WorldWideScience

Sample records for marker development annual

  1. Marker development

    Energy Technology Data Exchange (ETDEWEB)

    Adams, M.R.

    1987-05-01

    This report is to discuss the marker development for radioactive waste disposal sites. The markers must be designed to last 10,000 years, and place no undue burdens on the future generations. Barriers cannot be constructed that preclude human intrusion. Design specifications for surface markers will be discussed, also marker pictograms will also be covered.

  2. Marker development in ornamental plants

    NARCIS (Netherlands)

    Heusden, van A.W.; Arens, P.

    2009-01-01

    Development of markers for a new crop or development of additional markers for a crop where markers have been developed in the past raises the question of the intended use of the markers. Depending on the different objectives in mind one marker type may be better suited then another. In general one

  3. Marker development in ornamental plants

    OpenAIRE

    2009-01-01

    Development of markers for a new crop or development of additional markers for a crop where markers have been developed in the past raises the question of the intended use of the markers. Depending on the different objectives in mind one marker type may be better suited then another. In general one can think of two main objectives for the use of markers; variety identification and breeding applications. In view of recent developments in molecular genetics, and sequencing technologies in parti...

  4. Review of the Methods for Developing SSR Molecular Markers

    Institute of Scientific and Technical Information of China (English)

    ZHAO Xue; CHANG Wei; HAN Yingpeng; LI Wenbin

    2008-01-01

    Microsatellite marker (or Simple Sequence Repeate,SSR) is a marker technology based on DNA molecular length polymorphism.It is also one of the most commonly used molecular markers.Traditional SSR marker development methods are relatively time-consuming and mostly relying on the known genome sequence information while recently developed methods of SSR marker based on RAPD,ISSR-PCR SSR,the use of hybrid options, sequence tag SSR library access and screening EST-SSR have been widely used.This paper gave an overview of the methods mentioned above for the development of SSR markers.

  5. Development of single-nucleotide polymorphism markers for Bromus tectorum (Poaceae) from a partially sequenced transcriptome

    Science.gov (United States)

    Keith R. Merrill; Craig E. Coleman; Susan E. Meyer; Elizabeth A. Leger; Katherine A. Collins

    2016-01-01

    Premise of the study: Bromus tectorum (Poaceae) is an annual grass species that is invasive in many areas of the world but most especially in the U.S. Intermountain West. Single-nucleotide polymorphism (SNP) markers were developed for use in investigating the geospatial and ecological diversity of B. tectorum in the Intermountain West to better understand the...

  6. Molecular Marker Development in Post-genomic Era:Leveraging Multiple Resources for Marker Development in Cotton and Other Crops

    Institute of Scientific and Technical Information of China (English)

    KUMPATLA Siva P; SHAH Manali R; MUKHOPADHYAY Snehasis; THOMPSON Steven A; GREENE Thomas W

    2008-01-01

    @@ While the importance of molecular marker technology was realized more than two decades ago,high-throughput marker development came into vogue only after the availability of hundreds of thousands of sequences in public databases.Many examples now exist where markers are being used routinely in breeding programs for marker-assisted selection (MAS) of traits of interest or marker assisted recovery of genome of interest.

  7. Molecular Marker Development in Post-genomic Era:Leveraging Multiple Resources for Marker Development in Cotton and Other Crops

    Institute of Scientific and Technical Information of China (English)

    KUMPATLA; Siva; P; SHAH; Manali; R; MUKHOPADHYAY; Snehasis; THOMPSON; Steven; A; GREENE; Thomas; W

    2008-01-01

    While the importance of molecular marker technology was realized more than two decades ago,high-throughput marker development came into vogue only after the availability of hundreds of thousands of sequences in public databases.Many examples now exist where markers are being used routinely in breeding programs for marker-assisted selection(MAS) of traits of interest or marker assisted recovery of genome of interest.Genetic analysis with thousands to tens of thousands of markers is now possible due to the...

  8. Research and Development Annual Report, 1992

    Science.gov (United States)

    1993-01-01

    Issued as a companion to Johnson Space Center's Research and Technology Annual Report, which reports JSC accomplishments under NASA Research and Technology Operating Plan (RTOP) funding, this report describes 42 additional JSC projects that are funded through sources other than the RTOP. Emerging technologies in four major disciplines are summarized: space systems technology, medical and life sciences, mission operations, and computer systems. Although these projects focus on support of human spacecraft design, development, and safety, most have wide civil and commercial applications in areas such as advanced materials, superconductors, advanced semiconductors, digital imaging, high density data storage, high performance computers, optoelectronics, artificial intelligence, robotics and automation, sensors, biotechnology, medical devices and diagnosis, and human factors engineering.

  9. Methods for Development of Microsatellite Markers: An Overview

    Directory of Open Access Journals (Sweden)

    Siju SENAN

    2014-03-01

    Full Text Available Microsatellite or Simple Sequence Repeat (SSR markers have evolved to the status of a most versatile and popular genetic marker in a ubiquity of plant systems. Due to their co-dominant, hyper-variable and multiallelic nature, they are the prominent markers of choice for fingerprinting, conservation genetics, plant breeding and phylogenetic studies. Despite its development of a new set of SSR markers for a species remained time consuming and expensive for many years. However, with the recent advancement in genomics, new strategies/protocols are now available for the generation of SSR markers. This review presents an overview on microsatellite markers with a special emphasis on the various strategies used for the development of microsatellite markers

  10. Development and assessment of DArT markers in triticale.

    Science.gov (United States)

    Badea, A; Eudes, F; Salmon, D; Tuvesson, S; Vrolijk, A; Larsson, C-T; Caig, V; Huttner, E; Kilian, A; Laroche, André

    2011-05-01

    Triticale (X Triticosecale Wittm.) is a hybrid derived by crossing wheat (Triticum sp.) and rye (Secale sp.). Till date, only a limited number of simple sequence repeat (SSRs) markers have been used in triticale molecular analyses and there is a need to identify dedicated high-throughput molecular markers to better exploit this crop. The objective of this study was to develop and evaluate diversity arrays technology (DArT) markers in triticale. DArT marker technology offers a high level of multiplexing. Development of new markers from triticale accessions was combined with mining the large collection of previously developed markers in rye and wheat. Three genotyping arrays were used to analyze a collection of 144 triticale accessions. The polymorphism level ranged from 8.6 to 23.8% for wheat and rye DArT markers, respectively. Among the polymorphic markers, rye markers were the most abundant (3,109) followed by wheat (2,214) and triticale (719). The mean polymorphism information content values were 0.34 for rye DArT markers and 0.37 for those from triticale and wheat. High correlation was observed between similarity matrices derived from rye, triticale, wheat and combined marker sets, as well as for the cophenetic values matrices. Cluster analysis revealed genetic relationships among the accessions consistent with the agronomic and pedigree information available. The newly developed triticale DArT markers as well as those originated from rye and wheat provide high quality markers that can be used for diversity analyses and might be exploited in a range of molecular breeding and genomics applications in triticale.

  11. Workforce Training and Economic Development Fund: 2015 Annual Progress Report

    Science.gov (United States)

    Iowa Department of Education, 2015

    2015-01-01

    The Department of Education, Division of Community Colleges, will annually provide the State Board of Education with The Workforce Training and Economic Development (WTED) Fund Annual Progress Report. Administration and oversight responsibility for the fund was transferred from the Iowa Economic Development Authority to the Iowa Department of…

  12. Geothermal Energy Development annual report 1979

    Energy Technology Data Exchange (ETDEWEB)

    1980-08-01

    This report is an exerpt from Earth Sciences Division Annual Report 1979 (LBL-10686). Progress in thirty-four research projects is reported including the following area: geothermal exploration technology, geothermal energy conversion technology, reservoir engineering, and geothermal environmental research. Separate entries were prepared for each project. (MHR)

  13. DEVELOPMENT OF CODOMINANT MARKERS FOR IDENTIFYING SPECIES HYBRIDS

    Science.gov (United States)

    Herein we describe a simple method for developing species-diagnostic markers that would permit the rapid identification of hybrid individuals. Our method relies on amplified length polymorphism (AFLP) and single strand conformation polymorphism (SSCP) technologies, both of which...

  14. Laboratory Directed Research and Development FY 2000 Annual Report

    Energy Technology Data Exchange (ETDEWEB)

    Al-Ayat, R

    2001-05-24

    This Annual Report provides an overview of the FY2000 Laboratory Directed Research and Development (LDRD) Program at Lawrence Livermore National Laboratory (LLNL) and presents a summary of the results achieved by each project during the year.

  15. A bioinformatics approach to marker development

    NARCIS (Netherlands)

    Tang, J.

    2008-01-01

    The thesis focuses on two bioinformatics research topics: the development of tools for an efficient and reliable identification of single nucleotides polymorphisms (SNPs) and polymorphic simple sequence repeats (SSRs) from expressed sequence tags (ESTs) (Chapter 2, 3 and 4), and the subsequent imple

  16. Early Markers of Vulnerable Language Skill Development in Galactosaemia

    Science.gov (United States)

    Lewis, Fiona M.; Coman, David J.; Syrmis, Maryanne

    2014-01-01

    There are no known biomedical or genetic markers to identify which infants with galactosaemia (GAL) are most at risk of poor language skill development, yet pre-linguistic communicative "red flag" behaviours are recognised as early identifiers of heightened vulnerability to impaired language development. We report on pre-linguistic…

  17. Early Markers of Vulnerable Language Skill Development in Galactosaemia

    Science.gov (United States)

    Lewis, Fiona M.; Coman, David J.; Syrmis, Maryanne

    2014-01-01

    There are no known biomedical or genetic markers to identify which infants with galactosaemia (GAL) are most at risk of poor language skill development, yet pre-linguistic communicative "red flag" behaviours are recognised as early identifiers of heightened vulnerability to impaired language development. We report on pre-linguistic…

  18. Development of microsatellite markers for Carallia brachiata (Rhizophoraceae)1

    Science.gov (United States)

    Qiang, Yinmeng; Xie, Hongxian; Qiao, Sitan; Yuan, Yang; Liu, Ying; Shi, Xianggang; Shu, Mi; Jin, Jianhua; Shi, Suhua; Tan, Fengxiao; Huang, Yelin

    2015-01-01

    Premise of the study: Microsatellite markers were developed for Carallia brachiata to assess the genetic diversity and structure of this terrestrial species of the Rhizophoraceae. Methods and Results: Based on transcriptome data for C. brachiata, 40 primer pairs were initially designed and tested, of which 18 were successfully amplified and 11 were polymorphic. For these microsatellites, one to three alleles per locus were identified. The observed and expected heterozygosities ranged from 0 to 0.727 and 0 to 0.520, respectively. In addition, all primers were successfully amplified in two congeners: C. pectinifolia and C. garciniifolia. Conclusions: The microsatellite markers described here will be useful in population genetic studies of C. brachiata and related species, suggesting that developing microsatellite markers from next-generation sequencing data can be efficient for genetic studies across this genus. PMID:25798345

  19. FY2015 ceramic fuels development annual highlights

    Energy Technology Data Exchange (ETDEWEB)

    Mcclellan, Kenneth James [Los Alamos National Laboratory (LANL), Los Alamos, NM (United States)

    2015-09-22

    Key challenges for the Advanced Fuels Campaign are the development of fuel technologies to enable major increases in fuel performance (safety, reliability, power and burnup) beyond current technologies, and development of characterization methods and predictive fuel performance models to enable more efficient development and licensing of advanced fuels. Ceramic fuel development activities for fiscal year 2015 fell within the areas of 1) National and International Technical Integration, 2) Advanced Accident Tolerant Ceramic Fuel Development, 3) Advanced Techniques and Reference Materials Development, and 4) Fabrication of Enriched Ceramic Fuels. High uranium density fuels were the focus of the ceramic fuels efforts. Accomplishments for FY15 primarily reflect the prioritization of identification and assessment of new ceramic fuels for light water reactors which have enhanced accident tolerance while also maintaining or improving normal operation performance, and exploration of advanced post irradiation examination techniques which will support more efficient testing and qualification of new fuel systems.

  20. FY2016 Ceramic Fuels Development Annual Highlights

    Energy Technology Data Exchange (ETDEWEB)

    Mcclellan, Kenneth James [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-01-24

    Key challenges for the Advanced Fuels Campaign are the development of fuel technologies to enable major increases in fuel performance (safety, reliability, power and burnup) beyond current technologies, and development of characterization methods and predictive fuel performance models to enable more efficient development and licensing of advanced fuels. Ceramic fuel development activities for fiscal year 2016 fell within the areas of 1) National and International Technical Integration, 2) Advanced Accident Tolerant Ceramic Fuel Development, 3) Advanced Techniques and Reference Materials Development, and 4) Fabrication of Enriched Ceramic Fuels. High uranium density fuels were the focus of the ceramic fuels efforts. Accomplishments for FY16 primarily reflect the prioritization of identification and assessment of new ceramic fuels for light water reactors which have enhanced accident tolerance while also maintaining or improving normal operation performance, and exploration of advanced post irradiation examination techniques which will support more efficient testing and qualification of new fuel systems.

  1. Research and Development. Annual Report 2000

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-07-01

    This report discusses the research and development activities in which NVE has been involved in 2000. These activities fall into three categories: watercourse research, hydrological research and energy related research. The HYDRA research programme, which studied flooding and human intervention, is discussed in particular. The report includes a list of research and development reports that were published in 2000.

  2. Studies in development immunogenetics. Annual progress report

    Energy Technology Data Exchange (ETDEWEB)

    Owen, R D

    1975-03-26

    This contract provides the research support for a group concerned with a relatively large range of problems. The integrating thread that runs through it is that of an interest in development and its genetic regulation, mainly in complex organisms and with an emphasis on the immune system as a model for developmental analysis and as a tool for following the development of other systems, especially the brain. It includes studies of biochemical genetics, primarily from a developmental viewpoint and with particular regard to defense mechanisms, and cellular aspects of the immune system. It extends into the area of cancer immunology and cell specificities as related to tumor systems, primarily from an immunogenetic viewpoint and with particular reference to leukemias in the mouse, and to disruptions of genetic control mechanisms in tumor development, especially as approached through the reappearance of fetal antigens associated with tumor development.

  3. Development of discrimination SNP markers for Hanwoo (Korean native cattle).

    Science.gov (United States)

    Cheong, H S; Kim, L H; Namgoong, S; Shin, H D

    2013-07-01

    In the Korean meat market, the native cattle, Hanwoo beef, are preferred over imported beef and domestic Holstein beef despite its relatively high price. In order to hold the beef industry accountable and support consumers' right to know, correct beef-origin labeling is required. For this purpose, we developed 90 single-nucleotide polymorphism markers to discriminate between Hanwoo and other breeds including Holstein using 1602 cattle DNAs. The probability of discrimination was found to be 100% in a subsequent validation set consisting of 632 DNAs. Our study suggests that improved beef-origin discrimination can be achieved by using a combined genetic model that takes into account small genetic differences among a large number of markers. These markers could be useful for discriminating between Hanwoo and imported breeds including domestic Holsteins, and would contribute to the prevention of falsified beef origin.

  4. The Virtual Extension Annual Conference: Addressing Contemporary Professional Development Needs

    Science.gov (United States)

    Franz, Nancy K.; Brekke, Robin; Coates, Deb; Kress, Cathann; Hlas, Julie

    2014-01-01

    Extension systems are experimenting with new models for conducting professional development to enhance staff competence and other returns on professional development investments. The ISUEO virtual annual conference provides a successful flipped classroom model of asynchronous and synchronous learning events for conducting an Extension annual…

  5. Oil for development initiative annual report 2010

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2011-07-01

    In 2010, Oil for Development continued to develop its role as a key actor within the field of petroleum related development assistance. Five years after the programme started, we experience a steady demand for our product, which is to provide advice and competence building within petroleum sector management. Our cooperating partners are government agencies and to a lesser extent civil society organizations and parliamentary committees.Main trends in 2010 include the following: OfD continued to be a high priority programme in Norwegian development cooperation. The budget spending was Nok 222 million, 15 million higher than in 2009. The programme provided tailor made assistance to more than 20 countries, taking a holistic approach towards petroleum sector management. This implies that resource management, revenue management and environmental management are addressed in a coordinated manner, and that principles of good governance, such as anti-corruption, transparency and accountability, are cross-cutting. The funding for regional initiatives and South-South cooperation was doubled. (au)

  6. Imperial County geothermal development annual meeting: summary

    Energy Technology Data Exchange (ETDEWEB)

    1983-01-01

    All phases of current geothermal development in Imperial County are discussed and future plans for development are reviewed. Topics covered include: Heber status update, Heber binary project, direct geothermal use for high-fructose corn sweetener production, update on county planning activities, Brawley and Salton Sea facility status, status of Imperial County projects, status of South Brawley Prospect 1983, Niland geothermal energy program, recent and pending changes in federal procedures/organizations, plant indicators of geothermal fluid on East Mesa, state lands activities in Imperial County, environmental interests in Imperial County, offshore exploration, strategic metals in geothermal fluids rebuilding of East Mesa Power Plant, direct use geothermal potential for Calipatria industrial Park, the Audubon Society case, status report of the Cerro Prieto geothermal field, East Brawley Prospect, and precision gravity survey at Heber and Cerro Prieto geothermal fields. (MHR)

  7. Development of Microsatellite Markers for Isodon longitubus (Lamiaceae

    Directory of Open Access Journals (Sweden)

    Tadashi Yamashiro

    2013-10-01

    Full Text Available Premise of the study: Microsatellite markers were developed for Isodon longitubus to study the natural hybridization of the species and its congeners. Methods and Results: A total of 10 primer sets were developed for I. longitubus. From the initial screening, all of 10 loci were polymorphic with five to 19 alleles per locus in the Mt. Ishizuchi population, whereas nine loci were polymorphic with two to 12 alleles per loci in the Toon population. Although one locus was monomorphic at one population, the observed and expected heterozygosity values estimated from 34 I. longitubus samples ranged from 0.273 to 1.000 and from 0.483 to 0.918, respectively. Six primer sets could amplify all three species examined in this study (I. inflexus, I. japonicus, and I. shikokianus. Conclusions: The 10 microsatellite markers developed here will be useful in analyzing the population genetic structure of I. longitubus and in studying the natural hybridization between Isodon species.

  8. Laboratory Directed Research and Development FY-10 Annual Report

    Energy Technology Data Exchange (ETDEWEB)

    Dena Tomchak

    2011-03-01

    The FY 2010 Laboratory Directed Research and Development (LDRD) Annual Report is a compendium of the diverse research performed to develop and ensure the INL's technical capabilities can support the future DOE missions and national research priorities. LDRD is essential to the INL -- it provides a means for the laboratory to pursue novel scientific and engineering research in areas that are deemed too basic or risky for programmatic investments. This research enhances technical capabilities at the laboratory, providing scientific and engineering staff with opportunities for skill building and partnership development.

  9. High-throughput development of genome-wide locus-specific informative SSR markers in wheat

    Science.gov (United States)

    Although simple sequence repeat (SSR) markers are not new, they are still useful and often used markers in molecular mapping and marker-assisted breeding, particularly in developing countries. However, locus-specific SSR markers could be more useful and informative in wheat breeding and genetic stud...

  10. Structured Annual Faculty Review Program Accelerates Professional Development and Promotion

    Directory of Open Access Journals (Sweden)

    Stanley J. Robboy MD

    2017-03-01

    Full Text Available This retrospective observational study on faculty development analyzes the Duke University Pathology Department’s 18-year experience with a structured mentoring program involving 51 junior faculty members. The majority had MD degrees only (55%. The percentage of young women faculty hires before 1998 was 25%, increasing to 72% after 2005. Diversity also broadened from 9% with varied heritages before 1998 to 37% since then. The mentoring process pivoted on an annual review process. The reviews generally helped candidates focus much earlier, identified impediments they individually felt, and provided new avenues to gain a national reputation for academic excellence. National committee membership effectively helped gain national exposure. Thirty-eight percent of the mentees served on College of American Pathologists (CAP committees, exponential multiples of any other national society. Some used CAP resources to develop major programs, some becoming nationally and internationally recognized for their academic activities. Several faculty gained national recognition as thought leaders for publishing about work initiated to serve administrative needs in the Department. The review process identified the need for more protected time for research, issues with time constraints, and avoiding exploitation when collaborating with other departments. This review identified a rigorous faculty mentoring and review process that included annual career counseling, goal-oriented academic careers, monitored advancement to promotion, higher salaries, and national recognition. All contributed to high faculty satisfaction and low faculty turnover. We conclude that a rigorous annual faculty review program and its natural sequence, promotion, can greatly foster faculty satisfaction.

  11. 2015 Fermilab Laboratory Directed Research & Development Annual Report

    Energy Technology Data Exchange (ETDEWEB)

    Wester, W. [Fermi National Accelerator Lab. (FNAL), Batavia, IL (United States)

    2016-05-26

    The Fermi National Accelerator Laboratory (FNAL) is conducting a Laboratory Directed Research and Development (LDRD) program. Fiscal year 2015 represents the first full year of LDRD at Fermilab and includes seven projects approved mid-year in FY14 and six projects approved in FY15. One of the seven original projects has been completed just after the beginning of FY15. The implementation of LDRD at Fermilab is captured in the approved Fermilab 2015 LDRD Annual Program Plan. In FY15, the LDRD program represents 0.64% of Laboratory funding. The scope of the LDRD program at Fermilab will be established over the next couple of years where a portfolio of about 20 on-going projects representing approximately between 1% and 1.5% of the Laboratory funding is anticipated. This Annual Report focuses on the status of the current projects and provides an overview of the current status of LDRD at Fermilab.

  12. Development of Sequence-Based Microsatellite Marker for Phalaenopsis Orchid

    Directory of Open Access Journals (Sweden)

    FATIMAH

    2011-06-01

    Full Text Available Phalaenopsis is one of the most interesting genera of orchids due to the members are often used as parents to produce hybrids. The establishment and development of highly reliable and discriminatory methods for identifying species and cultivars has become increasingly more important to plant breeders and members of the nursery industry. The aim of this research was to develop sequence-based microsatellite (eSSR markers for the Phalaenopsis orchid designed from the sequence of GenBank NCBI. Seventeen primers were designed and thirteen primers pairs could amplify the DNA giving the expected PCR product with polymorphism. A total of 51 alleles, with an average of 3 alleles per locus and polymorphism information content (PIC values at 0.674, were detected at the 16 SSR loci. Therefore, these markers could be used for identification of the Phalaenopsis orchid used in this study. Genetic similarity and principle coordinate analysis identified five major groups of Phalaenopsis sp. the first group consisted of P. amabilis, P. fuscata, P. javanica, and P. zebrine. The second group consisted of P. amabilis, P. amboinensis, P. bellina, P. floresens, and P. mannii. The third group consisted of P. bellina, P. cornucervi, P. cornucervi, P. violaceae sumatra, P. modesta. The forth group consisted of P. cornucervi and P. lueddemanniana, and the fifth group was P. amboinensis.

  13. Developing SCAR markers to study predation on Trialeurodes vaporariorum.

    Science.gov (United States)

    Agustí, N; de Vicente, M C; Gabarra, R

    2000-06-01

    DNA markers of Trialeurodes vaporariorum were developed to detect remains of these whitefly in the gut of the predator Dicyphus tamaninii. A 2400-bp DNA fragment of T. vaporariorum, absent in other closely related prey species and in the predator banding pattern, was identified by random amplified polymorphic DNA (RAPD) analysis. After cloning and sequencing this fragment, two pairs of sequence-characterized amplified region (SCAR) primers were developed, amplifying single bands of 2100 bp and 310 bp, respectively. Detection of T. vaporariorum DNA in the predator gut was only possible using the primers that amplified the shortest fragment. Specificity tests performed with this pair of primers showed the presence of the 310-bp band for T. vaporariorum in all stages.

  14. Development and Characterization of Microsatellite Markers for Lilium longiflorum (Liliaceae

    Directory of Open Access Journals (Sweden)

    Satomi Sakazono

    2013-09-01

    Full Text Available Premise of the study: Ten microsatellite primers were developed to obtain information on genetic variation in Lilium longiflorum, a bulbous species showing high intraspecific genetic differentiation. Methods and Results: Of 61 microsatellite loci isolated using the dual suppression PCR technique, 10 loci were effective to characterize and estimate genetic variation in two populations of L. longiflorum. The number of alleles at each locus was different between the populations (averages = 3.2 and 10.3 alleles per locus, and the mean observed heterozygosity values were 0.245 and 0.732. Conclusions: Our results demonstrate that there is significant genetic variation between the populations and that the microsatellite markers developed in this study will be useful tools for the investigation of the genetic structure and mating system of natural L. longiflorum populations.

  15. Development of Pineapple Microsatellite Markers and Germplasm Genetic Diversity Analysis

    Directory of Open Access Journals (Sweden)

    Suping Feng

    2013-01-01

    Full Text Available Two methods were used to develop pineapple microsatellite markers. Genomic library-based SSR development: using selectively amplified microsatellite assay, 86 sequences were generated from pineapple genomic library. 91 (96.8% of the 94 Simple Sequence Repeat (SSR loci were dinucleotide repeats (39 AC/GT repeats and 52 GA/TC repeats, accounting for 42.9% and 57.1%, resp., and the other three were mononucleotide repeats. Thirty-six pairs of SSR primers were designed; 24 of them generated clear bands of expected sizes, and 13 of them showed polymorphism. EST-based SSR development: 5659 pineapple EST sequences obtained from NCBI were analyzed; among 1397 nonredundant EST sequences, 843 were found containing 1110 SSR loci (217 of them contained more than one SSR locus. Frequency of SSRs in pineapple EST sequences is 1SSR/3.73 kb, and 44 types were found. Mononucleotide, dinucleotide, and trinucleotide repeats dominate, accounting for 95.6% in total. AG/CT and AGC/GCT were the dominant type of dinucleotide and trinucleotide repeats, accounting for 83.5% and 24.1%, respectively. Thirty pairs of primers were designed for each of randomly selected 30 sequences; 26 of them generated clear and reproducible bands, and 22 of them showed polymorphism. Eighteen pairs of primers obtained by the one or the other of the two methods above that showed polymorphism were selected to carry out germplasm genetic diversity analysis for 48 breeds of pineapple; similarity coefficients of these breeds were between 0.59 and 1.00, and they can be divided into four groups accordingly. Amplification products of five SSR markers were extracted and sequenced, corresponding repeat loci were found and locus mutations are mainly in copy number of repeats and base mutations in the flanking region.

  16. Development and validation of SSR markers for Coffea arabica L.

    Directory of Open Access Journals (Sweden)

    Robson Fernando Missio

    2009-01-01

    Full Text Available With the objective of developing new SSR markers for Coffea arabica, two enriched genomic libraries withprobes (GT15 and (AGG10 were constructed. A total of 835 clones were sequenced and 756 presented good quality sequences.Redundant sequences were observed for 113 clones (14.94%. SSRs were found in 287 clones (38%. An estimated size of417.5Kb of the C. arabica genome was sampled, with an average of one SSR per 1.46Kb. Dinucleotide repeats were morefrequent than trinucleotides. Four repeat sequences, (AG/CTn, (AC/GTn, (AAG/CTTn, and (AGG/CCTn represented 61.1%of the total observed. A total of 96 SSR primers were designed and tested by PCR for two C. arabica genotypes. Ninety new SSRmarkers were validated for further genetic studies of C. arabica.

  17. Towards the Development of a Molecular Map in Switchgrass: I. Microsatellite Marker Development

    Energy Technology Data Exchange (ETDEWEB)

    Gunter, L.E.

    2001-08-23

    The long-term goal of the switchgrass breeding program is to improve regionally adapted varieties and increase biomass yield and feedstock quality. Although, to some extent, biomass yields are dependent on environmental constraints, increased yield can be achieved through the development of genotypes with improved seasonal adaptation, tolerance to unfavorable environmental conditions, and improved resistance to pest and disease. To date, improvement in switchgrass has relied on recurrent breeding strategies based on phenotypic or genotypic selection. Yield improvements have been modest by this method. If we expect to make significant increase in yields, we need tools that will allow us to map complex traits and uncover the genes that influence them. A genetic linkage map could be a powerful tool for accelerating switchgrass development through marker-assisted selection, breeding and recombination. This type of mapping requires the development of markers that can be associated with phenotypic traits in a population of known pedigree. The most commonly used markers for mapping include restriction fragment length polymorphisms (RFLP) and simple sequence repeats (SSR). At ORNL, we have been concentrating on the development of SSR markers, while our colleagues at the University of Georgia are developing RFLP markers in order to select parents to produce a mapping population and from there to create a framework map from {approx}100 F1 progeny.

  18. Laboratory Directed Research and Development annual report, fiscal year 1997

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    The Department of Energy Order 413.2(a) establishes DOE`s policy and guidelines regarding Laboratory Directed Research and Development (LDRD) at its multiprogram laboratories. As described in 413.2, LDRD is research and development of a creative and innovative nature which is selected by the Laboratory Director or his or her designee, for the purpose of maintaining the scientific and technological vitality of the Laboratory and to respond to scientific and technological opportunities in conformance with the guidelines in this Order. DOE Order 413.2 requires that each laboratory submit an annual report on its LDRD activities to the cognizant Secretarial Officer through the appropriate Operations Office Manager. The report provided in this document represents Pacific Northwest National Laboratory`s LDRD report for FY 1997.

  19. Zoning Rural Area For The Development Of Annual Plants

    Directory of Open Access Journals (Sweden)

    Bariot Hafif

    2013-01-01

    Full Text Available One strategy to protect land from degradation is to use the land according to their capability. Zoning of commodities is an effort in that direction and determination of commodities is based on the suitability of land with agronomic needs of crops and farming feasibility analysis. The purpose of this study was to determine the development zone of annual crops, based on the analysis of agro-ecological characteristics and agricultural viability. Analysis of land suitability for the cultivation of coffee, vanilla, pepper, cocoa, banana, durian, mango, and melinjo, found that land can be recommended for the development of the annual crops is about 29,230 ha from an area of 54,764 ha. The land was divided into six agro-ecological zones i.e. two zones at area with land slope of 3- 8%, each covering an area of 2,737 ha at an altitude of 15-50 m above sea level (asl, and 12,008 ha at an altitude of 50-300 m asl, the two zone at area with land slope of 8-15%, each covering 6119 ha at an altitude of 25-250 m asl and 1,221 ha at an altitude of 15-50 m asl, and two zones at area with land slope of 16-40% , each covering an area of 1,101 ha at an altitude of 400-700 m asl, and 6,134 ha at an altitude of 400-500 m asl. The soil types found are Typic /Vitrandic Eutrudepts, Typic Hapludands, and Vitrandic Hapludalfs. This study recommends that the banana is a perennial plant with the most potential to be developed and has good economic prospects in almost all agro-ecological zones. Other commodities are also preferred, coffee and vanilla.

  20. Laboratory Directed Research and Development 1998 Annual Report

    Energy Technology Data Exchange (ETDEWEB)

    Pam Hughes; Sheila Bennett eds.

    1999-07-14

    The Laboratory's Directed Research and Development (LDRD) program encourages the advancement of science and the development of major new technical capabilities from which future research and development will grow. Through LDRD funding, Pacific Northwest continually replenishes its inventory of ideas that have the potential to address major national needs. The LDRD program has enabled the Laboratory to bring to bear its scientific and technical capabilities on all of DOE's missions, particularly in the arena of environmental problems. Many of the concepts related to environmental cleanup originally developed with LDRD funds are now receiving programmatic support from DOE, LDRD-funded work in atmospheric sciences is now being applied to DOE's Atmospheric Radiation Measurement Program. We also have used concepts initially explored through LDRD to develop several winning proposals in the Environmental Management Science Program. The success of our LDRD program is founded on good management practices that ensure funding is allocated and projects are conducted in compliance with DOE requirements. We thoroughly evaluate the LDRD proposals based on their scientific and technical merit, as well as their relevance to DOE's programmatic needs. After a proposal is funded, we assess progress annually using external peer reviews. This year, as in years past, the LDRD program has once again proven to be the major enabling vehicle for our staff to formulate new ideas, advance scientific capability, and develop potential applications for DOE's most significant challenges.

  1. The JSC Research and Development Annual Report 1993

    Science.gov (United States)

    1994-01-01

    Issued as a companion to Johnson Space Center's Research and Technology Annual Report, which reports JSC accomplishments under NASA Research and Technology Operating Plan (RTOP) funding, this report describes 47 additional projects that are funded through sources other than the RTOP. Emerging technologies in four major disciplines are summarized: space systems technology, medical and life sciences, mission operations, and computer systems. Although these projects focus on support of human spacecraft design, development, and safety, most have wide civil and commercial applications in areas such as advanced materials, superconductors, advanced semiconductors, digital imaging, high density data storage, high performance computers, optoelectronics, artificial intelligence, robotics and automation, sensors, biotechnology, medical devices and diagnosis, and human factors engineering.

  2. Laboratory Directed Research and Development FY 2000 Annual Progress Report

    Energy Technology Data Exchange (ETDEWEB)

    Los Alamos National Laboratory

    2001-05-01

    This is the FY00 Annual Progress report for the Laboratory Directed Research and Development (LDRD) Program at Los Alamos National Laboratory. It gives an overview of the LDRD Program, summarizes progress on each project conducted during FY00, characterizes the projects according to their relevance to major funding sources, and provides an index to principal investigators. Project summaries are grouped by LDRD component: Directed Research and Exploratory Research. Within each component, they are further grouped into the ten technical categories: (1) atomic, molecular, optical, and plasma physics, fluids, and beams, (2) bioscience, (3) chemistry, (4) computer science and software engineering, (5) engineering science, (6) geoscience, space science, and astrophysics, (7) instrumentation and diagnostics, (8) materials science, (9) mathematics, simulation, and modeling, and (10) nuclear and particle physics.

  3. 2014 Fermilab Laboratory Directoed Research & Development Annual Report

    Energy Technology Data Exchange (ETDEWEB)

    Wester, W. [Fermi National Accelerator Lab. (FNAL), Batavia, IL (United States)

    2016-05-26

    After initiation by the Fermilab Laboratory Director, a team from the senior Laboratory leadership and a Laboratory Directed Research and Development (LDRD) Advisory Committee developed an implementation plan for LDRD at Fermilab for the first time. This implementation was captured in the approved Fermilab 2014 LDRD Program Plan and followed directions and guidance from the Department of Energy (DOE) order, DOE O 413.2B, a “Roles, Responsibilities, and Guidelines, …” document, and examples of best practices at other DOE Office of Science Laboratories. At Fermilab, a FY14 midyear Call for Proposals was issued. A LDRD Selection Committee evaluated those proposals that were received and provided a recommendation to the Laboratory Director who approved seven LDRD projects. This Annual Report focuses on the status of those seven projects and provides an overview of the current status of LDRD at Fermilab. The seven FY14 LDRD approved projects had a date of initiation late in FY14 such that this report reflects approximately six months of effort approximately through January 2015. The progress of these seven projects, the subsequent award of six additional new projects beginning in FY15, and preparations for the issuance of the FY16 Call for Proposals indicates that LDRD is now integrated into the overall annual program at Fermilab. All indications are that LDRD is improving the scientific and technical vitality of the Laboratory and providing new, novel, or cutting edge projects carried out at the forefront of science and technology and aligned with the mission and strategic visions of Fermilab and the Department of Energy.

  4. Development and characterization of genomic microsatellite markers in Prosopis cineraria

    Directory of Open Access Journals (Sweden)

    Shashi Shekhar Anand

    2017-06-01

    Full Text Available Characterization of genetic diversity is a must for exploring the genetic resources for plant development and improvement. Prosopis cineraria is ecologically imperative species known for its innumerable biological benefits. Since there is a lack of genetic resources for the species, so it is crucial to unravel the population dynamics which will be very effective in plant improvement and conservation strategies. Of the 41 genomic microsatellite markers designed from (AGn enriched library, 24 were subsequently employed for characterization on 30 genotypes of Indian arid region. A total of 93 alleles with an average 3.875 could be amplified by tested primer pairs. The average observed and expected heterozygosity was 0.5139 and 0.5786, respectively with 23 primer pairs showing significant deviations from Hardy-Weinberg equilibrium. Polymorphic information content average to 0.5102 and the overall polymorphism level was found to be 93.27%. STRUCTURE analysis and DARwin exhibited the presence of 4 clusters among 30 genotypes.

  5. Laboratory directed research and development FY98 annual report

    Energy Technology Data Exchange (ETDEWEB)

    Al-Ayat, R; Holzrichter, J

    1999-05-01

    In 1984, Congress and the Department of Energy (DOE) established the Laboratory Directed Research and Development (LDRD) Program to enable the director of a national laboratory to foster and expedite innovative research and development (R and D) in mission areas. The Lawrence Livermore National Laboratory (LLNL) continually examines these mission areas through strategic planning and shapes the LDRD Program to meet its long-term vision. The goal of the LDRD Program is to spur development of new scientific and technical capabilities that enable LLNL to respond to the challenges within its evolving mission areas. In addition, the LDRD Program provides LLNL with the flexibility to nurture and enrich essential scientific and technical competencies and enables the Laboratory to attract the most qualified scientists and engineers. The FY98 LDRD portfolio described in this annual report has been carefully structured to continue the tradition of vigorously supporting DOE and LLNL strategic vision and evolving mission areas. The projects selected for LDRD funding undergo stringent review and selection processes, which emphasize strategic relevance and require technical peer reviews of proposals by external and internal experts. These FY98 projects emphasize the Laboratory's national security needs: stewardship of the U.S. nuclear weapons stockpile, responsibility for the counter- and nonproliferation of weapons of mass destruction, development of high-performance computing, and support of DOE environmental research and waste management programs.

  6. Chloroplast microsatellite markers for Artocarpus (Moraceae) developed from transcriptome sequences.

    Science.gov (United States)

    Gardner, Elliot M; Laricchia, Kristen M; Murphy, Matthew; Ragone, Diane; Scheffler, Brian E; Simpson, Sheron; Williams, Evelyn W; Zerega, Nyree J C

    2015-09-01

    Chloroplast microsatellite loci were characterized from transcriptomes of Artocarpus altilis (breadfruit) and A. camansi (breadnut). They were tested in A. odoratissimus (terap) and A. altilis and evaluated in silico for two congeners. Fifteen simple sequence repeats (SSRs) were identified in chloroplast sequences from four Artocarpus transcriptome assemblies. The markers were evaluated using capillary electrophoresis in A. odoratissimus (105 accessions) and A. altilis (73). They were also evaluated in silico in A. altilis (10), A. camansi (6), and A. altilis × A. mariannensis (7) transcriptomes. All loci were polymorphic in at least one species, with all 15 polymorphic in A. camansi. Per species, average alleles per locus ranged between 2.2 and 2.5. Three loci had evidence of fragment-length homoplasy. These markers will complement existing nuclear markers by enabling confident identification of maternal and clone lines, which are often important in vegetatively propagated crops such as breadfruit.

  7. Development of genomic SSR markers for fingerprinting lettuce (Lactuca sativa L.) cultivars and mapping genes.

    Science.gov (United States)

    Rauscher, Gilda; Simko, Ivan

    2013-01-22

    Lettuce (Lactuca sativa L.) is the major crop from the group of leafy vegetables. Several types of molecular markers were developed that are effectively used in lettuce breeding and genetic studies. However only a very limited number of microsattelite-based markers are publicly available. We have employed the method of enriched microsatellite libraries to develop 97 genomic SSR markers. Testing of newly developed markers on a set of 36 Lactuca accession (33 L. sativa, and one of each L. serriola L., L. saligna L., and L. virosa L.) revealed that both the genetic heterozygosity (UHe = 0.56) and the number of loci per SSR (Na = 5.50) are significantly higher for genomic SSR markers than for previously developed EST-based SSR markers (UHe = 0.32, Na = 3.56). Fifty-four genomic SSR markers were placed on the molecular linkage map of lettuce. Distribution of markers in the genome appeared to be random, with the exception of possible cluster on linkage group 6. Any combination of 32 genomic SSRs was able to distinguish genotypes of all 36 accessions. Fourteen of newly developed SSR markers originate from fragments with high sequence similarity to resistance gene candidates (RGCs) and RGC pseudogenes. Analysis of molecular variance (AMOVA) of L. sativa accessions showed that approximately 3% of genetic diversity was within accessions, 79% among accessions, and 18% among horticultural types. The newly developed genomic SSR markers were added to the pool of previously developed EST-SSRs markers. These two types of SSR-based markers provide useful tools for lettuce cultivar fingerprinting, development of integrated molecular linkage maps, and mapping of genes.

  8. Development of a RAD-Seq Based DNA Polymorphism Identification Software, AgroMarker Finder, and Its Application in Rice Marker-Assisted Breeding.

    Science.gov (United States)

    Fan, Wei; Zong, Jie; Luo, Zhijing; Chen, Mingjiao; Zhao, Xiangxiang; Zhang, Dabing; Qi, Yiping; Yuan, Zheng

    2016-01-01

    Rapid and accurate genome-wide marker detection is essential to the marker-assisted breeding and functional genomics studies. In this work, we developed an integrated software, AgroMarker Finder (AMF: http://erp.novelbio.com/AMF), for providing graphical user interface (GUI) to facilitate the recently developed restriction-site associated DNA (RAD) sequencing data analysis in rice. By application of AMF, a total of 90,743 high-quality markers (82,878 SNPs and 7,865 InDels) were detected between rice varieties JP69 and Jiaoyuan5A. The density of the identified markers is 0.2 per Kb for SNP markers, and 0.02 per Kb for InDel markers. Sequencing validation revealed that the accuracy of genome-wide marker detection by AMF is 93%. In addition, a validated subset of 82 SNPs and 31 InDels were found to be closely linked to 117 important agronomic trait genes, providing a basis for subsequent marker-assisted selection (MAS) and variety identification. Furthermore, we selected 12 markers from 31 validated InDel markers to identify seed authenticity of variety Jiaoyuanyou69, and we also identified 10 markers closely linked to the fragrant gene BADH2 to minimize linkage drag for Wuxiang075 (BADH2 donor)/Jiachang1 recombinants selection. Therefore, this software provides an efficient approach for marker identification from RAD-seq data, and it would be a valuable tool for plant MAS and variety protection.

  9. FY2007 Laboratory Directed Research and Development Annual Report

    Energy Technology Data Exchange (ETDEWEB)

    Craig, W W; Sketchley, J A; Kotta, P R

    2008-03-20

    The Laboratory Directed Research and Development (LDRD) annual report for fiscal year 2007 (FY07) provides a summary of LDRD-funded projects for the fiscal year and consists of two parts: An introduction to the LDRD Program, the LDRD portfolio-management process, program statistics for the year, and highlights of accomplishments for the year. A summary of each project, submitted by the principal investigator. Project summaries include the scope, motivation, goals, relevance to Department of Energy (DOE)/National Nuclear Security Administration (NNSA) and Lawrence Livermore National Laboratory (LLNL) mission areas, the technical progress achieved in FY07, and a list of publications that resulted from the research in FY07. Summaries are organized in sections by research category (in alphabetical order). Within each research category, the projects are listed in order of their LDRD project category: Strategic Initiative (SI), Exploratory Research (ER), Laboratory-Wide Competition (LW), and Feasibility Study (FS). Within each project category, the individual project summaries appear in order of their project tracking code, a unique identifier that consists of three elements. The first is the fiscal year the project began, the second represents the project category, and the third identifies the serial number of the proposal for that fiscal year.

  10. Laboratory Directed Research and Development FY2010 Annual Report

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, K J

    2011-03-22

    A premier applied-science laboratory, Lawrence Livermore National Laboratory (LLNL) has at its core a primary national security mission - to ensure the safety, security, and reliability of the nation's nuclear weapons stockpile without nuclear testing, and to prevent and counter the spread and use of weapons of mass destruction: nuclear, chemical, and biological. The Laboratory uses the scientific and engineering expertise and facilities developed for its primary mission to pursue advanced technologies to meet other important national security needs - homeland defense, military operations, and missile defense, for example - that evolve in response to emerging threats. For broader national needs, LLNL executes programs in energy security, climate change and long-term energy needs, environmental assessment and management, bioscience and technology to improve human health, and for breakthroughs in fundamental science and technology. With this multidisciplinary expertise, the Laboratory serves as a science and technology resource to the U.S. government and as a partner with industry and academia. This annual report discusses the following topics: (1) Advanced Sensors and Instrumentation; (2) Biological Sciences; (3) Chemistry; (4) Earth and Space Sciences; (5) Energy Supply and Use; (6) Engineering and Manufacturing Processes; (7) Materials Science and Technology; Mathematics and Computing Science; (8) Nuclear Science and Engineering; and (9) Physics.

  11. Development of genetic markers distinguishing two invasive fire ant species (Hymenoptera: Formicidae) and their hybrids

    Science.gov (United States)

    Three SNP markers were developed that are completely diagnostic in distinguishing the two fire ant species Solenopsis invicta and S. richteri. Although a fourth marker we developed is not fully diagnostic, it is still useful given one of the variants is confined to S. richteri. Joint use of these ma...

  12. Development and transferability of black and red raspberry microsatellite markers from short-read sequences

    Science.gov (United States)

    The advent of next-generation sequencing technologies has been a boon to the cost-effective development of molecular markers, particularly in non-model species. Here, we demonstrate the efficiency of microsatellite or simple sequence repeat (SSR) marker development from short-read sequences using th...

  13. Laboratory Directed Research and Development Program FY 2008 Annual Report

    Energy Technology Data Exchange (ETDEWEB)

    editor, Todd C Hansen

    2009-02-23

    consideration and review by the Office of Science Program Offices, such as LDRD projects germane to new research facility concepts and new fundamental science directions. Berkeley Lab LDRD program also play an important role in leveraging DOE capabilities for national needs. The fundamental scientific research and development conducted in the program advances the skills and technologies of importance to our Work For Others (WFO) sponsors. Among many directions, these include a broad range of health-related science and technology of interest to the National Institutes of Health, breast cancer and accelerator research supported by the Department of Defense, detector technologies that should be useful to the Department of Homeland Security, and particle detection that will be valuable to the Environmental Protection Agency. The Berkeley Lab Laboratory Directed Research and Development Program FY2008 report is compiled from annual reports submitted by principal investigators following the close of the fiscal year. This report describes the supported projects and summarizes their accomplishments. It constitutes a part of the LDRD program planning and documentation process that includes an annual planning cycle, project selection, implementation, and review.

