(ISSR) and internal transcribed spacer
African Journals Online (AJOL)
Cladistic relationships within the genus Cinnamomum (Lauraceae) in Taiwan based on analysis of leaf morphology and inter-simple sequence repeat (ISSR) and internal transcribed spacer (ITS) molecular markers.
Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen
2012-04-17
Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.
PCR-Internal Transcribed Spacer (ITS) genes sequencing and ...
African Journals Online (AJOL)
Methods: DNA extraction, purification, amplification and sequencing of Internal Transcribed Spacer (ITS) genes were per- formed using ... Keywords: Internal transcribed spacer genes, phylogenetic, genetic relationship, clinical and environmental fungi, HIV-TB. ... Nigeria. An Ethical clearance was obtained from the Eth-.
Minamoto, Toshifumi; Uchii, Kimiko; Takahara, Teruhiko; Kitayoshi, Takumi; Tsuji, Satsuki; Yamanaka, Hiroki; Doi, Hideyuki
2017-03-01
The recently developed environmental DNA (eDNA) analysis has been used to estimate the distribution of aquatic vertebrates by using mitochondrial DNA (mtDNA) as a genetic marker. However, mtDNA markers have certain drawbacks such as variable copy number and maternal inheritance. In this study, we investigated the potential of using nuclear DNA (ncDNA) as a more reliable genetic marker for eDNA analysis by using common carp (Cyprinus carpio). We measured the copy numbers of cytochrome b (CytB) gene region of mtDNA and internal transcribed spacer 1 (ITS1) region of ribosomal DNA of ncDNA in various carp tissues and then compared the detectability of these markers in eDNA samples. In the DNA extracted from the brain and gill tissues and intestinal contents, CytB was detected at 95.1 ± 10.7 (mean ± 1 standard error), 29.7 ± 1.59 and 24.0 ± 4.33 copies per cell, respectively, and ITS1 was detected at 1760 ± 343, 2880 ± 503 and 1910 ± 352 copies per cell, respectively. In the eDNA samples from mesocosm, pond and lake water, the copy numbers of ITS1 were about 160, 300 and 150 times higher than those of CytB, respectively. The minimum volume of pond water required for quantification was 33 and 100 mL for ITS1 and CytB, respectively. These results suggested that ITS1 is a more sensitive genetic marker for eDNA studies of C. carpio. © 2016 John Wiley & Sons Ltd.
Ribosomal DNA internal transcribed spacer 1 and internal ...
African Journals Online (AJOL)
USER
2010-07-26
Jul 26, 2010 ... in some East Asian countries such as China, Korea and. *Corresponding author. E-mail: soonkwan@kangwon.ac.kr. Tel: +82 33 250 6476. Fax: +82 33 250 6470. Abbreviations: nrDNA, Nuclear ribosomal DNA; ITS, internal transcribed spacer; PCR, polymerase chain reaction; BLAST, basic local alignment ...
Daniel L. Lindner; Tor Carlsen; Henrik Nilsson; Marie Davey; Trond Schumacher; Havard. Kauserud
2013-01-01
The rDNA internal transcribed spacer (ITS) region has been accepted as a DNA barcoding marker for fungi and is widely used in phylogenetic studies; however, intragenomic ITS variability has been observed in a broad range of taxa, including prokaryotes, plants, animals, and fungi, and this variability has the potential to inflate species richness estimates in molecular...
Al-Qurainy, F; Khan, S; Nadeem, M; Tarroum, M; Alaklabi, A
2013-03-11
The rare and endangered plants of any country are important genetic resources that often require urgent conservation measures. Assessment of phylogenetic relationships and evaluation of genetic diversity is very important prior to implementation of conservation strategies for saving rare and endangered plant species. We used internal transcribed spacer sequences of nuclear ribosomal DNA for the evaluation of sequence identity from the available taxa in the GenBank database by using the Basic Local Alignment Search Tool (BLAST). Two rare plant species viz, Heliotropium strigosum claded with H. pilosum (98% branch support) and Pancratium tortuosum claded with P. tenuifolium (61% branch support) clearly. However, some species, viz Scadoxus multiflorus, Commiphora myrrha and Senecio hadiensis showed close relationships with more than one species. We conclude that nuclear ribosomal internal transcribed spacer sequences are useful markers for phylogenetic study of these rare plant species in Saudi Arabia.
Directory of Open Access Journals (Sweden)
Patrick P Edger
Full Text Available The internal transcribed spacers of the nuclear ribosomal RNA gene cluster, termed ITS1 and ITS2, are the most frequently used nuclear markers for phylogenetic analyses across many eukaryotic groups including most plant families. The reasons for the popularity of these markers include: 1. Ease of amplification due to high copy number of the gene clusters, 2. Available cost-effective methods and highly conserved primers, 3. Rapidly evolving markers (i.e. variable between closely related species, and 4. The assumption (and/or treatment that these sequences are non-functional, neutrally evolving phylogenetic markers. Here, our analyses of ITS1 and ITS2 for 50 species suggest that both sequences are instead under selective constraints to preserve proper secondary structure, likely to maintain complete self-splicing functions, and thus are not neutrally-evolving phylogenetic markers. Our results indicate the majority of sequence sites are co-evolving with other positions to form proper secondary structure, which has implications for phylogenetic inference. We also found that the lowest energy state and total number of possible alternate secondary structures are highly significantly different between ITS regions and random sequences with an identical overall length and Guanine-Cytosine (GC content. Lastly, we review recent evidence highlighting some additional problematic issues with using these regions as the sole markers for phylogenetic studies, and thus strongly recommend additional markers and cost-effective approaches for future studies to estimate phylogenetic relationships.
Zhang, Dequan; Jiang, Bei; Duan, Lizhen; Zhou, Nong
2016-01-01
DNA barcoding is a technique used to identify species based on species-specific differences in short regions of their DNA. It is widely used in species discrimination of medicinal plants and traditional medicines. In the present study, four potential DNA barcodes, namely rbcL , matK , trnH-psbA and ITS (nuclear ribosomal internal transcribed spacer) were adopted for species discrimination in Crawfurdia Wall (Genetiaceae). Identification ability of these DNA barcodes and combinations were evaluated using three classic methods (Distance, Blast and Tree-Building). As a result, ITS, trnH-psbA and rbcL regions showed great universality for a success rate of 100%; whereas matK was disappointing for which only 65% samples gained useful DNA sequences. ITS region, which could clearly and effectively identify the five species in Crawfurdia , performed very well in this study. On the contrary, trnH-psbA and rbcL performed poorly in discrimination among these species. ITS marker was an ideal DNA barcode in Crawfurdia and it should be incorporated into one of the core barcodes for seed plants.
Theodorus H. de Koker; Karen K. Nakasone; Jacques Haarhof; Harold H. Burdsall; Bernard J.H. Janse
2003-01-01
Phanerochaete is a genus of resupinate homobasidiomycetes that are saprophytic on woody debris and logs. Morphological studies in the past indicated that Phanerochaete is a heterogeneous assemblage of species. In this study the internal transcribed spacer (ITS) region of the nuclear ribosomal DNA was used to test the monophyly of the genus Phanerochaete and to infer...
Directory of Open Access Journals (Sweden)
Ana Sahara
2015-10-01
Full Text Available Rhiphicephalus (Boophilus microplus is important obligatory blood feeding ectoparasites transmittingmany different viral, bacterial and protozoan and plays a role as a vector of Babesia sp., The leria sp. andAnaplasma sp. in cattle. The accuracy in identifying and distinguishing interspecies and intraspeciesdiversity among parasites is needed to understand the epidemiology, biology and capacity as a vector.Variations in the DNA base sequence of the internal transcribed spacer region2 (ITS 2 has been used asa molecular marker for identification in an effort to determine phylogenetic relationships. The aim of thisstudy was to determine the ITS 2 gene nucleotide sequence of R. microplus, which was expected to beuseful for accurate identification the parasite diversity and phylogenetic relationship among many differentspecies. DNA amplification was conducted using BOO2 forward dan BOO2 reverse primers. The DNAsamples containing ITS2 region fragment of 1099 nt were derived from the nucleotide sequence multiplealignments of R.microplus and other ticks genes obtained from Gene bank using Clustal W software, andthen analyzed using the MEGA program version 6. Genetic distances based on nucleotide sequence weredetermined with Kimura 2-parameter method producing the smallest genetic distance of 0 % and 1.2 %.Construction of phylogenetic trees using the Neighbor joining method showed that ticks from variousregions in Indonesia was species complex which have a closer with R.microplus isolates from India, Laos,South Africa, China and Australia R.australis origin.
Directory of Open Access Journals (Sweden)
Koushik Das
2015-01-01
Full Text Available Taxonomic differentiation among morphologically identical Ascaris species is a debatable scientific issue in the context of Ascariasis epidemiology. To explain the disease epidemiology and also the taxonomic position of different Ascaris species, genome information of infecting strains from endemic areas throughout the world is certainly crucial. Ascaris population from human has been genetically characterized based on the widely used genetic marker, internal transcribed spacer1 (ITS1. Along with previously reported and prevalent genotype G1, 8 new sequence variants of ITS1 have been identified. Genotype G1 was significantly present among female patients aged between 10 to 15 years. Intragenic linkage disequilibrium (LD analysis at target locus within our study population has identified an incomplete LD value with potential recombination events. A separate cluster of Indian isolates with high bootstrap value indicate their distinct phylogenetic position in comparison to the global Ascaris population. Genetic shuffling through recombination could be a possible reason for high population diversity and frequent emergence of new sequence variants, identified in present and other previous studies. This study explores the genetic organization of Indian Ascaris population for the first time which certainly includes some fundamental information on the molecular epidemiology of Ascariasis.
Directory of Open Access Journals (Sweden)
Peng Chen
2016-03-01
Full Text Available Serofluid dish (or Jiangshui, in Chinese, a traditional food in the Chinese culture for thousands of years, is made from vegetables by fermentation. In this work, microorganism community of the fermented serofluid dish was investigated by the culture-independent method. The metagenomic data in this article contains the sequences of fungal internal transcribed spacer (ITS regions of rRNA genes from 12 different serofluid dish samples. The metagenome comprised of 50,865 average raw reads with an average of 8,958,220 bp and G + C content is 45.62%. This is the first report on metagenomic data of fungal ITS from serofluid dish employing Illumina platform to profile the fungal communities of this little known fermented food from Gansu Province, China. The Metagenomic data of fungal internal transcribed spacer can be accessed at NCBI, SRA database accession no. SRP067411. Keywords: Serofluid dish, Jiangshui, Fungal ITS, Cultivation-independent, Microbial diversity
Directory of Open Access Journals (Sweden)
Yoshida Takuhiro
2008-06-01
assembled to form 2737 unique marker groups as contigs. These contigs were applied for pairwise comparison among linkage maps obtained from different EST map resources. Conclusion TriMEDB provides information regarding transcribed genetic markers and functions as a semantic knowledgebase offering an informatics facility for the acceleration of QTL analysis and for population genetics studies of Triticeae.
Harpke, Doerte; Peterson, Angela
2008-05-01
The internal transcribed spacer (ITS) region (ITS1, 5.8S rDNA, ITS2) represents the most widely applied nuclear marker in eukaryotic phylogenetics. Although this region has been assumed to evolve in concert, the number of investigations revealing high degrees of intra-individual polymorphism connected with the presence of pseudogenes has risen. The 5.8S rDNA is the most important diagnostic marker for functionality of the ITS region. In Mammillaria, intra-individual 5.8S rDNA polymorphisms of up to 36% and up to nine different types have been found. Twenty-eight of 30 cloned genomic Mammillaria sequences were identified as putative pseudogenes. For the identification of pseudogenic ITS regions, in addition to formal tests based on substitution rates, we attempted to focus on functional features of the 5.8S rDNA (5.8S motif, secondary structure). The importance of functional data for the identification of pseudogenes is outlined and discussed. The identification of pseudogenes is essential, because they may cause erroneous phylogenies and taxonomic problems.
Directory of Open Access Journals (Sweden)
Mahsa Shahbakhsh
2016-02-01
Full Text Available Background: The Fasciola trematodes are the most common liver flukes, living in a range of animals with global distribution and resulting in profound economic loss and public health challenges. Previous studies have indicated that the sequences of the second internal transcribed spacer (ITS-2 of ribosomal DNA (rDNA provide reliable genetic markers for molecular systemic studies of Fasciola. Objectives: The objective of the present study was to characterize Fasciola samples from different geographical regions of Sistan and Balouchestan province using sequences of second internal transcribed spacer (ITS-2 of ribosomal DNA (rDNA. Materials and Methods: Twenty adult trematodes were collected from the livers of slaughtered infected cattle. Total genomic DNA was extracted and ITS-2 rDNA targets were amplified by polymerase chain reaction (PCR. All samples were sequenced and investigated using the ClustalW2 sequence alignment tool and MEGA software. The sequences of some Iranian and non-Iranian isolates were used for comparison, in order to evaluate the variation in sequence homology between geographically different trematode populations. Results: The results of comparing the ITS-2 sequences with the BLAST GenBank database showed one type of sequence for F. hepatica and three different types of sequences for F. gigantica in the specimens. Conclusions: The present study demonstrated that Fasciola samples from cattle in two geographical locations in Sistan and Balouchestan province represented no genetic diversity in F. hepatica and high genetic variation in F. gigantica.
Schoch, C.L.; Seifert, K.A.; Huhndorf, S.; Robert, V.; Spouge, J.L.; Levesque, C.A.; Chen, W.; Crous, P.W.; Boekhout, T.; Damm, U.; Hoog, de G.S.; Eberhardt, U.; Groenewald, J.Z.; Groenewald, M.; Hagen, F.; Houbraken, J.; Quaedvlieg, W.; Stielow, B.; Vu, T.D.; Walther, G.
2012-01-01
Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it
Six DNA regions were evaluated in a multi-national, multi-laboratory consortium as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it...
Directory of Open Access Journals (Sweden)
Xiaoyue Wang
2017-01-01
Full Text Available Many species belonging to the genus Dendrobium are of great commercial value. However, their difficult growth conditions and high demand have caused many of these species to become endangered. Indeed, counterfeit Dendrobium products are common, especially in medicinal markets. This study aims to assess the suitability of the internal transcribed spacer 2 (ITS2 region as a marker for identifying Dendrobium and to evaluate its intragenomic variation in Dendrobium species. In total, 29,624 ITS2 copies from 18 species were obtained using 454 pyrosequencing to evaluate intragenomic variation. In addition, 513 ITS2 sequences from 26 Dendrobium species were used to assess its identification suitability. The highest intragenomic genetic distance was observed in Dendrobium chrysotoxum (0.081. The average intraspecific genetic distances of each species ranged from 0 to 0.032. Phylogenetic trees based on ITS2 sequences showed that most Dendrobium species are monophyletic. The intragenomic and intraspecies divergence analysis showed that greater intragenomic divergence is mostly correlated with larger intraspecific variation. As a major ITS2 variant becomes more common in genome, there are fewer intraspecific variable sites in ITS2 sequences at the species level. The results demonstrated that the intragenomic multiple copies of ITS2 did not affect species identification.
Wang, Xiaoyue; Chen, Xiaochen; Yang, Pei; Wang, Lili; Han, Jianping
2017-01-01
Many species belonging to the genus Dendrobium are of great commercial value. However, their difficult growth conditions and high demand have caused many of these species to become endangered. Indeed, counterfeit Dendrobium products are common, especially in medicinal markets. This study aims to assess the suitability of the internal transcribed spacer 2 (ITS2) region as a marker for identifying Dendrobium and to evaluate its intragenomic variation in Dendrobium species. In total, 29,624 ITS2 copies from 18 species were obtained using 454 pyrosequencing to evaluate intragenomic variation. In addition, 513 ITS2 sequences from 26 Dendrobium species were used to assess its identification suitability. The highest intragenomic genetic distance was observed in Dendrobium chrysotoxum (0.081). The average intraspecific genetic distances of each species ranged from 0 to 0.032. Phylogenetic trees based on ITS2 sequences showed that most Dendrobium species are monophyletic. The intragenomic and intraspecies divergence analysis showed that greater intragenomic divergence is mostly correlated with larger intraspecific variation. As a major ITS2 variant becomes more common in genome, there are fewer intraspecific variable sites in ITS2 sequences at the species level. The results demonstrated that the intragenomic multiple copies of ITS2 did not affect species identification.
Jill E. Petrisko; Christopher A. Pearl; David S. Pilliod; Peter P. Sheridan; Charles F. Williams; Charles R. Peterson; R. Bruce Bury
2008-01-01
We assessed the diversity and phylogeny of Saprolegniaceae on amphibian eggs from the Pacific Northwest, with particular focus on Saprolegnia ferax, a species implicated in high egg mortality. We identified isolates from eggs of six amphibians with the internal transcribed spacer (ITS) and 5.8S gene regions and BLAST of the GenBank database. We...
Directory of Open Access Journals (Sweden)
Andrew P Liguori
Full Text Available Length polymorphisms within the 16S-23S ribosomal DNA internal transcribed spacer (ITS have been described as stable genetic markers for studying bacterial phylogenetics. In this study, we used these genetic markers to investigate phylogenetic relationships in Burkholderia pseudomallei and its near-relative species. B. pseudomallei is known as one of the most genetically recombined bacterial species. In silico analysis of multiple B. pseudomallei genomes revealed approximately four homologous rRNA operons and ITS length polymorphisms therein. We characterized ITS distribution using PCR and analyzed via a high-throughput capillary electrophoresis in 1,191 B. pseudomallei strains. Three major ITS types were identified, two of which were commonly found in most B. pseudomallei strains from the endemic areas, whereas the third one was significantly correlated with worldwide sporadic strains. Interestingly, mixtures of the two common ITS types were observed within the same strains, and at a greater incidence in Thailand than Australia suggesting that genetic recombination causes the ITS variation within species, with greater recombination frequency in Thailand. In addition, the B. mallei ITS type was common to B. pseudomallei, providing further support that B. mallei is a clone of B. pseudomallei. Other B. pseudomallei near-neighbors possessed unique and monomorphic ITS types. Our data shed light on evolutionary patterns of B. pseudomallei and its near relative species.
Bladder tumor markers beyond cytology: International Consensus Panel on bladder tumor markers.
Lokeshwar, V.B.; Habuchi, T.; Grossman, H.B.; Murphy, W.M.; Hautmann, S.H.; Hemstreet, G.P.; Bono, A.V.; Getzenberg, R.H.; Goebell, P.; Schmitz-Drager, B.J.; Schalken, J.A.; Fradet, Y.; Marberger, M.; Messing, E.; Droller, M.J.
2005-01-01
This is the first of 2 articles that summarize the findings of the International Consensus Panel on cytology and bladder tumor markers. The objectives of our panel were to reach a consensus on the areas where markers are needed, to define the attributes of an ideal tumor marker, and to identify
Callejón, R; Halajian, A; de Rojas, M; Marrugal, A; Guevara, D; Cutillas, C
2012-05-25
Comparative morphological, biometrical and molecular studies of Trichuris discolor isolated from Bos taurus from Spain and Iran was carried out. Furthermore, Trichuris ovis isolated from B. taurus and Capra hircus from Spain has been, molecularly, analyzed. Morphological studies revealed clear differences between T. ovis and T. discolor isolated from B. taurus but differences were not observed between populations of T. discolor isolated from different geographical regions. Nevertheless, the molecular studies based on the amplification and sequencing of the internal transcribed spacers 1 and 2 ribosomal DNA and 16S partial gene mitochondrial DNA showed clear differences between both populations of T. discolor from Spain and Iran suggesting two cryptic species. Phylogenetic studies corroborated these data. Thus, phylogenetic trees based on ITS1, ITS2 and 16S partial gene sequences showed that individuals of T. discolor from B. taurus from Iran clustered together and separated, with high bootstrap values, of T. discolor isolated from B. taurus from Spain, while populations of T. ovis from B. taurus and C. hircus from Spain clustered together but separated with high bootstrap values of both populations of T. discolor. Furthermore, a comparative phylogenetic study has been carried out with the ITS1and ITS2 sequences of Trichuris species from different hosts. Three clades were observed: the first clustered all the species of Trichuris parasitizing herbivores (T. discolor, T. ovis, Trichuris leporis and Trichuris skrjabini), the second clustered all the species of Trichuris parasitizing omnivores (Trichuris trichiura and Trichuris suis) and finally, the third clustered species of Trichuris parasitizing carnivores (Trichuris muris, Trichuris arvicolae and Trichuris vulpis). Copyright © 2011 Elsevier B.V. All rights reserved.
Transcribing for Greater Musicality.
Hinz, Bob
1995-01-01
States that transcribing is notating the performance of a musical composition or improvisation as the music is grasped aurally. Maintains that transcribing is effective for high school and college students who want to understand jazz techniques. Includes eight suggestions for teaching transcribing. (CFR)
Newton, L A; Chilton, N B; Beveridge, I; Gasser, R B
1998-02-01
Genetic differences among Nematodirus spathiger, Nematodirus filicollis, Nematodirus helvetianus and Nematodirus battus in the nucleotide sequence of the second internal transcribed spacer (ITS-2) of ribosomal DNA ranged from 3.9 to 24.7%. Pairwise comparisons of their ITS-2 sequences indicated that the most genetically similar species were N. spathiger and N. helvetianus. N. battus was the most genetically distinct species, with differences ranging from 22.8 to 24.7% with respect to the other three species. Some of the nucleotide differences among species provided different endonuclease restriction sites that could be used in restriction fragment length polymorphism studies. The ITS-2 sequence data may prove useful in studies of the systematics of molineid nematodes.
Alastruey-Izquierdo, Ana; Castelli, Maria Victoria; Cuesta, Isabel; Monzon, Araceli; Cuenca-Estrella, Manuel; Rodriguez-Tudela, Juan Luis
2009-04-01
The antifungal susceptibility profiles of 77 clinical strains of Mucorales species, identified by internal transcribed spacer sequencing, were analyzed. MICs obtained at 24 and 48 h were compared. Amphotericin B was the most active agent against all isolates, except for Cunninghamella and Apophysomyces isolates. Posaconazole also showed good activity for all species but Cunninghamella bertholletiae. Voriconazole had no activity against any of the fungi tested. Terbinafine showed good activity, except for Rhizopus oryzae, Mucor circinelloides, and Rhizomucor variabilis isolates.
Nelson, Leigh A; Wallman, James F; Dowton, Mark
2008-05-20
The identification of forensically important blowflies of the genus Chrysomya (Diptera: Calliphoridae) may be hampered by their close morphological similarities, especially as immatures. In contrast to most previous studies, the utility of a nuclear rather than mitochondrial genetic marker was investigated to solve this problem. The second internal transcribed spacer (ITS2) of ribosomal DNA (rDNA) was amplified and sequenced from all nine Chrysomya species known from Australia. Difficulties encountered with direct sequencing of ITS2 for Chrysomya flavifrons necessitated cloning prior to sequencing for this species, which revealed a low level (0-0.23%) of intraindividual variation. Five restriction enzymes (DraI, BsaXI, BciVI, AseI and HinfI) were identified that were able to differentiate most members of the genus by polymerase chain reaction (PCR) restriction fragment length polymorphism (PCR-RFLP). The PCR-RFLP analysis revealed characteristic restriction profiles for all species except the closely related species pairs Chrysomya latifrons+Chrysomya semimetallica and Chrysomya incisuralis+Chrysomya rufifacies. Ch. incisuralis and Ch. rufifacies were able to be separated using the size differences resulting from amplification of the entire ITS region. The lack of intraspecific ITS2 sequence variation among eight Ch. incisuralis specimens was verified by the identical restriction profiles generated from these specimens. A DNA-based approach, such as PCR-RFLP, has the capacity to be useful for the identification of forensic entomological evidence in cases where morphological characters are unreliable.
Alastruey-Izquierdo, Ana; Castelli, Maria Victoria; Cuesta, Isabel; Monzon, Araceli; Cuenca-Estrella, Manuel; Rodriguez-Tudela, Juan Luis
2009-01-01
The antifungal susceptibility profiles of 77 clinical strains of Mucorales species, identified by internal transcribed spacer sequencing, were analyzed. MICs obtained at 24 and 48 h were compared. Amphotericin B was the most active agent against all isolates, except for Cunninghamella and Apophysomyces isolates. Posaconazole also showed good activity for all species but Cunninghamella bertholletiae. Voriconazole had no activity against any of the fungi tested. Terbinafine showed good activity, except for Rhizopus oryzae, Mucor circinelloides, and Rhizomucor variabilis isolates. PMID:19171801
Wang, Pei; Lu, Yanli; Zheng, Mingmin; Rong, Tingzhao; Tang, Qilin
2011-01-01
Genetic relationship of a newly discovered teosinte from Nicaragua, Zea nicaraguensis with waterlogging tolerance, was determined based on randomly amplified polymorphic DNA (RAPD) markers and the internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA using 14 accessions from Zea species. RAPD analysis showed that a total of 5,303 fragments were produced by 136 random decamer primers, of which 84.86% bands were polymorphic. RAPD-based UPGMA analysis demonstrated that the genus Zea can be divided into section Luxuriantes including Zea diploperennis, Zea luxurians, Zea perennis and Zea nicaraguensis, and section Zea including Zea mays ssp. mexicana, Zea mays ssp. parviglumis, Zea mays ssp. huehuetenangensis and Zea mays ssp. mays. ITS sequence analysis showed the lengths of the entire ITS region of the 14 taxa in Zea varied from 597 to 605 bp. The average GC content was 67.8%. In addition to the insertion/deletions, 78 variable sites were recorded in the total ITS region with 47 in ITS1, 5 in 5.8S, and 26 in ITS2. Sequences of these taxa were analyzed with neighbor-joining (NJ) and maximum parsimony (MP) methods to construct the phylogenetic trees, selecting Tripsacum dactyloides L. as the outgroup. The phylogenetic relationships of Zea species inferred from the ITS sequences are highly concordant with the RAPD evidence that resolved two major subgenus clades. Both RAPD and ITS sequence analyses indicate that Zea nicaraguensis is more closely related to Zea luxurians than the other teosintes and cultivated maize, which should be regarded as a section Luxuriantes species. PMID:21525982
The internal transcribed spacer rDNA specific markers for ...
African Journals Online (AJOL)
GREGORY
2010-09-13
Sep 13, 2010 ... amplified efficiently when paired with universal primer ITS4 in Z. piperitum, but not in Z. schinifolium. ..... generation of protein database search programs. ... Dillon SL, Lawrence PK, Henry RJ, Ross L, Price HJ, Johnston JS.
Internal transcribed spacer 2 barcode: A good tool for identifying Acanthopanacis cortex
Directory of Open Access Journals (Sweden)
Sha eZhao
2015-10-01
Full Text Available Acanthopanacis cortex has been used in clinical applications for a long time. Considering some historical and geographical factors, Acanthopanacis cortex is easily confused with other herbs in medicine markets, thereby causing potential safety issues. In this study, we used the internal transcribed spacer 2 (ITS2 barcode to identify 69 samples belonging to six species, including Acanthopanacis cortex and its adulterants. The nearest distance, single-nucleotide polymorphisms (SNPs, and neighbor-joining (NJ tree methods were used to evaluate the identification ability of the ITS2 barcode. According to the kimura-2-parameter model, the intraspecific distance of Eleutherococcus nodiflorus ITS2 sequences ranged from 0 to 0.0132. The minimum interspecific distance between E. nodiflorus and E. giraldii was 0.0221, which was larger than the maximum intraspecific distance of E. nodiflorus. Three stable SNPs in ITS2 can be used to distinguish Acanthopanacis cortex and its closely related species. The NJ tree indicated that the Acanthopanacis cortex samples clustered into one clade, which can be distinguished clearly from the adulterants of this herb. A secondary structure of ITS2 provided another dimensionality to identify species. In conclusion, the ITS2 barcode effectively identifies Acanthopanacis cortex, and DNA barcoding is a convenient tool for medicine market supervision.
Identification of Clinical Staphylococcal Isolates from Humans by Internal Transcribed Spacer PCR
Couto, Isabel; Pereira, Sandro; Miragaia, Maria; Sanches, Ilda Santos; de Lencastre, Hermínia
2001-01-01
The emergence of coagulase-negative staphylococci not only as human pathogens but also as reservoirs of antibiotic resistance determinants requires the deployment and development of methods for their rapid and reliable identification. Internal transcribed spacer-PCR (ITS-PCR) was used to identify a collection of 617 clinical staphylococcal isolates. The amplicons were resolved in high-resolution agarose gels and visually compared with the patterns obtained for the control strains of 29 staphylococcal species. Of the 617 isolates studied, 592 (95.95%) were identified by ITS-PCR and included 11 species: 302 isolates of Staphylococcus epidermidis, 157 of S. haemolyticus, 79 of S. aureus, 21 of S. hominis, 14 of S. saprophyticus, 8 of S. warneri, 6 of S. simulans, 2 of S. lugdunensis, and 1 each of S. caprae, S. carnosus, and S. cohnii. All species analyzed had unique ITS-PCR patterns, although some were very similar, namely, the group S. saprophyticus, S. cohnii, S. gallinarum, S. xylosus, S. lentus, S. equorum, and S. chromogenes, the pair S. schleiferi and S. vitulus, and the pair S. piscifermentans and S. carnosus. Four species, S. aureus, S. caprae, S. haemolyticus, and S. lugdunensis, showed polymorphisms on their ITS-PCR patterns. ITS-PCR proved to be a valuable alternative for the identification of staphylococci, offering, within the same response time and at lower cost, higher reliability than the currently available commercial systems. PMID:11526135
Identification of clinical staphylococcal isolates from humans by internal transcribed spacer PCR.
Couto, I; Pereira, S; Miragaia, M; Sanches, I S; de Lencastre, H
2001-09-01
The emergence of coagulase-negative staphylococci not only as human pathogens but also as reservoirs of antibiotic resistance determinants requires the deployment and development of methods for their rapid and reliable identification. Internal transcribed spacer-PCR (ITS-PCR) was used to identify a collection of 617 clinical staphylococcal isolates. The amplicons were resolved in high-resolution agarose gels and visually compared with the patterns obtained for the control strains of 29 staphylococcal species. Of the 617 isolates studied, 592 (95.95%) were identified by ITS-PCR and included 11 species: 302 isolates of Staphylococcus epidermidis, 157 of S. haemolyticus, 79 of S. aureus, 21 of S. hominis, 14 of S. saprophyticus, 8 of S. warneri, 6 of S. simulans, 2 of S. lugdunensis, and 1 each of S. caprae, S. carnosus, and S. cohnii. All species analyzed had unique ITS-PCR patterns, although some were very similar, namely, the group S. saprophyticus, S. cohnii, S. gallinarum, S. xylosus, S. lentus, S. equorum, and S. chromogenes, the pair S. schleiferi and S. vitulus, and the pair S. piscifermentans and S. carnosus. Four species, S. aureus, S. caprae, S. haemolyticus, and S. lugdunensis, showed polymorphisms on their ITS-PCR patterns. ITS-PCR proved to be a valuable alternative for the identification of staphylococci, offering, within the same response time and at lower cost, higher reliability than the currently available commercial systems.
Decat, E.; van Mechelen, E.; Saerens, B.; Vermeulen, S.J.T.; Boekhout, T.; de Blaiser, S.; Vaneechoutte, M.; Deschaght, P.
2013-01-01
Rapid identification of clinically important yeasts can facilitate the initiation of anti-fungal therapy, since susceptibility is largely species-dependent. We evaluated melting peak and melting curve analysis of the internally transcribed spacer region 2 fragment (ITS2-MCA) as an identification
Hebeler-Barbosa, Flavia; Morais, Flavia V.; Montenegro, Mario R.; Kuramae, Eiko E.; Montes, Beatriz; McEwen, Juan G.; Bagagli, Eduardo; Puccia, Rosana
2003-01-01
Paracoccidioides brasiliensis isolates from 10 nine-banded armadillos (Dasypus novemcinctus) were comparable with 19 clinical isolates by sequence analysis of the PbGP43 gene and ribosomal internal transcribed spacer 1 (ITS1) and ITS2 and by random amplified polymorphic DNA. In this original ITS study, eight isolates differed by one or three sites among five total substitution sites. PMID:14662970
Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Cheng, Jingwei; Xu, Yingchun; Lau, Susanna K P; Woo, Patrick C Y
2015-10-22
Internal transcribed spacer region (ITS) sequencing is the most extensively used technology for accurate molecular identification of fungal pathogens in clinical microbiology laboratories. Intra-genomic ITS sequence heterogeneity, which makes fungal identification based on direct sequencing of PCR products difficult, has rarely been reported in pathogenic fungi. During the process of performing ITS sequencing on 71 yeast strains isolated from various clinical specimens, direct sequencing of the PCR products showed ambiguous sequences in six of them. After cloning the PCR products into plasmids for sequencing, interpretable sequencing electropherograms could be obtained. For each of the six isolates, 10-49 clones were selected for sequencing and two to seven intra-genomic ITS copies were detected. The identities of these six isolates were confirmed to be Candida glabrata (n=2), Pichia (Candida) norvegensis (n=2), Candida tropicalis (n=1) and Saccharomyces cerevisiae (n=1). Multiple sequence alignment revealed that one to four intra-genomic ITS polymorphic sites were present in the six isolates, and all these polymorphic sites were located in the ITS1 and/or ITS2 regions. We report and describe the first evidence of intra-genomic ITS sequence heterogeneity in four different pathogenic yeasts, which occurred exclusively in the ITS1 and ITS2 spacer regions for the six isolates in this study.
Ramaraj, Vijayakumar; Vijayaraman, Rajyoganandh S; Elavarashi, Elangovan; Rangarajan, Sudha; Kindo, Anupma Jyoti
2017-05-01
Dermatophytes are a group of fungi which infect keratinized tissues and causes superficial mycoses in humans and animals. The group comprises of three major genera, Trichophyton , Microsporum and Epidermophyton . Among them Trichophyton rubrum is a predominant anthropophilic fungi which causes chronic infections. Although, the infection is superficial and treatable, reinfection/coinfection causes inflation in the treatment cost. Identifying the source and mode of transmission is essential to prevent its transmission. Accurate discrimination is required to understand the clinical (relapse or reinfection) and epidemiological implications of the genetic heterogeneity of this species. Polymorphism in the Non Transcribed Spacer (NTS) region of ribosomal DNA (rDNA) clusters renders an effective way to discriminate strains among T. rubrum . To carry out the strain typing of the clinical isolates, Trichophyton rubrum using NTS as a molecular marker. Seventy T.rubrum clinical isolates obtained from April-2011-March 2013, from Sri Ramachandra Medical Centre, Chennai, Tamil Nadu, India, were identified by conventional phenotypic methods and included in this prospective study. The isolates were then subjected to Polymerase Chain Reaction (PCR) targeting two subrepeat elements (SREs), TRS-1 and TRS-2 of the NTS region. Strain-specific polymorphism was observed in both subrepeat loci. Total, nine different strains were obtained on combining both TRS-1 and TRS-2, SREs. The outcome has given a strong representation for using NTS region amplification in discriminating the T. rubrum clinical isolates. The method can be adapted as a tool for conducting epidemiology and population based study in T. rubrum infections. This will help in future exploration of the epidemiology of T. rubrum .
Directory of Open Access Journals (Sweden)
Teofânia HDA Vidigal
2004-03-01
Full Text Available The first and second internal transcribed spacer regions (ITS1 and ITS2 of the ribosomal DNA of Biomphalaria tenagophila complex (B. tenagophila, B. occidentalis, and B. t. guaibensis were sequenced and compared. The alignment lengths of these regions were about 655 bp and 481 bp, respectively. Phylogenetic relationships among the Biomphalaria species were inferred by Maximum Parsimony and Neighbor-joining methods. The phylogenetic trees produced, in most of the cases, were in accordance with morphological systematics and other molecular data previously obtained by polymerase chain reaction and restriction fragment length polymorphism analysis. The present results provide support for the proposal that B. tenagophila represents a complex comprising B. tenagophila, B. occidentalis and B. t. guaibensis.
The Heterogeneity of the Internal Transcribed Spacers (ITS of rDNAs in Imperata cylindrica in Taiwan
Directory of Open Access Journals (Sweden)
Chi-Chu Tsai
2000-09-01
Full Text Available Ribosomal DNA for internal transcribed spacers ITS, ITS1, 5.8S rRNA gene, ITS2 and the adjoining regions of the 17S and 25S rRNA genes were obtained from 45 individuals of Imperata cylindrica (Cogongrass in Taiwan via PCR amplification. The length of each PCR product was 692 bp, except for one sample (about 702 bp. All ITS DNA fragments were digested with EcoRV, CfoI, BanI, HaeIII, MspI, HinfI, BstOI, Sau96I, StyI and Eco109I, respectively. The ITS, including ITS1, 5.8S rRNA gene and ITS2, were very heterogeneous within an individual of Cogongrass in Taiwan. Of 45 individuals of Cogongrass in Taiwan, the ITS1 and ITS2 regions showed at least eight type variants, and 5.8S rRNA gene showed at least five type variants among Cogongrass population in Taiwan based on PCR-amplified RFLP. In conclusion, the ITS repeat sequences from Cogongrass in Taiwan was very high heterogeneous.
Liu, Y T; Chen, R K; Lin, S J; Chen, Y C; Chin, S W; Chen, F C; Lee, C Y
2014-04-08
The Orchidaceae is one of the largest and most diverse families of flowering plants. The Dendrobium genus has high economic potential as ornamental plants and for medicinal purposes. In addition, the species of this genus are able to produce large crops. However, many Dendrobium varieties are very similar in outward appearance, making it difficult to distinguish one species from another. This study demonstrated that the 12 Dendrobium species used in this study may be divided into 2 groups by internal transcribed spacer (ITS) sequence analysis. Red and yellow flowers may also be used to separate these species into 2 main groups. In particular, the deciduous characteristic is associated with the ITS genetic diversity of the A group. Of 53 designed simple sequence repeat (SSR) primer pairs, 7 pairs were polymorphic for polymerase chain reaction products that were amplified from a specific band. The results of this study demonstrate that these 7 SSR primer pairs may potentially be used to identify Dendrobium species and their progeny in future studies.
International Nuclear Information System (INIS)
Okamura, K; Hisada, T; Takata, K; Hiraishi, A
2013-01-01
Rapid and accurate identification of microbial species is essential task in microbiology and biotechnology. In prokaryotic systematics, genomic DNA-DNA hybridization is the ultimate tool to determine genetic relationships among bacterial strains at the species level. However, a practical problem in this assay is that the experimental procedure is laborious and time-consuming. In recent years, information on the 16S-23S rRNA gene internal transcribed spacer (ITS) region has been used to classify bacterial strains at the species and intraspecies levels. It is unclear how much information on the ITS region can reflect the genome that contain it. In this study, therefore, we evaluate the quantitative relationship between ITS DNA and entire genomic DNA similarities. For this, we determined ITS sequences of several species of anoxygenic phototrophic bacteria belonging to the order Rhizobiales, and compared with DNA-DNA relatedness among these species. There was a high correlation between the two genetic markers. Based on the regression analysis of this relationship, 70% DNA-DNA relatedness corresponded to 92% ITS sequence similarity. This suggests the usefulness of the ITS sequence similarity as a criterion for determining the genospecies of the phototrophic bacteria. To avoid the effects of polymorphism bias of ITS on similarities, PCR products from all loci of ITS were used directly as genetic probes for comparison. The results of ITS DNA-DNA hybridization coincided well with those of genomic DNA-DNA relatedness. These collective data indicate that the whole ITS DNA-DNA similarity can be used as an alternative to genomic DNA-DNA similarity.
Balasubramani, Subramani Paranthaman; Murugan, Ramar; Ravikumar, Kaliamoorthy; Venkatasubramanian, Padma
2010-09-01
Tribulus terrestris L. (Zygophyllaceae) is one of the highly traded raw drugs and also used as a stimulative food additive in Europe and USA. While, Ayurvedic Pharmacopoeia of India recognizes T. terrestris as Goksura, Tribulus lanuginosus and T. subramanyamii are also traded by the same name raising issues of quality control. The nuclear ribosomal RNA genes and ITS (internal transcribed spacer) sequence were used to develop species-specific DNA markers. The species-specific markers efficiently amplified 295bp for T. terrestris (TT1F and TT1R), 300bp for T. lanuginosus (TL1F and TL1R) and 214bp for T. subramanyamii (TS1F and TS1R). These DNA markers can be used to distinguish T. terrestris from its adulterants. Copyright (c) 2010 Elsevier B.V. All rights reserved.
Distanced Data: Transcribing Other People's Research Tapes
Tilley, Susan A.; Powick, Kelly D.
2004-01-01
In this article, we report on our qualitative study involving eight individuals hired to transcribe research tapes in university contexts. We consider issues of data analysis and data trustworthiness and the implications for both when transcription is assigned to someone other than the researcher. We explore the challenges transcribers faced…
Krak, Karol; Alvarez, Inés; Caklová, Petra; Costa, Andrea; Chrtek, Jindrich; Fehrer, Judith
2012-02-01
The development of three low-copy nuclear markers for low taxonomic level phylogenies in Asteraceae with emphasis on the subtribe Hieraciinae is reported. Marker candidates were selected by comparing a Lactuca complementary DNA (cDNA) library with public DNA sequence databases. Interspecific variation and phylogenetic signal of the selected genes were investigated for diploid taxa from the subtribe Hieraciinae and compared to a reference phylogeny. Their ability to cross-amplify was assessed for other Asteraceae tribes. All three markers had higher variation (2.1-4.5 times) than the internal transcribed spacer (ITS) in Hieraciinae. Cross-amplification was successful in at least seven other tribes of the Asteraceae. Only three cases indicating the presence of paralogs or pseudogenes were detected. The results demonstrate the potential of these markers for phylogeny reconstruction in the Hieraciinae as well as in other Asteraceae tribes, especially for very closely related species.
Directory of Open Access Journals (Sweden)
Topik Hidayat
2016-04-01
Full Text Available Withania somnifera (family Solanaceae, known commonly as Ashwaganda, is one of the important medicinal plants, and recent studies reported that Withanone, one of the chemical components in this plant, has ability to kill cancer cell. Because of endemic state of this plant to South Asia, exploring plant species under the same family which grow well in Indonesia has been of interest. The purpose of this study was to screen the Indonesian plant which has strong phylogenetic relationship with Ashwaganda. Thus, phylogenetic analysis using DNA sequences of internal transcribed spacer (ITS region was conducted. Thus, 19 species of Solanaceae and two species of Convolvulaceae as outgroup were examined. Five ITS regions of Ashwaganda retrieved from GenBank were included in the phylogenetic analysis. Parsimony analysis showed that Indonesia Solanaceae comprises seven groups which is consistent with the global Solanaceae relationship as previously reported. Furthermore, our study revealed that two species, Physalis angulata and Physalis peruviana, are relative to W. somnifera. Morphologically, they share characters of flower and fruit. This result indicated that these two species are potential to have similar chemical properties as Ashwaganda, thus we can have new variants of Withanone originated from Indonesia with similar effect.
International Nuclear Information System (INIS)
Gierga, David P.; Brewer, Johanna; Sharp, Gregory C.; Betke, Margrit; Willett, Christopher G.; Chen, George T.Y.
2005-01-01
Purpose: The correlation of the respiratory motion of external patient markers and abdominal tumors was examined. Data of this type are important for image-guided therapy techniques, such as respiratory gating, that monitor the movement of external fiducials. Methods and Materials: Fluoroscopy sessions for 4 patients with internal, radiopaque tumor fiducial clips were analyzed by computer vision techniques. The motion of the internal clips and the external markers placed on the patient's abdominal skin surface were quantified and correlated. Results: In general, the motion of the tumor and external markers were well correlated. The maximum amount of peak-to-peak craniocaudal tumor motion was 2.5 cm. The ratio of tumor motion to external-marker motion ranged from 0.85 to 7.1. The variation in tumor position for a given external-marker position ranged from 2 to 9 mm. The period of the breathing cycle ranged from 2.7 to 4.5 seconds, and the frequency patterns for both the tumor and the external markers were similar. Conclusions: Although tumor motion generally correlated well with external fiducial marker motion, relatively large underlying tumor motion can occur compared with external-marker motion and variations in the tumor position for a given marker position. Treatment margins should be determined on the basis of a detailed understanding of tumor motion, as opposed to relying only on external-marker information
Douglas J. Rhodes; Jane Leslie Hayes; Chris Steiner
1998-01-01
If retained, markers used in mark-release-recapture studies of bark beetle dispersal could provide valuable tools in the determination of post-dispersal fate. Retention of the internal marker rubidium (Rb) and of the external marker fluorescent powder during egg gallery construction, oviposition, and feeding were quantified at intervals from 0 to 96 hours by allowing...
A revised nomenclature for transcribed human endogenous retroviral loci
2011-01-01
Background Endogenous retroviruses (ERVs) and ERV-like sequences comprise 8% of the human genome. A hitherto unknown proportion of ERV loci are transcribed and thus contribute to the human transcriptome. A small proportion of these loci encode functional proteins. As the role of ERVs in normal and diseased biological processes is not yet established, transcribed ERV loci are of particular interest. As more transcribed ERV loci are likely to be identified in the near future, the development of a systematic nomenclature is important to ensure that all information on each locus can be easily retrieved. Results Here we present a revised nomenclature of transcribed human endogenous retroviral loci that sorts loci into groups based on Repbase classifications. Each symbol is of the format ERV + group symbol + unique number. Group symbols are based on a mixture of Repbase designations and well-supported symbols used in the literature. The presented guidelines will allow newly identified loci to be easily incorporated into the scheme. Conclusions The naming system will be employed by the HUGO Gene Nomenclature Committee for naming transcribed human ERV loci. We hope that the system will contribute to clarifying a certain aspect of a sometimes confusing nomenclature for human endogenous retroviruses. The presented system may also be employed for naming transcribed loci of human non-ERV repeat loci. PMID:21542922
Directory of Open Access Journals (Sweden)
Qiwei Zeng
Full Text Available Mulberry, belonging to the order Rosales, family Moraceae, and genus Morus, has received attention because of both its economic and medicinal value, as well as for its important ecological function. The genus Morus has a worldwide distribution, however, its taxonomy remains complex and disputed. Many studies have attempted to classify Morus species, resulting in varied numbers of designated Morus spp. To address this issue, we used information from internal transcribed spacer (ITS genetic sequences to study the taxonomy of all the members of generally accepted genus Morus. We found that intraspecific 5.8S rRNA sequences were identical but that interspecific 5.8S sequences were diverse. M. alba and M. notabilis showed the shortest (215 bp and the longest (233 bp ITS1 sequence length, respectively. With the completion of the mulberry genome, we could identify single nucleotide polymorphisms within the ITS locus in the M. notabilis genome. From reconstruction of a phylogenetic tree based on the complete ITS data, we propose that the Morus genus should be classified into eight species, including M. alba, M. nigra, M. notabilis, M. serrata, M. celtidifolia, M. insignis, M. rubra, and M. mesozygia. Furthermore, the classification of the ITS sequences of known interspecific hybrid clones into both paternal and maternal clades indicated that ITS variation was sufficient to distinguish interspecific hybrids in the genus Morus.
Zeng, Qiwei; Chen, Hongyu; Zhang, Chao; Han, Minjing; Li, Tian; Qi, Xiwu; Xiang, Zhonghuai; He, Ningjia
2015-01-01
Mulberry, belonging to the order Rosales, family Moraceae, and genus Morus, has received attention because of both its economic and medicinal value, as well as for its important ecological function. The genus Morus has a worldwide distribution, however, its taxonomy remains complex and disputed. Many studies have attempted to classify Morus species, resulting in varied numbers of designated Morus spp. To address this issue, we used information from internal transcribed spacer (ITS) genetic sequences to study the taxonomy of all the members of generally accepted genus Morus. We found that intraspecific 5.8S rRNA sequences were identical but that interspecific 5.8S sequences were diverse. M. alba and M. notabilis showed the shortest (215 bp) and the longest (233 bp) ITS1 sequence length, respectively. With the completion of the mulberry genome, we could identify single nucleotide polymorphisms within the ITS locus in the M. notabilis genome. From reconstruction of a phylogenetic tree based on the complete ITS data, we propose that the Morus genus should be classified into eight species, including M. alba, M. nigra, M. notabilis, M. serrata, M. celtidifolia, M. insignis, M. rubra, and M. mesozygia. Furthermore, the classification of the ITS sequences of known interspecific hybrid clones into both paternal and maternal clades indicated that ITS variation was sufficient to distinguish interspecific hybrids in the genus Morus.
Zeng, Qiwei; Chen, Hongyu; Zhang, Chao; Han, Minjing; Li, Tian; Qi, Xiwu; Xiang, Zhonghuai; He, Ningjia
2015-01-01
Mulberry, belonging to the order Rosales, family Moraceae, and genus Morus, has received attention because of both its economic and medicinal value, as well as for its important ecological function. The genus Morus has a worldwide distribution, however, its taxonomy remains complex and disputed. Many studies have attempted to classify Morus species, resulting in varied numbers of designated Morus spp. To address this issue, we used information from internal transcribed spacer (ITS) genetic sequences to study the taxonomy of all the members of generally accepted genus Morus. We found that intraspecific 5.8S rRNA sequences were identical but that interspecific 5.8S sequences were diverse. M. alba and M. notabilis showed the shortest (215 bp) and the longest (233 bp) ITS1 sequence length, respectively. With the completion of the mulberry genome, we could identify single nucleotide polymorphisms within the ITS locus in the M. notabilis genome. From reconstruction of a phylogenetic tree based on the complete ITS data, we propose that the Morus genus should be classified into eight species, including M. alba, M. nigra, M. notabilis, M. serrata, M. celtidifolia, M. insignis, M. rubra, and M. mesozygia. Furthermore, the classification of the ITS sequences of known interspecific hybrid clones into both paternal and maternal clades indicated that ITS variation was sufficient to distinguish interspecific hybrids in the genus Morus. PMID:26266951
Manuscript Transcription by Crowdsourcing: Transcribe Bentham
Directory of Open Access Journals (Sweden)
Martin Moyle
2011-02-01
Full Text Available Transcribe Bentham is testing the feasibility of outsourcing the work of manuscript transcription to members of the public. UCL Library Services holds 60,000 folios of manuscripts of the philosopher and jurist Jeremy Bentham (1748–1832. Transcribe Bentham will digitise 12,500 Bentham folios, and, through a wiki-based interface, allow volunteer transcribers to take temporary ownership of manuscript images and to create TEI-encoded transcription text for final approval by UCL experts. Approved transcripts will be stored and preserved, with the manuscript images, in UCL’s public Digital Collections repository. The project makes innovative use of traditional library material. It will stimulate public engagement with UCL’s scholarly archive collections and the challenges of palaeography and manuscript transcription; it will raise the profile of the work and thought of Jeremy Bentham; and it will create new digital resources for future use by professional researchers. Towards the end of the project, the transcription tool will be made available to other projects and services. This paper is based on a presentation given by the lead author at LIBER’s 39th Annual General Conference in Aarhus, Denmark, 2010.
Motif signatures of transcribed enhancers
Kleftogiannis, Dimitrios A.; Ashoor, Haitham; Zarokanellos, Nikolaos; Bajic, Vladimir B.
2017-01-01
In mammalian cells, transcribed enhancers (TrEn) play important roles in the initiation of gene expression and maintenance of gene expression levels in spatiotemporal manner. One of the most challenging questions in biology today is how the genomic
Directory of Open Access Journals (Sweden)
Iole Di Capua
Full Text Available Copepods belonging to the Oncaeidae family are commonly and abundantly found in marine zooplankton. In the Mediterranean Sea, forty-seven oncaeid species occur, of which eleven in the Gulf of Naples. In this Gulf, several Oncaea species were morphologically analysed and described at the end of the XIX century by W. Giesbrecht. In the same area, oncaeids are being investigated over seasonal and inter-annual scales at the long-term coastal station LTER-MC. In the present work, we identified six oncaeid species using the nuclear ribosomal internal transcribed spacers (ITS rDNA and the mitochondrial cytochrome c oxidase subunit I (mtCOI. Phylogenetic analyses based on these two genomic regions validated the sisterhood of the genera Triconia and the Oncaea sensu stricto. ITS1 and ITS2 phylogenies produced incongruent results about the position of Oncaea curta, calling for further investigations on this species. We also characterised the ITS2 region by secondary structure predictions and found that all the sequences analysed presented the distinct eukaryotic hallmarks. A Compensatory Base Change search corroborated the close relationship between O. venusta and O. curta and between O. media and O. venusta already identified by ITS phylogenies. The present results, which stem from the integration of molecular and morphological taxonomy, represent an encouraging step towards an improved knowledge of copepod biodiversity: The two complementary approaches, when applied to long-term copepod monitoring, will also help to better understanding their genetic variations and ecological niches of co-occurring species.
Ciardo, Diana E; Lucke, Katja; Imhof, Alex; Bloemberg, Guido V; Böttger, Erik C
2010-08-01
The implementation of internal transcribed spacer (ITS) sequencing for routine identification of molds in the diagnostic mycology laboratory was analyzed in a 5-year study. All mold isolates (n = 6,900) recovered in our laboratory from 2005 to 2009 were included in this study. According to a defined work flow, which in addition to troublesome phenotypic identification takes clinical relevance into account, 233 isolates were subjected to ITS sequence analysis. Sequencing resulted in successful identification for 78.6% of the analyzed isolates (57.1% at species level, 21.5% at genus level). In comparison, extended in-depth phenotypic characterization of the isolates subjected to sequencing achieved taxonomic assignment for 47.6% of these, with a mere 13.3% at species level. Optimization of DNA extraction further improved the efficacy of molecular identification. This study is the first of its kind to testify to the systematic implementation of sequence-based identification procedures in the routine workup of mold isolates in the diagnostic mycology laboratory.
Petrisko, Jill E; Pearl, Christopher A; Pilliod, David S; Sheridan, Peter P; Williams, Charles F; Peterson, Charles R; Bury, R Bruce
2008-01-01
We assessed the diversity and phylogeny of Saprolegniaceae on amphibian eggs from the Pacific Northwest, with particular focus on Saprolegnia ferax, a species implicated in high egg mortality. We identified isolates from eggs of six amphibians with the internal transcribed spacer (ITS) and 5.8S gene regions and BLAST of the GenBank database. We identified 68 sequences as Saprolegniaceae and 43 sequences as true fungi from at least nine genera. Our phylogenetic analysis of the Saprolegniaceae included isolates within the genera Saprolegnia, Achlya and Leptolegnia. Our phylogeny grouped S. semihypogyna with Achlya rather than with the Saprolegnia reference sequences. We found only one isolate that grouped closely with S. ferax, and this came from a hatchery-raised salmon (Idaho) that we sampled opportunistically. We had representatives of 7-12 species and three genera of Saprolegniaceae on our amphibian eggs. Further work on the ecological roles of different species of Saprolegniaceae is needed to clarify their potential importance in amphibian egg mortality and potential links to population declines.
Kusaba, M; Tsuge, T
1995-10-01
The internal transcribed spacer regions (ITS1 and ITS2) of ribosomal DNA from Alternaria species, including seven fungi known to produce host-specific toxins, were analyzed by polymerase chain reaction-amplification and direct sequencing. Phylogenetic analysis of the sequence data by the Neighbor-joining method showed that the seven toxin-producing fungi belong to a monophyletic group together with A. alternata. In contract, A. dianthi, A. panax, A. dauci, A. bataticola, A. porri, A. sesami and A. solani, species that can be morphologically distinguished from A. alternata, could be clearly separated from A. alternata by phylogenetic of the ITS variation. These results suggest that Alternaria pathogens which produce host-specific toxins are pathogenic variants within a single variable species, A. alternata.
Ciardo, Diana E.; Lucke, Katja; Imhof, Alex; Bloemberg, Guido V.; Böttger, Erik C.
2010-01-01
The implementation of internal transcribed spacer (ITS) sequencing for routine identification of molds in the diagnostic mycology laboratory was analyzed in a 5-year study. All mold isolates (n = 6,900) recovered in our laboratory from 2005 to 2009 were included in this study. According to a defined work flow, which in addition to troublesome phenotypic identification takes clinical relevance into account, 233 isolates were subjected to ITS sequence analysis. Sequencing resulted in successful identification for 78.6% of the analyzed isolates (57.1% at species level, 21.5% at genus level). In comparison, extended in-depth phenotypic characterization of the isolates subjected to sequencing achieved taxonomic assignment for 47.6% of these, with a mere 13.3% at species level. Optimization of DNA extraction further improved the efficacy of molecular identification. This study is the first of its kind to testify to the systematic implementation of sequence-based identification procedures in the routine workup of mold isolates in the diagnostic mycology laboratory. PMID:20573873
Oliveros, R; Cutillas, C; De Rojas, M; Arias, P
2000-12-01
Adult worms of Trichuris ovis and T. globulosa were collected from Ovis aries (sheep) and Capra hircus (goats). T. suis was isolated from Sus scrofa domestica (swine) and T. leporis was isolated from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and a ribosomal internal transcribed spacer (ITS2) was amplified and sequenced using polymerase-chain-reaction (PCR) techniques. The ITS2 of T. ovis and T. globulosa was 407 nucleotides in length and had a GC content of about 62%. Furthermore, the ITS2 of T. suis and T. leporis was 534 and 418 nucleotides in length and had a GC content of about 64.8% and 62.4%, respectively. There was evidence of slight variation in the sequence within individuals of all species analyzed, indicating intraindividual variation in the sequence of different copies of the ribosomal DNA. Furthermore, low-level intraspecific variation was detected. Sequence analyses of ITS2 products of T. ovis and T. globulosa demonstrated no sequence difference between them. Nevertheless, differences were detected between the ITS2 sequences of T. suis, T. leporis, and T. ovis, indicating that Trichuris species can reliably be differentiated by their ITS2 sequences and PCR-linked restriction-fragment-length polymorphism (RFLP).
Ieda, Shinsuke; Moriyama, Masafumi; Takeshita, Toru; Takashita, Toru; Maehara, Takashi; Imabayashi, Yumi; Shinozaki, Shoichi; Tanaka, Akihiko; Hayashida, Jun-Nosuke; Furukawa, Sachiko; Ohta, Miho; Yamashita, Yoshihisa; Nakamura, Seiji
2014-01-01
Oral candidiasis is closely associated with changes in the oral fungal flora and is caused primarily by Candida albicans. Conventional methods of fungal culture are time-consuming and not always conclusive. However, molecular genetic analysis of internal transcribed spacer (ITS) regions of fungal rRNA is rapid, reproducible and simple to perform. In this study we examined the fungal flora in patients with oral candidiasis and investigated changes in the flora after antifungal treatment using length heterogeneity-polymerization chain reaction (LH-PCR) analysis of ITS regions. Fifty-two patients with pseudomembranous oral candidiasis (POC) and 30 healthy controls were included in the study. Fungal DNA from oral rinse was examined for fungal species diversity by LH-PCR. Fungal populations were quantified by real-time PCR and previously-unidentified signals were confirmed by nucleotide sequencing. Relationships between the oral fungal flora and treatment-resistant factors were also examined. POC patients showed significantly more fungal species and a greater density of fungi than control individuals. Sixteen fungi were newly identified. The fungal populations from both groups were composed predominantly of C. albicans, though the ratio of C. dubliniensis was significantly higher in POC patients than in controls. The diversity and density of fungi were significantly reduced after treatment. Furthermore, fungal diversity and the proportion of C. dubliniensis were positively correlated with treatment duration. These results suggest that C. dubliniensis and high fungal flora diversity might be involved in the pathogenesis of oral candidiasis. We therefore conclude that LH-PCR is a useful technique for diagnosing and assessing the severity of oral candidal infection.
The Effect of Transcribing on Elementary Iranian EFL Learners’ Listening Comprehension
Directory of Open Access Journals (Sweden)
Mohammad Afsharrad
2015-12-01
Full Text Available This study is motivated by the gap existing between theory and practice in teaching listening. Most of the techniques used to teach listening put more emphasis on top-down processing while listeners’ problems are more of perceptive ones (bottom-up. In order to address the pervasive decoding problem in listening, this study suggests using transcribing exercise as an input enhancement device and investigates its effect on beginning learners’ listening ability. To this end, 31 learners participated in the study. The control group did not have any transcribing practice while the experimental group received transcribing exercise. In the data analysis step, an independent samples t test was employed to compare the two groups. The results show that transcribing has a significant positive effect on beginning learners’ listening comprehension. The findings of the study as well as advantages of transcribing exercise are discussed. Implications of the study and scope for future research are also addressed.
MytiBase: a knowledgebase of mussel (M. galloprovincialis transcribed sequences
Directory of Open Access Journals (Sweden)
Roch Philippe
2009-02-01
Full Text Available Abstract Background Although Bivalves are among the most studied marine organisms due to their ecological role, economic importance and use in pollution biomonitoring, very little information is available on the genome sequences of mussels. This study reports the functional analysis of a large-scale Expressed Sequence Tag (EST sequencing from different tissues of Mytilus galloprovincialis (the Mediterranean mussel challenged with toxic pollutants, temperature and potentially pathogenic bacteria. Results We have constructed and sequenced seventeen cDNA libraries from different Mediterranean mussel tissues: gills, digestive gland, foot, anterior and posterior adductor muscle, mantle and haemocytes. A total of 24,939 clones were sequenced from these libraries generating 18,788 high-quality ESTs which were assembled into 2,446 overlapping clusters and 4,666 singletons resulting in a total of 7,112 non-redundant sequences. In particular, a high-quality normalized cDNA library (Nor01 was constructed as determined by the high rate of gene discovery (65.6%. Bioinformatic screening of the non-redundant M. galloprovincialis sequences identified 159 microsatellite-containing ESTs. Clusters, consensuses, related similarities and gene ontology searches have been organized in a dedicated, searchable database http://mussel.cribi.unipd.it. Conclusion We defined the first species-specific catalogue of M. galloprovincialis ESTs including 7,112 unique transcribed sequences. Putative microsatellite markers were identified. This annotated catalogue represents a valuable platform for expression studies, marker validation and genetic linkage analysis for investigations in the biology of Mediterranean mussels.
Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.
1998-01-01
Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304
Santamaria, Monica; Fosso, Bruno; Licciulli, Flavio; Balech, Bachir; Larini, Ilaria; Grillo, Giorgio; De Caro, Giorgio; Liuni, Sabino; Pesole, Graziano
2018-01-04
A holistic understanding of environmental communities is the new challenge of metagenomics. Accordingly, the amplicon-based or metabarcoding approach, largely applied to investigate bacterial microbiomes, is moving to the eukaryotic world too. Indeed, the analysis of metabarcoding data may provide a comprehensive assessment of both bacterial and eukaryotic composition in a variety of environments, including human body. In this respect, whereas hypervariable regions of the 16S rRNA are the de facto standard barcode for bacteria, the Internal Transcribed Spacer 1 (ITS1) of ribosomal RNA gene cluster has shown a high potential in discriminating eukaryotes at deep taxonomic levels. As metabarcoding data analysis rely on the availability of a well-curated barcode reference resource, a comprehensive collection of ITS1 sequences supplied with robust taxonomies, is highly needed. To address this issue, we created ITSoneDB (available at http://itsonedb.cloud.ba.infn.it/) which in its current version hosts 985 240 ITS1 sequences spanning over 134 000 eukaryotic species. Each ITS1 is mapped on the NCBI reference taxonomy with its start and end positions precisely annotated. ITSoneDB has been developed in agreement to the FAIR guidelines by enabling the users to query and download its content through a simple web-interface and access relevant metadata by cross-linking to European Nucleotide Archive. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Piccin-Santos, Viviane; Brandão, Marcelo Mendes; Bittencourt-Oliveira, Maria Do Carmo
2014-08-01
Selection of genes that have not been horizontally transferred for prokaryote phylogenetic inferences is regarded as a challenging task. The markers internal transcribed spacer of ribosomal genes (16S-23S ITS) and phycocyanin intergenic spacer (PC-IGS), based on the operons of ribosomal and phycocyanin genes respectively, are among the most used markers in cyanobacteria. The region of the ribosomal genes has been considered stable, whereas the phycocyanin operon may have undergone horizontal transfer. To investigate the occurrence of horizontal transfer of PC-IGS, phylogenetic trees of Geitlerinema and Microcystis strains were generated using PC-IGS and 16S-23S ITS and compared. Phylogenetic trees based on the two markers were mostly congruent for Geitlerinema and Microcystis, indicating a common evolutionary history among ribosomal and phycocyanin genes with no evidence for horizontal transfer of PC-IGS. Thus, PC-IGS is a suitable marker, along with 16S-23S ITS for phylogenetic studies of cyanobacteria. © 2014 Phycological Society of America.
Liu, Junlong; Guan, Guiquan; Liu, Aihong; Li, Youquan; Yin, Hong; Luo, Jianxun
2014-03-01
In this study, two pairs of oligonucleotide primers were designed according to the nucleotide sequence of the internal transcribed spacers (ITSs) of Babesia bigemina and B. bovis isolates from China. The primers were used in a multiplex PCR to detect parasite DNA in blood samples from cattle. There was no cross reactions with B. ovata, B. major, B. sp. Kashi, Theileria annulata, T. sergenti, T. sinensis or normal bovine DNA. The sensitivity of multiplex PCR assay was 1 pg and 10 pg DNA for B. bigemina and B. bovis, respectively. A total of 260 field blood samples collected from cattle in five provinces of China were analyzed by multiplex PCR and light microscopy. PCR testing revealed that 7.3% (19/260) and 5.8% (15/260) of cattle were positive for B. bigemina and B. bovis and 1.2% (3/260) of cattle were co-infected with B. bigemina and B. bovis. Using light microscopy, 2.3% (6/260) and 1.5% (4/260) of cattle were infected by B. bigemina and B. bovis, respectively, and no co-infection was found. The results showed that the multiplex PCR developed in the present study could be an alternative diagnostic tool for the detection of B. bovis and B. bigemina infection in cattle.
Kehie, Mechuselie; Kumaria, Suman; Devi, Khumuckcham Sangeeta; Tandon, Pramod
2016-02-01
Sequences of the Internal Transcribed Spacer (ITS1-5.8S-ITS2) of nuclear ribosomal DNAs were explored to study the genetic diversity and molecular evolution of Naga King Chili. Our study indicated the occurrence of nucleotide polymorphism and haplotypic diversity in the ITS regions. The present study demonstrated that the variability of ITS1 with respect to nucleotide diversity and sequence polymorphism exceeded that of ITS2. Sequence analysis of 5.8S gene revealed a much conserved region in all the accessions of Naga King Chili. However, strong phylogenetic information of this species is the distinct 13 bp deletion in the 5.8S gene which discriminated Naga King Chili from the rest of the Capsicum sp. Neutrality test results implied a neutral variation, and population seems to be evolving at drift-mutation equilibrium and free from directed selection pressure. Furthermore, mismatch analysis showed multimodal curve indicating a demographic equilibrium. Phylogenetic relationships revealed by Median Joining Network (MJN) analysis denoted a clear discrimination of Naga King Chili from its closest sister species (Capsicum chinense and Capsicum frutescens). The absence of star-like network of haplotypes suggested an ancient population expansion of this chili.
Sutton, Bruce D.; Steck, Gary J.; Norrbom, Allen L.; Rodriguez, Erick J.; Srivastava, Pratibha; Alvarado, Norma Nolazco; Colque, Fredy; Landa, Erick Yábar; Sánchez, Juan José Lagrava; Quisberth, Elizabeth; Peñaranda, Emilio Arévalo; Clavijo, P. A. Rodriguez; Alvarez-Baca, Jeniffer K.; Zapata, Tito Guevara; Ponce, Patricio
2015-01-01
Abstract The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The ITS1 regions of additional specimens (17 collections) from Central America (México, Guatemala, Costa Rica, and Panamá), Brazil, Caribbean Colombia, and coastal Venezuela were sequenced and together with published sequences (Paraguay) provided context for interpretation. A total of six ITS1 sequence variants were recognized in the Andean region comprising four groups. Type I predominates in the southernmost range of Anastrepha fraterculus. Type II predominates in its northernmost range. In the central and northern Andes, the geographic distributions overlap and interdigitate with a strong elevational effect. A discussion of relationships between observed ITS1 types and morphometric types is included. PMID:26798259
Motif signatures of transcribed enhancers
Kleftogiannis, Dimitrios
2017-09-14
In mammalian cells, transcribed enhancers (TrEn) play important roles in the initiation of gene expression and maintenance of gene expression levels in spatiotemporal manner. One of the most challenging questions in biology today is how the genomic characteristics of enhancers relate to enhancer activities. This is particularly critical, as several recent studies have linked enhancer sequence motifs to specific functional roles. To date, only a limited number of enhancer sequence characteristics have been investigated, leaving space for exploring the enhancers genomic code in a more systematic way. To address this problem, we developed a novel computational method, TELS, aimed at identifying predictive cell type/tissue specific motif signatures. We used TELS to compile a comprehensive catalog of motif signatures for all known TrEn identified by the FANTOM5 consortium across 112 human primary cells and tissues. Our results confirm that distinct cell type/tissue specific motif signatures characterize TrEn. These signatures allow discriminating successfully a) TrEn from random controls, proxy of non-enhancer activity, and b) cell type/tissue specific TrEn from enhancers expressed and transcribed in different cell types/tissues. TELS codes and datasets are publicly available at http://www.cbrc.kaust.edu.sa/TELS.
Romi, Wahengbam; Keisam, Santosh; Ahmed, Giasuddin; Jeyaram, Kumaraswamy
2014-02-28
Meyerozyma guilliermondii (anamorph Candida guilliermondii) and Meyerozyma caribbica (anamorph Candida fermentati) are closely related species of the genetically heterogenous M. guilliermondii complex. Conventional phenotypic methods frequently misidentify the species within this complex and also with other species of the Saccharomycotina CTG clade. Even the long-established sequencing of large subunit (LSU) rRNA gene remains ambiguous. We also faced similar problem during identification of yeast isolates of M. guilliermondii complex from indigenous bamboo shoot fermentation in North East India. There is a need for development of reliable and accurate identification methods for these closely related species because of their increasing importance as emerging infectious yeasts and associated biotechnological attributes. We targeted the highly variable internal transcribed spacer (ITS) region (ITS1-5.8S-ITS2) and identified seven restriction enzymes through in silico analysis for differentiating M. guilliermondii from M. caribbica. Fifty five isolates of M. guilliermondii complex which could not be delineated into species-specific taxonomic ranks by API 20 C AUX and LSU rRNA gene D1/D2 sequencing were subjected to ITS-restriction fragment length polymorphism (ITS-RFLP) analysis. TaqI ITS-RFLP distinctly differentiated the isolates into M. guilliermondii (47 isolates) and M. caribbica (08 isolates) with reproducible species-specific patterns similar to the in silico prediction. The reliability of this method was validated by ITS1-5.8S-ITS2 sequencing, mitochondrial DNA RFLP and electrophoretic karyotyping. We herein described a reliable ITS-RFLP method for distinct differentiation of frequently misidentified M. guilliermondii from M. caribbica. Even though in silico analysis differentiated other closely related species of M. guilliermondii complex from the above two species, it is yet to be confirmed by in vitro analysis using reference strains. This method can be used
Su, Lei; Zhang, Qianqian; Gong, Jun
2017-07-01
Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.
