most Cercospora species from cereal crops formed a subgroup within the main Cercospora cluster. Only species within the Cercospora cluster produced the toxin cercosporin, suggesting that the ability to produce this compound had a single evolutionary origin. Intraspecific variation for 25 taxa in the Mycosphaerella clade averaged 1.7 nucleotides (nts) in the ITS region. Thus, isolates with ITS sequences that differ by two or more nucleotides may be distinct species. ITS sequences of groups I and II of the gray leaf spot pathogen Cercospora zeae-maydis differed by 7 nts and clearly represent different species. There were 6.5 nt differences on average between the ITS sequences of the sorghum pathogen Cercospora sorghi and the maize pathogen Cercospora sorghi var. maydis, indicating that the latter is a separate species and not simply a variety of Cercospora sorghi. The large monophyletic Mycosphaerella cluster contained a number of anamorph genera with no known teleomorph associations. Therefore, the number of anamorph genera related to Mycosphaerella may be much larger than suspected previously.

  13. Molecular analysis of fungal populations in patients with oral candidiasis using internal transcribed spacer region.

    Science.gov (United States)

    Ieda, Shinsuke; Moriyama, Masafumi; Takeshita, Toru; Takashita, Toru; Maehara, Takashi; Imabayashi, Yumi; Shinozaki, Shoichi; Tanaka, Akihiko; Hayashida, Jun-Nosuke; Furukawa, Sachiko; Ohta, Miho; Yamashita, Yoshihisa; Nakamura, Seiji

    2014-01-01

    Oral candidiasis is closely associated with changes in the oral fungal flora and is caused primarily by Candida albicans. Conventional methods of fungal culture are time-consuming and not always conclusive. However, molecular genetic analysis of internal transcribed spacer (ITS) regions of fungal rRNA is rapid, reproducible and simple to perform. In this study we examined the fungal flora in patients with oral candidiasis and investigated changes in the flora after antifungal treatment using length heterogeneity-polymerization chain reaction (LH-PCR) analysis of ITS regions. Fifty-two patients with pseudomembranous oral candidiasis (POC) and 30 healthy controls were included in the study. Fungal DNA from oral rinse was examined for fungal species diversity by LH-PCR. Fungal populations were quantified by real-time PCR and previously-unidentified signals were confirmed by nucleotide sequencing. Relationships between the oral fungal flora and treatment-resistant factors were also examined. POC patients showed significantly more fungal species and a greater density of fungi than control individuals. Sixteen fungi were newly identified. The fungal populations from both groups were composed predominantly of C. albicans, though the ratio of C. dubliniensis was significantly higher in POC patients than in controls. The diversity and density of fungi were significantly reduced after treatment. Furthermore, fungal diversity and the proportion of C. dubliniensis were positively correlated with treatment duration. These results suggest that C. dubliniensis and high fungal flora diversity might be involved in the pathogenesis of oral candidiasis. We therefore conclude that LH-PCR is a useful technique for diagnosing and assessing the severity of oral candidal infection.

  14. Reliable differentiation of Meyerozyma guilliermondii from Meyerozyma caribbica by internal transcribed spacer restriction fingerprinting.

    Science.gov (United States)

    Romi, Wahengbam; Keisam, Santosh; Ahmed, Giasuddin; Jeyaram, Kumaraswamy

    2014-02-28

    Meyerozyma guilliermondii (anamorph Candida guilliermondii) and Meyerozyma caribbica (anamorph Candida fermentati) are closely related species of the genetically heterogenous M. guilliermondii complex. Conventional phenotypic methods frequently misidentify the species within this complex and also with other species of the Saccharomycotina CTG clade. Even the long-established sequencing of large subunit (LSU) rRNA gene remains ambiguous. We also faced similar problem during identification of yeast isolates of M. guilliermondii complex from indigenous bamboo shoot fermentation in North East India. There is a need for development of reliable and accurate identification methods for these closely related species because of their increasing importance as emerging infectious yeasts and associated biotechnological attributes. We targeted the highly variable internal transcribed spacer (ITS) region (ITS1-5.8S-ITS2) and identified seven restriction enzymes through in silico analysis for differentiating M. guilliermondii from M. caribbica. Fifty five isolates of M. guilliermondii complex which could not be delineated into species-specific taxonomic ranks by API 20 C AUX and LSU rRNA gene D1/D2 sequencing were subjected to ITS-restriction fragment length polymorphism (ITS-RFLP) analysis. TaqI ITS-RFLP distinctly differentiated the isolates into M. guilliermondii (47 isolates) and M. caribbica (08 isolates) with reproducible species-specific patterns similar to the in silico prediction. The reliability of this method was validated by ITS1-5.8S-ITS2 sequencing, mitochondrial DNA RFLP and electrophoretic karyotyping. We herein described a reliable ITS-RFLP method for distinct differentiation of frequently misidentified M. guilliermondii from M. caribbica. Even though in silico analysis differentiated other closely related species of M. guilliermondii complex from the above two species, it is yet to be confirmed by in vitro analysis using reference strains. This method can be used

  15. Molecular phylogeny of Oncaeidae (Copepoda using nuclear ribosomal internal transcribed spacer (ITS rDNA.

    Directory of Open Access Journals (Sweden)

    Iole Di Capua

    Full Text Available Copepods belonging to the Oncaeidae family are commonly and abundantly found in marine zooplankton. In the Mediterranean Sea, forty-seven oncaeid species occur, of which eleven in the Gulf of Naples. In this Gulf, several Oncaea species were morphologically analysed and described at the end of the XIX century by W. Giesbrecht. In the same area, oncaeids are being investigated over seasonal and inter-annual scales at the long-term coastal station LTER-MC. In the present work, we identified six oncaeid species using the nuclear ribosomal internal transcribed spacers (ITS rDNA and the mitochondrial cytochrome c oxidase subunit I (mtCOI. Phylogenetic analyses based on these two genomic regions validated the sisterhood of the genera Triconia and the Oncaea sensu stricto. ITS1 and ITS2 phylogenies produced incongruent results about the position of Oncaea curta, calling for further investigations on this species. We also characterised the ITS2 region by secondary structure predictions and found that all the sequences analysed presented the distinct eukaryotic hallmarks. A Compensatory Base Change search corroborated the close relationship between O. venusta and O. curta and between O. media and O. venusta already identified by ITS phylogenies. The present results, which stem from the integration of molecular and morphological taxonomy, represent an encouraging step towards an improved knowledge of copepod biodiversity: The two complementary approaches, when applied to long-term copepod monitoring, will also help to better understanding their genetic variations and ecological niches of co-occurring species.

  16. Secondary structure analyses of the nuclear rRNA internal transcribed spacers and assessment of its phylogenetic utility across the Brassicaceae (mustards.

    Directory of Open Access Journals (Sweden)

    Patrick P Edger

    Full Text Available The internal transcribed spacers of the nuclear ribosomal RNA gene cluster, termed ITS1 and ITS2, are the most frequently used nuclear markers for phylogenetic analyses across many eukaryotic groups including most plant families. The reasons for the popularity of these markers include: 1. Ease of amplification due to high copy number of the gene clusters, 2. Available cost-effective methods and highly conserved primers, 3. Rapidly evolving markers (i.e. variable between closely related species, and 4. The assumption (and/or treatment that these sequences are non-functional, neutrally evolving phylogenetic markers. Here, our analyses of ITS1 and ITS2 for 50 species suggest that both sequences are instead under selective constraints to preserve proper secondary structure, likely to maintain complete self-splicing functions, and thus are not neutrally-evolving phylogenetic markers. Our results indicate the majority of sequence sites are co-evolving with other positions to form proper secondary structure, which has implications for phylogenetic inference. We also found that the lowest energy state and total number of possible alternate secondary structures are highly significantly different between ITS regions and random sequences with an identical overall length and Guanine-Cytosine (GC content. Lastly, we review recent evidence highlighting some additional problematic issues with using these regions as the sole markers for phylogenetic studies, and thus strongly recommend additional markers and cost-effective approaches for future studies to estimate phylogenetic relationships.

  17. Molecular Strain Typing of Clinical Isolates, Trichophyton rubrum using Non Transcribed Spacer (NTS) Region as a Molecular Marker.

    Science.gov (United States)

    Ramaraj, Vijayakumar; Vijayaraman, Rajyoganandh S; Elavarashi, Elangovan; Rangarajan, Sudha; Kindo, Anupma Jyoti

    2017-05-01

    Dermatophytes are a group of fungi which infect keratinized tissues and causes superficial mycoses in humans and animals. The group comprises of three major genera, Trichophyton , Microsporum and Epidermophyton . Among them Trichophyton rubrum is a predominant anthropophilic fungi which causes chronic infections. Although, the infection is superficial and treatable, reinfection/coinfection causes inflation in the treatment cost. Identifying the source and mode of transmission is essential to prevent its transmission. Accurate discrimination is required to understand the clinical (relapse or reinfection) and epidemiological implications of the genetic heterogeneity of this species. Polymorphism in the Non Transcribed Spacer (NTS) region of ribosomal DNA (rDNA) clusters renders an effective way to discriminate strains among T. rubrum . To carry out the strain typing of the clinical isolates, Trichophyton rubrum using NTS as a molecular marker. Seventy T.rubrum clinical isolates obtained from April-2011-March 2013, from Sri Ramachandra Medical Centre, Chennai, Tamil Nadu, India, were identified by conventional phenotypic methods and included in this prospective study. The isolates were then subjected to Polymerase Chain Reaction (PCR) targeting two subrepeat elements (SREs), TRS-1 and TRS-2 of the NTS region. Strain-specific polymorphism was observed in both subrepeat loci. Total, nine different strains were obtained on combining both TRS-1 and TRS-2, SREs. The outcome has given a strong representation for using NTS region amplification in discriminating the T. rubrum clinical isolates. The method can be adapted as a tool for conducting epidemiology and population based study in T. rubrum infections. This will help in future exploration of the epidemiology of T. rubrum .

  18. RAPD and Internal Transcribed Spacer Sequence Analyses Reveal Zea nicaraguensis as a Section Luxuriantes Species Close to Zea luxurians

    Science.gov (United States)

    Wang, Pei; Lu, Yanli; Zheng, Mingmin; Rong, Tingzhao; Tang, Qilin

    2011-01-01

    Genetic relationship of a newly discovered teosinte from Nicaragua, Zea nicaraguensis with waterlogging tolerance, was determined based on randomly amplified polymorphic DNA (RAPD) markers and the internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA using 14 accessions from Zea species. RAPD analysis showed that a total of 5,303 fragments were produced by 136 random decamer primers, of which 84.86% bands were polymorphic. RAPD-based UPGMA analysis demonstrated that the genus Zea can be divided into section Luxuriantes including Zea diploperennis, Zea luxurians, Zea perennis and Zea nicaraguensis, and section Zea including Zea mays ssp. mexicana, Zea mays ssp. parviglumis, Zea mays ssp. huehuetenangensis and Zea mays ssp. mays. ITS sequence analysis showed the lengths of the entire ITS region of the 14 taxa in Zea varied from 597 to 605 bp. The average GC content was 67.8%. In addition to the insertion/deletions, 78 variable sites were recorded in the total ITS region with 47 in ITS1, 5 in 5.8S, and 26 in ITS2. Sequences of these taxa were analyzed with neighbor-joining (NJ) and maximum parsimony (MP) methods to construct the phylogenetic trees, selecting Tripsacum dactyloides L. as the outgroup. The phylogenetic relationships of Zea species inferred from the ITS sequences are highly concordant with the RAPD evidence that resolved two major subgenus clades. Both RAPD and ITS sequence analyses indicate that Zea nicaraguensis is more closely related to Zea luxurians than the other teosintes and cultivated maize, which should be regarded as a section Luxuriantes species. PMID:21525982

  19. Activity of Posaconazole and Other Antifungal Agents against Mucorales Strains Identified by Sequencing of Internal Transcribed Spacers▿

    Science.gov (United States)

    Alastruey-Izquierdo, Ana; Castelli, Maria Victoria; Cuesta, Isabel; Monzon, Araceli; Cuenca-Estrella, Manuel; Rodriguez-Tudela, Juan Luis

    2009-01-01

    The antifungal susceptibility profiles of 77 clinical strains of Mucorales species, identified by internal transcribed spacer sequencing, were analyzed. MICs obtained at 24 and 48 h were compared. Amphotericin B was the most active agent against all isolates, except for Cunninghamella and Apophysomyces isolates. Posaconazole also showed good activity for all species but Cunninghamella bertholletiae. Voriconazole had no activity against any of the fungi tested. Terbinafine showed good activity, except for Rhizopus oryzae, Mucor circinelloides, and Rhizomucor variabilis isolates. PMID:19171801

  20. Activity of posaconazole and other antifungal agents against Mucorales strains identified by sequencing of internal transcribed spacers.

    Science.gov (United States)

    Alastruey-Izquierdo, Ana; Castelli, Maria Victoria; Cuesta, Isabel; Monzon, Araceli; Cuenca-Estrella, Manuel; Rodriguez-Tudela, Juan Luis

    2009-04-01

    The antifungal susceptibility profiles of 77 clinical strains of Mucorales species, identified by internal transcribed spacer sequencing, were analyzed. MICs obtained at 24 and 48 h were compared. Amphotericin B was the most active agent against all isolates, except for Cunninghamella and Apophysomyces isolates. Posaconazole also showed good activity for all species but Cunninghamella bertholletiae. Voriconazole had no activity against any of the fungi tested. Terbinafine showed good activity, except for Rhizopus oryzae, Mucor circinelloides, and Rhizomucor variabilis isolates.

  1. Molecular Characterization of Fasciola Samples Using Sequences of Second Internal Transcribed Spacer-rDNA in Different Geographical Localities of Sistan and Balouchestan Province, Iran

    Directory of Open Access Journals (Sweden)

    Mahsa Shahbakhsh

    2016-02-01

    Full Text Available Background: The Fasciola trematodes are the most common liver flukes, living in a range of animals with global distribution and resulting in profound economic loss and public health challenges. Previous studies have indicated that the sequences of the second internal transcribed spacer (ITS-2 of ribosomal DNA (rDNA provide reliable genetic markers for molecular systemic studies of Fasciola. Objectives: The objective of the present study was to characterize Fasciola samples from different geographical regions of Sistan and Balouchestan province using sequences of second internal transcribed spacer (ITS-2 of ribosomal DNA (rDNA. Materials and Methods: Twenty adult trematodes were collected from the livers of slaughtered infected cattle. Total genomic DNA was extracted and ITS-2 rDNA targets were amplified by polymerase chain reaction (PCR. All samples were sequenced and investigated using the ClustalW2 sequence alignment tool and MEGA software. The sequences of some Iranian and non-Iranian isolates were used for comparison, in order to evaluate the variation in sequence homology between geographically different trematode populations. Results: The results of comparing the ITS-2 sequences with the BLAST GenBank database showed one type of sequence for F. hepatica and three different types of sequences for F. gigantica in the specimens. Conclusions: The present study demonstrated that Fasciola samples from cattle in two geographical locations in Sistan and Balouchestan province represented no genetic diversity in F. hepatica and high genetic variation in F. gigantica.

  2. Phylogenetic reconstruction of endophytic fungal isolates using internal transcribed spacer 2 (ITS2) region.

    Science.gov (United States)

    GokulRaj, Kathamuthu; Sundaresan, Natesan; Ganeshan, Enthai Jagan; Rajapriya, Pandi; Muthumary, Johnpaul; Sridhar, Jayavel; Pandi, Mohan

    2014-01-01

    Endophytic fungi are inhabitants of plants, living most part of their lifecycle asymptomatically which mainly confer protection and ecological advantages to the host plant. In this present study, 48 endophytic fungi were isolated from the leaves of three medicinal plants and characterized based on ITS2 sequence - secondary structure analysis. ITS2 secondary structures were elucidated with minimum free energy method (MFOLD version 3.1) and consensus structure of each genus was generated by 4SALE. ProfDistS was used to generate ITS2 sequence structure based phylogenetic tree respectively. Our elucidated isolates were belonging to Ascomycetes family, representing 5 orders and 6 genera. Colletotrichum/Glomerella spp., Diaporthae/Phomopsis spp., and Alternaria spp., were predominantly observed while Cochliobolus sp., Cladosporium sp., and Emericella sp., were represented by singletons. The constructed phylogenetic tree has well resolved monophyletic groups with >50% bootstrap value support. Secondary structures based fungal systematics improves not only the stability; it also increases the precision of phylogenetic inference. Above ITS2 based phylogenetic analysis was performed for our 48 isolates along with sequences of known ex-types taken from GenBank which confirms the efficiency of the proposed method. Further, we propose it as superlative marker for reconstructing phylogenetic relationships at different taxonomic levels due to their lesser length.

  3. Analysis of the first and second internal transcribed spacer sequences of the ribosomal DNA in Biomphalaria tenagophila complex (Mollusca: Planorbidae

    Directory of Open Access Journals (Sweden)

    Teofânia HDA Vidigal

    2004-03-01

    Full Text Available The first and second internal transcribed spacer regions (ITS1 and ITS2 of the ribosomal DNA of Biomphalaria tenagophila complex (B. tenagophila, B. occidentalis, and B. t. guaibensis were sequenced and compared. The alignment lengths of these regions were about 655 bp and 481 bp, respectively. Phylogenetic relationships among the Biomphalaria species were inferred by Maximum Parsimony and Neighbor-joining methods. The phylogenetic trees produced, in most of the cases, were in accordance with morphological systematics and other molecular data previously obtained by polymerase chain reaction and restriction fragment length polymorphism analysis. The present results provide support for the proposal that B. tenagophila represents a complex comprising B. tenagophila, B. occidentalis and B. t. guaibensis.

  4. Diversity of 16S-23S rDNA internal transcribed spacer (ITS reveals phylogenetic relationships in Burkholderia pseudomallei and its near-neighbors.

    Directory of Open Access Journals (Sweden)

    Andrew P Liguori

    Full Text Available Length polymorphisms within the 16S-23S ribosomal DNA internal transcribed spacer (ITS have been described as stable genetic markers for studying bacterial phylogenetics. In this study, we used these genetic markers to investigate phylogenetic relationships in Burkholderia pseudomallei and its near-relative species. B. pseudomallei is known as one of the most genetically recombined bacterial species. In silico analysis of multiple B. pseudomallei genomes revealed approximately four homologous rRNA operons and ITS length polymorphisms therein. We characterized ITS distribution using PCR and analyzed via a high-throughput capillary electrophoresis in 1,191 B. pseudomallei strains. Three major ITS types were identified, two of which were commonly found in most B. pseudomallei strains from the endemic areas, whereas the third one was significantly correlated with worldwide sporadic strains. Interestingly, mixtures of the two common ITS types were observed within the same strains, and at a greater incidence in Thailand than Australia suggesting that genetic recombination causes the ITS variation within species, with greater recombination frequency in Thailand. In addition, the B. mallei ITS type was common to B. pseudomallei, providing further support that B. mallei is a clone of B. pseudomallei. Other B. pseudomallei near-neighbors possessed unique and monomorphic ITS types. Our data shed light on evolutionary patterns of B. pseudomallei and its near relative species.

  5. Extensive 5.8S nrDNA polymorphism in Mammillaria (Cactaceae) with special reference to the identification of pseudogenic internal transcribed spacer regions.

    Science.gov (United States)

    Harpke, Doerte; Peterson, Angela

    2008-05-01

    The internal transcribed spacer (ITS) region (ITS1, 5.8S rDNA, ITS2) represents the most widely applied nuclear marker in eukaryotic phylogenetics. Although this region has been assumed to evolve in concert, the number of investigations revealing high degrees of intra-individual polymorphism connected with the presence of pseudogenes has risen. The 5.8S rDNA is the most important diagnostic marker for functionality of the ITS region. In Mammillaria, intra-individual 5.8S rDNA polymorphisms of up to 36% and up to nine different types have been found. Twenty-eight of 30 cloned genomic Mammillaria sequences were identified as putative pseudogenes. For the identification of pseudogenic ITS regions, in addition to formal tests based on substitution rates, we attempted to focus on functional features of the 5.8S rDNA (5.8S motif, secondary structure). The importance of functional data for the identification of pseudogenes is outlined and discussed. The identification of pseudogenes is essential, because they may cause erroneous phylogenies and taxonomic problems.

  6. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

    Czech Academy of Sciences Publication Activity Database

    Schoch, C.L.; Seifert, K.A.; Huhndorf, S.; Robert, V.; Spouge, J.L.; Levesque, C.A.; Chen, W.; Bolchacova, E.; Voigt, K.; Crous, P.W.; Miller, A.N.; Wingfield, M. J.; Aime, M.C.; An, K.D.; Bai, F.Y.; Barreto, R.W.; Bergeron, M.J.; Blackwell, M.; Boekhout, T.; Bogale, M.; Boonyuen, N.; Burgaz, A.R.; Buyck, B.; Cai, L.; Cai, Q.; Cardinali, G.; Chaverri, P.; Coppins, B.J.; Crespo, A.; Cubas, P.; Cummings, C.; Damm, U.; de Beer, Z.W.; de Hoog, G.S.; Del-Prado, R.; Dentinger, B.; Dieguez-Uribeondo, J.; Divakar, P.K.; Douglas, B.; Duenas, M.; Duong, T.A.; Eberhardt, U.; Edwards, J.E.; Elshahed, M.S.; Fliegerová, Kateřina; Furtado, M.; Garcia, M.A.; Ge, Z.W.; Griffith, G.W.; Griffiths, K.; Groenewald, J.Z.; Groenewald, M.; Grube, M.; Gryzenhout, M.; Guo, L.D.; Hagen, F.; Hambleton, S.; Hamelin, R.C.; Hansen, K.; Harrold, P.; Heller, G.; Herrera, C.; Hirayama, K.; Hirooka, Y.; Ho, H.M.; Hoffmann, K.; Hofstetter, V.; Hognabba, F.; Hollingsworth, P.M.; Hong, S.B.; Hosaka, K.; Houbraken, J.; Hughes, K.; Huhtinen, S.; Hyde, K.D.; James, T.; Johnson, E.M.; Johnson, J.E.; Johnston, P.R.; Jones, E.B.; Kelly, L.J.; Kirk, P.M.; Knapp, D.G.; Koljalg, U.; Kovacs, G.M.; Kurtzman, C.P.; Landvik, S.; Leavitt, S.D.; Liggenstoffer, A.S.; Liimatainen, K.; Lombard, L.; Luangsa-Ard, J.J.; Lumbsch, H.T.; Maganti, H.; Maharachchikumbura, S.S.; Martin, M.P.; May, T.W.; McTaggart, A.R.; Methven, A.S.; Meyer, W.; Moncalvo, J.M.; Mongkolsamrit, S.; Nagy, L.G.; Nilsson, R.H.; Niskanen, T.; Nyilasi, I.; Okada, G.; Okane, I.; Olariaga, I.; Otte, J.; Papp, T.; Park, D.; Petkovits, T.; Pino-Bodas, R.; Quaedvlieg, W.; Raja, H.A.; Redecker, D.; Rintoul, T.; Ruibal, C.; Sarmiento-Ramirez, J.M.; Schmitt, I.; Schussler, A.; Shearer, C.; Sotome, K.; Stefani, F.O.; Stenroos, S.; Stielow, B.; Stockinger, H.; Suetrong, S.; Suh, S.O.; Sung, G.H.; Suzuki, M.; Tanaka, K.; Tedersoo, L.; Telleria, M.T.; Tretter, E.; Untereiner, W.A.; Urbina, H.; Vagvolgyi, C.; Vialle, A.; Vu, T.D.; Walther, G.; Wang, Q.M.; Wang, Y.; Weir, B.S.; Weiss, M.; White, M.M.; Xu, J.; Yahr, R.; Yang, Z.L.; Yurkov, A.; Zamora, J.C.; Zhang, N.; Zhuang, W.Y.; Schindel, D.

    2012-01-01

    Roč. 109, č. 16 (2012), s. 6241-6246 ISSN 0027-8424 Institutional research plan: CEZ:AV0Z50450515 Keywords : DNA barcoding * fungal biodiversity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.737, year: 2012

  7. Saprolegniaceae identified on amphibian eggs throughout the Pacific Northwest, USA, by internal transcribed spacer sequences and phylogenetic analysis.

    Science.gov (United States)

    Petrisko, Jill E; Pearl, Christopher A; Pilliod, David S; Sheridan, Peter P; Williams, Charles F; Peterson, Charles R; Bury, R Bruce

    2008-01-01

    We assessed the diversity and phylogeny of Saprolegniaceae on amphibian eggs from the Pacific Northwest, with particular focus on Saprolegnia ferax, a species implicated in high egg mortality. We identified isolates from eggs of six amphibians with the internal transcribed spacer (ITS) and 5.8S gene regions and BLAST of the GenBank database. We identified 68 sequences as Saprolegniaceae and 43 sequences as true fungi from at least nine genera. Our phylogenetic analysis of the Saprolegniaceae included isolates within the genera Saprolegnia, Achlya and Leptolegnia. Our phylogeny grouped S. semihypogyna with Achlya rather than with the Saprolegnia reference sequences. We found only one isolate that grouped closely with S. ferax, and this came from a hatchery-raised salmon (Idaho) that we sampled opportunistically. We had representatives of 7-12 species and three genera of Saprolegniaceae on our amphibian eggs. Further work on the ecological roles of different species of Saprolegniaceae is needed to clarify their potential importance in amphibian egg mortality and potential links to population declines.

  8. Molecular Identification of Isolated Fungi from Unopened Containers of Greek Yogurt by DNA Sequencing of Internal Transcribed Spacer Region

    Directory of Open Access Journals (Sweden)

    Irshad M. Sulaiman

    2014-06-01

    Full Text Available In our previous study, we described the development of an internal transcribed spacer (ITS1 sequencing method, and used this protocol in species-identification of isolated fungi collected from the manufacturing areas of a compounding company known to have caused the multistate fungal meningitis outbreak in the United States. In this follow-up study, we have analyzed the unopened vials of Greek yogurt from the recalled batch to determine the possible cause of microbial contamination in the product. A total of 15 unopened vials of Greek yogurt belonging to the recalled batch were examined for the detection of fungi in these samples known to cause foodborne illness following conventional microbiological protocols. Fungi were isolated from all of the 15 Greek yogurt samples analyzed. The isolated fungi were genetically typed by DNA sequencing of PCR-amplified ITS1 region of rRNA gene. Analysis of data confirmed all of the isolated fungal isolates from the Greek yogurt to be Rhizomucor variabilis. The generated ITS1 sequences matched 100% with the published sequences available in GenBank. In addition, these yogurt samples were also tested for the presence of five types of bacteria (Salmonella, Listeria, Staphylococcus, Bacillus and Escherichia coli causing foodborne disease in humans, and found negative for all of them.

  9. Genetic variability in Melipona quinquefasciata (Hymenoptera, Apidae, Meliponini) from northeastern Brazil determined using the first internal transcribed spacer (ITS1).

    Science.gov (United States)

    Pereira, J O P; Freitas, B M; Jorge, D M M; Torres, D C; Soares, C E A; Grangeiro, T B

    2009-01-01

    Melipona quinquefasciata is a ground-nesting South American stingless bee whose geographic distribution was believed to comprise only the central and southern states of Brazil. We obtained partial sequences (about 500-570 bp) of first internal transcribed spacer (ITS1) nuclear ribosomal DNA from Melipona specimens putatively identified as M. quinquefasciata collected from different localities in northeastern Brazil. To confirm the taxonomic identity of the northeastern samples, specimens from the state of Goiás (Central region of Brazil) were included for comparison. All sequences were deposited in GenBank (accession numbers EU073751-EU073759). The mean nucleotide divergence (excluding sites with insertions/deletions) in the ITS1 sequences was only 1.4%, ranging from 0 to 4.1%. When the sites with insertions/deletions were also taken into account, sequence divergences varied from 0 to 5.3%. In all pairwise comparisons, the ITS1 sequence from the specimens collected in Goiás was most divergent compared to the ITS1 sequences of the bees from the other locations. However, neighbor-joining phylogenetic analysis showed that all ITS1 sequences from northeastern specimens along with the sample of Goiás were resolved in a single clade with a bootstrap support of 100%. The ITS1 sequencing data thus support the occurrence of M. quinquefasciata in northeast Brazil.

  10. Systematic Internal Transcribed Spacer Sequence Analysis for Identification of Clinical Mold Isolates in Diagnostic Mycology: a 5-Year Study▿ †

    Science.gov (United States)

    Ciardo, Diana E.; Lucke, Katja; Imhof, Alex; Bloemberg, Guido V.; Böttger, Erik C.

    2010-01-01

    The implementation of internal transcribed spacer (ITS) sequencing for routine identification of molds in the diagnostic mycology laboratory was analyzed in a 5-year study. All mold isolates (n = 6,900) recovered in our laboratory from 2005 to 2009 were included in this study. According to a defined work flow, which in addition to troublesome phenotypic identification takes clinical relevance into account, 233 isolates were subjected to ITS sequence analysis. Sequencing resulted in successful identification for 78.6% of the analyzed isolates (57.1% at species level, 21.5% at genus level). In comparison, extended in-depth phenotypic characterization of the isolates subjected to sequencing achieved taxonomic assignment for 47.6% of these, with a mere 13.3% at species level. Optimization of DNA extraction further improved the efficacy of molecular identification. This study is the first of its kind to testify to the systematic implementation of sequence-based identification procedures in the routine workup of mold isolates in the diagnostic mycology laboratory. PMID:20573873

  11. Systematic internal transcribed spacer sequence analysis for identification of clinical mold isolates in diagnostic mycology: a 5-year study.

    Science.gov (United States)

    Ciardo, Diana E; Lucke, Katja; Imhof, Alex; Bloemberg, Guido V; Böttger, Erik C

    2010-08-01

    The implementation of internal transcribed spacer (ITS) sequencing for routine identification of molds in the diagnostic mycology laboratory was analyzed in a 5-year study. All mold isolates (n = 6,900) recovered in our laboratory from 2005 to 2009 were included in this study. According to a defined work flow, which in addition to troublesome phenotypic identification takes clinical relevance into account, 233 isolates were subjected to ITS sequence analysis. Sequencing resulted in successful identification for 78.6% of the analyzed isolates (57.1% at species level, 21.5% at genus level). In comparison, extended in-depth phenotypic characterization of the isolates subjected to sequencing achieved taxonomic assignment for 47.6% of these, with a mere 13.3% at species level. Optimization of DNA extraction further improved the efficacy of molecular identification. This study is the first of its kind to testify to the systematic implementation of sequence-based identification procedures in the routine workup of mold isolates in the diagnostic mycology laboratory.

  12. Genetic diversity and molecular evolution of Naga King Chili inferred from internal transcribed spacer sequence of nuclear ribosomal DNA.

    Science.gov (United States)

    Kehie, Mechuselie; Kumaria, Suman; Devi, Khumuckcham Sangeeta; Tandon, Pramod

    2016-02-01

    Sequences of the Internal Transcribed Spacer (ITS1-5.8S-ITS2) of nuclear ribosomal DNAs were explored to study the genetic diversity and molecular evolution of Naga King Chili. Our study indicated the occurrence of nucleotide polymorphism and haplotypic diversity in the ITS regions. The present study demonstrated that the variability of ITS1 with respect to nucleotide diversity and sequence polymorphism exceeded that of ITS2. Sequence analysis of 5.8S gene revealed a much conserved region in all the accessions of Naga King Chili. However, strong phylogenetic information of this species is the distinct 13 bp deletion in the 5.8S gene which discriminated Naga King Chili from the rest of the Capsicum sp. Neutrality test results implied a neutral variation, and population seems to be evolving at drift-mutation equilibrium and free from directed selection pressure. Furthermore, mismatch analysis showed multimodal curve indicating a demographic equilibrium. Phylogenetic relationships revealed by Median Joining Network (MJN) analysis denoted a clear discrimination of Naga King Chili from its closest sister species (Capsicum chinense and Capsicum frutescens). The absence of star-like network of haplotypes suggested an ancient population expansion of this chili.

  13. The Heterogeneity of the Internal Transcribed Spacers (ITS of rDNAs in Imperata cylindrica in Taiwan

    Directory of Open Access Journals (Sweden)

    Chi-Chu Tsai

    2000-09-01

    Full Text Available Ribosomal DNA for internal transcribed spacers ITS, ITS1, 5.8S rRNA gene, ITS2 and the adjoining regions of the 17S and 25S rRNA genes were obtained from 45 individuals of Imperata cylindrica (Cogongrass in Taiwan via PCR amplification. The length of each PCR product was 692 bp, except for one sample (about 702 bp. All ITS DNA fragments were digested with EcoRV, CfoI, BanI, HaeIII, MspI, HinfI, BstOI, Sau96I, StyI and Eco109I, respectively. The ITS, including ITS1, 5.8S rRNA gene and ITS2, were very heterogeneous within an individual of Cogongrass in Taiwan. Of 45 individuals of Cogongrass in Taiwan, the ITS1 and ITS2 regions showed at least eight type variants, and 5.8S rRNA gene showed at least five type variants among Cogongrass population in Taiwan based on PCR-amplified RFLP. In conclusion, the ITS repeat sequences from Cogongrass in Taiwan was very high heterogeneous.

  14. Sequence analysis of the internal transcribed spacer (ITS) region reveals a novel clade of Ichthyophonus sp. from rainbow trout.

    Science.gov (United States)

    Rasmussen, C; Purcell, M K; Gregg, J L; LaPatra, S E; Winton, J R; Hershberger, P K

    2010-03-09

    The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of approximately 740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).

  15. A PCR method targeting internal transcribed spacers: the simultaneous detection of Babesia bigemina and Babesia bovis in cattle.

    Science.gov (United States)

    Liu, Junlong; Guan, Guiquan; Liu, Aihong; Li, Youquan; Yin, Hong; Luo, Jianxun

    2014-03-01

    In this study, two pairs of oligonucleotide primers were designed according to the nucleotide sequence of the internal transcribed spacers (ITSs) of Babesia bigemina and B. bovis isolates from China. The primers were used in a multiplex PCR to detect parasite DNA in blood samples from cattle. There was no cross reactions with B. ovata, B. major, B. sp. Kashi, Theileria annulata, T. sergenti, T. sinensis or normal bovine DNA. The sensitivity of multiplex PCR assay was 1 pg and 10 pg DNA for B. bigemina and B. bovis, respectively. A total of 260 field blood samples collected from cattle in five provinces of China were analyzed by multiplex PCR and light microscopy. PCR testing revealed that 7.3% (19/260) and 5.8% (15/260) of cattle were positive for B. bigemina and B. bovis and 1.2% (3/260) of cattle were co-infected with B. bigemina and B. bovis. Using light microscopy, 2.3% (6/260) and 1.5% (4/260) of cattle were infected by B. bigemina and B. bovis, respectively, and no co-infection was found. The results showed that the multiplex PCR developed in the present study could be an alternative diagnostic tool for the detection of B. bovis and B. bigemina infection in cattle.

  16. Characterization of four species of Trichuris (Nematoda: Enoplida) by their second internal transcribed spacer ribosomal DNA sequence.

    Science.gov (United States)

    Oliveros, R; Cutillas, C; De Rojas, M; Arias, P

    2000-12-01

    Adult worms of Trichuris ovis and T. globulosa were collected from Ovis aries (sheep) and Capra hircus (goats). T. suis was isolated from Sus scrofa domestica (swine) and T. leporis was isolated from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and a ribosomal internal transcribed spacer (ITS2) was amplified and sequenced using polymerase-chain-reaction (PCR) techniques. The ITS2 of T. ovis and T. globulosa was 407 nucleotides in length and had a GC content of about 62%. Furthermore, the ITS2 of T. suis and T. leporis was 534 and 418 nucleotides in length and had a GC content of about 64.8% and 62.4%, respectively. There was evidence of slight variation in the sequence within individuals of all species analyzed, indicating intraindividual variation in the sequence of different copies of the ribosomal DNA. Furthermore, low-level intraspecific variation was detected. Sequence analyses of ITS2 products of T. ovis and T. globulosa demonstrated no sequence difference between them. Nevertheless, differences were detected between the ITS2 sequences of T. suis, T. leporis, and T. ovis, indicating that Trichuris species can reliably be differentiated by their ITS2 sequences and PCR-linked restriction-fragment-length polymorphism (RFLP).

  17. ITSoneDB: a comprehensive collection of eukaryotic ribosomal RNA Internal Transcribed Spacer 1 (ITS1) sequences.

    Science.gov (United States)

    Santamaria, Monica; Fosso, Bruno; Licciulli, Flavio; Balech, Bachir; Larini, Ilaria; Grillo, Giorgio; De Caro, Giorgio; Liuni, Sabino; Pesole, Graziano

    2018-01-04

    A holistic understanding of environmental communities is the new challenge of metagenomics. Accordingly, the amplicon-based or metabarcoding approach, largely applied to investigate bacterial microbiomes, is moving to the eukaryotic world too. Indeed, the analysis of metabarcoding data may provide a comprehensive assessment of both bacterial and eukaryotic composition in a variety of environments, including human body. In this respect, whereas hypervariable regions of the 16S rRNA are the de facto standard barcode for bacteria, the Internal Transcribed Spacer 1 (ITS1) of ribosomal RNA gene cluster has shown a high potential in discriminating eukaryotes at deep taxonomic levels. As metabarcoding data analysis rely on the availability of a well-curated barcode reference resource, a comprehensive collection of ITS1 sequences supplied with robust taxonomies, is highly needed. To address this issue, we created ITSoneDB (available at http://itsonedb.cloud.ba.infn.it/) which in its current version hosts 985 240 ITS1 sequences spanning over 134 000 eukaryotic species. Each ITS1 is mapped on the NCBI reference taxonomy with its start and end positions precisely annotated. ITSoneDB has been developed in agreement to the FAIR guidelines by enabling the users to query and download its content through a simple web-interface and access relevant metadata by cross-linking to European Nucleotide Archive. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Comparison of the Sequences of the Internal Transcribed Spacer Regions and PbGP43 Genes of Paracoccidioides brasiliensis from Patients and Armadillos (Dasypus novemcinctus)

    Science.gov (United States)

    Hebeler-Barbosa, Flavia; Morais, Flavia V.; Montenegro, Mario R.; Kuramae, Eiko E.; Montes, Beatriz; McEwen, Juan G.; Bagagli, Eduardo; Puccia, Rosana

    2003-01-01

    Paracoccidioides brasiliensis isolates from 10 nine-banded armadillos (Dasypus novemcinctus) were comparable with 19 clinical isolates by sequence analysis of the PbGP43 gene and ribosomal internal transcribed spacer 1 (ITS1) and ITS2 and by random amplified polymorphic DNA. In this original ITS study, eight isolates differed by one or three sites among five total substitution sites. PMID:14662970

  19. Rapid and accurate identification of isolates of Candida species by melting peak and melting curve analysis of the internally transcribed spacer region 2 fragment (ITS2-MCA)

    NARCIS (Netherlands)

    Decat, E.; van Mechelen, E.; Saerens, B.; Vermeulen, S.J.T.; Boekhout, T.; de Blaiser, S.; Vaneechoutte, M.; Deschaght, P.

    2013-01-01

    Rapid identification of clinically important yeasts can facilitate the initiation of anti-fungal therapy, since susceptibility is largely species-dependent. We evaluated melting peak and melting curve analysis of the internally transcribed spacer region 2 fragment (ITS2-MCA) as an identification

  20. Authentication of ruta graveolens and its adulterant using internal transcribed spacer (its) sequences of nuclear ribosomal DNA

    International Nuclear Information System (INIS)

    Qurainy, F.A.; Khan, S.; Ali, M.A.; Hemaid, M.A.; Ashraf, M.

    2011-01-01

    Ruta graveolens L. (Rutaceae) is commonly known as 'Sudab' which is well known for hippocratic medicine and is commonly used in indigenous health-care system in India. Euphorbia dracunculoides Lam. (Euphorbiaceae) in raw drug trading has almost similar morphology to R. graveolens in dried state, is being sold locally or used clinically as an adulterant of R. graveolens (genuine) at a relatively low price under the same name 'Sudab' which has ultimately reduced the efficacy and quality of this herb. The internal transcribed spacer (ITS) sequence of nuclear ribosomal DNA gene of genuine and adulterant were sequenced and analyzed to assess species admixture in raw drug trading of genuine herbal drug. The BLAST search results of ITS sequence of genuine sample of 'Sudab' i.e., R. graveolens showed 99% similarity to the sequence of R. graveolens, however, E. dracunculoides showed 100% similarity to the species of Euphorbia and did not show any similarity with R. graveolens. The sequence alignment of both species was entirely different to each other. Phylogenetic analysis based on ITS sequence of adulterant sample i.e., E. dracunculoides together with sequences of Euphorbia species available in the GenBank has also clearly showed its nesting within the Euphorbia tree. The generated ITS sequences of both samples in the present study may be referred hereafter as species-specific DNA barcode signature, which can be used in authenticating and validating the exact species identities to discriminate the genuine sample of 'Sudab' from its adulterants if any available to guarantee the quality and purity of this drug in the herbal drug market. (author)

  1. Low variation in ribosomal DNA and internal transcribed spacers of the symbiotic fungi of leaf-cutting ants (Attini: Formicidae

    Directory of Open Access Journals (Sweden)

    Silva-Pinhati A.C.O.

    2004-01-01

    Full Text Available Leaf-cutting ants of the genera Atta and Acromyrmex (tribe Attini are symbiotic with basidiomycete fungi of the genus Leucoagaricus (tribe Leucocoprineae, which they cultivate on vegetable matter inside their nests. We determined the variation of the 28S, 18S, and 5.8S ribosomal DNA (rDNA gene loci and the rapidly evolving internal transcribed spacers 1 and 2 (ITS1 and ITS2 of 15 sympatric and allopatric fungi associated with colonies of 11 species of leafcutter ants living up to 2,600 km apart in Brazil. We found that the fungal rDNA and ITS sequences from different species of ants were identical (or nearly identical to each other, whereas 10 GenBank Leucoagaricus species showed higher ITS variation. Our findings suggest that Atta and Acromyrmex leafcutters living in geographic sites that are very distant from each other cultivate a single fungal species made up of closely related lineages of Leucoagaricus gongylophorus. We discuss the strikingly high similarity in the ITS1 and ITS2 regions of the Atta and Acromyrmex symbiotic L. gongylophorus studied by us, in contrast to the lower similarity displayed by their non-symbiotic counterparts. We suggest that the similarity of our L. gongylophorus isolates is an indication of the recent association of the fungus with these ants, and propose that both the intense lateral transmission of fungal material within leafcutter nests and the selection of more adapted fungal strains are involved in the homogenization of the symbiotic fungal stock.

  2. Relationships between 16S-23S rRNA gene internal transcribed spacer DNA and genomic DNA similarities in the taxonomy of phototrophic bacteria

    International Nuclear Information System (INIS)

    Okamura, K; Hisada, T; Takata, K; Hiraishi, A

    2013-01-01

    Rapid and accurate identification of microbial species is essential task in microbiology and biotechnology. In prokaryotic systematics, genomic DNA-DNA hybridization is the ultimate tool to determine genetic relationships among bacterial strains at the species level. However, a practical problem in this assay is that the experimental procedure is laborious and time-consuming. In recent years, information on the 16S-23S rRNA gene internal transcribed spacer (ITS) region has been used to classify bacterial strains at the species and intraspecies levels. It is unclear how much information on the ITS region can reflect the genome that contain it. In this study, therefore, we evaluate the quantitative relationship between ITS DNA and entire genomic DNA similarities. For this, we determined ITS sequences of several species of anoxygenic phototrophic bacteria belonging to the order Rhizobiales, and compared with DNA-DNA relatedness among these species. There was a high correlation between the two genetic markers. Based on the regression analysis of this relationship, 70% DNA-DNA relatedness corresponded to 92% ITS sequence similarity. This suggests the usefulness of the ITS sequence similarity as a criterion for determining the genospecies of the phototrophic bacteria. To avoid the effects of polymorphism bias of ITS on similarities, PCR products from all loci of ITS were used directly as genetic probes for comparison. The results of ITS DNA-DNA hybridization coincided well with those of genomic DNA-DNA relatedness. These collective data indicate that the whole ITS DNA-DNA similarity can be used as an alternative to genomic DNA-DNA similarity.

  3. Transcribing for Greater Musicality.

    Science.gov (United States)

    Hinz, Bob

    1995-01-01

    States that transcribing is notating the performance of a musical composition or improvisation as the music is grasped aurally. Maintains that transcribing is effective for high school and college students who want to understand jazz techniques. Includes eight suggestions for teaching transcribing. (CFR)

  4. Bladder tumor markers beyond cytology: International Consensus Panel on bladder tumor markers.

    NARCIS (Netherlands)

    Lokeshwar, V.B.; Habuchi, T.; Grossman, H.B.; Murphy, W.M.; Hautmann, S.H.; Hemstreet, G.P.; Bono, A.V.; Getzenberg, R.H.; Goebell, P.; Schmitz-Drager, B.J.; Schalken, J.A.; Fradet, Y.; Marberger, M.; Messing, E.; Droller, M.J.

    2005-01-01

    This is the first of 2 articles that summarize the findings of the International Consensus Panel on cytology and bladder tumor markers. The objectives of our panel were to reach a consensus on the areas where markers are needed, to define the attributes of an ideal tumor marker, and to identify

  5. Phylogeny of Alternaria fungi known to produce host-specific toxins on the basis of variation in internal transcribed spacers of ribosomal DNA.

    Science.gov (United States)

    Kusaba, M; Tsuge, T

    1995-10-01

    The internal transcribed spacer regions (ITS1 and ITS2) of ribosomal DNA from Alternaria species, including seven fungi known to produce host-specific toxins, were analyzed by polymerase chain reaction-amplification and direct sequencing. Phylogenetic analysis of the sequence data by the Neighbor-joining method showed that the seven toxin-producing fungi belong to a monophyletic group together with A. alternata. In contract, A. dianthi, A. panax, A. dauci, A. bataticola, A. porri, A. sesami and A. solani, species that can be morphologically distinguished from A. alternata, could be clearly separated from A. alternata by phylogenetic of the ITS variation. These results suggest that Alternaria pathogens which produce host-specific toxins are pathogenic variants within a single variable species, A. alternata.

  6. Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

    Science.gov (United States)

    Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

    1998-01-01

    Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

  7. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    Science.gov (United States)

    Sutton, Bruce D.; Steck, Gary J.; Norrbom, Allen L.; Rodriguez, Erick J.; Srivastava, Pratibha; Alvarado, Norma Nolazco; Colque, Fredy; Landa, Erick Yábar; Sánchez, Juan José Lagrava; Quisberth, Elizabeth; Peñaranda, Emilio Arévalo; Clavijo, P. A. Rodriguez; Alvarez-Baca, Jeniffer K.; Zapata, Tito Guevara; Ponce, Patricio

    2015-01-01

    Abstract The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The ITS1 regions of additional specimens (17 collections) from Central America (México, Guatemala, Costa Rica, and Panamá), Brazil, Caribbean Colombia, and coastal Venezuela were sequenced and together with published sequences (Paraguay) provided context for interpretation. A total of six ITS1 sequence variants were recognized in the Andean region comprising four groups. Type I predominates in the southernmost range of Anastrepha fraterculus. Type II predominates in its northernmost range. In the central and northern Andes, the geographic distributions overlap and interdigitate with a strong elevational effect. A discussion of relationships between observed ITS1 types and morphometric types is included. PMID:26798259

  8. Characterization of Biomphalaria orbignyi, Biomphalaria peregrina and Biomphalaria oligoza by polymerase chain reaction and restriction enzyme digestion of the internal transcribed spacer region of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Spatz Linus

    2000-01-01

    Full Text Available The correct identification of Biomphalaria oligoza, B. orbignyi and B. peregrina species is difficult due to the morphological similarities among them. B. peregrina is widely distributed in South America and is considered a potential intermediate host of Schistosoma mansoni. We have reported the use of the polymerase chain reaction and restriction fragment length polymorphism analysis of the internal transcribed spacer region of the ribosomal DNA for the molecular identification of these snails. The snails were obtained from different localities of Argentina, Brazil and Uruguay. The restriction patterns obtained with MvaI enzyme presented the best profile to identify the three species. The profiles obtained with all enzymes were used to estimate genetic similarities among B. oligoza, B. peregrina and B. orbignyi. This is also the first report of B. orbignyi in Uruguay.

  9. Sequence analysis of the 5.8S ribosomal DNA and internal transcribed spacers (ITS1 and ITS2) from five species of the Oxalis tuberosa alliance.

    Science.gov (United States)

    Tosto, D S; Hopp, H E

    1996-01-01

    The internal transcribed spacer region (ITS1 and ITS2) of the 18S-25S nuclear ribosomal DNA sequence and the intervening 5.8S region from five species of the genus Oxalis was amplified by polymerase chain reaction and subjected to direct DNA sequencing. On the basis of cytogenetic studies some species of this genus were postulated to be related by the number of chromosomes. Sequence homologies in the ITS1, 5.8S and ITS2 among species are in good agreement with previous relationships established on the basis of chromosome numbers. We also identified a highly conserved sequence of six bp in the ITS1, reported to be present in a wide range of flowering plants, but not in the Oxalidaceae family to which the genus Oxalis belongs to.

  10. Case Report. Internal transcribed spacer sequence based molecular confirmation and drug efficacy assessment against Toxascaris leonina (Linstow, 1909 infection in Asiatic lions (Panthera leo persica

    Directory of Open Access Journals (Sweden)

    Moudgil A. D.

    2017-06-01

    Full Text Available The eggs recovered during faecal screening of Asiatic lions (kept at MC Zoological Park, Punjab, India were delineated as Toxascaris leonina eggs based on morphometric and molecular studies (polymerase chain reaction targeting internal transcribed spacer sequences. Therapeutic management with fenbendazole @10 mg/kg body weight, once daily orally for three consecutive days proved ineffective with maximum faecal egg count reduction (FECR on day 3 post treatments (69.35 %. But, therapeutic intervention with extended period dose schedule (5 consecutive days with fenbendazole (@10 mg/kg body weight proved effective and showed a maximum FECR of 95.34 % at day 7 post treatments. But, when ivermectin (@100μg/kg body weight was given orally on three alternate days, proved effective as FECR of 95.74 % was recorded at day 7 post treatments. Thus, present study highlights the molecular confi rmation of T. leonina and its management using fenbendazole and ivermectin in Asiatic lions.

  11. Evolutionary history of Phakopsora pachyrhizi (the Asian soybean rust in Brazil based on nucleotide sequences of the internal transcribed spacer region of the nuclear ribosomal DNA

    Directory of Open Access Journals (Sweden)

    Maíra C. M. Freire

    2008-01-01

    Full Text Available Phakopsora pachyrhizi has dispersed globally and brought severe economic losses to soybean growers. The fungus has been established in Brazil since 2002 and is found nationwide. To gather information on the temporal and spatial patterns of genetic variation in P. pachyrhizi , we sequenced the nuclear internal transcribed spacer regions (ITS1 and ITS2. Total genomic DNA was extracted using either lyophilized urediniospores or lesions removed from infected leaves sampled from 26 soybean fields in Brazil and one field in South Africa. Cloning prior to sequencing was necessary because direct sequencing of PCR amplicons gave partially unreadable electrophoretograms with peak displacements suggestive of multiple sequences with length polymorphism. Sequences were determined from four clones per field. ITS sequences from African or Asian isolates available from the GenBank were included in the analyses. Independent sequence alignments of the ITS1 and ITS2 datasets identified 27 and 19 ribotypes, respectively. Molecular phylogeographic analyses revealed that ribotypes of widespread distribution in Brazil displayed characteristics of ancestrality and were shared with Africa and Asia, while ribotypes of rare occurrence in Brazil were indigenous. The results suggest P. pachyrhizi found in Brazil as originating from multiple, independent long-distance dispersal events.

  12. Rapid authentication of the precious herb saffron by loop-mediated isothermal amplification (LAMP) based on internal transcribed spacer 2 (ITS2) sequence.

    Science.gov (United States)

    Zhao, Mingming; Shi, Yuhua; Wu, Lan; Guo, Licheng; Liu, Wei; Xiong, Chao; Yan, Song; Sun, Wei; Chen, Shilin

    2016-05-05

    Saffron is one of the most expensive species of Chinese herbs and has been subjected to various types of adulteration because of its high price and limited production. The present study introduces a loop-mediated isothermal amplification (LAMP) technique for the differentiation of saffron from its adulterants. This novel technique is sensitive, efficient and simple. Six specific LAMP primers were designed on the basis of the nucleotide sequence of the internal transcribed spacer 2 (ITS2) nuclear ribosomal DNA of Crocus sativus. All LAMP amplifications were performed successfully, and visual detection occurred within 60 min at isothermal conditions of 65 °C. The results indicated that the LAMP primers are accurate and highly specific for the discrimination of saffron from its adulterants. In particular, 10 fg of genomic DNA was determined to be the limit for template accuracy of LAMP in saffron. Thus, the proposed novel, simple, and sensitive LAMP assay is well suited for immediate on-site discrimination of herbal materials. Based on the study, a practical standard operating procedure (SOP) for utilizing the LAMP protocol for herbal authentication is provided.

  13. Characterization of fungi in office dust: Comparing results of microbial secondary metabolites, fungal internal transcribed spacer region sequencing, viable culture and other microbial indices.

    Science.gov (United States)

    Park, J-H; Sulyok, M; Lemons, A R; Green, B J; Cox-Ganser, J M

    2018-05-04

    Recent developments in molecular and chemical methods have enabled the analysis of fungal DNA and secondary metabolites, often produced during fungal growth, in environmental samples. We compared 3 fungal analytical methods by analysing floor dust samples collected from an office building for fungi using viable culture, internal transcribed spacer (ITS) sequencing and secondary metabolites using liquid chromatography-tandem mass spectrometry. Of the 32 metabolites identified, 29 had a potential link to fungi with levels ranging from 0.04 (minimum for alternariol monomethylether) to 5700 ng/g (maximum for neoechinulin A). The number of fungal metabolites quantified per sample ranged from 8 to 16 (average = 13/sample). We identified 216 fungal operational taxonomic units (OTUs) with the number per sample ranging from 6 to 29 (average = 18/sample). We identified 37 fungal species using culture, and the number per sample ranged from 2 to 13 (average = 8/sample). Agreement in identification between ITS sequencing and culturing was weak (kappa = -0.12 to 0.27). The number of cultured fungal species poorly correlated with OTUs, which did not correlate with the number of metabolites. These suggest that using multiple measurement methods may provide an improved understanding of fungal exposures in indoor environments and that secondary metabolites may be considered as an additional source of exposure. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Genetic analysis of Fasciola isolates from cattle in Korea based on second internal transcribed spacer (ITS-2) sequence of nuclear ribosomal DNA.

    Science.gov (United States)

    Choe, Se-Eun; Nguyen, Thuy Thi-Dieu; Kang, Tae-Gyu; Kweon, Chang-Hee; Kang, Seung-Won

    2011-09-01

    Nuclear ribosomal DNA sequence of the second internal transcribed spacer (ITS-2) has been used efficiently to identify the liver fluke species collected from different hosts and various geographic regions. ITS-2 sequences of 19 Fasciola samples collected from Korean native cattle were determined and compared. Sequence comparison including ITS-2 sequences of isolates from this study and reference sequences from Fasciola hepatica and Fasciola gigantica and intermediate Fasciola in Genbank revealed seven identical variable sites of investigated isolates. Among 19 samples, 12 individuals had ITS-2 sequences completely identical to that of pure F. hepatica, five possessed the sequences identical to F. gigantica type, whereas two shared the sequence of both F. hepatica and F. gigantica. No variations in length and nucleotide composition of ITS-2 sequence were observed within isolates that belonged to F. hepatica or F. gigantica. At the position of 218, five Fasciola containing a single-base substitution (C>T) formed a distinct branch inside the F. gigantica-type group which was similar to those of Asian-origin isolates. The phylogenetic tree of the Fasciola spp. based on complete ITS-2 sequences from this study and other representative isolates in different locations clearly showed that pure F. hepatica, F. gigantica type and intermediate Fasciola were observed. The result also provided additional genetic evidence for the existence of three forms of Fasciola isolated from native cattle in Korea by genetic approach using ITS-2 sequence.

  15. Detection of sodium azide-induced mutagenicity in the regenerated shoots of artemisia annual L., using internal transcribed spacer (its) sequences of nrDNA

    International Nuclear Information System (INIS)

    Al-Qurainy, F.; Al-Hemaidi, F.M.; Khan, S.; Ali, M.A.; Tarroum, M.; Ashraf, M.

    2011-01-01

    Sodium azide (NaN/sub 3/) is a well known chemical mutagen which can effectively cause point mutation in plant genome. The mutagenicity by this potential mutagen was assessed in the regenerated mutant shoots of Artemisia annua using internal transcribed spacer (ITS) sequences of n rDNA. Insertions and/or deletions were detected in n rDNA-ITS sequences of all mutant shoots and compared with control ones using the ClustalX program. The regenerated shoots TS1 and TS2 had deleted bases, whereas TS3, TS4 and TS5 had insertions, because NaN/sub 3/ replaced the cytosine (C) by thymine (T) (C - T) (shoots; TS1 and TS4) and thymine (T) replaced by guanine (G) (T - G) (shoot; TS5), respectively. Artemisinin content was also measured in the regenerated six-week-old shoots of A. annua. All regenerated shoots had enhanced level of this compound as compared to that in the controls, being highest in the regenerated shoot TS3. (author)

  16. Identification of Giardia species and Giardia duodenalis assemblages by sequence analysis of the 5.8S rDNA gene and internal transcribed spacers.

    Science.gov (United States)

    Cacciò, Simone M; Beck, Relja; Almeida, Andre; Bajer, Anna; Pozio, Edoardo

    2010-05-01

    PCR assays have been developed mainly to assist investigations into the epidemiology of Giardia duodenalis, the only species in the Giardia genus having zoonotic potential. However, a reliable identification of all species is of practical importance, particularly when water samples and samples from wild animals are investigated. The aim of the present work was to genotype Giardia species and G. duodenalis assemblages using as a target the region spanning the 5.8S gene and the 2 flanking internal transcribed spacers (ITS1 and ITS2) of the ribosomal gene. Primers were designed to match strongly conserved regions in the 3' end of the small subunit and in the 5' end of the large subunit ribosomal genes. The corresponding region (about 310 bp) was amplified from 49 isolates of both human and animal origin, representing all G. duodenalis assemblages as well as G. muris and G. microti. Sequence comparison and phylogenetic analysis showed that G. ardeae, G. muris, G. microti as well as the 7 G. duodenalis assemblages can be easily distinguished. Since the major subgroups within the zoonotic assemblages A and B can be identified by sequence analysis, this assay is also informative for molecular epidemiological studies.

  17. Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

    Science.gov (United States)

    Su, Lei; Zhang, Qianqian; Gong, Jun

    2017-07-01

    Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

  18. Molecular phylogeny of 21 tropical bamboo species reconstructed by integrating non-coding internal transcribed spacer (ITS1 and 2) sequences and their consensus secondary structure.

    Science.gov (United States)

    Ghosh, Jayadri Sekhar; Bhattacharya, Samik; Pal, Amita

    2017-06-01

    The unavailability of the reproductive structure and unpredictability of vegetative characters for the identification and phylogenetic study of bamboo prompted the application of molecular techniques for greater resolution and consensus. We first employed internal transcribed spacer (ITS1, 5.8S rRNA and ITS2) sequences to construct the phylogenetic tree of 21 tropical bamboo species. While the sequence alone could grossly reconstruct the traditional phylogeny amongst the 21-tropical species studied, some anomalies were encountered that prompted a further refinement of the phylogenetic analyses. Therefore, we integrated the secondary structure of the ITS sequences to derive individual sequence-structure matrix to gain more resolution on the phylogenetic reconstruction. The results showed that ITS sequence-structure is the reliable alternative to the conventional phenotypic method for the identification of bamboo species. The best-fit topology obtained by the sequence-structure based phylogeny over the sole sequence based one underscores closer clustering of all the studied Bambusa species (Sub-tribe Bambusinae), while Melocanna baccifera, which belongs to Sub-Tribe Melocanneae, disjointedly clustered as an out-group within the consensus phylogenetic tree. In this study, we demonstrated the dependability of the combined (ITS sequence+structure-based) approach over the only sequence-based analysis for phylogenetic relationship assessment of bamboo.

  19. Identification of cultured isolates of clinically important yeast species using fluorescent fragment length analysis of the amplified internally transcribed rRNA spacer 2 region

    Directory of Open Access Journals (Sweden)

    Muylaert An

    2002-07-01

    Full Text Available Abstract Background The number of patients with yeast infection has increased during the last years. Also the variety of species of clinical importance has increased. Correct species identification is often important for efficient therapy, but is currently mostly based on phenotypic features and is sometimes time-consuming and depends largely on the expertise of technicians. Therefore, we evaluated the feasibility of PCR-based amplification of the internally transcribed spacer region 2 (ITS2, followed by fragment size analysis on the ABI Prism 310 for the identification of clinically important yeasts. Results A rapid DNA-extraction method, based on simple boiling-freezing was introduced. Of the 26 species tested, 22 could be identified unambiguously by scoring the length of the ITS2-region. No distinction could be made between the species Trichosporon asteroides and T. inkin or between T. mucoides and T. ovoides. The two varieties of Cryptococcus neoformans (var. neoformans and var. gattii could be differentiated from each other due to a one bp length difference of the ITS2 fragment. The three Cryptococcus laurentii isolates were split into two groups according to their ITS2-fragment lengths, in correspondence with the phylogenetic groups described previously. Since the obtained fragment lengths compare well to those described previously and could be exchanged between two laboratories, an internationally usable library of ITS2 fragment lengths can be constructed. Conclusions The existing ITS2 size based library enables identification of most of the clinically important yeast species within 6 hours starting from a single colony and can be easily updated when new species are described. Data can be exchanged between laboratories.

  20. DNA barcode and identification of the varieties and provenances of Taiwan's domestic and imported made teas using ribosomal internal transcribed spacer 2 sequences.

    Science.gov (United States)

    Lee, Shih-Chieh; Wang, Chia-Hsiang; Yen, Cheng-En; Chang, Chieh

    2017-04-01

    The major aim of made tea identification is to identify the variety and provenance of the tea plant. The present experiment used 113 tea plants [Camellia sinensis (L.) O. Kuntze] housed at the Tea Research and Extension Substation, from which 113 internal transcribed spacer 2 (ITS2) fragments, 104 trnL intron, and 98 trnL-trnF intergenic sequence region DNA sequences were successfully sequenced. The similarity of the ITS2 nucleotide sequences between tea plants housed at the Tea Research and Extension Substation was 0.379-0.994. In this polymerase chain reaction-amplified noncoding region, no varieties possessed identical sequences. Compared with the trnL intron and trnL-trnF intergenic sequence fragments of chloroplast cpDNA, the proportion of ITS2 nucleotide sequence variation was large and is more suitable for establishing a DNA barcode database to identify tea plant varieties. After establishing the database, 30 imported teas and 35 domestic made teas were used in this model system to explore the feasibility of using ITS2 sequences to identify the varieties and provenances of made teas. A phylogenetic tree was constructed using ITS2 sequences with the unweighted pair group method with arithmetic mean, which indicated that the same variety of tea plant is likely to be successfully categorized into one cluster, but contamination from other tea plants was also detected. This result provides molecular evidence that the similarity between important tea varieties in Taiwan remains high. We suggest a direct, wide collection of made tea and original samples of tea plants to establish an ITS2 sequence molecular barcode identification database to identify the varieties and provenances of tea plants. The DNA barcode comparison method can satisfy the need for a rapid, low-cost, frontline differentiation of the large amount of made teas from Taiwan and abroad, and can provide molecular evidence of their varieties and provenances. Copyright © 2016. Published by Elsevier B.V.

  1. Myxobolus cerebralis internal transcribed spacer 1 (ITS-1) sequences support recent spread of the parasite to North America and within Europe

    Science.gov (United States)

    Whipps, Christopher M.; El-Matbouli, M.; Hedrick, R.P.; Blazer, V.; Kent, M.L.

    2004-01-01

    Molecular approaches for resolving relationships among the Myxozoa have relied mainly on small subunit (SSU) ribosomal DNA (rDNA) sequence analysis. This region of the gene is generally used for higher phylogenetic studies, and the conservative nature of this gene may make it inadequate for intraspecific comparisons. Previous intraspecific studies of Myxobolus cerebralis based on molecular analyses reported that the sequence of SSU rDNA and the internal transcribed spacer (ITS) were highly conserved in representatives of the parasite from North America and Europe. Considering that the ITS is usually a more variable region than the SSU, we reanalyzed available sequences on GenBank and obtained sequences from other M. cerebralis representatives from the states of California and West Virginia in the USA and from Germany and Russia. With the exception of 7 base pairs, most of the sequence designated as ITS-1 in GenBank was a highly conserved portion of the rDNA near the 3-prime end of the SSU region. Nonetheless, the additional ITS-1 sequences obtained from the available geographic representatives were well conserved. It is unlikely that we would have observed virtually identical ITS-1 sequences between European and American M. cerebralis samples had it spread naturally over time, particularly when compared to the variation seen between isolates of another myxozoan (Kudoa thyrsites) that has most likely spread naturally. These data further support the hypothesis that the current distribution of M. cerebralis in North America is a result of recent introductions followed by dispersal via anthropogenic means, largely through the stocking of infected trout for sport fishing.

  2. Motif signatures of transcribed enhancers

    KAUST Repository

    Kleftogiannis, Dimitrios A.; Ashoor, Haitham; Zarokanellos, Nikolaos; Bajic, Vladimir B.