  14. Development of novel chloroplast microsatellite markers for Ginkgo biloba.

    Science.gov (United States)

    Xu, M; Xu, L A; Cao, F L; Zhang, H J; Yu, F X

    2015-07-13

    Ginkgo biloba is considered to be a living fossil that can be used to understand the ancient evolutionary history of gymnosperms, but little attention has been given to the study of its population genetics, molecular phylogeography, and genetic resources assessment. Chloroplast simple sequence repeat (cpSSR) markers are powerful tools for genetic studies of plants. In this study, a total of 30 perfect cpSSRs of Ginkgo were identified and characterized, including di-, tri, tetra-, penta-, and hexanucleotide repeats. Fifteen of 21 designed primer pairs were successfully amplified to yield specific polymerase chain reaction products from 16 Ginkgo cultivars. Polymorphic cpSSRs were further applied to determine the genetic variation of 116 individuals in 5 populations of G. biloba. The results showed that 24 and 76% genetic variation existed within and among populations of this species, respectively. These polymorphic and monomorphic cpSSR markers can be used to trace the origin and evolutionary history of Ginkgo.

  15. Development of genic and genomic SSR markers of robusta coffee (Coffea canephora Pierre Ex A. Froehner.

    Directory of Open Access Journals (Sweden)

    Prasad S Hendre

    Full Text Available Coffee breeding and improvement efforts can be greatly facilitated by availability of a large repository of simple sequence repeats (SSRs based microsatellite markers, which provides efficiency and high-resolution in genetic analyses. This study was aimed to improve SSR availability in coffee by developing new genic-/genomic-SSR markers using in-silico bioinformatics and streptavidin-biotin based enrichment approach, respectively. The expressed sequence tag (EST based genic microsatellite markers (EST-SSRs were developed using the publicly available dataset of 13,175 unigene ESTs, which showed a distribution of 1 SSR/3.4 kb of coffee transcriptome. Genomic SSRs, on the other hand, were developed from an SSR-enriched small-insert partial genomic library of robusta coffee. In total, 69 new SSRs (44 EST-SSRs and 25 genomic SSRs were developed and validated as suitable genetic markers. Diversity analysis of selected coffee genotypes revealed these to be highly informative in terms of allelic diversity and PIC values, and eighteen of these markers (∼ 27% could be mapped on a robusta linkage map. Notably, the markers described here also revealed a very high cross-species transferability. In addition to the validated markers, we have also designed primer pairs for 270 putative EST-SSRs, which are expected to provide another ca. 200 useful genetic markers considering the high success rate (88% of marker conversion of similar pairs tested/validated in this study.

  16. Development of genic and genomic SSR markers of robusta coffee (Coffea canephora Pierre Ex A. Froehner).

    Science.gov (United States)

    Hendre, Prasad S; Aggarwal, Ramesh K

    2014-01-01

    Coffee breeding and improvement efforts can be greatly facilitated by availability of a large repository of simple sequence repeats (SSRs) based microsatellite markers, which provides efficiency and high-resolution in genetic analyses. This study was aimed to improve SSR availability in coffee by developing new genic-/genomic-SSR markers using in-silico bioinformatics and streptavidin-biotin based enrichment approach, respectively. The expressed sequence tag (EST) based genic microsatellite markers (EST-SSRs) were developed using the publicly available dataset of 13,175 unigene ESTs, which showed a distribution of 1 SSR/3.4 kb of coffee transcriptome. Genomic SSRs, on the other hand, were developed from an SSR-enriched small-insert partial genomic library of robusta coffee. In total, 69 new SSRs (44 EST-SSRs and 25 genomic SSRs) were developed and validated as suitable genetic markers. Diversity analysis of selected coffee genotypes revealed these to be highly informative in terms of allelic diversity and PIC values, and eighteen of these markers (∼ 27%) could be mapped on a robusta linkage map. Notably, the markers described here also revealed a very high cross-species transferability. In addition to the validated markers, we have also designed primer pairs for 270 putative EST-SSRs, which are expected to provide another ca. 200 useful genetic markers considering the high success rate (88%) of marker conversion of similar pairs tested/validated in this study.

  17. Development and Utilization of InDel Markers to Identify Peanut (Arachis hypogaea) Disease Resistance

    OpenAIRE

    Liu, Lifeng; Dang, Phat M.; Charles Y Chen

    2015-01-01

    Peanut diseases, such as leaf spot and spotted wilt caused by Tomato Spotted Wilt Virus, can significantly reduce yield and quality. Application of marker assisted plant breeding requires the development and validation of different types of DNA molecular markers. Nearly 10,000 SSR-based molecular markers have been identified by various research groups around the world, but less than 14.5% showed polymorphism in peanut and only 6.4% have been mapped. Low levels of polymorphism limit the applic...

  18. Development and Utilization of InDel Markers to Identify Peanut (Arachis hypogaea) Disease Resistance

    OpenAIRE

    Lifeng eLiu; Dang, Phat M.; Charles Y Chen

    2015-01-01

    Peanut diseases, such as leaf spot and spotted wilt caused by Tomato Spotted Wilt Virus, can significantly reduce yield and quality. Application of marker assisted plant breeding requires the development and validation of different types of DNA molecular markers. Nearly 10,000 SSR-based molecular markers have been identified by various research groups around the world, but less than 14.5% showed polymorphism in peanut and only 6.4% have been mapped. Low levels of polymorphism limit the app...

  19. Simple sequence repeat marker development and genetic mapping in quinoa (Chenopodium quinoa Willd.)

    Indian Academy of Sciences (India)

    D. E. Jarvis; O. R. Kopp; E. N. Jellen; M. A. Mallory; J. Pattee; A. Bonifacio; C. E. Coleman; M. R. Stevens; D. J. Fairbanks; P. J. Maughan

    2008-04-01

    Quinoa is a regionally important grain crop in the Andean region of South America. Recently quinoa has gained international attention for its high nutritional value and tolerances of extreme abiotic stresses. DNA markers and linkage maps are important tools for germplasm conservation and crop improvement programmes. Here we report the development of 216 new polymorphic SSR (simple sequence repeats) markers from libraries enriched for GA, CAA and AAT repeats, as well as 6 SSR markers developed from bacterial artificial chromosome-end sequences (BES-SSRs). Heterozygosity (H) values of the SSR markers ranges from 0.12 to 0.90, with an average value of 0.57. A linkage map was constructed for a newly developed recombinant inbred lines (RIL) population using these SSR markers. Additional markers, including amplified fragment length polymorphisms (AFLPs), two 11S seed storage protein loci, and the nucleolar organizing region (NOR), were also placed on the linkage map. The linkage map presented here is the first SSR-based map in quinoa and contains 275 markers, including 200 SSR. The map consists of 38 linkage groups (LGs) covering 913 cM. Segregation distortion was observed in the mapping population for several marker loci, indicating possible chromosomal regions associated with selection or gametophytic lethality. As this map is based primarily on simple and easily-transferable SSR markers, it will be particularly valuable for research in laboratories in Andean regions of South America.

  20. Simple sequence repeat marker development and genetic mapping in quinoa (Chenopodium quinoa Willd.).

    Science.gov (United States)

    Jarvis, D E; Kopp, O R; Jellen, E N; Mallory, M A; Pattee, J; Bonifacio, A; Coleman, C E; Stevens, M R; Fairbanks, D J; Maughan, P J

    2008-04-01

    Quinoa is a regionally important grain crop in the Andean region of South America. Recently quinoa has gained international attention for its high nutritional value and tolerances of extreme abiotic stresses. DNA markers and linkage maps are important tools for germplasm conservation and crop improvement programmes. Here we report the development of 216 new polymorphic SSR (simple sequence repeats) markers from libraries enriched for GA, CAA and AAT repeats, as well as 6 SSR markers developed from bacterial artificial chromosome-end sequences (BES-SSRs). Heterozygosity (H) values of the SSR markers ranges from 0.12 to 0.90, with an average value of 0.57. A linkage map was constructed for a newly developed recombinant inbred lines (RIL) population using these SSR markers. Additional markers, including amplified fragment length polymorphisms (AFLPs), two 11S seed storage protein loci, and the nucleolar organizing region (NOR), were also placed on the linkage map. The linkage map presented here is the first SSR-based map in quinoa and contains 275 markers, including 200 SSR. The map consists of 38 linkage groups (LGs) covering 913 cM. Segregation distortion was observed in the mapping population for several marker loci, indicating possible chromosomal regions associated with selection or gametophytic lethality. As this map is based primarily on simple and easily-transferable SSR markers, it will be particularly valuable for research in laboratories in Andean regions of South America.

  1. Laboratory Directed Research and Development FY2008 Annual Report

    Energy Technology Data Exchange (ETDEWEB)

    Kammeraad, J E; Jackson, K J; Sketchley, J A; Kotta, P R

    2009-03-24

    The Laboratory Directed Research and Development (LDRD) Program, authorized by Congress in 1991 and administered by the Institutional Science and Technology Office at Lawrence Livermore, is our primary means for pursuing innovative, long-term, high-risk, and potentially high-payoff research that supports the full spectrum of national security interests encompassed by the missions of the Laboratory, the Department of Energy, and National Nuclear Security Administration. The accomplishments described in this annual report demonstrate the strong alignment of the LDRD portfolio with these missions and contribute to the Laboratory's success in meeting its goals. The LDRD budget of $91.5 million for fiscal year 2008 sponsored 176 projects. These projects were selected through an extensive peer-review process to ensure the highest scientific quality and mission relevance. Each year, the number of deserving proposals far exceeds the funding available, making the selection a tough one indeed. Our ongoing investments in LDRD have reaped long-term rewards for the Laboratory and the nation. Many Laboratory programs trace their roots to research thrusts that began several years ago under LDRD sponsorship. In addition, many LDRD projects contribute to more than one mission area, leveraging the Laboratory's multidisciplinary team approach to science and technology. Safeguarding the nation from terrorist activity and the proliferation of weapons of mass destruction will be an enduring mission of this Laboratory, for which LDRD will continue to play a vital role. The LDRD Program is a success story. Our projects continue to win national recognition for excellence through prestigious awards, papers published in peer-reviewed journals, and patents granted. With its reputation for sponsoring innovative projects, the LDRD Program is also a major vehicle for attracting and retaining the best and the brightest technical staff and for establishing collaborations with

  2. Genome-wide microsatellite characterization and marker development in the sequenced Brassica crop species.

    Science.gov (United States)

    Shi, Jiaqin; Huang, Shunmou; Zhan, Jiepeng; Yu, Jingyin; Wang, Xinfa; Hua, Wei; Liu, Shengyi; Liu, Guihua; Wang, Hanzhong

    2014-02-01

    Although much research has been conducted, the pattern of microsatellite distribution has remained ambiguous, and the development/utilization of microsatellite markers has still been limited/inefficient in Brassica, due to the lack of genome sequences. In view of this, we conducted genome-wide microsatellite characterization and marker development in three recently sequenced Brassica crops: Brassica rapa, Brassica oleracea and Brassica napus. The analysed microsatellite characteristics of these Brassica species were highly similar or almost identical, which suggests that the pattern of microsatellite distribution is likely conservative in Brassica. The genomic distribution of microsatellites was highly non-uniform and positively or negatively correlated with genes or transposable elements, respectively. Of the total of 115 869, 185 662 and 356 522 simple sequence repeat (SSR) markers developed with high frequencies (408.2, 343.8 and 356.2 per Mb or one every 2.45, 2.91 and 2.81 kb, respectively), most represented new SSR markers, the majority had determined physical positions, and a large number were genic or putative single-locus SSR markers. We also constructed a comprehensive database for the newly developed SSR markers, which was integrated with public Brassica SSR markers and annotated genome components. The genome-wide SSR markers developed in this study provide a useful tool to extend the annotated genome resources of sequenced Brassica species to genetic study/breeding in different Brassica species.

  3. [Development of a sex-specific molecular marker for Japanese hop Humulus japonicus Siebold & Zucc].

    Science.gov (United States)

    Aleksandrov, O S; Divashuk, M G; Karlov, G I

    2011-08-01

    Japanese hop (Humulus japonicus Siebold & Zucc.) is a dioecious plant and a suitable model for studying the XX/XY1Y2 system of sex chromosomes. To develop a sex-specific marker, 12 RAPD and 36 ISSR markers were analyzed on the basis of pools of male and female plants identified after flowering. We were the first to identify ISSR marker K-16, which manifested stable amplification of an approximately 300-bp fragment in male plants and the absence of amplification in female plants in the populations examined. Marker effectiveness was confirmed in several Japanese hop populations of different origin.

  4. Development on Adjustable Calibration Marker for Shock Wave Focus

    Institute of Scientific and Technical Information of China (English)

    Xi-zhao Sun; Zhi-wei Zhang

    2005-01-01

    @@ Shock wave lithotripsy (SWL) is a treatment of choice for upper urinary stones. However, this procedure is inappropriate for obese patients because the focus is often unable to reach the target owing to the limited focal distance in shock wave source. Although treating such patients in a blast path may increase the application length of shock wave source,it's difficult to find this path on the lithotripter monitor. For this reason, we invented an adjustable calibration marker in order to set an effective focus in the shock wave path.

  5. Development of an integrative database with 499 novel microsatellite markers for Macaca fascicularis

    Directory of Open Access Journals (Sweden)

    Higashino Atsunori

    2009-06-01

    Full Text Available Abstract Background Cynomolgus macaques (Macaca fascicularis are a valuable resource for linkage studies of genetic disorders, but their microsatellite markers are not sufficient. In genetic studies, a prerequisite for mapping genes is development of a genome-wide set of microsatellite markers in target organisms. A whole genome sequence and its annotation also facilitate identification of markers for causative mutations. The aim of this study is to establish hundreds of microsatellite markers and to develop an integrative cynomolgus macaque genome database with a variety of datasets including marker and gene information that will be useful for further genetic analyses in this species. Results We investigated the level of polymorphisms in cynomolgus monkeys for 671 microsatellite markers that are covered by our established Bacterial Artificial Chromosome (BAC clones. Four hundred and ninety-nine (74.4% of the markers were found to be polymorphic using standard PCR analysis. The average number of alleles and average expected heterozygosity at these polymorphic loci in ten cynomolgus macaques were 8.20 and 0.75, respectively. Conclusion BAC clones and novel microsatellite markers were assigned to the rhesus genome sequence and linked with our cynomolgus macaque cDNA database (QFbase. Our novel microsatellite marker set and genomic database will be valuable integrative resources in analyzing genetic disorders in cynomolgus macaques.

  6. De novo genome assembly of Cercospora beticola for microsatellite marker development and validation

    Science.gov (United States)

    Cercospora leaf spot caused by Cercospora beticola is a significant threat to the production of sugar and table beet worldwide. A de novo genome assembly of C. beticola was used to develop eight polymorphic and reproducible microsatellite markers for population genetic analyses. These markers were u...

  7. Microsatellite isolation and marker development in carrot - genomic distribution, linkage mapping, genetic diversity analysis and marker transferability across Apiaceae

    Directory of Open Access Journals (Sweden)

    Yildiz Mehtap

    2011-08-01

    Full Text Available Abstract Background The Apiaceae family includes several vegetable and spice crop species among which carrot is the most economically important member, with ~21 million tons produced yearly worldwide. Despite its importance, molecular resources in this species are relatively underdeveloped. The availability of informative, polymorphic, and robust PCR-based markers, such as microsatellites (or SSRs, will facilitate genetics and breeding of carrot and other Apiaceae, including integration of linkage maps, tagging of phenotypic traits and assisting positional gene cloning. Thus, with the purpose of isolating carrot microsatellites, two different strategies were used; a hybridization-based library enrichment for SSRs, and bioinformatic mining of SSRs in BAC-end sequence and EST sequence databases. This work reports on the development of 300 carrot SSR markers and their characterization at various levels. Results Evaluation of microsatellites isolated from both DNA sources in subsets of 7 carrot F2 mapping populations revealed that SSRs from the hybridization-based method were longer, had more repeat units and were more polymorphic than SSRs isolated by sequence search. Overall, 196 SSRs (65.1% were polymorphic in at least one mapping population, and the percentage of polymophic SSRs across F2 populations ranged from 17.8 to 24.7. Polymorphic markers in one family were evaluated in the entire F2, allowing the genetic mapping of 55 SSRs (38 codominant onto the carrot reference map. The SSR loci were distributed throughout all 9 carrot linkage groups (LGs, with 2 to 9 SSRs/LG. In addition, SSR evaluations in carrot-related taxa indicated that a significant fraction of the carrot SSRs transfer successfully across Apiaceae, with heterologous amplification success rate decreasing with the target-species evolutionary distance from carrot. SSR diversity evaluated in a collection of 65 D. carota accessions revealed a high level of polymorphism for these

  8. Development of PCR-Based Markers to Determine the Sex of Kelps.

    Science.gov (United States)

    Lipinska, Agnieszka P; Ahmed, Sophia; Peters, Akira F; Faugeron, Sylvain; Cock, J Mark; Coelho, Susana M

    2015-01-01

    Sex discriminating genetic markers are commonly used to facilitate breeding programs in economically and ecologically important animal and plant species. However, despite their considerable economic and ecological value, the development of sex markers for kelp species has been very limited. In this study, we used the recently described sequence of the sex determining region (SDR) of the brown algal model Ectocarpus to develop novel DNA-based sex-markers for three commercially relevant kelps: Laminaria digitata, Undaria pinnatifida and Macrocystis pyrifera. Markers were designed within nine protein coding genes of Ectocarpus male and female (U/V) sex chromosomes and tested on gametophytes of the three kelp species. Seven primer pairs corresponding to three loci in the Ectocarpus SDR amplified sex-specific bands in the three kelp species, yielding at least one male and one female marker for each species. Our work has generated the first male sex-specific markers for L. digitata and U. pinnatifida, as well as the first sex markers developed for the genus Macrocystis. The markers and methodology presented here will not only facilitate seaweed breeding programs but also represent useful tools for population and demography studies and provide a means to investigate the evolution of sex determination across this largely understudied eukaryotic group.

  9. Development of PCR-Based Markers to Determine the Sex of Kelps.

    Directory of Open Access Journals (Sweden)

    Agnieszka P Lipinska

    Full Text Available Sex discriminating genetic markers are commonly used to facilitate breeding programs in economically and ecologically important animal and plant species. However, despite their considerable economic and ecological value, the development of sex markers for kelp species has been very limited. In this study, we used the recently described sequence of the sex determining region (SDR of the brown algal model Ectocarpus to develop novel DNA-based sex-markers for three commercially relevant kelps: Laminaria digitata, Undaria pinnatifida and Macrocystis pyrifera. Markers were designed within nine protein coding genes of Ectocarpus male and female (U/V sex chromosomes and tested on gametophytes of the three kelp species. Seven primer pairs corresponding to three loci in the Ectocarpus SDR amplified sex-specific bands in the three kelp species, yielding at least one male and one female marker for each species. Our work has generated the first male sex-specific markers for L. digitata and U. pinnatifida, as well as the first sex markers developed for the genus Macrocystis. The markers and methodology presented here will not only facilitate seaweed breeding programs but also represent useful tools for population and demography studies and provide a means to investigate the evolution of sex determination across this largely understudied eukaryotic group.

  10. Laboratory directed research and development fy1999 annual report

    Energy Technology Data Exchange (ETDEWEB)

    Al-Ayat, R A

    2000-04-11

    also enables many collaborations with the scientific community in academia, national and international laboratories, and industry. The projects in the FY1999 LDRD portfolio were carefully selected to continue vigorous support of the strategic vision and the long-term goals of DOE and the Laboratory. Projects chosen for LDRD funding undergo stringent selection processes, which look for high-potential scientific return, emphasize strategic relevance, and feature technical peer reviews by external and internal experts. The FY1999 projects described in this annual report focus on supporting the Laboratory's national security needs: stewardship of the U.S. nuclear weapons stockpile, responsibility for the counter- and nonproliferation of weapons of mass destruction, development of high-performance computing, and support of DOE environmental research and waste management programs. In the past, LDRD investments have significantly enhanced LLNL scientific capabilities and greatly contributed to the Laboratory's ability to meet its national security programmatic requirements. Examples of past investments include technical precursors to the Accelerated Strategic Computing Initiative (ASCI), special-materials processing and characterization, and biodefense. Our analysis of the FY1999 portfolio shows that it strongly supports the Laboratory's national security mission. About 95% of the LDRD dollars have directly supported LLNL's national security activities in FY1999, which far exceeds the portion of LLNL's overall budget supported by National Security Programs, which is 63% for FY1999.

  11. Development of an MRI fiducial marker prototype for automated MR-US fusion of abdominal images

    Science.gov (United States)

    Favazza, C. P.; Gorny, K. R.; Washburn, M. J.; Hangiandreou, N. J.

    2014-03-01

    External MRI fiducial marker devices are expected to facilitate robust, accurate, and efficient image fusion between MRI and other modalities. Automating of this process requires careful selection of a suitable marker size and material visible across a variety of pulse sequences, design of an appropriate fiducial device, and a robust segmentation algorithm. A set of routine clinical abdominal MRI pulse sequences was used to image a variety of marker materials and range of marker sizes. The most successfully detected marker was 12.7 mm diameter cylindrical reservoir filled with 1 g/L copper sulfate solution. A fiducial device was designed and fabricated from four such markers arranged in a tetrahedral orientation. MRI examinations were performed with the device attached to phantom and a volunteer, and custom developed algorithm was used to detect and segment the individual markers. The individual markers were accurately segmented in all sequences for both the phantom and volunteer. The measured intra-marker spacings matched well with the dimensions of the fiducial device. The average deviations from the actual physical spacings were 0.45+/- 0.40 mm and 0.52 +/- 0.36 mm for the phantom and the volunteer data, respectively. These preliminary results suggest that this general fiducial design and detection algorithm could be used for MRI multimodality fusion applications.

  12. Development of microsatellite markers for the clonal shrub Orixa japonica (Rutaceae) using 454 sequencing1

    Science.gov (United States)

    Tamaki, Ichiro; Setsuko, Suzuki; Sugai, Kyoko; Yanagisawa, Nao

    2016-01-01

    Premise of the study: Microsatellite markers were developed for a dioecious shrub, Orixa japonica (Rutaceae). Because O. japonica vigorously propagates by vegetative growth, microsatellite markers can be used to identify clonal relationships among its ramets. Methods and Results: Sixteen polymorphic microsatellite markers were identified by 454 next-generation sequencing. The number of alleles and expected heterozygosity for each locus among four populations ranged from two to 10 and from 0.140 to 0.875, respectively. Five of the 16 loci showed a low null allele frequency. Because Orixa is a monotypic genus, cross-amplification in a consubfamilial species, Skimmia japonica, was tested, and only one locus showed polymorphism. Conclusions: These microsatellite markers developed for O. japonica contribute to clone identification for studies examining the clonal structure and true sex ratio in the wild. Moreover, five markers that have a low null allele frequency can also be used for estimating mating systems or performing parentage analysis. PMID:27785383

  13. Development and Utilization of InDel Markers to Identify Peanut (Arachis hypogaea Disease Resistance

    Directory of Open Access Journals (Sweden)

    Lifeng eLiu

    2015-11-01

    Full Text Available Peanut diseases, such as leaf spot and spotted wilt caused by Tomato Spotted Wilt Virus, can significantly reduce yield and quality. Application of marker assisted plant breeding requires the development and validation of different types of DNA molecular markers. Nearly 10,000 SSR-based molecular markers have been identified by various research groups around the world, but less than 14.5% showed polymorphism in peanut and only 6.4% have been mapped. Low levels of polymorphism limit the application of marker assisted selection (MAS in peanut breeding programs. Insertion/deletion (InDel markers have been reported to be more polymorphic than SSRs in some crops. The goals of this study were to identify novel InDel markers and to evaluate the potential use in peanut breeding. Forty-eight InDel markers were developed from conserved sequences of functional genes and tested in a diverse panel of 118 accessions covering six botanical types of cultivated peanut, of which 104 were from the U.S. mini-core. Results showed that 16 InDel markers were polymorphic with polymorphic information content (PIC among InDels ranged from 0.017 to 0.660. With respect to botanical types, PICs varied from 0.176 for fastigiata var., 0.181 for hypogaea var., 0.306 for vulgaris var., 0.534 for aequatoriana var., 0.556 for peruviana var., to 0.660 for hirsuta var., implying that aequatoriana var., peruviana var., and hirsuta var. have higher genetic diversity than the other types and provide a basis for gene functional studies. Single marker analysis was conducted to associate specific marker to disease resistant traits. Five InDels from functional genes were identified to be significantly correlated to tomato spotted wilt virus (TSWV infection and leaf spot, and these novel markers will be utilized to identify disease resistant genotype in breeding populations.

  14. Director's Discretionary Research and Development Program: Annual Report, Fiscal Year 2006

    Energy Technology Data Exchange (ETDEWEB)

    2007-03-01

    The Director's Discretionary Research and Development Program, Annual Report Fiscal Year 2006 is an annual management report that summarizes research projects funded by the DDRD program. The NREL DDRD program comprises projects that strengthen NREL's four technical competencies: Integrated Systems, Renewable Electricity, Renewable Fuels, and Strategic Analysis.

  15. Exploiting Illumina Sequencing for the Development of 95 Novel Polymorphic EST-SSR Markers in Common Vetch (Vicia sativa subsp. sativa

    Directory of Open Access Journals (Sweden)

    Zhipeng Liu

    2014-05-01

    Full Text Available The common vetch (Vicia sativa subsp. sativa, a self-pollinating and diploid species, is one of the most important annual legumes in the world due to its short growth period, high nutritional value, and multiple usages as hay, grain, silage, and green manure. The available simple sequence repeat (SSR markers for common vetch, however, are insufficient to meet the developing demand for genetic and molecular research on this important species. Here, we aimed to develop and characterise several polymorphic EST-SSR markers from the vetch Illumina transcriptome. A total number of 1,071 potential EST-SSR markers were identified from 1025 unigenes whose lengths were greater than 1,000 bp, and 450 primer pairs were then designed and synthesized. Finally, 95 polymorphic primer pairs were developed for the 10 common vetch accessions, which included 50 individuals. Among the 95 EST-SSR markers, the number of alleles ranged from three to 13, and the polymorphism information content values ranged from 0.09 to 0.98. The observed heterozygosity values ranged from 0.00 to 1.00, and the expected heterozygosity values ranged from 0.11 to 0.98. These 95 EST-SSR markers developed from the vetch Illumina transcriptome could greatly promote the development of genetic and molecular breeding studies pertaining to in this species.

  16. Development of Genetic Markers for Triploid Verification of the Pacific Oyster,

    Directory of Open Access Journals (Sweden)

    Jung-Ha Kang

    2013-07-01

    Full Text Available The triploid Pacific oyster, which is produced by mating tetraploid and diploid oysters, is favored by the aquaculture industry because of its better flavor and firmer texture, particularly during the summer. However, tetraploid oyster production is not feasible in all oysters; the development of tetraploid oysters is ongoing in some oyster species. Thus, a method for ploidy verification is necessary for this endeavor, in addition to ploidy verification in aquaculture farms and in the natural environment. In this study, a method for ploidy verification of triploid and diploid oysters was developed using multiplex polymerase chain reaction (PCR panels containing primers for molecular microsatellite markers. Two microsatellite multiplex PCR panels consisting of three markers each were developed using previously developed microsatellite markers that were optimized for performance. Both panels were able to verify the ploidy levels of 30 triploid oysters with 100% accuracy, illustrating the utility of microsatellite markers as a tool for verifying the ploidy of individual oysters.

  17. Development of novel polymorphic microsatellite markers in Siganus fuscescens.

    Science.gov (United States)

    Mao, X Q; Li, Z B; Ning, Y F; Shangguan, J B; Yuan, Y; Huang, Y S; Li, B B

    2016-07-29

    Rabbitfish, Siganus fuscescens, is widely distributed in the Indo-Pacific regions and eastern Mediterranean. Its dwelling place includes reef flats, coral reef regions, and seagrass meadows in tropical area and reef areas or shallow waters in locations at high latitudes. In the present study, 10 new polymorphic microsatellite markers were screened from 30 wild S. fuscescens individuals, using a method of fast isolation protocol and amplified fragment length polymorphism of sequences containing repeats. The number of polymorphic alleles per locus was 3 to 5 with a mean of 4.3, while the value of polymorphic information content ranged from 0.283 to 0.680. The values of the observed and expected heterozygosities were in the range 0.3333-0.8462 and 0.3011-0.7424, respectively. Deviation from Hardy-Weinberg equilibrium was not observed in this study. These polymorphic loci are expected to be effective in evaluating the genetic diversity, population structure, and gene flow and in determining the paternity in S. fuscescens, as well as for conservation management.

  18. Development of a RAD-Seq Based DNA Polymorphism Identification Software, AgroMarker Finder, and Its Application in Rice Marker-Assisted Breeding.

    Directory of Open Access Journals (Sweden)

    Wei Fan

    Full Text Available Rapid and accurate genome-wide marker detection is essential to the marker-assisted breeding and functional genomics studies. In this work, we developed an integrated software, AgroMarker Finder (AMF: http://erp.novelbio.com/AMF, for providing graphical user interface (GUI to facilitate the recently developed restriction-site associated DNA (RAD sequencing data analysis in rice. By application of AMF, a total of 90,743 high-quality markers (82,878 SNPs and 7,865 InDels were detected between rice varieties JP69 and Jiaoyuan5A. The density of the identified markers is 0.2 per Kb for SNP markers, and 0.02 per Kb for InDel markers. Sequencing validation revealed that the accuracy of genome-wide marker detection by AMF is 93%. In addition, a validated subset of 82 SNPs and 31 InDels were found to be closely linked to 117 important agronomic trait genes, providing a basis for subsequent marker-assisted selection (MAS and variety identification. Furthermore, we selected 12 markers from 31 validated InDel markers to identify seed authenticity of variety Jiaoyuanyou69, and we also identified 10 markers closely linked to the fragrant gene BADH2 to minimize linkage drag for Wuxiang075 (BADH2 donor/Jiachang1 recombinants selection. Therefore, this software provides an efficient approach for marker identification from RAD-seq data, and it would be a valuable tool for plant MAS and variety protection.

  19. Authentication Markers for Five Major Panax Species Developed via Comparative Analysis of Complete Chloroplast Genome Sequences.

    Science.gov (United States)

    Nguyen, Van Binh; Park, Hyun-Seung; Lee, Sang-Choon; Lee, Junki; Park, Jee Young; Yang, Tae-Jin

    2017-08-02

    Ginseng represents a set of high-value medicinal plants of different species: Panax ginseng (Asian ginseng), Panax quinquefolius (American ginseng), Panax notoginseng (Chinese ginseng), Panax japonicus (Bamboo ginseng), and Panax vietnamensis (Vietnamese ginseng). Each species is pharmacologically and economically important, with differences in efficacy and price. Accordingly, an authentication system is needed to combat economically motivated adulteration of Panax products. We conducted comparative analysis of the chloroplast genome sequences of these five species, identifying 34-124 InDels and 141-560 SNPs. Fourteen InDel markers were developed to authenticate the Panax species. Among these, eight were species-unique markers that successfully differentiated one species from the others. We generated at least one species-unique marker for each of the five species, and any of the species can be authenticated by selection among these markers. The markers are reliable, easily detectable, and valuable for applications in the ginseng industry as well as in related research.

  20. Newly developed SSR markers reveal genetic diversity and geographical clustering in spinach (Spinacia oleracea).

    Science.gov (United States)

    Göl, Şurhan; Göktay, Mehmet; Allmer, Jens; Doğanlar, Sami; Frary, Anne

    2017-08-01

    Spinach is a popular leafy green vegetable due to its nutritional composition. It contains high concentrations of vitamins A, E, C, and K, and folic acid. Development of genetic markers for spinach is important for diversity and breeding studies. In this work, Next Generation Sequencing (NGS) technology was used to develop genomic simple sequence repeat (SSR) markers. After cleaning and contig assembly, the sequence encompassed 2.5% of the 980 Mb spinach genome. The contigs were mined for SSRs. A total of 3852 SSRs were detected. Of these, 100 primer pairs were tested and 85% were found to yield clear, reproducible amplicons. These 85 markers were then applied to 48 spinach accessions from worldwide origins, resulting in 389 alleles with 89% polymorphism. The average gene diversity (GD) value of the markers (based on a GD calculation that ranges from 0 to 0.5) was 0.25. Our results demonstrated that the newly developed SSR markers are suitable for assessing genetic diversity and population structure of spinach germplasm. The markers also revealed clustering of the accessions based on geographical origin with clear separation of Far Eastern accessions which had the overall highest genetic diversity when compared with accessions from Persia, Turkey, Europe, and the USA. Thus, the SSR markers have good potential to provide valuable information for spinach breeding and germplasm management. Also they will be helpful for genome mapping and core collection establishment.

  1. Development and characterization of highly polymorphic long TC repeat microsatellite markers for genetic analysis of peanut

    Directory of Open Access Journals (Sweden)

    Macedo Selma E

    2012-02-01

    Full Text Available Abstract Background Peanut (Arachis hypogaea L. is a crop of economic and social importance, mainly in tropical areas, and developing countries. Its molecular breeding has been hindered by a shortage of polymorphic genetic markers due to a very narrow genetic base. Microsatellites (SSRs are markers of choice in peanut because they are co-dominant, highly transferrable between species and easily applicable in the allotetraploid genome. In spite of substantial effort over the last few years by a number of research groups, the number of SSRs that are polymorphic for A. hypogaea is still limiting for routine application, creating the demand for the discovery of more markers polymorphic within cultivated germplasm. Findings A plasmid genomic library enriched for TC/AG repeats was constructed and 1401 clones sequenced. From the sequences obtained 146 primer pairs flanking mostly TC microsatellites were developed. The average number of repeat motifs amplified was 23. These 146 markers were characterized on 22 genotypes of cultivated peanut. In total 78 of the markers were polymorphic within cultivated germplasm. Most of those 78 markers were highly informative with an average of 5.4 alleles per locus being amplified. Average gene diversity index (GD was 0.6, and 66 markers showed a GD of more than 0.5. Genetic relationship analysis was performed and corroborated the current taxonomical classification of A. hypogaea subspecies and varieties. Conclusions The microsatellite markers described here are a useful resource for genetics and genomics in Arachis. In particular, the 66 markers that are highly polymorphic in cultivated peanut are a significant step towards routine genetic mapping and marker-assisted selection for the crop.

  2. Development of molecular markers linked to the 'Fiesta' linkage group 7 major QTL for fire blight resistance and their application for marker-assisted selection.

    Science.gov (United States)

    Khan, Muhammad A; Durel, Charles-Eric; Duffy, Brion; Drouet, Damien; Kellerhals, Markus; Gessler, Cesare; Patocchi, Andrea

    2007-06-01

    A fire blight resistance QTL explaining 34.3%-46.6% of the phenotypic variation was recently identified on linkage group 7 of apple cultivar 'Fiesta' (F7). However, markers flanking this QTL were AFLP and RAPD markers unsuitable for marker-assisted selection (MAS). Two RAPD markers bracketing the QTL have been transformed into SCAR (sequence-characterized amplified region) markers, and an SSR marker specific for the region was developed. Pedigree analysis of 'Fiesta' with these markers enabled tracking of the F7 QTL allele back to 'Cox's Orange Pippin'. Stability of the effect of this QTL allele in different backgrounds was analyzed by inoculating progeny plants of a cross between 'Milwa', a susceptible cultivar, and '1217', a moderately resistant cultivar, and a set of cultivars that carry or lack the allele conferring increased fire blight resistance. Progenies and cultivars that carried both markers were significantly more resistant than those that did not carry both markers, indicating high stability of the F7 QTL allele in different backgrounds. This stability and the availability of reproducible markers bracketing the QTL make this locus promising for use in MAS.

  3. Development of microsatellite markers using Illumina MiSeq sequencing to characterize Ephedra gerardiana (Ephedraceae)1

    Science.gov (United States)

    De, Ji; Zhu, Weidong; Liu, Tianmeng; Wang, Zhe; Zhong, Yang

    2017-01-01

    Premise of the study: Ephedra gerardiana (Ephedraceae), occurring in the Himalayan ranges, is an important plant species used in Tibetan medicine. Due to the lack of molecular markers to characterize genetic diversity, knowledge for conservation and uses of E. gerardiana resources is limited; we therefore developed microsatellite markers for use in this species. Methods and Results: Using Illumina MiSeq sequencing technology, we developed 29 polymorphic microsatellite loci suitable for E. gerardiana, of which 15 loci also showed polymorphisms in two related Ephedra species, E. saxatilis and E. monosperma. The average number of effective alleles per locus ranged from two to six. The observed and expected heterozygosity ranged from 0.23 to 0.83 and 0.44 to 0.86, respectively, in E. gerardiana populations. Conclusions: The developed 29 microsatellite markers are effective for the study of genetic structure and genetic diversity of E. gerardiana, and 15 of these markers are suitable for related Ephedra species. PMID:28337389

  4. Immunohistochemical markers for corneal stem cells in the early developing human eye

    DEFF Research Database (Denmark)

    Lyngholm, Mikkel; Høyer, Poul E; Vorum, Henrik;

    2008-01-01

    markers and potential markers for LSCs and early transient amplifying cells in human adults. In this study, we describe the development of the ectodermally derived LSCs and the mesodermally derived niche cells from the time at which the cornea is defined (week 6) until the formation of the early limbal...... niche (week 14) in human embryos and fetuses. The expression of SOD2 and CK15 was investigated together with other recently identified limbal proteins. Previously suggested LSC and differentiation markers (PAX6, aquaporin-1 and nestin) were also investigated. Both SOD2 and CK15 were present...

  5. Development of 13 Microsatellite Markers in the Endangered Sinai Primrose (Primula boveana, Primulaceae

    Directory of Open Access Journals (Sweden)

    Hassan Mansour

    2013-06-01

    Full Text Available Premise of the study: We developed microsatellite markers for the endangered plant Primula boveana, the Sinai primrose, and assessed the cross-transferability of these markers to six related taxa. Methods and Results: DNA sequences containing microsatellites were isolated from a microsatellite-enriched library. We obtained successful amplification of 13 microsatellite primer pairs, seven of which were polymorphic in P. boveana. Eleven of these primers successfully cross-amplified to related taxa. Conclusions: The markers reported herein will be useful to characterize the genetic diversity of the endangered P. boveana and to evaluate its mating system, and have the potential to be useful for similar studies in close relatives.

  6. Genome-enabled development of DNA markers for ecology, evolution and conservation.

    Science.gov (United States)

    Thomson, Robert C; Wang, Ian J; Johnson, Jarrett R

    2010-06-01

    Molecular markers have become a fundamental piece of modern biology's toolkit. In the last decade, new genomic resources from model organisms and advances in DNA sequencing technology have altered the way that these tools are developed, alleviating the marker limitation that researchers previously faced and opening new areas of research for studies of non-model organisms. This availability of markers is directly responsible for advances in several areas of research, including fine-scaled estimation of population structure and demography, the inference of species phylogenies, and the examination of detailed selective pressures in non-model organisms. This review summarizes methods for the development of large numbers of DNA markers in non-model organisms, the challenges encountered when utilizing different methods, and new research applications resulting from these advances.

  7. Development of SCAR Marker Related to Summer Stress Tolerance in Tall Fescue (Festuca arundinacea

    Directory of Open Access Journals (Sweden)

    Xiaojun YUAN

    2014-06-01

    Full Text Available Summer stress tolerance (SST is one of the most important breeding objectives in tall fescue (Festuca arundinacea, an important perennial cool-season grass. However, breeding for better SST is generally complicated by the many environmental factors involved during the growing season. Utilizing the bulked segregant analysis (BSA, we were able to identify one marker related to SST from 100 inter-simple sequence repeat (ISSR markers and 800 random amplified polymorphic DNA (RAPD markers, and successfully developed a dominant sequence characterized amplified region (SCAR marker T_SC856 from the UBC856 sequence. Furthermore, the SCAR marker was tested in different clones of new populations, which were identified under complex summer stress (high temperature and humidity, Pythium blight, and brown patch, and it exhibited relatively high consistency (77% with the phenotype. We believe that with more markers obtained in the future, better efficiency is likely to be achieved in breeding for improved SST in tall fescue and possibly other species as well. Further studies that analyze the factors relating to the SCAR marker are needed.

  8. Development and use of microsatellite markers in Marama bean

    African Journals Online (AJOL)

    Prof. Adipala Ekwamu

    develop SSR's for detection of polymorphisms in Marama bean. The microsatellite regions of the .... primer by combining 20 µl PCR product (200 µg) and 1 µl primer (10 µM) ... unrelated DNA (sheared herring sperm at 1 mg ml-1) was added to ...

  9. Development and Characterization of 37 Novel EST-SSR Markers in Pisum sativum (Fabaceae

    Directory of Open Access Journals (Sweden)

    Xiaofeng Zhuang

    2013-01-01

    Full Text Available Premise of the study: Simple sequence repeat markers were developed based on expressed sequence tags (EST-SSR and screened for polymorphism among 23 Pisum sativum individuals to assist development and refinement of pea linkage maps. In particular, the SSR markers were developed to assist in mapping of white mold disease resistance quantitative trait loci. Methods and Results: Primer pairs were designed for 46 SSRs identified in EST contiguous sequences assembled from a 454 pyrosequenced transcriptome of the pea cultivar, ‘LIFTER’. Thirty-seven SSR markers amplified PCR products, of which 11 (30% SSR markers produced polymorphism in 23 individuals, including parents of recombinant inbred lines, with two to four alleles. The observed and expected heterozygosities ranged from 0 to 0.43 and from 0.31 to 0.83, respectively. Conclusions: These EST-SSR markers for pea will be useful for refinement of pea linkage maps, and will likely be useful for comparative mapping of pea and as tools for marker-based pea breeding.

  10. Development and characterization of twelve microsatellite markers for Porphyra linearis Greville.

    Science.gov (United States)

    Varela-Álvarez, Elena; Paulino, Cristina; Serrão, Ester A

    2017-02-01

    The genus Porphyra (and its sister genus Pyropia) contains important red algal species that are cultivated and/or harvested for human consumption, sustaining a billion-dollar aquaculture industry. A vast amount of research has been focused on species of this genus, including studies on genetics and genomics among other areas. Twelve novel microsatellite markers were developed here for Porphyra linearis. Markers were characterized using 32 individuals collected from four natural populations of P. linearis with total heterozygosity varying from 0.098 to 0.916. The number of alleles per locus ranged from 2 to 18. All markers showed cross amplification with Porphyra umbilicalis and/or Porphyra dioica. These polymorphic microsatellite markers are useful for investigating population genetic diversity and differentiation in P. linearis and may become useful for other genetic research on the reproductive biology of this important species.

  11. Development of microsatellite markers for six Tetranychus species by transfer from Tetranychus urticae genome.

    Science.gov (United States)

    Zhang, Jia; Sun, Jing-Tao; Jin, Peng-Yu; Hong, Xiao-Yue

    2016-09-01

    Microsatellite markers are frequently used to explore the population genetic structure of organisms. Spider mites (genus Tetranychus) are important agricultural pests. Several markers have been developed for T. urticae, but for other spider mites, few such markers are available, hampering studies of their population genetics. In this study, we developed and characterized microsatellite markers for six non-model spider mite species (T. truncatus, T. kanzawai, T. ludeni, T. piercei, T. phaselus and T. pueraricola) by cross-species amplification of markers in the T. urticae genome, in order to better understand the population structure of Tetranychus species. Among 228 screened loci, many were polymorphic, including 13 loci in T. urticae, 11 loci in T. truncatus, 15 loci in T. pueraricola, 23 loci in T. kanzawai, 19 loci in T. piercei, 11 loci in T. phaselus and 9 loci in T. ludeni. Sequence analysis determined that the fragment length variations of the transferred microsatellites were mainly due to the variations of the numbers of repeats. These new microsatellite markers should be useful for studying the population genetics of the seven Tetranychus species.

  12. Development of EST-derived markers in Dendrobium from EST of related taxa

    Directory of Open Access Journals (Sweden)

    Narisa Juejun

    2013-04-01

    Full Text Available Public databases are useful for molecular marker development. The major aim of this study was to develop expressedsequence tag (EST-derived markers in Dendrobium from available ESTs of Phalaenopsis and Dendrobium. A total of 6063sequences were screened for simple sequence repeats (SSRs and introns. Primers flanking these regions were generated andtested on genomic DNAs of Phalaenopsis and Dendrobium. Twenty-three percent of amplifiable Phalaenopsis EST-derivedmarkers were cross-genera transferable to Dendrobium. Forty-one markers from both Phalaenopsis and Dendrobium thatamplified in Dendrobium were assessed on six commercial cultivars and six wild accessions. All of them were transferableamong Dendrobium species. High polymorphism and heterozygosity were observed within wild accessions. Sixteen polymorphic markers were evaluated for linkage analysis on an F1 segregating population. Seven markers were mapped into threelinkage groups, two of which showed syntenic relationship between dendrobium and rice. This relationship will facilitatefurther quantitative trait loci (QTL mapping and comparative genomic studies of Dendrobium. Our results indicate thatPhalaenopsis EST-derived markers are valuable tools for genetic research and breeding applications in Dendrobium.

  13. Development and mapping of SSR markers linked to resistance-gene homologue clusters in common bean

    Institute of Scientific and Technical Information of China (English)

    Luz; Nayibe; Garzon; Matthew; Wohlgemuth; Blair

    2014-01-01

    Common bean is an important but often a disease-susceptible legume crop of temperate,subtropical and tropical regions worldwide. The crop is affected by bacterial, fungal and viral pathogens. The strategy of resistance-gene homologue(RGH) cloning has proven to be an efficient tool for identifying markers and R(resistance) genes associated with resistances to diseases. Microsatellite or SSR markers can be identified by physical association with RGH clones on large-insert DNA clones such as bacterial artificial chromosomes(BACs). Our objectives in this work were to identify RGH-SSR in a BAC library from the Andean genotype G19833 and to test and map any polymorphic markers to identify associations with known positions of disease resistance genes. We developed a set of specific probes designed for clades of common bean RGH genes and then identified positive BAC clones and developed microsatellites from BACs having SSR loci in their end sequences. A total of 629 new RGH-SSRs were identified and named BMr(bean microsatellite RGH-associated markers). A subset of these markers was screened for detecting polymorphism in the genetic mapping population DOR364 × G19833. A genetic map was constructed with a total of 264 markers,among which were 80 RGH loci anchored to single-copy RFLP and SSR markers. Clusters of RGH-SSRs were observed on most of the linkage groups of common bean and in positions associated with R-genes and QTL. The use of these new markers to select for disease resistance is discussed.