Advances in plant gene-targeted and functional markers: a review
Directory of Open Access Journals (Sweden)
Poczai Péter
2013-02-01
Full Text Available Abstract Public genomic databases have provided new directions for molecular marker development and initiated a shift in the types of PCR-based techniques commonly used in plant science. Alongside commonly used arbitrarily amplified DNA markers, other methods have been developed. Targeted fingerprinting marker techniques are based on the well-established practices of arbitrarily amplified DNA methods, but employ novel methodological innovations such as the incorporation of gene or promoter elements in the primers. These markers provide good reproducibility and increased resolution by the concurrent incidence of dominant and co-dominant bands. Despite their promising features, these semi-random markers suffer from possible problems of collision and non-homology analogous to those found with randomly generated fingerprints. Transposable elements, present in abundance in plant genomes, may also be used to generate fingerprints. These markers provide increased genomic coverage by utilizing specific targeted sites and produce bands that mostly seem to be homologous. The biggest drawback with most of these techniques is that prior genomic information about retrotransposons is needed for primer design, prohibiting universal applications. Another class of recently developed methods exploits length polymorphism present in arrays of multi-copy gene families such as cytochrome P450 and β-tubulin genes to provide cross-species amplification and transferability. A specific class of marker makes use of common features of plant resistance genes to generate bands linked to a given phenotype, or to reveal genetic diversity. Conserved DNA-based strategies have limited genome coverage and may fail to reveal genetic diversity, while resistance genes may be under specific evolutionary selection. Markers may also be generated from functional and/or transcribed regions of the genome using different gene-targeting approaches coupled with the use of RNA information
Advances in plant gene-targeted and functional markers: a review
2013-01-01
Public genomic databases have provided new directions for molecular marker development and initiated a shift in the types of PCR-based techniques commonly used in plant science. Alongside commonly used arbitrarily amplified DNA markers, other methods have been developed. Targeted fingerprinting marker techniques are based on the well-established practices of arbitrarily amplified DNA methods, but employ novel methodological innovations such as the incorporation of gene or promoter elements in the primers. These markers provide good reproducibility and increased resolution by the concurrent incidence of dominant and co-dominant bands. Despite their promising features, these semi-random markers suffer from possible problems of collision and non-homology analogous to those found with randomly generated fingerprints. Transposable elements, present in abundance in plant genomes, may also be used to generate fingerprints. These markers provide increased genomic coverage by utilizing specific targeted sites and produce bands that mostly seem to be homologous. The biggest drawback with most of these techniques is that prior genomic information about retrotransposons is needed for primer design, prohibiting universal applications. Another class of recently developed methods exploits length polymorphism present in arrays of multi-copy gene families such as cytochrome P450 and β-tubulin genes to provide cross-species amplification and transferability. A specific class of marker makes use of common features of plant resistance genes to generate bands linked to a given phenotype, or to reveal genetic diversity. Conserved DNA-based strategies have limited genome coverage and may fail to reveal genetic diversity, while resistance genes may be under specific evolutionary selection. Markers may also be generated from functional and/or transcribed regions of the genome using different gene-targeting approaches coupled with the use of RNA information. Such techniques have the
Directory of Open Access Journals (Sweden)
Irshad M. Sulaiman
2014-06-01
Full Text Available In our previous study, we described the development of an internal transcribed spacer (ITS1 sequencing method, and used this protocol in species-identification of isolated fungi collected from the manufacturing areas of a compounding company known to have caused the multistate fungal meningitis outbreak in the United States. In this follow-up study, we have analyzed the unopened vials of Greek yogurt from the recalled batch to determine the possible cause of microbial contamination in the product. A total of 15 unopened vials of Greek yogurt belonging to the recalled batch were examined for the detection of fungi in these samples known to cause foodborne illness following conventional microbiological protocols. Fungi were isolated from all of the 15 Greek yogurt samples analyzed. The isolated fungi were genetically typed by DNA sequencing of PCR-amplified ITS1 region of rRNA gene. Analysis of data confirmed all of the isolated fungal isolates from the Greek yogurt to be Rhizomucor variabilis. The generated ITS1 sequences matched 100% with the published sequences available in GenBank. In addition, these yogurt samples were also tested for the presence of five types of bacteria (Salmonella, Listeria, Staphylococcus, Bacillus and Escherichia coli causing foodborne disease in humans, and found negative for all of them.
Rasmussen, C; Purcell, M K; Gregg, J L; LaPatra, S E; Winton, J R; Hershberger, P K
2010-03-09
The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of approximately 740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).
International Nuclear Information System (INIS)
Qurainy, F.A.; Khan, S.; Ali, M.A.; Hemaid, M.A.; Ashraf, M.
2011-01-01
Ruta graveolens L. (Rutaceae) is commonly known as 'Sudab' which is well known for hippocratic medicine and is commonly used in indigenous health-care system in India. Euphorbia dracunculoides Lam. (Euphorbiaceae) in raw drug trading has almost similar morphology to R. graveolens in dried state, is being sold locally or used clinically as an adulterant of R. graveolens (genuine) at a relatively low price under the same name 'Sudab' which has ultimately reduced the efficacy and quality of this herb. The internal transcribed spacer (ITS) sequence of nuclear ribosomal DNA gene of genuine and adulterant were sequenced and analyzed to assess species admixture in raw drug trading of genuine herbal drug. The BLAST search results of ITS sequence of genuine sample of 'Sudab' i.e., R. graveolens showed 99% similarity to the sequence of R. graveolens, however, E. dracunculoides showed 100% similarity to the species of Euphorbia and did not show any similarity with R. graveolens. The sequence alignment of both species was entirely different to each other. Phylogenetic analysis based on ITS sequence of adulterant sample i.e., E. dracunculoides together with sequences of Euphorbia species available in the GenBank has also clearly showed its nesting within the Euphorbia tree. The generated ITS sequences of both samples in the present study may be referred hereafter as species-specific DNA barcode signature, which can be used in authenticating and validating the exact species identities to discriminate the genuine sample of 'Sudab' from its adulterants if any available to guarantee the quality and purity of this drug in the herbal drug market. (author)
International Nuclear Information System (INIS)
Al-Qurainy, F.; Al-Hemaidi, F.M.; Khan, S.; Ali, M.A.; Tarroum, M.; Ashraf, M.
2011-01-01
Sodium azide (NaN/sub 3/) is a well known chemical mutagen which can effectively cause point mutation in plant genome. The mutagenicity by this potential mutagen was assessed in the regenerated mutant shoots of Artemisia annua using internal transcribed spacer (ITS) sequences of n rDNA. Insertions and/or deletions were detected in n rDNA-ITS sequences of all mutant shoots and compared with control ones using the ClustalX program. The regenerated shoots TS1 and TS2 had deleted bases, whereas TS3, TS4 and TS5 had insertions, because NaN/sub 3/ replaced the cytosine (C) by thymine (T) (C - T) (shoots; TS1 and TS4) and thymine (T) replaced by guanine (G) (T - G) (shoot; TS5), respectively. Artemisinin content was also measured in the regenerated six-week-old shoots of A. annua. All regenerated shoots had enhanced level of this compound as compared to that in the controls, being highest in the regenerated shoot TS3. (author)
Goodwin, S B; Dunkle, L D; Zismann, V L
2001-07-01
ABSTRACT Most of the 3,000 named species in the genus Cercospora have no known sexual stage, although a Mycosphaerella teleomorph has been identified for a few. Mycosphaerella is an extremely large and important genus of plant pathogens, with more than 1,800 named species and at least 43 associated anamorph genera. The goal of this research was to perform a large-scale phylogenetic analysis to test hypotheses about the past evolutionary history of Cercospora and Mycosphaerella. Based on the phylogenetic analysis of internal transcribed spacer (ITS) sequence data (ITS1, 5.8S rRNA gene, ITS2), the genus Mycosphaerella is monophyletic. In contrast, many anamorph genera within Mycosphaerella were polyphyletic and were not useful for grouping species. One exception was Cercospora, which formed a highly supported monophyletic group. Most Cercospora species from cereal crops formed a subgroup within the main Cercospora cluster. Only species within the Cercospora cluster produced the toxin cercosporin, suggesting that the ability to produce this compound had a single evolutionary origin. Intraspecific variation for 25 taxa in the Mycosphaerella clade averaged 1.7 nucleotides (nts) in the ITS region. Thus, isolates with ITS sequences that differ by two or more nucleotides may be distinct species. ITS sequences of groups I and II of the gray leaf spot pathogen Cercospora zeae-maydis differed by 7 nts and clearly represent different species. There were 6.5 nt differences on average between the ITS sequences of the sorghum pathogen Cercospora sorghi and the maize pathogen Cercospora sorghi var. maydis, indicating that the latter is a separate species and not simply a variety of Cercospora sorghi. The large monophyletic Mycosphaerella cluster contained a number of anamorph genera with no known teleomorph associations. Therefore, the number of anamorph genera related to Mycosphaerella may be much larger than suspected previously.
Tosto, D S; Hopp, H E
1996-01-01
The internal transcribed spacer region (ITS1 and ITS2) of the 18S-25S nuclear ribosomal DNA sequence and the intervening 5.8S region from five species of the genus Oxalis was amplified by polymerase chain reaction and subjected to direct DNA sequencing. On the basis of cytogenetic studies some species of this genus were postulated to be related by the number of chromosomes. Sequence homologies in the ITS1, 5.8S and ITS2 among species are in good agreement with previous relationships established on the basis of chromosome numbers. We also identified a highly conserved sequence of six bp in the ITS1, reported to be present in a wide range of flowering plants, but not in the Oxalidaceae family to which the genus Oxalis belongs to.
Geisler, Christoph; Jarvis, Donald L
2016-07-01
Spodoptera frugiperda (Sf) cell lines are used to produce several biologicals for human and veterinary use. Recently, it was discovered that all tested Sf cell lines are persistently infected with Sf-rhabdovirus, a novel rhabdovirus. As part of an effort to search for other adventitious viruses, we searched the Sf cell genome and transcriptome for sequences related to Sf-rhabdovirus. To our surprise, we found intact Sf-rhabdovirus N- and P-like ORFs, and partial Sf-rhabdovirus G- and L-like ORFs. The transcribed and genomic sequences matched, indicating the transcripts were derived from the genomic sequences. These appear to be endogenous viral elements (EVEs), which result from the integration of partial viral genetic material into the host cell genome. It is theoretically impossible for the Sf-rhabdovirus-like EVEs to produce infectious virus particles as 1) they are disseminated across 4 genomic loci, 2) the G and L ORFs are incomplete, and 3) the M ORF is missing. Our finding of transcribed virus-like sequences in Sf cells underscores that MPS-based searches for adventitious viruses in cell substrates used to manufacture biologics should take into account both genomic and transcribed sequences to facilitate the identification of transcribed EVE's, and to avoid false positive detection of replication-competent adventitious viruses. Copyright © 2016 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Terpos, E; Dimopoulos, M A; Sezer, O
2010-01-01
progression and overall survival. Bone markers have also been used for the early diagnosis of bone lesions. This International Myeloma Working Group report summarizes the existing data for the role of bone markers in assessing the extent of MM bone disease and in monitoring bone turnover during anti...
Zhao, Mingming; Shi, Yuhua; Wu, Lan; Guo, Licheng; Liu, Wei; Xiong, Chao; Yan, Song; Sun, Wei; Chen, Shilin
2016-05-05
Saffron is one of the most expensive species of Chinese herbs and has been subjected to various types of adulteration because of its high price and limited production. The present study introduces a loop-mediated isothermal amplification (LAMP) technique for the differentiation of saffron from its adulterants. This novel technique is sensitive, efficient and simple. Six specific LAMP primers were designed on the basis of the nucleotide sequence of the internal transcribed spacer 2 (ITS2) nuclear ribosomal DNA of Crocus sativus. All LAMP amplifications were performed successfully, and visual detection occurred within 60 min at isothermal conditions of 65 °C. The results indicated that the LAMP primers are accurate and highly specific for the discrimination of saffron from its adulterants. In particular, 10 fg of genomic DNA was determined to be the limit for template accuracy of LAMP in saffron. Thus, the proposed novel, simple, and sensitive LAMP assay is well suited for immediate on-site discrimination of herbal materials. Based on the study, a practical standard operating procedure (SOP) for utilizing the LAMP protocol for herbal authentication is provided.
Pereira, J O P; Freitas, B M; Jorge, D M M; Torres, D C; Soares, C E A; Grangeiro, T B
2009-01-01
Melipona quinquefasciata is a ground-nesting South American stingless bee whose geographic distribution was believed to comprise only the central and southern states of Brazil. We obtained partial sequences (about 500-570 bp) of first internal transcribed spacer (ITS1) nuclear ribosomal DNA from Melipona specimens putatively identified as M. quinquefasciata collected from different localities in northeastern Brazil. To confirm the taxonomic identity of the northeastern samples, specimens from the state of Goiás (Central region of Brazil) were included for comparison. All sequences were deposited in GenBank (accession numbers EU073751-EU073759). The mean nucleotide divergence (excluding sites with insertions/deletions) in the ITS1 sequences was only 1.4%, ranging from 0 to 4.1%. When the sites with insertions/deletions were also taken into account, sequence divergences varied from 0 to 5.3%. In all pairwise comparisons, the ITS1 sequence from the specimens collected in Goiás was most divergent compared to the ITS1 sequences of the bees from the other locations. However, neighbor-joining phylogenetic analysis showed that all ITS1 sequences from northeastern specimens along with the sample of Goiás were resolved in a single clade with a bootstrap support of 100%. The ITS1 sequencing data thus support the occurrence of M. quinquefasciata in northeast Brazil.
Directory of Open Access Journals (Sweden)
Moudgil A. D.
2017-06-01
Full Text Available The eggs recovered during faecal screening of Asiatic lions (kept at MC Zoological Park, Punjab, India were delineated as Toxascaris leonina eggs based on morphometric and molecular studies (polymerase chain reaction targeting internal transcribed spacer sequences. Therapeutic management with fenbendazole @10 mg/kg body weight, once daily orally for three consecutive days proved ineffective with maximum faecal egg count reduction (FECR on day 3 post treatments (69.35 %. But, therapeutic intervention with extended period dose schedule (5 consecutive days with fenbendazole (@10 mg/kg body weight proved effective and showed a maximum FECR of 95.34 % at day 7 post treatments. But, when ivermectin (@100μg/kg body weight was given orally on three alternate days, proved effective as FECR of 95.74 % was recorded at day 7 post treatments. Thus, present study highlights the molecular confi rmation of T. leonina and its management using fenbendazole and ivermectin in Asiatic lions.
Long-term Bias of Internal Markers in Sheep and Goat Digestion Trials
Directory of Open Access Journals (Sweden)
Gleidson Giordano Pinto de Carvalho
2013-01-01
Full Text Available Two digestion trials, one with sheep and another with goats, were conducted to evaluate the long-term bias (LTB of the indigestible dry matter (iDM, indigestible neutral detergent fiber (iNDF and indigestible acid detergent fiber (iADF internal markers. The study used eight Santa Inês castrated male sheep (average body weight of 16.6 kg distributed in two 4×4 Latin squares and eight Saanen castrated male goats (average body weight of 22.6 kg distributed in two 4×4 Latin squares. The experiments were conducted simultaneously, and the animals were housed in 1.2 m2 individual pens with wood-battened floors equipped with individual feeders and drinkers. The animals received isonitrogenous diets that were offered ad libitum and contained 14% crude protein and 70% sugar cane (with 0, 0.75, 1.5 or 2.25% CaO, in natural matter percentage, corrected with 1% urea and 30% concentrate. The experiment consisted of four experimental periods of 14 d each, with the feed, leftovers and feces sampled on the last four days of each period. The marker concentrations in the feed, leftovers and fecal samples were estimated by an in situ ruminal incubation procedure with a duration 240 h. The relationship between the intake and excretion of the markers was obtained by adjusting a simple linear regression model, independently from the treatment (diets fixed effects and Latin squares. For both the sheep and goats, a complete recovery of the iDM and iNDF markers was observed (p>0.05, indicating the absence of LTB for these markers. However, the iADF was not completely recovered, exhibiting an LTB of −9.12% (p<0.05 in the sheep evaluation and −3.02% (p<0.05 in the goat evaluation.
Directory of Open Access Journals (Sweden)
Spatz Linus
2000-01-01
Full Text Available The correct identification of Biomphalaria oligoza, B. orbignyi and B. peregrina species is difficult due to the morphological similarities among them. B. peregrina is widely distributed in South America and is considered a potential intermediate host of Schistosoma mansoni. We have reported the use of the polymerase chain reaction and restriction fragment length polymorphism analysis of the internal transcribed spacer region of the ribosomal DNA for the molecular identification of these snails. The snails were obtained from different localities of Argentina, Brazil and Uruguay. The restriction patterns obtained with MvaI enzyme presented the best profile to identify the three species. The profiles obtained with all enzymes were used to estimate genetic similarities among B. oligoza, B. peregrina and B. orbignyi. This is also the first report of B. orbignyi in Uruguay.
Directory of Open Access Journals (Sweden)
Silva-Pinhati A.C.O.
2004-01-01
Full Text Available Leaf-cutting ants of the genera Atta and Acromyrmex (tribe Attini are symbiotic with basidiomycete fungi of the genus Leucoagaricus (tribe Leucocoprineae, which they cultivate on vegetable matter inside their nests. We determined the variation of the 28S, 18S, and 5.8S ribosomal DNA (rDNA gene loci and the rapidly evolving internal transcribed spacers 1 and 2 (ITS1 and ITS2 of 15 sympatric and allopatric fungi associated with colonies of 11 species of leafcutter ants living up to 2,600 km apart in Brazil. We found that the fungal rDNA and ITS sequences from different species of ants were identical (or nearly identical to each other, whereas 10 GenBank Leucoagaricus species showed higher ITS variation. Our findings suggest that Atta and Acromyrmex leafcutters living in geographic sites that are very distant from each other cultivate a single fungal species made up of closely related lineages of Leucoagaricus gongylophorus. We discuss the strikingly high similarity in the ITS1 and ITS2 regions of the Atta and Acromyrmex symbiotic L. gongylophorus studied by us, in contrast to the lower similarity displayed by their non-symbiotic counterparts. We suggest that the similarity of our L. gongylophorus isolates is an indication of the recent association of the fungus with these ants, and propose that both the intense lateral transmission of fungal material within leafcutter nests and the selection of more adapted fungal strains are involved in the homogenization of the symbiotic fungal stock.
Cacciò, Simone M; Beck, Relja; Almeida, Andre; Bajer, Anna; Pozio, Edoardo
2010-05-01
PCR assays have been developed mainly to assist investigations into the epidemiology of Giardia duodenalis, the only species in the Giardia genus having zoonotic potential. However, a reliable identification of all species is of practical importance, particularly when water samples and samples from wild animals are investigated. The aim of the present work was to genotype Giardia species and G. duodenalis assemblages using as a target the region spanning the 5.8S gene and the 2 flanking internal transcribed spacers (ITS1 and ITS2) of the ribosomal gene. Primers were designed to match strongly conserved regions in the 3' end of the small subunit and in the 5' end of the large subunit ribosomal genes. The corresponding region (about 310 bp) was amplified from 49 isolates of both human and animal origin, representing all G. duodenalis assemblages as well as G. muris and G. microti. Sequence comparison and phylogenetic analysis showed that G. ardeae, G. muris, G. microti as well as the 7 G. duodenalis assemblages can be easily distinguished. Since the major subgroups within the zoonotic assemblages A and B can be identified by sequence analysis, this assay is also informative for molecular epidemiological studies.
Matheson, Jennifer L.
2007-01-01
Transcribing interview data is a time-consuming task that most qualitative researchers dislike. Transcribing is even more difficult for people with physical limitations because traditional transcribing requires manual dexterity and the ability to sit at a computer for long stretches of time. Researchers have begun to explore using an automated…
International Nuclear Information System (INIS)
Plathow, Christian; Zimmermann, Hendrik; Fink, Christian; Umathum, Reiner; Schoebinger, Max; Huber, Peter; Zuna, Ivan; Debus, Juergen; Schlegel, Wolfgang; Meinzer, Hans-Peter; Semmler, Wolfhard; Kauczor, Hans-Ulrich; Bock, Michael
2005-01-01
Purpose: To investigate, with dynamic magnetic resonance imaging (dMRI) and a fiducial marker, the influence of different breathing maneuvers on internal organ and external chest wall motion. Methods and materials: Lung and chest wall motion of 16 healthy subjects (13 male, 3 female) were examined with real-time trueFISP (true fast imaging with steady-state precession) dMRI and a small inductively coupled marker coil on either the abdomen or thorax. Three different breathing maneuvers were performed (predominantly 'abdominal breathing,' 'thoracic breathing,' and unspecific 'normal breathing'). The craniocaudal (CC), anteroposterior (AP), and mediolateral (ML) lung distances were correlated (linear regression coefficient) with marker coil position during forced and quiet breathing. Results: Differences of the CC distance between maximum forced inspiration and expiration were significant between abdominal and thoracic breathing (p < 0.05). The correlation between CC distance and coil position was best for forced abdominal breathing and a marker coil in the abdominal position (r 0.89 ± 0.04); for AP and ML distance, forced thoracic breathing and a coil in the thoracic position was best (r = 0.84 ± 0.03 and 0.82 ± 0.03, respectively). In quiet breathing, a lower correlation was found. Conclusion: A fiducial marker coil external to the thorax in combination with dMRI is a new technique to yield quantitative information on the correlation of internal organ and external chest wall motion. Correlations are highly dependent on the breathing maneuver
A Direct TeX-to-Braille Transcribing Method
Papasalouros, Andreas; Tsolomitis, Antonis
2017-01-01
The TeX/LaTeX typesetting system is the most wide-spread system for creating documents in Mathematics and Science. However, no reliable tool exists to this day for automatically transcribing documents from the above formats into Braille/Nemeth code. Thus, visually impaired students of related fields do not have access to the bulk of study material…
Dunster, Emily S; Kipnis, Daniel G; Angelo, F Michael
2014-01-01
In fall 2011, the Scott Memorial Library purchased 53 letters belonging to an 1841 graduate of Jefferson Medical College, John Plimpton Green. The library staff transcribed and digitized the letters, creating an online collection in the university's institutional repository, Jefferson Digital Commons. This article will detail the process of transcribing and digitizing the collection along with sharing statistics and the benefits of this project to global researchers.
Directory of Open Access Journals (Sweden)
Audra Skukauskaite
2012-01-01
Full Text Available This article presents a reflexive analysis of two transcripts of an open-ended interview and argues for transparency in transcribing processes and outcomes. By analyzing ways in which a researcher's theories become consequential in producing and using transcripts of an open-ended interview, this paper makes visible the importance of examining and presenting theoretical bases of transcribing decisions. While scholars across disciplines have argued that transcribing is a theoretically laden process (GREEN, FRANQUIZ & DIXON, 1997; KVALE & BRINKMAN, 2009, few have engaged in reflexive analyses of the data history to demonstrate the consequences particular theoretical and methodological approaches pose in producing knowledge claims and inciting dialogues across traditions. The article demonstrates how theory-method-claim relationships in transcribing influence research transparency and warrantability. URN: http://nbn-resolving.de/urn:nbn:de:0114-fqs1201146
Identification of human chromosome 22 transcribed sequences with ORF expressed sequence tags
de Souza, Sandro J.; Camargo, Anamaria A.; Briones, Marcelo R. S.; Costa, Fernando F.; Nagai, Maria Aparecida; Verjovski-Almeida, Sergio; Zago, Marco A.; Andrade, Luis Eduardo C.; Carrer, Helaine; El-Dorry, Hamza F. A.; Espreafico, Enilza M.; Habr-Gama, Angelita; Giannella-Neto, Daniel; Goldman, Gustavo H.; Gruber, Arthur; Hackel, Christine; Kimura, Edna T.; Maciel, Rui M. B.; Marie, Suely K. N.; Martins, Elizabeth A. L.; Nóbrega, Marina P.; Paçó-Larson, Maria Luisa; Pardini, Maria Inês M. C.; Pereira, Gonçalo G.; Pesquero, João Bosco; Rodrigues, Vanderlei; Rogatto, Silvia R.; da Silva, Ismael D. C. G.; Sogayar, Mari C.; de Fátima Sonati, Maria; Tajara, Eloiza H.; Valentini, Sandro R.; Acencio, Marcio; Alberto, Fernando L.; Amaral, Maria Elisabete J.; Aneas, Ivy; Bengtson, Mário Henrique; Carraro, Dirce M.; Carvalho, Alex F.; Carvalho, Lúcia Helena; Cerutti, Janete M.; Corrêa, Maria Lucia C.; Costa, Maria Cristina R.; Curcio, Cyntia; Gushiken, Tsieko; Ho, Paulo L.; Kimura, Elza; Leite, Luciana C. C.; Maia, Gustavo; Majumder, Paromita; Marins, Mozart; Matsukuma, Adriana; Melo, Analy S. A.; Mestriner, Carlos Alberto; Miracca, Elisabete C.; Miranda, Daniela C.; Nascimento, Ana Lucia T. O.; Nóbrega, Francisco G.; Ojopi, Élida P. B.; Pandolfi, José Rodrigo C.; Pessoa, Luciana Gilbert; Rahal, Paula; Rainho, Claudia A.; da Ro's, Nancy; de Sá, Renata G.; Sales, Magaly M.; da Silva, Neusa P.; Silva, Tereza C.; da Silva, Wilson; Simão, Daniel F.; Sousa, Josane F.; Stecconi, Daniella; Tsukumo, Fernando; Valente, Valéria; Zalcberg, Heloisa; Brentani, Ricardo R.; Reis, Luis F. L.; Dias-Neto, Emmanuel; Simpson, Andrew J. G.
2000-01-01
Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central coding regions of the resulting transcripts. They are termed ORF expressed sequence tags (ORESTES). The 250,000 ORESTES were assembled into 81,429 contigs. Of these, 1,181 (1.45%) were found to match sequences in chromosome 22 with at least one ORESTES contig for 162 (65.6%) of the 247 known genes, for 67 (44.6%) of the 150 related genes, and for 45 of the 148 (30.4%) EST-predicted genes on this chromosome. Using a set of stringent criteria to validate our sequences, we identified a further 219 previously unannotated transcribed sequences on chromosome 22. Of these, 171 were in fact also defined by EST or full length cDNA sequences available in GenBank but not utilized in the initial annotation of the first human chromosome sequence. Thus despite representing less than 15% of all expressed human sequences in the public databases at the time of the present analysis, ORESTES sequences defined 48 transcribed sequences on chromosome 22 not defined by other sequences. All of the transcribed sequences defined by ORESTES coincided with DNA regions predicted as encoding exons by genscan. (http://genes.mit.edu/GENSCAN.html). PMID:11070084
Gosman, Minna L.
Developed as a result of an analysis of the task of transcribing as practiced in a health facility, this study guide was designed to teach the knowledge and skills required of a medical transcriber. The medical record department was identified as a major occupational area, and a task inventory for medical records was developed and used as a basis…
Gosman, Minna L.
Following an analysis of the task of transcribing as practiced in a health facility, this study guide was developed to teach the knowledge and skills required of a medical transcriber. The medical record department was identified as a major occupational area, and a task inventory for medical records was developed and used as a basis for a…
International Nuclear Information System (INIS)
Kitamura, Kei; Shirato, Hiroki; Shimizu, Shinichi; Shinohara, Nobuo; Harabayashi, Toru; Shimizu, Tadashi; Kodama, Yoshihisa; Endo, Hideho; Onimaru, Rikiya; Nishioka, Seiko; Aoyama, Hidefumi; Tsuchiya, Kazuhiko; Miyasaka, Kazuo
2002-01-01
Background and purpose: We have developed a linear accelerator synchronized with a fluoroscopic real-time tumor-tracking system to reduce errors due to setup and organ motion. In the real-time tumor-tracking radiation therapy (RTRT) system, the accuracy of tumor tracking depends on the registration of the marker's coordinates. The registration accuracy and possible migration of the internal fiducial gold marker implanted into prostate and liver was investigated. Materials and methods: Internal fiducial gold markers were implanted in 14 patients with prostate cancer and four patients with liver tumors. Computed tomography (CT) was carried out as a part of treatment planning in the 18 patients. A total of 72 follow-up CT scans were taken. We calculated the relative relationship between the coordinates of the center of mass (CM) of the organs and those of the marker. The discrepancy in the CM coordinates during a follow-up CT compared to those recorded during the planning CT was used to study possible marker migration. Results: The standard deviation (SD) of interobserver variations in the CM coordinates was within 2.0 and 0.4 mm for the organ and the marker, respectively, in seven observers. Assuming that organs do not shrink, grow, or rotate, the maximum SD of migration error in each direction was estimated to be less than 2.5 and 2.0 mm for liver and prostate, respectively. There was no correlation between the marker position and the time after implantation. Conclusion: The degree of possible migration of the internal fiducial marker was within the limits of accuracy of the CT measurement. Most of the marker movement can be attributed to the measurement uncertainty, which also influences registration in actual treatment planning. Thus, even with the gold marker and RTRT system, a planning target volume margin should be used to account for registration uncertainty
Hind, Katharine R; Saunders, Gary W
2013-05-01
The use of molecular markers in taxonomic studies has become a standard practice in biology. However, consensus on which markers to use at the species level is lacking because evolutionary lineages show differences in divergence rates between organellar genomes. Ideally, researchers use multiple lines of evidence when first describing a species, such as the incorporation of several molecular markers from varied genomes (mitochondrion, plastid and nucleus). This study examined species boundaries in the red algal genus Chiharaea. We used five molecular markers, with at least one marker from each genome, coupled with thorough morphological analyses. We recognized three species in Chiharaea (C.americana, C. rhododactyla sp. nov., C. silvae) and two forms (C. americana f. americana and C. americana f. bodegensis (H.W. Johansen) stat. nov.). For C. americana f. americana and C. americana f. bodegensis differentiation based on morphological data was reflected in the plastid-encoded large subunit of RuBisCO (rbcL), but was not concordant with either the mitochondrial cytochrome c oxidase subunit 1 (COI-5P) or nuclear internal transcribed spacer (ITS) sequence data. We suggest that this discordance is indicative of ongoing hybridization and introgression between populations of C. americana f. americana and C. americana f. bodegensis. In addition, we used a PCR assay with ITS specific primers to amplify multiple ITS variants for collections assignable to C. americana indicating that there is genetic variability within ITS copies most likely due to introgression, crossing over and/or the retention of ancestral variants. Copyright © 2013 Elsevier Inc. All rights reserved.
Murray, Vincent; Chen, Jon K; Galea, Anne M
2014-04-01
The genome-wide pattern of DNA cleavage at transcription start sites (TSSs) for the anti-tumor drug bleomycin was examined in human HeLa cells using next-generation DNA sequencing. It was found that actively transcribed genes were preferentially cleaved compared with non-transcribed genes. The 143,600 identified human TSSs were split into non-transcribed genes (82,596) and transcribed genes (61,004) for HeLa cells. These transcribed genes were further split into quintiles of 12,201 genes comprising the top 20, 20-40, 40-60, 60-80, and 80-100 % of expressed genes. The bleomycin cleavage pattern at highly transcribed gene TSSs was greatly enhanced compared with purified DNA and non-transcribed gene TSSs. The top 20 and 20-40 % quintiles had a very similar enhanced cleavage pattern, the 40-60 % quintile was intermediate, while the 60-80 and 80-100 % quintiles were close to the non-transcribed and purified DNA profiles. The pattern of bleomycin enhanced cleavage had peaks that were approximately 200 bp apart, and this indicated that bleomycin was identifying the presence of phased nucleosomes at TSSs. Hence bleomycin can be utilized to detect chromatin structures that are present at actively transcribed genes. In this study, for the first time, the pattern of DNA damage by a clinically utilized cancer chemotherapeutic agent was performed on a human genome-wide scale at the nucleotide level.
Sarower, Mohammed Golam; Shahriar, Sheik Istiak Md; Nakamura, Hiromasa; Rouf, Muhammad Abdur; Okada, Shigeru
2017-11-01
Taxonomy of mud crabs genus Scylla has been misidentified for several years due to their high morphological plasticity. Several reports concerning mud crab have been published with misleading identification in Bangladesh. In this study, partial fragments of nuclear and mitochondrial DNA of Scylla species obtained from four locations along the Bangladesh coast were used to resolve taxonomical ambiguity of mud crab species. A single PCR product from the nuclear first internal transcribed spacer (ITS-1) marker and phylogenetic trees constructed based on 16S rDNA sequences indicated that all Scylla species obtained in this study were S. olivacea. Both molecular data and morphological characters revealed that S. olivacea is the only major species in Bangladesh coastal waters. Further, the 16S rDNA haplotypes significantly differed with known S. serrata by 33%. From this study it is clear that 'S. serrata' commonly reported from Bangladesh should be S. olivacea.
Cho, Junsang; Cheon, Wonjoong; Ahn, Sanghee; Jung, Hyunuk; Sheen, Heesoon; Park, Hee Chul; Han, Youngyih
2017-09-01
Target motion-induced uncertainty in particle therapy is more complicated than that in X-ray therapy, requiring more accurate motion management. Therefore, a hybrid motion-tracking system that can track internal tumor motion and as well as an external surrogate of tumor motion was developed. Recently, many correlation tests between internal and external markers in X-ray therapy have been developed; however, the accuracy of such internal/external marker tracking systems, especially in particle therapy, has not yet been sufficiently tested. In this article, the process of installing an in-house hybrid internal/external motion-tracking system is described and the accuracy level of tracking system was acquired. Our results demonstrated that the developed in-house external/internal combined tracking system has submillimeter accuracy, and can be clinically used as a particle therapy system as well as a simulation system for moving tumor treatment. © The Author 2017. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.
Czech Academy of Sciences Publication Activity Database
Schoch, C.L.; Seifert, K.A.; Huhndorf, S.; Robert, V.; Spouge, J.L.; Levesque, C.A.; Chen, W.; Bolchacova, E.; Voigt, K.; Crous, P.W.; Miller, A.N.; Wingfield, M. J.; Aime, M.C.; An, K.D.; Bai, F.Y.; Barreto, R.W.; Bergeron, M.J.; Blackwell, M.; Boekhout, T.; Bogale, M.; Boonyuen, N.; Burgaz, A.R.; Buyck, B.; Cai, L.; Cai, Q.; Cardinali, G.; Chaverri, P.; Coppins, B.J.; Crespo, A.; Cubas, P.; Cummings, C.; Damm, U.; de Beer, Z.W.; de Hoog, G.S.; Del-Prado, R.; Dentinger, B.; Dieguez-Uribeondo, J.; Divakar, P.K.; Douglas, B.; Duenas, M.; Duong, T.A.; Eberhardt, U.; Edwards, J.E.; Elshahed, M.S.; Fliegerová, Kateřina; Furtado, M.; Garcia, M.A.; Ge, Z.W.; Griffith, G.W.; Griffiths, K.; Groenewald, J.Z.; Groenewald, M.; Grube, M.; Gryzenhout, M.; Guo, L.D.; Hagen, F.; Hambleton, S.; Hamelin, R.C.; Hansen, K.; Harrold, P.; Heller, G.; Herrera, C.; Hirayama, K.; Hirooka, Y.; Ho, H.M.; Hoffmann, K.; Hofstetter, V.; Hognabba, F.; Hollingsworth, P.M.; Hong, S.B.; Hosaka, K.; Houbraken, J.; Hughes, K.; Huhtinen, S.; Hyde, K.D.; James, T.; Johnson, E.M.; Johnson, J.E.; Johnston, P.R.; Jones, E.B.; Kelly, L.J.; Kirk, P.M.; Knapp, D.G.; Koljalg, U.; Kovacs, G.M.; Kurtzman, C.P.; Landvik, S.; Leavitt, S.D.; Liggenstoffer, A.S.; Liimatainen, K.; Lombard, L.; Luangsa-Ard, J.J.; Lumbsch, H.T.; Maganti, H.; Maharachchikumbura, S.S.; Martin, M.P.; May, T.W.; McTaggart, A.R.; Methven, A.S.; Meyer, W.; Moncalvo, J.M.; Mongkolsamrit, S.; Nagy, L.G.; Nilsson, R.H.; Niskanen, T.; Nyilasi, I.; Okada, G.; Okane, I.; Olariaga, I.; Otte, J.; Papp, T.; Park, D.; Petkovits, T.; Pino-Bodas, R.; Quaedvlieg, W.; Raja, H.A.; Redecker, D.; Rintoul, T.; Ruibal, C.; Sarmiento-Ramirez, J.M.; Schmitt, I.; Schussler, A.; Shearer, C.; Sotome, K.; Stefani, F.O.; Stenroos, S.; Stielow, B.; Stockinger, H.; Suetrong, S.; Suh, S.O.; Sung, G.H.; Suzuki, M.; Tanaka, K.; Tedersoo, L.; Telleria, M.T.; Tretter, E.; Untereiner, W.A.; Urbina, H.; Vagvolgyi, C.; Vialle, A.; Vu, T.D.; Walther, G.; Wang, Q.M.; Wang, Y.; Weir, B.S.; Weiss, M.; White, M.M.; Xu, J.; Yahr, R.; Yang, Z.L.; Yurkov, A.; Zamora, J.C.; Zhang, N.; Zhuang, W.Y.; Schindel, D.
2012-01-01
Roč. 109, č. 16 (2012), s. 6241-6246 ISSN 0027-8424 Institutional research plan: CEZ:AV0Z50450515 Keywords : DNA barcoding * fungal biodiversity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.737, year: 2012
Directory of Open Access Journals (Sweden)
Muylaert An
2002-07-01
Full Text Available Abstract Background The number of patients with yeast infection has increased during the last years. Also the variety of species of clinical importance has increased. Correct species identification is often important for efficient therapy, but is currently mostly based on phenotypic features and is sometimes time-consuming and depends largely on the expertise of technicians. Therefore, we evaluated the feasibility of PCR-based amplification of the internally transcribed spacer region 2 (ITS2, followed by fragment size analysis on the ABI Prism 310 for the identification of clinically important yeasts. Results A rapid DNA-extraction method, based on simple boiling-freezing was introduced. Of the 26 species tested, 22 could be identified unambiguously by scoring the length of the ITS2-region. No distinction could be made between the species Trichosporon asteroides and T. inkin or between T. mucoides and T. ovoides. The two varieties of Cryptococcus neoformans (var. neoformans and var. gattii could be differentiated from each other due to a one bp length difference of the ITS2 fragment. The three Cryptococcus laurentii isolates were split into two groups according to their ITS2-fragment lengths, in correspondence with the phylogenetic groups described previously. Since the obtained fragment lengths compare well to those described previously and could be exchanged between two laboratories, an internationally usable library of ITS2 fragment lengths can be constructed. Conclusions The existing ITS2 size based library enables identification of most of the clinically important yeast species within 6 hours starting from a single colony and can be easily updated when new species are described. Data can be exchanged between laboratories.
Whipps, Christopher M.; El-Matbouli, M.; Hedrick, R.P.; Blazer, V.; Kent, M.L.
2004-01-01
Molecular approaches for resolving relationships among the Myxozoa have relied mainly on small subunit (SSU) ribosomal DNA (rDNA) sequence analysis. This region of the gene is generally used for higher phylogenetic studies, and the conservative nature of this gene may make it inadequate for intraspecific comparisons. Previous intraspecific studies of Myxobolus cerebralis based on molecular analyses reported that the sequence of SSU rDNA and the internal transcribed spacer (ITS) were highly conserved in representatives of the parasite from North America and Europe. Considering that the ITS is usually a more variable region than the SSU, we reanalyzed available sequences on GenBank and obtained sequences from other M. cerebralis representatives from the states of California and West Virginia in the USA and from Germany and Russia. With the exception of 7 base pairs, most of the sequence designated as ITS-1 in GenBank was a highly conserved portion of the rDNA near the 3-prime end of the SSU region. Nonetheless, the additional ITS-1 sequences obtained from the available geographic representatives were well conserved. It is unlikely that we would have observed virtually identical ITS-1 sequences between European and American M. cerebralis samples had it spread naturally over time, particularly when compared to the variation seen between isolates of another myxozoan (Kudoa thyrsites) that has most likely spread naturally. These data further support the hypothesis that the current distribution of M. cerebralis in North America is a result of recent introductions followed by dispersal via anthropogenic means, largely through the stocking of infected trout for sport fishing.
Choe, Se-Eun; Nguyen, Thuy Thi-Dieu; Kang, Tae-Gyu; Kweon, Chang-Hee; Kang, Seung-Won
2011-09-01
Nuclear ribosomal DNA sequence of the second internal transcribed spacer (ITS-2) has been used efficiently to identify the liver fluke species collected from different hosts and various geographic regions. ITS-2 sequences of 19 Fasciola samples collected from Korean native cattle were determined and compared. Sequence comparison including ITS-2 sequences of isolates from this study and reference sequences from Fasciola hepatica and Fasciola gigantica and intermediate Fasciola in Genbank revealed seven identical variable sites of investigated isolates. Among 19 samples, 12 individuals had ITS-2 sequences completely identical to that of pure F. hepatica, five possessed the sequences identical to F. gigantica type, whereas two shared the sequence of both F. hepatica and F. gigantica. No variations in length and nucleotide composition of ITS-2 sequence were observed within isolates that belonged to F. hepatica or F. gigantica. At the position of 218, five Fasciola containing a single-base substitution (C>T) formed a distinct branch inside the F. gigantica-type group which was similar to those of Asian-origin isolates. The phylogenetic tree of the Fasciola spp. based on complete ITS-2 sequences from this study and other representative isolates in different locations clearly showed that pure F. hepatica, F. gigantica type and intermediate Fasciola were observed. The result also provided additional genetic evidence for the existence of three forms of Fasciola isolated from native cattle in Korea by genetic approach using ITS-2 sequence.
Belagal, Praveen; Normand, Christophe; Shukla, Ashutosh; Wang, Renjie; Léger-Silvestre, Isabelle; Dez, Christophe; Bhargava, Purnima; Gadal, Olivier
2016-01-01
The association of RNA polymerase III (Pol III)–transcribed genes with nucleoli seems to be an evolutionarily conserved property of the spatial organization of eukaryotic genomes. However, recent studies of global chromosome architecture in budding yeast have challenged this view. We used live-cell imaging to determine the intranuclear positions of 13 Pol III–transcribed genes. The frequency of association with nucleolus and nuclear periphery depends on linear genomic distance from the tethering elements—centromeres or telomeres. Releasing the hold of the tethering elements by inactivating centromere attachment to the spindle pole body or changing the position of ribosomal DNA arrays resulted in the association of Pol III–transcribed genes with nucleoli. Conversely, ectopic insertion of a Pol III–transcribed gene in the vicinity of a centromere prevented its association with nucleolus. Pol III–dependent transcription was independent of the intranuclear position of the gene, but the nucleolar recruitment of Pol III–transcribed genes required active transcription. We conclude that the association of Pol III–transcribed genes with the nucleolus, when permitted by global chromosome architecture, provides nucleolar and/or nuclear peripheral anchoring points contributing locally to intranuclear chromosome organization. PMID:27559135
Transcribed enhancers lead waves of coordinated transcription in transitioning mammalian cells
DEFF Research Database (Denmark)
Arner, Erik; Daub, Carsten O.; Vitting-Seerup, Kristoffer
2015-01-01
Although it is generally accepted that cellular differentiation requires changes to transcriptional networks, dynamic regulation of promoters and enhancers at specific sets of genes has not been previously studied en masse. Exploiting the fact that active promoters and enhancers are transcribed, ...
Alasaad, S; Soglia, D; Spalenza, V; Maione, S; Soriguer, R C; Pérez, J M; Rasero, R; Degiorgis, M P Ryser; Nimmervoll, H; Zhu, X Q; Rossi, L
2009-02-05
The present study examined the relationship among individual Sarcoptes scabiei mites from 13 wild mammalian populations belonging to nine species in four European countries using the second internal transcribed spacer (ITS-2) of nuclear ribosomal DNA (rDNA) as genetic marker. The ITS-2 plus primer flanking 5.8S and 28S rDNA (ITS-2+) was amplified from individual mites by polymerase chain reaction (PCR) and the amplicons were sequenced directly. A total of 148 ITS-2+ sequences of 404bp in length were obtained and 67 variable sites were identified (16.59%). UPGMA analyses did not show any geographical or host-specific clustering, and a similar outcome was obtained using population pairwise Fst statistics. These results demonstrated that ITS-2 rDNA does not appear to be suitable for examining genetic diversity among mite populations.
Ghosh, Jayadri Sekhar; Bhattacharya, Samik; Pal, Amita
2017-06-01
The unavailability of the reproductive structure and unpredictability of vegetative characters for the identification and phylogenetic study of bamboo prompted the application of molecular techniques for greater resolution and consensus. We first employed internal transcribed spacer (ITS1, 5.8S rRNA and ITS2) sequences to construct the phylogenetic tree of 21 tropical bamboo species. While the sequence alone could grossly reconstruct the traditional phylogeny amongst the 21-tropical species studied, some anomalies were encountered that prompted a further refinement of the phylogenetic analyses. Therefore, we integrated the secondary structure of the ITS sequences to derive individual sequence-structure matrix to gain more resolution on the phylogenetic reconstruction. The results showed that ITS sequence-structure is the reliable alternative to the conventional phenotypic method for the identification of bamboo species. The best-fit topology obtained by the sequence-structure based phylogeny over the sole sequence based one underscores closer clustering of all the studied Bambusa species (Sub-tribe Bambusinae), while Melocanna baccifera, which belongs to Sub-Tribe Melocanneae, disjointedly clustered as an out-group within the consensus phylogenetic tree. In this study, we demonstrated the dependability of the combined (ITS sequence+structure-based) approach over the only sequence-based analysis for phylogenetic relationship assessment of bamboo.
Marti, Romain; Dabert, Patrick; Pourcher, Anne-Marie
2009-01-01
The objective of this study was to identify a microbial marker for pig manure contamination. We quantified the persistence of four dominant bacterial groups from the pig intestinal tract throughout manure handling at 10 livestock operations (including aerobic digestion) by using molecular typing. The partial 16S rRNA genes of Bacteroides-Prevotella, Eubacterium-Clostridiaceae, Bacillus-Streptococcus-Lactobacillus (BSL), and Bifidobacterium group isolates were amplified and analyzed by capillary electrophoresis single-strand conformation polymorphism. The most dominant bacterial populations were identified by cloning and sequencing their 16S rRNA genes. The results showed that Bifidobacterium spp. and, to a lesser extent, members of the BSL group, were less affected by the aerobic treatment than either Eubacterium-Clostridiaceae or Bacteroides-Prevotella. Two Bifidobacterium species found in raw manure were still present in manure during land application, suggesting that they can survive outside the pig intestinal tract and also survive aerobic treatment. The 16S-23S rRNA internal transcribed spacer of one species, Bifidobacterium thermacidophilum subsp. porcinum, was sequenced, and a specific pair of primers was designed for its detection in the environment. With this nested PCR assay, this potential marker was not detected in samples from 30 bovine, 30 poultry, and 28 human fecal samples or in 15 urban wastewater effluents. As it was detected in runoff waters after spreading of pig manure, we propose this marker as a suitable microbial indicator of pig manure contamination. PMID:19525269
Marti, Romain; Dabert, Patrick; Pourcher, Anne-Marie
2009-08-01
The objective of this study was to identify a microbial marker for pig manure contamination. We quantified the persistence of four dominant bacterial groups from the pig intestinal tract throughout manure handling at 10 livestock operations (including aerobic digestion) by using molecular typing. The partial 16S rRNA genes of Bacteroides-Prevotella, Eubacterium-Clostridiaceae, Bacillus-Streptococcus-Lactobacillus (BSL), and Bifidobacterium group isolates were amplified and analyzed by capillary electrophoresis single-strand conformation polymorphism. The most dominant bacterial populations were identified by cloning and sequencing their 16S rRNA genes. The results showed that Bifidobacterium spp. and, to a lesser extent, members of the BSL group, were less affected by the aerobic treatment than either Eubacterium-Clostridiaceae or Bacteroides-Prevotella. Two Bifidobacterium species found in raw manure were still present in manure during land application, suggesting that they can survive outside the pig intestinal tract and also survive aerobic treatment. The 16S-23S rRNA internal transcribed spacer of one species, Bifidobacterium thermacidophilum subsp. porcinum, was sequenced, and a specific pair of primers was designed for its detection in the environment. With this nested PCR assay, this potential marker was not detected in samples from 30 bovine, 30 poultry, and 28 human fecal samples or in 15 urban wastewater effluents. As it was detected in runoff waters after spreading of pig manure, we propose this marker as a suitable microbial indicator of pig manure contamination.
Directory of Open Access Journals (Sweden)
Dunja K Lamatsch
Full Text Available Sex-specific markers are a prerequisite for understanding reproductive biology, genetic factors involved in sex differences, mechanisms of sex determination, and ultimately the evolution of sex chromosomes. The Western mosquitofish, Gambusia affinis, may be considered a model species for sex-chromosome evolution, as it displays female heterogamety (ZW/ZZ, and is also ecologically interesting as a worldwide invasive species. Here, de novo RNA-sequencing on the gonads of sexually mature G. affinis was used to identify contigs that were highly transcribed in females but not in males (i.e., transcripts with ovary-specific expression. Subsequently, 129 primer pairs spanning 79 contigs were tested by PCR to identify sex-specific transcripts. Of those primer pairs, one female-specific DNA marker was identified, Sanger sequenced and subsequently validated in 115 fish. Sequence analyses revealed a high similarity between the identified sex-specific marker and the 3´ UTR of the aminomethyl transferase (amt gene of the closely related platyfish (Xiphophorus maculatus. This is the first time that RNA-seq has been used to successfully characterize a sex-specific marker in a fish species in the absence of a genome map. Additionally, the identified sex-specific marker represents one of only a handful of such markers in fishes.
Directory of Open Access Journals (Sweden)
Byeong Cheol Moon
2017-06-01
Full Text Available Determining the precise botanical origin of a traditional herbal medicine is important for basic quality control. In both the Chinese and Korean herbal pharmacopoeia, authentic Adenophorae Radix is defined as the roots of Adenophora stricta and Adenophora triphylla. However, the roots of Codonopsis lanceolata, Codonopsis pilosula, and Glehnia littoralis are frequently distributed as Adenophorae Radix in Korean herbal markets. Unfortunately, correctly identifying dried roots is difficult using conventional methods because the roots of those species are morphologically similar. Therefore, we developed DNA-based markers for the identification of authentic Adenophorae Radix and its common adulterants in commercially-processed samples. To develop a reliable method to discriminate between Adenophorae Radix and its adulterants, we sequenced the nuclear ribosomal DNA internal transcribed spacers (nrDNA-ITS and designed sequence-characterized amplified region (SCAR primers specific to the authentic and adulterant species. Using these primers, we developed SCAR markers for each species and established a multiplex-PCR method that can authenticate the four herbal medicines in a single PCR reaction. Furthermore, we confirmed that commercially-processed herbal medicines, which often have degraded DNA, could be assessed with our method. Therefore, our method is a reliable genetic tool to protect against adulteration and to standardize the quality of Adenophorae Radix.
Energy Technology Data Exchange (ETDEWEB)
Gardiner, K.
1993-11-01
The Second International Workshop on the Identification of Transcribed Sequences was held in San Francisco on November 7--8, 1992. The purpose of the workshop was to discuss and evaluate techniques for developing a complete transcriptional map of the human genome. Such a map requires the positions, sequences, and expression patterns of all genes. This goal is being approached from two different directions, each with strengths and weaknesses. One method is to identify the transcribed sequences from genomic DNA of a given region; the other is to systematically sequence and map cDNAs. The cDNA approach yields sequence information rapidly, but mapping each cDNA is a technical challenge. In the first approach, the map locations of genomic sequences are known at the outset, and the challenge is to identify exons. The efficient construction of a transcriptional map will require a diverse array of techniques.
Manni, Mosè; Gomulski, Ludvik M; Aketarawong, Nidchaya; Tait, Gabriella; Scolari, Francesca; Somboon, Pradya; Guglielmino, Carmela R; Malacrida, Anna R; Gasperi, Giuliano
2015-03-28
The dramatic worldwide expansion of Aedes albopictus (the Asian tiger mosquito) and its vector competence for numerous arboviruses represent a growing threat to public health security. Molecular markers are crucially needed for tracking the rapid spread of this mosquito and to obtain a deeper knowledge of population structure. This is a fundamental requirement for the development of strict monitoring protocols and for the improvement of sustainable control measures. Wild population samples from putative source areas and from newly colonised regions were analysed for variability at the ribosomal DNA internal transcribed spacer 2 (ITS2). Moreover, a new set of 23 microsatellite markers (SSR) was developed. Sixteen of these SSRs were tested in an ancestral (Thailand) and two adventive Italian populations. Seventy-six ITS2 sequences representing 52 unique haplotypes were identified, and AMOVA indicated that most of their variation occurred within individuals (74.36%), while only about 8% was detected among populations. Spatial analyses of molecular variance revealed that haplotype genetic similarity was not related to the geographic proximity of populations and the haplotype phylogeny clearly indicated that highly related sequences were distributed across populations from different geographical regions. The SSR markers displayed a high level of polymorphism both in the ancestral and in adventive populations, and F ST estimates suggested the absence of great differentiation. The ancestral nature of the Thai population was corroborated by its higher level of variability. The two types of genetic markers here implemented revealed the distribution of genetic diversity within and between populations and provide clues on the dispersion dynamics of this species. It appears that the diffusion of this mosquito does not conform to a progressive expansion from the native Asian source area, but to a relatively recent and chaotic propagule distribution mediated by human activities
Differential Reading, Naming, and Transcribing Speeds of Japanese Romaji and Hiragana
Yamada, Jun; Leong, Che Kan
2005-01-01
The morpho-syllabic Japanese writing system consists of the phonetic scripts of hiragana and katakana, the logographic kanji derived from Chinese characters and the less well researched romaji based on the Roman alphabet. In four experiments we investigated the speed with which Japanese college students read, named, and transcribed romaji as…
International scientific communications in the field of colorectal tumour markers.
Ivanov, Krasimir; Donev, Ivan
2017-05-27
To analyze scientometrically the dynamic science internationalization on colorectal tumour markers as reflected in five information portals and to outline the significant journals, scientists and institutions. A retrospective problem-oriented search was performed in Web of Science Core Collection (WoS), MEDLINE, BIOSIS Citation Index (BIOSIS) and Scopus for 1986-2015 as well as in Dervent Innovations Index (Derwent) for 1995-2015. Several specific scientometric parameters of the publication output and citation activity were comparatively analyzed. The following scientometric parameters were analyzed: (1) annual dynamics of publications; (2) scientific institutions; (3) journals; (4) authors; (5) scientific forums; (6) patents - number of patents, names and countries of inventors, and (7) citations (number of citations to publications by single authors received in WoS, BIOSIS Citation Index and Scopus). There is a trend towards increasing publication output on colorectal tumour markers worldwide along with high citation rates. Authors from 70 countries have published their research results in journals and conference proceedings in 21 languages. There is considerable country stratification similar to that in most systematic investigations. The information provided to end users and scientometricians varies between these data-bases in terms of most parameters due to different journal coverage, indexing systems and editorial policy. The lists of the so-called "core" journals and most productive authors in WoS, BIOSIS, MEDLINE and Scopus along with the list of the most productive authors - inventors in Derwent present a particular interest to the beginners in the field, the institutional and national science managers and the journal editorial board members. The role of the purposeful assessment of scientific forums and patents is emphasized. Our results along with this problem-oriented collection containing the researchers' names, addresses and publications could
Belagal, Praveen; Normand, Christophe; Shukla, Ashutosh; Wang, Renjie; Léger-Silvestre, Isabelle; Dez, Christophe; Bhargava, Purnima; Gadal, Olivier
2016-10-15
The association of RNA polymerase III (Pol III)-transcribed genes with nucleoli seems to be an evolutionarily conserved property of the spatial organization of eukaryotic genomes. However, recent studies of global chromosome architecture in budding yeast have challenged this view. We used live-cell imaging to determine the intranuclear positions of 13 Pol III-transcribed genes. The frequency of association with nucleolus and nuclear periphery depends on linear genomic distance from the tethering elements-centromeres or telomeres. Releasing the hold of the tethering elements by inactivating centromere attachment to the spindle pole body or changing the position of ribosomal DNA arrays resulted in the association of Pol III-transcribed genes with nucleoli. Conversely, ectopic insertion of a Pol III-transcribed gene in the vicinity of a centromere prevented its association with nucleolus. Pol III-dependent transcription was independent of the intranuclear position of the gene, but the nucleolar recruitment of Pol III-transcribed genes required active transcription. We conclude that the association of Pol III-transcribed genes with the nucleolus, when permitted by global chromosome architecture, provides nucleolar and/or nuclear peripheral anchoring points contributing locally to intranuclear chromosome organization. © 2016 Belagal et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
Transcribing Gail Jefferson: The 1977 Boston talk as it actually was
DEFF Research Database (Denmark)
Nevile, Maurice Richard
2015-01-01
A talk by Gail Jefferson, one of the founders of Conversation Analysis, has been recently made available, and Maurice Nevile undertook to transcribe it for the benefit of the language-in-interaction community. Here he reports on what it meant to him, and what we can all get out of such a powerful...
Directory of Open Access Journals (Sweden)
Maíra C. M. Freire
2008-01-01
Full Text Available Phakopsora pachyrhizi has dispersed globally and brought severe economic losses to soybean growers. The fungus has been established in Brazil since 2002 and is found nationwide. To gather information on the temporal and spatial patterns of genetic variation in P. pachyrhizi , we sequenced the nuclear internal transcribed spacer regions (ITS1 and ITS2. Total genomic DNA was extracted using either lyophilized urediniospores or lesions removed from infected leaves sampled from 26 soybean fields in Brazil and one field in South Africa. Cloning prior to sequencing was necessary because direct sequencing of PCR amplicons gave partially unreadable electrophoretograms with peak displacements suggestive of multiple sequences with length polymorphism. Sequences were determined from four clones per field. ITS sequences from African or Asian isolates available from the GenBank were included in the analyses. Independent sequence alignments of the ITS1 and ITS2 datasets identified 27 and 19 ribotypes, respectively. Molecular phylogeographic analyses revealed that ribotypes of widespread distribution in Brazil displayed characteristics of ancestrality and were shared with Africa and Asia, while ribotypes of rare occurrence in Brazil were indigenous. The results suggest P. pachyrhizi found in Brazil as originating from multiple, independent long-distance dispersal events.
Forensic botany II, DNA barcode for land plants: Which markers after the international agreement?
Ferri, G; Corradini, B; Ferrari, F; Santunione, A L; Palazzoli, F; Alu', M
2015-03-01
The ambitious idea of using a short piece of DNA for large-scale species identification (DNA barcoding) is already a powerful tool for scientists and the application of this standard technique seems promising in a range of fields including forensic genetics. While DNA barcoding enjoyed a remarkable success for animal identification through cytochrome c oxidase I (COI) analysis, the attempts to identify a single barcode for plants remained a vain hope for a longtime. From the beginning, the Consortium for the Barcode of Life (CBOL) showed a lack of agreement on a core plant barcode, reflecting the diversity of viewpoints. Different research groups advocated various markers with divergent set of criteria until the recent publication by the CBOL-Plant Working Group. After a four-year effort, in 2009 the International Team concluded to agree on standard markers promoting a multilocus solution (rbcL and matK), with 70-75% of discrimination to the species level. In 2009 our group firstly proposed the broad application of DNA barcoding principles as a tool for identification of trace botanical evidence through the analysis of two chloroplast loci (trnH-psbA and trnL-trnF) in plant species belonging to local flora. Difficulties and drawbacks that were encountered included a poor coverage of species in specific databases and the lack of authenticated reference sequences for the selected markers. Successful preliminary results were obtained providing an approach to progressively identify unknown plant specimens to a given taxonomic rank, usable by any non-specialist botanist or in case of a shortage of taxonomic expertise. Now we considered mandatory to update and to compare our previous findings with the new selected plastid markers (matK+rbcL), taking into account forensic requirements. Features of all the four loci (the two previously analyzed trnH-psbA+trnL-trnF and matK+rbcL) were compared singly and in multilocus solutions to assess the most suitable combination for
International Nuclear Information System (INIS)
West, Catharine M.L.; McKay, Michael J.; Hoelscher, Tobias; Baumann, Michael; Stratford, Ian J.; Bristow, Robert G.; Iwakawa, Mayumi; Imai, Takashi; Zingde, Surekha M.; Anscher, Mitchell S.; Bourhis, Jean; Begg, Adrian C.; Haustermans, Karin; Bentzen, Soren M.; Hendry, Jolyon H.
2005-01-01
Purpose: There is increasing interest in radiogenomics and the characterization of molecular profiles that predict normal tissue and tumor radioresponse. A meeting in Amsterdam was organized by the International Atomic Energy Agency to discuss this topic on an international basis. Methods and Materials: This report is not completely exhaustive, but highlights some of the ongoing studies and new initiatives being carried out worldwide in the banking of tumor and normal tissue samples underpinning the development of molecular marker profiles for predicting patient response to radiotherapy. It is generally considered that these profiles will more accurately define individual or group radiosensitivities compared with the nondefinitive findings from the previous era of cellular-based techniques. However, so far there are only a few robust reports of molecular markers predicting normal tissue or tumor response. Results: Many centers in different countries have initiated tissue and tumor banks to store samples from clinical trials for future molecular profiling analysis, to identify profiles that predict for radiotherapy response. The European Society for Therapeutic Radiology and Oncology GENEtic pathways for the Prediction of the effects of Irradiation (GENEPI) project, to store, document, and analyze sample characteristics vs. response, is the most comprehensive in this regard. Conclusions: The next 5-10 years are likely to see the results of these and other correlative studies, and promising associations of profiles with response should be validated in larger definitive trials
Gasiorowski, Janik C; Richardson, Dean W
2015-02-01
To describe clinical use of computed tomography (CT) and hoof surface markers to facilitate internal fixation within the confines of the hoof wall. Retrospective case series. Horses (n = 16) that had CT-guided internal fixation of the distal phalanx (DP) or distal sesamoid bone (DSB). Drill bit entry point and direction were planned from CT image series performed on hooves with grids of barium paste dots at proposed entry and projected exit sites. Post-implantation CT images were obtained to check screw position and length as well as fracture reduction. Imaging, reduction, and surgical and general anesthesia times were evaluated. Outcome was recorded. Screw position and length were considered near optimal in all horses, with no consequential malposition of bits or screws. Fracture reduction was evident in all cases. Preoperative planning times (at least 2 CT image acquisitions and grid creation) ranged from 10 to 20 minutes. Surgery time ranged from 45 to 90 minutes (mean, 61 minutes) and general anesthesia time ranged from 115 to 220 minutes (mean, 171 minutes). The combination of CT and surface marker grids allowed accurate positioning of screws in clinical DP and DSB fractures. The technique was simple and rapid. An aiming device is useful for the technique. © Copyright 2014 by The American College of Veterinary Surgeons.
Directory of Open Access Journals (Sweden)
Manen Jean-François
2004-11-01
Full Text Available Abstract Background Intra-specific and intra-individual polymorphism is frequently observed in nuclear markers of Ilex (Aquifoliaceae and discrepancy between plastid and nuclear phylogenies is the rule in this genus. These observations suggest that inter-specific plastid or/and nuclear introgression played an important role in the process of evolution of Ilex. With the aim of a precise understanding of the evolution of this genus, two distantly related sympatric species collected in Tenerife (Canary Islands, I. perado and I. canariensis, were studied in detail. Introgression between these two species was previously never reported. One plastid marker (the atpB-rbcL spacer and two nuclear markers, the ribosomal internal transcribed spacer (ITS and the nuclear encoded plastid glutamine synthetase (nepGS were analyzed for 13 and 27 individuals of I. perado and I. canariensis, respectively. Results The plastid marker is intra-specifically constant and correlated with species identity. On the other hand, whereas the nuclear markers are conserved in I. perado, they are highly polymorphic in I. canariensis. The presence of pseudogenes and recombination in ITS sequences of I. canariensis explain this polymorphism. Ancestral sequence polymorphism with incomplete lineage sorting, or past or recent hybridization with an unknown species could explain this polymorphism, not resolved by concerted evolution. However, as already reported for many other plants, past or recent introgression of an alien genotype seem the most probable explanation for such a tremendous polymorphism. Conclusions Data do not allow the determination with certitude of the putative species introgressing I. canariensis, but I. perado is suspected. The introgression would be unilateral, with I. perado as the male donor, and the paternal sequences would be rapidly converted in highly divergent and consequently unidentifiable pseudogenes. At least, this study allows the establishment of
Park, J-H; Sulyok, M; Lemons, A R; Green, B J; Cox-Ganser, J M
2018-05-04
Recent developments in molecular and chemical methods have enabled the analysis of fungal DNA and secondary metabolites, often produced during fungal growth, in environmental samples. We compared 3 fungal analytical methods by analysing floor dust samples collected from an office building for fungi using viable culture, internal transcribed spacer (ITS) sequencing and secondary metabolites using liquid chromatography-tandem mass spectrometry. Of the 32 metabolites identified, 29 had a potential link to fungi with levels ranging from 0.04 (minimum for alternariol monomethylether) to 5700 ng/g (maximum for neoechinulin A). The number of fungal metabolites quantified per sample ranged from 8 to 16 (average = 13/sample). We identified 216 fungal operational taxonomic units (OTUs) with the number per sample ranging from 6 to 29 (average = 18/sample). We identified 37 fungal species using culture, and the number per sample ranged from 2 to 13 (average = 8/sample). Agreement in identification between ITS sequencing and culturing was weak (kappa = -0.12 to 0.27). The number of cultured fungal species poorly correlated with OTUs, which did not correlate with the number of metabolites. These suggest that using multiple measurement methods may provide an improved understanding of fungal exposures in indoor environments and that secondary metabolites may be considered as an additional source of exposure. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Comparing COI and ITS as DNA barcode markers for mushrooms and allies (Agaricomycotina).
Dentinger, Bryn T M; Didukh, Maryna Y; Moncalvo, Jean-Marc
2011-01-01
DNA barcoding is an approach to rapidly identify species using short, standard genetic markers. The mitochondrial cytochrome oxidase I gene (COI) has been proposed as the universal barcode locus, but its utility for barcoding in mushrooms (ca. 20,000 species) has not been established. We succeeded in generating 167 partial COI sequences (~450 bp) representing ~100 morphospecies from ~650 collections of Agaricomycotina using several sets of new primers. Large introns (~1500 bp) at variable locations were detected in ~5% of the sequences we obtained. We suspect that widespread presence of large introns is responsible for our low PCR success (~30%) with this locus. We also sequenced the nuclear internal transcribed spacer rDNA regions (ITS) to compare with COI. Among the small proportion of taxa for which COI could be sequenced, COI and ITS perform similarly as a barcode. However, in a densely sampled set of closely related taxa, COI was less divergent than ITS and failed to distinguish all terminal clades. Given our results and the wealth of ITS data already available in public databases, we recommend that COI be abandoned in favor of ITS as the primary DNA barcode locus in mushrooms.
Identification of human chromosome 22 transcribed sequences with ORF expressed sequence tags
DEFF Research Database (Denmark)
de Souza, S J; Camargo, A A; Briones, M R
2000-01-01
Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central ...
DEFF Research Database (Denmark)
Milano, I.; Babbucci, M.; Cariani, A.
2014-01-01
fishery. Analysis of 850 individuals from 19 locations across the entire distribution range showed evidence for several outlier loci, with significantly higher resolving power. While 299 putatively neutral SNPs confirmed the genetic break between basins (FCT = 0.016) and weak differentiation within basins...... even when neutral markers provide genetic homogeneity across populations. Here, 381 SNPs located in transcribed regions were used to assess largeand fine-scale population structure in the European hake (Merluccius merluccius), a widely distributed demersal species of high priority for the European...
Molecular phylogeny of Ranunculaceae based on internal ...
African Journals Online (AJOL)
The botanical family Ranunculaceae contains important medicinal plants. To obtain new evolutionary evidence regarding the systematic classification of Ranunculaceae plants, we used molecular phylogenies to test relationships based on the internal transcribed spacer region. The results of phylogenetic analysis of 92 ...
‘I’m fishing really’ — inflammatory marker testing in primary care: a qualitative study
Watson, Jessica; de Salis, Isabel; Hamilton, Willie; Salisbury, Chris
2016-01-01
Background Inflammatory markers can be helpful as part of the diagnostic workup for specific diseases or for monitoring disease activity. A third use is as a screening and/or triage tool to differentiate between the presence or absence of disease. Most research into inflammatory markers looks at diagnosis of specific diseases and comes from secondary care. Qualitative studies to explore when and why clinicians use these tests in primary care are lacking. Aim To identify clinicians’ approaches to inflammatory marker testing in primary care. Design and setting Qualitative study with 26 GPs and nurse practitioners. Method Interviews were conducted using a semi-structured topic guide. Clinicians reviewed recent cases of inflammatory marker testing in their pathology inbox. Interviews were audiorecorded and transcribed. Qualitative analysis was conducted by two of the authors. Results Clinicians are uncertain about the appropriate use of inflammatory markers and differ in their approach to testing patients with undifferentiated symptoms. Normal or significantly elevated inflammatory markers are seen as helpful, but mildly raised inflammatory markers in the context of non-specific symptoms are difficult to interpret. Clinicians describe a tension between not wanting to ‘miss anything’ and, on the other hand, being wary of picking up borderline abnormalities that can lead to cascades of further tests. Diagnostic uncertainty is a common reason for inflammatory marker testing, with the aim to reassure; however, paradoxically, inconclusive results can generate a cycle of uncertainty and anxiety. Conclusion Further research is needed to define when inflammatory marker testing is useful in primary care and how to interpret results. PMID:26852797
Ramchiary, Nirala; Nguyen, Van Dan; Li, Xiaonan; Hong, Chang Pyo; Dhandapani, Vignesh; Choi, Su Ryun; Yu, Ge; Piao, Zhong Yun; Lim, Yong Pyo
2011-01-01
Genic microsatellite markers, also known as functional markers, are preferred over anonymous markers as they reveal the variation in transcribed genes among individuals. In this study, we developed a total of 707 expressed sequence tag-derived simple sequence repeat markers (EST-SSRs) and used for development of a high-density integrated map using four individual mapping populations of B. rapa. This map contains a total of 1426 markers, consisting of 306 EST-SSRs, 153 intron polymorphic markers, 395 bacterial artificial chromosome-derived SSRs (BAC-SSRs), and 572 public SSRs and other markers covering a total distance of 1245.9 cM of the B. rapa genome. Analysis of allelic diversity in 24 B. rapa germplasm using 234 mapped EST-SSR markers showed amplification of 2 alleles by majority of EST-SSRs, although amplification of alleles ranging from 2 to 8 was found. Transferability analysis of 167 EST-SSRs in 35 species belonging to cultivated and wild brassica relatives showed 42.51% (Sysimprium leteum) to 100% (B. carinata, B. juncea, and B. napus) amplification. Our newly developed EST-SSRs and high-density linkage map based on highly transferable genic markers would facilitate the molecular mapping of quantitative trait loci and the positional cloning of specific genes, in addition to marker-assisted selection and comparative genomic studies of B. rapa with other related species. PMID:21768136
Chen, Wen; Djama, Zeinab Robleh; Coffey, Michael D; Martin, Frank N; Bilodeau, Guillaume J; Radmer, Lorien; Denton, Geoff; Lévesque, C André
2013-01-01
Most Phytophthora spp. are destructive plant pathogens; therefore, effective monitoring and accurate early detection are important means of preventing potential epidemics and outbreaks of diseases. In the current study, a membrane-based oligonucleotide array was developed that can detect Phytophthora spp. reliably using three DNA regions; namely, the internal transcribed spacer (ITS), the 5' end of cytochrome c oxidase 1 gene (cox1), and the intergenic region between cytochrome c oxidase 2 gene (cox2) and cox1 (cox2-1 spacer). Each sequence data set contained ≈250 sequences representing 98 described and 15 undescribed species of Phytophthora. The array was validated with 143 pure cultures and 35 field samples. Together, nonrejected oligonucleotides from all three markers have the ability to reliably detect 82 described and 8 undescribed Phytophthora spp., including several quarantine or regulated pathogens such as Phytophthora ramorum. Our results showed that a DNA array containing signature oligonucleotides designed from multiple genomic regions provided robustness and redundancy for the detection and differentiation of closely related taxon groups. This array has the potential to be used as a routine diagnostic tool for Phytophthora spp. from complex environmental samples without the need for extensive growth of cultures.