    2017-01-01

    In mammalian cells, transcribed enhancers (TrEn) play important roles in the initiation of gene expression and maintenance of gene expression levels in spatiotemporal manner. One of the most challenging questions in biology today is how the genomic

  3. The internal transcribed spacer (ITS region and trnH-psbA [corrected] are suitable candidate loci for DNA barcoding of tropical tree species of India.

    Directory of Open Access Journals (Sweden)

    Abhinandan Mani Tripathi

    Full Text Available DNA barcoding as a tool for species identification has been successful in animals and other organisms, including certain groups of plants. The exploration of this new tool for species identification, particularly in tree species, is very scanty from biodiversity-rich countries like India. rbcL and matK are standard barcode loci while ITS, and trnH-psbA are considered as supplementary loci for plants.Plant barcode loci, namely, rbcL, matK, ITS, trnH-psbA, and the recently proposed ITS2, were tested for their efficacy as barcode loci using 300 accessions of tropical tree species. We tested these loci for PCR, sequencing success, and species discrimination ability using three methods. rbcL was the best locus as far as PCR and sequencing success rate were concerned, but not for the species discrimination ability of tropical tree species. ITS and trnH-psbA were the second best loci in PCR and sequencing success, respectively. The species discrimination ability of ITS ranged from 24.4 percent to 74.3 percent and that of trnH-psbA was 25.6 percent to 67.7 percent, depending upon the data set and the method used. matK provided the least PCR success, followed by ITS2 (59. 0%. Species resolution by ITS2 and rbcL ranged from 9.0 percent to 48.7 percent and 13.2 percent to 43.6 percent, respectively. Further, we observed that the NCBI nucleotide database is poorly represented by the sequences of barcode loci studied here for tree species.Although a conservative approach of a success rate of 60-70 percent by both ITS and trnH-psbA may not be considered as highly successful but would certainly help in large-scale biodiversity inventorization, particularly for tropical tree species, considering the standard success rate of plant DNA barcode program reported so far. The recommended matK and rbcL primers combination may not work in tropical tree species as barcode markers.

  4. Identification of planorbids from Venezuela by polymerase chain reaction amplification and restriction fragment length polymorphism of internal transcriber spacer of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2000-01-01

    Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.

  5. International scientific communications in the field of colorectal tumour markers.

    Science.gov (United States)

    Ivanov, Krasimir; Donev, Ivan

    2017-05-27

    To analyze scientometrically the dynamic science internationalization on colorectal tumour markers as reflected in five information portals and to outline the significant journals, scientists and institutions. A retrospective problem-oriented search was performed in Web of Science Core Collection (WoS), MEDLINE, BIOSIS Citation Index (BIOSIS) and Scopus for 1986-2015 as well as in Dervent Innovations Index (Derwent) for 1995-2015. Several specific scientometric parameters of the publication output and citation activity were comparatively analyzed. The following scientometric parameters were analyzed: (1) annual dynamics of publications; (2) scientific institutions; (3) journals; (4) authors; (5) scientific forums; (6) patents - number of patents, names and countries of inventors, and (7) citations (number of citations to publications by single authors received in WoS, BIOSIS Citation Index and Scopus). There is a trend towards increasing publication output on colorectal tumour markers worldwide along with high citation rates. Authors from 70 countries have published their research results in journals and conference proceedings in 21 languages. There is considerable country stratification similar to that in most systematic investigations. The information provided to end users and scientometricians varies between these data-bases in terms of most parameters due to different journal coverage, indexing systems and editorial policy. The lists of the so-called "core" journals and most productive authors in WoS, BIOSIS, MEDLINE and Scopus along with the list of the most productive authors - inventors in Derwent present a particular interest to the beginners in the field, the institutional and national science managers and the journal editorial board members. The role of the purposeful assessment of scientific forums and patents is emphasized. Our results along with this problem-oriented collection containing the researchers' names, addresses and publications could

  6. Retention of external and internal markers by southern pine beetles (Coleoptera: Scolytidae) during gallery

    Science.gov (United States)

    Douglas J. Rhodes; Jane Leslie Hayes; Chris Steiner

    1998-01-01

    If retained, markers used in mark-release-recapture studies of bark beetle dispersal could provide valuable tools in the determination of post-dispersal fate. Retention of the internal marker rubidium (Rb) and of the external marker fluorescent powder during egg gallery construction, oviposition, and feeding were quantified at intervals from 0 to 96 hours by allowing...

  7. Population Structure of the Primary Malaria Vector in South America, Anopheles darlingi, Using Isozyme, Random Amplified Polymorphic DNA, Internal Transcribed Spacer 2, and Morphologic Markers

    Science.gov (United States)

    1999-01-01

    401 16 to Jan E. Conn for the ITS2 sequencing, by Consejo National de Investigaciones Cientificas y Tecnologicas (MPS-RPIV-130032-9), and the Pan... Investigaciones , Escuela de Malariologia y Saneamiento Ambiental, Maracay, Venezuela Abstract. A genetic and morphologic survey of Anopheles darlingi...0086. Yasmin Rubio-Palis, Division de Investigaciones , Escuela de Malariologia y Saneamiento Ambiental Dr. Arnold0 Ga- baldon, Apartado 2073

  8. Motif signatures of transcribed enhancers

    KAUST Repository

    Kleftogiannis, Dimitrios

    2017-09-14

    In mammalian cells, transcribed enhancers (TrEn) play important roles in the initiation of gene expression and maintenance of gene expression levels in spatiotemporal manner. One of the most challenging questions in biology today is how the genomic characteristics of enhancers relate to enhancer activities. This is particularly critical, as several recent studies have linked enhancer sequence motifs to specific functional roles. To date, only a limited number of enhancer sequence characteristics have been investigated, leaving space for exploring the enhancers genomic code in a more systematic way. To address this problem, we developed a novel computational method, TELS, aimed at identifying predictive cell type/tissue specific motif signatures. We used TELS to compile a comprehensive catalog of motif signatures for all known TrEn identified by the FANTOM5 consortium across 112 human primary cells and tissues. Our results confirm that distinct cell type/tissue specific motif signatures characterize TrEn. These signatures allow discriminating successfully a) TrEn from random controls, proxy of non-enhancer activity, and b) cell type/tissue specific TrEn from enhancers expressed and transcribed in different cell types/tissues. TELS codes and datasets are publicly available at http://www.cbrc.kaust.edu.sa/TELS.

  9. The correlation between internal and external markers for abdominal tumors: Implications for respiratory gating

    International Nuclear Information System (INIS)

    Gierga, David P.; Brewer, Johanna; Sharp, Gregory C.; Betke, Margrit; Willett, Christopher G.; Chen, George T.Y.

    2005-01-01

    Purpose: The correlation of the respiratory motion of external patient markers and abdominal tumors was examined. Data of this type are important for image-guided therapy techniques, such as respiratory gating, that monitor the movement of external fiducials. Methods and Materials: Fluoroscopy sessions for 4 patients with internal, radiopaque tumor fiducial clips were analyzed by computer vision techniques. The motion of the internal clips and the external markers placed on the patient's abdominal skin surface were quantified and correlated. Results: In general, the motion of the tumor and external markers were well correlated. The maximum amount of peak-to-peak craniocaudal tumor motion was 2.5 cm. The ratio of tumor motion to external-marker motion ranged from 0.85 to 7.1. The variation in tumor position for a given external-marker position ranged from 2 to 9 mm. The period of the breathing cycle ranged from 2.7 to 4.5 seconds, and the frequency patterns for both the tumor and the external markers were similar. Conclusions: Although tumor motion generally correlated well with external fiducial marker motion, relatively large underlying tumor motion can occur compared with external-marker motion and variations in the tumor position for a given marker position. Treatment margins should be determined on the basis of a detailed understanding of tumor motion, as opposed to relying only on external-marker information

  10. Markers

    Science.gov (United States)

    Healthy Schools Network, Inc., 2011

    2011-01-01

    Dry erase whiteboards come with toxic dry erase markers and toxic cleaning products. Dry erase markers labeled "nontoxic" are not free of toxic chemicals and can cause health problems. Children are especially vulnerable to environmental health hazards; moreover, schools commonly have problems with indoor air pollution, as they are more densely…

  11. Misidentification of Aspergillus nomius and Aspergillus tamarii as Aspergillus flavus: characterization by internal transcribed spacer, β-Tubulin, and calmodulin gene sequencing, metabolic fingerprinting, and matrix-assisted laser desorption ionization-time of flight mass spectrometry.

    Science.gov (United States)

    Tam, Emily W T; Chen, Jonathan H K; Lau, Eunice C L; Ngan, Antonio H Y; Fung, Kitty S C; Lee, Kim-Chung; Lam, Ching-Wan; Yuen, Kwok-Yung; Lau, Susanna K P; Woo, Patrick C Y

    2014-04-01

    Aspergillus nomius and Aspergillus tamarii are Aspergillus species that phenotypically resemble Aspergillus flavus. In the last decade, a number of case reports have identified A. nomius and A. tamarii as causes of human infections. In this study, using an internal transcribed spacer, β-tubulin, and calmodulin gene sequencing, only 8 of 11 clinical isolates reported as A. flavus in our clinical microbiology laboratory by phenotypic methods were identified as A. flavus. The other three isolates were A. nomius (n = 2) or A. tamarii (n = 1). The results corresponded with those of metabolic fingerprinting, in which the A. flavus, A. nomius, and A. tamarii strains were separated into three clusters based on ultra-high-performance liquid chromatography-tandem mass spectrometry (UHPLC MS) analysis. The first two patients with A. nomius infections had invasive aspergillosis and chronic cavitary and fibrosing pulmonary and pleural aspergillosis, respectively, whereas the third patient had A. tamarii colonization of the airway. Identification of the 11 clinical isolates and three reference strains by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) showed that only six of the nine strains of A. flavus were identified correctly. None of the strains of A. nomius and A. tamarii was correctly identified. β-Tubulin or the calmodulin gene should be the gene target of choice for identifying A. flavus, A. nomius, and A. tamarii. To improve the usefulness of MALDI-TOF MS, the number of strains for each species in MALDI-TOF MS databases should be expanded to cover intraspecies variability.

  12. Misidentification of Aspergillus nomius and Aspergillus tamarii as Aspergillus flavus: Characterization by Internal Transcribed Spacer, β-Tubulin, and Calmodulin Gene Sequencing, Metabolic Fingerprinting, and Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry

    Science.gov (United States)

    Tam, Emily W. T.; Chen, Jonathan H. K.; Lau, Eunice C. L.; Ngan, Antonio H. Y.; Fung, Kitty S. C.; Lee, Kim-Chung; Lam, Ching-Wan; Yuen, Kwok-Yung

    2014-01-01

    Aspergillus nomius and Aspergillus tamarii are Aspergillus species that phenotypically resemble Aspergillus flavus. In the last decade, a number of case reports have identified A. nomius and A. tamarii as causes of human infections. In this study, using an internal transcribed spacer, β-tubulin, and calmodulin gene sequencing, only 8 of 11 clinical isolates reported as A. flavus in our clinical microbiology laboratory by phenotypic methods were identified as A. flavus. The other three isolates were A. nomius (n = 2) or A. tamarii (n = 1). The results corresponded with those of metabolic fingerprinting, in which the A. flavus, A. nomius, and A. tamarii strains were separated into three clusters based on ultra-high-performance liquid chromatography-tandem mass spectrometry (UHPLC MS) analysis. The first two patients with A. nomius infections had invasive aspergillosis and chronic cavitary and fibrosing pulmonary and pleural aspergillosis, respectively, whereas the third patient had A. tamarii colonization of the airway. Identification of the 11 clinical isolates and three reference strains by matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) showed that only six of the nine strains of A. flavus were identified correctly. None of the strains of A. nomius and A. tamarii was correctly identified. β-Tubulin or the calmodulin gene should be the gene target of choice for identifying A. flavus, A. nomius, and A. tamarii. To improve the usefulness of MALDI-TOF MS, the number of strains for each species in MALDI-TOF MS databases should be expanded to cover intraspecies variability. PMID:24452174

  13. Distanced Data: Transcribing Other People's Research Tapes

    Science.gov (United States)

    Tilley, Susan A.; Powick, Kelly D.

    2004-01-01

    In this article, we report on our qualitative study involving eight individuals hired to transcribe research tapes in university contexts. We consider issues of data analysis and data trustworthiness and the implications for both when transcription is assigned to someone other than the researcher. We explore the challenges transcribers faced…

  14. Comparison of sequencing the D2 region of the large subunit ribosomal RNA gene (MicroSEQ®) versus the internal transcribed spacer (ITS) regions using two public databases for identification of common and uncommon clinically relevant fungal species.

    Science.gov (United States)

    Arbefeville, S; Harris, A; Ferrieri, P

    2017-09-01

    Fungal infections cause considerable morbidity and mortality in immunocompromised patients. Rapid and accurate identification of fungi is essential to guide accurately targeted antifungal therapy. With the advent of molecular methods, clinical laboratories can use new technologies to supplement traditional phenotypic identification of fungi. The aims of the study were to evaluate the sole commercially available MicroSEQ® D2 LSU rDNA Fungal Identification Kit compared to the in-house developed internal transcribed spacer (ITS) regions assay in identifying moulds, using two well-known online public databases to analyze sequenced data. 85 common and uncommon clinically relevant fungi isolated from clinical specimens were sequenced for the D2 region of the large subunit (LSU) of ribosomal RNA (rRNA) gene with the MicroSEQ® Kit and the ITS regions with the in house developed assay. The generated sequenced data were analyzed with the online GenBank and MycoBank public databases. The D2 region of the LSU rRNA gene identified 89.4% or 92.9% of the 85 isolates to the genus level and the full ITS region (f-ITS) 96.5% or 100%, using GenBank or MycoBank, respectively, when compared to the consensus ID. When comparing species-level designations to the consensus ID, D2 region of the LSU rRNA gene aligned with 44.7% (38/85) or 52.9% (45/85) of these isolates in GenBank or MycoBank, respectively. By comparison, f-ITS possessed greater specificity, followed by ITS1, then ITS2 regions using GenBank or MycoBank. Using GenBank or MycoBank, D2 region of the LSU rRNA gene outperformed phenotypic based ID at the genus level. Comparing rates of ID between D2 region of the LSU rRNA gene and the ITS regions in GenBank or MycoBank at the species level against the consensus ID, f-ITS and ITS2 exceeded performance of the D2 region of the LSU rRNA gene, but ITS1 had similar performance to the D2 region of the LSU rRNA gene using MycoBank. Our results indicated that the MicroSEQ® D2 LSU r

  15. Manuscript Transcription by Crowdsourcing: Transcribe Bentham

    Directory of Open Access Journals (Sweden)

    Martin Moyle

    2011-02-01

    Full Text Available Transcribe Bentham is testing the feasibility of outsourcing the work of manuscript transcription to members of the public. UCL Library Services holds 60,000 folios of manuscripts of the philosopher and jurist Jeremy Bentham (1748–1832. Transcribe Bentham will digitise 12,500 Bentham folios, and, through a wiki-based interface, allow volunteer transcribers to take temporary ownership of manuscript images and to create TEI-encoded transcription text for final approval by UCL experts. Approved transcripts will be stored and preserved, with the manuscript images, in UCL’s public Digital Collections repository. The project makes innovative use of traditional library material. It will stimulate public engagement with UCL’s scholarly archive collections and the challenges of palaeography and manuscript transcription; it will raise the profile of the work and thought of Jeremy Bentham; and it will create new digital resources for future use by professional researchers. Towards the end of the project, the transcription tool will be made available to other projects and services. This paper is based on a presentation given by the lead author at LIBER’s 39th Annual General Conference in Aarhus, Denmark, 2010.

  16. The use of biochemical markers of bone remodeling in multiple myeloma: a report of the International Myeloma Working Group

    DEFF Research Database (Denmark)

    Terpos, E; Dimopoulos, M A; Sezer, O

    2010-01-01

    progression and overall survival. Bone markers have also been used for the early diagnosis of bone lesions. This International Myeloma Working Group report summarizes the existing data for the role of bone markers in assessing the extent of MM bone disease and in monitoring bone turnover during anti...

  17. Long-term Bias of Internal Markers in Sheep and Goat Digestion Trials

    Directory of Open Access Journals (Sweden)

    Gleidson Giordano Pinto de Carvalho

    2013-01-01

    Full Text Available Two digestion trials, one with sheep and another with goats, were conducted to evaluate the long-term bias (LTB of the indigestible dry matter (iDM, indigestible neutral detergent fiber (iNDF and indigestible acid detergent fiber (iADF internal markers. The study used eight Santa Inês castrated male sheep (average body weight of 16.6 kg distributed in two 4×4 Latin squares and eight Saanen castrated male goats (average body weight of 22.6 kg distributed in two 4×4 Latin squares. The experiments were conducted simultaneously, and the animals were housed in 1.2 m2 individual pens with wood-battened floors equipped with individual feeders and drinkers. The animals received isonitrogenous diets that were offered ad libitum and contained 14% crude protein and 70% sugar cane (with 0, 0.75, 1.5 or 2.25% CaO, in natural matter percentage, corrected with 1% urea and 30% concentrate. The experiment consisted of four experimental periods of 14 d each, with the feed, leftovers and feces sampled on the last four days of each period. The marker concentrations in the feed, leftovers and fecal samples were estimated by an in situ ruminal incubation procedure with a duration 240 h. The relationship between the intake and excretion of the markers was obtained by adjusting a simple linear regression model, independently from the treatment (diets fixed effects and Latin squares. For both the sheep and goats, a complete recovery of the iDM and iNDF markers was observed (p>0.05, indicating the absence of LTB for these markers. However, the iADF was not completely recovered, exhibiting an LTB of −9.12% (p<0.05 in the sheep evaluation and −3.02% (p<0.05 in the goat evaluation.

  18. Molecular markers predicting radiotherapy response: Report and recommendations from an International Atomic Energy Agency technical meeting

    International Nuclear Information System (INIS)

    West, Catharine M.L.; McKay, Michael J.; Hoelscher, Tobias; Baumann, Michael; Stratford, Ian J.; Bristow, Robert G.; Iwakawa, Mayumi; Imai, Takashi; Zingde, Surekha M.; Anscher, Mitchell S.; Bourhis, Jean; Begg, Adrian C.; Haustermans, Karin; Bentzen, Soren M.; Hendry, Jolyon H.

    2005-01-01

    Purpose: There is increasing interest in radiogenomics and the characterization of molecular profiles that predict normal tissue and tumor radioresponse. A meeting in Amsterdam was organized by the International Atomic Energy Agency to discuss this topic on an international basis. Methods and Materials: This report is not completely exhaustive, but highlights some of the ongoing studies and new initiatives being carried out worldwide in the banking of tumor and normal tissue samples underpinning the development of molecular marker profiles for predicting patient response to radiotherapy. It is generally considered that these profiles will more accurately define individual or group radiosensitivities compared with the nondefinitive findings from the previous era of cellular-based techniques. However, so far there are only a few robust reports of molecular markers predicting normal tissue or tumor response. Results: Many centers in different countries have initiated tissue and tumor banks to store samples from clinical trials for future molecular profiling analysis, to identify profiles that predict for radiotherapy response. The European Society for Therapeutic Radiology and Oncology GENEtic pathways for the Prediction of the effects of Irradiation (GENEPI) project, to store, document, and analyze sample characteristics vs. response, is the most comprehensive in this regard. Conclusions: The next 5-10 years are likely to see the results of these and other correlative studies, and promising associations of profiles with response should be validated in larger definitive trials

  19. Clinical use of computed tomography and surface markers to assist internal fixation within the equine hoof.

    Science.gov (United States)

    Gasiorowski, Janik C; Richardson, Dean W

    2015-02-01

    To describe clinical use of computed tomography (CT) and hoof surface markers to facilitate internal fixation within the confines of the hoof wall. Retrospective case series. Horses (n = 16) that had CT-guided internal fixation of the distal phalanx (DP) or distal sesamoid bone (DSB). Drill bit entry point and direction were planned from CT image series performed on hooves with grids of barium paste dots at proposed entry and projected exit sites. Post-implantation CT images were obtained to check screw position and length as well as fracture reduction. Imaging, reduction, and surgical and general anesthesia times were evaluated. Outcome was recorded. Screw position and length were considered near optimal in all horses, with no consequential malposition of bits or screws. Fracture reduction was evident in all cases. Preoperative planning times (at least 2 CT image acquisitions and grid creation) ranged from 10 to 20 minutes. Surgery time ranged from 45 to 90 minutes (mean, 61 minutes) and general anesthesia time ranged from 115 to 220 minutes (mean, 171 minutes). The combination of CT and surface marker grids allowed accurate positioning of screws in clinical DP and DSB fractures. The technique was simple and rapid. An aiming device is useful for the technique. © Copyright 2014 by The American College of Veterinary Surgeons.

  20. Forensic botany II, DNA barcode for land plants: Which markers after the international agreement?

    Science.gov (United States)

    Ferri, G; Corradini, B; Ferrari, F; Santunione, A L; Palazzoli, F; Alu', M

    2015-03-01

    The ambitious idea of using a short piece of DNA for large-scale species identification (DNA barcoding) is already a powerful tool for scientists and the application of this standard technique seems promising in a range of fields including forensic genetics. While DNA barcoding enjoyed a remarkable success for animal identification through cytochrome c oxidase I (COI) analysis, the attempts to identify a single barcode for plants remained a vain hope for a longtime. From the beginning, the Consortium for the Barcode of Life (CBOL) showed a lack of agreement on a core plant barcode, reflecting the diversity of viewpoints. Different research groups advocated various markers with divergent set of criteria until the recent publication by the CBOL-Plant Working Group. After a four-year effort, in 2009 the International Team concluded to agree on standard markers promoting a multilocus solution (rbcL and matK), with 70-75% of discrimination to the species level. In 2009 our group firstly proposed the broad application of DNA barcoding principles as a tool for identification of trace botanical evidence through the analysis of two chloroplast loci (trnH-psbA and trnL-trnF) in plant species belonging to local flora. Difficulties and drawbacks that were encountered included a poor coverage of species in specific databases and the lack of authenticated reference sequences for the selected markers. Successful preliminary results were obtained providing an approach to progressively identify unknown plant specimens to a given taxonomic rank, usable by any non-specialist botanist or in case of a shortage of taxonomic expertise. Now we considered mandatory to update and to compare our previous findings with the new selected plastid markers (matK+rbcL), taking into account forensic requirements. Features of all the four loci (the two previously analyzed trnH-psbA+trnL-trnF and matK+rbcL) were compared singly and in multilocus solutions to assess the most suitable combination for

  1. Internal Transcribed Spacer (ITS), an ideal DNA barcode for species ...

    African Journals Online (AJOL)

    Background: DNA barcoding is a technique used to identify species based on species-specific differences in short regions of their DNA. It is widely used in species discrimination of medicinal plants and traditional medicines. Materials and Methods: In the present study, four potential DNA barcodes, namely rbcL, matK, ...

  2. 5. international workshop on the identification of transcribed sequences

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-12-31

    This workshop was held November 5--8, 1995 in Les Embiez, France. The purpose of this conference was to provide a multidisciplinary forum for exchange of state-of-the-art information on mapping the human genome. Attention is focused on the following topics: transcriptional maps; functional analysis; techniques; model organisms; and tissue specific libraries and genes. Abstracts are included of the papers that were presented.

  3. National survey on internal quality control for tumour markers in clinical laboratories in China.

    Science.gov (United States)

    Wang, Wei; Zhong, Kun; Yuan, Shuai; He, Falin; Du, Yuxuan; Hu, Zhehui; Wang, Zhiguo

    2018-06-15

    This survey was initiated to obtain knowledge on the current situation of internal quality control (IQC) practice for tumour markers (TMs) in China. Additionally, we tried to acquire the most appropriate quality specifications. This survey was a current status survey. The IQC information had been collected via online questionnaires. All of 1821 clinical laboratories which participated in the 2016 TMs external quality assessment (EQA) programme had been enrolled. The imprecision evaluation criteria were the minimal, desirable, and optimal allowable imprecisions based on biological variations, and 1/3 total allowable error (TEa) and 1/4 TEa. A total of 1628 laboratories answered the questionnaires (89%). The coefficients of variation (CVs) of the IQC of participant laboratories varied greatly from 1% (5 th percentile) to 13% (95 th percentile). More than 82% (82 - 91%) of participant laboratories two types of CVs met 1/3 TEa except for CA 19-9. The percentiles of current CVs were smaller than cumulative CVs. A number of 1240 laboratories (76%) reported their principles and systems used. The electrochemiluminescence was the most used principle (45%) and had the smallest CVs. The performance of laboratories for TMs IQC has yet to be improved. On the basis of the obtained results, 1/3 TEa would be realistic and attainable quality specification for TMs IQC for clinical laboratories in China.

  4. Influence of different breathing maneuvers on internal and external organ motion: Use of fiducial markers in dynamic MRI

    International Nuclear Information System (INIS)

    Plathow, Christian; Zimmermann, Hendrik; Fink, Christian; Umathum, Reiner; Schoebinger, Max; Huber, Peter; Zuna, Ivan; Debus, Juergen; Schlegel, Wolfgang; Meinzer, Hans-Peter; Semmler, Wolfhard; Kauczor, Hans-Ulrich; Bock, Michael

    2005-01-01

    Purpose: To investigate, with dynamic magnetic resonance imaging (dMRI) and a fiducial marker, the influence of different breathing maneuvers on internal organ and external chest wall motion. Methods and materials: Lung and chest wall motion of 16 healthy subjects (13 male, 3 female) were examined with real-time trueFISP (true fast imaging with steady-state precession) dMRI and a small inductively coupled marker coil on either the abdomen or thorax. Three different breathing maneuvers were performed (predominantly 'abdominal breathing,' 'thoracic breathing,' and unspecific 'normal breathing'). The craniocaudal (CC), anteroposterior (AP), and mediolateral (ML) lung distances were correlated (linear regression coefficient) with marker coil position during forced and quiet breathing. Results: Differences of the CC distance between maximum forced inspiration and expiration were significant between abdominal and thoracic breathing (p < 0.05). The correlation between CC distance and coil position was best for forced abdominal breathing and a marker coil in the abdominal position (r 0.89 ± 0.04); for AP and ML distance, forced thoracic breathing and a coil in the thoracic position was best (r = 0.84 ± 0.03 and 0.82 ± 0.03, respectively). In quiet breathing, a lower correlation was found. Conclusion: A fiducial marker coil external to the thorax in combination with dMRI is a new technique to yield quantitative information on the correlation of internal organ and external chest wall motion. Correlations are highly dependent on the breathing maneuver

  5. A revised nomenclature for transcribed human endogenous retroviral loci

    Science.gov (United States)

    2011-01-01

    Background Endogenous retroviruses (ERVs) and ERV-like sequences comprise 8% of the human genome. A hitherto unknown proportion of ERV loci are transcribed and thus contribute to the human transcriptome. A small proportion of these loci encode functional proteins. As the role of ERVs in normal and diseased biological processes is not yet established, transcribed ERV loci are of particular interest. As more transcribed ERV loci are likely to be identified in the near future, the development of a systematic nomenclature is important to ensure that all information on each locus can be easily retrieved. Results Here we present a revised nomenclature of transcribed human endogenous retroviral loci that sorts loci into groups based on Repbase classifications. Each symbol is of the format ERV + group symbol + unique number. Group symbols are based on a mixture of Repbase designations and well-supported symbols used in the literature. The presented guidelines will allow newly identified loci to be easily incorporated into the scheme. Conclusions The naming system will be employed by the HUGO Gene Nomenclature Committee for naming transcribed human ERV loci. We hope that the system will contribute to clarifying a certain aspect of a sometimes confusing nomenclature for human endogenous retroviruses. The presented system may also be employed for naming transcribed loci of human non-ERV repeat loci. PMID:21542922

  6. Predictors, Quality Markers, and Economics of Volunteering Internationally: Results from a Comprehensive Survey of American Society of Plastic Surgeons Members.

    Science.gov (United States)

    McIntyre, Joyce K; Schoenbrunner, Anna R; Kelley, Kristen D; Gosman, Amanda A

    2017-09-01

    Plastic surgeons have a long history of international volunteer work. To date, there have been no outcome-based studies among surgeons who volunteer internationally. The purpose of this study was to describe predictors of volunteering, clinical quality markers, and economics of international volunteering among American plastic surgeons. A cross-sectional validated e-mail survey tool was sent to all board-certified plastic surgeons by the American Society of Plastic Surgeons. The survey response rate was 15 percent (745 total individuals), of which 283 respondents traveled within the past 5 years. Analysis was performed in R. Stepwise multivariate logistic regression was performed to determine the predictors of death/complication. Respondents reported high use of medical records, follow-up care, and host affiliation. Fewer than half of all respondents reported use of international safety surgery guidelines, and the majority of respondents reported volunteering abroad outside of their scope of practice. The majority of children younger than 5 years were not cared for by a pediatric anesthesiologist. The majority of participants reported personally spending more than $1000 on their last trip and performing surgery estimated to be worth on average $28,000 each. International surgical volunteer trips attempt to ease the global burden of surgical disease. The authors' study reports variation in quality of care provided on these trips. Most significantly, the majority of children younger than 5 years were not cared for by a pediatric anesthesiologist, and many plastic surgeons operated outside of their scope of practice.

  7. Splenomegaly and tumor marker response following selective internal radiation therapy for non-resectable liver metastases from neuroendocrine tumor

    International Nuclear Information System (INIS)

    Shehata, M.; Yan, K.; Itoh, Seiji; King, J.; Glenn, D.; Quinn, R.; Morris, D.L.

    2009-01-01

    The aim of this study was to investigate changes in spleen size, the level of chromogranin A as a tumor marker, and the relationship between these two parameters before and 3 months after selective internal radiation therapy (SIRT) for non-resectable liver metastases from neuroendocrine tumor (NET). Our first serious adverse event with this relatively new treatment is also discussed. A retrospective review of a prospective database identified patients with non-resectable liver metastases from NET who underwent SIRT between 2003 and 2007. Patients who underwent CT scans before and 3 months after treatment were included. The patients were divided into two groups: those with and without a 20% or more increase in splenic volume on the CT scans. The percentages of patients showing a tumor marker response in the two groups were then compared. Fourteen patients were included in the present analysis. A tumor marker response was seen in 6 of 7 patients (85.7%) who showed an increase in splenic volume of >20%, and in 3 of 7 patients (42.9%) without an increase in splenic volume (p=0.266). There was one death as a result of oesophageal variceal bleeding due to portal hypertension at 9 months after treatment. Splenic enlargement after SIRT may be associated with tumor marker response, although this could not be confirmed statistically in this study due to the small number of patients. Long-term splenomegaly and portal hypertension may be important complications of SIRT. This issue needs to be investigated further using a larger number of patients and longer follow-up. (author)

  8. A Direct TeX-to-Braille Transcribing Method

    Science.gov (United States)

    Papasalouros, Andreas; Tsolomitis, Antonis

    2017-01-01

    The TeX/LaTeX typesetting system is the most wide-spread system for creating documents in Mathematics and Science. However, no reliable tool exists to this day for automatically transcribing documents from the above formats into Braille/Nemeth code. Thus, visually impaired students of related fields do not have access to the bulk of study material…

  9. Registration accuracy and possible migration of internal fiducial gold marker implanted in prostate and liver treated with real-time tumor-tracking radiation therapy (RTRT)

    International Nuclear Information System (INIS)

    Kitamura, Kei; Shirato, Hiroki; Shimizu, Shinichi; Shinohara, Nobuo; Harabayashi, Toru; Shimizu, Tadashi; Kodama, Yoshihisa; Endo, Hideho; Onimaru, Rikiya; Nishioka, Seiko; Aoyama, Hidefumi; Tsuchiya, Kazuhiko; Miyasaka, Kazuo

    2002-01-01

    Background and purpose: We have developed a linear accelerator synchronized with a fluoroscopic real-time tumor-tracking system to reduce errors due to setup and organ motion. In the real-time tumor-tracking radiation therapy (RTRT) system, the accuracy of tumor tracking depends on the registration of the marker's coordinates. The registration accuracy and possible migration of the internal fiducial gold marker implanted into prostate and liver was investigated. Materials and methods: Internal fiducial gold markers were implanted in 14 patients with prostate cancer and four patients with liver tumors. Computed tomography (CT) was carried out as a part of treatment planning in the 18 patients. A total of 72 follow-up CT scans were taken. We calculated the relative relationship between the coordinates of the center of mass (CM) of the organs and those of the marker. The discrepancy in the CM coordinates during a follow-up CT compared to those recorded during the planning CT was used to study possible marker migration. Results: The standard deviation (SD) of interobserver variations in the CM coordinates was within 2.0 and 0.4 mm for the organ and the marker, respectively, in seven observers. Assuming that organs do not shrink, grow, or rotate, the maximum SD of migration error in each direction was estimated to be less than 2.5 and 2.0 mm for liver and prostate, respectively. There was no correlation between the marker position and the time after implantation. Conclusion: The degree of possible migration of the internal fiducial marker was within the limits of accuracy of the CT measurement. Most of the marker movement can be attributed to the measurement uncertainty, which also influences registration in actual treatment planning. Thus, even with the gold marker and RTRT system, a planning target volume margin should be used to account for registration uncertainty

  10. A general methodology for full-field plastic strain measurements using X-ray absorption tomography and internal markers

    DEFF Research Database (Denmark)

    Haldrup, Martin Kristoffer; Nielsen, Søren Fæster; Wert, John A.

    2008-01-01

    on a homogenous distribution of marker particles throughout the bulk of a sample, markers which are detected through the application of synchrotron X-ray tomography. Making use of the morphology of individual markers, motion of individual markers is tracked during deformation allowing the local displacement field...

  11. Diversity of the marine picocyanobacteria Prochlorococcus and Synechococcus assessed by terminal restriction fragment length polymorphisms of 16S-23S rRNA internal transcribed spacer sequences Diversidad de las picocianobacterias marinas Prochlorococcus y Synechococcus por medio de polimorfismos de longitud de fragmentos de restricción terminal en secuencias del espaciador transcrito interno del ARNr 16S - 23S

    Directory of Open Access Journals (Sweden)

    PARIS LAVIN

    2008-12-01

    Full Text Available In order to assess the appropriateness of the use of internal transcribed spacer (ITS sequences for the study of population genetics of marine cyanobacteria, we amplified and cloned the 16S rRNA gene plus the 16S-23S ITS regions of six strains of Prochlorococcus and Synechococcus. We analyzed them by denaturing gradient gel electrophoresis (DGGE and terminal restriction fragment length polymorphisms (T-RFLP. When using the standard application of these techniques, we obtained more than one band or terminal restriction fragment (T-RF per strain or cloned sequence. Reports in literature have suggested that these anomalies can result from the formation of secondary structures. Secondary structures of the ITS sequences of Prochlorococcus and Synechococcus strains were computationally modelled at the different temperatures that were used during the polymerase chain reaction (PCR. Modelling results predicted the existence of hairpin loops that would still be present at the extensión temperature; it is likely that these loops produced incomplete and single stranded PCR products. We modified the standard T-RFLP procedure by adding the labelled ITS primer in the last two cycles of the PCR reaction; this resulted, in most cases, in only one T-RF per ribotype. Application of this technique to a natural picoplankton community in marine waters off northern Chile, showed that it was possible to identify the presence, and determine the relative abundance, of several phylogenetic lineages within the genera Prochlorococcus and Synechococcus inhabiting the euphotic zone. Phylogenetic analysis of ITS sequences obtained by cloning and sequencing DNA from the same sample confirmed the presence of the different genotypes. With the proposed modification, T-RFLP profiles should therefore be suitable for studying the diversity of natural populations of cyanobacteria, and should become an important tool to study the factors influencing the genetic structure and

  12. Four-dimensional measurement of the displacement of internal fiducial and skin markers during 320-multislice computed tomography scanning of breast cancer.

    Science.gov (United States)

    Yamashita, Hideomi; Okuma, Kae; Tada, Keiichiro; Shiraishi, Kenshiro; Takahashi, Wataru; Shibata-Mobayashi, Shino; Sakumi, Akira; Saotome, Naoya; Haga, Akihiro; Onoe, Tsuyoshi; Ino, Kenji; Akahane, Masaaki; Ohtomo, Kuni; Nakagawa, Keiichi

    2012-10-01

    To study the three-dimensional movement of internal tumor bed fiducial and breast skin markers, using 320-multislice computed tomography (CT); and to analyze intrafractional errors for breast cancer patients undergoing breast irradiation. This study examined 280 markers on the skin of the breast (200 markers) and on the primary tumor bed (80 markers) of 20 patients treated by external-beam photon radiotherapy. Motion assessment was analyzed in 41 respiratory phases during 20 s of cine CT in the radiotherapy position. To assess intrafractional errors resulting from respiratory motion, four-dimensional CT scans were acquired for 20 patients. Motion in the anterior-posterior (A/P) and superior-inferior (S/I) directions showed a strong correlation (|r| > 0.7) with the respiratory curve for most markers (79% and 70%, respectively). The average marker displacements between maximum and minimum value during 20 s for the 200 breast skin metal markers were 1.1 ± 0.3 mm, 2.1 ± 0.6 mm, and 1.6 ± 0.4 mm in the left-right, A/P, and S/I directions, respectively. For the 80 tumor bed clips, displacements were 0.9 ± 0.2 mm in left-right, 1.7 ± 0.5 mm in A/P, and 1.1 ± 0.3 mm in S/I. There was no significant difference in the motion between breast quadrant regions or between the primary site and the other regions. Motion in primary breast tumors was evaluated with 320-multislice CT. Very little change was detected during individual radiation treatment fractions. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. Development of a real-time internal and external marker tracking system for particle therapy: a phantom study using patient tumor trajectory data.

    Science.gov (United States)

    Cho, Junsang; Cheon, Wonjoong; Ahn, Sanghee; Jung, Hyunuk; Sheen, Heesoon; Park, Hee Chul; Han, Youngyih

    2017-09-01

    Target motion-induced uncertainty in particle therapy is more complicated than that in X-ray therapy, requiring more accurate motion management. Therefore, a hybrid motion-tracking system that can track internal tumor motion and as well as an external surrogate of tumor motion was developed. Recently, many correlation tests between internal and external markers in X-ray therapy have been developed; however, the accuracy of such internal/external marker tracking systems, especially in particle therapy, has not yet been sufficiently tested. In this article, the process of installing an in-house hybrid internal/external motion-tracking system is described and the accuracy level of tracking system was acquired. Our results demonstrated that the developed in-house external/internal combined tracking system has submillimeter accuracy, and can be clinically used as a particle therapy system as well as a simulation system for moving tumor treatment. © The Author 2017. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.

  14. Detection of Esophageal Fiducial Marker Displacement During Radiation Therapy With a 2-dimensional On-board Imager: Analysis of Internal Margin for Esophageal Cancer

    International Nuclear Information System (INIS)

    Fukada, Junichi; Hanada, Takashi; Kawaguchi, Osamu; Ohashi, Toshio; Takeuchi, Hiroya; Kitagawa, Yuko; Seki, Satoshi; Shiraishi, Yutaka; Ogata, Haruhiko; Shigematsu, Naoyuki

    2013-01-01

    Purpose: To quantify the interfraction displacement of esophageal fiducial markers for primary esophageal cancer radiation therapy. Methods and Materials: Orthogonal 2-dimensional (2D) matching records fused to vertebrae were analyzed in clinically staged T1/2N0 esophageal cancer patients undergoing endoscopic clipping as fiducial metal markers. Displacement of the markers between the digitally reconstructed radiographs and on-board kilovoltage images during radiation therapy was analyzed according to direction and esophageal site. Results: Forty-four patients, with 81 markers (10 proximal, 42 middle, and 29 distal), underwent 367 2D matching sessions during radiation therapy. The mean (SD) absolute marker displacement was 0.26 (0.30) cm in the right–left (RL), 0.50 (0.39) cm in the superior–inferior (SI), and 0.24 (0.21) cm in the anterior–posterior (AP) direction. Displacement was significantly larger in the SI than in the RL and AP directions (P<.0001). In the SI direction, mean absolute displacements of the distal, middle, and proximal esophagus were 0.67 (0.45) cm, 0.42 (0.32) cm, and 0.36 (0.30) cm, respectively. Distal esophagus displacement was significantly larger than those of the middle and proximal esophagus (P<.0001). The estimated internal margin to cover 95% of the cases was 0.75 cm in the RL and AP directions. In the SI direction, the margin was 1.25 cm for the proximal and middle esophagus and 1.75 cm for the distal esophagus. Conclusions: The magnitude of interfraction displacement of esophageal clips was larger in the SI direction, particularly in the distal esophagus, but substantial displacement was observed in other directions and at other esophageal sites. It is practical to take estimated movements into account with internal margins, even if vertebrae-based 2D matching is performed

  15. MytiBase: a knowledgebase of mussel (M. galloprovincialis transcribed sequences

    Directory of Open Access Journals (Sweden)

    Roch Philippe

    2009-02-01

    Full Text Available Abstract Background Although Bivalves are among the most studied marine organisms due to their ecological role, economic importance and use in pollution biomonitoring, very little information is available on the genome sequences of mussels. This study reports the functional analysis of a large-scale Expressed Sequence Tag (EST sequencing from different tissues of Mytilus galloprovincialis (the Mediterranean mussel challenged with toxic pollutants, temperature and potentially pathogenic bacteria. Results We have constructed and sequenced seventeen cDNA libraries from different Mediterranean mussel tissues: gills, digestive gland, foot, anterior and posterior adductor muscle, mantle and haemocytes. A total of 24,939 clones were sequenced from these libraries generating 18,788 high-quality ESTs which were assembled into 2,446 overlapping clusters and 4,666 singletons resulting in a total of 7,112 non-redundant sequences. In particular, a high-quality normalized cDNA library (Nor01 was constructed as determined by the high rate of gene discovery (65.6%. Bioinformatic screening of the non-redundant M. galloprovincialis sequences identified 159 microsatellite-containing ESTs. Clusters, consensuses, related similarities and gene ontology searches have been organized in a dedicated, searchable database http://mussel.cribi.unipd.it. Conclusion We defined the first species-specific catalogue of M. galloprovincialis ESTs including 7,112 unique transcribed sequences. Putative microsatellite markers were identified. This annotated catalogue represents a valuable platform for expression studies, marker validation and genetic linkage analysis for investigations in the biology of Mediterranean mussels.

  16. Development of novel low-copy nuclear markers for Hieraciinae (Asteraceae) and their perspective for other tribes.

    Science.gov (United States)

    Krak, Karol; Alvarez, Inés; Caklová, Petra; Costa, Andrea; Chrtek, Jindrich; Fehrer, Judith

    2012-02-01

    The development of three low-copy nuclear markers for low taxonomic level phylogenies in Asteraceae with emphasis on the subtribe Hieraciinae is reported. Marker candidates were selected by comparing a Lactuca complementary DNA (cDNA) library with public DNA sequence databases. Interspecific variation and phylogenetic signal of the selected genes were investigated for diploid taxa from the subtribe Hieraciinae and compared to a reference phylogeny. Their ability to cross-amplify was assessed for other Asteraceae tribes. All three markers had higher variation (2.1-4.5 times) than the internal transcribed spacer (ITS) in Hieraciinae. Cross-amplification was successful in at least seven other tribes of the Asteraceae. Only three cases indicating the presence of paralogs or pseudogenes were detected. The results demonstrate the potential of these markers for phylogeny reconstruction in the Hieraciinae as well as in other Asteraceae tribes, especially for very closely related species.

  17. Genetic relationships in an international collection of Puccinia horiana isolates based on newly identified molecular markers and demonstration of recombination.

    Science.gov (United States)

    De Backer, M; Bonants, P; Pedley, K F; Maes, M; Roldan-Ruiz, I; Van Bockstaele, E; Heungens, K; van der Lee, T

    2013-11-01

    The obligate biotrophic pathogen Puccinia horiana is the causal agent of chrysanthemum white rust. Although P. horiana is a quarantine organism, it has been able to spread to most chrysanthemum-producing regions in the world since the 1960s; however, the transfer routes are largely obscure. An extremely low level of allelic diversity was observed in a geographically diverse set of eight isolates using complexity reduction of polymorphic sequences (CRoPS) technology. Only 184 of the 16,196 contigs (1.1%) showed one or more single-nucleotide polymorphisms (SNPs). Thirty-two SNPs and one simple-sequence repeat were translated into molecular markers and used to genotype 45 isolates originating from North and South America, Asia, and Europe. In most cases, phylogenetic clustering was related to geographic origin, indicating local establishment. The European isolates mostly grouped in two major populations that may relate to the two historic introductions previously reported. However, evidence of recent geographic transfer was also observed, including transfer events between Europe and South America and between Southeast Asia and Europe. In contrast with the presumed clonal propagation of this microcyclic rust, strong indications of marker recombination were observed, presumably as a result of anastomosis, karyogamy, and somatic meiosis. Recombination and transfer also explain the geographic dispersal of specific markers. A near-to-significant correlation between the genotypic data and previously obtained pathotype data was observed and one marker was associated with the most virulent pathotype group. In combination with a fast SNP detection method, the markers presented here will be helpful tools to further elucidate the transfer pathways and local survival of this pathogen.

  18. Development of ITS sequence based molecular marker to distinguish, Tribulus terrestris L. (Zygophyllaceae) from its adulterants.

    Science.gov (United States)

    Balasubramani, Subramani Paranthaman; Murugan, Ramar; Ravikumar, Kaliamoorthy; Venkatasubramanian, Padma

    2010-09-01

    Tribulus terrestris L. (Zygophyllaceae) is one of the highly traded raw drugs and also used as a stimulative food additive in Europe and USA. While, Ayurvedic Pharmacopoeia of India recognizes T. terrestris as Goksura, Tribulus lanuginosus and T. subramanyamii are also traded by the same name raising issues of quality control. The nuclear ribosomal RNA genes and ITS (internal transcribed spacer) sequence were used to develop species-specific DNA markers. The species-specific markers efficiently amplified 295bp for T. terrestris (TT1F and TT1R), 300bp for T. lanuginosus (TL1F and TL1R) and 214bp for T. subramanyamii (TS1F and TS1R). These DNA markers can be used to distinguish T. terrestris from its adulterants. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  19. Detection of esophageal fiducial marker displacement during radiation therapy with a 2-dimensional on-board imager: analysis of internal margin for esophageal cancer.

    Science.gov (United States)

    Fukada, Junichi; Hanada, Takashi; Kawaguchi, Osamu; Ohashi, Toshio; Takeuchi, Hiroya; Kitagawa, Yuko; Seki, Satoshi; Shiraishi, Yutaka; Ogata, Haruhiko; Shigematsu, Naoyuki

    2013-03-15

    To quantify the interfraction displacement of esophageal fiducial markers for primary esophageal cancer radiation therapy. Orthogonal 2-dimensional (2D) matching records fused to vertebrae were analyzed in clinically staged T1/2N0 esophageal cancer patients undergoing endoscopic clipping as fiducial metal markers. Displacement of the markers between the digitally reconstructed radiographs and on-board kilovoltage images during radiation therapy was analyzed according to direction and esophageal site. Forty-four patients, with 81 markers (10 proximal, 42 middle, and 29 distal), underwent 367 2D matching sessions during radiation therapy. The mean (SD) absolute marker displacement was 0.26 (0.30) cm in the right-left (RL), 0.50 (0.39) cm in the superior-inferior (SI), and 0.24 (0.21) cm in the anterior-posterior (AP) direction. Displacement was significantly larger in the SI than in the RL and AP directions (Pdisplacements of the distal, middle, and proximal esophagus were 0.67 (0.45) cm, 0.42 (0.32) cm, and 0.36 (0.30) cm, respectively. Distal esophagus displacement was significantly larger than those of the middle and proximal esophagus (Pinternal margin to cover 95% of the cases was 0.75 cm in the RL and AP directions. In the SI direction, the margin was 1.25 cm for the proximal and middle esophagus and 1.75 cm for the distal esophagus. The magnitude of interfraction displacement of esophageal clips was larger in the SI direction, particularly in the distal esophagus, but substantial displacement was observed in other directions and at other esophageal sites. It is practical to take estimated movements into account with internal margins, even if vertebrae-based 2D matching is performed. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. Technical, economic and policy considerations on marker-assisted selection in crops: lessons from the experience at an international agricultural research centre

    International Nuclear Information System (INIS)

    William, H.M.; Warburton, M.; Morris, M.; Hoisington, D.A.

    2007-01-01

    Molecular markers and related technologies have been used extensively in genetic characterization and identification of loci controlling traits of economic importance in many crop species. However, the application of such tools for crop improvement has not been extensive, at least in the public sector. Although there are clear advantages in using molecular markers as tools for indirect selection of traits of importance, available examples indicate that their use is restricted to traits with monogenic inheritance or when the inheritance is conditioned by a few genes with large effects. Another important limitation of large-scale marker applications is the cost involved in marker assays, which may be beyond the capacities of many public plant breeding enterprises. For an effective marker-assisted selection (MAS) activity to facilitate ongoing crop improvement programmes, especially in the context of the developing countries, laboratories with adequate capacity and adequately trained scientific personnel as well as operational resources are required. Although recent technological advances such as single nucleotide polymorphisms (SNPs) and associated assay protocols are likely to reduce assay costs significantly, for many of these operations, assay platforms with significant capital investments including computational capacity are required. Coupled with these limitations, private sector domination of biotechnology research with proprietary rights to important products and processes with immediate benefits to developing countries may further constrain the benefits these technologies may offer to resource-poor farmers. Policy-makers in different national programmes and international development and research agencies have a responsibility to sustain and augment the capacity of national public agricultural research organizations to ensure that biotechnology tools and processes are infused appropriately into national research efforts. They must also ensure that any

  1. Four-Dimensional Measurement of the Displacement of Internal Fiducial Markers During 320-Multislice Computed Tomography Scanning of Thoracic Esophageal Cancer

    International Nuclear Information System (INIS)

    Yamashita, Hideomi; Kida, Satoshi; Sakumi, Akira; Haga, Akihiro; Ito, Saori; Onoe, Tsuyoshi; Okuma, Kae; Ino, Kenji; Akahane, Masaaki; Ohtomo, Kuni; Nakagawa, Keiichi

    2011-01-01

    Purpose: To investigate the three-dimensional movement of internal fiducial markers placed near esophageal cancers using 320-multislice CT. Methods and Materials: This study examined 22 metal markers in the esophageal wall near the primary tumors of 12 patients treated with external-beam photon radiotherapy. Motion assessment was analyzed in 41 respiratory phases during 20 s of cine CT in the radiotherapy position. Results: Motion in the cranial-caudal (CC) direction showed a strong correlation (R 2 > 0.4) with the respiratory curve in most markers (73%). The average absolute amplitude of the marker movement was 1.5 ± 1.6 mm, 1.6 ± 1.7 mm, and 3.3 ± 3.3 mm in the left-right (LR), anterior-posterior (AP), and CC directions, respectively. The average marker displacements in the CC direction between peak exhalation and inhalation for the 22 clips were 1.1 mm (maximum, 5.5 mm), 3.0 mm (14.5 mm), and 5.1 mm (16.3 mm) for the upper, middle, and lower thoracic esophagus, respectively. Conclusions: Motion in primary esophagus tumor was evaluated with 320-multislice CT. According to this study, 4.3 mm CC, 1.5 mm AP, and 2.0 mm LR in the upper, 7.4 mm CC, 3.0 mm AP, and 2.4 mm LR in the middle, and 13.8 mm CC, 6.6 mm AP, and 6.8 mm LR in the lower thoracic esophagus provided coverage of tumor motion in 95% of the cases in our study population.

  2. Early puberty in internationally adopted girls: hormonal and clinical markers of puberty in 276 girls examined biannually over two years

    DEFF Research Database (Denmark)

    Teilmann, Grete; Petersen, Jørgen H; Gormsen, Magdalena

    2009-01-01

    Retrospective studies have indicated that internationally adopted girls are at high risk of developing precocious puberty. Hypothetically, this could be due to selection bias. The aim of this study was to determine age at reaching pubertal milestones in healthy internationally adopted girls...

  3. Medical Terminology of the Circulatory System. Medical Records. Instructional Unit for the Medical Transcriber.

    Science.gov (United States)

    Gosman, Minna L.

    Developed as a result of an analysis of the task of transcribing as practiced in a health facility, this study guide was designed to teach the knowledge and skills required of a medical transcriber. The medical record department was identified as a major occupational area, and a task inventory for medical records was developed and used as a basis…

  4. Medical Terminology of the Musculoskeletal System. Medical Records. Instructional Unit for the Medical Transcriber.

    Science.gov (United States)

    Gosman, Minna L.

    Following an analysis of the task of transcribing as practiced in a health facility, this study guide was developed to teach the knowledge and skills required of a medical transcriber. The medical record department was identified as a major occupational area, and a task inventory for medical records was developed and used as a basis for a…

  5. The Effect of Transcribing on Elementary Iranian EFL Learners’ Listening Comprehension

    Directory of Open Access Journals (Sweden)

    Mohammad Afsharrad

    2015-12-01

    Full Text Available This study is motivated by the gap existing between theory and practice in teaching listening. Most of the techniques used to teach listening put more emphasis on top-down processing while listeners’ problems are more of perceptive ones (bottom-up. In order to address the pervasive decoding problem in listening, this study suggests using transcribing exercise as an input enhancement device and investigates its effect on beginning learners’ listening ability. To this end, 31 learners participated in the study. The control group did not have any transcribing practice while the experimental group received transcribing exercise. In the data analysis step, an independent samples t test was employed to compare the two groups. The results show that transcribing has a significant positive effect on beginning learners’ listening comprehension. The findings of the study as well as advantages of transcribing exercise are discussed. Implications of the study and scope for future research are also addressed.

  6. Marker-assisted selection in crop and livestock improvement: how to strengthen national research capacity and international partnerships

    International Nuclear Information System (INIS)

    Lopes, M.A.

    2007-01-01

    It is generally recognized that marker-assisted selection (MAS) is a tool that breeders can use to accelerate the speed and precision of crop and livestock breeding in developing countries. However, its practical application has been more difficult than previously expected. Although advances in molecular marker technology have uncovered many possibilities for transferring genes into desired crops and livestock through MAS, more methodological development and better planning and implementation strategies will be needed for its successful and expeditious application to breeding programmes. Also, this technology should not be regarded as an end in itself, but as an interacting part of complex strategies and decision-making processes. An appropriate mix of technologies and capabilities together with effective approaches to networking must be viewed as key ingredients for its correct development and application to breeding programmes. This chapter describes some strategies to guide decisions about structures, methods and capacities that may contribute to enhancing the access and successful use of MAS in developing countries. (author)

  7. [Comparison of rDNA internal transcribed spacer sequences in asparagus].

    Science.gov (United States)

    Ou, Li-Jun; Ye, Wei; Zeng, Gui-Ping; Jiang, Xiang-Hui; She, Chao-Wen; Xu, Dong; Yang, Jia-Qiang

    2010-10-01

    Using ITS sequence of nine species to identify counterfeiting medicine and analyse phylogenetic of Asparagus. Analysing ITS sequences by amplification, cloning,sequencing and alignment. The length range of ITS sequence of nine species was from 711 to 748 bp, the percentage of G + C content was about 60%. The phylogenetic tree constructed on the basis of the ITS sequences showed that nine species were divided into two branches: Asparagus cochinchinensis, Asparagus officinalis, Asparagus densiflorus, Asparagus densiflorus cv. Myers and Asparagus densiflorus cv. Sprengeri were a branch and the others were a branch. Asparagus densiflorus and Asparagus densflorus cv. Myers those were from Africa had priority to clustering and then clustering with Asparagus densiflorus cv. Sprengeri that was a variant of Asparagus densiflorus in the first branch. Asparagus setaceus had relatively distant genetic relationship with the others three materials in another branch. The ITS sequences could distinguish species of Asparagus to test the counterfeit. Division status in phylogenetic tree of some species were debatable and ITS sequence was combined with others analytical tools to analyze the realistic phylogeny.

  8. Comparison of athlete-coach perceptions of internal and external load markers for elite junior tennis training.

    Science.gov (United States)

    Murphy, Alistair P; Duffield, Rob; Kellett, Aaron; Reid, Machar

    2014-09-01

    To investigate the discrepancy between coach and athlete perceptions of internal load and notational analysis of external load in elite junior tennis. Fourteen elite junior tennis players and 6 international coaches were recruited. Ratings of perceived exertion (RPEs) were recorded for individual drills and whole sessions, along with a rating of mental exertion, coach rating of intended session exertion, and athlete heart rate (HR). Furthermore, total stroke count and unforced-error count were notated using video coding after each session, alongside coach and athlete estimations of shots and errors made. Finally, regression analyses explained the variance in the criterion variables of athlete and coach RPE. Repeated-measures analyses of variance and interclass correlation coefficients revealed that coaches significantly (P coach and athlete. However, athlete drill RPE (P = .14; r = .71) and mental exertion (P = .44; r = .68) were comparable and substantially correlated. No significant differences in estimated stroke count were evident between athlete and coach (P = .21), athlete notational analysis (P = .06), or coach notational analysis (P = .49). Coaches estimated significantly greater unforced errors than either athletes or notational analysis (P coach RPE was explained by intended session exertion and coach drill RPE, while drill RPE and peak HR explained 45.3% of the variance in athlete session RPE. Coaches misinterpreted session RPE but not drill RPE, while inaccurately monitoring error counts. Improved understanding of external- and internal-load monitoring may help coach-athlete relationships in individual sports like tennis avoid maladaptive training.

  9. Transparency in Transcribing: Making Visible Theoretical Bases Impacting Knowledge Construction from Open-Ended Interview Records

    Directory of Open Access Journals (Sweden)

    Audra Skukauskaite

    2012-01-01

    Full Text Available This article presents a reflexive analysis of two transcripts of an open-ended interview and argues for transparency in transcribing processes and outcomes. By analyzing ways in which a researcher's theories become consequential in producing and using transcripts of an open-ended interview, this paper makes visible the importance of examining and presenting theoretical bases of transcribing decisions. While scholars across disciplines have argued that transcribing is a theoretically laden process (GREEN, FRANQUIZ & DIXON, 1997; KVALE & BRINKMAN, 2009, few have engaged in reflexive analyses of the data history to demonstrate the consequences particular theoretical and methodological approaches pose in producing knowledge claims and inciting dialogues across traditions. The article demonstrates how theory-method-claim relationships in transcribing influence research transparency and warrantability. URN: http://nbn-resolving.de/urn:nbn:de:0114-fqs1201146

  10. Plasma membrane cholesterol level and agonist-induced internalization of δ-opioid receptors; colocalization study with intracellular membrane markers of Rab family.

    Science.gov (United States)

    Brejchova, Jana; Vosahlikova, Miroslava; Roubalova, Lenka; Parenti, Marco; Mauri, Mario; Chernyavskiy, Oleksandr; Svoboda, Petr

    2016-08-01

    Decrease of cholesterol level in plasma membrane of living HEK293 cells transiently expressing FLAG-δ-OR by β-cyclodextrin (β-CDX) resulted in a slight internalization of δ-OR. Massive internalization of δ-OR induced by specific agonist DADLE was diminished in cholesterol-depleted cells. These results suggest that agonist-induced internalization of δ-OR, which has been traditionally attributed exclusively to clathrin-mediated pathway, proceeds at least partially via membrane domains. Identification of internalized pools of FLAG-δ-OR by colocalization studies with proteins of Rab family indicated the decreased presence of receptors in early endosomes (Rab5), late endosomes and lysosomes (Rab7) and fast recycling vesicles (Rab4). Slow type of recycling (Rab11) was unchanged by cholesterol depletion. As expected, agonist-induced internalization of oxytocin receptors was totally suppressed in β-CDX-treated cells. Determination of average fluorescence lifetime of TMA-DPH, the polar derivative of hydrophobic membrane probe diphenylhexatriene, in live cells by FLIM indicated a significant alteration of the overall PM structure which may be interpreted as an increased "water-accessible space" within PM area. Data obtained by studies of HEK293 cells transiently expressing FLAG-δ-OR by "antibody feeding" method were extended by analysis of the effect of cholesterol depletion on distribution of FLAG-δ-OR in sucrose density gradients prepared from HEK293 cells stably expressing FLAG-δ-OR. Major part of FLAG-δ-OR was co-localized with plasma membrane marker Na,K-ATPase and β-CDX treatment resulted in shift of PM fragments containing both FLAG-δ-OR and Na,K-ATPase to higher density. Thus, the decrease in content of the major lipid constituent of PM resulted in increased density of resulting PM fragments.

  11. Transcribing and digitizing eighteenth- and nineteenth-century letters for a historical digital repository.

    Science.gov (United States)

    Dunster, Emily S; Kipnis, Daniel G; Angelo, F Michael

    2014-01-01

    In fall 2011, the Scott Memorial Library purchased 53 letters belonging to an 1841 graduate of Jefferson Medical College, John Plimpton Green. The library staff transcribed and digitized the letters, creating an online collection in the university's institutional repository, Jefferson Digital Commons. This article will detail the process of transcribing and digitizing the collection along with sharing statistics and the benefits of this project to global researchers.

  12. The Voice Transcription Technique: Use of Voice Recognition Software to Transcribe Digital Interview Data in Qualitative Research

    Science.gov (United States)

    Matheson, Jennifer L.

    2007-01-01

    Transcribing interview data is a time-consuming task that most qualitative researchers dislike. Transcribing is even more difficult for people with physical limitations because traditional transcribing requires manual dexterity and the ability to sit at a computer for long stretches of time. Researchers have begun to explore using an automated…

  13. Rhabdovirus-like endogenous viral elements in the genome of Spodoptera frugiperda insect cells are actively transcribed: Implications for adventitious virus detection.

    Science.gov (United States)

    Geisler, Christoph; Jarvis, Donald L

    2016-07-01

    Spodoptera frugiperda (Sf) cell lines are used to produce several biologicals for human and veterinary use. Recently, it was discovered that all tested Sf cell lines are persistently infected with Sf-rhabdovirus, a novel rhabdovirus. As part of an effort to search for other adventitious viruses, we searched the Sf cell genome and transcriptome for sequences related to Sf-rhabdovirus. To our surprise, we found intact Sf-rhabdovirus N- and P-like ORFs, and partial Sf-rhabdovirus G- and L-like ORFs. The transcribed and genomic sequences matched, indicating the transcripts were derived from the genomic sequences. These appear to be endogenous viral elements (EVEs), which result from the integration of partial viral genetic material into the host cell genome. It is theoretically impossible for the Sf-rhabdovirus-like EVEs to produce infectious virus particles as 1) they are disseminated across 4 genomic loci, 2) the G and L ORFs are incomplete, and 3) the M ORF is missing. Our finding of transcribed virus-like sequences in Sf cells underscores that MPS-based searches for adventitious viruses in cell substrates used to manufacture biologics should take into account both genomic and transcribed sequences to facilitate the identification of transcribed EVE's, and to avoid false positive detection of replication-competent adventitious viruses. Copyright © 2016 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

  14. Use of a Deuterated Internal Standard with Pyrolysis-GC/MS Dimeric Marker Analysis to Quantify Tire Tread Particles in the Environment

    Directory of Open Access Journals (Sweden)

    Julie M. Panko

    2012-11-01

    Full Text Available Pyrolysis(pyr-GC/MS analysis of characteristic thermal decomposition fragments has been previously used for qualitative fingerprinting of organic sources in environmental samples. A quantitative pyr-GC/MS method based on characteristic tire polymer pyrolysis products was developed for tread particle quantification in environmental matrices including soil, sediment, and air. The feasibility of quantitative pyr-GC/MS analysis of tread was confirmed in a method evaluation study using artificial soil spiked with known amounts of cryogenically generated tread. Tread concentration determined by blinded analyses was highly correlated (r2 ³ 0.88 with the known tread spike concentration. Two critical refinements to the initial pyrolysis protocol were identified including use of an internal standard and quantification by the dimeric markers vinylcyclohexene and dipentene, which have good specificity for rubber polymer with no other appreciable environmental sources. A novel use of deuterated internal standards of similar polymeric structure was developed to correct the variable analyte recovery caused by sample size, matrix effects, and ion source variability. The resultant quantitative pyr-GC/MS protocol is reliable and transferable between laboratories.

  15. Use of a deuterated internal standard with pyrolysis-GC/MS dimeric marker analysis to quantify tire tread particles in the environment.

    Science.gov (United States)

    Unice, Kenneth M; Kreider, Marisa L; Panko, Julie M

    2012-11-08

    Pyrolysis(pyr)-GC/MS analysis of characteristic thermal decomposition fragments has been previously used for qualitative fingerprinting of organic sources in environmental samples. A quantitative pyr-GC/MS method based on characteristic tire polymer pyrolysis products was developed for tread particle quantification in environmental matrices including soil, sediment, and air. The feasibility of quantitative pyr-GC/MS analysis of tread was confirmed in a method evaluation study using artificial soil spiked with known amounts of cryogenically generated tread. Tread concentration determined by blinded analyses was highly correlated (r2 ≥ 0.88) with the known tread spike concentration. Two critical refinements to the initial pyrolysis protocol were identified including use of an internal standard and quantification by the dimeric markers vinylcyclohexene and dipentene, which have good specificity for rubber polymer with no other appreciable environmental sources. A novel use of deuterated internal standards of similar polymeric structure was developed to correct the variable analyte recovery caused by sample size, matrix effects, and ion source variability. The resultant quantitative pyr-GC/MS protocol is reliable and transferable between laboratories.

  16. Polycyclic Aromatic Hydrocarbons (PAHs) and Hopanes in Plastic Resin Pellets as Markers of Oil Pollution via International Pellet Watch Monitoring.