  14. Repetitive flanking sequences challenge microsatellite marker development: a case study in the lepidopteran Melanargia galathea.

    Science.gov (United States)

    Schmid, Max; Csencsics, Daniela; Gugerli, Felix

    2016-11-01

    Microsatellite DNA families (MDF) are stretches of DNA that share similar or identical sequences beside nuclear simple-sequence repeat (nSSR) motifs, potentially causing problems during nSSR marker development. Primers positioned within MDFs can bind several times within the genome and might result in multiple banding patterns. It is therefore common practice to exclude MDF loci in the course of marker development. Here, we propose an approach to deal with multiple primer-binding sites by purposefully positioning primers within the detected repetitive element. We developed a new protocol to determine the family type and the primer position in relation to MDFs using the software packages repark and repeatmasker together with an in-house R script. We re-evaluated newly developed nSSR markers for the lepidopteran Marbled White (Melanargia galathea) and explored the implications of our results with regard to published data sets of the butterfly Euphydryas aurinia, the grasshopper Stethophyma grossum, the conifer Pinus cembra and the crucifer Arabis alpina. For M. galathea, we show that it is not only possible to develop reliable nSSR markers for MDF loci, but even to benefit from their presence in some cases: We used one unlabelled primer, successfully binding within an MDF, for two different loci in a multiplex PCR, combining this family primer with uniquely binding and fluorescently labelled primers outside of MDFs, respectively. As MDFs are abundant in many taxa, we propose to consider these during nSSR marker development in taxa concerned. Our new approach might help in reducing the number of tested primers during nSSR marker development. © 2016 John Wiley & Sons Ltd.

  15. Development of Microsatellite Markers for the Neotropical Vine Dalechampia scandens (Euphorbiaceae

    Directory of Open Access Journals (Sweden)

    Mohsen Falahati-Anbaran

    2013-06-01

    Full Text Available Premise of the study: Microsatellite markers were developed to assess polymorphism and level of genetic diversity in four Mexican populations of the neotropical vine Dalechampia scandens (Euphorbiaceae. Methods and Results: Thirty-seven microsatellite markers representing bi-, tri-, tetra-, and pentanucleotide microsatellite repeats were developed. In total, 166 alleles were identified across 54 individuals. The number of alleles varied from one to 11 with an average of 4.49 alleles per locus. All loci except one were highly polymorphic between populations, whereas considerably less variation was detected within populations for most loci. The average observed and expected heterozygosities across study populations ranged from 0 to 0.63 and 0 to 0.59, respectively, for individual loci, and a deviation from Hardy–Weinberg equilibrium was observed for most loci. Conclusions: The developed markers may be useful for studying genetic structure, parentage analysis, mapping, phylogeography, and cross-amplification in other closely related species of Dalechampia.

  16. Workforce and Economic Development Annual Report, 2011-2012

    Science.gov (United States)

    California Community Colleges, Chancellor's Office, 2013

    2013-01-01

    The California Community Colleges Workforce and Economic Development program (WED program) helps students, incumbent workers, business partners and industries develop skilled competencies in critical industry sectors. As a source for developing and implementing training and curriculum, the WED program is instrumental in helping the community…

  17. Development of novel microsatellite markers for strain-specific identification of Chlorella vulgaris.

    Science.gov (United States)

    Jo, Beom-Ho; Lee, Chang Soo; Song, Hae-Ryong; Lee, Hyung-Gwan; Oh, Hee-Mock

    2014-09-01

    A strain-specific identification method is required to secure Chlorella strains with useful genetic traits, such as a fast growth rate or high lipid productivity, for application in biofuels, functional foods, and pharmaceuticals. Microsatellite markers based on simple sequence repeats can be a useful tool for this purpose. Therefore, this study developed five novel microsatellite markers (mChl-001, mChl-002, mChl-005, mChl-011, and mChl-012) using specific loci along the chloroplast genome of Chlorella vulgaris. The microsatellite markers were characterized based on their allelic diversities among nine strains of C. vulgaris with the same 18S rRNA sequence similarity. Each microsatellite marker exhibited 2~5 polymorphic allele types, and their combinations allowed discrimination between seven of the C. vulgaris strains. The two remaining strains were distinguished using one specific interspace region between the mChl-001 and mChl-005 loci, which was composed of about 27 single nucleotide polymorphisms, 13~15 specific sequence sites, and (T)n repeat sites. Thus, the polymorphic combination of the five microsatellite markers and one specific locus facilitated a clear distinction of C. vulgaris at the strain level, suggesting that the proposed microsatellite marker system can be useful for the accurate identification and classification of C. vulgaris.

  18. Development of 10 microsatellite markers from Pantala flavescens and their applicability in studying genetics diversity.

    Science.gov (United States)

    Cao, Lingzhen; Fu, Xiaowei; Wu, Kongming

    2015-08-01

    Pantala flavescens (Fabricius 1798) is one of the most common species among migration dragonflies. It is often encountered in large swarms during migration or directed dispersal flights. For a better understanding of its gene flow, genetic structure and migration patterns throughout the world, 10 polymorphic microsatellite markers were isolated in this study. We respectively collected 32 P. flavescens from three places (Hunan, Liaoning and Heilongjiang) and 20 P. flavescens from Beijing. Partial genomic libraries containing microsatellite sequences were constructed with magnetic-bead enrichment method. By screening, sequence analysis, PCR amplification and so on, ten 10 polymorphic microsatellite markers were isolated. In order to assess their applicability, genetic diversity of these novel markers was tested in 96 individuals from three populations in China (Hunan, Liaoning and Heilongjiang). These markers were highly polymorphic, with 3-12 alleles per markers. The observed (Ho) and expected (He) heterozygosities ranged 0.321-0.667 and from 0.531 to 0.948 respectively. The genetic difference between Hunan and Liaoning is 0.429, while the genetic difference between Liaoning and Heilongjiang is 0.0508. These microsatellite markers for P. flavescens were developed for the first time, and will be a powerful tool for studying population genetic diversity and dispersal behavior of P. flavescens in China and worldwide.

  19. Development of Diagnostic Microscopic and Chemical Markers of Some Euphorbia Latexes

    Institute of Scientific and Technical Information of China (English)

    Uppuluri Venkata Mallavadhani; Kantamreddi Venkata Siva Satyanarayana; Anita Mahapatra; Akella Venkata Subrahmanya Sudhakar; Kilambi Narasimhan; Devendar Kumar Pandey; Manikkannan Thirunavokkarasu

    2006-01-01

    The latexes of the three Euphorbia species, namely E. antiquorum L., E. nerifolia L., and E. tirucalli L., are highly valued in the Indian system of medicine as purgatives, in addition to their specific and distinct therapeutic activities. In order to distinguish these latexes and develop their diagnostic microscopic and chemical markers, we performed extensive chemical and microscopic studies. The three latexes differ significantly in their microscopic features by exhibiting characteristic starch grain patterns. Although amoebic structures were found to be characteristic of E. antiquorum, dumb-bell and oval structures are characteristic of E. nerifolia and E. tirucalli, respectively. In addition, these latexes showed bone-shaped structures as a common feature, but these differed considerably in their length (10-60, 30-55, and 50-70 μm in length in E. antiquorum, E. nerifolia, and E. tirucalli, respectively). The chemical markers nerifoliene and euphol were found to be common to both E. antiquorum and E. nerifolia, whereas euphol is the only marker for E.tirucalli. A reverse-phase high-performance thin-layer chromatographic (HPTLC) method was developed to distinguish these three latexes and to generate their standard fingerprinting patterns. Most significantly,the markers nerifoliene and euphol could be resolved by RP-18 F254s precoated aluminium plates and the latexes have been quantitatively estimated with respect to these markers. The developed microscopic,chemical and HPTLC patterns can be used to distinguish the three latexes.

  20. Developing genome-wide microsatellite markers of bamboo and their applications on molecular marker assisted taxonomy for accessions in the genus Phyllostachys.

    Science.gov (United States)

    Zhao, Hansheng; Yang, Li; Peng, Zhenhua; Sun, Huayu; Yue, Xianghua; Lou, Yongfeng; Dong, Lili; Wang, Lili; Gao, Zhimin

    2015-01-26

    Morphology-based taxonomy via exiguously reproductive organ has severely limitation on bamboo taxonomy, mainly owing to infrequent and unpredictable flowering events of bamboo. Here, we present the first genome-wide analysis and application of microsatellites based on the genome of moso bamboo (Phyllostachys edulis) to assist bamboo taxonomy. Of identified 127,593 microsatellite repeat-motifs, the primers of 1,451 microsatellites were designed and 1,098 markers were physically mapped on the genome of moso bamboo. A total of 917 markers were successfully validated in 9 accessions with ~39.8% polymorphic potential. Retrieved from validated microsatellite markers, 23 markers were selected for polymorphic analysis among 78 accessions and 64 alleles were detected with an average of 2.78 alleles per primers. The cluster result indicated the majority of the accessions were consistent with their current taxonomic classification, confirming the suitability and effectiveness of the developed microsatellite markers. The variations of microsatellite marker in different species were confirmed by sequencing and in silico comparative genome mapping were investigated. Lastly, a bamboo microsatellites database (http://www.bamboogdb.org/ssr) was implemented to browse and search large information of bamboo microsatellites. Consequently, our results of microsatellite marker development are valuable for assisting bamboo taxonomy and investigating genomic studies in bamboo and related grass species.

  1. Development of microsatellite markers in Gonystylus bancanus (Ramin) useful for tracing and tracking of wood of this protected species

    NARCIS (Netherlands)

    Smulders, M.J.M.; Westende, van 't W.P.C.; Diway, B.; Esselink, G.D.; Meer, van der P.J.; Koopman, W.J.M.

    2008-01-01

    Ten polymorphic microsatellite markers have been developed for Gonystylus bancanus (Ramin), a protected tree species of peat swamp forests in Malaysia and Indonesia. Eight markers were also shown to be polymorphic in other Gonystylus species. The markers will enable assessing the amount of genetic v

  2. Genomic sequencing and microsatellite marker development for Boswellia papyrifera, an economically important but threatened tree native to dry tropical forests

    NARCIS (Netherlands)

    Addisalem, A.B.; Esselink, G.; Bongers, F.; Smulders, M.J.M.

    2015-01-01

    Microsatellite (or simple sequence repeat, SSR) markers are highly informative DNA markers often used in conservation genetic research. Next-generation sequencing enables efficient development of large numbers of SSR markers at lower costs. Boswellia papyrifera is an economically important tree spec

  3. Developing Faculty as Researchers. ASHE 1985 Annual Meeting Paper.

    Science.gov (United States)

    Wheeler, Daniel; Creswell, John

    Domains of faculty research development are considered, with attention to various scholarly activities such as publishing in journals, editing books/monographs, publishing book reviews, and delivering papers at professional meetings. A cognitive map of faculty development is presented that incorporates findings from the literature on the sociology…

  4. The somatic marker theory in the context of addiction: contributions to understanding development and maintenance

    Directory of Open Access Journals (Sweden)

    Olsen VV

    2015-07-01

    Full Text Available Vegard V Olsen,1 Ricardo G Lugo,1 Stefan Sütterlin1,2 1Section of Psychology, Lillehammer University College, Lillehammer, 2Department of Psychosomatic Medicine, Division of Surgery and Clinical Neuroscience, Oslo University Hospital – Rikshospitalet, Oslo, Norway Abstract: Recent theoretical accounts of addiction have acknowledged that addiction to substances and behaviors share inherent similarities (eg, insensitivity to future consequences and self-regulatory deficits. This recognition is corroborated by inquiries into the neurobiological correlates of addiction, which has indicated that different manifestations of addictive pathology share common neural mechanisms. This review of the literature will explore the feasibility of the somatic marker hypothesis as a unifying explanatory framework of the decision-making deficits that are believed to be involved in addiction development and maintenance. The somatic marker hypothesis provides a neuroanatomical and cognitive framework of decision making, which posits that decisional processes are biased toward long-term prospects by emotional marker signals engendered by a neuronal architecture comprising both cortical and subcortical circuits. Addicts display markedly impulsive and compulsive behavioral patterns that might be understood as manifestations of decision-making processes that fail to take into account the long-term consequences of actions. Evidence demonstrates that substance dependence, pathological gambling, and Internet addiction are characterized by structural and functional abnormalities in neural regions, as outlined by the somatic marker hypothesis. Furthermore, both substance dependents and behavioral addicts show similar impairments on a measure of decision making that is sensitive to somatic marker functioning. The decision-making deficits that characterize addiction might exist a priori to addiction development; however, they may be worsened by ingestion of substances with

  5. Self-(in)compatibility inheritance and allele-specific marker development in yellow mustard (Sinapis alba).

    Science.gov (United States)

    Zeng, Fangqin; Cheng, Bifang

    2014-01-01

    Yellow mustard (Sinapis alba) has a sporophytic self-incompatibility reproduction system. Genetically stable self-incompatible (SI) and self-compatible (SC) inbred lines have recently been developed in this crop. Understanding the S haplotype of different inbred lines and the inheritance of the self-(in)compatibility (SI/SC) trait is very important for breeding purposes. In this study, we used the S-locus gene-specific primers in Brassica rapa and Brassica oleracea to clone yellow mustard S-locus genes of SI lines Y514 and Y1130 and SC lines Y1499 and Y1501. The PCR amplification results and DNA sequences of the S-locus genes revealed that Y514 carried the class I S haplotype, while Y1130, Y1499, and Y1501 had the class II S haplotype. The results of our genetic studies indicated that self-incompatibility was dominant over self-compatibility and controlled by a one-gene locus in the two crosses of Y514 × Y1499 and Y1130 × Y1501. Of the five S-locus gene polymorphic primer pairs, Sal-SLGI and Sal-SRKI each generated one dominant marker for the SI phenotype of Y514; Sal-SLGII and Sal-SRKII produced dominant marker(s) for the SC phenotype of Y1501 and Y1499; Sal-SP11II generated one dominant marker for Y1130. These markers co-segregated with the SI/SC phenotype in the F2 populations of the two crosses. In addition, co-dominant markers were developed by mixing the two polymorphic primer pairs specific for each parent in the multiplex PCR, which allowed zygosity to be determined in the F2 populations. The SI/SC allele-specific markers have proven to be very useful for the selection of the desirable SC genotypes in our yellow mustard breeding program.

  6. Development of Microsatellite Markers for Lagerstroemia indica (Lythraceae and Related Species

    Directory of Open Access Journals (Sweden)

    Yang Liu

    2013-02-01

    Full Text Available Premise of the study: Microsatellite markers were developed and characterized to analyze genetic diversity within Lagerstroemia cultivars and related species. Methods and Results: Using simple sequence repeat (SSR-enriched libraries, 11 species-specific polymorphic genomic SSRs were developed from L. indica ‘Hong Die Fei Wu’. All primers were tested on 48 L. indica individuals from China, the United States, and France. The primers amplified four to 12 alleles per locus, including di-, tri-, and tetranucleotide repeats. Observed and expected heterozygosities ranged from 0.1875 to 0.7609 and 0.2836 to 0.8385, respectively. The primers were also highly cross-transferrable to L. subcostata, L. limii, L. fauriei, L. caudata, and L. speciosa. Conclusions: The new primers will enlarge the bank of SSRs available to genetic research of Lagerstroemia. These SSR markers will facilitate population genetics and molecular marker-assisted selection of L. indica.

  7. Development of microsatellite markers using next-generation sequencing for the columnar cactus Echinopsis chiloensis (Cactaceae).

    Science.gov (United States)

    Ossa, Carmen G; Larridon, Isabel; Peralta, Gioconda; Asselman, Pieter; Pérez, Fernanda

    2016-12-01

    The aim of this study was to develop microsatellite markers as a tool to study population structure, genetic diversity and effective population size of Echinopsis chiloensis, an endemic cactus from arid and semiarid regions of Central Chile. We developed 12 polymorphic microsatellite markers for E. chiloensis using next-generation sequencing and tested them in 60 individuals from six sites, covering all the latitudinal range of this species. The number of alleles per locus ranged from 3 to 8, while the observed (Ho) and expected (He) heterozygosity ranged from 0.0 to 0.80 and from 0.10 to 0.76, respectively. We also detected significant differences between sites, with FST values ranging from 0.05 to 0.29. Microsatellite markers will enable us to estimate genetic diversity and population structure of E. chiloensis in future ecological and phylogeographic studies.

  8. Development of microsatellite markers in potato and their transferability in some members of Solanaceae.

    Science.gov (United States)

    Grover, Atul; Ramesh, B; Sharma, P C

    2009-10-01

    We have developed thirty new microsatellite markers in potato by screening genomic libraries and ESTs. Genomic libraries of potato cultivar Kufri Bahar were screened for sequences containing microsatellite motifs GA, GT, ACA, ATC, GAA, TAA and GATA. Using flanking sequences, PCR primers were designed for microsatellites identified from genomic libraries and ESTs. Sixteen new primer pairs from genomic libraries and fourteen from ESTs along with seven previously published primer pairs amplified PCR products in the selected genotypes comprising of 65 Solanum tuberosum lines and 14 other species of the potato gene pool. Neighbor-joining tree based on genetic distance matrix developed using microsatellite markers successfully distinguished all these genotypes in the expected size range. Seventeen microsatellites could also be cross-amplified in at least one of the five members of solanaceae, namely tomato, eggplant, pepper, petunia and tobacco. The new microsatellite markers obtained in this study will be useful in various genetic and taxonomic studies in potato and related genomes.

  9. Development of surface enhanced Raman scattering (SERS) spectroscopy monitoring of fuel markers to prevent fraud

    Science.gov (United States)

    Wilkinson, Timothy; Clarkson, John; White, Peter C.; Meakin, Nicholas; McDonald, Ken

    2013-05-01

    Governments often tax fuel products to generate revenues to support and stimulate their economies. They also subsidize the cost of essential fuel products. Fuel taxation and subsidization practices are both subject to fraud. Oil marketing companies also suffer from fuel fraud with loss of legitimate sales and additional quality and liability issues. The use of an advanced marking system to identify and control fraud has been shown to be effective in controlling illegal activity. DeCipher has developed surface enhanced Raman scattering (SERS) spectroscopy as its lead technology for measuring markers in fuel to identify and control malpractice. SERS has many advantages that make it highly suitable for this purpose. The SERS instruments are portable and can be used to monitor fuel at any point in the supply chain. SERS shows high specificity for the marker, with no false positives. Multiple markers can also be detected in a single SERS analysis allowing, for example, specific regional monitoring of fuel. The SERS analysis from fuel is also quick, clear and decisive, with a measurement time of less than 5 minutes. We will present results highlighting our development of the use of a highly stable silver colloid as a SERS substrate to measure the markers at ppb levels. Preliminary results from the use of a solid state SERS substrate to measure fuel markers will also be presented.

  10. Development of INDEL Markers for Genetic Mapping Based on Whole Genome Resequencing in Soybean.

    Science.gov (United States)

    Song, Xiaofeng; Wei, Haichao; Cheng, Wen; Yang, Suxin; Zhao, Yanxiu; Li, Xuan; Luo, Da; Zhang, Hui; Feng, Xianzhong

    2015-10-19

    Soybean [Glycine max (L.) Merrill] is an important crop worldwide. In this study, a Chinese local soybean cultivar, Hedou 12, was resequenced by next generation sequencing technology to develop INsertion/DELetion (INDEL) markers for genetic mapping. 49,276 INDEL polymorphisms and 242,059 single nucleotide polymorphisms were detected between Hedou 12 and the Williams 82 reference sequence. Of these, 243 candidate INDEL markers ranging from 5-50 bp in length were chosen for validation, and 165 (68%) of them revealed polymorphisms between Hedou 12 and Williams 82. The validated INDEL markers were also tested in 12 other soybean cultivars. The number of polymorphisms in the pairwise comparisons of 14 soybean cultivars varied from 27 to 165. To test the utility of these INDEL markers, they were used to perform genetic mapping of a crinkly leaf mutant, and the CRINKLY LEAF locus was successfully mapped to a 360 kb region on chromosome 7. This research shows that high-throughput sequencing technologies can facilitate the development of genome-wide molecular markers for genetic mapping in soybean.

  11. Laboratory directed research development annual report. Fiscal year 1996

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-05-01

    This document comprises Pacific Northwest National Laboratory`s report for Fiscal Year 1996 on research and development programs. The document contains 161 project summaries in 16 areas of research and development. The 16 areas of research and development reported on are: atmospheric sciences, biotechnology, chemical instrumentation and analysis, computer and information science, ecological science, electronics and sensors, health protection and dosimetry, hydrological and geologic sciences, marine sciences, materials science and engineering, molecular science, process science and engineering, risk and safety analysis, socio-technical systems analysis, statistics and applied mathematics, and thermal and energy systems. In addition, this report provides an overview of the research and development program, program management, program funding, and Fiscal Year 1997 projects.

  12. Laboratory directed research and development 2006 annual report.

    Energy Technology Data Exchange (ETDEWEB)

    Westrich, Henry Roger

    2007-03-01

    This report summarizes progress from the Laboratory Directed Research and Development (LDRD) program during fiscal year 2006. In addition to a programmatic and financial overview, the report includes progress reports from 430 individual R&D projects in 17 categories.

  13. Thoria development activities. Annual report, fiscal year 1978

    Energy Technology Data Exchange (ETDEWEB)

    Hart, P.E.

    1979-02-01

    Pacific Northwest Laboratory's (PNL) ThO/sub 2/ development activities for FY-1978 are reviewed. These activities are in support of the FRAD (Fuels Refabrication and Development) program's goal of developing proliferation resistant fuel cycles. Included are results for the five ThO/sub 2/ fuel related elements that are assigned to PNL. During FY-1978, work on these elements has been directed primarily toward establishing the TOFDL (Thorium Oxide Fuel Development Laboratory) facility where unit operations for ThO/sub 2/-based fuels will be defined and fuels for test irradiations fabricated. Additional activities include evaluation of ThO/sub 2/ powders derived by various oxalate precipitation conditions, the fabricability of commercially available ThO/sub 2/ powders, hybrid pellet fuel fabrication and definition of an irradiation test plan.

  14. Biofuels feedstock development program. Annual progress report for 1992

    Energy Technology Data Exchange (ETDEWEB)

    Wright, L.L.; Cushman, J.H.; Ehrenshaft, A.R.; McLaughlin, S.B.; McNabb, W.A.; Martin, S.A.; Ranney, J.W.; Tuskan, G.A.; Turhollow, A.F.

    1993-11-01

    The Department of Energy`s (DOE`s) Biofuels Feedstock Development Program (BFDP) leads the nation in the research, development, and demonstration of environmentally acceptable and commercially viable dedicated feedstock supply systems (DFSS). The purpose of this report is to highlight the status and accomplishments of the research that is currently being funded by the BFDP. Highlights summarized here and additional accomplishments are described in more detail in the sections associated with each major program task. A few key accomplishments include (1) development of a methodology for doing a cost-supply analysis for energy crops and the application of that methodology to looking at possible land use changes around a specific energy facility in East Tennessee; (2) preliminary documentation of the relationship between woody crop plantation locations and bird diversity at sites in the Midwest, Canada, and the pacific Northwest supplied indications that woody crop plantations could be beneficial to biodiversity; (3) the initiation of integrated switchgrass variety trials, breeding research, and biotechnology research for the south/southeast region; (4) development of a data base management system for documenting the results of herbaceous energy crop field trials; (5) publication of three issues of Energy Crops Forum and development of a readership of over 2,300 individuals or organizations as determined by positive responses on questionnaires.

  15. Suitability of non-lethal marker and marker-free systems for development of transgenic crop plants: present status and future prospects.

    Science.gov (United States)

    Manimaran, P; Ramkumar, G; Sakthivel, K; Sundaram, R M; Madhav, M S; Balachandran, S M

    2011-01-01

    Genetically modified crops are one of the prudent options for enhancing the production and productivity of crop plants by safeguarding from the losses due to biotic and abiotic stresses. Agrobacterium-mediated and biolistic transformation methods are used to develop transgenic crop plants in which selectable marker genes (SMG) are generally deployed to identify 'true' transformants. The commonly used SMG obtained from prokaryotic sources when employed in transgenic plants pose risks due to their lethal nature during selection process. In the recent past, some non-lethal SMGs have been identified and used for selection of transformants with increased precision and high selection efficiency. Considering the concerns related to bio-safety of the environment, it is desirable to remove the SMG in order to maximize the commercial success through wide adoption and public acceptance of genetically modified (GM) food crops. In this review, we examine the availability, and the suitability of wide range of non-lethal selection markers and elimination of SMG methods to develop marker-free transgenics for achieving global food security. As the strategies for marker-free plants are still in proof-of-concept stage, adaptation of new genomics tools for identification of novel non-lethal marker systems and its application for developing marker-free transgenics would further strengthen the crop improvement program.

  16. Transportation Development Centre annual review, 1997-1998

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-12-31

    Report describing the activities and accomplishments of the Transportation Development Centre (TDC) for the fiscal year ending March 31, 1998 is presented. The role of the TDC is to improve the safety, security, energy efficiency and accessibility of the Canadian transportation system while protecting the environment. From a management perspective, one of the important developments during the reporting year was a new framework for research and development in Transport Canada, which defines a process for identifying and setting departmental research and development priorities. The year also marked the finalization of a five-year science and technology plan for increased cooperation in the field of North American transportation technologies. Among research and development highlights in air, marine, road and rail transportation work done on aircraft takeoff behaviour of failed de-icing fluids; the winter runway friction measurement program; revision of flight recorder configuration standards; development of a new child safety system; a ship-based search and rescue radar detection system; research on flooding protection of ro-ro ferries; completion of a study on leak-before-burst performance of various designs of natural gas vehicle cylinders; work on school bus safety and a thermal management system for road vehicles; plastic- lined traction motor bearings for locomotives, and work on a guided radar system designed to detect rock falls and washouts, were singled out. Progress related to issues regarding the transportation of dangerous goods, transportation accessibility, human factors and security are also reported. A financial overview which provides a detailed breakdown of TDC`s funding and funding sources for 1997-98 is also included. tabs., figs.

  17. Biofuels Feedstock Development Program annual progress report for 1991

    Energy Technology Data Exchange (ETDEWEB)

    Wright, L.L.; Cushman, J.H.; Ehrenshaft, A.R.; McLaughlin, S.B.; McNabb, W.A.; Ranney, J.W.; Tuskan, G.A.; Turhollow, A.F.

    1992-12-01

    This report provides an overview of the ongoing research funded in 1991 by the Department of Energy's Biofuels Feedstock Development Program (BFDP). The BFDP is managed by the Environmental Sciences Division of the Oak Ridge National Laboratory and encompasses the work formerly funded by the Short Rotation Woody Crops Program and the Herbaceous Energy Crops Program. The combined program includes crop development research on both woody and herbaceous energy crop species, cross-cutting energy and environmental analysis and integration, and information management activities. Brief summaries of 26 different program activities are included in the report.

  18. Biofuels Feedstock Development Program annual progress report for 1991

    Energy Technology Data Exchange (ETDEWEB)

    Wright, L.L.; Cushman, J.H.; Ehrenshaft, A.R.; McLaughlin, S.B.; McNabb, W.A.; Ranney, J.W.; Tuskan, G.A.; Turhollow, A.F.

    1992-12-01

    This report provides an overview of the ongoing research funded in 1991 by the Department of Energy`s Biofuels Feedstock Development Program (BFDP). The BFDP is managed by the Environmental Sciences Division of the Oak Ridge National Laboratory and encompasses the work formerly funded by the Short Rotation Woody Crops Program and the Herbaceous Energy Crops Program. The combined program includes crop development research on both woody and herbaceous energy crop species, cross-cutting energy and environmental analysis and integration, and information management activities. Brief summaries of 26 different program activities are included in the report.

  19. Advanced waste forms research and development. Annual report

    Energy Technology Data Exchange (ETDEWEB)

    McCarthy, G.J.

    1975-06-11

    Research and development activities on advanced (alternatives to glass) nuclear waste forms are reported. The emphasis is on two phases of the work to give essential background information on supercalcine development. The first is a report of the data obtained in the study of cesium aluminosilicate for Cs and Ru fixation. Research on the compatibility of the phases formed in the complex oxide system made up of waste and additive cations is reported. The phase stability in a number of proposed formulations was determined. (JSR)

  20. Molecular marker development and genetic diversity exploration by RNA-seq in Platycodon grandiflorum.

    Science.gov (United States)

    Kim, Hyun Jung; Jung, Jungsu; Kim, Myung-Shin; Lee, Je Min; Choi, Doil; Yeam, Inhwa

    2015-10-01

    Platycodon grandiflorum, generally known as the bellflower or balloon flower, is the only species in the genus Platycodon of the family Campanulaceae. Platycodon plants have been traditionally used as a medicinal crop in East Asia for their antiphlogistic, antitussive, and expectorant properties. Despite these practical uses, marker-assisted selection and molecular breeding in platycodons have lagged due to the lack of genetic information on this genus. In this study, we performed RNA-seq analysis of three platycodon accessions to develop molecular markers and explore genetic diversity. First, genic simple sequence repeats (SSRs) were retrieved and compared; dinucleotide motifs were the most abundant repeats (39%-40%) followed by trinucleotide (25%-31%), tetranucleotide (1.5%-1.9%), and pentanucleotide (0.3%-1.0%) repeats. The result of in silico SSR analysis, three SSR markers were detected and showed possibility to distinguish three platycodon accessions. After several filtering procedures, 180 single nucleotide polymorphisms (SNPs) were used to design 40 cleaved amplified polymorphic sequence (CAPS) markers. Twelve of these PCR-based markers were validated as highly polymorphic and utilized to investigate genetic diversity in 21 platycodon accessions collected from various regions of South Korea. Collectively, the 12 markers yielded 35 alleles, with an average of 3 alleles per locus. Polymorphism information content (PIC) values ranged from 0.087 to 0.693, averaging 0.373 per locus. Since platycodon genetics have not been actively studied, the sequence information and the DNA markers generated from our research have the potential to contribute to further genetic improvements, genomic studies, and gene discovery in this genus.

  1. Recent advances in development of marker-free transgenic plants: Regulation and biosafety concern

    Indian Academy of Sciences (India)

    Narendra Tuteja; Shiv Verma; Ranjan Kumar Sahoo; Sebastian Raveendar; In Bheema Lingeshwara Reddy

    2012-03-01

    During the efficient genetic transformation of plants with the gene of interest, some selectable marker genes are also used in order to identify the transgenic plant cells or tissues. Usually, antibiotic- or herbicide-selective agents and their corresponding resistance genes are used to introduce economically valuable genes into crop plants. From the biosafety authority and consumer viewpoints, the presence of selectable marker genes in released transgenic crops may be transferred to weeds or pathogenic microorganisms in the gastrointestinal tract or soil, making them resistant to treatment with herbicides or antibiotics, respectively. Sexual crossing also raises the problem of transgene expression because redundancy of transgenes in the genome may trigger homology-dependent gene silencing. The future potential of transgenic technologies for crop improvement depends greatly on our abilities to engineer stable expression of multiple transgenic traits in a predictable fashion and to prevent the transfer of undesirable transgenic material to non-transgenic crops and related species. Therefore, it is now essential to develop an efficient marker-free transgenic system. These considerations underline the development of various approaches designed to facilitate timely elimination of transgenes when their function is no longer needed. Due to the limiting number of available selectable marker genes, in future the stacking of transgenes will be increasingly desirable. The production of marker-free transgenic plants is now a critical requisite for their commercial deployment and also for engineering multiple and complex trait. Here we describe the current technologies to eliminate the selectablemarker genes (SMG) in order to develop marker-free transgenic plants and also discuss the regulation and biosafety concern of genetically modified (GM) crops.

  2. Triangulated IEP Transition Goals: Developing Relevant and Genuine Annual Goals

    Science.gov (United States)

    Peterson, Lori Y.; Burden, Jon Paul; Sedaghat, Jennifer M.; Gothberg, June E.; Kohler, Paula D.; Coyle, Jennifer L.

    2013-01-01

    Special education professionals are charged to develop relevant, compliant, and legally defensible IEPs for transition-age students with disabilities. This charge is intensified as educators strive to provide plans that will genuinely prepare students for postsecondary education, employment, and independent living. This manuscript demonstrates how…

  3. Triangulated IEP Transition Goals: Developing Relevant and Genuine Annual Goals

    Science.gov (United States)

    Peterson, Lori Y.; Burden, Jon Paul; Sedaghat, Jennifer M.; Gothberg, June E.; Kohler, Paula D.; Coyle, Jennifer L.

    2013-01-01

    Special education professionals are charged to develop relevant, compliant, and legally defensible IEPs for transition-age students with disabilities. This charge is intensified as educators strive to provide plans that will genuinely prepare students for postsecondary education, employment, and independent living. This manuscript demonstrates how…

  4. Annual Review of Selected Developments; Agricultural Education and Training.

    Science.gov (United States)

    United Nations Food and Agriculture Organization, Rome (Italy).

    This document is the second in a series designed to describe agricultural education projects and practices which have been successful in promoting agricultural change and improvement in areas of the world where subsistance agriculture predominates. The projects are included here because of their emphasis on development of human resources and…

  5. Laboratory Directed Research and Development Program. Annual report

    Energy Technology Data Exchange (ETDEWEB)

    Ogeka, G.J.

    1991-12-01

    Today, new ideas and opportunities, fostering the advancement of technology, are occurring at an ever-increasing rate. It, therefore, seems appropriate that a vehicle be available which fosters the development of these new ideas and technologies, promotes the early exploration and exploitation of creative and innovative concepts, and which develops new ``fundable`` R&D projects and programs. At Brookhaven National Laboratory (BNL), one such method is through its Laboratory Directed Research and Development (LDRD) Program. This discretionary research and development tool is critical in maintaining the scientific excellence and vitality of the Laboratory. Additionally, it is a means to stimulate the scientific community, fostering new science and technology ideas, which is the major factor achieving and maintaining staff excellence, and a means to address national needs, with the overall mission of the Department of Energy (DOE) and the Brookhaven National Laboratory. The Project Summaries with their accomplishments described in this report reflect the above. Aside from leading to new fundable or promising programs and producing especially noteworthy research, they have resulted in numerous publications in various professional and scientific journals, and presentations at meetings and forums.

  6. Laboratory directed research and development annual report: Fiscal year 1992

    Energy Technology Data Exchange (ETDEWEB)

    1993-01-01

    The Department of Energy Order DOE 5000.4A establishes DOE's policy and guidelines regarding Laboratory Directed Research and Development (LDRD) at its multiprogram laboratories. As described in 5000.4A, LDRD is research and development of a creative and innovative nature which is selected by the Laboratory Director or his or her designee, for the purpose of maintaining the scientific and technological vitality of the Laboratory and to respond to scientific and technological opportunities in conformance with the guidelines in this order. Consistent with the Mission Statement and Strategic Plan provided in PNL's Institutional Plan, the LDRD investments are focused on developing new and innovative approaches to research related to our core competencies.'' Currently, PNL's core competencies have been identified as: integrated environmental research; process science and engineering; energy distribution and utilization. In this report, the individual summaries of Laboratory-level LDRD projects are organized according to these corecompetencies. The largest proportion of Laboratory-level LDRD funds is allocated to the core competency of integrated environmental research. The projects described in this report represent PNL's investment in its future and are vital to maintaining the ability to develop creative solutions for the scientific and technical challenges faced by DOE and the nation. The report provides an overview of PNL's LDRD program and the management process used for the program and project summaries for each LDRD project.

  7. Laboratory directed research and development annual report: Fiscal year 1992

    Energy Technology Data Exchange (ETDEWEB)

    1993-01-01

    The Department of Energy Order DOE 5000.4A establishes DOE`s policy and guidelines regarding Laboratory Directed Research and Development (LDRD) at its multiprogram laboratories. As described in 5000.4A, LDRD is ``research and development of a creative and innovative nature which is selected by the Laboratory Director or his or her designee, for the purpose of maintaining the scientific and technological vitality of the Laboratory and to respond to scientific and technological opportunities in conformance with the guidelines in this order. Consistent with the Mission Statement and Strategic Plan provided in PNL`s Institutional Plan, the LDRD investments are focused on developing new and innovative approaches to research related to our ``core competencies.`` Currently, PNL`s core competencies have been identified as: integrated environmental research; process science and engineering; energy distribution and utilization. In this report, the individual summaries of Laboratory-level LDRD projects are organized according to these corecompetencies. The largest proportion of Laboratory-level LDRD funds is allocated to the core competency of integrated environmental research. The projects described in this report represent PNL`s investment in its future and are vital to maintaining the ability to develop creative solutions for the scientific and technical challenges faced by DOE and the nation. The report provides an overview of PNL`s LDRD program and the management process used for the program and project summaries for each LDRD project.

  8. Laboratory Directed Research and Development annual report, Fiscal year 1993

    Energy Technology Data Exchange (ETDEWEB)

    1994-01-01

    The Department of Energy Order DOE 5000.4A establishes DOE`s policy and guidelines regarding Laboratory Directed Research and Development (LDRD) at its multiprogram laboratories. As described in 5000.4A, LDRD is ``research and development of a creative and innovative nature which is selected by the Laboratory Director or his or her designee, for the purpose of maintaining the scientific and technological vitality of the Laboratory and to respond to scientific and technological opportunities in conformance with the guidelines in this Order. LDRD includes activities previously defined as ER&D, as well as other discretionary research and development activities not provided for in a DOE program.`` Consistent with the Mission Statement and Strategic Plan provided in PNL`s Institutional Plan, the LDRD investments are focused on developing new and innovative approaches in research related to our ``core competencies.`` Currently, PNL`s core competencies have been identified as integrated environmental research; process technology; energy systems research. In this report, the individual summaries of Laboratory-level LDRD projects are organized according to these core competencies. The largest proportion of Laboratory-level LDRD funds is allocated to the core competency of integrated environmental research. A significant proportion of PNL`s LDRD funds are also allocated to projects within the various research centers that are proposed by individual researchers or small research teams. The projects are described in Section 2.0. The projects described in this report represent PNL`s investment in its future and are vital to maintaining the ability to develop creative solutions for the scientific and technical challenges faced by DOE and the nation. In accordance with DOE guidelines, the report provides an overview of PNL`s LDRD program and the management process used for the program and project summaries for each LDRD project.

  9. Development and characterization of microsatellite markers in the sexual-apomictic complex Taraxacum officinale (dandelion)

    NARCIS (Netherlands)

    Falque, M.; Keurentjes, J.J.B.; Bakx-Schotman, J.M.T.; Van Dijk, P.J.

    1998-01-01

    Microsatellite markers were developed in Taraxacum officinale to study gene flow between sexual and apomictic plants and to identify clones. Twenty five thousand genomic DNA clones were hybridized with a (CT)(12)D probe. The density of (GA/CT)(n) repeats was estimated at one every 61 kb in the T.

  10. Development and characterization of nine new microsatellite markers in Taraxacum (Asteraceae).

    NARCIS (Netherlands)

    Vasut, R.; Dijk, P.J.; Falque, M.; Trávnicek, B.; Jong, de J.H.S.G.M.

    2004-01-01

    This study aims at developing and characterizing new microsatellite primer pairs in Taraxacum officinale auct. to produce polymorphic markers for genetical and evolutionary studies on apomixis in this sexual-apomictic complex. A total of 24 diploid plants were tested for allelic polymorphism and

  11. Development and characterization of 35 single nucleotide polymorphism markers for the brown alga Fucus vesiculosus

    NARCIS (Netherlands)

    Canovas, Fernando; Mota, Catarina; Ferreira-Costa, Joana; Serrao, Ester; Coyer, Jim; Olsen, Jeanine; Pearson, Gareth

    2011-01-01

    We characterized 35 single nucleotide polymorphism (SNP) markers for the brown alga Fucus vesiculosus. Based on existing Fucus Expressed Sequence Tag libraries for heat and desiccation-stressed tissue, SNPs were developed and confirmed by re-sequencing cDNA from a diverse panel of individuals. SNP l

  12. Development and characterization of microsatellite markers in the sexual-apomictic complex Taraxacum officinale (dandelion)

    NARCIS (Netherlands)

    Falque, M.; Keurentjes, J.J.B.; Bakx-Schotman, J.M.T.; Van Dijk, P.J.

    1998-01-01

    Microsatellite markers were developed in Taraxacum officinale to study gene flow between sexual and apomictic plants and to identify clones. Twenty five thousand genomic DNA clones were hybridized with a (CT)(12)D probe. The density of (GA/CT)(n) repeats was estimated at one every 61 kb in the T. of

  13. Development and characterization of nine new microsatellite markers in Taraxacum (Asteraceae)

    NARCIS (Netherlands)

    Vašut, R.J.; van Dijk, P.J.; Falque, M.; Trávnícek, B.; Jong, J.P.

    2004-01-01

    This study aims at developing and characterizing new microsatellite primer pairs in Taraxacum officinale auct. to produce polymorphic markers for genetical and evolutionary studies on apomixis in this sexual-apomictic complex. A total of 24 diploid plants were tested for allelic polymorphism and het

  14. Development and characterization of nine new microsatellite markers in Taraxacum (Asteraceae).

    NARCIS (Netherlands)

    Vasut, R.; Dijk, P.J.; Falque, M.; Trávnicek, B.; Jong, de J.H.S.G.M.

    2004-01-01

    This study aims at developing and characterizing new microsatellite primer pairs in Taraxacum officinale auct. to produce polymorphic markers for genetical and evolutionary studies on apomixis in this sexual-apomictic complex. A total of 24 diploid plants were tested for allelic polymorphism and het

  15. Development and characterization of 35 single nucleotide polymorphism markers for the brown alga Fucus vesiculosus

    NARCIS (Netherlands)

    Canovas, Fernando; Mota, Catarina; Ferreira-Costa, Joana; Serrao, Ester; Coyer, Jim; Olsen, Jeanine; Pearson, Gareth

    2011-01-01

    We characterized 35 single nucleotide polymorphism (SNP) markers for the brown alga Fucus vesiculosus. Based on existing Fucus Expressed Sequence Tag libraries for heat and desiccation-stressed tissue, SNPs were developed and confirmed by re-sequencing cDNA from a diverse panel of individuals. SNP

  16. Functional marker development is challenged by the ubiquity of endophytes-a practical perspective.

    Science.gov (United States)

    Arnholdt-Schmitt, Birgit; Valadas, Vera; Döring, Matthias

    2016-01-01

    Functional markers (FMs) are supposed to assist in diagnosis, disease treatment and turning plant and animal breeding more efficient. However, efficient FM application is challenged through current insights in the multi-organism nature of life. This letter aims to raise awareness for re-thinking concepts for FM development in plant breeding and proposes a novel perspective.

  17. Development and characterization of microsatellite markers for two dioecious Ficus species

    NARCIS (Netherlands)

    Zavodna, M.; Arens, P.F.P.; Dijk, P.J.; Vosman, B.J.

    2005-01-01

    Microsatellite markers for Ficus montana and Ficus septica were developed using genomic libraries enriched for di-, tri- and tetranucleotide repeats. The subsets of five and three best scorable primer pairs were characterized on 24 F. montana and 36 F. septica individuals, respectively. For F. monta

  18. A blackberry (Rubus L.) expressed sequence tag library for the development of simple sequence repeat markers

    Science.gov (United States)

    A blackberry (Rubus L.) expressed sequence tag (EST) library was produced for developing simple sequence repeat (SSR) markers from the tetraploid blackberry cultivar, Merton Thornless, the source of the thornless trait in commercial cultivars. RNA was extracted from young expanding leaves and used f...

  19. Development and characterization of 35 single nucleotide polymorphism markers for the brown alga Fucus vesiculosus

    NARCIS (Netherlands)

    Canovas, Fernando; Mota, Catarina; Ferreira-Costa, Joana; Serrao, Ester; Coyer, Jim; Olsen, Jeanine; Pearson, Gareth

    2011-01-01

    We characterized 35 single nucleotide polymorphism (SNP) markers for the brown alga Fucus vesiculosus. Based on existing Fucus Expressed Sequence Tag libraries for heat and desiccation-stressed tissue, SNPs were developed and confirmed by re-sequencing cDNA from a diverse panel of individuals. SNP l

  20. Development of polymorphic microsatellite markers for the human botfly, Dermatobia hominis (Diptera: Oestridae).

    Science.gov (United States)

    Bitarello, Bárbara Domingues; Torres, Tatiana Teixeira; Lyra, Mariana Lúcio; DE Azeredo-Espin, Ana Maria Lima

    2009-01-01

    In this report, we describe the development of 17 polymorphic microsatellite markers for the human botfly, Dermatobia hominis, an obligatory parasite of mammals of great veterinary importance in Latin America. The number of alleles ranged from 5 to 21 per locus, with a mean of 12.2 alleles per locus. The expected heterozygosity ranged from 0.2571 to 0.9206 and from 0.2984 to 0.9291 in two populations from Brazil. These markers should provide a high resolution tool for assessment of the fine-scale genetic structure of natural populations of the human botfly. © 2009 The Authors. Journal compilation © 2009 Blackwell Publishing Ltd.

  1. Development of genic-SSR markers by deep transcriptome sequencing in pigeonpea [Cajanus cajan (L. Millspaugh

    Directory of Open Access Journals (Sweden)

    Bashasab Fakrudin

    2011-01-01

    Full Text Available Abstract Background Pigeonpea [Cajanus cajan (L. Millspaugh], one of the most important food legumes of semi-arid tropical and subtropical regions, has limited genomic resources, particularly expressed sequence based (genic markers. We report a comprehensive set of validated genic simple sequence repeat (SSR markers using deep transcriptome sequencing, and its application in genetic diversity analysis and mapping. Results In this study, 43,324 transcriptome shotgun assembly unigene contigs were assembled from 1.696 million 454 GS-FLX sequence reads of separate pooled cDNA libraries prepared from leaf, root, stem and immature seed of two pigeonpea varieties, Asha and UPAS 120. A total of 3,771 genic-SSR loci, excluding homopolymeric and compound repeats, were identified; of which 2,877 PCR primer pairs were designed for marker development. Dinucleotide was the most common repeat motif with a frequency of 60.41%, followed by tri- (34.52%, hexa- (2.62%, tetra- (1.67% and pentanucleotide (0.76% repeat motifs. Primers were synthesized and tested for 772 of these loci with repeat lengths of ≥18 bp. Of these, 550 markers were validated for consistent amplification in eight diverse pigeonpea varieties; 71 were found to be polymorphic on agarose gel electrophoresis. Genetic diversity analysis was done on 22 pigeonpea varieties and eight wild species using 20 highly polymorphic genic-SSR markers. The number of alleles at these loci ranged from 4-10 and the polymorphism information content values ranged from 0.46 to 0.72. Neighbor-joining dendrogram showed distinct separation of the different groups of pigeonpea cultivars and wild species. Deep transcriptome sequencing of the two parental lines helped in silico identification of polymorphic genic-SSR loci to facilitate the rapid development of an intra-species reference genetic map, a subset of which was validated for expected allelic segregation in the reference mapping population. Conclusion We

  2. Development of microsatellite markers from an enriched genomic library of pumpkin (Cucurbita moschata L.

    Directory of Open Access Journals (Sweden)

    Nuchjaree Watcharawongpaiboon

    2007-09-01

    Full Text Available Development of microsatellite markers in Pumpkin (Cucurbita moschata L. was performed using the biotin-streptavidin enrichment procedure. One hundred and thirty three clones were randomly selected. After sequence analysis of 31 randomly picked positive colonies, 100% of the colonies were found to contain microsatellite sequences, and 9 primer pairs were designed. Five of the primers tested could amplify pumpkins DNA and can be used for genetic purity testing of the commercial hybrids. This paper reports the first isolation and utilization of microsatellite markers in pumpkin.