International Nuclear Information System (INIS)
Stroian, G.; Falco, T.; Seuntjens, J.P.
2004-01-01
The accuracy of dose delivery in radiotherapy is affected by the uncertainty in tumor localization. Motion of internal anatomy due to physiological processes such as respiration may lead to significant displacements which compromise tumor coverage and generate irradiation of healthy tissue. Real-time tracking with infrared-based systems is often used for tracking thoracic motion in radiation therapy. We studied the origin of ghost markers ('crosstalk') which may appear during dual sensor-based infrared tracking of independent reflective markers. Ghost markers occur when two or more reflective markers are coplanar with each other and with the sensors of the two camera-based infrared tracking system. Analysis shows that sensors are not points but they have a finite extent and this extent determines for each marker a 'ghost volume'. If one reflective marker enters the ghost volume of another marker, ghost markers will be reported by the tracking system; if the reflective markers belong to a surface their 'ghost volume' is reduced to a 'ghost surface' (ghost zone). Appearance of ghost markers is predicted for markers taped on the torso of an anthropomorphic phantom. This study illustrates the dependence of the shape, extent, and location of the ghost zones on the shape of the anthropomorphic phantom, the angle of view of the tracking system, and the distance between the tracking system and the anthropomorphic phantom. It is concluded that the appearance of ghost markers can be avoided by positioning the markers outside the ghost zones of the other markers. However, if this is not possible and the initial marker configuration is ghost marker-free, ghost markers can be eliminated during real-time tracking by virtue of the fact that they appear in the coordinate data sequence only temporarily
International Nuclear Information System (INIS)
Fukada, Junichi; Hanada, Takashi; Kawaguchi, Osamu; Ohashi, Toshio; Takeuchi, Hiroya; Kitagawa, Yuko; Seki, Satoshi; Shiraishi, Yutaka; Ogata, Haruhiko; Shigematsu, Naoyuki
2013-01-01
Purpose: To quantify the interfraction displacement of esophageal fiducial markers for primary esophageal cancer radiation therapy. Methods and Materials: Orthogonal 2-dimensional (2D) matching records fused to vertebrae were analyzed in clinically staged T1/2N0 esophageal cancer patients undergoing endoscopic clipping as fiducial metal markers. Displacement of the markers between the digitally reconstructed radiographs and on-board kilovoltage images during radiation therapy was analyzed according to direction and esophageal site. Results: Forty-four patients, with 81 markers (10 proximal, 42 middle, and 29 distal), underwent 367 2D matching sessions during radiation therapy. The mean (SD) absolute marker displacement was 0.26 (0.30) cm in the right–left (RL), 0.50 (0.39) cm in the superior–inferior (SI), and 0.24 (0.21) cm in the anterior–posterior (AP) direction. Displacement was significantly larger in the SI than in the RL and AP directions (P<.0001). In the SI direction, mean absolute displacements of the distal, middle, and proximal esophagus were 0.67 (0.45) cm, 0.42 (0.32) cm, and 0.36 (0.30) cm, respectively. Distal esophagus displacement was significantly larger than those of the middle and proximal esophagus (P<.0001). The estimated internal margin to cover 95% of the cases was 0.75 cm in the RL and AP directions. In the SI direction, the margin was 1.25 cm for the proximal and middle esophagus and 1.75 cm for the distal esophagus. Conclusions: The magnitude of interfraction displacement of esophageal clips was larger in the SI direction, particularly in the distal esophagus, but substantial displacement was observed in other directions and at other esophageal sites. It is practical to take estimated movements into account with internal margins, even if vertebrae-based 2D matching is performed
Yamashita, Hideomi; Okuma, Kae; Tada, Keiichiro; Shiraishi, Kenshiro; Takahashi, Wataru; Shibata-Mobayashi, Shino; Sakumi, Akira; Saotome, Naoya; Haga, Akihiro; Onoe, Tsuyoshi; Ino, Kenji; Akahane, Masaaki; Ohtomo, Kuni; Nakagawa, Keiichi
2012-10-01
To study the three-dimensional movement of internal tumor bed fiducial and breast skin markers, using 320-multislice computed tomography (CT); and to analyze intrafractional errors for breast cancer patients undergoing breast irradiation. This study examined 280 markers on the skin of the breast (200 markers) and on the primary tumor bed (80 markers) of 20 patients treated by external-beam photon radiotherapy. Motion assessment was analyzed in 41 respiratory phases during 20 s of cine CT in the radiotherapy position. To assess intrafractional errors resulting from respiratory motion, four-dimensional CT scans were acquired for 20 patients. Motion in the anterior-posterior (A/P) and superior-inferior (S/I) directions showed a strong correlation (|r| > 0.7) with the respiratory curve for most markers (79% and 70%, respectively). The average marker displacements between maximum and minimum value during 20 s for the 200 breast skin metal markers were 1.1 ± 0.3 mm, 2.1 ± 0.6 mm, and 1.6 ± 0.4 mm in the left-right, A/P, and S/I directions, respectively. For the 80 tumor bed clips, displacements were 0.9 ± 0.2 mm in left-right, 1.7 ± 0.5 mm in A/P, and 1.1 ± 0.3 mm in S/I. There was no significant difference in the motion between breast quadrant regions or between the primary site and the other regions. Motion in primary breast tumors was evaluated with 320-multislice CT. Very little change was detected during individual radiation treatment fractions. Copyright © 2012 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Shehata, M.; Yan, K.; Itoh, Seiji; King, J.; Glenn, D.; Quinn, R.; Morris, D.L.
2009-01-01
The aim of this study was to investigate changes in spleen size, the level of chromogranin A as a tumor marker, and the relationship between these two parameters before and 3 months after selective internal radiation therapy (SIRT) for non-resectable liver metastases from neuroendocrine tumor (NET). Our first serious adverse event with this relatively new treatment is also discussed. A retrospective review of a prospective database identified patients with non-resectable liver metastases from NET who underwent SIRT between 2003 and 2007. Patients who underwent CT scans before and 3 months after treatment were included. The patients were divided into two groups: those with and without a 20% or more increase in splenic volume on the CT scans. The percentages of patients showing a tumor marker response in the two groups were then compared. Fourteen patients were included in the present analysis. A tumor marker response was seen in 6 of 7 patients (85.7%) who showed an increase in splenic volume of >20%, and in 3 of 7 patients (42.9%) without an increase in splenic volume (p=0.266). There was one death as a result of oesophageal variceal bleeding due to portal hypertension at 9 months after treatment. Splenic enlargement after SIRT may be associated with tumor marker response, although this could not be confirmed statistically in this study due to the small number of patients. Long-term splenomegaly and portal hypertension may be important complications of SIRT. This issue needs to be investigated further using a larger number of patients and longer follow-up. (author)
International Nuclear Information System (INIS)
Yamashita, Hideomi; Kida, Satoshi; Sakumi, Akira; Haga, Akihiro; Ito, Saori; Onoe, Tsuyoshi; Okuma, Kae; Ino, Kenji; Akahane, Masaaki; Ohtomo, Kuni; Nakagawa, Keiichi
2011-01-01
Purpose: To investigate the three-dimensional movement of internal fiducial markers placed near esophageal cancers using 320-multislice CT. Methods and Materials: This study examined 22 metal markers in the esophageal wall near the primary tumors of 12 patients treated with external-beam photon radiotherapy. Motion assessment was analyzed in 41 respiratory phases during 20 s of cine CT in the radiotherapy position. Results: Motion in the cranial-caudal (CC) direction showed a strong correlation (R 2 > 0.4) with the respiratory curve in most markers (73%). The average absolute amplitude of the marker movement was 1.5 ± 1.6 mm, 1.6 ± 1.7 mm, and 3.3 ± 3.3 mm in the left-right (LR), anterior-posterior (AP), and CC directions, respectively. The average marker displacements in the CC direction between peak exhalation and inhalation for the 22 clips were 1.1 mm (maximum, 5.5 mm), 3.0 mm (14.5 mm), and 5.1 mm (16.3 mm) for the upper, middle, and lower thoracic esophagus, respectively. Conclusions: Motion in primary esophagus tumor was evaluated with 320-multislice CT. According to this study, 4.3 mm CC, 1.5 mm AP, and 2.0 mm LR in the upper, 7.4 mm CC, 3.0 mm AP, and 2.4 mm LR in the middle, and 13.8 mm CC, 6.6 mm AP, and 6.8 mm LR in the lower thoracic esophagus provided coverage of tumor motion in 95% of the cases in our study population.
GokulRaj, Kathamuthu; Sundaresan, Natesan; Ganeshan, Enthai Jagan; Rajapriya, Pandi; Muthumary, Johnpaul; Sridhar, Jayavel; Pandi, Mohan
2014-01-01
Endophytic fungi are inhabitants of plants, living most part of their lifecycle asymptomatically which mainly confer protection and ecological advantages to the host plant. In this present study, 48 endophytic fungi were isolated from the leaves of three medicinal plants and characterized based on ITS2 sequence - secondary structure analysis. ITS2 secondary structures were elucidated with minimum free energy method (MFOLD version 3.1) and consensus structure of each genus was generated by 4SALE. ProfDistS was used to generate ITS2 sequence structure based phylogenetic tree respectively. Our elucidated isolates were belonging to Ascomycetes family, representing 5 orders and 6 genera. Colletotrichum/Glomerella spp., Diaporthae/Phomopsis spp., and Alternaria spp., were predominantly observed while Cochliobolus sp., Cladosporium sp., and Emericella sp., were represented by singletons. The constructed phylogenetic tree has well resolved monophyletic groups with >50% bootstrap value support. Secondary structures based fungal systematics improves not only the stability; it also increases the precision of phylogenetic inference. Above ITS2 based phylogenetic analysis was performed for our 48 isolates along with sequences of known ex-types taken from GenBank which confirms the efficiency of the proposed method. Further, we propose it as superlative marker for reconstructing phylogenetic relationships at different taxonomic levels due to their lesser length.
Gasser, R B; Rossi, L; Zhu, X
1999-11-01
The sequence of the second internal transcribed spacer of ribosomal DNA was determined for four species of Nematodirus (Nematodirus rupicaprae, Nematodirus oiratianus, Nematodirus davtiani alpinus and Nematodirus europaeus) from roe deer or alpine chamois. The second internal transcribed spacer of the four species varied in length from 228 to 236 bp, and the G + C contents ranged from 41 to 44%. While no intraspecific sequence variation was detected among multiple samples representing three of the taxa, sequence differences of 5.9-9.7% were detected among the four species, Nematodirus davtiani alpinus and N. rupicaprae were genetically most similar (94.1%), followed by N. oiratianus, N. europaeus and N. rupicaprae (91.1-91.5%), whereas N. oiratianus was genetically most different from N. davtiani alpinus. The interspecific sequence differences were exploited for the delineation of the four species by PCR-based restriction fragment length polymorphism (using two enzymes) and single-strand conformation polymorphism. The results have implications for diagnosis, epidemiology and for studying the systematics of the Nematodirinae.
Molecular Markers Useful for Intraspecies Subtyping and Strain Differentiation of Dermatophytes.
Mochizuki, Takashi; Takeda, Kiminobu; Anzawa, Kazushi
2017-02-01
Dermatophytosis is a very common skin disorder and the most frequent infection encountered by practicing dermatologists. The identification, pathogenicity, biology, and epidemiology of dermatophytes, the causative agents of dermatophytosis, are of interest for both dermatologists and medical mycologists. Recent advances in molecular methods have provided new techniques for identifying dermatophytes, including intraspecies variations. Intraspecies subtyping and strain differentiation have made possible the tracking of infections, the identification of common sources of infections, recurrence or reinfection after treatment, and analysis of strain virulence and drug resistance. This review describes molecular methods of intraspecies subtyping and strain differentiation, including analyses of mitochondrial DNA and non-transcribed spacer regions of ribosomal RNA genes, random amplification of polymorphic DNA, and microsatellite markers, along with their advantages and limitations.
Transcribed DNA is preferentially located in the perichromatin region of mammalian cell nuclei
Energy Technology Data Exchange (ETDEWEB)
Niedojadlo, Janusz [Centre of Electron Microscopy, University of Lausanne, Bugnon 27, CH-1005 Lausanne (Switzerland); Department of Cell Biology, Institute of General and Molecular Biology, Nicolaus Copernicus University, PL-87-100 Torun (Poland); Perret-Vivancos, Cecile [Centre of Electron Microscopy, University of Lausanne, Bugnon 27, CH-1005 Lausanne (Switzerland); Kalland, Karl-Henning [Centre for Research in Virology, The Gade Institute, University of Bergen, Jonas Liesv. 91, N-5009 Bergen (Norway); Cmarko, Dusan [Centre of Electron Microscopy, University of Lausanne, Bugnon 27, CH-1005 Lausanne (Switzerland); Charles University in Prague, First Faculty of Medicine, Institute of Cellular Biology and Pathology, and Department of Cell Biology, Institute of Physiology, Academy of Sciences of the Czech Republic, v.v.i., Albertov 4, CZ-12801 Prague (Czech Republic); Cremer, Thomas [Department of Biology II, LMU Biozentrum, Grosshaderner Strasse 2, D-82152 Planegg-Martinsried (Germany); Center for Integrated Protein Science Munich (CIPSM), LMU Munich, Munich (Germany); Driel, Roel van, E-mail: r.vandriel@uva.nl [Swammerdam Institute for Life Sciences, University of Amsterdam, P.O. Box 94215, 1090GE Amsterdam (Netherlands); Fakan, Stanislav, E-mail: sfakan@lrz.uni-muenchen.de [Centre of Electron Microscopy, University of Lausanne, Bugnon 27, CH-1005 Lausanne (Switzerland); Department of Biology II, LMU Biozentrum, Grosshaderner Strasse 2, D-82152 Planegg-Martinsried (Germany); Center for Integrated Protein Science Munich (CIPSM), LMU Munich, Munich (Germany)
2011-02-15
The precise localization of transcribed DNA and resulting RNA is an important aspect of the functional architecture of the nucleus. To this end we have developed a novel in situ hybridization approach in combination with immunoelectron microscopy, using sense and anti-sense RNA probes that are derived from total cellular or cytoplasmic poly(A+) RNA. This new technology is much more gentle than classical in situ hybridization using DNA probes and shows excellent preservation of nuclear structure. Carried out on ultrathin sections of fixed and resin-embedded COS-7 cells, it revealed at high resolution the localization of the genes that code for the cellular mRNAs. Quantitative analysis shows that most transcribed DNA is concentrated in the perichromatin region, i.e. the interface between subchromosomal compact chromatin domains and the interchromatin space essentially devoid of DNA. The RNA that is produced is found mainly in the perichromatin region and the interchromatin space. These results imply that in the mammalian nucleus the chromatin fiber is folded so that active genes are predominantly present in the perichromatin region, which is the most prominent site of transcription.
International Nuclear Information System (INIS)
Leadon, S.A.; Copper, P.K.
1993-01-01
Cells from patients with Cockayne syndrome (CS), which are sensitive to killing by UV although overall damage removal appears normal, are specifically defective in repair of UV damage in actively transcribe genes. Because several CS strains display cross-sensitivity to killing by ionizing radiation, the authors examined whether ionizing radiation-induced damage in active genes is preferentially repaired by normal cells and whether the radiosensitivity of CS cells can be explained by a defect in this process. They found that ionizing radiation-induced damage was repaired more rapidly in the transcriptionally active metallothionein IIA (MTIIA) gene than in the inactive MTIIB gene or in the genome overall in normal cells as a result of faster repair on the transcribed strand of MTIIA. Cells of the radiosensitive CS strain CS1AN are completely defective in this strand-selective repair of ionizing radiation-induced damage, although their overall repair rate appears normal. CS3BE cells, which are intermediate in radiosensitivity, do exhibit more rapid repair of the transcribed strand but at a reduced rate compared to normal cells. Xeroderma pigmentosum complementation group A cells, which are hypersensitive to UV light because of a defect in the nucleotide excision repair pathway but do not show increased sensitivity to ionizing radiation, preferentially repair ionizing radiation-induced damage on the transcribed strand of MTIIA. Thus, the ability to rapidly repair ionizing radiation-induced damage in actively transcribing genes correlates with cell survival. The results extend the generality of preferential repair in active genes to include damage other than bulky lesions
Lee, Shih-Chieh; Wang, Chia-Hsiang; Yen, Cheng-En; Chang, Chieh
2017-04-01
The major aim of made tea identification is to identify the variety and provenance of the tea plant. The present experiment used 113 tea plants [Camellia sinensis (L.) O. Kuntze] housed at the Tea Research and Extension Substation, from which 113 internal transcribed spacer 2 (ITS2) fragments, 104 trnL intron, and 98 trnL-trnF intergenic sequence region DNA sequences were successfully sequenced. The similarity of the ITS2 nucleotide sequences between tea plants housed at the Tea Research and Extension Substation was 0.379-0.994. In this polymerase chain reaction-amplified noncoding region, no varieties possessed identical sequences. Compared with the trnL intron and trnL-trnF intergenic sequence fragments of chloroplast cpDNA, the proportion of ITS2 nucleotide sequence variation was large and is more suitable for establishing a DNA barcode database to identify tea plant varieties. After establishing the database, 30 imported teas and 35 domestic made teas were used in this model system to explore the feasibility of using ITS2 sequences to identify the varieties and provenances of made teas. A phylogenetic tree was constructed using ITS2 sequences with the unweighted pair group method with arithmetic mean, which indicated that the same variety of tea plant is likely to be successfully categorized into one cluster, but contamination from other tea plants was also detected. This result provides molecular evidence that the similarity between important tea varieties in Taiwan remains high. We suggest a direct, wide collection of made tea and original samples of tea plants to establish an ITS2 sequence molecular barcode identification database to identify the varieties and provenances of tea plants. The DNA barcode comparison method can satisfy the need for a rapid, low-cost, frontline differentiation of the large amount of made teas from Taiwan and abroad, and can provide molecular evidence of their varieties and provenances. Copyright © 2016. Published by Elsevier B.V.
Cai, Shao-hang; Lu, Shi-xun; Liu, Li-li; Zhang, Chris Zhiyi; Yun, Jing-ping
2017-01-01
Background: Hepatocyte nuclear factor 4 alpha (HNF4α) plays an important role in tumourigenesis. There is growing evidence indicating that HNF4α transcribed by promoter 1 (P1-HNF4α) is expressed at relatively low levels in HCC and its presence predicts a favourable outcome for hepatocellular carcinoma (HCC) patients. However, the role of HNF4α transcribed by promoter 2 (P2-HNF4α) in HCC remains unclear. Methods: A total of 615 HCC specimens were obtained to construct tissue microarrays and pe...
Gupta, Sarika; Kumari, Kajal; Das, Jyotirmoy; Lata, Charu; Puranik, Swati; Prasad, Manoj
2011-07-01
Introns are noncoding sequences in a gene that are transcribed to precursor mRNA but spliced out during mRNA maturation and are abundant in eukaryotic genomes. The availability of codominant molecular markers and saturated genetic linkage maps have been limited in foxtail millet (Setaria italica (L.) P. Beauv.). Here, we describe the development of 98 novel intron length polymorphic (ILP) markers in foxtail millet using sequence information of the model plant rice. A total of 575 nonredundant expressed sequence tag (EST) sequences were obtained, of which 327 and 248 unique sequences were from dehydration- and salinity-stressed suppression subtractive hybridization libraries, respectively. The BLAST analysis of 98 EST sequences suggests a nearly defined function for about 64% of them, and they were grouped into 11 different functional categories. All 98 ILP primer pairs showed a high level of cross-species amplification in two millets and two nonmillets species ranging from 90% to 100%, with a mean of ∼97%. The mean observed heterozygosity and Nei's average gene diversity 0.016 and 0.171, respectively, established the efficiency of the ILP markers for distinguishing the foxtail millet accessions. Based on 26 ILP markers, a reasonable dendrogram of 45 foxtail millet accessions was constructed, demonstrating the utility of ILP markers in germplasm characterizations and genomic relationships in millets and nonmillets species.
Czech Academy of Sciences Publication Activity Database
Holubec jr., L.; Topolčan, O.; Pašková, H.; Holubec sen., L.; Pecen, Ladislav; Třeška, L.; Finek, J.; Pikner, R.; Visokai, V.; Lipská, V.; Svobodová, S.
2002-01-01
Roč. 17, č. 3 (2002), s. 133-134 ISSN 0886-3849. [International Conference on Human Tumor Markers /19./. 25.08.2002-29.08.2002, Velje] Institutional research plan: AV0Z1030915 Keywords : tumor markers * GIT cancers Subject RIV: BA - General Mathematics
International Nuclear Information System (INIS)
Tucker, M.A.
1988-01-01
Poly(A) + RNA from early or mid-stage ovarian follicles of C. erythrocephala was used to generate radiolabelled oogenesis-specific cDNA probes for screening the phage libraries. A cDNA probe made from mid-stage embryo poly(A) + RNA was used as the differential screening probe. Thus plaques hybridizing to the two oogenesis-specific probes but not the mid-stage embryo probe were selected as potentially containing oogenesis-specific genes. Two further rounds of screening were used to eliminate false positives and, after plaque purification, restriction digests of the remaining clones were screened by Southern blot hybridization to identify DNA fragments transcribed in an oogenesis-specific manner. In situ hybridization to sections of ovarian follicles has been used to determine the cell types within the follicles in which the various genes are expressed. Radiolabelled RNA probes for four of the C. erythrocephala oogenesis-specific clones and the two D. melanogaster clones have been hybridized to ovarian follicles. Further studies have been concentrated on the two germ-line transcribed, oogenesis-specific clones isolated from the D. melanogaster clone library. Detailed genetic mapping of the DA clone and of these mutations was performed to determine which mutations might represent the DA gene. cDNA clones have been isolated for the transcribed region of clone DA and have been used to further define the transcription unit from this region of the D. melanogaster genome
An annotated genetic map of loblolly pine based on microsatellite and cDNA markers
Directory of Open Access Journals (Sweden)
Wimalanathan Kokulapalan
2011-01-01
Full Text Available Abstract Background Previous loblolly pine (Pinus taeda L. genetic linkage maps have been based on a variety of DNA polymorphisms, such as AFLPs, RAPDs, RFLPs, and ESTPs, but only a few SSRs (simple sequence repeats, also known as simple tandem repeats or microsatellites, have been mapped in P. taeda. The objective of this study was to integrate a large set of SSR markers from a variety of sources and published cDNA markers into a composite P. taeda genetic map constructed from two reference mapping pedigrees. A dense genetic map that incorporates SSR loci will benefit complete pine genome sequencing, pine population genetics studies, and pine breeding programs. Careful marker annotation using a variety of references further enhances the utility of the integrated SSR map. Results The updated P. taeda genetic map, with an estimated genome coverage of 1,515 cM(Kosambi across 12 linkage groups, incorporated 170 new SSR markers and 290 previously reported SSR, RFLP, and ESTP markers. The average marker interval was 3.1 cM. Of 233 mapped SSR loci, 84 were from cDNA-derived sequences (EST-SSRs and 149 were from non-transcribed genomic sequences (genomic-SSRs. Of all 311 mapped cDNA-derived markers, 77% were associated with NCBI Pta UniGene clusters, 67% with RefSeq proteins, and 62% with functional Gene Ontology (GO terms. Duplicate (i.e., redundant accessory and paralogous markers were tentatively identified by evaluating marker sequences by their UniGene cluster IDs, clone IDs, and relative map positions. The average gene diversity, He, among polymorphic SSR loci, including those that were not mapped, was 0.43 for 94 EST-SSRs and 0.72 for 83 genomic-SSRs. The genetic map can be viewed and queried at http://www.conifergdb.org/pinemap. Conclusions Many polymorphic and genetically mapped SSR markers are now available for use in P. taeda population genetics, studies of adaptive traits, and various germplasm management applications. Annotating mapped
Marker-controlled watershed for lymphoma segmentation in sequential CT images
International Nuclear Information System (INIS)
Yan Jiayong; Zhao Binsheng; Wang, Liang; Zelenetz, Andrew; Schwartz, Lawrence H.
2006-01-01
Segmentation of lymphoma containing lymph nodes is a difficult task because of multiple variables associated with the tumor's location, intensity distribution, and contrast to its surrounding tissues. In this paper, we present a reliable and practical marker-controlled watershed algorithm for semi-automated segmentation of lymphoma in sequential CT images. Robust determination of internal and external markers is the key to successful use of the marker-controlled watershed transform in the segmentation of lymphoma and is the focus of this work. The external marker in our algorithm is the circle enclosing the lymphoma in a single slice. The internal marker, however, is determined automatically by combining techniques including Canny edge detection, thresholding, morphological operation, and distance map estimation. To obtain tumor volume, the segmented lymphoma in the current slice needs to be propagated to the adjacent slice to help determine the external and internal markers for delineation of the lymphoma in that slice. The algorithm was applied to 29 lymphomas (size range, 9-53 mm in diameter; mean, 23 mm) in nine patients. A blinded radiologist manually delineated all lymphomas on all slices. The manual result served as the ''gold standard'' for comparison. Several quantitative methods were applied to objectively evaluate the performance of the segmentation algorithm. The algorithm received a mean overlap, overestimation, and underestimation ratios of 83.2%, 13.5%, and 5.5%, respectively. The mean average boundary distance and Hausdorff boundary distance were 0.7 and 3.7 mm. Preliminary results have shown the potential of this computer algorithm to allow reliable segmentation and quantification of lymphomas on sequential CT images
International Nuclear Information System (INIS)
William, H.M.; Warburton, M.; Morris, M.; Hoisington, D.A.
2007-01-01
Molecular markers and related technologies have been used extensively in genetic characterization and identification of loci controlling traits of economic importance in many crop species. However, the application of such tools for crop improvement has not been extensive, at least in the public sector. Although there are clear advantages in using molecular markers as tools for indirect selection of traits of importance, available examples indicate that their use is restricted to traits with monogenic inheritance or when the inheritance is conditioned by a few genes with large effects. Another important limitation of large-scale marker applications is the cost involved in marker assays, which may be beyond the capacities of many public plant breeding enterprises. For an effective marker-assisted selection (MAS) activity to facilitate ongoing crop improvement programmes, especially in the context of the developing countries, laboratories with adequate capacity and adequately trained scientific personnel as well as operational resources are required. Although recent technological advances such as single nucleotide polymorphisms (SNPs) and associated assay protocols are likely to reduce assay costs significantly, for many of these operations, assay platforms with significant capital investments including computational capacity are required. Coupled with these limitations, private sector domination of biotechnology research with proprietary rights to important products and processes with immediate benefits to developing countries may further constrain the benefits these technologies may offer to resource-poor farmers. Policy-makers in different national programmes and international development and research agencies have a responsibility to sustain and augment the capacity of national public agricultural research organizations to ensure that biotechnology tools and processes are infused appropriately into national research efforts. They must also ensure that any
International Nuclear Information System (INIS)
Sun, Y.; Zheng, S.; Lee, J.; Hong, S.
2017-01-01
The genus Perilla, known as an oil crop or a Chinese medicine, vegetable crop, is widely cultivated in East Asia. It occurs in two distinct varieties, var. frutescens and var. crispa, and their genetic relationship is still obscure. To understand the genetic diversity and relationships of the cultivated and weedy types of Perilla crops in Korea, Japan and China, we evaluated the genetic variation of 20 accessions by 3 rDNA markers. Among these three markers, the nuclear ribosomal DNA (nrDNA) internal transcribed spacers (ITS) region of Perilla crops showed less sequence variations than the 5S and 18S genes. There were abundant variable nucleotide sites appearing in the 5S and 18S genes. Especially in the 18S gene, the variable nucleotide sites showed specificity between some Perilla type and other varieties. JPN1 showed 6 special variable nucleotide sites differing from other varieties, resulting in the farthest phylogenetic relationship in the 18S tree. CHI15 shared 8 special variable sites, also showing far phylogenetic relationship with other varieties. According to the sequence analysis result, the cultivated types of Korean var. frutescens showed relatively more genetic diversity than those of Japanese var. frutescens, while Korean var. crispa showed lower genetic diversity than those of Japanese var. crispa. However, the intra- or inter-variety genetic distance did not have significant difference. This work provided more sequence resources of Perilla crops and evidences to evaluate the genetic variation and relationships. Our result would help molecular type identification, functional plant breeding and trait improvement of Perilla crops. (author)
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1998-01-01
The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...
Ichikawa, Madoka; Bawn, Saw; Maw, Ni Ni; Htun, Lat Lat; Thein, Myint; Gyi, Aung; Sunn, Kyaw; Katakura, Ken; Itagaki, Tadashi
2011-12-01
Fasciola spp. in Myanmar were characterized on the basis of spermatogenesis status and DNA markers of nuclear internal transcribed spacer 1 (ITS1) and mitochondrial NADH dehydrogenase subunit 1 (nad1). We collected 88 adult flukes from Yangon, Lashio, and Myitkyina. Spermatogenesis status was analyzed by the presence of sperm in the seminal vesicles, and 8 aspermic and 80 spermic flukes were detected. The flukes were identified on the basis of spermatogenesis status and ITS1 types which were analyzed by a PCR-RFLP method, and 80 spermic flukes were identified as F. gigantica. A very low detection rate of aspermic Fasciola sp. indicated that they are not established in Myanmar. In phylogenetic analyses, the 7 aspermic Fasciola sp. from Myitkyina displayed a haplotype in nad1 sequence, which was identical to that of aspermic Fasciola sp. from other Asian countries including China. Therefore, they were probably introduced from China through an infected domestic ruminant. On the other hand, 17 nad1 haplotypes detected in F. gigantica belonged to 2 clades unique to Myanmar, each with a distinct founder haplotype in a network analysis. This indicated a unique history of F. gigantica introduction into Myanmar involving ancient artificial movements of domestic ruminants. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
DEFF Research Database (Denmark)
Haldrup, Martin Kristoffer; Nielsen, Søren Fæster; Wert, John A.
2008-01-01
on a homogenous distribution of marker particles throughout the bulk of a sample, markers which are detected through the application of synchrotron X-ray tomography. Making use of the morphology of individual markers, motion of individual markers is tracked during deformation allowing the local displacement field...
Directory of Open Access Journals (Sweden)
Li Yujun
2011-10-01
Full Text Available Abstract Background Currently there exists a limited availability of genetic marker resources in sweetpotato (Ipomoea batatas, which is hindering genetic research in this species. It is necessary to develop more molecular markers for potential use in sweetpotato genetic research. With the newly developed next generation sequencing technology, large amount of transcribed sequences of sweetpotato have been generated and are available for identifying SSR markers by data mining. Results In this study, we investigated 181,615 ESTs for the identification and development of SSR markers. In total, 8,294 SSRs were identified from 7,163 SSR-containing unique ESTs. On an average, one SSR was found per 7.1 kb of EST sequence with tri-nucleotide motifs (42.9% being the most abundant followed by di- (41.2%, tetra- (9.2%, penta- (3.7% and hexa-nucleotide (3.1% repeat types. The top five motifs included AG/CT (26.9%, AAG/CTT (13.5%, AT/TA (10.6%, CCG/CGG (5.8% and AAT/ATT (4.5%. After removing possible duplicate of published EST-SSRs of sweetpotato, a total of non-repeat 7,958 SSR motifs were identified. Based on these SSR-containing sequences, 1,060 pairs of high-quality SSR primers were designed and used for validation of the amplification and assessment of the polymorphism between two parents of one mapping population (E Shu 3 Hao and Guang 2k-30 and eight accessions of cultivated sweetpotatoes. The results showed that 816 primer pairs could yield reproducible and strong amplification products, of which 195 (23.9% and 342 (41.9% primer pairs exhibited polymorphism between E Shu 3 Hao and Guang 2k-30 and among the 8 cultivated sweetpotatoes, respectively. Conclusion This study gives an insight into the frequency, type and distribution of sweetpotato EST-SSRs and demonstrates successful development of EST-SSR markers in cultivated sweetpotato. These EST-SSR markers could enrich the current resource of molecular markers for the sweetpotato community and would
Population genetic analysis of Enterocytozoon bieneusi in humans.
Li, Wei; Cama, Vitaliano; Feng, Yaoyu; Gilman, Robert H; Bern, Caryn; Zhang, Xichen; Xiao, Lihua
2012-01-01
Genotyping based on sequence analysis of the ribosomal internal transcribed spacer has revealed significant genetic diversity in Enterocytozoonbieneusi. Thus far, the population genetics of E. bieneusi and its significance in the epidemiology of microsporidiosis have not been examined. In this study, a multilocus sequence typing of E. bieneusi in AIDS patients in Lima, Peru was conducted, using 72 specimens previously genotyped as A, D, IV, EbpC, WL11, Peru7, Peru8, Peru10 and Peru11 at the internal transcribed spacer locus. Altogether, 39 multilocus genotypes were identified among the 72 specimens. The observation of strong intragenic linkage disequilibria and limited genetic recombination among markers were indicative of an overall clonal population structure of E. bieneusi. Measures of pair-wise intergenic linkage disequilibria and a standardised index of association (IAS) based on allelic profile data further supported this conclusion. Both sequence-based and allelic profile-based phylogenetic analyses showed the presence of two genetically isolated groups in the study population, one (group 1) containing isolates of the anthroponotic internal transcribed spacer genotype A, and the other (group 2) containing isolates of multiple internal transcribed spacer genotypes (mainly genotypes D and IV) with zoonotic potential. The measurement of linkage disequilibria and recombination indicated group 2 had a clonal population structure, whereas group 1 had an epidemic population structure. The formation of the two sub-populations was confirmed by STRUCTURE and Wright's fixation index (FST) analyses. The data highlight the power of MLST in understanding the epidemiology of E. bieneusi. Published by Elsevier Ltd.
Iterative h-minima-based marker-controlled watershed for cell nucleus segmentation.
Koyuncu, Can Fahrettin; Akhan, Ece; Ersahin, Tulin; Cetin-Atalay, Rengul; Gunduz-Demir, Cigdem
2016-04-01
Automated microscopy imaging systems facilitate high-throughput screening in molecular cellular biology research. The first step of these systems is cell nucleus segmentation, which has a great impact on the success of the overall system. The marker-controlled watershed is a technique commonly used by the previous studies for nucleus segmentation. These studies define their markers finding regional minima on the intensity/gradient and/or distance transform maps. They typically use the h-minima transform beforehand to suppress noise on these maps. The selection of the h value is critical; unnecessarily small values do not sufficiently suppress the noise, resulting in false and oversegmented markers, and unnecessarily large ones suppress too many pixels, causing missing and undersegmented markers. Because cell nuclei show different characteristics within an image, the same h value may not work to define correct markers for all the nuclei. To address this issue, in this work, we propose a new watershed algorithm that iteratively identifies its markers, considering a set of different h values. In each iteration, the proposed algorithm defines a set of candidates using a particular h value and selects the markers from those candidates provided that they fulfill the size requirement. Working with widefield fluorescence microscopy images, our experiments reveal that the use of multiple h values in our iterative algorithm leads to better segmentation results, compared to its counterparts. © 2016 International Society for Advancement of Cytometry. © 2016 International Society for Advancement of Cytometry.
International Nuclear Information System (INIS)
Munir, T.A.; Afzal, M.N.
2010-01-01
To determine levels of C-reactive protein (CRP) and its association with coronary markers, lipid profile and markers of coagulation in patients of acute coronary syndrome (ACS). The study was conducted at Shifa college of Medicine and Shifa international hospital for a period of one year (November 2005-December 2006). Patients and Methods: Sixty nine age matched controls and 133 consecutive patients of ACS were included in the study. CRP were measured by immunoturbidometric method, MB fraction of creatine kinase (CK-MB) and Troponin-1 by micro-particle enzyme immunoassay, lipid levels by Colorimetric Enzymatic methods, platelets by celldyn and coagulation markers were measured by CA-50 Sysmax. At admission mean CRP levels, cardiac biomarkers, lipid profile and coagulation markers were significantly increased in patients of ACS versus controls. Within the patients of ACS the mean levels of CRP, CK-MB, Trop I, prothrombin time (PT) and activated partial thromboplastin time (Am) were significantly raised in patients with ST - elevation myocardial infarction (STEMI) and non STEMI (NSTEMI) versus patients of unstable angina (VA). Association between CRP levels and coronary markers, coagulation markers and lipid profile was found to be non significant. The CRP levels were increased in patients with ACS as compared to controls. The CRP levels were insignificantly correlated with coronary markers (CK-MB, Trop I), coagulation markers (platelet count, PT, Am), and lipid profile (cholesterol, triglyceride, HDL and LDL cholesterol) in patients with ACS. (author)
International Nuclear Information System (INIS)
Kaatee, Robert S.J.P.; Olofsen, Manouk J.J.; Verstraate, Marjolein B.J.; Quint, Sandra; Heijmen, Ben J.M.
2002-01-01
Purpose: To investigate the use of a fluoroscopic electronic portal imaging device (EPID) and radiopaque markers to detect internal cervix movement. Methods and Materials: For 10 patients with radiopaque markers clamped to the cervix, electronic portal images were made during external beam irradiation. Bony structures and markers in the portal images were registered with the same structures in the corresponding digitally reconstructed radiographs of the planning computed tomogram. Results: The visibility of the markers in the portal images was good, but their fixation should be improved. Generally, the correlation between bony structure displacements and marker movement was poor, the latter being substantially larger. The standard deviations describing the systematic and random bony anatomy displacements were 1.2 and 2.6 mm, 1.7 and 2.9 mm, and 1.6 and 2.7 mm in the lateral, cranial-caudal, and dorsal-ventral directions, respectively. For the marker movement those values were 3.4 and 3.4 mm, 4.3 and 5.2 mm, 3.2 and 5.2 mm, respectively. Estimated clinical target volume to planning target volume (CTV-PTV) planning margins (∼11 mm) based on the observed overall marker displacements (bony anatomy + internal cervix movement) are only marginally larger than the margins required to account for internal marker movement alone. Conclusions: With our current patient setup techniques and methods of setup verification and correction, the required CTV-PTV margins are almost fully determined by internal organ motion. Setup verification and correction using radiopaque markers might allow decreasing those margins, but technical improvements are needed
McIntyre, Joyce K; Schoenbrunner, Anna R; Kelley, Kristen D; Gosman, Amanda A
2017-09-01
Plastic surgeons have a long history of international volunteer work. To date, there have been no outcome-based studies among surgeons who volunteer internationally. The purpose of this study was to describe predictors of volunteering, clinical quality markers, and economics of international volunteering among American plastic surgeons. A cross-sectional validated e-mail survey tool was sent to all board-certified plastic surgeons by the American Society of Plastic Surgeons. The survey response rate was 15 percent (745 total individuals), of which 283 respondents traveled within the past 5 years. Analysis was performed in R. Stepwise multivariate logistic regression was performed to determine the predictors of death/complication. Respondents reported high use of medical records, follow-up care, and host affiliation. Fewer than half of all respondents reported use of international safety surgery guidelines, and the majority of respondents reported volunteering abroad outside of their scope of practice. The majority of children younger than 5 years were not cared for by a pediatric anesthesiologist. The majority of participants reported personally spending more than $1000 on their last trip and performing surgery estimated to be worth on average $28,000 each. International surgical volunteer trips attempt to ease the global burden of surgical disease. The authors' study reports variation in quality of care provided on these trips. Most significantly, the majority of children younger than 5 years were not cared for by a pediatric anesthesiologist, and many plastic surgeons operated outside of their scope of practice.
International Nuclear Information System (INIS)
Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)
Troponin is a Potential Marker of Subclinical Myocardial Injury in Patient Undergoing Chemotherapy
Czech Academy of Sciences Publication Activity Database
Umlauf, J.; Pecen, Ladislav; Šimíčková, M.; Nekulová, M.; Vondráček, V.; Valík, D.
2002-01-01
Roč. 17, č. 3 (2002), s. 131 ISSN 0886-3849. [International Conference on Human Tumor Markers /19./. 25.08.2002-29.08.2002, Velje] Institutional research plan: AV0Z1030915 Keywords : markers of myocardial injury * troponin Subject RIV: BA - General Mathematics
Changes in Values of Tumor Markers with Pregnant Women in their IInd Trimester
Czech Academy of Sciences Publication Activity Database
Topolčan, O.; Holubec jr., L.; Pecen, Ladislav; Pikner, R.; Svobodová, S.
2002-01-01
Roč. 17, č. 3 (2002), s. 121-123 ISSN 0886-3849. [International Conference on Human Tumor Markers /19./. 25.08.2002-29.08.2002, Velje] Institutional research plan: AV0Z1030915 Keywords : tumor markers * pregrancy Subject RIV: BA - General Mathematics
Fukada, Junichi; Hanada, Takashi; Kawaguchi, Osamu; Ohashi, Toshio; Takeuchi, Hiroya; Kitagawa, Yuko; Seki, Satoshi; Shiraishi, Yutaka; Ogata, Haruhiko; Shigematsu, Naoyuki
2013-03-15
To quantify the interfraction displacement of esophageal fiducial markers for primary esophageal cancer radiation therapy. Orthogonal 2-dimensional (2D) matching records fused to vertebrae were analyzed in clinically staged T1/2N0 esophageal cancer patients undergoing endoscopic clipping as fiducial metal markers. Displacement of the markers between the digitally reconstructed radiographs and on-board kilovoltage images during radiation therapy was analyzed according to direction and esophageal site. Forty-four patients, with 81 markers (10 proximal, 42 middle, and 29 distal), underwent 367 2D matching sessions during radiation therapy. The mean (SD) absolute marker displacement was 0.26 (0.30) cm in the right-left (RL), 0.50 (0.39) cm in the superior-inferior (SI), and 0.24 (0.21) cm in the anterior-posterior (AP) direction. Displacement was significantly larger in the SI than in the RL and AP directions (Pdisplacements of the distal, middle, and proximal esophagus were 0.67 (0.45) cm, 0.42 (0.32) cm, and 0.36 (0.30) cm, respectively. Distal esophagus displacement was significantly larger than those of the middle and proximal esophagus (Pinternal margin to cover 95% of the cases was 0.75 cm in the RL and AP directions. In the SI direction, the margin was 1.25 cm for the proximal and middle esophagus and 1.75 cm for the distal esophagus. The magnitude of interfraction displacement of esophageal clips was larger in the SI direction, particularly in the distal esophagus, but substantial displacement was observed in other directions and at other esophageal sites. It is practical to take estimated movements into account with internal margins, even if vertebrae-based 2D matching is performed. Copyright © 2013 Elsevier Inc. All rights reserved.
A novel TBP-TAF complex on RNA polymerase II-transcribed snRNA genes.
Zaborowska, Justyna; Taylor, Alice; Roeder, Robert G; Murphy, Shona
2012-01-01
Initiation of transcription of most human genes transcribed by RNA polymerase II (RNAP II) requires the formation of a preinitiation complex comprising TFIIA, B, D, E, F, H and RNAP II. The general transcription factor TFIID is composed of the TATA-binding protein and up to 13 TBP-associated factors. During transcription of snRNA genes, RNAP II does not appear to make the transition to long-range productive elongation, as happens during transcription of protein-coding genes. In addition, recognition of the snRNA gene-type specific 3' box RNA processing element requires initiation from an snRNA gene promoter. These characteristics may, at least in part, be driven by factors recruited to the promoter. For example, differences in the complement of TAFs might result in differential recruitment of elongation and RNA processing factors. As precedent, it already has been shown that the promoters of some protein-coding genes do not recruit all the TAFs found in TFIID. Although TAF5 has been shown to be associated with RNAP II-transcribed snRNA genes, the full complement of TAFs associated with these genes has remained unclear. Here we show, using a ChIP and siRNA-mediated approach, that the TBP/TAF complex on snRNA genes differs from that found on protein-coding genes. Interestingly, the largest TAF, TAF1, and the core TAFs, TAF10 and TAF4, are not detected on snRNA genes. We propose that this snRNA gene-specific TAF subset plays a key role in gene type-specific control of expression.
Mahfoodh, Omer Hassan Ali
2014-01-01
This paper reports a qualitative study which examines the challenges faced by six international undergraduate students in their socialisation of oral academic discourse in a Malaysian public university. Data were collected employing interviews. Students' presentations were also collected. Semi-structured interviews were transcribed verbatim and…
Detection of Secondary Liver Tumors in Patients with Colorectal Carcinoma by Using Tumor Markers
Czech Academy of Sciences Publication Activity Database
Holubec jr., L.; Topolčan, O.; Třeška, V.; Holubec sen., L.; Pecen, Ladislav; Pikner, R.; Finek, J.; Visokai, V.; Lipská, L.
2002-01-01
Roč. 17, č. 3 (2002), s. 134-135 ISSN 0886-3849. [International Conference on Human Tumor Markers /19./. 25.08.2002-29.08.2002, Velje] Institutional research plan: AV0Z1030915 Keywords : tumor markers * colorectal CA Subject RIV: BA - General Mathematics
Criteria for the Selection of Reference Groups in the Statistical Evaluation of Tumor Markers
Czech Academy of Sciences Publication Activity Database
Holubec jr., L.; Topolčan, O.; Pikner, R.; Pecen, Ladislav; Holubec sen., L.
2002-01-01
Roč. 22, 1B (2002), s. 531 ISSN 0250-7005. [International Hamburg Symposium on Tumor Markers /11./. 27.01.2002-29.01.2002, Hamburg] Institutional research plan: AV0Z1030915 Keywords : reference groups * tumor markers Subject RIV: BA - General Mathematics
Marker-assisted selection in common beans and cassava
International Nuclear Information System (INIS)
Blair, M.W.; Fregene, M.A.; Beebe, S.E.; Ceballos, H.
2007-01-01
Marker-assisted selection (MAS) in common beans (Phaseolus vulgaris L.) and cassava (Manihot esculenta) is reviewed in relation to the breeding system of each crop and the breeding goals of International Agricultural Research Centres (IARCs) and National Agricultural Research Systems (NARS). The importance of each crop is highlighted and examples of successful use of molecular markers within selection cycles and breeding programmes are given for each. For common beans, examples are given of gene tagging for several traits that are important for bean breeding for tropical environments and aspects considered that contribute to successful application of MAS. Simple traits that are tagged with easy-to-use markers are discussed first as they were the first traits prioritized for breeding at the International Center for Tropical Agriculture (CIAT) and with NARS partners in Central America, Colombia and eastern Africa. The specific genes for MAS selection were the bgm-1 gene for bean golden yellow mosaic virus (BGYMV) resistance and the bc-3 gene for bean common mosaic virus (BCMV) resistance. MAS was efficient for reducing breeding costs under both circumstances as land and labour savings resulted from eliminating susceptible individuals. The use of markers for other simply inherited traits in marker-assisted backcrossing and introgression across Andean and Mesoamerican gene pools is suggested. The possibility of using MAS for quantitative traits such as low soil phosphorus adaptation is also discussed as are the advantages and disadvantages of MAS in a breeding programme. For cassava, the use of multiple flanking markers for selection of a dominant gene, CMD2 for cassava mosaic virus (CMV) resistance at CIAT and the International Institute of Tropical Agriculture (IITA) as well as with NARS partners in the United Republic of Tanzania using a participatory plant breeding scheme are reviewed. MAS for the same gene is important during introgression of cassava green mite
A Software for the Analysis of Scripted Dialogs Based on Surface Markers
Directory of Open Access Journals (Sweden)
Sylvain Delisle
2003-04-01
Full Text Available Most information systems that deal with natural language texts do not tolerate much deviation from their idealized and simplified model of language. Spoken dialog is notoriously ungrammatical however. Because the MAREDI project focuses in particular on the automatic analysis of scripted dialogs, we needed to develop a robust capacity to analyze transcribed spoken language. This paper presents the main elements of our approach, which is based on exploiting surface markers as the best route to the semantics of the conversation modelled. We highlight the foundations of our particular conversational model and give an overview of the MAREDI system. The latter consists of three key modules, which are 1 a connectionist network to recognise speech acts, 2 a robust syntactic parser, and 3 a semantic analyzer. These three modules are fully implemented in Prolog and C++ and have been packaged into an integrated software.
Cryer, Heather; Home, Sarah; Morley Wilkins, Sarah
2013-01-01
To inform decision-making around the adoption of the Unified English Braille (UEB) code in the United Kingdom, a suite of research was carried out. This study involved a variety of braille stakeholders--student braille readers (in full time education), adult braille readers, braille teachers, and braille transcribers. Participants were sent…
Das, Aparajita Roy; Borthakur, Madhusmita; Saha, Ajay Krishna; Joshi, Santa Ram; Das, Panna
2017-01-01
The aim of this study was to characterize 3 wild culinary-medicinal mushrooms using molecular tools and to analyze their antioxidant activity. Antioxidant properties were studied by evaluating free radical scavenging, reducing power, and chelating effect. The mushrooms were identified as Lentinus squarrosulus, L. tuber-regium, and Macrocybe gigantean by amplifying internal transcribed spacer regions of ribosomal DNA. The results demonstrated that the methanolic extract of M. gigantean has the highest free radical scavenging effect and chelating effect, whereas the methanolic extract of L. squarrosulus has the highest reducing power. The highest total phenol content and the most ascorbic acid were found in the M. gigantean extracts. Among the 3 mushroom extracts, M. gigantean displayed the most potent antioxidant activity. Molecular characterization using the nuclear ribosomal internal transcribed spacer region as a universal DNA marker was an effective tool in the identification and phylogenetic analysis of the studied mushrooms. The study also indicated that these wild macrofungi are rich sources of natural antioxidants.
Davidson, Christina
2010-01-01
The development of transcripts is central to the work of many researchers yet questions of what and how researchers transcribe, and why, receive little attention in research literature. Conversation analysis is one research approach that has consistently addressed the integral relationship between theoretical and methodological perspectives,…
NABIC marker database: A molecular markers information network of agricultural crops.
Kim, Chang-Kug; Seol, Young-Joo; Lee, Dong-Jun; Jeong, In-Seon; Yoon, Ung-Han; Lee, Gang-Seob; Hahn, Jang-Ho; Park, Dong-Suk
2013-01-01
In 2013, National Agricultural Biotechnology Information Center (NABIC) reconstructs a molecular marker database for useful genetic resources. The web-based marker database consists of three major functional categories: map viewer, RSN marker and gene annotation. It provides 7250 marker locations, 3301 RSN marker property, 3280 molecular marker annotation information in agricultural plants. The individual molecular marker provides information such as marker name, expressed sequence tag number, gene definition and general marker information. This updated marker-based database provides useful information through a user-friendly web interface that assisted in tracing any new structures of the chromosomes and gene positional functions using specific molecular markers. The database is available for free at http://nabic.rda.go.kr/gere/rice/molecularMarkers/
Directory of Open Access Journals (Sweden)
Julie M. Panko
2012-11-01
Full Text Available Pyrolysis(pyr-GC/MS analysis of characteristic thermal decomposition fragments has been previously used for qualitative fingerprinting of organic sources in environmental samples. A quantitative pyr-GC/MS method based on characteristic tire polymer pyrolysis products was developed for tread particle quantification in environmental matrices including soil, sediment, and air. The feasibility of quantitative pyr-GC/MS analysis of tread was confirmed in a method evaluation study using artificial soil spiked with known amounts of cryogenically generated tread. Tread concentration determined by blinded analyses was highly correlated (r2 ³ 0.88 with the known tread spike concentration. Two critical refinements to the initial pyrolysis protocol were identified including use of an internal standard and quantification by the dimeric markers vinylcyclohexene and dipentene, which have good specificity for rubber polymer with no other appreciable environmental sources. A novel use of deuterated internal standards of similar polymeric structure was developed to correct the variable analyte recovery caused by sample size, matrix effects, and ion source variability. The resultant quantitative pyr-GC/MS protocol is reliable and transferable between laboratories.
Unice, Kenneth M; Kreider, Marisa L; Panko, Julie M
2012-11-08
Pyrolysis(pyr)-GC/MS analysis of characteristic thermal decomposition fragments has been previously used for qualitative fingerprinting of organic sources in environmental samples. A quantitative pyr-GC/MS method based on characteristic tire polymer pyrolysis products was developed for tread particle quantification in environmental matrices including soil, sediment, and air. The feasibility of quantitative pyr-GC/MS analysis of tread was confirmed in a method evaluation study using artificial soil spiked with known amounts of cryogenically generated tread. Tread concentration determined by blinded analyses was highly correlated (r2 ≥ 0.88) with the known tread spike concentration. Two critical refinements to the initial pyrolysis protocol were identified including use of an internal standard and quantification by the dimeric markers vinylcyclohexene and dipentene, which have good specificity for rubber polymer with no other appreciable environmental sources. A novel use of deuterated internal standards of similar polymeric structure was developed to correct the variable analyte recovery caused by sample size, matrix effects, and ion source variability. The resultant quantitative pyr-GC/MS protocol is reliable and transferable between laboratories.
Prindull, Gregor
2012-11-01
This review focuses on gene transcription patterns of leukemogenic S-phases in mitotic cell cycles for identification of enzymatic reactions as potential targets for epigenetics-based drug therapy. Transcription of leukemic genes is triggered by reprogrammed transcription factors (TFs) mediated by chromatin histones. Reprogrammed TFs originate from transcriptional alterations of CpG methylation patterns of mutated epigenetic genes. They preserve memory information of earlier leukemogenic exposures, even transgenerationally via the zygote, through small (e.g. pi)RNA transmitted between cells by exosomes. Normally, reprogrammed TFs are enzymatically silenced and stored as markers in heterochromatic domains. Failure of intra S-phase surveillance (IS) permits the formation and continual operation of DNA replication forks in spite of persisting genotoxic stress. Silenced TFs are re-activated by euchromatin, most likely through leakages of insulator barriers of cis-regulating chromatin modulators (CRM) that normally separate hetero- from euchromatin domains. During transport by sliding nucleosomes, reprogrammed leukemogenic TFs are misplaced at transcription factor binding-/starting-sites (TFBS /TSS) allowing them to interact with and trigger replication of mutated leukemic genes. Interactions of enzymatically reprogrammed TFs, transcribed from mutated epigenetic genes, with replicating leukemic genes at TFBS/TSSs are key driving forces in leukemogenesis. Probably, epigenetic genes, although mutated, still retain their control of replication of leukemic genes. Epigenetics-based enzyme inhibitors must target reprogrammed TFs. Prudently, therapeutic corrections should be introduced within the frame of conventional, cytoreductive treatment protocols. Alternatively, reprogrammed TFs could be replaced by cell populations with regular TF production. Clinically, classification of leukemias should be based on their epigenetic presentation.
National survey on internal quality control for tumour markers in clinical laboratories in China.
Wang, Wei; Zhong, Kun; Yuan, Shuai; He, Falin; Du, Yuxuan; Hu, Zhehui; Wang, Zhiguo
2018-06-15
This survey was initiated to obtain knowledge on the current situation of internal quality control (IQC) practice for tumour markers (TMs) in China. Additionally, we tried to acquire the most appropriate quality specifications. This survey was a current status survey. The IQC information had been collected via online questionnaires. All of 1821 clinical laboratories which participated in the 2016 TMs external quality assessment (EQA) programme had been enrolled. The imprecision evaluation criteria were the minimal, desirable, and optimal allowable imprecisions based on biological variations, and 1/3 total allowable error (TEa) and 1/4 TEa. A total of 1628 laboratories answered the questionnaires (89%). The coefficients of variation (CVs) of the IQC of participant laboratories varied greatly from 1% (5 th percentile) to 13% (95 th percentile). More than 82% (82 - 91%) of participant laboratories two types of CVs met 1/3 TEa except for CA 19-9. The percentiles of current CVs were smaller than cumulative CVs. A number of 1240 laboratories (76%) reported their principles and systems used. The electrochemiluminescence was the most used principle (45%) and had the smallest CVs. The performance of laboratories for TMs IQC has yet to be improved. On the basis of the obtained results, 1/3 TEa would be realistic and attainable quality specification for TMs IQC for clinical laboratories in China.
International commission radiological protection: its policy, its works, its thoughts
International Nuclear Information System (INIS)
Nenot, J.C.
1999-01-01
The I.C.R.P. is an advisory organism. It offers recommendations to regulatory and advisory organisms at the international and national levels. Given the differences that exist between the national legislations, its recommendations cannot be directly transcribed in regulatory terms. The base recommendations are used for the essential in the international regulations and in particular in the European Directive, whom transposition in national law is compulsory. The aim of the Commission is to elaborate a protection system against ionizing radiations, sufficiently general to apply at the totality of situations during which ones the human is exposed or could be exposed to radiations. (N.C.)
Molecular markers of oocyte differentiation in European eel during hormonally induced oogenesis.
Rojo-Bartolomé, Iratxe; Martínez-Miguel, Leticia; Lafont, Anne-Gaëlle; Vílchez, M Carmen; Asturiano, Juan F; Pérez, Luz; Cancio, Ibon
2017-09-01
Reproduction in captivity is a key study issue in Anguilla anguilla as a possible solution for its dwindling population. Understanding the mechanisms controlling the production of ribosomal building blocks during artificially induced oocyte maturation could be particularly interesting. Transcription levels of ribosomal biogenesis associated genes could be used as markers to monitor oogenesis. Eels from the Albufera Lagoon were injected with carp pituitary extract for 15weeks and ovaries in previtellogenic (PV) stage (non-injected), in early-, mid-, late-vitellogenesis (EV, MV, LV), as well as in migratory nucleus stage (MN) were analysed. 5S rRNA and related genes were highly transcribed in ovaries with PV oocytes. As oocytes developed, transcriptional levels of genes related to 5S rRNA production (gtf3a), accumulation (gtf3a, 42sp43) and nucleocytoplasmic transport (rpl5, rpl11) and the 5S/18S rRNA index decreased (PV>EV>MV>LV>MN). On the contrary, 18S rRNA was at its highest at MN stage while ubtf1 in charge of activating RNA-polymerase I and synthesising 18S rRNA behaved as 5S related genes. Individuals that did not respond (NR) to the treatment showed 5S/18S index values similar to PV females, while studied genes showed EV/LV-like transcription levels. Therefore, NR females fail to express the largest rRNAs, which could thus be taken as markers of successful vitellogenesis progression. In conclusion, we have proved that the transcriptional dynamics of ribosomal genes provides useful tools to characterize induced ovarian development in European eels. In the future, such markers should be studied as putative indicators of response to hormonal treatments and of the quality of obtained eel oocytes. Copyright © 2017. Published by Elsevier Inc.
An externally and internally deformable, programmable lung motion phantom
Energy Technology Data Exchange (ETDEWEB)
Cheung, Yam; Sawant, Amit, E-mail: amit.sawant@utsouthwestern.edu [UT Southwestern Medical Center, University of Texas, Dallas, Texas 75390 (United States)
2015-05-15
Purpose: Most clinically deployed strategies for respiratory motion management in lung radiotherapy (e.g., gating and tracking) use external markers that serve as surrogates for tumor motion. However, typical lung phantoms used to validate these strategies are based on a rigid exterior and a rigid or a deformable-interior. Such designs do not adequately represent respiration because the thoracic anatomy deforms internally as well as externally. In order to create a closer approximation of respiratory motion, the authors describe the construction and experimental testing of an externally as well as internally deformable, programmable lung phantom. Methods: The outer shell of a commercially available lung phantom (RS-1500, RSD, Inc.) was used. The shell consists of a chest cavity with a flexible anterior surface, and embedded vertebrae, rib-cage and sternum. A custom-made insert was designed using a piece of natural latex foam block. A motion platform was programmed with sinusoidal and ten patient-recorded lung tumor trajectories. The platform was used to drive a rigid foam “diaphragm” that compressed/decompressed the phantom interior. Experimental characterization comprised of determining the reproducibility and the external–internal correlation of external and internal marker trajectories extracted from kV x-ray fluoroscopy. Experiments were conducted to illustrate three example applications of the phantom—(i) validating the geometric accuracy of the VisionRT surface photogrammetry system; (ii) validating an image registration tool, NiftyReg; and (iii) quantifying the geometric error due to irregular motion in four-dimensional computed tomography (4DCT). Results: The phantom correctly reproduced sinusoidal and patient-derived motion, as well as realistic respiratory motion-related effects such as hysteresis. The reproducibility of marker trajectories over multiple runs for sinusoidal as well as patient traces, as characterized by fluoroscopy, was within 0
Wang, Zan; Yu, Guohui; Shi, Binbin; Wang, Xuemin; Qiang, Haiping; Gao, Hongwen
2014-01-01
Sufficient codominant genetic markers are needed for various genetic investigations in alfalfa since the species is an outcrossing autotetraploid. With the newly developed next generation sequencing technology, a large amount of transcribed sequences of alfalfa have been generated and are available for identifying SSR markers by data mining. A total of 54,278 alfalfa non-redundant unigenes were assembled through the Illumina HiSeqTM 2000 sequencing technology. Based on 3,903 unigene sequences, 4,493 SSRs were identified. Tri-nucleotide repeats (56.71%) were the most abundant motif class while AG/CT (21.7%), AGG/CCT (19.8%), AAC/GTT (10.3%), ATC/ATG (8.8%), and ACC/GGT (6.3%) were the subsequent top five nucleotide repeat motifs. Eight hundred and thirty- seven EST-SSR primer pairs were successfully designed. Of these, 527 (63%) primer pairs yielded clear and scored PCR products and 372 (70.6%) exhibited polymorphisms. High transferability was observed for ssp falcata at 99.2% (523) and 71.7% (378) in M. truncatula. In addition, 313 of 527 SSR marker sequences were in silico mapped onto the eight M. truncatula chromosomes. Thirty-six polymorphic SSR primer pairs were used in the genetic relatedness analysis of 30 Chinese alfalfa cultivated accessions generating a total of 199 scored alleles. The mean observed heterozygosity and polymorphic information content were 0.767 and 0.635, respectively. The codominant markers not only enriched the current resources of molecular markers in alfalfa, but also would facilitate targeted investigations in marker-trait association, QTL mapping, and genetic diversity analysis in alfalfa. PMID:24642969
Molecular marker to identify radiolarian species -toward establishment of paleo-environmental proxy-
Ishitani, Y.
2017-12-01
Marine fossilized unicellular plankton are known to have many genetically divergent species (biological species) in the single morphological species and these biological species show the species-specific environments much more precisely than that of morphological species. Among these plankton, Radiolaria are one of the best candidates for time- and environmental-indicators in the modern and past oceans, because radiolarians are the only group which represent entire water column from shallow to deep waters. However, the ecology and evolution of radiolarian were traditionally studied in paleontology and paleoceanography by morphological species. Even Radiolaria has a huge potential for novel proxy of wide and deep environments, there is no criterion to identify the biological species. The motivation for this study is setting the quantitative delimitation to establish the biological species of radiolarians based on molecular data, for leading the future ecological and paleo-environmental study. Identification of the biological species by ribosomal DNA sequences are mainly based on two ways: one is the evolutionary distance of the small subunit (SSU) rDNA, the internal transcribed spacer region of ribosomal DNA (ITS1 and 2), and the large subunit (LSU) rDNA; and the other is the secondary structure of ITS2. In the present study, all four possible genetic markers (SSU, ITS1, ITS2, and LSU rDNA) were amplified from 232 individuals of five radiolarian morphological species and applied to examine the evolutionary distance and secondary structure of rDNA. Comprehensive survey clearly shows that evolutionary distance of ITS1 rDNA and the secondary structure of ITS2 is good to identify the species. Notably, evolutionary distance of ITS1 rDNA is possible to set the common delimitation to identify the biological species, as 0.225 substitution per site. The results show that the ITS1 and ITS 2 rDNA could be the criterion for radiolarian species identification.
Molecular markers in well-differentiated thyroid cancer.
D'Cruz, Anil K; Vaish, Richa; Vaidya, Abhishek; Nixon, Iain J; Williams, Michelle D; Vander Poorten, Vincent; López, Fernando; Angelos, Peter; Shaha, Ashok R; Khafif, Avi; Skalova, Alena; Rinaldo, Alessandra; Hunt, Jennifer L; Ferlito, Alfio
2018-06-01
Thyroid nodules are of common occurrence in the general population. About a fourth of these nodules are indeterminate on aspiration cytology placing many a patient at risk of unwanted surgery. The purpose of this review is to discuss various molecular markers described to date and place their role in proper perspective. This review covers the fundamental role of the signaling pathways and genetic changes involved in thyroid carcinogenesis. The current literature on the prognostic significance of these markers is also described. PubMed was used to search relevant articles. The key terms "thyroid nodules", "thyroid cancer papillary", "carcinoma papillary follicular", "carcinoma papillary", "adenocarcinoma follicular" were searched in MeSH, and "molecular markers", "molecular testing", mutation, BRAF, RAS, RET/PTC, PAX 8, miRNA, NIFTP in title and abstract fields. Multiple combinations were done and a group of experts in the subject from the International Head and Neck Scientific Group extracted the relevant articles and formulated the review. There has been considerable progress in the understanding of thyroid carcinogenesis and the emergence of numerous molecular markers in the recent years with potential to be used in the diagnostic algorithm of these nodules. However, their precise role in routine clinical practice continues to be a contentious issue. Majority of the studies in this context are retrospective and impact of these mutations is not independent of other prognostic factors making the interpretation difficult. The prevalence of these mutations in thyroid nodule is high and it is a continuously evolving field. Clinicians should stay informed as recommendation on the use of these markers is expected to evolve.
Brejchova, Jana; Vosahlikova, Miroslava; Roubalova, Lenka; Parenti, Marco; Mauri, Mario; Chernyavskiy, Oleksandr; Svoboda, Petr
2016-08-01
Decrease of cholesterol level in plasma membrane of living HEK293 cells transiently expressing FLAG-δ-OR by β-cyclodextrin (β-CDX) resulted in a slight internalization of δ-OR. Massive internalization of δ-OR induced by specific agonist DADLE was diminished in cholesterol-depleted cells. These results suggest that agonist-induced internalization of δ-OR, which has been traditionally attributed exclusively to clathrin-mediated pathway, proceeds at least partially via membrane domains. Identification of internalized pools of FLAG-δ-OR by colocalization studies with proteins of Rab family indicated the decreased presence of receptors in early endosomes (Rab5), late endosomes and lysosomes (Rab7) and fast recycling vesicles (Rab4). Slow type of recycling (Rab11) was unchanged by cholesterol depletion. As expected, agonist-induced internalization of oxytocin receptors was totally suppressed in β-CDX-treated cells. Determination of average fluorescence lifetime of TMA-DPH, the polar derivative of hydrophobic membrane probe diphenylhexatriene, in live cells by FLIM indicated a significant alteration of the overall PM structure which may be interpreted as an increased "water-accessible space" within PM area. Data obtained by studies of HEK293 cells transiently expressing FLAG-δ-OR by "antibody feeding" method were extended by analysis of the effect of cholesterol depletion on distribution of FLAG-δ-OR in sucrose density gradients prepared from HEK293 cells stably expressing FLAG-δ-OR. Major part of FLAG-δ-OR was co-localized with plasma membrane marker Na,K-ATPase and β-CDX treatment resulted in shift of PM fragments containing both FLAG-δ-OR and Na,K-ATPase to higher density. Thus, the decrease in content of the major lipid constituent of PM resulted in increased density of resulting PM fragments.
International Nuclear Information System (INIS)
Imura, Mikado; Yamazaki, Koichi; Kubota, Kanako C.; Itoh, Tomoo; Onimaru, Rikiya; Cho, Yasushi; Hida, Yasuhiro; Kaga, Kichizo; Onodera, Yuya; Ogura, Shigeaki; Dosaka-Akita, Hirotoshi; Shirato, Hiroki; Nishimura, Masaharu
2008-01-01
Purpose: Internal fiducial gold markers, safely inserted with bronchoscopy, have been used in real-time tumor-tracking radiotherapy for lung cancer. We investigated the histopathologic findings at several points after the insertion of the gold markers. Methods and Materials: Sixteen gold markers were inserted for preoperative marking in 7 patients who subsequently underwent partial resection of tumors by video-assisted thoracoscopic surgery within 7 days. Results: Fibrotic changes and hyperplasia of type 2 pneumocytes around the markers were seen 5 or 7 days after insertion, and fibrin exudation without fibrosis was detected 1 or 2 days after insertion. Conclusions: Because fibroblastic changes start approximately 5 days after gold marker insertion, real-time tumor-tracking radiotherapy should be started >5 days after gold marker insertion
Genetic diversity of Halla horses using microsatellite markers
Directory of Open Access Journals (Sweden)
Joo-Hee Seo
2016-11-01
Full Text Available Abstract Background Currently about 26,000 horses are breeding in Korea and 57.2% (14,776 horses of them are breeding in Jeju island. According to the statistics published in 2010, the horses breeding in Jeju island are subdivided into Jeju horse (6.1%, Thoroughbred (18.8% and Halla horse (75.1%. Halla horses are defined as a crossbreed between Jeju and Thoroughbred horses and are used for horse racing, horse riding and horse meat production. However, little research has been conducted on Halla horses because of the perception of crossbreed and people’s weighted interest toward Jeju horses. Method Using 17 Microsatellite (MS Markers recommended by International Society for Animal Genetics (ISAG, genomic DNAs were extracted from the hair roots of 3,880 Halla horses breeding in Korea and genetic diversity was identified by genotyping after PCR was performed. Results and conclusion In average, 10.41 alleles (from 6 alleles in HTG7 to 17 alleles in ASB17 were identified after the analysis using 17 MS Markers. The mean value of Hobs was 0.749 with a range from 0.612(HMS1 to 0.857(ASB2. Also, it was found that Hexp and PIC values were lowest in HMS1 (0.607 and 0.548, respectively, and highest in LEX3(0.859 and 0.843, respectively, and the mean value of Hexp was 0.760 and that of PIC was 0.728. 17 MS markers used in this studies were considered as appropriate markers for the polymorphism analysis of Halla horses. The frequency for the appearance of identical individuals was 5.90 × 10−20 when assumed as random mating population and when assumed as half-sib and full-sib population, frequencies were 4.08 × 10−15 and 3.56 × 10−8, respectively. Based on these results, the 17 MS markers can be used adequately for the Individual Identification and Parentage Verification of Halla horses. Remarkably, allele M and Q of ASB23 marker, G of HMS2 marker, H and L of HTG6 marker, L of HTG7 marker, E of LEX3 marker were the specific alleles
Reliability and Concurrent Validity of the International Personality ...
African Journals Online (AJOL)
Reliability and Concurrent Validity of the International Personality item Pool (IPIP) Big-five Factor Markers in Nigeria. ... Nigerian Journal of Psychiatry ... Aims: The aim of this study was to assess the internal consistency and concurrent validity ...
Tam, Emily W T; Chen, Jonathan H K; Lau, Eunice C L; Ngan, Antonio H Y; Fung, Kitty S C; Lee, Kim-Chung; Lam, Ching-Wan; Yuen, Kwok-Yung; Lau, Susanna K P; Woo, Patrick C Y
2014-04-01
Aspergillus nomius and Aspergillus tamarii are Aspergillus species that phenotypically resemble Aspergillus flavus. In the last decade, a number of case reports have identified A. nomius and A. tamarii as causes of human infections. In this study, using an internal transcribed spacer, β-tubulin, and calmodulin gene sequencing, only 8 of 11 clinical isolates reported as A. flavus in our clinical microbiology laboratory by phenotypic methods were identified as A. flavus. The other three isolates were A. nomius (n = 2) or A. tamarii (n = 1). The results corresponded with those of metabolic fingerprinting, in which the A. flavus, A. nomius, and A. tamarii strains were separated into three clusters based on ultra-high-performance liquid chromatography-tandem mass spectrometry (UHPLC MS) analysis. The first two patients with A. nomius infections had invasive aspergillosis and chronic cavitary and fibrosing pulmonary and pleural aspergillosis, respectively, whereas the third patient had A. tamarii colonization of the airway. Identification of the 11 clinical isolates and three reference strains by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) showed that only six of the nine strains of A. flavus were identified correctly. None of the strains of A. nomius and A. tamarii was correctly identified. β-Tubulin or the calmodulin gene should be the gene target of choice for identifying A. flavus, A. nomius, and A. tamarii. To improve the usefulness of MALDI-TOF MS, the number of strains for each species in MALDI-TOF MS databases should be expanded to cover intraspecies variability.