    Science.gov (United States)

    Yeo, Bee Geok; Takada, Hideshige; Hosoda, Junki; Kondo, Atsuko; Yamashita, Rei; Saha, Mahua; Maes, Thomas

    2017-08-01

    Oil pollution in the marine environment is an unavoidable problem due to chronic input from local sources, particularly in urban areas and oil spills. Oil pollution not only causes immediate physical damages to surrounding wildlife but also some components, including higher molecular weight PAHs, can persist in the environment for many years and pose insidious threats to the ecosystem. Long-term and nontargeted monitoring of oil pollution is important. This paper examines the ability of International Pellet Watch (IPW) for initial identification and monitoring of oil pollution by analysing PAHs and hopanes in plastic pellet samples collected globally by volunteers. PAH concentrations with the sum of 28 parent and methyl PAHs vary geographically, ranging from 0.035 to 24.4 µg/g-pellet, in line with the presence or absence of local oil pollution sources, such as oil refineries or oil spill sites. This suggests that PAHs can be used to monitor petroleum pollution in IPW. A colour-coded categorization for PAH concentrations within IPW monitoring also is established to facilitate data presentation and understanding. PAH concentrations are generally higher in Western Europe, especially around the North Sea shorelines, moderate in East Asia and North America, and lower in South East Asia, Oceania, South America, and Africa. Hopane concentrations, with a smaller spatial variation (1.7-101 µg/g-pellet), showed no spatial pattern. This result and the poor correlation between hopanes and PAHs suggest that hopane concentrations alone are unsuited to identify petroleum pollution. However, hopane compositions can be used for fingerprinting sources of oil pollution. Thus, both PAHs and hopanes in IPW allow for low cost, remote monitoring of global oil pollution.

  17. Transcribed enhancers lead waves of coordinated transcription in transitioning mammalian cells

    DEFF Research Database (Denmark)

    Arner, Erik; Daub, Carsten O.; Vitting-Seerup, Kristoffer

    2015-01-01

    Although it is generally accepted that cellular differentiation requires changes to transcriptional networks, dynamic regulation of promoters and enhancers at specific sets of genes has not been previously studied en masse. Exploiting the fact that active promoters and enhancers are transcribed, ...

  18. Identification of human chromosome 22 transcribed sequences with ORF expressed sequence tags

    DEFF Research Database (Denmark)

    de Souza, S J; Camargo, A A; Briones, M R

    2000-01-01

    Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central ...

  19. Identification of human chromosome 22 transcribed sequences with ORF expressed sequence tags

    Science.gov (United States)

    de Souza, Sandro J.; Camargo, Anamaria A.; Briones, Marcelo R. S.; Costa, Fernando F.; Nagai, Maria Aparecida; Verjovski-Almeida, Sergio; Zago, Marco A.; Andrade, Luis Eduardo C.; Carrer, Helaine; El-Dorry, Hamza F. A.; Espreafico, Enilza M.; Habr-Gama, Angelita; Giannella-Neto, Daniel; Goldman, Gustavo H.; Gruber, Arthur; Hackel, Christine; Kimura, Edna T.; Maciel, Rui M. B.; Marie, Suely K. N.; Martins, Elizabeth A. L.; Nóbrega, Marina P.; Paçó-Larson, Maria Luisa; Pardini, Maria Inês M. C.; Pereira, Gonçalo G.; Pesquero, João Bosco; Rodrigues, Vanderlei; Rogatto, Silvia R.; da Silva, Ismael D. C. G.; Sogayar, Mari C.; de Fátima Sonati, Maria; Tajara, Eloiza H.; Valentini, Sandro R.; Acencio, Marcio; Alberto, Fernando L.; Amaral, Maria Elisabete J.; Aneas, Ivy; Bengtson, Mário Henrique; Carraro, Dirce M.; Carvalho, Alex F.; Carvalho, Lúcia Helena; Cerutti, Janete M.; Corrêa, Maria Lucia C.; Costa, Maria Cristina R.; Curcio, Cyntia; Gushiken, Tsieko; Ho, Paulo L.; Kimura, Elza; Leite, Luciana C. C.; Maia, Gustavo; Majumder, Paromita; Marins, Mozart; Matsukuma, Adriana; Melo, Analy S. A.; Mestriner, Carlos Alberto; Miracca, Elisabete C.; Miranda, Daniela C.; Nascimento, Ana Lucia T. O.; Nóbrega, Francisco G.; Ojopi, Élida P. B.; Pandolfi, José Rodrigo C.; Pessoa, Luciana Gilbert; Rahal, Paula; Rainho, Claudia A.; da Ro's, Nancy; de Sá, Renata G.; Sales, Magaly M.; da Silva, Neusa P.; Silva, Tereza C.; da Silva, Wilson; Simão, Daniel F.; Sousa, Josane F.; Stecconi, Daniella; Tsukumo, Fernando; Valente, Valéria; Zalcberg, Heloisa; Brentani, Ricardo R.; Reis, Luis F. L.; Dias-Neto, Emmanuel; Simpson, Andrew J. G.

    2000-01-01

    Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central coding regions of the resulting transcripts. They are termed ORF expressed sequence tags (ORESTES). The 250,000 ORESTES were assembled into 81,429 contigs. Of these, 1,181 (1.45%) were found to match sequences in chromosome 22 with at least one ORESTES contig for 162 (65.6%) of the 247 known genes, for 67 (44.6%) of the 150 related genes, and for 45 of the 148 (30.4%) EST-predicted genes on this chromosome. Using a set of stringent criteria to validate our sequences, we identified a further 219 previously unannotated transcribed sequences on chromosome 22. Of these, 171 were in fact also defined by EST or full length cDNA sequences available in GenBank but not utilized in the initial annotation of the first human chromosome sequence. Thus despite representing less than 15% of all expressed human sequences in the public databases at the time of the present analysis, ORESTES sequences defined 48 transcribed sequences on chromosome 22 not defined by other sequences. All of the transcribed sequences defined by ORESTES coincided with DNA regions predicted as encoding exons by genscan. (http://genes.mit.edu/GENSCAN.html). PMID:11070084

  20. Differential Reading, Naming, and Transcribing Speeds of Japanese Romaji and Hiragana

    Science.gov (United States)

    Yamada, Jun; Leong, Che Kan

    2005-01-01

    The morpho-syllabic Japanese writing system consists of the phonetic scripts of hiragana and katakana, the logographic kanji derived from Chinese characters and the less well researched romaji based on the Roman alphabet. In four experiments we investigated the speed with which Japanese college students read, named, and transcribed romaji as…

  1. Transcribing Gail Jefferson: The 1977 Boston talk as it actually was

    DEFF Research Database (Denmark)

    Nevile, Maurice Richard

    2015-01-01

    A talk by Gail Jefferson, one of the founders of Conversation Analysis, has been recently made available, and Maurice Nevile undertook to transcribe it for the benefit of the language-in-interaction community. Here he reports on what it meant to him, and what we can all get out of such a powerful...

  2. Transcribed sequences in the human genome to be held in San Francisco, November 7 and 8, 1992. Final report, September 1, 1992--August 31, 1993

    Energy Technology Data Exchange (ETDEWEB)

    Gardiner, K.

    1993-11-01

    The Second International Workshop on the Identification of Transcribed Sequences was held in San Francisco on November 7--8, 1992. The purpose of the workshop was to discuss and evaluate techniques for developing a complete transcriptional map of the human genome. Such a map requires the positions, sequences, and expression patterns of all genes. This goal is being approached from two different directions, each with strengths and weaknesses. One method is to identify the transcribed sequences from genomic DNA of a given region; the other is to systematically sequence and map cDNAs. The cDNA approach yields sequence information rapidly, but mapping each cDNA is a technical challenge. In the first approach, the map locations of genomic sequences are known at the outset, and the challenge is to identify exons. The efficient construction of a transcriptional map will require a diverse array of techniques.

  3. Real-time 3D internal marker tracking during arc radiotherapy by the use of combined MV-kV imaging

    International Nuclear Information System (INIS)

    Liu, W; Wiersma, R D; Mao, W; Luxton, G; Xing, L

    2008-01-01

    To minimize the adverse dosimetric effect caused by tumor motion, it is desirable to have real-time knowledge of the tumor position throughout the beam delivery process. A promising technique to realize the real-time image guided scheme in external beam radiation therapy is through the combined use of MV and onboard kV beam imaging. The success of this MV-kV triangulation approach for fixed-gantry radiation therapy has been demonstrated. With the increasing acceptance of modern arc radiotherapy in the clinics, a timely and clinically important question is whether the image guidance strategy can be extended to arc therapy to provide the urgently needed real-time tumor motion information. While conceptually feasible, there are a number of theoretical and practical issues specific to the arc delivery that need to be resolved before clinical implementation. The purpose of this work is to establish a robust procedure of system calibration for combined MV and kV imaging for internal marker tracking during arc delivery and to demonstrate the feasibility and accuracy of the technique. A commercially available LINAC equipped with an onboard kV imager and electronic portal imaging device (EPID) was used for the study. A custom built phantom with multiple ball bearings was used to calibrate the stereoscopic MV-kV imaging system to provide the transformation parameters from imaging pixels to 3D world coordinates. The accuracy of the fiducial tracking system was examined using a 4D motion phantom capable of moving in accordance with a pre-programmed trajectory. Overall, spatial accuracy of MV-kV fiducial tracking during the arc delivery process for normal adult breathing amplitude and period was found to be better than 1 mm. For fast motion, the results depended on the imaging frame rates. The RMS error ranged from ∼0.5 mm for the normal adult breathing pattern to ∼1.5 mm for more extreme cases with a low imaging frame rate of 3.4 Hz. In general, highly accurate real

  4. Real-time 3D internal marker tracking during arc radiotherapy by the use of combined MV-kV imaging.

    Science.gov (United States)

    Liu, W; Wiersma, R D; Mao, W; Luxton, G; Xing, L

    2008-12-21

    To minimize the adverse dosimetric effect caused by tumor motion, it is desirable to have real-time knowledge of the tumor position throughout the beam delivery process. A promising technique to realize the real-time image guided scheme in external beam radiation therapy is through the combined use of MV and onboard kV beam imaging. The success of this MV-kV triangulation approach for fixed-gantry radiation therapy has been demonstrated. With the increasing acceptance of modern arc radiotherapy in the clinics, a timely and clinically important question is whether the image guidance strategy can be extended to arc therapy to provide the urgently needed real-time tumor motion information. While conceptually feasible, there are a number of theoretical and practical issues specific to the arc delivery that need to be resolved before clinical implementation. The purpose of this work is to establish a robust procedure of system calibration for combined MV and kV imaging for internal marker tracking during arc delivery and to demonstrate the feasibility and accuracy of the technique. A commercially available LINAC equipped with an onboard kV imager and electronic portal imaging device (EPID) was used for the study. A custom built phantom with multiple ball bearings was used to calibrate the stereoscopic MV-kV imaging system to provide the transformation parameters from imaging pixels to 3D world coordinates. The accuracy of the fiducial tracking system was examined using a 4D motion phantom capable of moving in accordance with a pre-programmed trajectory. Overall, spatial accuracy of MV-kV fiducial tracking during the arc delivery process for normal adult breathing amplitude and period was found to be better than 1 mm. For fast motion, the results depended on the imaging frame rates. The RMS error ranged from approximately 0.5 mm for the normal adult breathing pattern to approximately 1.5 mm for more extreme cases with a low imaging frame rate of 3.4 Hz. In general

  5. Tumors markers

    International Nuclear Information System (INIS)

    Yamaguchi-Mizumoto, N.H.

    1989-01-01

    In order to study blood and cell components alterations (named tumor markers) that may indicate the presence of a tumor, several methods are presented. Aspects as diagnostic, prognostic, therapeutic value and clinical evaluation are discussed. (M.A.C.)

  6. Correlation of Peripheral Vein Tumour Marker Levels, Internal Iliac Vein Tumour Marker Levels and Radical Prostatectomy Specimens in Patients with Prostate Cancer and Borderline High Prostate-Specific Antigen: A Pilot Study

    Energy Technology Data Exchange (ETDEWEB)

    Farrelly, Cormac, E-mail: farrellycormac@gmail.com [Hospital of the University of Pennsylvania, Perelman School of Medicine at the University of Pennsylvania, Division of Interventional Radiology, Department of Radiology (United States); Lal, Priti [University of Pennsylvania Perelman School of Medicine, Department of Pathology and Laboratory Medicine (United States); Trerotola, Scott O.; Nadolski, Gregory J.; Watts, Micah M. [Hospital of the University of Pennsylvania, Perelman School of Medicine at the University of Pennsylvania, Division of Interventional Radiology, Department of Radiology (United States); Gorrian, Catherine Mc. [Mater Misericordiae University Hospital, University College Dublin School of Medicine & Medical Science (Ireland); Guzzo, Thomas J. [University of Pennsylvania Perelman School of Medicine, Department of Urology and Surgery (United States)

    2016-05-15

    PurposeTo correlate prostate-specific antigen (PSA), free to total PSA percentage (fPSA%) and prostatic acid phosphatase (PAP) levels from peripheral and pelvic venous samples with prostatectomy specimens in patients with prostate adenocarcinoma and borderline elevation of PSA.Materials and MethodsIn this prospective institutional review board approved study, 7 patients with biopsy proven prostate cancer had a venous sampling procedure prior to prostatectomy (mean 3.2 days, range 1–7). Venous samples were taken from a peripheral vein (PVS), the right internal iliac vein, a deep right internal iliac vein branch, left internal iliac vein and a deep left internal iliac vein branch. Venous sampling results were compared to tumour volume, laterality, stage and grade in prostatectomy surgical specimens.ResultsMean PVS PSA was 4.29, range 2.3–6 ng/ml. PSA and PAP values in PVS did not differ significantly from internal iliac or deep internal iliac vein samples (p > 0.05). fPSA% was significantly higher in internal iliac (p = 0.004) and deep internal iliac (p = 0.003) vein samples compared to PVS. One of 7 patients had unilateral tumour only. This patient, with left–sided tumour, had a fPSA% of 6, 6, 6, 14 and 12 in his peripheral, right internal iliac, deep right internal iliac branch, left internal iliac and deep left internal iliac branch samples respectively. There were no adverse events.ConclusionfPSA%, unlike total PSA or PAP, is significantly higher in pelvic vein compared to peripheral vein samples when prostate cancer is present. Larger studies including patients with higher PSA values are warranted to further investigate this counterintuitive finding.

  7. Correlation of Peripheral Vein Tumour Marker Levels, Internal Iliac Vein Tumour Marker Levels and Radical Prostatectomy Specimens in Patients with Prostate Cancer and Borderline High Prostate-Specific Antigen: A Pilot Study

    International Nuclear Information System (INIS)

    Farrelly, Cormac; Lal, Priti; Trerotola, Scott O.; Nadolski, Gregory J.; Watts, Micah M.; Gorrian, Catherine Mc.; Guzzo, Thomas J.

    2016-01-01

    PurposeTo correlate prostate-specific antigen (PSA), free to total PSA percentage (fPSA%) and prostatic acid phosphatase (PAP) levels from peripheral and pelvic venous samples with prostatectomy specimens in patients with prostate adenocarcinoma and borderline elevation of PSA.Materials and MethodsIn this prospective institutional review board approved study, 7 patients with biopsy proven prostate cancer had a venous sampling procedure prior to prostatectomy (mean 3.2 days, range 1–7). Venous samples were taken from a peripheral vein (PVS), the right internal iliac vein, a deep right internal iliac vein branch, left internal iliac vein and a deep left internal iliac vein branch. Venous sampling results were compared to tumour volume, laterality, stage and grade in prostatectomy surgical specimens.ResultsMean PVS PSA was 4.29, range 2.3–6 ng/ml. PSA and PAP values in PVS did not differ significantly from internal iliac or deep internal iliac vein samples (p > 0.05). fPSA% was significantly higher in internal iliac (p = 0.004) and deep internal iliac (p = 0.003) vein samples compared to PVS. One of 7 patients had unilateral tumour only. This patient, with left–sided tumour, had a fPSA% of 6, 6, 6, 14 and 12 in his peripheral, right internal iliac, deep right internal iliac branch, left internal iliac and deep left internal iliac branch samples respectively. There were no adverse events.ConclusionfPSA%, unlike total PSA or PAP, is significantly higher in pelvic vein compared to peripheral vein samples when prostate cancer is present. Larger studies including patients with higher PSA values are warranted to further investigate this counterintuitive finding.

  8. Correlation of Peripheral Vein Tumour Marker Levels, Internal Iliac Vein Tumour Marker Levels and Radical Prostatectomy Specimens in Patients with Prostate Cancer and Borderline High Prostate-Specific Antigen: A Pilot Study.

    Science.gov (United States)

    Farrelly, Cormac; Lal, Priti; Trerotola, Scott O; Nadolski, Gregory J; Watts, Micah M; Gorrian, Catherine Mc; Guzzo, Thomas J

    2016-05-01

    To correlate prostate-specific antigen (PSA), free to total PSA percentage (fPSA%) and prostatic acid phosphatase (PAP) levels from peripheral and pelvic venous samples with prostatectomy specimens in patients with prostate adenocarcinoma and borderline elevation of PSA. In this prospective institutional review board approved study, 7 patients with biopsy proven prostate cancer had a venous sampling procedure prior to prostatectomy (mean 3.2 days, range 1-7). Venous samples were taken from a peripheral vein (PVS), the right internal iliac vein, a deep right internal iliac vein branch, left internal iliac vein and a deep left internal iliac vein branch. Venous sampling results were compared to tumour volume, laterality, stage and grade in prostatectomy surgical specimens. Mean PVS PSA was 4.29, range 2.3-6 ng/ml. PSA and PAP values in PVS did not differ significantly from internal iliac or deep internal iliac vein samples (p > 0.05). fPSA% was significantly higher in internal iliac (p = 0.004) and deep internal iliac (p = 0.003) vein samples compared to PVS. One of 7 patients had unilateral tumour only. This patient, with left-sided tumour, had a fPSA% of 6, 6, 6, 14 and 12 in his peripheral, right internal iliac, deep right internal iliac branch, left internal iliac and deep left internal iliac branch samples respectively. There were no adverse events. fPSA%, unlike total PSA or PAP, is significantly higher in pelvic vein compared to peripheral vein samples when prostate cancer is present. Larger studies including patients with higher PSA values are warranted to further investigate this counterintuitive finding.

  9. Taxonomic confirmation of mud crab species (genus Scylla) in Bangladesh by nuclear and mitochondrial DNA markers.

    Science.gov (United States)

    Sarower, Mohammed Golam; Shahriar, Sheik Istiak Md; Nakamura, Hiromasa; Rouf, Muhammad Abdur; Okada, Shigeru

    2017-11-01

    Taxonomy of mud crabs genus Scylla has been misidentified for several years due to their high morphological plasticity. Several reports concerning mud crab have been published with misleading identification in Bangladesh. In this study, partial fragments of nuclear and mitochondrial DNA of Scylla species obtained from four locations along the Bangladesh coast were used to resolve taxonomical ambiguity of mud crab species. A single PCR product from the nuclear first internal transcribed spacer (ITS-1) marker and phylogenetic trees constructed based on 16S rDNA sequences indicated that all Scylla species obtained in this study were S. olivacea. Both molecular data and morphological characters revealed that S. olivacea is the only major species in Bangladesh coastal waters. Further, the 16S rDNA haplotypes significantly differed with known S. serrata by 33%. From this study it is clear that 'S. serrata' commonly reported from Bangladesh should be S. olivacea.

  10. (SSR) markers

    African Journals Online (AJOL)

    acer

    2013-06-26

    Jun 26, 2013 ... analysis was in general agreement with PCoA in discrimi- nating the cultivars. Conclusions. Estimation of morphological diversity may provide addi- tional information on the present finding. Nonetheless, the 29 SSR markers provided considerable genetic reso- lution and this genetic diversity analysis ...

  11. (SSR) markers

    African Journals Online (AJOL)

    SAM

    2014-07-30

    Jul 30, 2014 ... India and the country is currently the leading producer, consumer and exporter of ... registration with the competent authority for plant variety protection. Conventionally ... detection of duplicates, parental verification in crosses, gene tagging in .... allelic patterns as revealed by the current set of SSR markers.

  12. The anti-tumor drug bleomycin preferentially cleaves at the transcription start sites of actively transcribed genes in human cells.

    Science.gov (United States)

    Murray, Vincent; Chen, Jon K; Galea, Anne M

    2014-04-01

    The genome-wide pattern of DNA cleavage at transcription start sites (TSSs) for the anti-tumor drug bleomycin was examined in human HeLa cells using next-generation DNA sequencing. It was found that actively transcribed genes were preferentially cleaved compared with non-transcribed genes. The 143,600 identified human TSSs were split into non-transcribed genes (82,596) and transcribed genes (61,004) for HeLa cells. These transcribed genes were further split into quintiles of 12,201 genes comprising the top 20, 20-40, 40-60, 60-80, and 80-100 % of expressed genes. The bleomycin cleavage pattern at highly transcribed gene TSSs was greatly enhanced compared with purified DNA and non-transcribed gene TSSs. The top 20 and 20-40 % quintiles had a very similar enhanced cleavage pattern, the 40-60 % quintile was intermediate, while the 60-80 and 80-100 % quintiles were close to the non-transcribed and purified DNA profiles. The pattern of bleomycin enhanced cleavage had peaks that were approximately 200 bp apart, and this indicated that bleomycin was identifying the presence of phased nucleosomes at TSSs. Hence bleomycin can be utilized to detect chromatin structures that are present at actively transcribed genes. In this study, for the first time, the pattern of DNA damage by a clinically utilized cancer chemotherapeutic agent was performed on a human genome-wide scale at the nucleotide level.

  13. Transcribed DNA is preferentially located in the perichromatin region of mammalian cell nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Niedojadlo, Janusz [Centre of Electron Microscopy, University of Lausanne, Bugnon 27, CH-1005 Lausanne (Switzerland); Department of Cell Biology, Institute of General and Molecular Biology, Nicolaus Copernicus University, PL-87-100 Torun (Poland); Perret-Vivancos, Cecile [Centre of Electron Microscopy, University of Lausanne, Bugnon 27, CH-1005 Lausanne (Switzerland); Kalland, Karl-Henning [Centre for Research in Virology, The Gade Institute, University of Bergen, Jonas Liesv. 91, N-5009 Bergen (Norway); Cmarko, Dusan [Centre of Electron Microscopy, University of Lausanne, Bugnon 27, CH-1005 Lausanne (Switzerland); Charles University in Prague, First Faculty of Medicine, Institute of Cellular Biology and Pathology, and Department of Cell Biology, Institute of Physiology, Academy of Sciences of the Czech Republic, v.v.i., Albertov 4, CZ-12801 Prague (Czech Republic); Cremer, Thomas [Department of Biology II, LMU Biozentrum, Grosshaderner Strasse 2, D-82152 Planegg-Martinsried (Germany); Center for Integrated Protein Science Munich (CIPSM), LMU Munich, Munich (Germany); Driel, Roel van, E-mail: r.vandriel@uva.nl [Swammerdam Institute for Life Sciences, University of Amsterdam, P.O. Box 94215, 1090GE Amsterdam (Netherlands); Fakan, Stanislav, E-mail: sfakan@lrz.uni-muenchen.de [Centre of Electron Microscopy, University of Lausanne, Bugnon 27, CH-1005 Lausanne (Switzerland); Department of Biology II, LMU Biozentrum, Grosshaderner Strasse 2, D-82152 Planegg-Martinsried (Germany); Center for Integrated Protein Science Munich (CIPSM), LMU Munich, Munich (Germany)

    2011-02-15

    The precise localization of transcribed DNA and resulting RNA is an important aspect of the functional architecture of the nucleus. To this end we have developed a novel in situ hybridization approach in combination with immunoelectron microscopy, using sense and anti-sense RNA probes that are derived from total cellular or cytoplasmic poly(A+) RNA. This new technology is much more gentle than classical in situ hybridization using DNA probes and shows excellent preservation of nuclear structure. Carried out on ultrathin sections of fixed and resin-embedded COS-7 cells, it revealed at high resolution the localization of the genes that code for the cellular mRNAs. Quantitative analysis shows that most transcribed DNA is concentrated in the perichromatin region, i.e. the interface between subchromosomal compact chromatin domains and the interchromatin space essentially devoid of DNA. The RNA that is produced is found mainly in the perichromatin region and the interchromatin space. These results imply that in the mammalian nucleus the chromatin fiber is folded so that active genes are predominantly present in the perichromatin region, which is the most prominent site of transcription.

  14. Marker lamps

    International Nuclear Information System (INIS)

    Watkins, D.V.

    1980-01-01

    A marker lamp is described which consists of a block of transparent plastics material encapsulated in which is a radioactive light source. These lights comprise a small sealed glass capsule, the hollow inside surface of which is coated with phosphor and which contains tritium or similar radioactive gas. The use of such lamps for identification marking of routes, for example roads, and for identification of underwater oil pipelines is envisaged. (U.K.)

  15. Decoding the principles underlying the frequency of association with nucleoli for RNA polymerase III–transcribed genes in budding yeast

    Science.gov (United States)

    Belagal, Praveen; Normand, Christophe; Shukla, Ashutosh; Wang, Renjie; Léger-Silvestre, Isabelle; Dez, Christophe; Bhargava, Purnima; Gadal, Olivier

    2016-01-01

    The association of RNA polymerase III (Pol III)–transcribed genes with nucleoli seems to be an evolutionarily conserved property of the spatial organization of eukaryotic genomes. However, recent studies of global chromosome architecture in budding yeast have challenged this view. We used live-cell imaging to determine the intranuclear positions of 13 Pol III–transcribed genes. The frequency of association with nucleolus and nuclear periphery depends on linear genomic distance from the tethering elements—centromeres or telomeres. Releasing the hold of the tethering elements by inactivating centromere attachment to the spindle pole body or changing the position of ribosomal DNA arrays resulted in the association of Pol III–transcribed genes with nucleoli. Conversely, ectopic insertion of a Pol III–transcribed gene in the vicinity of a centromere prevented its association with nucleolus. Pol III–dependent transcription was independent of the intranuclear position of the gene, but the nucleolar recruitment of Pol III–transcribed genes required active transcription. We conclude that the association of Pol III–transcribed genes with the nucleolus, when permitted by global chromosome architecture, provides nucleolar and/or nuclear peripheral anchoring points contributing locally to intranuclear chromosome organization. PMID:27559135

  16. A novel TBP-TAF complex on RNA polymerase II-transcribed snRNA genes.

    Science.gov (United States)

    Zaborowska, Justyna; Taylor, Alice; Roeder, Robert G; Murphy, Shona

    2012-01-01

    Initiation of transcription of most human genes transcribed by RNA polymerase II (RNAP II) requires the formation of a preinitiation complex comprising TFIIA, B, D, E, F, H and RNAP II. The general transcription factor TFIID is composed of the TATA-binding protein and up to 13 TBP-associated factors. During transcription of snRNA genes, RNAP II does not appear to make the transition to long-range productive elongation, as happens during transcription of protein-coding genes. In addition, recognition of the snRNA gene-type specific 3' box RNA processing element requires initiation from an snRNA gene promoter. These characteristics may, at least in part, be driven by factors recruited to the promoter. For example, differences in the complement of TAFs might result in differential recruitment of elongation and RNA processing factors. As precedent, it already has been shown that the promoters of some protein-coding genes do not recruit all the TAFs found in TFIID. Although TAF5 has been shown to be associated with RNAP II-transcribed snRNA genes, the full complement of TAFs associated with these genes has remained unclear. Here we show, using a ChIP and siRNA-mediated approach, that the TBP/TAF complex on snRNA genes differs from that found on protein-coding genes. Interestingly, the largest TAF, TAF1, and the core TAFs, TAF10 and TAF4, are not detected on snRNA genes. We propose that this snRNA gene-specific TAF subset plays a key role in gene type-specific control of expression.

  17. Introduction of in vitro transcribed ENO1 mRNA into neuroblastoma cells induces cell death

    International Nuclear Information System (INIS)

    Ejeskär, Katarina; Krona, Cecilia; Carén, Helena; Zaibak, Faten; Li, Lingli; Martinsson, Tommy; Ioannou, Panayiotis A

    2005-01-01

    Neuroblastoma is a solid tumour of childhood often with an unfavourable outcome. One common genetic feature in aggressive tumours is 1p-deletion. The α-enolase (ENO1) gene is located in chromosome region 1p36.2, within the common region of deletion in neuroblastoma. One alternative translated product of the ENO1 gene, known as MBP-1, acts as a negative regulator of the c-myc oncogene, making the ENO1 gene a candidate as a tumour suppressor gene. Methods used in this study are transfection of cDNA-vectors and in vitro transcribed mRNA, cell growth assay, TUNEL-assay, real-time RT-PCR (TaqMan) for expression studies, genomic sequencing and DHPLC for mutation detection. Here we demonstrate that transfection of ENO1 cDNA into 1p-deleted neuroblastoma cell lines causes' reduced number of viable cells over time compared to a negative control and that it induces apoptosis. Interestingly, a similar but much stronger dose-dependent reduction of cell growth was observed by transfection of in vitro transcribed ENO1 mRNA into neuroblastoma cells. These effects could also be shown in non-neuroblastoma cells (293-cells), indicating ENO1 to have general tumour suppressor activity. Expression of ENO1 is detectable in primary neuroblastomas of all different stages and no difference in the level of expression can be detected between 1p-deleted and 1p-intact tumour samples. Although small numbers (11 primary neuroblastomas), there is some evidence that Stage 4 tumours has a lower level of ENO1-mRNA than Stage 2 tumours (p = 0.01). However, mutation screening of 44 primary neuroblastomas of all different stages, failed to detect any mutations. Our studies indicate that ENO1 has tumour suppressor activity and that high level of ENO1 expression has growth inhibitory effects

  18. International

    International Nuclear Information System (INIS)

    Anon.

    1997-01-01

    This rubric reports on 10 short notes about international economical facts about nuclear power: Electricite de France (EdF) and its assistance and management contracts with Eastern Europe countries (Poland, Hungary, Bulgaria); Transnuclear Inc. company (a 100% Cogema daughter company) acquired the US Vectra Technologies company; the construction of the Khumo nuclear power plant in Northern Korea plays in favour of the reconciliation between Northern and Southern Korea; the delivery of two VVER 1000 Russian reactors to China; the enforcement of the cooperation agreement between Euratom and Argentina; Japan requested for the financing of a Russian fast breeder reactor; Russia has planned to sell a floating barge-type nuclear power plant to Indonesia; the control of the Swedish reactor vessels of Sydkraft AB company committed to Tractebel (Belgium); the renewal of the nuclear cooperation agreement between Swiss and USA; the call for bids from the Turkish TEAS electric power company for the building of the Akkuyu nuclear power plant answered by three candidates: Atomic Energy of Canada Limited (AECL), Westinghouse (US) and the French-German NPI company. (J.S.)

  19. A microarray for screening the variability of 16S–23S rRNA internal transcribed spacer in Pseudomonas syringae

    Czech Academy of Sciences Publication Activity Database

    Lenz, Ondřej; Beran, Pavel; Fousek, Jan; Mráz, Ivan

    2010-01-01

    Roč. 82, č. 1 (2010), s. 90-94 ISSN 0167-7012 R&D Projects: GA ČR GP522/07/P338 Institutional research plan: CEZ:AV0Z50510513 Keywords : microarray * ITS1 * mosaicism Subject RIV: EE - Microbiology, Virology Impact factor: 2.018, year: 2010

  20. A Bibliometric Study of the Resource-based View (RB V in International Business Research Using Barney (1991 as a Key Marker

    Directory of Open Access Journals (Sweden)

    Manuel Portugal Ferreira

    2016-06-01

    Full Text Available In this study we examine how the RBV has been included in IB research over the past twenty years using Barney’s (1991 article as a key marker. Bibliometric techniques analyzing citations, co-citations and research themes delved into, were applied to the articles published between 1991 and 2010 in five leading IB journals. Data was collected from the Social Science Citation Index (SSCI of the Institute for Scientific Information (ISI. We conclude that the RBV has been having an important impact on most of IB research themes and has been driving a large portion of current thought on the multinational corporations’ strategies, location choices and internationalization. Although, we also find areas that have been explored to much lesser extent. In addition to identify the stock of accumulated knowledge, this study contributes to highlight areas for future inquiry on how IB studies may further benefit from an RBV-oriented perspective.

  1. Quantitative determination of conjugated linoleic acid and polyunsaturated fatty acids in milk with C17 as internal marker – Evaluation of different methylation procedures

    DEFF Research Database (Denmark)

    Lashkari, Saman; Jensen, Søren Krogh

    2017-01-01

    in the methylation steps, as they are sensitive to pH changes and oxidation. The present study was carried out to determine the efficiency of different methylation procedures on quantitative determination of conjugated linoleic acid (CLA), PUFA and response of internal standard. The highest response of internal...... standard was observed for boron trifluoride (BF3)/methanol and methanolic HCl followed by NaOCH3, while cis-9, trans-11 CLA, total CLA and PUFA was higher with methanolic HCl followed by NaOCH3 compared with the BF3 method. These data can be useful for quantitating of milk FA....

  2. Are both sympatric species Ilex perado and Ilex canariensis secretly hybridizing? Indication from nuclear markers collected in Tenerife

    Directory of Open Access Journals (Sweden)

    Manen Jean-François

    2004-11-01

    Full Text Available Abstract Background Intra-specific and intra-individual polymorphism is frequently observed in nuclear markers of Ilex (Aquifoliaceae and discrepancy between plastid and nuclear phylogenies is the rule in this genus. These observations suggest that inter-specific plastid or/and nuclear introgression played an important role in the process of evolution of Ilex. With the aim of a precise understanding of the evolution of this genus, two distantly related sympatric species collected in Tenerife (Canary Islands, I. perado and I. canariensis, were studied in detail. Introgression between these two species was previously never reported. One plastid marker (the atpB-rbcL spacer and two nuclear markers, the ribosomal internal transcribed spacer (ITS and the nuclear encoded plastid glutamine synthetase (nepGS were analyzed for 13 and 27 individuals of I. perado and I. canariensis, respectively. Results The plastid marker is intra-specifically constant and correlated with species identity. On the other hand, whereas the nuclear markers are conserved in I. perado, they are highly polymorphic in I. canariensis. The presence of pseudogenes and recombination in ITS sequences of I. canariensis explain this polymorphism. Ancestral sequence polymorphism with incomplete lineage sorting, or past or recent hybridization with an unknown species could explain this polymorphism, not resolved by concerted evolution. However, as already reported for many other plants, past or recent introgression of an alien genotype seem the most probable explanation for such a tremendous polymorphism. Conclusions Data do not allow the determination with certitude of the putative species introgressing I. canariensis, but I. perado is suspected. The introgression would be unilateral, with I. perado as the male donor, and the paternal sequences would be rapidly converted in highly divergent and consequently unidentifiable pseudogenes. At least, this study allows the establishment of

  3. Identifying different transcribed proteins in the newly described Theraphosidae Pamphobeteus verdolaga.

    Science.gov (United States)

    Estrada-Gómez, Sebastian; Vargas-Muñoz, Leidy Johana; Saldarriaga-Córdoba, Mónica; Cifuentes, Yeimy; Perafan, Carlos

    2017-04-01

    Theraphosidae spider venoms are well known for possess a complex mixture of protein and non-protein compounds in their venom. The objective of this study was to report and identify different proteins translated from the venom gland DNA information of the recently described Theraphosidae spider Pamphobeteus verdolaga. Using a venom gland transcriptomic analysis, we reported a set of the first complete sequences of seven different proteins of the recenlty described Theraphosidae spider P. verdolaga. Protein analysis indicates the presence of different proteins on the venom composition of this new spider, some of them uncommon in the Theraphosidae family. MS/MS analysis of P. verdolaga showed different fragments matching sphingomyelinases (sicaritoxin), barytoxins, hexatoxins, latroinsectotoxins, and linear (zadotoxins) peptides. Only four of the MS/MS fragments showed 100% sequence similarity with one of the transcribed proteins. Transcriptomic analysis showed the presence of different groups of proteins like phospholipases, hyaluronidases, inhibitory cysteine knots (ICK) peptides among others. The three database of protein domains used in this study (Pfam, SMART and CDD) showed congruency in the search of unique conserved protein domain for only four of the translated proteins. Those proteins matched with EF-hand proteins, cysteine rich secretory proteins, jingzhaotoxins, theraphotoxins and hexatoxins, from different Mygalomorphae spiders belonging to the families Theraphosidae, Barychelidae and Hexathelidae. None of the analyzed sequences showed a complete 100% similarity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Opposite replication polarities of transcribed and nontranscribed histone H5 genes

    International Nuclear Information System (INIS)

    Trempe, J.P.; Lindstrom, Y.I.; Leffak, M.

    1988-01-01

    The authors used an in vitro nuclear runoff replication assay to analyze the direction of replication of the active and inactive histone H5 genes in avian cells. In embryonic erythrocytes the transcribed histone H5 gene displayed sensitivity to endogenous nuclease cleavage. In contrast, this gene was insensitive to endogenous nuclease digestion under the same conditions in nuclei of the lymphoblastoid cell line MSB-1, and histone H5 gene transcripts were not detectable by dot-blot analysis of MSB-1 cell RNA. When nuclei were isolated from embryonic erythrocyctes and incubated with bromodeoxyuridine triphosphate, runoff replication from endogenous nuclease cleavage sites led to a relative enrichment for fragments near the 3' end of the histone H5 gene in the density-labeled DNA. In nuclei of MSB-1 cells or chicken embryo fibroblasts, however, runoff replication from restriction enzyme-cut sites (or induced endogenous nuclease-cut sites in MSB-1 nuclei) led to a relative enrichment for fragments near the 5' end of the H5 gene in dense DNA. Based on the enhanced incorporation of bromodeoxyuridine into origin-distal regions of DNA during the in vitro runoff replication assay, the authors conclude that the active histone H5 gene in embryonic erythrocytes is preferentially replicated in the transcriptional direction from an origin in the 5'-flanking DNA, whereas its inactive counterparts in MSB-1 cells and chicken embryo fibroblasts are preferentially replicated in the opposite direction

  5. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions.

    Science.gov (United States)

    Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade

    2015-11-14

    FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.

  6. Plasma membrane cholesterol level and agonist-induced internalization of delta-opioid receptors; colocalization study with intracellular membrane markers of Rab family\

    Czech Academy of Sciences Publication Activity Database

    Brejchová, Jana; Vošahlíková, Miroslava; Roubalová, Lenka; Parenti, M.; Mauri, M.; Chernyavskiy, Oleksandr; Svoboda, Petr

    2016-01-01

    Roč. 48, č. 4 (2016), s. 375-396 ISSN 0145-479X R&D Projects: GA ČR(CZ) GAP207/12/0919 Institutional support: RVO:67985823 Keywords : cholesterol * plasma membrane * delta-opioid receptor * internalization * Rab proteins Subject RIV: CE - Biochemistry Impact factor: 2.576, year: 2016

  7. Decoding the principles underlying the frequency of association with nucleoli for RNA polymerase III-transcribed genes in budding yeast.

    Science.gov (United States)

    Belagal, Praveen; Normand, Christophe; Shukla, Ashutosh; Wang, Renjie; Léger-Silvestre, Isabelle; Dez, Christophe; Bhargava, Purnima; Gadal, Olivier

    2016-10-15

    The association of RNA polymerase III (Pol III)-transcribed genes with nucleoli seems to be an evolutionarily conserved property of the spatial organization of eukaryotic genomes. However, recent studies of global chromosome architecture in budding yeast have challenged this view. We used live-cell imaging to determine the intranuclear positions of 13 Pol III-transcribed genes. The frequency of association with nucleolus and nuclear periphery depends on linear genomic distance from the tethering elements-centromeres or telomeres. Releasing the hold of the tethering elements by inactivating centromere attachment to the spindle pole body or changing the position of ribosomal DNA arrays resulted in the association of Pol III-transcribed genes with nucleoli. Conversely, ectopic insertion of a Pol III-transcribed gene in the vicinity of a centromere prevented its association with nucleolus. Pol III-dependent transcription was independent of the intranuclear position of the gene, but the nucleolar recruitment of Pol III-transcribed genes required active transcription. We conclude that the association of Pol III-transcribed genes with the nucleolus, when permitted by global chromosome architecture, provides nucleolar and/or nuclear peripheral anchoring points contributing locally to intranuclear chromosome organization. © 2016 Belagal et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  8. Increased expression of hepatocyte nuclear factor 4 alpha transcribed by promoter 2 indicates a poor prognosis in hepatocellular carcinoma

    OpenAIRE

    Cai, Shao-hang; Lu, Shi-xun; Liu, Li-li; Zhang, Chris Zhiyi; Yun, Jing-ping

    2017-01-01

    Background: Hepatocyte nuclear factor 4 alpha (HNF4α) plays an important role in tumourigenesis. There is growing evidence indicating that HNF4α transcribed by promoter 1 (P1-HNF4α) is expressed at relatively low levels in HCC and its presence predicts a favourable outcome for hepatocellular carcinoma (HCC) patients. However, the role of HNF4α transcribed by promoter 2 (P2-HNF4α) in HCC remains unclear. Methods: A total of 615 HCC specimens were obtained to construct tissue microarrays and pe...

  9. Identification of a noncanonically transcribed subgenomic mRNA of infectious bronchitis virus and other gammacoronaviruses.

    Science.gov (United States)

    Bentley, Kirsten; Keep, Sarah May; Armesto, Maria; Britton, Paul

    2013-02-01

    Coronavirus subgenomic mRNA (sgmRNA) synthesis occurs via a process of discontinuous transcription involving transcription regulatory sequences (TRSs) located in the 5' leader sequence (TRS-L) and upstream of each structural and group-specific gene (TRS-B). Several gammacoronaviruses including infectious bronchitis virus (IBV) contain a putative open reading frame (ORF), localized between the M gene and gene 5, which is controversial due to the perceived absence of a TRS. We have studied the transcription of a novel sgmRNA associated with this potential ORF and found it to be transcribed via a previously unidentified noncanonical TRS-B. Using an IBV reverse genetics system, we demonstrated that the template-switching event during intergenic region (IR) sgmRNA synthesis occurs at the 5' end of the noncanonical TRS-B and recombines between nucleotides 5 and 6 of the 8-nucleotide consensus TRS-L. Introduction of a complete TRS-B showed that higher transcription levels are achieved by increasing the number of nucleotide matches between TRS-L and TRS-B. Translation of a protein from the sgmRNA was demonstrated using enhanced green fluorescent protein, suggesting the translation of a fifth, novel, group-specific protein for IBV. This study has resolved an issue concerning the number of ORFs expressed by members of the Gammacoronavirus genus and proposes the existence of a fifth IBV accessory protein. We confirmed previous reports that coronaviruses can produce sgmRNAs from noncanonical TRS-Bs, which may expand their repertoire of proteins. We also demonstrated that noncanonical TRS-Bs may provide a mechanism by which coronaviruses can control protein expression levels by reducing sgmRNA synthesis.

  10. Polyadenylation of RNA transcribed from mammalian SINEs by RNA polymerase III: Complex requirements for nucleotide sequences.

    Science.gov (United States)

    Borodulina, Olga R; Golubchikova, Julia S; Ustyantsev, Ilia G; Kramerov, Dmitri A

    2016-02-01

    It is generally accepted that only transcripts synthesized by RNA polymerase II (e.g., mRNA) were subject to AAUAAA-dependent polyadenylation. However, we previously showed that RNA transcribed by RNA polymerase III (pol III) from mouse B2 SINE could be polyadenylated in an AAUAAA-dependent manner. Many species of mammalian SINEs end with the pol III transcriptional terminator (TTTTT) and contain hexamers AATAAA in their A-rich tail. Such SINEs were united into Class T(+), whereas SINEs lacking the terminator and AATAAA sequences were classified as T(-). Here we studied the structural features of SINE pol III transcripts that are necessary for their polyadenylation. Eight and six SINE families from classes T(+) and T(-), respectively, were analyzed. The replacement of AATAAA with AACAAA in T(+) SINEs abolished the RNA polyadenylation. Interestingly, insertion of the polyadenylation signal (AATAAA) and pol III transcription terminator in T(-) SINEs did not result in polyadenylation. The detailed analysis of three T(+) SINEs (B2, DIP, and VES) revealed areas important for the polyadenylation of their pol III transcripts: the polyadenylation signal and terminator in A-rich tail, β region positioned immediately downstream of the box B of pol III promoter, and τ region located upstream of the tail. In DIP and VES (but not in B2), the τ region is a polypyrimidine motif which is also characteristic of many other T(+) SINEs. Most likely, SINEs of different mammals acquired these structural features independently as a result of parallel evolution. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Poly A tail length analysis of in vitro transcribed mRNA by LC-MS.

    Science.gov (United States)

    Beverly, Michael; Hagen, Caitlin; Slack, Olga

    2018-02-01

    The 3'-polyadenosine (poly A) tail of in vitro transcribed (IVT) mRNA was studied using liquid chromatography coupled to mass spectrometry (LC-MS). Poly A tails were cleaved from the mRNA using ribonuclease T1 followed by isolation with dT magnetic beads. Extracted tails were then analyzed by LC-MS which provided tail length information at single-nucleotide resolution. A 2100-nt mRNA with plasmid-encoded poly A tail lengths of either 27, 64, 100, or 117 nucleotides was used for these studies as enzymatically added poly A tails showed significant length heterogeneity. The number of As observed in the tails closely matched Sanger sequencing results of the DNA template, and even minor plasmid populations with sequence variations were detected. When the plasmid sequence contained a discreet number of poly As in the tail, analysis revealed a distribution that included tails longer than the encoded tail lengths. These observations were consistent with transcriptional slippage of T7 RNAP taking place within a poly A sequence. The type of RNAP did not alter the observed tail distribution, and comparison of T3, T7, and SP6 showed all three RNAPs produced equivalent tail length distributions. The addition of a sequence at the 3' end of the poly A tail did, however, produce narrower tail length distributions which supports a previously described model of slippage where the 3' end can be locked in place by having a G or C after the poly nucleotide region. Graphical abstract Determination of mRNA poly A tail length using magnetic beads and LC-MS.

  12. Pig Manure Contamination Marker Selection Based on the Influence of Biological Treatment on the Dominant Fecal Microbial Groups▿

    Science.gov (United States)

    Marti, Romain; Dabert, Patrick; Pourcher, Anne-Marie

    2009-01-01

    The objective of this study was to identify a microbial marker for pig manure contamination. We quantified the persistence of four dominant bacterial groups from the pig intestinal tract throughout manure handling at 10 livestock operations (including aerobic digestion) by using molecular typing. The partial 16S rRNA genes of Bacteroides-Prevotella, Eubacterium-Clostridiaceae, Bacillus-Streptococcus-Lactobacillus (BSL), and Bifidobacterium group isolates were amplified and analyzed by capillary electrophoresis single-strand conformation polymorphism. The most dominant bacterial populations were identified by cloning and sequencing their 16S rRNA genes. The results showed that Bifidobacterium spp. and, to a lesser extent, members of the BSL group, were less affected by the aerobic treatment than either Eubacterium-Clostridiaceae or Bacteroides-Prevotella. Two Bifidobacterium species found in raw manure were still present in manure during land application, suggesting that they can survive outside the pig intestinal tract and also survive aerobic treatment. The 16S-23S rRNA internal transcribed spacer of one species, Bifidobacterium thermacidophilum subsp. porcinum, was sequenced, and a specific pair of primers was designed for its detection in the environment. With this nested PCR assay, this potential marker was not detected in samples from 30 bovine, 30 poultry, and 28 human fecal samples or in 15 urban wastewater effluents. As it was detected in runoff waters after spreading of pig manure, we propose this marker as a suitable microbial indicator of pig manure contamination. PMID:19525269

  13. Pig manure contamination marker selection based on the influence of biological treatment on the dominant fecal microbial groups.

    Science.gov (United States)

    Marti, Romain; Dabert, Patrick; Pourcher, Anne-Marie

    2009-08-01

    The objective of this study was to identify a microbial marker for pig manure contamination. We quantified the persistence of four dominant bacterial groups from the pig intestinal tract throughout manure handling at 10 livestock operations (including aerobic digestion) by using molecular typing. The partial 16S rRNA genes of Bacteroides-Prevotella, Eubacterium-Clostridiaceae, Bacillus-Streptococcus-Lactobacillus (BSL), and Bifidobacterium group isolates were amplified and analyzed by capillary electrophoresis single-strand conformation polymorphism. The most dominant bacterial populations were identified by cloning and sequencing their 16S rRNA genes. The results showed that Bifidobacterium spp. and, to a lesser extent, members of the BSL group, were less affected by the aerobic treatment than either Eubacterium-Clostridiaceae or Bacteroides-Prevotella. Two Bifidobacterium species found in raw manure were still present in manure during land application, suggesting that they can survive outside the pig intestinal tract and also survive aerobic treatment. The 16S-23S rRNA internal transcribed spacer of one species, Bifidobacterium thermacidophilum subsp. porcinum, was sequenced, and a specific pair of primers was designed for its detection in the environment. With this nested PCR assay, this potential marker was not detected in samples from 30 bovine, 30 poultry, and 28 human fecal samples or in 15 urban wastewater effluents. As it was detected in runoff waters after spreading of pig manure, we propose this marker as a suitable microbial indicator of pig manure contamination.

  14. Unified English Braille in the United Kingdom: Part 2--Examination by Literary Braille Users, Braille Teachers, and Transcribers

    Science.gov (United States)

    Cryer, Heather; Home, Sarah; Morley Wilkins, Sarah

    2013-01-01

    To inform decision-making around the adoption of the Unified English Braille (UEB) code in the United Kingdom, a suite of research was carried out. This study involved a variety of braille stakeholders--student braille readers (in full time education), adult braille readers, braille teachers, and braille transcribers. Participants were sent…

  15. The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1998-01-01

    The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

  16. Transcription Matters: Transcribing Talk and Interaction to Facilitate Conversation Analysis of the Taken-for-Granted in Young Children's Interactions

    Science.gov (United States)

    Davidson, Christina

    2010-01-01

    The development of transcripts is central to the work of many researchers yet questions of what and how researchers transcribe, and why, receive little attention in research literature. Conversation analysis is one research approach that has consistently addressed the integral relationship between theoretical and methodological perspectives,…

  17. Cutaneous Lymphoma International Consortium Study of Outcome in Advanced Stages of Mycosis Fungoides and Sézary Syndrome: Effect of Specific Prognostic Markers on Survival and Development of a Prognostic Model

    Science.gov (United States)

    Scarisbrick, Julia J.; Prince, H. Miles; Vermeer, Maarten H.; Quaglino, Pietro; Horwitz, Steven; Porcu, Pierluigi; Stadler, Rudolf; Wood, Gary S.; Beylot-Barry, Marie; Pham-Ledard, Anne; Foss, Francine; Girardi, Michael; Bagot, Martine; Michel, Laurence; Battistella, Maxime; Guitart, Joan; Kuzel, Timothy M.; Martinez-Escala, Maria Estela; Estrach, Teresa; Papadavid, Evangelia; Antoniou, Christina; Rigopoulos, Dimitis; Nikolaou, Vassilki; Sugaya, Makoto; Miyagaki, Tomomitsu; Gniadecki, Robert; Sanches, José Antonio; Cury-Martins, Jade; Miyashiro, Denis; Servitje, Octavio; Muniesa, Cristina; Berti, Emilio; Onida, Francesco; Corti, Laura; Hodak, Emilia; Amitay-Laish, Iris; Ortiz-Romero, Pablo L.; Rodríguez-Peralto, Jose L.; Knobler, Robert; Porkert, Stefanie; Bauer, Wolfgang; Pimpinelli, Nicola; Grandi, Vieri; Cowan, Richard; Rook, Alain; Kim, Ellen; Pileri, Alessandro; Patrizi, Annalisa; Pujol, Ramon M.; Wong, Henry; Tyler, Kelly; Stranzenbach, Rene; Querfeld, Christiane; Fava, Paolo; Maule, Milena; Willemze, Rein; Evison, Felicity; Morris, Stephen; Twigger, Robert; Talpur, Rakhshandra; Kim, Jinah; Ognibene, Grant; Li, Shufeng; Tavallaee, Mahkam; Hoppe, Richard T.; Duvic, Madeleine; Whittaker, Sean J.; Kim, Youn H.

    2015-01-01

    Purpose Advanced-stage mycosis fungoides (MF; stage IIB to IV) and Sézary syndrome (SS) are aggressive lymphomas with a median survival of 1 to 5 years. Clinical management is stage based; however, there is wide range of outcome within stages. Published prognostic studies in MF/SS have been single-center trials. Because of the rarity of MF/SS, only a large collaboration would power a study to identify independent prognostic markers. Patients and Methods Literature review identified the following 10 candidate markers: stage, age, sex, cutaneous histologic features of folliculotropism, CD30 positivity, proliferation index, large-cell transformation, WBC/lymphocyte count, serum lactate dehydrogenase, and identical T-cell clone in blood and skin. Data were collected at specialist centers on patients diagnosed with advanced-stage MF/SS from 2007. Each parameter recorded at diagnosis was tested against overall survival (OS). Results Staging data on 1,275 patients with advanced MF/SS from 29 international sites were included for survival analysis. The median OS was 63 months, with 2- and 5-year survival rates of 77% and 52%, respectively. The median OS for patients with stage IIB disease was 68 months, but patients diagnosed with stage III disease had slightly improved survival compared with patients with stage IIB, although patients diagnosed with stage IV disease had significantly worse survival (48 months for stage IVA and 33 months for stage IVB). Of the 10 variables tested, four (stage IV, age > 60 years, large-cell transformation, and increased lactate dehydrogenase) were independent prognostic markers for a worse survival. Combining these four factors in a prognostic index model identified the following three risk groups across stages with significantly different 5-year survival rates: low risk (68%), intermediate risk (44%), and high risk (28%). Conclusion To our knowledge, this study includes the largest cohort of patients with advanced-stage MF/SS and

  18. Avaliação do uso de frações indigestíveis do alimento como indicadores internos de digestibilidade em ovinos Evaluation of indigestible feed fractions as internal markers for predicting digestibility in lambs

    Directory of Open Access Journals (Sweden)

    Gilberto Vilmar Kozloski

    2009-09-01

    markers to estimate digestibility in lambs was evaluated. Data and samples were obtained from six independent digestion trials with lambs housed in metabolism cages given ad libitum different forage and concentrate feedstuffs. Indigestible residues were determined after 144 hours of in situ incubation of feed and faeces samples. Recovery rate varied from 64.8 to 108.5% for iDM, and from 49.5 to 67.9% for iNDF. As the marker ratio between marker concentration in the faeces and the feed was not corrected for fecal recovery, the large part of the estimated apparent organic matter digestibility (AOMD of the experimental means were lower than the in vivo that obtained. As the marker ratio was corrected for fecal recovery of the marker, the AOMD means estimated using both markers were similar to the in vivo data in all experiments. As individual estimates, corrected for fecal recovery of the marker, were related to in vivo observations through regression analysis, the slope of the regression for iDM was not different from 1 whereas for iNDF, the slope was lower than 1. Individual AOMD values estimates using both markers, however, were poorly related to the in vivo observations (r² varied from 0.60 to 0.63. Once corrected for fecal recovery, residual DM after 144 hours of in situ incubation is suitable for use as an internal marker to estimate mean diet digestibility consumed for a group of animals. However, individual estimates were not accurate to detect small differences in digestibility imposed by different treatments within an experiment.

  19. Phylogenetic study of Geitlerinema and Microcystis (Cyanobacteria) using PC-IGS and 16S-23S ITS as markers: investigation of horizontal gene transfer.

    Science.gov (United States)

    Piccin-Santos, Viviane; Brandão, Marcelo Mendes; Bittencourt-Oliveira, Maria Do Carmo

    2014-08-01

    Selection of genes that have not been horizontally transferred for prokaryote phylogenetic inferences is regarded as a challenging task. The markers internal transcribed spacer of ribosomal genes (16S-23S ITS) and phycocyanin intergenic spacer (PC-IGS), based on the operons of ribosomal and phycocyanin genes respectively, are among the most used markers in cyanobacteria. The region of the ribosomal genes has been considered stable, whereas the phycocyanin operon may have undergone horizontal transfer. To investigate the occurrence of horizontal transfer of PC-IGS, phylogenetic trees of Geitlerinema and Microcystis strains were generated using PC-IGS and 16S-23S ITS and compared. Phylogenetic trees based on the two markers were mostly congruent for Geitlerinema and Microcystis, indicating a common evolutionary history among ribosomal and phycocyanin genes with no evidence for horizontal transfer of PC-IGS. Thus, PC-IGS is a suitable marker, along with 16S-23S ITS for phylogenetic studies of cyanobacteria. © 2014 Phycological Society of America.

  20. Molecular markers from three organellar genomes unravel complex taxonomic relationships within the coralline algal genus Chiharaea (Corallinales, Rhodophyta).

    Science.gov (United States)

    Hind, Katharine R; Saunders, Gary W

    2013-05-01

    The use of molecular markers in taxonomic studies has become a standard practice in biology. However, consensus on which markers to use at the species level is lacking because evolutionary lineages show differences in divergence rates between organellar genomes. Ideally, researchers use multiple lines of evidence when first describing a species, such as the incorporation of several molecular markers from varied genomes (mitochondrion, plastid and nucleus). This study examined species boundaries in the red algal genus Chiharaea. We used five molecular markers, with at least one marker from each genome, coupled with thorough morphological analyses. We recognized three species in Chiharaea (C.americana, C. rhododactyla sp. nov., C. silvae) and two forms (C. americana f. americana and C. americana f. bodegensis (H.W. Johansen) stat. nov.). For C. americana f. americana and C. americana f. bodegensis differentiation based on morphological data was reflected in the plastid-encoded large subunit of RuBisCO (rbcL), but was not concordant with either the mitochondrial cytochrome c oxidase subunit 1 (COI-5P) or nuclear internal transcribed spacer (ITS) sequence data. We suggest that this discordance is indicative of ongoing hybridization and introgression between populations of C. americana f. americana and C. americana f. bodegensis. In addition, we used a PCR assay with ITS specific primers to amplify multiple ITS variants for collections assignable to C. americana indicating that there is genetic variability within ITS copies most likely due to introgression, crossing over and/or the retention of ancestral variants. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Internal validation of the renal pelvic score: a novel marker of renal pelvic anatomy that predicts urine leak after partial nephrectomy.

    Science.gov (United States)

    Tomaszewski, Jeffrey J; Smaldone, Marc C; Cung, Bic; Li, Tianyu; Mehrazin, Reza; Kutikov, Alexander; Canter, Daniel J; Viterbo, Rosalia; Chen, David Y T; Greenberg, Richard E; Uzzo, Robert G

    2014-08-01

    To internally validate the renal pelvic score (RPS) in an expanded cohort of patients undergoing partial nephrectomy (PN). Our prospective institutional renal cell carcinoma database was used to identify all patients undergoing PN for localized renal cell carcinoma from 2007 to 2013. Patients were classified by RPS as having an intraparenchymal or extraparenchymal renal pelvis. Multivariate logistic regression models were used to examine the relationship between RPS and urine leak. Eight hundred thirty-one patients (median age, 60 ± 11.6 years; 65.1% male) undergoing PN (57.3% robotic) for low (28.9%), intermediate (56.5%), and high complexity (14.5%) localized renal tumors (median size, 3.0 ± 2.3 cm; median nephrometry score, 7.0 ± 2.6) were included. Fifty-four patients (6.5%) developed a clinically significant or radiographically identified urine leak. Seventy-two of 831 renal pelvises (8.7%) were classified as intraparenchymal. Intrarenal pelvic anatomy was associated with a markedly increased risk of urine leak (43.1% vs 3.0%; P renal pelvis; odds ratio [OR], 24.8; confidence interval [CI], 11.5-53.4; P Renal pelvic anatomy as measured by the RPS best predicts urine leak after open and robotic partial nephrectomy. Although external validation of the RPS is required, preoperative identification of patients at increased risk for urine leak should be considered in perioperative management and counseling algorithms. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Elimination of ghost markers during dual sensor-based infrared tracking of multiple individual reflective markers

    International Nuclear Information System (INIS)

    Stroian, G.; Falco, T.; Seuntjens, J.P.

    2004-01-01

    The accuracy of dose delivery in radiotherapy is affected by the uncertainty in tumor localization. Motion of internal anatomy due to physiological processes such as respiration may lead to significant displacements which compromise tumor coverage and generate irradiation of healthy tissue. Real-time tracking with infrared-based systems is often used for tracking thoracic motion in radiation therapy. We studied the origin of ghost markers ('crosstalk') which may appear during dual sensor-based infrared tracking of independent reflective markers. Ghost markers occur when two or more reflective markers are coplanar with each other and with the sensors of the two camera-based infrared tracking system. Analysis shows that sensors are not points but they have a finite extent and this extent determines for each marker a 'ghost volume'. If one reflective marker enters the ghost volume of another marker, ghost markers will be reported by the tracking system; if the reflective markers belong to a surface their 'ghost volume' is reduced to a 'ghost surface' (ghost zone). Appearance of ghost markers is predicted for markers taped on the torso of an anthropomorphic phantom. This study illustrates the dependence of the shape, extent, and location of the ghost zones on the shape of the anthropomorphic phantom, the angle of view of the tracking system, and the distance between the tracking system and the anthropomorphic phantom. It is concluded that the appearance of ghost markers can be avoided by positioning the markers outside the ghost zones of the other markers. However, if this is not possible and the initial marker configuration is ghost marker-free, ghost markers can be eliminated during real-time tracking by virtue of the fact that they appear in the coordinate data sequence only temporarily

  3. Is ITS-2 rDNA suitable marker for genetic characterization of Sarcoptes mites from different wild animals in different geographic areas?

    Science.gov (United States)

    Alasaad, S; Soglia, D; Spalenza, V; Maione, S; Soriguer, R C; Pérez, J M; Rasero, R; Degiorgis, M P Ryser; Nimmervoll, H; Zhu, X Q; Rossi, L

    2009-02-05

    The present study examined the relationship among individual Sarcoptes scabiei mites from 13 wild mammalian populations belonging to nine species in four European countries using the second internal transcribed spacer (ITS-2) of nuclear ribosomal DNA (rDNA) as genetic marker. The ITS-2 plus primer flanking 5.8S and 28S rDNA (ITS-2+) was amplified from individual mites by polymerase chain reaction (PCR) and the amplicons were sequenced directly. A total of 148 ITS-2+ sequences of 404bp in length were obtained and 67 variable sites were identified (16.59%). UPGMA analyses did not show any geographical or host-specific clustering, and a similar outcome was obtained using population pairwise Fst statistics. These results demonstrated that ITS-2 rDNA does not appear to be suitable for examining genetic diversity among mite populations.

  4. Isolation of oogenesis-specific genes transcribed in the germ-line of Calliphora erythrocephala and Drosophila melanogaster

    International Nuclear Information System (INIS)

    Tucker, M.A.

    1988-01-01

    Poly(A) + RNA from early or mid-stage ovarian follicles of C. erythrocephala was used to generate radiolabelled oogenesis-specific cDNA probes for screening the phage libraries. A cDNA probe made from mid-stage embryo poly(A) + RNA was used as the differential screening probe. Thus plaques hybridizing to the two oogenesis-specific probes but not the mid-stage embryo probe were selected as potentially containing oogenesis-specific genes. Two further rounds of screening were used to eliminate false positives and, after plaque purification, restriction digests of the remaining clones were screened by Southern blot hybridization to identify DNA fragments transcribed in an oogenesis-specific manner. In situ hybridization to sections of ovarian follicles has been used to determine the cell types within the follicles in which the various genes are expressed. Radiolabelled RNA probes for four of the C. erythrocephala oogenesis-specific clones and the two D. melanogaster clones have been hybridized to ovarian follicles. Further studies have been concentrated on the two germ-line transcribed, oogenesis-specific clones isolated from the D. melanogaster clone library. Detailed genetic mapping of the DA clone and of these mutations was performed to determine which mutations might represent the DA gene. cDNA clones have been isolated for the transcribed region of clone DA and have been used to further define the transcription unit from this region of the D. melanogaster genome

  5. Quality assurance program of a respiratory gating irradiation system based on external and internal fiducial markers; Programa de garantia de calidad de un sistema de irradiacion con control respiratorio basado en marcadores fiduciales externos e internos

    Energy Technology Data Exchange (ETDEWEB)

    Zucca Aparicio, D.; Perez Moreno, J. M.; Fernandez Leton, P.; Garcia Ruiz-Zorrilla, J.; Minambres Moro, A.

    2011-07-01

    Respiratory Gating involves the administration of radiation during treatment delivery within a particular portion of the patients breathing cycle, so the absorbed dose administration with respiratory control techniques requires specific quality control to ensure the correctness of the delivered dose. The establishment of a Quality Control Program (QC) is proposed for the Respiratory Gating based techniques in order to have a better understanding of how this system works and to know its associated dosimetric impact. The influence of the CT acquisition under respiratory motion conditions has been analyzed for the treatment isocenter localization, using internal and external fiducial markers with IGRT techniques that allow the correlation of the isocenter positioning with the phase of the respiratory cycle. Radiation delivery in the presence of intra fraction organ motion causes an averaging or blurring of the static dose distribution over the path of motion increasing the beam penumbra of the radiation field and reducing the therapeutic region when the irradiation is not breath controlled. The feasibility of intensity modulated treatments (IMRT) for both static and dynamic techniques, managed by respiratory control has been tested, demonstrating the possibility of synchronizing the movement of the leaves in the microfluorimeter collimator (mMLC) with the gated beam irradiation. (Author) 45 refs.