  3. Characterization and development of EST-derived SSR markers in cultivated sweetpotato (Ipomoea batatas

    Directory of Open Access Journals (Sweden)

    Li Yujun

    2011-10-01

    Full Text Available Abstract Background Currently there exists a limited availability of genetic marker resources in sweetpotato (Ipomoea batatas, which is hindering genetic research in this species. It is necessary to develop more molecular markers for potential use in sweetpotato genetic research. With the newly developed next generation sequencing technology, large amount of transcribed sequences of sweetpotato have been generated and are available for identifying SSR markers by data mining. Results In this study, we investigated 181,615 ESTs for the identification and development of SSR markers. In total, 8,294 SSRs were identified from 7,163 SSR-containing unique ESTs. On an average, one SSR was found per 7.1 kb of EST sequence with tri-nucleotide motifs (42.9% being the most abundant followed by di- (41.2%, tetra- (9.2%, penta- (3.7% and hexa-nucleotide (3.1% repeat types. The top five motifs included AG/CT (26.9%, AAG/CTT (13.5%, AT/TA (10.6%, CCG/CGG (5.8% and AAT/ATT (4.5%. After removing possible duplicate of published EST-SSRs of sweetpotato, a total of non-repeat 7,958 SSR motifs were identified. Based on these SSR-containing sequences, 1,060 pairs of high-quality SSR primers were designed and used for validation of the amplification and assessment of the polymorphism between two parents of one mapping population (E Shu 3 Hao and Guang 2k-30 and eight accessions of cultivated sweetpotatoes. The results showed that 816 primer pairs could yield reproducible and strong amplification products, of which 195 (23.9% and 342 (41.9% primer pairs exhibited polymorphism between E Shu 3 Hao and Guang 2k-30 and among the 8 cultivated sweetpotatoes, respectively. Conclusion This study gives an insight into the frequency, type and distribution of sweetpotato EST-SSRs and demonstrates successful development of EST-SSR markers in cultivated sweetpotato. These EST-SSR markers could enrich the current resource of molecular markers for the sweetpotato community and would

  4. Institutional Research and Development: (Annual report), FY 1986

    Energy Technology Data Exchange (ETDEWEB)

    Strack, B. (ed.)

    1987-01-01

    The Institutional Research and Development (IR and D) program was established at the Lawrence Livermore National Laboratory (LLNL) by the Director in October 1984. The IR and D program fosters exploratory work to advance science and technology; disciplinary research to create varied, innovative approaches to selected scientific fields; and long-term research in support of the defense and energy missions at LLNL. Each project in the IR and D program was selected after personal interviews by the Director and his delegates and was deemed to show unusual promise. These projects include research in the following fields: chemistry and materials science, computation, earth sciences, engineering, nuclear chemistry, biotechnology, environmental consequences of nuclear war, geophysics and planetary physics, and supercomputer research and development. A separate section of the report is devoted to research projects receiving individual awards.

  5. Native Fish Sanctuary Project - Sanctuary Development Phase, 2007 Annual Report

    Science.gov (United States)

    Mueller, Gordon A.

    2007-01-01

    Notable progress was made in 2007 toward the development of native fish facilities in the Lower Colorado River Basin. More than a dozen facilities are, or soon will be, online to benefit native fish. When this study began in 2005 no self-supporting communities of either bonytail or razorback sucker existed. Razorback suckers were removed from Rock Tank in 1997 and the communities at High Levee Pond had been compromised by largemouth bass in 2004. This project reversed that trend with the establishment of the Davis Cove native fish community in 2005. Bonytail and razorback sucker successfully produced young in Davis Cove in 2006. Bonytail successfully produced young in Parker Dam Pond in 2007, representing the first successful sanctuary established solely for bonytail. This past year, Three Fingers Lake received 135 large razorback suckers, and Federal and State agencies have agreed to develop a cooperative management approach dedicating a portion of that lake toward grow-out and (or) the establishment of another sanctuary. Two ponds at River's Edge Golf Course in Needles, California, were renovated in June and soon will be stocked with bonytail. Similar activities are taking place at Mohave Community College, Cerbat Cliffs Golf Course, Cibola High Levee Pond, Office Cove, Emerald Canyon Golf Course, and Bulkhead Cove. Recruitment can be expected as fish become sexually mature at these facilities. Flood-plain facilities have the potential to support 6,000 adult razorback suckers and nearly 20,000 bonytail if native fish management is aggressively pursued. This sanctuary project has assisted agencies in developing 15 native fish communities by identifying specific resource objectives for those sites, listing and prioritizing research opportunities and needs, and strategizing on management approaches through the use of resource-management plans. Such documents have been developed for Davis Cove, Cibola High Levee Pond, Parker Dam Pond, and Three Fingers Lake. We

  6. Laboratory Directed Research and Development Program FY 2006 Annual Report

    Energy Technology Data Exchange (ETDEWEB)

    Sjoreen, Terrence P [ORNL

    2007-04-01

    The Oak Ridge National Laboratory (ORNL) Laboratory Directed Research and Development (LDRD) Program reports its status to the US Departmental of Energy (DOE) in March of each year. The program operates under the authority of DOE Order 413.2B, 'Laboratory Directed Research and Development' (April 19, 2006), which establishes DOE's requirements for the program while providing the Laboratory Director broad flexibility for program implementation. LDRD funds are obtained through a charge to all Laboratory programs. This report includes summaries all ORNL LDRD research activities supported during FY 2006. The associated FY 2006 ORNL LDRD Self-Assessment (ORNL/PPA-2007/2) provides financial data about the FY 2006 projects and an internal evaluation of the program's management process.

  7. Independent Research and Independent Exploratory Development FY91 Annual Report

    Science.gov (United States)

    1992-03-01

    Computers in Human Behavior , 6, 167-175. Heinssen, R. K., Glass, C. R., & Knight, L...A. (1987). Assessing computer anxiety: Development and validation of the computer anxiety rating scale. Computers in Human Behavior , 3, 49-59. Hess...administered MMPIs: A comparison of patients’ attitudes. Computers in Human Behavior , 2, 111-116. Schuldberg, D. (1988). The MMPI is less sensitive to

  8. FY 1999 Laboratory Directed Research and Development annual report

    Energy Technology Data Exchange (ETDEWEB)

    PJ Hughes

    2000-06-13

    A short synopsis of each project is given covering the following main areas of research and development: Atmospheric sciences; Biotechnology; Chemical and instrumentation analysis; Computer and information science; Design and manufacture engineering; Ecological science; Electronics and sensors; Experimental technology; Health protection and dosimetry; Hydrologic and geologic science; Marine sciences; Materials science; Nuclear science and engineering; Process science and engineering; Sociotechnical systems analysis; Statistics and applied mathematics; and Thermal and energy systems.

  9. Waste form development program. Annual report, October 1982-September 1983

    Energy Technology Data Exchange (ETDEWEB)

    Colombo, P.; Kalb, P.D.; Fuhrmann, M.

    1983-09-01

    This report provides a summary of the work conducted for the Waste Form Development/Test Program at Brookhaven National Laboratory in FY 1983 under the sponsorship of the US Department of Energy's Low-Level Waste Management Program. The primary focus of this work is the investigation of new solidification agents which will provide improved immobilization of low-level radioactive wastes in an efficient, cost-effective manner. A working set of preliminary waste form evaluation criteria which could impact upon the movement of radionuclides in the disposal environment was developed. The selection of potential solidification agents for further investigation is described. Two thermoplastic materials, low-density polyethylene and a modified sulfur cement were chosen as primary candidates for further study. Three waste types were selected for solidification process development and waste form property evaluation studies which represent both new volume reduction wastes (dried evaporator concentrates and incinerator ash) and current problem wastes (ion exchange resins). Preliminary process development scoping studies were conducted to verify the compatibility of selected solidification agents and waste types and the potential for improved solidification. Waste loadings of 60 wt % Na/sub 2/SO/sub 4/, 25 wt % H/sub 3/BO/sub 3/, 25 wt % incinerator ash and 50 wt % dry ion exchange resin were achieved using low density polyethylene as a matrix material. Samples incorporating 65 wt % Na/sub 2/SO/sub 4/, 40 wt % H/sub 3/BO/sub 3/, 20 wt % incinerator ash and 40 wt % dry ion exchange resin were successfully solidified in modified sulfur cement. Additional improvements are expected for both matrix materials as process parameters are optimized. Several preliminary property evaluation studies were performed to provide the basis for an initial assessment of waste form acceptability. These included a two-week water immersion test and compressive load testing.

  10. Laboratory directed research and development annual report. Fiscal year 1994

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-02-01

    The Department of Energy Order DOE 5000.4A establishes DOE`s policy and guidelines regarding Laboratory Directed Research and Development (LDRD) at its multiprogram laboratories. This report represents Pacific Northwest Laboratory`s (PNL`s) LDRD report for FY 1994. During FY 1994, 161 LDRD projects were selected for support through PNL`s LDRD project selection process. Total funding allocated to these projects was $13.7 million. Consistent with the Mission Statement and Strategic Plan provided in PNL`s Institutional Plan, the LDRD investments are focused on developing new and innovative approaches in research related to our {open_quotes}core competencies.{close_quotes} Currently, PNL`s core competencies have been identified as integrated environmental research; process science and engineering; energy systems development. In this report, the individual summaries of LDRD projects (presented in Section 1.0) are organized according to these core competencies. The largest proportion of Laboratory-level LDRD funds is allocated to the core competency of integrated environmental research. Projects within the three core competency areas were approximately 91.4 % of total LDRD project funding at PNL in FY 1994. A significant proportion of PNL`s LDRD funds are also allocated to projects within the various research centers that are proposed by individual researchers or small research teams. Funding allocated to each of these projects is typically $35K or less. The projects described in this report represent PNL`s investment in its future and are vital to maintaining the ability to develop creative solutions for the scientific and technical challenges faced by DOE and the nation. The report provides an overview of PNL`s LDRD program, the management process used for the program, and project summaries for each LDRD project.

  11. FY 2016 Site-Directed Research & Development Annual Report

    Energy Technology Data Exchange (ETDEWEB)

    Bender, Howard [National Security Technologies, LLC. (NSTec), Mercury, NV (United States)

    2017-04-01

    As the Nevada National Security Site (NNSS) continues to evolve and transition its mission to a broader scope, significant challenges lie ahead that present unique opportunities for our research and development (R&D) enterprise. At the juncture, we are poised to create a different future investment strategy. Our decisions at the beginning of a new tri-decade span must be guided as expertly as possible given the greater complexity and multifaceted nature of our work.

  12. Laboratory Directed Research and Development FY2001 Annual Report

    Energy Technology Data Exchange (ETDEWEB)

    Al-Ayat, R

    2002-06-20

    Established by Congress in 1991, the Laboratory Directed Research and Development (LDRD) Program provides the Department of Energy (DOE)/National Nuclear Security Administration (NNSA) laboratories, like Lawrence Livermore National Laboratory (LLNL or the Laboratory), with the flexibility to invest up to 6% of their budget in long-term, high-risk, and potentially high payoff research and development (R&D) activities to support the DOE/NNSA's national security missions. By funding innovative R&D, the LDRD Program at LLNL develops and extends the Laboratory's intellectual foundations and maintains its vitality as a premier research institution. As proof of the Program's success, many of the research thrusts that started many years ago under LDRD sponsorship are at the core of today's programs. The LDRD Program, which serves as a proving ground for innovative ideas, is the Laboratory's most important single resource for fostering excellent science and technology for today's needs and tomorrow's challenges. Basic and applied research activities funded by LDRD enhance the Laboratory's core strengths, driving its technical vitality to create new capabilities that enable LLNL to meet DOE/NNSA's national security missions. The Program also plays a key role in building a world-class multidisciplinary workforce by engaging the Laboratory's best researchers, recruiting its future scientists and engineers, and promoting collaborations with all sectors of the larger scientific community.

  13. Laboratory Directed Research and Development Annual Report FY 2016

    Energy Technology Data Exchange (ETDEWEB)

    Sullivan, Kelly O. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

    2017-03-30

    A national laboratory must establish and maintain an environment in which creativity and innovation are encouraged and supported in order to fulfill its missions and remain viable in the long term. As such, multiprogram laboratories are given discretion to allocate a percentage of their operating budgets to support research and development projects that align to PNNL’s and DOE’s missions and support the missions of other federal agencies, including DHS, DOD, and others. DOE Order 413.2C sets forth DOE’s Laboratory Directed Research and Development (LDRD) policy and guidelines for DOE multiprogram laboratories, and it authorizes the national laboratories to allocate up to 6 percent of their operating budgets to fund the program. LDRD is innovative research and development, selected by the Laboratory Director or his/her designee, for the purpose of maintaining the scientific and technological vitality of the Laboratory. The projects supported by LDRD funding all have demonstrable ties to DOE/DHS missions and may also be relevant to the missions of other federal agencies that sponsor work at the Laboratory. The program plays a key role in attracting the best and brightest scientific staff, which is needed to serve the highest priority DOE mission objectives. Individual project reports comprise the bulk of this LDRD report. The Laboratory focuses its LDRD research on scientific assets that often address more than one scientific discipline.

  14. Laboratory-Directed Research and Development 2016 Summary Annual Report

    Energy Technology Data Exchange (ETDEWEB)

    Pillai, Rekha Sukamar [Idaho National Lab. (INL), Idaho Falls, ID (United States); Jacobson, Julie Ann [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2017-01-01

    The Laboratory-Directed Research and Development (LDRD) Program at Idaho National Laboratory (INL) reports its status to the U.S. Department of Energy (DOE) by March of each year. The program operates under the authority of DOE Order 413.2C, “Laboratory Directed Research and Development” (April 19, 2006), which establishes DOE’s requirements for the program while providing the laboratory director broad flexibility for program implementation. LDRD funds are obtained through a charge to all INL programs. This report includes summaries of all INL LDRD research activities supported during Fiscal Year (FY) 2016. INL is the lead laboratory for the DOE Office of Nuclear Energy (DOE-NE). The INL mission is to discover, demonstrate, and secure innovative nuclear energy solutions, other clean energy options, and critical infrastructure with a vision to change the world’s energy future and secure our critical infrastructure. Operating since 1949, INL is the nation’s leading research, development, and demonstration center for nuclear energy, including nuclear nonproliferation and physical and cyber-based protection of energy systems and critical infrastructure, as well as integrated energy systems research, development, demonstration, and deployment. INL has been managed and operated by Battelle Energy Alliance, LLC (a wholly owned company of Battelle) for DOE since 2005. Battelle Energy Alliance, LLC, is a partnership between Battelle, BWX Technologies, Inc., AECOM, the Electric Power Research Institute, the National University Consortium (Massachusetts Institute of Technology, Ohio State University, North Carolina State University, University of New Mexico, and Oregon State University), and the Idaho university collaborators (i.e., University of Idaho, Idaho State University, and Boise State University). Since its creation, INL’s research and development (R&D) portfolio has broadened with targeted programs supporting national missions to advance nuclear energy

  15. Development, characterisation, and across-taxa utility of oil palm (Elaeis guineensis Jacq.) microsatellite markers.

    Science.gov (United States)

    Billotte, N; Risterucci, A M; Barcelos, E; Noyer, J L; Amblard, P; Baurens, F C

    2001-06-01

    The results of the development of oil palm (Elaeis guineensis Jacq.) microsatellite markers are given step by step, from the screening of libraries enriched in (GA)n, (GT)n, and (CCG)n simple-sequence repeats (SSRs) to the final characterisation of 21 SSR loci. Also published are primer sequences, estimates of allele size range, and expected heterozygosity in E. guineensis and in the closely related species E. oleifera, in which an optimal utility of the SSR markers was observed. Multivariate data analyses showed the ability of SSR markers to efficiently reveal the genetic-diversity structure of the genus Elaeis in accordance with known geographical origins and with measured genetic relationships based on previous molecular studies. High levels of allelic variability indicated that E. guineensis SSRs will be a powerful tool for genetic studies of the genus Elaeis, including variety identification and intra- or inter-specific genetic mapping. PCR amplification tests on a subset of 16 other palm species and allele-sequence data showed that E. guineensis SSRs are putative transferable markers across palm taxa. In addition, phenetic information based on SSR flanking region sequences makes E. guineensis SSR markers a potentially useful molecular resource for any researcher studying the phylogeny of palm taxa.

  16. Development of new molecular markers for the Colletotrichum genus using RetroCl1 sequences.

    Science.gov (United States)

    Dos Santos, Leandro Vieira; de Queiroz, Marisa Vieira; Santana, Mateus Ferreira; Soares, Marcos Antônio; de Barros, Everaldo Gonçalves; de Araújo, Elza Fernandes; Langin, Thierry

    2012-03-01

    A nonautonomous element of 624 bp, called RetroCl1 (Retroelement Colletotrichum lindemuthianum 1), was identified in the plant pathogenic fungus Colletotrichum lindemuthianum. RetroCl1 contains terminal direct repeats (223 bp) that are surrounded by CTAGT sequences. It has a short internal domain of 178 bp and shows characteristics of terminal-repeat retrotransposon in miniature (TRIM) family. We used RetroCl1 sequence to develop molecular markers for the Colletotrichum genus. IRAP (Inter-Retrotransposon Amplified Polymorphism) and REMAP (Retrotransposon-Microsatellite Amplified Polymorphism) markers were used to analyze the genetic diversity of C. lindemuthianum. Fifty-four isolates belonging to different races were used. A total of 45 loci were amplified. The Nei index showed significant differences among the populations divided according to race, indicating that they are structured according to pathotype. No clear correlation between IRAP and REMAP markers with pathogenic characterization was found. C. lindemuthianum has high genetic diversity, and the analysis of molecular variance showed that 51% of variability is found among the populations of different races. The markers were also tested in different Colletotrichum species. In every case, multiple bands were amplified, indicating that these markers can be successfully used in different species belonging to the Colletotrichum genus.

  17. Development of retrotransposon-based markers IRAP and REMAP for cassava (Manihot esculenta).

    Science.gov (United States)

    Kuhn, B C; Mangolin, C A; Souto, E R; Vicient, C M; Machado, M F P S

    2016-04-07

    Retrotransposons are abundant in the genomes of plants. In the present study, inter-retrotransposon amplified polymorphism (IRAP) and retrotransposon-microsatellite amplified polymorphism (REMAP) markers were developed for the cassava genome (Manihot esculenta Crantz). Four cassava cultivars (Fécula Branca, IPR-União, Olho Junto, and Tamboara, two samples per cultivar) were used to obtain IRAP and REMAP fingerprints. Twelve designed primers were amplified alone and in combinations. The 42 IRAP/REMAP primer combinations amplified 431 DNA segments (bands; markers) of which 36 (8.36%) were polymorphic. The largest number of informative markers (16) was detected using the primers AYF2 and AYF2xAYF4. The number of bands for each primer varied from 3 to 16, with an average of 10.26 amplified segments per primer. The size of the amplified products ranged between 100 and 7000 bp. The AYF2 primer generated the highest number of amplified segments and showed the highest number of polymorphic bands (68.75%). Two samples of each cassava cultivar were used to illustrate the usefulness and the polymorphism of IRAP/REMAP markers. IRAP and REMAP markers produced a high number of reproducible bands, and might be informative and reliable for investigation of genetic diversity and relationships among cassava cultivars.

  18. [Development of new SSR markers from EST of SSH cDNA libraries on rose fragrance].

    Science.gov (United States)

    Yan, Hui-Jun; Zhang, Hao; Xie, Ji-Rong; Li, Shu-Fa; Jian, Hong-Ying; Qiu, Xian-Qin; Wang, Qi-Gang; Wang, Ji-Hua; Tang, Kai-Xue

    2009-09-01

    The new SSR markers of rose related fragrance were developed based on the SSH cDNA libraries of rose floral scent mutant. In this study, 10 EST-SSRs (2.6%) from 391 ESTs in the libraries were identified. Six EST-SSRs primers were designed to sequence flanking SSRs. The primer pairs designed were screened on the wild-type Jinyindao, which has flowers full of pleasant scent, and the mutant-type Wangriqinghuai without perceivable floral scent. Five primer pairs were amplified effectively in Jinyindao and Wangriqinghuai, and 3 were polymorphic between Jinyindao and Wangriqinghuai. Eighteen rose cultivars including fragrant roses and nonfragrant roses were identified by the five prime pairs. These results proved that EST-SSR markers are effective markers to identify the polymorphism of the rose.

  19. Development of ITS sequence based molecular marker to distinguish, Tribulus terrestris L. (Zygophyllaceae) from its adulterants.

    Science.gov (United States)

    Balasubramani, Subramani Paranthaman; Murugan, Ramar; Ravikumar, Kaliamoorthy; Venkatasubramanian, Padma

    2010-09-01

    Tribulus terrestris L. (Zygophyllaceae) is one of the highly traded raw drugs and also used as a stimulative food additive in Europe and USA. While, Ayurvedic Pharmacopoeia of India recognizes T. terrestris as Goksura, Tribulus lanuginosus and T. subramanyamii are also traded by the same name raising issues of quality control. The nuclear ribosomal RNA genes and ITS (internal transcribed spacer) sequence were used to develop species-specific DNA markers. The species-specific markers efficiently amplified 295bp for T. terrestris (TT1F and TT1R), 300bp for T. lanuginosus (TL1F and TL1R) and 214bp for T. subramanyamii (TS1F and TS1R). These DNA markers can be used to distinguish T. terrestris from its adulterants.

  20. Development of a Ribosomal DNA ITS2 Marker for the Identification of the Thrips, Scirtothrips dorsalis

    Science.gov (United States)

    Farris, R E; Ruiz-Arce, R; Ciomperlik, M; Vasquez, J D; DeLeón, R

    2010-01-01

    The thrips Scirtothrips dorsalis Hood (Thysanoptera: Thripidae) is an invasive pest that poses a significant economical threat to U.S. agriculture and trade. In this study, DNA sequence data and polymerase chain reaction (PCR) were utilized to develop a molecular diagnostic marker for S. dorsalis. The DNA sequence variation from the internal transcribed spacer 2 (ITS2) region of nuclear ribosomal DNA (rDNA) was analyzed from various thrips species, including S. dorsalis. A primer set and polymerase chain reaction cycling parameters were designed for the amplification of a single marker fragment of S. dorsalis ITS2 rDNA. Specificity tests performed on ten thrips species, efficacy tests performed on fifteen S. dorsalis populations, and tests on primer sensitivity and robustness all demonstrated the diagnostic utility of this marker. This diagnostic PCR assay provides a quick, simple, and reliable molecular technique to be used in the identification of S. dorsalis. PMID:20578948

  1. Radioimmunotherapy: Development of an effective approach. Annual report, 1991

    Energy Technology Data Exchange (ETDEWEB)

    DeNardo, S.J.

    1991-12-31

    We plan to extend our success in treating B cell malignancies with {sup 131}I labeled Lym-1 by a major effort in therapy with {sup 67}Cu Lym-1. Yttrium-90 labeled by a macrocycle, DOTA will be studied in patients as a continuation of the {sup 111}In-BAD (DOTA) Lym-1 studies. Excellent images and pharmacokinetics of the {sup 111}In-BAD(DOTA)-Lym-1 studies. Lymphomas and related diseases represent a special case for radioimmunotherapy because of their documented radiosensitivity and immunodeficiency, and thus offer a unique opportunity to conduct therapeutic feasibility studies in a responsive human model. Using marine and chimeric L6 and other MoAb to breast cancer, we have applied the strategies that were developed in taking Lym-1 antibody from the bench to the patient. We have examined a number of monoclonal antibodies for treatment of breast cancer and chose chimeric L6 for prototype studies because of certain characteristics. The chemistry of attachment of conjugates to antibodies and their impact on immunological targeting biological activities (cytotoxicity), metabolic fate, and therapeutic index will continue to be a major strength and function of this program. This grant has supported the conception, synthesis, and development of the first macrocylic, bifunctional chelating agent TETA (6-p-nitrobenzyl-1,4,8,11-tetraazatetradecane-N,N{prime},N{double_prime}, N{prime}{double_prime}-tetraacetic acid and its derivatives, including Lym-1-2IT-BAT), for use in Cu-67-based radioimmunodiagnosis and therapy. This work has led to the further development of several new macrocylic bifunctional chelating agents for copper, indium, yttrium and other metals. In addition, successful Cu-67 labelings of Lym-1-2IT-BAT for human radiopharmaceutical have shown patient pharmacokinetics of {sup 67}Cu-BAT(TETA)-Lym-1 with promising therapeutic dosimetry.

  2. Laboratory Directed Research and Development Program: FY 2015 Annual Report

    Energy Technology Data Exchange (ETDEWEB)

    SLAC,

    2016-04-04

    The Department of Energy (DOE) and the SLAC National Accelerator Laboratory (SLAC) encourage innovation, creativity, originality and quality to maintain the Laboratory’s research activities and staff at the forefront of science and technology. To further advance its scientific research capabilities, the Laboratory allocates a portion of its funds for the Laboratory Directed Research and Development (LDRD) program. With DOE guidance, the LDRD program enables SLAC scientists to make rapid and significant contributions that seed new strategies for solving important national science and technology problems. The LDRD program is conducted using existing research facilities.

  3. 1995 Laboratory-Directed Research and Development Annual report

    Energy Technology Data Exchange (ETDEWEB)

    Cauffman, D.P.; Shoaf, D.L.; Hill, D.A.; Denison, A.B.

    1995-12-31

    The Laboratory-Directed Research and Development Program (LDRD) is a key component of the discretionary research conducted by Lockheed Idaho Technologies Company (Lockheed Idaho) at the Idaho National Engineering Laboratory (INEL). The threefold purpose and goal of the LDRD program is to maintain the scientific and technical vitality of the INEL, respond to and support new technical opportunities, and enhance the agility and flexibility of the national laboratory and Lockheed Idaho to address the current and future missions of the Department of Energy.

  4. Laboratory Directed Research and Development Annual Report - Fiscal Year 2000

    Energy Technology Data Exchange (ETDEWEB)

    Fisher, Darrell R.; Hughes, Pamela J.; Pearson, Erik W.

    2001-04-01

    The projects described in this report represent the Laboratory's investment in its future and are vital to maintaining the ability to develop creative solutions for the scientific and technical challenges faced by DOE and the nation. In accordance with DOE guidelines, the report provides, a) a director's statement, b) an overview of the laboratory's LDRD program, including PNNL's management process and a self-assessment of the program, c) a five-year project funding table, and d) project summaries for each LDRD project.

  5. Laboratory directed research and development annual report 2004.

    Energy Technology Data Exchange (ETDEWEB)

    2005-03-01

    This report summarizes progress from the Laboratory Directed Research and Development (LDRD) program during fiscal year 2004. In addition to a programmatic and financial overview, the report includes progress reports from 352 individual R and D projects in 15 categories. The 15 categories are: (1) Advanced Concepts; (2) Advanced Manufacturing; (3) Biotechnology; (4) Chemical and Earth Sciences; (5) Computational and Information Sciences; (6) Differentiating Technologies; (7) Electronics and Photonics; (8) Emerging Threats; (9) Energy and Critical Infrastructures; (10) Engineering Sciences; (11) Grand Challenges; (12) Materials Science and Technology; (13) Nonproliferation and Materials Control; (14) Pulsed Power and High Energy Density Sciences; and (15) Corporate Objectives.

  6. 1996 Laboratory directed research and development annual report

    Energy Technology Data Exchange (ETDEWEB)

    Meyers, C.E.; Harvey, C.L.; Lopez-Andreas, L.M.; Chavez, D.L.; Whiddon, C.P. [comp.

    1997-04-01

    This report summarizes progress from the Laboratory Directed Research and Development (LDRD) program during fiscal year 1996. In addition to a programmatic and financial overview, the report includes progress reports from 259 individual R&D projects in seventeen categories. The general areas of research include: engineered processes and materials; computational and information sciences; microelectronics and photonics; engineering sciences; pulsed power; advanced manufacturing technologies; biomedical engineering; energy and environmental science and technology; advanced information technologies; counterproliferation; advanced transportation; national security technology; electronics technologies; idea exploration and exploitation; production; and science at the interfaces - engineering with atoms.

  7. 1997 Laboratory directed research and development. Annual report

    Energy Technology Data Exchange (ETDEWEB)

    Meyers, C.E.; Harvey, C.L.; Chavez, D.L.; Whiddon, C.P. [comps.

    1997-12-31

    This report summarizes progress from the Laboratory Directed Research and Development (LDRD) program during fiscal year 1997. In addition to a programmatic and financial overview, the report includes progress reports from 218 individual R&D projects in eleven categories. Theses reports are grouped into the following areas: materials science and technology; computer sciences; electronics and photonics; phenomenological modeling and engineering simulation; manufacturing science and technology; life-cycle systems engineering; information systems; precision sensing and analysis; environmental sciences; risk and reliability; national grand challenges; focused technologies; and reserve.

  8. Laboratory Directed Research and Development FY-15 Annual Report

    Energy Technology Data Exchange (ETDEWEB)

    Pillai, Rekha Sukamar [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2016-03-01

    The Laboratory Directed Research and Development (LDRD) Program at Idaho National Laboratory (INL) reports its status to the U.S. Department of Energy (DOE) by March of each year. The program operates under the authority of DOE Order 413.2B, “Laboratory Directed Research and Development” (April 19, 2006), which establishes DOE’s requirements for the program while providing the laboratory director broad flexibility for program implementation. LDRD funds are obtained through a charge to all INL programs. This report includes summaries of all INL LDRD research activities supported during Fiscal Year (FY) 2015.

  9. A blackberry (Rubus L. expressed sequence tag library for the development of simple sequence repeat markers

    Directory of Open Access Journals (Sweden)

    Main Dorrie S

    2008-06-01

    Full Text Available Abstract Background The recent development of novel repeat-fruiting types of blackberry (Rubus L. cultivars, combined with a long history of morphological marker-assisted selection for thornlessness by blackberry breeders, has given rise to increased interest in using molecular markers to facilitate blackberry breeding. Yet no genetic maps, molecular markers, or even sequences exist specifically for cultivated blackberry. The purpose of this study is to begin development of these tools by generating and annotating the first blackberry expressed sequence tag (EST library, designing primers from the ESTs to amplify regions containing simple sequence repeats (SSR, and testing the usefulness of a subset of the EST-SSRs with two blackberry cultivars. Results A cDNA library of 18,432 clones was generated from expanding leaf tissue of the cultivar Merton Thornless, a progenitor of many thornless commercial cultivars. Among the most abundantly expressed of the 3,000 genes annotated were those involved with energy, cell structure, and defense. From individual sequences containing SSRs, 673 primer pairs were designed. Of a randomly chosen set of 33 primer pairs tested with two blackberry cultivars, 10 detected an average of 1.9 polymorphic PCR products. Conclusion This rate predicts that this library may yield as many as 940 SSR primer pairs detecting 1,786 polymorphisms. This may be sufficient to generate a genetic map that can be used to associate molecular markers with phenotypic traits, making possible molecular marker-assisted breeding to compliment existing morphological marker-assisted breeding in blackberry.

  10. MARKER ASSISTED SELECTION (MAS FOR DEVELOPMENT OF BARLEY AND WHEAT LINES WITH REQUESTED TRAITS

    Directory of Open Access Journals (Sweden)

    M. Hudcovicová

    2008-09-01

    Full Text Available Molecular markers closely linked to interesting genes enable early, proper and fast detection of plant individuals with desired allele during backcross breeding, what can make plant breeding faster and cheaper. We are focused on molecular breeding of barley and wheat lines for disease resistance and some important quality traits. As acceptors of interesting genes we use especially elite Slovak and Czech cultivars and lines. After five backcross generations with the help of MAS new created lines carrying markers linked to desired genes undergo resistance, agronomic and technological tests. In breeding of winter barley for resistance to BaYMV/BaMMV viruses we use codominant STS and SSR markers linked to rym4 and rym11 resistance genes. Cultivar Romanze has been used as a donor of rym4 gene and landrace Russia57 as gene rym11 donor. In spring barley we are focused on transfer of Yd2 gene from landraces Shannon and Sutter resistant to BYDV by use of dominant ASPCR marker. We are also working on transfer of effective leaf rust resistance genes Lr19, Lr24 derived from Thinopyrum ponticum and gene Lr35 from Aegilops speltoides into hexaploid wheat by use of dominant STS and SCAR markers. Near isogenic lines with these genes are used in gene pyramiding to develop a single line with all three genes. By use of protein markers we develop near isogenic wheat lines for higher sedimentation values, higher dough strength and better breadmaking quality. These are lines with new combination of HMW glutenin subunits (21*, 7+8, 5+10 as well as wheat lines with new unknown HMW-GS and with new HMW-GS pair.

  11. Laboratory Directed Research and Development Program. Annual report

    Energy Technology Data Exchange (ETDEWEB)

    Ogeka, G.J.; Romano, A.J.

    1992-12-01

    This report briefly discusses the following research: Advances in Geoexploration; Transvenous Coronary Angiography with Synchrotron X-Rays; Borehole Measurements of Global Warming; Molecular Ecology: Development of Field Methods for Microbial Growth Rate and Activity Measurements; A New Malaria Enzyme - A Potential Source for a New Diagnostic Test for Malaria and a Target for a New Antimalarial Drug; Basic Studies on Thoron and Thoron Precursors; Cloning of the cDNA for a Human Serine/Threonine Protein Kinase that is Activated Specifically by Double-Stranded DNA; Development of an Ultra-Fast Laser System for Accelerator Applications; Cluster Impact Fusion; Effect of a Bacterial Spore Protein on Mutagenesis; Structure and Function of Adenovirus Penton Base Protein; High Resolution Fast X-Ray Detector; Coherent Synchrotron Radiation Longitudinal Bunch Shape Monitor; High Grain Harmonic Generation Experiment; BNL Maglev Studies; Structural Investigations of Pt-Based Catalysts; Studies on the Cellular Toxicity of Cocaine and Cocaethylene; Human Melanocyte Transformation; Exploratory Applications of X-Ray Microscopy; Determination of the Higher Ordered Structure of Eukaryotic Chromosomes; Uranium Neutron Capture Therapy; Tunneling Microscopy Studies of Nanoscale Structures; Nuclear Techiques for Study of Biological Channels; RF Sources for Accelerator Physics; Induction and Repair of Double-Strand Breaks in the DNA of Human Lymphocytes; and An EBIS Source of High Charge State Ions up to Uranium.

  12. Development of simple sequence repeat (SSR) markers of sesame (Sesamum indicum) from a genome survey.

    Science.gov (United States)

    Wei, Xin; Wang, Linhai; Zhang, Yanxin; Qi, Xiaoqiong; Wang, Xiaoling; Ding, Xia; Zhang, Jing; Zhang, Xiurong

    2014-04-22

    Sesame (Sesamum indicum), an important oil crop, is widely grown in tropical and subtropical regions. It provides part of the daily edible oil allowance for almost half of the world's population. A limited number of co-dominant markers has been developed and applied in sesame genetic diversity and germplasm identity studies. Here we report for the first time a whole genome survey used to develop simple sequence repeat (SSR) markers and to detect the genetic diversity of sesame germplasm. From the initial assembled sesame genome, 23,438 SSRs (≥5 repeats) were identified. The most common repeat motif was dinucleotide with a frequency of 84.24%, followed by 13.53% trinucleotide, 1.65% tetranucleotide, 0.3% pentanucleotide and 0.28% hexanucleotide motifs. From 1500 designed and synthesised primer pairs, 218 polymorphic SSRs were developed and used to screen 31 sesame accessions that from 12 countries. STRUCTURE and phylogenetic analyses indicated that all sesame accessions could be divided into two groups: one mainly from China and another from other countries. Cluster analysis classified Chinese major sesame varieties into three groups. These novel SSR markers are a useful tool for genetic linkage map construction, genetic diversity detection, and marker-assisted selective sesame breeding.

  13. Laboratory Directed Research and Development Program FY 2005 Annual Report

    Energy Technology Data Exchange (ETDEWEB)

    Sjoreen, Terrence P [ORNL

    2006-04-01

    The Oak Ridge National Laboratory (ORNL) Laboratory Directed Research and Development (LDRD) Program reports its status to the U.S. Department of Energy (DOE) in March of each year. The program operates under the authority of DOE Order 413.2A, 'Laboratory Directed Research and Development' (January 8, 2001), which establishes DOE's requirements for the program while providing the Laboratory Director broad flexibility for program implementation. LDRD funds are obtained through a charge to all Laboratory programs. This report describes all ORNL LDRD research activities supported during FY 2005 and includes final reports for completed projects and shorter progress reports for projects that were active, but not completed, during this period. The FY 2005 ORNL LDRD Self-Assessment (ORNL/PPA-2006/2) provides financial data about the FY 2005 projects and an internal evaluation of the program's management process. ORNL is a DOE multiprogram science, technology, and energy laboratory with distinctive capabilities in materials science and engineering, neutron science and technology, energy production and end-use technologies, biological and environmental science, and scientific computing. With these capabilities ORNL conducts basic and applied research and development (R&D) to support DOE's overarching national security mission, which encompasses science, energy resources, environmental quality, and national nuclear security. As a national resource, the Laboratory also applies its capabilities and skills to the specific needs of other federal agencies and customers through the DOE Work For Others (WFO) program. Information about the Laboratory and its programs is available on the Internet at . LDRD is a relatively small but vital DOE program that allows ORNL, as well as other multiprogram DOE laboratories, to select a limited number of R&D projects for the purpose of: (1) maintaining the scientific and technical vitality of the

  14. Laboratory Directed Research and Development Program FY 2004 Annual Report

    Energy Technology Data Exchange (ETDEWEB)

    Sjoreen, Terrence P [ORNL

    2005-04-01

    The Oak Ridge National Laboratory (ORNL) Laboratory Directed Research and Development (LDRD) Program reports its status to the U.S. Department of Energy (DOE) in March of each year. The program operates under the authority of DOE Order 413.2A, 'Laboratory Directed Research and Development' (January 8, 2001), which establishes DOE's requirements for the program while providing the Laboratory Director broad flexibility for program implementation. LDRD funds are obtained through a charge to all Laboratory programs. This report describes all ORNL LDRD research activities supported during FY 2004 and includes final reports for completed projects and shorter progress reports for projects that were active, but not completed, during this period. The FY 2004 ORNL LDRD Self-Assessment (ORNL/PPA-2005/2) provides financial data about the FY 2004 projects and an internal evaluation of the program's management process. ORNL is a DOE multiprogram science, technology, and energy laboratory with distinctive capabilities in materials science and engineering, neutron science and technology, energy production and end-use technologies, biological and environmental science, and scientific computing. With these capabilities ORNL conducts basic and applied research and development (R&D) to support DOE's overarching national security mission, which encompasses science, energy resources, environmental quality, and national nuclear security. As a national resource, the Laboratory also applies its capabilities and skills to the specific needs of other federal agencies and customers through the DOE Work For Others (WFO) program. Information about the Laboratory and its programs is available on the Internet at . LDRD is a relatively small but vital DOE program that allows ORNL, as well as other multiprogram DOE laboratories, to select a limited number of R&D projects for the purpose of: (1) maintaining the scientific and technical vitality of the

  15. Laboratory Directed Research and Development Program FY 2007 Annual Report

    Energy Technology Data Exchange (ETDEWEB)

    Sjoreen, Terrence P [ORNL

    2008-04-01

    The Oak Ridge National Laboratory (ORNL) Laboratory Directed Research and Development (LDRD) program reports its status to the U.S. Department of Energy (DOE) in March of each year. The program operates under the authority of DOE Order 413.2B, 'Laboratory Directed Research and Development' (April 19, 2006), which establishes DOE's requirements for the program while providing the Laboratory Director broad flexibility for program implementation. LDRD funds are obtained through a charge to all Laboratory programs. This report includes summaries for all ORNL LDRD research activities supported during FY 2007. The associated FY 2007 ORNL LDRD Self-Assessment (ORNL/PPA-2008/2) provides financial data and an internal evaluation of the program's management process. ORNL is a DOE multiprogram science, technology, and energy laboratory with distinctive capabilities in materials science and engineering, neutron science and technology, energy production and end-use technologies, biological and environmental science, and scientific computing. With these capabilities ORNL conducts basic and applied research and development (R&D) to support DOE's overarching mission to advance the national, economic, and energy security of the United States and promote scientific and technological innovation in support of that mission. As a national resource, the Laboratory also applies its capabilities and skills to specific needs of other federal agencies and customers through the DOE Work for Others (WFO) program. Information about the Laboratory and its programs is available on the Internet at http://www.ornl.gov/. LDRD is a relatively small but vital DOE program that allows ORNL, as well as other DOE laboratories, to select a limited number of R&D projects for the purpose of: (1) maintaining the scientific and technical vitality of the Laboratory; (2) enhancing the Laboratory's ability to address future DOE missions; (3) fostering creativity and stimulating

  16. SMD Technology Development Story for NASA Annual Technology report

    Science.gov (United States)

    Seablom, Michael S.

    2017-01-01

    The role of the Science Mission Directorate (SMD) is to enable NASA to achieve its science goals in the context of the Nation's science agenda. SMD's strategic decisions regarding future missions and scientific pursuits are guided by Agency goals, input from the science community-including the recommendations set forth in the National Research Council (NRC) decadal surveys-and a commitment to preserve a balanced program across the major science disciplines. Toward this end, each of the four SMD science divisions-Heliophysics, Earth Science, Planetary Science, and Astrophysics-develops fundamental science questions upon which to base future research and mission programs. Often the breakthrough science required to answer these questions requires significant technological innovation-e.g., instruments or platforms with capabilities beyond the current state of the art. SMD's targeted technology investments fill technology gaps, enabling NASA to build the challenging and complex missions that accomplish groundbreaking science.

  17. Laboratory directed research and development annual report 2003.

    Energy Technology Data Exchange (ETDEWEB)

    2004-03-01

    Science historian James Burke is well known for his stories about how technological innovations are intertwined and embedded in the culture of the time, for example, how the steam engine led to safety matches, imitation diamonds, and the landing on the moon.1 A lesson commonly drawn from his stories is that the path of science and technology (S&T) is nonlinear and unpredictable. Viewed another way, the lesson is that the solution to one problem can lead to solutions to other problems that are not obviously linked in advance, i.e., there is a ripple effect. The motto for Sandia's approach to research and development (R&D) is 'Science with the mission in mind.' In our view, our missions contain the problems that inspire our R&D, and the resulting solutions almost always have multiple benefits. As discussed below, Sandia's Laboratory Directed Research and Development (LDRD) Program is structured to bring problems relevant to our missions to the attention of researchers. LDRD projects are then selected on the basis of their programmatic merit as well as their technical merit. Considerable effort is made to communicate between investment areas to create the ripple effect. In recent years, attention to the ripple effect and to the performance of the LDRD Program, in general, has increased. Inside Sandia, as it is the sole source of discretionary research funding, LDRD funding is recognized as being the most precious of research dollars. Hence, there is great interest in maximizing its impact, especially through the ripple effect. Outside Sandia, there is increased scrutiny of the program's performance to be sure that it is not a 'sandbox' in which researchers play without relevance to national security needs. Let us therefore address the performance of the LDRD Program in fiscal year 2003 and then show how it is designed to maximize impact.

  18. Problems of genetic diagnosis: serological markers in the prognosis of the development of human speed abilities

    Directory of Open Access Journals (Sweden)

    Serhiyenko Leonid Prokopovich

    2011-10-01

    Full Text Available The article deals with the study of correlation between blood groups system AB0 and Rh with the peculiarities of the development of human speed abilities. Complex of genetic markers is defined. It is possible to use this complex in the individual prognosis of the development of human motor abilities. With 0(I and A(II blood groups and Rh+ have a high inclination to the physical development. Better identify trends in the phenotypic expression of high-speed abilities in people with 0(I and A(II blood groups in comparison with people with the AB(IV and B(III blood group. The pattern of decreasing susceptibility to the development of high-speed abilities as follows: 0(I>A(II>B(III>AB (IV. It is established that a complex system of genetic markers AB0 and Rh blood has no gender differences.

  19. Site-Directed Research and Development FY 2012 Annual Report

    Energy Technology Data Exchange (ETDEWEB)

    ,

    2013-04-01

    The reports included in this report are for project activities that occurred from October 2011 through September 2012. These reports describe in detail the discoveries, achievements, and challenges encountered by our talented and enthusiastic principal investigators (PIs). Many of the reports describe R&D efforts that were “successful” in their pursuits and resulted in a positive outcome or technology realization. As we’ve stated before, and continue to stress, in some cases the result is a “negative” finding, for instance a technology is currently impractical or out of reach. This can often be viewed erroneously as a “failure,” but is actually a valid outcome in the pursuit of high-risk research, which often leads to unforeseen new paths of discovery. Either result advances our knowledge and increases our ability to identify solutions and/or likewise avoid costly paths not appropriate for the challenges presented. The SDRD program continues to provide an unfettered mechanism for innovation and development that returns multifold to the NNSS mission. Overall the program is a strong R&D innovation engine, benefited by an enhanced mission, committed resources, and sound competitiveness to yield maximum benefit. The 23 projects described exemplify the creativity and ability of a diverse scientific and engineering talent base. The efforts also showcase an impressive capability and resource that can be brought to find solutions to a broad array of technology needs and applications relevant to the NNSS mission and national security.