Tam, Emily W. T.; Chen, Jonathan H. K.; Lau, Eunice C. L.; Ngan, Antonio H. Y.; Fung, Kitty S. C.; Lee, Kim-Chung; Lam, Ching-Wan; Yuen, Kwok-Yung
2014-01-01
Aspergillus nomius and Aspergillus tamarii are Aspergillus species that phenotypically resemble Aspergillus flavus. In the last decade, a number of case reports have identified A. nomius and A. tamarii as causes of human infections. In this study, using an internal transcribed spacer, β-tubulin, and calmodulin gene sequencing, only 8 of 11 clinical isolates reported as A. flavus in our clinical microbiology laboratory by phenotypic methods were identified as A. flavus. The other three isolates were A. nomius (n = 2) or A. tamarii (n = 1). The results corresponded with those of metabolic fingerprinting, in which the A. flavus, A. nomius, and A. tamarii strains were separated into three clusters based on ultra-high-performance liquid chromatography-tandem mass spectrometry (UHPLC MS) analysis. The first two patients with A. nomius infections had invasive aspergillosis and chronic cavitary and fibrosing pulmonary and pleural aspergillosis, respectively, whereas the third patient had A. tamarii colonization of the airway. Identification of the 11 clinical isolates and three reference strains by matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) showed that only six of the nine strains of A. flavus were identified correctly. None of the strains of A. nomius and A. tamarii was correctly identified. β-Tubulin or the calmodulin gene should be the gene target of choice for identifying A. flavus, A. nomius, and A. tamarii. To improve the usefulness of MALDI-TOF MS, the number of strains for each species in MALDI-TOF MS databases should be expanded to cover intraspecies variability. PMID:24452174
5. international workshop on the identification of transcribed sequences
Energy Technology Data Exchange (ETDEWEB)
NONE
1995-12-31
This workshop was held November 5--8, 1995 in Les Embiez, France. The purpose of this conference was to provide a multidisciplinary forum for exchange of state-of-the-art information on mapping the human genome. Attention is focused on the following topics: transcriptional maps; functional analysis; techniques; model organisms; and tissue specific libraries and genes. Abstracts are included of the papers that were presented.
Porcine cluster of differentiation (CD) markers 2018 update.
Dawson, Harry D; Lunney, Joan K
2018-06-01
Pigs are a major source of food worldwide; preventing and treating their infectious diseases is essential, requiring a thorough understanding of porcine immunity. The use of pigs as models for human physiology is a growing area; progress in this area has been limited because the immune toolkit is not robust. The international community has established cluster of differentiation (CD) markers for assessing cells involved in immunity as well as characterizing numerous other cells like stem cells. Overall, for humans 419 proteins have been designated as CD markers, each reacting with a defined set of antibodies (Abs). This paper summarizes current knowledge of swine CD markers and identifies 359 corresponding CD proteins in pigs. A broad-based literature and vendor search was conducted to identify defined sets of monoclonal (mAbs) and polyclonal Abs (pAbs) reacting with porcine CD markers along with other reagents (fusion proteins, ELISAs, PCR assays, and gene edited cell and pig models). This process identified over 800 reagents that are reportedly reactive with 266 pig CD markers. Despite this number, there is a great need to develop and characterize additional CD marker reagents, particularly mAbs, for pig research. There are numerous high priority targets: reagents for the characterization of porcine innate lymphoid cells, polarized macrophages and T regulatory cells and for the detection of porcine CD45 isoforms. Overall, improved technologies and genomics have contributed to dramatic increases in our knowledge of the pig, its immune system, disease and vaccine responses, and utility as a biomedical model. The development of more CD reagents will clearly advance these initiatives. Published by Elsevier Ltd.
International Nuclear Information System (INIS)
Vejko, N.N.; Spitkovskij, D.M.
2000-01-01
The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru
Learning to mark: a qualitative study of the experiences and concerns of medical markers
Directory of Open Access Journals (Sweden)
Cannings-John Rebecca
2006-04-01
Full Text Available Abstract Background Although there is published research on the methods markers use in marking various types of assessment, there is relatively little information on the processes markers use in approaching a marking exercise. This qualitative paper describes the preparation and experiences of general practice (GP teachers who undertake marking a written assessment in an undergraduate medical course. Methods Semi-structured interviews were conducted with seven of the 16 GP tutors on an undergraduate course. The purposive sample comprised two new markers, two who had marked for a couple of years and three experienced markers. Each respondent was interviewed twice, once following a formative assessment of a written case study, and again after a summative assessment. All interviews were audio-taped and analysed for emerging themes. A respondent validation exercise was conducted with all 16 GP tutors. Results Markers had internal concerns about their ability to mark fairly and made considerable efforts to calibrate their marking. They needed guidance and coaching when marking for the first time and adopted a variety of marking styles, reaching a decision through a number of routes. Dealing with pass/fail borderline scripts and the consequences of the mark on the student were particular concerns. Even experienced markers felt the need to calibrate their marks both internally and externally Conclusion Previous experience of marking appears to improve markers' confidence and is a factor in determining the role which markers adopt. Confidence can be improved by giving clear instructions, along with examples of marking. The authors propose that one method of providing this support and coaching could be by a process of peer review of a selection of papers prior to the main marking. New markers in particular would benefit from further guidance, however they are influenced by others early on in their marking career and course organisers should be mindful of
Reis, António M C; Mills, Wilbur K; Ramachandran, Ilangovan; Friedberg, Errol C; Thompson, David; Queimado, Lurdes
2012-01-01
Endogenous DNA damage is removed mainly via base excision repair (BER), however, whether there is preferential strand repair of endogenous DNA damage is still under intense debate. We developed a highly sensitive primer-anchored DNA damage detection assay (PADDA) to map and quantify in vivo endogenous DNA damage. Using PADDA, we documented significantly higher levels of endogenous damage in Saccharomyces cerevisiae cells in stationary phase than in exponential phase. We also documented that yeast BER-defective cells have significantly higher levels of endogenous DNA damage than isogenic wild-type cells at any phase of growth. PADDA provided detailed fingerprint analysis at the single-nucleotide level, documenting for the first time that persistent endogenous nucleotide damage in CAN1 co-localizes with previously reported spontaneous CAN1 mutations. To quickly and reliably quantify endogenous strand-specific DNA damage in the constitutively expressed CAN1 gene, we used PADDA on a real-time PCR setting. We demonstrate that wild-type cells repair endogenous damage preferentially on the CAN1 transcribed strand. In contrast, yeast BER-defective cells accumulate endogenous damage preferentially on the CAN1 transcribed strand. These data provide the first direct evidence for preferential strand repair of endogenous DNA damage and documents the major role of BER in this process.
Polyphenols as Possible Markers of Botanical Origin of Honey.
Gašić, Uroš M; Milojković-Opsenica, Dušanka M; Tešić, Živoslav Lj
2017-07-01
In recent years, the botanical and geographical origin of food has become an important topic in the context of food quality and safety, as well as consumer protection, in accordance with international standards. Finding chemical markers, especially phytochemicals, characteristic for some kind of food is the subject of interest of a significant number of researchers in the world. This paper is focused on the use of polyphenols as potential markers for the determination of botanical origin of honey. It includes a review of the polyphenols present in various honey samples and the methods for their separation and identification. Special emphasis in this paper is placed on the identification of honey polyphenols using advanced LC-MS techniques in order to find specific markers of botanical origin of honey. In this regard, this study gives an overview of the literature that describes the use of LC-MS techniques for the isolation and determination of honey polyphenols. This review focuses on the research performed in the past two decades.
Prognostic value of tumour endothelial markers in patients with endometrial cancer
BERSINGER, NICK A.; SCHNEIDER, BRIGITTE; VORBURGER, STEPHAN A.; JOHANN, SILKE; CANDINAS, DANIEL; MUELLER, MICHAEL D.
2010-01-01
Endometrial cancer is one of the more frequent and most lethal gynaecological cancer types. Since it occurs more frequently in elderly and overweight patients, a pre-operative staging method would be beneficial. The growth of solid neoplasms is always accompanied by neovascularisation. Tumour endothelial markers (TEMs) are a group of recently described endothelial cell surface markers that appear to be specific to neoplastic tissue. This study aimed to investigate the potential usefulness of TEM assessment in the endometrium by comparing the transcriptional expression of TEMs in the normal endometrium with endometroid adenocarcinoma tissue. Tissues were lysed and the RNA was extracted, assessed and reverse transcribed in one batch. Real-time quantitative PCR was performed for TEM-1, -2, -6, -7, -7r and -8. GAPDH, β-actin and ribosomal protein L13A (RPL13A) were used as control genes. TEM-8 showed the highest expression level in all of the groups. TEM-1 showed higher expression levels in the normal endometrium than in the tumour tissues. For the remaining TEMs, we found a higher expression in the cancer samples than in the normal endometria. Statistical significance of this difference was achieved for TEM-1, -2 and-7. No clear correlation was noted between the tumour stage and the level of TEM-1, -6 and -8 expression. Apart from TEM-6, the highest expression in FIGO I cancer stages was noted in the remaining TEMs. Our results showed that for most of these tumour endothelial markers, gene expression was slightly higher in the endometrial carcinoma tissue samples than in the endometrium of normal cycling women. However, with the possible exception of TEM-8 and -6, absolute expression levels were generally low, indicating that most TEMs may only be specifically expressed in a restricted number of cancer types (e.g., colorectal). Therefore, TEMs may not be useful in the context of endometrial cancer. PMID:22966283
Prognostic value of tumour endothelial markers in patients with endometrial cancer.
Bersinger, Nick A; Schneider, Brigitte; Vorburger, Stephan A; Johann, Silke; Candinas, Daniel; Mueller, Michael D
2010-01-01
Endometrial cancer is one of the more frequent and most lethal gynaecological cancer types. Since it occurs more frequently in elderly and overweight patients, a pre-operative staging method would be beneficial. The growth of solid neoplasms is always accompanied by neovascularisation. Tumour endothelial markers (TEMs) are a group of recently described endothelial cell surface markers that appear to be specific to neoplastic tissue. This study aimed to investigate the potential usefulness of TEM assessment in the endometrium by comparing the transcriptional expression of TEMs in the normal endometrium with endometroid adenocarcinoma tissue. Tissues were lysed and the RNA was extracted, assessed and reverse transcribed in one batch. Real-time quantitative PCR was performed for TEM-1, -2, -6, -7, -7r and -8. GAPDH, β-actin and ribosomal protein L13A (RPL13A) were used as control genes. TEM-8 showed the highest expression level in all of the groups. TEM-1 showed higher expression levels in the normal endometrium than in the tumour tissues. For the remaining TEMs, we found a higher expression in the cancer samples than in the normal endometria. Statistical significance of this difference was achieved for TEM-1, -2 and-7. No clear correlation was noted between the tumour stage and the level of TEM-1, -6 and -8 expression. Apart from TEM-6, the highest expression in FIGO I cancer stages was noted in the remaining TEMs. Our results showed that for most of these tumour endothelial markers, gene expression was slightly higher in the endometrial carcinoma tissue samples than in the endometrium of normal cycling women. However, with the possible exception of TEM-8 and -6, absolute expression levels were generally low, indicating that most TEMs may only be specifically expressed in a restricted number of cancer types (e.g., colorectal). Therefore, TEMs may not be useful in the context of endometrial cancer.
Internal amplification control of PCR for the Glu1-Dx5 allele in wheat.
Heim, H N; Vieira, E S N; Polo, L R T; Lima, N K; Silva, G J; Linde, G A; Colauto, N B; Schuster, I
2017-08-17
One of the limiting factors in using dominant markers is the unique amplification of the target fragment. Therefore, failures in polymerase chain reaction (PCR) or non-amplifications can be interpreted as an absence of the allele. The possibility of false negatives implies in reduced efficiency in the selection process in genetic breeding programs besides the loss of valuable genetic material. Thus, this study aimed to evaluate the viability of a microsatellite marker as an internal amplification control with a dominant marker for the wheat Glu1-Dx5 gene. A population of 77 wheat cultivars/breeding lines was analyzed. Fourteen microsatellite markers were analyzed in silico regarding the formation of dimers and clamps. The biplex reaction conditions were optimized, and the Xbarc117 marker was selected as the internal amplification control with a Glu1-Dx5 marker in wheat. It was concluded that the Xbarc117 microsatellite marker was effective in the simultaneous amplification with a dominant Glu1-Dx5 marker, making biplex PCR viable in wheat for the studied markers.
Single-tube tetradecaplex panel of highly polymorphic microsatellite markers hemophilia A.
Zhao, M; Chen, M; Tan, A S C; Cheah, F S H; Mathew, J; Wong, P C; Chong, S S
2017-07-01
microsatellite marker panel simplifies identification and selection of informative markers for linkage-based PGD of HEMA. Informative markers can also be easily co-amplified with mutation-containing F8 amplicons for combined mutation detection and linkage analysis. © 2017 International Society on Thrombosis and Haemostasis.
Healthy Schools Network, Inc., 2011
2011-01-01
Dry erase whiteboards come with toxic dry erase markers and toxic cleaning products. Dry erase markers labeled "nontoxic" are not free of toxic chemicals and can cause health problems. Children are especially vulnerable to environmental health hazards; moreover, schools commonly have problems with indoor air pollution, as they are more densely…
Energy Technology Data Exchange (ETDEWEB)
Gaede, Stewart; Yu, Edward; Van Dyk, Jake; Battista, Jerry [Radiation Oncology Program, London Regional Cancer Program, London, Ontario (Canada); Carnes, Gregory; Lee, Ting-Yim [Department of Medical Biophysics, University of Western Ontario, London, Ontario (Canada)
2009-01-21
The purpose of this paper is to describe a non-invasive method to monitor the motion of internal organs affected by respiration without using external markers or spirometry, to test the correlation with external markers, and to calculate any time shift between the datasets. Ten lung cancer patients were CT scanned with a GE LightSpeed Plus 4-Slice CT scanner operating in a cine mode. We retrospectively reconstructed the raw CT data to obtain consecutive 0.5 s reconstructions at 0.1 s intervals to increase image sampling. We defined regions of interest containing tissue interfaces, including tumour/lung interfaces that move due to breathing on multiple axial slices and measured the mean CT number versus respiratory phase. Tumour motion was directly correlated with external marker motion, acquired simultaneously, using the sample coefficient of determination, r{sup 2}. Only three of the ten patients showed correlation higher than r{sup 2} = 0.80 between tumour motion and external marker position. However, after taking into account time shifts (ranging between 0 s and 0.4 s) between the two data sets, all ten patients showed correlation better than r{sup 2} = 0.8. This non-invasive method for monitoring the motion of internal organs is an effective tool that can assess the use of external markers for 4D-CT imaging and respiratory-gated radiotherapy on a patient-specific basis.
Introduction of in vitro transcribed ENO1 mRNA into neuroblastoma cells induces cell death
International Nuclear Information System (INIS)
Ejeskär, Katarina; Krona, Cecilia; Carén, Helena; Zaibak, Faten; Li, Lingli; Martinsson, Tommy; Ioannou, Panayiotis A
2005-01-01
Neuroblastoma is a solid tumour of childhood often with an unfavourable outcome. One common genetic feature in aggressive tumours is 1p-deletion. The α-enolase (ENO1) gene is located in chromosome region 1p36.2, within the common region of deletion in neuroblastoma. One alternative translated product of the ENO1 gene, known as MBP-1, acts as a negative regulator of the c-myc oncogene, making the ENO1 gene a candidate as a tumour suppressor gene. Methods used in this study are transfection of cDNA-vectors and in vitro transcribed mRNA, cell growth assay, TUNEL-assay, real-time RT-PCR (TaqMan) for expression studies, genomic sequencing and DHPLC for mutation detection. Here we demonstrate that transfection of ENO1 cDNA into 1p-deleted neuroblastoma cell lines causes' reduced number of viable cells over time compared to a negative control and that it induces apoptosis. Interestingly, a similar but much stronger dose-dependent reduction of cell growth was observed by transfection of in vitro transcribed ENO1 mRNA into neuroblastoma cells. These effects could also be shown in non-neuroblastoma cells (293-cells), indicating ENO1 to have general tumour suppressor activity. Expression of ENO1 is detectable in primary neuroblastomas of all different stages and no difference in the level of expression can be detected between 1p-deleted and 1p-intact tumour samples. Although small numbers (11 primary neuroblastomas), there is some evidence that Stage 4 tumours has a lower level of ENO1-mRNA than Stage 2 tumours (p = 0.01). However, mutation screening of 44 primary neuroblastomas of all different stages, failed to detect any mutations. Our studies indicate that ENO1 has tumour suppressor activity and that high level of ENO1 expression has growth inhibitory effects
International Nuclear Information System (INIS)
Venema, J.; van Hoffen, A.; Karcagi, V.; Natarajan, A.T.; van Zeeland, A.A.; Mullenders, L.H.
1991-01-01
The authors have measured the removal of UV-induced pyrimidine dimers from DNA fragments of the adenosine deaminase (ADA) and dihydrofolate reductase (DHFR) genes in primary normal human and xeroderma pigmentosum complementation group C (XP-C) cells. Using strand-specific probes, we show that in normal cells, preferential repair of the 5' part of the ADA gene is due to the rapid and efficient repair of the transcribed strand. Within 8 h after irradiation with UV at 10 J m-2, 70% of the pyrimidine dimers in this strand are removed. The nontranscribed strand is repaired at a much slower rate, with 30% dimers removed after 8 h. Repair of the transcribed strand in XP-C cells occurs at a rate indistinguishable from that in normal cells, but the nontranscribed strand is not repaired significantly in these cells. Similar results were obtained for the DHFR gene. In the 3' part of the ADA gene, however, both normal and XP-C cells perform fast and efficient repair of either strand, which is likely to be caused by the presence of transcription units on both strands. The factor defective in XP-C cells is apparently involved in the processing of DNA damage in inactive parts of the genome, including nontranscribed strands of active genes. These findings have important implications for the understanding of the mechanism of UV-induced excision repair and mutagenesis in mammalian cells
THE PHRASEOLOGY OF PUBLIC INTERNATIONAL ENGLISH
Directory of Open Access Journals (Sweden)
Peter Howarth
2006-06-01
Full Text Available In Howarth 2002 a limited amount of data was presented for preliminary analysis of the phraseology of international press conferences. Tliat study focused on the distinction between spontaneous and scripted spoken English and examined whether these styles of speech could be correlated with differences in phraseological performance. The current study broadens the scope of this research and aims to investigate in more detail the nature of the language used in public international settings between native- and non-native speakers. It will draw on a corpus of approximately 2.5 million words of transcribed press conferences, containing large numbers of exchanges between native and non-native spokespeople and journalists. 'The press conferences have been conducted during the last eight years in Former Yugoslavia and have the common subject matter of peace-keeping and security. In addition to using a variety of corpus analyses (e.g. keywords, recurrent word combinations, fixed phrases, the study will attempt to deepen our understanding of this genre.
Directory of Open Access Journals (Sweden)
Pilar Mur Dueñas
2009-10-01
Full Text Available The ultimate aim of intercultural analyses in English for Academic Purposes is to help non-native scholars function successfully in the international disciplinary community in English. The aim of this paper is to show how corpus-based intercultural analyses can be useful to design EAP materials on a particular metadiscourse category, logical markers, in research article writing. The paper first describes the analysis carried out of additive, contrastive and consecutive logical markers in a corpus of research articles in English and in Spanish in a particular discipline, Business Management. Differences were found in their frequency and also in the use of each of the sub-categories. Then, five activities designed on the basis of these results are presented. They are aimed at raising Spanish Business scholars' awareness of the specific uses and pragmatic function of frequent logical markers in international research articles in English.
Alternative fiducial markers for Vero real-time tumor tracking radiotherapy: A phantom study
Park, Shin-Hyung; Kim, Jae-Chul; Kim, Sung Joon
2016-12-01
The objective of this study was to investigate the feasibility of potential fiducial markers consisting of various materials in a Vero real-time tumor-tracking (RTTT) system. In order to determine the applicability of fiducial markers for the Vero RTTT system, we tested various markers consisting of 8 kinds of material (titanium, stainless steel, high-carbon steel, pure steel, copper, silver, tantalum, and gold) with various diameters ranging from 0.3 mm to 1.6 mm and a length of 5 mm. Additionally, a commercial gold coil marker (Visicoil™, IBA dosimetry, Schwarzenbruck, Germany) of diameter 0.5 mm and length 1 cm was included for evaluation. The radiologic visibility on kV fluoroscopy/kV CT scan images of the fiducial markers was evaluated. The detectability on the RTTT system was tested using a two-dimensional moving phantom (Brainlab AG, Feldkirchen, Germany), producing sinusoidal motion. The target center's accuracy was evaluated by calculating the deviation of the position of a metal sphere from the center on the dose profile. Dose profiles were measured using Gafchromic EBT2 films (International Specialty Products, NJ, USA). All markers were visible on kV fluoroscopy/kV CT while markers with atomic number ≥ 25.7 were detectable on the Vero RTTT system. All the detected markers showed excellent geometric accuracy.
Markers for nutrition studies: review of criteria for the evaluation of markers.
de Vries, Jan; Antoine, Jean-Michel; Burzykowski, Tomasz; Chiodini, Alessandro; Gibney, Mike; Kuhnle, Gunter; Méheust, Agnès; Pijls, Loek; Rowland, Ian
2013-10-01
Markers are important tools to assess the nutrition status and effects of nutrition interventions. There is currently insufficient consensus in nutrition sciences on how to evaluate markers, despite the need for properly evaluating them. To identify the criteria for the evaluation of markers related to nutrition, health and disease and to propose generic criteria for evaluation. The report on "Evaluation of Biomarker and Surrogate Endpoints in Chronic Disease" from the Institute of Medicine was the starting point for the literature search. Additionally, specific search strategies were developed for Pubmed. In nutrition, no set of criteria or systematic approach to evaluate markers is currently available. There is a reliance on the medical area where statistical methods have been developed to quantify the evaluation of markers. Even here, a systematic approach is lacking-markers are still evaluated on a case-by-case basis. The review of publications from the literature search resulted in a database with definitions, criteria for validity and the rationale behind the criteria. It was recognized that, in nutrition, a number of methodological aspects differ from medical research. The following criteria were identified as essential elements in the evaluation of markers: (1) the marker has a causal biological link with the endpoint, (2) there is a significant association between marker and endpoint in the target population, (3) marker changes consistently with the endpoint, e.g., in response to an intervention, and (4) change in the marker explains a substantial proportion of the change in the endpoint in response to the intervention.
Expert judgment on markers to deter inadvertent human intrusion into the Waste Isolation Pilot Plant
Energy Technology Data Exchange (ETDEWEB)
Trauth, K.M. [Sandia National Labs., Albuquerque, NM (United States); Hora, S.C. [Hawaii Univ., Hilo, HI (United States); Guzowski, R.V. [Science Applications International Corp., San Diego, CA (United States)
1993-11-01
The expert panel identified basic principles to guide current and future marker development efforts: (1) the site must be marked, (2) message(s) must be truthful and informative, (3) multiple components within a marker system, (4) multiple means of communication (e.g., language, pictographs, scientific diagrams), (5) multiple levels of complexity within individual messages on individual marker system elements, (6) use of materials with little recycle value, and (7) international effort to maintain knowledge of the locations and contents of nuclear waste repositories. The efficacy of the markers in deterring inadvertent human intrusion was estimated to decrease with time, with the probability function varying with the mode of intrusion (who is intruding and for what purpose) and the level of technological development of the society. The development of a permanent, passive marker system capable of surviving and remaining interpretable for 10,000 years will require further study prior to implementation.
Expert judgment on markers to deter inadvertent human intrusion into the Waste Isolation Pilot Plant
International Nuclear Information System (INIS)
Trauth, K.M.; Hora, S.C.; Guzowski, R.V.
1993-11-01
The expert panel identified basic principles to guide current and future marker development efforts: (1) the site must be marked, (2) message(s) must be truthful and informative, (3) multiple components within a marker system, (4) multiple means of communication (e.g., language, pictographs, scientific diagrams), (5) multiple levels of complexity within individual messages on individual marker system elements, (6) use of materials with little recycle value, and (7) international effort to maintain knowledge of the locations and contents of nuclear waste repositories. The efficacy of the markers in deterring inadvertent human intrusion was estimated to decrease with time, with the probability function varying with the mode of intrusion (who is intruding and for what purpose) and the level of technological development of the society. The development of a permanent, passive marker system capable of surviving and remaining interpretable for 10,000 years will require further study prior to implementation
Genomic markers for decision making: what is preventing us from using markers?
Coyle, Vicky M; Johnston, Patrick G
2010-02-01
The advent of novel genomic technologies that enable the evaluation of genomic alterations on a genome-wide scale has significantly altered the field of genomic marker research in solid tumors. Researchers have moved away from the traditional model of identifying a particular genomic alteration and evaluating the association between this finding and a clinical outcome measure to a new approach involving the identification and measurement of multiple genomic markers simultaneously within clinical studies. This in turn has presented additional challenges in considering the use of genomic markers in oncology, such as clinical study design, reproducibility and interpretation and reporting of results. This Review will explore these challenges, focusing on microarray-based gene-expression profiling, and highlights some common failings in study design that have impacted on the use of putative genomic markers in the clinic. Despite these rapid technological advances there is still a paucity of genomic markers in routine clinical use at present. A rational and focused approach to the evaluation and validation of genomic markers is needed, whereby analytically validated markers are investigated in clinical studies that are adequately powered and have pre-defined patient populations and study endpoints. Furthermore, novel adaptive clinical trial designs, incorporating putative genomic markers into prospective clinical trials, will enable the evaluation of these markers in a rigorous and timely fashion. Such approaches have the potential to facilitate the implementation of such markers into routine clinical practice and consequently enable the rational and tailored use of cancer therapies for individual patients.
DEFF Research Database (Denmark)
Durkin, M E; Jäger, A C; Khurana, T S
1999-01-01
The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...
International Nuclear Information System (INIS)
Forrester, H.B.; Radford, I.R.
2003-01-01
Full text: DNA rearrangement events leading to chromosomal aberrations are central to ionizing radiation-induced cell death. Although DNA double-strand breaks are probably the lesion that initiates formation of chromosomal aberrations, little is understood about the molecular mechanisms that generate and modulate DNA rearrangement. Examination of the sequences that flank sites of DNA rearrangement may provide information regarding the processes and enzymes involved in rearrangement events. Accordingly, we developed a method using inverse PCR that allows the detection and sequencing of putative radiation-induced DNA rearrangements in defined regions of the human genome. The method can detect single copies of a rearrangement event that has occurred in a particular region of the genome and, therefore, DNA rearrangement detection does not require survival and continued multiplication of the affected cell. Ionizing radiation-induced DNA rearrangements were detected in several different regions of the genome of human fibroblast cells that were exposed to 30 Gy of γ-irradiation and then incubated for 24 hours at 37 deg C. There was a 3- to 5-fold increase in the number of products amplified from irradiated as compared with control cells in the target regions 5' to the C-MYC, CDKN1A, RB1, and FGFR2 genes. Sequences were examined from 121 DNA rearrangements. Approximately half of the PCR products were derived from possible inter-chromosomal rearrangements and the remainder were from intra-chromosomal events. A high proportion of the sequences that rearranged with target regions were located in genes, suggesting that rearrangements may occur preferentially in transcribed regions. Eighty-four percent of the sequences examined by reverse transcriptase PCR were from transcribed sequences in IMR-90 cells. The distribution of DNA rearrangements within the target regions is non-random and homology occurs between the sequences involved in rearrangements in some cases but is not
Directory of Open Access Journals (Sweden)
Dewi Safitri Tanjung
2017-02-01
Full Text Available Abstract Breast cancer remains the leading cause of death among women, and there is a need to develop minimally invasive marker. In our previous study based on clinicopathologic in pre-chemotherapy patients showed miR-21 was upregulated 1.32 times higher at advanced stage compared with early stage. Therefore the matched patients for post-chemotherapy samples were used. The aim of this research is to examine the expression of miR-21 as potential marker to adjuvant chemotherapy in breast cancer patients. The samples were taken by using cross sectional method with total 39 blood plasma samples from breast cancer patients in adjuvant chemotherapy and 12 healthy control samples. Plasma was obtained from blood samples and then RNA isolated were performed. Total RNA was reverse transcribed using cDNA synthesis. The expression of miR-21 was then analyzed using specific primer for miR-21 and miR-16 as the reference gene. Livak Method was used to calculate the expression level in each group. The result showed that there is significant downregulated expression of miR-21 in postchemotherapy 2.61 fold compared with pre-chemotherapy (p<0.05. The expression of miR-21 upregulated 2.2 folds (p<0.05 in pre-chemotherapy compared with healthy control, while in post-chemotherapy compared with healthy control, the expression of miR-21 was 0.8 fold (p<0.05. In conclusion, Hsa-miR-21-5p can be used as marker for adjuvant chemotherapy response in breast cancer because there is significant different expression between prechemotherapy, post-chemotherapy and healthy control. The continuation research in the near future for detecting the expression of tumor suppressor protein regulated by miR-21 is needed. Keywords: breast cancer, adjuvant chemotherapy, miR-21, minimal invasive marker
A search for markers of sugarcane evolution
Directory of Open Access Journals (Sweden)
M. Bacci Jr.
2001-12-01
Full Text Available To determine the phylogenetic relationship between sugarcane cultivars and other members of the Saccharinae subtribe, we identified the fast evolving ITS1-5.8S-ITS2 (ITS = internal transcribed spacer; 5.8S = 5.8S ribosomal DNA region of the sugarcane genome in the Sugarcane Expressed Sequence Tag (SUCEST genome project database. Parsimony analysis utilizing this region and homologs belonging to the 23 closely related Andropogoneae currently deposited in the GenBank database has shown sugarcane as the sister group of Saccharum sinense. However, because there are few parsimony-informative characters and high homoplasy in the ITS1-5.8S-ITS2 region we were not able to determine with confidence the phylogenetic relationship between sugarcane and some of the remaining members of Saccharine subtribe. To find alternatives for the phylogenetic reconstruction of sugarcane evolutionary history, we selected 17 markers (nuclear, chloroplastic or mitochondrial from the SUCEST database of which apha-tubulin, ribosomal protein L16 (rpl16 and DNA-directed RNA polymerase beta chain (rpoC2 were found to have a low incidence of polymorphism and comparable, or even faster, rates of evolution than the ITS1-5.8S-ITS2 region. We suggest that these markers should be considered as preferential choices for phylogenetic studies of Saccharinae subtribe.Com o propósito de determinar a relação filogenética entre a cana-de-açúcar e membros da subtribo Saccharinae, a região gênica nuclear ITS1-5,8S-ITS2 (ITS: espaçador interno transcrito; 5,8S: DNA ribossomal 5.8S, com alta taxa evolutiva, foi identificada no banco de dados do projeto genoma "Sugarcane Expressed Sequence Tag" (SUCEST. Uma análise através do método de parcimônia, utilizando esta região e seqüências homólogas de 23 Andropogoneae retiradas da base de dados GenBank, indicou que a cana-de-açúcar é o grupo-irmão de Saccharum sinense. No entanto, devido à pequena quantidade de caracteres
The use of n-alkane markers to estimate the intake and apparent ...
African Journals Online (AJOL)
However, the effect of the higher recovery of the dosed marker needs further investigation. The estimates of apparent dry matter digestibility corresponded well with measured values, provided the factor for the incomplete faecal recovery of the internal alkanes was included in the calculation. It was concluded that the alkane ...
[Correlation between five RNA markers of rat's skin and PMI at different temperatures].
Pan, Hui; Zhang, Heng; Lü, Ye-hui; Ma, Jian-long; Ma, Kai-jun; Chen, Long
2014-08-01
To explore the correlation between postmortem interval (PMI) and five RNA markers of rat's skin--β-actin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 18S ribosomal RNA(18S rRNA), 5S ribosomal RNA (5S rRNA), and microRNA-203 (miR-203), at different temperatures. Eighteen SD rats were randomly divided into three environmental temperature groups: 4 °C, 15 °C and 35 °C, respectively. Skin samples were taken at 11 time points from 0 h to 120 h post-mortem. The total RNA was extracted from the skin samples and the five RNA levels were detected by real-time fluorescent quantitative PCR. Proper internal reference was selected by geNorm software. Regression analysis of the RNA markers was conducted by GraphPad software. 5S rRNA and miR-203 were most suitable internal references. A good linear relationship between PMI and RNA levels (β-actin and GAPDH) was observed in two groups (4 °C and 15 °C), whereas the S type curve relationship between the expression levels of the two markers (β-actin and GAPDH) and PMI was observed in the 35 °C group. The partial linear relationship between 18S rRNA and PMI was observed in the groups (15 °C and 35 °C). Skin could be a suitable material for extracting RNA. The RNA expression levels of β-actin and GAPDH correlate well with PMI, and these RNA markers of skin tissue could be additional indice for the estimation of PMI.
Song, Xiao-Xia; Zhao, Yan; Song, Chun-Yan; Li, Chuan-Hua; Song, Ying; Chen, Ming-Jie; Bao, Da-Peng; Tan, Qi
2018-01-01
China is home to rich wild and cultivated strains of Lentinus edodes, an important edible and medicinal mushroom. Artificial selection of L. edodes has a long history, and the widely cultivated strains belong to populations different from those of most wild strains. Internal transcribed spacer (ITS) regions have been used as good markers to identify L. edodes populations. But because ITS regions exhibit incomplete concerted evolution, the use of an ITS to identify L. edodes populations has been questioned. The objective of this study was to determine whether the ITS region is suitable for identifying L. edodes populations and which populations the widely cultivated strains and the most wild strains belong to by investigating intraindividual and differential ITS polymorphisms between 44 cultivars and 44 wild strains of L. edodes in China. Intraindividual ITS polymorphism is common in L. edodes strains, and most strains possessed 2 different ITS sequences, which came from their heterokaryons. The genetic polymorphisms of ITS1, 5.8S, and ITS2 in L. edodes strains are distinct. All strains were divided into one 5.8S type (5.8S-A), 2 ITS1 types (ITS1-A and ITS1-B), and 2 ITS2 types (ITS2-A and ITS2-B), which were subdivided into 2 branches (ITS2-A1 and ITS2-A2; ITS2-B1 and ITS2-B2). ITS1/5.8S/ITS2 could be used as a good marker in preliminary classification of L. edodes strains in China. It not only exhibited classified information of ITS1, 5.8S, and ITS2 for each strain at the same time, it also indicated whether the strain was heterozygous. The 44 cultivated strains were mainly the A/A/A1 type, and the 44 wild strains were mainly the A/A/A2 and other mixed types.
Tantalum markers in radiography
International Nuclear Information System (INIS)
Aronson, A.S.; Jonsson, N.; Alberius, P.
1985-01-01
The biocompatibility of two types of radiopaque tantalum markers was evaluated histologically. Reactions to pin markers (99.9% purity) and spherical markers (95.2% purity) were investigated after 3-6 weeks in rabbits and 5-48 weeks in children with abnormal growth. Both marker types were firmly attached to bone trabeculae; this was most pronounced in rabbit bone, and no adverse macroscopic reactions were observed. Microscopically, no reactions or only slight fibrosis of bone tissue were detected, while soft tissues only demonstrated a minor inflammatory reaction. Nevertheless, the need for careful preparation and execution of marker implantations is stressed, and particularly avoidance iof the use of emery in sharpening of cannulae. The bioinertness of tantalum was reconfirmed as was its suitability for use as skeletal and soft tissue radiographic markers. (orig.)
Internal Transcribed Spacer (ITS), an ideal DNA barcode for species ...
African Journals Online (AJOL)
Background: DNA barcoding is a technique used to identify species based on species-specific differences in short regions of their DNA. It is widely used in species discrimination of medicinal plants and traditional medicines. Materials and Methods: In the present study, four potential DNA barcodes, namely rbcL, matK, ...
[Comparison of rDNA internal transcribed spacer sequences in asparagus].
Ou, Li-Jun; Ye, Wei; Zeng, Gui-Ping; Jiang, Xiang-Hui; She, Chao-Wen; Xu, Dong; Yang, Jia-Qiang
2010-10-01
Using ITS sequence of nine species to identify counterfeiting medicine and analyse phylogenetic of Asparagus. Analysing ITS sequences by amplification, cloning,sequencing and alignment. The length range of ITS sequence of nine species was from 711 to 748 bp, the percentage of G + C content was about 60%. The phylogenetic tree constructed on the basis of the ITS sequences showed that nine species were divided into two branches: Asparagus cochinchinensis, Asparagus officinalis, Asparagus densiflorus, Asparagus densiflorus cv. Myers and Asparagus densiflorus cv. Sprengeri were a branch and the others were a branch. Asparagus densiflorus and Asparagus densflorus cv. Myers those were from Africa had priority to clustering and then clustering with Asparagus densiflorus cv. Sprengeri that was a variant of Asparagus densiflorus in the first branch. Asparagus setaceus had relatively distant genetic relationship with the others three materials in another branch. The ITS sequences could distinguish species of Asparagus to test the counterfeit. Division status in phylogenetic tree of some species were debatable and ITS sequence was combined with others analytical tools to analyze the realistic phylogeny.
Tumor markers in clinical oncology
International Nuclear Information System (INIS)
Novakovic, S.
2004-01-01
The subtle differences between normal and tumor cells are exploited in the detection and treatment of cancer. These differences are designated as tumor markers and can be either qualitative or quantitative in their nature. That means that both the structures that are produced by tumor cells as well as the structures that are produced in excessive amounts by host tissues under the influence of tumor cells can function as tumor markers. Speaking in general, the tumor markers are the specific molecules appearing in the blood or tissues and the occurrence of which is associated with cancer. According to their application, tumor markers can be roughly divided as markers in clinical oncology and markers in pathology. In this review, only tumor markers in clinical oncology are going to be discussed. Current tumor markers in clinical oncology include (i) oncofetal antigens, (ii) placental proteins, (iii) hormones, (iv) enzymes, (v) tumor-associated antigens, (vi) special serum proteins, (vii) catecholamine metabolites, and (viii) miscellaneous markers. As to the literature, an ideal tumor marker should fulfil certain criteria - when using it as a test for detection of cancer disease: (1) positive results should occur in the early stages of the disease, (2) positive results should occur only in the patients with a specific type of malignancy, (3) positive results should occur in all patients with the same malignancy, (4) the measured values should correlate with the stage of the disease, (5) the measured values should correlate to the response to treatment, (6) the marker should be easy to measure. Most tumor markers available today meet several, but not all criteria. As a consequence of that, some criteria were chosen for the validation and proper selection of the most appropriate marker in a particular malignancy, and these are: (1) markers' sensitivity, (2) specificity, and (3) predictive values. Sensitivity expresses the mean probability of determining an elevated tumor
Jain, Ashali; Khalid, Maria; Qureshi, Muhammad M; Georgian-Smith, Dianne; Kaplan, Jonah A; Buch, Karen; Grinstaff, Mark W; Hirsch, Ariel E; Hines, Neely L; Anderson, Stephan W; Gallagher, Katherine M; Bates, David D B; Bloch, B Nicolas
2017-11-01
To evaluate breast biopsy marker migration in stereotactic core needle biopsy procedures and identify contributing factors. This retrospective study analyzed 268 stereotactic biopsy markers placed in 263 consecutive patients undergoing stereotactic biopsies using 9G vacuum-assisted devices from August 2010-July 2013. Mammograms were reviewed and factors contributing to marker migration were evaluated. Basic descriptive statistics were calculated and comparisons were performed based on radiographically-confirmed marker migration. Of the 268 placed stereotactic biopsy markers, 35 (13.1%) migrated ≥1 cm from their biopsy cavity. Range: 1-6 cm; mean (± SD): 2.35 ± 1.22 cm. Of the 35 migrated biopsy markers, 9 (25.7%) migrated ≥3.5 cm. Patient age, biopsy pathology, number of cores, and left versus right breast were not associated with migration status (P> 0.10). Global fatty breast density (P= 0.025) and biopsy in the inner region of breast (P = 0.031) were associated with marker migration. Superior biopsy approach (P= 0.025), locally heterogeneous breast density, and t-shaped biopsy markers (P= 0.035) were significant for no marker migration. Multiple factors were found to influence marker migration. An overall migration rate of 13% supports endeavors of research groups actively developing new biopsy marker designs for improved resistance to migration. • Breast biopsy marker migration is documented in 13% of 268 procedures. • Marker migration is affected by physical, biological, and pathological factors. • Breast density, marker shape, needle approach etc. affect migration. • Study demonstrates marker migration prevalence; marker design improvements are needed.
Directory of Open Access Journals (Sweden)
Macarena Morillo-Huesca
2010-05-01
Full Text Available The FACT complex participates in chromatin assembly and disassembly during transcription elongation. The yeast mutants affected in the SPT16 gene, which encodes one of the FACT subunits, alter the expression of G1 cyclins and exhibit defects in the G1/S transition. Here we show that the dysfunction of chromatin reassembly factors, like FACT or Spt6, down-regulates the expression of the gene encoding the cyclin that modulates the G1 length (CLN3 in START by specifically triggering the repression of its promoter. The G1 delay undergone by spt16 mutants is not mediated by the DNA-damage checkpoint, although the mutation of RAD53, which is otherwise involved in histone degradation, enhances the cell-cycle defects of spt16-197. We reveal how FACT dysfunction triggers an accumulation of free histones evicted from transcribed chromatin. This accumulation is enhanced in a rad53 background and leads to a delay in G1. Consistently, we show that the overexpression of histones in wild-type cells down-regulates CLN3 in START and causes a delay in G1. Our work shows that chromatin reassembly factors are essential players in controlling the free histones potentially released from transcribed chromatin and describes a new cell cycle phenomenon that allows cells to respond to excess histones before starting DNA replication.
The level of embryonation influences detection of Ostertagia ostertagi eggs by semi-quantitative PCR
DEFF Research Database (Denmark)
Drag, Markus; Höglund, Johan; Nejsum, Peter
2016-01-01
The Internal Transcribed Spacer 2 (ITS2) is a candidate diagnostic marker of the pathogenic cattle nematode Ostertagia ostertagi. The aims of this study were: (i) to document and quantify how the development of O. ostertagi eggs affects ITS2 copies under different storage conditions, and (ii......) to suggest optimal storage conditions for faecal samples in a diagnostic pipeline that involves detection and semi-quantification by real-time semi-quantitative polymerase chain reaction (qPCR). Eggs of Ostertagia ostertagi were obtained from fresh faeces and stored at 4 °C or 25 °C under aerobic...
International Nuclear Information System (INIS)
Cheung, Y; Sawant, A
2014-01-01
Purpose: Most clinically-deployed strategies for respiratory motion management in lung radiotherapy (e.g., gating, tracking) use external markers that serve as surrogates for tumor motion. However, typical lung phantoms used to validate these strategies are rigid-exterior+rigid-interior or rigid-exterior+deformable-interior. Neither class adequately represents the human anatomy, which is deformable internally as well as externally. We describe the construction and experimental validation of a more realistic, externally- and internally-deformable, programmable lung phantom. Methods: The outer shell of a commercially-available lung phantom (RS- 1500, RSD Inc.) was used. The shell consists of a chest cavity with a flexible anterior surface, and embedded vertebrae, rib-cage and sternum. A 3-axis platform was programmed with sinusoidal and six patient-recorded lung tumor trajectories. The platform was used to drive a rigid foam ‘diaphragm’ that compressed/decompressed the phantom interior. Experimental characterization comprised of mapping the superior-inferior (SI) and anterior-posterior (AP) trajectories of external and internal radioopaque markers with kV x-ray fluoroscopy and correlating these with optical surface monitoring using the in-room VisionRT system. Results: The phantom correctly reproduced the programmed motion as well as realistic effects such as hysteresis. The reproducibility of marker trajectories over multiple runs for sinusoidal as well as patient traces, as characterized by fluoroscopy, was within 0.4 mm RMS error for internal as well as external markers. The motion trajectories of internal and external markers as measured by fluoroscopy were found to be highly correlated (R=0.97). Furthermore, motion trajectories of arbitrary points on the deforming phantom surface, as recorded by the VisionRT system also showed a high correlation with respect to the fluoroscopically-measured trajectories of internal markers (R=0.92). Conclusion: We have
Enzyme markers in inbred rat strains: genetics of new markers and strain profiles.
Adams, M; Baverstock, P R; Watts, C H; Gutman, G A
1984-08-01
Twenty-six inbred strains of the laboratory rat (Rattus norvegicus) were examined for electrophoretic variation at an estimated 97 genetic loci. In addition to previously documented markers, variation was observed for the enzymes aconitase, aldehyde dehydrogenase, and alkaline phosphatase. The genetic basis of these markers (Acon-1, Ahd-2, and Akp-1) was confirmed. Linkage analysis between 35 pairwise comparisons revealed that the markers Fh-1 and Pep-3 are linked. The strain profiles of the 25 inbred strains at 11 electrophoretic markers are given.
Opposite replication polarities of transcribed and nontranscribed histone H5 genes
International Nuclear Information System (INIS)
Trempe, J.P.; Lindstrom, Y.I.; Leffak, M.
1988-01-01
The authors used an in vitro nuclear runoff replication assay to analyze the direction of replication of the active and inactive histone H5 genes in avian cells. In embryonic erythrocytes the transcribed histone H5 gene displayed sensitivity to endogenous nuclease cleavage. In contrast, this gene was insensitive to endogenous nuclease digestion under the same conditions in nuclei of the lymphoblastoid cell line MSB-1, and histone H5 gene transcripts were not detectable by dot-blot analysis of MSB-1 cell RNA. When nuclei were isolated from embryonic erythrocyctes and incubated with bromodeoxyuridine triphosphate, runoff replication from endogenous nuclease cleavage sites led to a relative enrichment for fragments near the 3' end of the histone H5 gene in the density-labeled DNA. In nuclei of MSB-1 cells or chicken embryo fibroblasts, however, runoff replication from restriction enzyme-cut sites (or induced endogenous nuclease-cut sites in MSB-1 nuclei) led to a relative enrichment for fragments near the 5' end of the H5 gene in dense DNA. Based on the enhanced incorporation of bromodeoxyuridine into origin-distal regions of DNA during the in vitro runoff replication assay, the authors conclude that the active histone H5 gene in embryonic erythrocytes is preferentially replicated in the transcriptional direction from an origin in the 5'-flanking DNA, whereas its inactive counterparts in MSB-1 cells and chicken embryo fibroblasts are preferentially replicated in the opposite direction
Estrada-Gómez, Sebastian; Vargas-Muñoz, Leidy Johana; Saldarriaga-Córdoba, Mónica; Cifuentes, Yeimy; Perafan, Carlos
2017-04-01
Theraphosidae spider venoms are well known for possess a complex mixture of protein and non-protein compounds in their venom. The objective of this study was to report and identify different proteins translated from the venom gland DNA information of the recently described Theraphosidae spider Pamphobeteus verdolaga. Using a venom gland transcriptomic analysis, we reported a set of the first complete sequences of seven different proteins of the recenlty described Theraphosidae spider P. verdolaga. Protein analysis indicates the presence of different proteins on the venom composition of this new spider, some of them uncommon in the Theraphosidae family. MS/MS analysis of P. verdolaga showed different fragments matching sphingomyelinases (sicaritoxin), barytoxins, hexatoxins, latroinsectotoxins, and linear (zadotoxins) peptides. Only four of the MS/MS fragments showed 100% sequence similarity with one of the transcribed proteins. Transcriptomic analysis showed the presence of different groups of proteins like phospholipases, hyaluronidases, inhibitory cysteine knots (ICK) peptides among others. The three database of protein domains used in this study (Pfam, SMART and CDD) showed congruency in the search of unique conserved protein domain for only four of the translated proteins. Those proteins matched with EF-hand proteins, cysteine rich secretory proteins, jingzhaotoxins, theraphotoxins and hexatoxins, from different Mygalomorphae spiders belonging to the families Theraphosidae, Barychelidae and Hexathelidae. None of the analyzed sequences showed a complete 100% similarity. Copyright © 2017 Elsevier Ltd. All rights reserved.
Ambros, P F; Ambros, I M; Brodeur, G M; Haber, M; Khan, J; Nakagawara, A; Schleiermacher, G; Speleman, F; Spitz, R; London, W B; Cohn, S L; Pearson, A D J; Maris, J M
2009-01-01
Neuroblastoma serves as a paradigm for utilising tumour genomic data for determining patient prognosis and treatment allocation. However, before the establishment of the International Neuroblastoma Risk Group (INRG) Task Force in 2004, international consensus on markers, methodology, and data interpretation did not exist, compromising the reliability of decisive genetic markers and inhibiting translational research efforts. The objectives of the INRG Biology Committee were to identify highly prognostic genetic aberrations to be included in the new INRG risk classification schema and to develop precise definitions, decisive biomarkers, and technique standardisation. The review of the INRG database (n=8800 patients) by the INRG Task Force finally enabled the identification of the most significant neuroblastoma biomarkers. In addition, the Biology Committee compared the standard operating procedures of different cooperative groups to arrive at international consensus for methodology, nomenclature, and future directions. Consensus was reached to include MYCN status, 11q23 allelic status, and ploidy in the INRG classification system on the basis of an evidence-based review of the INRG database. Standardised operating procedures for analysing these genetic factors were adopted, and criteria for proper nomenclature were developed. Neuroblastoma treatment planning is highly dependant on tumour cell genomic features, and it is likely that a comprehensive panel of DNA-based biomarkers will be used in future risk assignment algorithms applying genome-wide techniques. Consensus on methodology and interpretation is essential for uniform INRG classification and will greatly facilitate international and cooperative clinical and translational research studies. PMID:19401703
Marker Registration Technique for Handwritten Text Marker in Augmented Reality Applications
Thanaborvornwiwat, N.; Patanukhom, K.
2018-04-01
Marker registration is a fundamental process to estimate camera poses in marker-based Augmented Reality (AR) systems. We developed AR system that creates correspondence virtual objects on handwritten text markers. This paper presents a new method for registration that is robust for low-content text markers, variation of camera poses, and variation of handwritten styles. The proposed method uses Maximally Stable Extremal Regions (MSER) and polygon simplification for a feature point extraction. The experiment shows that we need to extract only five feature points per image which can provide the best registration results. An exhaustive search is used to find the best matching pattern of the feature points in two images. We also compared performance of the proposed method to some existing registration methods and found that the proposed method can provide better accuracy and time efficiency.
Jin, Peng; Hulshof, Maarten C C M; de Jong, Rianne; van Hooft, Jeanin E; Bel, Arjan; Alderliesten, Tanja
2016-03-01
Respiration-induced tumor motion is an important geometrical uncertainty in esophageal cancer radiation therapy. The aim of this study was to quantify this motion using fiducial markers and four-dimensional computed tomography (4DCT). Twenty esophageal cancer patients underwent endoscopy-guided marker implantation in the tumor volume and 4DCT acquisition. The 4DCT data were sorted into 10 breathing phases and the end-of-inhalation phase was selected as reference. We quantified for each visible marker (n=60) the motion in each phase and derived the peak-to-peak motion magnitude throughout the breathing cycle. The motion was quantified and analyzed for four different regions and in three orthogonal directions. The median(interquartile range) of the peak-to-peak magnitudes of the respiration-induced marker motion (left-right/anterior-posterior/cranial-caudal) was 1.5(0.5)/1.6(0.5)/2.9(1.4) mm for the proximal esophagus (n=6), 1.5(1.4)/1.4(1.3)/3.7(2.6) mm for the middle esophagus (n=12), 2.6(1.3)/3.3(1.8)/5.4(2.9) mm for the distal esophagus (n=25), and 3.7(2.1)/5.3(1.8)/8.2(3.1) mm for the proximal stomach (n=17). The variations in the results between the three directions, four regions, and patients suggest the need of individualized region-dependent anisotropic internal margins. Therefore, we recommend using markers with 4DCT to patient-specifically adapt the internal target volume (ITV). Without 4DCT, 3DCTs at the end-of-inhalation and end-of-exhalation phases could be alternatively applied for ITV individualization. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Epothilone D prevents binge methamphetamine-mediated loss of striatal dopaminergic markers.
Killinger, Bryan A; Moszczynska, Anna
2016-02-01
decreasing the levels of DAergic markers in the striatum. We have determined that high-dose METH destabilizes microtubules in this pathway, which is manifested by decreased levels of acetylated (Acetyl) and detyrosinated (Detyr) α-tubulin (I). A microtubule stabilizing agent epothilone D protects striatal microtubules form the METH-induced loss of DAergic markers (II). These findings provide a new strategy for protection form METH - restoration of proper axonal transport. © 2015 International Society for Neurochemistry.
International Nuclear Information System (INIS)
Yan, Guanghua; Li, Jonathan; Huang, Yin; Mittauer, Kathryn; Lu, Bo; Liu, Chihray
2014-01-01
Purpose: To propose a simple model to explain the origin of ghost markers in marker-based optical tracking systems (OTS) and to develop retrospective strategies to detect and eliminate ghost markers. Methods: In marker-based OTS, ghost markers are virtual markers created due to the cross-talk between the two camera sensors, which can lead to system execution failure or inaccuracy in patient tracking. As a result, the users have to limit the number of markers and avoid certain marker configurations to reduce the chances of ghost markers. In this work, the authors propose retrospective strategies to detect and eliminate ghost markers. The two camera sensors were treated as mathematical points in space. The authors identified the coplanar within limit (CWL) condition as the necessary condition for ghost marker occurrence. A simple ghost marker detection method was proposed based on the model. Ghost marker elimination was achieved through pattern matching: a ghost marker-free reference set was matched with the optical marker set observed by the OTS; unmatched optical markers were eliminated as either ghost markers or misplaced markers. The pattern matching problem was formulated as a constraint satisfaction problem (using pairwise distances as constraints) and solved with an iterative backtracking algorithm. Wildcard markers were introduced to address missing or misplaced markers. An experiment was designed to measure the sensor positions and the limit for the CWL condition. The ghost marker detection and elimination algorithms were verified with samples collected from a five-marker jig and a nine-marker anthropomorphic phantom, rotated with the treatment couch from −60° to +60°. The accuracy of the pattern matching algorithm was further validated with marker patterns from 40 patients who underwent stereotactic body radiotherapy (SBRT). For this purpose, a synthetic optical marker pattern was created for each patient by introducing ghost markers, marker position
Energy Technology Data Exchange (ETDEWEB)
Yan, Guanghua, E-mail: yan@ufl.edu; Li, Jonathan; Huang, Yin; Mittauer, Kathryn; Lu, Bo; Liu, Chihray [Department of Radiation Oncology, University of Florida, Gainesville, Florida 32610 (United States)
2014-10-15
Purpose: To propose a simple model to explain the origin of ghost markers in marker-based optical tracking systems (OTS) and to develop retrospective strategies to detect and eliminate ghost markers. Methods: In marker-based OTS, ghost markers are virtual markers created due to the cross-talk between the two camera sensors, which can lead to system execution failure or inaccuracy in patient tracking. As a result, the users have to limit the number of markers and avoid certain marker configurations to reduce the chances of ghost markers. In this work, the authors propose retrospective strategies to detect and eliminate ghost markers. The two camera sensors were treated as mathematical points in space. The authors identified the coplanar within limit (CWL) condition as the necessary condition for ghost marker occurrence. A simple ghost marker detection method was proposed based on the model. Ghost marker elimination was achieved through pattern matching: a ghost marker-free reference set was matched with the optical marker set observed by the OTS; unmatched optical markers were eliminated as either ghost markers or misplaced markers. The pattern matching problem was formulated as a constraint satisfaction problem (using pairwise distances as constraints) and solved with an iterative backtracking algorithm. Wildcard markers were introduced to address missing or misplaced markers. An experiment was designed to measure the sensor positions and the limit for the CWL condition. The ghost marker detection and elimination algorithms were verified with samples collected from a five-marker jig and a nine-marker anthropomorphic phantom, rotated with the treatment couch from −60° to +60°. The accuracy of the pattern matching algorithm was further validated with marker patterns from 40 patients who underwent stereotactic body radiotherapy (SBRT). For this purpose, a synthetic optical marker pattern was created for each patient by introducing ghost markers, marker position
Biochemical markers of bone turnover
International Nuclear Information System (INIS)
Kim, Deog Yoon
1999-01-01
Biochemical markers of bone turnover has received increasing attention over the past few years, because of the need for sensitivity and specific tool in the clinical investigation of osteoporosis. Bone markers should be unique to bone, reflect changes of bone less, and should be correlated with radiocalcium kinetics, histomorphometry, or changes in bone mass. The markers also should be useful in monitoring treatment efficacy. Although no bone marker has been established to meet all these criteria, currently osteocalcin and pyridinium crosslinks are the most efficient markers to assess the level of bone turnover in the menopausal and senile osteoporosis. Recently, N-terminal telopeptide (NTX), C-terminal telopeptide (CTX) and bone specific alkaline phosphatase are considered as new valid markers of bone turnover. Recent data suggest that CTX and free deoxypyridinoline could predict the subsequent risk of hip fracture of elderly women. Treatment of postmenopausal women with estrogen, calcitonin and bisphosphonates demonstrated rapid decrease of the levels of bone markers that correlated with the long-term increase of bone mass. Factors such as circadian rhythms, diet, age, sex, bone mass and renal function affect the results of biochemical markers and should be appropriately adjusted whenever possible. Each biochemical markers of bone turnover may have its own specific advantages and limitations. Recent advances in research will provide more sensitive and specific assays
Marker Detection in Aerial Images
Alharbi, Yazeed
2017-04-09
The problem that the thesis is trying to solve is the detection of small markers in high-resolution aerial images. Given a high-resolution image, the goal is to return the pixel coordinates corresponding to the center of the marker in the image. The marker has the shape of two triangles sharing a vertex in the middle, and it occupies no more than 0.01% of the image size. An improvement on the Histogram of Oriented Gradients (HOG) is proposed, eliminating the majority of baseline HOG false positives for marker detection. The improvement is guided by the observation that standard HOG description struggles to separate markers from negatives patches containing an X shape. The proposed method alters intensities with the aim of altering gradients. The intensity-dependent gradient alteration leads to more separation between filled and unfilled shapes. The improvement is used in a two-stage algorithm to achieve high recall and high precision in detection of markers in aerial images. In the first stage, two classifiers are used: one to quickly eliminate most of the uninteresting parts of the image, and one to carefully select the marker among the remaining interesting regions. Interesting regions are selected by scanning the image with a fast classifier trained on the HOG features of markers in all rotations and scales. The next classifier is more precise and uses our method to eliminate the majority of the false positives of standard HOG. In the second stage, detected markers are tracked forward and backward in time. Tracking is needed to detect extremely blurred or distorted markers that are missed by the previous stage. The algorithm achieves 94% recall with minimal user guidance. An average of 30 guesses are given per image; the user verifies for each whether it is a marker or not. The brute force approach would return 100,000 guesses per image.
Clinical usefulness of bone turnover marker concentrations in osteoporosis
DEFF Research Database (Denmark)
Morris, H A; Eastell, R; Jorgensen, N R
2017-01-01
Current evidence continues to support the potential for bone turnover markers (BTM) to provide clinically useful information particularly for monitoring the efficacy of osteoporosis treatment. Many of the limitations identified earlier remain, principally in regard to the relationship between BTM...... of combining such data for meta-analyses. Harmonization of units for reporting serum/plasma CTX (ng/L) and PINP (μg/L) is recommended. The development of international collaborations continues with an important initiative to combine BTM results from clinical trials in osteoporosis in a meta...
International Nuclear Information System (INIS)
Ibarra, M.; Castro, A; Capdevielle, F.
2013-01-01
The organization of agricultural systems requires the verification of the genetic identity and purity of cultivars. The increase in the number of soy varieties to be evaluated, and the narrow genetic base of soybean cultivars, make the identification using phenotypic descriptors very difficult. The International Union for the Protection of New Varieties of Plants (UPOV) has recognized the utility of molecular markers associated with descriptive phenotypic characteristics. With the goal of developing this kind of markers, six genic or genomic S SR were selected in silico (Sat286, Satt229, GmPrx1, GMES1173, Satt571 and Gm Hi), plus two previously reported markers (GmF35H and SoyF3H). All were evaluated in 35 soybean cultivars. The SSRs GmPrx1 and Gm Hi selected for seed coat peroxidase and hilum color respectively were monomorphic. The mean Polymorphism Information Content (PI C) value within the selected group of polymorphic markers was 0.48 with an average of 3.12 allele per locus. GmF35H discriminated the soybean varieties according to the flower color (white and purple). Discrimination tests showed a high percentage of accurate classification of growth habit (95.8%) and pubescence color (80.6%) with Sat286 and Soy F3H, respectively. The classification values for pod color (74.2%) and leaflet size (73.5%) were intermediate using GMES1173 and Satt571, respectively. The marker Satt229 was not discriminating for flowering time (50%) and maturity (42.8%). Molecular markers selected in or close to sequences of interest can be integrated into a genetic identification system as complementary markers to the classic phenotypic descriptors of soybean varieties
Marker-trait association study for protein content in chickpea (Cicer arietinum L.).
Jadhav, A A; Rayate, S J; Mhase, L B; Thudi, M; Chitikineni, A; Harer, P N; Jadhav, A S; Varshney, R K; Kulwal, P L
2015-06-01
Chickpea (Cicer arietinum L.) is the second most important cool season food legume cultivated in arid and semiarid regions of the world. The objective of the present study was to study variation for protein content in chickpea germplasm, and to find markers associated with it. A set of 187 genotypes comprising both international and exotic collections, and representing both desi and kabuli types with protein content ranging from 13.25% to 26.77% was used. Twenty-three SSR markers representing all eight linkage groups (LG) amplifying 153 loci were used for the analysis. Population structure analysis identified three subpopulations, and corresponding Q values of principal components were used to take care of population structure in the analysis which was performed using general linear and mixed linear models. Marker-trait association (MTA) analysis identified nine significant associations representing four QTLs in the entire population. Subpopulation analyses identified ten significant MTAs representing five QTLs, four of which were common with that of the entire population. Two most significant QTLs linked with markers TR26.205 and CaM1068.195 were present on LG3 and LG5. Gene ontology search identified 29 candidate genes in the region of significant MTAs on LG3. The present study will be helpful in concentrating on LG3 and LG5 for identification of closely linked markers for protein content in chickpea and for their use in molecular breeding programme for nutritional quality improvement.
Incorporation of conventional genetic markers and RAPD markers into an RFLP based map in maize
International Nuclear Information System (INIS)
Coe, E.H. Jr.; McMullen, M.D.; Polacco, M.; Davis, G.L.; Chao, S.
1998-01-01
Integration of classical genetic markers, in particular mutants, onto the maize Restriction Fragment Length Polymorphism (RFLP) map will provide the tools necessary to further our understanding of plant development and of complex traits. Initially integration was accomplished by visual alignment of common markers and sometimes involved the use of information from several different molecular maps to determine the relative placement of a single mutant. The maize core marker set was designed to provide a common set of markers which could be used for integration of map data. We have completed the mapping, of 56 mutants on chromosome one relative to the core marker set. Phenotypes included whole plant, seedling, and kernel effects and represented a variety of biological processes. Since these mutants were previously located to chromosome arm, mapping required the use of only seven markers per mutant to define the correct bin location. Two mistakes in marker order relative to the classical map were identified, as well as, six groups of mutants which require allelism testing. Placement of mutants and cDNAs into bins using, the core markers provides a necessary resource for identification of gene function in maize. (author)
Reference values of thirty-one frequently used laboratory markers for 75-year-old males and females
Ryden, Ingvar; Lind, Lars
2012-01-01
Background We have previously reported reference values for common clinical chemistry tests in healthy 70-year-old males and females. We have now repeated this study 5 years later to establish reference values also at the age of 75. It is important to have adequate reference values for elderly patients as biological markers may change over time, and adequate reference values are essential for correct clinical decisions. Methods We have investigated 31 frequently used laboratory markers in 75-year-old males (n = 354) and females (n = 373) without diabetes. The 2.5 and 97.5 percentiles for these markers were calculated according to the recommendations of the International Federation of Clinical Chemistry. Results Reference values are reported for 75-year-old males and females for 31 frequently used laboratory markers. Conclusion There were minor differences between reference intervals calculated with and without individuals with cardiovascular diseases. Several of the reference intervals differed from Scandinavian reference intervals based on younger individuals (Nordic Reference Interval Project). PMID:22300333
Insertion and fixation of fiducial markers for setup and tracking of lung tumors in radiotherapy
International Nuclear Information System (INIS)
Imura, Mikado; Yamazaki, Koichi; Shirato, Hiroki; Onimaru, Rikiya; Fujino, Masaharu; Shimizu, Shinichi; Harada, Toshiyuki; Ogura, Shigeaki; Dosaka-Akita, Hirotoshi; Miyasaka, Kazuo; Nishimura, Masaharu
2005-01-01
Purpose: Internal 1.5-mm fiducial markers were used in real-time tumor-tracking radiotherapy (RT) for lung cancer. The fixation rate of the markers using the bronchial insertion technique, reliability of the setup using markers around the target volume, dislocation of the markers after real-time tumor-tracking RT, and long-term toxicity of marker insertion were investigated. Methods and Materials: Between July 2000 and April 2004, 154 gold markers were inserted into 57 patients with peripheral lung cancer. The distances between the implanted markers in 198 measurements in 71 setups in 11 patients were measured using two sets of orthogonal diagnostic X-ray images of the real-time tumor-tracking RT system. The distance between the markers and the chest wall was also measured in a transaxial CT image on 186 occasions in 48 patients during treatment planning and during follow-up. The median treatment time was 6 days (range, 4-14 days). Results: In 115 (75%) of the 154 inserted markers, the gold marker was detected throughout the treatment period. In 122 markers detected at CT planning, 115 (94%) were detected until the end of treatment. The variation in the distances between the implanted markers was within ±2 mm in 95% and ±1 mm in 80% during treatment. The variation in the distances between the implanted markers was >2 mm in at least one direction in 9% of the setups for which reexamination with a CT scan was indicated. The fixation rate in the left upper lobe was lower than in the other lobes. A statistically significant relationship was found between a shorter distance between the markers and the chest wall and the fixation rate, suggesting that the markers in the smaller bronchial lumens fixed better than those in the larger lumens. A learning curve among the endoscopists was suggested in the fixation rate. The distance between the markers and the chest wall changed significantly within a median of 44 days (range, 16-181 days) after treatment. Conclusion: The
De Backer, M; Bonants, P; Pedley, K F; Maes, M; Roldan-Ruiz, I; Van Bockstaele, E; Heungens, K; van der Lee, T
2013-11-01
The obligate biotrophic pathogen Puccinia horiana is the causal agent of chrysanthemum white rust. Although P. horiana is a quarantine organism, it has been able to spread to most chrysanthemum-producing regions in the world since the 1960s; however, the transfer routes are largely obscure. An extremely low level of allelic diversity was observed in a geographically diverse set of eight isolates using complexity reduction of polymorphic sequences (CRoPS) technology. Only 184 of the 16,196 contigs (1.1%) showed one or more single-nucleotide polymorphisms (SNPs). Thirty-two SNPs and one simple-sequence repeat were translated into molecular markers and used to genotype 45 isolates originating from North and South America, Asia, and Europe. In most cases, phylogenetic clustering was related to geographic origin, indicating local establishment. The European isolates mostly grouped in two major populations that may relate to the two historic introductions previously reported. However, evidence of recent geographic transfer was also observed, including transfer events between Europe and South America and between Southeast Asia and Europe. In contrast with the presumed clonal propagation of this microcyclic rust, strong indications of marker recombination were observed, presumably as a result of anastomosis, karyogamy, and somatic meiosis. Recombination and transfer also explain the geographic dispersal of specific markers. A near-to-significant correlation between the genotypic data and previously obtained pathotype data was observed and one marker was associated with the most virulent pathotype group. In combination with a fast SNP detection method, the markers presented here will be helpful tools to further elucidate the transfer pathways and local survival of this pathogen.
Real-time 3D internal marker tracking during arc radiotherapy by the use of combined MV-kV imaging.
Liu, W; Wiersma, R D; Mao, W; Luxton, G; Xing, L
2008-12-21
To minimize the adverse dosimetric effect caused by tumor motion, it is desirable to have real-time knowledge of the tumor position throughout the beam delivery process. A promising technique to realize the real-time image guided scheme in external beam radiation therapy is through the combined use of MV and onboard kV beam imaging. The success of this MV-kV triangulation approach for fixed-gantry radiation therapy has been demonstrated. With the increasing acceptance of modern arc radiotherapy in the clinics, a timely and clinically important question is whether the image guidance strategy can be extended to arc therapy to provide the urgently needed real-time tumor motion information. While conceptually feasible, there are a number of theoretical and practical issues specific to the arc delivery that need to be resolved before clinical implementation. The purpose of this work is to establish a robust procedure of system calibration for combined MV and kV imaging for internal marker tracking during arc delivery and to demonstrate the feasibility and accuracy of the technique. A commercially available LINAC equipped with an onboard kV imager and electronic portal imaging device (EPID) was used for the study. A custom built phantom with multiple ball bearings was used to calibrate the stereoscopic MV-kV imaging system to provide the transformation parameters from imaging pixels to 3D world coordinates. The accuracy of the fiducial tracking system was examined using a 4D motion phantom capable of moving in accordance with a pre-programmed trajectory. Overall, spatial accuracy of MV-kV fiducial tracking during the arc delivery process for normal adult breathing amplitude and period was found to be better than 1 mm. For fast motion, the results depended on the imaging frame rates. The RMS error ranged from approximately 0.5 mm for the normal adult breathing pattern to approximately 1.5 mm for more extreme cases with a low imaging frame rate of 3.4 Hz. In general
Real-time 3D internal marker tracking during arc radiotherapy by the use of combined MV-kV imaging
International Nuclear Information System (INIS)
Liu, W; Wiersma, R D; Mao, W; Luxton, G; Xing, L
2008-01-01
To minimize the adverse dosimetric effect caused by tumor motion, it is desirable to have real-time knowledge of the tumor position throughout the beam delivery process. A promising technique to realize the real-time image guided scheme in external beam radiation therapy is through the combined use of MV and onboard kV beam imaging. The success of this MV-kV triangulation approach for fixed-gantry radiation therapy has been demonstrated. With the increasing acceptance of modern arc radiotherapy in the clinics, a timely and clinically important question is whether the image guidance strategy can be extended to arc therapy to provide the urgently needed real-time tumor motion information. While conceptually feasible, there are a number of theoretical and practical issues specific to the arc delivery that need to be resolved before clinical implementation. The purpose of this work is to establish a robust procedure of system calibration for combined MV and kV imaging for internal marker tracking during arc delivery and to demonstrate the feasibility and accuracy of the technique. A commercially available LINAC equipped with an onboard kV imager and electronic portal imaging device (EPID) was used for the study. A custom built phantom with multiple ball bearings was used to calibrate the stereoscopic MV-kV imaging system to provide the transformation parameters from imaging pixels to 3D world coordinates. The accuracy of the fiducial tracking system was examined using a 4D motion phantom capable of moving in accordance with a pre-programmed trajectory. Overall, spatial accuracy of MV-kV fiducial tracking during the arc delivery process for normal adult breathing amplitude and period was found to be better than 1 mm. For fast motion, the results depended on the imaging frame rates. The RMS error ranged from ∼0.5 mm for the normal adult breathing pattern to ∼1.5 mm for more extreme cases with a low imaging frame rate of 3.4 Hz. In general, highly accurate real
Intersection tests for single marker QTL analysis can be more powerful than two marker QTL analysis
Directory of Open Access Journals (Sweden)
Doerge RW
2003-06-01
Full Text Available Abstract Background It has been reported in the quantitative trait locus (QTL literature that when testing for QTL location and effect, the statistical power supporting methodologies based on two markers and their estimated genetic map is higher than for the genetic map independent methodologies known as single marker analyses. Close examination of these reports reveals that the two marker approaches are more powerful than single marker analyses only in certain cases. Simulation studies are a commonly used tool to determine the behavior of test statistics under known conditions. We conducted a simulation study to assess the general behavior of an intersection test and a two marker test under a variety of conditions. The study was designed to reveal whether two marker tests are always more powerful than intersection tests, or whether there are cases when an intersection test may outperform the two marker approach. We present a reanalysis of a data set from a QTL study of ovariole number in Drosophila melanogaster. Results Our simulation study results show that there are situations where the single marker intersection test equals or outperforms the two marker test. The intersection test and the two marker test identify overlapping regions in the reanalysis of the Drosophila melanogaster data. The region identified is consistent with a regression based interval mapping analysis. Conclusion We find that the intersection test is appropriate for analysis of QTL data. This approach has the advantage of simplicity and for certain situations supplies equivalent or more powerful results than a comparable two marker test.