  6. A search for markers of sugarcane evolution

    Directory of Open Access Journals (Sweden)

    M. Bacci Jr.

    2001-12-01

    Full Text Available To determine the phylogenetic relationship between sugarcane cultivars and other members of the Saccharinae subtribe, we identified the fast evolving ITS1-5.8S-ITS2 (ITS = internal transcribed spacer; 5.8S = 5.8S ribosomal DNA region of the sugarcane genome in the Sugarcane Expressed Sequence Tag (SUCEST genome project database. Parsimony analysis utilizing this region and homologs belonging to the 23 closely related Andropogoneae currently deposited in the GenBank database has shown sugarcane as the sister group of Saccharum sinense. However, because there are few parsimony-informative characters and high homoplasy in the ITS1-5.8S-ITS2 region we were not able to determine with confidence the phylogenetic relationship between sugarcane and some of the remaining members of Saccharine subtribe. To find alternatives for the phylogenetic reconstruction of sugarcane evolutionary history, we selected 17 markers (nuclear, chloroplastic or mitochondrial from the SUCEST database of which apha-tubulin, ribosomal protein L16 (rpl16 and DNA-directed RNA polymerase beta chain (rpoC2 were found to have a low incidence of polymorphism and comparable, or even faster, rates of evolution than the ITS1-5.8S-ITS2 region. We suggest that these markers should be considered as preferential choices for phylogenetic studies of Saccharinae subtribe.Com o propósito de determinar a relação filogenética entre a cana-de-açúcar e membros da subtribo Saccharinae, a região gênica nuclear ITS1-5,8S-ITS2 (ITS: espaçador interno transcrito; 5,8S: DNA ribossomal 5.8S, com alta taxa evolutiva, foi identificada no banco de dados do projeto genoma "Sugarcane Expressed Sequence Tag" (SUCEST. Uma análise através do método de parcimônia, utilizando esta região e seqüências homólogas de 23 Andropogoneae retiradas da base de dados GenBank, indicou que a cana-de-açúcar é o grupo-irmão de Saccharum sinense. No entanto, devido à pequena quantidade de caracteres

  7. Epigenetic mismatches with mutated transcribing genes at leukemogenic S-phase binding/start sites--potential targets for therapy with enzyme inhibitors.

    Science.gov (United States)

    Prindull, Gregor

    2012-11-01

    This review focuses on gene transcription patterns of leukemogenic S-phases in mitotic cell cycles for identification of enzymatic reactions as potential targets for epigenetics-based drug therapy. Transcription of leukemic genes is triggered by reprogrammed transcription factors (TFs) mediated by chromatin histones. Reprogrammed TFs originate from transcriptional alterations of CpG methylation patterns of mutated epigenetic genes. They preserve memory information of earlier leukemogenic exposures, even transgenerationally via the zygote, through small (e.g. pi)RNA transmitted between cells by exosomes. Normally, reprogrammed TFs are enzymatically silenced and stored as markers in heterochromatic domains. Failure of intra S-phase surveillance (IS) permits the formation and continual operation of DNA replication forks in spite of persisting genotoxic stress. Silenced TFs are re-activated by euchromatin, most likely through leakages of insulator barriers of cis-regulating chromatin modulators (CRM) that normally separate hetero- from euchromatin domains. During transport by sliding nucleosomes, reprogrammed leukemogenic TFs are misplaced at transcription factor binding-/starting-sites (TFBS /TSS) allowing them to interact with and trigger replication of mutated leukemic genes. Interactions of enzymatically reprogrammed TFs, transcribed from mutated epigenetic genes, with replicating leukemic genes at TFBS/TSSs are key driving forces in leukemogenesis. Probably, epigenetic genes, although mutated, still retain their control of replication of leukemic genes. Epigenetics-based enzyme inhibitors must target reprogrammed TFs. Prudently, therapeutic corrections should be introduced within the frame of conventional, cytoreductive treatment protocols. Alternatively, reprogrammed TFs could be replaced by cell populations with regular TF production. Clinically, classification of leukemias should be based on their epigenetic presentation.

  8. Internal time marker (Q1) of the Cretaceous super chron in the Bay of Bengal - a new age constraint for the oceanic crust evolved between India and Elan Bank

    Science.gov (United States)

    Krishna, K. S.; Ismaiel, M.; Karlapati, S.; Saha, D.; Mishra, J.

    2014-12-01

    Analysis of marine magnetic data of the Bay of Bengal (BOB) led to suggest two different tectonic models for the evolution of lithosphere between India and East Antarctica. The first model explains the presence of M-series (M11 to M0) magnetic anomalies in BOB with a small room leaving for accommodating the crust evolved during the long Cretaceous Magnetic Quiet Period. Second model explains in other way that most part of the crust in BOB was evolved during the quite period together with the possible presence of oldest magnetic chron M1/ M0 in close vicinity of ECMI. It is with this perspective we have reinvestigated the existing and recently acquired magnetic data together with regional magnetic model of BOB for identification of new tectonic constraints, thereby to better understand the evolution of lithosphere. Analysis of magnetic data revealed the presence of spreading anomalies C33 and C34 in the vicinity of 8°N, and internal time marker (Q1) corresponding to the age 92 Ma at 12°N in a corridor between 85°E and Ninetyeast ridges. The new time marker and its location, indeed, become a point of reference and benchmark in BOB for estimating the age of oceanic crust towards ECMI. The magnetic model further reveals the presence of network of fracture zones (FZs) with different orientations. Between 85°E and Ninetyeast ridges, two near N-S FZs, approximately followed 87°E and 89.5°E are found to extend into BOB up to 12°N, from there the FZs reorient in N60°W direction and reach to the continental margin region. Along ECMI two sets of FZs are identified with a northern set oriented in N60°W and southern one in N40°W direction. This suggests that both north and south segments of the ECMI were evolved in two different tectonic settings. The bend in FZs marks the timing (92 Ma) of occurrence of first major plate reorganisation of the Indian Ocean and becomes a very critical constraint for understanding the plate tectonic process in early opening of the

  9. Differentiating Authentic Adenophorae Radix from Its Adulterants in Commercially-Processed Samples Using Multiplexed ITS Sequence-Based SCAR Markers

    Directory of Open Access Journals (Sweden)

    Byeong Cheol Moon

    2017-06-01

    Full Text Available Determining the precise botanical origin of a traditional herbal medicine is important for basic quality control. In both the Chinese and Korean herbal pharmacopoeia, authentic Adenophorae Radix is defined as the roots of Adenophora stricta and Adenophora triphylla. However, the roots of Codonopsis lanceolata, Codonopsis pilosula, and Glehnia littoralis are frequently distributed as Adenophorae Radix in Korean herbal markets. Unfortunately, correctly identifying dried roots is difficult using conventional methods because the roots of those species are morphologically similar. Therefore, we developed DNA-based markers for the identification of authentic Adenophorae Radix and its common adulterants in commercially-processed samples. To develop a reliable method to discriminate between Adenophorae Radix and its adulterants, we sequenced the nuclear ribosomal DNA internal transcribed spacers (nrDNA-ITS and designed sequence-characterized amplified region (SCAR primers specific to the authentic and adulterant species. Using these primers, we developed SCAR markers for each species and established a multiplex-PCR method that can authenticate the four herbal medicines in a single PCR reaction. Furthermore, we confirmed that commercially-processed herbal medicines, which often have degraded DNA, could be assessed with our method. Therefore, our method is a reliable genetic tool to protect against adulteration and to standardize the quality of Adenophorae Radix.

  10. SF Treg cells transcribing high levels of Bcl-2 and microRNA-21 demonstrate limited apoptosis in RA

    NARCIS (Netherlands)

    van der Geest, Kornelis S. M.; Smigielska, Katarzyna; Park, Ji-Ah; Abdulahad, Wayel H.; Kim, Hye-Won; Kroesen, Bart-Jan; van den Berg, Anke; Boots, Annemieke M. H.; Lee, Eun-Bong; Brouwer, Elisabeth

    Objective. The aim of this study was to investigate the turnover of Treg cells in the SF of RA patients. Methods. Treg cells were enumerated in peripheral blood and SF of RA patients and analysed by flow cytometry for expression of the proliferation marker Ki-67 and binding of the apoptosis marker

  11. A comparison of the use of bony anatomy and internal markers for offline verification and an evaluation of the potential benefit of online and offline verification protocols for prostate radiotherapy.

    Science.gov (United States)

    McNair, Helen A; Hansen, Vibeke N; Parker, Christopher C; Evans, Phil M; Norman, Andrew; Miles, Elizabeth; Harris, Emma J; Del-Acroix, Louise; Smith, Elizabeth; Keane, Richard; Khoo, Vincent S; Thompson, Alan C; Dearnaley, David P

    2008-05-01

    To evaluate the utility of intraprostatic markers in the treatment verification of prostate cancer radiotherapy. Specific aims were: to compare the effectiveness of offline correction protocols, either using gold markers or bony anatomy; to estimate the potential benefit of online correction protocol's using gold markers; to determine the presence and effect of intrafraction motion. Thirty patients with three gold markers inserted had pretreatment and posttreatment images acquired and were treated using an offline correction protocol and gold markers. Retrospectively, an offline protocol was applied using bony anatomy and an online protocol using gold markers. The systematic errors were reduced from 1.3, 1.9, and 2.5 mm to 1.1, 1.1, and 1.5 mm in the right-left (RL), superoinferior (SI), and anteroposterior (AP) directions, respectively, using the offline correction protocol and gold markers instead of bony anatomy. The subsequent decrease in margins was 1.7, 3.3, and 4 mm in the RL, SI, and AP directions, respectively. An offline correction protocol combined with an online correction protocol in the first four fractions reduced random errors further to 0.9, 1.1, and 1.0 mm in the RL, SI, and AP directions, respectively. A daily online protocol reduced all errors to markers is effective in reducing the systematic error. The value of online protocols is reduced by intrafraction motion.

  12. Molecular markers for analyses of intraspecific genetic diversity in the Asian Tiger mosquito, Aedes albopictus.

    Science.gov (United States)

    Manni, Mosè; Gomulski, Ludvik M; Aketarawong, Nidchaya; Tait, Gabriella; Scolari, Francesca; Somboon, Pradya; Guglielmino, Carmela R; Malacrida, Anna R; Gasperi, Giuliano

    2015-03-28

    The dramatic worldwide expansion of Aedes albopictus (the Asian tiger mosquito) and its vector competence for numerous arboviruses represent a growing threat to public health security. Molecular markers are crucially needed for tracking the rapid spread of this mosquito and to obtain a deeper knowledge of population structure. This is a fundamental requirement for the development of strict monitoring protocols and for the improvement of sustainable control measures. Wild population samples from putative source areas and from newly colonised regions were analysed for variability at the ribosomal DNA internal transcribed spacer 2 (ITS2). Moreover, a new set of 23 microsatellite markers (SSR) was developed. Sixteen of these SSRs were tested in an ancestral (Thailand) and two adventive Italian populations. Seventy-six ITS2 sequences representing 52 unique haplotypes were identified, and AMOVA indicated that most of their variation occurred within individuals (74.36%), while only about 8% was detected among populations. Spatial analyses of molecular variance revealed that haplotype genetic similarity was not related to the geographic proximity of populations and the haplotype phylogeny clearly indicated that highly related sequences were distributed across populations from different geographical regions. The SSR markers displayed a high level of polymorphism both in the ancestral and in adventive populations, and F ST estimates suggested the absence of great differentiation. The ancestral nature of the Thai population was corroborated by its higher level of variability. The two types of genetic markers here implemented revealed the distribution of genetic diversity within and between populations and provide clues on the dispersion dynamics of this species. It appears that the diffusion of this mosquito does not conform to a progressive expansion from the native Asian source area, but to a relatively recent and chaotic propagule distribution mediated by human activities

  13. Targeted detection of in vivo endogenous DNA base damage reveals preferential base excision repair in the transcribed strand.

    Science.gov (United States)

    Reis, António M C; Mills, Wilbur K; Ramachandran, Ilangovan; Friedberg, Errol C; Thompson, David; Queimado, Lurdes

    2012-01-01

    Endogenous DNA damage is removed mainly via base excision repair (BER), however, whether there is preferential strand repair of endogenous DNA damage is still under intense debate. We developed a highly sensitive primer-anchored DNA damage detection assay (PADDA) to map and quantify in vivo endogenous DNA damage. Using PADDA, we documented significantly higher levels of endogenous damage in Saccharomyces cerevisiae cells in stationary phase than in exponential phase. We also documented that yeast BER-defective cells have significantly higher levels of endogenous DNA damage than isogenic wild-type cells at any phase of growth. PADDA provided detailed fingerprint analysis at the single-nucleotide level, documenting for the first time that persistent endogenous nucleotide damage in CAN1 co-localizes with previously reported spontaneous CAN1 mutations. To quickly and reliably quantify endogenous strand-specific DNA damage in the constitutively expressed CAN1 gene, we used PADDA on a real-time PCR setting. We demonstrate that wild-type cells repair endogenous damage preferentially on the CAN1 transcribed strand. In contrast, yeast BER-defective cells accumulate endogenous damage preferentially on the CAN1 transcribed strand. These data provide the first direct evidence for preferential strand repair of endogenous DNA damage and documents the major role of BER in this process.

  14. FACT prevents the accumulation of free histones evicted from transcribed chromatin and a subsequent cell cycle delay in G1.

    Directory of Open Access Journals (Sweden)

    Macarena Morillo-Huesca

    2010-05-01

    Full Text Available The FACT complex participates in chromatin assembly and disassembly during transcription elongation. The yeast mutants affected in the SPT16 gene, which encodes one of the FACT subunits, alter the expression of G1 cyclins and exhibit defects in the G1/S transition. Here we show that the dysfunction of chromatin reassembly factors, like FACT or Spt6, down-regulates the expression of the gene encoding the cyclin that modulates the G1 length (CLN3 in START by specifically triggering the repression of its promoter. The G1 delay undergone by spt16 mutants is not mediated by the DNA-damage checkpoint, although the mutation of RAD53, which is otherwise involved in histone degradation, enhances the cell-cycle defects of spt16-197. We reveal how FACT dysfunction triggers an accumulation of free histones evicted from transcribed chromatin. This accumulation is enhanced in a rad53 background and leads to a delay in G1. Consistently, we show that the overexpression of histones in wild-type cells down-regulates CLN3 in START and causes a delay in G1. Our work shows that chromatin reassembly factors are essential players in controlling the free histones potentially released from transcribed chromatin and describes a new cell cycle phenomenon that allows cells to respond to excess histones before starting DNA replication.

  15. Xeroderma pigmentosum complementation group C cells remove pyrimidine dimers selectively from the transcribed strand of active genes

    International Nuclear Information System (INIS)

    Venema, J.; van Hoffen, A.; Karcagi, V.; Natarajan, A.T.; van Zeeland, A.A.; Mullenders, L.H.

    1991-01-01

    The authors have measured the removal of UV-induced pyrimidine dimers from DNA fragments of the adenosine deaminase (ADA) and dihydrofolate reductase (DHFR) genes in primary normal human and xeroderma pigmentosum complementation group C (XP-C) cells. Using strand-specific probes, we show that in normal cells, preferential repair of the 5' part of the ADA gene is due to the rapid and efficient repair of the transcribed strand. Within 8 h after irradiation with UV at 10 J m-2, 70% of the pyrimidine dimers in this strand are removed. The nontranscribed strand is repaired at a much slower rate, with 30% dimers removed after 8 h. Repair of the transcribed strand in XP-C cells occurs at a rate indistinguishable from that in normal cells, but the nontranscribed strand is not repaired significantly in these cells. Similar results were obtained for the DHFR gene. In the 3' part of the ADA gene, however, both normal and XP-C cells perform fast and efficient repair of either strand, which is likely to be caused by the presence of transcription units on both strands. The factor defective in XP-C cells is apparently involved in the processing of DNA damage in inactive parts of the genome, including nontranscribed strands of active genes. These findings have important implications for the understanding of the mechanism of UV-induced excision repair and mutagenesis in mammalian cells

  16. Comparing COI and ITS as DNA barcode markers for mushrooms and allies (Agaricomycotina).

    Science.gov (United States)

    Dentinger, Bryn T M; Didukh, Maryna Y; Moncalvo, Jean-Marc

    2011-01-01

    DNA barcoding is an approach to rapidly identify species using short, standard genetic markers. The mitochondrial cytochrome oxidase I gene (COI) has been proposed as the universal barcode locus, but its utility for barcoding in mushrooms (ca. 20,000 species) has not been established. We succeeded in generating 167 partial COI sequences (~450 bp) representing ~100 morphospecies from ~650 collections of Agaricomycotina using several sets of new primers. Large introns (~1500 bp) at variable locations were detected in ~5% of the sequences we obtained. We suspect that widespread presence of large introns is responsible for our low PCR success (~30%) with this locus. We also sequenced the nuclear internal transcribed spacer rDNA regions (ITS) to compare with COI. Among the small proportion of taxa for which COI could be sequenced, COI and ITS perform similarly as a barcode. However, in a densely sampled set of closely related taxa, COI was less divergent than ITS and failed to distinguish all terminal clades. Given our results and the wealth of ITS data already available in public databases, we recommend that COI be abandoned in favor of ITS as the primary DNA barcode locus in mushrooms.

  17. Membrane-based oligonucleotide array developed from multiple markers for the detection of many Phytophthora species.

    Science.gov (United States)

    Chen, Wen; Djama, Zeinab Robleh; Coffey, Michael D; Martin, Frank N; Bilodeau, Guillaume J; Radmer, Lorien; Denton, Geoff; Lévesque, C André

    2013-01-01

    Most Phytophthora spp. are destructive plant pathogens; therefore, effective monitoring and accurate early detection are important means of preventing potential epidemics and outbreaks of diseases. In the current study, a membrane-based oligonucleotide array was developed that can detect Phytophthora spp. reliably using three DNA regions; namely, the internal transcribed spacer (ITS), the 5' end of cytochrome c oxidase 1 gene (cox1), and the intergenic region between cytochrome c oxidase 2 gene (cox2) and cox1 (cox2-1 spacer). Each sequence data set contained ≈250 sequences representing 98 described and 15 undescribed species of Phytophthora. The array was validated with 143 pure cultures and 35 field samples. Together, nonrejected oligonucleotides from all three markers have the ability to reliably detect 82 described and 8 undescribed Phytophthora spp., including several quarantine or regulated pathogens such as Phytophthora ramorum. Our results showed that a DNA array containing signature oligonucleotides designed from multiple genomic regions provided robustness and redundancy for the detection and differentiation of closely related taxon groups. This array has the potential to be used as a routine diagnostic tool for Phytophthora spp. from complex environmental samples without the need for extensive growth of cultures.

  18. Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

    International Nuclear Information System (INIS)

    Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

  19. Tantalum markers in radiography

    International Nuclear Information System (INIS)

    Aronson, A.S.; Jonsson, N.; Alberius, P.

    1985-01-01

    The biocompatibility of two types of radiopaque tantalum markers was evaluated histologically. Reactions to pin markers (99.9% purity) and spherical markers (95.2% purity) were investigated after 3-6 weeks in rabbits and 5-48 weeks in children with abnormal growth. Both marker types were firmly attached to bone trabeculae; this was most pronounced in rabbit bone, and no adverse macroscopic reactions were observed. Microscopically, no reactions or only slight fibrosis of bone tissue were detected, while soft tissues only demonstrated a minor inflammatory reaction. Nevertheless, the need for careful preparation and execution of marker implantations is stressed, and particularly avoidance iof the use of emery in sharpening of cannulae. The bioinertness of tantalum was reconfirmed as was its suitability for use as skeletal and soft tissue radiographic markers. (orig.)

  20. A Comparison of the Use of Bony Anatomy and Internal Markers for Offline Verification and an Evaluation of the Potential Benefit of Online and Offline Verification Protocols for Prostate Radiotherapy

    International Nuclear Information System (INIS)

    McNair, Helen A.; Hansen, Vibeke N.; Parker, Christopher; Evans, Phil M.; Norman, Andrew; Miles, Elizabeth; Harris, Emma J.; Del-Acroix, Louise; Smith, Elizabeth; Keane, Richard; Khoo, Vincent S.; Thompson, Alan C.; Dearnaley, David P.

    2008-01-01

    Purpose: To evaluate the utility of intraprostatic markers in the treatment verification of prostate cancer radiotherapy. Specific aims were: to compare the effectiveness of offline correction protocols, either using gold markers or bony anatomy; to estimate the potential benefit of online correction protocol's using gold markers; to determine the presence and effect of intrafraction motion. Methods and Materials: Thirty patients with three gold markers inserted had pretreatment and posttreatment images acquired and were treated using an offline correction protocol and gold markers. Retrospectively, an offline protocol was applied using bony anatomy and an online protocol using gold markers. Results: The systematic errors were reduced from 1.3, 1.9, and 2.5 mm to 1.1, 1.1, and 1.5 mm in the right-left (RL), superoinferior (SI), and anteroposterior (AP) directions, respectively, using the offline correction protocol and gold markers instead of bony anatomy. The subsequent decrease in margins was 1.7, 3.3, and 4 mm in the RL, SI, and AP directions, respectively. An offline correction protocol combined with an online correction protocol in the first four fractions reduced random errors further to 0.9, 1.1, and 1.0 mm in the RL, SI, and AP directions, respectively. A daily online protocol reduced all errors to <1 mm. Intrafraction motion had greater impact on the effectiveness of the online protocol than the offline protocols. Conclusions: An offline protocol using gold markers is effective in reducing the systematic error. The value of online protocols is reduced by intrafraction motion

  1. Increased expression of hepatocyte nuclear factor 4 alpha transcribed by promoter 2 indicates a poor prognosis in hepatocellular carcinoma.

    Science.gov (United States)

    Cai, Shao-Hang; Lu, Shi-Xun; Liu, Li-Li; Zhang, Chris Zhiyi; Yun, Jing-Ping

    2017-10-01

    Hepatocyte nuclear factor 4 alpha (HNF4α) plays an important role in tumourigenesis. There is growing evidence indicating that HNF4α transcribed by promoter 1 (P1-HNF4α) is expressed at relatively low levels in HCC and its presence predicts a favourable outcome for hepatocellular carcinoma (HCC) patients. However, the role of HNF4α transcribed by promoter 2 (P2-HNF4α) in HCC remains unclear. A total of 615 HCC specimens were obtained to construct tissue microarrays and perform immunohistochemistry. The relationship between P2-HNF4α and clinical features of HCC patients were analysed. Kaplan-Meier analysis was conducted to assess the prognostic value of P2-HNF4α. The results showed that the expression of P2-HNF4α in HCC was noticeably increased in HCC tissues compared with the nontumourous tissues. In addition, P1-HNF4α expression was negatively correlated with P2-HNF4α expression ( p  = 0.023). High P2-HNF4α expression was significantly associated with poor differentiation of HCC ( p = 0.002) and vascular invasion ( p = 0.017). Kaplan-Meier analysis showed that P2-HNF4α expression was closely correlated with overall survival in the training group ( p = 0.01), validation group ( p = 0.034), and overall group of patients with HCC ( p P2-HNF4α, different from P1-HNF4α, is markedly upregulated and serves as an oncogene-associated protein in HCC. Our study therefore provides a promising biomarker for prognostic prediction and a potential therapeutic target for HCC.

  2. DNA rearrangements from γ-irradiated normal human fibroblasts preferentially occur in transcribed regions of the genome

    International Nuclear Information System (INIS)

    Forrester, H.B.; Radford, I.R.

    2003-01-01

    Full text: DNA rearrangement events leading to chromosomal aberrations are central to ionizing radiation-induced cell death. Although DNA double-strand breaks are probably the lesion that initiates formation of chromosomal aberrations, little is understood about the molecular mechanisms that generate and modulate DNA rearrangement. Examination of the sequences that flank sites of DNA rearrangement may provide information regarding the processes and enzymes involved in rearrangement events. Accordingly, we developed a method using inverse PCR that allows the detection and sequencing of putative radiation-induced DNA rearrangements in defined regions of the human genome. The method can detect single copies of a rearrangement event that has occurred in a particular region of the genome and, therefore, DNA rearrangement detection does not require survival and continued multiplication of the affected cell. Ionizing radiation-induced DNA rearrangements were detected in several different regions of the genome of human fibroblast cells that were exposed to 30 Gy of γ-irradiation and then incubated for 24 hours at 37 deg C. There was a 3- to 5-fold increase in the number of products amplified from irradiated as compared with control cells in the target regions 5' to the C-MYC, CDKN1A, RB1, and FGFR2 genes. Sequences were examined from 121 DNA rearrangements. Approximately half of the PCR products were derived from possible inter-chromosomal rearrangements and the remainder were from intra-chromosomal events. A high proportion of the sequences that rearranged with target regions were located in genes, suggesting that rearrangements may occur preferentially in transcribed regions. Eighty-four percent of the sequences examined by reverse transcriptase PCR were from transcribed sequences in IMR-90 cells. The distribution of DNA rearrangements within the target regions is non-random and homology occurs between the sequences involved in rearrangements in some cases but is not

  3. Uso de indicadores internos na avaliação da digestibilidade aparente de alimentos para gatos: comparação de métodos Internal markers in the evaluation of apparent digestibility of cat feeds: method comparison

    Directory of Open Access Journals (Sweden)

    Aulus Cavalieri Carciofí

    1998-06-01

    to the feed, or internal (already present in the feed. In the present work, the comparison of both methods was made, aiming the search for simpler and safer methods for the determination of the digestibility of commercial cat feed. We tested the TC and IM using, for the latter, the crudefibre (CF and the acid-detergent fibre (ADF as internal indicators. We used 4 young adult cats (2 males and 2 females held in individual metabolism cages for 30 days (24 for adaptation and 6 for total collection of faeces and fed ad libitum with a commercial dry extruded cat feed. The results for the TC, CF and ADF were, respectively, 74.0, 71.4 and 75.0% for dry matter, 77.0, 74.8 and 77.9% for organic matter, 79.2, 77.2 and 80.0% for crude protein, 81.7, 80.4 and 82.8% for ether extract and 78.8, 76.6 and 79.6% for nitrogen-free extract. The statistical analysis did not show significant diffèrences between the methods (p > 0.2. It was recovered 96.1% of the ADF and 104.3% of the CF, and these figures could be considered statistically equivalents by the t test (p > 0.49. The internal markers method presents some practical advantages when compared to the total collection method. However, further studies are required in order to check the efficiency of the tested markers, using diets with different amounts and sources of CF and ADF.

  4. Radiopaque anastomosis marker

    International Nuclear Information System (INIS)

    Elliott, D.P.; Halseth, W.L.

    1977-01-01

    This invention relates to split ring markers fabricated in whole or in part from a radiopaque material, usually metal, having the terminal ends thereof and a medial portion formed to define eyelets by means of which said marker can be sutured to the tissue at the site of an anastomosis to provide a visual indication of its location when examined fluoroscopically

  5. Multiple marker abundance profiling

    DEFF Research Database (Denmark)

    Hooper, Cornelia M.; Stevens, Tim J.; Saukkonen, Anna

    2017-01-01

    proteins and the scoring accuracy of lower-abundance proteins in Arabidopsis. NPAS was combined with subcellular protein localization data, facilitating quantitative estimations of organelle abundance during routine experimental procedures. A suite of targeted proteomics markers for subcellular compartment...

  6. (DArT) markers

    Indian Academy of Sciences (India)

    2EH Graham Centre for Agricultural Innovation (NSW Department of Industry and Investment and Charles Sturt. University), P. O. Box 588 Wagga Wagga, NSW 2650, Australia. 3Guangxi .... and obtain marker statistics. The exact order of the ...

  7. VT Roadside Historic Markers

    Data.gov (United States)

    Vermont Center for Geographic Information — Roadside Historic Site Marker program has proven an effective way to commemorate Vermont’s many people, events, and places of regional, statewide, or national...

  8. Passage kinetics of dry matter and neutral detergent fibre through the gastro-intestinal tract of growing beef heifers fed a high-concentrate diet measured with internal ð13C and external markers

    NARCIS (Netherlands)

    Daniel, J.B.; Laar, van H.; Warner, D.; Dijkstra, J.; Navarro-Villa, A.; Pellikaan, W.F.

    2014-01-01

    Fractional rumen passage rates (K1) are fundamental in feed evaluation systems for ruminants to predict the extent of nutrient degradation. Data on passage kinetics of growing beef cattle fed high-concentrate diets are scarce and mainly rely on external passage markers which do not provide

  9. The SET1 Complex Selects Actively Transcribed Target Genes via Multivalent Interaction with CpG Island Chromatin.

    Science.gov (United States)

    Brown, David A; Di Cerbo, Vincenzo; Feldmann, Angelika; Ahn, Jaewoo; Ito, Shinsuke; Blackledge, Neil P; Nakayama, Manabu; McClellan, Michael; Dimitrova, Emilia; Turberfield, Anne H; Long, Hannah K; King, Hamish W; Kriaucionis, Skirmantas; Schermelleh, Lothar; Kutateladze, Tatiana G; Koseki, Haruhiko; Klose, Robert J

    2017-09-05

    Chromatin modifications and the promoter-associated epigenome are important for the regulation of gene expression. However, the mechanisms by which chromatin-modifying complexes are targeted to the appropriate gene promoters in vertebrates and how they influence gene expression have remained poorly defined. Here, using a combination of live-cell imaging and functional genomics, we discover that the vertebrate SET1 complex is targeted to actively transcribed gene promoters through CFP1, which engages in a form of multivalent chromatin reading that involves recognition of non-methylated DNA and histone H3 lysine 4 trimethylation (H3K4me3). CFP1 defines SET1 complex occupancy on chromatin, and its multivalent interactions are required for the SET1 complex to place H3K4me3. In the absence of CFP1, gene expression is perturbed, suggesting that normal targeting and function of the SET1 complex are central to creating an appropriately functioning vertebrate promoter-associated epigenome. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  10. The SET1 Complex Selects Actively Transcribed Target Genes via Multivalent Interaction with CpG Island Chromatin

    Directory of Open Access Journals (Sweden)

    David A. Brown

    2017-09-01

    Full Text Available Chromatin modifications and the promoter-associated epigenome are important for the regulation of gene expression. However, the mechanisms by which chromatin-modifying complexes are targeted to the appropriate gene promoters in vertebrates and how they influence gene expression have remained poorly defined. Here, using a combination of live-cell imaging and functional genomics, we discover that the vertebrate SET1 complex is targeted to actively transcribed gene promoters through CFP1, which engages in a form of multivalent chromatin reading that involves recognition of non-methylated DNA and histone H3 lysine 4 trimethylation (H3K4me3. CFP1 defines SET1 complex occupancy on chromatin, and its multivalent interactions are required for the SET1 complex to place H3K4me3. In the absence of CFP1, gene expression is perturbed, suggesting that normal targeting and function of the SET1 complex are central to creating an appropriately functioning vertebrate promoter-associated epigenome.

  11. A systematic analysis of the early transcribed membrane protein family throughout the life cycle of Plasmodium yoelii.

    Science.gov (United States)

    MacKellar, Drew C; Vaughan, Ashley M; Aly, Ahmed S I; DeLeon, Sasha; Kappe, Stefan H I

    2011-11-01

    The early transcribed membrane proteins (ETRAMPs) are a family of small, highly charged transmembrane proteins unique to malaria parasites. Some members of the ETRAMP family have been localized to the parasitophorous vacuole membrane that separates the intracellular parasite from the host cell and thus presumably have a role in host-parasite interactions. Although it was previously shown that two ETRAMPs are critical for rodent malaria parasite liver-stage development, the importance of most ETRAMPs during the parasite life cycle remains unknown. Here, we comprehensively identify nine new etramps in the genome of the rodent malaria parasite Plasmodium yoelii, and elucidate their conservation in other malaria parasites. etramp expression profiles are diverse throughout the parasite life cycle as measured by RT-PCR. Epitope tagging of two ETRAMPs demonstrates protein expression in blood and liver stages, and reveals differences in both their timing of expression and their subcellular localization. Gene targeting studies of each of the nine uncharacterized etramps show that two are refractory to deletion and thus likely essential for blood-stage replication. Seven etramps are not essential for any life cycle stage. Systematic characterization of the members of the ETRAMP family reveals the diversity in importance of each family member at the interface between host and parasite throughout the developmental cycle of the malaria parasite. © 2011 Blackwell Publishing Ltd.

  12. A 3'-coterminal nested set of independently transcribed mRNAs is generated during Berne virus replication

    International Nuclear Information System (INIS)

    Snijder, E.J.; Horzinek, M.C.; Spaan, W.J.

    1990-01-01

    By using poly(A)-selected RNA from Berne virus (BEV)-infected embryonic mule skin cells as a template, cDNA was prepared and cloned in plasmid pUC9. Recombinants covering a contiguous sequence of about 10 kilobases were identified. Northern (RNA) blot hybridizations with various restriction fragments from these clones showed that the five BEV mRNAs formed a 3'-coterminal nested set. Sequence analysis revealed the presence of four complete open reading frames of 4743, 699, 426, and 480 nucleotides, with initiation codons coinciding with the 5' ends of BEV RNAs 2 through 5, respectively. By using primer extension analysis and oligonucleotide hybridizations, RNA 5 was found to be contiguous on the consensus sequence. The transcription of BEV mRNAs was studied by means of UV mapping. BEV RNAs 1, 2, and 3 were shown to be transcribed independently, which is also likely--although not rigorously proven--for RNAs 4 and 5. Upstream of the AUG codon of each open reading frame a conserved sequence pattern was observed which is postulated to function as a core promoter sequence in subgenomic RNA transcription. In the area surrounding the core promoter region of the two most abundant subgenomic BEV RNAs, a number of homologous sequence motifs were identified

  13. Molecular phylogeny of Ranunculaceae based on internal ...

    African Journals Online (AJOL)

    The botanical family Ranunculaceae contains important medicinal plants. To obtain new evolutionary evidence regarding the systematic classification of Ranunculaceae plants, we used molecular phylogenies to test relationships based on the internal transcribed spacer region. The results of phylogenetic analysis of 92 ...

  14. Strand bias in complementary single-nucleotide polymorphisms of transcribed human sequences: evidence for functional effects of synonymous polymorphisms

    Directory of Open Access Journals (Sweden)

    Majewski Jacek

    2006-08-01

    Full Text Available Abstract Background Complementary single-nucleotide polymorphisms (SNPs may not be distributed equally between two DNA strands if the strands are functionally distinct, such as in transcribed genes. In introns, an excess of A↔G over the complementary C↔T substitutions had previously been found and attributed to transcription-coupled repair (TCR, demonstrating the valuable functional clues that can be obtained by studying such asymmetry. Here we studied asymmetry of human synonymous SNPs (sSNPs in the fourfold degenerate (FFD sites as compared to intronic SNPs (iSNPs. Results The identities of the ancestral bases and the direction of mutations were inferred from human-chimpanzee genomic alignment. After correction for background nucleotide composition, excess of A→G over the complementary T→C polymorphisms, which was observed previously and can be explained by TCR, was confirmed in FFD SNPs and iSNPs. However, when SNPs were separately examined according to whether they mapped to a CpG dinucleotide or not, an excess of C→T over G→A polymorphisms was found in non-CpG site FFD SNPs but was absent from iSNPs and CpG site FFD SNPs. Conclusion The genome-wide discrepancy of human FFD SNPs provides novel evidence for widespread selective pressure due to functional effects of sSNPs. The similar asymmetry pattern of FFD SNPs and iSNPs that map to a CpG can be explained by transcription-coupled mechanisms, including TCR and transcription-coupled mutation. Because of the hypermutability of CpG sites, more CpG site FFD SNPs are relatively younger and have confronted less selection effect than non-CpG FFD SNPs, which can explain the asymmetric discrepancy of CpG site FFD SNPs vs. non-CpG site FFD SNPs.

  15. Comparative analysis of the mating-type loci from Neurospora crassa and Sordaria macrospora: identification of novel transcribed ORFs.

    Science.gov (United States)

    Pöggeler, S; Kück, U

    2000-03-01

    The mating-type locus controls mating and sexual development in filamentous ascomycetes. In the heterothallic ascomycete Neurospora crassa, the genes that confer mating behavior comprise dissimilar DNA sequences (idiomorphs) in the mat a and mat A mating partners. In the homothallic fungus Sordaria macrospora, sequences corresponding to both idiomorphs are located contiguously in the mating-type locus, which contains one chimeric gene, Smt A-3, that includes sequences which are similar to sequences found at the mat A and mat a mating-type idiomorphs in N. crassa. In this study, we describe the comparative transcriptional analysis of the chimeric mating-type region of S. macrospora and the corresponding region of the N. crassa mat a idiomorph. By means of RT-PCR experiments, we identified novel intervening sequences in the mating-type loci of both ascomycetes and, hence, concluded that an additional ORF, encoding a putative polypeptide of 79 amino acids, is present in the N. crassa mat a idiomorph. Furthermore, our analysis revealed co-transcription of the novel gene with the mat a-1 gene in N. crassa. The same mode of transcription was found in the corresponding mating-type region of S. macrospora, where the chimeric Smt A-3 gene is co-transcribed with the mat a-specific Smt a-1 gene. Analysis of a Smt A-3 cDNA revealed optional splicing of two introns. We believe that this is the first report of co-transcription of protein-encoding nuclear genes in filamentous fungi. Possible functions of the novel ORFs in regulating mating-type gene expression are discussed.

  16. Molecular markers in glioma.

    Science.gov (United States)

    Ludwig, Kirsten; Kornblum, Harley I

    2017-09-01

    Gliomas are the most malignant and aggressive form of brain tumors, and account for the majority of brain cancer related deaths. Malignant gliomas, including glioblastoma are treated with radiation and temozolomide, with only a minor benefit in survival time. A number of advances have been made in understanding glioma biology, including the discovery of cancer stem cells, termed glioma stem cells (GSC). Some of these advances include the delineation of molecular heterogeneity both between tumors from different patients as well as within tumors from the same patient. Such research highlights the importance of identifying and validating molecular markers in glioma. This review, intended as a practical resource for both clinical and basic investigators, summarizes some of the more well-known molecular markers (MGMT, 1p/19q, IDH, EGFR, p53, PI3K, Rb, and RAF), discusses how they are identified, and what, if any, clinical relevance they may have, in addition to discussing some of the specific biology for these markers. Additionally, we discuss identification methods for studying putative GSC's (CD133, CD15, A2B5, nestin, ALDH1, proteasome activity, ABC transporters, and label-retention). While much research has been done on these markers, there is still a significant amount that we do not yet understand, which may account for some conflicting reports in the literature. Furthermore, it is unlikely that the investigator will be able to utilize one single marker to prospectively identify and isolate GSC from all, or possibly, any gliomas.

  17. Tumour markers in urology

    International Nuclear Information System (INIS)

    Schmid, L.; Fornara, P.; Fabricius, P.G.

    1988-01-01

    The same applies essentially also for the bladder carcinomas: There is no reliable marker for these cancers which would be useful for clinical purposes. TPA has proven to be too non-specific in malignoma-detection and therefore hardly facilitates clinical decision-making in individual cases. The CEA is not sensitive enough to be recommendable for routine application. However, in advanced stages a CEA examination may be useful if applied within the scope of therapeutic efforts made to evaluate efficacy. In cases of carcinomas of the prostate the sour prostate-specific phosphatase (SPP) and, more recently, especially the prostate-specific antigen (PSA) have proven in follow-up and therapy monitoring, whereby the PSA is superior to the SPP. Nevertheless, both these markers should be employed in therapy monitoring because differences in behaviour will be observed when the desired treatment effect is only achieved in one of the two markers producing tumour cell clonuses. Both markers, but especially the PSA, are quite reliably in agreement with the result of the introduced chemo-/hormone therapy, whereby an increase may be a sure indicator of relapse several months previous to clinical symptoms, imaging procedures, so-called routine laboratory results and subjective complaints. However, none of the 2 markers is appropriate for the purposes of screening or early diagnosis of carcinomas of the prostate. (orig.) [de

  18. Characterization of Fasciola spp. in Myanmar on the basis of spermatogenesis status and nuclear and mitochondrial DNA markers.

    Science.gov (United States)

    Ichikawa, Madoka; Bawn, Saw; Maw, Ni Ni; Htun, Lat Lat; Thein, Myint; Gyi, Aung; Sunn, Kyaw; Katakura, Ken; Itagaki, Tadashi

    2011-12-01

    Fasciola spp. in Myanmar were characterized on the basis of spermatogenesis status and DNA markers of nuclear internal transcribed spacer 1 (ITS1) and mitochondrial NADH dehydrogenase subunit 1 (nad1). We collected 88 adult flukes from Yangon, Lashio, and Myitkyina. Spermatogenesis status was analyzed by the presence of sperm in the seminal vesicles, and 8 aspermic and 80 spermic flukes were detected. The flukes were identified on the basis of spermatogenesis status and ITS1 types which were analyzed by a PCR-RFLP method, and 80 spermic flukes were identified as F. gigantica. A very low detection rate of aspermic Fasciola sp. indicated that they are not established in Myanmar. In phylogenetic analyses, the 7 aspermic Fasciola sp. from Myitkyina displayed a haplotype in nad1 sequence, which was identical to that of aspermic Fasciola sp. from other Asian countries including China. Therefore, they were probably introduced from China through an infected domestic ruminant. On the other hand, 17 nad1 haplotypes detected in F. gigantica belonged to 2 clades unique to Myanmar, each with a distinct founder haplotype in a network analysis. This indicated a unique history of F. gigantica introduction into Myanmar involving ancient artificial movements of domestic ruminants. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  19. Preferential repair of ionizing radiation-induced damage in the transcribed strand of an active human gene is defective in Cockayne syndrome

    International Nuclear Information System (INIS)

    Leadon, S.A.; Copper, P.K.

    1993-01-01

    Cells from patients with Cockayne syndrome (CS), which are sensitive to killing by UV although overall damage removal appears normal, are specifically defective in repair of UV damage in actively transcribe genes. Because several CS strains display cross-sensitivity to killing by ionizing radiation, the authors examined whether ionizing radiation-induced damage in active genes is preferentially repaired by normal cells and whether the radiosensitivity of CS cells can be explained by a defect in this process. They found that ionizing radiation-induced damage was repaired more rapidly in the transcriptionally active metallothionein IIA (MTIIA) gene than in the inactive MTIIB gene or in the genome overall in normal cells as a result of faster repair on the transcribed strand of MTIIA. Cells of the radiosensitive CS strain CS1AN are completely defective in this strand-selective repair of ionizing radiation-induced damage, although their overall repair rate appears normal. CS3BE cells, which are intermediate in radiosensitivity, do exhibit more rapid repair of the transcribed strand but at a reduced rate compared to normal cells. Xeroderma pigmentosum complementation group A cells, which are hypersensitive to UV light because of a defect in the nucleotide excision repair pathway but do not show increased sensitivity to ionizing radiation, preferentially repair ionizing radiation-induced damage on the transcribed strand of MTIIA. Thus, the ability to rapidly repair ionizing radiation-induced damage in actively transcribing genes correlates with cell survival. The results extend the generality of preferential repair in active genes to include damage other than bulky lesions

  20. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  1. Characterization of the human laminin beta2 chain locus (LAMB2): linkage to a gene containing a nonprocessed, transcribed LAMB2-like pseudogene (LAMB2L) and to the gene encoding glutaminyl tRNA synthetase (QARS)

    DEFF Research Database (Denmark)

    Durkin, M E; Jäger, A C; Khurana, T S

    1999-01-01

    The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...

  2. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.

    Science.gov (United States)

    Dingman, Douglas W

    2012-07-01

    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions. Copyright © 2012 Elsevier Inc

  3. Peptide Nucleic Acid Based Molecular Authentication for Identification of Four Medicinal Paeonia Species Using Melting Array Analysis of the Internal Transcribed Spacer 2 Region

    Directory of Open Access Journals (Sweden)

    Wook Jin Kim

    2017-11-01

    Full Text Available Accurate taxonomic identification of plant materials in herbal medicines is important for product quality control. The genus Paeonia (Saxifragales is the source of the herbal preparations Paeoniae Radix (Paeoniae Radix Alba and Paeoniae Radix Rubra and Moutan Radicis Cotex. However, confusion has arisen regarding their contents due to linguistic and taxonomic ambiguities, similar morphologies and different definitions of Paeoniae Radix in the Korean and Chinese national pharmacopoeias, leading to the distribution of adulterated products. To develop a method for identifying the four Paeonia species used in these medicines, three fluorescently-labeled peptide nucleic acid (PNA probes were designed against ITS2 sequences containing single nucleotide polymorphisms (SNPs and used in a real-time PCR melting curve assay. Each of the four Paeonia species was accurately identified using this analysis. The accuracy and analytical stability of the PNA melting curve assay was confirmed using commercially available samples of the four Paeonia species. This assay is a reliable genetic tool to distinguish between different Paeonia-derived herbal medicines and identify the botanical origins of Paeoniae Radix and Moutan Radicis Cortex. This technique may also contribute to quality control and standardization of herbal medicines by providing a reliable authentication tool and preventing the distribution of inauthentic adulterants.

  4. Peptide Nucleic Acid Based Molecular Authentication for Identification of Four Medicinal Paeonia Species Using Melting Array Analysis of the Internal Transcribed Spacer 2 Region.

    Science.gov (United States)

    Kim, Wook Jin; Yang, Sungyu; Choi, Goya; Moon, Byeong Cheol

    2017-11-07

    Accurate taxonomic identification of plant materials in herbal medicines is important for product quality control. The genus Paeonia (Saxifragales) is the source of the herbal preparations Paeoniae Radix (Paeoniae Radix Alba and Paeoniae Radix Rubra) and Moutan Radicis Cotex. However, confusion has arisen regarding their contents due to linguistic and taxonomic ambiguities, similar morphologies and different definitions of Paeoniae Radix in the Korean and Chinese national pharmacopoeias, leading to the distribution of adulterated products. To develop a method for identifying the four Paeonia species used in these medicines, three fluorescently-labeled peptide nucleic acid (PNA) probes were designed against ITS2 sequences containing single nucleotide polymorphisms (SNPs) and used in a real-time PCR melting curve assay. Each of the four Paeonia species was accurately identified using this analysis. The accuracy and analytical stability of the PNA melting curve assay was confirmed using commercially available samples of the four Paeonia species. This assay is a reliable genetic tool to distinguish between different Paeonia -derived herbal medicines and identify the botanical origins of Paeoniae Radix and Moutan Radicis Cortex. This technique may also contribute to quality control and standardization of herbal medicines by providing a reliable authentication tool and preventing the distribution of inauthentic adulterants.

  5. Cyanobacterial ecotypes in different optical microenvironments of a 68 C hot spring mat community revealed by 16S-23S rRNA internal transcribed spacer region variation

    DEFF Research Database (Denmark)

    Ferris, Mike J.; Kühl, Michael; Wieland, Andrea

    2003-01-01

    We examined the population of unicellular cyanobacteria (Synechococcus) in the upper 3-mm vertical interval of a 68°C region of a microbial mat in a hot spring effluent channel (Yellowstone National Park, Wyoming). Fluorescence microscopy and microsensor measurements of O2 and oxygenic photosynth...

  6. Phylogenetic reconstruction using secondary structures of Internal Transcribed Spacer 2 (ITS2, rDNA: finding the molecular and morphological gap in Caribbean gorgonian corals

    Directory of Open Access Journals (Sweden)

    Sánchez Juan A

    2007-06-01

    Full Text Available Abstract Background Most phylogenetic studies using current methods have focused on primary DNA sequence information. However, RNA secondary structures are particularly useful in systematics because they include characteristics, not found in the primary sequence, that give "morphological" information. Despite the number of recent molecular studies on octocorals, there is no consensus opinion about a region that carries enough phylogenetic resolution to solve intrageneric or close species relationships. Moreover, intrageneric morphological information by itself does not always produce accurate phylogenies; intra-species comparisons can reveal greater differences than intra-generic ones. The search for new phylogenetic approaches, such as by RNA secondary structure analysis, is therefore a priority in octocoral research. Results Initially, twelve predicted RNA secondary structures were reconstructed to provide the basic information for phylogenetic analyses; they accorded with the 6 helicoidal ring model, also present in other groups of corals and eukaryotes. We obtained three similar topologies for nine species of the Caribbean gorgonian genus Eunicea (candelabrum corals with two sister taxa as outgroups (genera Plexaura and Pseudoplexaura on the basis of molecular morphometrics of ITS2 RNA secondary structures only, traditional primary sequence analyses and maximum likelihood, and a Bayesian analysis of the combined data. The latter approach allowed us to include both primary sequence and RNA molecular morphometrics; each data partition was allowed to have a different evolution rate. In addition, each helix was partitioned as if it had evolved at a distinct rate. Plexaura flexuosa was found to group within Eunicea; this was best supported by both the molecular morphometrics and combined analyses. We suggest Eunicea flexuosa (Lamouroux, 1821 comb. nov., and we present a new species description including Scanning Electron Microscopy (SEM images of morphological characteristics (sclerites. Eunicea flexuosa, E. pallida, E. laxispica and E. mammosa formed a separate clade in the molecular phylogenies, and were reciprocally monophyletic with respect to other Eunicea (Euniceopsis subgenus, e.g. E. tourneforti and E. laciniata in the molecular morphometrics tree, with the exception of E. fusca. Moreover, we suggest a new diagnostic character for Eunicea, also present in E. flexuosa: middle layer sclerites > 1 mm in length. Conclusion ITS2 was a reliable sequence for intrageneric studies in gorgonian octocorals because of the amount of phylogenetic signal, and was corroborated against morphological characters separating Eunicea from Plexaura. The ITS2 RNA secondary structure approach to phylogeny presented here did not rely on alignment methods such as INDELS, but provided clearly homologous characters for partition analysis and RNA molecular morphometrics. These approaches support the divergence of Eunicea flexuosa comb. nov. from the outgroup Plexaura, although it has been considered part of this outgroup for nearly two centuries because of morphological resemblance.

  7. Development of a PCR assay based on the 16S-23S rDNA internal transcribed spacer for identification of strictly anaerobic bacterium Zymophilus

    Czech Academy of Sciences Publication Activity Database

    Felsberg, Jürgen; Jelínková, Markéta; Kubizniaková, P.; Matoulková, D.

    2015-01-01

    Roč. 33, June (2015), s. 85-89 ISSN 1075-9964 Institutional support: RVO:61388971 Keywords : Brewing microbiology * Strictly anaerobic bacteria * Yeast contamination Subject RIV: GM - Food Processing Impact factor: 2.424, year: 2015

  8. Genetic variations in the beta-tubulin gene and the internal transcribed spacer 2 region of Trichuris species from man and baboons

    DEFF Research Database (Denmark)

    Hansen, Tina Vicky Alstrup; Thamsborg, Stig Milan; Olsen, Annette

    2013-01-01

    The whipworm Trichuris trichiura has been estimated to infect 604 -- 795 million people worldwide. The current control strategy against trichuriasis using the benzimidazoles (BZs) albendazole (400 mg) or mebendazole (500 mg) as single-dose treatment is not satisfactory. The occurrence of single...

  9. The Swift Turbidity Marker

    Science.gov (United States)

    Omar, Ahmad Fairuz; MatJafri, Mohd Zubir

    2011-01-01

    The Swift Turbidity Marker is an optical instrument developed to measure the level of water turbidity. The components and configuration selected for the system are based on common turbidity meter design concepts but use a simplified methodology to produce rapid turbidity measurements. This work is aimed at high school physics students and is the…

  10. Paleoreconstruction by biological markers

    Energy Technology Data Exchange (ETDEWEB)

    Seifert, W K; Moldowan, J M

    1981-06-01

    During diagenesis and conversion of the original lipid fraction of biological systems to petroleum hydrocarbons, the following four basic events needed for paleoreconstruction may be monitored by biological markers: (1) sourcing, (2) maturation, (3) migration and (4) biodegradation. Actual cases of applying biological markers to petroleum exploration problems in different parts of the world are demonstrated. Cretaceous- and Phosphoria-sourced oils in the Wyoming Thrust Belt can be distinguished from one another by high quality source fingerprinting of biomarker terpanes using gas chromatography mass spectrometry. Identification of recently discovered biological markers, head-to-head isoprenoids, allows source differentiation between some oils from Sumatra. The degree of crude oil maturation in basins from California, Alaska, Russia, Wyoming and Louisiana can be assessed by specific biomarker ratios (20S/20R sterane epimers). Field evidence from such interpretation is augmented by laboratory pyrolysis of the rock. Extensive migration is documented by biomarkers in several oils. Biological marker results are consistent with the geological setting and add a dimension in assisting the petroleum explorationist towar paleoreconstruction.

  11. Magik Markers Trehvis

    Index Scriptorium Estoniae

    2008-01-01

    Müra-rock'i viljelevast USA duost Magik Markers (ansambel osaleb režissöör Veiko Õunapuu uue mängufilmi "Püha Tõnu kiusamine" võtetel, kontsert 15. nov. Tartus klubis Trehv, vt. www.magikmarkers.audiosport.org.)

  12. Genetic variations and relationships of cultivated and weedy types of perilla species in Korea and Japan using multi DNA markers

    International Nuclear Information System (INIS)

    Sun, Y.; Zheng, S.; Lee, J.; Hong, S.

    2017-01-01

    The genus Perilla, known as an oil crop or a Chinese medicine, vegetable crop, is widely cultivated in East Asia. It occurs in two distinct varieties, var. frutescens and var. crispa, and their genetic relationship is still obscure. To understand the genetic diversity and relationships of the cultivated and weedy types of Perilla crops in Korea, Japan and China, we evaluated the genetic variation of 20 accessions by 3 rDNA markers. Among these three markers, the nuclear ribosomal DNA (nrDNA) internal transcribed spacers (ITS) region of Perilla crops showed less sequence variations than the 5S and 18S genes. There were abundant variable nucleotide sites appearing in the 5S and 18S genes. Especially in the 18S gene, the variable nucleotide sites showed specificity between some Perilla type and other varieties. JPN1 showed 6 special variable nucleotide sites differing from other varieties, resulting in the farthest phylogenetic relationship in the 18S tree. CHI15 shared 8 special variable sites, also showing far phylogenetic relationship with other varieties. According to the sequence analysis result, the cultivated types of Korean var. frutescens showed relatively more genetic diversity than those of Japanese var. frutescens, while Korean var. crispa showed lower genetic diversity than those of Japanese var. crispa. However, the intra- or inter-variety genetic distance did not have significant difference. This work provided more sequence resources of Perilla crops and evidences to evaluate the genetic variation and relationships. Our result would help molecular type identification, functional plant breeding and trait improvement of Perilla crops. (author)

  13. Comparison of acid-detergent lignin, alkaline-peroxide lignin, and acid-detergent insoluble ash as internal markers for predicting fecal output and digestibility by cattle offered bermudagrass hays of varying nutrient composition.

    Science.gov (United States)

    Kanani, Juvenal; Philipp, Dirk; Coffey, Kenneth P; Kegley, Elizabeth B; West, Charles P; Gadberry, Shane; Jennings, John; Young, Ashley N; Rhein, Robert T

    2014-01-13

    The potential for acid-detergent insoluble ash (ADIA), alkaline-peroxide lignin (APL), and acid-detergent lignin (ADL) to predict fecal output (FO) and dry matter digestibility (DMD) by cattle offered bermudagrass [Cynodon dactylon (L.) Pers.] hays of different qualities was evaluated. Eight ruminally cannulated cows (594 ± 35.5 kg) were allocated randomly to 4 hay diets: low (L), medium low (ML), medium high (MH), and high (H) crude protein (CP) concentration (79, 111, 131, and 164 g CP/kg on a DM basis, respectively). Diets were offered in 3 periods with 2 diet replicates per period and were rotated across cows between periods. Cows were individually fed 20 g DM/kg of body weight in equal feedings at 08:00 and 16:00 h for a 10-d adaptation followed by a 5-d total fecal collection. Actual DM intake (DMI), DMD, and FO were determined based on hay offered, ort, and feces excreted. These components were then analyzed for ADL, APL, and ADIA concentration to determine marker recovery and marker-based estimates of FO and DMD. Forage DMI was affected by diet (P = 0.02), and DMI from MH and H was greater (P forages. Results from such studies may be used to develop improved equations to predict energy values of forages based on the relationship of dietary components to digestibility across a wide range of forages.

  14. Genic Microsatellite Markers in Brassica rapa: Development, Characterization, Mapping, and Their Utility in Other Cultivated and Wild Brassica Relatives

    Science.gov (United States)

    Ramchiary, Nirala; Nguyen, Van Dan; Li, Xiaonan; Hong, Chang Pyo; Dhandapani, Vignesh; Choi, Su Ryun; Yu, Ge; Piao, Zhong Yun; Lim, Yong Pyo

    2011-01-01

    Genic microsatellite markers, also known as functional markers, are preferred over anonymous markers as they reveal the variation in transcribed genes among individuals. In this study, we developed a total of 707 expressed sequence tag-derived simple sequence repeat markers (EST-SSRs) and used for development of a high-density integrated map using four individual mapping populations of B. rapa. This map contains a total of 1426 markers, consisting of 306 EST-SSRs, 153 intron polymorphic markers, 395 bacterial artificial chromosome-derived SSRs (BAC-SSRs), and 572 public SSRs and other markers covering a total distance of 1245.9 cM of the B. rapa genome. Analysis of allelic diversity in 24 B. rapa germplasm using 234 mapped EST-SSR markers showed amplification of 2 alleles by majority of EST-SSRs, although amplification of alleles ranging from 2 to 8 was found. Transferability analysis of 167 EST-SSRs in 35 species belonging to cultivated and wild brassica relatives showed 42.51% (Sysimprium leteum) to 100% (B. carinata, B. juncea, and B. napus) amplification. Our newly developed EST-SSRs and high-density linkage map based on highly transferable genic markers would facilitate the molecular mapping of quantitative trait loci and the positional cloning of specific genes, in addition to marker-assisted selection and comparative genomic studies of B. rapa with other related species. PMID:21768136

  15. Molecular marker to identify radiolarian species -toward establishment of paleo-environmental proxy-

    Science.gov (United States)

    Ishitani, Y.

    2017-12-01

    Marine fossilized unicellular plankton are known to have many genetically divergent species (biological species) in the single morphological species and these biological species show the species-specific environments much more precisely than that of morphological species. Among these plankton, Radiolaria are one of the best candidates for time- and environmental-indicators in the modern and past oceans, because radiolarians are the only group which represent entire water column from shallow to deep waters. However, the ecology and evolution of radiolarian were traditionally studied in paleontology and paleoceanography by morphological species. Even Radiolaria has a huge potential for novel proxy of wide and deep environments, there is no criterion to identify the biological species. The motivation for this study is setting the quantitative delimitation to establish the biological species of radiolarians based on molecular data, for leading the future ecological and paleo-environmental study. Identification of the biological species by ribosomal DNA sequences are mainly based on two ways: one is the evolutionary distance of the small subunit (SSU) rDNA, the internal transcribed spacer region of ribosomal DNA (ITS1 and 2), and the large subunit (LSU) rDNA; and the other is the secondary structure of ITS2. In the present study, all four possible genetic markers (SSU, ITS1, ITS2, and LSU rDNA) were amplified from 232 individuals of five radiolarian morphological species and applied to examine the evolutionary distance and secondary structure of rDNA. Comprehensive survey clearly shows that evolutionary distance of ITS1 rDNA and the secondary structure of ITS2 is good to identify the species. Notably, evolutionary distance of ITS1 rDNA is possible to set the common delimitation to identify the biological species, as 0.225 substitution per site. The results show that the ITS1 and ITS 2 rDNA could be the criterion for radiolarian species identification.

  16. The urine marker test

    DEFF Research Database (Denmark)

    Elbe, Anne-Marie; Jensen, Stine Nylandsted; Elsborg, Peter

    2016-01-01

    BACKGROUND: Urine sample collection for doping control tests is a key component of the World Anti-Doping Agency's fight against doping in sport. However, a substantial number of athletes experience difficulty when having to urinate under supervision. Furthermore, it cannot always be ensured...... that athletes are actually delivering their own urine. A method that can be used to alleviate the negative impact of a supervised urination procedure and which can also identify urine as coming from a specific athlete is the urine marker test. Monodisperse low molecular weight polyethylene glycols (PEGs......) are given orally prior to urination. Urine samples can be traced to the donor by analysis of the PEGs previously given. OBJECTIVE: The objective of this study was to investigate the use of the urine marker during urine doping control testing. METHODS: Two studies investigated athletes' acceptance...

  17. Quantitative determination of conjugated linoleic acid and polyunsaturated fatty acids in milk with C17:0 as internal marker – Evaluation of different methylation procedures

    Directory of Open Access Journals (Sweden)

    S. Lashkari

    2017-12-01

    Full Text Available Fatty acids are commonly analysed by gas chromatography as their corresponding fatty acid (FA methyl esters (FAME. For quantitative determination of individual FA an internal standard like C17:0 is necessary. Conjugated FA and polyunsaturated fatty acid (PUFA represents a challenge in the methylation steps, as they are sensitive to pH changes and oxidation. The present study was carried out to determine the efficiency of different methylation procedures on quantitative determination of conjugated linoleic acid (CLA, PUFA and response of internal standard. The highest response of internal standard was observed for boron trifluoride (BF3/methanol and methanolic HCl followed by NaOCH3, while cis-9, trans-11 CLA, total CLA and PUFA was higher with methanolic HCl followed by NaOCH3 compared with the BF3 method. These data can be useful for quantitating of milk FA. Keywords: Methylation procedures, Milk fatty acid, Conjugated linoleic acid

  18. Interferon antagonist NSs of La Crosse virus triggers a DNA damage response-like degradation of transcribing RNA polymerase II.

    Science.gov (United States)

    Verbruggen, Paul; Ruf, Marius; Blakqori, Gjon; Överby, Anna K; Heidemann, Martin; Eick, Dirk; Weber, Friedemann

    2011-02-04

    La Crosse encephalitis virus (LACV) is a mosquito-borne member of the negative-strand RNA virus family Bunyaviridae. We have previously shown that the virulence factor NSs of LACV is an efficient inhibitor of the antiviral type I interferon system. A recombinant virus unable to express NSs (rLACVdelNSs) strongly induced interferon transcription, whereas the corresponding wt virus (rLACV) suppressed it. Here, we show that interferon induction by rLACVdelNSs mainly occurs through the signaling pathway leading from the pattern recognition receptor RIG-I to the transcription factor IRF-3. NSs expressed by rLACV, however, acts downstream of IRF-3 by specifically blocking RNA polymerase II-dependent transcription. Further investigations revealed that NSs induces proteasomal degradation of the mammalian RNA polymerase II subunit RPB1. NSs thereby selectively targets RPB1 molecules of elongating RNA polymerase II complexes, the so-called IIo form. This phenotype has similarities to the cellular DNA damage response, and NSs was indeed found to transactivate the DNA damage response gene pak6. Moreover, NSs expressed by rLACV boosted serine 139 phosphorylation of histone H2A.X, one of the earliest cellular reactions to damaged DNA. However, other DNA damage response markers such as up-regulation and serine 15 phosphorylation of p53 or serine 1524 phosphorylation of BRCA1 were not triggered by LACV infection. Collectively, our data indicate that the strong suppression of interferon induction by LACV NSs is based on a shutdown of RNA polymerase II transcription and that NSs achieves this by exploiting parts of the cellular DNA damage response pathway to degrade IIo-borne RPB1 subunits.

  19. Micrologie de Chris Marker

    Directory of Open Access Journals (Sweden)

    Nicolas Geneix

    2009-10-01

    Full Text Available Abstract (E: Using "micrology", as set out by Adorno in Negative Dialectics, this paper tries to
    characterize a central feature of Chris Marker's approach, as iconographer and writer, namely the way
    in which he explores the echoes of history and culture in the singularity and rarity of the documentary.
    As traveller and photographer he catches and collects microcosmic fragments, tying them up and
    editing them in the various frames of the book, the film or the new media.
    Abstract (F: En s'appuyant sur la "micrologie" proposée par Adorno dans la Dialectique négative,
    cet article tente de caractériser un aspect de la démarche de Chris Marker, iconographe et écrivain.
    C'est en effet dans le singulier et la rareté documentaires que ce cinéaste sonde des échos historiques et
    culturels. Voyageur et photographe, il saisit et collectionne des fragments microcosmiques, les liant et
    les montant dans les cadres divers du livre, du film et des nouveaux médias.

  20. A transcriptome derived female-specific marker from the invasive Western mosquitofish (Gambusia affinis.

    Directory of Open Access Journals (Sweden)

    Dunja K Lamatsch

    Full Text Available Sex-specific markers are a prerequisite for understanding reproductive biology, genetic factors involved in sex differences, mechanisms of sex determination, and ultimately the evolution of sex chromosomes. The Western mosquitofish, Gambusia affinis, may be considered a model species for sex-chromosome evolution, as it displays female heterogamety (ZW/ZZ, and is also ecologically interesting as a worldwide invasive species. Here, de novo RNA-sequencing on the gonads of sexually mature G. affinis was used to identify contigs that were highly transcribed in females but not in males (i.e., transcripts with ovary-specific expression. Subsequently, 129 primer pairs spanning 79 contigs were tested by PCR to identify sex-specific transcripts. Of those primer pairs, one female-specific DNA marker was identified, Sanger sequenced and subsequently validated in 115 fish. Sequence analyses revealed a high similarity between the identified sex-specific marker and the 3´ UTR of the aminomethyl transferase (amt gene of the closely related platyfish (Xiphophorus maculatus. This is the first time that RNA-seq has been used to successfully characterize a sex-specific marker in a fish species in the absence of a genome map. Additionally, the identified sex-specific marker represents one of only a handful of such markers in fishes.