  20. Development of microsatellite markers by transcriptome sequencing in two species of Amorphophallus (Araceae).

    Science.gov (United States)

    Zheng, Xingfei; Pan, Cheng; Diao, Ying; You, Yongning; Yang, Chaozhu; Hu, Zhongli

    2013-07-19

    Amorphophallus is a genus of perennial plants widely distributed in the tropics or subtropics of West Africa and South Asia. Its corms contain a high level of water-soluble glucomannan; therefore, it has long been used as a medicinal herb and food source. Genetic studies of Amorphophallus have been hindered by a lack of genetic markers. A large number of molecular markers are required for genetic diversity study and improving disease resistance in Amorphophallus. Here, we report large scale of transcriptome sequencing of two species: Amorphophallus konjac and Amorphophallus bulbifer using deep sequencing technology, and microsatellite (SSR) markers were identified based on these transcriptome sequences. cDNAs of A. konjac and A. bulbifer were sequenced using Illumina HiSeq™ 2000 sequencing technology. A total of 135,822 non-redundant unigenes were assembled from about 9.66 gigabases, and 19,596 SSRs were identified in 16,027 non-redundant unigenes. Di-nucleotide SSRs were the most abundant motif (61.6%), followed by tri- (30.3%), tetra- (5.6%), penta- (1.5%), and hexa-nucleotides (1%) repeats. The top di- and tri-nucleotide repeat motifs included AG/CT (45.2%) and AGG/CCT (7.1%), respectively. A total of 10,754 primer pairs were designed for marker development. Of these, 320 primers were synthesized and used for validation of amplification and assessment of polymorphisms in 25 individual plants. The total of 275 primer pairs yielded PCR amplification products, of which 205 were polymorphic. The number of alleles ranged from 2 to 14 and the polymorphism information content valued ranged from 0.10 to 0.90. Genetic diversity analysis was done using 177 highly polymorphic SSR markers. A phenogram based on Jaccard's similarity coefficients was constructed, which showed a distinct cluster of 25 Amorphophallus individuals. A total of 10,754 SSR markers have been identified in Amorphophallus using transcriptome sequencing. One hundred and seventy-seven polymorphic

  1. ESAP plus: a web-based server for EST-SSR marker development.

    Science.gov (United States)

    Ponyared, Piyarat; Ponsawat, Jiradej; Tongsima, Sissades; Seresangtakul, Pusadee; Akkasaeng, Chutipong; Tantisuwichwong, Nathpapat

    2016-12-22

    Simple sequence repeats (SSRs) have become widely used as molecular markers in plant genetic studies due to their abundance, high allelic variation at each locus and simplicity to analyze using conventional PCR amplification. To study plants with unknown genome sequence, SSR markers from Expressed Sequence Tags (ESTs), which can be obtained from the plant mRNA (converted to cDNA), must be utilized. With the advent of high-throughput sequencing technology, huge EST sequence data have been generated and are now accessible from many public databases. However, SSR marker identification from a large in-house or public EST collection requires a computational pipeline that makes use of several standard bioinformatic tools to design high quality EST-SSR primers. Some of these computational tools are not users friendly and must be tightly integrated with reference genomic databases. A web-based bioinformatic pipeline, called EST Analysis Pipeline Plus (ESAP Plus), was constructed for assisting researchers to develop SSR markers from a large EST collection. ESAP Plus incorporates several bioinformatic scripts and some useful standard software tools necessary for the four main procedures of EST-SSR marker development, namely 1) pre-processing, 2) clustering and assembly, 3) SSR mining and 4) SSR primer design. The proposed pipeline also provides two alternative steps for reducing EST redundancy and identifying SSR loci. Using public sugarcane ESTs, ESAP Plus automatically executed the aforementioned computational pipeline via a simple web user interface, which was implemented using standard PHP, HTML, CSS and Java scripts. With ESAP Plus, users can upload raw EST data and choose various filtering options and parameters to analyze each of the four main procedures through this web interface. All input EST data and their predicted SSR results will be stored in the ESAP Plus MySQL database. Users will be notified via e-mail when the automatic process is completed and they can

  2. Laboratory Directed Research and Development FY2011 Annual Report

    Energy Technology Data Exchange (ETDEWEB)

    Craig, W; Sketchley, J; Kotta, P

    2012-03-22

    A premier applied-science laboratory, Lawrence Livermore National Laboratory (LLNL) has earned the reputation as a leader in providing science and technology solutions to the most pressing national and global security problems. The LDRD Program, established by Congress at all DOE national laboratories in 1991, is LLNL's most important single resource for fostering excellent science and technology for today's needs and tomorrow's challenges. The LDRD internally directed research and development funding at LLNL enables high-risk, potentially high-payoff projects at the forefront of science and technology. The LDRD Program at Livermore serves to: (1) Support the Laboratory's missions, strategic plan, and foundational science; (2) Maintain the Laboratory's science and technology vitality; (3) Promote recruiting and retention; (4) Pursue collaborations; (5) Generate intellectual property; and (6) Strengthen the U.S. economy. Myriad LDRD projects over the years have made important contributions to every facet of the Laboratory's mission and strategic plan, including its commitment to nuclear, global, and energy and environmental security, as well as cutting-edge science and technology and engineering in high-energy-density matter, high-performance computing and simulation, materials and chemistry at the extremes, information systems, measurements and experimental science, and energy manipulation. A summary of each project was submitted by the principal investigator. Project summaries include the scope, motivation, goals, relevance to DOE/NNSA and LLNL mission areas, the technical progress achieved in FY11, and a list of publications that resulted from the research. The projects are: (1) Nuclear Threat Reduction; (2) Biosecurity; (3) High-Performance Computing and Simulation; (4) Intelligence; (5) Cybersecurity; (6) Energy Security; (7) Carbon Capture; (8) Material Properties, Theory, and Design; (9) Radiochemistry; (10) High

  3. Development of universal genetic markers based on single-copy orthologous (COSII) genes in Poaceae.

    Science.gov (United States)

    Liu, Hailan; Guo, Xiaoqin; Wu, Jiasheng; Chen, Guo-Bo; Ying, Yeqing

    2013-03-01

    KEY MESSAGE : We develop a set of universal genetic markers based on single-copy orthologous (COSII) genes in Poaceae. Being evolutionary conserved, single-copy orthologous (COSII) genes are particularly useful in comparative mapping and phylogenetic investigation among species. In this study, we identified 2,684 COSII genes based on five sequenced Poaceae genomes including rice, maize, sorghum, foxtail millet, and brachypodium, and then developed 1,072 COSII markers whose transferability and polymorphism among five bamboo species were further evaluated with 46 pairs of randomly selected primers. 91.3 % of the 46 primers obtained clear amplification in at least one bamboo species, and 65.2 % of them produced polymorphism in more than one species. We also used 42 of them to construct the phylogeny for the five bamboo species, and it might reflect more precise evolutionary relationship than the one based on the vegetative morphology. The results indicated a promising prospect of applying these markers to the investigation of genetic diversity and the classification of Poaceae. To ease and facilitate access of the information of common interest to readers, a web-based database of the COSII markers is provided ( http://www.sicau.edu.cn/web/yms/PCOSWeb/PCOS.html ).

  4. Development of simple sequence repeats (SSR) markers of ramie and comparison of SSR and inter-SSR marker systems

    Institute of Scientific and Technical Information of China (English)

    ZHOU Jianlin; JIE Yucheng; JIANG Yanbo; ZHONG Yingli; LIU Yunhai; ZHANG Jian

    2005-01-01

    Ramie (Boehmeria nivea L. ) is an important bast fiber crop. To study genetic background of this species, we isolated and characterized microsatellite markers of ramie. A genomic library containing inserts of rapid amplification of polymorphic DNA (RAPD)fragments was constructed, and screened by PCR amplification using anchored simple sequence repeats as primers. A total of 26 clones were identified as positives, and 13 microsatellite loci were found after sequencing. The polymorphism of these 13 microsatellite loci was examined and the utility of simple sequence repeats (SSR) and inter-SSR (ISSR) marker systems for genetic characterization compared using 19 selected ramie cultivars. Both approaches successfully discriminated the 19 cultivars which differed in the amount of polymorphism detected. The level of polymorphism detected by SSR was 95.0 %, higher than that by ISSR (72.3 % ), but the average polymorphism information content (PIC) of ISSR (0. 651) was higher than that of SSR (0. 441). The higher PIC value of ISSR suggests that ISSR is more efficient for fingerprinting ramie cultivars than SSR markers. However, because the SSR loci are codominant, they are more suitable for determining the homozygosity levels of ramie, constructing linkage map, quantitative trait loci study of complex traits and marker-as-sisted selection.

  5. FY2011 Annual Progress Report for Advanced Combustion Engine Research and Development

    Energy Technology Data Exchange (ETDEWEB)

    none,

    2011-12-01

    Annual Progress Report for the Advanced Combustion Engine Research and Development (R&D) subprogram supporting the mission of the Vehicle Technologies Program by removing the critical technical barriers to commercialization of advanced internal combustion engines (ICEs) for passenger and commercial vehicles that meet future federal emissions regulations.

  6. Single-copy, species-transferable microsatellite markers developed from loblolly pine ESTs.

    Science.gov (United States)

    Liewlaksaneeyanawin, Cherdsak; Ritland, Carol E; El-Kassaby, Yousry A; Ritland, Kermit

    2004-07-01

    Microsatellites, or simple sequence repeats (SSRs), are usually regarded as the "markers of choice" in population genetics research because they exhibit high variability. The development cost of these markers is usually high. In addition, microsatellite primers developed for one species often do not cross-amplify in related species, requiring separate development for each species. However, microsatellites found in expressed sequence tags (ESTs) might better cross-amplify as they reside in or near conserved coding DNA. In this study, we identified 14 Pinus taeda (loblolly pine) EST-SSRs from public EST databases and tested for their cross-species transferability to P. contorta ssp. latifolia, P. ponderosa, and P. sylvestris. As part of our development of a P. contorta microsatellite set, we also compared their transferability to that of 99 traditional microsatellite markers developed in P. taeda and tested on P. contorta ssp. latifolia. Compared to traditional microsatellites, EST-SSRs had higher transfer rates across pine species; however, the level of polymorphism of microsatellites derived from ESTs was lower. Sequence analyses revealed that the frequencies of insertions/deletions and base substitutions were lower in EST-SSRs than in other types of microsatellites, confirming that EST-SSRs are more conserved than traditional SSRs. Our results also provide a battery of 23 polymorphic, robust microsatellite primer pairs for lodgepole pine.

  7. Development and validation of genic-SSR markers in sesame by RNA-seq.

    Science.gov (United States)

    Zhang, Haiyang; Wei, Libin; Miao, Hongmei; Zhang, Tide; Wang, Cuiying

    2012-07-16

    genic-SSRs could be integrated into 9 main linkage groups. 2,164 genic-SSR markers have been developed in sesame using transcriptome sequencing. 276 of 300 validated primer pairs successfully yielded PCR amplicons in 24 cultivated sesame accessions. These markers increase current SSR marker resources and will greatly benefit genetic diversity, qualitative and quantitative trait mapping and marker-assisted selection studies in sesame.

  8. Comparative analyses of fungicide sensitivity and SSR marker variations indicate a low risk of developing azoxystrobin resistance in Phytophthora infestans.

    Science.gov (United States)

    Qin, Chun-Fang; He, Meng-Han; Chen, Feng-Ping; Zhu, Wen; Yang, Li-Na; Wu, E-Jiao; Guo, Zheng-Liang; Shang, Li-Ping; Zhan, Jiasui

    2016-02-08

    Knowledge of the evolution of fungicide resistance is important in securing sustainable disease management in agricultural systems. In this study, we analyzed and compared the spatial distribution of genetic variation in azoxystrobin sensitivity and SSR markers in 140 Phytophthora infestans isolates sampled from seven geographic locations in China. Sensitivity to azoxystrobin and its genetic variation in the pathogen populations was measured by the relative growth rate (RGR) at four fungicide concentrations and determination of the effective concentration for 50% inhibition (EC50). We found that all isolates in the current study were sensitive to azoxystrobin and their EC50 was similar to that detected from a European population about 20 years ago, suggesting the risk of developing azoxystrobin resistance in P. infestans populations is low. Further analyses indicate that reduced genetic variation and high fitness cost in resistant mutations are the likely causes for the low evolutionary likelihood of developing azoxystrobin resistance in the pathogen. We also found a negative correlation between azoxystrobin tolerance in P. infestans populations and the mean annual temperature of collection sites, suggesting that global warming may increase the efficiency of using the fungicide to control the late blight.

  9. GMATA: an integrated software package for genome-scale SSR mining, marker development and viewing

    Directory of Open Access Journals (Sweden)

    Xuewen Wang

    2016-09-01

    Full Text Available Simple sequence repeats (SSRs, also referred to as microsatellites, are highly variable tandem DNAs that are widely used as genetic markers. The increasing availability of whole-genome and transcript sequences provides information resources for SSR marker development. However, efficient software is required to efficiently identify and display SSR information along with other gene features at a genome scale. We developed novel software package Genome-wide Microsatellite Analyzing Tool Package (GMATA integrating SSR mining, statistical analysis and plotting, marker design, polymorphism screening and marker transferability, and enabled simultaneously display SSR markers with other genome features. GMATA applies novel strategies for SSR analysis and primer design in large genomes, which allows GMATA to perform faster calculation and provides more accurate results than existing tools. Our package is also capable of processing DNA sequences of any size on a standard computer. GMATA is user friendly, only requires mouse clicks or types inputs on the command line, and is executable in multiple computing platforms. We demonstrated the application of GMATA in plants genomes and reveal a novel distribution pattern of SSRs in 15 grass genomes. The most abundant motifs are dimer GA/TC, the A/T monomer and the GCG/CGC trimer, rather than the rich G/C content in DNA sequence. We also revealed that SSR count is a linear to the chromosome length in fully assembled grass genomes. GMATA represents a powerful application tool that facilitates genomic sequence analyses. GAMTA is freely available at http://sourceforge.net/projects/gmata/?source=navbar.

  10. GMATA: An Integrated Software Package for Genome-Scale SSR Mining, Marker Development and Viewing

    Science.gov (United States)

    Wang, Xuewen; Wang, Le

    2016-01-01

    Simple sequence repeats (SSRs), also referred to as microsatellites, are highly variable tandem DNAs that are widely used as genetic markers. The increasing availability of whole-genome and transcript sequences provides information resources for SSR marker development. However, efficient software is required to efficiently identify and display SSR information along with other gene features at a genome scale. We developed novel software package Genome-wide Microsatellite Analyzing Tool Package (GMATA) integrating SSR mining, statistical analysis and plotting, marker design, polymorphism screening and marker transferability, and enabled simultaneously display SSR markers with other genome features. GMATA applies novel strategies for SSR analysis and primer design in large genomes, which allows GMATA to perform faster calculation and provides more accurate results than existing tools. Our package is also capable of processing DNA sequences of any size on a standard computer. GMATA is user friendly, only requires mouse clicks or types inputs on the command line, and is executable in multiple computing platforms. We demonstrated the application of GMATA in plants genomes and reveal a novel distribution pattern of SSRs in 15 grass genomes. The most abundant motifs are dimer GA/TC, the A/T monomer and the GCG/CGC trimer, rather than the rich G/C content in DNA sequence. We also revealed that SSR count is a linear to the chromosome length in fully assembled grass genomes. GMATA represents a powerful application tool that facilitates genomic sequence analyses. GAMTA is freely available at http://sourceforge.net/projects/gmata/?source=navbar. PMID:27679641

  11. Development of Gene-Based SSR Markers in Rice Bean (Vigna umbellata L. Based on Transcriptome Data.

    Directory of Open Access Journals (Sweden)

    Honglin Chen

    Full Text Available Rice bean (Vigna umbellata (Thunb. Ohwi & Ohashi is a warm season annual legume mainly grown in East Asia. Only scarce genomic resources are currently available for this legume crop species and no simple sequence repeat (SSR markers have been specifically developed for rice bean yet. In this study, approximately 26 million high quality cDNA sequence reads were obtained from rice bean using Illumina paired-end sequencing technology and assembled into 71,929 unigenes with an average length of 986 bp. Of these unigenes, 38,840 (33.2% showed significant similarity to proteins in the NCBI non-redundant protein and nucleotide sequence databases. Furthermore, 30,170 (76.3% could be classified into gene ontology categories, 25,451 (64.4% into Swiss-Prot categories and 21,982 (55.6% into KOG database categories (E-value < 1.0E-5. A total of 9,301 (23.5% were mapped onto 118 pathways using the Kyoto Encyclopedia of Genes and Genome (KEGG pathway database. A total of 3,011 genic SSRs were identified as potential molecular markers. AG/CT (30.3%, AAG/CTT (8.1% and AGAA/TTCT (20.0% are the three main repeat motifs. A total of 300 SSR loci were randomly selected for validation by using PCR amplification. Of these loci, 23 primer pairs were polymorphic among 32 rice bean accessions. A UPGMA dendrogram revealed three major clusters among 32 rice bean accessions. The large number of SSR-containing sequences and genic SSRs in this study will be valuable for the construction of high-resolution genetic linkage maps, association or comparative mapping and genetic analyses of various Vigna species.

  12. Microsatellite markers developed for Corallodiscus lanuginosus (Gesneriaceae) and their cross-species transferability.

    Science.gov (United States)

    Gao, Lian-Ming; Zhang, Zhi-Rong; Zhou, Ping; Möller, Michael; Li, De-Zhu

    2012-12-01

    Corallodiscus is widespread across China and in adjacent countries to the west and south, with C. lanuginosus covering the entire range of the genus. Microsatellite markers will be useful to address within-complex taxonomic and biogeographic structures of this species. • Fourteen markers were developed using the Fast Isolation by AFLP of Sequences COntaining repeats (FIASCO) protocol. Polymorphism was assessed in 12 individuals each from two populations from West Yunnan, China. Nine primers displayed polymorphisms. The number of alleles per locus ranged from one to six (mean: 2.7). The observed and expected heterozygosities ranged from 0 to 1 and from 0 to 0.772 (average: 0.487 and 0.448). Only one of the polymorphic loci deviated from Hardy-Weinberg equilibrium. Among the four congeneric species, cross-amplification success ranged from two to eight markers. • The markers will be useful for population genetic and evolutionary history studies for C. lanuginosus and the allied species C. bhutanicus, C. cooperi, and C. kingianus.

  13. Development of a SCAR marker for detection of Bipolaris sorokiniana causing spot blotch of wheat.

    Science.gov (United States)

    Aggarwal, R; Gupta, S; Banerjee, S; Singh, V B

    2011-11-01

    Spot blotch of wheat caused by Bipolaris sorokiniana is an important disease of wheat, especially in slightly warm (25 ± 1 °C) and humid weather conditions. A quick and reliable PCR-based diagnostic assay has been developed to detect B. sorokiniana using a pathogen-specific marker derived from genomic DNA. A PCR-amplified band of 650 bp obtained in B. sorokiniana isolates using universal rice primer (URP 1F) was cloned in pGEMT easy vector and sequenced. Based on sequences, six primers were designed, out of which a primer pair RABSF1 (GGTCCGAGACAACCAACAA) and RABSR2 (AAAGAAAGCGGTCGACGTAA) amplified a sequence of 600 bp in B. sorokiniana isolates. The specificity of the marker when tested against 40 isolates of B. sorokiniana, seven isolates of other species of Bipolaris, and 27 isolates of other pathogens infecting wheat and other crops showed a specific band of 600 bp only in B. sorokiniana. The detection limit was 50 pg of genomic DNA. The marker could detect the pathogen in soil and wheat leaves at presymptomatic stage. This sequence characterized amplified region (SCAR) marker designated as SCRABS(600) could clearly distinguish B. sorokiniana from other fungal plant pathogens, including Bipolaris spp. The utilization of this diagnostic PCR assay in analysis of field soil and wheat leaves will play a key role in effective management of the disease.

  14. Message development for surface markers at the Hanford Radwaste Disposal sites

    Energy Technology Data Exchange (ETDEWEB)

    Kaplan, M.F.

    1984-12-31

    At the Hanford Reservation in Washington, there are sites which received liquid and solid transuranic wastes from the late 1940`s until 1970. Rockwell Hanford Operations (Rockwell) is investigating the feasibility of several options for the permanent disposal of these wastes. One option is to stabilize the wastes in their present locations and to add barriers to minimize water infiltration and root penetration into the wastes. This report forms part of the project to develop a marking system for transuranic wastes on the Hanford Reservation. The focus of this report is the development of the message system to appear on the surface markers. A logical framework is developed to deduce what is required by the message system. Alternatives for each message component are evaluated and justification is provided for the choice of each component. The components are then laid out on the surface marker to provide a legible, comprehensible message system. The surface markers are tall, standing monoliths which ring the perimeter of each disposal area. Based on the logical framework, it is recommended that three domains of representation -- symbols, pictures, and language -- be used in the message system. The warning symbol chosen for the message system is the radiation trefoil. Two other options were considered, including the warning symbol developed by the Human Interference Task Force for a high-level waste repository. The trefoil was preferred because of the widespread usage and international acceptance which is already enjoys.

  15. Development of Microsatellite Markers for a Tropical Seagrass, Syringodium filiforme (Cymodoceaceae

    Directory of Open Access Journals (Sweden)

    Alexandra L. Bijak

    2014-10-01

    Full Text Available Premise of the study: A total of 17 polymorphic microsatellite markers were developed for the tropical Atlantic seagrass Syringodium filiforme (Cymodoceaceae, enabling analysis of population genetic structure in this species for the first time. Methods and Results: The 17 primers amplified di- and trinucleotide repeats revealing two to eight alleles per locus among the South Florida populations tested. In the analysis of two populations from the Florida Keys (Florida, USA, observed heterozygosity ranged from 0.063 to 0.905, although sampling was from relatively closely located populations so heterozygosity is expected to be higher across larger spatial scales. Multiplex PCRs consisting of two 6-plex and one 5-plex reactions were developed to maximize genotyping efficiency. Conclusions: We present here 17 polymorphic markers that will be useful for the study of clonality and population structure of S. filiforme, a marine plant that forms extensive habitat throughout the tropical Atlantic and Caribbean.

  16. Development and Identification of Novel Rice Blast Resistant Sources and Their Characterization Using Molecular Markers

    Institute of Scientific and Technical Information of China (English)

    S J S RAMA DEVI; M. S. MADHAV; Kuldeep SINGH; B UMAKANTH; B VISHALAKSHI; P RENUKA; K. VIJAY SUDHAKAR; M. S. PRASAD3; B. C. VIRAKTAMATH; V. RAVINDRA BABU

    2015-01-01

    To develop and characterize introgression lines for leaf and neck blast resistance, 326 introgression lines were developed using various accessions of six different AA genome wild species in the genetic background of elite Indian varieties like PR114 and Pusa 44 and were screened for blast resistance. Stringent phenotyping coupled with genotyping using gene based markers led to the identification of four resistant introgression lines, which showed promising resistance and do not possess any of the tested genes. Furthermore, multi-location screening confirmed the field resistance of the four introgression lines to both leaf and neck blast. Molecular characterization of these introgression lines using genome-wide simple sequence repeat markers revealed the presence of small percentage of wildOryza genome introgrssion. So these lines can be used for mapping and identification of novel leaf and neck blast resistance genes. Thus, these four introgression lines can be considered as new genetic resources for blast resistance.

  17. Development of Polymorphic Microsatellite Markers for Phyllostachys edulis (Poaceae, an Important Bamboo Species in China

    Directory of Open Access Journals (Sweden)

    Wei-Xin Jiang

    2013-06-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for Phyllostachys edulis (Poaceae, an ecologically and economically important bamboo species in China, to evaluate the genetic diversity and population genetic structure of P. edulis and other Phyllostachys species. Methods and Results: Twenty microsatellite markers were developed and their polymorphisms were tested on 71 samples from three geographically disparate populations. Each locus exhibited between two and 10 alleles with an average of five alleles. Excluding monomorphic loci, observed and expected heterozygosity ranged from zero to one and from 0.041 to 0.676, respectively. Conclusions: These 20 polymorphic microsatellite loci will be useful for studies on the molecular ecology, population genetics, and conservation of P. edulis.

  18. Development and Characterization of Microsatellite Markers for the Medicinal Plant Smilax brasiliensis (Smilacaceae and Related Species

    Directory of Open Access Journals (Sweden)

    Aline R. Martins

    2013-06-01

    Full Text Available Premise of the study: A new set of microsatellite or simple sequence repeat (SSR markers were developed for Smilax brasiliensis, which is popularly known as sarsaparilla and used in folk medicine as a tonic, antirheumatic, and antisyphilitic. Smilax brasiliensis is sold in Brazilian pharmacies, and its origin and effectiveness are not subject to quality control. Methods and Results: Using a protocol for genomic library enrichment, primer pairs were developed for 26 microsatellite loci and validated in 17 accessions of S. brasiliensis. Thirteen loci were polymorphic and four were monomorphic. The primers successfully amplified alleles in the congeners S. campestris, S. cissoides, S. fluminensis, S . goyazana, S. polyantha, S. quinquenervia, S. rufescens, S. subsessiliflora, and S. syphilitica. Conclusions: The new SSR markers described herein are informative tools for genetic diversity and gene flow studies in S. brasiliensis and several congeners.

  19. DOMINO: development of informative molecular markers for phylogenetic and genome-wide population genetic studies in non-model organisms.

    Science.gov (United States)

    Frías-López, Cristina; Sánchez-Herrero, José F; Guirao-Rico, Sara; Mora, Elisa; Arnedo, Miquel A; Sánchez-Gracia, Alejandro; Rozas, Julio

    2016-12-15

    The development of molecular markers is one of the most important challenges in phylogenetic and genome wide population genetics studies, especially in studies with non-model organisms. A highly promising approach for obtaining suitable markers is the utilization of genomic partitioning strategies for the simultaneous discovery and genotyping of a large number of markers. Unfortunately, not all markers obtained from these strategies provide enough information for solving multiple evolutionary questions at a reasonable taxonomic resolution. We have developed Development Of Molecular markers In Non-model Organisms (DOMINO), a bioinformatics tool for informative marker development from both next generation sequencing (NGS) data and pre-computed sequence alignments. The application implements popular NGS tools with new utilities in a highly versatile pipeline specifically designed to discover or select personalized markers at different levels of taxonomic resolution. These markers can be directly used to study the taxa surveyed for their design, utilized for further downstream PCR amplification in a broader set taxonomic scope, or exploited as suitable templates to bait design for target DNA enrichment techniques. We conducted an exhaustive evaluation of the performance of DOMINO via computer simulations and illustrate its utility to find informative markers in an empirical dataset. DOMINO is freely available from www.ub.edu/softevol/domino CONTACT: elsanchez@ub.edu or jrozas@ub.eduSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  20. The Use of Recently Developed Histochemical Markers for Localizing Neurotoxicant Induced Regional Brain Pathologies

    Directory of Open Access Journals (Sweden)

    Sumit Sarkar

    2014-04-01

    Full Text Available Neuronal and vascular brain components are interrelated morphologically, physiologically and developmentally. Due to this close interrelationship, it is often difficult to understand the cause and effect relationship between neuronal vs. vascular dysfunction and pathology. This review will discuss four of the more promising recent developments for detecting vascular pathology, and will compare them with the labeling pattern seen with markers of glial and neuronal pathology; following exposure to well characterized neurotoxicants. To detect the vascular dysfunction in the brain, we recently developed a Fluoro-Turquoise gelatin conjugate (FT-gel, a fluorescent probe that helps to delineate between healthy vs. sclerotic vessels. Similarly, we have investigated the potential for Fluoro-Gold to label in vivo all the endothelial cells in the brain as they co-localize with RECA, an endothelial cell marker. We have also developed Amylo-Glo, a fluorescent tracer that can detect neurotoxic A-beta aggregates in the brain. In this article, we will discuss the potential use of these novel histochemical markers to study the neurotoxicant induced brain. We will also discuss neurovascular strategies that may offer novel therapeutic opportunities for neurodegenerative disorders.

  1. Development of novel tetra- and trinucleotide microsatellite markers for giant grouper Epinephelus lanceolatus using 454 pyrosequencing.

    Science.gov (United States)

    Kim, Keun-Sik; Noh, Choong Hwan; Moon, Shin-Joo; Han, Seung-Hee; Bang, In-Chul

    2016-06-01

    Giant grouper (Epinephelus lanceolatus) is a commercially important species, but its wild population has recently been classified as vulnerable. This species has significant potential for use in aquaculture, though a greater understanding of population genetics is necessary for selective breeding programs to minimize kinship for genetically healthy individuals. High-throughput pyrosequencing of genomic DNA was used to identify and characterize novel tetra- and trinucleotide microsatellite markers in giant grouper from Sabah, Malaysia. In total, of 62,763 sequences containing simple sequence repeats (SSRs) were obtained, and 78 SSR loci were selected to possibly contain tetra- and trinucleotide repeats. Of these loci, 16 had tetra- and 8 had trinucleotide repeats, all of which exhibited polymorphisms within easily genotyped regions. A total of 143 alleles were identified with an average of 5.94 alleles per locus, with mean observed and expected heterozygosities of 0.648 and 0.620, respectively. Among of them, 15 microsatellite markers were identified without null alleles and with Hardy-Weinberg equilibrium. These alleles showed a combined non-exclusion probability of 0.01138. The probability of individual identification (PID) value combined with in descending order 12 microsatellite markers was 0.00008, which strongly suggests that the use of the microsatellite markers developed in this study in various combinations would result in a high resolution method for parentage analysis and individual identification. These markers could be used to establish a broodstock management program for giant grouper and to provide a foundation for genetic studies such as population structure, parentage analysis, and kinship selection.

  2. Development of co-dominant SCAR markers linked to resistant gene against the Fusarium oxysporum f. sp. radicis-lycopersici.

    Science.gov (United States)

    Mutlu, Nedim; Demirelli, Aylin; Ilbi, Hülya; Ikten, Cengiz

    2015-09-01

    We developed highly reliable co-dominant SCAR markers linked to the Frl gene. FORL testing is difficult. The marker is expected to be quickly adapted for MAS by tomato breeders. Fusarium oxysporum f. sp. radicis-lycopersici causes Fusarium crown and root rot (FCR), an economically important soil-borne disease of tomato. The resistance against FCR is conferred by a single dominant gene (Frl) located on chromosome 9. The aim of this study was to develop molecular markers linked to the Frl gene for use in marker-assisted breeding (MAS) programs. The FCR-resistant 'Fla. 7781' and susceptible 'B560' lines were crossed, and F1 was both selfed and backcrossed to 'B560' to generate segregating F2 and BC1 populations. The two conserved set II (COSII) markers were found linked to the Frl gene, one co-segregated with FCR resistance in both F2 and BC1 populations and the other was 8.5 cM away. Both COSII markers were converted into co-dominant SCAR markers. SCARFrl marker produced a 950 and a 1000 bp fragments for resistant and susceptible alleles, respectively. The linkage of SCARFrl marker was confirmed in BC2F3 populations developed by backcrossing the resistant 'Fla. 7781' to five different susceptible lines. The SCARFrl marker has been in use in the tomato breeding programs in BATEM, Antalya, Turkey, since 2012 and has proved highly reliable. The SCARFrl marker is expected to aid in the development of FCR-resistant lines via marker-assisted selection (MAS).

  3. Fine Mapping for Identification of Citrus Alternaria Brown Spot Candidate Resistance Genes and Development of New SNP Markers for Marker-Assisted Selection

    Science.gov (United States)

    Cuenca, Jose; Aleza, Pablo; Garcia-Lor, Andres; Ollitrault, Patrick; Navarro, Luis

    2016-01-01

    Alternaria brown spot (ABS) is a serious disease affecting susceptible citrus genotypes, which is a strong concern regarding citrus breeding programs. Resistance is conferred by a recessive locus (ABSr) previously located by our group within a 3.3 Mb genome region near the centromere in chromosome III. This work addresses fine-linkage mapping of this region for identifying candidate resistance genes and develops new molecular markers for ABS-resistance effective marker-assisted selection (MAS). Markers closely linked to ABSr locus were used for fine mapping using a 268-segregating diploid progeny derived from a heterozygous susceptible × resistant cross. Fine mapping limited the genomic region containing the ABSr resistance gene to 366 kb, flanked by markers at 0.4 and 0.7 cM. This region contains nine genes related to pathogen resistance. Among them, eight are resistance (R) gene homologs, with two of them harboring a serine/threonine protein kinase domain. These two genes along with a gene encoding a S-adenosyl-L-methionine-dependent-methyltransferase protein, should be considered as strong candidates for ABS-resistance. Moreover, the closest SNP was genotyped in 40 citrus varieties, revealing very high association with the resistant/susceptible phenotype. This new marker is currently used in our citrus breeding program for ABS-resistant parent and cultivar selection, at diploid, triploid and tetraploid level. PMID:28066498

  4. 77 FR 69553 - Policy Statement on the Principles for Development and Distribution of Annual Stress Test Scenarios

    Science.gov (United States)

    2012-11-20

    ... Part 325 Policy Statement on the Principles for Development and Distribution of Annual Stress Test... and factors to be used by the FDIC in developing and distributing the stress test scenarios for the annual stress tests required by the Dodd- Frank Wall Street Reform and Consumer Protection Act of 2010...

  5. Generation and analysis of expressed sequence tags (ESTs) for marker development in yam (Dioscorea alata L.).

    Science.gov (United States)

    Narina, Satya S; Buyyarapu, Ramesh; Kottapalli, Kameswara Rao; Sartie, Alieu M; Ali, Mohamed I; Robert, Asiedu; Hodeba, Mignouna J D; Sayre, Brian L; Scheffler, Brian E

    2011-02-09

    Anthracnose (Colletotrichum gloeosporioides) is a major limiting factor in the production of yam (Dioscorea spp.) worldwide. Availability of high quality sequence information is necessary for designing molecular markers associated with resistance. However, very limited sequence information pertaining to yam is available at public genome databases. Therefore, this collaborative project was developed for genetic improvement and germplasm characterization of yams using molecular markers. The current investigation is focused on studying gene expression, by large scale generation of ESTs, from one susceptible (TDa 95-0310) and two resistant yam genotypes (TDa 87-01091, TDa 95-0328) challenged with the fungus. Total RNA was isolated from young leaves of resistant and susceptible genotypes and cDNA libraries were sequenced using Roche 454 technology. A total of 44,757 EST sequences were generated from the cDNA libraries of the resistant and susceptible genotypes. Greater than 56% of ESTs were annotated using MapMan Mercator tool and Blast2GO search tools. Gene annotations were used to characterize the transcriptome in yam and also perform a differential gene expression analysis between the resistant and susceptible EST datasets. Mining for SSRs in the ESTs revealed 1702 unique sequences containing SSRs and 1705 SSR markers were designed using those sequences. We have developed a comprehensive annotated transcriptome data set in yam to enrich the EST information in public databases. cDNA libraries were constructed from anthracnose fungus challenged leaf tissues for transcriptome characterization, and differential gene expression analysis. Thus, it helped in identifying unique transcripts in each library for disease resistance. These EST resources provide the basis for future microarray development, marker validation, genetic linkage mapping and QTL analysis in Dioscorea species.

  6. Generation and analysis of expressed sequence tags (ESTs for marker development in yam (Dioscorea alata L.

    Directory of Open Access Journals (Sweden)

    Robert Asiedu

    2011-02-01

    Full Text Available Abstract Background Anthracnose (Colletotrichum gloeosporioides is a major limiting factor in the production of yam (Dioscorea spp. worldwide. Availability of high quality sequence information is necessary for designing molecular markers associated with resistance. However, very limited sequence information pertaining to yam is available at public genome databases. Therefore, this collaborative project was developed for genetic improvement and germplasm characterization of yams using molecular markers. The current investigation is focused on studying gene expression, by large scale generation of ESTs, from one susceptible (TDa 95-0310 and two resistant yam genotypes (TDa 87-01091, TDa 95-0328 challenged with the fungus. Total RNA was isolated from young leaves of resistant and susceptible genotypes and cDNA libraries were sequenced using Roche 454 technology. Results A total of 44,757 EST sequences were generated from the cDNA libraries of the resistant and susceptible genotypes. Greater than 56% of ESTs were annotated using MapMan Mercator tool and Blast2GO search tools. Gene annotations were used to characterize the transcriptome in yam and also perform a differential gene expression analysis between the resistant and susceptible EST datasets. Mining for SSRs in the ESTs revealed 1702 unique sequences containing SSRs and 1705 SSR markers were designed using those sequences. Conclusion We have developed a comprehensive annotated transcriptome data set in yam to enrich the EST information in public databases. cDNA libraries were constructed from anthracnose fungus challenged leaf tissues for transcriptome characterization, and differential gene expression analysis. Thus, it helped in identifying unique transcripts in each library for disease resistance. These EST resources provide the basis for future microarray development, marker validation, genetic linkage mapping and QTL analysis in Dioscorea species.

  7. SAT, a flexible and optimized Web application for SSR marker development

    Directory of Open Access Journals (Sweden)

    Rami Jean-François

    2007-11-01

    Full Text Available Abstract Background Simple Sequence Repeats (SSRs, or microsatellites, are among the most powerful genetic markers known. A common method for the development of SSR markers is the construction of genomic DNA libraries enriched for SSR sequences, followed by DNA sequencing. However, designing optimal SSR markers from bulk sequence data is a laborious and time-consuming process. Results SAT (SSR Analysis Tool is a user-friendly Web application developed to minimize tedious manual operations and reduce errors. This tool facilitates the integration, analysis and display of sequence data from SSR-enriched libraries. SAT is designed to successively perform base calling and quality evaluation of chromatograms, eliminate cloning vector, adaptors and low quality sequences, detect chimera or partially digested sequences, search for SSR motifs, cluster and assemble the redundant sequences, and design SSR primer pairs. An additional virtual PCR step establishes primer specificity. Users may modify the different parameters of each step of the SAT analysis. Although certain steps are compulsory, such as SSR motifs search and sequence assembly, users do not have to run the entire pipeline, and they can choose selectively which steps to perform. A database allows users to store and query results, and to redo individual steps of the workflow. Conclusion The SAT Web application is available at http://sat.cirad.fr/sat, and a standalone command-line version is also freely downloadable. Users must send an email to the SAT administrator tropgene@cirad.fr to request a login and password.

  8. Development and Characterisation of Irap Markers From Expressed Retrotransposon-like sequences in Pinus sylvestris L.

    Directory of Open Access Journals (Sweden)

    Voronova Angelika

    2014-07-01

    Full Text Available Conifer genomes are large and stably diploid, in contrast to angiosperms, which are more variable both in genome size and ploidy. Conifer genomes are characterised by multiple gene families and pseudogenes, contain large inter-gene regions and a considerable proportion of repetitive sequences. All members of plant retrotransposon orders have been identified in gymnosperm genomes, however active elements have not been described. Investigation of transposable elements in Scots pine (Pinus sylvestris L. could offer insights into transposon-mediated reorganisation under stress conditions in complex and ancient plant genomes. Nine Pinus sylvestris specific markers were developed to hypothetical long terminal repeats (LTRs from differentially expressed retrotransposon-like fragments after heat stress and insect damage. Genetic diversity of 150 trees from a naturally regenerated pine stand was investigated using the IRAP method. The developed markers revealed high levels of genetic diversity and were able to distinguish subpopulations growing in long-term differential environmental conditions. Somaclonal variation was also investigated using these markers and polymorphic fragments were identified between ramets of Scots pine clones growing in two different plantations, possibly indicating evidence of recent transposition events. Sequencing of the polymorphic fragments identified two groups of sequences containing LTR sequences of an unknown retrotransposon with homology to the LTRs of the Copia-17-PAb-I element.

  9. Development and Characterization of 25 EST-SSR markers in Pinus sylvestris var. mongolica (Pinaceae

    Directory of Open Access Journals (Sweden)

    Pan Fang

    2014-01-01

    Full Text Available Premise of the study: A set of novel expressed sequence tag (EST microsatellite markers was developed in Pinus sylvestris var. mongolica to promote further genetic studies in this species. Methods and Results: One hundred seventy-five EST–simple sequence repeat (SSR primers were designed and synthesized for 31,653 isotigs based on P. tabuliformis EST sequences. The primer pairs were used to identify 25 polymorphic loci in 48 individuals. The number of alleles ranged from two to eight with observed and expected heterozygosity values of 0.0435 to 0.8125 and 0.0430 to 0.7820, respectively. Conclusions: These new polymorphic EST-SSR markers will be useful for assessing genetic diversity, molecular breeding and genetic improvement, and conservation of P. sylvestris var. mongolica.

  10. Development of microsatellite markers in Garcinia paucinervis (Clusiaceae), an endangered species of karst habitats.

    Science.gov (United States)

    Hu, Gang; Zhang, Zhong-Hua; Yang, Ping; Zhang, Qi-Wei; Yuan, Chang-An

    2017-01-01

    Microsatellite markers were developed for Garcinia paucinervis (Clusiaceae), an endangered and endemic tree species of karst habitats, to analyze its genetic diversity and genetic structure. Using shotgun sequencing on an Illumina MiSeq platform, a total of 22 microsatellite primer sets were characterized, of which 17 were identified as polymorphic. For these polymorphic loci, the total number of alleles per locus ranged from two to 12 across 54 individuals from three populations. The observed and expected heterozygosities ranged from 0.000 to 1.000 and from 0.000 to 0.850, respectively. No pair of loci showed significant linkage disequilibrium. Three loci in one population deviated significantly from Hardy-Weinberg equilibrium (P < 0.05). Seven loci (JSL3, JSL5, JSL22, JSL29, JSL32, JSL39, and JSL43) were successfully amplified in G. bracteata. These markers will be useful in studies on genetic diversity and population structure of G. paucinervis.

  11. Marker-assisted selection strategies for developing resistant soybean plants to cyst nematode

    Directory of Open Access Journals (Sweden)

    Fernanda Abreu Santana

    2014-10-01

    Full Text Available Resistant lines can be identified by marker-assisted selection (MAS, based on alleles of genetic markers linked to the resistance trait. This reduces the number of phenotypically evaluated lines, one of the limitations in the development of cultivars with resistance to soybean cyst nematode (SCN. This study evaluated the efficiency of microsatellites near quantitative trait loci (QTL for SCN resistance, in the linkage groups (LG G and A2 of soybean, for the selection of resistant genotypes in populations originated from crosses between the cultivars Vmax and CD201. The QTL of LG A2 was not detected in ‘Vmax’ (derived from PI 88788. In MAS, the microsatellites of LG G were efficient in selecting F6:7 families with resistance and moderate resistance to SCN race 3. The selection efficiency of the microsatellites Sat_168, Satt309 and Sat_141 was greater than 93%.

  12. Development and characterization of 27 microsatellite markers for the mangrove fern, Acrostichum aureum (Pteridaceae)1

    Science.gov (United States)

    Yamamoto, Takashi; Tsuda, Yoshiaki; Mori, Gustavo Maruyama; Cruz, Mariana Vargas; Shinmura, Yoshimi; Wee, Alison K. S.; Takayama, Koji; Asakawa, Takeshi; Yamakawa, Takeru; Suleiman, Monica; Núñez-Farfán, Juan; Webb, Edward L.; Watano, Yasuyuki; Kajita, Tadashi

    2016-01-01

    Premise of the study: Twenty-seven nuclear microsatellite markers were developed for the mangrove fern, Acrostichum aureum (Pteridaceae), to investigate the genetic structure and demographic history of the only pantropical mangrove plant. Methods and Results: Fifty-six A. aureum individuals from three populations were sampled and genotyped to characterize the 27 loci. The number of alleles and expected heterozygosity ranged from one to 15 and 0.000 to 0.893, respectively. Across the 26 polymorphic loci, the Malaysian population showed much higher levels of polymorphism compared to the other two populations in Guam and Brazil. Cross-amplification tests in the other two species from the genus determined that seven and six loci were amplifiable in A. danaeifolium and A. speciosum, respectively. Conclusions: The 26 polymorphic microsatellite markers will be useful for future studies investigating the genetic structure and demographic history of of A. aureum, which has the widest distributional range of all mangrove plants. PMID:27672519

  13. Development and mapping of DArT markers within the Festuca - Lolium complex

    DEFF Research Database (Denmark)

    Kopecký, David; Bartos, Jan; Lukaszewski, Adam J

    2009-01-01

    Background Grasses are among the most important and widely cultivated plants on Earth. They provide high quality fodder for livestock, are used for turf and amenity purposes, and play a fundamental role in environment protection. Among cultivated grasses, species within the Festuca-Lolium complex...... predominate, especially in temperate regions. To facilitate high-throughput genome profiling and genetic mapping within the complex, we have developed a Diversity Arrays Technology (DArT) array for five grass species: F. pratensis, F. arundinacea, F. glaucescens, L. perenne and L. multiflorum. Results The DAr......T markers identified in every single genotype varied from 821 to 1852. To test the usefulness of DArTFest array for physical mapping, DArT markers were assigned to each of the seven chromosomes of F. pratensis using single chromosome substitution lines while recombinants of F. pratensis chromosome 3 were...

  14. Development and Characterization of Microsatellite Markers from the Transcriptome of Firmiana danxiaensis (Malvaceae s.l.

    Directory of Open Access Journals (Sweden)

    Qiang Fan

    2013-11-01

    Full Text Available Premise of the study: Firmiana consists of 12–16 species, many of which are narrow endemics. Expressed sequence tag (EST–simple sequence repeat (SSR markers were developed and characterized for size polymorphism in four Firmiana species. Methods and Results: A total of 102 EST-SSR primer pairs were designed based on the transcriptome sequences of F. danxiaensis; these were then characterized in four Firmiana species—F. danxiaensis, F. kwangsiensis, F. hainanensis, and F. simplex. In these four species, 17 primer pairs were successfully amplified, and 14 were polymorphic in at least one species. The number of alleles ranged from one to 13, and the observed and expected heterozygosities ranged from 0 to 1 and 0 to 0.925, respectively. The lowest level of polymorphism was observed in F. danxiaensis. Conclusions: These polymorphic EST-SSR markers are valuable for conservation genetics studies in the endangered Firmiana species.

  15. Development and characterization of microsatellite markers for Central American Begonia sect. Gireoudia (Begoniaceae)1

    Science.gov (United States)

    Twyford, Alex D.; Ennos, Richard A.; Kidner, Catherine A.