Molecular markers in the epidemiology and diagnosis of coccidioidomycosis.
Duarte-Escalante, Esperanza; Frías-De-León, María Guadalupe; Zúñiga, Gerardo; Martínez-Herrera, Erick; Acosta-Altamirano, Gustavo; Reyes-Montes, María Del Rocío
2014-01-01
The prevalence of coccidioidomycosis in endemic areas has been observed to increase daily. To understand the causes of the spread of the disease and design strategies for fungal detection in clinical and environmental samples, scientists have resorted to molecular tools that allow fungal detection in a natural environment, reliable identification in clinical cases and the study of biological characteristics, such as reproductive and genetic structure, demographic history and diversification. We conducted a review of the most important molecular markers in the epidemiology of Coccidioides spp. and the diagnosis of coccidioidomycosis. A literature search was performed for scientific publications concerning the application of molecular tools for the epidemiology and diagnosis of coccidioidomycosis. The use of molecular markers in the epidemiological study and diagnosis of coccidioidomycosis has allowed for the typing of Coccidioides spp. isolates, improved understanding of their mode of reproduction, genetic variation and speciation and resulted in the development specific, rapid and sensitive strategies for detecting the fungus in environmental and clinical samples. Molecular markers have revealed genetic variability in Coccidioides spp. This finding influences changes in the epidemiology of coccidioidomycosis, such as the emergence of more virulent or antifungal resistant genotypes. Furthermore, the molecular markers currently used to identify Coccidioides immitis and Coccidioides posadasii are specific and sensitive. However, they must be validated to determine their application in diagnosis. This manuscript is part of the series of works presented at the "V International Workshop: Molecular genetic approaches to the study of human pathogenic fungi" (Oaxaca, Mexico, 2012). Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.
Cheung, Victoria; Segal, Devorah; Gardner, Sharon L; Zagzag, David; Wisoff, Jeffrey H; Allen, Jeffrey C; Karajannis, Matthias A
2016-09-01
Patients with marker-positive central nervous system (CNS) germ cell tumors are typically monitored for tumor recurrence with both tumor markers (AFP and b-hCG) and MRI. We hypothesize that the recurrence of these tumors will always be accompanied by an elevation in tumor markers, and that surveillance MRI may not be necessary. We retrospectively identified 28 patients with CNS germ cell tumors treated at our institution that presented with an elevated serum or cerebrospinal fluid (CSF) tumor marker at the time of diagnosis. We then identified those who had a tumor recurrence after having been in remission and whether each recurrence was detected via MRI changes, elevated tumor markers, or both. Four patients suffered a tumor recurrence. Only one patient had simultaneously elevated tumor markers and MRI evidence of recurrence. Two patients had evidence of recurrence on MRI without corresponding elevations in serum or CSF tumor markers. One patient had abnormal tumor markers with no evidence of recurrence on MRI until 6 months later. We conclude that in patients with marker-positive CNS germ cell tumors who achieve complete remission, continued surveillance imaging in addition to measurement of tumor markers is indicated to detect recurrences.
Cai, Shao-Hang; Lu, Shi-Xun; Liu, Li-Li; Zhang, Chris Zhiyi; Yun, Jing-Ping
2017-10-01
Hepatocyte nuclear factor 4 alpha (HNF4α) plays an important role in tumourigenesis. There is growing evidence indicating that HNF4α transcribed by promoter 1 (P1-HNF4α) is expressed at relatively low levels in HCC and its presence predicts a favourable outcome for hepatocellular carcinoma (HCC) patients. However, the role of HNF4α transcribed by promoter 2 (P2-HNF4α) in HCC remains unclear. A total of 615 HCC specimens were obtained to construct tissue microarrays and perform immunohistochemistry. The relationship between P2-HNF4α and clinical features of HCC patients were analysed. Kaplan-Meier analysis was conducted to assess the prognostic value of P2-HNF4α. The results showed that the expression of P2-HNF4α in HCC was noticeably increased in HCC tissues compared with the nontumourous tissues. In addition, P1-HNF4α expression was negatively correlated with P2-HNF4α expression ( p = 0.023). High P2-HNF4α expression was significantly associated with poor differentiation of HCC ( p = 0.002) and vascular invasion ( p = 0.017). Kaplan-Meier analysis showed that P2-HNF4α expression was closely correlated with overall survival in the training group ( p = 0.01), validation group ( p = 0.034), and overall group of patients with HCC ( p P2-HNF4α, different from P1-HNF4α, is markedly upregulated and serves as an oncogene-associated protein in HCC. Our study therefore provides a promising biomarker for prognostic prediction and a potential therapeutic target for HCC.
SF Treg cells transcribing high levels of Bcl-2 and microRNA-21 demonstrate limited apoptosis in RA
van der Geest, Kornelis S. M.; Smigielska, Katarzyna; Park, Ji-Ah; Abdulahad, Wayel H.; Kim, Hye-Won; Kroesen, Bart-Jan; van den Berg, Anke; Boots, Annemieke M. H.; Lee, Eun-Bong; Brouwer, Elisabeth
Objective. The aim of this study was to investigate the turnover of Treg cells in the SF of RA patients. Methods. Treg cells were enumerated in peripheral blood and SF of RA patients and analysed by flow cytometry for expression of the proliferation marker Ki-67 and binding of the apoptosis marker
Hernández, P; Dorado, G; Ramírez, M C; Laurie, D A; Snape, J W; Martín, A
2003-01-01
Hordeum chilense is a potential source of useful genes for wheat breeding. The use of this wild species to increase genetic variation in wheat will be greatly facilitated by marker-assisted introgression. In recent years, the search for the most suitable DNA marker system for tagging H. chilense genomic regions in a wheat background has lead to the development of RAPD and SCAR markers for this species. RAPDs represent an easy way of quickly generating suitable introgression markers, but their use is limited in heterogeneous wheat genetic backgrounds. SCARs are more specific assays, suitable for automatation or multiplexing. Direct sequencing of RAPD products is a cost-effective approach that reduces labour and costs for SCAR development. The use of SSR and STS primers originally developed for wheat and barley are additional sources of genetic markers. Practical applications of the different marker approaches for obtaining derived introgression products are described.
DEFF Research Database (Denmark)
Worm, Esben S; Bertholet, Jenny; Høyer, Morten
2016-01-01
To minimize the risk of marker migration in fiducial marker guided liver SBRT it is common to add a delay of a week between marker implantation and planning CT. This study found that such a delay is unnecessary and could be avoided to minimize the treatment preparation time.......To minimize the risk of marker migration in fiducial marker guided liver SBRT it is common to add a delay of a week between marker implantation and planning CT. This study found that such a delay is unnecessary and could be avoided to minimize the treatment preparation time....
Czech Academy of Sciences Publication Activity Database
Pecen, Ladislav; Topolčan, O.; Nekulová, M.; Šimíčková, M.; Kaušitz, J.; Eben, Kryštof; Vondráček, Jiří; Pikner, R.; Holubec, L.
2000-01-01
Roč. 15, č. 1 (2000), s. 57-58 ISSN 0886-3849. [International Conference on Human Tumor Markers /17./. 23.03.2000-24.03.2000, Hong Kong] Grant - others:IGA MZ ČR(CZ) NC4780; IGA MZ ČR(CZ) NC4746 Institutional research plan: AV0Z1030915
International Nuclear Information System (INIS)
Elliott, D.P.; Halseth, W.L.
1977-01-01
This invention relates to split ring markers fabricated in whole or in part from a radiopaque material, usually metal, having the terminal ends thereof and a medial portion formed to define eyelets by means of which said marker can be sutured to the tissue at the site of an anastomosis to provide a visual indication of its location when examined fluoroscopically
Upadhyaya, Hari D; Wang, Yi-Hong; Sharma, Rajan; Sharma, Shivali
2013-06-01
Anthracnose in sorghum caused by Colletotrichum sublineolum is one of the most destructive diseases affecting sorghum production under warm and humid conditions. Markers and genes linked to resistance to the disease are important for plant breeding. Using 14,739 SNP markers, we have mapped eight loci linked to resistance in sorghum through association analysis of a sorghum mini-core collection consisting of 242 diverse accessions evaluated for anthracnose resistance for 2 years in the field. The mini-core was representative of the International Crops Research Institute for the Semi-Arid Tropics' world-wide sorghum landrace collection. Eight marker loci were associated with anthracnose resistance in both years. Except locus 8, disease resistance-related genes were found in all loci based on their physical distance from linked SNP markers. These include two NB-ARC class of R genes on chromosome 10 that were partially homologous to the rice blast resistance gene Pib, two hypersensitive response-related genes: autophagy-related protein 3 on chromosome 1 and 4 harpin-induced 1 (Hin1) homologs on chromosome 8, a RAV transcription factor that is also part of R gene pathway, an oxysterol-binding protein that functions in the non-specific host resistance, and homologs of menthone:neomenthol reductase (MNR) that catalyzes a menthone reduction to produce the antimicrobial neomenthol. These genes and markers may be developed into molecular tools for genetic improvement of anthracnose resistance in sorghum.
Frameworking memory and serotonergic markers.
Meneses, Alfredo
2017-07-26
The evidence for neural markers and memory is continuously being revised, and as evidence continues to accumulate, herein, we frame earlier and new evidence. Hence, in this work, the aim is to provide an appropriate conceptual framework of serotonergic markers associated with neural activity and memory. Serotonin (5-hydroxytryptamine [5-HT]) has multiple pharmacological tools, well-characterized downstream signaling in mammals' species, and established 5-HT neural markers showing new insights about memory functions and dysfunctions, including receptors (5-HT1A/1B/1D, 5-HT2A/2B/2C, and 5-HT3-7), transporter (serotonin transporter [SERT]) and volume transmission present in brain areas involved in memory. Bidirectional influence occurs between 5-HT markers and memory/amnesia. A growing number of researchers report that memory, amnesia, or forgetting modifies neural markers. Diverse approaches support the translatability of using neural markers and cerebral functions/dysfunctions, including memory formation and amnesia. At least, 5-HT1A, 5-HT4, 5-HT6, and 5-HT7 receptors and SERT seem to be useful neural markers and therapeutic targets. Hence, several mechanisms cooperate to achieve synaptic plasticity or memory, including changes in the expression of neurotransmitter receptors and transporters.
A protein-based set of reference markers for liver tissues and hepatocellular carcinoma
International Nuclear Information System (INIS)
Sun, Stella; Yi, Xin; Poon, Ronnie TP; Yeung, Chun; Day, Philip JR; Luk, John M
2009-01-01
During the last decade, investigations have focused on revealing genes or proteins that are involved in HCC carcinogenesis using either genetic or proteomic techniques. However, these studies are overshadowed by a lack of good internal reference standards. The need to identify 'housekeeping' markers, whose expression is stable in various experimental and clinical conditions, is therefore of the utmost clinical relevance in quantitative studies. This is the first study employed 2-DE analysis to screen for potential reference markers and aims to correlate the abundance of these proteins with their level of transcript expression. A Chinese cohort of 224 liver tissues samples (105 cancerous, 103 non-tumourous cirrhotic, and 16 normal) was profiled using 2-DE analysis. Expression of the potential reference markers was confirmed by western blot, immunohistochemistry and real-time quantitative PCR. geNorm algorithm was employed for gene stability measure of the identified reference markers. The expression levels of three protein markers beta-actin (ACTB), heat shock protein 60 (HSP60), and protein disulphide isomerase (PDI) were found to be stable using p-values (p > 0.99) as a ranking tool in all 224 human liver tissues examined by 2-DE analysis. Of high importance, ACTB and HSP 60 were successfully validated at both protein and mRNA levels in human hepatic tissues by western blot, immunohistochemistry and real-time quantitative PCR. In addition, no significant correlation of these markers with any clinicopathological features of HCC and cirrhosis was found. Gene stability measure of these two markers with other conventionally applied housekeeping genes was assessed by the geNorm algorithm, which ranked ACTB and HSP60 as the most stable genes among this cohort of clinical samples. Our findings identified 2 reference markers that exhibited stable expression across human liver tissues with different conditions thus should be regarded as reliable reference
Directory of Open Access Journals (Sweden)
Khairul Zakaria Muhamad
2018-01-01
Full Text Available There is lack of studies on the use of metadiscourse markers; especially amongst international students studying in Malaysia and Malaysia are receiving scores of international students particularly from the Middle East annually. This study involves a textual analysis of students’ academic writing where the metadiscourse markers in 50 Arab IIUM students’ academic texts were identified and analyzed. The findings of this study indicated that Arab writers had a greater inclination for the deployment of the interactive markers (Total counts = 919 than interactional ones (Total counts = 592 as there was a higher percentage of interactive metadiscourse (60.8% usage than the interactional ones (39.2%. It might be useful for English language teachers to integrate cultural considerations within their syllabus with regard to metadiscourse markers in order to prepare relevant materials based on their students’ needs as well as to develop the students’ awareness of the importance of these linguistic features.
DEFF Research Database (Denmark)
Poulsen, Henrik E.; Loft, Steffen
1995-01-01
Early bichemical marker, enzyme induction, oncogene activation, oxidative damage, low-density lipoprotein......Early bichemical marker, enzyme induction, oncogene activation, oxidative damage, low-density lipoprotein...
Montes-Rodríguez, María de los Ángeles; Hernández-Bojórquez, Mariana; Martínez-Gómez, Alma Angélica; Contreras-Pérez, Agustín; Negrete-Hernández, Ingrid Mireya; Hernández-Oviedo, Jorge Omar; Mitsoura, Eleni; Santiago-Concha, Bernardino Gabriel
2014-11-01
Stereotactic Body Radiation Therapy (SBRT) requires a controlled immobilization and position monitoring of patient and target. The purpose of this work is to analyze the performance of the imaging system ExacTrac® (ETX) using infrared and fiducial markers. Materials and methods: In order to assure the accuracy of isocenter localization, a Quality Assurance procedure was applied using an infrared marker-based positioning system. Scans were acquired of an inhouse-agar gel and solid water phantom with infrared spheres. In the inner part of the phantom, three reference markers were delineated as reference and one pellet was place internally; which was assigned as the isocenter. The iPlan® RT Dose treatment planning system. Images were exported to the ETX console. Images were acquired with the ETX to check the correctness of the isocenter placement. Adjustments were made in 6D the reference markers were used to fuse the images. Couch shifts were registered. The procedure was repeated for verification purposes. Results: The data recorded of the verifications in translational and rotational movements showed averaged 3D spatial uncertainties of 0.31 ± 0.42 mm respectively 0.82° ± 0.46° in the phantom and the first correction of these uncertainties were of 1.51 ± 1.14 mm respectively and 1.37° ± 0.61°. Conclusions: This study shows a high accuracy and repeatability in positioning the selected isocenter. The ETX-system for verifying the treatment isocenter position has the ability to monitor the tracing position of interest, making it possible to be used for SBRT positioning within uncertainty ≤1mm.
Energy Technology Data Exchange (ETDEWEB)
Montes-Rodríguez, María de los Ángeles, E-mail: angy24538@yahoo.com; Mitsoura, Eleni [Medical Physics Graduate Programme, Universidad Autónoma del Estado de México, Facultad de Medicina, Paseo Tollocan esquina Jesús Carranza Colonia Moderna de la Cruz, C.P. 50180, Toluca, Estado de México (Mexico); Hernández-Bojórquez, Mariana; Martínez-Gómez, Alma Angélica; Contreras-Pérez, Agustín; Negrete-Hernández, Ingrid Mireya; Hernández-Oviedo, Jorge Omar; Santiago-Concha, Bernardino Gabriel [Centro de Cáncer ABC, The American British Cowdray Medical Center I.A.P. (CMABC), Calle Sur 136, no. 116, Colonia las Américas, C.P. 01120, México, D.F. (Mexico)
2014-11-07
Stereotactic Body Radiation Therapy (SBRT) requires a controlled immobilization and position monitoring of patient and target. The purpose of this work is to analyze the performance of the imaging system ExacTrac® (ETX) using infrared and fiducial markers. Materials and methods: In order to assure the accuracy of isocenter localization, a Quality Assurance procedure was applied using an infrared marker-based positioning system. Scans were acquired of an inhouse-agar gel and solid water phantom with infrared spheres. In the inner part of the phantom, three reference markers were delineated as reference and one pellet was place internally; which was assigned as the isocenter. The iPlan® RT Dose treatment planning system. Images were exported to the ETX console. Images were acquired with the ETX to check the correctness of the isocenter placement. Adjustments were made in 6D the reference markers were used to fuse the images. Couch shifts were registered. The procedure was repeated for verification purposes. Results: The data recorded of the verifications in translational and rotational movements showed averaged 3D spatial uncertainties of 0.31 ± 0.42 mm respectively 0.82° ± 0.46° in the phantom and the first correction of these uncertainties were of 1.51 ± 1.14 mm respectively and 1.37° ± 0.61°. Conclusions: This study shows a high accuracy and repeatability in positioning the selected isocenter. The ETX-system for verifying the treatment isocenter position has the ability to monitor the tracing position of interest, making it possible to be used for SBRT positioning within uncertainty ≤1mm.
International Nuclear Information System (INIS)
Lopes, M.A.
2007-01-01
It is generally recognized that marker-assisted selection (MAS) is a tool that breeders can use to accelerate the speed and precision of crop and livestock breeding in developing countries. However, its practical application has been more difficult than previously expected. Although advances in molecular marker technology have uncovered many possibilities for transferring genes into desired crops and livestock through MAS, more methodological development and better planning and implementation strategies will be needed for its successful and expeditious application to breeding programmes. Also, this technology should not be regarded as an end in itself, but as an interacting part of complex strategies and decision-making processes. An appropriate mix of technologies and capabilities together with effective approaches to networking must be viewed as key ingredients for its correct development and application to breeding programmes. This chapter describes some strategies to guide decisions about structures, methods and capacities that may contribute to enhancing the access and successful use of MAS in developing countries. (author)
Hajibarat, Zahra; Saidi, Abbas; Hajibarat, Zohreh; Talebi, Reza
2015-07-01
To evaluate the genetic diversity among 48 genotypes of chickpea comprising cultivars, landraces and internationally developed improved lines genetic distances were evaluated using three different molecular marker techniques: Simple Sequence Repeat (SSR); Start Codon Targeted (SCoT) and Conserved DNA-derived Polymorphism (CDDP). Average polymorphism information content (PIC) for SSR, SCoT and CDDP markers was 0.47, 0.45 and 0.45, respectively, and this revealed that three different marker types were equal for the assessment of diversity amongst genotypes. Cluster analysis for SSR and SCoT divided the genotypes in to three distinct clusters and using CDDP markers data, genotypes grouped in to five clusters. There were positive significant correlation (r = 0.43, P SSR markers. These results suggest that efficiency of SSR, SCOT and CDDP markers was relatively the same in fingerprinting of chickpea genotypes. To our knowledge, this is the first detailed report of using targeted DNA region molecular marker (CDDP) for genetic diversity analysis in chickpea in comparison with SCoT and SSR markers. Overall, our results are able to prove the suitability of SCoT and CDDP markers for genetic diversity analysis in chickpea for their high rates of polymorphism and their potential for genome diversity and germplasm conservation.
An Investigation of Metadiscourse Features in International Postgraduate Business Students’ Texts
Directory of Open Access Journals (Sweden)
Hesham Suleiman Alyousef
2015-10-01
Full Text Available Metadiscourse analysis reveals the way writers engage with different texts and communicate with each other. Examining these linguistic resources is important because they play a vital role in maximizing the learning experiences of students in the Master’s program in Accounting. Yet, there is a lack of research investigating these features in a key topic in the Principles of Finance course: management reports that encompass tables and graphs. This study explores the use of metadiscourse markers in three multimodal management reports written by 10 international Master’s of Accounting students. It employs Hyland and Tse’s model and Hyland’s model for the multimodal analysis of metadiscourse markers in finance texts. The findings show a high frequency of interactive and interactional markers in the orthographic texts compared with a lack of implicit interactive markers and a high frequency of implicit interactional markers in the tables and graphs. Implications for the teaching of English for Business Purposes (EBP are discussed.
Scarisbrick, Julia J.; Prince, H. Miles; Vermeer, Maarten H.; Quaglino, Pietro; Horwitz, Steven; Porcu, Pierluigi; Stadler, Rudolf; Wood, Gary S.; Beylot-Barry, Marie; Pham-Ledard, Anne; Foss, Francine; Girardi, Michael; Bagot, Martine; Michel, Laurence; Battistella, Maxime; Guitart, Joan; Kuzel, Timothy M.; Martinez-Escala, Maria Estela; Estrach, Teresa; Papadavid, Evangelia; Antoniou, Christina; Rigopoulos, Dimitis; Nikolaou, Vassilki; Sugaya, Makoto; Miyagaki, Tomomitsu; Gniadecki, Robert; Sanches, José Antonio; Cury-Martins, Jade; Miyashiro, Denis; Servitje, Octavio; Muniesa, Cristina; Berti, Emilio; Onida, Francesco; Corti, Laura; Hodak, Emilia; Amitay-Laish, Iris; Ortiz-Romero, Pablo L.; Rodríguez-Peralto, Jose L.; Knobler, Robert; Porkert, Stefanie; Bauer, Wolfgang; Pimpinelli, Nicola; Grandi, Vieri; Cowan, Richard; Rook, Alain; Kim, Ellen; Pileri, Alessandro; Patrizi, Annalisa; Pujol, Ramon M.; Wong, Henry; Tyler, Kelly; Stranzenbach, Rene; Querfeld, Christiane; Fava, Paolo; Maule, Milena; Willemze, Rein; Evison, Felicity; Morris, Stephen; Twigger, Robert; Talpur, Rakhshandra; Kim, Jinah; Ognibene, Grant; Li, Shufeng; Tavallaee, Mahkam; Hoppe, Richard T.; Duvic, Madeleine; Whittaker, Sean J.; Kim, Youn H.
2015-01-01
Purpose Advanced-stage mycosis fungoides (MF; stage IIB to IV) and Sézary syndrome (SS) are aggressive lymphomas with a median survival of 1 to 5 years. Clinical management is stage based; however, there is wide range of outcome within stages. Published prognostic studies in MF/SS have been single-center trials. Because of the rarity of MF/SS, only a large collaboration would power a study to identify independent prognostic markers. Patients and Methods Literature review identified the following 10 candidate markers: stage, age, sex, cutaneous histologic features of folliculotropism, CD30 positivity, proliferation index, large-cell transformation, WBC/lymphocyte count, serum lactate dehydrogenase, and identical T-cell clone in blood and skin. Data were collected at specialist centers on patients diagnosed with advanced-stage MF/SS from 2007. Each parameter recorded at diagnosis was tested against overall survival (OS). Results Staging data on 1,275 patients with advanced MF/SS from 29 international sites were included for survival analysis. The median OS was 63 months, with 2- and 5-year survival rates of 77% and 52%, respectively. The median OS for patients with stage IIB disease was 68 months, but patients diagnosed with stage III disease had slightly improved survival compared with patients with stage IIB, although patients diagnosed with stage IV disease had significantly worse survival (48 months for stage IVA and 33 months for stage IVB). Of the 10 variables tested, four (stage IV, age > 60 years, large-cell transformation, and increased lactate dehydrogenase) were independent prognostic markers for a worse survival. Combining these four factors in a prognostic index model identified the following three risk groups across stages with significantly different 5-year survival rates: low risk (68%), intermediate risk (44%), and high risk (28%). Conclusion To our knowledge, this study includes the largest cohort of patients with advanced-stage MF/SS and
Directory of Open Access Journals (Sweden)
Gilberto Vilmar Kozloski
2009-09-01
markers to estimate digestibility in lambs was evaluated. Data and samples were obtained from six independent digestion trials with lambs housed in metabolism cages given ad libitum different forage and concentrate feedstuffs. Indigestible residues were determined after 144 hours of in situ incubation of feed and faeces samples. Recovery rate varied from 64.8 to 108.5% for iDM, and from 49.5 to 67.9% for iNDF. As the marker ratio between marker concentration in the faeces and the feed was not corrected for fecal recovery, the large part of the estimated apparent organic matter digestibility (AOMD of the experimental means were lower than the in vivo that obtained. As the marker ratio was corrected for fecal recovery of the marker, the AOMD means estimated using both markers were similar to the in vivo data in all experiments. As individual estimates, corrected for fecal recovery of the marker, were related to in vivo observations through regression analysis, the slope of the regression for iDM was not different from 1 whereas for iNDF, the slope was lower than 1. Individual AOMD values estimates using both markers, however, were poorly related to the in vivo observations (r² varied from 0.60 to 0.63. Once corrected for fecal recovery, residual DM after 144 hours of in situ incubation is suitable for use as an internal marker to estimate mean diet digestibility consumed for a group of animals. However, individual estimates were not accurate to detect small differences in digestibility imposed by different treatments within an experiment.
Matsutani Sachiko
2004-01-01
Abstract Background In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFII...
Effectiveness of Vascular Markers (Immunohistochemical Stains) in Soft Tissue Sarcomas.
Naeem, Namra; Mushtaq, Sajid; Akhter, Noreen; Hussain, Mudassar; Hassan, Usman
2018-05-01
To ascertain the effectiveness of IHC markers of vascular origin like CD31, CD34, FLI1 and ERG in vascular soft tissue sarcomas including angiosarcomas, Kaposi sarcomas, epithelioid hemangioendothelioma and a non-vascular soft tissue sarcoma (Epithelioid sarcoma). Descriptive study. Shaukat Khanum Memorial Cancer Hospital and Research Centre, Lahore, from 2011 to 2017. Diagnosed cases of angiosarcomas (n=48), epithelioid hemangioendothelioma (n=9), Kaposi sarcoma (n=9) and epithelioid sarcoma (n=20) were selected. Immunohistochemical staining as performed on formalin fixed paraffin embedded sections. The sections were stained for the following markers: CD34 (VENTANA clone Q Bend 10), CD31 (Leica clone 1 A 10), FLI1 (CELL MARQUE clone MRQ-1) and ERG (CELL MARQUE clone EP111). A complete panel of CD34, CD31 and ERG was applied on 8/48 cases of angiosarcomas with triple positivity in 6 cases. Eight cases showed positivity for only CD31 and ERG and 2 cases showed positivity for only ERG. A complete panel of CD34, CD31 and ERG was applied on 3/9 cases of epithelioid hemangioendothelioma with positivity for all markers in 2 cases. Combined positivity for ERG and CD34 was seen in 2 cases and on 4 cases only CD31 immunohistochemical was solely applied with 100% positivity. FLI1 was not applied on any case. Among 9 cases of Kaposi sarcoma, ERG, CD34 and CD31 in combination were applied on only 1 case with triple positivity. Remaining cases show positivity for either CD34, CD31 or FLI1. Majority of cases of epithelioid sarcomas were diagnosed on the basis of cytokeratin and CD34 positivity with loss of INI1. The other vascular markers showed negativity in all cases. Among these four markers, ERG immunohistochemical stain is highly effective for endothelial differentiation due to its specific nuclear staining pattern in normal blood vessel endothelial cells (internal control) as well as neoplastic cells of vascular tumors and lack of background staining.
Czech Academy of Sciences Publication Activity Database
Holubec jr., L.; Botterlich, N.; Topolčan, O.; Finek, J.; Pikner, R.; Pecen, Ladislav; Holubec, L.
2002-01-01
Roč. 23, Suppl.1 (2002), s. 57 ISSN 1010-4283. [Meeting of the International Society for Oncodevelopmental Biology and Medicine /30./. 08.09.2002-12.09.2002, Boston] R&D Projects: GA MŠk ME 438 Institutional research plan: AV0Z1030915 Keywords : tumor markers * colorectal CA * mathematical classification Subject RIV: BA - General Mathematics
Li, Li; Tacke, Eckhard; Hofferbert, Hans-Reinhardt; Lübeck, Jens; Strahwald, Josef; Draffehn, Astrid M; Walkemeier, Birgit; Gebhardt, Christiane
2013-04-01
Tuber yield, starch content, starch yield and chip color are complex traits that are important for industrial uses and food processing of potato. Chip color depends on the quantity of reducing sugars glucose and fructose in the tubers, which are generated by starch degradation. Reducing sugars accumulate when tubers are stored at low temperatures. Early and efficient selection of cultivars with superior yield, starch yield and chip color is hampered by the fact that reliable phenotypic selection requires multiple year and location trials. Application of DNA-based markers early in the breeding cycle, which are diagnostic for superior alleles of genes that control natural variation of tuber quality, will reduce the number of clones to be evaluated in field trials. Association mapping using genes functional in carbohydrate metabolism as markers has discovered alleles of invertases and starch phosphorylases that are associated with tuber quality traits. Here, we report on new DNA variants at loci encoding ADP-glucose pyrophosphorylase and the invertase Pain-1, which are associated with positive or negative effect with chip color, tuber starch content and starch yield. Marker-assisted selection (MAS) and marker validation were performed in tetraploid breeding populations, using various combinations of 11 allele-specific markers associated with tuber quality traits. To facilitate MAS, user-friendly PCR assays were developed for specific candidate gene alleles. In a multi-parental population of advanced breeding clones, genotypes were selected for having different combinations of five positive and the corresponding negative marker alleles. Genotypes combining five positive marker alleles performed on average better than genotypes with four negative alleles and one positive allele. When tested individually, seven of eight markers showed an effect on at least one quality trait. The direction of effect was as expected. Combinations of two to three marker alleles were
Kim, Jin-Hee; Chung, Il Kyung; Kim, Kyung-Min
2017-01-01
The Sweet potato, Ipomoea batatas (L.) Lam, is difficult to study in genetics and genomics because it is a hexaploid. The sweet potato study not have been performed domestically or internationally. In this study was performed to construct genetic map and quantitative trait loci (QTL) analysis. A total of 245 EST-SSR markers were developed, and the map was constructed by using 210 of those markers. The total map length was 1508.1 cM, and the mean distance between markers was 7.2 cM. Fifteen characteristics were investigated for QTLs analysis. According to those, the Four QTLs were identified, and The LOD score was 3.0. Further studies need to develop molecular markers in terms of EST-SSR markers for doing to be capable of efficient breeding. The genetic map created here using EST-SSR markers will facilitate planned breeding of sweet potato cultivars with various desirable traits.
Radiographic markers - A reservoir for bacteria?
International Nuclear Information System (INIS)
Tugwell, Jenna; Maddison, Adele
2011-01-01
Introduction: Amongst the most frequently handled objects in the radiology department are radiographic markers. They are personal accessories used with every patient, and are kept in the radiographers pockets when not utilised. Upon enquiry it was discovered that many radiographers disregarded the potential of these accessories to become a vector for cross-contamination thus never or rarely clean them. The aims of this study were therefore to identify if radiographic markers are a reservoir for bacteria and to establish an effective cleaning method for decontaminating them. Methodology: 25 radiographers/student radiographers were selected for this study. Swabbing of their markers prior and post cleaning took place. The microbiology laboratory subsequently analyzed the results by quantifying and identifying the bacteria present. The participants also completed a closed questionnaire regarding their markers (e.g. frequency of cleaning and type of marker) to help specify the results gained from the swabbing procedure. Results: From the sample swabbed, 92% were contaminated with various organisms including Staphylococcus and Bacillus species, the amount of bacteria present ranged from 0 to >50 CFU. There were no significant differences between disinfectant wipes and alcohol gel in decontaminating the markers. Both successfully reduced their bacterial load, with 80% of the markers post cleaning having 0 CFU. Conclusion: The results indicated that radiographic markers can become highly contaminated with various organisms thus serve as a reservoir for bacteria. In addition, the markers need to be cleaned on a regular basis, with either disinfectant wipes or alcohol gel to reduce their bacterial load.
Tumor markers in colorectal cancer
Fernandes, Luís César [UNIFESP; Matos, Delcio [UNIFESP
2002-01-01
Colorectal cancer is a clinical entity of a persistent relevance in clinical practice and its early diagnosis is a determinant factor to obtain better therapeutic results. Tumor markers are helpful means for a better approach to individuals with such neoplasm. In the present review, the authors analyze the phases in which surgical-clinical treatment markers must be used: diagnosis, determination of tumor stage, establishment of prognosis and detection of recurrence. Current and future markers...
Rahbek-Clemmensen, Troels; Bay, Tina; Eriksen, Jacob; Gether, Ulrik; Jørgensen, Trine Nygaard
2014-01-01
The serotonin transporter (SERT) plays a critical role in regulating serotonin signaling by mediating reuptake of serotonin from the extracellular space. The molecular and cellular mechanisms controlling SERT levels in the membrane remain poorly understood. To study trafficking of the surface resident SERT, two functional epitope-tagged variants were generated. Fusion of a FLAG-tagged one-transmembrane segment protein Tac to the SERT N terminus generated a transporter with an extracellular epitope suited for trafficking studies (TacSERT). Likewise, a construct with an extracellular antibody epitope was generated by introducing an HA (hemagglutinin) tag in the extracellular loop 2 of SERT (HA-SERT). By using TacSERT and HA-SERT in antibody-based internalization assays, we show that SERT undergoes constitutive internalization in a dynamin-dependent manner. Confocal images of constitutively internalized SERT demonstrated that SERT primarily co-localized with the late endosomal/lysosomal marker Rab7, whereas little co-localization was observed with the Rab11, a marker of the “long loop” recycling pathway. This sorting pattern was distinct from that of a prototypical recycling membrane protein, the β2-adrenergic receptor. Furthermore, internalized SERT co-localized with the lysosomal marker LysoTracker and not with transferrin. The sorting pattern was further confirmed by visualizing internalization of SERT using the fluorescent cocaine analog JHC1-64 and by reversible and pulse-chase biotinylation assays showing evidence for lysosomal degradation of the internalized transporter. Finally, we found that SERT internalized in response to stimulation with 12-myristate 13-acetate co-localized primarily with Rab7- and LysoTracker-positive compartments. We conclude that SERT is constitutively internalized and that the internalized transporter is sorted mainly to degradation. PMID:24973209
International Nuclear Information System (INIS)
Schmid, L.; Fornara, P.; Fabricius, P.G.
1988-01-01
The same applies essentially also for the bladder carcinomas: There is no reliable marker for these cancers which would be useful for clinical purposes. TPA has proven to be too non-specific in malignoma-detection and therefore hardly facilitates clinical decision-making in individual cases. The CEA is not sensitive enough to be recommendable for routine application. However, in advanced stages a CEA examination may be useful if applied within the scope of therapeutic efforts made to evaluate efficacy. In cases of carcinomas of the prostate the sour prostate-specific phosphatase (SPP) and, more recently, especially the prostate-specific antigen (PSA) have proven in follow-up and therapy monitoring, whereby the PSA is superior to the SPP. Nevertheless, both these markers should be employed in therapy monitoring because differences in behaviour will be observed when the desired treatment effect is only achieved in one of the two markers producing tumour cell clonuses. Both markers, but especially the PSA, are quite reliably in agreement with the result of the introduced chemo-/hormone therapy, whereby an increase may be a sure indicator of relapse several months previous to clinical symptoms, imaging procedures, so-called routine laboratory results and subjective complaints. However, none of the 2 markers is appropriate for the purposes of screening or early diagnosis of carcinomas of the prostate. (orig.) [de
Markers and residual time to AIDS
Geskus, R. B.
2002-01-01
The value of immunological and virological markers as predictors of progression to AIDS, or death by AIDS, is a topic of much current interest. Mostly, the influence of markers is investigated in a time-dependent or a baseline proportional hazard model, relating time-varying or baseline marker
Predicting Missing Marker Trajectories in Human Motion Data Using Marker Intercorrelations.
Gløersen, Øyvind; Federolf, Peter
2016-01-01
Missing information in motion capture data caused by occlusion or detachment of markers is a common problem that is difficult to avoid entirely. The aim of this study was to develop and test an algorithm for reconstruction of corrupted marker trajectories in datasets representing human gait. The reconstruction was facilitated using information of marker inter-correlations obtained from a principal component analysis, combined with a novel weighting procedure. The method was completely data-driven, and did not require any training data. We tested the algorithm on datasets with movement patterns that can be considered both well suited (healthy subject walking on a treadmill) and less suited (transitioning from walking to running and the gait of a subject with cerebral palsy) to reconstruct. Specifically, we created 50 copies of each dataset, and corrupted them with gaps in multiple markers at random temporal and spatial positions. Reconstruction errors, quantified by the average Euclidian distance between predicted and measured marker positions, was ≤ 3 mm for the well suited dataset, even when there were gaps in up to 70% of all time frames. For the less suited datasets, median reconstruction errors were in the range 5-6 mm. However, a few reconstructions had substantially larger errors (up to 29 mm). Our results suggest that the proposed algorithm is a viable alternative both to conventional gap-filling algorithms and state-of-the-art reconstruction algorithms developed for motion capture systems. The strengths of the proposed algorithm are that it can fill gaps anywhere in the dataset, and that the gaps can be considerably longer than when using conventional interpolation techniques. Limitations are that it does not enforce musculoskeletal constraints, and that the reconstruction accuracy declines if applied to datasets with less predictable movement patterns.
Serum markers of liver fibrosis
DEFF Research Database (Denmark)
Veidal, Sanne Skovgård; Bay-Jensen, Anne-Christine; Tougas, Gervais
2010-01-01
-epitopes, may be targeted for novel biochemical marker development in fibrosis. We used the recently proposed BIPED system (Burden of disease, Investigative, Prognostic, Efficacy and Diagnostic) to characterise present serological markers. METHODS: Pubmed was search for keywords; Liver fibrosis, neo......, a systematic use of the neo-epitope approach, i.e. the quantification of peptide epitopes generated from enzymatic cleavage of proteins during extracellular remodeling, may prove productive in the quest to find new markers of liver fibrosis....
Ipek, M; Seker, M; Ipek, A; Gul, M K
2015-03-31
The purpose of this study was to characterize olive core collection with amplified fragment length polymorphism (AFLP) markers and fruit traits and to determine AFLP markers significantly associated with these fruit characters in olive. A total of 168 polymorphic AFLP markers generated by five primer combinations and nine fruit traits were used to characterize relationships between 18 olive cultivars. Although all olive cultivars were discriminated from each other by either AFLP markers (markers and fruit traits was not significantly correlated (r = 0.13). Partial clustering of olive cultivars by AFLP markers according to their geographical origin was observed. Associations of AFLP markers with fruits were determined using a multiple-regression analysis with stepwise addition of AFLP markers. Significant associations between eight AFLP markers and fruit traits were identified. While five AFLP markers demonstrated significant negative correlation with fruit and stone weight, width and length and total polyphenols (P markers displayed significant positive correlation with α-tocopherol and γ-tocopherol (P molecular markers with fruit traits in olive. Molecular markers associated with morphological and agronomic traits could be utilized for the breeding of olive cultivars. However, the association power of these markers needs to be confirmed in larger populations, and highly correlated markers should then be converted to PCR-based DNA markers such as sequence-characterized amplified region markers for better utilization.
The role of molecular markers and marker assisted selection in breeding for organic agriculture
DEFF Research Database (Denmark)
Lammerts van Bueren, E.T.; Backes, G.; de Vriend, H.
2010-01-01
markers is not self-evident and is often debated. Organic and low-input farming conditions require breeding for robust and flexible varieties, which may be hampered by too much focus on the molecular level. Pros and contras for application of molecular markers in breeding for organic agriculture...... was the topic of a recent European plant breeding workshop. The participants evaluated strengths, weaknesses, opportunities, and threats of the use of molecular markers and we formalized their inputs into breeder’s perspectives and perspectives seen from the organic sector’s standpoint. Clear strengths were...
Ouabain-induced internalization and lysosomal degradation of the Na+/K+-ATPase.
Cherniavsky-Lev, Marina; Golani, Ofra; Karlish, Steven J D; Garty, Haim
2014-01-10
Internalization of the Na(+)/K(+)-ATPase (the Na(+) pump) has been studied in the human lung carcinoma cell line H1299 that expresses YFP-tagged α1 from its normal genomic localization. Both real-time imaging and surface biotinylation have demonstrated internalization of α1 induced by ≥100 nm ouabain which occurs in a time scale of hours. Unlike previous studies in other systems, the ouabain-induced internalization was insensitive to Src or PI3K inhibitors. Accumulation of α1 in the cells could be augmented by inhibition of lysosomal degradation but not by proteosomal inhibitors. In agreement, the internalized α1 could be colocalized with the lysosomal marker LAMP1 but not with Golgi or nuclear markers. In principle, internalization could be triggered by a conformational change of the ouabain-bound Na(+)/K(+)-ATPase molecule or more generally by the disruption of cation homeostasis (Na(+), K(+), Ca(2+)) due to the partial inhibition of active Na(+) and K(+) transport. Overexpression of ouabain-insensitive rat α1 failed to inhibit internalization of human α1 expressed in the same cells. In addition, incubating cells in a K(+)-free medium did not induce internalization of the pump or affect the response to ouabain. Thus, internalization is not the result of changes in the cellular cation balance but is likely to be triggered by a conformational change of the protein itself. In physiological conditions, internalization may serve to eliminate pumps that have been blocked by endogenous ouabain or other cardiac glycosides. This mechanism may be required due to the very slow dissociation of the ouabain·Na(+)/K(+)-ATPase complex.
Williams, Larry J; O'Boyle, Ernest H
2015-09-01
A persistent concern in the management and applied psychology literature is the effect of common method variance on observed relations among variables. Recent work (i.e., Richardson, Simmering, & Sturman, 2009) evaluated 3 analytical approaches to controlling for common method variance, including the confirmatory factor analysis (CFA) marker technique. Their findings indicated significant problems with this technique, especially with nonideal marker variables (those with theoretical relations with substantive variables). Based on their simulation results, Richardson et al. concluded that not correcting for method variance provides more accurate estimates than using the CFA marker technique. We reexamined the effects of using marker variables in a simulation study and found the degree of error in estimates of a substantive factor correlation was relatively small in most cases, and much smaller than error associated with making no correction. Further, in instances in which the error was large, the correlations between the marker and substantive scales were higher than that found in organizational research with marker variables. We conclude that in most practical settings, the CFA marker technique yields parameter estimates close to their true values, and the criticisms made by Richardson et al. are overstated. (c) 2015 APA, all rights reserved).
Paleoreconstruction by biological markers
Energy Technology Data Exchange (ETDEWEB)
Seifert, W K; Moldowan, J M
1981-06-01
During diagenesis and conversion of the original lipid fraction of biological systems to petroleum hydrocarbons, the following four basic events needed for paleoreconstruction may be monitored by biological markers: (1) sourcing, (2) maturation, (3) migration and (4) biodegradation. Actual cases of applying biological markers to petroleum exploration problems in different parts of the world are demonstrated. Cretaceous- and Phosphoria-sourced oils in the Wyoming Thrust Belt can be distinguished from one another by high quality source fingerprinting of biomarker terpanes using gas chromatography mass spectrometry. Identification of recently discovered biological markers, head-to-head isoprenoids, allows source differentiation between some oils from Sumatra. The degree of crude oil maturation in basins from California, Alaska, Russia, Wyoming and Louisiana can be assessed by specific biomarker ratios (20S/20R sterane epimers). Field evidence from such interpretation is augmented by laboratory pyrolysis of the rock. Extensive migration is documented by biomarkers in several oils. Biological marker results are consistent with the geological setting and add a dimension in assisting the petroleum explorationist towar paleoreconstruction.
Czech Academy of Sciences Publication Activity Database
Pecen, Ladislav; Eben, Kryštof; Vondráček, Jiří; Holubec, L.; Topolčan, O.; Pikner, R.; Kausitz, J.; Nekulová, M.; Šimíčková, M.
2002-01-01
Roč. 23, Suppl.1 (2002), s. 38 ISSN 1010-4283. [Meeting of the International Society for Oncodevelopmental Biology and Medicine /30./. 08.09.2002-12.09.2002, Boston] Institutional research plan: AV0Z1030915 Keywords : tumor markers * decision support systems Subject RIV: BA - General Mathematics
Directory of Open Access Journals (Sweden)
Danielle Canioni
2009-07-01
Full Text Available Although most classical Hodgkin lymphoma patients are cured, a significant minority fail after primary therapy and may die as result of their disease. To date, there is no consensus on biological markers that add value to usual parameters (which comprise the International Prognostic Score used at diagnosis to predict outcome. We evaluated 59 patients (18 with primary refractory or early relapse disease and 41 responders for bcl2, Ki67, CD20, TiA1 and c-kit expression by semi-quantitative immunohistochemical study and correlated the results with the response to treatment.The results showed that expression of bcl2 and CD20 in Hodgkin and Reed Sternberg cells, and expression of TiA1 in micro-environmental lymphocytes, and c-kit positive mast cells in microenvironment, were independent prognostic markers. These novel cHL markers could be used in association with clinical parameters to identify newly diagnosed patients with favorable or unfavorable prognosis and to better tailor treatment for different risk groups.
Directory of Open Access Journals (Sweden)
Zoran Damnjanović
2014-03-01
Full Text Available The aim of this study was to examine the connection between cholestatic markers and the oxidative protein modification intensity in patients with choledocholithiasis. All the participants were subjected to clinical, laboratory and ultrasonic check-up at the Internal Department of the Military Hospital in Niš, Serbia. The parameters of oxidative stress: carbonyl groups, a measure of oxidative protein modification, and biochemical markers of cholestasis were determined by standard biochemical methods. The concentration of total (r=0.41, p<0.05, direct (r=0.49, p<+0.01 and indirect (r=0.41, p<0.05 bilirubin was in statistically significant positive linear correlation with the intensity of oxidative modification of proteins, while the other biochemical markers of cholestasis did not show such correlation. Total, direct and indirect bilirubins showed a significant positive correlation with oxidative protein modification, assessed through the levels of carbonyl groups in patients with choledocholithiasis.
1999-01-01
401 16 to Jan E. Conn for the ITS2 sequencing, by Consejo National de Investigaciones Cientificas y Tecnologicas (MPS-RPIV-130032-9), and the Pan... Investigaciones , Escuela de Malariologia y Saneamiento Ambiental, Maracay, Venezuela Abstract. A genetic and morphologic survey of Anopheles darlingi...0086. Yasmin Rubio-Palis, Division de Investigaciones , Escuela de Malariologia y Saneamiento Ambiental Dr. Arnold0 Ga- baldon, Apartado 2073
Calder, Philip C; Boobis, Alan; Braun, Deborah; Champ, Claire L; Dye, Louise; Einöther, Suzanne; Greyling, Arno; Matthys, Christophe; Putz, Peter; Wopereis, Suzan; Woodside, Jayne V; Antoine, Jean-Michel
2017-06-01
The conduct of high-quality nutrition research requires the selection of appropriate markers as outcomes, for example as indicators of food or nutrient intake, nutritional status, health status or disease risk. Such selection requires detailed knowledge of the markers, and consideration of the factors that may influence their measurement, other than the effects of nutritional change. A framework to guide selection of markers within nutrition research studies would be a valuable tool for researchers. A multidisciplinary Expert Group set out to test criteria designed to aid the evaluation of candidate markers for their usefulness in nutrition research and subsequently to develop a scoring system for markers. The proposed criteria were tested using thirteen markers selected from a broad range of nutrition research fields. The result of this testing was a modified list of criteria and a template for evaluating a potential marker against the criteria. Subsequently, a semi-quantitative system for scoring a marker and an associated template were developed. This system will enable the evaluation and comparison of different candidate markers within the same field of nutrition research in order to identify their relative usefulness. The ranking criteria of proven, strong, medium or low are likely to vary according to research setting, research field and the type of tool used to assess the marker and therefore the considerations for scoring need to be determined in a setting-, field- and tool-specific manner. A database of such markers, their interpretation and range of possible values would be valuable to nutrition researchers.
Genetic analyses of ribosomal loci of Anopheles minimus species from north east India.
Dutta, P; Khan, S A; Topno, R; Chowdhury, P; Baishya, M; Prakash, A; Bhattacharyya, D R; Mahanta, J
2013-09-01
Anopheles minimus is one of the major vectors for transmission of malaria disease in north eastern (NE) region of India. The minimus species complex of Minimus subgroup of Myzomyia series of anophelines were studied in malaria affected states--Assam and Arunachal Pradesh (AP) of NE India. Ribosomal DNA markers--second internal transcribed spacer (ITS2) and third domain (D3) of 28S gene were used to characterize An. minimus species. Sequence homogeneity was observed in D3 sequences of An.minimus specimens throughout both the states. However, a transversion in ITS2 sequence of single specimen collected from Assam-Meghalaya border areas illustrates possibility of intra population polymorphism in ITS2 sequence within the geographical region.
Daamen, Lois A; Groot, Vincent P; Heerkens, Hanne D; Intven, Martijn P W; van Santvoort, Hjalmar C; Molenaar, I Quintus
2018-04-01
Biomarker testing can be helpful to monitor disease progression after resection of pancreatic cancer. This systematic review aims to give an overview of the literature on the diagnostic value of serum tumor markers for the detection of recurrent pancreatic cancer during follow-up. A systematic search was performed to 2 October 2017. All studies reporting on the diagnostic value of postoperatively measured serum biomarkers for the detection of pancreatic cancer recurrence were included. Data on diagnostic accuracy of tumor markers were extracted. Forest plots and pooled values of sensitivity and specificity were calculated. Four articles described test results of CA 19-9. A pooled sensitivity and specificity of respectively 0.73 (95% CI 0.66-0.80) and 0.83 (95% CI 0.73-0.91) were calculated. One article reported on CEA, showing a sensitivity of 50% and specificity of 65%. No other serum tumor markers were discussed for surveillance purposes in the current literature. Although testing of serum CA 19-9 has considerable limitations, CA 19-9 remains the most used serum tumor marker for surveillance after surgical resection of pancreatic cancer. Further studies are needed to assess the role of serum tumor marker testing in the detection of recurrent pancreatic cancer and to optimize surveillance strategies. Copyright © 2017 International Hepato-Pancreato-Biliary Association Inc. Published by Elsevier Ltd. All rights reserved.
Tumor markers in pancreatic cancer: a European Group on Tumor Markers (EGTM) status report.
LENUS (Irish Health Repository)
Duffy, M J
2012-02-01
Pancreatic ductal adenocarcinoma is one of the most difficult malignancies to diagnose and treat. The aim of this article is to review how tumor markers can aid the diagnosis and management of patients with this malignancy. The most widely used and best validated marker for pancreatic cancer is CA 19-9. Inadequate sensitivity and specificity limit the use of CA 19-9 in the early diagnosis of pancreatic cancer. In non-jaundiced patients, however, CA 19-9 may complement other diagnostic procedures. In patients with resectable pancreatic cancer, presurgical and postresection CA 19-9 levels correlate with overall survival. In advanced disease, elevated pretreatment levels of CA 19-9 are associated with adverse patient outcome and thus may be combined with other factors for risk stratification. Most, but not all, reports indicate that serial levels of CA 19-9 correlate with response to systemic therapy. Use of CA 19-9 kinetics in conjunction with imaging is therefore recommended in monitoring therapy. Although several potential serum and tissue markers for pancreatic cancer are currently undergoing evaluation, none are sufficiently validated for routine clinical use. CA 19-9 thus remains the serum pancreatic cancer marker against which new markers for this malignancy should be judged.
Directory of Open Access Journals (Sweden)
David A. Brown
2017-09-01
Full Text Available Chromatin modifications and the promoter-associated epigenome are important for the regulation of gene expression. However, the mechanisms by which chromatin-modifying complexes are targeted to the appropriate gene promoters in vertebrates and how they influence gene expression have remained poorly defined. Here, using a combination of live-cell imaging and functional genomics, we discover that the vertebrate SET1 complex is targeted to actively transcribed gene promoters through CFP1, which engages in a form of multivalent chromatin reading that involves recognition of non-methylated DNA and histone H3 lysine 4 trimethylation (H3K4me3. CFP1 defines SET1 complex occupancy on chromatin, and its multivalent interactions are required for the SET1 complex to place H3K4me3. In the absence of CFP1, gene expression is perturbed, suggesting that normal targeting and function of the SET1 complex are central to creating an appropriately functioning vertebrate promoter-associated epigenome.
Directory of Open Access Journals (Sweden)
Millaray D Salas
2015-10-01
Full Text Available This paper reports the preliminary results of the first phase of an ongoing educational intervention conducted with students enrolled in an ELT training program at PUCV. The study set out to explore the feasibility and effectiveness of the recording and self-transcription methodology (Lynch, 2001, 2007; Mennim, 2003, 2012 as a route to noticing the gap and defossilization. Students (N=20 transcribed the oral texts they produced during the speaking section of the diagnostic test for English 5. The tasks were: (1 transcribing three minutes of their speaking time, (2 highlighting all the errors they identified in their own speech (3 coding them (e.g. grammatical, lexical, phonological and (4 sending the annotated transcript to the instructor by email. Drawing on the theory of questionnaire design and processing (Dörnyei, 2003, a survey was designed and posted online (GoogleForm and emailed to the students. The questionnaire asked students to evaluate the perceived benefits of the self-transcription methodology. The study data consist of the annotated transcripts and the questionnaire responses. The results of this study were much less positive than what has been reported in the literature (Willis & Willis, 1996, Burns & Joyce, 1997; Lynch, 2001, 2007; Mennim, 2003, 2012; Thornbury & Slade, 2006; Boettinger, Park & Timmis 2010; Stillwell et al., 2010, so an attempt is made to see why this might have been the case. Some pedagogical implications of this approach in the Chilean context are discussed.
International Nuclear Information System (INIS)
Zhuang, J.Y.; Lu, J.; Qian, H.R.; Lin, H.X.; Zheng, K.L.
1998-01-01
This paper reports progress made on the tagging of blast resistance gene(s) to DNA markers and on the initiation of marker-assisted selection (MAS) for blast resistance in rice improvement. A pair of near isogenic lines, K8OR and K79S, were developed using a Chinese landrace Hong-jiao-zhan as the resistance donor. Ten putatively positive markers were identified by screening 177 mapped DNA markers. Using the F 2 population of 143 plants and the derived F 3 lines, three Restriction Fragment Length Polymorphism (RFLP) markers (RG81, RG869 and RZ397) on chromosome 12 of rice were identified to be closely linked to the blast resistance gene Pi-12(t). The genetic distance between Pi-12(t) and the closest marker RG869 was 5.1 cM. By employing the bulk segregant analysis (BSA) procedure, six of 199 arbitrary primers were found to produce positive Randomly Amplified Polymorphic DNA (RAPD) bands. Tight linkage between Pi-12(t) and three RAPD bands, each from a different primer, was confirmed after amplification of DNA of all F 2 individuals. Two fragments were cloned and sequenced, and two sequence characterised amplified re-ion (SCAR) markers were established. In two other F 3 populations, Xian-feng I/Tetep and Xian-feng, 1/Hong-jiao-zhan, the blast resistance was found to be controlled by interactions of two or more genes. One resistance gene was located in the vicinity of RG81 in both populations. Work to identify other gene(s) is currently under way. Marker assisted selection for blast resistance was initiated. Crosses were made between elite varieties and blast resistance donors to develop populations for DNA marker-assisted selection of blast resistance. In addition, 48 varieties widely used in current rice breeding programs were provided by rice breeders. DNA marker-based polymorphism among, these varieties and resistance donors were analysed to produce a database for future MAS program. (author)
Wei, Jingli; Hu, Xiaorong; Yang, Jingjing; Yang, Wencai
2012-01-01
The genus Physalis includes a number of commercially important edible and ornamental species. Its high nutritional value and potential medicinal properties leads to the increased commercial interest in the products of this genus worldwide. However, lack of molecular markers prevents the detailed study of genetics and phylogeny in Physalis, which limits the progress of breeding. In the present study, we compared the DNA sequences between Physalis and tomato, and attempted to analyze genetic diversity in Physalis using tomato markers. Blasting 23180 DNA sequences derived from Physalis against the International Tomato Annotation Group (ITAG) Release2.3 Predicted CDS (SL2.40) discovered 3356 single-copy orthologous genes between them. A total of 38 accessions from at least six species of Physalis were subjected to genetic diversity analysis using 97 tomato markers and 25 SSR markers derived from P. peruviana. Majority (73.2%) of tomato markers could amplify DNA fragments from at least one accession of Physalis. Diversity in Physalis at molecular level was also detected. The average Nei's genetic distance between accessions was 0.3806 with a range of 0.2865 to 0.7091. These results indicated Physalis and tomato had similarity at both molecular marker and DNA sequence levels. Therefore, the molecular markers developed in tomato can be used in genetic study in Physalis.
Microsatellite markers linked to the locus of the watermelon fruit stripe pattern.
Gama, R N C S; Santos, C A F; Dias, R C S; Alves, J C S F; Nogueira, T O
2015-01-16
Agronomic performance and external and internal appearance of watermelon (Citrullus lanatus) fruit are important traits that should be taken into consideration during the development of a new cultivar, as well as being the principal identification elements used by the consumer, which are based on the external appearance and quality of the fruit. Externally, the fruit can be characterized in terms of the shape, the color of the lower rind, and the presence of grooves and stripes, the stripes can be classified as clearly defined or diffuse. The objective of this study was to identify microsatellite markers linked to the stripe pattern of watermelon fruit to support watermelon improvement programs, with the selection of this characteristic in the plantlet stage. F1 and F2 populations, result of a cross between the cultivars BRS Opara (clearly defined stripes) and Pérola (diffuse stripes), were phenotyped for their fruit stripe pattern. The CTAB 2X protocol was used for DNA extraction and 116 microsatellite markers were examined in a group of F2 plants that had fruit with well-defined stripes and fruit with diffuse stripes. The microsatellite loci MCPI_05 and MCPI_16 exhibited a linkage to the stripe pattern at a distance of 1.5 and 1.8 cM, respectively, with LOD scores of 39.28 and 38.11, respectively, which were located on chromosome six of the watermelon genome. These markers can be used in marker-assisted selection in watermelon improvement programs, by various research institutions.
Fatigue as prognostic risk marker of mental sickness absence in white collar employees.
Roelen, C A M; Heymans, M W; van Rhenen, W; Groothoff, J W; Twisk, J W R; Bültmann, U
2014-06-01
To investigate fatigue as prognostic risk marker for identifying working employees at risk of long-term sickness absence (SA). At baseline, fatigue was measured in 633 white collar employees with the checklist individual strength (CIS) including scales for fatigue severity, reduced concentration, reduced motivation, and reduced physical activity. SA was medically certified by an occupational physician in the 3rd or 4th SA week with diagnostic codes according to the 10th version of the International Classification of Diseases. Medically certified SA was retrieved at the individual level from an occupational health register after 1-year follow-up. CIS scores were investigated as prognostic risk markers predicting medically certified SA and particularly SA certified as mental SA. 614 employees (N = 378 men and N = 236 women) had complete data and were eligible for analysis; 63 (10 %) had medically certified SA of whom 39 (6 %) had mental SA. Fatigue severity and total CIS scores were associated with medically certified SA in men, but poorly discriminated between men with and without medically certified SA. Fatigue severity, reduced concentration, reduced motivation, and total CIS scores were also associated with mental SA in men. CIS and its reduced concentration scale were valid prognostic risk markers of mental SA. CONCLUSION Fatigue was a prognostic risk marker of mental SA in white collar men. The CIS should be further validated as a screening tool for the risk of mental SA in white collar working populations.
Stemness-related markers in cancer
Directory of Open Access Journals (Sweden)
Wenxiu Zhao
2017-01-01
Full Text Available Cancer stem cells (CSCs, with their self-renewal ability and multilineage differentiation potential, are a critical subpopulation of tumor cells that can drive tumor initiation, growth, and resistance to therapy. Like embryonic and adult stem cells, CSCs express markers that are not expressed in normal somatic cells and are thus thought to contribute toward a “stemness” phenotype. This review summarizes the current knowledge of stemness-related markers in human cancers, with a particular focus on important transcription factors, protein surface markers, and signaling pathways.
2010-01-07
... locations: January 21, 2010: Marathon Garden Club, 5270 Overseas Hwy (Mile Marker 50), Marathon, FL 33050... cards and verbal comments will be recorded and transcribed. Dated: December 29, 2009. Daniel J. Basta...
Oliver-Pozo, Celia; Aparicio-Ruiz, Ramón; Romero, Inmaculada; García-González, Diego L
2015-12-09
The need to explain virgin olive oil (VOO) aroma descriptors by means of volatiles has raised interest in applying analytical techniques for trapping and quantitating volatiles. Static headspace sampling with solid phase microextraction (SPME) as trapping material is one of the most applied solutions for analyzing volatiles. The use of an internal standard and the determination of the response factors of the main volatiles seem to guarantee the correct determination of volatile concentrations in VOOs by SPME-GC/FID. This paper, however, shows that the competition phenomena between volatiles in their adsorption to the SPME fiber, inherent in static headspace sampling, may affect the quantitation. These phenomena are more noticeable in the particular case of highly odorant matrices, such as rancid and vinegary VOOs with high intensity of defect. The competition phenomena can modify the measurement sensitivity, which can be observed in volatile quantitation as well as in the recording of internal standard areas in different matrices. This paper analyzes the bias of the peak areas and concentrations of those volatiles that are markers for each sensory defect of VOOs (rancid, vinegary, musty, and fusty) when the intensity and complexity of aroma are increased. Of the 17 volatile markers studied in this work, 10 presented some anomalies in the quantitation in highly odorant matrices due the competition phenomena. However, quantitation was not affected in the concentration ranges at which each volatile marker is typically found in the defective oils they were characteristic of, validating their use as markers.
Ludwig, Kirsten; Kornblum, Harley I
2017-09-01
Gliomas are the most malignant and aggressive form of brain tumors, and account for the majority of brain cancer related deaths. Malignant gliomas, including glioblastoma are treated with radiation and temozolomide, with only a minor benefit in survival time. A number of advances have been made in understanding glioma biology, including the discovery of cancer stem cells, termed glioma stem cells (GSC). Some of these advances include the delineation of molecular heterogeneity both between tumors from different patients as well as within tumors from the same patient. Such research highlights the importance of identifying and validating molecular markers in glioma. This review, intended as a practical resource for both clinical and basic investigators, summarizes some of the more well-known molecular markers (MGMT, 1p/19q, IDH, EGFR, p53, PI3K, Rb, and RAF), discusses how they are identified, and what, if any, clinical relevance they may have, in addition to discussing some of the specific biology for these markers. Additionally, we discuss identification methods for studying putative GSC's (CD133, CD15, A2B5, nestin, ALDH1, proteasome activity, ABC transporters, and label-retention). While much research has been done on these markers, there is still a significant amount that we do not yet understand, which may account for some conflicting reports in the literature. Furthermore, it is unlikely that the investigator will be able to utilize one single marker to prospectively identify and isolate GSC from all, or possibly, any gliomas.
Use of DNA markers in forest tree improvement research
D.B. Neale; M.E. Devey; K.D. Jermstad; M.R. Ahuja; M.C. Alosi; K.A. Marshall
1992-01-01
DNA markers are rapidly being developed for forest trees. The most important markers are restriction fragment length polymorphisms (RFLPs), polymerase chain reaction- (PCR) based markers such as random amplified polymorphic DNA (RAPD), and fingerprinting markers. DNA markers can supplement isozyme markers for monitoring tree improvement activities such as; estimating...
Martel, Michelle M
2013-11-01
Despite the well-established sex difference in prevalence of many childhood and adolescent psychopathological conditions, no integrative metatheory of sex differences in psychopathology exists. This review attempts to provide a metatheoretical framework to guide empirical examination of sex differences in prevalence of childhood-onset "externalizing" and adolescent-onset "internalizing" disorders, based on sexual selection evolutionary theory. Sexual selection theory suggests important between-sex differences in markers, mechanisms, etiology, and developmental timing of risk and resilience relevant to psychopathology. Namely, sexual selection theory hypothesizes that disinhibition and sensation-seeking may be important proximate risk markers for childhood-onset externalizing disorders in males. The theory suggests that these male-biased markers may be a product of their higher exposure to prenatal testosterone, which makes them more susceptible to prenatal stressors with downstream effects on dopaminergic neurotransmission, especially for those with genetic alleles associated with lower dopaminergic function. In contrast, sexual selection theory hypothesizes that negative emotionality, empathy, and cognitive rumination may be important proximate risk markers for adolescent-onset internalizing disorders in females. The theory suggests that these markers are propagated by rapidly rising levels of estradiol at puberty that interact with cortisol and oxytocin. These hormones exert downstream effects on the serotonergic system in such a way as to increase females' sensitivity to interpersonal stressors particularly at puberty and especially for those with lower functional serotonergic activity. Such a metatheory can help integrate prior ideas about sex differences and can also generate new predictions of sex differences in markers, etiology, mechanisms, and developmental timing of common forms of psychopathology. © 2013 American Psychological Association
Machiels, Melanie; van Hooft, Jeanin; Jin, Peng; van Berge Henegouwen, Mark I; van Laarhoven, Hanneke M; Alderliesten, Tanja; Hulshof, Maarten C
2015-10-01
Markers placed at the borders of esophageal tumors are potentially useful to facilitate radiotherapy (RT) target delineation, which offers the possibility of image-guided RT. To evaluate and compare the feasibility and technical benefit of endoscopy/EUS-guided marker placement of 3 different types of markers in patients with esophageal cancer referred for RT. Prospective, single-center, feasibility and comparative study. Tertiary-care medical center. Thirty patients with esophageal cancer who were referred for RT. Patients underwent endoscopy/EUS-guided implantation of 1 type of marker. A solid gold marker (SM) with fixed dimensions, a flexible coil-shaped gold marker (FM) with hand-cut length (2-10 mm), and a radiopaque hydrogel marker (HG) were used. Technical feasibility and adverse events were registered. CT scans and cone-beam CT scans (CBCT) acquired during RT were analyzed to determine and compare the visibility and continuous clear visibility of the implanted markers. Technical feasibility, technical benefit, and adverse events of 3 types of markers. A total of 101 markers were placed in 30 patients. Implantation was technically feasible in all patients without grade 3 to 4 adverse events. Two patients with asymptomatic mediastinitis and one with asymptomatic pneumothorax were seen. Visibility on CT scan of all 3 types of implanted markers was adequate for target delineation. Eighty percent of FMs remained continuously visible over the treatment period on CBCT, significantly better than SMs (63%) and HGs (11%) (P = .015). When we selected FMs ≥5 mm, 90.5% remained visible on CBCT between implantation and the end of RT. Single-center, nonrandomized design. Endoscopy/EUS-guided fiducial marker placement for esophageal cancer is both safe and feasible and can be used for target volume delineation purposes on CT. Our results imply a significant advantage of FMs over SMs and HGs, regarding visibility and continuous clear visibility over the treatment period
Prenatal Screening Using Maternal Markers
Directory of Open Access Journals (Sweden)
Howard Cuckle
2014-05-01
Full Text Available Maternal markers are widely used to screen for fetal neural tube defects (NTDs, chromosomal abnormalities and cardiac defects. Some are beginning to broaden prenatal screening to include pregnancy complications such as pre-eclampsia. The methods initially developed for NTDs using a single marker have since been built upon to develop high performance multi-maker tests for chromosomal abnormalities. Although cell-free DNA testing is still too expensive to be considered for routine application in public health settings, it can be cost-effective when used in combination with existing multi-maker marker tests. The established screening methods can be readily applied in the first trimester to identify pregnancies at high risk of pre-eclampsia and offer prevention though aspirin treatment. Prenatal screening for fragile X syndrome might be adopted more widely if the test was to be framed as a form of maternal marker screening.
Elevated tumour marker: an indication for imaging?
LENUS (Irish Health Repository)
McMahon, Colm J
2012-02-01
INTRODUCTION: The purpose of this study was to evaluate the utility of imaging examinations in patients with elevated tumour markers when (a) the tumour marker is not validated for as a primary diagnostic test; (b) the patient had no personal history of cancer and (c) the patient had no other imaging indication. MATERIALS AND METHODS: Patients without known cancer who had abnormal carcinoembryonic antigen, CA19-9, CA125 and\\/or CA15-3 serology over a one-year period were included. A retrospective medical record review was performed to assess the number of these cases who underwent imaging because of \\'elevated tumour marker\\' in the absence of a clinical indication for imaging. The number and result of these imaging studies were evaluated. RESULTS: Eight hundred and nineteen patients were included. Of those, 25 patients (mean age: 67.8 [range 41-91] y), were imaged to evaluate: \\'elevated tumour marker\\'. They underwent 29 imaging studies (mean [+\\/-standard deviation (SD)] per patient = 1.2 [+\\/-0.4]), and had 42 elevated tumour marker serology tests (mean [+\\/-SD] per patient = 1.7 [+\\/-0.7]). Four patients had >1 imaging test. No patient had an imaging study which diagnosed a malignancy or explained the elevated tumour marker. CONCLUSION: The non-judicious use of tumour markers can prompt further unnecessary investigations including imaging. In this study, there was no positive diagnostic yield for imaging performed for investigation of \\'elevated tumour marker\\'. \\'Elevated tumour marker\\
Quantifying the Value of Markers in Screening Programmes
DEFF Research Database (Denmark)
Østergaard, Søren Dinesen; Dinesen, Peter Thisted; Foldager, Leslie
2010-01-01
Existing methods used to rank the value of individual screening markers in screening programmes are inadequate. We have developed a simple Screening Marker Index: (Screening Marker Index = Positive Predictive Value x Sensitivity). The Screening Marker Index proved to be superior to existing indices...
New approach for isolation of VNTR markers.
Nakamura, Y; Carlson, M; Krapcho, K; Kanamori, M; White, R
1988-01-01
Elsewhere we have reported an efficient method for isolating VNTR (Variable Number of Tandem Repeats) markers. Several of the VNTR markers isolated in those experiments were sequenced, and a DNA sequence of 9 bp (GNNGTGGG) emerged as an apparent consensus sequence for VNTR markers. To confirm this result and to develop more VNTR markers, we synthesized nine different 18-base-long oligonucleotides whose sequences each included GNNGTGGG. When 102 cosmid clones selected by these oligonucleotides...