  1. Outlier SNP markers reveal fine-scale genetic structuring across European hake populations (Merluccius merluccius)

    DEFF Research Database (Denmark)

    Milano, I.; Babbucci, M.; Cariani, A.

    2014-01-01

    fishery. Analysis of 850 individuals from 19 locations across the entire distribution range showed evidence for several outlier loci, with significantly higher resolving power. While 299 putatively neutral SNPs confirmed the genetic break between basins (FCT = 0.016) and weak differentiation within basins...... even when neutral markers provide genetic homogeneity across populations. Here, 381 SNPs located in transcribed regions were used to assess largeand fine-scale population structure in the European hake (Merluccius merluccius), a widely distributed demersal species of high priority for the European...

  2. Report on achievements in fiscal 1998. Venture business growing type consortium - small business creating infrastructure (Development of simplified analysis system by using bio-markers of internal secretion disturbing substances - environmental hormone acting substances); 1998 nendo naibunpi kakuran busshitsu (kankyo hormone sayo busshitsu) no bio marker ni yoru kanben bunseki system no kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    Using the vitellogenin levels in male fishes as a parameter of pollution caused by internal secretion disturbing substances would allow collective measurement of compounding action of pollutants, acquisition of time averaged values, and large reduction in analysis cost. The present research and development works are intended to put such technological seeds into practical use, and promote its proliferation. The following subjects were implemented: (1) fabrication of effective anti-bodies, (2) their application to fresh water fishes, salmon, and trout, (3) their application to sea water fishes, (4) effects on mummichog and medaka, (5) correlation between spawning actions and vitellogenin manifestation in male fish, (6) discussions on chemical analysis methods and the correlativity therewith, and (7) establishment of methods for field investigation and evaluation. In Item (1), an ELISA system using vitellogenin anti-bodies of different fishes was established. A universal anti-body reacting commonly to all of fish vitellogenins was developed. In Items (2), (3) and (4), an evaluation system was established on actions of internal secretion disturbing substances on sea water fish and fresh water fish by using fish vitellogenins. In Item (5), effects on spawning of medaka, and effects on procreation activities (sterility) were evaluated by using vitellogenin. (NEDO)

  3. ‘I’m fishing really’ — inflammatory marker testing in primary care: a qualitative study

    Science.gov (United States)

    Watson, Jessica; de Salis, Isabel; Hamilton, Willie; Salisbury, Chris

    2016-01-01

    Background Inflammatory markers can be helpful as part of the diagnostic workup for specific diseases or for monitoring disease activity. A third use is as a screening and/or triage tool to differentiate between the presence or absence of disease. Most research into inflammatory markers looks at diagnosis of specific diseases and comes from secondary care. Qualitative studies to explore when and why clinicians use these tests in primary care are lacking. Aim To identify clinicians’ approaches to inflammatory marker testing in primary care. Design and setting Qualitative study with 26 GPs and nurse practitioners. Method Interviews were conducted using a semi-structured topic guide. Clinicians reviewed recent cases of inflammatory marker testing in their pathology inbox. Interviews were audiorecorded and transcribed. Qualitative analysis was conducted by two of the authors. Results Clinicians are uncertain about the appropriate use of inflammatory markers and differ in their approach to testing patients with undifferentiated symptoms. Normal or significantly elevated inflammatory markers are seen as helpful, but mildly raised inflammatory markers in the context of non-specific symptoms are difficult to interpret. Clinicians describe a tension between not wanting to ‘miss anything’ and, on the other hand, being wary of picking up borderline abnormalities that can lead to cascades of further tests. Diagnostic uncertainty is a common reason for inflammatory marker testing, with the aim to reassure; however, paradoxically, inconclusive results can generate a cycle of uncertainty and anxiety. Conclusion Further research is needed to define when inflammatory marker testing is useful in primary care and how to interpret results. PMID:26852797

  4. Cancer and tumour markers

    International Nuclear Information System (INIS)

    Osifo, B.

    1999-02-01

    Cancer has been a major cause of death world wide and in Nigeria there are six commonest forms of manifestation of cancer known. Of these prostrate cancer is the highest with 16% occurrence of all known cancers according to a study by the Histopathology Department of the UCH. Many factors, amongst them dietary, environmental, lifestyle, age and sedentary work are possible causes. With the global rise in incidents, the IAEA initiated the Tumour Marker Project as a means of screening cancers in 15 African countries including Nigeria. In Nigeria, 4 groups of the commonest cancers have been chosen for screening. These are prostrate cancer, primary liver cancer, cancer of the GI tract and trophoblastic cancer

  5. C-reactive protein in patients with acute coronary syndrome: association with coronary markers, lipid profile and markers of coagulation

    International Nuclear Information System (INIS)

    Munir, T.A.; Afzal, M.N.

    2010-01-01

    To determine levels of C-reactive protein (CRP) and its association with coronary markers, lipid profile and markers of coagulation in patients of acute coronary syndrome (ACS). The study was conducted at Shifa college of Medicine and Shifa international hospital for a period of one year (November 2005-December 2006). Patients and Methods: Sixty nine age matched controls and 133 consecutive patients of ACS were included in the study. CRP were measured by immunoturbidometric method, MB fraction of creatine kinase (CK-MB) and Troponin-1 by micro-particle enzyme immunoassay, lipid levels by Colorimetric Enzymatic methods, platelets by celldyn and coagulation markers were measured by CA-50 Sysmax. At admission mean CRP levels, cardiac biomarkers, lipid profile and coagulation markers were significantly increased in patients of ACS versus controls. Within the patients of ACS the mean levels of CRP, CK-MB, Trop I, prothrombin time (PT) and activated partial thromboplastin time (Am) were significantly raised in patients with ST - elevation myocardial infarction (STEMI) and non STEMI (NSTEMI) versus patients of unstable angina (VA). Association between CRP levels and coronary markers, coagulation markers and lipid profile was found to be non significant. The CRP levels were increased in patients with ACS as compared to controls. The CRP levels were insignificantly correlated with coronary markers (CK-MB, Trop I), coagulation markers (platelet count, PT, Am), and lipid profile (cholesterol, triglyceride, HDL and LDL cholesterol) in patients with ACS. (author)

  6. Advances in plant gene-targeted and functional markers: a review

    Directory of Open Access Journals (Sweden)

    Poczai Péter

    2013-02-01

    Full Text Available Abstract Public genomic databases have provided new directions for molecular marker development and initiated a shift in the types of PCR-based techniques commonly used in plant science. Alongside commonly used arbitrarily amplified DNA markers, other methods have been developed. Targeted fingerprinting marker techniques are based on the well-established practices of arbitrarily amplified DNA methods, but employ novel methodological innovations such as the incorporation of gene or promoter elements in the primers. These markers provide good reproducibility and increased resolution by the concurrent incidence of dominant and co-dominant bands. Despite their promising features, these semi-random markers suffer from possible problems of collision and non-homology analogous to those found with randomly generated fingerprints. Transposable elements, present in abundance in plant genomes, may also be used to generate fingerprints. These markers provide increased genomic coverage by utilizing specific targeted sites and produce bands that mostly seem to be homologous. The biggest drawback with most of these techniques is that prior genomic information about retrotransposons is needed for primer design, prohibiting universal applications. Another class of recently developed methods exploits length polymorphism present in arrays of multi-copy gene families such as cytochrome P450 and β-tubulin genes to provide cross-species amplification and transferability. A specific class of marker makes use of common features of plant resistance genes to generate bands linked to a given phenotype, or to reveal genetic diversity. Conserved DNA-based strategies have limited genome coverage and may fail to reveal genetic diversity, while resistance genes may be under specific evolutionary selection. Markers may also be generated from functional and/or transcribed regions of the genome using different gene-targeting approaches coupled with the use of RNA information

  7. Advances in plant gene-targeted and functional markers: a review

    Science.gov (United States)

    2013-01-01

    Public genomic databases have provided new directions for molecular marker development and initiated a shift in the types of PCR-based techniques commonly used in plant science. Alongside commonly used arbitrarily amplified DNA markers, other methods have been developed. Targeted fingerprinting marker techniques are based on the well-established practices of arbitrarily amplified DNA methods, but employ novel methodological innovations such as the incorporation of gene or promoter elements in the primers. These markers provide good reproducibility and increased resolution by the concurrent incidence of dominant and co-dominant bands. Despite their promising features, these semi-random markers suffer from possible problems of collision and non-homology analogous to those found with randomly generated fingerprints. Transposable elements, present in abundance in plant genomes, may also be used to generate fingerprints. These markers provide increased genomic coverage by utilizing specific targeted sites and produce bands that mostly seem to be homologous. The biggest drawback with most of these techniques is that prior genomic information about retrotransposons is needed for primer design, prohibiting universal applications. Another class of recently developed methods exploits length polymorphism present in arrays of multi-copy gene families such as cytochrome P450 and β-tubulin genes to provide cross-species amplification and transferability. A specific class of marker makes use of common features of plant resistance genes to generate bands linked to a given phenotype, or to reveal genetic diversity. Conserved DNA-based strategies have limited genome coverage and may fail to reveal genetic diversity, while resistance genes may be under specific evolutionary selection. Markers may also be generated from functional and/or transcribed regions of the genome using different gene-targeting approaches coupled with the use of RNA information. Such techniques have the

  8. Tumor markers in colorectal cancer

    OpenAIRE

    Fernandes, Luís César [UNIFESP; Matos, Delcio [UNIFESP

    2002-01-01

    Colorectal cancer is a clinical entity of a persistent relevance in clinical practice and its early diagnosis is a determinant factor to obtain better therapeutic results. Tumor markers are helpful means for a better approach to individuals with such neoplasm. In the present review, the authors analyze the phases in which surgical-clinical treatment markers must be used: diagnosis, determination of tumor stage, establishment of prognosis and detection of recurrence. Current and future markers...

  9. Serum markers of liver fibrosis

    DEFF Research Database (Denmark)

    Veidal, Sanne Skovgård; Bay-Jensen, Anne-Christine; Tougas, Gervais

    2010-01-01

    -epitopes, may be targeted for novel biochemical marker development in fibrosis. We used the recently proposed BIPED system (Burden of disease, Investigative, Prognostic, Efficacy and Diagnostic) to characterise present serological markers. METHODS: Pubmed was search for keywords; Liver fibrosis, neo......, a systematic use of the neo-epitope approach, i.e. the quantification of peptide epitopes generated from enzymatic cleavage of proteins during extracellular remodeling, may prove productive in the quest to find new markers of liver fibrosis....

  10. Biochemical markers of bone turnover

    International Nuclear Information System (INIS)

    Kim, Deog Yoon

    1999-01-01

    Biochemical markers of bone turnover has received increasing attention over the past few years, because of the need for sensitivity and specific tool in the clinical investigation of osteoporosis. Bone markers should be unique to bone, reflect changes of bone less, and should be correlated with radiocalcium kinetics, histomorphometry, or changes in bone mass. The markers also should be useful in monitoring treatment efficacy. Although no bone marker has been established to meet all these criteria, currently osteocalcin and pyridinium crosslinks are the most efficient markers to assess the level of bone turnover in the menopausal and senile osteoporosis. Recently, N-terminal telopeptide (NTX), C-terminal telopeptide (CTX) and bone specific alkaline phosphatase are considered as new valid markers of bone turnover. Recent data suggest that CTX and free deoxypyridinoline could predict the subsequent risk of hip fracture of elderly women. Treatment of postmenopausal women with estrogen, calcitonin and bisphosphonates demonstrated rapid decrease of the levels of bone markers that correlated with the long-term increase of bone mass. Factors such as circadian rhythms, diet, age, sex, bone mass and renal function affect the results of biochemical markers and should be appropriately adjusted whenever possible. Each biochemical markers of bone turnover may have its own specific advantages and limitations. Recent advances in research will provide more sensitive and specific assays

  11. Tumor markers in clinical oncology

    International Nuclear Information System (INIS)

    Novakovic, S.

    2004-01-01

    The subtle differences between normal and tumor cells are exploited in the detection and treatment of cancer. These differences are designated as tumor markers and can be either qualitative or quantitative in their nature. That means that both the structures that are produced by tumor cells as well as the structures that are produced in excessive amounts by host tissues under the influence of tumor cells can function as tumor markers. Speaking in general, the tumor markers are the specific molecules appearing in the blood or tissues and the occurrence of which is associated with cancer. According to their application, tumor markers can be roughly divided as markers in clinical oncology and markers in pathology. In this review, only tumor markers in clinical oncology are going to be discussed. Current tumor markers in clinical oncology include (i) oncofetal antigens, (ii) placental proteins, (iii) hormones, (iv) enzymes, (v) tumor-associated antigens, (vi) special serum proteins, (vii) catecholamine metabolites, and (viii) miscellaneous markers. As to the literature, an ideal tumor marker should fulfil certain criteria - when using it as a test for detection of cancer disease: (1) positive results should occur in the early stages of the disease, (2) positive results should occur only in the patients with a specific type of malignancy, (3) positive results should occur in all patients with the same malignancy, (4) the measured values should correlate with the stage of the disease, (5) the measured values should correlate to the response to treatment, (6) the marker should be easy to measure. Most tumor markers available today meet several, but not all criteria. As a consequence of that, some criteria were chosen for the validation and proper selection of the most appropriate marker in a particular malignancy, and these are: (1) markers' sensitivity, (2) specificity, and (3) predictive values. Sensitivity expresses the mean probability of determining an elevated tumor

  12. Developing the metacognitive skill of noticing the gap through self-transcribing: The case of students enrolled in an ELT training program in Chile

    Directory of Open Access Journals (Sweden)

    Millaray D Salas

    2015-10-01

    Full Text Available This paper reports the preliminary results of the first phase of an ongoing educational intervention conducted with students enrolled in an ELT training program at PUCV. The study set out to explore the feasibility and effectiveness of the recording and self-transcription methodology (Lynch, 2001, 2007; Mennim, 2003, 2012 as a route to noticing the gap and defossilization. Students (N=20 transcribed the oral texts they produced during the speaking section of the diagnostic test for English 5. The tasks were: (1 transcribing three minutes of their speaking time, (2 highlighting all the errors they identified in their own speech (3 coding them (e.g. grammatical, lexical, phonological and (4 sending the annotated transcript to the instructor by email. Drawing on the theory of questionnaire design and processing (Dörnyei, 2003, a survey was designed and posted online (GoogleForm and emailed to the students. The questionnaire asked students to evaluate the perceived benefits of the self-transcription methodology. The study data consist of the annotated transcripts and the questionnaire responses. The results of this study were much less positive than what has been reported in the literature (Willis & Willis, 1996, Burns & Joyce, 1997; Lynch, 2001, 2007; Mennim, 2003, 2012; Thornbury & Slade, 2006; Boettinger, Park & Timmis 2010; Stillwell et al., 2010, so an attempt is made to see why this might have been the case. Some pedagogical implications of this approach in the Chilean context are discussed.

  13. Changes in Tumor Marker Values with Patients with Beginning Disease Git. Detection of Secondary Liver Tumors in Patients with Colorectal Carcinoma by using Tumor Markers

    Czech Academy of Sciences Publication Activity Database

    Holubec jr., L.; Topolčan, O.; Pašková, H.; Holubec sen., L.; Pecen, Ladislav; Třeška, L.; Finek, J.; Pikner, R.; Visokai, V.; Lipská, V.; Svobodová, S.

    2002-01-01

    Roč. 17, č. 3 (2002), s. 133-134 ISSN 0886-3849. [International Conference on Human Tumor Markers /19./. 25.08.2002-29.08.2002, Velje] Institutional research plan: AV0Z1030915 Keywords : tumor markers * GIT cancers Subject RIV: BA - General Mathematics

  14. Marker Detection in Aerial Images

    KAUST Repository

    Alharbi, Yazeed

    2017-04-09

    The problem that the thesis is trying to solve is the detection of small markers in high-resolution aerial images. Given a high-resolution image, the goal is to return the pixel coordinates corresponding to the center of the marker in the image. The marker has the shape of two triangles sharing a vertex in the middle, and it occupies no more than 0.01% of the image size. An improvement on the Histogram of Oriented Gradients (HOG) is proposed, eliminating the majority of baseline HOG false positives for marker detection. The improvement is guided by the observation that standard HOG description struggles to separate markers from negatives patches containing an X shape. The proposed method alters intensities with the aim of altering gradients. The intensity-dependent gradient alteration leads to more separation between filled and unfilled shapes. The improvement is used in a two-stage algorithm to achieve high recall and high precision in detection of markers in aerial images. In the first stage, two classifiers are used: one to quickly eliminate most of the uninteresting parts of the image, and one to carefully select the marker among the remaining interesting regions. Interesting regions are selected by scanning the image with a fast classifier trained on the HOG features of markers in all rotations and scales. The next classifier is more precise and uses our method to eliminate the majority of the false positives of standard HOG. In the second stage, detected markers are tracked forward and backward in time. Tracking is needed to detect extremely blurred or distorted markers that are missed by the previous stage. The algorithm achieves 94% recall with minimal user guidance. An average of 30 guesses are given per image; the user verifies for each whether it is a marker or not. The brute force approach would return 100,000 guesses per image.

  15. ITS1/5.8S/ITS2, a Good Marker for Initial Classification of Shiitake Culinary-Medicinal Lentinus edodes (Agaricomycetes) Strains in China.

    Science.gov (United States)

    Song, Xiao-Xia; Zhao, Yan; Song, Chun-Yan; Li, Chuan-Hua; Song, Ying; Chen, Ming-Jie; Bao, Da-Peng; Tan, Qi

    2018-01-01

    China is home to rich wild and cultivated strains of Lentinus edodes, an important edible and medicinal mushroom. Artificial selection of L. edodes has a long history, and the widely cultivated strains belong to populations different from those of most wild strains. Internal transcribed spacer (ITS) regions have been used as good markers to identify L. edodes populations. But because ITS regions exhibit incomplete concerted evolution, the use of an ITS to identify L. edodes populations has been questioned. The objective of this study was to determine whether the ITS region is suitable for identifying L. edodes populations and which populations the widely cultivated strains and the most wild strains belong to by investigating intraindividual and differential ITS polymorphisms between 44 cultivars and 44 wild strains of L. edodes in China. Intraindividual ITS polymorphism is common in L. edodes strains, and most strains possessed 2 different ITS sequences, which came from their heterokaryons. The genetic polymorphisms of ITS1, 5.8S, and ITS2 in L. edodes strains are distinct. All strains were divided into one 5.8S type (5.8S-A), 2 ITS1 types (ITS1-A and ITS1-B), and 2 ITS2 types (ITS2-A and ITS2-B), which were subdivided into 2 branches (ITS2-A1 and ITS2-A2; ITS2-B1 and ITS2-B2). ITS1/5.8S/ITS2 could be used as a good marker in preliminary classification of L. edodes strains in China. It not only exhibited classified information of ITS1, 5.8S, and ITS2 for each strain at the same time, it also indicated whether the strain was heterozygous. The 44 cultivated strains were mainly the A/A/A1 type, and the 44 wild strains were mainly the A/A/A2 and other mixed types.

  16. The Infinitive Marker across Scandinavian

    DEFF Research Database (Denmark)

    Christensen, Ken Ramshøj

    2007-01-01

    In this paper I argue that the base-position of the infinitive marker in the Scandinavian languages and English share a common origin site. It is inserted as the top-most head in the VP-domain. The cross-linguistic variation in the syntactic distribution of the infinitive marker can be accounted...

  17. Does Late Gadolinium Enhancement still have Value? Right Ventricular Internal Mechanical Work, Ea/Emax and Late Gadolinium Enhancement as Prognostic Markers in Patients with Advanced Pulmonary Hypertension via Cardiac MRI.

    Science.gov (United States)

    Abouelnour, Amr Ei; Doyle, Mark; Thompson, Diane V; Yamrozik, June; Williams, Ronald B; Shah, Moneal B; Soma, Siva Kr; Murali, Srinivas; Benza, Raymond L; Biederman, Robert Ww

    2017-01-01

    Investigate the impact of Right Ventricular (RV) Internal Work (IW), ratio of arterial to ventricular end-systolic elastance (E a /E max ), and RV Insertion Point (IP) Late Gadolinium Enhancement (LGE) on outcome in Pulmonary Hypertension (PH) patients. LGE is well known to be present within the RVIPs and Inter Ventricular Septum (IVS) in PH patients, but its prognostic role remains complex and potentially overestimated via 2D qualitative relative to the 3D quantitative measures now available. However, E a /E max , a measure of ventricular-arterial coupling and IW, when added to external cardiac work i.e. the P-V loop area as correlates to the heart's energy demands, might fundamentally improve measures of prognosis as they interrogate physiology beyond just the RV. Cardiac Magnetic Resonance Imaging (CMR) of 124 PH patients (age = 60±13, 85F) referred to a large tertiary PH center, was retrospectively examined for RV volumetric and functional indices and RVIP LGE%. Right Heart Catheterizations (RHC) performed within 1±2 months of the CMR were reviewed. E a /E max was derived as RV End-Systolic Volume (ESV/RVSV). IW was estimated as RVESV ×(RV end-systolic pressure-RV diastolic pressure). Patients were followed from date of CMR for up to 5 years for MACE (death, hospitalized RV failure, initiation of parenteral prostacyclin, sustained ventricular arrhythmia or referral for lung transplantation). MACE was high; 48/124 (39%) patients had MACE by 1.6±1.3 years. Neither RVIP nor IVS LGE using visual assessment or even 3D quantization predicted MACE. The strongest predictor of MACE was RVIW (OR=1.00013, pright-sided human myocardial pathologies.

  18. International Trade. International Business

    OpenAIRE

    Мохнюк, А. М.; Mokhniuk, A. M.

    2015-01-01

    Work programme of the study course “International Trade. International Business” was prepared in accordance with educational and vocational training program for bachelors of training direction 6.030601 “Management”.

  19. Hands as markers of fragmentation

    Directory of Open Access Journals (Sweden)

    A. Barnard

    2005-07-01

    Full Text Available Margaret Atwood is an internationally read, translated, and critiqued writer whose novels have established her as one of the most esteemed authors in English (McCombs & Palmer, 1991:1. Critical studies of her work deal mainly with notions of identity from psychoanalytical perspectives. This study has identified a gap in current critical studies on Atwood’s works, namely the challenging of textual unity which is paralleled in the challenging of the traditional (single narrative voice. The challenging of textual unity and the single narrative voice brings about the fragmentation of both. This article will focus on the role that hands play as markers of fragmentation in “The Blind Assassin” (2000. In the novel, the writing hand destabilises the narrative voice, since it is not connected to the voice of a single author. If the author of the text – the final signified – is eliminated, the text becomes fragmentary and open, inviting the reader to contribute to the creation of meaning. Hands play a signficant role in foregrounding the narrator’s fragmented identity, and consequently, the fragmentation of the text. We will investigate this concept in the light of Roland Barthes’ notion of the scriptor, whose hand is metaphorically severed from his or her “voice”. Instead of the text being a unified entity, it becomes unstable and it displays the absence of hierarchical textual levels. Based mainly on Barthes’ writings, this article concludes that hands foreground the narrator’s fragmented identity, which is paralleled in the fragmented text.

  20. Frameworking memory and serotonergic markers.

    Science.gov (United States)

    Meneses, Alfredo

    2017-07-26

    The evidence for neural markers and memory is continuously being revised, and as evidence continues to accumulate, herein, we frame earlier and new evidence. Hence, in this work, the aim is to provide an appropriate conceptual framework of serotonergic markers associated with neural activity and memory. Serotonin (5-hydroxytryptamine [5-HT]) has multiple pharmacological tools, well-characterized downstream signaling in mammals' species, and established 5-HT neural markers showing new insights about memory functions and dysfunctions, including receptors (5-HT1A/1B/1D, 5-HT2A/2B/2C, and 5-HT3-7), transporter (serotonin transporter [SERT]) and volume transmission present in brain areas involved in memory. Bidirectional influence occurs between 5-HT markers and memory/amnesia. A growing number of researchers report that memory, amnesia, or forgetting modifies neural markers. Diverse approaches support the translatability of using neural markers and cerebral functions/dysfunctions, including memory formation and amnesia. At least, 5-HT1A, 5-HT4, 5-HT6, and 5-HT7 receptors and SERT seem to be useful neural markers and therapeutic targets. Hence, several mechanisms cooperate to achieve synaptic plasticity or memory, including changes in the expression of neurotransmitter receptors and transporters.

  1. A Defective mRNA Cleavage and Polyadenylation Complex Facilitates Expansions of Transcribed (GAAn Repeats Associated with Friedreich’s Ataxia

    Directory of Open Access Journals (Sweden)

    Ryan J. McGinty

    2017-09-01

    Full Text Available Expansions of microsatellite repeats are responsible for numerous hereditary diseases in humans, including myotonic dystrophy and Friedreich’s ataxia. Whereas the length of an expandable repeat is the main factor determining disease inheritance, recent data point to genomic trans modifiers that can impact the likelihood of expansions and disease progression. Detection of these modifiers may lead to understanding and treating repeat expansion diseases. Here, we describe a method for the rapid, genome-wide identification of trans modifiers for repeat expansion in a yeast experimental system. Using this method, we found that missense mutations in the endoribonuclease subunit (Ysh1 of the mRNA cleavage and polyadenylation complex dramatically increase the rate of (GAAn repeat expansions but only when they are actively transcribed. These expansions correlate with slower transcription elongation caused by the ysh1 mutation. These results reveal an interplay between RNA processing and repeat-mediated genome instability, confirming the validity of our approach.

  2. Prenatal Screening Using Maternal Markers

    Directory of Open Access Journals (Sweden)

    Howard Cuckle

    2014-05-01

    Full Text Available Maternal markers are widely used to screen for fetal neural tube defects (NTDs, chromosomal abnormalities and cardiac defects. Some are beginning to broaden prenatal screening to include pregnancy complications such as pre-eclampsia. The methods initially developed for NTDs using a single marker have since been built upon to develop high performance multi-maker tests for chromosomal abnormalities. Although cell-free DNA testing is still too expensive to be considered for routine application in public health settings, it can be cost-effective when used in combination with existing multi-maker marker tests. The established screening methods can be readily applied in the first trimester to identify pregnancies at high risk of pre-eclampsia and offer prevention though aspirin treatment. Prenatal screening for fragile X syndrome might be adopted more widely if the test was to be framed as a form of maternal marker screening.

  3. Detection of Secondary Liver Tumors in Patients with Colorectal Carcinoma by Using Tumor Markers

    Czech Academy of Sciences Publication Activity Database

    Holubec jr., L.; Topolčan, O.; Třeška, V.; Holubec sen., L.; Pecen, Ladislav; Pikner, R.; Finek, J.; Visokai, V.; Lipská, L.

    2002-01-01

    Roč. 17, č. 3 (2002), s. 134-135 ISSN 0886-3849. [International Conference on Human Tumor Markers /19./. 25.08.2002-29.08.2002, Velje] Institutional research plan: AV0Z1030915 Keywords : tumor markers * colorectal CA Subject RIV: BA - General Mathematics

  4. Troponin is a Potential Marker of Subclinical Myocardial Injury in Patient Undergoing Chemotherapy

    Czech Academy of Sciences Publication Activity Database

    Umlauf, J.; Pecen, Ladislav; Šimíčková, M.; Nekulová, M.; Vondráček, V.; Valík, D.

    2002-01-01

    Roč. 17, č. 3 (2002), s. 131 ISSN 0886-3849. [International Conference on Human Tumor Markers /19./. 25.08.2002-29.08.2002, Velje] Institutional research plan: AV0Z1030915 Keywords : markers of myocardial injury * troponin Subject RIV: BA - General Mathematics

  5. Criteria for the Selection of Reference Groups in the Statistical Evaluation of Tumor Markers

    Czech Academy of Sciences Publication Activity Database

    Holubec jr., L.; Topolčan, O.; Pikner, R.; Pecen, Ladislav; Holubec sen., L.

    2002-01-01

    Roč. 22, 1B (2002), s. 531 ISSN 0250-7005. [International Hamburg Symposium on Tumor Markers /11./. 27.01.2002-29.01.2002, Hamburg] Institutional research plan: AV0Z1030915 Keywords : reference groups * tumor markers Subject RIV: BA - General Mathematics

  6. Changes in Values of Tumor Markers with Pregnant Women in their IInd Trimester

    Czech Academy of Sciences Publication Activity Database

    Topolčan, O.; Holubec jr., L.; Pecen, Ladislav; Pikner, R.; Svobodová, S.

    2002-01-01

    Roč. 17, č. 3 (2002), s. 121-123 ISSN 0886-3849. [International Conference on Human Tumor Markers /19./. 25.08.2002-29.08.2002, Velje] Institutional research plan: AV0Z1030915 Keywords : tumor markers * pregrancy Subject RIV: BA - General Mathematics

  7. An annotated genetic map of loblolly pine based on microsatellite and cDNA markers

    Directory of Open Access Journals (Sweden)

    Wimalanathan Kokulapalan

    2011-01-01

    Full Text Available Abstract Background Previous loblolly pine (Pinus taeda L. genetic linkage maps have been based on a variety of DNA polymorphisms, such as AFLPs, RAPDs, RFLPs, and ESTPs, but only a few SSRs (simple sequence repeats, also known as simple tandem repeats or microsatellites, have been mapped in P. taeda. The objective of this study was to integrate a large set of SSR markers from a variety of sources and published cDNA markers into a composite P. taeda genetic map constructed from two reference mapping pedigrees. A dense genetic map that incorporates SSR loci will benefit complete pine genome sequencing, pine population genetics studies, and pine breeding programs. Careful marker annotation using a variety of references further enhances the utility of the integrated SSR map. Results The updated P. taeda genetic map, with an estimated genome coverage of 1,515 cM(Kosambi across 12 linkage groups, incorporated 170 new SSR markers and 290 previously reported SSR, RFLP, and ESTP markers. The average marker interval was 3.1 cM. Of 233 mapped SSR loci, 84 were from cDNA-derived sequences (EST-SSRs and 149 were from non-transcribed genomic sequences (genomic-SSRs. Of all 311 mapped cDNA-derived markers, 77% were associated with NCBI Pta UniGene clusters, 67% with RefSeq proteins, and 62% with functional Gene Ontology (GO terms. Duplicate (i.e., redundant accessory and paralogous markers were tentatively identified by evaluating marker sequences by their UniGene cluster IDs, clone IDs, and relative map positions. The average gene diversity, He, among polymorphic SSR loci, including those that were not mapped, was 0.43 for 94 EST-SSRs and 0.72 for 83 genomic-SSRs. The genetic map can be viewed and queried at http://www.conifergdb.org/pinemap. Conclusions Many polymorphic and genetically mapped SSR markers are now available for use in P. taeda population genetics, studies of adaptive traits, and various germplasm management applications. Annotating mapped

  8. Reliability and Concurrent Validity of the International Personality ...

    African Journals Online (AJOL)

    Reliability and Concurrent Validity of the International Personality item Pool (IPIP) Big-five Factor Markers in Nigeria. ... Nigerian Journal of Psychiatry ... Aims: The aim of this study was to assess the internal consistency and concurrent validity ...

  9. [Immunological Markers in Organ Transplantation].

    Science.gov (United States)

    Beckmann, J H; Heits, N; Braun, F; Becker, T

    2017-04-01

    The immunological monitoring in organ transplantation is based mainly on the determination of laboratory parameters as surrogate markers of organ dysfunction. Structural damage, caused by alloreactivity, can only be detected by invasive biopsy of the graft, which is why inevitably rejection episodes are diagnosed at a rather progressive stage. New non-invasive specific markers that enable transplant clinicians to identify rejection episodes at an earlier stage, on the molecular level, are needed. The accurate identification of rejection episodes and the establishment of operational tolerance permit early treatment or, respectively, a controlled cessation of immunosuppression. In addition, new prognostic biological markers are expected to allow a pre-transplant risk stratification thus having an impact on organ allocation and immunosuppressive regimen. New high-throughput screening methods allow simultaneous examination of hundreds of characteristics and the generation of specific biological signatures, which might give concrete information about acute rejection, chronic dysfunction as well as operational tolerance. Even though multiple studies and a variety of publications report about important advances on this subject, almost no new biological marker has been implemented in clinical practice as yet. Nevertheless, new technologies, in particular analysis of the genome, transcriptome, proteome and metabolome will make personalised transplantation medicine possible and will further improve the long-term results and graft survival rates. This article gives a survey of the limitations and possibilities of new immunological markers in organ transplantation. Georg Thieme Verlag KG Stuttgart · New York.

  10. Biological Markers and Salivary Cortisol

    DEFF Research Database (Denmark)

    Hansen, Åse Marie; Gunnarsson, Lars-Gunnar; Harris, Anette

    2011-01-01

    This chapter focuses on salivary cortisol in relation to biological markers. Specifically, associations with conventional cardiovascular risk factors and metabolic abnormalities (body mass index, waist circumference, waist/hip ratio, lipid status, glucose, blood pressure, heart rate and heart rate...... variations and pharmacological interventions were also excluded. After meeting all exclusion criteria, 42 papers remained. In total, 273 associations between salivary cortisol and any of the markers mentioned were studied, comprising 241 associations on metabolic abnormalities, 30 on inflammation, and 2...... on stress hormones. Of the salivary cortisol measures reported for evaluations of all markers tested were 136 (49%) single time points, 100 (37%) deviations, 36 (13%) AUC, and 1 (1%) dexamethasone test. Of these, 72 (26%) were statistically significant, and 201 (74%) indicated non-significant findings...

  11. Antimelanoma CTL recognizes peptides derived from an ORF transcribed from the antisense strand of the 3′ untranslated region of TRIT1

    Directory of Open Access Journals (Sweden)

    Rolf K Swoboda

    2014-01-01

    Full Text Available Noncoding regions of the genome play an important role in tumorigenesis of cancer. Using expression cloning, we have identified a cytotoxic T lymphocyte (CTL–defined antigen that recognizes a protein sequence derived from an open reading frame transcribed from the reverse strand in the 3′ untranslated region of tRNA isopentenyltransferase 1 (TRIT1. A peptide derived from this open reading frame (ORF sequence and predicted to bind to HLA-B57, sensitized HLA-B57+ tumor cells to lysis by CTL793. The peptide also induced a CTL response in peripheral blood mononuclear cells (PBMC of patient 793 and in two other melanoma patients. The CTL lysed peptide-pulsed HLA-B57+ target cells and melanoma cells with endogenous antigen expression. The recognition of this antigen is not limited to HLA-B57-restricted CTLs. An HLA-A2 peptide derived from the ORF was able to induce CTLs in PBMC of 2 HLA-A2+ patients. This study describes for the first time a CTL-defined melanoma antigen that is derived from an ORF on the reverse strand of the putative tumor suppressor gene TRIT1. This antigen has potential use as a vaccine or its ability to induce CTLs in vitro could be used as a predictive biomarker.

  12. The glnAntrBC operon of Herbaspirillum seropedicae is transcribed by two oppositely regulated promoters upstream of glnA.

    Science.gov (United States)

    Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U

    2007-01-01

    Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.

  13. PAV markers in Sorghum bicolour

    DEFF Research Database (Denmark)

    Shen, Xin; Liu, Zhiquan; Mocoeur, Anne Raymonde Joelle

    2015-01-01

    Abstract Genic presence/absence variants (PAVs) correlate closely to the phenotypic variation, impacting plant genome sizes and the adaption to the environment. To shed more light on their genome-wide patterns, functions and to test the possibility of using them as molecular markers, we analyzed...... enriched in stress responses and protein modification. We used 325 polymorphic PAVs in two sorghum inbred lines Ji2731 and E-Tian, together with 49 SSR markers, and constructed a genetic map, which consisted of 10 linkage groups corresponding to the 10 chromosomes of sorghum and spanned 1430.3 cM in length...

  14. EasyClone-MarkerFree

    DEFF Research Database (Denmark)

    Fabre, Mathew Malcolm Jessop; Jakociunas, Tadas; Stovicek, Vratislav

    2016-01-01

    Clone-MarkerFree. The integration of linearized expression cassettes into defined genomic loci is facilitated by CRISPR/Cas9. Cas9 is recruited to the chromosomal location by specific guide RNAs (gRNAs) expressed from a set of gRNA helper vectors. Using our genome engineering vector suite, single and triple insertions are obtained...

  15. Tumour markers in gynaecological practice

    International Nuclear Information System (INIS)

    Adewole, I.F.

    1999-02-01

    Gynaecological cancers are fairly common in developing countries and represent about 26 % f all cancers. Application of cervical cytology screening nationally has made cervical cancer one of the most preventable malignant diseases thus eliminating the challenges of advanced cancer management. Tumour markers has played a most crucial role in this respect

  16. Testing theories about ethnic markers

    DEFF Research Database (Denmark)

    Jensen, Niels Holm; Petersen, Michael Bang; Høgh-Olesen, Henrik

    2015-01-01

    In recent years, evolutionary psychologists and anthropologists have debated whether ethnic markers have evolved to solve adaptive problems related to interpersonal coordination or to interpersonal cooperation. In the present study, we add to this debate by exploring how individuals living in a m...

  17. Biochemical Markers in Neurocritical Care

    Directory of Open Access Journals (Sweden)

    Omidvar Rezae

    2016-07-01

    Full Text Available During the past two decades, a variety of serum or cerebrospinal fluid (CSF biochemical markers in daily clinical practice have been recommended to diagnose and monitor diverse diseases or pathologic situations. It will be essential to develop a panel of biomarkers, to be suitable for evaluation of treatment efficacy, representing distinct phases of injury and recovery and consider the temporal profile of those. Among the possible and different biochemical markers, S100b appeared to fulfill many of optimized criteria of an ideal marker. S100b, a cytosolic low molecular weight dimeric calciumbinding protein from chromosome 21, synthesized in glial cells throughout the CNS, an homodimeric diffusible, belongs to a family of closely related protein, predominantly expressed by astrocytes and Schwann cells and a classic immunohistochemical marker for these cells, is implicated in brain development and neurophysiology. Of the 3 isoforms of S-100, the BB subunit (S100B is present in high concentrations in central and peripheral glial and Schwann cells, Langerhans and anterior pituitary cells, fat, muscle, and bone marrow tissues. The biomarker has shown to be a sensitive marker of clinical and subclinical cerebral damage, such as stroke, traumatic brain injury, and spinal cord injury. Increasing evidence suggests that the biomarker plays a double function as an intracellular regulator and an extracellular signal of the CNS. S100b is found in the cytoplasm in a soluble form and also is associated with intracellular membranes, centrosomes, microtubules, and type III intermediate filaments. Their genomic organization now is known, and many of their target proteins have been identified, although the mechanisms of regulating S100b secretion are not completely understood and appear to be related to many factors, such as the proinflammatory cytokines, tumor necrosis factor alpha (TNF-a, interleukin (IL-1b, and metabolic stress. 

  18. Genetic diversity of Halla horses using microsatellite markers

    Directory of Open Access Journals (Sweden)

    Joo-Hee Seo

    2016-11-01

    Full Text Available Abstract Background Currently about 26,000 horses are breeding in Korea and 57.2% (14,776 horses of them are breeding in Jeju island. According to the statistics published in 2010, the horses breeding in Jeju island are subdivided into Jeju horse (6.1%, Thoroughbred (18.8% and Halla horse (75.1%. Halla horses are defined as a crossbreed between Jeju and Thoroughbred horses and are used for horse racing, horse riding and horse meat production. However, little research has been conducted on Halla horses because of the perception of crossbreed and people’s weighted interest toward Jeju horses. Method Using 17 Microsatellite (MS Markers recommended by International Society for Animal Genetics (ISAG, genomic DNAs were extracted from the hair roots of 3,880 Halla horses breeding in Korea and genetic diversity was identified by genotyping after PCR was performed. Results and conclusion In average, 10.41 alleles (from 6 alleles in HTG7 to 17 alleles in ASB17 were identified after the analysis using 17 MS Markers. The mean value of Hobs was 0.749 with a range from 0.612(HMS1 to 0.857(ASB2. Also, it was found that Hexp and PIC values were lowest in HMS1 (0.607 and 0.548, respectively, and highest in LEX3(0.859 and 0.843, respectively, and the mean value of Hexp was 0.760 and that of PIC was 0.728. 17 MS markers used in this studies were considered as appropriate markers for the polymorphism analysis of Halla horses. The frequency for the appearance of identical individuals was 5.90 × 10−20 when assumed as random mating population and when assumed as half-sib and full-sib population, frequencies were 4.08 × 10−15 and 3.56 × 10−8, respectively. Based on these results, the 17 MS markers can be used adequately for the Individual Identification and Parentage Verification of Halla horses. Remarkably, allele M and Q of ASB23 marker, G of HMS2 marker, H and L of HTG6 marker, L of HTG7 marker, E of LEX3 marker were the specific alleles

  19. A vaccinia virus recombinant transcribing an alphavirus replicon and expressing alphavirus structural proteins leads to packaging of alphavirus infectious single cycle particles.

    Directory of Open Access Journals (Sweden)

    Juana M Sánchez-Puig

    Full Text Available Poxviruses and Alphaviruses constitute two promising viral vectors that have been used extensively as expression systems, or as vehicles for vaccine purposes. Poxviruses, like vaccinia virus (VV are well-established vaccine vectors having large insertion capacity, excellent stability, and ease of administration. In turn, replicons derived from Alphaviruses like Semliki Forest virus (SFV are potent protein expression and immunization vectors but stocks are difficult to produce and maintain. In an attempt to demonstrate the use of a Poxvirus as a means for the delivery of small vaccine vectors, we have constructed and characterized VV/SFV hybrid vectors. A SFV replicon cDNA was inserted in the VV genome and placed under the control of a VV early promoter. The replicon, transcribed from the VV genome as an early transcript, was functional, and thus capable of initiating its own replication and transcription. Further, we constructed a VV recombinant additionally expressing the SFV structural proteins under the control of a vaccinia synthetic early/late promoter. Infection with this recombinant produced concurrent transcription of the replicon and expression of SFV structural proteins, and led to the generation of replicon-containing SFV particles that were released to the medium and were able to infect additional cells. This combined VV/SFV system in a single virus allows the use of VV as a SFV delivery vehicle in vivo. The combination of two vectors, and the possibility of generating in vivo single-cycle, replicon containing alphavirus particles, may open new strategies in vaccine development or in the design of oncolytic viruses.

  20. A vaccinia virus recombinant transcribing an alphavirus replicon and expressing alphavirus structural proteins leads to packaging of alphavirus infectious single cycle particles.

    Science.gov (United States)

    Sánchez-Puig, Juana M; Lorenzo, María M; Blasco, Rafael

    2013-01-01

    Poxviruses and Alphaviruses constitute two promising viral vectors that have been used extensively as expression systems, or as vehicles for vaccine purposes. Poxviruses, like vaccinia virus (VV) are well-established vaccine vectors having large insertion capacity, excellent stability, and ease of administration. In turn, replicons derived from Alphaviruses like Semliki Forest virus (SFV) are potent protein expression and immunization vectors but stocks are difficult to produce and maintain. In an attempt to demonstrate the use of a Poxvirus as a means for the delivery of small vaccine vectors, we have constructed and characterized VV/SFV hybrid vectors. A SFV replicon cDNA was inserted in the VV genome and placed under the control of a VV early promoter. The replicon, transcribed from the VV genome as an early transcript, was functional, and thus capable of initiating its own replication and transcription. Further, we constructed a VV recombinant additionally expressing the SFV structural proteins under the control of a vaccinia synthetic early/late promoter. Infection with this recombinant produced concurrent transcription of the replicon and expression of SFV structural proteins, and led to the generation of replicon-containing SFV particles that were released to the medium and were able to infect additional cells. This combined VV/SFV system in a single virus allows the use of VV as a SFV delivery vehicle in vivo. The combination of two vectors, and the possibility of generating in vivo single-cycle, replicon containing alphavirus particles, may open new strategies in vaccine development or in the design of oncolytic viruses.

  1. NABIC marker database: A molecular markers information network of agricultural crops.

    Science.gov (United States)

    Kim, Chang-Kug; Seol, Young-Joo; Lee, Dong-Jun; Jeong, In-Seon; Yoon, Ung-Han; Lee, Gang-Seob; Hahn, Jang-Ho; Park, Dong-Suk

    2013-01-01

    In 2013, National Agricultural Biotechnology Information Center (NABIC) reconstructs a molecular marker database for useful genetic resources. The web-based marker database consists of three major functional categories: map viewer, RSN marker and gene annotation. It provides 7250 marker locations, 3301 RSN marker property, 3280 molecular marker annotation information in agricultural plants. The individual molecular marker provides information such as marker name, expressed sequence tag number, gene definition and general marker information. This updated marker-based database provides useful information through a user-friendly web interface that assisted in tracing any new structures of the chromosomes and gene positional functions using specific molecular markers. The database is available for free at http://nabic.rda.go.kr/gere/rice/molecularMarkers/

  2. Development and utilization of novel intron length polymorphic markers in foxtail millet (Setaria italica (L.) P. Beauv.).

    Science.gov (United States)

    Gupta, Sarika; Kumari, Kajal; Das, Jyotirmoy; Lata, Charu; Puranik, Swati; Prasad, Manoj

    2011-07-01

    Introns are noncoding sequences in a gene that are transcribed to precursor mRNA but spliced out during mRNA maturation and are abundant in eukaryotic genomes. The availability of codominant molecular markers and saturated genetic linkage maps have been limited in foxtail millet (Setaria italica (L.) P. Beauv.). Here, we describe the development of 98 novel intron length polymorphic (ILP) markers in foxtail millet using sequence information of the model plant rice. A total of 575 nonredundant expressed sequence tag (EST) sequences were obtained, of which 327 and 248 unique sequences were from dehydration- and salinity-stressed suppression subtractive hybridization libraries, respectively. The BLAST analysis of 98 EST sequences suggests a nearly defined function for about 64% of them, and they were grouped into 11 different functional categories. All 98 ILP primer pairs showed a high level of cross-species amplification in two millets and two nonmillets species ranging from 90% to 100%, with a mean of ∼97%. The mean observed heterozygosity and Nei's average gene diversity 0.016 and 0.171, respectively, established the efficiency of the ILP markers for distinguishing the foxtail millet accessions. Based on 26 ILP markers, a reasonable dendrogram of 45 foxtail millet accessions was constructed, demonstrating the utility of ILP markers in germplasm characterizations and genomic relationships in millets and nonmillets species.

  3. Oral Academic Discourse Socialisation: Challenges Faced by International Undergraduate Students in a Malaysian Public University

    Science.gov (United States)

    Mahfoodh, Omer Hassan Ali

    2014-01-01

    This paper reports a qualitative study which examines the challenges faced by six international undergraduate students in their socialisation of oral academic discourse in a Malaysian public university. Data were collected employing interviews. Students' presentations were also collected. Semi-structured interviews were transcribed verbatim and…

  4. redD and actII-ORF4, Pathway-Specific Regulatory Genes for Antibiotic Production in Streptomyces coelicolor A3(2), Are Transcribed In Vitro by an RNA Polymerase Holoenzyme Containing σhrdD

    NARCIS (Netherlands)

    Fujii, T.; Gramajo, H.C.; Takano, E.; Bibb, M.J.

    1996-01-01

    redD and actII-ORF4, regulatory genes required for synthesis of the antibiotics undecylprodigiosin and actinorhodin by Streptomyces coelicolor A3(2), were transcribed in vitro by an RNA polymerase holoenzyme containing σhrdD. Disruption of hrdD had no effect on antibiotic production, indicating that

  5. Early bichemical markers of effects: Enzyme induction, oncogene activation and markers of oxidative damage

    DEFF Research Database (Denmark)

    Poulsen, Henrik E.; Loft, Steffen

    1995-01-01

    Early bichemical marker, enzyme induction, oncogene activation, oxidative damage, low-density lipoprotein......Early bichemical marker, enzyme induction, oncogene activation, oxidative damage, low-density lipoprotein...

  6. A Software for the Analysis of Scripted Dialogs Based on Surface Markers

    Directory of Open Access Journals (Sweden)

    Sylvain Delisle

    2003-04-01

    Full Text Available Most information systems that deal with natural language texts do not tolerate much deviation from their idealized and simplified model of language. Spoken dialog is notoriously ungrammatical however. Because the MAREDI project focuses in particular on the automatic analysis of scripted dialogs, we needed to develop a robust capacity to analyze transcribed spoken language. This paper presents the main elements of our approach, which is based on exploiting surface markers as the best route to the semantics of the conversation modelled. We highlight the foundations of our particular conversational model and give an overview of the MAREDI system. The latter consists of three key modules, which are 1 a connectionist network to recognise speech acts, 2 a robust syntactic parser, and 3 a semantic analyzer. These three modules are fully implemented in Prolog and C++ and have been packaged into an integrated software.

  7. Molecular Markers Useful for Intraspecies Subtyping and Strain Differentiation of Dermatophytes.

    Science.gov (United States)

    Mochizuki, Takashi; Takeda, Kiminobu; Anzawa, Kazushi

    2017-02-01

    Dermatophytosis is a very common skin disorder and the most frequent infection encountered by practicing dermatologists. The identification, pathogenicity, biology, and epidemiology of dermatophytes, the causative agents of dermatophytosis, are of interest for both dermatologists and medical mycologists. Recent advances in molecular methods have provided new techniques for identifying dermatophytes, including intraspecies variations. Intraspecies subtyping and strain differentiation have made possible the tracking of infections, the identification of common sources of infections, recurrence or reinfection after treatment, and analysis of strain virulence and drug resistance. This review describes molecular methods of intraspecies subtyping and strain differentiation, including analyses of mitochondrial DNA and non-transcribed spacer regions of ribosomal RNA genes, random amplification of polymorphic DNA, and microsatellite markers, along with their advantages and limitations.

  8. Insertion and fixation of fiducial markers for setup and tracking of lung tumors in radiotherapy

    International Nuclear Information System (INIS)

    Imura, Mikado; Yamazaki, Koichi; Shirato, Hiroki; Onimaru, Rikiya; Fujino, Masaharu; Shimizu, Shinichi; Harada, Toshiyuki; Ogura, Shigeaki; Dosaka-Akita, Hirotoshi; Miyasaka, Kazuo; Nishimura, Masaharu

    2005-01-01

    Purpose: Internal 1.5-mm fiducial markers were used in real-time tumor-tracking radiotherapy (RT) for lung cancer. The fixation rate of the markers using the bronchial insertion technique, reliability of the setup using markers around the target volume, dislocation of the markers after real-time tumor-tracking RT, and long-term toxicity of marker insertion were investigated. Methods and Materials: Between July 2000 and April 2004, 154 gold markers were inserted into 57 patients with peripheral lung cancer. The distances between the implanted markers in 198 measurements in 71 setups in 11 patients were measured using two sets of orthogonal diagnostic X-ray images of the real-time tumor-tracking RT system. The distance between the markers and the chest wall was also measured in a transaxial CT image on 186 occasions in 48 patients during treatment planning and during follow-up. The median treatment time was 6 days (range, 4-14 days). Results: In 115 (75%) of the 154 inserted markers, the gold marker was detected throughout the treatment period. In 122 markers detected at CT planning, 115 (94%) were detected until the end of treatment. The variation in the distances between the implanted markers was within ±2 mm in 95% and ±1 mm in 80% during treatment. The variation in the distances between the implanted markers was >2 mm in at least one direction in 9% of the setups for which reexamination with a CT scan was indicated. The fixation rate in the left upper lobe was lower than in the other lobes. A statistically significant relationship was found between a shorter distance between the markers and the chest wall and the fixation rate, suggesting that the markers in the smaller bronchial lumens fixed better than those in the larger lumens. A learning curve among the endoscopists was suggested in the fixation rate. The distance between the markers and the chest wall changed significantly within a median of 44 days (range, 16-181 days) after treatment. Conclusion: The

  9. Endometriosis and possible inflammation markers

    OpenAIRE

    Meng-Hsing Wu; Kuei-Yang Hsiao; Shaw-Jenq Tsai

    2015-01-01

    Inflammation plays an important role in the pathogenesis of endometriosis. Infiltration of peritoneal macrophages and local proinflammatory mediators in the peritoneal microenvironment affect ovarian function and pelvic anatomy leading to the symptoms and signs of endometriosis. The identification of a noninvasive marker for endometriosis will facilitate early diagnosis and treatment of this disease. This review provides an overview of local microenvironmental inflammation and systemic inflam...

  10. Endometriosis and possible inflammation markers

    Directory of Open Access Journals (Sweden)

    Meng-Hsing Wu

    2015-08-01

    Full Text Available Inflammation plays an important role in the pathogenesis of endometriosis. Infiltration of peritoneal macrophages and local proinflammatory mediators in the peritoneal microenvironment affect ovarian function and pelvic anatomy leading to the symptoms and signs of endometriosis. The identification of a noninvasive marker for endometriosis will facilitate early diagnosis and treatment of this disease. This review provides an overview of local microenvironmental inflammation and systemic inflammation biomarkers in endometriosis.

  11. Molecular markers for thyroid cancer

    International Nuclear Information System (INIS)

    Marrero Rodriguez, Maria Teresa; Sinconegui Gomez, Belkys; Cruz Cruz, Anaisa

    2015-01-01

    The importance of the study of the thyroid nodule lies in excluding the possibility of a malignant lesion because the majority of lesions are benign but there is a malignancy risk of 5 to 10%. Most of them are well differentiated carcinomas originating in the follicular epithelium. In spite of the fact that the majority are benign lesions, distinguishing them from carcinomas is crucial to treatment and adequate follow-up. Fine-needle biopsy allows making the diagnosis in most of cases. However, this method is restricted, particularly when diagnosing follicular lesions. In an effort to improve the diagnostic accuracy of biopsy and to provide new diagnosing criteria, a number of molecular markers have been put forward, some of which has wide range of approval whereas others still awaits to be validated for further implementation. This article presented an updated review of molecular markers with higher number of evidence, more accessible and potentially usable from a methodological viewpoint for diagnosis of the thyroid nodule before surgery. The importance of the study of the thyroid nodule lies in excluding the possibility of a malignant lesion because the majority of lesions are benign but there is a malignancy risk of 5 to 10%. Most of them are well differentiated carcinomas originating in the follicular epithelium. In spite of the fact that the majority are benign lesions, distinguishing them from carcinomas is crucial to treatment and adequate follow-up. Fine-needle biopsy allows making the diagnosis in most of cases. However, this method is restricted, particularly when diagnosing follicular lesions. In an effort to improve the diagnostic accuracy of biopsy and to provide new diagnosing criteria, a number of molecular markers have been put forward, some of which has wide range of approval whereas others still awaits to be validated for further implementation. This article presented an updated review of molecular markers with higher number of evidence, more

  12. Serotonin, neural markers and memory

    Directory of Open Access Journals (Sweden)

    Alfredo eMeneses

    2015-07-01

    Full Text Available Diverse neuropsychiatric disorders present dysfunctional memory and no effective treatment exits for them; likely as result of the absence of neural markers associated to memory. Neurotransmitter systems and signaling pathways have been implicated in memory and dysfunctional memory; however, their role is poorly understood. Hence, neural markers and cerebral functions and dysfunctions are revised. To our knowledge no previous systematic works have been published addressing these issues. The interactions among behavioral tasks, control groups and molecular changes and/or pharmacological effects are mentioned. Neurotransmitter receptors and signaling pathways, during normal and abnormally functioning memory with an emphasis on the behavioral aspects of memory are revised. With focus on serotonin, since as it is a well characterized neurotransmitter, with multiple pharmacological tools, and well characterized downstream signaling in mammals’ species. 5-HT1A, 5-HT4, 5-HT5, 5-HT6 and 5-HT7 receptors as well as SERT (serotonin transporter seem to be useful neural markers and/or therapeutic targets. Certainly, if the mentioned evidence is replicated, then the translatability from preclinical and clinical studies to neural changes might be confirmed. Hypothesis and theories might provide appropriate limits and perspectives of evidence

  13. Apoptotic markers in protozoan parasites

    Directory of Open Access Journals (Sweden)

    Fasel Nicolas

    2010-11-01

    Full Text Available Abstract The execution of the apoptotic death program in metazoans is characterized by a sequence of morphological and biochemical changes that include cell shrinkage, presentation of phosphatidylserine at the cell surface, mitochondrial alterations, chromatin condensation, nuclear fragmentation, membrane blebbing and the formation of apoptotic bodies. Methodologies for measuring apoptosis are based on these markers. Except for membrane blebbing and formation of apoptotic bodies, all other events have been observed in most protozoan parasites undergoing cell death. However, while techniques exist to detect these markers, they are often optimised for metazoan cells and therefore may not pick up subtle differences between the events occurring in unicellular organisms and multi-cellular organisms. In this review we discuss the markers most frequently used to analyze cell death in protozoan parasites, paying special attention to changes in cell morphology, mitochondrial activity, chromatin structure and plasma membrane structure/permeability. Regarding classical regulators/executors of apoptosis, we have reviewed the present knowledge of caspase-like and nuclease activities.

  14. New approach for isolation of VNTR markers.

    OpenAIRE

    Nakamura, Y; Carlson, M; Krapcho, K; Kanamori, M; White, R

    1988-01-01

    Elsewhere we have reported an efficient method for isolating VNTR (Variable Number of Tandem Repeats) markers. Several of the VNTR markers isolated in those experiments were sequenced, and a DNA sequence of 9 bp (GNNGTGGG) emerged as an apparent consensus sequence for VNTR markers. To confirm this result and to develop more VNTR markers, we synthesized nine different 18-base-long oligonucleotides whose sequences each included GNNGTGGG. When 102 cosmid clones selected by these oligonucleotides...

  15. Markers and residual time to AIDS

    NARCIS (Netherlands)

    Geskus, R. B.

    2002-01-01

    The value of immunological and virological markers as predictors of progression to AIDS, or death by AIDS, is a topic of much current interest. Mostly, the influence of markers is investigated in a time-dependent or a baseline proportional hazard model, relating time-varying or baseline marker

  16. Porcine cluster of differentiation (CD) markers 2018 update.

    Science.gov (United States)

    Dawson, Harry D; Lunney, Joan K

    2018-06-01

    Pigs are a major source of food worldwide; preventing and treating their infectious diseases is essential, requiring a thorough understanding of porcine immunity. The use of pigs as models for human physiology is a growing area; progress in this area has been limited because the immune toolkit is not robust. The international community has established cluster of differentiation (CD) markers for assessing cells involved in immunity as well as characterizing numerous other cells like stem cells. Overall, for humans 419 proteins have been designated as CD markers, each reacting with a defined set of antibodies (Abs). This paper summarizes current knowledge of swine CD markers and identifies 359 corresponding CD proteins in pigs. A broad-based literature and vendor search was conducted to identify defined sets of monoclonal (mAbs) and polyclonal Abs (pAbs) reacting with porcine CD markers along with other reagents (fusion proteins, ELISAs, PCR assays, and gene edited cell and pig models). This process identified over 800 reagents that are reportedly reactive with 266 pig CD markers. Despite this number, there is a great need to develop and characterize additional CD marker reagents, particularly mAbs, for pig research. There are numerous high priority targets: reagents for the characterization of porcine innate lymphoid cells, polarized macrophages and T regulatory cells and for the detection of porcine CD45 isoforms. Overall, improved technologies and genomics have contributed to dramatic increases in our knowledge of the pig, its immune system, disease and vaccine responses, and utility as a biomedical model. The development of more CD reagents will clearly advance these initiatives. Published by Elsevier Ltd.

  17. Characterization and development of EST-derived SSR markers in cultivated sweetpotato (Ipomoea batatas

    Directory of Open Access Journals (Sweden)

    Li Yujun

    2011-10-01

    Full Text Available Abstract Background Currently there exists a limited availability of genetic marker resources in sweetpotato (Ipomoea batatas, which is hindering genetic research in this species. It is necessary to develop more molecular markers for potential use in sweetpotato genetic research. With the newly developed next generation sequencing technology, large amount of transcribed sequences of sweetpotato have been generated and are available for identifying SSR markers by data mining. Results In this study, we investigated 181,615 ESTs for the identification and development of SSR markers. In total, 8,294 SSRs were identified from 7,163 SSR-containing unique ESTs. On an average, one SSR was found per 7.1 kb of EST sequence with tri-nucleotide motifs (42.9% being the most abundant followed by di- (41.2%, tetra- (9.2%, penta- (3.7% and hexa-nucleotide (3.1% repeat types. The top five motifs included AG/CT (26.9%, AAG/CTT (13.5%, AT/TA (10.6%, CCG/CGG (5.8% and AAT/ATT (4.5%. After removing possible duplicate of published EST-SSRs of sweetpotato, a total of non-repeat 7,958 SSR motifs were identified. Based on these SSR-containing sequences, 1,060 pairs of high-quality SSR primers were designed and used for validation of the amplification and assessment of the polymorphism between two parents of one mapping population (E Shu 3 Hao and Guang 2k-30 and eight accessions of cultivated sweetpotatoes. The results showed that 816 primer pairs could yield reproducible and strong amplification products, of which 195 (23.9% and 342 (41.9% primer pairs exhibited polymorphism between E Shu 3 Hao and Guang 2k-30 and among the 8 cultivated sweetpotatoes, respectively. Conclusion This study gives an insight into the frequency, type and distribution of sweetpotato EST-SSRs and demonstrates successful development of EST-SSR markers in cultivated sweetpotato. These EST-SSR markers could enrich the current resource of molecular markers for the sweetpotato community and would

  18. Expert judgment on markers to deter inadvertent human intrusion into the Waste Isolation Pilot Plant

    Energy Technology Data Exchange (ETDEWEB)

    Trauth, K.M. [Sandia National Labs., Albuquerque, NM (United States); Hora, S.C. [Hawaii Univ., Hilo, HI (United States); Guzowski, R.V. [Science Applications International Corp., San Diego, CA (United States)

    1993-11-01

    The expert panel identified basic principles to guide current and future marker development efforts: (1) the site must be marked, (2) message(s) must be truthful and informative, (3) multiple components within a marker system, (4) multiple means of communication (e.g., language, pictographs, scientific diagrams), (5) multiple levels of complexity within individual messages on individual marker system elements, (6) use of materials with little recycle value, and (7) international effort to maintain knowledge of the locations and contents of nuclear waste repositories. The efficacy of the markers in deterring inadvertent human intrusion was estimated to decrease with time, with the probability function varying with the mode of intrusion (who is intruding and for what purpose) and the level of technological development of the society. The development of a permanent, passive marker system capable of surviving and remaining interpretable for 10,000 years will require further study prior to implementation.

  19. Expert judgment on markers to deter inadvertent human intrusion into the Waste Isolation Pilot Plant

    International Nuclear Information System (INIS)

    Trauth, K.M.; Hora, S.C.; Guzowski, R.V.

    1993-11-01

    The expert panel identified basic principles to guide current and future marker development efforts: (1) the site must be marked, (2) message(s) must be truthful and informative, (3) multiple components within a marker system, (4) multiple means of communication (e.g., language, pictographs, scientific diagrams), (5) multiple levels of complexity within individual messages on individual marker system elements, (6) use of materials with little recycle value, and (7) international effort to maintain knowledge of the locations and contents of nuclear waste repositories. The efficacy of the markers in deterring inadvertent human intrusion was estimated to decrease with time, with the probability function varying with the mode of intrusion (who is intruding and for what purpose) and the level of technological development of the society. The development of a permanent, passive marker system capable of surviving and remaining interpretable for 10,000 years will require further study prior to implementation

  20. From Subordinate Marker to Discourse Marker: que in Andean Spanish

    Directory of Open Access Journals (Sweden)

    Anna María Escobar

    2005-06-01

    Full Text Available This paper proposes an analysis of a redundant use of que ('that' found in Andean Spanish as an expression which has undergone a grammaticalization process. Evidence suggests that the function of que as subordinate marker is much more generalized in this variety than in other dialects of Spanish. que is found to be used as a marker introducing both nominal and adjectival clauses, suggesting that adjectival subordinates behave as nominal subordinates in this variety of Spanish. An intrusive que appears in restricted syntactic and semantic contexts with clauses that have nominal and adjectival functions, and even appears replacing adverbial expressions in some adverbial subordinates (temporal, spatial, and manner. Furthermore, it is found to be sensitive to the degree of the argument’s thematic/semantic function in the subordinate clause. In particular, it seems to occur more often with low-agency arguments in adjectival and nominal contexts, and, in nominal subordinates, tends to appear with a restricted set of epistemic and evidential main verbs (e.g. creer 'to believe', saber 'to know', decir 'to say'. The analysis suggests that que has developed a new function in this variety of Spanish, namely, one of indicating that the information contained in the subordinate clause does not constitute background information (as would be expected in non-contact varieties of Spanish but instead contains information relevant to the discourse.

  1. Identification of Nematodirus species (Nematoda: Molineidae) from wild ruminants in Italy using ribosomal DNA markers.

    Science.gov (United States)

    Gasser, R B; Rossi, L; Zhu, X

    1999-11-01

    The sequence of the second internal transcribed spacer of ribosomal DNA was determined for four species of Nematodirus (Nematodirus rupicaprae, Nematodirus oiratianus, Nematodirus davtiani alpinus and Nematodirus europaeus) from roe deer or alpine chamois. The second internal transcribed spacer of the four species varied in length from 228 to 236 bp, and the G + C contents ranged from 41 to 44%. While no intraspecific sequence variation was detected among multiple samples representing three of the taxa, sequence differences of 5.9-9.7% were detected among the four species, Nematodirus davtiani alpinus and N. rupicaprae were genetically most similar (94.1%), followed by N. oiratianus, N. europaeus and N. rupicaprae (91.1-91.5%), whereas N. oiratianus was genetically most different from N. davtiani alpinus. The interspecific sequence differences were exploited for the delineation of the four species by PCR-based restriction fragment length polymorphism (using two enzymes) and single-strand conformation polymorphism. The results have implications for diagnosis, epidemiology and for studying the systematics of the Nematodirinae.