    2013-01-01

    • Premise of the study: Transcriptome sequence data were used to design microsatellite primers for two widespread Central American Begonia species, B. heracleifolia and B. nelumbiifolia, to investigate population structure and hybridization. • Methods and Results: The transcriptome from vegetative meristem tissue from the related B. plebeja was mined for microsatellite loci, and 31 primer pairs amplified in the target species. Fifteen primer pairs were combined in two multiplex PCR reactions, which amplified an average of four alleles per locus. • Conclusions: The markers developed will be a valuable genetic resource for medium-throughput genotyping of Central American species of Begonia sect. Gireoudia. A subset of these markers have perfect sequence matches to Asian B. venusta, and are promising for studies in other Begonia sections. PMID:25202548

  16. Development and Characterization of Microsatellite Markers for Central American Begonia sect. Gireoudia (Begoniaceae

    Directory of Open Access Journals (Sweden)

    Alex D. Twyford

    2013-05-01

    Full Text Available Premise of the study: Transcriptome sequence data were used to design microsatellite primers for two widespread Central American Begonia species, B. heracleifolia and B. nelumbiifolia, to investigate population structure and hybridization. Methods and Results: The transcriptome from vegetative meristem tissue from the related B. plebeja was mined for microsatellite loci, and 31 primer pairs amplified in the target species. Fifteen primer pairs were combined in two multiplex PCR reactions, which amplified an average of four alleles per locus. Conclusions: The markers developed will be a valuable genetic resource for medium-throughput genotyping of Central American species of Begonia sect. Gireoudia. A subset of these markers have perfect sequence matches to Asian B. venusta, and are promising for studies in other Begonia sections.

  17. A general pipeline for the development of anchor markers for comparative genomics in plants

    Directory of Open Access Journals (Sweden)

    Stougaard Jens

    2006-08-01

    Full Text Available Abstract Background Complete or near-complete genomic sequence information is presently only available for a few plant species representing a large phylogenetic diversity among plants. In order to effectively transfer this information to species lacking sequence information, comparative genomic tools need to be developed. Molecular markers permitting cross-species mapping along co-linear genomic regions are central to comparative genomics. These "anchor" markers, defining unique loci in genetic linkage maps of multiple species, are gene-based and possess a number of features that make them relatively sparse. To identify potential anchor marker sequences more efficiently, we have established an automated bioinformatic pipeline that combines multi-species Expressed Sequence Tags (EST and genome sequence data. Results Taking advantage of sequence data from related species, the pipeline identifies evolutionarily conserved sequences that are likely to define unique orthologous loci in most species of the same phylogenetic clade. The key features are the identification of evolutionarily conserved sequences followed by automated design of intron-flanking Polymerase Chain Reaction (PCR primer pairs. Polymorphisms can subsequently be identified by size- or sequence variation of PCR products, amplified from mapping parents or populations. We illustrate our procedure in legumes and grasses and exemplify its application in legumes, where model plant studies and the genome- and EST-sequence data available have a potential impact on the breeding of crop species and on our understanding of the evolution of this large and diverse family. Conclusion We provide a database of 459 candidate anchor loci which have the potential to serve as map anchors in more than 18,000 legume species, a number of which are of agricultural importance. For grasses, the database contains 1335 candidate anchor loci. Based on this database, we have evaluated 76 candidate anchor loci

  18. Development of a SCAR (sequence-characterised amplified region) marker for acid resistance-related gene in Lactobacillus plantarum.

    Science.gov (United States)

    Liu, Shu-Wen; Li, Kai; Yang, Shi-Ling; Tian, Shu-Fen; He, Ling

    2015-03-01

    A sequence characterised amplified region marker was developed to determine an acid resistance-related gene in Lactobacillus plantarum. A random amplified polymorphic DNA marker named S116-680 was reported to be closely related to the acid resistance of the strains. The DNA band corresponding to this marker was cloned and sequenced with the induction of specific designed PCR primers. The results of PCR test helped to amplify a clear specific band of 680 bp in the tested acid-resistant strains. S116-680 marker would be useful to explore the acid-resistant mechanism of L. plantarum and to screen desirable malolactic fermentation strains.

  19. (SSR) markers

    African Journals Online (AJOL)

    Yomi

    2012-04-03

    Apr 3, 2012 ... seeded and black-seeded cultivars and breeding lines. The group B included 70 ... maize, rice and tomatoes (Reif et al., 2006; Vigouroux et al., 2005; Warburton et ..... development of molecular markers for marker-assisted breeding. .... Selection under domestication: evidence for a sweep in the rice Waxy ...

  20. Efficient development of highly polymorphic microsatellite markers based on polymorphic repeats in transcriptome sequences of multiple individuals.

    Science.gov (United States)

    Vukosavljev, M; Esselink, G D; van 't Westende, W P C; Cox, P; Visser, R G F; Arens, P; Smulders, M J M

    2015-01-01

    The first hurdle in developing microsatellite markers, cloning, has been overcome by next-generation sequencing. The second hurdle is testing to differentiate polymorphic from nonpolymorphic loci. The third hurdle, somewhat hidden, is that only polymorphic markers with a large effective number of alleles are sufficiently informative to be deployed in multiple studies. Both steps are laborious and still performed manually. We have developed a strategy in which we first screen reads from multiple genotypes for repeats that show the most length variants, and only these are subsequently developed into markers. We validated our strategy in tetraploid garden rose using Illumina paired-end transcriptome sequences of 11 roses. Of 48 tested two markers failed to amplify, but all others were polymorphic. Ten loci amplified more than one locus, indicating duplicated genes or gene families. Completely avoiding duplicated loci will be difficult because the range of numbers of predicted alleles of highly polymorphic single- and multilocus markers largely overlapped. Of the remainder, half were replicate markers (i.e. multiple primer pairs for one locus), indicating the difficulty of correctly filtering short reads containing repeat sequences. We subsequently refined the approach to eliminate multiple primer sets to the same loci. The remaining 18 markers were all highly polymorphic, amplifying on average 11.7 alleles per marker (range = 6-20) in 11 tetraploid roses, exceeding the 8.2 alleles per marker of the 24 most polymorphic markers genotyped previously. This strategy therefore represents a major step forward in the development of highly polymorphic microsatellite markers.

  1. Identification of cold-responsive genes in energycane for their use in genetic diversity analysis and future functional marker development

    Science.gov (United States)

    Breeding for cold tolerance in sugarcane will allow its cultivation as a dedicated biomass crop in cold environments. Development of functional markers to facilitate marker-assisted breeding requires identification of cold stress tolerance genes. Using suppression subtractive hybridization, 465 cold...

  2. The Development of the Preverbal Markers in St-Louis-Creole: The Formation of a TMA-System?

    Science.gov (United States)

    Ehrhart, Sabine

    1992-01-01

    Presents phrases and structures quoted from Melanesian families of the St-Louis tribe in New Caledonia. The system of preverbal markers in Tayo is not well developed and is subject to fluctuation. The use of preverbal markers does not follow the Tempus-Modus-Aspekt rules. (five references) (Author/JP)

  3. Highly variable microsatellite markers for the fungal and algal symbionts of the lichen Lobaria pulmonaria and challenges in developing biont-specific molecular markers for fungal associations.

    Science.gov (United States)

    Widmer, Ivo; Dal Grande, Francesco; Cornejo, Carolina; Scheidegger, Christoph

    2010-07-01

    The availability of highly variable markers for the partners of a fungal symbiosis enables the integrated investigation of ecological and evolutionary processes at the symbiotic level. In this article we analyze the specificity of the first and to date only microsatellite markers that had been developed for an epiphytic lichen (Lobaria pulmonaria). We used DNA extracts from cultures of the fungal and of the green algal symbionts of L. pulmonaria as well as total DNA extracts from related Lobaria species associated with the same algal partner, and got evidence that five of the previously described microsatellite markers, proposed to be fungus-specific, are indeed alga-specific. Hence, highly variable microsatellite primer sets available for both, the algal and the fungal symbionts of L. pulmonaria are now at our hands, which allow us to investigate so far unexplored biological processes of lichen symbionts, such as codispersal and coevolution. In a broader sense, our work evaluates and discusses the challenges in developing biont-specific molecular markers for fungi forming close associations with other organisms.

  4. Development of DNA markers associated with beer foam stability for barley breeding.

    Science.gov (United States)

    Iimure, Takashi; Kihara, Makoto; Ichikawa, Seiichiro; Ito, Kazutoshi; Takeda, Kazuyoshi; Sato, Kazuhiro

    2011-01-01

    Traits conferring brewing quality are important objectives in malting barley breeding. Beer foam stability is one of the more difficult traits to evaluate due to the requirement for a relatively large amount of grain to be malted and then the experimental costs for subsequent brewing trials. Consequently, foam stability tends to be evaluated with only advanced lines in the final stages of the breeding process. To simplify the evaluation and selection for this trait, efficient DNA makers were developed in this study. Previous studies have suggested that the level of both of the foam-associated proteins Z4 and Z7 were possible factors that influenced beer foam stability. To confirm the relationship between levels of these proteins in beer and foam stability, 24 beer samples prepared from malt made from 10 barley cultivars, were examined. Regression analyses suggested that beer proteins Z4 and Z7 could be positive and negative markers for beer foam stability, respectively. To develop DNA markers associated with contents of proteins Z4 and Z7 in barley grain, nucleotide sequence polymorphisms in barley cultivars in the upstream region of the translation initiation codon, where the promoter region might be located were compared. As a result, 5 and 23 nucleotide sequence polymorphisms were detected in protein Z4 and protein Z7, respectively. By using these polymorphisms, cleaved amplified polymorphic sequence (CAPS) markers were developed. The CAPS markers for proteins Z4 and Z7 were applied to classify the barley grain content of 23 barley cultivars into two protein Z4 (pZ4-H and pZ4-L) and three protein Z7 (the pZ7-H, pZ7-L and pZ7-L2) haplotypes, respectively. Barley cultivars with pZ4-H showed significantly higher levels of protein Z4 in grain, and those with pZ7-L and pZ7-L2 showed significantly lower levels of protein Z7 in grain. Beer foam stability in the cultivars with pZ4-H and pZ7-L was significantly higher than that with pZ4-L and pZ7-H, respectively. Our

  5. Proceedings of the sixth annual conference of the International Nuclear Target Development Society

    Energy Technology Data Exchange (ETDEWEB)

    Steers, G. (comp.)

    1978-08-01

    The Sixth Annual Conference of the International Nuclear Target Development Society was held at the Lawrence Berkeley Laboratory, University of California, Berkeley, California, on October 19--21, 1977. The discussion covered nuclear target preparation by evaporation, reduction of oxides, electrodeposition, reactive sputtering, rolling, gas jets, and related techniques. Abstracts were prepared for eighteen of the papers presented at the conference and are included in the data base. (GHT)

  6. MENINGES HARBOR CELLS EXPRESSING NEURAL PRECURSOR MARKERS DURING DEVELOPMENT AND ADULTHOOD

    Directory of Open Access Journals (Sweden)

    Francesco eBifari

    2015-10-01

    Full Text Available Brain and skull developments are tightly synchronized, allowing the cranial bones to dynamically adapt to the brain shape. At the brain-skull interface, meninges produce the trophic signals necessary for normal corticogenesis and bone development. Meninges harbor different cell populations, including cells forming the endosteum of the cranial vault. Recently, we and other groups have described the presence in meninges of a cell population endowed with neural differentiation potential in vitro and, after transplantation, in vivo. However, whether meninges may be a niche for neural progenitor cells during embryonic development and in adulthood remains to be determined.In this work we provide the first description of the distribution of neural precursor markers in rat meninges during development up to adulthood. We conclude that meninges share common properties with the classical neural stem cell niche, as they: i are a highly proliferating tissue; ii host cells expressing neural precursor markers such as nestin, vimentin, Sox2 and doublecortin; and iii are enriched in extracellular matrix components (e.g. fractones known to bind and concentrate growth factors. This study underlines the importance of meninges as a potential niche for endogenous precursor cells during development and in adulthood.

  7. Meninges harbor cells expressing neural precursor markers during development and adulthood.

    Science.gov (United States)

    Bifari, Francesco; Berton, Valeria; Pino, Annachiara; Kusalo, Marijana; Malpeli, Giorgio; Di Chio, Marzia; Bersan, Emanuela; Amato, Eliana; Scarpa, Aldo; Krampera, Mauro; Fumagalli, Guido; Decimo, Ilaria

    2015-01-01

    Brain and skull developments are tightly synchronized, allowing the cranial bones to dynamically adapt to the brain shape. At the brain-skull interface, meninges produce the trophic signals necessary for normal corticogenesis and bone development. Meninges harbor different cell populations, including cells forming the endosteum of the cranial vault. Recently, we and other groups have described the presence in meninges of a cell population endowed with neural differentiation potential in vitro and, after transplantation, in vivo. However, whether meninges may be a niche for neural progenitor cells during embryonic development and in adulthood remains to be determined. In this work we provide the first description of the distribution of neural precursor markers in rat meninges during development up to adulthood. We conclude that meninges share common properties with the classical neural stem cell niche, as they: (i) are a highly proliferating tissue; (ii) host cells expressing neural precursor markers such as nestin, vimentin, Sox2 and doublecortin; and (iii) are enriched in extracellular matrix components (e.g., fractones) known to bind and concentrate growth factors. This study underlines the importance of meninges as a potential niche for endogenous precursor cells during development and in adulthood.

  8. Development and Implementation of Autoverification Rules for ELISA Results of HBV Serological Markers.

    Science.gov (United States)

    Li, Jiancheng; Cheng, Bizhen; Yang, Li; Zhao, Ying; Pan, Meichen; Zheng, Gaozhe; Xu, Xiaoyan; Hu, Jing; Xiao, Tongtong; Cai, Yingmu

    2016-10-01

    Autoverification is a process of using computer-based rules to verify clinical laboratory test results without manual review. But to date, there are few published articles on the use of autoverification over the course of years in a clinical laboratory. In our study, we firstly described the development and implementation of autoverification rules for enzyme-linked immunosorbent assay (ELISA) results of hepatitis B virus (HBV) serological markers in a clinical immunology laboratory. We designed the autoverification rules for HBV by using Boolean logic on five clinically used serological markers in accordance with the framework of AUTO-10A, issued by the American Clinical Laboratory Standards Institute in 2006. The rules were written into the laboratory information system (LIS) and installed in the computer, so we could use the LIS to screen the test results. If the results passed the autoverification rules, they could be sent to doctors immediately. To evaluate the autoverification rules, we applied the real-time data of 11,585 patients with the autoverification rules. The autoverification rate of the five HBV serological markers was 79.5%. Furthermore, the turnaround time (TAT) was reduced by 38% (78 minutes vs. 126 minutes). The error rate was nearly eliminated. These results show that using LIS with autoverification rules can shorten TAT, enhance efficiency, and reduce manual review errors.

  9. Quantification of the fate of dietary fiber in humans by a newly developed radiolabeled fiber marker

    Energy Technology Data Exchange (ETDEWEB)

    Carryer, P.W.; Brown, M.I.; Malagelada, J.R.; Carlson, G.L.; McCall, J.T.

    1982-06-01

    A radiolabeled cellulose (/sup 131/I-fiber) that retains the essential physical and chemical properties of this class of fiber was developed in our laboratory. Researchers quantified the fate of orally ingested /sup 131/I-fiber in healthy individuals by external gamma camera monitoring and fecal collections. The marker passes virtually intact through the human gastrointestinal tract with negligible release and absorption of the label in the gut. Comparison of the gastric emptying rate of /sup 131/I-fiber with that of a predominantly aqueous marker, /sup 99/mTc-diethylenetriamine pentaacetic acid (/sup 99/mTc-DTPA), showed that /sup 131/I-fiber strands were evacuated more slowly than intragastric fluids. An important finding was that some /sup 131/I-fiber emptying occurred during most time periods, even before liquids were completely evacuated. This suggests that the human stomach is able to empty simultaneously liquids and fiber strands (1-15 mm in length) that are resistant to grinding by antral mechanical forces and to digestion by acid-peptic secretion. Thus, some nondigestible solids may be emptied with the bulk of a meal, although at a slower rate. /sup 131/I-Fiber may be a useful marker for quantifying gastric emptying of nondigestible solids. Further, the stability of /sup 131/I-fiber in the gut, as opposed to most other physiologic solid labels, should enable future investigation of intestinal and colonic transit of fiber, which is an important component of the human diet.

  10. Drosophila genomes and the development of affordable molecular markers for species genotyping.

    Science.gov (United States)

    Minuk, Leigh; Civetta, Alberto

    2011-04-01

    The recent completion of genome sequencing of 12 species of Drosophila has provided a powerful resource for hypothesis testing, as well as the development of technical tools. Here we take advantage of genome sequence data from two closely related species of Drosophila, Drosophila simulans and Drosophila sechellia, to quickly identify candidate molecular markers for genotyping based on expected insertion or deletion (indel) differences between species. Out of 64 candidate molecular markers selected along the second and third chromosome of Drosophila, 51 molecular markers were validated using PCR and gel electrophoresis. We found that the 20% error rate was due to sequencing errors in the genome data, although we cannot rule out possible indel polymorphisms. The approach has the advantage of being affordable and quick, as it only requires the use of bioinformatics tools for predictions and a PCR and agarose gel based assay for validation. Moreover, the approach could be easily extended to a wide variety of taxa with the only limitation being the availability of complete or partial genome sequence data.

  11. Development of Gateway Binary Vector Series with Four Different Selection Markers for the Liverwort Marchantia polymorpha.

    Directory of Open Access Journals (Sweden)

    Kimitsune Ishizaki

    Full Text Available We previously reported Agrobacterium-mediated transformation methods for the liverwort Marchantia polymorpha using the hygromycin phosphotransferase gene as a marker for selection with hygromycin. In this study, we developed three additional markers for M. polymorpha transformation: the gentamicin 3'-acetyltransferase gene for selection with gentamicin; a mutated acetolactate synthase gene for selection with chlorsulfuron; and the neomycin phosphotransferase II gene for selection with G418. Based on these four marker genes, we have constructed a series of Gateway binary vectors designed for transgenic experiments on M. polymorpha. The 35S promoter from cauliflower mosaic virus and endogenous promoters for constitutive and heat-inducible expression were used to create these vectors. The reporters and tags used were Citrine, 3×Citrine, Citrine-NLS, TagRFP, tdTomato, tdTomato-NLS, GR, SRDX, SRDX-GR, GUS, ELuc(PEST, and 3×FLAG. These vectors, designated as the pMpGWB series, will facilitate molecular genetic analyses of the emerging model plant M. polymorpha.

  12. LABORATORY DIRECTED RESEARCH AND DEVELOPMENT ANNUAL REPORT TO THE DEPARTMENT OF ENERGY - DECEMBER 2006

    Energy Technology Data Exchange (ETDEWEB)

    FOX, K.J.

    2006-12-31

    Brookhaven National Laboratory (BNL) is a multidisciplinary laboratory that carries out basic and applied research in the physical, biomedical, and environmental sciences, and in selected energy technologies. It is managed by Brookhaven Science Associates, LLC, (BSA) under contract with the U. S. Department of Energy (DOE). BNL's total annual budget has averaged about $460 million. There are about 2,500 employees, and another 4,500 guest scientists and students who come each year to use the Laboratory's facilities and work with the staff. The BNL Laboratory Directed Research and Development (LDRD) Program reports its status to the U.S. Department of Energy (DOE) annually in March, as required by DOE Order 413.2B, ''Laboratory Directed Research and Development,'' April 19, 2006, and the Roles, Responsibilities, and Guidelines for Laboratory Directed Research and Development at the Department of Energy National Nuclear Security Administration Laboratories dated June 13, 2006. In accordance this is our Annual Report in which we describe the Purpose, Approach, Technical Progress and Results, and Specific Accomplishments of all LDRD projects that received funding during Fiscal Year 2006.

  13. Annual Proceedings of Selected Research and Development Papers Presented at the Annual Convention of the Association for Educational Communications and Technology (31st, Orlando, FL, 2008)

    Science.gov (United States)

    Simonson, Michael, Ed.

    2008-01-01

    For the thirty-first year, the Research and Theory Division of the Association for Educational Communications and Technology (AECT) sponsored the publication of these Proceedings. Papers were presented at the annual AECT Convention in Orlando, Florida. This year's Proceedings has two sections--Section 1 includes research and development papers and…

  14. Development of marker-free transgenic lettuce resistant to Mirafiori lettuce big-vein virus.

    Science.gov (United States)

    Kawazu, Yoichi; Fujiyama, Ryoi; Imanishi, Shunsuke; Fukuoka, Hiroyuki; Yamaguchi, Hirotaka; Matsumoto, Satoru

    2016-10-01

    Lettuce big-vein disease caused by Mirafiori lettuce big-vein virus (MLBVV) is found in major lettuce production areas worldwide, but highly resistant cultivars have not yet been developed. To produce MLBVV-resistant marker-free transgenic lettuce that would have a transgene with a promoter and terminator of lettuce origin, we constructed a two T-DNA binary vector, in which the first T-DNA contained the selectable marker gene neomycin phosphotransferase II, and the second T-DNA contained the lettuce ubiquitin gene promoter and terminator and inverted repeats of the coat protein (CP) gene of MLBVV. This vector was introduced into lettuce cultivars 'Watson' and 'Fuyuhikari' by Agrobacterium tumefaciens-mediated transformation. Regenerated plants (T0 generation) that were CP gene-positive by PCR analysis were self-pollinated, and 312 T1 lines were analyzed for resistance to MLBVV. Virus-negative plants were checked for the CP gene and the marker gene, and nine lines were obtained which were marker-free and resistant to MLBVV. Southern blot analysis showed that three of the nine lines had two copies of the CP gene, whereas six lines had a single copy and were used for further analysis. Small interfering RNAs, which are indicative of RNA silencing, were detected in all six lines. MLBVV infection was inhibited in all six lines in resistance tests performed in a growth chamber and a greenhouse, resulting in a high degree of resistance to lettuce big-vein disease. Transgenic lettuce lines produced in this study could be used as resistant cultivars or parental lines for breeding.

  15. Environmental DNA Marker Development with Sparse Biological Information: A Case Study on Opossum Shrimp (Mysis diluviana).

    Science.gov (United States)

    Carim, Kellie J; Christianson, Kyle R; McKelvey, Kevin M; Pate, William M; Silver, Douglas B; Johnson, Brett M; Galloway, Bill T; Young, Michael K; Schwartz, Michael K

    2016-01-01

    The spread of Mysis diluviana, a small glacial relict crustacean, outside its native range has led to unintended shifts in the composition of native fish communities throughout western North America. As a result, biologists seek accurate methods of determining the presence of M. diluviana, especially at low densities or during the initial stages of an invasion. Environmental DNA (eDNA) provides one solution for detecting M. diluviana, but building eDNA markers that are both sensitive and species-specific is challenging when the distribution and taxonomy of closely related non-target taxa are poorly understood, published genetic data are sparse, and tissue samples are difficult to obtain. To address these issues, we developed a pair of independent eDNA markers to increase the likelihood of a positive detection of M. diluviana when present and reduce the probability of false positive detections from closely related non-target species. Because tissue samples of closely-related and possibly sympatric, non-target taxa could not be obtained, we used synthetic DNA sequences of closely related non-target species to test the specificity of eDNA markers. Both eDNA markers yielded positive detections from five waterbodies where M. diluviana was known to be present, and no detections in five others where this species was thought to be absent. Daytime samples from varying depths in one waterbody occupied by M. diluviana demonstrated that samples near the lake bottom produced 5 to more than 300 times as many eDNA copies as samples taken at other depths, but all samples tested positive regardless of depth.

  16. SEXCMD: Development and validation of sex marker sequences for whole-exome/genome and RNA sequencing.

    Science.gov (United States)

    Jeong, Seongmun; Kim, Jiwoong; Park, Won; Jeon, Hongmin; Kim, Namshin

    2017-01-01

    Over the last decade, a large number of nucleotide sequences have been generated by next-generation sequencing technologies and deposited to public databases. However, most of these datasets do not specify the sex of individuals sampled because researchers typically ignore or hide this information. Male and female genomes in many species have distinctive sex chromosomes, XX/XY and ZW/ZZ, and expression levels of many sex-related genes differ between the sexes. Herein, we describe how to develop sex marker sequences from syntenic regions of sex chromosomes and use them to quickly identify the sex of individuals being analyzed. Array-based technologies routinely use either known sex markers or the B-allele frequency of X or Z chromosomes to deduce the sex of an individual. The same strategy has been used with whole-exome/genome sequence data; however, all reads must be aligned onto a reference genome to determine the B-allele frequency of the X or Z chromosomes. SEXCMD is a pipeline that can extract sex marker sequences from reference sex chromosomes and rapidly identify the sex of individuals from whole-exome/genome and RNA sequencing after training with a known dataset through a simple machine learning approach. The pipeline counts total numbers of hits from sex-specific marker sequences and identifies the sex of the individuals sampled based on the fact that XX/ZZ samples do not have Y or W chromosome hits. We have successfully validated our pipeline with mammalian (Homo sapiens; XY) and avian (Gallus gallus; ZW) genomes. Typical calculation time when applying SEXCMD to human whole-exome or RNA sequencing datasets is a few minutes, and analyzing human whole-genome datasets takes about 10 minutes. Another important application of SEXCMD is as a quality control measure to avoid mixing samples before bioinformatics analysis. SEXCMD comprises simple Python and R scripts and is freely available at https://github.com/lovemun/SEXCMD.

  17. An atlas of transcriptional, chromatin accessibility, and surface marker changes in human mesoderm development.

    Science.gov (United States)

    Koh, Pang Wei; Sinha, Rahul; Barkal, Amira A; Morganti, Rachel M; Chen, Angela; Weissman, Irving L; Ang, Lay Teng; Kundaje, Anshul; Loh, Kyle M

    2016-12-20

    Mesoderm is the developmental precursor to myriad human tissues including bone, heart, and skeletal muscle. Unravelling the molecular events through which these lineages become diversified from one another is integral to developmental biology and understanding changes in cellular fate. To this end, we developed an in vitro system to differentiate human pluripotent stem cells through primitive streak intermediates into paraxial mesoderm and its derivatives (somites, sclerotome, dermomyotome) and separately, into lateral mesoderm and its derivatives (cardiac mesoderm). Whole-population and single-cell analyses of these purified populations of human mesoderm lineages through RNA-seq, ATAC-seq, and high-throughput surface marker screens illustrated how transcriptional changes co-occur with changes in open chromatin and surface marker landscapes throughout human mesoderm development. This molecular atlas will facilitate study of human mesoderm development (which cannot be interrogated in vivo due to restrictions on human embryo studies) and provides a broad resource for the study of gene regulation in development at the single-cell level, knowledge that might one day be exploited for regenerative medicine.

  18. 77 FR 68047 - Policy Statement on the Principles for Development and Distribution of Annual Stress Test Scenarios

    Science.gov (United States)

    2012-11-15

    ... of Annual Stress Test Scenarios AGENCY: Office of the Comptroller of the Currency (OCC), Treasury... general processes and factors to be used by the OCC in development and distributing the stress test scenarios for the annual stress test required by the Dodd- Frank Wall Street Reform and Consumer...

  19. Rapid Development of Microsatellite Markers for Plantago ovata Forsk.: Using Next Generation Sequencing and Their Cross-Species Transferability

    Directory of Open Access Journals (Sweden)

    Ranbir Singh Fougat

    2014-06-01

    Full Text Available Isabgol (Plantago ovata Forsk. is an important medicinal plant having high pharmacological activity in its seed husk, which is substantially used in the food, beverages and packaging industries. Nevertheless, isabgol lags behind in research, particularly for genomic resources, like molecular markers, genetic maps, etc. Presently, molecular markers can be easily developed through next generation sequencing technologies, more efficiently, cost effectively and in less time than ever before. This study was framed keeping in view the need to develop molecular markers for this economically important crop by employing a microsatellite enrichment protocol using a next generation sequencing platform (ion torrent PGM™ to obtain simple sequence repeats (SSRs for Plantago ovata for the very first time. A total of 3447 contigs were assembled, which contained 249 SSRs. Thirty seven loci were randomly selected for primer development; of which, 30 loci were successfully amplified. The developed microsatellite markers showed the amplification of the expected size and cross-amplification in another six species of Plantago. The SSR markers were unable to show polymorphism within P. ovata, suggesting that low variability exists within genotypes of P. ovata. This study suggests that PGM™ sequencing is a rapid and cost-effective tool for developing SSR markers for non-model species, and the markers so-observed could be useful in the molecular breeding of P. ovata.

  20. Microsatellite marker isolation and development for the giant Pacific Octopus (Enteroctopus dofleini)

    Science.gov (United States)

    Toussaint, Rebecca K.; Sage, G. Kevin; Talbot, Sandra L.; Scheel, David

    2012-01-01

    We isolated and developed 18 novel microsatellite markers for the giant Pacific octopus (Enteroctopus dofleini) and examined them for 31 individuals from Prince William Sound (PWS), Alaska. These loci displayed moderate levels of allelic diversity (averaging 11 alleles per locus) and heterozygosity (averaging 65%). Seven loci deviated from Hardy–Weinberg Equilibrium (HWE) due to heterozygote deficiency for the PWS population, although deviations were not observed for all these loci in other populations, suggesting the PWS population is not in mutation-drift equilibrium. These novel microsatellite loci yielded sufficient genetic diversity for potential use in population genetics, individual identification, and parentage studies.

  1. Hybrid Rice Resistant to Bacterial Leaf Blight Developed By Marker Assisted Selection

    Institute of Scientific and Technical Information of China (English)

    CAO; Li-yong; ZHUANG; Jie-yun; YUAN; Shou-jiang; ZHAN; Xiao-deng; ZHENG; Kang-le; CHENG; Shi-hua

    2003-01-01

    Through recurrént backcrossing in combination with molecular marker-assisted selection (MAS), restorer lines R8006 and R1176 carrying Xa-21 , a gene having broad-spectrum resistance to rice bacterial leaf blight, were selected. By crossing the two lines to CMS line Zhong 9A, two new hybrid rice combinations, Zhongyou 6 and Zhongyou 1176 were developed. The hybrids showed high resistance to diseases, good grain quality and high yielding potential in national and provincial adaptability and yield trials.

  2. Development of a novel set of microsatellite markers for castor bean, Ricinus communis (Euphorbiaceae).

    Science.gov (United States)

    Bajay, Miklos Maximiliano; Zucchi, Maria Imaculada; Kiihl, Tammy Aparecida Manabe; Batista, Carlos Eduardo Araújo; Monteiro, Mariza; Pinheiro, José Baldin

    2011-04-01

    Microsatellite primers were developed for castor bean (Ricinus communis L.) to investigate genetic diversity and population structure, and to provide support to germplasm management. Eleven microsatellite loci were isolated using an enrichment cloning protocol and used to characterize castor bean germplasm from the collection at the Instituto Agronômico de Campinas (IAC). In a survey of 76 castor bean accessions, the investigated loci displayed polymorphism ranging from two to five alleles. The information derived from microsatellite markers led to significant gains in conserved allelic richness and provides support to the implementation of several molecular breeding strategies for castor bean.

  3. Development and bin mapping of a Rosaceae Conserved Ortholog Set (COS of markers

    Directory of Open Access Journals (Sweden)

    Kozik Alex

    2009-01-01

    Full Text Available Abstract Background Detailed comparative genome analyses within the economically important Rosaceae family have not been conducted. This is largely due to the lack of conserved gene-based molecular markers that are transferable among the important crop genera within the family [e.g. Malus (apple, Fragaria (strawberry, and Prunus (peach, cherry, apricot and almond]. The lack of molecular markers and comparative whole genome sequence analysis for this family severely hampers crop improvement efforts as well as QTL confirmation and validation studies. Results We identified a set of 3,818 rosaceaous unigenes comprised of two or more ESTs that correspond to single copy Arabidopsis genes. From this Rosaceae Conserved Orthologous Set (RosCOS, 1039 were selected from which 857 were used for the development of intron-flanking primers and allele amplification. This led to successful amplification and subsequent mapping of 613 RosCOS onto the Prunus TxE reference map resulting in a genome-wide coverage of 0.67 to 1.06 gene-based markers per cM per linkage group. Furthermore, the RosCOS primers showed amplification success rates from 23 to 100% across the family indicating that a substantial part of the RosCOS primers can be directly employed in other less studied rosaceaous crops. Comparisons of the genetic map positions of the RosCOS with the physical locations of the orthologs in the Populus trichocarpa genome identified regions of colinearity between the genomes of Prunus-Rosaceae and Populus-Salicaceae. Conclusion Conserved orthologous genes are extremely useful for the analysis of genome evolution among closely and distantly related species. The results presented in this study demonstrate the considerable potential of the mapped Prunus RosCOS for genome-wide marker employment and comparative whole genome studies within the Rosaceae family. Moreover, these markers will also function as useful anchor points for the genome sequencing efforts currently

  4. Development of a Behavioural Marker System for Rating Cadet’s Non-Technical Skills

    Directory of Open Access Journals (Sweden)

    Victor Fernando PlÁcido da ConceiçÌo

    2017-06-01

    Full Text Available Despite the adoption of crew resource management training for bridge teams over the last decades, the training is still heavily focussed on technical achievements. In an educational context, the situation is more problematical, since with requirement of developing the technical skills, there is a need to build and evaluate the non-technical skills of cadets with little experience in bridge team management. In parallel with the application of team leadership models, the Portuguese Naval Academy conducted a research to improve the development and assessment of non-technical skills in bridge simulators. This paper describes the method used to identify the key non-technical skills required for naval cadets and to develop a behavioural marker system for their measurement. A literature review of behavioural marker systems was supplemented with an analysis of interviews conducted with students and simulator instructors. Additionally, further analysis of Portuguese Navy accidents reports was made, applying the HFACS framework to identify the relevant non-technical skills involved in the accidents. The resulting rating system covers five skill categories (leadership, situational awareness, communication, team work and decision making, each one with three rating elements. The framework is currently under evaluation tests in bridge simulators sessions, within an educational context.

  5. Development of microsatellite markers and their correlation with morphological and chemical markers in Withania somnifera (L. Dunal

    Directory of Open Access Journals (Sweden)

    Punit Kumar Khanna

    2016-04-01

    Full Text Available The genetic variation and relationships among 14 Withania accessions were evaluated using morphological, chemical and Simple Sequence Repeat (SSR markers. Wild accessions are more robust and better performing in morphological and chemical metabolite accumulation than cultivated one. The results revealed that out of fourteen, four primers showed distinct polymorphism, indicating the robust nature of microsatellites in revealing polymorphism. The banding pattern was recorded in the form of 0-1 data sheet which was analyzed using unweighted pair group method with arithmetic mean (UPGMA based on Jaccard's similarity coefficient. The cluster analysis showed higher level of genetic variation among the accessions. Similarity coefficients ranged from 0.125 to 1. The dendrogram revealed 3 major distinct clusters. Higher range of similarity values for related genotypes using simple sequence repeats (SSR provides greater confidence for the assessment of genetic diversity and relationships. The polymorphism information content (PIC value for the SSR loci ranged from 0.0 to 0.40. Higher PIC values were associated with higher level of polymorphism. Results of this study showed a high degree of variation among analyzed accessions, indicating an important source of genetic diversity that can be used in future breeding programs.

  6. Laboratory Directed Research and Development Program FY2016 Annual Summary of Completed Projects

    Energy Technology Data Exchange (ETDEWEB)

    None, None

    2017-03-30

    ORNL FY 2016 Annual Summary of Laboratory Directed Research and Development Program (LDRD) Completed Projects. The Laboratory Directed Research and Development (LDRD) program at ORNL operates under the authority of DOE Order 413.2C, “Laboratory Directed Research and Development” (October 22, 2015), which establishes DOE’s requirements for the program while providing the Laboratory Director broad flexibility for program implementation. The LDRD program funds are obtained through a charge to all Laboratory programs. ORNL reports its status to DOE in March of each year.

  7. Development of unigene-derived SSR markers in cowpea (Vigna unguiculata) and their transferability to other Vigna species.

    Science.gov (United States)

    Gupta, S K; Gopalakrishna, T

    2010-07-01

    Unigene sequences available in public databases provide a cost-effective and valuable source for the development of molecular markers. In this study, the identification and development of unigene-based SSR markers in cowpea (Vigna unguiculata (L.) Walp.) is presented. A total of 1071 SSRs were identified in 15 740 cowpea unigene sequences downloaded from the National Center for Biotechnology Information. The most frequent SSR motifs present in the unigenes were trinucleotides (59.7%), followed by dinucleotides (34.8%), pentanucleotides (4%), and tetranucleotides (1.5%). The copy number varied from 6 to 33 for dinucleotide, 5 to 29 for trinucleotide, 5 to 7 for tetranucleotide, and 4 to 6 for pentanucleotide repeats. Primer pairs were successfully designed for 803 SSR motifs and 102 SSR markers were finally characterized and validated. Putative function was assigned to 64.7% of the unigene SSR markers based on significant homology to reported proteins. About 31.7% of the SSRs were present in coding sequences and 68.3% in untranslated regions of the genes. About 87% of the SSRs located in the coding sequences were trinucleotide repeats. Allelic variation at 32 SSR loci produced 98 alleles in 20 cowpea genotypes. The polymorphic information content for the SSR markers varied from 0.10 to 0.83 with an average of 0.53. These unigene SSR markers showed a high rate of transferability (88%) across other Vigna species, thereby expanding their utility. Alignment of unigene sequences with soybean genomic sequences revealed the presence of introns in amplified products of some of the SSR markers. This study presents the distribution of SSRs in the expressed portion of the cowpea genome and is the first report of the development of functional unigene-based SSR markers in cowpea. These SSR markers would play an important role in molecular mapping, comparative genomics, and marker-assisted selection strategies in cowpea and other Vigna species.

  8. Development and characterisation of microsatellite markers for Liporrhopalum tentacularis Grandi, the pollinator fig wasp of Ficus montana Blume

    NARCIS (Netherlands)

    Zavodna, M.; Arens, P.; Vosman, B.; Van Dijk, P.J.; Van Damme, J.M.M.

    2002-01-01

    Microsatellite markers for the pollinator fig wasp Liporrhopalum tentacularis were developed using genomic libraries enriched for di-, tri- and tetranucleotide repeats. A subset of 31 positive clones was sequenced and primers were designed. Eleven primer pairs produced polymorphic amplification prod

  9. Development and use of genic molecular markers (GMMs) for construction of a transcript map of chickpea (Cicer arietinum L.).

    Science.gov (United States)

    Gujaria, Neha; Kumar, Ashish; Dauthal, Preeti; Dubey, Anuja; Hiremath, Pavana; Bhanu Prakash, A; Farmer, Andrew; Bhide, Mangla; Shah, Trushar; Gaur, Pooran M; Upadhyaya, Hari D; Bhatia, Sabhyata; Cook, Douglas R; May, Greg D; Varshney, Rajeev K

    2011-05-01

    A transcript map has been constructed by the development and integration of genic molecular markers (GMMs) including single nucleotide polymorphism (SNP), genic microsatellite or simple sequence repeat (SSR) and intron spanning region (ISR)-based markers, on an inter-specific mapping population of chickpea, the third food legume crop of the world and the first food legume crop of India. For SNP discovery through allele re-sequencing, primer pairs were designed for 688 genes/expressed sequence tags (ESTs) of chickpea and 657 genes/ESTs of closely related species of chickpea. High-quality sequence data obtained for 220 candidate genic regions on 2-20 genotypes representing 9 Cicer species provided 1,893 SNPs with an average frequency of 1/35.83 bp and 0.34 PIC (polymorphism information content) value. On an average 2.9 haplotypes were present in 220 candidate genic regions with an average haplotype diversity of 0.6326. SNP2CAPS analysis of 220 sequence alignments, as mentioned above, provided a total of 192 CAPS candidates. Experimental analysis of these 192 CAPS candidates together with 87 CAPS candidates identified earlier through in silico mining of ESTs provided scorable amplification in 173 (62.01%) cases of which predicted assays were validated in 143 (82.66%) cases (CGMM). Alignments of chickpea unigenes with Medicago truncatula genome were used to develop 121 intron spanning region (CISR) markers of which 87 yielded scorable products. In addition, optimization of 77 EST-derived SSR (ICCeM) markers provided 51 scorable markers. Screening of easily assayable 281 markers including 143 CGMMs, 87 CISRs and 51 ICCeMs on 5 parental genotypes of three mapping populations identified 104 polymorphic markers including 90 markers on the inter-specific mapping population. Sixty-two of these GMMs together with 218 earlier published markers (including 64 GMM loci) and 20 other unpublished markers could be integrated into this genetic map. A genetic map developed here

  10. Comparative genomic analysis reveals species-dependent complexities that explain difficulties with microsatellite marker development in molluscs

    OpenAIRE

    2010-01-01

    Reliable population DNA molecular markers are difficult to develop for molluscs, the reasons for which are largely unknown. Identical protocols for microsatellite marker development were implemented in three gastropods. Success rates were lower for Gibbula cineraria compared to Littorina littorea and L. saxatilis. Comparative genomic analysis of 47.2 kb of microsatellite containing sequences (MCS) revealed a high incidence of cryptic repetitive DNA in their flanking regions. The majority of t...

  11. Adenylate Cyclase Type III Is Not a Ubiquitous Marker for All Primary Cilia during Development

    Science.gov (United States)

    Antal, Maria Cristina; Bénardais, Karelle; Samama, Brigitte; Auger, Cyril; Schini-Kerth, Valérie; Ghandour, Said; Boehm, Nelly

    2017-01-01

    Adenylate cyclase type III (AC3) is localized in plasma membrane of neuronal primary cilium and can be used as a marker of this cilium. AC3 has also been detected in some other primary cilia such as those of fibroblasts, synoviocytes or astrocytes. Despite the presence of a cilium in almost all cell types, we show that AC3 is not a common marker of all primary cilia of different human and mouse tissues during development. In peripheral organs, AC3 is present mainly in primary cilia in cells of the mesenchymal lineage (fibroblasts, chondroblasts, osteoblasts-osteocytes, odontoblasts, muscle cells and endothelial cells). In epithelia, the apical cilium of renal and pancreatic tubules and of ductal plate in liver is AC3-negative whereas the cilium of basal cells of stratified epithelia is AC3-positive. Using fibroblasts cell culture, we show that AC3 appears at the plasma membrane of the primary cilium as soon as this organelle develops. The functional significance of AC3 localization at the cilium membrane in some cells but not others has to be investigated in relationship with cell physiology and expression at the cilium plasma membrane of specific upstream receptors. PMID:28122017

  12. Development of CAPS markers to identify Indian tea (Camellia sinensis) clones with high catechin content.

    Science.gov (United States)

    Elangbam, M; Misra, A K

    2016-06-10

    Tea leaves are rich in plant secondary phenolics, especially flavonoids. Catechins are considered to be the most valuable flavonoids, and the catechin content in tea is an important trait for determining its quality. We have developed cleaved amplified polymorphic sequence (CAPS)-based markers for evaluating total catechin content that target two important secondary metabolite pathway genes, PAL (phenylalanine ammonia-lyase) and CHS (chalcone synthase). Catechin content levels in the tea samples tested ranged from 9 to 33 mg/mg. The CAPS technique identified clones with the homozygous profile PRc1, which has relatively lower catechin content than clones with the heterozygous profile PRc2. A significant difference (t = 16.85) in the level of catechin content was also detected between heterozygotes and homozygotes in the tea seed stock TS379. We found a polynomial relationship between the marker developed for CHS2 and catechin content in these tea samples with R2 = 0.9788. Moreover, PAL has less of a relationship with catechin content. Therefore, we recommend tea clones with heterozygous CAPS profiles for the gene CHS2+RcaI for the further improvement in these clones.

  13. Characterization of microsatellite DNA libraries from three mealybug species and development of microsatellite markers for Pseudococcus viburni (Hemiptera: Pseudococcidae).

    Science.gov (United States)

    Correa, M C G; Zaviezo, T; Le Maguet, J; Herrbach, E; Malausa, T

    2014-04-01

    Mealybugs (Hemiptera: Pseudococcidae) are important pests for crops worldwide. Different species, cryptic taxa under the same species name or even populations within a species can differ in biological characteristics, such as phenology, resistance to insecticides, virus transmission and susceptibility to natural enemies. Therefore, their management efficacy depends on their accurate identification. Microsatellite genetic markers are efficient in revealing the fine-scale taxonomic status of insects, both at inter- and intra-specific level. Despite their potential uses, microsatellites have been developed only for one mealybug species so far. Hence, it is unclear whether microsatellites may be useful to assess mealybug population differentiation and structuring. In this work, we tested the feasibility of developing microsatellite markers in mealybugs by: (i) producing and characterizing microsatellite DNA libraries for three species: Pseudococcus viburni, Pseudococcus comstocki and Heliococcus bohemicus, and (ii) by developing and testing markers for Ps. viburni. The obtained libraries contained balanced percentages of dinucleotide (ranging from 15 to 25%) and trinucleotide (from 5 to 17%) motifs. The marker setup for Ps. viburni was successful, although 70% of the primers initially tested were discarded for a lack of polymorphism. Finally, 25 markers were combined in two multiplex polymerase chain reactions with 21 displaying no evidence of deviation from Hardy-Weinberg equilibrium. Ps. viburni markers were tested on one population from France and one from Chile. The markers revealed a significant genetic differentiation between the two populations with an Fst estimate of 0.266.

  14. Development of new gene-specific markers associated with salt tolerance for mungbean (Vigna radiata L. Wilczek

    Directory of Open Access Journals (Sweden)

    Nirmala Sehrawat

    2014-07-01

    Full Text Available Thirty eight novel microsatellite markers (SSRs specific to candidate genes involved in salt tolerance were developed for detection of genetic variations in 12 mungbean genotypes variably adapted to salt stress. A 100 out of 124 putative alleles were found polymorphic between wild and cultivated genotypes (inter-specific, 80.65%, 65 were within cultivars of mungbean (intra-specific, 52.42% and 52 were within wild genotypes (inter-specific, 41.94%. The polymorphism varied from 86.84% to 100%, while the number of polymorphic alleles ranged from 1 to 4 with an average value of 2.63 per locus. The polymorphism information content (PIC values ranged from 0.326 to 0.875 with an average value of 0.671, which shows their effectiveness in genetic analysis. Cluster analysis resulted in the distribution of salt tolerant and susceptible genotypes in separate groups which revealed the presence of inherent variations among mungbean cultivars. These variations were explored effectively for SSR markers studies. The developed SSR markers may help along with already available markers to execute further research on mungbean. The markers may be coupled with specific loci linked with salt tolerance. The developed markers will help to identify the QTLs (quantitative trait loci or other important genes. These markers can also be utilized for testing the purity of hybrids or diversity assessment of Vigna species for important agronomic traits.