Dodge, Hiroko H; Mattek, Nora; Gregor, Mattie; Bowman, Molly; Seelye, Adriana; Ybarra, Oscar; Asgari, Meysam; Kaye, Jeffrey A
2015-01-01
Detecting early signs of Alzheimer's disease (AD) and mild cognitive impairment (MCI) during the pre-symptomatic phase is becoming increasingly important for costeffective clinical trials and also for deriving maximum benefit from currently available treatment strategies. However, distinguishing early signs of MCI from normal cognitive aging is difficult. Biomarkers have been extensively examined as early indicators of the pathological process for AD, but assessing these biomarkers is expensive and challenging to apply widely among pre-symptomatic community dwelling older adults. Here we propose assessment of social markers, which could provide an alternative or complementary and ecologically valid strategy for identifying the pre-symptomatic phase leading to MCI and AD. The data came from a larger randomized controlled clinical trial (RCT), where we examined whether daily conversational interactions using remote video telecommunications software could improve cognitive functions of older adult participants. We assessed the proportion of words generated by participants out of total words produced by both participants and staff interviewers using transcribed conversations during the intervention trial as an indicator of how two people (participants and interviewers) interact with each other in one-on-one conversations. We examined whether the proportion differed between those with intact cognition and MCI, using first, generalized estimating equations with the proportion as outcome, and second, logistic regression models with cognitive status as outcome in order to estimate the area under ROC curve (ROC AUC). Compared to those with normal cognitive function, MCI participants generated a greater proportion of words out of the total number of words during the timed conversation sessions (p=0.01). This difference remained after controlling for participant age, gender, interviewer and time of assessment (p=0.03). The logistic regression models showed the ROC AUC of
Marín-Llera, Jessica Cristina; Chimal-Monroy, Jesús
2018-05-01
Skeletal progenitors are derived from resident limb bud mesenchymal cells of the vertebrate embryos. However, it remains poorly understood if they represent stem cells, progenitors, or multipotent mesenchymal stromal cells (MSC). Derived-MSC of different adult tissues under in vitro experimental conditions can differentiate into the same cellular lineages that are present in the limb. Here, comparing non-cultured versus cultured mesenchymal limb bud cells, we determined the expression of MSC-associated markers, the in vitro differentiation capacity and their gene expression profile. Results showed that in freshly isolated limb bud mesenchymal cells, the proportion of cells expressing Sca1, CD44, CD105, CD90, and CD73 is very low and a low expression of lineage-specific genes was observed. However, recently seeded limb bud mesenchymal cells acquired Sca1 and CD44 markers and the expression of the key differentiation genes Runx2 and Sox9, while Scx and Pparg genes decreased. Also, their chondrogenic differentiation capacity decreased through cellular passages while the osteogenic increased. Our findings suggest that the modification of the cell adhesion process through the in vitro method changed the limb mesenchymal cell immunophenotype leading to the expression and maintenance of common MSC-associated markers. These findings could have a significant impact on MSC study and isolation strategy because they could explain common variations observed in the MSC immunophenotype in different tissues. © 2018 International Federation for Cell Biology.
Rejmanek, Daniel; Miller, Melissa A; Grigg, Michael E; Crosbie, Paul R; Conrad, Patricia A
2010-05-28
Sarcocystis neurona is a significant cause of neurological disease in horses and other animals, including the threatened Southern sea otter (Enhydra lutris nereis). Opossums (Didelphis virginiana), the only known definitive hosts for S. neurona in North America, are an introduced species in California. S. neurona DNA isolated from sporocysts and/or infected tissues of 10 opossums, 6 horses, 1 cat, 23 Southern sea otters, and 1 harbor porpoise (Phocoena phocoena) with natural infections was analyzed based on 15 genetic markers, including the first internal transcribed spacer (ITS-1) region; the 25/396 marker; S. neurona surface antigen genes (snSAGs) 2, 3, and 4; and 10 different microsatellites. Based on phylogenetic analysis, most of the S. neurona strains segregated into three genetically distinct groups. Additionally, fifteen S. neurona samples from opossums and several intermediate hosts, including sea otters and horses, were found to be genetically identical across all 15 genetic markers, indicating that fatal encephalitis in Southern sea otters and equine protozoal myeloencephalitis (EPM) in horses is strongly linked to S. neurona sporocysts shed by opossums. (c) 2010 Elsevier B.V. All rights reserved.
CHRONICITY OF DEPRESSION AND MOLECULAR MARKERS IN A LARGE SAMPLE OF HAN CHINESE WOMEN.
Edwards, Alexis C; Aggen, Steven H; Cai, Na; Bigdeli, Tim B; Peterson, Roseann E; Docherty, Anna R; Webb, Bradley T; Bacanu, Silviu-Alin; Flint, Jonathan; Kendler, Kenneth S
2016-04-25
Major depressive disorder (MDD) has been associated with changes in mean telomere length and mitochondrial DNA (mtDNA) copy number. This study investigates if clinical features of MDD differentially impact these molecular markers. Data from a large, clinically ascertained sample of Han Chinese women with recurrent MDD were used to examine whether symptom presentation, severity, and comorbidity were related to salivary telomere length and/or mtDNA copy number (maximum N = 5,284 for both molecular and phenotypic data). Structural equation modeling revealed that duration of longest episode was positively associated with mtDNA copy number, while earlier age of onset of most severe episode and a history of dysthymia were associated with shorter telomeres. Other factors, such as symptom presentation, family history of depression, and other comorbid internalizing disorders, were not associated with these molecular markers. Chronicity of depressive symptoms is related to more pronounced telomere shortening and increased mtDNA copy number among individuals with a history of recurrent MDD. As these molecular markers have previously been implicated in physiological aging and morbidity, individuals who experience prolonged depressive symptoms are potentially at greater risk of adverse medical outcomes. © 2016 Wiley Periodicals, Inc.
Internalization and localization of basal insulin peglispro in cells.
Moyers, Julie S; Volk, Catherine B; Cao, Julia X C; Zhang, Chen; Ding, Liyun; Kiselyov, Vladislav V; Michael, M Dodson
2017-10-15
Basal insulin peglispro (BIL) is a novel, PEGylated insulin lispro that has a large hydrodynamic size compared with insulin lispro. It has a prolonged duration of action, which is related to a delay in insulin absorption and a reduction in clearance. Given the different physical properties of BIL compared with native insulin and insulin lispro, it is important to assess the cellular internalization characteristics of the molecule. Using immunofluorescent confocal imaging, we compared the cellular internalization and localization patterns of BIL, biosynthetic human insulin, and insulin lispro. We assessed the effects of BIL on internalization of the insulin receptor (IR) and studied cellular clearance of BIL. Co-localization studies using antibodies to either insulin or PEG, and the early endosomal marker EEA1 showed that the overall internalization and subcellular localization pattern of BIL was similar to that of human insulin and insulin lispro; all were rapidly internalized and co-localized with EEA1. During ligand washout for 4 h, concomitant loss of insulin, PEG methoxy group, and PEG backbone immunostaining was observed for BIL, similar to the loss of insulin immunostaining observed for insulin lispro and human insulin. Co-localization studies using an antibody to the lysosomal marker LAMP1 did not reveal evidence of lysosomal localization for insulin lispro, human insulin, BIL, or PEG using either insulin or PEG immunostaining reagents. BIL and human insulin both induced rapid phosphorylation and internalization of human IR. Our findings show that treatment of cells with BIL stimulates internalization and localization of IR to early endosomes. Both the insulin and PEG moieties of BIL undergo a dynamic cellular process of rapid internalization and transport to early endosomes followed by loss of cellular immunostaining in a manner similar to that of insulin lispro and human insulin. The rate of clearance for the insulin lispro portion of BIL was slower than
Yu, Xiaoxue; Zhang, Yafeng; Wang, Dongmei; Jiang, Lin; Xu, Xinjun
2018-01-01
Background: Citri Reticulatae Pericarpium is the dried mature pericarp of Citrus reticulata Blanco which can be divided into “Chenpi” and “Guangchenpi.” “Guangchenpi” is the genuine Chinese medicinal material in Xinhui, Guangdong province; based on the greatest quality and least amount, it is most expensive among others. Hesperidin is used as the marker to identify Citri Reticulatae Pericarpium described in the Chinese Pharmacopoeia 2010. However, both “Chenpi” and “Guangchenpi” contain hesperidin so that it is impossible to differentiate them by measuring hesperidin. Objective: Our study aims to develop an efficient and accurate method to separate and identify “Guangchenpi” from other Citri Reticulatae Pericarpium. Materials and Methods: The genomic deoxyribonucleic acid (DNA) of all the materials was extracted and then the internal transcribed spacer 2 was amplified, sequenced, aligned, and analyzed. The secondary structures were created in terms of the database and website established by Jörg Schultz et al. High-performance liquid chromatography-diode array detection-electrospray Ionization/mass spectrometry (HPLC-DAD-ESI-MS)/MS coupled with chemometric analysis was applied to compare the differences in chemical profiles of the three kinds of Citri Reticulatae Pericarpium. Results: A total of 22 samples were classified into three groups. The results of DNA barcoding were in accordance with principal component analysis and hierarchical cluster analysis. Eight compounds were deduced from HPLC-DAD-ESI-MS/MS. Conclusions: This method is a reliable and effective tool to differentiate the three Citri Reticulatae Pericarpium. SUMMARY The internal transcribed spacer 2 regions and the secondary structure among three kinds of Citri Reticulatae Pericarpium varied considerablyAll the 22 samples were analyzed by high-performance liquid chromatography (HPLC) to obtain the chemical profilesPrincipal component analysis and hierarchical cluster analysis
Directory of Open Access Journals (Sweden)
Falafivka Olesya
2016-12-01
Full Text Available Background: Ethnic stereotypes are in the focus of current linguistic research, because they play an important role in the formation of international relations that develop rapidly in the modern world. The majority of linguistic studies today are devoted to the cognitive nature of stereotypes. However, researchers also pay attention to means of stereotype verbalization in different languages. The main ones have been identified already: these are ethnonyms, toponyms, ethnically marked anthroponyms, ethnically marked color names, names of religions, names of national symbols and values, ethnic and national realia and code switching. Nevertheless, not always do these units verbalize ethnic stereotypes in discourse. Purpose: The purpose of this research is to develop a method of identification and suggest a typology of linguistic markers of stereotype that occur in descriptions of different national characters in Ukrainian journalistic discourse. Results: Linguistic markers of stereotype have been identified at almost all levels of the language structure. They are morphemes, lexemes, set phrases, idioms, proverbs, certain syntactic structures and even texts (anecdotes, the semantic structure of which contains the semes MANY and ALWAYS. Importantly, linguistic markers of stereotype are used in combination rather than separately. Discussion: Ethnic stereotypes can be identified in discourse using two basic criteria. The first one is explicit description or implicit reference to the features of a certain national character (ethnonyms, toponyms, realia etc. are indispensable elements of such a description or reference; the second one is occurrence of the aforesaid markers of stereotype (different language units, the semantic structure of which includes the semes MANY and ALWAYS in the text. The prospect of this research is comparative analysis of markers of ethnic stereotypes in Ukrainian and other languages.
Molecular phylogeny of elasmobranchs inferred from mitochondrial and nuclear markers.
Pavan-Kumar, A; Gireesh-Babu, P; Babu, P P Suresh; Jaiswar, A K; Hari Krishna, V; Prasasd, K Pani; Chaudhari, Aparna; Raje, S G; Chakraborty, S K; Krishna, Gopal; Lakra, W S
2014-01-01
The elasmobranchs (sharks, rays and skates) being the extant survivors of one of the earliest offshoots of the vertebrate evolutionary tree are good model organisms to study the primitive vertebrate conditions. They play a significant role in maintaining the ecological balance and have high economic value. Due to over-exploitation and illegal fishing worldwide, the elasmobranch stocks are being decimated at an alarming rate. Appropriate management measures are necessary for restoring depleted elasmobranch stocks. One approach for restoring stocks is implementation of conservation measures and these measures can be formulated effectively by knowing the evolutionary relationship among the elasmobranchs. In this study, a total of 30 species were chosen for molecular phylogeny studies using mitochondrial cytochrome c oxidase subunit I, 12S ribosomal RNA gene and nuclear Internal Transcribed Spacer 2. Among different genes, the combined dataset of COI and 12S rRNA resulted in a well resolved tree topology with significant bootstrap/posterior probabilities values. The results supported the reciprocal monophyly of sharks and batoids. Within Galeomorphii, Heterodontiformes (bullhead sharks) formed as a sister group to Lamniformes (mackerel sharks): Orectolobiformes (carpet sharks) and to Carcharhiniformes (ground sharks). Within batoids, the Myliobatiformes formed a monophyly group while Pristiformes (sawfishes) and Rhinobatiformes (guitar fishes) formed a sister group to all other batoids.
Marker-Free Human Motion Capture
DEFF Research Database (Denmark)
Grest, Daniel
Human Motion Capture is a widely used technique to obtain motion data for animation of virtual characters. Commercial optical motion capture systems are marker-based. This book is about marker-free motion capture and its possibilities to acquire motion from a single viewing direction. The focus...
DEFF Research Database (Denmark)
Sturgeon, Catharine M; Hoffman, Barry R; Chan, Daniel W
2008-01-01
BACKGROUND: This report presents updated National Academy of Clinical Biochemistry Laboratory Medicine Practice Guidelines summarizing quality requirements for the use of tumor markers. METHODS: One subcommittee developed guidelines for analytical quality relevant to serum and tissue-based tumor...... questions to ensure selection of the appropriate test, adherence to good clinical and laboratory practices (e.g., minimization of the risk of incorrect patient and/or specimen identification, tube type, or timing), use of internationally standardized and well-characterized methods, careful adherence...... records. Also mandatory is extensive validation encompassing all stages of analysis before introduction of new technologies such as microarrays and mass spectrometry. Provision of high-quality tumor marker services is facilitated by dialogue involving researchers, diagnostic companies, clinical...
Rosa, Sabrina F P; Monteyne, Daniel; Milinkovitch, Michel C
2009-01-01
The two species of Galápagos land iguanas (Conolophus subcristatus and C. pallidus) are listed as 'vulnerable' species by the International Union for the Conservation of Nature (IUCN Red List; http://www.iucnredlist.org). Here, we report on the isolation and characterization of 10 microsatellite markers using 562 individuals sampled on all Galápagos islands where Conolophus species occur today. We show that these 10 loci are highly polymorphic and display diagnostic alleles for five out of the six island populations. These markers will be useful for Conolophus population genetic analyses as well as for guiding ongoing captive breeding programmes. © 2009 The Authors. Journal compilation © 2009 Blackwell Publishing Ltd.
International Nuclear Information System (INIS)
Yamaguchi-Mizumoto, N.H.
1989-01-01
In order to study blood and cell components alterations (named tumor markers) that may indicate the presence of a tumor, several methods are presented. Aspects as diagnostic, prognostic, therapeutic value and clinical evaluation are discussed. (M.A.C.)
Proceedings of the 1978 international meeting on reduced enrichment for research and test reactors
Energy Technology Data Exchange (ETDEWEB)
Travelli, A [Argonne National Laboratory, Argonne, IL (United States)
1993-08-01
November 9-10, 1978, marked the first of what has become an annual event - the International Meeting on Reduced Enrichment for Research and Test Reactors (RERTR). The RERTR Program had been started only three months earlier, and the meeting brought together for the first time many people who became major program participants in later years. This first meeting emphasized fuel development, and while it established the basis for all later meetings, it was unique in several respects. It was a time of feeling each other out, and of sharing new ideas, concerns, and hopes. In the absence of an established precedent, a number of participants came with written papers while others made only verbal presentations. Informality added spice and special importance to the discussions at the end of each presentation and, especially, to the panel discussion at the end of the meeting. An important achievement was a consensus on near-, medium-, and long-term density goals for the various fuels. This consensus resulted in a list written on the blackboard at the end of the panel discussion, and reproduced on page 216, which outlined the goals of each fabricator. Luckily, both presentations and discussions were recorded on audio tape. These recordings were transcribed and used to complete the informal presentations and to append the discussions at the end of each presentation. Considerable effort was expended in clearing the transcribed papers and key discussions with the participants. A few issues could not be resolved quickly, and in the frantic rush of those early years, these proceedings were set aside. Believing that the proceedings of this first meeting are important as a historical record of the beginning of the international RERTR effort, we have recently dusted off the manuscript and finished our editing job.
Proceedings of the 1978 international meeting on reduced enrichment for research and test reactors
International Nuclear Information System (INIS)
Travelli, A.
1993-08-01
November 9-10, 1978, marked the first of what has become an annual event - the International Meeting on Reduced Enrichment for Research and Test Reactors (RERTR). The RERTR Program had been started only three months earlier, and the meeting brought together for the first time many people who became major program participants in later years. This first meeting emphasized fuel development, and while it established the basis for all later meetings, it was unique in several respects. It was a time of feeling each other out, and of sharing new ideas, concerns, and hopes. In the absence of an established precedent, a number of participants came with written papers while others made only verbal presentations. Informality added spice and special importance to the discussions at the end of each presentation and, especially, to the panel discussion at the end of the meeting. An important achievement was a consensus on near-, medium-, and long-term density goals for the various fuels. This consensus resulted in a list written on the blackboard at the end of the panel discussion, and reproduced on page 216, which outlined the goals of each fabricator. Luckily, both presentations and discussions were recorded on audio tape. These recordings were transcribed and used to complete the informal presentations and to append the discussions at the end of each presentation. Considerable effort was expended in clearing the transcribed papers and key discussions with the participants. A few issues could not be resolved quickly, and in the frantic rush of those early years, these proceedings were set aside. Believing that the proceedings of this first meeting are important as a historical record of the beginning of the international RERTR effort, we have recently dusted off the manuscript and finished our editing job
Skin changes in internal malignancy
Directory of Open Access Journals (Sweden)
Rajagopal Ravi
2004-07-01
Full Text Available BACKGROUND: Internal malignancies are accompanied by various skin changes which may be specific infiltrates or non-specific changes. This study is aimed at determining the frequency of such changes in malignant disease treatment center attendees in India. METHODS: A study of 300 confirmed cases of internal malignancy at a malignant disease treatment center was undertaken to evaluate these skin changes. Specific infiltrates were confirmed by histopathology. Statistical methods were employed to calculate significance in non-specific lesions by comparing with 300 controls not suffering from internal malignancy. RESULTS: Skin changes were present in 82 (27.3%. Cutaneous metastases were found in 19 (6.3%; non-contiguous in 5 (1.6%; contiguous in 14 (4.3%. Non-specific skin lesions numbered 74 (11.6% in 52 patients. Statistically significant non-specific skin changes were acquired ichthyosis, herpes zoster and generalized pruritus. CONCLUSION: Metastases usually occurred late in internal malignancy (17, 5.6% except in a case each of histiocytic lymphoma and non-Hodgkin′s lymphoma (2, 0.7% where the lesions preceded malignancy by 3 months and 1 month respectively. Contiguous nodules were a marker of relapse after surgery in 3 (1%.
Directory of Open Access Journals (Sweden)
Jingli Wei
Full Text Available The genus Physalis includes a number of commercially important edible and ornamental species. Its high nutritional value and potential medicinal properties leads to the increased commercial interest in the products of this genus worldwide. However, lack of molecular markers prevents the detailed study of genetics and phylogeny in Physalis, which limits the progress of breeding. In the present study, we compared the DNA sequences between Physalis and tomato, and attempted to analyze genetic diversity in Physalis using tomato markers. Blasting 23180 DNA sequences derived from Physalis against the International Tomato Annotation Group (ITAG Release2.3 Predicted CDS (SL2.40 discovered 3356 single-copy orthologous genes between them. A total of 38 accessions from at least six species of Physalis were subjected to genetic diversity analysis using 97 tomato markers and 25 SSR markers derived from P. peruviana. Majority (73.2% of tomato markers could amplify DNA fragments from at least one accession of Physalis. Diversity in Physalis at molecular level was also detected. The average Nei's genetic distance between accessions was 0.3806 with a range of 0.2865 to 0.7091. These results indicated Physalis and tomato had similarity at both molecular marker and DNA sequence levels. Therefore, the molecular markers developed in tomato can be used in genetic study in Physalis.
Eberhard, Jörg; Grote, Karsten; Luchtefeld, Maren; Heuer, Wieland; Schuett, Harald; Divchev, Dimitar; Scherer, Ralph; Schmitz-Streit, Ruth; Langfeldt, Daniela; Stumpp, Nico; Staufenbiel, Ingmar; Schieffer, Bernhard; Stiesch, Meike
2013-01-01
We here investigated whether experimental gingivitis enhances systemic markers of inflammation which are also known as surrogate markers of atherosclerotic plaque development. Gingivitis is a low-level oral infection induced by bacterial deposits with a high prevalence within Western populations. A potential link between the more severe oral disease periodontitis and cardiovascular disease has already been shown. 37 non-smoking young volunteers with no inflammatory disease or any cardiovascular risk factors participated in this single-subject interventional study with an intra-individual control. Intentionally experimental oral inflammation was induced by the interruption of oral hygiene for 21 days, followed by a 21-days resolving phase after reinitiation of oral hygiene. Primary outcome measures at baseline, day 21 and 42 were concentrations of hsCRP, IL-6, and MCP-1, as well as adhesion capacity and oxLDL uptake of isolated blood monocytes. The partial cessation of oral hygiene procedures was followed by the significant increase of gingival bleeding (34.0%, Pgingivitis. Bacterial-induced gingival low-level inflammation induced a systemic increase in inflammatory markers. Dental hygiene almost completely reversed this experimental inflammatory process, suggesting that appropriate dental prophylaxis may also limit systemic markers of inflammation in subjects with natural gingivitis. International Clinical Trials Register Platform of the World Health Organization, registry number: DRKS00003366, URL: http://apps.who.int/trialsearch/Default.aspx.
The Infinitive Marker across Scandinavian
DEFF Research Database (Denmark)
Christensen, Ken Ramshøj
2007-01-01
In this paper I argue that the base-position of the infinitive marker in the Scandinavian languages and English share a common origin site. It is inserted as the top-most head in the VP-domain. The cross-linguistic variation in the syntactic distribution of the infinitive marker can be accounted...
Insulin internalization in isolated rat hepatocytes
International Nuclear Information System (INIS)
Galan, J.; Trankina, M.; Noel, R.; Ward, W.
1990-01-01
This project was designed to determine whether neomycin, an aminoglycoside antibiotic, has a significant effect upon the pathways of ligand endocytosis in isolated rat hepatocytes. The pathways studied include receptor-mediated endocytosis and fluid-phase endocytosis. Neomycin causes a dose-dependent acceleration of 125 I-insulin internalization. Since fluid-phase endocytosis can also be a significant factor in 125 I-insulin internalization, lucifer yellow (LY), a marker for fluid-phase endocytosis, was incorporated into an assay similar to the 125 I-insulin internalization procedure. In the presence of 5 mM neomycin, a significant increase in LY uptake was evident at 0.2 and 0.4 mg/ml of LY. At 0.8 mg/ml, a decrease in LY uptake was observed. The increased rate of 125 I-insulin internalization in the presence of neomycin was intriguing. Since one action of neomycin is to inhibit phosphoinositidase C, it suggests that the phosphotidylinositol cycle may be involved in ligand internalization by hepatocytes. At low insulin concentrations, receptor-mediated uptake predominates. Fluid-phase uptake can become an important uptake route as insulin concentrations are increased. Since neomycin stimulates fluid-phase endocytosis, it must also be taken into account when measuring ligand internalization
Molecular markers. Amplified fragment length polymorphism
Directory of Open Access Journals (Sweden)
Pržulj Novo
2005-01-01
Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.
DEFF Research Database (Denmark)
Abbott, Diana; Li, Yi-Ju; Guggenheim, Jeremy A
2012-01-01
To investigate quantitative trait loci linked to refractive error, we performed a genome-wide quantitative trait linkage analysis using single nucleotide polymorphism markers and family data from five international sites....
Brown, David A; Di Cerbo, Vincenzo; Feldmann, Angelika; Ahn, Jaewoo; Ito, Shinsuke; Blackledge, Neil P; Nakayama, Manabu; McClellan, Michael; Dimitrova, Emilia; Turberfield, Anne H; Long, Hannah K; King, Hamish W; Kriaucionis, Skirmantas; Schermelleh, Lothar; Kutateladze, Tatiana G; Koseki, Haruhiko; Klose, Robert J
2017-09-05
Chromatin modifications and the promoter-associated epigenome are important for the regulation of gene expression. However, the mechanisms by which chromatin-modifying complexes are targeted to the appropriate gene promoters in vertebrates and how they influence gene expression have remained poorly defined. Here, using a combination of live-cell imaging and functional genomics, we discover that the vertebrate SET1 complex is targeted to actively transcribed gene promoters through CFP1, which engages in a form of multivalent chromatin reading that involves recognition of non-methylated DNA and histone H3 lysine 4 trimethylation (H3K4me3). CFP1 defines SET1 complex occupancy on chromatin, and its multivalent interactions are required for the SET1 complex to place H3K4me3. In the absence of CFP1, gene expression is perturbed, suggesting that normal targeting and function of the SET1 complex are central to creating an appropriately functioning vertebrate promoter-associated epigenome. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Smart markers for watershed-based cell segmentation.
Directory of Open Access Journals (Sweden)
Can Fahrettin Koyuncu
Full Text Available Automated cell imaging systems facilitate fast and reliable analysis of biological events at the cellular level. In these systems, the first step is usually cell segmentation that greatly affects the success of the subsequent system steps. On the other hand, similar to other image segmentation problems, cell segmentation is an ill-posed problem that typically necessitates the use of domain-specific knowledge to obtain successful segmentations even by human subjects. The approaches that can incorporate this knowledge into their segmentation algorithms have potential to greatly improve segmentation results. In this work, we propose a new approach for the effective segmentation of live cells from phase contrast microscopy. This approach introduces a new set of "smart markers" for a marker-controlled watershed algorithm, for which the identification of its markers is critical. The proposed approach relies on using domain-specific knowledge, in the form of visual characteristics of the cells, to define the markers. We evaluate our approach on a total of 1,954 cells. The experimental results demonstrate that this approach, which uses the proposed definition of smart markers, is quite effective in identifying better markers compared to its counterparts. This will, in turn, be effective in improving the segmentation performance of a marker-controlled watershed algorithm.
Smart markers for watershed-based cell segmentation.
Koyuncu, Can Fahrettin; Arslan, Salim; Durmaz, Irem; Cetin-Atalay, Rengul; Gunduz-Demir, Cigdem
2012-01-01
Automated cell imaging systems facilitate fast and reliable analysis of biological events at the cellular level. In these systems, the first step is usually cell segmentation that greatly affects the success of the subsequent system steps. On the other hand, similar to other image segmentation problems, cell segmentation is an ill-posed problem that typically necessitates the use of domain-specific knowledge to obtain successful segmentations even by human subjects. The approaches that can incorporate this knowledge into their segmentation algorithms have potential to greatly improve segmentation results. In this work, we propose a new approach for the effective segmentation of live cells from phase contrast microscopy. This approach introduces a new set of "smart markers" for a marker-controlled watershed algorithm, for which the identification of its markers is critical. The proposed approach relies on using domain-specific knowledge, in the form of visual characteristics of the cells, to define the markers. We evaluate our approach on a total of 1,954 cells. The experimental results demonstrate that this approach, which uses the proposed definition of smart markers, is quite effective in identifying better markers compared to its counterparts. This will, in turn, be effective in improving the segmentation performance of a marker-controlled watershed algorithm.
The role of Molecular Markers in Improvement of Fruit Crops
Directory of Open Access Journals (Sweden)
Zahoor Ahmad BHAT
2010-06-01
Full Text Available Markers have been used over the years for the classification of plants. Markers are any trait of an organism that can be identified with confidence and relative easy, and can be followed in a mapping population on another hand markers be defined as heritable entities associated with the economically important trait under the control of polygenes. Morphological markers can be detected with naked eye (naked eye polymorphism or as difference in physical or chemical properties of the macromolecules. In other words, there are two types of genetic markers viz. morphological markers or naked eye polymorphism and non-morphological markers or molecular markers. Morphological markers include traits such as plant height, disease response, photoperiod, sensitivity, shape or colour of flowers, fruits or seeds etc. Molecular markers include biochemical constituents. Morphological markers have many limitations for being used as markers particularly in fruit crops because of long generation time and large size of fruit trees besides being influenced by environment. Consequently, molecular markers could be appropriate choice to study and preserve the diversity in any germplasm. Molecular markers have diverse applications in fruit crop improvement, particularly in the areas of genetic diversity and varietal identification studies, gene tagging, disease diagnostics, pedigree analysis, hybrid detection, sex differentiation and marker assisted selection.
Making short-term international medical volunteer placements work: a qualitative study.
Elnawawy, Omnia; Lee, Andrew C K; Pohl, Gerda
2014-06-01
International medical volunteering has grown in recent decades. It has the potential to benefit and harm the volunteer and host countries; but there is a paucity of literature on the impacts of international medical volunteering and a need to find ways to optimise the benefits of such placements. In this study, one example of international medical volunteering was examined involving British GPs on short-term placements in Nepal. The intention was to explore the expectations and experiences of the local health workers, volunteers, and host organisation to try and understand what makes volunteer placements work. Qualitative study of key informant interviews. Stakeholders of a short-term international medical volunteer (IMV) placement programme in Nepal. Key informant interviews were carried out via face-to-face or telephone/internet interviews with five previous volunteers, three representatives from a non-governmental organisation providing placements, and five local health workers in Nepal who had had contact with the IMVs. Interviews were recorded, transcribed, and analysed using standard thematic framework approaches. All the stakeholders had their own specific motives for participating in the IMV programme. The relationship between volunteers and the Nepalese health workers was complex and characterised by discrepant and occasionally unrealistic expectations. Managing these different expectations was challenging. Contextual issues and cultural differences are important considerations in medical volunteer programmes, and this study highlights the importance of robust preparation pre-placement for the volunteer and host to ensure positive outcomes. © British Journal of General Practice 2014.
Diagnostic value of different tumor markers, our experience
International Nuclear Information System (INIS)
Pervez, T.; Anwar, S.
2000-01-01
Variety of tumor markers with varying sensitivity and specificity are used for diagnosis of different malignancies. This study was done to determine the diagnostic value of different tumor markers in our patients with various malignancies. Out of 235 patients studied, 162 were suffering from malignant and 73 from benign diseases. Among these 84 were positive for tumor markers. Out of these positive tumor markers, 75 were suffering from malignancy. Tumor marker analyzed were ca-15-3, ca-125, BETA-HCG, CEA, PSA and alpha-FP depending upon the type of the disease these cases presented. Analysis of the results revealed that different tumor markers had sensitivity varying from 76.9-95.8% and specificity varying form 75-90.9%. CA-125 was observed to be the most specific and sensitive tumor marker for ovarian tumors followed by alpha-FP for hepatocellular tumors and CEA for gastrointestinal tumors. Similarly, PSA for prostate cancers, beta-HCG for choriocarcinoma and CA-15-3 for breast cancer. It is concluded that all the tumor markers have a variable diagnostic value, which cannot be relied upon independently, without other tests added to increase diagnostic value. (author)
Epigenetic Markers of Renal Function in African Americans
Directory of Open Access Journals (Sweden)
Samantha M. Bomotti
2013-01-01
Full Text Available Chronic kidney disease (CKD is an increasing concern in the United States due to its rapidly rising prevalence, particularly among African Americans. Epigenetic DNA methylation markers are becoming important biomarkers of chronic diseases such as CKD. To better understand how these methylation markers play a role in kidney function, we measured 26,428 DNA methylation sites in 972 African Americans from the Genetic Epidemiology Network of Arteriopathy (GENOA study. We then evaluated (1 whether epigenetic markers are associated with estimated glomerular filtration rate (eGFR, (2 whether the significantly associated markers are also associated with traditional risk factors and/or novel biomarkers for eGFR, and (3 how much additional variation in eGFR is explained by epigenetic markers beyond established risk factors and biomarkers. The majority of methylation markers most significantly associated with eGFR (24 out of the top 30 appeared to function, at least in part, through pathways related to aging, inflammation, or cholesterol. However, six epigenetic markers were still able to significantly predict eGFR after adjustment for other risk factors. This work shows that epigenetic markers may offer valuable new insight into the complex pathophysiology of CKD in African Americans.
Liu, Guo-Hua; Gasser, Robin B; Young, Neil D; Song, Hui-Qun; Ai, Lin; Zhu, Xing-Quan
2014-03-31
Fascioliasis is an important and neglected disease of humans and other mammals, caused by trematodes of the genus Fasciola. Fasciola hepatica and F. gigantica are valid species that infect humans and animals, but the specific status of Fasciola sp. ('intermediate form') is unclear. Single specimens inferred to represent Fasciola sp. ('intermediate form'; Heilongjiang) and F. gigantica (Guangxi) from China were genetically identified and characterized using PCR-based sequencing of the first and second internal transcribed spacer regions of nuclear ribosomal DNA. The complete mitochondrial (mt) genomes of these representative specimens were then sequenced. The relationships of these specimens with selected members of the Trematoda were assessed by phylogenetic analysis of concatenated amino acid sequence datasets by Bayesian inference (BI). The complete mt genomes of representatives of Fasciola sp. and F. gigantica were 14,453 bp and 14,478 bp in size, respectively. Both mt genomes contain 12 protein-coding genes, 22 transfer RNA genes and two ribosomal RNA genes, but lack an atp8 gene. All protein-coding genes are transcribed in the same direction, and the gene order in both mt genomes is the same as that published for F. hepatica. Phylogenetic analysis of the concatenated amino acid sequence data for all 12 protein-coding genes showed that the specimen of Fasciola sp. was more closely related to F. gigantica than to F. hepatica. The mt genomes characterized here provide a rich source of markers, which can be used in combination with nuclear markers and imaging techniques, for future comparative studies of the biology of Fasciola sp. from China and other countries.
Ali, Marwan; Shah, Dhara; Pasha, Zeeshan; Jassim, Sarmad H; Jassim Jaboori, Assraa; Setabutr, Pete; Aakalu, Vinay K
2017-04-01
The accessory lacrimal glands (ALGs) are an understudied component of the tear functional unit, even though they are important in the development of dry eye syndrome (DES). To advance our understanding of aging changes, regenerative potential, and histologic correlates to human characteristics, we investigated human ALG tissue from surgical samples to determine the presence or absence of progenitor cell markers and lacrimal epithelial markers and to correlate marker expression to relevant patient characteristics. ALG tissues obtained from Muller's muscle conjunctival resection (MMCR) specimens were created using tissue microarrays (TMAs). Immunofluorescence staining of MMCR sections was performed using primary antibodies specific to cell protein markers. Cell marker localization in TMAs was then assessed by two blinded observers using a standardized scoring system. Patient characteristics including age, race, and status of ocular surface health were then compared against expression of stem cell markers. Human ALG expressed a number of epithelial markers, and in particular, histatin-1 was well correlated with the expression of epithelial markers and was present in most acini. In addition, we noted the presence of precursor cell markers nestin, ABCG2, and CD90 in ALG tissue. There was a decrease in precursor cell marker expression with increasing age. Finally, we noted that a negative association was present between histatin-1 expression and DES. Thus, we report for the first time that human ALG tissues contain precursor marker-positive cells and that this marker expression may decrease with increasing age. Moreover, histatin-1 expression may be decreased in DES. Future studies will be performed to use these cell markers to isolate and culture lacrimal epithelial cells from heterogeneous tissues, determine the relevance of histatin-1 expression to DES, and isolate candidate precursor cells from ALG tissue.
Sudheer Pamidimarri, D V N; Singh, Sweta; Mastan, Shaik G; Patel, Jalpa; Reddy, Muppala P
2009-07-01
Jatropha curcas L., a multipurpose shrub has acquired significant economic importance for its seed oil which can be converted to biodiesel, is emerging as an alternative to petro-diesel. The deoiled seed cake remains after oil extraction is toxic and cannot be used as a feed despite having best nutritional contents. No quantitative and qualitative differences were observed between toxic and non-toxic varieties of J. curcas except for phorbol esters content. Development of molecular marker will enable to differentiate non-toxic from toxic variety in a mixed population and also help in improvement of the species through marker assisted breeding programs. The present investigation was undertaken to characterize the toxic and non-toxic varieties at molecular level and to develop PCR based molecular markers for distinguishing non-toxic from toxic or vice versa. The polymorphic markers were successfully identified specific to non-toxic and toxic variety using RAPD and AFLP techniques. Totally 371 RAPD, 1,442 AFLP markers were analyzed and 56 (15.09%) RAPD, 238 (16.49%) AFLP markers were found specific to either of the varieties. Genetic similarity between non-toxic and toxic verity was found to be 0.92 by RAPD and 0.90 by AFLP fingerprinting. In the present study out of 12 microsatellite markers analyzed, seven markers were found polymorphic. Among these seven, jcms21 showed homozygous allele in the toxic variety. The study demonstrated that both RAPD and AFLP techniques were equally competitive in identifying polymorphic markers and differentiating both the varieties of J. curcas. Polymorphism of SSR markers prevailed between the varieties of J. curcas. These RAPD and AFLP identified markers will help in selective cultivation of specific variety and along with SSRs these markers can be exploited for further improvement of the species through breeding and Marker Assisted Selection (MAS).
[Immunological Markers in Organ Transplantation].
Beckmann, J H; Heits, N; Braun, F; Becker, T
2017-04-01
The immunological monitoring in organ transplantation is based mainly on the determination of laboratory parameters as surrogate markers of organ dysfunction. Structural damage, caused by alloreactivity, can only be detected by invasive biopsy of the graft, which is why inevitably rejection episodes are diagnosed at a rather progressive stage. New non-invasive specific markers that enable transplant clinicians to identify rejection episodes at an earlier stage, on the molecular level, are needed. The accurate identification of rejection episodes and the establishment of operational tolerance permit early treatment or, respectively, a controlled cessation of immunosuppression. In addition, new prognostic biological markers are expected to allow a pre-transplant risk stratification thus having an impact on organ allocation and immunosuppressive regimen. New high-throughput screening methods allow simultaneous examination of hundreds of characteristics and the generation of specific biological signatures, which might give concrete information about acute rejection, chronic dysfunction as well as operational tolerance. Even though multiple studies and a variety of publications report about important advances on this subject, almost no new biological marker has been implemented in clinical practice as yet. Nevertheless, new technologies, in particular analysis of the genome, transcriptome, proteome and metabolome will make personalised transplantation medicine possible and will further improve the long-term results and graft survival rates. This article gives a survey of the limitations and possibilities of new immunological markers in organ transplantation. Georg Thieme Verlag KG Stuttgart · New York.
HAYASHI, Kei; ICHIKAWA-SEKI, Madoka; MOHANTA, Uday Kumar; SHORIKI, Takuya; CHAICHANASAK, Pannigan; ITAGAKI, Tadashi
2017-01-01
Nuclear gene markers, phosphoenolpyruvate carboxykinase (pepck) and DNA polymerase delta (pold), have been developed for precise discrimination of Fasciola flukes instead of internal transcribed spacer 1. In this study, these two genes of 730 Fasciola flukes from eight Asian countries were analyzed. The results were compared with their mitochondrial NADH dehydrogenase subunit 1 (nad1) lineages for obtaining a definitive evidence of the hybrid origin of aspermic Fasciola flukes. All the flukes categorized into the aspermic nad1 lineages possessed both the fragment patterns of F. hepatica and F. gigantica (mixed types) in pepck and/or pold. These findings provide clear evidence for the hybrid origin of aspermic Fasciola lineages and suggest that “aspermic Fasciola flukes” should hereafter be called “hybrid Fasciola flukes”. PMID:29187710
Immunocytochemistry of the olfactory marker protein.
Monti-Graziadei, G A; Margolis, F L; Harding, J W; Graziadei, P P
1977-12-01
The olfactory marker protein has been localized, by means of immunohistochemical techniques in the primary olfactory neurons of mice. The olfactory marker protein is not present in the staminal cells of the olfactory neuroepithelium, and the protein may be regarded as indicative of the functional stage of the neurons. Our data indicate that the olfactory marker protein is present in the synaptic terminals of the olfactory neurons at the level of the olfactory bulb glomeruli. The postsynaptic profiles of both mitral and periglomerular cells are negative.
The role of tumor marker CA 15-3 in detection of breast cancer relapse after curative mastectomy
International Nuclear Information System (INIS)
Hyun, In Young; Kim, In Ho; Lee, Moon Hee; Kim, Chul Soo
2004-01-01
The purpose of this study was to determine the utility of tumor marker CA 15-3 in the following: the diagnosis of breast cancer relapse after curative mastectomy, and the differentiation of the value of tumor marker by site of metastases. Two hundred two patients (median age 48 years) with breast cancer included in the follow-up after curative mastectomy. The tumor marker CA 15-3 was determined by IRMA (CIS BIO INTERNATIONAl, France). Test values > 30 U/ml were considered elevated (positive). Among 202 patients, recurrent diseases were found in 16 patients. CA 15-3 was elevated in 5 of 16 patients with recurrences. There was no false-positive patients who had elevated CA 15-3. Sensitivity and specificity of CA 15-3 for detection of breast cancer recurrence were 31%, and 100%. CA 15-3 was elevated in all of the 4 patients with liver metastases. CA 15-3 was elevated in none of the patients who relapsed with metastasis to bone-only or contralateral breast-only. The tumor marker CA 15-3 in the detection of breast cancer relapse after curative mastectomy is specific, but not sensitive. However, it is useful to rule out liver metastases of breast cancer, which indicates bad prognosis
Generation and application of SSR markers in avocado
International Nuclear Information System (INIS)
Sharon, D.; Lavi, U.; Cregan, P.B.; Hillel, J.
1998-01-01
Simple Sequence Repeat (SSR) DNA markers were generated and applied to avocado. An SSR marker is based on a pair of primers which are synthesized on the basis of DNA sequences flanking a micro satellite. These markers are PCR based, quite polymorphic and abundant in several species. These are the markers, of choice in the human genome. The number of SSR markers in the avocado genome was calculated to be about 45,000, with the A/T micro satellite being the most frequent (1 in 40 kb). SSR markers are quite expensive to generate due to the required multi-step procedure; Screening a genomic library, about 66% of the positive clones turned out after sequencing to be SSR containing clones. In only about 55% of these, was it possible to synthesize primers and, of this group, only about 50% of the markers were useful for typing a specific family. Typing of five avocado cultivars using 59 SSR markers results in one to eight alleles per locus, mean heterozygosity ranging between 0.51 and 0.66 and gene diversity ranging between 0.42 and 0.66. The SSR markers were used to estimate the genetic relationships between various Persea species. The number of alleles in these species ranged between five and twelve with heterozygosity levels between 0.11-0.78 and gene diversity between 0.69-0.89. A preliminary genetic map, based on these SSR markers together with some DNA fingerprints (DFP) and randomly amplified polymorphic DNA (RAPD) markers, was drawn. The map consists of 12 linkage group having two to five markers each. Linkage analysis with several quantitative trait loci (QTLs) was performed by genetic typing and phenotypic assessment of the progeny of a controlled cross. The results of the interval mapping suggest that the gene(s) coding for the existence of fibers in the flesh, are probably linked to linkage group 3. (author)
Generation and application of SSR markers in avocado
Energy Technology Data Exchange (ETDEWEB)
Sharon, D; Lavi, U [Institute of Horticulture, ARO Volcani Center, Bet-Dagan (Israel); Cregan, P B [United States Department of Agriculture, Agricultural Research Service, Beltsville, Maryland (United States); Hillel, J [Faculty of Agriculture, Hebrew University of Jerusalem, Rehovot (Israel)
1998-10-01
Simple Sequence Repeat (SSR) DNA markers were generated and applied to avocado. An SSR marker is based on a pair of primers which are synthesized on the basis of DNA sequences flanking a micro satellite. These markers are PCR based, quite polymorphic and abundant in several species. These are the markers, of choice in the human genome. The number of SSR markers in the avocado genome was calculated to be about 45,000, with the A/T micro satellite being the most frequent (1 in 40 kb). SSR markers are quite expensive to generate due to the required multi-step procedure; Screening a genomic library, about 66% of the positive clones turned out after sequencing to be SSR containing clones. In only about 55% of these, was it possible to synthesize primers and, of this group, only about 50% of the markers were useful for typing a specific family. Typing of five avocado cultivars using 59 SSR markers results in one to eight alleles per locus, mean heterozygosity ranging between 0.51 and 0.66 and gene diversity ranging between 0.42 and 0.66. The SSR markers were used to estimate the genetic relationships between various Persea species. The number of alleles in these species ranged between five and twelve with heterozygosity levels between 0.11-0.78 and gene diversity between 0.69-0.89. A preliminary genetic map, based on these SSR markers together with some DNA fingerprints (DFP) and randomly amplified polymorphic DNA (RAPD) markers, was drawn. The map consists of 12 linkage group having two to five markers each. Linkage analysis with several quantitative trait loci (QTLs) was performed by genetic typing and phenotypic assessment of the progeny of a controlled cross. The results of the interval mapping suggest that the gene(s) coding for the existence of fibers in the flesh, are probably linked to linkage group 3. (author) 20 refs, 3 figs, 8 tabs
African Journals Online (AJOL)
acer
2013-06-26
Jun 26, 2013 ... analysis was in general agreement with PCoA in discrimi- nating the cultivars. Conclusions. Estimation of morphological diversity may provide addi- tional information on the present finding. Nonetheless, the 29 SSR markers provided considerable genetic reso- lution and this genetic diversity analysis ...
African Journals Online (AJOL)
SAM
2014-07-30
Jul 30, 2014 ... India and the country is currently the leading producer, consumer and exporter of ... registration with the competent authority for plant variety protection. Conventionally ... detection of duplicates, parental verification in crosses, gene tagging in .... allelic patterns as revealed by the current set of SSR markers.
Rice genetic marker database: An identification of single nucleotide ...
African Journals Online (AJOL)
based genetic marker system to provide information about SNP and QTL markers in rice. The SNP marker database provides 7,227 SNP markers including location information on chromosomes by using genetic map. It allows users to access a ...
International Nuclear Information System (INIS)
Mir, Z.A.
2015-01-01
Objectives: To compare the frequencies of post- operative surgical site infection after preoperative marking done with non-sterile stationary. grade markers versus sterile surgical markers in the same patient. Design: Randomized control trial. Place and Duration of Study: The department of Plastic surgery, Mayo hospital, Lahore from August 2013 to August 2014. Methods: This study was conducted after taking approval from the departmental ethical committee. Forty consecutive patients were included. A sterile surgical marker was used to mark one incision site while an alcohol based stationary grade marker was used to mark another incision site on the same patient. A standard preoperative, intraoperative and postoperative protocol was followed. Cultures were performed on swabs taken from the incision sites and surgical site infection was assessed for 30 days. Results: The study included 40 patients; 17 males and 23 females. The mean age of subjects was 25.32 ± 19.69 years with the minimum age being 2 years and the maximum being 63 years. No growth was seen in cultures taken from all the incision sites after skin preparation in the non sterile stationary grade marker group as well as the sterile surgical grade marker group. Also no surgical site infection appeared during the 30 day postoperative observation period in the non sterile stationary grade marker group as well as the sterile surgical grade marker group. (author)
Biological Markers and Salivary Cortisol
DEFF Research Database (Denmark)
Hansen, Åse Marie; Gunnarsson, Lars-Gunnar; Harris, Anette
2011-01-01
This chapter focuses on salivary cortisol in relation to biological markers. Specifically, associations with conventional cardiovascular risk factors and metabolic abnormalities (body mass index, waist circumference, waist/hip ratio, lipid status, glucose, blood pressure, heart rate and heart rate...... variations and pharmacological interventions were also excluded. After meeting all exclusion criteria, 42 papers remained. In total, 273 associations between salivary cortisol and any of the markers mentioned were studied, comprising 241 associations on metabolic abnormalities, 30 on inflammation, and 2...... on stress hormones. Of the salivary cortisol measures reported for evaluations of all markers tested were 136 (49%) single time points, 100 (37%) deviations, 36 (13%) AUC, and 1 (1%) dexamethasone test. Of these, 72 (26%) were statistically significant, and 201 (74%) indicated non-significant findings...
Tumor markers: applications and recommendations. New IZOTOPE products
International Nuclear Information System (INIS)
Gyenes, Ana Rosa
2016-01-01
At work aspects are discussed: Tumor markers; New products IZOTOP; Measuring principle of IRMA kits for tumor markers; Guidelines and Recommendations for the use of tumor markers. pre-analytical, post-analytical and Quality control recommendations are given
Liska, Vaclav; Treska, Vladislav; Skalicky, Tomas; Fichtl, Jakub; Bruha, Jan; Vycital, Ondrej; Topolcan, Ondrej; Palek, Richard; Rosendorf, Jachym; Polivka, Jiri; Holubec, Lubos
2017-04-01
The behavior of tumor markers in biliary tract malignancies is not well-known and has been scarcely studied. Such markers could play important roles in diagnostic and prognostic schemes as well as in decision-making about the best treatment strategies. This study analyzed the preoperative serum levels of conventional tumor markers (AFP, CEA, CA 19-9, CA 72-4), proliferative marker thymidine kinase (TK) and cytokeratins (TPA, TPS and CYFRA 21.1) in patients with gallbladder carcinoma, bile duct carcinoma (Klatskin) and cholangiocellular carcinoma, in relation to the patient prognosis. The study aimed in finding the role of tumor markers in not properly investigated diseases, where their importance is often marginalized. The study included 43 patients, who underwent either radical surgical procedure (n=21) or explorative laparotomy without any surgical treatment (n=22) for gallbladder carcinoma, bile duct carcinoma (Klatskin tumor) and cholangiocellular carcinoma (24, 8 and 11 patients, respectively) between 2003 and 2010 at our Department. The association of serum tumor markers and patients' prognosis were assessed for the entire cohort and for each cancer type and also with regard to treatment (radical surgery versus explorative laparotomy). Overall survival (OS) and disease-free interval (DFI) were estimated by the Kaplan-Meier method and statistically evaluated using the LogRank test. DFI was computed only in the subgroup of patients treated by radical surgery. The statistical analysis of tumor markers revealed TK as a poor prognostic factor for shorter DFI (HR=3.5, 95%CI=0.6-21.3, ptumor markers for assessment of prognosis (OS or DFI) in patients with gallbladder carcinoma, bile duct carcinoma, and cholangiocellular carcinoma. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
McNair, Helen A; Hansen, Vibeke N; Parker, Christopher C; Evans, Phil M; Norman, Andrew; Miles, Elizabeth; Harris, Emma J; Del-Acroix, Louise; Smith, Elizabeth; Keane, Richard; Khoo, Vincent S; Thompson, Alan C; Dearnaley, David P
2008-05-01
To evaluate the utility of intraprostatic markers in the treatment verification of prostate cancer radiotherapy. Specific aims were: to compare the effectiveness of offline correction protocols, either using gold markers or bony anatomy; to estimate the potential benefit of online correction protocol's using gold markers; to determine the presence and effect of intrafraction motion. Thirty patients with three gold markers inserted had pretreatment and posttreatment images acquired and were treated using an offline correction protocol and gold markers. Retrospectively, an offline protocol was applied using bony anatomy and an online protocol using gold markers. The systematic errors were reduced from 1.3, 1.9, and 2.5 mm to 1.1, 1.1, and 1.5 mm in the right-left (RL), superoinferior (SI), and anteroposterior (AP) directions, respectively, using the offline correction protocol and gold markers instead of bony anatomy. The subsequent decrease in margins was 1.7, 3.3, and 4 mm in the RL, SI, and AP directions, respectively. An offline correction protocol combined with an online correction protocol in the first four fractions reduced random errors further to 0.9, 1.1, and 1.0 mm in the RL, SI, and AP directions, respectively. A daily online protocol reduced all errors to markers is effective in reducing the systematic error. The value of online protocols is reduced by intrafraction motion.
14 CFR 171.269 - Marker beacon performance requirements.
2010-01-01
... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Marker beacon performance requirements. 171.269 Section 171.269 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF... Landing System (ISMLS) § 171.269 Marker beacon performance requirements. ISMLS marker beacon equipment...
Ali, Marwan; Shah, Dhara; Pasha, Zeeshan; Jassim, Sarmad H.; Jaboori, Assraa Jassim; Setabutr, Pete; Aakalu, Vinay K.
2017-01-01
Purpose The accessory lacrimal glands (ALG) are an understudied component of the tear functional unit, even though they are important in the development of dry eye syndrome (DES). To advance our understanding of aging changes, regenerative potential and histologic correlates to human characteristics, we investigated human ALG tissue from surgical samples to determine the presence or absence of progenitor cell markers and lacrimal epithelial markers and to correlate marker expression to relevant patient characteristics. Materials and Methods ALG tissues obtained from Muller’s Muscle Conjunctival Resection (MMCR) specimens were created using tissue microarrays (TMAs). Immunofluorescence staining of MMCR sections was performed using primary antibodies specific to cell protein markers. Cell marker localization in TMAs was then assessed by two blinded observers using a standardized scoring system. Patient characteristics including age, race, and status of ocular surface health were then compared against expression of stem cell markers. Results Human ALG expressed a number of epithelial markers, and in particular, histatin-1 was well correlated with the expression of epithelial markers and was present in most acini. In addition, we noted the presence of precursor cell markers nestin, ABCG2 and CD90 in ALG tissue. There was a decrease in precursor cell marker expression with increasing age. Finally, we noted that a negative association was present between histatin-1 expression and DES. Conclusions Thus, we report for the first time that human ALG tissues contain precursor marker positive cells and that this marker expression may decrease with increasing age. Moreover, histatin-1 expression may be decreased in DES. Future studies will be performed to use these cell markers to isolate and culture lacrimal epithelial cells from heterogeneous tissues, determine the relevance of histatin-1 expression to DES and isolate candidate precursor cells from ALG tissue. PMID:27612554
Kahounová, Zuzana; Kurfürstová, Daniela; Bouchal, Jan; Kharaishvili, Gvantsa; Navrátil, Jiří; Remšík, Ján; Šimečková, Šárka; Študent, Vladimír; Kozubík, Alois; Souček, Karel
2017-04-06
The identification of fibroblasts and cancer-associated fibroblasts from human cancer tissue using surface markers is difficult, especially because the markers used currently are usually not expressed solely by fibroblasts, and the identification of fibroblast-specific surface molecules is still under investigation. It was aimed to compare three commercially available antibodies in the detection of different surface epitopes of fibroblasts (anti-fibroblast, fibroblast activation protein α, and fibroblast surface protein). The specificity of their expression, employing fibroblast cell lines and tumor-derived fibroblasts from breast and prostate tissues was investigated. Both the established fibroblast cell line HFF-1 and ex vivo primary fibroblasts isolated from breast and prostate cancer tissues expressed the tested surface markers to different degrees. Surprisingly, those markers were expressed also by permanent cell lines of epithelial origin, both benign and cancer-derived (breast-cell lines MCF 10A, HMLE and prostate-cell lines BPH-1, DU 145, and PC-3). The expression of fibroblast activation protein α increased on the surface of previously described models of epithelial cells undergoing epithelial-to-mesenchymal transition in response to treatment with TGF-β1. To prove the co-expression of the fibroblast markers on cells of epithelial origin, we used freshly dissociated human prostate and breast cancer tissues. The results confirmed the co-expression of anti-fibroblast and fibroblast surface protein on CD31/CD45-negative/EpCAM-positive epithelial cells. In summary, our data support the findings that the tested fibroblast markers are not fibroblast specific and may be expressed also by cells of epithelial origin (e.g., cells undergoing EMT). Therefore, the expression of these markers should be interpreted with caution, and the combination of several epitopes for both positive (anti-fibroblast or fibroblast activation protein α) and negative (Ep
International Nuclear Information System (INIS)
Darolles, Carine
2010-01-01
Uranium (U) is a heavy metal that is also considered as an alpha emitter. Thus the origin of U toxicity is both chemical and radiological. The identification of bio-markers to discriminate chemical and radiological toxicity for a given U compound is required to assess accurately the health effects of isotopic mixtures such as depleted U in 235 U with a low specific activity. Data from the literature show that the best candidates are cytogenetic markers. In the present work, the assessment of bio-markers of U contamination was performed on three cellular models (mouse fibroblasts, rat lymphocytes and human lymphocytes) that were exposed to different isotopic mixtures of U. The cytokinesis-block micronucleus (MN) centromere assay was performed to discriminate the chemo-toxic and radio-toxic effects of U. This study showed that the evaluation of micronuclei in bi-nucleated cells could not assess U genotoxicity accurately. Instead, the assessment of centromere-negative micronuclei and nucleo-plasmic bridges correlated with the radio-toxic effects of U. The evaluation of centromere-positive micronuclei and micronuclei in mono-nucleated cells correlated with the chemo-toxic effects of U. These cytogenetic markers should be validated on different biological models and could be proposed to discriminate radiological and chemical toxicity of a given isotopic mixture of U. These four cytogenetic markers could be a useful complement of the classical dosimetric bio-markers for the assessment of internal uranium contamination. (author)
International Nuclear Information System (INIS)
Snijder, E.J.; Horzinek, M.C.; Spaan, W.J.
1990-01-01
By using poly(A)-selected RNA from Berne virus (BEV)-infected embryonic mule skin cells as a template, cDNA was prepared and cloned in plasmid pUC9. Recombinants covering a contiguous sequence of about 10 kilobases were identified. Northern (RNA) blot hybridizations with various restriction fragments from these clones showed that the five BEV mRNAs formed a 3'-coterminal nested set. Sequence analysis revealed the presence of four complete open reading frames of 4743, 699, 426, and 480 nucleotides, with initiation codons coinciding with the 5' ends of BEV RNAs 2 through 5, respectively. By using primer extension analysis and oligonucleotide hybridizations, RNA 5 was found to be contiguous on the consensus sequence. The transcription of BEV mRNAs was studied by means of UV mapping. BEV RNAs 1, 2, and 3 were shown to be transcribed independently, which is also likely--although not rigorously proven--for RNAs 4 and 5. Upstream of the AUG codon of each open reading frame a conserved sequence pattern was observed which is postulated to function as a core promoter sequence in subgenomic RNA transcription. In the area surrounding the core promoter region of the two most abundant subgenomic BEV RNAs, a number of homologous sequence motifs were identified
Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade
2015-11-14
FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.
Li, Ziqiang; Liu, Jia; Li, Yazhuo; Du, Xi; Li, Yanfen; Wang, Ruihua; Lv, Chunxiao; He, Xin; Wang, Baohe; Huang, Yuhong; Zhang, Deqin
2018-06-01
A quality marker (Q-marker) is defined as an inherent chemical compound that is used for the quality control of a drug. Its biological activities are closely related to safety and therapeutic effects. Generally, a multiple-component herbal medicine may have many Q-markers. We therefore proposed a concept of "super Q-marker" satisfying both the criterion of Q-markers and PK-markers to be used in more effective quality control of herbal medicine. The first aim was to find suitable prototype-based PK-markers from Tangzhiqing tablets (TZQ), a Chinese patent medicine. Then super Q-markers were expected to be identified from the prototype-based PK-markers based on an in vitro-in vivo correlation study. Potentially eligible prototype-based PK-markers were identified in a single- and multiple-dose pharmacokinetic study on TZQ in 30 healthy volunteers. The in vitro dissolution and permeation profiles of the prototype-based PK-markers of TZQ were evaluated by the physiologically-based drug dissolution/absorption simulating system (DDASS). An in vitro-in vivo correlation analysis was conducted between the dissolution/permeation behaviors in DDASS and the actual absorption profiles in human to test the transferability and traceability of the promising super Q-markers for TZQ. In human, plasma paeoniflorin and nuciferine as prototype-based PK-markers exhibited the appropriate pharmacokinetic properties, including dose-dependent systemic exposure (AUC, C max ) and a proper elimination half-life (1∼3h). In DDASS, it was predicted that paeoniflorin and nuciferine are highly permeable but the absorption rates are primarily limited by the dissolution rates. Moreover, the established in vitro-in vivo correlations of paeoniflorin and nuciferine were in support of the super Q-markers features. Paeoniflorin and nuciferine are identified as the super Q-markers from the prototype-based PK-markers of TZQ based on findings from a combination of in vitro, in vivo, and in vitro-in vivo
Directory of Open Access Journals (Sweden)
Ryan J. McGinty
2017-09-01
Full Text Available Expansions of microsatellite repeats are responsible for numerous hereditary diseases in humans, including myotonic dystrophy and Friedreich’s ataxia. Whereas the length of an expandable repeat is the main factor determining disease inheritance, recent data point to genomic trans modifiers that can impact the likelihood of expansions and disease progression. Detection of these modifiers may lead to understanding and treating repeat expansion diseases. Here, we describe a method for the rapid, genome-wide identification of trans modifiers for repeat expansion in a yeast experimental system. Using this method, we found that missense mutations in the endoribonuclease subunit (Ysh1 of the mRNA cleavage and polyadenylation complex dramatically increase the rate of (GAAn repeat expansions but only when they are actively transcribed. These expansions correlate with slower transcription elongation caused by the ysh1 mutation. These results reveal an interplay between RNA processing and repeat-mediated genome instability, confirming the validity of our approach.
Marker-assisted selection in forestry species
International Nuclear Information System (INIS)
Butcher, P.; Southerton, S.
2007-01-01
The primary goal of tree breeding is to increase the quantity and quality of wood products from plantations. Major gains have been achieved using recurrent selection in genetically diverse breeding populations to capture additive variation. However, the long generation times of trees, together with poor juvenile-mature trait correlations, have promoted interest in marker-assisted selection (MAS) to accelerate breeding through early selection. MAS relies on identifying DNA markers, which explain a high proportion of variation in phenotypic traits. Genetic linkage maps have been developed for most commercial tree species and these can be used to locate chromosomal regions where DNA markers co-segregate with quantitative traits (quantitative trait loci, QTL). MAS based on QTL is most likely to be used for within-family selection in a limited number of elite families that can be clonally propagated. Limitations of the approach include the low resolution of marker-trait associations, the small proportion of phenotypic variation explained by QTL and the low success rate in validating QTL in different genetic backgrounds and environments. This has led to a change in research focus towards association mapping to identify variation in the DNA sequence of genes directly controlling phenotypic variation (gene-assisted selection, GAS). The main advantages of GAS are the high resolution of marker-trait associations and the ability to transfer markers across families and even species. Association studies are being used to examine the adaptive significance of variation in genes controlling wood formation and quality, pathogen resistance, cold tolerance and drought tolerance. Single nucleotide polymorphisms (SNPs) in these gene sequences that are significantly associated with trait variation can then be used for early selection. Markers for SNPs can be transferred among individuals regardless of pedigree or family relationship, increasing opportunities for their application in
Molecular markers linked to apomixis in Panicum maximum Jacq.
African Journals Online (AJOL)
SAM
2014-05-28
May 28, 2014 ... The objective of this work was to identify molecular markers linked to apomixis in ... Four RAPD markers linked to apomixis were identified and mapped in this .... Data analysis. The amplification of the potential markers was analyzed as binary, with 1 for presence and 0 for absence of the marker. The binary.
Lin, Geng-Ming; Lai, Yu-Heng; Audira, Gilbert; Hsiao, Chung-Der
2017-11-06
Green algae, Chlorella ellipsoidea , Haematococcus pluvialis and Aegagropila linnaei (Phylum Chlorophyta) were simultaneously decoded by a genomic skimming approach within 18-5.8-28S rRNA region. Whole genomic DNAs were isolated from green algae and directly subjected to low coverage genome skimming sequencing. After de novo assembly and mapping, the size of complete 18-5.8-28S rRNA repeated units for three green algae were ranged from 5785 to 6028 bp, which showed high nucleotide diversity (π is around 0.5-0.6) within ITS1 and ITS2 (Internal Transcribed Spacer) regions. Previously, the evolutional diversity of algae has been difficult to decode due to the inability design universal primers that amplify specific marker genes across diverse algal species. In this study, our method provided a rapid and universal approach to decode the 18-5.8-28S rRNA repeat unit in three green algal species. In addition, the completely sequenced 18-5.8-28S rRNA repeated units provided a solid nuclear marker for phylogenetic and evolutionary analysis for green algae for the first time.
An Efficiency Analysis of Augmented Reality Marker Recognition Algorithm
Directory of Open Access Journals (Sweden)
Kurpytė Dovilė
2014-05-01
Full Text Available The article reports on the investigation of augmented reality system which is designed for identification and augmentation of 100 different square markers. Marker recognition efficiency was investigated by rotating markers along x and y axis directions in range from −90° to 90°. Virtual simulations of four environments were developed: a an intense source of light, b an intense source of light falling from the left side, c the non-intensive light source falling from the left side, d equally falling shadows. The graphics were created using the OpenGL graphics computer hardware interface; image processing was programmed in C++ language using OpenCV, while augmented reality was developed in Java programming language using NyARToolKit. The obtained results demonstrate that augmented reality marker recognition algorithm is accurate and reliable in the case of changing lighting conditions and rotational angles - only 4 % markers were unidentified. Assessment of marker recognition efficiency let to propose marker classification strategy in order to use it for grouping various markers into distinct markers’ groups possessing similar recognition properties.
Arshed, Muhammad Jefte C; Valdez, Marcos B; Alejandro, Grecebio Jonathan D
2017-01-01
The pantropical genus Lasianthus Jack is identified for high phenotypic plasticity making traditional taxonomic identification difficult. Having some members with important medicinal properties, a precise complimentary identification through DNA barcoding is needed for species delineation. In this study, 12 samples representing six Philippine Lasianthus species were used to determine the most efficient barcoding loci among the cpDNA markers ( mat K, rbc L, rps 16, and trn T-F) and nrDNA (ITS) based on the criteria of universality, discriminatory power, and resolution of species. The results revealed that ITS has the recommended primer universality, greatest interspecific divergences, and average resolution of species. Among the cpDNA markers, mat K and rbc L are recommended but with minimal resolution of species. While trn T-F showed moderate interspecific variations and resolution of Lasianthus species, rps 16 has the lowest interspecific divergence and resolution of species. Consequently, ITS is the potential ideal DNA barcode for Lasianthus species. ITS, mat K, and rps 16 markers have the excellent amplification and sequence qualityITS marker has the highest interspecific divergence with the maximum values, followed by mat K, rbc L, trn T-F, and rps 16, respectivelyAll markers except rps 16 yielded average resolution to Lasianthus speciesITS marker is the most ideal locus in terms of excellent universality, high interspecific discriminatory ability, and average species resolution. Abbreviations used: ITS: Internal Transcribe Spacer, mat K: maturase K, rbc L: ribulose-1,5-biphospahte-carboxylase, rps 16: ribosomal protein 16 small subunit gene.
Monitoring external and internal loads of brazilian soccer referees during official matches.
Costa, Eduardo C; Vieira, Caio M A; Moreira, Alexandre; Ugrinowitsch, Carlos; Castagna, Carlo; Aoki, Marcelo S
2013-01-01
This study aimed to assess the external and internal loads of Brazilian soccer referees during official matches. A total of 11 field referees (aged 36.2 ± 7.5 years) were monitored during 35 matches. The external (distance covered, mean and maximal speed) and internal load parameters (session ratings of perceived exertion [RPE] training load [TL], Edwards' TL, and time spent in different heart rate [HR] zones) were assessed in 3-4 matches per referee. External load parameters were measured using a wrist Global Positioning System (GPS) receiver. No differences in distance covered (5.219 ± 205 vs. 5.230 ± 237 m) and maximal speed (19.3 ± 1.0 vs. 19.4 ± 1.4 km·h(-1)) were observed between the halves of the matches (p > 0.05). However, the mean speed was higher in the first half of the matches (6.6 ± 0.4 vs. 6.4 ± 0.3 km·h(-1)) (p external and internal load demands during official matches. The portable GPS/HR monitors and session RPE method can provide relevant information regarding the magnitude of the physiological strain during official matches. Key PointsHigh external and internal loads were imposed on Brazilian soccer referees during official matches.There was a high positive correlation between a subjective marker of internal load (session RPE) and parameters of external load (distance covered between 90-100% of HRmax and maximal speed).There was a high positive correlation between session RPE method and Edwards' method.Session RPE seems to be a reliable marker of internal load.The portable GPS/HR monitors and the session RPE method can provide relevant information regarding the magnitude of external and internal loads of soccer referees during official matches.
Plant breeding with marker-assisted selection in Brazil
Directory of Open Access Journals (Sweden)
Ney Sussumu Sakiyama
2014-03-01
Full Text Available Over the past three decades, molecular marker studies reached extraordinary advances, especially for sequencing and bioinformatics techniques. Marker-assisted selection became part of the breeding program routines of important seed companies, in order to accelerate and optimize the cultivar developing processes. Private seed companies increasingly use marker-assisted selection, especially for the species of great importance to the seed market, e.g. corn, soybean, cotton, and sunflower. In the Brazilian public institutions few breeding programs use it efficiently. The possible reasons are: lack of know-how, lack of appropriate laboratories, few validated markers, high cost, and lack of urgency in obtaining cultivars. In this article we analyze the use and the constraints of marker-assisted selection in plant breeding programs of Brazilian public institutes
Fujii, T.; Gramajo, H.C.; Takano, E.; Bibb, M.J.
1996-01-01
redD and actII-ORF4, regulatory genes required for synthesis of the antibiotics undecylprodigiosin and actinorhodin by Streptomyces coelicolor A3(2), were transcribed in vitro by an RNA polymerase holoenzyme containing σhrdD. Disruption of hrdD had no effect on antibiotic production, indicating that
Kulaeva, Olga A; Zhernakov, Aleksandr I; Afonin, Alexey M; Boikov, Sergei S; Sulima, Anton S; Tikhonovich, Igor A; Zhukov, Vladimir A
2017-01-01
Pea (Pisum sativum L.) is the oldest model object of plant genetics and one of the most agriculturally important legumes in the world. Since the pea genome has not been sequenced yet, identification of genes responsible for mutant phenotypes or desirable agricultural traits is usually performed via genetic mapping followed by candidate gene search. Such mapping is best carried out using gene-based molecular markers, as it opens the possibility for exploiting genome synteny between pea and its close relative Medicago truncatula Gaertn., possessing sequenced and annotated genome. In the last 5 years, a large number of pea gene-based molecular markers have been designed and mapped owing to the rapid evolution of "next-generation sequencing" technologies. However, the access to the complete set of markers designed worldwide is limited because the data are not uniformed and therefore hard to use. The Pea Marker Database was designed to combine the information about pea markers in a form of user-friendly and practical online tool. Version 1 (PMD1) comprises information about 2484 genic markers, including their locations in linkage groups, the sequences of corresponding pea transcripts and the names of related genes in M. truncatula. Version 2 (PMD2) is an updated version comprising 15944 pea markers in the same format with several advanced features. To test the performance of the PMD, fine mapping of pea symbiotic genes Sym13 and Sym27 in linkage groups VII and V, respectively, was carried out. The results of mapping allowed us to propose the Sen1 gene (a homologue of SEN1 gene of Lotus japonicus (Regel) K. Larsen) as the best candidate gene for Sym13, and to narrow the list of possible candidate genes for Sym27 to ten, thus proving PMD to be useful for pea gene mapping and cloning. All information contained in PMD1 and PMD2 is available at www.peamarker.arriam.ru.
MOLECULAR MARKERS FOR METASTATIC PROSTATE ADENOCARCINOMA
Directory of Open Access Journals (Sweden)
I. S. Kunin
2012-01-01
Full Text Available The search of molecular markers of metastasing and prognosis in prostate cancer remains an urgent task. In this study, we investigated the relationship of gene expression heparanase-1 (HPSE1 and D-glucuronil C5-epimerase (GLCE with early disease relapse and metastasis of a 2,5−3 years after diagnosis. It was shown that the ratio of the expression levels of genes HPSE1/GLCE > 1 may serve as a prognostic relapse marker and trends of the tumour to metastasis. The data obtained suggest to use this option as a molecular marker for the diagnostics of metastatic process and the disease prognosis.
A molecular marker map for roses
Debener, T.; Mattiesch, L.; Vosman, B.