  2. Iterative h-minima-based marker-controlled watershed for cell nucleus segmentation.

    Science.gov (United States)

    Koyuncu, Can Fahrettin; Akhan, Ece; Ersahin, Tulin; Cetin-Atalay, Rengul; Gunduz-Demir, Cigdem

    2016-04-01

    Automated microscopy imaging systems facilitate high-throughput screening in molecular cellular biology research. The first step of these systems is cell nucleus segmentation, which has a great impact on the success of the overall system. The marker-controlled watershed is a technique commonly used by the previous studies for nucleus segmentation. These studies define their markers finding regional minima on the intensity/gradient and/or distance transform maps. They typically use the h-minima transform beforehand to suppress noise on these maps. The selection of the h value is critical; unnecessarily small values do not sufficiently suppress the noise, resulting in false and oversegmented markers, and unnecessarily large ones suppress too many pixels, causing missing and undersegmented markers. Because cell nuclei show different characteristics within an image, the same h value may not work to define correct markers for all the nuclei. To address this issue, in this work, we propose a new watershed algorithm that iteratively identifies its markers, considering a set of different h values. In each iteration, the proposed algorithm defines a set of candidates using a particular h value and selects the markers from those candidates provided that they fulfill the size requirement. Working with widefield fluorescence microscopy images, our experiments reveal that the use of multiple h values in our iterative algorithm leads to better segmentation results, compared to its counterparts. © 2016 International Society for Advancement of Cytometry. © 2016 International Society for Advancement of Cytometry.

  3. Corneal markers of diabetic neuropathy.

    Science.gov (United States)

    Pritchard, Nicola; Edwards, Katie; Shahidi, Ayda M; Sampson, Geoff P; Russell, Anthony W; Malik, Rayaz A; Efron, Nathan

    2011-01-01

    Diabetic neuropathy is a significant clinical problem that currently has no effective therapy, and in advanced cases, leads to foot ulceration and lower limb amputation. The accurate detection, characterization and quantification of this condition are important in order to define at-risk patients, anticipate deterioration, monitor progression, and assess new therapies. This review evaluates novel corneal methods of assessing diabetic neuropathy. Two new noninvasive corneal markers have emerged, and in cross-sectional studies have demonstrated their ability to stratify the severity of this disease. Corneal confocal microscopy allows quantification of corneal nerve parameters and noncontact corneal esthesiometry, the functional correlate of corneal structure, assesses the sensitivity of the cornea. Both these techniques are quick to perform, produce little or no discomfort for the patient, and are suitable for clinical settings. Each has advantages and disadvantages over traditional techniques for assessing diabetic neuropathy. Application of these new corneal markers for longitudinal evaluation of diabetic neuropathy has the potential to reduce dependence on more invasive, costly, and time-consuming assessments, such as skin biopsy.

  4. Single-tube tetradecaplex panel of highly polymorphic microsatellite markers hemophilia A.

    Science.gov (United States)

    Zhao, M; Chen, M; Tan, A S C; Cheah, F S H; Mathew, J; Wong, P C; Chong, S S

    2017-07-01

    microsatellite marker panel simplifies identification and selection of informative markers for linkage-based PGD of HEMA. Informative markers can also be easily co-amplified with mutation-containing F8 amplicons for combined mutation detection and linkage analysis. © 2017 International Society on Thrombosis and Haemostasis.

  5. Marker-assisted selection in common beans and cassava

    International Nuclear Information System (INIS)

    Blair, M.W.; Fregene, M.A.; Beebe, S.E.; Ceballos, H.

    2007-01-01

    Marker-assisted selection (MAS) in common beans (Phaseolus vulgaris L.) and cassava (Manihot esculenta) is reviewed in relation to the breeding system of each crop and the breeding goals of International Agricultural Research Centres (IARCs) and National Agricultural Research Systems (NARS). The importance of each crop is highlighted and examples of successful use of molecular markers within selection cycles and breeding programmes are given for each. For common beans, examples are given of gene tagging for several traits that are important for bean breeding for tropical environments and aspects considered that contribute to successful application of MAS. Simple traits that are tagged with easy-to-use markers are discussed first as they were the first traits prioritized for breeding at the International Center for Tropical Agriculture (CIAT) and with NARS partners in Central America, Colombia and eastern Africa. The specific genes for MAS selection were the bgm-1 gene for bean golden yellow mosaic virus (BGYMV) resistance and the bc-3 gene for bean common mosaic virus (BCMV) resistance. MAS was efficient for reducing breeding costs under both circumstances as land and labour savings resulted from eliminating susceptible individuals. The use of markers for other simply inherited traits in marker-assisted backcrossing and introgression across Andean and Mesoamerican gene pools is suggested. The possibility of using MAS for quantitative traits such as low soil phosphorus adaptation is also discussed as are the advantages and disadvantages of MAS in a breeding programme. For cassava, the use of multiple flanking markers for selection of a dominant gene, CMD2 for cassava mosaic virus (CMV) resistance at CIAT and the International Institute of Tropical Agriculture (IITA) as well as with NARS partners in the United Republic of Tanzania using a participatory plant breeding scheme are reviewed. MAS for the same gene is important during introgression of cassava green mite

  6. Alternative fiducial markers for Vero real-time tumor tracking radiotherapy: A phantom study

    Science.gov (United States)

    Park, Shin-Hyung; Kim, Jae-Chul; Kim, Sung Joon

    2016-12-01

    The objective of this study was to investigate the feasibility of potential fiducial markers consisting of various materials in a Vero real-time tumor-tracking (RTTT) system. In order to determine the applicability of fiducial markers for the Vero RTTT system, we tested various markers consisting of 8 kinds of material (titanium, stainless steel, high-carbon steel, pure steel, copper, silver, tantalum, and gold) with various diameters ranging from 0.3 mm to 1.6 mm and a length of 5 mm. Additionally, a commercial gold coil marker (Visicoil™, IBA dosimetry, Schwarzenbruck, Germany) of diameter 0.5 mm and length 1 cm was included for evaluation. The radiologic visibility on kV fluoroscopy/kV CT scan images of the fiducial markers was evaluated. The detectability on the RTTT system was tested using a two-dimensional moving phantom (Brainlab AG, Feldkirchen, Germany), producing sinusoidal motion. The target center's accuracy was evaluated by calculating the deviation of the position of a metal sphere from the center on the dose profile. Dose profiles were measured using Gafchromic EBT2 films (International Specialty Products, NJ, USA). All markers were visible on kV fluoroscopy/kV CT while markers with atomic number ≥ 25.7 were detectable on the Vero RTTT system. All the detected markers showed excellent geometric accuracy.

  7. Understanding oceanic migrations with intrinsic biogeochemical markers.

    Directory of Open Access Journals (Sweden)

    Raül Ramos

    2009-07-01

    Full Text Available Migratory marine vertebrates move annually across remote oceanic water masses crossing international borders. Many anthropogenic threats such as overfishing, bycatch, pollution or global warming put millions of marine migrants at risk especially during their long-distance movements. Therefore, precise knowledge about these migratory movements to understand where and when these animals are more exposed to human impacts is vital for addressing marine conservation issues. Because electronic tracking devices suffer from several constraints, mainly logistical and financial, there is emerging interest in finding appropriate intrinsic markers, such as the chemical composition of inert tissues, to study long-distance migrations and identify wintering sites. Here, using tracked pelagic seabirds and some of their own feathers which were known to be grown at different places and times within the annual cycle, we proved the value of biogeochemical analyses of inert tissue as tracers of marine movements and habitat use. Analyses of feathers grown in summer showed that both stable isotope signatures and element concentrations can signal the origin of breeding birds feeding in distinct water masses. However, only stable isotopes signalled water masses used during winter because elements mainly accumulated during the long breeding period are incorporated into feathers grown in both summer and winter. Our findings shed new light on the simple and effective assignment of marine organisms to distinct oceanic areas, providing new opportunities to study unknown migration patterns of secretive species, including in relation to human-induced mortality on specific populations in the marine environment.

  8. International commission radiological protection: its policy, its works, its thoughts

    International Nuclear Information System (INIS)

    Nenot, J.C.

    1999-01-01

    The I.C.R.P. is an advisory organism. It offers recommendations to regulatory and advisory organisms at the international and national levels. Given the differences that exist between the national legislations, its recommendations cannot be directly transcribed in regulatory terms. The base recommendations are used for the essential in the international regulations and in particular in the European Directive, whom transposition in national law is compulsory. The aim of the Commission is to elaborate a protection system against ionizing radiations, sufficiently general to apply at the totality of situations during which ones the human is exposed or could be exposed to radiations. (N.C.)

  9. Metabolic markers in sports medicine.

    Science.gov (United States)

    Banfi, Giuseppe; Colombini, Alessandra; Lombardi, Giovanni; Lubkowska, Anna

    2012-01-01

    Physical exercise induces adaptations in metabolism considered beneficial for health. Athletic performance is linked to adaptations, training, and correct nutrition in individuals with genetic traits that can facilitate such adaptations. Intense and continuous exercise, training, and competitions, however, can induce changes in the serum concentrations of numerous laboratory parameters. When these modifications, especially elevated laboratory levels, result outside the reference range, further examinations are ordered or participation in training and competition is discontinued or sports practice loses its appeal. In order to correctly interpret commonly used laboratory data, laboratory professionals and sport physicians need to know the behavior of laboratory parameters during and after practice and competition. We reviewed the literature on liver, kidney, muscle, heart, energy, and bone parameters in athletes with a view to increase the knowledge about clinical chemistry applied to sport and to stimulate studies in this field. In liver metabolism, the interpretation of serum aminotransferases concentration in athletes should consider the release of aspartate aminotransferase (AST) from muscle and of alanine aminotransferase (ALT) mainly from the liver, when bilirubin can be elevated because of continuous hemolysis, which is typical of exercise. Muscle metabolism parameters such as creatine kinase (CK) are typically increased after exercise. This parameter can be used to interpret the physiological release of CK from muscle, its altered release due to rhabdomyolysis, or incomplete recovery due to overreaching or trauma. Cardiac markers are released during exercise, and especially endurance training. Increases in these markers should not simply be interpreted as a signal of cardiac damage or wall stress but rather as a sign of regulation of myocardial adaptation. Renal function can be followed in athletes by measuring serum creatinine concentration, but it should

  10. Molecular phylogeny of elasmobranchs inferred from mitochondrial and nuclear markers.

    Science.gov (United States)

    Pavan-Kumar, A; Gireesh-Babu, P; Babu, P P Suresh; Jaiswar, A K; Hari Krishna, V; Prasasd, K Pani; Chaudhari, Aparna; Raje, S G; Chakraborty, S K; Krishna, Gopal; Lakra, W S

    2014-01-01

    The elasmobranchs (sharks, rays and skates) being the extant survivors of one of the earliest offshoots of the vertebrate evolutionary tree are good model organisms to study the primitive vertebrate conditions. They play a significant role in maintaining the ecological balance and have high economic value. Due to over-exploitation and illegal fishing worldwide, the elasmobranch stocks are being decimated at an alarming rate. Appropriate management measures are necessary for restoring depleted elasmobranch stocks. One approach for restoring stocks is implementation of conservation measures and these measures can be formulated effectively by knowing the evolutionary relationship among the elasmobranchs. In this study, a total of 30 species were chosen for molecular phylogeny studies using mitochondrial cytochrome c oxidase subunit I, 12S ribosomal RNA gene and nuclear Internal Transcribed Spacer 2. Among different genes, the combined dataset of COI and 12S rRNA resulted in a well resolved tree topology with significant bootstrap/posterior probabilities values. The results supported the reciprocal monophyly of sharks and batoids. Within Galeomorphii, Heterodontiformes (bullhead sharks) formed as a sister group to Lamniformes (mackerel sharks): Orectolobiformes (carpet sharks) and to Carcharhiniformes (ground sharks). Within batoids, the Myliobatiformes formed a monophyly group while Pristiformes (sawfishes) and Rhinobatiformes (guitar fishes) formed a sister group to all other batoids.

  11. Molecular markers in well-differentiated thyroid cancer.

    Science.gov (United States)

    D'Cruz, Anil K; Vaish, Richa; Vaidya, Abhishek; Nixon, Iain J; Williams, Michelle D; Vander Poorten, Vincent; López, Fernando; Angelos, Peter; Shaha, Ashok R; Khafif, Avi; Skalova, Alena; Rinaldo, Alessandra; Hunt, Jennifer L; Ferlito, Alfio

    2018-06-01

    Thyroid nodules are of common occurrence in the general population. About a fourth of these nodules are indeterminate on aspiration cytology placing many a patient at risk of unwanted surgery. The purpose of this review is to discuss various molecular markers described to date and place their role in proper perspective. This review covers the fundamental role of the signaling pathways and genetic changes involved in thyroid carcinogenesis. The current literature on the prognostic significance of these markers is also described. PubMed was used to search relevant articles. The key terms "thyroid nodules", "thyroid cancer papillary", "carcinoma papillary follicular", "carcinoma papillary", "adenocarcinoma follicular" were searched in MeSH, and "molecular markers", "molecular testing", mutation, BRAF, RAS, RET/PTC, PAX 8, miRNA, NIFTP in title and abstract fields. Multiple combinations were done and a group of experts in the subject from the International Head and Neck Scientific Group extracted the relevant articles and formulated the review. There has been considerable progress in the understanding of thyroid carcinogenesis and the emergence of numerous molecular markers in the recent years with potential to be used in the diagnostic algorithm of these nodules. However, their precise role in routine clinical practice continues to be a contentious issue. Majority of the studies in this context are retrospective and impact of these mutations is not independent of other prognostic factors making the interpretation difficult. The prevalence of these mutations in thyroid nodule is high and it is a continuously evolving field. Clinicians should stay informed as recommendation on the use of these markers is expected to evolve.

  12. Use of DNA markers in forest tree improvement research

    Science.gov (United States)

    D.B. Neale; M.E. Devey; K.D. Jermstad; M.R. Ahuja; M.C. Alosi; K.A. Marshall

    1992-01-01

    DNA markers are rapidly being developed for forest trees. The most important markers are restriction fragment length polymorphisms (RFLPs), polymerase chain reaction- (PCR) based markers such as random amplified polymorphic DNA (RAPD), and fingerprinting markers. DNA markers can supplement isozyme markers for monitoring tree improvement activities such as; estimating...

  13. Molecular Markers for Food Traceability

    Directory of Open Access Journals (Sweden)

    Paula Martins-Lopes

    2013-01-01

    Full Text Available DNA analysis with molecular markers has opened a way to understand complex organism's genome. It is presently being widely applied across different fields, where food takes a preeminent position. Constant outbreaks of foodborne illnesses are increasing consumer's attention towards more detailed information related to what they are consuming. This overview reports on the areas where food traceability has been considered, and the problems that still remain to be bypassed in order to be widely applied. An outline of the most broadly used PCR-based methods for food traceability is described. Applications in the area of detection of genetically modified organisms, protected denomination of origin, allergenic and intolerance reactions are detailed in order to understand the dimension of the performed studies.

  14. Learning to mark: a qualitative study of the experiences and concerns of medical markers

    Directory of Open Access Journals (Sweden)

    Cannings-John Rebecca

    2006-04-01

    Full Text Available Abstract Background Although there is published research on the methods markers use in marking various types of assessment, there is relatively little information on the processes markers use in approaching a marking exercise. This qualitative paper describes the preparation and experiences of general practice (GP teachers who undertake marking a written assessment in an undergraduate medical course. Methods Semi-structured interviews were conducted with seven of the 16 GP tutors on an undergraduate course. The purposive sample comprised two new markers, two who had marked for a couple of years and three experienced markers. Each respondent was interviewed twice, once following a formative assessment of a written case study, and again after a summative assessment. All interviews were audio-taped and analysed for emerging themes. A respondent validation exercise was conducted with all 16 GP tutors. Results Markers had internal concerns about their ability to mark fairly and made considerable efforts to calibrate their marking. They needed guidance and coaching when marking for the first time and adopted a variety of marking styles, reaching a decision through a number of routes. Dealing with pass/fail borderline scripts and the consequences of the mark on the student were particular concerns. Even experienced markers felt the need to calibrate their marks both internally and externally Conclusion Previous experience of marking appears to improve markers' confidence and is a factor in determining the role which markers adopt. Confidence can be improved by giving clear instructions, along with examples of marking. The authors propose that one method of providing this support and coaching could be by a process of peer review of a selection of papers prior to the main marking. New markers in particular would benefit from further guidance, however they are influenced by others early on in their marking career and course organisers should be mindful of

  15. Internal Bleeding

    Science.gov (United States)

    ... Fractures (Part II) Additional Content Medical News Internal Bleeding By Amy H. Kaji, MD, PhD, Associate Professor, ... Emergency First Aid Priorities Cardiac Arrest Choking Internal Bleeding Severed or Constricted Limbs or Digits Soft-Tissue ...

  16. Elevated tumour marker: an indication for imaging?

    LENUS (Irish Health Repository)

    McMahon, Colm J

    2012-02-01

    INTRODUCTION: The purpose of this study was to evaluate the utility of imaging examinations in patients with elevated tumour markers when (a) the tumour marker is not validated for as a primary diagnostic test; (b) the patient had no personal history of cancer and (c) the patient had no other imaging indication. MATERIALS AND METHODS: Patients without known cancer who had abnormal carcinoembryonic antigen, CA19-9, CA125 and\\/or CA15-3 serology over a one-year period were included. A retrospective medical record review was performed to assess the number of these cases who underwent imaging because of \\'elevated tumour marker\\' in the absence of a clinical indication for imaging. The number and result of these imaging studies were evaluated. RESULTS: Eight hundred and nineteen patients were included. Of those, 25 patients (mean age: 67.8 [range 41-91] y), were imaged to evaluate: \\'elevated tumour marker\\'. They underwent 29 imaging studies (mean [+\\/-standard deviation (SD)] per patient = 1.2 [+\\/-0.4]), and had 42 elevated tumour marker serology tests (mean [+\\/-SD] per patient = 1.7 [+\\/-0.7]). Four patients had >1 imaging test. No patient had an imaging study which diagnosed a malignancy or explained the elevated tumour marker. CONCLUSION: The non-judicious use of tumour markers can prompt further unnecessary investigations including imaging. In this study, there was no positive diagnostic yield for imaging performed for investigation of \\'elevated tumour marker\\'. \\'Elevated tumour marker\\

  17. Radiographic markers - A reservoir for bacteria?

    International Nuclear Information System (INIS)

    Tugwell, Jenna; Maddison, Adele

    2011-01-01

    Introduction: Amongst the most frequently handled objects in the radiology department are radiographic markers. They are personal accessories used with every patient, and are kept in the radiographers pockets when not utilised. Upon enquiry it was discovered that many radiographers disregarded the potential of these accessories to become a vector for cross-contamination thus never or rarely clean them. The aims of this study were therefore to identify if radiographic markers are a reservoir for bacteria and to establish an effective cleaning method for decontaminating them. Methodology: 25 radiographers/student radiographers were selected for this study. Swabbing of their markers prior and post cleaning took place. The microbiology laboratory subsequently analyzed the results by quantifying and identifying the bacteria present. The participants also completed a closed questionnaire regarding their markers (e.g. frequency of cleaning and type of marker) to help specify the results gained from the swabbing procedure. Results: From the sample swabbed, 92% were contaminated with various organisms including Staphylococcus and Bacillus species, the amount of bacteria present ranged from 0 to >50 CFU. There were no significant differences between disinfectant wipes and alcohol gel in decontaminating the markers. Both successfully reduced their bacterial load, with 80% of the markers post cleaning having 0 CFU. Conclusion: The results indicated that radiographic markers can become highly contaminated with various organisms thus serve as a reservoir for bacteria. In addition, the markers need to be cleaned on a regular basis, with either disinfectant wipes or alcohol gel to reduce their bacterial load.

  18. International Relations

    OpenAIRE

    McGlinchey, S.

    2017-01-01

    A ‘Day 0’ introduction to International Relations for beginners. Written by a range of emerging and established experts, the chapters offer a broad sweep of the basic components of International Relations and the key contemporary issues that concern the discipline. The narrative arc forms a complete circle, taking readers from no knowledge to competency. The journey starts by examining how the international system was formed and ends by reflecting that International Relations is always adapti...

  19. Histopathologic Consideration of Fiducial Gold Markers Inserted for Real-Time Tumor-Tracking Radiotherapy Against Lung Cancer

    International Nuclear Information System (INIS)

    Imura, Mikado; Yamazaki, Koichi; Kubota, Kanako C.; Itoh, Tomoo; Onimaru, Rikiya; Cho, Yasushi; Hida, Yasuhiro; Kaga, Kichizo; Onodera, Yuya; Ogura, Shigeaki; Dosaka-Akita, Hirotoshi; Shirato, Hiroki; Nishimura, Masaharu

    2008-01-01

    Purpose: Internal fiducial gold markers, safely inserted with bronchoscopy, have been used in real-time tumor-tracking radiotherapy for lung cancer. We investigated the histopathologic findings at several points after the insertion of the gold markers. Methods and Materials: Sixteen gold markers were inserted for preoperative marking in 7 patients who subsequently underwent partial resection of tumors by video-assisted thoracoscopic surgery within 7 days. Results: Fibrotic changes and hyperplasia of type 2 pneumocytes around the markers were seen 5 or 7 days after insertion, and fibrin exudation without fibrosis was detected 1 or 2 days after insertion. Conclusions: Because fibroblastic changes start approximately 5 days after gold marker insertion, real-time tumor-tracking radiotherapy should be started >5 days after gold marker insertion

  20. International law

    CERN Document Server

    Shaw, Malcolm N

    2017-01-01

    International Law is the definitive and authoritative text on the subject, offering Shaw's unbeatable combination of clarity of expression and academic rigour and ensuring both understanding and critical analysis in an engaging and authoritative style. Encompassing the leading principles, practice and cases, and retaining and developing the detailed references which encourage and assist the reader in further study, this new edition motivates and challenges students and professionals while remaining accessible and engaging. Fully updated to reflect recent case law and treaty developments, this edition contains an expanded treatment of the relationship between international and domestic law, the principles of international humanitarian law, and international criminal law alongside additional material on international economic law.

  1. Clinical usefulness of bone turnover marker concentrations in osteoporosis

    DEFF Research Database (Denmark)

    Morris, H A; Eastell, R; Jorgensen, N R

    2017-01-01

    Current evidence continues to support the potential for bone turnover markers (BTM) to provide clinically useful information particularly for monitoring the efficacy of osteoporosis treatment. Many of the limitations identified earlier remain, principally in regard to the relationship between BTM...... of combining such data for meta-analyses. Harmonization of units for reporting serum/plasma CTX (ng/L) and PINP (μg/L) is recommended. The development of international collaborations continues with an important initiative to combine BTM results from clinical trials in osteoporosis in a meta...

  2. Identification and phylogeny of some species of the genera Sporidiobolus and Rhodotorula using analysis of the 5.8s rDNA gene and two ribosomal internal transcribed spacers

    Directory of Open Access Journals (Sweden)

    Mokhtari M.

    2011-01-01

    Full Text Available Due to the problems encountered in routine morphological and physiological procedures that are used in yeast identification, DNA-based methods have recently been developed. In the present study, l66 yeast strains were isolated from several apple and citrus cultivars. After analysis by basic morphological methods, the ITS1 and ITS2 regions of the isolates were amplified separately, and the isolates were grouped based on fragment size polymorphism (FSP of the amplicons. By comparing the electrophoretic patterns of the PCR products with Rhodotorula mucilaginosa, species were identified as Rhodotorula. For precise and final identification, the ITS-PCR products were subjected to sequencing followed by Blast analysis. As a result, eight isolates were identified as belonging to the Rhodotorula genus, of which five were identified as R. mucilaginosa and three as R. glutinis, and one as a Sporidiobolus. We conclude that the method PCR-FSP, in combination with other approaches, is useful for the identification of yeast species.

  3. Reconstruction of phylogenetic relationships in dermatomycete genus Trichophyton Malmsten 1848 based on ribosomal internal transcribed spacer region, partial 28S rRNA and beta-tubulin genes sequences.

    Science.gov (United States)

    Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E

    2016-09-01

    Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. © 2016 Blackwell Verlag GmbH.

  4. Stereotactic core needle breast biopsy marker migration: An analysis of factors contributing to immediate marker migration.

    Science.gov (United States)

    Jain, Ashali; Khalid, Maria; Qureshi, Muhammad M; Georgian-Smith, Dianne; Kaplan, Jonah A; Buch, Karen; Grinstaff, Mark W; Hirsch, Ariel E; Hines, Neely L; Anderson, Stephan W; Gallagher, Katherine M; Bates, David D B; Bloch, B Nicolas

    2017-11-01

    To evaluate breast biopsy marker migration in stereotactic core needle biopsy procedures and identify contributing factors. This retrospective study analyzed 268 stereotactic biopsy markers placed in 263 consecutive patients undergoing stereotactic biopsies using 9G vacuum-assisted devices from August 2010-July 2013. Mammograms were reviewed and factors contributing to marker migration were evaluated. Basic descriptive statistics were calculated and comparisons were performed based on radiographically-confirmed marker migration. Of the 268 placed stereotactic biopsy markers, 35 (13.1%) migrated ≥1 cm from their biopsy cavity. Range: 1-6 cm; mean (± SD): 2.35 ± 1.22 cm. Of the 35 migrated biopsy markers, 9 (25.7%) migrated ≥3.5 cm. Patient age, biopsy pathology, number of cores, and left versus right breast were not associated with migration status (P> 0.10). Global fatty breast density (P= 0.025) and biopsy in the inner region of breast (P = 0.031) were associated with marker migration. Superior biopsy approach (P= 0.025), locally heterogeneous breast density, and t-shaped biopsy markers (P= 0.035) were significant for no marker migration. Multiple factors were found to influence marker migration. An overall migration rate of 13% supports endeavors of research groups actively developing new biopsy marker designs for improved resistance to migration. • Breast biopsy marker migration is documented in 13% of 268 procedures. • Marker migration is affected by physical, biological, and pathological factors. • Breast density, marker shape, needle approach etc. affect migration. • Study demonstrates marker migration prevalence; marker design improvements are needed.

  5. Development and characterization of microsatellite markers for ...

    Indian Academy of Sciences (India)

    This species is threatened throughout its range in West- ern Ghats as a result of overexploitation and habitat destruc- tion, which have reduced local population sizes and has led many populations to local extinction. In this study, we report the development of microsatellite markers and discuss the utility of these markers in ...

  6. A molecular marker map for roses

    NARCIS (Netherlands)

    Debener, T.; Mattiesch, L.; Vosman, B.

    2001-01-01

    n addition to an existing core map for diploid roses which comprised 305 molecular markers 60 additional markers were mapped to extend the map. As a first application of the information contained in the map, the map position of a resistance gene from roses, Rdr1, was determined by identifying

  7. (SSR) markers for drought tolerance in maize

    African Journals Online (AJOL)

    use

    2011-11-21

    Nov 21, 2011 ... and dominance gene effects in inheritance are included in almost all traits related to drought (Shiri et al., 2010a, b). Identifying the complete-linked molecular markers with target gene and mapping its chromosome locus is an important goal in plant breeding for gene cloning and marker-aided selection.

  8. Marker-Free Human Motion Capture

    DEFF Research Database (Denmark)

    Grest, Daniel

    Human Motion Capture is a widely used technique to obtain motion data for animation of virtual characters. Commercial optical motion capture systems are marker-based. This book is about marker-free motion capture and its possibilities to acquire motion from a single viewing direction. The focus...

  9. germplasm using ISSR markers and their relationships

    African Journals Online (AJOL)

    STORAGESEVER

    2008-12-17

    Dec 17, 2008 ... (MAS) is the current trend in 'Modern Agriculture'. These. DNA markers allow the construction of ... are inherited in Mendelian fashion and are scored as dominant markers (Ratnaparkhe et al., 1998) ... ISSR amplified PCR products were resolved on 2% agarose gel in. 1X TBE buffer (89 mM Tris-Hcl, pH 8.3, ...

  10. Chromosomal location of genomic SSR markers associated

    Indian Academy of Sciences (India)

    Among the same earlier tested 230 primers, one SSR marker (Xgwm311) also amplified a fragment which is present in the resistant parent and in the resistant bulks, but absent in the susceptible parent and in the susceptible bulks. To understand the chromosome group location of these diagnostic markers, Xgwm382 and ...

  11. Polyphenols as Possible Markers of Botanical Origin of Honey.

    Science.gov (United States)

    Gašić, Uroš M; Milojković-Opsenica, Dušanka M; Tešić, Živoslav Lj

    2017-07-01

    In recent years, the botanical and geographical origin of food has become an important topic in the context of food quality and safety, as well as consumer protection, in accordance with international standards. Finding chemical markers, especially phytochemicals, characteristic for some kind of food is the subject of interest of a significant number of researchers in the world. This paper is focused on the use of polyphenols as potential markers for the determination of botanical origin of honey. It includes a review of the polyphenols present in various honey samples and the methods for their separation and identification. Special emphasis in this paper is placed on the identification of honey polyphenols using advanced LC-MS techniques in order to find specific markers of botanical origin of honey. In this regard, this study gives an overview of the literature that describes the use of LC-MS techniques for the isolation and determination of honey polyphenols. This review focuses on the research performed in the past two decades.

  12. internal branding

    OpenAIRE

    Rai, Anu; Omanga, Josphat

    2014-01-01

    The project report provides an insight into internal branding of two different leading firms – Coca-Cola and Google. The aim of this project report is to study how these two companies use internal branding to promote or build brand performance of the company. This report follows a qualitative research method. The report is deductive in nature and hence, it is guided by the literatures of internal branding. The project report conducted research on brand identity, brand commitment and brand loy...

  13. Internal branding

    OpenAIRE

    Rijal, Ramesh; Dhakal, Rajendra

    2015-01-01

    The project report provides an insight into internal branding of two different leading firms – Coca-Cola and Google. The aim of this project report is to study how these two companies use internal branding to promote or build brand performance of the company. This report follows a qualitative research method. The report is deductive in nature and hence, it is guided by the literatures of internal branding. The project report conducted research on brand identity, brand commitment and brand loy...

  14. DESIGNING EAP MATERIALS BASED ON INTERCULTURAL CORPUS ANALYSES: THE CASE OF LOGICAL MARKERS IN RESEARCH ARTICLES

    Directory of Open Access Journals (Sweden)

    Pilar Mur Dueñas

    2009-10-01

    Full Text Available The ultimate aim of intercultural analyses in English for Academic Purposes is to help non-native scholars function successfully in the international disciplinary community in English. The aim of this paper is to show how corpus-based intercultural analyses can be useful to design EAP materials on a particular metadiscourse category, logical markers, in research article writing. The paper first describes the analysis carried out of additive, contrastive and consecutive logical markers in a corpus of research articles in English and in Spanish in a particular discipline, Business Management. Differences were found in their frequency and also in the use of each of the sub-categories. Then, five activities designed on the basis of these results are presented. They are aimed at raising Spanish Business scholars' awareness of the specific uses and pragmatic function of frequent logical markers in international research articles in English.

  15. Molecular markers of oocyte differentiation in European eel during hormonally induced oogenesis.

    Science.gov (United States)

    Rojo-Bartolomé, Iratxe; Martínez-Miguel, Leticia; Lafont, Anne-Gaëlle; Vílchez, M Carmen; Asturiano, Juan F; Pérez, Luz; Cancio, Ibon

    2017-09-01

    Reproduction in captivity is a key study issue in Anguilla anguilla as a possible solution for its dwindling population. Understanding the mechanisms controlling the production of ribosomal building blocks during artificially induced oocyte maturation could be particularly interesting. Transcription levels of ribosomal biogenesis associated genes could be used as markers to monitor oogenesis. Eels from the Albufera Lagoon were injected with carp pituitary extract for 15weeks and ovaries in previtellogenic (PV) stage (non-injected), in early-, mid-, late-vitellogenesis (EV, MV, LV), as well as in migratory nucleus stage (MN) were analysed. 5S rRNA and related genes were highly transcribed in ovaries with PV oocytes. As oocytes developed, transcriptional levels of genes related to 5S rRNA production (gtf3a), accumulation (gtf3a, 42sp43) and nucleocytoplasmic transport (rpl5, rpl11) and the 5S/18S rRNA index decreased (PV>EV>MV>LV>MN). On the contrary, 18S rRNA was at its highest at MN stage while ubtf1 in charge of activating RNA-polymerase I and synthesising 18S rRNA behaved as 5S related genes. Individuals that did not respond (NR) to the treatment showed 5S/18S index values similar to PV females, while studied genes showed EV/LV-like transcription levels. Therefore, NR females fail to express the largest rRNAs, which could thus be taken as markers of successful vitellogenesis progression. In conclusion, we have proved that the transcriptional dynamics of ribosomal genes provides useful tools to characterize induced ovarian development in European eels. In the future, such markers should be studied as putative indicators of response to hormonal treatments and of the quality of obtained eel oocytes. Copyright © 2017. Published by Elsevier Inc.

  16. Prognostic value of tumour endothelial markers in patients with endometrial cancer

    Science.gov (United States)

    BERSINGER, NICK A.; SCHNEIDER, BRIGITTE; VORBURGER, STEPHAN A.; JOHANN, SILKE; CANDINAS, DANIEL; MUELLER, MICHAEL D.

    2010-01-01

    Endometrial cancer is one of the more frequent and most lethal gynaecological cancer types. Since it occurs more frequently in elderly and overweight patients, a pre-operative staging method would be beneficial. The growth of solid neoplasms is always accompanied by neovascularisation. Tumour endothelial markers (TEMs) are a group of recently described endothelial cell surface markers that appear to be specific to neoplastic tissue. This study aimed to investigate the potential usefulness of TEM assessment in the endometrium by comparing the transcriptional expression of TEMs in the normal endometrium with endometroid adenocarcinoma tissue. Tissues were lysed and the RNA was extracted, assessed and reverse transcribed in one batch. Real-time quantitative PCR was performed for TEM-1, -2, -6, -7, -7r and -8. GAPDH, β-actin and ribosomal protein L13A (RPL13A) were used as control genes. TEM-8 showed the highest expression level in all of the groups. TEM-1 showed higher expression levels in the normal endometrium than in the tumour tissues. For the remaining TEMs, we found a higher expression in the cancer samples than in the normal endometria. Statistical significance of this difference was achieved for TEM-1, -2 and-7. No clear correlation was noted between the tumour stage and the level of TEM-1, -6 and -8 expression. Apart from TEM-6, the highest expression in FIGO I cancer stages was noted in the remaining TEMs. Our results showed that for most of these tumour endothelial markers, gene expression was slightly higher in the endometrial carcinoma tissue samples than in the endometrium of normal cycling women. However, with the possible exception of TEM-8 and -6, absolute expression levels were generally low, indicating that most TEMs may only be specifically expressed in a restricted number of cancer types (e.g., colorectal). Therefore, TEMs may not be useful in the context of endometrial cancer. PMID:22966283

  17. Prognostic value of tumour endothelial markers in patients with endometrial cancer.

    Science.gov (United States)

    Bersinger, Nick A; Schneider, Brigitte; Vorburger, Stephan A; Johann, Silke; Candinas, Daniel; Mueller, Michael D

    2010-01-01

    Endometrial cancer is one of the more frequent and most lethal gynaecological cancer types. Since it occurs more frequently in elderly and overweight patients, a pre-operative staging method would be beneficial. The growth of solid neoplasms is always accompanied by neovascularisation. Tumour endothelial markers (TEMs) are a group of recently described endothelial cell surface markers that appear to be specific to neoplastic tissue. This study aimed to investigate the potential usefulness of TEM assessment in the endometrium by comparing the transcriptional expression of TEMs in the normal endometrium with endometroid adenocarcinoma tissue. Tissues were lysed and the RNA was extracted, assessed and reverse transcribed in one batch. Real-time quantitative PCR was performed for TEM-1, -2, -6, -7, -7r and -8. GAPDH, β-actin and ribosomal protein L13A (RPL13A) were used as control genes. TEM-8 showed the highest expression level in all of the groups. TEM-1 showed higher expression levels in the normal endometrium than in the tumour tissues. For the remaining TEMs, we found a higher expression in the cancer samples than in the normal endometria. Statistical significance of this difference was achieved for TEM-1, -2 and-7. No clear correlation was noted between the tumour stage and the level of TEM-1, -6 and -8 expression. Apart from TEM-6, the highest expression in FIGO I cancer stages was noted in the remaining TEMs. Our results showed that for most of these tumour endothelial markers, gene expression was slightly higher in the endometrial carcinoma tissue samples than in the endometrium of normal cycling women. However, with the possible exception of TEM-8 and -6, absolute expression levels were generally low, indicating that most TEMs may only be specifically expressed in a restricted number of cancer types (e.g., colorectal). Therefore, TEMs may not be useful in the context of endometrial cancer.

  18. Detection of organ movement in cervix cancer patients using a fluoroscopic electronic portal imaging device and radiopaque markers

    International Nuclear Information System (INIS)

    Kaatee, Robert S.J.P.; Olofsen, Manouk J.J.; Verstraate, Marjolein B.J.; Quint, Sandra; Heijmen, Ben J.M.

    2002-01-01

    Purpose: To investigate the use of a fluoroscopic electronic portal imaging device (EPID) and radiopaque markers to detect internal cervix movement. Methods and Materials: For 10 patients with radiopaque markers clamped to the cervix, electronic portal images were made during external beam irradiation. Bony structures and markers in the portal images were registered with the same structures in the corresponding digitally reconstructed radiographs of the planning computed tomogram. Results: The visibility of the markers in the portal images was good, but their fixation should be improved. Generally, the correlation between bony structure displacements and marker movement was poor, the latter being substantially larger. The standard deviations describing the systematic and random bony anatomy displacements were 1.2 and 2.6 mm, 1.7 and 2.9 mm, and 1.6 and 2.7 mm in the lateral, cranial-caudal, and dorsal-ventral directions, respectively. For the marker movement those values were 3.4 and 3.4 mm, 4.3 and 5.2 mm, 3.2 and 5.2 mm, respectively. Estimated clinical target volume to planning target volume (CTV-PTV) planning margins (∼11 mm) based on the observed overall marker displacements (bony anatomy + internal cervix movement) are only marginally larger than the margins required to account for internal marker movement alone. Conclusions: With our current patient setup techniques and methods of setup verification and correction, the required CTV-PTV margins are almost fully determined by internal organ motion. Setup verification and correction using radiopaque markers might allow decreasing those margins, but technical improvements are needed

  19. Markers for nutrition studies: review of criteria for the evaluation of markers.

    Science.gov (United States)

    de Vries, Jan; Antoine, Jean-Michel; Burzykowski, Tomasz; Chiodini, Alessandro; Gibney, Mike; Kuhnle, Gunter; Méheust, Agnès; Pijls, Loek; Rowland, Ian

    2013-10-01

    Markers are important tools to assess the nutrition status and effects of nutrition interventions. There is currently insufficient consensus in nutrition sciences on how to evaluate markers, despite the need for properly evaluating them. To identify the criteria for the evaluation of markers related to nutrition, health and disease and to propose generic criteria for evaluation. The report on "Evaluation of Biomarker and Surrogate Endpoints in Chronic Disease" from the Institute of Medicine was the starting point for the literature search. Additionally, specific search strategies were developed for Pubmed. In nutrition, no set of criteria or systematic approach to evaluate markers is currently available. There is a reliance on the medical area where statistical methods have been developed to quantify the evaluation of markers. Even here, a systematic approach is lacking-markers are still evaluated on a case-by-case basis. The review of publications from the literature search resulted in a database with definitions, criteria for validity and the rationale behind the criteria. It was recognized that, in nutrition, a number of methodological aspects differ from medical research. The following criteria were identified as essential elements in the evaluation of markers: (1) the marker has a causal biological link with the endpoint, (2) there is a significant association between marker and endpoint in the target population, (3) marker changes consistently with the endpoint, e.g., in response to an intervention, and (4) change in the marker explains a substantial proportion of the change in the endpoint in response to the intervention.

  20. Intersection tests for single marker QTL analysis can be more powerful than two marker QTL analysis

    Directory of Open Access Journals (Sweden)

    Doerge RW

    2003-06-01

    Full Text Available Abstract Background It has been reported in the quantitative trait locus (QTL literature that when testing for QTL location and effect, the statistical power supporting methodologies based on two markers and their estimated genetic map is higher than for the genetic map independent methodologies known as single marker analyses. Close examination of these reports reveals that the two marker approaches are more powerful than single marker analyses only in certain cases. Simulation studies are a commonly used tool to determine the behavior of test statistics under known conditions. We conducted a simulation study to assess the general behavior of an intersection test and a two marker test under a variety of conditions. The study was designed to reveal whether two marker tests are always more powerful than intersection tests, or whether there are cases when an intersection test may outperform the two marker approach. We present a reanalysis of a data set from a QTL study of ovariole number in Drosophila melanogaster. Results Our simulation study results show that there are situations where the single marker intersection test equals or outperforms the two marker test. The intersection test and the two marker test identify overlapping regions in the reanalysis of the Drosophila melanogaster data. The region identified is consistent with a regression based interval mapping analysis. Conclusion We find that the intersection test is appropriate for analysis of QTL data. This approach has the advantage of simplicity and for certain situations supplies equivalent or more powerful results than a comparable two marker test.

  1. Molecular markers in the epidemiology and diagnosis of coccidioidomycosis.

    Science.gov (United States)

    Duarte-Escalante, Esperanza; Frías-De-León, María Guadalupe; Zúñiga, Gerardo; Martínez-Herrera, Erick; Acosta-Altamirano, Gustavo; Reyes-Montes, María Del Rocío

    2014-01-01

    The prevalence of coccidioidomycosis in endemic areas has been observed to increase daily. To understand the causes of the spread of the disease and design strategies for fungal detection in clinical and environmental samples, scientists have resorted to molecular tools that allow fungal detection in a natural environment, reliable identification in clinical cases and the study of biological characteristics, such as reproductive and genetic structure, demographic history and diversification. We conducted a review of the most important molecular markers in the epidemiology of Coccidioides spp. and the diagnosis of coccidioidomycosis. A literature search was performed for scientific publications concerning the application of molecular tools for the epidemiology and diagnosis of coccidioidomycosis. The use of molecular markers in the epidemiological study and diagnosis of coccidioidomycosis has allowed for the typing of Coccidioides spp. isolates, improved understanding of their mode of reproduction, genetic variation and speciation and resulted in the development specific, rapid and sensitive strategies for detecting the fungus in environmental and clinical samples. Molecular markers have revealed genetic variability in Coccidioides spp. This finding influences changes in the epidemiology of coccidioidomycosis, such as the emergence of more virulent or antifungal resistant genotypes. Furthermore, the molecular markers currently used to identify Coccidioides immitis and Coccidioides posadasii are specific and sensitive. However, they must be validated to determine their application in diagnosis. This manuscript is part of the series of works presented at the "V International Workshop: Molecular genetic approaches to the study of human pathogenic fungi" (Oaxaca, Mexico, 2012). Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  2. Checking the Course of Colorectal Carcinoma Follow up Using Mathematical Classification of Tumor Marker Profiles

    Czech Academy of Sciences Publication Activity Database

    Holubec jr., L.; Botterlich, N.; Topolčan, O.; Finek, J.; Pikner, R.; Pecen, Ladislav; Holubec, L.

    2002-01-01

    Roč. 23, Suppl.1 (2002), s. 57 ISSN 1010-4283. [Meeting of the International Society for Oncodevelopmental Biology and Medicine /30./. 08.09.2002-12.09.2002, Boston] R&D Projects: GA MŠk ME 438 Institutional research plan: AV0Z1030915 Keywords : tumor markers * colorectal CA * mathematical classification Subject RIV: BA - General Mathematics

  3. Evaluation of the CRACTES and BIANTA Programs for the Result Interpretation of Tumor Marker Assessment

    Czech Academy of Sciences Publication Activity Database

    Pecen, Ladislav; Topolčan, O.; Nekulová, M.; Šimíčková, M.; Kaušitz, J.; Eben, Kryštof; Vondráček, Jiří; Pikner, R.; Holubec, L.

    2000-01-01

    Roč. 15, č. 1 (2000), s. 57-58 ISSN 0886-3849. [International Conference on Human Tumor Markers /17./. 23.03.2000-24.03.2000, Hong Kong] Grant - others:IGA MZ ČR(CZ) NC4780; IGA MZ ČR(CZ) NC4746 Institutional research plan: AV0Z1030915

  4. The use of n-alkane markers to estimate the intake and apparent ...

    African Journals Online (AJOL)

    However, the effect of the higher recovery of the dosed marker needs further investigation. The estimates of apparent dry matter digestibility corresponded well with measured values, provided the factor for the incomplete faecal recovery of the internal alkanes was included in the calculation. It was concluded that the alkane ...

  5. International cooperation

    International Nuclear Information System (INIS)

    2008-01-01

    In this chapter international cooperation of the Division for Radiation Safety, NPP Decommissioning and Radwaste Management of the VUJE, a. s. is presented. Very important is cooperation with the International Atomic Energy Agency. This cooperation has various forms - national and regional projects of technical cooperation, coordinated research activities, participation of our experts in preparation of the IAEA documentation etc.

  6. International indsats

    DEFF Research Database (Denmark)

    Sachs, Therese

    En analyse af Beredskabsstyrelsens internationale engagement og muligheder for international indsats fremover. Forslag til struktur logistisk og materielt samt til udvikling af personel-kompetencer......En analyse af Beredskabsstyrelsens internationale engagement og muligheder for international indsats fremover. Forslag til struktur logistisk og materielt samt til udvikling af personel-kompetencer...

  7. International Curriculums.

    Science.gov (United States)

    Neal, Larry L.

    This workshop presentation on international curriculums in the field of parks, recreation, leisure, cultural services, and travel/tourism comments that the literature is replete with articles addressing what the field is about, but not about curriculum issues, models, and structure. It reports an international survey of 12 college educators…

  8. International Illiquidity

    DEFF Research Database (Denmark)

    Malkhozov, Aytek; Mueller, Philippe; Vedolin, Andrea

    -predicted effect of funding conditions on asset prices internationally. Global illiquidity lowers the slope and increases the intercept of the international security market line. Local illiquidity helps explain the variation in alphas, Sharpe ratios, and the performance of betting-against-beta (BAB) strategies...

  9. International relations

    International Nuclear Information System (INIS)

    Anon.

    2008-01-01

    Concerning international relations, the different meetings in the field of nuclear safety are reported (Western european nuclear regulator association or Wenra, Nea, IAEA, northern dimension environmental partnership or N.D.E.P., nuclear safety and security group or N.S.S.G., international nuclear regulators association or I.N.R.A.). (N.C.)

  10. MOLECULAR MARKERS FOR METASTATIC PROSTATE ADENOCARCINOMA

    Directory of Open Access Journals (Sweden)

    I. S. Kunin

    2012-01-01

    Full Text Available The search of molecular markers of metastasing and prognosis in prostate cancer remains an urgent task. In this study, we investigated the relationship of gene expression heparanase-1 (HPSE1 and D-glucuronil C5-epimerase (GLCE with early disease relapse and metastasis of a 2,5−3 years after diagnosis. It was shown that the ratio of the expression levels of genes HPSE1/GLCE > 1 may serve as a prognostic relapse marker and trends of the tumour to metastasis. The data obtained suggest to use this option as a molecular marker for the diagnostics of metastatic process and the disease prognosis.

  11. Immunocytochemistry of the olfactory marker protein.

    Science.gov (United States)

    Monti-Graziadei, G A; Margolis, F L; Harding, J W; Graziadei, P P

    1977-12-01

    The olfactory marker protein has been localized, by means of immunohistochemical techniques in the primary olfactory neurons of mice. The olfactory marker protein is not present in the staminal cells of the olfactory neuroepithelium, and the protein may be regarded as indicative of the functional stage of the neurons. Our data indicate that the olfactory marker protein is present in the synaptic terminals of the olfactory neurons at the level of the olfactory bulb glomeruli. The postsynaptic profiles of both mitral and periglomerular cells are negative.

  12. Stemness-related markers in cancer

    Directory of Open Access Journals (Sweden)

    Wenxiu Zhao

    2017-01-01

    Full Text Available Cancer stem cells (CSCs, with their self-renewal ability and multilineage differentiation potential, are a critical subpopulation of tumor cells that can drive tumor initiation, growth, and resistance to therapy. Like embryonic and adult stem cells, CSCs express markers that are not expressed in normal somatic cells and are thus thought to contribute toward a “stemness” phenotype. This review summarizes the current knowledge of stemness-related markers in human cancers, with a particular focus on important transcription factors, protein surface markers, and signaling pathways.

  13. International Specialization

    DEFF Research Database (Denmark)

    Kleindienst, Ingo; Geisler Asmussen, Christian; Hutzschenreuter, Thomas

    2012-01-01

    Whether and how international diversification and cross-border arbitrage affects firm performance remains one of the major unresolved research questions in the strategy and international business literatures. We propose that knowing how much a firm has internationally diversified tells us very...... little about performance implications, if we do not know, and do not ask, how the firm has diversified. Therefore, building on the two broad arguments of operating flexibility and location-specific commitment, we develop a theoretical framework that focuses on the extent to which a firm's international...... arbitrage strategy is characterized by specialization versus replication and argue that these different strategies may have differential impact on profitability and risk reduction. Developing a sophisticated measure of international specialization and using a unique panel data set of 92 German MNEs to test...

  14. Dehalogenimonas lykanthroporepellens BL-DC-9T simultaneously transcribes many rdhA genes during organohalide respiration with 1,2-DCA, 1,2-DCP, and 1,2,3-TCP as electron acceptors.

    Science.gov (United States)

    Mukherjee, Kalpataru; Bowman, Kimberly S; Rainey, Fred A; Siddaramappa, Shivakumara; Challacombe, Jean F; Moe, William M

    2014-05-01

    The genome sequence of the organohalide-respiring bacterium Dehalogenimonas lykanthroporepellensBL-DC-9(T) contains numerous loci annotated as reductive dehalogenase homologous (rdh) genes based on inferred protein sequence identity with functional dehalogenases of other bacterial species. Many of these genes are truncated, lack adjacent regulatory elements, or lack cognate genes coding for membrane-anchoring proteins typical of the functionally characterized active reductive dehalogenases of organohalide-respiring bacteria. To investigate the expression patterns of the rdh genes in D. lykanthroporepellensBL-DC-9(T), oligonucleotide primers were designed to uniquely target 25 rdh genes present in the genome as well as four putative regulatory genes. RNA extracts from cultures of strain BL-DC-9(T) actively dechlorinating three different electron acceptors, 1,2-dichloroethane, 1,2-dichloropropane, and 1,2,3-trichloropropane were reverse-transcribed and subjected to PCR amplification using rdh-specific primers. Nineteen rdh gene transcripts, including 13 full-length rdhA genes, six truncated rdhA genes, and five rdhA genes having cognate rdhB genes were consistently detected during the dechlorination of all three of the polychlorinated alkanes tested. Transcripts from all four of the putative regulatory genes were also consistently detected. Results reported here expand the diversity of bacteria known to simultaneously transcribe multiple rdh genes and provide insights into the transcription factors associated with rdh gene expression. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  15. Genomic markers for decision making: what is preventing us from using markers?

    Science.gov (United States)

    Coyle, Vicky M; Johnston, Patrick G

    2010-02-01

    The advent of novel genomic technologies that enable the evaluation of genomic alterations on a genome-wide scale has significantly altered the field of genomic marker research in solid tumors. Researchers have moved away from the traditional model of identifying a particular genomic alteration and evaluating the association between this finding and a clinical outcome measure to a new approach involving the identification and measurement of multiple genomic markers simultaneously within clinical studies. This in turn has presented additional challenges in considering the use of genomic markers in oncology, such as clinical study design, reproducibility and interpretation and reporting of results. This Review will explore these challenges, focusing on microarray-based gene-expression profiling, and highlights some common failings in study design that have impacted on the use of putative genomic markers in the clinic. Despite these rapid technological advances there is still a paucity of genomic markers in routine clinical use at present. A rational and focused approach to the evaluation and validation of genomic markers is needed, whereby analytically validated markers are investigated in clinical studies that are adequately powered and have pre-defined patient populations and study endpoints. Furthermore, novel adaptive clinical trial designs, incorporating putative genomic markers into prospective clinical trials, will enable the evaluation of these markers in a rigorous and timely fashion. Such approaches have the potential to facilitate the implementation of such markers into routine clinical practice and consequently enable the rational and tailored use of cancer therapies for individual patients.

  16. Tumor markers: applications and recommendations. New IZOTOPE products

    International Nuclear Information System (INIS)

    Gyenes, Ana Rosa

    2016-01-01

    At work aspects are discussed: Tumor markers; New products IZOTOP; Measuring principle of IRMA kits for tumor markers; Guidelines and Recommendations for the use of tumor markers. pre-analytical, post-analytical and Quality control recommendations are given

  17. Ten polymorphic microsatellite markers characterized for ...

    Indian Academy of Sciences (India)

    MING MING BAO

    development of new microsatellite primers is expensive and time-consuming, whereas ... constructing microsatellite-enriched libraries (Guo et al. 2013). Thirteen markers .... Due to the influence of human activities, stocks of this species have ...

  18. Diagnostic markers for germ cell neoplasms

    DEFF Research Database (Denmark)

    Rajpert-De Meyts, Ewa; Nielsen, John E; Skakkebaek, Niels E

    2015-01-01

    This concise review summarises tissue and serum markers useful for differential diagnosis of germ cell tumours (GCTs), with focus on the most common testicular GCTs (TGCTs). GCTs are characterised by phenotypic heterogeneity due to largely retained embryonic pluripotency and aberrant somatic diff...... of molecular markers, which allow specific diagnosis of various subtypes of GCT and are very useful for early detection at the precursor stage and for monitoring of patients during the follow-up....

  19. International Health

    Science.gov (United States)

    ... create refugee populations with immediate and long-term health problems. Some of the major diseases currently affecting ... also an international problem which can affect people's health. Many countries and health organizations are working together ...

  20. Juris International

    CERN Document Server

    A database on international trade law aimed at lawyers and legal counsel in developing and transition economies. Juris International is a multilingual collection (English, Spanish, and French) of legal information on international trade. Juris International aims to facilitate and reduce the work involved in research for business lawyers, advisers and in-house counsel, and state organizations in developing nd transition economies, by providing access to texts which have often been difficult to obtain. Its objective is to gather a large quantity of basic information at one site (favoring complete legal texts), without the need to send for the information, and consequently without excessive communication costs for users who d benefit from an efficient and cheap telecommunications network.

  1. Regulating Internalities

    OpenAIRE

    Sunstein, Cass Robert; Allcott, Hunt

    2015-01-01

    This paper offers a framework for regulating internalities. Using a simple economic model, we provide four principles for designing and evaluating behaviorally-motivated policy. We then outline rules for determining which contexts reliably reflect true preferences and discuss empirical strategies for measuring internalities. As a case study, we focus on energy efficiency policy, including Corporate Average Fuel Economy (CAFE) standards and appliance and lighting energy efficiency standards.

  2. Effectiveness of Vascular Markers (Immunohistochemical Stains) in Soft Tissue Sarcomas.

    Science.gov (United States)

    Naeem, Namra; Mushtaq, Sajid; Akhter, Noreen; Hussain, Mudassar; Hassan, Usman

    2018-05-01

    To ascertain the effectiveness of IHC markers of vascular origin like CD31, CD34, FLI1 and ERG in vascular soft tissue sarcomas including angiosarcomas, Kaposi sarcomas, epithelioid hemangioendothelioma and a non-vascular soft tissue sarcoma (Epithelioid sarcoma). Descriptive study. Shaukat Khanum Memorial Cancer Hospital and Research Centre, Lahore, from 2011 to 2017. Diagnosed cases of angiosarcomas (n=48), epithelioid hemangioendothelioma (n=9), Kaposi sarcoma (n=9) and epithelioid sarcoma (n=20) were selected. Immunohistochemical staining as performed on formalin fixed paraffin embedded sections. The sections were stained for the following markers: CD34 (VENTANA clone Q Bend 10), CD31 (Leica clone 1 A 10), FLI1 (CELL MARQUE clone MRQ-1) and ERG (CELL MARQUE clone EP111). A complete panel of CD34, CD31 and ERG was applied on 8/48 cases of angiosarcomas with triple positivity in 6 cases. Eight cases showed positivity for only CD31 and ERG and 2 cases showed positivity for only ERG. A complete panel of CD34, CD31 and ERG was applied on 3/9 cases of epithelioid hemangioendothelioma with positivity for all markers in 2 cases. Combined positivity for ERG and CD34 was seen in 2 cases and on 4 cases only CD31 immunohistochemical was solely applied with 100% positivity. FLI1 was not applied on any case. Among 9 cases of Kaposi sarcoma, ERG, CD34 and CD31 in combination were applied on only 1 case with triple positivity. Remaining cases show positivity for either CD34, CD31 or FLI1. Majority of cases of epithelioid sarcomas were diagnosed on the basis of cytokeratin and CD34 positivity with loss of INI1. The other vascular markers showed negativity in all cases. Among these four markers, ERG immunohistochemical stain is highly effective for endothelial differentiation due to its specific nuclear staining pattern in normal blood vessel endothelial cells (internal control) as well as neoplastic cells of vascular tumors and lack of background staining.

  3. Enzyme markers in inbred rat strains: genetics of new markers and strain profiles.

    Science.gov (United States)

    Adams, M; Baverstock, P R; Watts, C H; Gutman, G A

    1984-08-01

    Twenty-six inbred strains of the laboratory rat (Rattus norvegicus) were examined for electrophoretic variation at an estimated 97 genetic loci. In addition to previously documented markers, variation was observed for the enzymes aconitase, aldehyde dehydrogenase, and alkaline phosphatase. The genetic basis of these markers (Acon-1, Ahd-2, and Akp-1) was confirmed. Linkage analysis between 35 pairwise comparisons revealed that the markers Fh-1 and Pep-3 are linked. The strain profiles of the 25 inbred strains at 11 electrophoretic markers are given.

  4. Marker-controlled watershed for lymphoma segmentation in sequential CT images

    International Nuclear Information System (INIS)

    Yan Jiayong; Zhao Binsheng; Wang, Liang; Zelenetz, Andrew; Schwartz, Lawrence H.

    2006-01-01

    Segmentation of lymphoma containing lymph nodes is a difficult task because of multiple variables associated with the tumor's location, intensity distribution, and contrast to its surrounding tissues. In this paper, we present a reliable and practical marker-controlled watershed algorithm for semi-automated segmentation of lymphoma in sequential CT images. Robust determination of internal and external markers is the key to successful use of the marker-controlled watershed transform in the segmentation of lymphoma and is the focus of this work. The external marker in our algorithm is the circle enclosing the lymphoma in a single slice. The internal marker, however, is determined automatically by combining techniques including Canny edge detection, thresholding, morphological operation, and distance map estimation. To obtain tumor volume, the segmented lymphoma in the current slice needs to be propagated to the adjacent slice to help determine the external and internal markers for delineation of the lymphoma in that slice. The algorithm was applied to 29 lymphomas (size range, 9-53 mm in diameter; mean, 23 mm) in nine patients. A blinded radiologist manually delineated all lymphomas on all slices. The manual result served as the ''gold standard'' for comparison. Several quantitative methods were applied to objectively evaluate the performance of the segmentation algorithm. The algorithm received a mean overlap, overestimation, and underestimation ratios of 83.2%, 13.5%, and 5.5%, respectively. The mean average boundary distance and Hausdorff boundary distance were 0.7 and 3.7 mm. Preliminary results have shown the potential of this computer algorithm to allow reliable segmentation and quantification of lymphomas on sequential CT images

  5. Marker-assisted selection in forestry species

    International Nuclear Information System (INIS)

    Butcher, P.; Southerton, S.

    2007-01-01

    The primary goal of tree breeding is to increase the quantity and quality of wood products from plantations. Major gains have been achieved using recurrent selection in genetically diverse breeding populations to capture additive variation. However, the long generation times of trees, together with poor juvenile-mature trait correlations, have promoted interest in marker-assisted selection (MAS) to accelerate breeding through early selection. MAS relies on identifying DNA markers, which explain a high proportion of variation in phenotypic traits. Genetic linkage maps have been developed for most commercial tree species and these can be used to locate chromosomal regions where DNA markers co-segregate with quantitative traits (quantitative trait loci, QTL). MAS based on QTL is most likely to be used for within-family selection in a limited number of elite families that can be clonally propagated. Limitations of the approach include the low resolution of marker-trait associations, the small proportion of phenotypic variation explained by QTL and the low success rate in validating QTL in different genetic backgrounds and environments. This has led to a change in research focus towards association mapping to identify variation in the DNA sequence of genes directly controlling phenotypic variation (gene-assisted selection, GAS). The main advantages of GAS are the high resolution of marker-trait associations and the ability to transfer markers across families and even species. Association studies are being used to examine the adaptive significance of variation in genes controlling wood formation and quality, pathogen resistance, cold tolerance and drought tolerance. Single nucleotide polymorphisms (SNPs) in these gene sequences that are significantly associated with trait variation can then be used for early selection. Markers for SNPs can be transferred among individuals regardless of pedigree or family relationship, increasing opportunities for their application in

  6. A protein-based set of reference markers for liver tissues and hepatocellular carcinoma

    International Nuclear Information System (INIS)

    Sun, Stella; Yi, Xin; Poon, Ronnie TP; Yeung, Chun; Day, Philip JR; Luk, John M

    2009-01-01

    During the last decade, investigations have focused on revealing genes or proteins that are involved in HCC carcinogenesis using either genetic or proteomic techniques. However, these studies are overshadowed by a lack of good internal reference standards. The need to identify 'housekeeping' markers, whose expression is stable in various experimental and clinical conditions, is therefore of the utmost clinical relevance in quantitative studies. This is the first study employed 2-DE analysis to screen for potential reference markers and aims to correlate the abundance of these proteins with their level of transcript expression. A Chinese cohort of 224 liver tissues samples (105 cancerous, 103 non-tumourous cirrhotic, and 16 normal) was profiled using 2-DE analysis. Expression of the potential reference markers was confirmed by western blot, immunohistochemistry and real-time quantitative PCR. geNorm algorithm was employed for gene stability measure of the identified reference markers. The expression levels of three protein markers beta-actin (ACTB), heat shock protein 60 (HSP60), and protein disulphide isomerase (PDI) were found to be stable using p-values (p > 0.99) as a ranking tool in all 224 human liver tissues examined by 2-DE analysis. Of high importance, ACTB and HSP 60 were successfully validated at both protein and mRNA levels in human hepatic tissues by western blot, immunohistochemistry and real-time quantitative PCR. In addition, no significant correlation of these markers with any clinicopathological features of HCC and cirrhosis was found. Gene stability measure of these two markers with other conventionally applied housekeeping genes was assessed by the geNorm algorithm, which ranked ACTB and HSP60 as the most stable genes among this cohort of clinical samples. Our findings identified 2 reference markers that exhibited stable expression across human liver tissues with different conditions thus should be regarded as reliable reference

  7. International Criminalization of International Terrorizm

    Directory of Open Access Journals (Sweden)

    Alexander Grigoryevich Volevodz

    2014-01-01

    Full Text Available Analysis and studying of the terrorism in all its facets is a complex entangled problem with less clear legal regulation that it might seem at first glance, especially after its transformation from local phenomenon into a world threat. Hitherto terrorism and actions connected to it have been criminalized by the majority of states. There are in modern criminal law whole systems of rules on criminal liability for terrorism which differs considerably from country to country. Terrorism has been criminalized in numerous international regional and universal antiterrorist legal instruments. The author notes that differences in definitions that are enshrined in them hinders international cooperation in criminal matters with respect to terrorist cases. Difficulties reside in the necessity to meet the dual criminality requirement and in the political offense exception. These difficulties can only be overcome through elaboration of a universally recognized definition of the notion of international terrorism and making it legally binding via its inclusion into a universal convention. The issue of definition of international terrorism is an important part of an efficient mutual assistance among states in fight against this crime. In this article the author accounts of actual ways of tackling by the international community of the issue of criminalization of international terrorism and of factors influencing them.

  8. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

    2000-01-01

    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  9. Invisible marker based augmented reality system

    Science.gov (United States)

    Park, Hanhoon; Park, Jong-Il

    2005-07-01

    Augmented reality (AR) has recently gained significant attention. The previous AR techniques usually need a fiducial marker with known geometry or objects of which the structure can be easily estimated such as cube. Placing a marker in the workspace of the user can be intrusive. To overcome this limitation, we present an AR system using invisible markers which are created/drawn with an infrared (IR) fluorescent pen. Two cameras are used: an IR camera and a visible camera, which are positioned in each side of a cold mirror so that their optical centers coincide with each other. We track the invisible markers using IR camera and visualize AR in the view of visible camera. Additional algorithms are employed for the system to have a reliable performance in the cluttered background. Experimental results are given to demonstrate the viability of the proposed system. As an application of the proposed system, the invisible marker can act as a Vision-Based Identity and Geometry (VBIG) tag, which can significantly extend the functionality of RFID. The invisible tag is the same as RFID in that it is not perceivable while more powerful in that the tag information can be presented to the user by direct projection using a mobile projector or by visualizing AR on the screen of mobile PDA.