  15. Microsatellite markers of water buffalo, Bubalus bubalis - development, characterisation and linkage disequilibrium studies

    Directory of Open Access Journals (Sweden)

    Vaidhegi R

    2009-10-01

    Full Text Available Abstract Background Microsatellite markers are highly polymorphic and widely used in genome mapping and population genetic studies in livestock species. River buffalo, Bubalus bubalis is an economically important livestock species, though only a limited number of microsatellite markers have been reported thus far in this species. Results In the present study, using two different approaches 571 microsatellite markers have been characterized for water buffalo. Of the 571 microsatellite markers, 498 were polymorphic with average heterozygosity of 0.51 on a panel of 24 unrelated buffalo. Fisher exact test was used to detect LD between the marker pairs. Among the 137550 pairs of marker combination, 14.58% pairs showed significant LD (P Conclusion The high conservation of cattle microsatellite loci in water buffalo promises the usefulness of the cattle microsatellites markers on buffalo. The polymorphic markers characterised in this study will contribute to genetic linkage and radiation hybrid mapping of water buffalo and population genetic studies.

  16. Characterization of flower-bud transcriptome and development of genic SSR markers in Asian lotus (Nelumbo nucifera Gaertn..

    Directory of Open Access Journals (Sweden)

    Weiwei Zhang

    Full Text Available Asian lotus (Nelumbo nucifera Gaertn. is the national flower of India, Vietnam, and one of the top ten traditional Chinese flowers. Although lotus is highly valued for its ornamental, economic and cultural uses, genomic information, particularly the expressed sequence based (genic markers is limited. High-throughput transcriptome sequencing provides large amounts of transcriptome data for promoting gene discovery and development of molecular markers.In this study, 68,593 unigenes were assembled from 1.34 million 454 GS-FLX sequence reads of a mixed flower-bud cDNA pool derived from three accessions of N. nucifera. A total of 5,226 SSR loci were identified, and 3,059 primer pairs were designed for marker development. Di-nucleotide repeat motifs were the most abundant type identified with a frequency of 65.2%, followed by tri- (31.7%, tetra- (2.1%, penta- (0.5% and hexa-nucleotide repeats (0.5%. A total of 575 primer pairs were synthesized, of which 514 (89.4% yielded PCR amplification products. In eight Nelumbo accessions, 109 markers were polymorphic. They were used to genotype a sample of 44 accessions representing diverse wild and cultivated genotypes of Nelumbo. The number of alleles per locus varied from 2 to 9 alleles and the polymorphism information content values ranged from 0.6 to 0.9. We performed genetic diversity analysis using 109 polymorphic markers. A UPGMA dendrogram was constructed based on Jaccard's similarity coefficients revealing distinct clusters among the 44 accessions.Deep transcriptome sequencing of lotus flower buds developed 3,059 genic SSRs, making a significant addition to the existing SSR markers in lotus. Among them, 109 polymorphic markers were successfully validated in 44 accessions of Nelumbo. This comprehensive set of genic SSR markers developed in our study will facilitate analyses of genetic diversity, construction of linkage maps, gene mapping, and marker-assisted selection breeding for lotus.

  17. Genome-wide distribution and organization of microsatellites in plants: an insight into marker development in Brachypodium.

    Science.gov (United States)

    Sonah, Humira; Deshmukh, Rupesh K; Sharma, Anshul; Singh, Vinay P; Gupta, Deepak K; Gacche, Raju N; Rana, Jai C; Singh, Nagendra K; Sharma, Tilak R

    2011-01-01

    Plant genomes are complex and contain large amounts of repetitive DNA including microsatellites that are distributed across entire genomes. Whole genome sequences of several monocot and dicot plants that are available in the public domain provide an opportunity to study the origin, distribution and evolution of microsatellites, and also facilitate the development of new molecular markers. In the present investigation, a genome-wide analysis of microsatellite distribution in monocots (Brachypodium, sorghum and rice) and dicots (Arabidopsis, Medicago and Populus) was performed. A total of 797,863 simple sequence repeats (SSRs) were identified in the whole genome sequences of six plant species. Characterization of these SSRs revealed that mono-nucleotide repeats were the most abundant repeats, and that the frequency of repeats decreased with increase in motif length both in monocots and dicots. However, the frequency of SSRs was higher in dicots than in monocots both for nuclear and chloroplast genomes. Interestingly, GC-rich repeats were the dominant repeats only in monocots, with the majority of them being present in the coding region. These coding GC-rich repeats were found to be involved in different biological processes, predominantly binding activities. In addition, a set of 22,879 SSR markers that were validated by e-PCR were developed and mapped on different chromosomes in Brachypodium for the first time, with a frequency of 101 SSR markers per Mb. Experimental validation of 55 markers showed successful amplification of 80% SSR markers in 16 Brachypodium accessions. An online database 'BraMi' (Brachypodium microsatellite markers) of these genome-wide SSR markers was developed and made available in the public domain. The observed differential patterns of SSR marker distribution would be useful for studying microsatellite evolution in a monocot-dicot system. SSR markers developed in this study would be helpful for genomic studies in Brachypodium and related

  18. Genome-wide distribution and organization of microsatellites in plants: an insight into marker development in Brachypodium.

    Directory of Open Access Journals (Sweden)

    Humira Sonah

    Full Text Available Plant genomes are complex and contain large amounts of repetitive DNA including microsatellites that are distributed across entire genomes. Whole genome sequences of several monocot and dicot plants that are available in the public domain provide an opportunity to study the origin, distribution and evolution of microsatellites, and also facilitate the development of new molecular markers. In the present investigation, a genome-wide analysis of microsatellite distribution in monocots (Brachypodium, sorghum and rice and dicots (Arabidopsis, Medicago and Populus was performed. A total of 797,863 simple sequence repeats (SSRs were identified in the whole genome sequences of six plant species. Characterization of these SSRs revealed that mono-nucleotide repeats were the most abundant repeats, and that the frequency of repeats decreased with increase in motif length both in monocots and dicots. However, the frequency of SSRs was higher in dicots than in monocots both for nuclear and chloroplast genomes. Interestingly, GC-rich repeats were the dominant repeats only in monocots, with the majority of them being present in the coding region. These coding GC-rich repeats were found to be involved in different biological processes, predominantly binding activities. In addition, a set of 22,879 SSR markers that were validated by e-PCR were developed and mapped on different chromosomes in Brachypodium for the first time, with a frequency of 101 SSR markers per Mb. Experimental validation of 55 markers showed successful amplification of 80% SSR markers in 16 Brachypodium accessions. An online database 'BraMi' (Brachypodium microsatellite markers of these genome-wide SSR markers was developed and made available in the public domain. The observed differential patterns of SSR marker distribution would be useful for studying microsatellite evolution in a monocot-dicot system. SSR markers developed in this study would be helpful for genomic studies in Brachypodium

  19. Using the chicken genome sequence in the development and mapping of genetic markers in the turkey (Meleagris gallopavo).

    Science.gov (United States)

    Chaves, L D; Knutson, T P; Krueth, S B; Reed, K M

    2006-04-01

    The efficacy of employing the chicken genome sequence in developing genetic markers and in mapping the turkey genome was studied. Eighty previously uncharacterized microsatellite markers were identified for the turkey using BLAST alignment to the chicken genome. The chicken sequence was then used to develop primers for polymerase chain reaction where the turkey sequence was either unavailable or insufficient. A total of 78 primer sets were tested for amplification and polymorphism in the turkey, and informative markers were genetically mapped. Sixty-five (83%) amplified turkey genomic DNA, and 33 (42%) were polymorphic in the University of Minnesota/Nicholas Turkey Breeding Farms mapping families. All but one marker genetically mapped to the position predicted from the chicken genome sequence. These results demonstrate the usefulness of the chicken sequence for the development of genomic resources in other avian species.

  20. Development of an affordable typing method for Meyerozyma guilliermondii using microsatellite markers.

    Science.gov (United States)

    Wrent, Petra; Rivas, Eva-María; Peinado, José M; de Silóniz, María-Isabel

    2016-01-18

    Despite previously published methods, there is still a lack of rapid and affordable methods for genotyping the Meyerozyma guilliermondii yeast species. The development of microsatellite markers is a useful genotyping method in several yeast species. Using the Tandem Repeat Finder Software, a total of 19 microsatellite motifs (di-, tri-, and tetra- repetition) were found in silico in seven of the nine scaffolds published so far. Primer pairs were designed for all of them, although only four were used in this work. All microsatellite amplifications showed size polymorphism, and the results were identical when repeated. The combination of three microsatellite markers (sc15F/R, sc32 F/R and sc72 F/R) produced a different pattern for each of the Type Culture Collection strains of M. guilliermondii used to optimize the method. The three primer pairs can be used in the same PCR reaction, which reduces costs, in tandem with the fluorescent labeling of only the forward primer in each primer pair. Microsatellite typing was applied on 40 more M. guilliermondii strains. The results showed that no pattern is repeated between the different environmental niches. Four M. guilliermondii strains were only amplified with primer pair sc32 F/R, and subsequently identified as Meyerozyma caribbica by Taq I-RFLP of the 5.8S ITS rDNA. Most out-group species gave negative results even for physiologically similarly species such as Debaryomyces hansenii. The microsatellite markers used in this work were stable over time, which enables their use as a traceability tool.

  1. Development and multiplexing of microsatellite markers using pyrosequencing in the clonal plant Comarum palustre (Rosaceae).

    Science.gov (United States)

    Somme, L; Raabová, J; Jacquemart, A L; Raspé, O

    2012-01-01

    Microsatellites represent one of the most commonly used genetic markers for population genetic studies. Traditionally, their development is quite time consuming, requiring construction of a genomic library enriched for repeated motifs. Using pyrosequencing, a fast and cost-effective new generation sequencing technique, we produced 24,340,862 bases in 63,860 short fragment reads, including 1170 dinucleotide motifs with a minimum of six repeats and 1383 trinucleotide motifs with a minimum of four repeats for the Marsh Cinquefoil, Comarum palustre L., an endangered marsh pioneer species. We selected 58 loci with SSR (Short Sequence Repeat) segments (at least 10 repeats) for a preliminary screening. Out of them, we screened 29 loci on a capillary sequencer after ligation in a vector and PCR using T7 forward primer labelled with FAM fluorescent dye and the specific unlabeled reverse primers. This procedure allowed us to screen large number of candidate loci with the same labelled primer and unlabelled specific primers. Finally, we characterized 20 polymorphic microsatellite markers, nine dinucleotides and 11 trinucleotides. We used these markers to assess genetic diversity and clonal structure in two Belgian populations. All loci showed a maximum of two alleles per individual, suggesting that they are from a diploid genome. One genet was detected in a newly extending population while 53 different genets in a long-term ecologically managed population. The number of alleles per locus ranged from 6 to 14 in this old population with an expected heterozygosity, ranging from 0.5964 to 0.8278. These preliminary results show a genet size up to 7.2 m.

  2. De novo transcriptome analysis and molecular marker development of two Hemarthria species

    Directory of Open Access Journals (Sweden)

    Xiu eHuang

    2016-04-01

    Full Text Available Hemarthria R. Br. is an important genus of perennial forage grasses that is widely used in subtropical and tropical regions. Hemarthria grasses have made remarkable contributions to the development of animal husbandry and agro-ecosystem maintenance; however, there is currently a lack of comprehensive genomic data available for these species. In this study, we used Illumina high-throughput deep sequencing to characterize of two agriculturally important Hemarthria materials, H. compressa ‘Yaan’ and H. altissima ‘1110.’ Sequencing runs that used each of four normalized RNA samples from the leaves or roots of the two materials yielded more than 24 million high-quality reads. After de novo assembly, 137,142 and 77,150 unigenes were obtained for ‘Yaan’ and ‘1110’, respectively. In addition, a total of 86,731 ‘Yaan’ and 48,645 ‘1110’ unigenes were successfully annotated. After consolidating the unigenes for both materials, 42,646 high-quality SNPs were identified in 10,880 unigenes and 10,888 SSRs were identified in 8,330 unigenes. To validate the identified markers, high quality PCR primers were designed for both SNPs and SSRs. We randomly tested 16 of the SNP primers and 54 of the SSR primers and found that the majority of these primers successfully amplified the desired PCR product. In addition, high cross-species transferability (61.11%-87.04% of SSR markers was achieved for four other Poaceae species. The amount of RNA sequencing data that was generated for these two Hemarthria species greatly increases the amount of genomic information available for Hemarthria and the SSR and SNP markers identified in this study will facilitate further advancements in genetic and molecular studies of the Hemarthria genus.

  3. Developing single nucleotide polymorphism markers for the identification of pineapple (Ananas comosus) germplasm.

    Science.gov (United States)

    Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng

    2015-01-01

    Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. 'Cayenne', 'Spanish', 'Queen') was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops.

  4. Characterization and Development of EST-SSR Markers Derived from Transcriptome of Yellow Catfish

    Directory of Open Access Journals (Sweden)

    Jin Zhang

    2014-10-01

    Full Text Available Yellow catfish (Pelteobagrus fulvidraco is one of the most important freshwater fish due to its delicious flesh and high nutritional value. However, lack of sufficient simple sequence repeat (SSR markers has hampered the progress of genetic selection breeding and molecular research for yellow catfish. To this end, we aimed to develop and characterize polymorphic expressed sequence tag (EST–SSRs from the 454 pyrosequencing transcriptome of yellow catfish. Totally, 82,794 potential EST-SSR markers were identified and distributed in the coding and non-coding regions. Di-nucleotide (53,933 is the most abundant motif type, and AC/GT, AAT/ATT, AAAT/ATTT are respective the most frequent di-, tri-, tetra-nucleotide repeats. We designed primer pairs for all of the identified EST-SSRs and randomly selected 300 of these pairs for further validation. Finally, 263 primer pairs were successfully amplified and 57 primer pairs were found to be consistently polymorphic when four populations of 48 individuals were tested. The number of alleles for the 57 loci ranged from 2 to 17, with an average of 8.23. The observed heterozygosity (HO, expected heterozygosity (HE, polymorphism information content (PIC and fixation index (fis values ranged from 0.04 to 1.00, 0.12 to 0.92, 0.12 to 0.91 and −0.83 to 0.93, respectively. These EST-SSR markers generated in this study could greatly facilitate future studies of genetic diversity and molecular breeding in yellow catfish.

  5. Microsatellite markers for the human nematode parasite Ascaris lumbricoides: development and assessment of utility.

    Science.gov (United States)

    Criscione, Charles D; Anderson, Joel D; Raby, Kyle; Sudimack, Dan; Subedi, Janardan; Rai, Dev R; Upadhayay, Ram P; Jha, Bharat; Williams-Blangero, Sarah; Anderson, Timothy J C

    2007-06-01

    We describe 35 microsatellite markers from the human parasitic nematode Ascaris lumbricoides. We found 7 sex-linked markers and demonstrate that 26 autosomal loci can be scored reliably. These markers have high genetic variability and provide the tools to address multiple questions concerning the epidemiology, fine-scale genetic structure, host specificity, and mating systems of this parasite.

  6. Development and validation of new SSR markers from expressed regions in the garlic genome

    Science.gov (United States)

    Limited number of simple sequence repeat (SSR) markers is available for the genome of garlic (Allium sativum L.) although SSR markers have become one of the most preferred marker systems because they are typically co-dominant, reproducible, cross species transferable and highly polymorphic. In this ...

  7. Development of a greenhouse-based inoculation protocol for the fungus Colletotrichum cereale pathogenic to annual bluegrass (Poa annua

    Directory of Open Access Journals (Sweden)

    Lisa A. Beirn

    2015-08-01

    Full Text Available The fungus Colletotrichum cereale incites anthracnose disease on Poa annua (annual bluegrass turfgrass. Anthracnose disease is geographically widespread throughout the world and highly destructive to cool-season turfgrasses, with infections by C. cereale resulting in extensive turf loss. Comprehensive research aimed at controlling turfgrass anthracnose has been performed in the field, but knowledge of the causal organism and its basic biology is still needed. In particular, the lack of a reliable greenhouse-based inoculation protocol performed under controlled environmental conditions is an obstacle to the study of C. cereale and anthracnose disease. Our objective was to develop a consistent and reproducible inoculation protocol for the two major genetic lineages of C. cereale. By adapting previously successful field-based protocols and combining with components of existing inoculation procedures, the method we developed consistently produced C. cereale infection on two susceptible P. annua biotypes. Approximately 7 to 10 days post-inoculation, plants exhibited chlorosis and thinning consistent with anthracnose disease symptomology. Morphological inspection of inoculated plants revealed visual signs of the fungus (appressoria and acervuli, although acervuli were not always present. After stringent surface sterilization of inoculated host tissue, C. cereale was consistently re-isolated from symptomatic tissue. Real-time PCR detection analysis based on the Apn2 marker confirmed the presence of the pathogen in host tissue, with both lineages of C. cereale detected from all inoculated plants. When a humidifier was not used, no infection developed for any biotypes or fungal isolates tested. The inoculation protocol described here marks significant progress for in planta studies of C. cereale, and will enable scientifically reproducible investigations of the biology, infectivity and lifestyle of this important grass pathogen.

  8. SU-C-17A-02: Sirius MRI Markers for Prostate Post-Implant Assessment: MR Protocol Development

    Energy Technology Data Exchange (ETDEWEB)

    Lim, T; Wang, J; Kudchadker, R; Stafford, R; Bathala, T; Pugh, T; Ibbott, G; Frank, S [UT MD Anderson Cancer Center, Houston, TX (United States)

    2014-06-15

    Purpose: Currently, CT is used to visualize prostate brachytherapy sources, at the expense of accurate structure contouring. MRI is superior to CT for anatomical delineation, but the sources appear as voids on MRI images. Previously we have developed Sirius MRI markers (C4 Imaging) to replace spacers to assist source localization on MRI images. Here we develop an MRI pulse sequence protocol that enhances the signal of these markers to enable MRI-only post-implant prostate dosimetric analysis. Methods: To simulate a clinical scenario, a CIRS multi-modality prostate phantom was implanted with 66 markers and 86 sources. The implanted phantom was imaged on both 1.5T and 3.0T GE scanners under various conditions, different pulse sequences (2D fast spin echo [FSE], 3D balanced steadystate free precession [bSSFP] and 3D fast spoiled gradient echo [FSPGR]), as well as varying amount of padding to simulate various patient sizes and associated signal fall-off from the surface coil elements. Standard FSE sequences from the current clinical protocols were also evaluated. Marker visibility, marker size, intra-marker distance, total scan time and artifacts were evaluated for various combinations of echo time, repetition time, flip angle, number of excitations, bandwidth, slice thickness and spacing, fieldof- view, frequency/phase encoding steps and frequency direction. Results: We have developed a 3D FSPGR pulse sequence that enhances marker signal and ensures the integrity of the marker shape while maintaining reasonable scan time. For patients contraindicated for 3.0T, we have also developed a similar sequence for 1.5T scanners. Signal fall-off with distance from prostate to coil can be compensated mainly by decreasing bandwidth. The markers are not visible using standard FSE sequences. FSPGR sequences are more robust for consistent marker visualization as compared to bSSFP sequences. Conclusion: The developed MRI pulse sequence protocol for Sirius MRI markers assists source

  9. Development of SSR markers from Citrus clementina (Rutaceae) BAC end sequences and interspecific transferability in Citrus.

    Science.gov (United States)

    Ollitrault, Frédérique; Terol, Javier; Pina, Jose Antonio; Navarro, Luis; Talon, Manuel; Ollitrault, Patrick

    2010-11-01

    Microsatellite primers were developed from bacterial artificial chromosome (BAC) end sequences of Citrus clementina and their transferability and polymorphism tested in the genus Citrus for future anchorage of physical and genetic maps and comparative interspecific genetic mapping. • Using PAGE and DNA silver staining, 79 primer pairs were selected for their transferability and polymorphism among 526 microsatellites mined in BES. A preliminary diversity study in Citrus was conducted with 18 of them, in C. reticulata, C. maxima, C. medica, C. sinensis, C. aurantium, C. paradisi, C. lemon, C. aurantifolia, and some papedas (wild citrus), using a capillary electrophoresis fragment analyzer. Intra- and interspecific polymorphism was observed, and heterozygous markers were identified for the different genotypes to be used for genetic mapping. • These results indicate the utility of the developed primers for comparative mapping studies and the integration of physical and genetic maps.

  10. Development of Polymorphic Microsatellite Markers for Indian Tobacco, Lobelia inflata (Campanulaceae

    Directory of Open Access Journals (Sweden)

    P. William Hughes

    2014-04-01

    Full Text Available Premise of the study: Nuclear microsatellite markers were developed for Lobelia inflata (Campanulaceae, an obligately self-fertilizing plant species, for use in the study of temporal fluctuation in allele frequency and of the genetic structure within and among populations. Methods and Results: We developed 28 primer pairs for L. inflata, all of which amplify CT dinucleotide repeats. We evaluated amplification of these loci in 53 L. inflata individuals at three sites in eastern North America and found that 24 loci showed microsatellite polymorphism. We also found that 16 loci amplified successfully in L. cardinalis, and 11 amplified successfully in L. siphilitica. Conclusions: These primers will be useful for assessing allelic diversity within and among populations of L. inflata, and show potential for use in congeneric species.

  11. Development of microsatellite markers for Viscum coloratum (Santalaceae) and their application to wild populations1

    Science.gov (United States)

    Kim, Bo-Yun; Park, Han-Sol; Kim, Soonok; Kim, Young-Dong

    2017-01-01

    Premise of the study: Microsatellite primers were developed for Viscum coloratum (Santalaceae), a semiparasitic medicinal plant that is known for its anticancer properties. Due to excessive human harvesting and loss of suitable habitat of its populations, it has become a potentially threatened species requiring immediate conservation efforts. Methods and Results: Based on transcriptome data for V. coloratum, 124 primer pairs were randomly selected for initial validation, of which 19 yielded polymorphic microsatellite loci, with two to six alleles per locus. The usefulness of these markers was assessed for 60 individuals representing three populations of V. coloratum. Observed and expected heterozygosity values ranged from 0.033 to 0.833 and 0.032 to 0.672, respectively. Cross-species amplification for 19 loci in the related species V. album was conducted. Conclusions: The 19 newly developed loci are expected to be useful for studying the population genetics and ecological conservation of V. coloratum. PMID:28090408

  12. FY2009 Annual Progress Report for Advanced Combustion Engine Research and Development

    Energy Technology Data Exchange (ETDEWEB)

    none,

    2009-12-01

    Fiscal Year 2009 Annual Progress Report for the Advanced Combustion Engine Research and Development (R&D) subprogram. The Advanced Combustion Engine R&D subprogram supports the mission of the VTP program by removing the critical technical barriers to commercialization of advanced internal combustion engines (ICEs) for passenger and commercial vehicles that meet future Federal emissions regulations. Dramatically improving the efficiency of ICEs and enabling their introduction in conventional as well as hybrid electric vehicles is the most promising and cost-effective approach to increasing vehicle fuel economy over the next 30 years.

  13. Divison of Environmental Education and Development Fiscal Year 1992 annual report

    Energy Technology Data Exchange (ETDEWEB)

    1992-12-31

    Primary design criterion for this division`s education activities is directly related to meeting the goal of environmental compliance on an accelerated basis and cleanup of the 1989 inventory of inactive sites and facilities by the year 2019. Therefore, the division`s efforts are directed toward stimulating knowledge and capability to achieve the goals while contributing to DOE`s overall goal of increasing scientific, mathematical, and technical literacy and competency. This annual report is divided into: overview, workforce development, academic partnerships, scholarships/fellowships, environmental restoration and waste management employment program, community colleges, outreach, evaluation, and principal DOE contacts.

  14. Development of Raman spectral markers to assess metastatic bone in breast cancer

    Science.gov (United States)

    Ding, Hao; Nyman, Jeffry S.; Sterling, Julie A.; Perrien, Daniel S.; Mahadevan-Jansen, Anita; Bi, Xiaohong

    2014-11-01

    Bone is the most common site for breast cancer metastases. One of the major complications of bone metastasis is pathological bone fracture caused by chronic bone loss and degeneration. Current guidelines for the prediction of pathological fracture mainly rely on radiographs or computed tomography, which are limited in their ability to predict fracture risk. The present study explored the feasibility of using Raman spectroscopy to estimate pathological fracture risk by characterizing the alterations in the compositional properties of metastatic bones. Tibiae with evident bone destruction were investigated using Raman spectroscopy. The carbonation level calculated by the ratio of carbonate/phosphate ν1 significantly increased in the tumor-bearing bone at all the sampling regions at the proximal metaphysis and diaphysis, while tumor-induced elevation in mineralization and crystallinity was more pronounced in the metaphysis. Furthermore, the increased carbonation level is positively correlated to bone lesion size, indicating that this parameter could serve as a unique spectral marker for tumor progression and bone loss. With the promising advances in the development of spatially offset Raman spectroscopy for deep tissue measurement, this spectral marker can potentially be used for future noninvasive evaluation of metastatic bone and prediction of pathological fracture risk.

  15. Transcriptome Analysis and Development of SSR Molecular Markers in Glycyrrhiza uralensis Fisch.

    Directory of Open Access Journals (Sweden)

    Yaling Liu

    Full Text Available Licorice is an important traditional Chinese medicine with clinical and industrial applications. Genetic resources of licorice are insufficient for analysis of molecular biology and genetic functions; as such, transcriptome sequencing must be conducted for functional characterization and development of molecular markers. In this study, transcriptome sequencing on the Illumina HiSeq 2500 sequencing platform generated a total of 5.41 Gb clean data. De novo assembly yielded a total of 46,641 unigenes. Comparison analysis using BLAST showed that the annotations of 29,614 unigenes were conserved. Further study revealed 773 genes related to biosynthesis of secondary metabolites of licorice, 40 genes involved in biosynthesis of the terpenoid backbone, and 16 genes associated with biosynthesis of glycyrrhizic acid. Analysis of unigenes larger than 1 Kb with a length of 11,702 nt presented 7,032 simple sequence repeats (SSR. Sixty-four of 69 randomly designed and synthesized SSR pairs were successfully amplified, 33 pairs of primers were polymorphism in in Glycyrrhiza uralensis Fisch., Glycyrrhiza inflata Bat., Glycyrrhiza glabra L. and Glycyrrhiza pallidiflora Maxim. This study not only presents the molecular biology data of licorice but also provides a basis for genetic diversity research and molecular marker-assisted breeding of licorice.

  16. Development of antibiotic marker-free creeping bentgrass resistance against herbicides

    Institute of Scientific and Technical Information of China (English)

    Ki-Won Lee; Ki-Yong Kim; Kyung-Hee Kim; Byung-Hyun Lee; Jin-Seog Kim; Sang-Hoon Lee

    2011-01-01

    Herbicide-resistant creeping bentgrass plants (Agrostis stolonifera L.) without antibiotic-resistant markers were produced by Agrobacterium-mediated transformation. Embryogenic callus tissues were infected with Agrobacterium tumefaciens EHAI05, harboring the bar and the CP4-EPSPS genes for bialaphos and glyphosate resistance. Phosphinothricin-resistant calli and plants were selected. Soil-grown plants were obtained at 14-16 weeks after transformation. Genetic transformation of the selected, regenerated plants was validated by PCR. Southern blot analysis revealed that at least one copy of the transgene was integrated into the genome of the transgenic plants. Transgene expression was confirmed by Northern blot. CP4-EPSPS protein was detected by ELISA. Transgenic plants remained green and healthy when sprayed with Basra, containing 0.5% glufosinate ammonium or glyphosate. The optimized Agrobacterium-mediated transformation method resulted in an average of 9.4% transgenic plants. The results of the present study suggest that the optimized marker-free technique could be used as an effective and reliable method for routine transformation, which may facilitate the development of varieties of new antibiotic-free grass species.

  17. Development of microsatellite markers in Garcinia paucinervis (Clusiaceae), an endangered species of karst habitats1

    Science.gov (United States)

    Hu, Gang; Zhang, Zhong-Hua; Yang, Ping; Zhang, Qi-Wei; Yuan, Chang-An

    2017-01-01

    Premise of the study: Microsatellite markers were developed for Garcinia paucinervis (Clusiaceae), an endangered and endemic tree species of karst habitats, to analyze its genetic diversity and genetic structure. Methods and Results: Using shotgun sequencing on an Illumina MiSeq platform, a total of 22 microsatellite primer sets were characterized, of which 17 were identified as polymorphic. For these polymorphic loci, the total number of alleles per locus ranged from two to 12 across 54 individuals from three populations. The observed and expected heterozygosities ranged from 0.000 to 1.000 and from 0.000 to 0.850, respectively. No pair of loci showed significant linkage disequilibrium. Three loci in one population deviated significantly from Hardy–Weinberg equilibrium (P < 0.05). Seven loci (JSL3, JSL5, JSL22, JSL29, JSL32, JSL39, and JSL43) were successfully amplified in G. bracteata. Conclusions: These markers will be useful in studies on genetic diversity and population structure of G. paucinervis. PMID:28090413

  18. Prevalence of polymorphisms in OPG, RANKL and RANK as potential markers for Charcot arthropathy development.

    Science.gov (United States)

    Bruhn-Olszewska, Bożena; Korzon-Burakowska, Anna; Węgrzyn, Grzegorz; Jakóbkiewicz-Banecka, Joanna

    2017-03-29

    Charcot arthropathy is one of the most serious complications of diabetic foot syndrome that leads to amputation of the affected limb. Since there is no cure for Charcot arthropathy, early diagnosis and implementation preventive care are the best available treatment. However, diagnosis is hindered by obscure clinical picture of the disease and lack of molecular markers for its early detection. Results of recent research suggest that OPG-RANKL-RANK axis regulating bone metabolism can be associated with Charcot arthropathy and that SNPs in OPG gene are associated with the disease. Here we report the results of comprehensive analysis of ten SNPs in OPG, RANKL and RANK genes in 260 subjects divided into diabetes, neuropathy and Charcot arthropathy groups. Besides genotype analysis we performed linkage disequilibrium and hierarchical clustering to obtain information about correlation between SNPs. Our results show that OPG 245T/G (rs3134069) and OPG 1217C/T (rs3102734) polymorphisms co-occur in patients with Charcot arthropathy (r2 = 0.99). Moreover, hierarchical clustering revealed a characteristic profile of all SNPs in Charcot arthropathy and neuropathy, which is distinct from control group. Our results suggest that analysis of multiple SNPs can be used as potential marker of Charcot arthropathy and provide insight into possible molecular mechanisms of its development.

  19. Development of microsatellite markers for Lachancea thermotolerans typing and population structure of wine-associated isolates.

    Science.gov (United States)

    Banilas, Georgios; Sgouros, Georgios; Nisiotou, Aspasia

    2016-12-01

    Lachancea (Kluyveromyces) thermotolerans is an important member of the grape/wine yeast community with great technological potential for the wine industry. Although several molecular marker techniques have been developed for typing different yeast species, no one has been designed so far for L. thermotolerans. Here we present a simple and efficient method based on a multilocus SSR analysis for molecular typing and genetic diversity assessment of L. thermotolerans isolates. Following whole genome screening, five polymorphic microsatellite markers were selected and tested on a panel of grape isolates from different vineyards of two geographically separated viticultural zones, Nemea and Peza, in Greece. The SSR method proved quite discriminatory as compared to tandem repeat-tRNA-PCR, a fingerprinting method for typing non-Saccharomyces yeasts. Genetic analysis based on SSR data revealed a clear structure between the populations of the two zones. Furthermore, significant differences were also detected in a number of phenotypic characters of enological interest. A positive correlation was observed between phenotypic and genotypic diversity. Taking together, present results support the microbial terroir concept in the case of L. thermotolerans in Greece, which is an important prerequisite for the exploitation of selected genotypes as fermentation starters with region-specific characters.

  20. Development of a New Marker System for Identification of Spirodela polyrhiza and Landoltia punctata

    Directory of Open Access Journals (Sweden)

    Bo Feng

    2017-01-01

    Full Text Available Lemnaceae (commonly called duckweed is an aquatic plant ideal for quantitative analysis in plant sciences. Several species of this family represent the smallest and fastest growing flowering plants. Different ecotypes of the same species vary in their biochemical and physiological properties. Thus, selecting of desirable ecotypes of a species is very important. Here, we developed a simple and rapid molecular identification system for Spirodela polyrhiza and Landoltia punctata based on the sequence polymorphism. First, several pairs of primers were designed and three markers were selected as good for identification. After PCR amplification, DNA fragments (the combination of three PCR products in different duckweeds were detected using capillary electrophoresis. The high-resolution capillary electrophoresis displayed high identity to the sequencing results. The combination of the PCR products containing several DNA fragments highly improved the identification frequency. These results indicate that this method is not only good for interspecies identification but also ideal for intraspecies distinguishing. Meanwhile, 11 haplotypes were found in both the S. polyrhiza and L. punctata ecotypes. The results suggest that this marker system is useful for large-scale identification of duckweed and for the screening of desirable ecotypes to improve the diverse usage in duckweed utilization.

  1. Enriching Genomic Resources and Marker Development from Transcript Sequences of Jatropha curcas for Microgravity Studies

    Science.gov (United States)

    Tian, Wenlan; Paudel, Dev

    2017-01-01

    Jatropha (Jatropha curcas L.) is an economically important species with a great potential for biodiesel production. To enrich the jatropha genomic databases and resources for microgravity studies, we sequenced and annotated the transcriptome of jatropha and developed SSR and SNP markers from the transcriptome sequences. In total 1,714,433 raw reads with an average length of 441.2 nucleotides were generated. De novo assembling and clustering resulted in 115,611 uniquely assembled sequences (UASs) including 21,418 full-length cDNAs and 23,264 new jatropha transcript sequences. The whole set of UASs were fully annotated, out of which 59,903 (51.81%) were assigned with gene ontology (GO) term, 12,584 (10.88%) had orthologs in Eukaryotic Orthologous Groups (KOG), and 8,822 (7.63%) were mapped to 317 pathways in six different categories in Kyoto Encyclopedia of Genes and Genome (KEGG) database, and it contained 3,588 putative transcription factors. From the UASs, 9,798 SSRs were discovered with AG/CT as the most frequent (45.8%) SSR motif type. Further 38,693 SNPs were detected and 7,584 remained after filtering. This UAS set has enriched the current jatropha genomic databases and provided a large number of genetic markers, which can facilitate jatropha genetic improvement and many other genetic and biological studies. PMID:28154822

  2. Development of Random Amplified Polymorphism DNA Markers Linked to Powdery Mildew Resistance Gene in Melon

    Directory of Open Access Journals (Sweden)

    Budi Setiadi Daryono

    2015-11-01

    Full Text Available A random amplified polymorphic DNA (RAPD marker linked to powdery mildew resistance gene (Pm-I in melon PI 371795 was reported. However, the RAPD marker has problem in scoring. To detect powdery mildew resistance gene (Pm-I in melon accurately, the RAPD marker was cloned and sequenced to design sequence characterized amplified region (SCAR markers. SCAPMAR5 marker derived from pUBC411 primer yielded a single DNA band at 1061 bp. Segregation of SCAPMAR5 marker in bulk of F2 plants demonstrated that the marker was co-segregated with RAPD marker from which the SCAR marker was originated. Moreover, results of SCAR analysis in diverse melons showed SCAPMAR5 primers obtained a single 1061 bp linked to Pm-I in resistant melon PI 371795 and PMAR5. On the other hand, SCAPMAR5 failed to detect Pm-I in susceptible melons. Results of this study revealed that SCAR analysis not only confirmed melons that had been clearly scored for resistance to Pm-I evaluated by RAPD markers, but also clarified the ambiguous resistance results obtained by the RAPD markers.   Key words: Cucumis melo L., Pm-I, RAPD, SCAPMAR5

  3. Development of CACTA transposon derived SCAR markers and their use in population structure analysis in Zea mays.

    Science.gov (United States)

    Roy, Neha Samir; Park, Kyong-Cheul; Lee, Sung-Il; Im, Min-Ji; Ramekar, Rahul Vasudeo; Kim, Nam-Soo

    2017-09-15

    Molecular marker technologies have proven to be an important breakthrough for genetic studies, construction of linkage maps and population genetics analysis. Transposable elements (TEs) constitute major fractions of repetitive sequences in plants and offer a wide range of possible areas to be explored as molecular markers. Sequence characterized amplified region (SCAR) marker development provides us with a simple and time saving alternative approach for marker development. We employed the CACTA-TD to develop SCARs and then integrated them into linkage map and used them for population structure and genetic diversity analysis of corn inbred population. A total of 108 dominant SCAR markers were designed out of which, 32 were successfully integrated in to the linkage map of maize RIL population and the remaining were added to a physical map for references to check the distribution throughout all chromosomes. Moreover, 76 polymorphic SCARs were used for diversity analysis of corn accessions being used in Korean corn breeding program. The overall average polymorphic information content (PIC) was 0.34, expected heterozygosity was 0.324 and Shannon's information index was 0.491 with a percentage of polymorphism of 98.67%. Further analysis by associating with desirable traits may also provide some accurate trait specific tagged SCAR markers. TE linked SCARs can provide an added level of polymorphism as well as improved discriminating ability and therefore can be useful in further breeding programs to develop high yielding germplasm.

  4. Developing market class specific InDel markers from next generation sequence data in Phaseolus vulgaris L.

    Science.gov (United States)

    Moghaddam, Samira Mafi; Song, Qijian; Mamidi, Sujan; Schmutz, Jeremy; Lee, Rian; Cregan, Perry; Osorno, Juan M; McClean, Phillip E

    2014-01-01

    Next generation sequence data provides valuable information and tools for genetic and genomic research and offers new insights useful for marker development. This data is useful for the design of accurate and user-friendly molecular tools. Common bean (Phaseolus vulgaris L.) is a diverse crop in which separate domestication events happened in each gene pool followed by race and market class diversification that has resulted in different morphological characteristics in each commercial market class. This has led to essentially independent breeding programs within each market class which in turn has resulted in limited within market class sequence variation. Sequence data from selected genotypes of five bean market classes (pinto, black, navy, and light and dark red kidney) were used to develop InDel-based markers specific to each market class. Design of the InDel markers was conducted through a combination of assembly, alignment and primer design software using 1.6× to 5.1× coverage of Illumina GAII sequence data for each of the selected genotypes. The procedure we developed for primer design is fast, accurate, less error prone, and higher throughput than when they are designed manually. All InDel markers are easy to run and score with no need for PCR optimization. A total of 2687 InDel markers distributed across the genome were developed. To highlight their usefulness, they were employed to construct a phylogenetic tree and a genetic map, showing that InDel markers are reliable, simple, and accurate.

  5. Yellow lupin (Lupinus luteus L.) transcriptome sequencing: molecular marker development and comparative studies

    Science.gov (United States)

    2012-01-01

    Background Yellow lupin (Lupinus luteus L.) is a minor legume crop characterized by its high seed protein content. Although grown in several temperate countries, its orphan condition has limited the generation of genomic tools to aid breeding efforts to improve yield and nutritional quality. In this study, we report the construction of 454-expresed sequence tag (EST) libraries, carried out comparative studies between L. luteus and model legume species, developed a comprehensive set of EST-simple sequence repeat (SSR) markers, and validated their utility on diversity studies and transferability to related species. Results Two runs of 454 pyrosequencing yielded 205 Mb and 530 Mb of sequence data for L1 (young leaves, buds and flowers) and L2 (immature seeds) EST- libraries. A combined assembly (L1L2) yielded 71,655 contigs with an average contig length of 632 nucleotides. L1L2 contigs were clustered into 55,309 isotigs. 38,200 isotigs translated into proteins and 8,741 of them were full length. Around 57% of L. luteus sequences had significant similarity with at least one sequence of Medicago, Lotus, Arabidopsis, or Glycine, and 40.17% showed positive matches with all of these species. L. luteus isotigs were also screened for the presence of SSR sequences. A total of 2,572 isotigs contained at least one EST-SSR, with a frequency of one SSR per 17.75 kbp. Empirical evaluation of the EST-SSR candidate markers resulted in 222 polymorphic EST-SSRs. Two hundred and fifty four (65.7%) and 113 (30%) SSR primer pairs were able to amplify fragments from L. hispanicus and L. mutabilis DNA, respectively. Fifty polymorphic EST-SSRs were used to genotype a sample of 64 L. luteus accessions. Neighbor-joining distance analysis detected the existence of several clusters among L. luteus accessions, strongly suggesting the existence of population subdivisions. However, no clear clustering patterns followed the accession’s origin. Conclusion L. luteus deep transcriptome

  6. Yellow lupin (Lupinus luteus L. transcriptome sequencing: molecular marker development and comparative studies

    Directory of Open Access Journals (Sweden)

    Parra-González Lorena B

    2012-08-01

    Full Text Available Abstract Background Yellow lupin (Lupinus luteus L. is a minor legume crop characterized by its high seed protein content. Although grown in several temperate countries, its orphan condition has limited the generation of genomic tools to aid breeding efforts to improve yield and nutritional quality. In this study, we report the construction of 454-expresed sequence tag (EST libraries, carried out comparative studies between L. luteus and model legume species, developed a comprehensive set of EST-simple sequence repeat (SSR markers, and validated their utility on diversity studies and transferability to related species. Results Two runs of 454 pyrosequencing yielded 205 Mb and 530 Mb of sequence data for L1 (young leaves, buds and flowers and L2 (immature seeds EST- libraries. A combined assembly (L1L2 yielded 71,655 contigs with an average contig length of 632 nucleotides. L1L2 contigs were clustered into 55,309 isotigs. 38,200 isotigs translated into proteins and 8,741 of them were full length. Around 57% of L. luteus sequences had significant similarity with at least one sequence of Medicago, Lotus, Arabidopsis, or Glycine, and 40.17% showed positive matches with all of these species. L. luteus isotigs were also screened for the presence of SSR sequences. A total of 2,572 isotigs contained at least one EST-SSR, with a frequency of one SSR per 17.75 kbp. Empirical evaluation of the EST-SSR candidate markers resulted in 222 polymorphic EST-SSRs. Two hundred and fifty four (65.7% and 113 (30% SSR primer pairs were able to amplify fragments from L. hispanicus and L. mutabilis DNA, respectively. Fifty polymorphic EST-SSRs were used to genotype a sample of 64 L. luteus accessions. Neighbor-joining distance analysis detected the existence of several clusters among L. luteus accessions, strongly suggesting the existence of population subdivisions. However, no clear clustering patterns followed the accession’s origin. Conclusion L. luteus deep

  7. Development of a new diagnostic marker for growth habit selection in faba bean (Vicia faba L.) breeding.

    Science.gov (United States)

    Avila, C M; Atienza, S G; Moreno, M T; Torres, A M

    2007-11-01

    Faba bean varieties with determinacy of the apical meristem are relevant to green production. A diagnostic CAPS (cleavage amplification polymorphic sequence) marker for determinate growth habit (ti) in faba bean was previously developed by Avila et al. (Mol Breed 17:185-190, 2006) but was effective only on a limited range of cultivars or genotypes. In this study, we studied the reasons for this limited application and developed a new marker useful for most faba bean-breeding programs. By designing a new set of primers, the complete genomic Vf_TFL1 sequences from different genotypes contrasting for the character were obtained and additional base changes associated with the ti phenotype were identified. The comparison among faba bean sequences showed that the previous CAPS marker was based on a SNP (single nucleotide polymorphism) at position 469 in the intron 2-3, a silent mutation. On the contrary, a SNP at position 26 that distinguishes determinate and indeterminate growth habit genotypes lead to an amino acid change (Leu-9 to Arg) in the determinate growth habit genotypes that could account for the ti phenotype. A dCAPS marker based on this SNP that creates a TaqI site in the ti allele was developed. The marker was 100% successful in predicting ti phenotypes in a broad range of faba bean germplasm representing all major cultivars historically grown in Europe. The outcome confirms the utility of the new dCAPS in worldwide marker-assisted selection programs.

  8. Development and characterization of microsatellite markers for Piptadenia gonoacantha (Fabaceae)1

    Science.gov (United States)

    Grando, Carolina; Bajay, Miklos M.; Bajay, Stephanie K.; Schwarcz, Kaiser D.; Campos, Jaqueline B.; Brancalion, Pedro H. S.; Pinheiro, José B.; Rodrigues, Ricardo R.; Souza, Anete P.; Zucchi, Maria I.

    2015-01-01

    • Premise of the study: Microsatellite primers were designed for Piptadenia gonoacantha (Fabaceae) and characterized to estimate genetic diversity parameters. The species is a native tree from the Atlantic Forest biome commonly used in forest restoration; it has medicinal potential and the wood is economically useful. • Methods and Results: Twenty-eight microsatellite loci were identified from an enriched genomic library. Fifteen loci resulted in successful amplifications and were characterized in a natural population of 94 individuals. Twelve loci were polymorphic, with allele numbers ranging from three to 15 per locus, and expected and observed heterozygosities ranging from 0.2142 to 0.8325 and 0.190 to 0.769, respectively. • Conclusions: The developed markers will be used in further studies of population genetics of P. gonoacantha, aimed at conservation and management of the species in natural populations and in forest restoration projects. PMID:25699220

  9. Development of new microsatellite markers from Mango (Mangifera indica) and cross-species amplification.

    Science.gov (United States)

    Ravishankar, Kundapura Venkataramana; Mani, Bellam Hanumantha-Reddy; Anand, Lalitha; Dinesh, Makki Ramachandra

    2011-04-01

    Microsatellite markers were developed and characterized to assess the genetic diversity among mango (Mangifera indica) cultivars and to test their amplification in closely related species. Thirty-six microsatellite (simple sequence repeats; SSR) loci were isolated by a microsatellite-enriched partial genomic library method. Primers designed for these loci were characterized using 30 diverse mango cultivars. The number of alleles ranged from 3 to 19 with an average of 9.2 alleles per locus. Polymorphic information content values ranged from 0.185 to 0.920 with a mean of 0.687. The total value for the probability of identity was 2.42 × 10(-31). The newly identified SSRs would be useful in genetic diversity studies, finger-printing, and mapping. Loci from five related species, M. odorata, M. anadamanica, M. zeylanica, M. camptosperma, and M. griffithii, were successfully amplified using these SSR primers, showing their potential utility across species.