2001-01-01
n addition to an existing core map for diploid roses which comprised 305 molecular markers 60 additional markers were mapped to extend the map. As a first application of the information contained in the map, the map position of a resistance gene from roses, Rdr1, was determined by identifying
Invisible marker based augmented reality system
Park, Hanhoon; Park, Jong-Il
2005-07-01
Augmented reality (AR) has recently gained significant attention. The previous AR techniques usually need a fiducial marker with known geometry or objects of which the structure can be easily estimated such as cube. Placing a marker in the workspace of the user can be intrusive. To overcome this limitation, we present an AR system using invisible markers which are created/drawn with an infrared (IR) fluorescent pen. Two cameras are used: an IR camera and a visible camera, which are positioned in each side of a cold mirror so that their optical centers coincide with each other. We track the invisible markers using IR camera and visualize AR in the view of visible camera. Additional algorithms are employed for the system to have a reliable performance in the cluttered background. Experimental results are given to demonstrate the viability of the proposed system. As an application of the proposed system, the invisible marker can act as a Vision-Based Identity and Geometry (VBIG) tag, which can significantly extend the functionality of RFID. The invisible tag is the same as RFID in that it is not perceivable while more powerful in that the tag information can be presented to the user by direct projection using a mobile projector or by visualizing AR on the screen of mobile PDA.
Prognostic molecular markers in early breast cancer
International Nuclear Information System (INIS)
Esteva, Francisco J; Hortobagyi, Gabriel N
2004-01-01
A multitude of molecules involved in breast cancer biology have been studied as potential prognostic markers. In the present review we discuss the role of established molecular markers, as well as potential applications of emerging new technologies. Those molecules used routinely to make treatment decisions in patients with early-stage breast cancer include markers of proliferation (e.g. Ki-67), hormone receptors, and the human epidermal growth factor receptor 2. Tumor markers shown to have prognostic value but not used routinely include cyclin D 1 and cyclin E, urokinase-like plasminogen activator/plasminogen activator inhibitor, and cathepsin D. The level of evidence for other molecular markers is lower, in part because most studies were retrospective and not adequately powered, making their findings unsuitable for choosing treatments for individual patients. Gene microarrays have been successfuly used to classify breast cancers into subtypes with specific gene expression profiles and to evaluate prognosis. RT-PCR has also been used to evaluate expression of multiple genes in archival tissue. Proteomics technologies are in development
Assessing Date Palm Genetic Diversity Using Different Molecular Markers.
Atia, Mohamed A M; Sakr, Mahmoud M; Adawy, Sami S
2017-01-01
Molecular marker technologies which rely on DNA analysis provide powerful tools to assess biodiversity at different levels, i.e., among and within species. A range of different molecular marker techniques have been developed and extensively applied for detecting variability in date palm at the DNA level. Recently, the employment of gene-targeting molecular marker approaches to study biodiversity and genetic variations in many plant species has increased the attention of researchers interested in date palm to carry out phylogenetic studies using these novel marker systems. Molecular markers are good indicators of genetic distances among accessions, because DNA-based markers are neutral in the face of selection. Here we describe the employment of multidisciplinary molecular marker approaches: amplified fragment length polymorphism (AFLP), start codon targeted (SCoT) polymorphism, conserved DNA-derived polymorphism (CDDP), intron-targeted amplified polymorphism (ITAP), simple sequence repeats (SSR), and random amplified polymorphic DNA (RAPD) to assess genetic diversity in date palm.
International Nuclear Information System (INIS)
McNair, Helen A.; Hansen, Vibeke N.; Parker, Christopher; Evans, Phil M.; Norman, Andrew; Miles, Elizabeth; Harris, Emma J.; Del-Acroix, Louise; Smith, Elizabeth; Keane, Richard; Khoo, Vincent S.; Thompson, Alan C.; Dearnaley, David P.
2008-01-01
Purpose: To evaluate the utility of intraprostatic markers in the treatment verification of prostate cancer radiotherapy. Specific aims were: to compare the effectiveness of offline correction protocols, either using gold markers or bony anatomy; to estimate the potential benefit of online correction protocol's using gold markers; to determine the presence and effect of intrafraction motion. Methods and Materials: Thirty patients with three gold markers inserted had pretreatment and posttreatment images acquired and were treated using an offline correction protocol and gold markers. Retrospectively, an offline protocol was applied using bony anatomy and an online protocol using gold markers. Results: The systematic errors were reduced from 1.3, 1.9, and 2.5 mm to 1.1, 1.1, and 1.5 mm in the right-left (RL), superoinferior (SI), and anteroposterior (AP) directions, respectively, using the offline correction protocol and gold markers instead of bony anatomy. The subsequent decrease in margins was 1.7, 3.3, and 4 mm in the RL, SI, and AP directions, respectively. An offline correction protocol combined with an online correction protocol in the first four fractions reduced random errors further to 0.9, 1.1, and 1.0 mm in the RL, SI, and AP directions, respectively. A daily online protocol reduced all errors to <1 mm. Intrafraction motion had greater impact on the effectiveness of the online protocol than the offline protocols. Conclusions: An offline protocol using gold markers is effective in reducing the systematic error. The value of online protocols is reduced by intrafraction motion
Nuclear medicine markers of tumor oxygenation and radioresistance
International Nuclear Information System (INIS)
Chapman, J. Donald; Schneider, R.H.; Stobbe, C.C.; Kim, E.; Engelhardt, E.L.; Coia, L.
1996-01-01
Purpose/Objective: The objective of this research project was to synthesize, purify, radiolabel and characterize second-generation nuclear medicine markers of tissue oxygenation with properties superior to iodoazomycin arabinoside (IAZA) and to validate the hypoxia-marking activity of optimal compounds by independent measurements of tumor oxygenation and tumor radioresistance. Materials and Methods: Six hypoxic markers of the iodoazomycin nucleoside class with water solubilities greater than IAZA were synthesized by published procedures. The markers were purified, chemically characterized and labeled with Iodine-125 or Iodine-131. Absolute rates of marker ligation to the macromolecules of hypoxic EMT-6 tumor cells in vitro were determined as a function of marker concentration and used to establish relative marker effectiveness. Hypoxic marking activity in tumors was determined from tumor/blood (T/B) and tumor/muscle (T/M) ratios of radiolabelled marker in EMT-6 tumor-bearing C.B17/Icr scid mice. The optimal marker was administered to R3327-H and R3327-AT tumor-bearing Fischer X Copenhagen rats for estimates of tumor oxygenation by T/B and T/M ratios. Oxygen distributions in the same tumors were obtained with the Eppendorf pO 2 Histograph. The radioresistance of individual tumors was determined from in vitro plating efficiencies of cells released from tumors which had been irradiated in vivo with 20 Gy Cs-137 γ-rays. Results: Of the six iodinated azomycin nucleosides investigated, five were novel markers and all had water solubilities higher than IAZA. Iodinated azomycin xylopyranoside (β-D-IAZXP) was selected as the optimal marker of this class since it 1) exhibited the highest absolute rate of ligation to hypoxic tumor cells in vitro, 2) had the fastest plasma clearance rate in tumor-bearing mice and 3) yielded high T/B ratios in both the mouse and rat tumor models employed in this study. Planar nuclear medicine images of (I-131) β-D-IAZXP in tumor-bearing rats
Indian Academy of Sciences (India)
2EH Graham Centre for Agricultural Innovation (NSW Department of Industry and Investment and Charles Sturt. University), P. O. Box 588 Wagga Wagga, NSW 2650, Australia. 3Guangxi .... and obtain marker statistics. The exact order of the ...
Lipid-related markers and cardiovascular disease prediction
DEFF Research Database (Denmark)
Di Angelantonio, Emanuele; Gao, Pei; Pennells, Lisa
2012-01-01
The value of assessing various emerging lipid-related markers for prediction of first cardiovascular events is debated.......The value of assessing various emerging lipid-related markers for prediction of first cardiovascular events is debated....
Molecular Diagnostics of Arthroconidial Yeasts, Frequent Pulmonary Opportunists.
Kaplan, Engin; Al-Hatmi, Abdullah M S; Ilkit, Macit; Gerrits van den Ende, A H G; Hagen, Ferry; Meis, Jacques F; de Hoog, G Sybren
2018-01-01
Magnusiomyces capitatus and Saprochaete clavata are members of the clade of arthroconidial yeasts that represent emerging opportunistic pulmonary pathogens in immunocompromised patients. Given that standard ribosomal DNA (rDNA) identification often provides confusing results, in this study, we analyzed 34 isolates with the goal of finding new genetic markers for classification using multilocus sequencing and amplified fragment length polymorphism (AFLP). The interspecific similarity obtained using rDNA markers (the internal transcribed spacer [ITS] and large subunit regions) was in the range of 96 to 99%, whereas that obtained using protein-coding loci ( Rbp2 , Act , and Tef1α ) was lower at 89.4 to 95.2%. Ultimately, Rbp2 was selected as the best marker for species distinction. On the basis of cloned ITS data, some strains proved to be misidentified in comparison with the identities obtained with phenotypic characters, protein sequences, and AFLP profiles, indicating that different copies of the ribosomal operon were present in a single species. Antifungal susceptibility testing revealed that voriconazole had the lowest MIC against M. capitatus , while amphotericin B had the lowest MIC against S. clavata Both species exhibited in vitro resistance to fluconazole and micafungin. Copyright © 2017 American Society for Microbiology.
A validated methodology for genetic identification of tuna species (genus Thunnus.
Directory of Open Access Journals (Sweden)
Jordi Viñas
2009-10-01
Full Text Available Tuna species of the genus Thunnus, such as the bluefin tunas, are some of the most important and yet most endangered trade fish in the world. Identification of these species in traded forms, however, may be difficult depending on the presentation of the products, which may hamper conservation efforts on trade control. In this paper, we validated a genetic methodology that can fully distinguish between the eight Thunnus species from any kind of processed tissue.After testing several genetic markers, a complete discrimination of the eight tuna species was achieved using Forensically Informative Nucleotide Sequencing based primarily on the sequence variability of the hypervariable genetic marker mitochondrial DNA control region (mtDNA CR, followed, in some specific cases, by a second validation by a nuclear marker rDNA first internal transcribed spacer (ITS1. This methodology was able to distinguish all tuna species, including those belonging to the subgenus Neothunnus that are very closely related, and in consequence can not be differentiated with other genetic markers of lower variability. This methodology also took into consideration the presence of introgression that has been reported in past studies between T. thynnus, T. orientalis and T. alalunga. Finally, we applied the methodology to cross-check the species identity of 26 processed tuna samples.Using the combination of two genetic markers, one mitochondrial and another nuclear, allows a full discrimination between all eight tuna species. Unexpectedly, the genetic marker traditionally used for DNA barcoding, cytochrome oxidase 1, could not differentiate all species, thus its use as a genetic marker for tuna species identification is questioned.
Biochemical Markers in Neurocritical Care
Directory of Open Access Journals (Sweden)
Omidvar Rezae
2016-07-01
Full Text Available During the past two decades, a variety of serum or cerebrospinal fluid (CSF biochemical markers in daily clinical practice have been recommended to diagnose and monitor diverse diseases or pathologic situations. It will be essential to develop a panel of biomarkers, to be suitable for evaluation of treatment efficacy, representing distinct phases of injury and recovery and consider the temporal profile of those. Among the possible and different biochemical markers, S100b appeared to fulfill many of optimized criteria of an ideal marker. S100b, a cytosolic low molecular weight dimeric calciumbinding protein from chromosome 21, synthesized in glial cells throughout the CNS, an homodimeric diffusible, belongs to a family of closely related protein, predominantly expressed by astrocytes and Schwann cells and a classic immunohistochemical marker for these cells, is implicated in brain development and neurophysiology. Of the 3 isoforms of S-100, the BB subunit (S100B is present in high concentrations in central and peripheral glial and Schwann cells, Langerhans and anterior pituitary cells, fat, muscle, and bone marrow tissues. The biomarker has shown to be a sensitive marker of clinical and subclinical cerebral damage, such as stroke, traumatic brain injury, and spinal cord injury. Increasing evidence suggests that the biomarker plays a double function as an intracellular regulator and an extracellular signal of the CNS. S100b is found in the cytoplasm in a soluble form and also is associated with intracellular membranes, centrosomes, microtubules, and type III intermediate filaments. Their genomic organization now is known, and many of their target proteins have been identified, although the mechanisms of regulating S100b secretion are not completely understood and appear to be related to many factors, such as the proinflammatory cytokines, tumor necrosis factor alpha (TNF-a, interleukin (IL-1b, and metabolic stress.
Monte Carlo simulations on marker grouping and ordering.
Wu, J; Jenkins, J; Zhu, J; McCarty, J; Watson, C
2003-08-01
Four global algorithms, maximum likelihood (ML), sum of adjacent LOD score (SALOD), sum of adjacent recombinant fractions (SARF) and product of adjacent recombinant fraction (PARF), and one approximation algorithm, seriation (SER), were used to compare the marker ordering efficiencies for correctly given linkage groups based on doubled haploid (DH) populations. The Monte Carlo simulation results indicated the marker ordering powers for the five methods were almost identical. High correlation coefficients were greater than 0.99 between grouping power and ordering power, indicating that all these methods for marker ordering were reliable. Therefore, the main problem for linkage analysis was how to improve the grouping power. Since the SER approach provided the advantage of speed without losing ordering power, this approach was used for detailed simulations. For more generality, multiple linkage groups were employed, and population size, linkage cutoff criterion, marker spacing pattern (even or uneven), and marker spacing distance (close or loose) were considered for obtaining acceptable grouping powers. Simulation results indicated that the grouping power was related to population size, marker spacing distance, and cutoff criterion. Generally, a large population size provided higher grouping power than small population size, and closely linked markers provided higher grouping power than loosely linked markers. The cutoff criterion range for achieving acceptable grouping power and ordering power differed for varying cases; however, combining all situations in this study, a cutoff criterion ranging from 50 cM to 60 cM was recommended for achieving acceptable grouping power and ordering power for different cases.
Development of RIA kits for tumor-markers monitoring
International Nuclear Information System (INIS)
Suprarop, P.
1997-01-01
All reagents for tumor markers assays are imported from various manufacturers mainly CIS bio international. The average cost of these reagents is ranged from 80-150 bath/test (2-4 dollars test). The screening test for cancers could not be done especially in other regions of Thailand whose budgets and resources are so limited. If the reagents are made locally, many laboratories can perform the tests and use as primary diagnosis, screening or monitor the course of the disease following treatment. In addition, these reagents could help clinicians and give complementary information on the tumor status to improve quality of life in Thailand. Research objectives include: 1. Development of IRMA reagent kits suitable for diagnosing staging and monitoring prostrate and breast cancer. 2. Transfer of technology and reagent kits to relevant laboratories in Thailand. 3. Routine distribution of the reagents kits to the end users
International Nuclear Information System (INIS)
Yamazaki, Rie; Nishioka, Seiko; Date, Hiroyuki; Shirato, Hiroki; Koike, Takao; Nishioka, Takeshi
2012-01-01
The use of stereotactic body radiotherapy (SBRT) is rapidly increasing. Presently, the most accurate method uses fiducial markers implanted near the tumor. A shortcoming of this method is that the beams turn off during the majority of the respiratory cycle, resulting in a prolonged treatment time. Recent advances in collimation technology have enabled continuous irradiation to a moving tumor. However, the lung is a dynamic organ characterized by inhalation exhalation cycles, during which marker/tumor geometry may change (i.e., misalignment), resulting in under-dosing to the tumor. Eight patients with lung cancer who were candidates for stereotactic radiotherapy were examined with 4D high-resolution CT. As a marker surrogate, virtual bronchoscopy using the pulmonary artery (VBPA) was conducted. To detect possible marker/tumor misalignment during the respiration cycle, the distance between the peripheral bronchus, where a marker could be implanted, and the center of gravity of a tumor were calculated for each respiratory phase. When the respiration cycle was divided into 10 phases, the median value was significantly larger for the 30%-70% respiratory phases compared to that for the 10% respiratory phase (P<0.05, Mann–Whitney U-test). These results demonstrate that physiological aspect must be considered when continuous tumor tracking is applied to a moving tumor. To minimize an “additional” internal target volume (ITV) margin, a marker should be placed approximately 2.5 cm from the tumor
Farrelly, Cormac; Lal, Priti; Trerotola, Scott O; Nadolski, Gregory J; Watts, Micah M; Gorrian, Catherine Mc; Guzzo, Thomas J
2016-05-01
To correlate prostate-specific antigen (PSA), free to total PSA percentage (fPSA%) and prostatic acid phosphatase (PAP) levels from peripheral and pelvic venous samples with prostatectomy specimens in patients with prostate adenocarcinoma and borderline elevation of PSA. In this prospective institutional review board approved study, 7 patients with biopsy proven prostate cancer had a venous sampling procedure prior to prostatectomy (mean 3.2 days, range 1-7). Venous samples were taken from a peripheral vein (PVS), the right internal iliac vein, a deep right internal iliac vein branch, left internal iliac vein and a deep left internal iliac vein branch. Venous sampling results were compared to tumour volume, laterality, stage and grade in prostatectomy surgical specimens. Mean PVS PSA was 4.29, range 2.3-6 ng/ml. PSA and PAP values in PVS did not differ significantly from internal iliac or deep internal iliac vein samples (p > 0.05). fPSA% was significantly higher in internal iliac (p = 0.004) and deep internal iliac (p = 0.003) vein samples compared to PVS. One of 7 patients had unilateral tumour only. This patient, with left-sided tumour, had a fPSA% of 6, 6, 6, 14 and 12 in his peripheral, right internal iliac, deep right internal iliac branch, left internal iliac and deep left internal iliac branch samples respectively. There were no adverse events. fPSA%, unlike total PSA or PAP, is significantly higher in pelvic vein compared to peripheral vein samples when prostate cancer is present. Larger studies including patients with higher PSA values are warranted to further investigate this counterintuitive finding.
Quality assurance for the IAEA International Database on Irradiated Nuclear Graphite Properties
International Nuclear Information System (INIS)
Wickham, A.J.; Humbert, D.
2006-06-01
Consideration has been given to the process of Quality Assurance applied to data entered into current versions of the IAEA International Database on Irradiated Nuclear Graphite Properties. Originally conceived simply as a means of collecting and preserving data on irradiation experiments and reactor operation, the data are increasingly being utilised for the preparation of safety arguments and in the design of new graphites for forthcoming generations of graphite-moderated plant. Under these circumstances, regulatory agencies require assurances that the data are of appropriate accuracy and correctly transcribed, that obvious errors in the original documentation are either highlighted or corrected, etc., before they are prepared to accept analyses built upon these data. The processes employed in the data transcription are described in this document, and proposals are made for the categorisation of data and for error reporting by Database users. (author)
Marker optimization for facial motion acquisition and deformation.
Le, Binh H; Zhu, Mingyang; Deng, Zhigang
2013-11-01
A long-standing problem in marker-based facial motion capture is what are the optimal facial mocap marker layouts. Despite its wide range of potential applications, this problem has not yet been systematically explored to date. This paper describes an approach to compute optimized marker layouts for facial motion acquisition as optimization of characteristic control points from a set of high-resolution, ground-truth facial mesh sequences. Specifically, the thin-shell linear deformation model is imposed onto the example pose reconstruction process via optional hard constraints such as symmetry and multiresolution constraints. Through our experiments and comparisons, we validate the effectiveness, robustness, and accuracy of our approach. Besides guiding minimal yet effective placement of facial mocap markers, we also describe and demonstrate its two selected applications: marker-based facial mesh skinning and multiresolution facial performance capture.
[Prognostic and predictive molecular markers for urologic cancers].
Hartmann, A; Schlomm, T; Bertz, S; Heinzelmann, J; Hölters, S; Simon, R; Stoehr, R; Junker, K
2014-04-01
Molecular prognostic factors and genetic alterations as predictive markers for cancer-specific targeted therapies are used today in the clinic for many malignancies. In recent years, many molecular markers for urogenital cancers have also been identified. However, these markers are not clinically used yet. In prostate cancer, novel next-generation sequencing methods revealed a detailed picture of the molecular changes. There is growing evidence that a combination of classical histopathological and validated molecular markers could lead to a more precise estimation of prognosis, thus, resulting in an increasing number of patients with active surveillance as a possible treatment option. In patients with urothelial carcinoma, histopathological factors but also the proliferation of the tumor, mutations in oncogenes leading to an increasing proliferation rate and changes in genes responsible for invasion and metastasis are important. In addition, gene expression profiles which could distinguish aggressive tumors with high risk of metastasis from nonmetastasizing tumors have been recently identified. In the future, this could potentially allow better selection of patients needing systemic perioperative treatment. In renal cell carcinoma, many molecular markers that are associated with metastasis and survival have been identified. Some of these markers were also validated as independent prognostic markers. Selection of patients with primarily organ-confined tumors and increased risk of metastasis for adjuvant systemic therapy could be clinically relevant in the future.
2008-01-01
Müra-rock'i viljelevast USA duost Magik Markers (ansambel osaleb režissöör Veiko Õunapuu uue mängufilmi "Püha Tõnu kiusamine" võtetel, kontsert 15. nov. Tartus klubis Trehv, vt. www.magikmarkers.audiosport.org.)
2012-01-01
Background Breeding of fire blight resistant scions and rootstocks is a goal of several international apple breeding programs, as options are limited for management of this destructive disease caused by the bacterial pathogen Erwinia amylovora. A broad, large-effect quantitative trait locus (QTL) for fire blight resistance has been reported on linkage group 3 of Malus ‘Robusta 5’. In this study we identified markers derived from putative fire blight resistance genes associated with the QTL by integrating further genetic mapping studies with bioinformatics analysis of transcript profiling data and genome sequence databases. Results When several defined E.amylovora strains were used to inoculate three progenies from international breeding programs, all with ‘Robusta 5’ as a common parent, two distinct QTLs were detected on linkage group 3, where only one had previously been mapped. In the New Zealand ‘Malling 9’ X ‘Robusta 5’ population inoculated with E. amylovora ICMP11176, the proximal QTL co-located with SNP markers derived from a leucine-rich repeat, receptor-like protein ( MxdRLP1) and a closely linked class 3 peroxidase gene. While the QTL detected in the German ‘Idared’ X ‘Robusta 5’ population inoculated with E. amylovora strains Ea222_JKI or ICMP11176 was approximately 6 cM distal to this, directly below a SNP marker derived from a heat shock 90 family protein gene ( HSP90). In the US ‘Otawa3’ X ‘Robusta5’ population inoculated with E. amylovora strains Ea273 or E2002a, the position of the LOD score peak on linkage group 3 was dependent upon the pathogen strains used for inoculation. One of the five MxdRLP1 alleles identified in fire blight resistant and susceptible cultivars was genetically associated with resistance and used to develop a high resolution melting PCR marker. A resistance QTL detected on linkage group 7 of the US population co-located with another HSP90 gene-family member and a WRKY transcription factor
Serum tumor markers in pediatric osteosarcoma: a summary review
Directory of Open Access Journals (Sweden)
Savitskaya Yulia A
2012-03-01
Full Text Available Abstract Osteosarcoma is the most common primary high-grade bone tumor in both adolescents and children. Early tumor detection is key to ensuring effective treatment. Serum marker discovery and validation for pediatric osteosarcoma has accelerated in recent years, coincident with an evolving understanding of molecules and their complex interactions, and the compelling need for improved pediatric osteosarcoma outcome measures in clinical trials. This review gives a short overview of serological markers for pediatric osteosarcoma, and highlights advances in pediatric osteosarcoma-related marker research within the past year. Studies in the past year involving serum markers in patients with pediatric osteosarcoma can be assigned to one of four categories, i.e., new approaches and new markers, exploratory studies in specialized disease subsets, large cross-sectional validation studies, and longitudinal studies, with and without an intervention. Most of the studies have examined the association of a serum marker with some aspect of the natural history of pediatric osteosarcoma. As illustrated by the many studies reviewed, several serum markers are emerging that show a credible association with disease modification. The expanding pool of informative osteosarcoma-related markers is expected to impact development of therapeutics for pediatric osteosarcoma positively and, it is hoped, ultimately clinical care. Combinations of serum markers of natural immunity, thyroid hormone homeostasis, and bone tumorigenesis may be undertaken together in patients with pediatric osteosarcoma. These serum markers in combination may do better. The potential effect of an intrinsic dynamic balance of tumor angiogenesis residing within a single hormone (tri-iodothyronine is an attractive concept for regulation of vascularization in pediatric osteosarcoma.
Esteghamati, A; Aryan, Z; Esteghamati, A; Nakhjavani, M
2014-11-01
This study aimed to compare concentrations of serum 25-hydroxy vitamin D and inflammatory markers in metabolically healthy obesity (MHO) and metabolically unhealthy obesity (MUO), and to determine whether the relationship between vitamin D levels and both cardiometabolic and inflammatory markers differs between MHO and MUO. This cross-sectional study comprised 4391 obese subjects aged>18 years. A panel of cardiometabolic and inflammatory markers, including anthropometric variables, glycaemic indices, lipid profiles, liver enzymes, homocysteine, C-reactive protein (CRP), fibrinogen and serum 25-hydroxy vitamin D levels, was investigated. All cardiometabolic and inflammatory markers in MHO and MUO as well as in vitamin D deficiency were compared. Prevalence of MHO was 41.9% in our obese subjects using International Diabetes Federation criteria. Considering insulin resistance and inflammation, the prevalence of MHO was 38.4%. Individuals with MHO had significantly higher vitamin D concentrations compared with MUO, and this difference in vitamin D status persisted after accounting for BMI and waist circumference. Subjects with MHO had significantly better metabolic status, lower liver enzymes, lower inflammatory markers and higher serum 25-hydroxy vitamin D than those with MUO. Associations between vitamin D levels and inflammatory and cardiometabolic markers differed according to MHO/MUO status. Among MUO subjects, vitamin D deficiency was associated with higher liver marker and homocysteine levels. Serum vitamin D was negatively associated with fasting plasma glucose and HbA1c in MHO only. Serum 25-hydroxy vitamin D levels were lower in MUO vs MHO, and reduced vitamin D concentrations were more strongly associated with cardiometabolic and inflammatory markers in MUO than in MHO subjects. These findings suggest that a deficiency in vitamin D could be a key component of MUO. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Jin, Peng; van der Horst, Astrid; de Jong, Rianne; van Hooft, Jeanin E.; Kamphuis, Martijn; van Wieringen, Niek; Machiels, Melanie; Bel, Arjan; Hulshof, Maarten C. C. M.; Alderliesten, Tanja
2015-01-01
The aim of this study was to quantify interfractional esophageal tumor position variation using markers and investigate the use of markers for setup verification. Sixty-five markers placed in the tumor volumes of 24 esophageal cancer patients were identified in computed tomography (CT) and follow-up
Energy Technology Data Exchange (ETDEWEB)
Farrelly, Cormac, E-mail: farrellycormac@gmail.com [Hospital of the University of Pennsylvania, Perelman School of Medicine at the University of Pennsylvania, Division of Interventional Radiology, Department of Radiology (United States); Lal, Priti [University of Pennsylvania Perelman School of Medicine, Department of Pathology and Laboratory Medicine (United States); Trerotola, Scott O.; Nadolski, Gregory J.; Watts, Micah M. [Hospital of the University of Pennsylvania, Perelman School of Medicine at the University of Pennsylvania, Division of Interventional Radiology, Department of Radiology (United States); Gorrian, Catherine Mc. [Mater Misericordiae University Hospital, University College Dublin School of Medicine & Medical Science (Ireland); Guzzo, Thomas J. [University of Pennsylvania Perelman School of Medicine, Department of Urology and Surgery (United States)
2016-05-15
PurposeTo correlate prostate-specific antigen (PSA), free to total PSA percentage (fPSA%) and prostatic acid phosphatase (PAP) levels from peripheral and pelvic venous samples with prostatectomy specimens in patients with prostate adenocarcinoma and borderline elevation of PSA.Materials and MethodsIn this prospective institutional review board approved study, 7 patients with biopsy proven prostate cancer had a venous sampling procedure prior to prostatectomy (mean 3.2 days, range 1–7). Venous samples were taken from a peripheral vein (PVS), the right internal iliac vein, a deep right internal iliac vein branch, left internal iliac vein and a deep left internal iliac vein branch. Venous sampling results were compared to tumour volume, laterality, stage and grade in prostatectomy surgical specimens.ResultsMean PVS PSA was 4.29, range 2.3–6 ng/ml. PSA and PAP values in PVS did not differ significantly from internal iliac or deep internal iliac vein samples (p > 0.05). fPSA% was significantly higher in internal iliac (p = 0.004) and deep internal iliac (p = 0.003) vein samples compared to PVS. One of 7 patients had unilateral tumour only. This patient, with left–sided tumour, had a fPSA% of 6, 6, 6, 14 and 12 in his peripheral, right internal iliac, deep right internal iliac branch, left internal iliac and deep left internal iliac branch samples respectively. There were no adverse events.ConclusionfPSA%, unlike total PSA or PAP, is significantly higher in pelvic vein compared to peripheral vein samples when prostate cancer is present. Larger studies including patients with higher PSA values are warranted to further investigate this counterintuitive finding.
International Nuclear Information System (INIS)
Farrelly, Cormac; Lal, Priti; Trerotola, Scott O.; Nadolski, Gregory J.; Watts, Micah M.; Gorrian, Catherine Mc.; Guzzo, Thomas J.
2016-01-01
PurposeTo correlate prostate-specific antigen (PSA), free to total PSA percentage (fPSA%) and prostatic acid phosphatase (PAP) levels from peripheral and pelvic venous samples with prostatectomy specimens in patients with prostate adenocarcinoma and borderline elevation of PSA.Materials and MethodsIn this prospective institutional review board approved study, 7 patients with biopsy proven prostate cancer had a venous sampling procedure prior to prostatectomy (mean 3.2 days, range 1–7). Venous samples were taken from a peripheral vein (PVS), the right internal iliac vein, a deep right internal iliac vein branch, left internal iliac vein and a deep left internal iliac vein branch. Venous sampling results were compared to tumour volume, laterality, stage and grade in prostatectomy surgical specimens.ResultsMean PVS PSA was 4.29, range 2.3–6 ng/ml. PSA and PAP values in PVS did not differ significantly from internal iliac or deep internal iliac vein samples (p > 0.05). fPSA% was significantly higher in internal iliac (p = 0.004) and deep internal iliac (p = 0.003) vein samples compared to PVS. One of 7 patients had unilateral tumour only. This patient, with left–sided tumour, had a fPSA% of 6, 6, 6, 14 and 12 in his peripheral, right internal iliac, deep right internal iliac branch, left internal iliac and deep left internal iliac branch samples respectively. There were no adverse events.ConclusionfPSA%, unlike total PSA or PAP, is significantly higher in pelvic vein compared to peripheral vein samples when prostate cancer is present. Larger studies including patients with higher PSA values are warranted to further investigate this counterintuitive finding.
Poly A tail length analysis of in vitro transcribed mRNA by LC-MS.
Beverly, Michael; Hagen, Caitlin; Slack, Olga
2018-02-01
The 3'-polyadenosine (poly A) tail of in vitro transcribed (IVT) mRNA was studied using liquid chromatography coupled to mass spectrometry (LC-MS). Poly A tails were cleaved from the mRNA using ribonuclease T1 followed by isolation with dT magnetic beads. Extracted tails were then analyzed by LC-MS which provided tail length information at single-nucleotide resolution. A 2100-nt mRNA with plasmid-encoded poly A tail lengths of either 27, 64, 100, or 117 nucleotides was used for these studies as enzymatically added poly A tails showed significant length heterogeneity. The number of As observed in the tails closely matched Sanger sequencing results of the DNA template, and even minor plasmid populations with sequence variations were detected. When the plasmid sequence contained a discreet number of poly As in the tail, analysis revealed a distribution that included tails longer than the encoded tail lengths. These observations were consistent with transcriptional slippage of T7 RNAP taking place within a poly A sequence. The type of RNAP did not alter the observed tail distribution, and comparison of T3, T7, and SP6 showed all three RNAPs produced equivalent tail length distributions. The addition of a sequence at the 3' end of the poly A tail did, however, produce narrower tail length distributions which supports a previously described model of slippage where the 3' end can be locked in place by having a G or C after the poly nucleotide region. Graphical abstract Determination of mRNA poly A tail length using magnetic beads and LC-MS.
DEFF Research Database (Denmark)
Englund, Marcus; Pornpongrungrueng, Pimwadee; Gustafsson, Mats
2009-01-01
Phylogenetic relationships in Inuleae subtribe Inulinae (Asteraceae) were investigated. DNA sequence data from three chloroplast regions (ndhF, trnL-F and psbA-trnH) and the nuclear ribosomal internal transcribed spacer (ITS) region were analysed separately and in combination using parsimony...... and Bayesian inference. A total of 163 ingroup taxa were included, of which 60 were sampled for all four markers. Conflicts between chloroplast and nuclear data were assessed using partitioned Bremer support (PBS). Rather than averaging PBS over several trees from constrained searches, individual trees were...... considered by evaluating PBS ranges. Criteria to be used in the detection of a significant conflict between data partitions are proposed. Three nodes in the total data tree were found to encompass significant conflict that could result from ancient hybridization. Neither of the large, heterogeneous...
Smilic, Tanja N; Novakovic, Tatjana R; Markovic-Jovanovic, Snezana R; Smilic, Ljiljana L J; Mitic, Javorka S; Radunovic, Miodrag L
2017-11-02
. The analysis of the activity of biochemical markers may obtain early information on the therapeutic response, before definitive assessment by bone density measurements. Copyright © 2017 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Apoptotic markers in protozoan parasites
Directory of Open Access Journals (Sweden)
Fasel Nicolas
2010-11-01
Full Text Available Abstract The execution of the apoptotic death program in metazoans is characterized by a sequence of morphological and biochemical changes that include cell shrinkage, presentation of phosphatidylserine at the cell surface, mitochondrial alterations, chromatin condensation, nuclear fragmentation, membrane blebbing and the formation of apoptotic bodies. Methodologies for measuring apoptosis are based on these markers. Except for membrane blebbing and formation of apoptotic bodies, all other events have been observed in most protozoan parasites undergoing cell death. However, while techniques exist to detect these markers, they are often optimised for metazoan cells and therefore may not pick up subtle differences between the events occurring in unicellular organisms and multi-cellular organisms. In this review we discuss the markers most frequently used to analyze cell death in protozoan parasites, paying special attention to changes in cell morphology, mitochondrial activity, chromatin structure and plasma membrane structure/permeability. Regarding classical regulators/executors of apoptosis, we have reviewed the present knowledge of caspase-like and nuclease activities.
Shriberg, Lawrence D.; Strand, Edythe A.; Fourakis, Marios; Jakielski, Kathy J.; Hall, Sheryl D.; Karlsson, Heather B.; Mabie, Heather L.; McSweeny, Jane L.; Tilkens, Christie M.; Wilson, David L.
2017-01-01
Purpose: Three previous articles provided rationale, methods, and several forms of validity support for a diagnostic marker of childhood apraxia of speech (CAS), termed the pause marker (PM). Goals of the present article were to assess the validity and stability of the PM Index (PMI) to scale CAS severity. Method: PM scores and speech, prosody,…
The Alcohol Dehydrogenase Isoenzyme as a Potential Marker of Pancreatitis.
Jelski, Wojciech; Piechota, Joanna; Orywal, Karolina; Szmitkowski, Maciej
2018-05-01
Human pancreas parenchyma contains various alcohol dehydrogenase (ADH) isoenzymes and also possesses aldehyde dehydrogenase (ALDH) activity. The altered activities of ADH and ALDH in damaged pancreatic tissue in the course of pancreatitis are reflected in the human serum. The aim of this study was to investigate a potential role of ADH and ALDH as markers for acute (AP) and chronic pancreatitis (CP). Serum samples were collected for routine biochemical investigations from 75 patients suffering from acute pancreatitis and 70 patients with chronic pancreatitis. Fluorometric methods were used to measure the activity of class I and II ADH and ALDH activity. The total ADH activity and activity of class III and IV isoenzymes were measured by a photometric method. There was a significant increase in the activity of ADH III isoenzyme (15.06 mU/l and 14.62 mU/l vs. 11.82 mU/l; ppancreatitis or chronic pancreatitis compared to the control. The diagnostic sensitivity for ADH III was about 84%, specificity was 92 %, positive and negative predictive values were 93% and 87% respectively in acute pancreatitis. Area under the Receiver Operating Curve (ROC) curve for ADH III in AP and CP was 0.88 and 0.86 respectively. ADH III has a potential role as a marker of acute and chronic pancreatitis. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Ion beam mixing of marker layers in Al and Si
International Nuclear Information System (INIS)
Mantl, S.; Rehn, L.E.; Averback, R.S.; Thompson, L.J. Jr.
1984-07-01
Ion beam mixing experiments on thin Pt, Au, and Ni markers in Al and Si have performed at 17, 85, and 300 K. After irradiation with 300-keV Ar ions the broadening and relative shifts of the markers have been determined by RBS measurements. The marker broadenings are more pronounced in Si than in Al; in both matrices the broadenings decrease in the following order: Au, Pt, and Ni. No dependence of mixing on irradiation temperature was observed between 17 and 300 K. The shifts of the heavy Au and Pt markers relative to the Ni markers are approximately equal to the experimental accuracy. However, a shift of the Ni marker toward the surface relative to the heavier Au and Pt markers was consistently observed. 13 references, 2 figures
Thin film characterization by resonantly excited internal standing waves
Energy Technology Data Exchange (ETDEWEB)
Di Fonzio, S [SINCROTRONE TRIESTE, Trieste (Italy)
1996-09-01
This contribution describes how a standing wave excited in a thin film can be used for the characterization of the properties of the film. By means of grazing incidence X-ray reflectometry one can deduce the total film thickness. On the other hand in making use of a strong resonance effect in the electric field intensity distribution inside a thin film on a bulk substrate one can learn more about the internal structure of the film. The profile of the internal standing wave is proven by diffraction experiments. The most appropriate non-destructive technique for the subsequent thin film characterization is angularly dependent X-ray fluorescence analysis. The existence of the resonance makes it a powerful tool for the detection of impurities and of ultra-thin maker layers, for which the position can be determined with very high precision (about 1% of the total film thickness). This latter aspect will be discussed here on samples which had a thin Ti marker layer at different positions in a carbon film. Due to the resonance enhancement it was still possible to perform these experiments with a standard laboratory x-ray tube and with standard laboratory tool for marker or impurity detection in thin films.
Directory of Open Access Journals (Sweden)
P Dorri
2014-12-01
Conclusion: The study findings demonstrated that rs438601 marker due to high heterozygosity could be suggested as an appropriate diagnostic marker in linkage analysis and carrier detection of hemophilia B in regard with a sample of Iranian population.
Craig, Claire; Piškur, Barbara
2012-01-01
This article presents a student evaluation of a joint international education developed as part of a European project which sought to equip health care practitioners with the skills to support employability of individuals furthest removed from the labour market, disadvantaged on account of age, gender, migration or ethnicity. Thirty eight students out of the forty one students that participated in the pilot of four modules (NL, UK, SE, DE) returned completed digital questionnaires (92.6% response rate). The study is descriptive by nature. A questionnaire was used to collect the data from students. Additionally students attending the module in the UK also took part in a series of qualitative interviews which sought to explore their experiences in more detail. These were recorded, transcribed and analyzed. Students reported that joint education facilitates competence development. The competencies they identified (Information Communications Technology) were recognised as being key to enhancing employability of disadvantaged groups. The joint international education exemplified by EEE4all offers one model of how to build a responsive international curriculum to ensure that the workforce of the future is well placed to meet the needs of this changing world.
Diagnostic markers of infection in curret pediatric practice | Chiabia ...
African Journals Online (AJOL)
chemokines, cytokines, adhesion molecules, cell surface markers and polymerase chain reaction are expensive and available only in specialised research laboratories. Optimal benefit can be obtained from rational use of currently available markers either by multiple marker assays or serial measurements which increase ...
2014-01-01
Background Fascioliasis is an important and neglected disease of humans and other mammals, caused by trematodes of the genus Fasciola. Fasciola hepatica and F. gigantica are valid species that infect humans and animals, but the specific status of Fasciola sp. (‘intermediate form’) is unclear. Methods Single specimens inferred to represent Fasciola sp. (‘intermediate form’; Heilongjiang) and F. gigantica (Guangxi) from China were genetically identified and characterized using PCR-based sequencing of the first and second internal transcribed spacer regions of nuclear ribosomal DNA. The complete mitochondrial (mt) genomes of these representative specimens were then sequenced. The relationships of these specimens with selected members of the Trematoda were assessed by phylogenetic analysis of concatenated amino acid sequence datasets by Bayesian inference (BI). Results The complete mt genomes of representatives of Fasciola sp. and F. gigantica were 14,453 bp and 14,478 bp in size, respectively. Both mt genomes contain 12 protein-coding genes, 22 transfer RNA genes and two ribosomal RNA genes, but lack an atp8 gene. All protein-coding genes are transcribed in the same direction, and the gene order in both mt genomes is the same as that published for F. hepatica. Phylogenetic analysis of the concatenated amino acid sequence data for all 12 protein-coding genes showed that the specimen of Fasciola sp. was more closely related to F. gigantica than to F. hepatica. Conclusions The mt genomes characterized here provide a rich source of markers, which can be used in combination with nuclear markers and imaging techniques, for future comparative studies of the biology of Fasciola sp. from China and other countries. PMID:24685294
Why Africa matters: evolution of Old World Salvia (Lamiaceae) in Africa.
Will, Maria; Claßen-Bockhoff, Regine
2014-07-01
Salvia is the largest genus in Lamiaceae and it has recently been found to be non-monophyletic. Molecular data on Old World Salvia are largely lacking. In this study, we present data concerning Salvia in Africa. The focus is on the colonization of the continent, character evolution and the switch of pollination systems in the genus. Maximum likelihood and Bayesian inference were used for phylogenetic reconstruction. Analyses were based on two nuclear markers [internal transcribed spacer (ITS) and external transcribed spacer (ETS)] and one plastid marker (rpl32-trnL). Sequence data were generated for 41 of the 62 African taxa (66 %). Mesquite was used to reconstruct ancestral character states for distribution, life form, calyx shape, stamen type and pollination syndrome. Salvia in Africa is non-monophyletic. Each of the five major regions in Africa, except Madagascar, was colonized at least twice, and floristic links between North African, south-west Asian and European species are strongly supported. The large radiation in Sub-Saharan Africa (23 species) can be traced back to dispersal from North Africa via East Africa to the Cape Region. Adaptation to bird pollination in southern Africa and Madagascar reflects parallel evolution. The phenotypic diversity in African Salvia is associated with repeated introductions to the continent. Many important evolutionary processes, such as colonization, adaptation, parallelism and character transformation, are reflected in this comparatively small group. The data presented in this study can help to understand the evolution of Salvia sensu lato and other large genera. © The Author 2014. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Phylogeny of Cirsium spp. in North America: host specificity does not follow phylogeny
Weedy invasive Cirsium spp. are widespread in temperate regions of North America and some of their biological control agents have attacked native Cirsium spp. A phylogenetic tree was developed from DNA sequences for the internal transcribed spacer and external transcribed spacer regions from native ...
Barak, Vivian; Meirovitz, Amichay; Leibovici, Vera; Rachmut, Jacob; Peretz, Tamar; Eliashar, Ron; Gross, Menachem
2015-10-01
Establishing prognostic factors is very important in the management of cancer patients. Our aim was to evaluate the clinical significance of a panel of tumor markers, including CEA (Carcino Embryonic Antigen), SCC (Squamous Cell Carcinoma Antigen), TPS (Tissue Polypeptide Specific Antigen) and CYFRA 21-1 in head and neck cancer patients, for assessing treatment response and prognosis of patients. We evaluated 312 blood samples from 143 head and neck cancer patients, from several sub-groups: 82 Larynx Carcinoma pre- and 38 post-therapy, 46 Oral Cavity pre and 29 post-therapy, 12 nasopharynx, 16 parotid and other salivary gland patients. Blood tumor markers levels were evaluated by conventional ELISA assays. Correlations of marker levels to stage of disease, lymph node involvement and therapy, were performed. Serum levels of all four tumor markers were higher before therapy and decreased thereafter in all patients. The decrease in TPS level following therapy was significant (p=0.03). Significantly higher levels of TPS and similarly higher levels of the other tumor markers were demonstrated in advanced disease (stages III and IV) patients, as opposed to early disease (stages I and II) patients (p=0.012). Node positive patients had significantly higher TPS levels as compared to node negative (p=0.02). The same trend was shown by the other markers as well, but did not reach statistical significance. TPS was best correlated to survival of patients; those having low levels had the best clinical outcome and longer survival. CEA, SCC, TPS and CYFRA 21-1 can all serve as useful tumor markers in HNC patients. They assessed response to therapy and were prognostic for recurrence. TPS proved to be the most sensitive predictor of advanced disease and poor prognosis. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Tumor markers in breast cancer- European Group on Tumor Markers recommendations
DEFF Research Database (Denmark)
Molina, Rafael; Barak, Vivian; van Dalen, Arie
2005-01-01
in the selection of patients for treatment with hormone therapy, while HER-2 is essential in selecting patients with advanced breast cancer for treatment with Herceptin (trastuzumab). Urokinase plasminogen activator and plasminogen activator inhibitor 1 are recently validated prognostic markers for lymph node...
Lifescience Database Archive (English)
Full Text Available List Contact us PGDBj Registered plant list, Marker list, QTL list, Plant DB link & Genome analysis methods ...Database Site Policy | Contact Us Marker list - PGDBj Registered plant list, Marker list, QTL list, Plant DB link & Genome analysis methods | LSDB Archive ...
Molecular markers of neuropsychological functioning and Alzheimer's disease.
Edwards, Melissa; Balldin, Valerie Hobson; Hall, James; O'Bryant, Sid
2015-03-01
The current project sought to examine molecular markers of neuropsychological functioning among elders with and without Alzheimer's disease (AD) and determine the predictive ability of combined molecular markers and select neuropsychological tests in detecting disease presence. Data were analyzed from 300 participants (n = 150, AD and n = 150, controls) enrolled in the Texas Alzheimer's Research and Care Consortium. Linear regression models were created to examine the link between the top five molecular markers from our AD blood profile and neuropsychological test scores. Logistical regressions were used to predict AD presence using serum biomarkers in combination with select neuropsychological measures. Using the neuropsychological test with the least amount of variance overlap with the molecular markers, the combined neuropsychological test and molecular markers was highly accurate in detecting AD presence. This work provides the foundation for the generation of a point-of-care device that can be used to screen for AD.
Identification and Validation of EST-Derived Molecular Markers, TRAP and VNTRs, for Banana Research
Garcia, S.A.L.; Talebi, R.; Ferreira, C.F.; Vroh, B.I.; Paiva, L.V.; Kema, G.H.J.; Souza, M.T.
2011-01-01
The advent of high-throughput sequencing technology has generated abundant information on DNA sequences for the genomes of many plant species. Expressed Sequence Tags (ESTs), which are unique DNA sequences derived from a cDNA library and therefore representing genes transcribed in specific tissues
Image Processing Marker Augmented Reality for Design Furniture Room
Desy Siswanti, Sri; Titoyan, Titoyan
2015-01-01
AR useful for industrial applications to enhance the visual perception of the user, for example, the AR system is capable of visually new building project at a real construction site, which gives the viewer a better understanding in accordance with the existing environment. The method used by the AR is a marker detection and tracking, the method used for the detection and tracking marker is a natural feature tracking. This method detects features that are in the marker. In detecting marker ob...
Assessing the clinical significance of tumor markers in common neoplasms.
Beketic-Oreskovic, Lidija; Maric, Petra; Ozretic, Petar; Oreskovic, Darko; Ajdukovic, Mia; Levanat, Sonja
2012-06-01
The term tumor markers include a spectrum of molecules and substances with widely divergent characteristics whose presence in the significant amount can be related to the malignant disease. An ideal tumor marker should have high specificity and sensitivity, which would allow its use in early diagnosis and prognosis of malignant disease, as well as in prediction of therapeutic response and follow-up of the patients. Numerous biochemical entities have emerged as potentially valuable tumor markers so far, but only few markers showed to be of considerable clinical reliability and have been accepted into standard clinical practice. Recent development of genomics and proteomics has enabled the examination of many new potential tumor markers. Scientific studies on discovery, development, and application of tumor markers have been proceeding quite rapidly providing great opportunities for improving the management of cancer patients. This review is focusing on the clinical usefulness of various tumor markers already in clinical practice as well as certain potential markers, giving a brief description of their prognostic and predictive significance in most common malignancies.
Comparison of respiratory surrogates for gated lung radiotherapy without internal fiducials
International Nuclear Information System (INIS)
Korreman, S.; Mostafavi, H.; Le, Q.T.; Boyer, A.
2006-01-01
An investigation was carried out to compare the ability of two respiratory surrogates to mimic actual lung tumor motion during audio coaching. The investigation employed video clips acquired after patients had had fiducial markers implanted in lung tumors to be used for image-guided stereoscopic radiotherapy. The positions of the markers in the clips were measured within the video frames and used as the standard for tumor volume motion. An external marker was tracked optically during the fluoroscopic acquisitions. An image correlation technique was developed to compute a gating signal from the fluoroscopic images. The correlation gating trace was similar to the optical gating trace in the phase regions of the respiratory cycle used for gating. A cross correlation analysis and comparison of the external optical marker gating with internal fluoroscopic gating was performed. The fluoroscopic image correlation surrogate was found to be superior to the external optical surrogate in the AP-views in four out of six cases. In one of the remaining two cases, the two surrogates performed comparably, while in the last case, the external fiducial trace performed best. It was concluded that fluoroscopic gating based on correlation of native image features in the fluoroscopic images will be adequate for respiratory gating
Comparison of respiratory surrogates for gated lung radiotherapy without internal fiducials
Energy Technology Data Exchange (ETDEWEB)
Korreman, S. [Rigshospitalet, Copenhagen (Denmark). Dept. of Radiation Oncology; Mostafavi, H. [Varian Medical Systems, Mountain View, CA (United States). Gintzon Technology Center; Le, Q.T.; Boyer, A. [Stanford Univ. School of Medicine, CA (United States). Dept. of Radiation Oncology
2006-09-15
An investigation was carried out to compare the ability of two respiratory surrogates to mimic actual lung tumor motion during audio coaching. The investigation employed video clips acquired after patients had had fiducial markers implanted in lung tumors to be used for image-guided stereoscopic radiotherapy. The positions of the markers in the clips were measured within the video frames and used as the standard for tumor volume motion. An external marker was tracked optically during the fluoroscopic acquisitions. An image correlation technique was developed to compute a gating signal from the fluoroscopic images. The correlation gating trace was similar to the optical gating trace in the phase regions of the respiratory cycle used for gating. A cross correlation analysis and comparison of the external optical marker gating with internal fluoroscopic gating was performed. The fluoroscopic image correlation surrogate was found to be superior to the external optical surrogate in the AP-views in four out of six cases. In one of the remaining two cases, the two surrogates performed comparably, while in the last case, the external fiducial trace performed best. It was concluded that fluoroscopic gating based on correlation of native image features in the fluoroscopic images will be adequate for respiratory gating.
Stability of percutaneously implanted markers for lung stereotactic radiotherapy
DEFF Research Database (Denmark)
Persson, Gitte Bjørnsen Fredberg; Josipovic, Mirjana; Von Der Recke, Peter
2013-01-01
The purpose of this study was to evaluate the stability of complex markers implanted into lung tumors throughout a course of stereotactic body radiotherapy (SBRT). Fifteen patients referred for lung SBRT were prospectively included. Radio-opaque markers were implanted percutaneously, guided...... mm in one or more registrations throughout the SBRT course. This is the first study to evaluate stability of complex markers implanted percutaneously into lung tumors for image guidance in SBRT. We conclude that the observed stability of marker position within the tumor indicates that complex markers...... can be used as surrogates for tumor position during a short course of SBRT as long as the uncertainties related to their position within the tumor are incorporated into the planning target volume....
The relationship between tumor markers and pulmonary embolism in lung cancer.
Xiong, Wei; Zhao, Yunfeng; Xu, Mei; Guo, Jian; Pudasaini, Bigyan; Wu, Xueling; Liu, Jinming
2017-06-20
Tumor markers (TMs) and D-Dimer are both hallmarks of severity and prognosis of lung cancer. Tumor markers could be related to pulmonary embolism (PE) in lung cancer. The number of abnormal tumor markers of lung cancer patients with pulmonary embolism (3.9 ± 1.1vs1.6 ± 0.6,P 0.005) was more than that in patients without pulmonary embolism. TMs panel (P trend tumor markers, TMs panel (OR5.98, P Tumor markers were compared between lung cancer patients complicated with pulmonary embolism and those without pulmonary embolism Then the correlation between each tumor marker as well as panel of combined TMs and D-Dimer as well as pulmonary embolism were analyzed for patients with pulmonary embolism. There is a relationship between tumor markers and pulmonary embolism in patients with lung cancer. The panel of combined tumor markers is a valuable diagnostic marker for pulmonary embolism in lung cancer.
Molecular markers for use in plant molecular breeding and germplasm evaluation
International Nuclear Information System (INIS)
Edwards, J.D.; McCouch, S.R.
2007-01-01
A number of molecular marker technologies exist, each with different advantages and disadvantages. When available, genome sequence allows for the development of greater numbers and higher quality molecular markers. When genome sequence is limited in the organism of interest, related species may serve as sources of molecular markers. Some molecular marker technologies combine the discovery and assay of DNA sequence variations, and therefore can be used in species without the need for prior sequence information and up-front investment in marker development. As a prerequisite for marker-assisted selection (MAS), there must be a known association between genetic markers and genes affecting the phenotype to be modified. Comparative databases can facilitate the transfer of knowledge of genetic marker-phenotype association across species so that discoveries in one species may be applied to many others. Further genomics research and reductions in the costs associated with molecular markers will continue to provide new opportunities to employ MAS. (author)
de Groot, M; van Haeringen, W A
2017-08-01
In this study, the International Society for Animal Genetics (ISAG) recommended panel for the identification of the domestic pigeon (Columba livia domestica) is characterized based on commonly used statistical parameters. The marker panel is based on 16 short tandem repeat (STR) loci (PIGN15, PIGN10, PIGN57, PIGN26, CliμD16, CliμD19, PIGN12, CliμD17, CliμT17, PIGN04, CliμD01, CliμD11, CliμD35, CliμT02, CliμT13, CliμT43). The alleles of the 16 loci consist of a mixture of tri-, tetra-, penta- and hexameric repeat patterns. A sex determination marker was included in the multiplex for quality control. The repeat sequence of the PIGN markers was previously unpublished and therefore sequenced to reveal the sequence pattern. In total, 1421 pigeons were genotyped on 16 STR loci to generate allele frequency data for each locus. For all 16 markers combined, a PE1 (combined non-exclusion probability, first parent) of 0.9986 and PE2 (combined non-exclusion probability, second parent) of >0.9999 was observed. Comparing the alleged father and mother, a PE value of >0.9999 was observed. Two of the markers, CliμD19 and PIGN12, were found to have relatively high Hardy-Weinberg equilibrium and F(null) values. Therefore these markers may be considered to be replaced by other STRs. Another point of discussion may be to add a gender identification marker to the recommended ISAG panel. Not only can this serve as an extra identification marker, but this can also confirm the sex of a sample, because it is challenging to determine the sex based on phenotypical characteristics, especially for chicks. In conclusion, the set of 16 STR markers can be used in routine parentage verification and the identification of individuals. © 2017 Stichting International Foundation for Animal Genetics.
[Gender differences in the use of tumour markers].
Moreno-Campoy, E E; Mérida-De la Torre, F J; Martos-Crespo, F; Plebani, M
2015-01-01
Gender is one of the factors that can influence the use of health resources. The use of tumour markers is widespread, due to the importance of these in monitoring cancer development. The aim of this study is to analyse the influence of gender on the use of tumour markers, and to investigate whether there are differences in their use. A longitudinal, retrospective and descriptive study, with a 2-year follow-up, was conducted in the catchment area of the University Hospital of Padua. An analysis was performed on 23,059 analytical requests for tumour markers. A descriptive and frequency analysis was performed on all variables. The statistical analysis was performed using Chi squared, Student t and Mann-Whitney U to test for significance. The number of requests for women (1.5) was lower than men (1.6). In patients with tumour pathology, the number of requests was higher than in patients without tumour disease. In the analysis by disease and gender, the difference remained significant. As regards the number of tumour markers per request, the difference between genders was also significant: 2.13 in males versus 2.85 in women. Similar results were obtained when requests for tumour markers linked to gender-related diseases were eliminated. There are differences in the use of tumour markers by gender with the number of requests for male patients being higher than for females. However, the number of tumour markers per request is greater in women than in men. Copyright © 2015 SECA. Published by Elsevier Espana. All rights reserved.
Vermont Center for Geographic Information — Roadside Historic Site Marker program has proven an effective way to commemorate Vermont’s many people, events, and places of regional, statewide, or national...
Algorithms for selecting informative marker panels for population assignment.
Rosenberg, Noah A
2005-11-01
Given a set of potential source populations, genotypes of an individual of unknown origin at a collection of markers can be used to predict the correct source population of the individual. For improved efficiency, informative markers can be chosen from a larger set of markers to maximize the accuracy of this prediction. However, selecting the loci that are individually most informative does not necessarily produce the optimal panel. Here, using genotypes from eight species--carp, cat, chicken, dog, fly, grayling, human, and maize--this univariate accumulation procedure is compared to new multivariate "greedy" and "maximin" algorithms for choosing marker panels. The procedures generally suggest similar panels, although the greedy method often recommends inclusion of loci that are not chosen by the other algorithms. In seven of the eight species, when applied to five or more markers, all methods achieve at least 94% assignment accuracy on simulated individuals, with one species--dog--producing this level of accuracy with only three markers, and the eighth species--human--requiring approximately 13-16 markers. The new algorithms produce substantial improvements over use of randomly selected markers; where differences among the methods are noticeable, the greedy algorithm leads to slightly higher probabilities of correct assignment. Although none of the approaches necessarily chooses the panel with optimal performance, the algorithms all likely select panels with performance near enough to the maximum that they all are suitable for practical use.
Henry Hub and national balancing point prices: what will be the international gas price reference?
International Nuclear Information System (INIS)
Mazighi, A.E.H.
2005-01-01
One of the lessons in the history of international trade in commodities is the emergence - sooner or later - of an international price reference, most commonly known as an international marker price. In the area of oil, West Texas Intermediate (WTI) plays the role of a marker for sour crudes traded in the Atlantic basin. Brent oil fulfils this function for sweet crudes traded in Europe. Another important aspect in the area of global commodities is that the emergence of a marker price is not always necessarily related to the relative share of production of exports of the commodity, but primarily to the existence of an organized market for this commodity. Today, while international gas trade is intensifying, we still lack an international price reference for this commodity. This is due to the fact that the international trade of natural gas is still highly regionalized. It is also due to the fact that most gas markets are still regulated. Nevertheless, deregulation efforts have been implemented in both developed (the United States, the United Kingdom, continental Europe, Korea) and developing countries (Brazil, Chile) and have led to new market structures based on more competition in all segments of the gas chain, except transportation. In the meantime, price structures based on supply and demand principles are supposed to have emerged in the US and UK markets in the 1990s as a result of the implementation of deregulation measures. Today, the US gas market, which represents more than 660 billion cubic metres per year of consumption and the UK gas market, which is close to 100 bcm annually, are considered mature enough to make the principles of supply and demand operate inside these markets. In fact, the Henry Hub (HH) price, which is determined at a physical location in Louisiana, US, and the national balancing point (NBP) price, which is determined somewhere inside the national transmission system (NTS), without any precise location, are considered as potential
Emam, Aufaugh; Carter, William G; Lingwood, Clifford
2010-01-01
Internalization of PAK strain Pseudomonas aeruginosa into human respiratory epithelial cell lines and HeLa cervical cancer cells in vitro was readily demonstrable via a gentamycin protection assay. Depletion of target cell glycosphingolipids (GSLs) using a glucosyl ceramide synthase inhibitor, P4, completely prevented P. aeruginosa internalization. In contrast, P4 treatment had no effect on the internalization of Salmonella typhimurium into HeLa cells. Internalized P. aeruginosa were within membrane vacuoles, often containing microvesicles, between the bacterium and the limiting membrane. P. aeruginosa internalization was markedly enhanced by target cell pretreatment with the exogenous GSL, deacetyl gangliotetraosyl ceramide (Gg4). Gg4 binds the lipid raft marker, GM1 ganglioside. Target cell pretreatment with TLCK, but not other (serine) protease inhibitors, prevented both P. aeruginosa host cell binding and internalization. NFkB inhibition also prevented internalization. A GSL-containing lipid-raft model of P. aeruginosa host cell binding/internalization is proposed PMID:21270937
"They Will Come to Understand": Supervisor Reflections on International Medical Electives.
Roebbelen, Erica; Dorman, Katie; Hunter, Andrea; Kraeker, Christian; O'Shea, Tim; Bozinoff, Nikki
2018-03-22
Phenomenon: Increasing numbers of medical students from high-income countries are undertaking international medical electives (IMEs) during their training. Much has been written about the benefits of these experiences for the student, and concerns have been raised regarding the burden of IMEs on host communities. The voices of physicians from low- and middle-income countries who supervise IMEs have not been explored in depth. The current study sought to investigate host-physician perspectives on IMEs. Host supervisors were recruited by convenience sampling through students travelling abroad for IMEs during the summer of 2012. From 2012 through 2014, 11 semistructured interviews were conducted by telephone with host supervisors from Nepal, Uganda, Ghana, Guyana, and Kenya. Participants were invited to describe their motivations for hosting IMEs and their experiences of the benefits and harms of IMEs. Interviews were transcribed verbatim and checked for accuracy. An initial coding framework was developed and underwent multiple revisions, after which analytic categories were derived using conventional qualitative content analysis. For host supervisors, visits from international medical students provided a window into the resource-rich medical practice of high-income countries, and supervisors positioned themselves, their education, and clinical expertise against perceived standards of the international students' context. Hosting IMEs also contributed to supervisors' identities as educators connected to a global community. Supervisors described the challenge of helping students navigate their distress when confronting global health inequity. Finally, the desire for increasingly reciprocal relationships was expressed as a hope for the future. Insights: IMEs can be formative for host supervisors' identities and are used to benchmark host institutions compared with international medical standards. Reciprocity was articulated as essential for IMEs moving forward.
Bai, Gang; Zhang, Tiejun; Hou, Yuanyuan; Ding, Guoyu; Jiang, Min; Luo, Guoan
2018-01-31
The quality of traditional Chinese medicine (TCM) forms the foundation of its clinical efficacy. The standardization of TCM is the most important task of TCM modernization. In recent years, there has been great progress in the quality control of TCM. However, there are still many issues related to the current quality standards, and it is difficult to objectively evaluate and effectively control the quality of TCM. To face these challenge, we summarized the current quality marker (Q-marker) research based on its characteristics and benefits, and proposed a reasonable and intelligentized quality evaluation strategy for the development and application of Q-markers. Ultra-performance liquid chromatography-quadrupole/time-of-flight with partial least squares-discriminant analysis was suggested to screen the chemical markers from Chinese medicinal materials (CMM), and a bioactive-guided evaluation method was used to select the Q-markers. Near-infrared spectroscopy (NIRS), based on the distinctive wavenumber zones or points from the Q-markers, was developed for its determination. Then, artificial intelligence algorithms were used to clarify the complex relationship between the Q-markers and their integral functions. Internet and mobile communication technology helped us to perform remote analysis and determine the information feedback of test samples. The quality control research, evaluation, standard establishment and quality control of TCM must be based on the systematic analysis of Q-markers to study and describe the material basis of TCM efficacy, define the chemical markers in the plant body, and understand the process of herb drug acquisition, change and transmission laws affecting metabolism and exposure. Based on the advantages of chemometrics, new sensor technologies, including infrared spectroscopy, hyperspectral imaging, chemical imaging, electronic nose and electronic tongue, have become increasingly important in the quality evaluation of CMM. Inspired by the
Study of skin markers for magnetic resonance imaging examinations
International Nuclear Information System (INIS)
Takatsu, Yasuo; Umezaki, Yoshie; Miyati, Tosiaki; Yamamura, Kenichirou
2013-01-01
In magnetic resonance imaging (MRI), skin markers are used as a landmark in order to make plans for examinations. However, there isn't a lot of research about the material and shape of skin markers. The skin marker's essential elements are safety, good cost performance, high signal intensity for T 1 weighted image (T 1 WI) and T 2 weighted image (T 2 WI), and durable. In order to get a high signal-to-noise ratio (SNR) of T 1 WI and T 2 WI, baby oil, salad oil and olive oil were chosen, because these materials were easy to obtain and safe for the skin. The SNR of baby oil was the best. Baby oil was injected into the infusion tube, and the tube was solvent welded and cut by a heat sealer. In order to make ring shaped skin markers, both ends of the tube were stuck with adhesive tape. Three different diameters of markers were made (3, 5, 10 cmφ). Ring shaped skin markers were put on to surround the examination area, therefore, the edge of the examination area could be seen at every cross section. Using baby oil in the ring shaped infusion tube is simple, easy, and a highly useful skin marker. (author)
2011-01-01
Background A number of molecular marker linkage maps have been developed for melon (Cucumis melo L.) over the last two decades. However, these maps were constructed using different marker sets, thus, making comparative analysis among maps difficult. In order to solve this problem, a consensus genetic map in melon was constructed using primarily highly transferable anchor markers that have broad potential use for mapping, synteny, and comparative quantitative trait loci (QTL) analysis, increasing breeding effectiveness and efficiency via marker-assisted selection (MAS). Results Under the framework of the International Cucurbit Genomics Initiative (ICuGI, http://www.icugi.org), an integrated genetic map has been constructed by merging data from eight independent mapping experiments using a genetically diverse array of parental lines. The consensus map spans 1150 cM across the 12 melon linkage groups and is composed of 1592 markers (640 SSRs, 330 SNPs, 252 AFLPs, 239 RFLPs, 89 RAPDs, 15 IMAs, 16 indels and 11 morphological traits) with a mean marker density of 0.72 cM/marker. One hundred and ninety-six of these markers (157 SSRs, 32 SNPs, 6 indels and 1 RAPD) were newly developed, mapped or provided by industry representatives as released markers, including 27 SNPs and 5 indels from genes involved in the organic acid metabolism and transport, and 58 EST-SSRs. Additionally, 85 of 822 SSR markers contributed by Syngenta Seeds were included in the integrated map. In addition, 370 QTL controlling 62 traits from 18 previously reported mapping experiments using genetically diverse parental genotypes were also integrated into the consensus map. Some QTL associated with economically important traits detected in separate studies mapped to similar genomic positions. For example, independently identified QTL controlling fruit shape were mapped on similar genomic positions, suggesting that such QTL are possibly responsible for the phenotypic variability observed for this trait in
Directory of Open Access Journals (Sweden)
Schaffer Arthur
2011-07-01
Full Text Available Abstract Background A number of molecular marker linkage maps have been developed for melon (Cucumis melo L. over the last two decades. However, these maps were constructed using different marker sets, thus, making comparative analysis among maps difficult. In order to solve this problem, a consensus genetic map in melon was constructed using primarily highly transferable anchor markers that have broad potential use for mapping, synteny, and comparative quantitative trait loci (QTL analysis, increasing breeding effectiveness and efficiency via marker-assisted selection (MAS. Results Under the framework of the International Cucurbit Genomics Initiative (ICuGI, http://www.icugi.org, an integrated genetic map has been constructed by merging data from eight independent mapping experiments using a genetically diverse array of parental lines. The consensus map spans 1150 cM across the 12 melon linkage groups and is composed of 1592 markers (640 SSRs, 330 SNPs, 252 AFLPs, 239 RFLPs, 89 RAPDs, 15 IMAs, 16 indels and 11 morphological traits with a mean marker density of 0.72 cM/marker. One hundred and ninety-six of these markers (157 SSRs, 32 SNPs, 6 indels and 1 RAPD were newly developed, mapped or provided by industry representatives as released markers, including 27 SNPs and 5 indels from genes involved in the organic acid metabolism and transport, and 58 EST-SSRs. Additionally, 85 of 822 SSR markers contributed by Syngenta Seeds were included in the integrated map. In addition, 370 QTL controlling 62 traits from 18 previously reported mapping experiments using genetically diverse parental genotypes were also integrated into the consensus map. Some QTL associated with economically important traits detected in separate studies mapped to similar genomic positions. For example, independently identified QTL controlling fruit shape were mapped on similar genomic positions, suggesting that such QTL are possibly responsible for the phenotypic variability
Williams, Christopher; Costa, Joseph; Mandia, Stephen; Henderson, Randal; Marino, Robert; Mendenhall, Nancy
2012-05-01
Surgical absence of the prostate can make placement of fiducial markers difficult, because anatomic landmarks are distorted and there is a paucity of substantial tissue to hold fast the markers. We describe a method for improving the accuracy of fiducial marker placement for the purpose of salvage or adjuvant external beam radiation therapy for prostate cancer in patients who have undergone radical prostatectomy. To assist with identification of the urethrovesical junction and to facilitate placement of the markers, a Foley catheter was placed and the balloon was inflated. Gentle traction on the catheter seated the balloon at the bladder neck to echographically define the anatomy of the urethrovesical junction. Next, a rectal ultrasound probe was inserted into the rectum, allowing visualization of the region of the urethrovesical junction. Fiducial markers were then placed bilaterally in the detrusor muscle at the bladder neck or in the periurethral tissue using the applicator needle. The treating radiation oncologist verified that marker placement was suitable for assisting with radiation therapy in all cases. Preradiation pelvic imaging verified that markers were not in the bladder or urethral lumen, and there were no patient complaints of voiding out the markers with urination.
Trends in plant research using molecular markers.
Garrido-Cardenas, Jose Antonio; Mesa-Valle, Concepción; Manzano-Agugliaro, Francisco
2018-03-01
A deep bibliometric analysis has been carried out, obtaining valuable parameters that facilitate the understanding around the research in plant using molecular markers. The evolution of the improvement in the field of agronomy is fundamental for its adaptation to the new exigencies that the current world context raises. In addition, within these improvements, this article focuses on those related to the biotechnology sector. More specifically, the use of DNA markers that allow the researcher to know the set of genes associated with a particular quantitative trait or QTL. The use of molecular markers is widely extended, including: restriction fragment length polymorphism, random-amplified polymorphic DNA, amplified fragment length polymorphism, microsatellites, and single-nucleotide polymorphisms. In addition to classical methodology, new approaches based on the next generation sequencing are proving to be fundamental. In this article, a historical review of the molecular markers traditionally used in plants, since its birth and how the new molecular tools facilitate the work of plant breeders is carried out. The evolution of the most studied cultures from the point of view of molecular markers is also reviewed and other parameters whose prior knowledge can facilitate the approach of researchers to this field of research are analyzed. The bibliometric analysis of molecular markers in plants shows that top five countries in this research are: US, China, India, France, and Germany, and from 2013, this research is led by China. On the other hand, the basic research using Arabidopsis is deeper in France and Germany, while other countries focused its efforts in their main crops as the US for wheat or maize, while China and India for wheat and rice.
Y-Chromosome Markers for the Red Fox.