  10. Prognostic molecular markers in early breast cancer

    International Nuclear Information System (INIS)

    Esteva, Francisco J; Hortobagyi, Gabriel N

    2004-01-01

    A multitude of molecules involved in breast cancer biology have been studied as potential prognostic markers. In the present review we discuss the role of established molecular markers, as well as potential applications of emerging new technologies. Those molecules used routinely to make treatment decisions in patients with early-stage breast cancer include markers of proliferation (e.g. Ki-67), hormone receptors, and the human epidermal growth factor receptor 2. Tumor markers shown to have prognostic value but not used routinely include cyclin D 1 and cyclin E, urokinase-like plasminogen activator/plasminogen activator inhibitor, and cathepsin D. The level of evidence for other molecular markers is lower, in part because most studies were retrospective and not adequately powered, making their findings unsuitable for choosing treatments for individual patients. Gene microarrays have been successfuly used to classify breast cancers into subtypes with specific gene expression profiles and to evaluate prognosis. RT-PCR has also been used to evaluate expression of multiple genes in archival tissue. Proteomics technologies are in development

  11. Molecular markers. Amplified fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Pržulj Novo

    2005-01-01

    Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

  12. International Relations:

    DEFF Research Database (Denmark)

    This is the textbook for the Open University module International Relations: Continuity and Change in Global Politics. Instead of leading with a succession of theoretical 'isms', the module structures its presentation of the subject around six teaching ‘blocks’, each of which explores a dilemma...... • Block 6: Continuity or change in global politics? Each block introduces new IR theories through discussions of the substantive dilemmas and adds in a layered way levels of analysis and conceptual complexity......., or dimension of variation. The dilemmas in question were chosen for the way they capture key themes in the field of International Studies (IR) as well as central aspects of the ‘international’ itself (ir). The six Blocks are: • Block 1: Co-operation or conflict? Introducing international relations • Block 2...

  13. International cooperation

    International Nuclear Information System (INIS)

    Prieto, F.E.

    1984-01-01

    It looks doubtless that the need for an international cooperation to solve the worldwide energy problems is already a concern of individuals, institutions, and governments. This is an improvement. But there is something lacking. The author refers to the Atoms for Peace speech, the origin of the IAEA and of the subsequent spreading of the nuclear option. He also refers back to the call made by the Mexican government for a worldwide energy cooperation. He stresses the need for governments to cooperate, so that this international cooperation on energy can be put into operation for the benefit of mankind

  14. International collaboration

    International Nuclear Information System (INIS)

    Anon.

    1994-01-01

    In the wake of the demise of the US Superconducting Supercollider (SSC) project last year which empoverished both US and world science, some rapid scene shifting is going on. The SSC may be dead, but the underlying physics quest lives on. In the US, the 'future vision' subpanel of the High Energy Physics Advisory Board (HEPAP) is at work formulating its recommendations. On the international front, the International Committee for Future Accelerators (ICFA) at a special meeting in Vancouver in January drafted a statement

  15. Incorporation of conventional genetic markers and RAPD markers into an RFLP based map in maize

    International Nuclear Information System (INIS)

    Coe, E.H. Jr.; McMullen, M.D.; Polacco, M.; Davis, G.L.; Chao, S.

    1998-01-01

    Integration of classical genetic markers, in particular mutants, onto the maize Restriction Fragment Length Polymorphism (RFLP) map will provide the tools necessary to further our understanding of plant development and of complex traits. Initially integration was accomplished by visual alignment of common markers and sometimes involved the use of information from several different molecular maps to determine the relative placement of a single mutant. The maize core marker set was designed to provide a common set of markers which could be used for integration of map data. We have completed the mapping, of 56 mutants on chromosome one relative to the core marker set. Phenotypes included whole plant, seedling, and kernel effects and represented a variety of biological processes. Since these mutants were previously located to chromosome arm, mapping required the use of only seven markers per mutant to define the correct bin location. Two mistakes in marker order relative to the classical map were identified, as well as, six groups of mutants which require allelism testing. Placement of mutants and cDNAs into bins using, the core markers provides a necessary resource for identification of gene function in maize. (author)

  16. Rice genetic marker database: An identification of single nucleotide ...

    African Journals Online (AJOL)

    based genetic marker system to provide information about SNP and QTL markers in rice. The SNP marker database provides 7,227 SNP markers including location information on chromosomes by using genetic map. It allows users to access a ...

  17. Quantifying the Value of Markers in Screening Programmes

    DEFF Research Database (Denmark)

    Østergaard, Søren Dinesen; Dinesen, Peter Thisted; Foldager, Leslie

    2010-01-01

    Existing methods used to rank the value of individual screening markers in screening programmes are inadequate. We have developed a simple Screening Marker Index: (Screening Marker Index = Positive Predictive Value x Sensitivity). The Screening Marker Index proved to be superior to existing indices...

  18. Molecular markers linked to apomixis in Panicum maximum Jacq.

    African Journals Online (AJOL)

    SAM

    2014-05-28

    May 28, 2014 ... The objective of this work was to identify molecular markers linked to apomixis in ... Four RAPD markers linked to apomixis were identified and mapped in this .... Data analysis. The amplification of the potential markers was analyzed as binary, with 1 for presence and 0 for absence of the marker. The binary.

  19. SYTO probes: markers of apoptotic cell demise.

    Science.gov (United States)

    Wlodkowic, Donald; Skommer, Joanna

    2007-10-01

    As mechanistic studies on tumor cell death advance towards their ultimate translational goal, there is a need for specific, rapid, and high-throughput analytical tools to detect diverse cell demise modes. Patented DNA-binding SYTO probes, for example, are gaining increasing interest as easy-to-use markers of caspase-dependent apoptotic cell death. They are proving convenient for tracking apoptosis in diverse hematopoietic cell lines and primary tumor samples, and, due to their spectral characteristics, appear to be useful for the development of multiparameter flow cytometry assays. Herein, several protocols for multiparametric assessment of apoptotic events using SYTO probes are provided. There are protocols describing the use of green fluorescent SYTO 16 and red fluorescent SYTO 17 dyes in combination with plasma membrane permeability markers. Another protocol highlights the multiparametric use of SYTO 16 dye in conjunction with the mitochondrial membrane potential sensitive probe, tetramethylrhodamine methyl ester (TMRM), and the plasma membrane permeability marker, 7-aminoactinomycin D (7-AAD).

  20. The Alcohol Dehydrogenase Isoenzyme as a Potential Marker of Pancreatitis.

    Science.gov (United States)

    Jelski, Wojciech; Piechota, Joanna; Orywal, Karolina; Szmitkowski, Maciej

    2018-05-01

    Human pancreas parenchyma contains various alcohol dehydrogenase (ADH) isoenzymes and also possesses aldehyde dehydrogenase (ALDH) activity. The altered activities of ADH and ALDH in damaged pancreatic tissue in the course of pancreatitis are reflected in the human serum. The aim of this study was to investigate a potential role of ADH and ALDH as markers for acute (AP) and chronic pancreatitis (CP). Serum samples were collected for routine biochemical investigations from 75 patients suffering from acute pancreatitis and 70 patients with chronic pancreatitis. Fluorometric methods were used to measure the activity of class I and II ADH and ALDH activity. The total ADH activity and activity of class III and IV isoenzymes were measured by a photometric method. There was a significant increase in the activity of ADH III isoenzyme (15.06 mU/l and 14.62 mU/l vs. 11.82 mU/l; ppancreatitis or chronic pancreatitis compared to the control. The diagnostic sensitivity for ADH III was about 84%, specificity was 92 %, positive and negative predictive values were 93% and 87% respectively in acute pancreatitis. Area under the Receiver Operating Curve (ROC) curve for ADH III in AP and CP was 0.88 and 0.86 respectively. ADH III has a potential role as a marker of acute and chronic pancreatitis. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  1. Trends in plant research using molecular markers.

    Science.gov (United States)

    Garrido-Cardenas, Jose Antonio; Mesa-Valle, Concepción; Manzano-Agugliaro, Francisco

    2018-03-01

    A deep bibliometric analysis has been carried out, obtaining valuable parameters that facilitate the understanding around the research in plant using molecular markers. The evolution of the improvement in the field of agronomy is fundamental for its adaptation to the new exigencies that the current world context raises. In addition, within these improvements, this article focuses on those related to the biotechnology sector. More specifically, the use of DNA markers that allow the researcher to know the set of genes associated with a particular quantitative trait or QTL. The use of molecular markers is widely extended, including: restriction fragment length polymorphism, random-amplified polymorphic DNA, amplified fragment length polymorphism, microsatellites, and single-nucleotide polymorphisms. In addition to classical methodology, new approaches based on the next generation sequencing are proving to be fundamental. In this article, a historical review of the molecular markers traditionally used in plants, since its birth and how the new molecular tools facilitate the work of plant breeders is carried out. The evolution of the most studied cultures from the point of view of molecular markers is also reviewed and other parameters whose prior knowledge can facilitate the approach of researchers to this field of research are analyzed. The bibliometric analysis of molecular markers in plants shows that top five countries in this research are: US, China, India, France, and Germany, and from 2013, this research is led by China. On the other hand, the basic research using Arabidopsis is deeper in France and Germany, while other countries focused its efforts in their main crops as the US for wheat or maize, while China and India for wheat and rice.

  2. Transparency International

    NARCIS (Netherlands)

    Hulten, van M. (Michel)

    2009-01-01

    Established in 1993, Transparency International (TI) defines itself as “the global civil society organization leading the fight against corruption, that brings people together in a powerful worldwide coalition to end the devastating impact of corruption on men, women and children around the

  3. International Entomology

    Science.gov (United States)

    Pests and diseases of plants in agriculture are a shared international problem. Yet some of the very places that pest invaders come from often lack the institutional structure and organization necessary to help in understanding the biology of the pest or disease. Strengthening entomology by stimulat...

  4. International safeguards

    International Nuclear Information System (INIS)

    Sanders, B.; Ha Vinh Phuong

    1976-01-01

    Since the start of the post-war era, international safeguards were considered essential to ensure that nuclear materials should not be diverted to unauthorised uses. In parallel, it was proposed to set up an international atomic energy agency within the United Nations through which international cooperation in nuclear matters would be channelled and controlled. Created in 1957, the IAEA was authorized to administer safeguards in connection with any assistance it provided as well as at the request of Member State and of any party to bilateral or multilateral arrangements in its ambit. Today, there are two international treaties requiring that its parties should accept Agency safeguards unilaterally, the Latin America Tlatelolco Treaty of 1967, and the Treaty on the Non-Proliferation of Nuclear Weapons (NPT), operative since 1970, which requires in particular that non-nuclear weapon states should accept Agency safeguards on its peaceful nuclear activities. Thus while NPT covers peaceful nuclear activities indiscriminately in a country, the Agency's original safeguards system is applied according to specific agreements and to given facilities. A basic conflict has now emerged between commercial interests and the increasing wish that transfer of nuclear equipment and know-how should not result in proliferation of military nuclear capacity; however, serious efforts are currently in progress to ensure universal application of IAEA safeguards and to develop them in step with the uses of nuclear energy. (N.E.A.) [fr

  5. Development and Characterization of Simple Sequence Repeat (SSR) Markers Based on RNA-Sequencing of Medicago sativa and In silico Mapping onto the M. truncatula Genome

    Science.gov (United States)

    Wang, Zan; Yu, Guohui; Shi, Binbin; Wang, Xuemin; Qiang, Haiping; Gao, Hongwen

    2014-01-01

    Sufficient codominant genetic markers are needed for various genetic investigations in alfalfa since the species is an outcrossing autotetraploid. With the newly developed next generation sequencing technology, a large amount of transcribed sequences of alfalfa have been generated and are available for identifying SSR markers by data mining. A total of 54,278 alfalfa non-redundant unigenes were assembled through the Illumina HiSeqTM 2000 sequencing technology. Based on 3,903 unigene sequences, 4,493 SSRs were identified. Tri-nucleotide repeats (56.71%) were the most abundant motif class while AG/CT (21.7%), AGG/CCT (19.8%), AAC/GTT (10.3%), ATC/ATG (8.8%), and ACC/GGT (6.3%) were the subsequent top five nucleotide repeat motifs. Eight hundred and thirty- seven EST-SSR primer pairs were successfully designed. Of these, 527 (63%) primer pairs yielded clear and scored PCR products and 372 (70.6%) exhibited polymorphisms. High transferability was observed for ssp falcata at 99.2% (523) and 71.7% (378) in M. truncatula. In addition, 313 of 527 SSR marker sequences were in silico mapped onto the eight M. truncatula chromosomes. Thirty-six polymorphic SSR primer pairs were used in the genetic relatedness analysis of 30 Chinese alfalfa cultivated accessions generating a total of 199 scored alleles. The mean observed heterozygosity and polymorphic information content were 0.767 and 0.635, respectively. The codominant markers not only enriched the current resources of molecular markers in alfalfa, but also would facilitate targeted investigations in marker-trait association, QTL mapping, and genetic diversity analysis in alfalfa. PMID:24642969

  6. Evaluation of radiolabelled microspheres as digesta markers

    International Nuclear Information System (INIS)

    Young, B.A.; Turner, B.V.; Dixon, A.E.; Exley, D.M.; Young, S.B.; Abidin, Z.

    1991-01-01

    The suitability of microspheres as markers for measuring digesta kinetics in sheep was examined. Microspheres offer advantages of uniformity of size and density, and stability during passage through the gastrointestinal tract. They are commercially available labelled with the choice of one of eleven different radionuclides and can be easily measured in digesta and faecal material. Tests comparing several types of digesta markers gave different measures of kinetic parameters when the measurements were made concurrently in the same sheep. However, concurrent measurements derived from use of microspheres were consistent. Microspheres offer a new alternative for digestive studies. (author). 19 refs, 4 tabs

  7. Connection between markers of cholestasis and intensity of oxidative modification of proteins in patients with choledocholithiasis

    Directory of Open Access Journals (Sweden)

    Zoran Damnjanović

    2014-03-01

    Full Text Available The aim of this study was to examine the connection between cholestatic markers and the oxidative protein modification intensity in patients with choledocholithiasis. All the participants were subjected to clinical, laboratory and ultrasonic check-up at the Internal Department of the Military Hospital in Niš, Serbia. The parameters of oxidative stress: carbonyl groups, a measure of oxidative protein modification, and biochemical markers of cholestasis were determined by standard biochemical methods. The concentration of total (r=0.41, p<0.05, direct (r=0.49, p<+0.01 and indirect (r=0.41, p<0.05 bilirubin was in statistically significant positive linear correlation with the intensity of oxidative modification of proteins, while the other biochemical markers of cholestasis did not show such correlation. Total, direct and indirect bilirubins showed a significant positive correlation with oxidative protein modification, assessed through the levels of carbonyl groups in patients with choledocholithiasis.

  8. Development of RIA kits for tumor-markers monitoring

    International Nuclear Information System (INIS)

    Suprarop, P.

    1997-01-01

    All reagents for tumor markers assays are imported from various manufacturers mainly CIS bio international. The average cost of these reagents is ranged from 80-150 bath/test (2-4 dollars test). The screening test for cancers could not be done especially in other regions of Thailand whose budgets and resources are so limited. If the reagents are made locally, many laboratories can perform the tests and use as primary diagnosis, screening or monitor the course of the disease following treatment. In addition, these reagents could help clinicians and give complementary information on the tumor status to improve quality of life in Thailand. Research objectives include: 1. Development of IRMA reagent kits suitable for diagnosing staging and monitoring prostrate and breast cancer. 2. Transfer of technology and reagent kits to relevant laboratories in Thailand. 3. Routine distribution of the reagents kits to the end users

  9. Construction of a genetic map using EST-SSR markers and QTL analysis of major agronomic characters in hexaploid sweet potato (Ipomoea batatas (L.) Lam).

    Science.gov (United States)

    Kim, Jin-Hee; Chung, Il Kyung; Kim, Kyung-Min

    2017-01-01

    The Sweet potato, Ipomoea batatas (L.) Lam, is difficult to study in genetics and genomics because it is a hexaploid. The sweet potato study not have been performed domestically or internationally. In this study was performed to construct genetic map and quantitative trait loci (QTL) analysis. A total of 245 EST-SSR markers were developed, and the map was constructed by using 210 of those markers. The total map length was 1508.1 cM, and the mean distance between markers was 7.2 cM. Fifteen characteristics were investigated for QTLs analysis. According to those, the Four QTLs were identified, and The LOD score was 3.0. Further studies need to develop molecular markers in terms of EST-SSR markers for doing to be capable of efficient breeding. The genetic map created here using EST-SSR markers will facilitate planned breeding of sweet potato cultivars with various desirable traits.

  10. Transcribing the balanced scorecard into system dynamics

    DEFF Research Database (Denmark)

    Nielsen, Steen; Nielsen, Erland Hejn

    2013-01-01

    The purpose of this paper is to show how a System Dynamics Modelling approach can be integrated into the Balanced Scorecard (BSC) for a case company with special focus on the handling of causality in a dynamic perspective. The BSC model includes five perspectives and a number of financial and non...... the cause-and-effect relationships of an integrated BSC model. Including dynamic aspects of BSCs into the discussion is only in its infancy, so the aim of our work is also to contribute to both scholars’ and practitioners’ general understanding of how such delayed dynamic effects propagate through system...

  11. A ribozyme transcribed by a ribozyme

    DEFF Research Database (Denmark)

    Bentin, Thomas

    2011-01-01

    Prominent current ideas on how life emerged on Earth include an RNA world hypothesis in which RNA performed informational as well as catalytic functions in the absence of both DNA and protein. Demonstration of a self-replicative system based on ribonucleic acid polymers as both information carriers...... and catalysts would lend support to such a scenario. A pivotal component of this system would be an RNA dependent RNA polymerase ribozyme capable of replicating its own RNA gene. Recent work from the Holliger group at the Laboratory for Molecular Biology in Cambridge has provided synthetic ribozymes1 that just...

  12. The role of Molecular Markers in Improvement of Fruit Crops

    Directory of Open Access Journals (Sweden)

    Zahoor Ahmad BHAT

    2010-06-01

    Full Text Available Markers have been used over the years for the classification of plants. Markers are any trait of an organism that can be identified with confidence and relative easy, and can be followed in a mapping population on another hand markers be defined as heritable entities associated with the economically important trait under the control of polygenes. Morphological markers can be detected with naked eye (naked eye polymorphism or as difference in physical or chemical properties of the macromolecules. In other words, there are two types of genetic markers viz. morphological markers or naked eye polymorphism and non-morphological markers or molecular markers. Morphological markers include traits such as plant height, disease response, photoperiod, sensitivity, shape or colour of flowers, fruits or seeds etc. Molecular markers include biochemical constituents. Morphological markers have many limitations for being used as markers particularly in fruit crops because of long generation time and large size of fruit trees besides being influenced by environment. Consequently, molecular markers could be appropriate choice to study and preserve the diversity in any germplasm. Molecular markers have diverse applications in fruit crop improvement, particularly in the areas of genetic diversity and varietal identification studies, gene tagging, disease diagnostics, pedigree analysis, hybrid detection, sex differentiation and marker assisted selection.

  13. Internal pump

    International Nuclear Information System (INIS)

    Kushima, Jun; Hayashi, Youjiro; Ueda, Masayuki.

    1997-01-01

    The present invention relates to an internal pump. A water hole allowing communication between internal and external circumferences of a stretch tube is provided at the portion of the stretch tube corresponding to a position where an end face of a nozzle portion of a motor case and an end face of a diffuser are joined with each other so that hot filtered water inside a pressure container which has entered from where the end face of the nozzle portion of the motor case and the end face of the diffuser are joined with each other is combined with the purged water so that it can be sent back to the pressure container again. (author) figs

  14. Markers of Airway Remodeling in Bronchopulmonary Diseases

    Directory of Open Access Journals (Sweden)

    O.Ye. Chernyshova

    2014-10-01

    Full Text Available The article presents information about markers of airway remodeling in bronchopulmonary diseases. There is described the influence of matrix metalloproteinases, tissue inhibitor of matrix metalloproteinase, transforming growth factor, collagen autoantibodies III type, endothelin-1 on the processes of morphological airway reconstruction as smooth muscle hypertrophy, enhanced neovascularization, epithelial cell hyperplasia, collagen deposition, compaction of the basal membrane, observed in bronchial asthma.

  15. Structuring Conversation: Discourse Markers in Cervantes's "Entremeses"

    Science.gov (United States)

    King, Jeremy

    2011-01-01

    Due to the recent shift in the linguistic pragmatics literature from the analysis of isolated speech acts to the focus on phenomena which affect the global meaning of a message, discourse markers (DMs) have become a frequent research topic. Despite their popularity, the evolution and development of these forms is often neglected in investigations…

  16. Molecular marker analysis of 'Shatangju' and 'Wuzishatangju ...

    African Journals Online (AJOL)

    'Wuzishatangju'(Citrus reticulata Blanco) is an excellent cultivar derived from a bud sport of a seedy 'Shatangju' cultivar found in Guangdong Province in the 1980s. In this study, six molecular markers including random amplified polymorphic DNA (RAPD), inter-simple sequence repeat (ISSR), simple sequence repeat (SSR) ...

  17. (L.) Dunal using RAPD and AFLP markers

    African Journals Online (AJOL)

    ajl yemi

    2011-10-26

    Oct 26, 2011 ... Fragment Length Polymorphism (AFLP) markers. Eighteen ... importance due to its simplicity, efficiency, relative ease .... nation, number of polymorphic bands, percentage polymorphism .... roots, stems, leaves, flowers, pollen grains, mature fruits ... genetic changes that isolated it from the wild species.

  18. Preoperative Molecular Markers in Thyroid Nodules.

    Science.gov (United States)

    Sahli, Zeyad T; Smith, Philip W; Umbricht, Christopher B; Zeiger, Martha A

    2018-01-01

    The need for distinguishing benign from malignant thyroid nodules has led to the pursuit of differentiating molecular markers. The most common molecular tests in clinical use are Afirma ® Gene Expression Classifier (GEC) and Thyroseq ® V2. Despite the rapidly developing field of molecular markers, several limitations exist. These challenges include the recent introduction of the histopathological diagnosis "Non-Invasive Follicular Thyroid neoplasm with Papillary-like nuclear features", the correlation of genetic mutations within both benign and malignant pathologic diagnoses, the lack of follow-up of molecular marker negative nodules, and the cost-effectiveness of molecular markers. In this manuscript, we review the current published literature surrounding the diagnostic value of Afirma ® GEC and Thyroseq ® V2. Among Afirma ® GEC studies, sensitivity (Se), specificity (Sp), positive predictive value (PPV), and negative predictive value (NPV) ranged from 75 to 100%, 5 to 53%, 13 to 100%, and 20 to 100%, respectively. Among Thyroseq ® V2 studies, Se, Sp, PPV, and NPV ranged from 40 to 100%, 56 to 93%, 13 to 90%, and 48 to 97%, respectively. We also discuss current challenges to Afirma ® GEC and Thyroseq ® V2 utility and clinical application, and preview the future directions of these rapidly developing technologies.

  19. (SSR) markers for drought tolerance in maize

    African Journals Online (AJOL)

    Maize is moderately sensitive to drought. Drought affects virtually all aspects of maize growth in varying degrees at all stages, from germination to maturity. Tolerance to drought is genetically and physiologically complicated and inherited quantitatively. Application of molecular-marker aided selection technique for ...

  20. Molecular markers unravel intraspecific and interspecific genetic ...

    Indian Academy of Sciences (India)

    [Kotwal S., Dhar M. K., Kour B., Raj K. and Kaul S. 2013 Molecular markers unravel intraspecific and interspecific genetic variability in ... of bowel problems including chronic constipation, amoebic ..... while to select parents from accessions, Pov80 and Pov79 ... nology (DBT), Govt. of India, for financial assistance in the form.

  1. Isolation and characterization of polymorphic microsatellite markers ...

    African Journals Online (AJOL)

    Flax (Linum usitatissimum L.) is the third largest natural fiber crop and one of the five major oil crops in the world. ... These novel polymorphic microsatellite loci will be useful in genetic linkage map construction, germplasm classification and identification, gene identification and QTL mapping, and marker-assisted selection ...

  2. SIMPLE SEQUENCE REPEAT MARKERS ASSOCIATED WITH ...

    African Journals Online (AJOL)

    ACSS

    2016-02-20

    Feb 20, 2016 ... Deployment of host resistance remains the most cost effective strategy for management of foliar and grain diseases, especially for resource constrained farmers. There is paucity of information on dual resistance in sorghum to both diseases. The objective of this study was to identify SSR markers associated ...

  3. Multiplexed microsatellite markers for seven Metarhizium species

    Science.gov (United States)

    Cross-species transferability of 41 previously published simple sequence repeat (SSR) markers was assessed for 11 species of the entomopathogenic fungus Metarhizium. A collection of 65 Metarhizium isolates including all 54 used in a recent phylogenetic revision of the genus were characterized. Betwe...

  4. SNP marker detection and genotyping in tilapia

    NARCIS (Netherlands)

    Bers, van N.E.M.; Crooijmans, R.P.M.A.; Groenen, M.A.M.; Dibbits, B.W.; Komen, J.

    2012-01-01

    We have generated a unique resource consisting of nearly 175 000 short contig sequences and 3569 SNP markers from the widely cultured GIFT (Genetically Improved Farmed Tilapia) strain of Nile tilapia (Oreochromis niloticus). In total, 384 SNPs were selected to monitor the wider applicability of the

  5. Molecular marker genes for ectomycorrhizal symbiosis

    Science.gov (United States)

    Shiv Hiremath; Carolyn McQuattie; Gopi Podila; Jenise. Bauman

    2013-01-01

    Mycorrhizal symbiosis is a mutually beneficial association very commonly found among most vascular plants. Formation of mycorrhiza happens only between compatible partners and predicting this is often accomplished through a trial and error process. We investigated the possibility of using expression of symbiosis specific genes as markers to predict the formation of...

  6. International safeguards

    International Nuclear Information System (INIS)

    1995-01-01

    The system of international safeguards carried out by the IAEA is designed to verify that governments are living up to pledges to use nuclear energy only for peaceful purposes under the NPT (Treaty on the non-proliferation of nuclear weapons) and similar agreements. The film illustrates the range of field inspections and analytical work involved. It also shows how new approaches are helping to strengthen the system

  7. International cooperation

    International Nuclear Information System (INIS)

    1996-01-01

    In 1995, Nuclear Regulatory Authority of the Slovak Republic (NRA SR) ensured foreign cooperation particularly in the frame of the Slovak Republic is membership in the IAEA, as well as cooperation with the Nuclear Energy Agency of the Organization for Economic Cooperation and Development (OECD NEA), cooperation with European Union in the frame of PHARE programmes, and intergovernmental cooperation and cooperation among nuclear regulatory authorities. With respect to an international importance, prestige and a wide-scope possibilities of a technical assistance , either a direct one (expert assessments, technology supplies, work placement, scientific trips, training courses) or indirect one (participation at various conferences, seminars, technical committees, etc), the most important cooperation with the IAEA in Vienna. In 1994, the Slovak Republic, was elected to the Board Governors, the represent the group of Eastern European countries. The Slovak Government entrusted the NRA SR's Chairman with representing the Slovak Republic in the Board of Governors. Owing to a good name of Slovakia was elected to the one of two Vice-Chairmen of the Board of Governors at the 882-nd session on the Board. IAEA approved and developed 8 national projects for Slovakia in 1995. Generally, IAEA is contracting scientific contracts with research institutes, nuclear power plants and other organizations. Slovak organizations used these contracts as complementary funding of their tasks. In 1995, there were 12 scientific contracts in progress, or approved respectively. Other international activities of the NRA SR, international co-operations as well as foreign affairs are reported

  8. Development of functional markers associated with phenotypic characteristics for identification of soy variety

    International Nuclear Information System (INIS)

    Ibarra, M.; Castro, A; Capdevielle, F.

    2013-01-01

    The organization of agricultural systems requires the verification of the genetic identity and purity of cultivars. The increase in the number of soy varieties to be evaluated, and the narrow genetic base of soybean cultivars, make the identification using phenotypic descriptors very difficult. The International Union for the Protection of New Varieties of Plants (UPOV) has recognized the utility of molecular markers associated with descriptive phenotypic characteristics. With the goal of developing this kind of markers, six genic or genomic S SR were selected in silico (Sat286, Satt229, GmPrx1, GMES1173, Satt571 and Gm Hi), plus two previously reported markers (GmF35H and SoyF3H). All were evaluated in 35 soybean cultivars. The SSRs GmPrx1 and Gm Hi selected for seed coat peroxidase and hilum color respectively were monomorphic. The mean Polymorphism Information Content (PI C) value within the selected group of polymorphic markers was 0.48 with an average of 3.12 allele per locus. GmF35H discriminated the soybean varieties according to the flower color (white and purple). Discrimination tests showed a high percentage of accurate classification of growth habit (95.8%) and pubescence color (80.6%) with Sat286 and Soy F3H, respectively. The classification values for pod color (74.2%) and leaflet size (73.5%) were intermediate using GMES1173 and Satt571, respectively. The marker Satt229 was not discriminating for flowering time (50%) and maturity (42.8%). Molecular markers selected in or close to sequences of interest can be integrated into a genetic identification system as complementary markers to the classic phenotypic descriptors of soybean varieties

  9. The role of molecular markers and marker assisted selection in breeding for organic agriculture

    DEFF Research Database (Denmark)

    Lammerts van Bueren, E.T.; Backes, G.; de Vriend, H.

    2010-01-01

    markers is not self-evident and is often debated. Organic and low-input farming conditions require breeding for robust and flexible varieties, which may be hampered by too much focus on the molecular level. Pros and contras for application of molecular markers in breeding for organic agriculture...... was the topic of a recent European plant breeding workshop. The participants evaluated strengths, weaknesses, opportunities, and threats of the use of molecular markers and we formalized their inputs into breeder’s perspectives and perspectives seen from the organic sector’s standpoint. Clear strengths were...

  10. Systematic review on the role of serum tumor markers in the detection of recurrent pancreatic cancer.

    Science.gov (United States)

    Daamen, Lois A; Groot, Vincent P; Heerkens, Hanne D; Intven, Martijn P W; van Santvoort, Hjalmar C; Molenaar, I Quintus

    2018-04-01

    Biomarker testing can be helpful to monitor disease progression after resection of pancreatic cancer. This systematic review aims to give an overview of the literature on the diagnostic value of serum tumor markers for the detection of recurrent pancreatic cancer during follow-up. A systematic search was performed to 2 October 2017. All studies reporting on the diagnostic value of postoperatively measured serum biomarkers for the detection of pancreatic cancer recurrence were included. Data on diagnostic accuracy of tumor markers were extracted. Forest plots and pooled values of sensitivity and specificity were calculated. Four articles described test results of CA 19-9. A pooled sensitivity and specificity of respectively 0.73 (95% CI 0.66-0.80) and 0.83 (95% CI 0.73-0.91) were calculated. One article reported on CEA, showing a sensitivity of 50% and specificity of 65%. No other serum tumor markers were discussed for surveillance purposes in the current literature. Although testing of serum CA 19-9 has considerable limitations, CA 19-9 remains the most used serum tumor marker for surveillance after surgical resection of pancreatic cancer. Further studies are needed to assess the role of serum tumor marker testing in the detection of recurrent pancreatic cancer and to optimize surveillance strategies. Copyright © 2017 International Hepato-Pancreato-Biliary Association Inc. Published by Elsevier Ltd. All rights reserved.

  11. Identification of genetic markers linked to anthracnose resistance in sorghum using association analysis.

    Science.gov (United States)

    Upadhyaya, Hari D; Wang, Yi-Hong; Sharma, Rajan; Sharma, Shivali

    2013-06-01

    Anthracnose in sorghum caused by Colletotrichum sublineolum is one of the most destructive diseases affecting sorghum production under warm and humid conditions. Markers and genes linked to resistance to the disease are important for plant breeding. Using 14,739 SNP markers, we have mapped eight loci linked to resistance in sorghum through association analysis of a sorghum mini-core collection consisting of 242 diverse accessions evaluated for anthracnose resistance for 2 years in the field. The mini-core was representative of the International Crops Research Institute for the Semi-Arid Tropics' world-wide sorghum landrace collection. Eight marker loci were associated with anthracnose resistance in both years. Except locus 8, disease resistance-related genes were found in all loci based on their physical distance from linked SNP markers. These include two NB-ARC class of R genes on chromosome 10 that were partially homologous to the rice blast resistance gene Pib, two hypersensitive response-related genes: autophagy-related protein 3 on chromosome 1 and 4 harpin-induced 1 (Hin1) homologs on chromosome 8, a RAV transcription factor that is also part of R gene pathway, an oxysterol-binding protein that functions in the non-specific host resistance, and homologs of menthone:neomenthol reductase (MNR) that catalyzes a menthone reduction to produce the antimicrobial neomenthol. These genes and markers may be developed into molecular tools for genetic improvement of anthracnose resistance in sorghum.

  12. Marker-trait association study for protein content in chickpea (Cicer arietinum L.).

    Science.gov (United States)

    Jadhav, A A; Rayate, S J; Mhase, L B; Thudi, M; Chitikineni, A; Harer, P N; Jadhav, A S; Varshney, R K; Kulwal, P L

    2015-06-01

    Chickpea (Cicer arietinum L.) is the second most important cool season food legume cultivated in arid and semiarid regions of the world. The objective of the present study was to study variation for protein content in chickpea germplasm, and to find markers associated with it. A set of 187 genotypes comprising both international and exotic collections, and representing both desi and kabuli types with protein content ranging from 13.25% to 26.77% was used. Twenty-three SSR markers representing all eight linkage groups (LG) amplifying 153 loci were used for the analysis. Population structure analysis identified three subpopulations, and corresponding Q values of principal components were used to take care of population structure in the analysis which was performed using general linear and mixed linear models. Marker-trait association (MTA) analysis identified nine significant associations representing four QTLs in the entire population. Subpopulation analyses identified ten significant MTAs representing five QTLs, four of which were common with that of the entire population. Two most significant QTLs linked with markers TR26.205 and CaM1068.195 were present on LG3 and LG5. Gene ontology search identified 29 candidate genes in the region of significant MTAs on LG3. The present study will be helpful in concentrating on LG3 and LG5 for identification of closely linked markers for protein content in chickpea and for their use in molecular breeding programme for nutritional quality improvement.

  13. Epothilone D prevents binge methamphetamine-mediated loss of striatal dopaminergic markers.

    Science.gov (United States)

    Killinger, Bryan A; Moszczynska, Anna

    2016-02-01

    decreasing the levels of DAergic markers in the striatum. We have determined that high-dose METH destabilizes microtubules in this pathway, which is manifested by decreased levels of acetylated (Acetyl) and detyrosinated (Detyr) α-tubulin (I). A microtubule stabilizing agent epothilone D protects striatal microtubules form the METH-induced loss of DAergic markers (II). These findings provide a new strategy for protection form METH - restoration of proper axonal transport. © 2015 International Society for Neurochemistry.

  14. Equality marker in the language of bali

    Science.gov (United States)

    Wajdi, Majid; Subiyanto, Paulus

    2018-01-01

    The language of Bali could be grouped into one of the most elaborate languages of the world since the existence of its speech levels, low and high speech levels, as the language of Java has. Low and high speech levels of the language of Bali are language codes that could be used to show and express social relationship between or among its speakers. This paper focuses on describing, analyzing, and interpreting the use of the low code of the language of Bali in daily communication in the speech community of Pegayaman, Bali. Observational and documentation methods were applied to provide the data for the research. Recoding and field note techniques were executed to provide the data. Recorded in spoken language and the study of novel of Balinese were transcribed into written form to ease the process of analysis. Symmetric use of low code expresses social equality between or among the participants involves in the communication. It also implies social intimacy between or among the speakers of the language of Bali. Regular and patterned use of the low code of the language of Bali is not merely communication strategy, but it is a kind of communication agreement or communication contract between the participants. By using low code during their social and communication activities, the participants shared and express their social equality and intimacy between or among the participants involve in social and communication activities.

  15. Marker Registration Technique for Handwritten Text Marker in Augmented Reality Applications

    Science.gov (United States)

    Thanaborvornwiwat, N.; Patanukhom, K.

    2018-04-01

    Marker registration is a fundamental process to estimate camera poses in marker-based Augmented Reality (AR) systems. We developed AR system that creates correspondence virtual objects on handwritten text markers. This paper presents a new method for registration that is robust for low-content text markers, variation of camera poses, and variation of handwritten styles. The proposed method uses Maximally Stable Extremal Regions (MSER) and polygon simplification for a feature point extraction. The experiment shows that we need to extract only five feature points per image which can provide the best registration results. An exhaustive search is used to find the best matching pattern of the feature points in two images. We also compared performance of the proposed method to some existing registration methods and found that the proposed method can provide better accuracy and time efficiency.

  16. Internal education

    Directory of Open Access Journals (Sweden)

    Anita Zagorc

    2016-09-01

    Full Text Available Research Question (RQ: The importance of internal trainings in an organization. Purpose: The purpose of research is to examine and present internal trainings in an organization and their contribution to greater success of an organization. The paper studies employee training in a company, how the organization itself looks after its employees during training, how trainings contribute to further development of organization and the advancement of knowledge for successful operation of organization. Method: How to achieve the purpose of research, used methods and theoretical approach. Results: Specific examples and opinions of employees. Results show the importance of trainings for an organization. We can see that all employees are fairly motivated and ready to participate in trainings and can adapt to changing business environment very well. The results demonstrate that all trainings in the organization are very important and welcome. Only with continuous learning, the organization can be successful and survive in the market despite strong competition. Organization: Trainings are designed for all employees inside an organization. Different employees participate in trainings in a different way as all trainings are divided into certain work and fields that are important for each individual or department in an organization. Society: Trainings have an impact on the whole organization by contributing to its development. Originality: The originality of study is what was new in the research, what is the value and originality of research. Limitations/Future Research: Research was limited to a small number of sources.

  17. Seimo posėdžių stenogramų tekstynas autorystės nustatymo bei autoriaus profilio sudarymo tyrimams | Corpus of transcribed parliamentary speeches for authorship attribution and author profiling tasks

    Directory of Open Access Journals (Sweden)

    Jurgita Kapočiūtė-Dzikienė

    2014-12-01

    Full Text Available In our paper we present a corpus of transcribed Lithuanian parliamentary speeches. The corpus is prepared in a specific format, appropriate for different authorship identification tasks. The corpus consists of approximately 111 thousand texts (24 million words. Each text matches one parliamentary speech produced during an ordinary session from the period of 7 parliamentary terms starting on March 10, 1990 and ending on December 23, 2013. The texts are grouped into 147 categories corresponding to individual authors, therefore they can be used for authorship attribution tasks; besides, these texts are also grouped according to age, gender and political views, therefore they are also suitable for author profiling tasks. Whereas short texts complicate recognition of author speaking style and are ambiguous in relation to the style of other authors, we incorporated only texts containing not less than 100 words into the corpus. In order to make each category as comprehensive and representative as possible, we included only those authors, who produced speeches at least 200 times. All the texts are lemmatized, morphologically and syntactically annotated, tokenized into the character n-grams. The statistical information of the corpus is also available. We have also demonstrated that the created corpus can be effectively used in authorship attribution and author profiling tasks with supervised machine learning methods. The corpus structure also allows using it with unsupervised machine learning methods and can be used for creation of rule-based methods, as well as in different linguistic analyses.

  18. Biomolecular Markers in Cancer of the Tongue

    Directory of Open Access Journals (Sweden)

    Daris Ferrari

    2009-01-01

    Full Text Available The incidence of tongue cancer is increasing worldwide, and its aggressiveness remains high regardless of treatment. Genetic changes and the expression of abnormal proteins have been frequently reported in the case of head and neck cancers, but the little information that has been published concerning tongue tumours is often contradictory. This review will concentrate on the immunohistochemical expression of biomolecular markers and their relationships with clinical behaviour and prognosis. Most of these proteins are associated with nodal stage, tumour progression and metastases, but there is still controversy concerning their impact on disease-free and overall survival, and treatment response. More extensive clinical studies are needed to identify the patterns of molecular alterations and the most reliable predictors in order to develop tailored anti-tumour strategies based on the targeting of hypoxia markers, vascular and lymphangiogenic factors, epidermal growth factor receptors, intracytoplasmatic signalling and apoptosis.

  19. [Markers of angiogenesis in tumor growth].

    Science.gov (United States)

    Nefedova, N A; Kharlova, O A; Danilova, N V; Malkov, P G; Gaifullin, N M

    2016-01-01

    Angiogenesis is a process of new blood vessels formation. The role of angiogenesis in growth, invasion and metastasis of malignant tumours is nowdays universally recognized. Though, investigation of mechanisms of blood vessels formation and elaboration methods for assessment of tumour angiogenesis are still up-dated. Another important concern are different aspects of usage of immunohistochemical markers of blood vessels endothelium (CD31 and CD34) for assessment of tumour aggressiveness and prognosis. The problems of malignant lymphangiogenesis are also up-to-date. The focus is on methods of immunohistochemical visualization of forming lymphatic vessels, role of podoplanin, the most reliable marker of lymphatic vessels, in their identification, and formulization of the main criteria for lymphangiogenesis estimation, its correlation with metastatic activity and prognostic potential. Studying of angiogenesis and lymph angiogenesis in malignant tumors is important and challenging direction for researching tumour progression and invention of antiangiogenic therapy.

  20. Markers for blood-brain barrier integrity

    DEFF Research Database (Denmark)

    Saunders, Norman R; Dziegielewska, Katarzyna M; Møllgård, Kjeld

    2015-01-01

    In recent years there has been a resurgence of interest in brain barriers and various roles their intrinsic mechanisms may play in neurological disorders. Such studies require suitable models and markers to demonstrate integrity and functional changes at the interfaces between blood, brain......, and cerebrospinal fluid. Studies of brain barrier mechanisms and measurements of plasma volume using dyes have a long-standing history, dating back to the late nineteenth-century. Their use in blood-brain barrier studies continues in spite of their known serious limitations in in vivo applications. These were well...... known when first introduced, but seem to have been forgotten since. Understanding these limitations is important because Evans blue is still the most commonly used marker of brain barrier integrity and those using it seem oblivious to problems arising from its in vivo application. The introduction...

  1. Marker-assisted selection in Eucalyptus

    International Nuclear Information System (INIS)

    Grattapaglia, D.

    2007-01-01

    Planted Eucalyptus occupies globally more than 18 million hectares and has become the most widely planted hardwood tree in the world, supplying high-quality woody biomass for several industrial applications. In this chapter an overview is presented on the status and perspectives of marker-assisted selection (MAS) in species of Eucalyptus. After an introduction to the main features of modern eucalypt breeding and clonal forestry, some applications of molecular markers in support to operational breeding are presented. By reviewing the status of quantitative trait locus (QTL) mapping in Eucalyptus, the challenges and some realistic prospects for the application of MAS to improve relevant traits are outlined. With the expected availability of more powerful genomic tools, including a draft of the Eucalyptus genome, the main challenges in implementing MAS will be in phenotyping trees accurately, analysing the overwhelming amount of genomic data available and translating this into truly useful molecular tools for breeding. (author)

  2. Collagen markers in peritoneal dialysis patients

    DEFF Research Database (Denmark)

    Graff, J; Joffe, P; Fugleberg, S

    1995-01-01

    Possible relationships between the dialysate-to-plasma creatinine equilibration ratio (D/Pcreatinine 4 hour), duration of peritoneal dialysis treatment, number of peritonitis episodes, and mass appearance rates of three connective tissue markers [carboxyterminal propeptide of type I procollagen...... (PICP), aminoterminal propeptide of type III procollagen (PIIINP), and carboxyterminal telopeptide of type I collagen (ICTP)] were studied in 19 nondiabetic peritoneal dialysis patients. The absence of correlation between the mass appearance rates of the markers and the duration of dialysis treatment...... as well as the number of peritonitis episodes supports the concept that peritoneal dialysis does not cause persistent changes in the deposition and degradation rates of collagen. A correlation between the D/Pcreatinine 4 hr and the PICP mass appearance rates was found. Since it is unlikely...

  3. Marker-assisted selection for quantitative traits

    Directory of Open Access Journals (Sweden)

    Ivan Schuster

    2011-01-01

    Full Text Available Although thousands of scientific articles have been published on the subject of marker-assisted selection (MAS andquantitative trait loci (QTL, the application of MAS for QTL in plant breeding has been restricted. Among the main causes for thislimited use are the low accuracy of QTL mapping and the high costs of genotyping thousands of plants with tens or hundreds ofmolecular markers in routine breeding programs. Recently, new large-scale genotyping technologies have resulted in a costreduction. Nevertheless, the MAS for QTL has so far been limited to selection programs using several generations per year, wherephenotypic selection cannot be performed in all generations, mainly in recurrent selection programs. Methods of MAS for QTL inbreeding programs using self-pollination have been developed.

  4. Fiducial marker guided stereotactic liver radiotherapy: Is a time delay between marker implantation and planning CT needed?

    DEFF Research Database (Denmark)

    Worm, Esben S; Bertholet, Jenny; Høyer, Morten

    2016-01-01

    To minimize the risk of marker migration in fiducial marker guided liver SBRT it is common to add a delay of a week between marker implantation and planning CT. This study found that such a delay is unnecessary and could be avoided to minimize the treatment preparation time.......To minimize the risk of marker migration in fiducial marker guided liver SBRT it is common to add a delay of a week between marker implantation and planning CT. This study found that such a delay is unnecessary and could be avoided to minimize the treatment preparation time....

  5. Marker-assisted selection in poultry

    International Nuclear Information System (INIS)

    Koning, D.-J. de; Hocking, P.M.

    2007-01-01

    Among livestock species, chicken has the most extensive genomics toolbox available for detection of quantitative trait loci (QTL) and marker-assisted selection (MAS). The uptake of MAS is therefore not limited by technical resources but mostly by the priorities and financial constraints of the few remaining poultry breeding companies. With the cost of genotyping decreasing rapidly, an increase in the use of direct trait- single nucleotide polymorphism (SNP)-associations in MAS can be predicted. (author)

  6. Automated genotyping of dinucleotide repeat markers

    Energy Technology Data Exchange (ETDEWEB)

    Perlin, M.W.; Hoffman, E.P. [Carnegie Mellon Univ., Pittsburgh, PA (United States)]|[Univ. of Pittsburgh, PA (United States)

    1994-09-01

    The dinucleotide repeats (i.e., microsatellites) such as CA-repeats are a highly polymorphic, highly abundant class of PCR-amplifiable markers that have greatly streamlined genetic mapping experimentation. It is expected that over 30,000 such markers (including tri- and tetranucleotide repeats) will be characterized for routine use in the next few years. Since only size determination, and not sequencing, is required to determine alleles, in principle, dinucleotide repeat genotyping is easily performed on electrophoretic gels, and can be automated using DNA sequencers. Unfortunately, PCR stuttering with these markers generates not one band for each allele, but a pattern of bands. Since closely spaced alleles must be disambiguated by human scoring, this poses a key obstacle to full automation. We have developed methods that overcome this obstacle. Our model is that the observed data is generated by arithmetic superposition (i.e., convolution) of multiple allele patterns. By quantitatively measuring the size of each component band, and exploiting the unique stutter pattern associated with each marker, closely spaced alleles can be deconvolved; this unambiguously reconstructs the {open_quotes}true{close_quotes} allele bands, with stutter artifact removed. We used this approach in a system for automated diagnosis of (X-linked) Duchenne muscular dystrophy; four multiplexed CA-repeats within the dystrophin gene were assayed on a DNA sequencer. Our method accurately detected small variations in gel migration that shifted the allele size estimate. In 167 nonmutated alleles, 89% (149/167) showed no size variation, 9% (15/167) showed 1 bp variation, and 2% (3/167) showed 2 bp variation. We are currently developing a library of dinucleotide repeat patterns; together with our deconvolution methods, this library will enable fully automated genotyping of dinucleotide repeats from sizing data.

  7. Instagram photos reveal predictive markers of depression

    OpenAIRE

    Reece, Andrew G.; Danforth, Christopher M.

    2016-01-01

    Using Instagram data from 166 individuals, we applied machine learning tools to successfully identify markers of depression. Statistical features were computationally extracted from 43,950 participant Instagram photos, using color analysis, metadata components, and algorithmic face detection. Resulting models outperformed general practitioners' average diagnostic success rate for depression. These results held even when the analysis was restricted to posts made before depressed individuals we...

  8. Intraovarian markers of follicular and oocyte maturation.

    Science.gov (United States)

    Pellicer, A; Diamond, M P; DeCherney, A H; Naftolin, F

    1987-08-01

    The use of ovulation induction for multiple follicular growth in in vitro fertilization (IVF) has introduced the problem of follicular asynchrony. As a consequence of the asynchrony, the parameters most commonly used by IVF groups to assess follicular and oocyte quality within those follicles are not sufficiently sensitive or specific. Thus, each follicle must be considered separately, and specific markers of follicular and/or oocyte maturation must be sought from within the follicle. In this review we analyze previous reports of potential markers of follicular and oocyte maturation. In regards to the follicular fluid constituents, the level of estradiol in follicular fluid correlates with fertilization and pregnancy in stimulated cycles. Other steroids are only helpful when specific stimulation protocols are used. The level of some follicular proteins such as alpha-1-antitrypsin and fibrinogen also correlates with fertilization and pregnancy outcome. Cyclic AMP levels in follicular fluid are significantly reduced in follicles leading to conception. Regulators of oocyte maturation, such as the Oocyte Maturation Inhibitor (OMI) or the Meiosis Inducing Substance (MIS) have also been correlated with IVF outcome, but their exact structure remains still unknown. In addition, other sophisticated parameters, such as chemotactic activity of human leukocytes, or simple methods, such as the presence of intrafollicular echoes, have also been used as successful markers in predicting IVF outcome.

  9. Uniparental ancestry markers in Chilean populations

    Directory of Open Access Journals (Sweden)

    Camilla Dutra Vieira-Machado

    Full Text Available Abstract The presence of Native Americans, Europeans, and Africans has led to the development of a multi-ethnic, admixed population in Chile. This study aimed to contribute to the characterization of the uniparental genetic structure of three Chilean regions. Newborns from seven hospitals in Independencia, Providencia, Santiago, Curicó, Cauquenes, Valdívia, and Puerto Montt communes, belonging to the Chilean regions of Santiago, Maule, and Los Lagos, were studied. The presence of Native American mitochondrial DNA (mtDNA haplogroups and two markers present in the non-recombinant region of the Y chromosome, DYS199 and DYS287, indicative of Native American and African ancestry, respectively, was determined. A high Native American matrilineal contribution and a low Native American and African patrilineal contributions were found in all three studied regions. As previously found in Chilean admixed populations, the Native American matrilineal contribution was lower in Santiago than in the other studied regions. However, there was an unexpectedly higher contribution of Native American ancestry in one of the studied communes in Santiago, probably due to the high rate of immigration from other regions of the country. The population genetic sub-structure we detected in Santiago using few uniparental markers requires further confirmation, owing to possible stratification for autosomal and X-chromosome markers.

  10. Fecal Molecular Markers for Colorectal Cancer Screening

    Directory of Open Access Journals (Sweden)

    Rani Kanthan

    2012-01-01

    Full Text Available Despite multiple screening techniques, including colonoscopy, flexible sigmoidoscopy, radiological imaging, and fecal occult blood testing, colorectal cancer remains a leading cause of death. As these techniques improve, their sensitivity to detect malignant lesions is increasing; however, detection of precursor lesions remains problematic and has generated a lack of general acceptance for their widespread usage. Early detection by an accurate, noninvasive, cost-effective, simple-to-use screening technique is central to decreasing the incidence and mortality of this disease. Recent advances in the development of molecular markers in faecal specimens are encouraging for its use as a screening tool. Genetic mutations and epigenetic alterations that result from the carcinogenetic process can be detected by coprocytobiology in the colonocytes exfoliated from the lesion into the fecal matter. These markers have shown promising sensitivity and specificity in the detection of both malignant and premalignant lesions and are gaining popularity as a noninvasive technique that is representative of the entire colon. In this paper, we summarize the genetic and epigenetic fecal molecular markers that have been identified as potential targets in the screening of colorectal cancer.

  11. Markers of T Cell Senescence in Humans

    Directory of Open Access Journals (Sweden)

    Weili Xu

    2017-08-01

    Full Text Available Many countries are facing the aging of their population, and many more will face a similar obstacle in the near future, which could be a burden to many healthcare systems. Increased susceptibility to infections, cardiovascular and neurodegenerative disease, cancer as well as reduced efficacy of vaccination are important matters for researchers in the field of aging. As older adults show higher prevalence for a variety of diseases, this also implies higher risk of complications, including nosocomial infections, slower recovery and sequels that may reduce the autonomy and overall quality of life of older adults. The age-related effects on the immune system termed as “immunosenescence” can be exemplified by the reported hypo-responsiveness to influenza vaccination of the elderly. T cells, which belong to the adaptive arm of the immune system, have been extensively studied and the knowledge gathered enables a better understanding of how the immune system may be affected after acute/chronic infections and how this matters in the long run. In this review, we will focus on T cells and discuss the surface and molecular markers that are associated with T cell senescence. We will also look at the implications that senescent T cells could have on human health and diseases. Finally, we will discuss the benefits of having these markers for investigators and the future work that is needed to advance the field of T cell senescence markers.

  12. Functional molecular markers for crop improvement.

    Science.gov (United States)

    Kage, Udaykumar; Kumar, Arun; Dhokane, Dhananjay; Karre, Shailesh; Kushalappa, Ajjamada C

    2016-10-01

    A tremendous decline in cultivable land and resources and a huge increase in food demand calls for immediate attention to crop improvement. Though molecular plant breeding serves as a viable solution and is considered as "foundation for twenty-first century crop improvement", a major stumbling block for crop improvement is the availability of a limited functional gene pool for cereal crops. Advancement in the next generation sequencing (NGS) technologies integrated with tools like metabolomics, proteomics and association mapping studies have facilitated the identification of candidate genes, their allelic variants and opened new avenues to accelerate crop improvement through development and use of functional molecular markers (FMMs). The FMMs are developed from the sequence polymorphisms present within functional gene(s) which are associated with phenotypic trait variations. Since FMMs obviate the problems associated with random DNA markers, these are considered as "the holy grail" of plant breeders who employ targeted marker assisted selections (MAS) for crop improvement. This review article attempts to consider the current resources and novel methods such as metabolomics, proteomics and association studies for the identification of candidate genes and their validation through virus-induced gene silencing (VIGS) for the development of FMMs. A number of examples where the FMMs have been developed and used for the improvement of cereal crops for agronomic, food quality, disease resistance and abiotic stress tolerance traits have been considered.

  13. TLA-marker for wear rate monitoring

    International Nuclear Information System (INIS)

    Stan-Sion, C.; Plostinaru, D.; Ivan, A.; Catana, M.; Roman, M.

    1992-01-01

    A very effective and promising method of wear monitoring in industry is the Thin Layer Activation (TLA) method. The main feature of this technique is the creation of thin radioactive layers on the investigated surface by irradiation of the sample with an accelerated ion beam (protons, deuterons, 3-He). In the present paper we describe an extension of the TLA-Method to produce radioactive markers to be implanted into heavy object which can hardly be transported to an accelerator for direct surface activation. The sensitivity of wear measuring is usually 1% of the actual layer thickness. It is obvious that the TLA technique has a sensitivity about two orders of magnitude higher than the activation in the bulk volume, produced in a nuclear reactor. Controlling the activation depth (80 - 250 microns) we produced different marker sets with sensitivities of 1 - 3 microns. The TLA markers were used to measure the wear rate of railway-car brake disks and of the railroad. The measured data were corroborated with other physical parameters of interest. (Author)

  14. Prognostic DNA Methylation Markers for Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Siri H. Strand

    2014-09-01

    Full Text Available Prostate cancer (PC is the most commonly diagnosed neoplasm and the third most common cause of cancer-related death amongst men in the Western world. PC is a clinically highly heterogeneous disease, and distinction between aggressive and indolent disease is a major challenge for the management of PC. Currently, no biomarkers or prognostic tools are able to accurately predict tumor progression at the time of diagnosis. Thus, improved biomarkers for PC prognosis are urgently needed. This review focuses on the prognostic potential of DNA methylation biomarkers for PC. Epigenetic changes are hallmarks of PC and associated with malignant initiation as well as tumor progression. Moreover, DNA methylation is the most frequently studied epigenetic alteration in PC, and the prognostic potential of DNA methylation markers for PC has been demonstrated in multiple studies. The most promising methylation marker candidates identified so far include PITX2, C1orf114 (CCDC181 and the GABRE~miR-452~miR-224 locus, in addition to the three-gene signature AOX1/C1orf114/HAPLN3. Several other biomarker candidates have also been investigated, but with less stringent clinical validation and/or conflicting evidence regarding their possible prognostic value available at this time. Here, we review the current evidence for the prognostic potential of DNA methylation markers in PC.

  15. TLA-marker for wear rate monitoring

    Energy Technology Data Exchange (ETDEWEB)

    Stan-Sion, C; Plostinaru, D; Ivan, A [Institute of Atomic Physics, Institute of Physics and Nuclear Engineering, R-76900 Bucharest, P.O.Box MG-6, (Romania); Catana, M; Roman, M [Institute for Research and Design in Transportation, Bucharest, (Romania)

    1992-01-01

    A very effective and promising method of wear monitoring in industry is the Thin Layer Activation (TLA) method. The main feature of this technique is the creation of thin radioactive layers on the investigated surface by irradiation of the sample with an accelerated ion beam (protons, deuterons, 3-He). In the present paper we describe an extension of the TLA-Method to produce radioactive markers to be implanted into heavy object which can hardly be transported to an accelerator for direct surface activation. The sensitivity of wear measuring is usually 1% of the actual layer thickness. It is obvious that the TLA technique has a sensitivity about two orders of magnitude higher than the activation in the bulk volume, produced in a nuclear reactor. Controlling the activation depth (80 - 250 microns) we produced different marker sets with sensitivities of 1 - 3 microns. The TLA markers were used to measure the wear rate of railway-car brake disks and of the railroad. The measured data were corroborated with other physical parameters of interest. (Author).

  16. How could Decision Support System Based on Non-Linear Model Help to Interpret Tumor Marker Measurments in Oncology

    Czech Academy of Sciences Publication Activity Database

    Pecen, Ladislav; Eben, Kryštof; Vondráček, Jiří; Holubec, L.; Topolčan, O.; Pikner, R.; Kausitz, J.; Nekulová, M.; Šimíčková, M.

    2002-01-01

    Roč. 23, Suppl.1 (2002), s. 38 ISSN 1010-4283. [Meeting of the International Society for Oncodevelopmental Biology and Medicine /30./. 08.09.2002-12.09.2002, Boston] Institutional research plan: AV0Z1030915 Keywords : tumor markers * decision support systems Subject RIV: BA - General Mathematics

  17. Lipid-related markers and cardiovascular disease prediction

    DEFF Research Database (Denmark)

    Di Angelantonio, Emanuele; Gao, Pei; Pennells, Lisa

    2012-01-01

    The value of assessing various emerging lipid-related markers for prediction of first cardiovascular events is debated.......The value of assessing various emerging lipid-related markers for prediction of first cardiovascular events is debated....

  18. Evaluation of the use of snowplowable raised pavement markers.

    Science.gov (United States)

    2009-04-01

    The objective of this study was to evaluate the effectiveness and durability of snowplowable raised pavement markers (RPM) installed on the RPM system in Kentucky. The durability evaluation dealt wit the marker housing. : The data show that continued...

  19. Development of stable marker-free nuclear transformation strategy ...

    African Journals Online (AJOL)

    Development of stable marker-free nuclear transformation strategy in the green microalga Chlorella vulgaris. ... into Chlorella by electroporation has very low stability and it is hard to screen the transformants without antibiotic marker genes.

  20. Development and characterization of genic SSR markers from low ...

    Indian Academy of Sciences (India)

    Development and characterization of genic SSR markers from low depth genome ... A variety of molecular markers are currently ... chloroform method (Sambrook et al. 1989). ..... Available online, http://www.iucnredlist.org/details/168255/0.

  1. International safeguards

    International Nuclear Information System (INIS)

    Petit, A.

    1991-01-01

    The IAEA has now 200 Inspectors or so, and Euratom a similar number. People in Vienna are talking about increases of this staff, in the range of a possible doubling in the five years to come, although even an immediate restart of the expansion of nuclear industry, would not materialize significantly within this period. This means that keeping the same safeguarding approach would probably lead to another doubling of such staff in the ten following years, which is completely unrealistic. Such a staff is our of proportion with those of national inspectorates in other fields. The paper analyzes the basic irrealistic dogma which have hindered the progress of international safeguards, and recall the suggestions made since ten years to improve them

  2. Skin changes in internal malignancy

    Directory of Open Access Journals (Sweden)

    Rajagopal Ravi

    2004-07-01

    Full Text Available BACKGROUND: Internal malignancies are accompanied by various skin changes which may be specific infiltrates or non-specific changes. This study is aimed at determining the frequency of such changes in malignant disease treatment center attendees in India. METHODS: A study of 300 confirmed cases of internal malignancy at a malignant disease treatment center was undertaken to evaluate these skin changes. Specific infiltrates were confirmed by histopathology. Statistical methods were employed to calculate significance in non-specific lesions by comparing with 300 controls not suffering from internal malignancy. RESULTS: Skin changes were present in 82 (27.3%. Cutaneous metastases were found in 19 (6.3%; non-contiguous in 5 (1.6%; contiguous in 14 (4.3%. Non-specific skin lesions numbered 74 (11.6% in 52 patients. Statistically significant non-specific skin changes were acquired ichthyosis, herpes zoster and generalized pruritus. CONCLUSION: Metastases usually occurred late in internal malignancy (17, 5.6% except in a case each of histiocytic lymphoma and non-Hodgkin′s lymphoma (2, 0.7% where the lesions preceded malignancy by 3 months and 1 month respectively. Contiguous nodules were a marker of relapse after surgery in 3 (1%.

  3. An international collaborative family-based whole genome quantitative trait linkage scan for myopic refractive error

    DEFF Research Database (Denmark)

    Abbott, Diana; Li, Yi-Ju; Guggenheim, Jeremy A

    2012-01-01

    To investigate quantitative trait loci linked to refractive error, we performed a genome-wide quantitative trait linkage analysis using single nucleotide polymorphism markers and family data from five international sites....

  4. Image Processing Marker Augmented Reality for Design Furniture Room

    OpenAIRE

    Desy Siswanti, Sri; Titoyan, Titoyan

    2015-01-01

    AR useful for industrial applications to enhance the visual perception of the user, for example, the AR system is capable of visually new building project at a real construction site, which gives the viewer a better understanding in accordance with the existing environment. The method used by the AR is a marker detection and tracking, the method used for the detection and tracking marker is a natural feature tracking. This method detects features that are in the marker. In detecting marker ob...

  5. Haptocorrin as marker of disease progression in fibrolamellar hepatocellular carcinoma

    DEFF Research Database (Denmark)

    Lildballe, Dorte Launholt; Nguyen, Khoa Tran; Poulsen, Steen Seier

    2011-01-01

    No valid markers are routinely available to follow disease progression in patients with fibrolamellar hepatocellular carcinoma (FLHCC). We report data suggesting that the vitamin B12 binding protein haptocorrin (HC) may prove a suitable marker.......No valid markers are routinely available to follow disease progression in patients with fibrolamellar hepatocellular carcinoma (FLHCC). We report data suggesting that the vitamin B12 binding protein haptocorrin (HC) may prove a suitable marker....

  6. Characterization of genetic diversity in chickpea using SSR markers, Start Codon Targeted Polymorphism (SCoT) and Conserved DNA-Derived Polymorphism (CDDP).

    Science.gov (United States)

    Hajibarat, Zahra; Saidi, Abbas; Hajibarat, Zohreh; Talebi, Reza

    2015-07-01

    To evaluate the genetic diversity among 48 genotypes of chickpea comprising cultivars, landraces and internationally developed improved lines genetic distances were evaluated using three different molecular marker techniques: Simple Sequence Repeat (SSR); Start Codon Targeted (SCoT) and Conserved DNA-derived Polymorphism (CDDP). Average polymorphism information content (PIC) for SSR, SCoT and CDDP markers was 0.47, 0.45 and 0.45, respectively, and this revealed that three different marker types were equal for the assessment of diversity amongst genotypes. Cluster analysis for SSR and SCoT divided the genotypes in to three distinct clusters and using CDDP markers data, genotypes grouped in to five clusters. There were positive significant correlation (r = 0.43, P SSR markers. These results suggest that efficiency of SSR, SCOT and CDDP markers was relatively the same in fingerprinting of chickpea genotypes. To our knowledge, this is the first detailed report of using targeted DNA region molecular marker (CDDP) for genetic diversity analysis in chickpea in comparison with SCoT and SSR markers. Overall, our results are able to prove the suitability of SCoT and CDDP markers for genetic diversity analysis in chickpea for their high rates of polymorphism and their potential for genome diversity and germplasm conservation.

  7. Application of bio-marker to study on tumor radiosensitivity

    International Nuclear Information System (INIS)

    Guo Wanfeng; Ding Guirong; Han Liangfu

    2001-01-01

    To definite tumor radiosensitivity is important for applying the schedules of individualization of patient radiotherapy. Many laboratories were carrying on the research which predict the tumor radiosensitivity with one bio-marker or/and multi-bio-marker in various levels. At present has not witnessed the specific bio-marker, but it provides an excellent model for predicting tumor radiosensitivity

  8. 14 CFR 171.269 - Marker beacon performance requirements.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Marker beacon performance requirements. 171.269 Section 171.269 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF... Landing System (ISMLS) § 171.269 Marker beacon performance requirements. ISMLS marker beacon equipment...

  9. Diagnostic markers of infection in curret pediatric practice | Chiabia ...

    African Journals Online (AJOL)

    chemokines, cytokines, adhesion molecules, cell surface markers and polymerase chain reaction are expensive and available only in specialised research laboratories. Optimal benefit can be obtained from rational use of currently available markers either by multiple marker assays or serial measurements which increase ...

  10. Genetic markers and their application in livestock breeding in South ...

    African Journals Online (AJOL)

    The ultimate use of DNA markers would be to identify quantitative trait loci (QTL) in order to practice genotypic selection. This paper reviews DNA markers (RAPD, DFP, RFLP AFLP, minisatellites, microsatellites, SNP) and provides a brief overview of the current application of these markers in animal breeding.

  11. International recommendations

    International Nuclear Information System (INIS)

    Lindell, Bo

    1986-01-01

    Full text: This short presentation will indicate the general radiation protection background to protective measures against foodstuffs contaminated with radioactive substances. A number of international organizations are involved in various aspects of radiation protection, for example, the International Atomic Energy Agency (IAEA), the United Nations Food and Agriculture Organization (FAO), the United Nations Environment Programme (UNEP), and the World Health Organization (WHO). Two international organizations, however, provide the basic background. These are the International Commission on Radiological Protection (ICRP) and the United Nations Scientific Committee on the Effects of Atomic Radiation (UNSCEAR). UNSCEAR provides the scientific information on radiation levels and effects. It consists of 21 member countries, with truly international coverage. It issues reports to the UN General Assembly, including comprehensive scientific annexes. Its latest comprehensive report was issued in 1982, the next is expected to be published in 1988. That report will include an assessment of the radiological consequences of the Chernobyl accident. The ICRP is a non-governmental organization. It has issued recommendations on radiation protection since 1928. The postulated biological basis for radiation protection recommendations involves two types of biological effects. The so-called non-stochastic effects, mainly due to cell death, appear only when the radiation doses exceed a certain threshold value. These effects, therefore, can only appear after high accidental exposures. After the Chernobyl accident, they only affected about 200 individuals involved in fire extinction and rescue work at the damaged nuclear power plant. Stochastic effects, with some simplification, may be seen as the result of initial changes in the genetic code of some surviving cells. If these cells are germ cells, this may lead to hereditary harm. If they are somatic cells, the result could be cancer

  12. THE PHRASEOLOGY OF PUBLIC INTERNATIONAL ENGLISH

    Directory of Open Access Journals (Sweden)

    Peter Howarth

    2006-06-01

    Full Text Available In Howarth 2002 a limited amount of data was presented for preliminary analysis of the phraseology of international press conferences. Tliat study focused on the distinction between spontaneous and scripted spoken English and examined whether these styles of speech could be correlated with differences in phraseological performance. The current study broadens the scope of this research and aims to investigate in more detail the nature of the language used in public international settings between native- and non-native speakers. It will draw on a corpus of approximately 2.5 million words of transcribed press conferences, containing large numbers of exchanges between native and non-native spokespeople and journalists. 'The press conferences have been conducted during the last eight years in Former Yugoslavia and have the common subject matter of peace-keeping and security. In addition to using a variety of corpus analyses (e.g. keywords, recurrent word combinations, fixed phrases, the study will attempt to deepen our understanding of this genre.

  13. Genetic variation of rs438601 marker in the Iranian Population: An informative marker for molecular diagnosis of hemophilia B

    Directory of Open Access Journals (Sweden)

    P Dorri

    2014-12-01

    Conclusion: The study findings demonstrated that rs438601 marker due to high heterozygosity could be suggested as an appropriate diagnostic marker in linkage analysis and carrier detection of hemophilia B in regard with a sample of Iranian population.

  14. Tumor markers in pancreatic cancer: a European Group on Tumor Markers (EGTM) status report.

    LENUS (Irish Health Repository)

    Duffy, M J

    2012-02-01

    Pancreatic ductal adenocarcinoma is one of the most difficult malignancies to diagnose and treat. The aim of this article is to review how tumor markers can aid the diagnosis and management of patients with this malignancy. The most widely used and best validated marker for pancreatic cancer is CA 19-9. Inadequate sensitivity and specificity limit the use of CA 19-9 in the early diagnosis of pancreatic cancer. In non-jaundiced patients, however, CA 19-9 may complement other diagnostic procedures. In patients with resectable pancreatic cancer, presurgical and postresection CA 19-9 levels correlate with overall survival. In advanced disease, elevated pretreatment levels of CA 19-9 are associated with adverse patient outcome and thus may be combined with other factors for risk stratification. Most, but not all, reports indicate that serial levels of CA 19-9 correlate with response to systemic therapy. Use of CA 19-9 kinetics in conjunction with imaging is therefore recommended in monitoring therapy. Although several potential serum and tissue markers for pancreatic cancer are currently undergoing evaluation, none are sufficiently validated for routine clinical use. CA 19-9 thus remains the serum pancreatic cancer marker against which new markers for this malignancy should be judged.

  15. International relations

    International Nuclear Information System (INIS)

    Anon.

    2009-01-01

    The French nuclear safety authority (A.S.N.) has participated at different meeting in European Union as nuclear decommissioning assistance programme(N.D.A.P.), Regulatory assistance management group (R.A.M.G.) and Instrument for nuclear safety cooperation (I.N.S.C.). The members of Western European nuclear regulator association (W.E.N.R.A.) met and discussed about the future of W.E.N.R.A. and its representativeness and its cooperation with European nuclear safety regulator group (E.N.S.R.E.G.) and head of European radiation control authorities (H.E.R.C.A.). About International relations it is to noticed a meeting at the invitation of IAEA to discuss about the possibility to resort to the Ines scale for medical events. An audit mission under the IAEA aegis stood at Fessenheim, O.S.A.R.T. for operational safety review team. Two years and a half passed by between the audit mission Integrated regulatory review service (I.R.S.S.) welcome by A.S.N. in november 2006 and the audit mission follow up in 2009, 12 experts from 11 different countries and coordinated by three representatives of IAEA worked, the conclusions were that 90% of recommendations made to A.S.N. in 2006 were treated in a satisfying way; the evaluation gives three new recommendations, 7 new suggestions and 11 new correct practices. A meeting of the commission on safety standards (C.S.S.) stood in april 2009. Some others meeting are to be noticed: nuclear safety and security group (N.S.S.G.), expert group on nuclear and radiation safety (E.G.N.R.S.) instituted by the council of the Baltic sea states (C.B.S.S.) treats data exchange on the national networks of dose rates and surveillance of radioactivity in air. International nuclear regulator association (I.N.R.A.) held its first meeting in april 2009 at Seoul (Korea). Bilateral relations with Poland, Italy, Ukraine and Germany planed cooperation or information exchange in the field of nuclear safety. Participation to conference in Usa, meetings with United

  16. International perspective

    International Nuclear Information System (INIS)

    2003-01-01

    The workshop dealt with two distinct cases: - In Port Hope - an existing situation impacting a set of communities affected by the nuclear fuel industry since the 1930's. This situation concerns the remediation of soil 'tainted' by a low level of radioactivity resulting from the processing of uranium. The facility that produced those wastes is still in town but it has changed ownership and it no longer stores or disposes of the waste in the area. - The issuance and upcoming implementation of the Nuclear Fuel Waste Act (NWF Act) charting a path towards the identification of a national, long-term management solution for nuclear fuel (high level) waste in Canada. The NWF Act restarts a process that was interrupted a few years ago, after the Seaborn Environmental Assessment Panel concluded that the solution proposed by proponent Atomic Energy Canada Ltd. had not been demonstrated to have broad public support. From an international perspective, numerous observations can be made and lessons can be drawn both from the individual and the combined cases. Some of the most prominent observations, in the view of the NEA Secretariat, are presented hereafter. (author)

  17. Markers and mapping revisited: finding your gene.

    Science.gov (United States)

    Jones, Neil; Ougham, Helen; Thomas, Howard; Pasakinskiene, Izolda

    2009-01-01

    This paper is an update of our earlier review (Jones et al., 1997, Markers and mapping: we are all geneticists now. New Phytologist 137: 165-177), which dealt with the genetics of mapping, in terms of recombination as the basis of the procedure, and covered some of the first generation of markers, including restriction fragment length polymorphisms (RFLPs), random amplified polymorphic DNA (RAPDs), simple sequence repeats (SSRs) and quantitative trait loci (QTLs). In the intervening decade there have been numerous developments in marker science with many new systems becoming available, which are herein described: cleavage amplification polymorphism (CAP), sequence-specific amplification polymorphism (S-SAP), inter-simple sequence repeat (ISSR), sequence tagged site (STS), sequence characterized amplification region (SCAR), selective amplification of microsatellite polymorphic loci (SAMPL), single nucleotide polymorphism (SNP), expressed sequence tag (EST), sequence-related amplified polymorphism (SRAP), target region amplification polymorphism (TRAP), microarrays, diversity arrays technology (DArT), single-strand conformation polymorphism (SSCP), denaturing gradient gel electrophoresis (DGGE), temperature gradient gel electrophoresis (TGGE) and methylation-sensitive PCR. In addition there has been an explosion of knowledge and databases in the area of genomics and bioinformatics. The number of flowering plant ESTs is c. 19 million and counting, with all the opportunity that this provides for gene-hunting, while the survey of bioinformatics and computer resources points to a rapid growth point for future activities in unravelling and applying the burst of new information on plant genomes. A case study is presented on tracking down a specific gene (stay-green (SGR), a post-transcriptional senescence regulator) using the full suite of mapping tools and comparative mapping resources. We end with a brief speculation on how genome analysis may progress into the future of

  18. Biochemical Markers for Assessing Aquatic Contamination

    Directory of Open Access Journals (Sweden)

    Zdeňka Svobodová

    2007-11-01

    Full Text Available Biochemical markers, specifically enzymes of the first phase of xenobiotic transformation - cytochrome P450 and ethoxyresorufin-O-deethylase (EROD - were used to determine the quantities of persistent organic pollutants (POPs in fish muscle (PCB, HCB, HCH, OCS, DDT. Eight rivers were monitored (Orlice, Chrudimka, Cidlina, Jizera, Vltava, Ohře and Bílina; and the River Blanice was used as a control. The indicator species selected was the chub (Leuciscus cephalus L.. There were no significant differences in cytochrome P450 content between the locations monitored. The highest concentration of cytochrome P450 in fish liver was in the Vltava (0.241 nmol mg-1 protein, and the lowest was in the Orlice (0.120 nmol mg-1 protein. Analysis of EROD activity showed a significant difference between the Blanice and the Vltava (P< 0.05, and also between the Orlice and the Vltava (P< 0.01, the Orlice and the Bílina (P< 0.01, and the Orlice and the Ohře (P< 0.05. The highest EROD activity in fish liver was in the Vltava (576.4 pmol min-1 mg-1 protein, and the lowest was in the Orlice (63.05 pmol min-1 mg-1 protein. In individual locations, results of chemical monitoring and values of biochemical markers were compared. A significant correlation (P< 0.05 was found between biochemical markers and OCS, and PCB. Among the tributaries studied those that contaminated the Elbe most were the Vltava and the Bílina. These tributaries should not be considered the main sources of industrial contamination of the River Elbe, because the most important contamination sources were along the river Elbe itself.

  19. Salivary exoglycosidases as markers of alcohol dependence.

    Science.gov (United States)

    Waszkiewicz, Napoleon; Chojnowska, Sylwia; Zalewska, Anna; Zwierz, Krzysztof; Szulc, Agata; Szajda, Sławomir Dariusz

    2014-01-01

    Some salivary markers of alcohol abuse/dependence have been proposed so far: aminotransferases, gamma-glutamyltransferase, ethanol, ethyl glucuronide, ethyl sulfate, sialic acid, β-hexosaminidase A, oral peroxidase, methanol, diethylene/ethylene glycol, α-amylase, clusterin, haptoglobin, heavy/light chains of immunoglobulins and transferrin. To investigate the effect of chronic alcohol drinking and smoking on the activity (pKat/ml) and output (pKat/min) of salivary lysosomal exoglycosidases: α-fucosidase (FUC), α-mannosidase (MAN), β-galactosidase (GAL), and β-glucuronidase (GLU), and their applicability as markers of alcohol dependence. The activity of FUC, MAN, GAL and GLU was measured colorimetrically in the saliva of healthy social drinkers, alcohol-dependent non-smokers and alcohol-dependent smokers. We observed an increased salivary activity of FUC, GAL, GLU and MAN, as well as an increased output of GAL and GLU, in comparison with controls. The highest increase in the activity/output was found in salivary GLU and MAN (GLU, even 7- to 18-fold), and the least in GAL. We found an excellent sensitivity and specificity and a high accuracy (measured by the area under the ROC curve) for salivary FUC, GLU and MAN activities. The salivary GLU activity positively correlated with the number of days of last alcohol intoxication. Salivary activity of FUC, GAL and MAN, but not GLU, positively correlated with the periodontal parameters such as gingival index and papilla bleeding index. Although we found an excellent sensitivity and specificity as well as a high accuracy for the salivary activity of FUC, GLU and MAN, the GLU activity seems to be mostly applicable as a marker of chronic alcohol drinking (alcohol dependence). © The Author 2014. Medical Council on Alcohol and Oxford University Press. All rights reserved.

  20. Bacterial and fungal markers in tobacco smoke

    International Nuclear Information System (INIS)

    Szponar, B.; Pehrson, C.; Larsson, L.

    2012-01-01

    Previous research has demonstrated that cigarette smoke contains bacterial and fungal components including lipopolysaccharide (LPS) and ergosterol. In the present study we used gas chromatography–mass spectrometry to analyze tobacco as well as mainstream and second hand smoke for 3-hydroxy fatty acids (3-OH FAs) of 10 to 18 carbon chain lengths, used as LPS markers, and ergosterol, used as a marker of fungal biomass. The air concentrations of LPS were 0.0017 nmol/m 3 (N = 5) and 0.0007/m 3 (N = 6) in the smoking vs. non-smoking rooms (p = 0.0559) of the studied private houses, and 0.0231 nmol/m 3 (N = 5) vs. 0.0006 nmol/m 3 (N = 5) (p = 0.0173), respectively, at the worksite. The air concentrations of ergosterol were also significantly higher in rooms with ongoing smoking than in rooms without smoking. A positive correlation was found between LPS and ergosterol in rooms with smoking but not in rooms without smoking. 3-OH C14:0 was the main 3-OH FA, followed by 3-OH C12:0, both in mainstream and second hand smoke and in phenol:water smoke extracts prepared in order to purify the LPS. The Limulus activity of the phenolic phase of tobacco was 3900 endotoxin units (EU)/cigarette; the corresponding amount of the smoke, collected on filters from 8 puffs, was 4 EU/cigarette. Tobacco smoking has been associated with a range of inflammatory airway conditions including COPD, asthma, bronchitis, alveolar hypersensitivity etc. Significant levels of LPS and ergosterol were identified in tobacco smoke and these observations support the hypothesis that microbial components of tobacco smoke contribute to inflammation and airway disease. -- Highlights: ► Air concentration of bacterial and fungal markers is significantly higher in rooms with ongoing smoking than without smoking. ► Bacterial LPS correlates with fungal marker in rooms with ongoing smoking but not without smoking. ► LPS from mainstream smoke contains 3-hydroxy 14:0 and 12:0 fatty acids in similar proportion as

  1. Genetic markers for flowering in perennial ryegrass

    DEFF Research Database (Denmark)

    Paina, Cristiana; Byrne, Stephen; Andersen, Jeppe Reitan

    2011-01-01

    Perennial ryegrass (Lolium perenne L.) is the principal forage grass utilized in Danish agriculture and underpins the beef and dairy sectors. It is characterized as having high digestibility, high nutritional value, and high productivity during vegetative growth. However, at the reproductive growth...... genes will be converted to molecular markers and mapped in an existing mapping population previously characterized for flowering time and vernalization response. References: Amasino, R.M., Michaels S.D. (2010). The Timing of Flowering. Plant Physiology 154: 516–520 Greenup, A., W. Peacock, W.J., Dennis...

  2. Connective tissue markers of rheumatoid arthritis

    DEFF Research Database (Denmark)

    Møller, H J

    1998-01-01

    Rheumatoid arthritis (RA) is a common systemic autoimmune disorder of unknown aetiology. The most common outcome of RA is a progressive development of joint destruction and deformity. Early introduction of disease-modifying antirheumatic drugs seems important for prevention of the long term...... of rheumatoid factor contributes to the classification of arthritis as RA, and acute phase reactants are useful for quantifying and comparing the level of inflammatory activity in the course of a given patient. There is, however, a lack of sensitive and specific biochemical markers for RA, and frontline...

  3. [Circadian markers and genes in bipolar disorder].

    Science.gov (United States)

    Yeim, S; Boudebesse, C; Etain, B; Belliviera, F

    2015-09-01

    Bipolar disorder is a severe and complex multifactorial disease, characterized by alternance of acute episodes of depression and mania/hypomania, interspaced by euthymic periods. The etiological determinants of bipolar disorder yet, are still poorly understood. For the last 30 years, chronobiology is an important field of investigation to better understand the pathophysiology of bipolar disorder. We conducted a review using Medline, ISI Database, EMBase, PsyInfo up to January 2015, using the following keywords combinations: "mood disorder", "bipolar disorder", "depression", "unipolar disorder", "major depressive disorder", "affective disorder", for psychiatric conditions; and "circadian rhythms", "circadian markers", "circadian gene", "clock gene", "melatonin" for circadian rhythms. The search critera was presence of word in any field of the article. Quantitative and qualitative circadian abnormalities are associated with bipolar disorders both during acute episodes and euthymic periods, suggesting that these altered circadian rhythms may represent biological trait markers of the disorder. These circadian dysfunctions were assessed by various validated tools including polysomnography, actigraphy, sleep diaries, chronotype assessments and blood melatonin/cortisol measures. Other altered endogenous circadian activities have also been reported in bipolar patients, such as hormones secretion, core body temperature or fibroblasts activity. Moreover, these markers were also altered in healthy relatives of bipolar patients, suggesting a degree of heritability. Several genetic association studies have also showed associations between multiple circadian genes and bipolar disorder, such as CLOCK, ARTNL1, GSK3β, PER3, NPAS2, NR1D1, TIMELESS, RORA, RORB, and CSNK1ε. Thus, these circadian gene variants may contribute to the genetic susceptibility of the disease. Furthermore, the study of the clock system may help to better understand some phenotypic aspects like the

  4. Bacterial and fungal markers in tobacco smoke

    Energy Technology Data Exchange (ETDEWEB)

    Szponar, B., E-mail: szponar@iitd.pan.wroc.pl [Lund University, Dept. of Laboratory Medicine, Soelvegatan 23, 223 62 Lund (Sweden); Institute of Immunology and Experimental Therapy, Polish Academy of Sciences, Rudolfa Weigla 12, 53-114 Wroclaw (Poland); Pehrson, C.; Larsson, L. [Lund University, Dept. of Laboratory Medicine, Soelvegatan 23, 223 62 Lund (Sweden)

    2012-11-01

    Previous research has demonstrated that cigarette smoke contains bacterial and fungal components including lipopolysaccharide (LPS) and ergosterol. In the present study we used gas chromatography-mass spectrometry to analyze tobacco as well as mainstream and second hand smoke for 3-hydroxy fatty acids (3-OH FAs) of 10 to 18 carbon chain lengths, used as LPS markers, and ergosterol, used as a marker of fungal biomass. The air concentrations of LPS were 0.0017 nmol/m{sup 3} (N = 5) and 0.0007/m{sup 3} (N = 6) in the smoking vs. non-smoking rooms (p = 0.0559) of the studied private houses, and 0.0231 nmol/m{sup 3} (N = 5) vs. 0.0006 nmol/m{sup 3} (N = 5) (p = 0.0173), respectively, at the worksite. The air concentrations of ergosterol were also significantly higher in rooms with ongoing smoking than in rooms without smoking. A positive correlation was found between LPS and ergosterol in rooms with smoking but not in rooms without smoking. 3-OH C14:0 was the main 3-OH FA, followed by 3-OH C12:0, both in mainstream and second hand smoke and in phenol:water smoke extracts prepared in order to purify the LPS. The Limulus activity of the phenolic phase of tobacco was 3900 endotoxin units (EU)/cigarette; the corresponding amount of the smoke, collected on filters from 8 puffs, was 4 EU/cigarette. Tobacco smoking has been associated with a range of inflammatory airway conditions including COPD, asthma, bronchitis, alveolar hypersensitivity etc. Significant levels of LPS and ergosterol were identified in tobacco smoke and these observations support the hypothesis that microbial components of tobacco smoke contribute to inflammation and airway disease. -- Highlights: Black-Right-Pointing-Pointer Air concentration of bacterial and fungal markers is significantly higher in rooms with ongoing smoking than without smoking. Black-Right-Pointing-Pointer Bacterial LPS correlates with fungal marker in rooms with ongoing smoking but not without smoking. Black-Right-Pointing-Pointer LPS

  5. Induced marker gene mutations in soybean

    International Nuclear Information System (INIS)

    Sawada, S.; Palmer, R.G.

    1989-01-01

    Full text: Non-fluorescent root mutants in soybean are useful as markers in genetic studies. 13 such mutants were detected among more than 150 000 seedlings derived from soybean lines treated with 6 mutagens. One of them, derived from variety 'Williams' treated with 20 kR gamma rays, did not correspond to the already known spontaneous non-fluorescent mutants. It was assigned the identification no. T285 and the gene symbol fr5. The other mutants corresponded with known loci fr1, fr2 or fr4. (author)

  6. Fatigue as prognostic risk marker of mental sickness absence in white collar employees.

    Science.gov (United States)

    Roelen, C A M; Heymans, M W; van Rhenen, W; Groothoff, J W; Twisk, J W R; Bültmann, U

    2014-06-01

    To investigate fatigue as prognostic risk marker for identifying working employees at risk of long-term sickness absence (SA). At baseline, fatigue was measured in 633 white collar employees with the checklist individual strength (CIS) including scales for fatigue severity, reduced concentration, reduced motivation, and reduced physical activity. SA was medically certified by an occupational physician in the 3rd or 4th SA week with diagnostic codes according to the 10th version of the International Classification of Diseases. Medically certified SA was retrieved at the individual level from an occupational health register after 1-year follow-up. CIS scores were investigated as prognostic risk markers predicting medically certified SA and particularly SA certified as mental SA. 614 employees (N = 378 men and N = 236 women) had complete data and were eligible for analysis; 63 (10 %) had medically certified SA of whom 39 (6 %) had mental SA. Fatigue severity and total CIS scores were associated with medically certified SA in men, but poorly discriminated between men with and without medically certified SA. Fatigue severity, reduced concentration, reduced motivation, and total CIS scores were also associated with mental SA in men. CIS and its reduced concentration scale were valid prognostic risk markers of mental SA. CONCLUSION Fatigue was a prognostic risk marker of mental SA in white collar men. The CIS should be further validated as a screening tool for the risk of mental SA in white collar working populations.

  7. Experimental gingivitis induces systemic inflammatory markers in young healthy individuals: a single-subject interventional study.

    Science.gov (United States)

    Eberhard, Jörg; Grote, Karsten; Luchtefeld, Maren; Heuer, Wieland; Schuett, Harald; Divchev, Dimitar; Scherer, Ralph; Schmitz-Streit, Ruth; Langfeldt, Daniela; Stumpp, Nico; Staufenbiel, Ingmar; Schieffer, Bernhard; Stiesch, Meike

    2013-01-01

    We here investigated whether experimental gingivitis enhances systemic markers of inflammation which are also known as surrogate markers of atherosclerotic plaque development. Gingivitis is a low-level oral infection induced by bacterial deposits with a high prevalence within Western populations. A potential link between the more severe oral disease periodontitis and cardiovascular disease has already been shown. 37 non-smoking young volunteers with no inflammatory disease or any cardiovascular risk factors participated in this single-subject interventional study with an intra-individual control. Intentionally experimental oral inflammation was induced by the interruption of oral hygiene for 21 days, followed by a 21-days resolving phase after reinitiation of oral hygiene. Primary outcome measures at baseline, day 21 and 42 were concentrations of hsCRP, IL-6, and MCP-1, as well as adhesion capacity and oxLDL uptake of isolated blood monocytes. The partial cessation of oral hygiene procedures was followed by the significant increase of gingival bleeding (34.0%, Pgingivitis. Bacterial-induced gingival low-level inflammation induced a systemic increase in inflammatory markers. Dental hygiene almost completely reversed this experimental inflammatory process, suggesting that appropriate dental prophylaxis may also limit systemic markers of inflammation in subjects with natural gingivitis. International Clinical Trials Register Platform of the World Health Organization, registry number: DRKS00003366, URL: http://apps.who.int/trialsearch/Default.aspx.

  8. Microsatellite markers linked to the locus of the watermelon fruit stripe pattern.

    Science.gov (United States)

    Gama, R N C S; Santos, C A F; Dias, R C S; Alves, J C S F; Nogueira, T O

    2015-01-16

    Agronomic performance and external and internal appearance of watermelon (Citrullus lanatus) fruit are important traits that should be taken into consideration during the development of a new cultivar, as well as being the principal identification elements used by the consumer, which are based on the external appearance and quality of the fruit. Externally, the fruit can be characterized in terms of the shape, the color of the lower rind, and the presence of grooves and stripes, the stripes can be classified as clearly defined or diffuse. The objective of this study was to identify microsatellite markers linked to the stripe pattern of watermelon fruit to support watermelon improvement programs, with the selection of this characteristic in the plantlet stage. F1 and F2 populations, result of a cross between the cultivars BRS Opara (clearly defined stripes) and Pérola (diffuse stripes), were phenotyped for their fruit stripe pattern. The CTAB 2X protocol was used for DNA extraction and 116 microsatellite markers were examined in a group of F2 plants that had fruit with well-defined stripes and fruit with diffuse stripes. The microsatellite loci MCPI_05 and MCPI_16 exhibited a linkage to the stripe pattern at a distance of 1.5 and 1.8 cM, respectively, with LOD scores of 39.28 and 38.11, respectively, which were located on chromosome six of the watermelon genome. These markers can be used in marker-assisted selection in watermelon improvement programs, by various research institutions.

  9. Assessing Date Palm Genetic Diversity Using Different Molecular Markers.

    Science.gov (United States)

    Atia, Mohamed A M; Sakr, Mahmoud M; Adawy, Sami S

    2017-01-01

    Molecular marker technologies which rely on DNA analysis provide powerful tools to assess biodiversity at different levels, i.e., among and within species. A range of different molecular marker techniques have been developed and extensively applied for detecting variability in date palm at the DNA level. Recently, the employment of gene-targeting molecular marker approaches to study biodiversity and genetic variations in many plant species has increased the attention of researchers interested in date palm to carry out phylogenetic studies using these novel marker systems. Molecular markers are good indicators of genetic distances among accessions, because DNA-based markers are neutral in the face of selection. Here we describe the employment of multidisciplinary molecular marker approaches: amplified fragment length polymorphism (AFLP), start codon targeted (SCoT) polymorphism, conserved DNA-derived polymorphism (CDDP), intron-targeted amplified polymorphism (ITAP), simple sequence repeats (SSR), and random amplified polymorphic DNA (RAPD) to assess genetic diversity in date palm.

  10. Ion beam mixing of marker layers in Al and Si

    International Nuclear Information System (INIS)

    Mantl, S.; Rehn, L.E.; Averback, R.S.; Thompson, L.J. Jr.

    1984-07-01

    Ion beam mixing experiments on thin Pt, Au, and Ni markers in Al and Si have performed at 17, 85, and 300 K. After irradiation with 300-keV Ar ions the broadening and relative shifts of the markers have been determined by RBS measurements. The marker broadenings are more pronounced in Si than in Al; in both matrices the broadenings decrease in the following order: Au, Pt, and Ni. No dependence of mixing on irradiation temperature was observed between 17 and 300 K. The shifts of the heavy Au and Pt markers relative to the Ni markers are approximately equal to the experimental accuracy. However, a shift of the Ni marker toward the surface relative to the heavier Au and Pt markers was consistently observed. 13 references, 2 figures

  11. Internal Audit Service | Internal Audit Service

    Science.gov (United States)

    their internal auditing function in the areas of professional excellence, quality of service and Students and teachers Media Internal Audit Service Navbar Toggle Home About the Staff Risk Assessment and Planning Internal Audit Process Search for Search Home The mission of the Fermilab Internal Audit Service

  12. Internal amplification control of PCR for the Glu1-Dx5 allele in wheat.

    Science.gov (United States)

    Heim, H N; Vieira, E S N; Polo, L R T; Lima, N K; Silva, G J; Linde, G A; Colauto, N B; Schuster, I

    2017-08-17

    One of the limiting factors in using dominant markers is the unique amplification of the target fragment. Therefore, failures in polymerase chain reaction (PCR) or non-amplifications can be interpreted as an absence of the allele. The possibility of false negatives implies in reduced efficiency in the selection process in genetic breeding programs besides the loss of valuable genetic material. Thus, this study aimed to evaluate the viability of a microsatellite marker as an internal amplification control with a dominant marker for the wheat Glu1-Dx5 gene. A population of 77 wheat cultivars/breeding lines was analyzed. Fourteen microsatellite markers were analyzed in silico regarding the formation of dimers and clamps. The biplex reaction conditions were optimized, and the Xbarc117 marker was selected as the internal amplification control with a Glu1-Dx5 marker in wheat. It was concluded that the Xbarc117 microsatellite marker was effective in the simultaneous amplification with a dominant Glu1-Dx5 marker, making biplex PCR viable in wheat for the studied markers.

  13. Uniparental genetic markers in South Amerindians

    Directory of Open Access Journals (Sweden)

    Rafael Bisso-Machado

    2012-01-01

    Full Text Available A comprehensive review of uniparental systems in South Amerindians was undertaken. Variability in the Y-chromosome haplogroups were assessed in 68 populations and 1,814 individuals whereas that of Y-STR markers was assessed in 29 populations and 590 subjects. Variability in the mitochondrial DNA (mtDNA haplogroup was examined in 108 populations and 6,697 persons, and sequencing studies used either the complete mtDNA genome or the highly variable segments 1 and 2. The diversity of the markers made it difficult to establish a general picture of Y-chromosome variability in the populations studied. However, haplogroup Q1a3a* was almost always the most prevalent whereas Q1a3* occurred equally in all regions, which suggested its prevalence among the early colonizers. The STR allele frequencies were used to derive a possible ancient Native American Q-clade chromosome haplotype and five of six STR loci showed significant geographic variation. Geographic and linguistic factors moderately influenced the mtDNA distributions (6% and 7%, respectively and mtDNA haplogroups A and D correlated positively and negatively, respectively, with latitude. The data analyzed here provide rich material for understanding the biological history of South Amerindians and can serve as a basis for comparative studies involving other types of data, such as cultural data.

  14. Biological markers of Alzheimer?s disease

    Directory of Open Access Journals (Sweden)

    Leonardo Cruz de Souza

    2014-03-01

    Full Text Available The challenges for establishing an early diagnosis of Alzheimer’s disease (AD have created a need for biomarkers that reflect the core pathology of the disease. The cerebrospinal fluid (CSF levels of total Tau (T-tau, phosphorylated Tau (P-Tau and beta-amyloid peptide (Aβ42 reflect, respectively, neurofibrillary tangle and amyloid pathologies and are considered as surrogate markers of AD pathophysiology. The combination of low Aβ42 and high levels of T-tau and P-Tau can accurately identify patients with AD at early stages, even before the development of dementia. The combined analysis of the CSF biomarkers is also helpful for the differential diagnosis between AD and other degenerative dementias. The development of these CSF biomarkers has evolved to a novel diagnostic definition of the disease. The identification of a specific clinical phenotype combined with the in vivo evidence of pathophysiological markers offers the possibility to make a diagnosis of AD before the dementia stage with high specificity.

  15. Application of molecular markers in apple breeding

    Directory of Open Access Journals (Sweden)

    Marić Slađana

    2010-01-01

    Full Text Available Apple is economically the most important species of genus Malus Miller. In respect of production, trade and consumption, it ranks first among deciduous fruit and third on a global scale among all fruit species. Apple breeding is carried out on a large scale in several scientific institutes throughout the world. Due to this activity, apple is a fruit species with the highest number of described monogenic traits; 76 genes, encoding morphological traits, pest and disease resistance, as well as 69 genes encoding enzymes. The development of molecular markers (RFLPs, AFLPs, SCARs and SSRs has allowed the mapping of the apple genome and the development of several saturated genetic maps, to which genes controlling important traits are assigned. Markers flanking these genes not only play an important role in selecting parental combinations and seedlings with positive traits, but they are also particularly important in detecting recessive traits, such as seedless fruit. In addition they enable pre-selection for polygenic quantitative traits. In recent years, particular attention has been paid to biochemical and physiological processes involved in the pathway of important traits e.g., ripening and the storage capability of apple fruit.

  16. A small population of resident limb bud mesenchymal cells express few MSC-associated markers, but the expression of these markers is increased immediately after cell culture.

    Science.gov (United States)

    Marín-Llera, Jessica Cristina; Chimal-Monroy, Jesús

    2018-05-01

    Skeletal progenitors are derived from resident limb bud mesenchymal cells of the vertebrate embryos. However, it remains poorly understood if they represent stem cells, progenitors, or multipotent mesenchymal stromal cells (MSC). Derived-MSC of different adult tissues under in vitro experimental conditions can differentiate into the same cellular lineages that are present in the limb. Here, comparing non-cultured versus cultured mesenchymal limb bud cells, we determined the expression of MSC-associated markers, the in vitro differentiation capacity and their gene expression profile. Results showed that in freshly isolated limb bud mesenchymal cells, the proportion of cells expressing Sca1, CD44, CD105, CD90, and CD73 is very low and a low expression of lineage-specific genes was observed. However, recently seeded limb bud mesenchymal cells acquired Sca1 and CD44 markers and the expression of the key differentiation genes Runx2 and Sox9, while Scx and Pparg genes decreased. Also, their chondrogenic differentiation capacity decreased through cellular passages while the osteogenic increased. Our findings suggest that the modification of the cell adhesion process through the in vitro method changed the limb mesenchymal cell immunophenotype leading to the expression and maintenance of common MSC-associated markers. These findings could have a significant impact on MSC study and isolation strategy because they could explain common variations observed in the MSC immunophenotype in different tissues. © 2018 International Federation for Cell Biology.

  17. Improving selection of markers in nutrition research: evaluation of the criteria proposed by the ILSI Europe Marker Validation Initiative.

    Science.gov (United States)

    Calder, Philip C; Boobis, Alan; Braun, Deborah; Champ, Claire L; Dye, Louise; Einöther, Suzanne; Greyling, Arno; Matthys, Christophe; Putz, Peter; Wopereis, Suzan; Woodside, Jayne V; Antoine, Jean-Michel

    2017-06-01

    The conduct of high-quality nutrition research requires the selection of appropriate markers as outcomes, for example as indicators of food or nutrient intake, nutritional status, health status or disease risk. Such selection requires detailed knowledge of the markers, and consideration of the factors that may influence their measurement, other than the effects of nutritional change. A framework to guide selection of markers within nutrition research studies would be a valuable tool for researchers. A multidisciplinary Expert Group set out to test criteria designed to aid the evaluation of candidate markers for their usefulness in nutrition research and subsequently to develop a scoring system for markers. The proposed criteria were tested using thirteen markers selected from a broad range of nutrition research fields. The result of this testing was a modified list of criteria and a template for evaluating a potential marker against the criteria. Subsequently, a semi-quantitative system for scoring a marker and an associated template were developed. This system will enable the evaluation and comparison of different candidate markers within the same field of nutrition research in order to identify their relative usefulness. The ranking criteria of proven, strong, medium or low are likely to vary according to research setting, research field and the type of tool used to assess the marker and therefore the considerations for scoring need to be determined in a setting-, field- and tool-specific manner. A database of such markers, their interpretation and range of possible values would be valuable to nutrition researchers.

  18. Evaluation of Tumor Markers and Their Impact on Prognosis in Gallbladder, Bile Duct and Cholangiocellular Carcinomas - A Pilot Study.

    Science.gov (United States)

    Liska, Vaclav; Treska, Vladislav; Skalicky, Tomas; Fichtl, Jakub; Bruha, Jan; Vycital, Ondrej; Topolcan, Ondrej; Palek, Richard; Rosendorf, Jachym; Polivka, Jiri; Holubec, Lubos

    2017-04-01

    The behavior of tumor markers in biliary tract malignancies is not well-known and has been scarcely studied. Such markers could play important roles in diagnostic and prognostic schemes as well as in decision-making about the best treatment strategies. This study analyzed the preoperative serum levels of conventional tumor markers (AFP, CEA, CA 19-9, CA 72-4), proliferative marker thymidine kinase (TK) and cytokeratins (TPA, TPS and CYFRA 21.1) in patients with gallbladder carcinoma, bile duct carcinoma (Klatskin) and cholangiocellular carcinoma, in relation to the patient prognosis. The study aimed in finding the role of tumor markers in not properly investigated diseases, where their importance is often marginalized. The study included 43 patients, who underwent either radical surgical procedure (n=21) or explorative laparotomy without any surgical treatment (n=22) for gallbladder carcinoma, bile duct carcinoma (Klatskin tumor) and cholangiocellular carcinoma (24, 8 and 11 patients, respectively) between 2003 and 2010 at our Department. The association of serum tumor markers and patients' prognosis were assessed for the entire cohort and for each cancer type and also with regard to treatment (radical surgery versus explorative laparotomy). Overall survival (OS) and disease-free interval (DFI) were estimated by the Kaplan-Meier method and statistically evaluated using the LogRank test. DFI was computed only in the subgroup of patients treated by radical surgery. The statistical analysis of tumor markers revealed TK as a poor prognostic factor for shorter DFI (HR=3.5, 95%CI=0.6-21.3, ptumor markers for assessment of prognosis (OS or DFI) in patients with gallbladder carcinoma, bile duct carcinoma, and cholangiocellular carcinoma. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  19. Tumor markers in breast cancer- European Group on Tumor Markers recommendations

    DEFF Research Database (Denmark)

    Molina, Rafael; Barak, Vivian; van Dalen, Arie

    2005-01-01

    in the selection of patients for treatment with hormone therapy, while HER-2 is essential in selecting patients with advanced breast cancer for treatment with Herceptin (trastuzumab). Urokinase plasminogen activator and plasminogen activator inhibitor 1 are recently validated prognostic markers for lymph node...

  20. Development of diagnostic markers from disease resistance QTLs for marker-assisted breeding in peanut

    Science.gov (United States)

    Breeding for disease resistance in peanut cultivars has been constrained due to both a narrow genetic base and a low degree of polymorphism. Earlier attempts have resulted in the development of a few hundreds of simple sequence repeat (SSR) markers in peanut that could define broad QTL on the physic...

  1. Metadiscourse Markers of Online Texts: English and Persian Online Headlines Use of Metadiscourse Markers

    Science.gov (United States)

    Yazdani, Akram; Salehi, Hadi

    2016-01-01

    The aim of the present study was to illuminate the differences between Persian and English in online headlines in terms of applying metadiscourse markers in the first two months of the year 2015. To fulfill this purpose, 100 Persian and English online headlines (each 50 headlines) were chosen randomly from English and Persian newscasts such as…

  2. THE EXPRESSION OF Hsa-miR-21-5p AS MINIMAL INVASIVE MARKER TO ADJUVANT CHEMOTHERAPY IN BREAST CANCER PATIENTS

    Directory of Open Access Journals (Sweden)

    Dewi Safitri Tanjung

    2017-02-01

    Full Text Available Abstract Breast cancer remains the leading cause of death among women, and there is a need to develop minimally invasive marker. In our previous study based on clinicopathologic in pre-chemotherapy patients showed miR-21 was upregulated 1.32 times higher at advanced stage compared with early stage. Therefore the matched patients for post-chemotherapy samples were used. The aim of this research is to examine the expression of miR-21 as potential marker to adjuvant chemotherapy in breast cancer patients. The samples were taken by using cross sectional method with total 39 blood plasma samples from breast cancer patients in adjuvant chemotherapy and 12 healthy control samples. Plasma was obtained from blood samples and then RNA isolated were performed. Total RNA was reverse transcribed using cDNA synthesis. The expression of miR-21 was then analyzed using specific primer for miR-21 and miR-16 as the reference gene. Livak Method was used to calculate the expression level in each group. The result showed that there is significant downregulated expression of miR-21 in postchemotherapy 2.61 fold compared with pre-chemotherapy (p<0.05. The expression of miR-21 upregulated 2.2 folds (p<0.05 in pre-chemotherapy compared with healthy control, while in post-chemotherapy compared with healthy control, the expression of miR-21 was 0.8 fold (p<0.05. In conclusion, Hsa-miR-21-5p can be used as marker for adjuvant chemotherapy response in breast cancer because there is significant different expression between prechemotherapy, post-chemotherapy and healthy control. The continuation research in the near future for detecting the expression of tumor suppressor protein regulated by miR-21 is needed. Keywords: breast cancer, adjuvant chemotherapy, miR-21, minimal invasive marker

  3. Predicting Missing Marker Trajectories in Human Motion Data Using Marker Intercorrelations.

    Science.gov (United States)

    Gløersen, Øyvind; Federolf, Peter

    2016-01-01

    Missing information in motion capture data caused by occlusion or detachment of markers is a common problem that is difficult to avoid entirely. The aim of this study was to develop and test an algorithm for reconstruction of corrupted marker trajectories in datasets representing human gait. The reconstruction was facilitated using information of marker inter-correlations obtained from a principal component analysis, combined with a novel weighting procedure. The method was completely data-driven, and did not require any training data. We tested the algorithm on datasets with movement patterns that can be considered both well suited (healthy subject walking on a treadmill) and less suited (transitioning from walking to running and the gait of a subject with cerebral palsy) to reconstruct. Specifically, we created 50 copies of each dataset, and corrupted them with gaps in multiple markers at random temporal and spatial positions. Reconstruction errors, quantified by the average Euclidian distance between predicted and measured marker positions, was ≤ 3 mm for the well suited dataset, even when there were gaps in up to 70% of all time frames. For the less suited datasets, median reconstruction errors were in the range 5-6 mm. However, a few reconstructions had substantially larger errors (up to 29 mm). Our results suggest that the proposed algorithm is a viable alternative both to conventional gap-filling algorithms and state-of-the-art reconstruction algorithms developed for motion capture systems. The strengths of the proposed algorithm are that it can fill gaps anywhere in the dataset, and that the gaps can be considerably longer than when using conventional interpolation techniques. Limitations are that it does not enforce musculoskeletal constraints, and that the reconstruction accuracy declines if applied to datasets with less predictable movement patterns.

  4. A CONTRASTIVE ANALYSIS OF ARABIC AND ENGLISH NOUN PLURAL MARKERS

    Directory of Open Access Journals (Sweden)

    Aliyatul Himmah

    2015-01-01

    Full Text Available This paper is attempting to explore the plural markers in both Arabic and English. The data collected qualitatively are sorted to meet the scope of this paper. Through contrastive analysis, it is discovered that there are numerous significant differences rather than similarities in terms of syllable count start, patterns of plural nouns in relation to gender, regularity, regular vs irregular plural and internal vowel change. Moreover, Arabic has some uniqueness in its plural marking system. Being well informed on all of these might pave the way for second or foreign language learners to comprehensively understand the plural marking system in Arabic and English.   Tulisan ini mencoba untuk mengeksplorasi penanda jamak dalam bahasa Arab dan bahasa Inggris. Data yang dikumpulkan secara kualitatif diurutkan untuk memenuhi cakupan makalah ini. Melalui analisis kontrastif, ditemukan banyak perbedaan yang signifikan daripada kesamaan dalam segi jumlah awal suku kata, pola kata benda jamak dalam kaitannya dengan gender, keteraturan dan ketidakteraturan jamak, serta perubahan vokal. Selain itu, bahasa Arab memiliki beberapa keunikan dalam sistem menandai jamaknya. Memahami informasi hal tersebut dengan baik mungkin memudahkan pembelajar bahasa kedua atau asing untuk memahami secara komprehensif sistem penanda jamak dalam bahasa Arab dan Inggris

  5. Social Markers of Mild Cognitive Impairment: Proportion of Word Counts in Free Conversational Speech.

    Science.gov (United States)

    Dodge, Hiroko H; Mattek, Nora; Gregor, Mattie; Bowman, Molly; Seelye, Adriana; Ybarra, Oscar; Asgari, Meysam; Kaye, Jeffrey A

    2015-01-01

    Detecting early signs of Alzheimer's disease (AD) and mild cognitive impairment (MCI) during the pre-symptomatic phase is becoming increasingly important for costeffective clinical trials and also for deriving maximum benefit from currently available treatment strategies. However, distinguishing early signs of MCI from normal cognitive aging is difficult. Biomarkers have been extensively examined as early indicators of the pathological process for AD, but assessing these biomarkers is expensive and challenging to apply widely among pre-symptomatic community dwelling older adults. Here we propose assessment of social markers, which could provide an alternative or complementary and ecologically valid strategy for identifying the pre-symptomatic phase leading to MCI and AD. The data came from a larger randomized controlled clinical trial (RCT), where we examined whether daily conversational interactions using remote video telecommunications software could improve cognitive functions of older adult participants. We assessed the proportion of words generated by participants out of total words produced by both participants and staff interviewers using transcribed conversations during the intervention trial as an indicator of how two people (participants and interviewers) interact with each other in one-on-one conversations. We examined whether the proportion differed between those with intact cognition and MCI, using first, generalized estimating equations with the proportion as outcome, and second, logistic regression models with cognitive status as outcome in order to estimate the area under ROC curve (ROC AUC). Compared to those with normal cognitive function, MCI participants generated a greater proportion of words out of the total number of words during the timed conversation sessions (p=0.01). This difference remained after controlling for participant age, gender, interviewer and time of assessment (p=0.03). The logistic regression models showed the ROC AUC of

  6. Anthropopression markers in lake bottom sediments

    Science.gov (United States)

    Nadolna, Anna; Nowicka, Barbara

    2014-05-01

    Lakes are vulnerable to various types of anthropogenic disturbances. Responses of lake ecosystems to environmental stressors are varied and depend not only on the type of a factor but also on the lake natural resistance to degradation. Within the EULAKES project an evaluation of anthropogenic stress extent in a flow-through, postglacial, ribbon lake (Lake Charzykowskie) was carried out. It was assumed, that this impact manifests unevenly, depending on a type and degree of the pressure on the shore zones, water quality of tributaries, lake basin shape and dynamics of a water movement. It was stated, that anthropogenic markers are substances accumulated in bottom sediments as a result of allochthonous substances inflow from the catchment and atmosphere. Along the selected transects 105 samples from the top layer of sediments (about 20 cm) was collected representing the contemporary accumulation (about 15 years). The content of selected chemical elements and compounds was examined, including nutrients (TN and TP), heavy metals (arsenic, cadmium, lead, chromium, nickel, copper, zinc, mercury, iron, and manganese) and pesticides (DDT, DDD, DDE, DMDT , γ-HCH). The research was conducted in the deepest points of each lake basin and along the research transects - while choosing the spots, the increased intensity of anthropogenic impact (ports, roads with heavy traffic, wastewater discharge zones, built-up areas) was taken into consideration. The river outlets to the lake, where there are ecotonal zones between limnic and fluvial environment, were also taken into account. Analysis of the markers distribution was carried out against the diversity of chemical characteristics of limnic sediments. Ribbon shape of the lake basin and the dominant wind direction provide an opportunity of easy water mixing to a considerable depth. Intensive waving processes cause removal of the matter from the littoral zone towards lake hollows (separated by the underwater tresholds), where the

  7. Accuracy of an infrared marker-based patient positioning system (ExacTrac®) for stereotactic body radiotherapy in localizing the planned isocenter using fiducial markers

    Science.gov (United States)

    Montes-Rodríguez, María de los Ángeles; Hernández-Bojórquez, Mariana; Martínez-Gómez, Alma Angélica; Contreras-Pérez, Agustín; Negrete-Hernández, Ingrid Mireya; Hernández-Oviedo, Jorge Omar; Mitsoura, Eleni; Santiago-Concha, Bernardino Gabriel

    2014-11-01

    Stereotactic Body Radiation Therapy (SBRT) requires a controlled immobilization and position monitoring of patient and target. The purpose of this work is to analyze the performance of the imaging system ExacTrac® (ETX) using infrared and fiducial markers. Materials and methods: In order to assure the accuracy of isocenter localization, a Quality Assurance procedure was applied using an infrared marker-based positioning system. Scans were acquired of an inhouse-agar gel and solid water phantom with infrared spheres. In the inner part of the phantom, three reference markers were delineated as reference and one pellet was place internally; which was assigned as the isocenter. The iPlan® RT Dose treatment planning system. Images were exported to the ETX console. Images were acquired with the ETX to check the correctness of the isocenter placement. Adjustments were made in 6D the reference markers were used to fuse the images. Couch shifts were registered. The procedure was repeated for verification purposes. Results: The data recorded of the verifications in translational and rotational movements showed averaged 3D spatial uncertainties of 0.31 ± 0.42 mm respectively 0.82° ± 0.46° in the phantom and the first correction of these uncertainties were of 1.51 ± 1.14 mm respectively and 1.37° ± 0.61°. Conclusions: This study shows a high accuracy and repeatability in positioning the selected isocenter. The ETX-system for verifying the treatment isocenter position has the ability to monitor the tracing position of interest, making it possible to be used for SBRT positioning within uncertainty ≤1mm.

  8. Accuracy of an infrared marker-based patient positioning system (ExacTrac®) for stereotactic body radiotherapy in localizing the planned isocenter using fiducial markers

    Energy Technology Data Exchange (ETDEWEB)

    Montes-Rodríguez, María de los Ángeles, E-mail: angy24538@yahoo.com; Mitsoura, Eleni [Medical Physics Graduate Programme, Universidad Autónoma del Estado de México, Facultad de Medicina, Paseo Tollocan esquina Jesús Carranza Colonia Moderna de la Cruz, C.P. 50180, Toluca, Estado de México (Mexico); Hernández-Bojórquez, Mariana; Martínez-Gómez, Alma Angélica; Contreras-Pérez, Agustín; Negrete-Hernández, Ingrid Mireya; Hernández-Oviedo, Jorge Omar; Santiago-Concha, Bernardino Gabriel [Centro de Cáncer ABC, The American British Cowdray Medical Center I.A.P. (CMABC), Calle Sur 136, no. 116, Colonia las Américas, C.P. 01120, México, D.F. (Mexico)

    2014-11-07

    Stereotactic Body Radiation Therapy (SBRT) requires a controlled immobilization and position monitoring of patient and target. The purpose of this work is to analyze the performance of the imaging system ExacTrac® (ETX) using infrared and fiducial markers. Materials and methods: In order to assure the accuracy of isocenter localization, a Quality Assurance procedure was applied using an infrared marker-based positioning system. Scans were acquired of an inhouse-agar gel and solid water phantom with infrared spheres. In the inner part of the phantom, three reference markers were delineated as reference and one pellet was place internally; which was assigned as the isocenter. The iPlan® RT Dose treatment planning system. Images were exported to the ETX console. Images were acquired with the ETX to check the correctness of the isocenter placement. Adjustments were made in 6D the reference markers were used to fuse the images. Couch shifts were registered. The procedure was repeated for verification purposes. Results: The data recorded of the verifications in translational and rotational movements showed averaged 3D spatial uncertainties of 0.31 ± 0.42 mm respectively 0.82° ± 0.46° in the phantom and the first correction of these uncertainties were of 1.51 ± 1.14 mm respectively and 1.37° ± 0.61°. Conclusions: This study shows a high accuracy and repeatability in positioning the selected isocenter. The ETX-system for verifying the treatment isocenter position has the ability to monitor the tracing position of interest, making it possible to be used for SBRT positioning within uncertainty ≤1mm.

  9. [Correlation between five RNA markers of rat's skin and PMI at different temperatures].

    Science.gov (United States)

    Pan, Hui; Zhang, Heng; Lü, Ye-hui; Ma, Jian-long; Ma, Kai-jun; Chen, Long

    2014-08-01

    To explore the correlation between postmortem interval (PMI) and five RNA markers of rat's skin--β-actin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 18S ribosomal RNA(18S rRNA), 5S ribosomal RNA (5S rRNA), and microRNA-203 (miR-203), at different temperatures. Eighteen SD rats were randomly divided into three environmental temperature groups: 4 °C, 15 °C and 35 °C, respectively. Skin samples were taken at 11 time points from 0 h to 120 h post-mortem. The total RNA was extracted from the skin samples and the five RNA levels were detected by real-time fluorescent quantitative PCR. Proper internal reference was selected by geNorm software. Regression analysis of the RNA markers was conducted by GraphPad software. 5S rRNA and miR-203 were most suitable internal references. A good linear relationship between PMI and RNA levels (β-actin and GAPDH) was observed in two groups (4 °C and 15 °C), whereas the S type curve relationship between the expression levels of the two markers (β-actin and GAPDH) and PMI was observed in the 35 °C group. The partial linear relationship between 18S rRNA and PMI was observed in the groups (15 °C and 35 °C). Skin could be a suitable material for extracting RNA. The RNA expression levels of β-actin and GAPDH correlate well with PMI, and these RNA markers of skin tissue could be additional indice for the estimation of PMI.

  10. Linguistic Markers of Stereotype in National Character Descriptions (Based on Ukrainian Newspaper Articles

    Directory of Open Access Journals (Sweden)

    Falafivka Olesya

    2016-12-01

    Full Text Available Background: Ethnic stereotypes are in the focus of current linguistic research, because they play an important role in the formation of international relations that develop rapidly in the modern world. The majority of linguistic studies today are devoted to the cognitive nature of stereotypes. However, researchers also pay attention to means of stereotype verbalization in different languages. The main ones have been identified already: these are ethnonyms, toponyms, ethnically marked anthroponyms, ethnically marked color names, names of religions, names of national symbols and values, ethnic and national realia and code switching. Nevertheless, not always do these units verbalize ethnic stereotypes in discourse. Purpose: The purpose of this research is to develop a method of identification and suggest a typology of linguistic markers of stereotype that occur in descriptions of different national characters in Ukrainian journalistic discourse. Results: Linguistic markers of stereotype have been identified at almost all levels of the language structure. They are morphemes, lexemes, set phrases, idioms, proverbs, certain syntactic structures and even texts (anecdotes, the semantic structure of which contains the semes MANY and ALWAYS. Importantly, linguistic markers of stereotype are used in combination rather than separately. Discussion: Ethnic stereotypes can be identified in discourse using two basic criteria. The first one is explicit description or implicit reference to the features of a certain national character (ethnonyms, toponyms, realia etc. are indispensable elements of such a description or reference; the second one is occurrence of the aforesaid markers of stereotype (different language units, the semantic structure of which includes the semes MANY and ALWAYS in the text. The prospect of this research is comparative analysis of markers of ethnic stereotypes in Ukrainian and other languages.

  11. Inflammatory Genetic Markers of Prostate Cancer Risk

    Energy Technology Data Exchange (ETDEWEB)

    Tindall, Elizabeth A.; Hayes, Vanessa M. [Cancer Genetics Group, Children’s Cancer Institute Australia for Medical Research, Lowy Cancer Research Centre, University of New South Wales, PO Box 81, Randwick, NSW 2031 (Australia); University of New South Wales, Kensington Campus, Sydney, NSW 2052 (Australia); Petersen, Desiree C., E-mail: dpetersen@ccia.unsw.edu.au [Cancer Genetics Group, Children’s Cancer Institute Australia for Medical Research, Lowy Cancer Research Centre, University of New South Wales, PO Box 81, Randwick, NSW 2031 (Australia)

    2010-06-08

    Prostate cancer is the most common cancer in Western society males, with incidence rates predicted to rise with global aging. Etiology of prostate cancer is however poorly understood, while current diagnostic tools can be invasive (digital rectal exam or biopsy) and/or lack specificity for the disease (prostate-specific antigen (PSA) testing). Substantial histological, epidemiological and molecular genetic evidence indicates that inflammation is important in prostate cancer pathogenesis. In this review, we summarize the current status of inflammatory genetic markers influencing susceptibility to prostate cancer. The focus will be on inflammatory cytokines regulating T-helper cell and chemokine homeostasis, together with the Toll-like receptors as key players in the host innate immune system. Although association studies indicating a genetic basis for prostate cancer are presently limited mainly due to lack of replication, larger and more ethnically and clinically defined study populations may help elucidate the true contribution of inflammatory gene variants to prostate cancer risk.

  12. Oligothiophenes as Fluorescent Markers for Biological Applications

    Directory of Open Access Journals (Sweden)

    Antonio Manetto

    2012-01-01

    Full Text Available This paper summarizes some of our results on the application of oligothiophenes as fluorescent markers for biological studies. The oligomers of thiophene, widely known for their semiconductor properties in organic electronics, are also fluorescent compounds characterized by chemical and optical stability, high absorbance and quantum yield. Their fluorescent emission can be easily modulated via organic synthesis by changing the number of thiophene rings and the nature of side-chains. This review shows how oligothiophenes can be derivatized with active groups such as phosphoramidite, N-hydroxysuccinimidyl and 4-sulfotetrafluorophenyl esters, isothiocyanate and azide by which the (biomolecules of interest can be covalently bound. This paper also describes how molecules such as oligonucleotides, proteins and even nanoparticles, tagged with oligothiophenes, can be used in experiments ranging from hybridization studies to imaging of fixed and living cells. Finally, a few multilabeling experiments are described.

  13. Inflammatory Genetic Markers of Prostate Cancer Risk

    International Nuclear Information System (INIS)

    Tindall, Elizabeth A.; Hayes, Vanessa M.; Petersen, Desiree C.

    2010-01-01

    Prostate cancer is the most common cancer in Western society males, with incidence rates predicted to rise with global aging. Etiology of prostate cancer is however poorly understood, while current diagnostic tools can be invasive (digital rectal exam or biopsy) and/or lack specificity for the disease (prostate-specific antigen (PSA) testing). Substantial histological, epidemiological and molecular genetic evidence indicates that inflammation is important in prostate cancer pathogenesis. In this review, we summarize the current status of inflammatory genetic markers influencing susceptibility to prostate cancer. The focus will be on inflammatory cytokines regulating T-helper cell and chemokine homeostasis, together with the Toll-like receptors as key players in the host innate immune system. Although association studies indicating a genetic basis for prostate cancer are presently limited mainly due to lack of replication, larger and more ethnically and clinically defined study populations may help elucidate the true contribution of inflammatory gene variants to prostate cancer risk

  14. Biological Prognostic Markers in Chronic Lymphocytic Leukemia

    Directory of Open Access Journals (Sweden)

    Vladimíra Vroblová

    2009-01-01

    Full Text Available Chronic lymphocytic leukemia (CLL is the most frequent leukemic disease of adults in the Western world. It is remarkable by an extraordinary heterogeneity of clinical course with overall survival ranging from several months to more than 15 years. Classical staging sytems by Rai and Binet, while readily available and useful for initial assessment of prognosis, are not able to determine individual patient’s ongoing clinical course of CLL at the time of diagnosis, especially in early stages. Therefore, newer biological prognostic parameters are currently being clinically evaluated. Mutational status of variable region of immunoglobulin heavy chain genes (IgVH, cytogenetic aberrations, and both intracellular ZAP- 70 and surface CD38 expression are recognized as parameters with established prognostic value. Molecules regulating the process of angiogenesis are also considered as promising markers. The purpose of this review is to summarize in detail the specific role of these prognostic factors in chronic lymphocytic leukemia.

  15. Converging intracranial markers of conscious access.

    Directory of Open Access Journals (Sweden)

    Raphaël Gaillard

    2009-03-01

    Full Text Available We compared conscious and nonconscious processing of briefly flashed words using a visual masking procedure while recording intracranial electroencephalogram (iEEG in ten patients. Nonconscious processing of masked words was observed in multiple cortical areas, mostly within an early time window (<300 ms, accompanied by induced gamma-band activity, but without coherent long-distance neural activity, suggesting a quickly dissipating feedforward wave. In contrast, conscious processing of unmasked words was characterized by the convergence of four distinct neurophysiological markers: sustained voltage changes, particularly in prefrontal cortex, large increases in spectral power in the gamma band, increases in long-distance phase synchrony in the beta range, and increases in long-range Granger causality. We argue that all of those measures provide distinct windows into the same distributed state of conscious processing. These results have a direct impact on current theoretical discussions concerning the neural correlates of conscious access.

  16. Calprotectin--a novel marker of obesity

    DEFF Research Database (Denmark)

    Mortensen, Ole Hartvig; Nielsen, Anders Rinnov; Erikstrup, Christian

    2009-01-01

    obese subjects or subjects with type 2 diabetes. METHODOLOGY/PRINCIPAL FINDINGS: Plasma calprotectin and skeletal muscle S100A8 mRNA levels were measured in a cohort consisting of 199 subjects divided into four groups depending on presence or absence of type 2 diabetes (T2D), and presence or absence...... of obesity. There was a significant interaction between obesity and T2D (p = 0.012). Plasma calprotectin was increased in obese relative to non-obese controls (pobese and non-obese patients with T2D (p = 0.62). S100A8 mRNA levels in skeletal muscle were...... not influenced by obesity or T2D. Multivariate regression analysis (adjusting for age, sex, smoking and HOMA2-IR) showed plasma calprotectin to be strongly associated with BMI, even when further adjusted for fitness, CRP, TNF-alpha or neutrophil number. CONCLUSIONS/SIGNIFICANCE: Plasma calprotectin is a marker...

  17. Changes of hepatofibrosis markers in Graves' disease

    International Nuclear Information System (INIS)

    Zhou Feihua; Xu Haifeng; Zhou Runsuo; Gao Feng; Wang Lei

    2006-01-01

    Objective: To study the changes of hepatofibrosis markers (IV-C, PC III, HA, LN) in Graves' disease. Methods: Serum levels of hepatofibrosis were measured with RIA in 40 patients with Graves' disease (CD) before any treatment and 35 patients with Graves' disease after successful anti-thyroid drug therapy as well as in 30 controls. Results: The serum IV-C and PC III levels in GD patients were significant higher than those in controls before treatment (P<0.01). After successful treatment, the IV-C, PC III levels dropped markedly (vs before treatment, P<0.01). However, there were no significant differences among the serum HA, LN levels in all the subjects tested. Conclusion: Serum levels of IV-C and PC III increased markedly with hyperthyroidim. When IV-C and PC III levels were taken for assessment of degree of hepatofibeosis, GD must be ruled out first. (authors)

  18. Noninvasive Retinal Markers in Diabetic Retinopathy

    DEFF Research Database (Denmark)

    Blindbæk, Søren Leer; Torp, Thomas Lee; Lundberg, Kristian

    2017-01-01

    The retinal vascular system is the only part of the human body available for direct, in vivo inspection. Noninvasive retinal markers are important to identity patients in risk of sight-threatening diabetic retinopathy. Studies have correlated structural features like retinal vascular caliber...... and fractals with micro- and macrovascular dysfunction in diabetes. Likewise, the retinal metabolism can be evaluated by retinal oximetry, and higher retinal venular oxygen saturation has been demonstrated in patients with diabetic retinopathy. So far, most studies have been cross-sectional, but these can only...... retinopathy and diabetic macular edema. The Department of Ophthalmology at Odense University Hospital, Denmark, has a strong tradition of studying the retinal microvasculature in diabetic retinopathy. In the present paper, we demonstrate the importance of the retinal vasculature not only as predictors of long...

  19. Biological (molecular and cellular) markers of toxicity

    International Nuclear Information System (INIS)

    Shugart, L.R.; D'Surney, S.J.; Gettys-Hull, C.; Greeley, M.S. Jr.

    1991-01-01

    Several molecular and cellular markers of genotoxicity were adapted for measurement in the Medaka (Oryzias latipes), and were used to describe the effects of treatment of the organism with diethylnitrosamine (DEN). NO 6 -ethyl guanine adducts were detected, and a slight statistically significant, increase in DNA strand breaks was observed. These results are consistent with the hypothesis that prolonged exposure to high levels of DEN induced alkyltransferase activity which enzymatically removes any O 6 -ethyl guanine adducts but does not result in strand breaks or hypomethylation of the DNA such as might be expected from excision repair of chemically modified DNA. Following a five week continuous DEN exposure with 100 percent renewal of DEN-water every third day, the F values (DNA double strandedness) increased considerably and to similar extent in fish exposed to 25, 50, and 100 ppM DEN. This has been observed also in medaka exposed to BaP

  20. Predictive and therapeutic markers in ovarian cancer

    Science.gov (United States)

    Gray, Joe W.; Guan, Yinghui; Kuo, Wen-Lin; Fridlyand, Jane; Mills, Gordon B.

    2013-03-26

    Cancer markers may be developed to detect diseases characterized by increased expression of apoptosis-suppressing genes, such as aggressive cancers. Genes in the human chromosomal regions, 8q24, 11q13, 20q11-q13, were found to be amplified indicating in vivo drug resistance in diseases such as ovarian cancer. Diagnosis and assessment of amplification levels certain genes shown to be amplified, including PVT1, can be useful in prediction of poor outcome of patient's response and drug resistance in ovarian cancer patients with low survival rates. Certain genes were found to be high priority therapeutic targets by the identification of recurrent aberrations involving genome sequence, copy number and/or gene expression are associated with reduced survival duration in certain diseases and cancers, specifically ovarian cancer. Therapeutics to inhibit amplification and inhibitors of one of these genes, PVT1, target drug resistance in ovarian cancer patients with low survival rates is described.