Rando, Halie M; Stutchman, Jeremy T; Bastounes, Estelle R; Johnson, Jennifer L; Driscoll, Carlos A; Barr, Christina S; Trut, Lyudmila N; Sacks, Benjamin N; Kukekova, Anna V
2017-09-01
The de novo assembly of the red fox (Vulpes vulpes) genome has facilitated the development of genomic tools for the species. Efforts to identify the population history of red foxes in North America have previously been limited by a lack of information about the red fox Y-chromosome sequence. However, a megabase of red fox Y-chromosome sequence was recently identified over 2 scaffolds in the reference genome. Here, these scaffolds were scanned for repeated motifs, revealing 194 likely microsatellites. Twenty-three of these loci were selected for primer development and, after testing, produced a panel of 11 novel markers that were analyzed alongside 2 markers previously developed for the red fox from dog Y-chromosome sequence. The markers were genotyped in 76 male red foxes from 4 populations: 7 foxes from Newfoundland (eastern Canada), 12 from Maryland (eastern United States), and 9 from the island of Great Britain, as well as 48 foxes of known North American origin maintained on an experimental farm in Novosibirsk, Russia. The full marker panel revealed 22 haplotypes among these red foxes, whereas the 2 previously known markers alone would have identified only 10 haplotypes. The haplotypes from the 4 populations clustered primarily by continent, but unidirectional gene flow from Great Britain and farm populations may influence haplotype diversity in the Maryland population. The development of new markers has increased the resolution at which red fox Y-chromosome diversity can be analyzed and provides insight into the contribution of males to red fox population diversity and patterns of phylogeography. © The American Genetic Association 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Emily J Telfer
Full Text Available Pedigree reconstruction using molecular markers enables efficient management of inbreeding in open-pollinated breeding strategies, replacing expensive and time-consuming controlled pollination. This is particularly useful in preferentially outcrossed, insect pollinated Eucalypts known to suffer considerable inbreeding depression from related matings. A single nucleotide polymorphism (SNP marker panel consisting of 106 markers was selected for pedigree reconstruction from the recently developed high-density Eucalyptus Infinium SNP chip (EuCHIP60K. The performance of this SNP panel for pedigree reconstruction in open-pollinated progenies of two Eucalyptus nitens seed orchards was compared with that of two microsatellite panels with 13 and 16 markers respectively. The SNP marker panel out-performed one of the microsatellite panels in the resolution power to reconstruct pedigrees and out-performed both panels with respect to data quality. Parentage of all but one offspring in each clonal seed orchard was correctly matched to the expected seed parent using the SNP marker panel, whereas parentage assignment to less than a third of the expected seed parents were supported using the 13-microsatellite panel. The 16-microsatellite panel supported all but one of the recorded seed parents, one better than the SNP panel, although there was still a considerable level of missing and inconsistent data. SNP marker data was considerably superior to microsatellite data in accuracy, reproducibility and robustness. Although microsatellites and SNPs data provide equivalent resolution for pedigree reconstruction, microsatellite analysis requires more time and experience to deal with the uncertainties of allele calling and faces challenges for data transferability across labs and over time. While microsatellite analysis will continue to be useful for some breeding tasks due to the high information content, existing infrastructure and low operating costs, the multi
Telfer, Emily J; Stovold, Grahame T; Li, Yongjun; Silva-Junior, Orzenil B; Grattapaglia, Dario G; Dungey, Heidi S
2015-01-01
Pedigree reconstruction using molecular markers enables efficient management of inbreeding in open-pollinated breeding strategies, replacing expensive and time-consuming controlled pollination. This is particularly useful in preferentially outcrossed, insect pollinated Eucalypts known to suffer considerable inbreeding depression from related matings. A single nucleotide polymorphism (SNP) marker panel consisting of 106 markers was selected for pedigree reconstruction from the recently developed high-density Eucalyptus Infinium SNP chip (EuCHIP60K). The performance of this SNP panel for pedigree reconstruction in open-pollinated progenies of two Eucalyptus nitens seed orchards was compared with that of two microsatellite panels with 13 and 16 markers respectively. The SNP marker panel out-performed one of the microsatellite panels in the resolution power to reconstruct pedigrees and out-performed both panels with respect to data quality. Parentage of all but one offspring in each clonal seed orchard was correctly matched to the expected seed parent using the SNP marker panel, whereas parentage assignment to less than a third of the expected seed parents were supported using the 13-microsatellite panel. The 16-microsatellite panel supported all but one of the recorded seed parents, one better than the SNP panel, although there was still a considerable level of missing and inconsistent data. SNP marker data was considerably superior to microsatellite data in accuracy, reproducibility and robustness. Although microsatellites and SNPs data provide equivalent resolution for pedigree reconstruction, microsatellite analysis requires more time and experience to deal with the uncertainties of allele calling and faces challenges for data transferability across labs and over time. While microsatellite analysis will continue to be useful for some breeding tasks due to the high information content, existing infrastructure and low operating costs, the multi-species SNP resource
Preoperative Molecular Markers in Thyroid Nodules.
Sahli, Zeyad T; Smith, Philip W; Umbricht, Christopher B; Zeiger, Martha A
2018-01-01
The need for distinguishing benign from malignant thyroid nodules has led to the pursuit of differentiating molecular markers. The most common molecular tests in clinical use are Afirma ® Gene Expression Classifier (GEC) and Thyroseq ® V2. Despite the rapidly developing field of molecular markers, several limitations exist. These challenges include the recent introduction of the histopathological diagnosis "Non-Invasive Follicular Thyroid neoplasm with Papillary-like nuclear features", the correlation of genetic mutations within both benign and malignant pathologic diagnoses, the lack of follow-up of molecular marker negative nodules, and the cost-effectiveness of molecular markers. In this manuscript, we review the current published literature surrounding the diagnostic value of Afirma ® GEC and Thyroseq ® V2. Among Afirma ® GEC studies, sensitivity (Se), specificity (Sp), positive predictive value (PPV), and negative predictive value (NPV) ranged from 75 to 100%, 5 to 53%, 13 to 100%, and 20 to 100%, respectively. Among Thyroseq ® V2 studies, Se, Sp, PPV, and NPV ranged from 40 to 100%, 56 to 93%, 13 to 90%, and 48 to 97%, respectively. We also discuss current challenges to Afirma ® GEC and Thyroseq ® V2 utility and clinical application, and preview the future directions of these rapidly developing technologies.
Development and use of molecular markers: past and present.
Grover, Atul; Sharma, P C
2016-01-01
Molecular markers, due to their stability, cost-effectiveness and ease of use provide an immensely popular tool for a variety of applications including genome mapping, gene tagging, genetic diversity diversity, phylogenetic analysis and forensic investigations. In the last three decades, a number of molecular marker techniques have been developed and exploited worldwide in different systems. However, only a handful of these techniques, namely RFLPs, RAPDs, AFLPs, ISSRs, SSRs and SNPs have received global acceptance. A recent revolution in DNA sequencing techniques has taken the discovery and application of molecular markers to high-throughput and ultrahigh-throughput levels. Although, the choice of marker will obviously depend on the targeted use, microsatellites, SNPs and genotyping by sequencing (GBS) largely fulfill most of the user requirements. Further, modern transcriptomic and functional markers will lead the ventures onto high-density genetic map construction, identification of QTLs, breeding and conservation strategies in times to come in combination with other high throughput techniques. This review presents an overview of different marker technologies and their variants with a comparative account of their characteristic features and applications.
Urinary Markers of Tubular Injury in Early Diabetic Nephropathy
Directory of Open Access Journals (Sweden)
Temesgen Fiseha
2016-01-01
Full Text Available Diabetic nephropathy (DN is a common and serious complication of diabetes associated with adverse outcomes of renal failure, cardiovascular disease, and premature mortality. Early and accurate identification of DN is therefore of critical importance to improve patient outcomes. Albuminuria, a marker of glomerular involvement in early renal damage, cannot always detect early DN. Thus, more sensitive and specific markers in addition to albuminuria are needed to predict the early onset and progression of DN. Tubular injury, as shown by the detection of tubular injury markers in the urine, is a critical component of the early course of DN. These urinary tubular markers may increase in diabetic patients, even before diagnosis of microalbuminuria representing early markers of normoalbuminuric DN. In this review we summarized some new and important urinary markers of tubular injury, such as neutrophil gelatinase associated lipocalin (NGAL, kidney injury molecule-1 (KIM-1, liver-type fatty acid binding protein (L-FABP, N-acetyl-beta-glucosaminidase (NAG, alpha-1 microglobulin (A1M, beta 2-microglobulin (B2-M, and retinol binding protein (RBP associated with early DN.
Multiple Brain Markers are Linked to Age-Related Variation in Cognition
Hedden, Trey; Schultz, Aaron P.; Rieckmann, Anna; Mormino, Elizabeth C.; Johnson, Keith A.; Sperling, Reisa A.; Buckner, Randy L.
2016-01-01
Age-related alterations in brain structure and function have been challenging to link to cognition due to potential overlapping influences of multiple neurobiological cascades. We examined multiple brain markers associated with age-related variation in cognition. Clinically normal older humans aged 65–90 from the Harvard Aging Brain Study (N = 186) were characterized on a priori magnetic resonance imaging markers of gray matter thickness and volume, white matter hyperintensities, fractional anisotropy (FA), resting-state functional connectivity, positron emission tomography markers of glucose metabolism and amyloid burden, and cognitive factors of processing speed, executive function, and episodic memory. Partial correlation and mediation analyses estimated age-related variance in cognition shared with individual brain markers and unique to each marker. The largest relationships linked FA and striatum volume to processing speed and executive function, and hippocampal volume to episodic memory. Of the age-related variance in cognition, 70–80% was accounted for by combining all brain markers (but only ∼20% of total variance). Age had significant indirect effects on cognition via brain markers, with significant markers varying across cognitive domains. These results suggest that most age-related variation in cognition is shared among multiple brain markers, but potential specificity between some brain markers and cognitive domains motivates additional study of age-related markers of neural health. PMID:25316342
Carcinoembryonic antigen (CEA) as tumor marker in lung cancer.
Grunnet, M; Sorensen, J B
2012-05-01
The use of CEA as a prognostic and predictive marker in patients with lung cancer is widely debated. The aim of this review was to evaluate the results from studies made on this subject. Using the search words "CEA", "tumor markers in lung cancer", "prognostic significance", "diagnostic significance" and "predictive significance", a search was carried out on PubMed. Exclusion criteria was articles never published in English, articles before 1981 and articles evaluating tumor markers in lung cancer not involving CEA. Initially 217 articles were found, and 34 were left after selecting those relevant for the present study. Four of these included both Non-Small Cell Lung Cancer (NSCLC) and Small Cell Lung Cancer (SCLC) patients, and 31 dealt solely with NSCLC patients. Regarding SCLC no studies showed that serum level of CEA was a prognostic marker for overall survival (OS). The use of CEA serum level as a prognostic marker in NSCLC was investigated in 23 studies and the use of CEA plasma level in two. In 18 (17 serum, 1 plasma) of these studies CEA was found to be a useful prognostic marker for either OS, recurrence after surgery or/and progression free survival (PFS) in NSCLC patients. Interestingly, an overweight of low stage (stage I-II) disease and adenocarcinoma (AC) patients were observed in this group. The remaining 7 studies (6 serum, 1 plasma) contained an overweight of patients with squamous carcinoma (SQ). One study found evidence for that a tumor marker index (TMI), based on preoperative CEA and CYFRA21-1 serum levels, is useful as a prognostic marker for OS in NSCLC. Six studies evaluated the use of CEA as a predictive marker for risk of recurrence and risk of death in NSCLC patients. Four of these studies found, that CEA was useful as a predictive marker for risk of recurrence and risk of death measured over time. No studies found CEA levels useful as a diagnostic marker for lung cancer. With regard to NSCLC the level of CEA measured in tumor tissue in
Tomaszewska Gras, J.; Kijowski,; Schreurs, F.J.G.
2002-01-01
The method of quantitative determination of titin and nebulin in chicken meat by SDS-PAGE electrophoresis technique was developed by application of β-galactosidase as the internal standard. The method was tested first on marker protein samples of known concentrations (myosin, transferrin, glutamic
Stability of Markers Used for Real-Time Tumor Tracking After Percutaneous Intrapulmonary Placement
International Nuclear Information System (INIS)
Voort van Zyp, Noelle C. van der; Hoogeman, Mischa S.; Water, Steven van de; Levendag, Peter C.; Holt, Bronno van der; Heijmen, Ben J.M.; Nuyttens, Joost J.
2011-01-01
Purpose: To determine the stability of markers used for real-time tumor tracking after percutaneous intrapulmonary placement. Methods and Materials: A total of 42 patients with 44 lesions, 111 markers, and ≥2 repeat computed tomography (CT) scans were studied. The tumor on the repeat CT scans was registered with the tumor on the planning CT scan. Next, the three-dimensional marker coordinates were determined on the planning CT scan and repeat CT scans. Marker stability was analyzed by the displacement of the markers and the displacement of the center of mass (COM) of the marker configurations. In addition, we assessed the reliability of using the intermarker distance as a check for displacements in the COM of the marker configurations. Results: The median marker displacement was 1.3 mm (range, 0.1-53.6). The marker displacement was >5 mm in 12% of the markers and >10 mm in 5% of the markers. The causes of marker displacement >5 mm included marker migration (2 of 13) and target volume changes (5 of 13). Nonsynchronous tumor and marker movement during breathing might have been responsible for the displacements >5 mm in the other 6 of 13 markers. The median displacement in the COM of the marker configurations was 1.0 mm (range, 0.1-23.3). Displacements in the COM of the marker configurations of ≥2.0 mm were detected by changes in the intermarker distance of >1.5 mm in 96% of the treatment fractions. Conclusion: The median marker displacement was small (1.3 mm). Nevertheless, displacements >5 mm occurred in 12% of the markers. Therefore, we recommend the implantation of multiple markers because multiple markers will enable a quick and reliable check of marker displacement by determining the change in the intermarker distance. A displacement in the COM of the marker configuration of ≥2.0 mm was almost always detected (96%) by a change in the distance between the markers of >1.5 mm. This enabled the displaced marker to be disabled, such that tumor localization was
International Nuclear Information System (INIS)
Watkins, D.V.
1980-01-01
A marker lamp is described which consists of a block of transparent plastics material encapsulated in which is a radioactive light source. These lights comprise a small sealed glass capsule, the hollow inside surface of which is coated with phosphor and which contains tritium or similar radioactive gas. The use of such lamps for identification marking of routes, for example roads, and for identification of underwater oil pipelines is envisaged. (U.K.)
Khosa, Robin; Nangia, Sapna; Chufal, Kundan S; Ghosh, D; Kaul, Rakesh; Sharma, Lalit
2010-01-01
Aim of the study was to assess prostate motion on daily basis with respect to setup and to compare the shifts based on bony anatomy and gold fiducial markers. Gold fiducial markers were inserted in prostate under U/S guidance and daily portal images were taken and compared with digitally reconstructed images, both using bony landmarks and fiducial markers as reference. A dose of 2 MU was given for two orthogonal images daily. The mean and standard deviation of displacement using gold seeds and bone were calculated. Systematic and random errors were generated. The planning target volume (PTV) was calculated using the Van Herk formula. A total of 180 portal images from 10 patients were studied. The mean displacement along x, y and z axes was 1.67 mm, 3.58 mm, and 1.76 mm using fiducial markers and 2.12 mm, 3.47 mm, and 2.09 mm using bony landmarks, respectively. The mean internal organ motion was 1.23 mm (+1.45), 3.11 mm (+2.69 mm); and 1.87 mm (+1.67 mm) along x, y and z axes, respectively. The PTV to account for prostate motion if daily matching was not done was 4.64 mm, 10.41 mm and 4.40 mm along lateral, superoinferior, and anteroposterior directions, respectively. If bony landmarks were used for daily matching, margins of 3.61 mm, 7.31 mm, and 4.72 mm in lateral, superoinferior, and anteroposterior directions should be added to the clinical target volume. Daily alignment using gold fiducial markers is an effective method of localizing prostate displacement. It provides the option of reducing margins, thus limiting normal tissue toxicity and allowing the possibility of dose escalation for better long-term control.
PAV markers in Sorghum bicolour
DEFF Research Database (Denmark)
Shen, Xin; Liu, Zhiquan; Mocoeur, Anne Raymonde Joelle
2015-01-01
Abstract Genic presence/absence variants (PAVs) correlate closely to the phenotypic variation, impacting plant genome sizes and the adaption to the environment. To shed more light on their genome-wide patterns, functions and to test the possibility of using them as molecular markers, we analyzed...... enriched in stress responses and protein modification. We used 325 polymorphic PAVs in two sorghum inbred lines Ji2731 and E-Tian, together with 49 SSR markers, and constructed a genetic map, which consisted of 10 linkage groups corresponding to the 10 chromosomes of sorghum and spanned 1430.3 cM in length...
Application of bio-marker to study on tumor radiosensitivity
International Nuclear Information System (INIS)
Guo Wanfeng; Ding Guirong; Han Liangfu
2001-01-01
To definite tumor radiosensitivity is important for applying the schedules of individualization of patient radiotherapy. Many laboratories were carrying on the research which predict the tumor radiosensitivity with one bio-marker or/and multi-bio-marker in various levels. At present has not witnessed the specific bio-marker, but it provides an excellent model for predicting tumor radiosensitivity
Diagnostic markers for germ cell neoplasms
DEFF Research Database (Denmark)
Rajpert-De Meyts, Ewa; Nielsen, John E; Skakkebaek, Niels E
2015-01-01
This concise review summarises tissue and serum markers useful for differential diagnosis of germ cell tumours (GCTs), with focus on the most common testicular GCTs (TGCTs). GCTs are characterised by phenotypic heterogeneity due to largely retained embryonic pluripotency and aberrant somatic diff...... of molecular markers, which allow specific diagnosis of various subtypes of GCT and are very useful for early detection at the precursor stage and for monitoring of patients during the follow-up....
Haptocorrin as marker of disease progression in fibrolamellar hepatocellular carcinoma
DEFF Research Database (Denmark)
Lildballe, Dorte Launholt; Nguyen, Khoa Tran; Poulsen, Steen Seier
2011-01-01
No valid markers are routinely available to follow disease progression in patients with fibrolamellar hepatocellular carcinoma (FLHCC). We report data suggesting that the vitamin B12 binding protein haptocorrin (HC) may prove a suitable marker.......No valid markers are routinely available to follow disease progression in patients with fibrolamellar hepatocellular carcinoma (FLHCC). We report data suggesting that the vitamin B12 binding protein haptocorrin (HC) may prove a suitable marker....
Development of stable marker-free nuclear transformation strategy ...
African Journals Online (AJOL)
Development of stable marker-free nuclear transformation strategy in the green microalga Chlorella vulgaris. ... into Chlorella by electroporation has very low stability and it is hard to screen the transformants without antibiotic marker genes.
Development and characterization of microsatellite markers for ...
Indian Academy of Sciences (India)
This species is threatened throughout its range in West- ern Ghats as a result of overexploitation and habitat destruc- tion, which have reduced local population sizes and has led many populations to local extinction. In this study, we report the development of microsatellite markers and discuss the utility of these markers in ...
(SSR) markers for drought tolerance in maize
African Journals Online (AJOL)
use
2011-11-21
Nov 21, 2011 ... and dominance gene effects in inheritance are included in almost all traits related to drought (Shiri et al., 2010a, b). Identifying the complete-linked molecular markers with target gene and mapping its chromosome locus is an important goal in plant breeding for gene cloning and marker-aided selection.
Chromosomal location of genomic SSR markers associated
Indian Academy of Sciences (India)
Among the same earlier tested 230 primers, one SSR marker (Xgwm311) also amplified a fragment which is present in the resistant parent and in the resistant bulks, but absent in the susceptible parent and in the susceptible bulks. To understand the chromosome group location of these diagnostic markers, Xgwm382 and ...
Educational support for specialist international medical graduates in anaesthesia.
Higgins, Niall S; Taraporewalla, Kersi; Edirippulige, Sisira; Ware, Robert S; Steyn, Michael; Watson, Marcus O
2013-08-19
To measure specialist international medical graduates' (SIMGs) level of learning through participation in guided tutorials, face-to-face or through videoconferencing (VC), and the effect of tutorial attendance and quality of participation on success in specialist college examinations. Tutorials were conducted at the Royal Brisbane and Women's Hospital between 19 September 2007 and 23 August 2010, and delivered through VC to participants at other locations. Tutorials were recorded and transcribed, and speaker contributions were tagged and ranked using content analysis software. Summary examination results were obtained from the Australian and New Zealand College of Anaesthetists. Tutorial participation and attendance, and college examination pass and fail rates. Transcripts were obtained for 116 tutorials. The median participation percentage for those who subsequently failed the college examinations was 1% (interquartile range [IQR], 0%-1%), while for those who passed the exams it was 5% (IQR, 2%-8%; P technology was found to be a feasible method to assist SIMGs to become aware of the requirements of the exam and to prepare more effectively.
Directory of Open Access Journals (Sweden)
Mansoureh Taghavinia
2012-07-01
Full Text Available Introduction: the method and way of learning and teaching are effective in acquiring clinical skills, and identifying the shortcomings of learning and teaching will lead to better planning. The purpose of this study was to explain the experiences of the learning clinical procedures of the internal medicine residents in gastroenterology department. Methods: qualitative study using content thematic analysis was done. Six fourth-year residents were selected and interviewed considering purposive sampling. The data of the interviews were transcribed and analyzed after rereading. Results: the collected data are divided into three categories: learning and experience with the following four categories (learning time and experiencing, leaning and experiencing times, learning and experiencing opportunities, training and the lack of the training of some procedures. These categories are explained by using some quotes derived from the data. Conclusion: the results of this study suggest that the administrative management of internal residency is poor and should get seriously in implementation and application of intended instructions existing in the prepared program of Medical Education and Specialized Council of internal residency period. The attending physicians and residents must be aware of the content of education program at the beginning of the residency periods and the trainers must try to supervise the residents’ education.
Measurement of some tumor markers by IRMA in vietnam
International Nuclear Information System (INIS)
Tran Xuan Truong
2004-01-01
As we known that a perfect tumor markers could be used in five different ways : for population screening, for diagnose, for monitoring therapy and for follow-up early evidence of cancer recurrence. In order to achieve perfect status a tumor markers would require total negativity in healthy subject, total positivity for single tumor type and close correlation between plasma tumor marker concentration and tumor size . The advance of monoclonal antibodies has had dramatic impact in oncology, where new tumor markers have been discovered and assay methods for all tumor markers have been improved commercially . Analytical performance of these new methods are potentially as good as that of the best Immunoradiometric assay for others analytes. In Vietnam, the first time we use immunoradiometric assay (IRMA) for the measurement of some tumor markers in normal subject and cancer diseases. These are Thyroglobulin (TG) of thyroid cancer, cancer-antigen 15-3 (CA15-3) of breast cancer and cancer-antigen 72-4 (CA72-4) of stomach cancer. We would like applying the CA72-4 in the indication of stomach cancer, CA15-3 in the differential diagnosis of breast cancer, and TG in the differential diagnosis of thyroid cancer. And all of these tumor markers were also used in the clinical follow-up and early detection of recurrence and metastatic Cancer of them. We could try researching on them much more. (authors)
Chen, Min; Tan, Arnold S C; Cheah, Felicia S H; Saw, Eugene E L; Chong, Samuel S
2015-12-01
Beta (β)-thalassemia is one of the most common monogenic diseases worldwide. Affected pregnancies can be avoided through preimplantation genetic diagnosis (PGD), which commonly involves customized assays to detect the different combinations of β-globin (HBB) gene mutations present in couples, in conjunction with linkage analysis of flanking microsatellite markers. Currently, the limited number of reported closely linked markers hampers their utility in indirect linkage-based PGD for this disorder. To increase the available markers closely flanking the HBB gene, an in silico search was performed to identify all markers within 1 Mb flanking the HBB gene. Fifteen markers with potentially high polymorphism information content (PIC) and heterozygosity values were selected and optimized into a single-tube pentadecaplex PCR panel. Allele frequencies and polymorphism and heterozygosity indices of each marker were assessed in five populations. A total of 238 alleles were observed from the 15 markers. PIC was >0.7 for all markers, with expected heterozygosity and observed heterozygosity values ranging from 0.74 to 0.90 and 0.72 to 0.88, respectively. Greater than 99% of individuals were heterozygous for at least seven markers, with at least two heterozygous markers on either side of the HBB gene. The pentadecaplex marker assay also performed reliably on single cells either directly or after whole genome amplification, thus validating its use in standalone linkage-based β-thalassemia PGD or in conjunction with HBB mutation detection. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Shriberg, Lawrence D.; Strand, Edythe A.; Fourakis, Marios; Jakielski, Kathy J.; Hall, Sheryl D.; Karlsson, Heather B.; Mabie, Heather L.; McSweeny, Jane L.; Tilkens, Christie M.; Wilson, David L.
2017-01-01
Purpose: The purpose of this 2nd article in this supplement is to report validity support findings for the Pause Marker (PM), a proposed single-sign diagnostic marker of childhood apraxia of speech (CAS). Method: PM scores and additional perceptual and acoustic measures were obtained from 296 participants in cohorts with idiopathic and…
Linking the potato genome to the conserved ortholog set (COS) markers
2013-01-01
Background Conserved ortholog set (COS) markers are an important functional genomics resource that has greatly improved orthology detection in Asterid species. A comprehensive list of these markers is available at Sol Genomics Network (http://solgenomics.net/) and many of these have been placed on the genetic maps of a number of solanaceous species. Results We amplified over 300 COS markers from eight potato accessions involving two diploid landraces of Solanum tuberosum Andigenum group (formerly classified as S. goniocalyx, S. phureja), and a dihaploid clone derived from a modern tetraploid cultivar of S. tuberosum and the wild species S. berthaultii, S. chomatophilum, and S. paucissectum. By BLASTn (Basic Local Alignment Search Tool of the NCBI, National Center for Biotechnology Information) algorithm we mapped the DNA sequences of these markers into the potato genome sequence. Additionally, we mapped a subset of these markers genetically in potato and present a comparison between the physical and genetic locations of these markers in potato and in comparison with the genetic location in tomato. We found that most of the COS markers are single-copy in the reference genome of potato and that the genetic location in tomato and physical location in potato sequence are mostly in agreement. However, we did find some COS markers that are present in multiple copies and those that map in unexpected locations. Sequence comparisons between species show that some of these markers may be paralogs. Conclusions The sequence-based physical map becomes helpful in identification of markers for traits of interest thereby reducing the number of markers to be tested for applications like marker assisted selection, diversity, and phylogenetic studies. PMID:23758607
DEFF Research Database (Denmark)
Egbert, Maria; Hirataka, Fumiya; Sadeghi, Sima
In the area of pragmatics the numbers of studies on non-English data has been increasing. For the career of most researchers, it is highly desirable to publish internationally, and thus in English. When researchers transcribe and gloss non-English data for publications in English, they often need...... to make practical decisions that have an impact on the analysis and presentation of results. This paper argues methodologically that non-English data should be treated more faithfully. The paper starts by examining how researchers in different fields of pragmatics have handled this issue and what problems...... result from the current ‘mainstream’ way. Most authors make their decisions on a case-by-case basis, considering the publisher’s requirements, possibly taking space requirements into account, and most importantly, balancing the trade-off between precision in the data display and the readability...
Zhang, X J; Wang, L X; Chen, X X; Liu, Y L; Meng, R; Wang, Y J; Zhao, Z Y
2014-10-31
Pre-selection for fruit skin color at the seedling stage would be highly advantageous, with marker-assisted selection offering a potential method for apple pre-selection. A and MdMYB1 alleles are allele-specific DNA markers that are potentially associated with apple skin color, and co-segregate with the Rf and Rni loci, respectively. Here, we assessed the potential application of these 2 alleles for marker-assisted breeding across 30 diverse cultivars and 2 apple seedling progenies. The red skin color phenotype was usually associated with the MdMYB1-1 allele and A(1) allele, respectively, while the 2 molecular markers provided approximately 91% predictability in the 'Fuji' x 'Cripps Pink' and 'Fuji' x 'Gala' progenies. The results obtained from the 30 cultivars and 2 progenies were consistent for the 2 molecular markers. Hence, the results supported that Rf and Rni could be located in a gene cluster, or even correspond to alleles of the same gene. Our results are consistent with the hypothesis that red/yellow dimorphism is controlled by a monogenic system, with the presence of the red anthocyanin pigmentation being dominant. In addition, our results supported that the practical utilization of the 2 function markers to efficiently and accurately select red-skinned apple cultivars in apple scion breeding programs.
meta-analysis of Serum Tumor Markers in Lung Cancer
Directory of Open Access Journals (Sweden)
Xianfeng LU
2010-12-01
Full Text Available Background and objective The detection of serum tumor markers is of great value for early diagnosis of lung cancer. The aim of this study is to summarize the clinic significance characteristics of serum markers contributing to the detection of lung cancer. Methods References about serum markers of lung cancer were estimated using meta-analysis method. 712 references which included more than 20 cases, 20 controls, the serum markers of 52 832 patients with malignancies and 32 037 patients as controls were evaluated. Results Overall the detection of 13 markers play a significant part in lung cancer diagnosis. The sensitivity of CEA, CA125, CYFRA21-1, TPA, SCCAg, DKK1, NSE, ProGRP in the patients’ serum with lung cancer were 47.50%, 50.11%, 57.00%, 50.93%, 49.00%, 69.50%, 39.73%, 51.48% and the specificity were 92.34%, 80.19%, 90.16%, 88.41%, 91.07%, 92.20%, 89.11%, 94.89%. In the combined analysis of tumor markers: the sensitivity, specificity of NSE+ProGRP were 88.90% and 72.82% in diagnosis of small cell lung cancer, respectively. In diagnosis of squamous corcinoma, the sensitivity and specificity of TSGF+SCCAg+CYFRA21-1 were 95.30% and 74.20%. The the sensitivity and specificity of CA153+Ferrtin+CEA were 91.90% and 44.00% in diagnosis of lung cancer. Conclusion Although the assay of tumor markers in serum is useful for diagnosis of early lung cancer, the sensitivity and specificity are low. Combined detection of these tumor markers could increase sensitivity and specificity.
Segregation analysis of microsatellite (SSR) markers in sugarcane polyploids.
Lu, X; Zhou, H; Pan, Y-B; Chen, C Y; Zhu, J R; Chen, P H; Li, Y-R; Cai, Q; Chen, R K
2015-12-28
No information is available on segregation analysis of DNA markers involving both pollen and self-progeny. Therefore, we used capillary electrophoresis- and fluorescence-based DNA fingerprinting together with single pollen collection and polymerase chain reaction (PCR) to investigate simple sequence repeat (SSR) marker segregation among 964 single pollens and 288 self-progenies (S1) of sugarcane cultivar LCP 85-384. Twenty SSR DNA fragments (alleles) were amplified by five polymorphic SSR markers. Only one non-parental SSR allele was observed in 2392 PCRs. SSR allele inheritance was in accordance with Mendelian laws of segregation and independent assortment. Highly significant correlation coefficients were found between frequencies of observed and expected genotypes in pollen and S1 populations. Within the S1 population, the most frequent genotype of each SSR marker was the parental genotype of the same marker. The number of genotypes was higher in pollen than S1 population. PIC values of the five SSR markers were greater in pollen than S1 populations. Eleven of 20 SSR alleles (55%) were segregated in accordance with Mendelian segregation ratios expected from pollen and S1 populations of a 2n = 10x polyploid. Six of 20 SSR alleles were segregated in a 3:1 (presence:absence) ratio and were simplex markers. Four and one alleles were segregated in 77:4 and 143:1 ratios and considered duplex and triplex markers, respectively. Segregation ratios of remaining alleles were unexplainable. The results provide information about selection of crossing parents, estimation of seedling population optimal size, and promotion of efficient selection, which may be valuable for sugarcane breeders.
Hong, Ji S; Tillman, Rebecca; Luby, Joan L
2015-03-01
To investigate which disruptive behaviors in preschool were normative and transient vs markers of conduct disorder, as well as which disruptive behaviors predicted the persistence of conduct disorder into school age. Data from a longitudinal study of preschool children were used to investigate disruptive behaviors. Caregivers of preschoolers ages 3.0-5.11 years (n = 273) were interviewed using the Preschool Age Psychiatric Assessment to derive the following diagnostic groups: conduct disorder, externalizing disorder without conduct disorder, internalizing disorder without externalizing disorder, and healthy. At school age, participants were again assessed via an age-appropriate diagnostic interview. Logistic and linear regression with pairwise group comparisons was used to investigate clinical markers of preschool conduct disorder and predictors of school age conduct disorder. Losing one's temper, low-intensity destruction of property, and low-intensity deceitfulness/stealing in the preschool period were found in both healthy and disordered groups. In contrast, high-intensity argument/defiant behavior, both low- and high-intensity aggression to people/animals, high-intensity destruction of property, high-intensity deceitfulness/stealing, and high-intensity peer problems were markers of preschool conduct disorder and predictors of school age conduct disorder. Inappropriate sexual behavior was not a marker for preschool conduct disorder but was a predictor of school age conduct disorder. These findings provide a guide for primary care clinicians to help identify preschoolers with clinical conduct disorder and those who are at risk for persistent conduct disorder in childhood. Preschoolers displaying these symptoms should be targeted for mental health assessment. Copyright © 2015 Elsevier Inc. All rights reserved.
Molecular markers in bladder cancer: Novel research frontiers.
Sanguedolce, Francesca; Cormio, Antonella; Bufo, Pantaleo; Carrieri, Giuseppe; Cormio, Luigi
2015-01-01
Bladder cancer (BC) is a heterogeneous disease encompassing distinct biologic features that lead to extremely different clinical behaviors. In the last 20 years, great efforts have been made to predict disease outcome and response to treatment by developing risk assessment calculators based on multiple standard clinical-pathological factors, as well as by testing several molecular markers. Unfortunately, risk assessment calculators alone fail to accurately assess a single patient's prognosis and response to different treatment options. Several molecular markers easily assessable by routine immunohistochemical techniques hold promise for becoming widely available and cost-effective tools for a more reliable risk assessment, but none have yet entered routine clinical practice. Current research is therefore moving towards (i) identifying novel molecular markers; (ii) testing old and new markers in homogeneous patients' populations receiving homogeneous treatments; (iii) generating a multimarker panel that could be easily, and thus routinely, used in clinical practice; (iv) developing novel risk assessment tools, possibly combining standard clinical-pathological factors with molecular markers. This review analyses the emerging body of literature concerning novel biomarkers, ranging from genetic changes to altered expression of a huge variety of molecules, potentially involved in BC outcome and response to treatment. Findings suggest that some of these indicators, such as serum circulating tumor cells and tissue mitochondrial DNA, seem to be easily assessable and provide reliable information. Other markers, such as the phosphoinositide-3-kinase (PI3K)/AKT (serine-threonine kinase)/mTOR (mammalian target of rapamycin) pathway and epigenetic changes in DNA methylation seem to not only have prognostic/predictive value but also, most importantly, represent valuable therapeutic targets. Finally, there is increasing evidence that the development of novel risk assessment tools
germplasm using ISSR markers and their relationships
African Journals Online (AJOL)
STORAGESEVER
2008-12-17
Dec 17, 2008 ... (MAS) is the current trend in 'Modern Agriculture'. These. DNA markers allow the construction of ... are inherited in Mendelian fashion and are scored as dominant markers (Ratnaparkhe et al., 1998) ... ISSR amplified PCR products were resolved on 2% agarose gel in. 1X TBE buffer (89 mM Tris-Hcl, pH 8.3, ...
DNA Fingerprinting of Olive Varieties by Microsatellite Markers
Directory of Open Access Journals (Sweden)
Dunja Bandelj
2002-01-01
Full Text Available Microsatellites combine several features of an ultimate molecular marker and they are used increasingly in various plant genetic studies and applications. In this work we report on the utilisation of fourteen previously developed olive microsatellite markers for the identification and differentiation of a set of nineteen olive varieties. All analysed microsatellite markers revealed a high level of polymorphism that allowed unique genotyping of the examined varieties. Ninety-six alleles were detected at all 14 loci, which multiplied into a large number of observed genotypes, giving high discrimination value for varietal identification. A minimum number of three microsatellite markers was chosen for the rapid and unambiguous varietal identification of nineteen olive varieties and only two markers were sufficient for differentiation of five local varieties. DNA fingerprints of olive cultivars by means of microsatellites provided meaningful data, which can be extended by additional olive varieties or new microsatellites and used for accurate inter-laboratory comparison. The data obtained can be used for the varietal survey and construction of a database of all olive varieties grown in Slovenia providing also additional genetic information on the agronomic and quality characteristics of the olive varieties.
MacKellar, Drew C; Vaughan, Ashley M; Aly, Ahmed S I; DeLeon, Sasha; Kappe, Stefan H I
2011-11-01
The early transcribed membrane proteins (ETRAMPs) are a family of small, highly charged transmembrane proteins unique to malaria parasites. Some members of the ETRAMP family have been localized to the parasitophorous vacuole membrane that separates the intracellular parasite from the host cell and thus presumably have a role in host-parasite interactions. Although it was previously shown that two ETRAMPs are critical for rodent malaria parasite liver-stage development, the importance of most ETRAMPs during the parasite life cycle remains unknown. Here, we comprehensively identify nine new etramps in the genome of the rodent malaria parasite Plasmodium yoelii, and elucidate their conservation in other malaria parasites. etramp expression profiles are diverse throughout the parasite life cycle as measured by RT-PCR. Epitope tagging of two ETRAMPs demonstrates protein expression in blood and liver stages, and reveals differences in both their timing of expression and their subcellular localization. Gene targeting studies of each of the nine uncharacterized etramps show that two are refractory to deletion and thus likely essential for blood-stage replication. Seven etramps are not essential for any life cycle stage. Systematic characterization of the members of the ETRAMP family reveals the diversity in importance of each family member at the interface between host and parasite throughout the developmental cycle of the malaria parasite. © 2011 Blackwell Publishing Ltd.
Serotonin, neural markers and memory
Directory of Open Access Journals (Sweden)
Alfredo eMeneses
2015-07-01
Full Text Available Diverse neuropsychiatric disorders present dysfunctional memory and no effective treatment exits for them; likely as result of the absence of neural markers associated to memory. Neurotransmitter systems and signaling pathways have been implicated in memory and dysfunctional memory; however, their role is poorly understood. Hence, neural markers and cerebral functions and dysfunctions are revised. To our knowledge no previous systematic works have been published addressing these issues. The interactions among behavioral tasks, control groups and molecular changes and/or pharmacological effects are mentioned. Neurotransmitter receptors and signaling pathways, during normal and abnormally functioning memory with an emphasis on the behavioral aspects of memory are revised. With focus on serotonin, since as it is a well characterized neurotransmitter, with multiple pharmacological tools, and well characterized downstream signaling in mammals’ species. 5-HT1A, 5-HT4, 5-HT5, 5-HT6 and 5-HT7 receptors as well as SERT (serotonin transporter seem to be useful neural markers and/or therapeutic targets. Certainly, if the mentioned evidence is replicated, then the translatability from preclinical and clinical studies to neural changes might be confirmed. Hypothesis and theories might provide appropriate limits and perspectives of evidence
Directory of Open Access Journals (Sweden)
Heloísa Marcelina da Cunha Palhares
Full Text Available OBJECTIVE: This study analyzed the frequency of cardiometabolic risk markers and metabolic syndrome occurrence in overweight and obese children and adolescents. METHODS: The participants included 161 overweight (n=65 and obese (n=96 individuals aged between 5 and 19 years. Clinical markers were assessed (body mass index, body fat percentage, waist circumference, acanthosis, systolic and diastolic blood pressures, laboratory parameters [glucose, insulin, cholesterol (total and fractions and triglyceride levels and homeostasis model assessment of insulin resistance (HOMA-IR index] and leptin and adiponectin levels. The frequency of changes, odds ratios and correlations among markers were determined. Metabolic syndrome was assessed according to International Diabetes Federation criteria. RESULTS: A high frequency of acanthosis (51.6%; increased waist circumference (45.4%, systolic blood pressure / diastolic blood pressure (8.1% / 9.3%, glucose (10%, insulin (36.9% and HOMA-IR (44.3% values; and reduced high-density lipoprotein levels (47.2% were observed. Leptin levels were increased in 95% of obese and in 66% of overweight subjects. Adiponectin was decreased in 29.5% of obese and in 34% of overweight subjects. An odd ratio analysis revealed a greater probability of increased waist circumference (9.0, systolic blood pressure (4.1, triglyceride (2.3 and insulin (2.9 levels and HOMA-IR (3.0 in the obese group than in the overweight group. The clinical and laboratory parameters and leptin levels exhibited significant correlations, whereas adiponectin was negatively correlated with systolic blood pressure. The occurrence rate of metabolic syndrome was 13.6%. CONCLUSIONS: The high frequency of changes in clinical, laboratory and adipokine markers indicates the need for early interventions aimed at preventing cardiometabolic complications in adulthood.
Bentley, Kirsten; Keep, Sarah May; Armesto, Maria; Britton, Paul
2013-02-01
Coronavirus subgenomic mRNA (sgmRNA) synthesis occurs via a process of discontinuous transcription involving transcription regulatory sequences (TRSs) located in the 5' leader sequence (TRS-L) and upstream of each structural and group-specific gene (TRS-B). Several gammacoronaviruses including infectious bronchitis virus (IBV) contain a putative open reading frame (ORF), localized between the M gene and gene 5, which is controversial due to the perceived absence of a TRS. We have studied the transcription of a novel sgmRNA associated with this potential ORF and found it to be transcribed via a previously unidentified noncanonical TRS-B. Using an IBV reverse genetics system, we demonstrated that the template-switching event during intergenic region (IR) sgmRNA synthesis occurs at the 5' end of the noncanonical TRS-B and recombines between nucleotides 5 and 6 of the 8-nucleotide consensus TRS-L. Introduction of a complete TRS-B showed that higher transcription levels are achieved by increasing the number of nucleotide matches between TRS-L and TRS-B. Translation of a protein from the sgmRNA was demonstrated using enhanced green fluorescent protein, suggesting the translation of a fifth, novel, group-specific protein for IBV. This study has resolved an issue concerning the number of ORFs expressed by members of the Gammacoronavirus genus and proposes the existence of a fifth IBV accessory protein. We confirmed previous reports that coronaviruses can produce sgmRNAs from noncanonical TRS-Bs, which may expand their repertoire of proteins. We also demonstrated that noncanonical TRS-Bs may provide a mechanism by which coronaviruses can control protein expression levels by reducing sgmRNA synthesis.
Feasibility of magnetic marker localisation for non-palpable breast cancer.
Schermers, B; van der Hage, J A; Loo, C E; Vrancken Peeters, M T F D; Winter-Warnars, H A O; van Duijnhoven, F; Ten Haken, B; Muller, S H; Ruers, T J M
2017-06-01
Accurate tumour localisation is essential for breast-conserving surgery of non-palpable tumours. Current localisation technologies are associated with disadvantages such as logistical challenges and migration issues (wire guided localisation) or legislative complexities and high administrative burden (radioactive localisation). We present MAgnetic MArker LOCalisation (MaMaLoc), a novel technology that aims to overcome these disadvantages using a magnetic marker and a magnetic detection probe. This feasibility study reports on the first experience with this new technology for breast cancer localisation. Fifteen patients with unifocal, non-palpable breast cancer were recruited. They received concurrent placement of the magnetic marker in addition to a radioactive iodine seed, which is standard of care in our clinic. In a subset of five patients, migration of the magnetic marker was studied. During surgery, a magnetic probe and gammaprobe were alternately used to localise the markers and guide surgery. The primary outcome parameter was successful transcutaneous identification of the magnetic marker. Additionally, data on radiologist and surgeon satisfaction were collected. Magnetic marker placement was successful in all cases. Radiologists could easily adapt to the technology in the clinical workflow. Migration of the magnetic marker was negligible. The primary endpoint of the study was met with an identification rate of 100%. Both radiologists and surgeons reflected that the technology was intuitive to use and that it was comparable to radioactive iodine seed localisation. Magnetic marker localisation for non-palpable breast cancer is feasible and safe, and may be a viable non-radioactive alternative to current localisation technologies. Copyright © 2017 Elsevier Ltd. All rights reserved.
Molecular markers: a potential resource for ginger genetic diversity studies.
Ismail, Nor Asiah; Rafii, M Y; Mahmud, T M M; Hanafi, M M; Miah, Gous
2016-12-01
Ginger is an economically important and valuable plant around the world. Ginger is used as a food, spice, condiment, medicine and ornament. There is available information on biochemical aspects of ginger, but few studies have been reported on its molecular aspects. The main objective of this review is to accumulate the available molecular marker information and its application in diverse ginger studies. This review article was prepared by combing material from published articles and our own research. Molecular markers allow the identification and characterization of plant genotypes through direct access to hereditary material. In crop species, molecular markers are applied in different aspects and are useful in breeding programs. In ginger, molecular markers are commonly used to identify genetic variation and classify the relatedness among varieties, accessions, and species. Consequently, it provides important input in determining resourceful management strategies for ginger improvement programs. Alternatively, a molecular marker could function as a harmonizing tool for documenting species. This review highlights the application of molecular markers (isozyme, RAPD, AFLP, SSR, ISSR and others such as RFLP, SCAR, NBS and SNP) in genetic diversity studies of ginger species. Some insights on the advantages of the markers are discussed. The detection of genetic variation among promising cultivars of ginger has significance for ginger improvement programs. This update of recent literature will help researchers and students select the appropriate molecular markers for ginger-related research.
Multiple marker abundance profiling
DEFF Research Database (Denmark)
Hooper, Cornelia M.; Stevens, Tim J.; Saukkonen, Anna
2017-01-01
proteins and the scoring accuracy of lower-abundance proteins in Arabidopsis. NPAS was combined with subcellular protein localization data, facilitating quantitative estimations of organelle abundance during routine experimental procedures. A suite of targeted proteomics markers for subcellular compartment...
Nankali, Saber; Torshabi, Ahmad Esmaili; Miandoab, Payam Samadi; Baghizadeh, Amin
2016-01-08
In external-beam radiotherapy, using external markers is one of the most reliable tools to predict tumor position, in clinical applications. The main challenge in this approach is tumor motion tracking with highest accuracy that depends heavily on external markers location, and this issue is the objective of this study. Four commercially available feature selection algorithms entitled 1) Correlation-based Feature Selection, 2) Classifier, 3) Principal Components, and 4) Relief were proposed to find optimum location of external markers in combination with two "Genetic" and "Ranker" searching procedures. The performance of these algorithms has been evaluated using four-dimensional extended cardiac-torso anthropomorphic phantom. Six tumors in lung, three tumors in liver, and 49 points on the thorax surface were taken into account to simulate internal and external motions, respectively. The root mean square error of an adaptive neuro-fuzzy inference system (ANFIS) as prediction model was considered as metric for quantitatively evaluating the performance of proposed feature selection algorithms. To do this, the thorax surface region was divided into nine smaller segments and predefined tumors motion was predicted by ANFIS using external motion data of given markers at each small segment, separately. Our comparative results showed that all feature selection algorithms can reasonably select specific external markers from those segments where the root mean square error of the ANFIS model is minimum. Moreover, the performance accuracy of proposed feature selection algorithms was compared, separately. For this, each tumor motion was predicted using motion data of those external markers selected by each feature selection algorithm. Duncan statistical test, followed by F-test, on final results reflected that all proposed feature selection algorithms have the same performance accuracy for lung tumors. But for liver tumors, a correlation-based feature selection algorithm, in
DEFF Research Database (Denmark)
Elbe, Anne-Marie; Jensen, Stine Nylandsted; Elsborg, Peter
2016-01-01
BACKGROUND: Urine sample collection for doping control tests is a key component of the World Anti-Doping Agency's fight against doping in sport. However, a substantial number of athletes experience difficulty when having to urinate under supervision. Furthermore, it cannot always be ensured...... that athletes are actually delivering their own urine. A method that can be used to alleviate the negative impact of a supervised urination procedure and which can also identify urine as coming from a specific athlete is the urine marker test. Monodisperse low molecular weight polyethylene glycols (PEGs......) are given orally prior to urination. Urine samples can be traced to the donor by analysis of the PEGs previously given. OBJECTIVE: The objective of this study was to investigate the use of the urine marker during urine doping control testing. METHODS: Two studies investigated athletes' acceptance...
Mehdi, Muhammad Zain; Nagi, Abdul Hanan; Naseem, Nadia
2016-01-01
can act as surrogate markers for grade in a manner that is more objective and reproducible. Copyright® by the International Brazilian Journal of Urology.
DEFF Research Database (Denmark)
Bay-Jensen, Anne-Christine; Tabassi, Nadine; Sondergaard, Lene
2009-01-01
ABSTRACT: INTRODUCTION: The urinary level of type II collagen degradation marker CTX-II is increased in postmenopausal women and in ovariectomized rats, suggesting that estrogen deprivation induces cartilage breakdown. Here we investigate whether this response to estrogen holds true for other type...... II collagen turnover markers known to be affected in osteoarthritis, and whether it relates to its presence in specific areas of cartilage tissue. METHODS: The type II collagen degradation markers CTX-II and Helix-II were measured in body fluids of pre- and postmenopausal women and of ovariectomized...... rats receiving estrogen or not. Levels of PIIANP, a marker of type II collagen synthesis, were also measured in rats. Rat knee cartilage was analyzed for immunoreactivity of CTX-II and PIIANP and for type II collagen expression. RESULTS: As expected, urinary levels of CTX-II are significantly increased...
Genetic markers and their application in livestock breeding in South ...
African Journals Online (AJOL)
The ultimate use of DNA markers would be to identify quantitative trait loci (QTL) in order to practice genotypic selection. This paper reviews DNA markers (RAPD, DFP, RFLP AFLP, minisatellites, microsatellites, SNP) and provides a brief overview of the current application of these markers in animal breeding.
Arbefeville, S; Harris, A; Ferrieri, P
2017-09-01
Fungal infections cause considerable morbidity and mortality in immunocompromised patients. Rapid and accurate identification of fungi is essential to guide accurately targeted antifungal therapy. With the advent of molecular methods, clinical laboratories can use new technologies to supplement traditional phenotypic identification of fungi. The aims of the study were to evaluate the sole commercially available MicroSEQ® D2 LSU rDNA Fungal Identification Kit compared to the in-house developed internal transcribed spacer (ITS) regions assay in identifying moulds, using two well-known online public databases to analyze sequenced data. 85 common and uncommon clinically relevant fungi isolated from clinical specimens were sequenced for the D2 region of the large subunit (LSU) of ribosomal RNA (rRNA) gene with the MicroSEQ® Kit and the ITS regions with the in house developed assay. The generated sequenced data were analyzed with the online GenBank and MycoBank public databases. The D2 region of the LSU rRNA gene identified 89.4% or 92.9% of the 85 isolates to the genus level and the full ITS region (f-ITS) 96.5% or 100%, using GenBank or MycoBank, respectively, when compared to the consensus ID. When comparing species-level designations to the consensus ID, D2 region of the LSU rRNA gene aligned with 44.7% (38/85) or 52.9% (45/85) of these isolates in GenBank or MycoBank, respectively. By comparison, f-ITS possessed greater specificity, followed by ITS1, then ITS2 regions using GenBank or MycoBank. Using GenBank or MycoBank, D2 region of the LSU rRNA gene outperformed phenotypic based ID at the genus level. Comparing rates of ID between D2 region of the LSU rRNA gene and the ITS regions in GenBank or MycoBank at the species level against the consensus ID, f-ITS and ITS2 exceeded performance of the D2 region of the LSU rRNA gene, but ITS1 had similar performance to the D2 region of the LSU rRNA gene using MycoBank. Our results indicated that the MicroSEQ® D2 LSU r
Behavior of Lipiodol Markers During Image Guided Radiotherapy of Bladder Cancer
International Nuclear Information System (INIS)
Chai Xiangfei; Herk, Marcel van; Kamer, Jeroen B. van de; Remeijer, Peter; Bex, Axel; Betgen, Anja; De Reijke, Theo M.; Hulshof, Maarten C.C.M.; Pos, Floris J.; Bel, Arjan
2010-01-01
Purpose: To investigate the stability of a novel type of markers used in partial bladder tumor irradiation and tumor deformation as indicated by the markers. Materials and Methods: In 15 patients with solitary bladder cancer, lipiodol was injected in the bladder wall during flexible cystoscopy to identify the tumor. A planning CT scan was made, followed by daily cone-beam CT (CBCT) scans during treatment. To study the accuracy of using these markers for image guidance, uncertainties U1 and U2 were calculated, which were defined as the difference between submask registration (covering single marker) and the average of all submask registrations and the difference between the submask registration and the general mask registration (including all markers), respectively. Finally, to study tumor deformation, the relative movement of each marker pair was correlated with the relative bladder volume (RBV). Results: The analyzed patients had 2.3 marker injections on average. The lipiodol spot size was 0.72 ± 1.1 cm 3 . The intensity of spots in both CT and CBCT was significantly higher than the surrounding bladder tissue. The uncertainties U1 and U2 were comparable, and the uncertainties in left-right direction (0.14-0.19 cm) were smaller than those in cranial-caudal and anterior-posterior directions (0.19-0.32 cm). The relative marker movement of within-zone marker pairs was much smaller (and has less dependence on the RBV) than across-zones marker pairs. Conclusions: Lipiodol markers are a feasible method to track bladder tumor by using online CBCT. Tumor deformation is observed, especially for tumors that cross the defined bladder zones.
Behavior of Lipiodol Markers During Image Guided Radiotherapy of Bladder Cancer
Energy Technology Data Exchange (ETDEWEB)
Chai Xiangfei, E-mail: x.chai@amc.uva.n [Department of Radiation Oncology, Academic Medical Center, University of Amsterdam, Amsterdam (Netherlands); Herk, Marcel van [Department of Radiation Oncology, The Netherlands Cancer Institute, Antoni van Leeuwenhoek Hospital, Amsterdam (Netherlands); Kamer, Jeroen B. van de [Department of Radiation Oncology, Academic Medical Center, University of Amsterdam, Amsterdam (Netherlands); Remeijer, Peter [Department of Radiation Oncology, Netherlands Cancer Institute, Antoni van Leeuwenhoek Hospital, Amsterdam (Netherlands); Bex, Axel [Department of Urology, Netherlands Cancer Institute, Antoni van Leeuwenhoek Hospital, Amsterdam (Netherlands); Betgen, Anja [Department of Radiation Oncology, Netherlands Cancer Institute, Antoni van Leeuwenhoek Hospital, Amsterdam (Netherlands); De Reijke, Theo M [Department of Urology, Academic Medical Center, University of Amsterdam, Amsterdam (Netherlands); Hulshof, Maarten C.C.M. [Department of Radiation Oncology, Academic Medical Center, University of Amsterdam, Amsterdam (Netherlands); Pos, Floris J [Department of Radiation Oncology, Netherlands Cancer Institute, Antoni van Leeuwenhoek Hospital, Amsterdam (Netherlands); Bel, Arjan [Department of Radiation Oncology, Academic Medical Center, University of Amsterdam, Amsterdam (Netherlands)
2010-05-01
Purpose: To investigate the stability of a novel type of markers used in partial bladder tumor irradiation and tumor deformation as indicated by the markers. Materials and Methods: In 15 patients with solitary bladder cancer, lipiodol was injected in the bladder wall during flexible cystoscopy to identify the tumor. A planning CT scan was made, followed by daily cone-beam CT (CBCT) scans during treatment. To study the accuracy of using these markers for image guidance, uncertainties U1 and U2 were calculated, which were defined as the difference between submask registration (covering single marker) and the average of all submask registrations and the difference between the submask registration and the general mask registration (including all markers), respectively. Finally, to study tumor deformation, the relative movement of each marker pair was correlated with the relative bladder volume (RBV). Results: The analyzed patients had 2.3 marker injections on average. The lipiodol spot size was 0.72 +- 1.1 cm{sup 3}. The intensity of spots in both CT and CBCT was significantly higher than the surrounding bladder tissue. The uncertainties U1 and U2 were comparable, and the uncertainties in left-right direction (0.14-0.19 cm) were smaller than those in cranial-caudal and anterior-posterior directions (0.19-0.32 cm). The relative marker movement of within-zone marker pairs was much smaller (and has less dependence on the RBV) than across-zones marker pairs. Conclusions: Lipiodol markers are a feasible method to track bladder tumor by using online CBCT. Tumor deformation is observed, especially for tumors that cross the defined bladder zones.
Promise and pitfalls of molecular markers of thyroid nodules
Jadhav, S.; Lila, Anurag; Bandgar, Tushar; Shah, Nalini
2012-01-01
Thyroid nodules are common in the general population with a prevalence of 5-7% The initial evaluation of thyroid nodules commonly involves thyroid function tests, an ultrasound (USG) and fine needle aspiration biopsy (FNAB). The optimal management of patients with thyroid nodules with indeterminate cytology is plagued by the lack of highly sensitive and specific diagnostic modalities In this article we attempt to review the available literature on the molecular markers which are increasingly being studied for their diagnostic utility in assessing thyroid nodules. The various molecular markers consist of gene mutations, gene re arrangements, RNA based assays and immunohistochemical markers. The molecular markers definitely would help to optimise the management of such patients. PMID:23565369
Promise and pitfalls of molecular markers of thyroid nodules
Directory of Open Access Journals (Sweden)
S Jadhav
2012-01-01
Full Text Available Thyroid nodules are common in the general population with a prevalence of 5-7% The initial evaluation of thyroid nodules commonly involves thyroid function tests, an ultrasound (USG and fine needle aspiration biopsy (FNAB. The optimal management of patients with thyroid nodules with indeterminate cytology is plagued by the lack of highly sensitive and specific diagnostic modalities In this article we attempt to review the available literature on the molecular markers which are increasingly being studied for their diagnostic utility in assessing thyroid nodules. The various molecular markers consist of gene mutations, gene re arrangements, RNA based assays and immunohistochemical markers. The molecular markers definitely would help to optimise the management of such patients.
Microbiome Data Accurately Predicts the Postmortem Interval Using Random Forest Regression Models
Directory of Open Access Journals (Sweden)
Aeriel Belk
2018-02-01
Full Text Available Death investigations often include an effort to establish the postmortem interval (PMI in cases in which the time of death is uncertain. The postmortem interval can lead to the identification of the deceased and the validation of witness statements and suspect alibis. Recent research has demonstrated that microbes provide an accurate clock that starts at death and relies on ecological change in the microbial communities that normally inhabit a body and its surrounding environment. Here, we explore how to build the most robust Random Forest regression models for prediction of PMI by testing models built on different sample types (gravesoil, skin of the torso, skin of the head, gene markers (16S ribosomal RNA (rRNA, 18S rRNA, internal transcribed spacer regions (ITS, and taxonomic levels (sequence variants, species, genus, etc.. We also tested whether particular suites of indicator microbes were informative across different datasets. Generally, results indicate that the most accurate models for predicting PMI were built using gravesoil and skin data using the 16S rRNA genetic marker at the taxonomic level of phyla. Additionally, several phyla consistently contributed highly to model accuracy and may be candidate indicators of PMI.
Search Results | Page 12 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
Results 111 - 120 of 8496 ... The role of epitranscriptome and translational dysregulation in cancer. Proteins represent the final product of genes and are implicated in governing most cellular functions. Production of proteins from genes is referred to as gene expression. Genes are first transcribed into messenger ribonucleic ...
14 CFR 171.321 - DME and marker beacon performance requirements.
2010-01-01
... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false DME and marker beacon performance... (MLS) § 171.321 DME and marker beacon performance requirements. (a) The DME equipment must meet the..._regulations/ibr_locations.html. (b) MLS marker beacon equipment must meet the performance requirements...
Chua, Terence C; Chong, Chanel H; Liauw, Winston; Zhao, Jing; Morris, David L
2012-08-01
The study examines the role inflammatory and tumor markers as biomarkers to preoperatively predict outcome in patients with epithelial appendiceal neoplasm undergoing cytoreduction and intraperitoneal chemotherapy. Associations between baseline variables, tumor markers [CEA (carcinoembyronic antigen], CA125, CA199), inflammatory markers including neutrophils-lymphocyte ratio (NLR), platelet-lymphocyte ratio (PLR), and C-reactive protein (CRP) with progression-free survival (PFS) and overall survival (OS) were examined in patients undergoing surgical cytoreduction and intraperitoneal chemotherapy for epithelial appendiceal neoplasm. A total of 174 patients with epithelial appendiceal neoplasm (low-grade pseudomyxoma, n = 117; appendiceal cancer, n = 57) underwent cytoreduction. On univariate analysis, all 3 inflammatory and tumor markers predicted for both PFS and OS, respectively; NLR ≤ 2.6 (P = 0.01, P = 0.002), PLR ≤ 166 (P = 0.006, P = 0.016), CRP ≤ 12.5 (P = 0.001, P = 0.008), CEA (P 37 (P = 0.003), and a CRP > 12.5 (P = 0.013). A higher peritoneal cancer index (PCI > 24) was associated with elevation in CEA > 12, CA125 > 39, CA199 > 37, PLR > 166 and CRP > 12. The tumor histologic subtype was associated with CA 199 levels. The results from this investigation suggest that preoperative inflammatory markers in blood and serologic tumor markers may predict outcomes and are associated with tumor biology in patients with epithelial appendiceal neoplasm undergoing cytoreduction and intraperitoneal chemotherapy treatment.
Patrizi, Alfredo; Pennestrì, Ettore; Valentini, Pier Paolo
2016-01-01
The paper deals with the comparison between a high-end marker-based acquisition system and a low-cost marker-less methodology for the assessment of the human posture during working tasks. The low-cost methodology is based on the use of a single Microsoft Kinect V1 device. The high-end acquisition system is the BTS SMART that requires the use of reflective markers to be placed on the subject's body. Three practical working activities involving object lifting and displacement have been investigated. The operational risk has been evaluated according to the lifting equation proposed by the American National Institute for Occupational Safety and Health. The results of the study show that the risk multipliers computed from the two acquisition methodologies are very close for all the analysed activities. In agreement to this outcome, the marker-less methodology based on the Microsoft Kinect V1 device seems very promising to promote the dissemination of computer-aided assessment of ergonomics while maintaining good accuracy and affordable costs. PRACTITIONER’S SUMMARY: The study is motivated by the increasing interest for on-site working ergonomics assessment. We compared a low-cost marker-less methodology with a high-end marker-based system. We tested them on three different working tasks, assessing the working risk of lifting loads. The two methodologies showed comparable precision in all the investigations.
State and trait olfactory markers of major depression.
Directory of Open Access Journals (Sweden)
Marine Naudin
Full Text Available Nowadays, depression is a major issue in public health. Because of the partial overlap between the brain structures involved in depression, olfaction and emotion, the study of olfactory function could be a relevant way to find specific cognitive markers of depression. This study aims at determining whether the olfactory impairments are state or trait markers of major depressive episode (MDE through the study of the olfactory parameters involving the central olfactory pathway. In a pilot study, we evaluated prospectively 18 depressed patients during acute episodes of depression and 6 weeks after antidepressant treatment (escitalopram against 54 healthy volunteers, matched by age, gender and smoking status. We investigated the participants' abilities to identify odors (single odors and in binary mixture, to evaluate and discriminate the odors' intensity, and determine the hedonic valence of odors. The results revealed an "olfactory anhedonia" expressed by decrease of hedonic score for high emotional odorant as potential state marker of MDE. Moreover, these patients experienced an "olfactory negative alliesthesia", during the odor intensity evaluation, and failed to identify correctly two odorants with opposite valences in a binary iso-mixture, which constitute potential trait markers of the disease. This study provides preliminary evidence for olfactory impairments associated with MDE (state marker that are persistent after the clinical improvement of depressive symptoms (trait marker. These results could be explained by the chronicity of depression and/or by the impact of therapeutic means used (antidepressant treatment. They need to be confirmed particularly the ones obtained in complex olfactory environment which corresponds a more objective daily life situation.
Criteria for selection and application of molecular markers for clinical studies of osteoarthritis.
Otterness, I G; Swindell, A C
2003-03-01
To develop criteria for the selection and application of molecular markers for the study of osteoarthritis (OA). Statistical criteria for marker selection for OA are developed. After studying more than 20 different molecular markers for monitoring OA, procedures for choosing markers for clinical studies have been developed. For a particular study, the process starts with the markers showing 'face-validity' for monitoring OA. They are next required to successfully distinguish OA patients from controls. This necessitates definition of the distribution of marker values in OA patients and controls. So far, they have been consistently log-normal. The difference (Delta) in marker values between OA and controls defines the opportunity for marker improvement. The between-visit standard deviation (S) in patients puts limits on the detection of marker changes. The two variables can be combined to estimate the practicality of a marker using a modified power analysis. The number of patients (N*) required to observe a 50% improvement with an alpha level of P=0.05 and with 80% certainty is estimated as 50(S/Delta)(2). N*, S and Delta should be used to characterize and compare markers. Marker efficiency can be refined by regressing on secondary variables, such as age, sex, BMI, severity, etc. Finally, the use of two or more markers may be required to improve marker prediction of clinical outcome. Correlated markers can be used to reinforce conclusions by essentially adding replicative data. Independent, complementary markers can be used to develop associations with clinical parameters, and perhaps diagnose and monitor disease status, activities that so far have not been possible with single markers.
Directory of Open Access Journals (Sweden)
Rawnak Laila
2017-01-01
Full Text Available Clubroot is a soil-borne disease caused by the protist Plasmodiophora brassicae (P. brassicae. It is one of the most economically important diseases of Brassica rapa and other cruciferous crops as it can cause remarkable yield reductions. Understanding P. brassicae genetics, and developing efficient molecular markers, is essential for effective detection of harmful races of this pathogen. Samples from 11 Korean field populations of P. brassicae (geographic isolates, collected from nine different locations in South Korea, were used in this study. Genomic DNA was extracted from the clubroot-infected samples to sequence the ribosomal DNA. Primers and probes for P. brassicae were designed using a ribosomal DNA gene sequence from a Japanese strain available in GenBank (accession number AB526843; isolate NGY. The nuclear ribosomal DNA (rDNA sequence of P. brassicae, comprising 6932 base pairs (bp, was cloned and sequenced and found to include the small subunits (SSUs and a large subunit (LSU, internal transcribed spacers (ITS1 and ITS2, and a 5.8s. Sequence variation was observed in both the SSU and LSU. Four markers showed useful differences in high-resolution melting analysis to identify nucleotide polymorphisms including single- nucleotide polymorphisms (SNPs, oligonucleotide polymorphisms, and insertions/deletions (InDels. A combination of three markers was able to distinguish the geographical isolates into two groups.
Marker chromosome 21 identified by microdissection and FISH
Energy Technology Data Exchange (ETDEWEB)
Sun, Y.; Palmer, C.G. [Indiana Univ. School of Medicine, Indianapolis, IN (United States); Rubinstein, J. [Univ. Affiliated Cincinnati Center for Developmental Disorders, OH (United States)] [and others
1995-03-27
A child without Down`s syndrome but with developmental delay, short stature, and autistic behavior was found to be mosaic 46,XX/47,XX,+mar(21) de novo. The marker was a small ring or dot-like chromosome. Microdissection of the marker was performed. The dissected fragments were biotinylated with sequence-independent PCR as a probe pool for fluorescence in situ hybridization (FISH). FISH results suggested an acrocentric origin of the marker. Subsequent FISH with {alpha}-satellite DNA probes for acrocentric chromosomes and chromosome-specific 21 and 22 painting probes confirmed its origin from chromosome 21. 14 refs., 3 figs.
Discourse Markers s Sentence Openers in Legal English
Directory of Open Access Journals (Sweden)
Onorina Botezat
2010-06-01
Full Text Available Discourse markers can be defined as linguistic expressions of different length which carry pragmatic and propositional meaning, they are used to combine clauses or to connect sentence elements andthey appear in both speech and writing, and facilitate the discourse. Each discourse marker indicates a particular meaning relationship between two or more clauses. English is predominantly the language ofinternational legal practice and its importance to lawyers cannot be over-emphasized. The way in which one uses legal English can therefore be crucial to professional success. This paper stresses the importance of good usage of discourse markers in legal English.
Directory of Open Access Journals (Sweden)
Cherneva RV
2013-06-01
Full Text Available Radostina Vlaeva Cherneva,1 Ognian Borisov Georgiev,1 Daniela Stoichkova Petrova,1 Emil Ivanov Manov,2 Sylvia Rumenova Ruseva,3 Vanio Ivanov Mitev,3 Julia Ivanova Petrova4 1Department of Internal Medicine, Division of Pulmonary Medicine, Medical University of Sofia, Sofia, Bulgaria; 2Department of Internal Medicine, Division of Cardiology, Medical University of Sofia, Sofia, Bulgaria; 3Department of Medical Chemistry and Biochemistry, Laboratory of Synthesis and Analysis of Bioactive Substances, Medical University of Sofia, Sofia, Bulgaria; 4Department of Neurology, Medical University of Sofia, Sofia, Bulgaria Objective: Increased oxidative stress is considered to be an independent risk factor for cardiovascular diseases, but remains disputed in obstructive sleep apnea (OSA. Among oxidative stress markers, isorpostanes are considered to be the most sensitive and specific. Aims: The aim of the study was to compare urinary isorpostanes in patients with OSA and systolic dysfunction to patients with OSA and preserved ejection fraction (EF and determine their role as markers for increased oxidative stress and early cardiac damage. Materials and methods: Urinary 8F2-isorpostanes were measured in 30 patients with OSA and mild systolic dysfunction (EF = 45.7% ± 6.17% and compared to 15 patients with OSA and normal EF (EF = 60.3% ± 6.3%. Univariate regression analysis was performed to find predictors of left systolic dysfunction. Correlations between 8-isorpostanes, anthropometric, metabolic, and sleep study characteristics were explored. In addition, in 19 patients the effect of bilevel positive airway pressure (BiPAP therapy was evaluated during a 3 month follow-up. Markers of hemodynamic stress, N-terminal prohormone of brain natriuretic peptide and oxidative stress, measured by 8-isorpostanes were compared before and after the follow-up. Results: Urinary levels of 8-isorpostanes were significantly higher in the group with mild systolic dysfunction
Preclinical assessment of hypoxic marker specificity and sensitivity
International Nuclear Information System (INIS)
Iyer, Renuka V.; Engelhardt, Edward L.; Stobbe, Corinne C.; Schneider, Richard F.; Chapman, J. Donald
1998-01-01
Purpose: In the search for a sensitive, accurate, and noninvasive technique for quantifying human tumor hypoxia, our laboratory has synthesized several potential radiodiagnostic agents. The purpose of this study was to assess and compare the hypoxic marking properties of both radioiodinated and Tc-99m labeled markers in appropriate test systems which can predict for in vivo activity. Materials and Methods: Preclinical assessment of hypoxic marker specificity and sensitivity employed three laboratory assays with tumor cells in vitro and in vivo. Radiolabeled marker uptake and/or binding to whole EMT-6 tumor cells under extremely hypoxic and aerobic conditions was measured and their ratio defined hypoxia-specific factor (HSF). Marker specificity to hypoxic tumor tissue was estimated from its selective avidity to two rodent tumors in vivo, whose radiobiologic hypoxic fractions (HF) had been measured. The ratios of % injected dose/gram (%ID/g) of marker at various times in EMT-6 tumor tissue relative to that in the blood and muscle of scid mice were used to quantify hypoxia-specific activity. This tumor in this host exhibited an average radiobiologic HF of ∼35%. As well, nuclear medicine images were acquired from R3327-AT (HF ≅15%) and R3327-H (no measurable HF) prostate carcinomas growing in rats to distinguish between marker avidity due to hypoxia versus perfusion. Results: The HSF for FC-103 and other iodinated markers were higher (5-40) than those for FC-306 and other Tc-99m labeled markers. The latter did not show hypoxia-specific uptake into cells in vitro. Qualitative differences were observed in the biodistribution and clearance kinetics of the iodinated azomycin nucleosides relative to the technetium chelates. The largest tumor/blood (T/B) and tumor/muscle (T/M) ratios were observed for compounds of the azomycin nucleoside class in EMT-6 tumor-bearing scid mice. These markers also showed a 3-4 x higher uptake into R3327-AT tumors relative to the well