  10. Development of Randomly Amplified Polymorphic DNA Based SCAR Marker for Identification of Ipomoea mauritiana Jacq (Convolvulaceae

    Directory of Open Access Journals (Sweden)

    Kambiranda Devaiah

    2011-01-01

    Full Text Available Vidari is an Ayurvedic herbal drug used as aphrodisiac, galactagogue and is also used in the preparation of Chyavanaprash. Tubers of Ipomoea mauritiana Jacq. (Convolvulaceae, Pueraria tuberosa (Roxb. ex Willd. DC (Fabaceae, Adenia hondala (Gaertn. de Wilde (Passifloraceae and pith of Cycas circinalis L. (Cycadaceae are all traded in the name of Vidari, creating issues of botanical authenticity of the Ayurvedic raw drug. DNA-based markers have been developed to distinguish I. mauritiana from the other Vidari candidates. A putative 600-bp polymorphic sequence, specific to I. mauritiana was identified using randomly amplified polymorphic DNA (RAPD technique. Furthermore, sequence characterized amplified region (SCAR primers (IM1F and IM1R were designed from the unique RAPD amplicon. The SCAR primers produced a specific 323-bp amplicon in authentic I. mauritiana and not in the allied species.

  11. Characterizing proton-activated materials to develop PET-mediated proton range verification markers

    Science.gov (United States)

    Cho, Jongmin; Ibbott, Geoffrey S.; Kerr, Matthew D.; Amos, Richard A.; Stingo, Francesco C.; Marom, Edith M.; Truong, Mylene T.; Palacio, Diana M.; Betancourt, Sonia L.; Erasmus, Jeremy J.; DeGroot, Patricia M.; Carter, Brett W.; Gladish, Gregory W.; Sabloff, Bradley S.; Benveniste, Marcelo F.; Godoy, Myrna C.; Patil, Shekhar; Sorensen, James; Mawlawi, Osama R.

    2016-06-01

    Conventional proton beam range verification using positron emission tomography (PET) relies on tissue activation alone and therefore requires particle therapy PET whose installation can represent a large financial burden for many centers. Previously, we showed the feasibility of developing patient implantable markers using high proton cross-section materials (18O, Cu, and 68Zn) for in vivo proton range verification using conventional PET scanners. In this technical note, we characterize those materials to test their usability in more clinically relevant conditions. Two phantoms made of low-density balsa wood (~0.1 g cm-3) and beef (~1.0 g cm-3) were embedded with Cu or 68Zn foils of several volumes (10-50 mm3). The metal foils were positioned at several depths in the dose fall-off region, which had been determined from our previous study. The phantoms were then irradiated with different proton doses (1-5 Gy). After irradiation, the phantoms with the embedded foils were moved to a diagnostic PET scanner and imaged. The acquired data were reconstructed with 20-40 min of scan time using various delay times (30-150 min) to determine the maximum contrast-to-noise ratio. The resultant PET/computed tomography (CT) fusion images of the activated foils were then examined and the foils’ PET signal strength/visibility was scored on a 5 point scale by 13 radiologists experienced in nuclear medicine. For both phantoms, the visibility of activated foils increased in proportion to the foil volume, dose, and PET scan time. A linear model was constructed with visibility scores as the response variable and all other factors (marker material, phantom material, dose, and PET scan time) as covariates. Using the linear model, volumes of foils that provided adequate visibility (score 3) were determined for each dose and PET scan time. The foil volumes that were determined will be used as a guideline in developing practical implantable markers.

  12. Characterizing proton-activated materials to develop PET-mediated proton range verification markers.

    Science.gov (United States)

    Cho, Jongmin; Ibbott, Geoffrey S; Kerr, Matthew D; Amos, Richard A; Stingo, Francesco C; Marom, Edith M; Truong, Mylene T; Palacio, Diana M; Betancourt, Sonia L; Erasmus, Jeremy J; DeGroot, Patricia M; Carter, Brett W; Gladish, Gregory W; Sabloff, Bradley S; Benveniste, Marcelo F; Godoy, Myrna C; Patil, Shekhar; Sorensen, James; Mawlawi, Osama R

    2016-06-07

    Conventional proton beam range verification using positron emission tomography (PET) relies on tissue activation alone and therefore requires particle therapy PET whose installation can represent a large financial burden for many centers. Previously, we showed the feasibility of developing patient implantable markers using high proton cross-section materials ((18)O, Cu, and (68)Zn) for in vivo proton range verification using conventional PET scanners. In this technical note, we characterize those materials to test their usability in more clinically relevant conditions. Two phantoms made of low-density balsa wood (~0.1 g cm(-3)) and beef (~1.0 g cm(-3)) were embedded with Cu or (68)Zn foils of several volumes (10-50 mm(3)). The metal foils were positioned at several depths in the dose fall-off region, which had been determined from our previous study. The phantoms were then irradiated with different proton doses (1-5 Gy). After irradiation, the phantoms with the embedded foils were moved to a diagnostic PET scanner and imaged. The acquired data were reconstructed with 20-40 min of scan time using various delay times (30-150 min) to determine the maximum contrast-to-noise ratio. The resultant PET/computed tomography (CT) fusion images of the activated foils were then examined and the foils' PET signal strength/visibility was scored on a 5 point scale by 13 radiologists experienced in nuclear medicine. For both phantoms, the visibility of activated foils increased in proportion to the foil volume, dose, and PET scan time. A linear model was constructed with visibility scores as the response variable and all other factors (marker material, phantom material, dose, and PET scan time) as covariates. Using the linear model, volumes of foils that provided adequate visibility (score 3) were determined for each dose and PET scan time. The foil volumes that were determined will be used as a guideline in developing practical implantable markers.

  13. Development of genome-wide informative simple sequence repeat markers for molecular diversity analysis in chickpea and development of web resource

    Directory of Open Access Journals (Sweden)

    SWARUP KUMAR PARIDA

    2015-08-01

    Full Text Available Development of informative polymorphic simple sequence repeat (SSR markers at a genome-wide scale is essential for efficient large-scale genotyping applications. We identified genome-wide 1835 SSRs showing polymorphism between desi and kabuli chickpea. A total of 1470 polymorphic SSR markers from diverse coding and non-coding regions of the chickpea genome were developed. These physically-mapped SSR markers exhibited robust amplification efficiency (73.9% and high intra- and inter-specific polymorphic potential (63.5%, thereby suggesting their immense use in various genomics-assisted breeding applications. The SSR markers particularly derived from intergenic and intronic sequences revealed high polymorphic potential. Using the mapped SSR markers, a wider functional molecular diversity (16-94%, mean: 68%, and parentage- and cultivar-specific admixed domestication pattern and phylogenetic relationships in a structured population of desi and kabuli chickpea genotypes was evident. The intra-specific polymorphism (47.6% and functional molecular diversity (65% potential of polymorphic SSR markers developed in our study is much higher than that of previous documentations. Finally, we have developed a user-friendly web resource, Chickpea Microsatellite Database (CMsDB; http://www.nipgr.res.in/CMsDB.html, which provides public access to the data and results reported in this study. The developed informative SSR markers can serve as a resource for various genotyping applications, including genetic enhancement studies in chickpea.

  14. Development and characterization of EST-SSR markers in the eastern oyster Crassostrea virginica.

    Science.gov (United States)

    Wang, Yongping; Guo, Ximing

    2007-01-01

    Simple sequence repeat (SSR) markers were developed from expressed sequence tags (ESTs) in the eastern oyster (Crassostrea virginica). ESTs of the eastern oyster were downloaded from GenBank and screened for SSRs with at least eight units of dinucleotide or five units of tri-, tetra-, penta-, and hexa-nucleotide repeats. The screening of 9101 ESTs identified 127 (1.4%) SSR-containing sequences. Primers were designed for 88 SSR-containing ESTs with good and sufficient flanking sequences. Polymerase chain reaction (PCR) amplification was successful for 71 primer pairs, including 19 (27%) pairs that amplified fragments longer than expected sizes, probably due to introns. Sixty-six pairs that produced fragments shorter than 800 bp were screened for polymorphism in five oysters from three populations via polyacrylamide gels, and 53 of them (80%) were polymorphic. Fifty-three polymorphic SSRs were labeled and genotyped in 30 oysters from three populations via an automated sequencer. Five of the SSRs amplified more than two fragments per oyster, suggesting locus duplication. The remaining 48 SSRs had 2 alleles per individual, including 11 with null alleles. In the 30 oysters analyzed, the SSRs had an average of 9.3 alleles per locus, ranging from 2 to 24. Forty-three loci segregated in a family with 100 progeny, with nine showing significant deviation from Mendelian ratios (three after Bonferroni correction). Seventy percent of the loci were successfully amplified in C. rhizophorae and 34% in C. gigas. This study demonstrates that ESTs are valuable resources for the development of SSR markers in the eastern oyster, and EST-derived SSRs are more transferable across species than genomic SSRs.

  15. Development of microsatellite markers to genetically differentiate populations of Octopus minor from Korea and China.

    Science.gov (United States)

    Kang, Jung-Ha; Kim, Yi-Kyung; Park, Jung-Youn; An, Chel-Min; Jun, Je-Chun

    2012-08-01

    Of the more than 300 octopus species, Octopus minor is one of the most popular and economically important species in Eastern Asia, including Korea, along with O. vulgaris, O. ocellatus, and O. aegina. We developed 19 microsatellite markers from Octopus minor and eight polymorphic markers were developed to analyze the genetic diversity and relationships among four octopus populations from Korea and three from China. The number of alleles per locus varied from 10 to 49, and allelic richness per locus ranged from 2 to 16.4 across all populations. The average allele number among the populations was 11.1, with a minimum of 8.3 and a maximum of 13.6. The mean allelic richness was 8.7 in all populations. The Hardy-Weinberg equilibrium (HWE) test revealed significant deviation in 19 of the 56 single-locus sites, and null alleles were presumed in five of eight loci. The pairwise F ( ST ) values between populations from Korea and China differed significantly in all pairwise comparisons. The genetic distances between the China and Korea samples ranged from 0.161 to 0.454. The genetic distances among the populations from Korea ranged from 0.033 to 0.090, with an average of 0.062; those among populations from China ranged from 0.191 to 0.316, with an average of 0.254. The populations from Korea and China formed clearly separated into clusters via an unweighted pair group method with arithmetic mean dendrogram. Furthermore, a population from muddy flats on the western coast of the Korean Peninsula and one from a rocky area on Jeju Island formed clearly separated subclusters. An assignment test based on the allele distribution discriminated between the Korean and Chinese origins with 96.9 % accuracy.

  16. LABORATORY DIRECTED RESEARCH AND DEVELOPMENT ANNUAL REPORT TO THE DEPARTMENT OF ENERGY - DECEMBER 2003

    Energy Technology Data Exchange (ETDEWEB)

    FOX,K.J.

    2003-12-31

    Brookhaven National (BNL) Laboratory is a multidisciplinary laboratory that carries out basic and applied research in the physical, biomedical, and environmental sciences, and in selected energy technologies. It is managed by Brookhaven Science Associates, LLC, under contract with the U. S. Department of Energy. BNL's total annual budget has averaged about $450 million. There are about 3,000 employees, and another 4,500 guest scientists and students who come each year to use the Laboratory's facilities and work with the staff. The BNL Laboratory Directed Research and Development (LDRD) Program reports its status to the U.S. Department of Energy (DOE) annually in March, as required by DOE Order 41 3.2A, ''Laboratory Directed Research and Development,'' January 8, 2001, and the LDRD Annual Report guidance, updated February 12, 1999. The LDRD Program obtains its funds through the Laboratory overhead pool and operates under the authority of DOE Order 413.2A. The goals and objectives of BNL's LDRD Program can be inferred from the Program's stated purposes. These are to (1) encourage and support the development of new ideas and technology, (2) promote the early exploration and exploitation of creative and innovative concepts, and (3) develop new ''fundable'' R&D projects and programs. The emphasis is clearly articulated by BNL to be on supporting exploratory research ''which could lead to new programs, projects, and directions'' for the Laboratory. As one of the premier scientific laboratories of the DOE, BNL must continuously foster groundbreaking scientific research. At Brookhaven National Laboratory one such method is through its LDRD Program. This discretionary research and development tool is critical in maintaining the scientific excellence and long-term vitality of the Laboratory. Additionally, it is a means to stimulate the scientific community and foster new science and technology

  17. LABORATORY DIRECTED RESEARCH AND DEVELOPMENT ANNUAL REPORT TO THE DEPARTMENT OF ENERGY - DECEMBER 2004

    Energy Technology Data Exchange (ETDEWEB)

    FOX,K.J.

    2004-12-31

    Brookhaven National (BNL) Laboratory is a multidisciplinary laboratory that carries out basic and applied research in the physical, biomedical, and environmental sciences, and in selected energy technologies. It is managed by Brookhaven Science Associates, LLC, under contract with the U. S. Department of Energy. BNL's total annual budget has averaged about $460 million. There are about 2,800 employees, and another 4,500 guest scientists and students who come each year to use the Laboratory's facilities and work with the staff. The BNL Laboratory Directed Research and Development (LDRD) Program reports its status to the U.S. Department of Energy (DOE) annually in March, as required by DOE Order 4 13.2A, ''Laboratory Directed Research and Development,'' January 8, 2001, and the LDRD Annual Report guidance, updated February 12, 1999. The LDRD Program obtains its funds through the Laboratory overhead pool and operates under the authority of DOE Order 413.2A. The goals and objectives of BNL's LDRD Program can be inferred from the Program's stated purposes. These are to (1) encourage and support the development of new ideas and technology, (2) promote the early exploration and exploitation of creative and innovative concepts, and (3) develop new ''fundable'' R&D projects and programs. The emphasis is clearly articulated by BNL to be on supporting exploratory research ''which could lead to new programs, projects, and directions'' for the Laboratory. As one of the premier scientific laboratories of the DOE, BNL must continuously foster groundbreaking scientific research. At Brookhaven National Laboratory one such method is through its LDRD Program. This discretionary research and development tool is critical in maintaining the scientific excellence and long-term vitality of the Laboratory. Additionally, it is a means to stimulate the scientific community and foster new science and technology

  18. LABORATORY DIRECTED RESEARCH AND DEVELOPMENT ANNUAL REPORT TO THE DOE - DECEMBER 2001.

    Energy Technology Data Exchange (ETDEWEB)

    FOX,K.J.

    2001-12-01

    Brookhaven National (BNL) Laboratory is a multidisciplinary laboratory that carries out basic and applied research in the physical, biomedical, and environmental sciences, and in selected energy technologies. It is managed by Brookhaven Science Associates, LLC, under contract with the U. S. Department of Energy. BNL's total annual budget has averaged about $450 million. There are about 3,000 employees, and another 4,500 guest scientists and students who come each year to use the Laboratory's facilities and work with the staff. The BNL Laboratory Directed Research and Development (LDRD) Program reports its status to the U.S. Department of Energy (DOE) annually in March, as required by DOE Order 4 13.2, ''Laboratory Directed Research and Development,'' March 5, 1997, and the LDRD Annual Report guidance, updated February 12, 1999. The LDRD Program obtains its funds through the Laboratory overhead pool and operates under the authority of DOE Order 4 13.2. The goals and objectives of BNL's LDRD Program can be inferred from the Program's stated purposes. These are to (1) encourage and support the development of new ideas and technology, (2) promote the early exploration and exploitation of creative and innovative concepts, and (3) develop new ''fundable'' R&D projects and programs. The emphasis is clearly articulated by BNL to be on supporting exploratory research ''which could lead to new programs, projects, and directions'' for the Laboratory. As one of the premier scientific laboratories of the DOE, BNL must continuously foster groundbreaking scientific research. At Brookhaven National Laboratory one such method is through its LDRD Program. This discretionary research and development tool is critical in maintaining the scientific excellence and long-term vitality of the Laboratory. Additionally, it is a means to stimulate the scientific community and foster new science and technology ideas

  19. Development of SSR markers and construction of a linkage map in jute

    Indian Academy of Sciences (India)

    Maumita Das; Sumana Banerjee; Raman Dhariwal; Shailendra Vyas; Reyazul R. Mir; Niladri Topdar; Avijit Kundu; Jitendra P. Khurana; Akhilesh K. Tyagi; Debabrata Sarkar; Mohit K. Sinha; Harindra S. Balyan; Pushpendra K. Gupta

    2011-04-01

    Jute is an important natural fibre crop, which is only second to cotton in its importance at the global level. It is mostly grown in Indian subcontinent and has been recently used for the development of genomics resources.We recently initiated a programme to develop simple sequence repeat markers and reported a set of 2469 SSR that were developed using four SSR-enriched libraries (Mir et al. 2009). In this communication, we report an additional set of 607 novel SSR in 393 SSR containing sequences. However, primers could be designed for only 417 potentially useful SSR. Polymorphism survey was carried out for 374 primer pairs using two parental genotypes (JRO 524 and PPO4) of a mapping population developed for fibre fineness; only 66 SSR were polymorphic. Owing to a low level of polymorphism between the parental genotypes and a high degree of segregation distortion in recombinant inbred lines, genotypic data of only 53 polymorphic SSR on the mapping population consisting of 120 RIL could be used for the construction of a linkage map; 36 SSR loci were mapped on six linkage groups that covered a total genetic distance of 784.3 cM. Hopefully, this map will be enriched with more SSR loci in future and will prove useful for identification of quantitative trait loci/genes for molecular breeding involving improvement of fibre fineness and other related traits in jute.

  20. Development of SSR markers and construction of a linkage map in jute.

    Science.gov (United States)

    Das, Moumita; Banerjee, Sumana; Dhariwal, Raman; Vyas, Shailendra; Mir, Reyazul R; Topdar, Niladri; Kundu, Avijit; Khurana, Jitendra P; Tyagi, Akhilesh K; Sarkar, Debabrata; Sinha, Mohit K; Balyan, Harindra S; Gupta, Pushpendra K

    2012-01-01

    Jute is an important natural fibre crop, which is only second to cotton in its importance at the global level. It is mostly grown in Indian subcontinent and has been recently used for the development of genomics resources.We recently initiated a programme to develop simple sequence repeat markers and reported a set of 2469 SSR that were developed using four SSR-enriched libraries (Mir et al. 2009). In this communication, we report an additional set of 607 novel SSR in 393 SSR containing sequences. However, primers could be designed for only 417 potentially useful SSR. Polymorphism survey was carried out for 374 primer pairs using two parental genotypes (JRO 524 and PPO4) of a mapping population developed for fibre fineness; only 66 SSR were polymorphic. Owing to a low level of polymorphism between the parental genotypes and a high degree of segregation distortion in recombinant inbred lines, genotypic data of only 53 polymorphic SSR on the mapping population consisting of 120 RIL could be used for the construction of a linkage map; 36 SSR loci were mapped on six linkage groups that covered a total genetic distance of 784.3 cM. Hopefully, this map will be enriched with more SSR loci in future and will prove useful for identification of quantitative trait loci/genes for molecular breeding involving improvement of fibre fineness and other related traits in jute.

  1. Development of Simple Functional Markers for Low Glutelin Content Gene 1 (Lgc1) in Rice (Oryza sativa)

    Institute of Scientific and Technical Information of China (English)

    CHEN Tao; TIAN Meng-xiang; ZHANG Ya-dong; ZHU Zhen; ZHAO Ling; ZHAO Qing-yong; LIN Jing; ZHOU Li-hui; WANG Cai-lin

    2010-01-01

    Rice with low glutelin content is suitable as functional food for patients affected by kidney failure. Low glutelin- content gene Lgc1 in rice has a 3.5-kb deletion between two highly similar glutelin genes GluB4 and GluB5, which locates on the short arm of chromosome 2. To improve the selection efficiency in low glutelin-content rice breeding, two molecular markers designated as InDel-Lgc1-1 and InDel-Lgc1-2 were developed to detect the low glutelin-content gene Lgc1. A double PCR detection indicated that combined use of the two markers could easily distinguish the genotypes of Lgc1 from different rice varieties. Therefore, as a simple and low-cost technique, the molecular marker could be widely used to identify different varieties with Lgc1 gene and applied in marker-assisted selection of low glutelin-content rice.

  2. Development of SSR Markers for a Phytopathogenic Fungus, Blumeria graminis f.sp. tritici, Using a FIASCO Protocol

    Institute of Scientific and Technical Information of China (English)

    WANG Meng; XUE Fei; YANG Peng; DUAN Xia-yu; ZHOU Yi-lin; SHEN Chong-yao; ZHANG Guo-zhen; WANG Bao-tong

    2014-01-01

    Simple sequence repeats (SSR) have been widely used as molecular markers due to their abundance and high polymorphism. However, up to now, the SSR markers had not been developed in the obligate biotrophic phytopathogenic fungus, Blumeria graminis f.sp. tritici. From (AC)10 and (AG)10 enriched genomic libraries for Bgt, 25 primer pairs were designed using the FIASCO (fast isolation by AFLP of sequences containing repeats) protocol. Five primer pairs exhibited polymorphism with allelic diversity from two to seven alleles and produced 29 alleles in a survey of 90 isolates collected from six provinces (cities) in China, while the others displayed monomorphic. Levels of observed heterozygosity ranged from 0.000-0.044 (mean 0.025) and expected heterozygosity ranged from 0.297-0.816 (mean 0.538). These molecular markers provide a novel source to genetic diversity assays and to genetic and physical mapping of Bgt. SSR markers of Bgt need to be further explored.

  3. Annual report of Power Reactor and Nuclear Fuel Development Corporation, fiscal year 1994

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-09-01

    This was the Annual Report of the Power Reactor and Nuclear Fuel Development Corporation, Fiscal Year of 1994. In this report, the following 12 items are described: (1) Development of the fast breeding reactor; (a) operation of the fast experimental reactor, `Joyo`, (b) construction and trial operation of the fast breeding prototype reactor, `Monju`, and (c) R and D of FBR; (2) Development of the new type conversion reactor; (a) operation of prototype reactor, `Fugen`, and (b) R and D of ATR; (3) Development of uranium mining and conversion; (4) Development of uranium concentration technology; (5) Development of plutonium fuel; (a) preparation of the MOX fuel, (b) preparation facility construction of the MOX fuel, (c) R and D of plutonium fuel. and (d) technical development of plutonium mixing and conversion; (6) Reprocessing of spent fuel; (7) Environmental technology development of radioactive waste; (8) Creative and innovative R and D; (9) Management and nuclear non-proliferation countermeasure of nuclear matter; (10) Safety management and safety study; (11) Related common business; and (12) General management business. (G.K.)

  4. Expression kinetics of hepatic progenitor markers in cellular models of human liver development recapitulating hepatocyte and biliary cell fate commitment.

    Science.gov (United States)

    Chaudhari, Pooja; Tian, Lipeng; Deshmukh, Abhijeet; Jang, Yoon-Young

    2016-09-01

    Due to the limitations of research using human embryos and the lack of a biological model of human liver development, the roles of the various markers associated with liver stem or progenitor cell potential in humans are largely speculative, and based on studies utilizing animal models and certain patient tissues. Human pluripotent stem cell-based in vitro multistage hepatic differentiation systems may serve as good surrogate models for mimicking normal human liver development, pathogenesis and injury/regeneration studies. Here, we describe the implications of various liver stem or progenitor cell markers and their bipotency (i.e. hepatocytic- and biliary-epithelial cell differentiation), based on the pluripotent stem cell-derived model of human liver development. Future studies using the human cellular model(s) of liver and biliary development will provide more human relevant biological and/or pathological roles of distinct markers expressed in heterogeneous liver stem/progenitor cell populations.

  5. Development of Soybean EST-SSR Markers and Their Use to Assess Genetic Diversity in the Subgenus Soja

    Institute of Scientific and Technical Information of China (English)

    LIU Yu-lin; LI Ying-hui; ZHOU Guo-an; Uzokwe N; CHANG Ru-zhen; CHEN Shou-yi; QIU Li-juan

    2010-01-01

    Developing expressed sequence tag-derived SSR (EST-SSR) markers is imperative in genetic research. In this paper, we reported 37 EST-SSR markers which were developed from 286 unigenes obtained from soybean eDNA library. Among the 286 markers designed for the 4 accessions of Glycine max and 6 of its wild progenitor (G. soja) within the subgenus Soja,209 markers amplified DNA fragments, taking 73.1% and 37 markers appeared to be polymorphic, which was 12.9% of the total. The 37 loci detected a total of 142 alleles, while the PIC values varied from 0.194 to 0.794. Both the number of alleles per locus and PIC value were significantly related to the SSR motif. Six EST-SSR loci may be fixed for different alleles between G. max and G. soja since they were particularly polymorphic among the 6 G. soja accessions. A neighbor-joining tree placed the G. max accessions together as a group within the G. soja, though the average genetic distance among G. soja accessions was much higher. These new EST-SSRs markers will be useful for genetic diversity analysis, genetic mapping construction and gene discovery in Soja subgenus.

  6. Analysis of genetic diversity of Brassica rapa var. chinensis using ISSR markers and development of SCAR marker specific for Fragrant Bok Choy, a product of geographic indication.

    Science.gov (United States)

    Shen, X L; Zhang, Y M; Xue, J Y; Li, M M; Lin, Y B; Sun, X Q; Hang, Y Y

    2016-04-25

    Non-heading Chinese cabbage [Brassica rapa var. chinensis (Linnaeus) Kitamura] is a popular vegetable and is also used as a medicinal plant in traditional Chinese medicine. Fragrant Bok Choy is a unique accession of non-heading Chinese cabbage and a product of geographic indication certified by the Ministry of Agriculture of China, which is noted for its rich aromatic flavor. However, transitional and overlapping morphological traits can make it difficult to distinguish this accession from other non-heading Chinese cabbages. This study aimed to develop a molecular method for efficient identification of Fragrant Bok Choy. Genetic diversity analysis, based on inter-simple sequence repeat molecular markers, was conducted for 11 non-heading Chinese cabbage accessions grown in the Yangtze River Delta region. Genetic similarity coefficients between the 11 accessions ranged from 0.5455 to 0.8961, and the genetic distance ranged from 0.0755 to 0.4475. Cluster analysis divided the 11 accessions into two major groups. The primer ISSR-840 amplified a fragment specific for Fragrant Bok Choy. A pair of specific sequence-characterized amplified region (SCAR) primers based on this fragment amplified a target band in Fragrant Bok Choy individuals, but no band was detected in individuals of other accessions. In conclusion, this study has developed an efficient strategy for authentication of Fragrant Bok Choy. The SCAR marker described here will facilitate the conservation and utilization of this unique non-heading Chinese cabbage germplasm resource.

  7. Development of single nucleotide polymorphism (SNP) markers from the mango (Mangiferaindica) transcriptome for mapping and estimation of genetic diversity

    Science.gov (United States)

    The development of resources for genomic studies in Mangifera indica (mango) will allow marker-assisted selection and identification of genetically diverse germplasm, greatly aiding mango breeding programs. We report here a first step in developing such resources, our identification of thousands una...

  8. Development of polymorphic genic-SSR markers by cDNA library sequencing in boxwood, Buxus spp. (Buxaceae)

    Science.gov (United States)

    Genic microsatellites or simple sequence repeat (genic-SSR) markers were developed in boxwood (Buxus taxa) for genetic diversity analysis, identification of taxa, and to facilitate breeding. cDNA libraries were developed from mRNA extracted from leaves of Buxus sempervirens ‘Vardar Valley’ and seque...

  9. Development of tools and strategies towards marker assisted selection and gene cloning

    NARCIS (Netherlands)

    Brugmans, B.W.

    2005-01-01

    In this thesis research is described aiming at alleviation of the perceived limitations in the standard protocol which encompasses: mapping a trait, followed by marker saturation, genetic resolution, and finally BAC landing and walking to span the physical distance between the markers.

  10. Development of simple sequence repeat markers and diversity analysis in alfalfa (Medicago sativa L.).

    Science.gov (United States)

    Wang, Zan; Yan, Hongwei; Fu, Xinnian; Li, Xuehui; Gao, Hongwen

    2013-04-01

    Efficient and robust molecular markers are essential for molecular breeding in plant. Compared to dominant and bi-allelic markers, multiple alleles of simple sequence repeat (SSR) markers are particularly informative and superior in genetic linkage map and QTL mapping in autotetraploid species like alfalfa. The objective of this study was to enrich SSR markers directly from alfalfa expressed sequence tags (ESTs). A total of 12,371 alfalfa ESTs were retrieved from the National Center for Biotechnology Information. Total 774 SSR-containing ESTs were identified from 716 ESTs. On average, one SSR was found per 7.7 kb of EST sequences. Tri-nucleotide repeats (48.8 %) was the most abundant motif type, followed by di-(26.1 %), tetra-(11.5 %), penta-(9.7 %), and hexanucleotide (3.9 %). One hundred EST-SSR primer pairs were successfully designed and 29 exhibited polymorphism among 28 alfalfa accessions. The allele number per marker ranged from two to 21 with an average of 6.8. The PIC values ranged from 0.195 to 0.896 with an average of 0.608, indicating a high level of polymorphism of the EST-SSR markers. Based on the 29 EST-SSR markers, assessment of genetic diversity was conducted and found that Medicago sativa ssp. sativa was clearly different from the other subspecies. The high transferability of those EST-SSR markers was also found for relative species.

  11. Development of a Simvastatin Selection Marker for a Hyperthermophilic Acidophile, Sulfolobus islandicus

    DEFF Research Database (Denmark)

    Zheng, Tao; Huang, Qihong; Zhang, Changyi;

    2012-01-01

    We report here a novel selectable marker for the hyperthermophilic crenarchaeon Sulfolobus islandicus. The marker cassette is composed of the sac7d promoter and the hmg gene coding for the 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase (P(sac7d)-hmg), which confers simvastatin resistance...

  12. Development and mapping of a public reference set of SSR markers in Lolium perenne L.

    NARCIS (Netherlands)

    Bach, J.L.; Muylle, H.; Arens, P.F.P.; Andersen, C.H.; Bach Holm, P.; Ghesquiere, M.; Julier, B.; Lubberstedt, T.; Nielsen, K.K.; Riek, de J.; Roldán-Ruiz, I.; Roulund, N.; Taylor, C.; Vosman, B.J.; Barre, P.

    2005-01-01

    We report on the characterization and mapping of 76 simple sequence repeat (SSR) markers for Lolium perenne. These markers are publicly available or obtained either from genomic libraries enriched for SSR motifs or L. perenne expressed sequence tag (EST) clones. Four L. perenne mapping populations w

  13. Annual and monthly range fidelity of female boreal woodland caribou in respons to petroleum development

    Directory of Open Access Journals (Sweden)

    Boyan V. Tracz

    2010-03-01

    Full Text Available Petroleum-sector development in northern Alberta, Canada has been implicated as one factor influencing the decline of boreal woodland caribou (Rangifer tarandus caribou. Previous research showed that caribou are farther from petroleum-sector disturbances within their home range than expected. As petroleum development increases, the distance caribou can selectively place themselves relative to industrial disturbance must decrease, because distances between disturbances decrease. Conceptually, the number of local disturbances becomes so large that caribou either abandon their local avoidance behaviour or leave their traditional home range. We evaluated whether an intense petroleum- development event in northern Alberta was sufficient to result in home range abandonment by female woodland caribou. Using well locations as an index of petroleum development, we found that caribou studied from 1992 to 2000 did not change their annual or monthly range fidelity as a function of development intensity. Caribou remained in peatland complexes containing a large number of petroleum-sector disturbances rather than move to new areas, presumably because the risks of dispersing across upland habitat to reach other suitable habitat are high. Such range fidelity may have fitness consequences for woodland caribou if they suffer greater predation in areas where petroleum development is occurring.

  14. Development of Molecular Marker Linked to Cf-10 Gene Using SSR and AFLP Method in Tomato

    Institute of Scientific and Technical Information of China (English)

    Li Ning; Jiang Jing-bin; Li Jing-fu; Xu Xiang-yang

    2012-01-01

    The leaf mould resistance gene Cf-10 on tomato confered resistant or immune to all prevalent physiological races of Cladosporium fulvum presented in three northeastern provinces of China in inoculation test. In order to better utilize Cf-10 gene in a marker-assisted selection program and to permit the pyramiding of one or several resistance genes in a cultivar, tightly linked SSR and AFLP markers were obtained by the bulked segregant analysis method. One SSR marker and three AFLP markers were identified linked to Cf-10 gene, with the distance of 9.73, 5.8, 8.5, and 10.6 cM, respectively. These markers will facilitate the selection of resistant tomato germplasm containing Cf-10 gene.

  15. Development of EST-SSR markers for the study of population structure in lettuce (Lactuca sativa L.).

    Science.gov (United States)

    Simko, Ivan

    2009-01-01

    A set of 61 simple sequence repeat (SSR) markers was developed from the 19,523 Lactuca sativa and Lactuca serriola unigenes. Approximately 4.5% of the unigenes contained a perfect SSR at least 20 bp long, corresponding to roughly 1 perfect SSR per 14.7 kb. Marker polymorphism was tested on a set comprising 96 accessions representing all major horticultural types and 3 wild species (L. serriola, Lactuca saligna, and Lactuca virosa). Both the average marker heterozygosity (UHe = 0.32) and the number of different alleles per locus (Na = 3.56) were significantly reduced in expressed sequence tag (EST)-SSRs as compared with anonymous SSRs (UHe = 0.59, Na = 5.53). Marker transfer rate to the wild species corresponded to the decreasing sexual compatibility with L. sativa and was higher for EST-SSRs (100% L. serriola, 87% L. saligna, and 75% L. virosa) than for anonymous SSRs (93%, 66%, and 42%, respectively). Assessment of population structure among 90 L. sativa cultivars with SSRs was in good agreement with classification into the horticultural types. The average marker heterozygosity was smallest in iceberg (0.097), Latin (0.140), and romaine-type (0.151) cultivars while highest in leaf (green leaf 0.208 and red leaf 0.240) lettuces. The level of marker heterozygosity is in accord with morphological variability observed in different horticultural types.

  16. Development of Insertion and Deletion Markers based on Biparental Resequencing for Fine Mapping Seed Weight in Soybean

    Directory of Open Access Journals (Sweden)

    Ying-hui Li

    2014-11-01

    Full Text Available As a complement to single nucleotide polymorphisms (SNPs and simple sequence repeats (SSRs, biallelic insertions and deletions (InDels represent powerful molecular markers with desirable features for filling the gap in current genetic linkage maps. In this study, 28,908 small InDel polymorphisms (1–5 base pair, bp distributed genome-wide were identified and annotated by comparison of a whole-genome resequencing data set from two soybean [ (L. Merr.] genotypes, cultivar Zhonghunag13 (ZH and line Zhongpin03-5373 (ZP. The physical distribution of InDel polymorphisms in soybean genome was uneven, and matched closely with the distribution of previously annotated genes. The average density of InDel in the arm region was significantly higher than that in the pericentromeric region. The genomic regions that were fixed between the two elites were elucidated. With this information, five InDel markers within a putative quantitative trait locus (QTL for seed weight (SW, , were developed and used to genotype 254 recombinant inbred lines (RILs derived from the cross of ZP × ZH. Adding these five InDel markers to previously used SNP and SSR markers facilitated the discovery of further recombination events allowing fine-mapping the QTL to a 0.5 Mbp region. Our study clearly underlines the high value of InDel markers for map-based cloning and marker-assisted selection in soybean.

  17. Novel microsatellite marker development from the unassembled genome sequence data of the marbled flounder Pseudopleuronectes yokohamae.

    Science.gov (United States)

    Minegishi, Yuki; Ikeda, Minoru; Kijima, Akihiro

    2015-12-01

    Various genome-scale data have been increasingly published in diverged species, but they can be reused for other purposes by re-analyzing in other ways. As a case study to utilize the published genome data, we developed microsatellite markers from the genome sequence data (assembled contigs and unassembled reads) of the marbled flounder Pseudopleuronectes yokohamae. No microsatellites were identified in the contig sequences, whereas the computer software found 781,773 sequences containing microsatellites with di- to hexa-nucleotide motif in the unassembled reads. For 86,732 unique sequences among them, a total of 331,368 primer pairs were designed. Screening based on PCR amplification, polymorphisms and accurate genotyping resulted in sixteen primer sets, which were later characterized using 45 samples collected in Onagawa Bay, Miyagi, Japan. The presence of null alleles was suggested at four loci in the studied population but no evidence of allelic dropout was found. The observed number of alleles and heterozygosity was 2-20 and 0-0.88889, respectively, indicating polymorphisms and usefulness for population genetic analyses of this species. In addition, a large number of the microsatellite primers developed in this study are potentially applicable also for kinship estimation, individual fingerprint and linkage map construction.

  18. Development and characterization of genic SSR markers from low depth genome sequence of Clarias batrachus (magur)

    Indian Academy of Sciences (India)

    SHREYA SRIVASTAVA; BASDEO KUSHWAHA; JYOTI PRAKASH; RAVINDRA KUMAR; N. S. NAGPURE; SUYASH AGARWAL; MANMOHAN PANDEY; P. DAS; C.G. JOSHI; J. K. JENA

    2016-09-01

    Indian magur (Clarias batrachus) is an important freshwater catfish, which is listed as endangered under A3cde+ 4acde ver. 3.1 categories by the IUCN (2015) due to decreasing population trend. Microsatellites or short sequence repeats (SSRs) tagged to genes have been utilized as gene marker. In the present study, 31,814 SSRs of C. batrachus (magur) were identified using microsatellite identification tool programme from the next generation sequencing data generated on Roche 454 and Ion Torrent platforms. A bioinformatics pipeline, with stringent criteria resulted in selection of 1672 microsatellite loci falling in the genic region. Initially, a total of 30 loci were selected for primer development; and of these 14 were successfully amplified and five were found to be polymorphic in 30 individuals of C. batrachus(magur). The observed as well as expected heterozygosity ranged from 0.038 to 0.526 and 0.434 to 0.784, respectively, and the number of observed alleles ranged from three to five. The study reported the application of next generation sequencing technologies for rapid development of microsatellite loci in Indian catfish species,C. batrachus (magur)

  19. A Set of 20 New SSR Markers Developed and Evaluated in Mandevilla Lindl.

    Directory of Open Access Journals (Sweden)

    Alev Oder

    2016-09-01

    Full Text Available Mandevilla is an ornamental crop with a bright future worldwide because of its high commercial acceptance and added value. However, as with most ornamental species, there are few molecular tools to support cultivar breeding and innovation. In this work, we report the development and analysis of 20 new Simple Sequence Repeat (SSR markers in Mandevilla. Microsatellites were isolated from two enriched small-insert genomic libraries of Mandevilla × amabilis. The diversity parameters estimated after their amplification in a group of 11 commercial genotypes illustrate the effect of two opposite drifts: the high relatedness of cultivars belonging to the same commercial group and the high divergence of other cultivars, especially M. × amabilis. Based on their different band patterns, six genotypes were uniquely distinguished, and two groups of sport mutations remained undistinguishable. The amplification of the SSRs in three wild species suggested the existence of unexploited diversity available to be introgressed into the commercial pool. This is the first report of available microsatellites in Mandevilla. The development process has provided some clues concerning the genome structure of the species, and the SSRs obtained will help to create new products and to protect existing and upcoming plant innovations.

  20. A Set of 20 New SSR Markers Developed and Evaluated in Mandevilla Lindl.

    Science.gov (United States)

    Oder, Alev; Lannes, Robert; Viruel, Maria Angeles

    2016-09-30

    Mandevilla is an ornamental crop with a bright future worldwide because of its high commercial acceptance and added value. However, as with most ornamental species, there are few molecular tools to support cultivar breeding and innovation. In this work, we report the development and analysis of 20 new Simple Sequence Repeat (SSR) markers in Mandevilla. Microsatellites were isolated from two enriched small-insert genomic libraries of Mandevilla × amabilis. The diversity parameters estimated after their amplification in a group of 11 commercial genotypes illustrate the effect of two opposite drifts: the high relatedness of cultivars belonging to the same commercial group and the high divergence of other cultivars, especially M. × amabilis. Based on their different band patterns, six genotypes were uniquely distinguished, and two groups of sport mutations remained undistinguishable. The amplification of the SSRs in three wild species suggested the existence of unexploited diversity available to be introgressed into the commercial pool. This is the first report of available microsatellites in Mandevilla. The development process has provided some clues concerning the genome structure of the species, and the SSRs obtained will help to create new products and to protect existing and upcoming plant innovations.

  1. Allelic diversity of a beer haze active protein gene in cultivated and Tibetan wild barley and development of allelic specific markers.

    Science.gov (United States)

    Ye, Lingzhen; Dai, Fei; Qiu, Long; Sun, Dongfa; Zhang, Guoping

    2011-07-13

    The formation of haze is a serious quality problem in beer production. It has been shown that the use of silica elute (SE)-ve malt (absence of molecular weight (MW) ∼14000 Da) for brewing can improve haze stability in the resultant beer, and the protein was identified as a barley trypsin inhibitor of the chloroform/methanol type (BTI-CMe). The objectives of this study were to determine (1) the allelic diversity of the gene controlling BTI-CMe in cultivated and Tibetan wild barley and (2) allele-specific (AS) markers for screening SE protein type. A survey of 172 Tibetan annual wild barley accessions and 71 cultivated barley genotypes was conducted, and 104 wild accessions and 35 cultivated genotypes were identified as SE+ve and 68 wild accessions and 36 cultivated genotypes as SE-ve. The allelic diversity of the gene controlling BTI-CMe was investigated by cloning, alignment, and association analysis. It was found that there were significant differences between the SE+ve and SE-ve types in single-nucleotide polymorphisms at 234 (SNP(234)), SNP(313), and SNP(385.) Furthermore, two sets of AS markers were developed to screen SE protein type based on SNP(313). AS-PCR had results very similar to those obtained by immunoblot method. Mapping analysis showed that the gene controlling the MW∼14 kDa band was located on the short arm of chromosome 3H, at the position of marker BPB-0527 (33.302 cM) in the Franklin/Yerong DH population.

  2. ES12; The 24th Annual Workshop on Recent Developments in Electronic Structure Theory

    Energy Technology Data Exchange (ETDEWEB)

    Holzwarth, Natalie; Thonhauser, Timo; Salam, Akbar

    2012-06-29

    ES12: The 24th Annual Workshop on Recent Developments in Electronic Structure Theory was held June 5-8, 2012 at Wake Forest University in Winston-Salem, NC 27109. The program consisted of 24 oral presentations, 70 posters, and 2 panel discussions. The attendance of the Workshop was comparable to or larger than previous workshops and participation was impressively diverse. The 136 participants came from all over the world and included undergraduate students, graduate students, postdoctoral researchers, and senior scientists. The general assessment of the Workshop was extremely positive in terms of the high level of scientific presentations and discussions, and in terms of the schedule, accommodations, and affordability of the meeting.

  3. Development and application of the electrochemical etching technique. Annual progress report

    Energy Technology Data Exchange (ETDEWEB)

    1980-08-01

    This annual progress report documents further advances in the development and application of electrochemical etching of polycarbonate foils (ECEPF) for fast, intermediate, and thermal neutron dosimetry as well as alpha particle dosimetry. The fast (> 1.1 MeV) and thermal neutron dosimetry techniques were applied to a thorough investigation of the neutron contamination inherent in and about the primary x-ray beam of several medical therapy electron accelerators. Because of the small size of ECEPF dosimeters in comparison to other neutron meters, they have an unusually low perturbation of the radiation field under measurement. Due to this small size and the increased sensitivity of the ECEPF dosimeter over current techniques of measuring neutrons in a high photon field, the fast neutron contamination in the primary x-ray beam of all the investigated accelerators was measured with precision and found to be greater than that suggested by the other, more common, neutron dosimetry methods.

  4. Proteomic profiling of pretreatment serum from HIV-infected patients identifies candidate markers predictive of lymphoma development

    DEFF Research Database (Denmark)

    Vase, Maja Ølholm; Ludvigsen, Maja; Bendix, Knud;

    2016-01-01

    Objective: HIV-infected individuals have an increased risk of developing lymphoma. We sought to identify markers predictive of lymphoma development by comparing protein expression patterns in serum obtained at the time of HIV diagnosis from patients who later developed malignant lymphoma or benign...... protein spots were detected. Using principal components analysis, spots containing immunoglobulin J chain, apolipoprotein A-I, procollagen C-endopeptidase enhancer-1 and complement C4-A were associated with lymphoma development (P...

  5. Developing and testing a global-scale regression model to quantify mean annual streamflow

    Science.gov (United States)

    Barbarossa, Valerio; Huijbregts, Mark A. J.; Hendriks, A. Jan; Beusen, Arthur H. W.; Clavreul, Julie; King, Henry; Schipper, Aafke M.

    2017-01-01

    Quantifying mean annual flow of rivers (MAF) at ungauged sites is essential for assessments of global water supply, ecosystem integrity and water footprints. MAF can be quantified with spatially explicit process-based models, which might be overly time-consuming and data-intensive for this purpose, or with empirical regression models that predict MAF based on climate and catchment characteristics. Yet, regression models have mostly been developed at a regional scale and the extent to which they can be extrapolated to other regions is not known. In this study, we developed a global-scale regression model for MAF based on a dataset unprecedented in size, using observations of discharge and catchment characteristics from 1885 catchments worldwide, measuring between 2 and 106 km2. In addition, we compared the performance of the regression model with the predictive ability of the spatially explicit global hydrological model PCR-GLOBWB by comparing results from both models to independent measurements. We obtained a regression model explaining 89% of the variance in MAF based on catchment area and catchment averaged mean annual precipitation and air temperature, slope and elevation. The regression model performed better than PCR-GLOBWB for the prediction of MAF, as root-mean-square error (RMSE) values were lower (0.29-0.38 compared to 0.49-0.57) and the modified index of agreement (d) was higher (0.80-0.83 compared to 0.72-0.75). Our regression model can be applied globally to estimate MAF at any point of the river network, thus providing a feasible alternative to spatially explicit process-based global hydrological models.

  6. Late appearance of a type I alveolar epithelial cell marker during fetal rat lung development.

    Science.gov (United States)

    Danto, S I; Zabski, S M; Crandall, E D

    1994-10-01

    Recent studies in fetal lung using immunological and molecular probes have revealed type I and type II cell phenotypic markers in primordial lung epithelial cells prior to the morphogenesis of these cell types. We have recently developed monoclonal antibodies specific for adult type I cells. To evaluate further the temporal appearance of the type I cell phenotype during alveolar epithelial cell ontogeny, we analyzed fetal lung development using one of our monoclonal antibodies (mAb VIII B2). The epitope recognized by mAb VIII B2 first appears in the canalicular stage of fetal lung development, at approx. embryonic day 19 (E19), in occasional, faintly stained tubules. Staining with this type I cell probe becomes more intense and more widespread with increasing gestational age, during which time the pattern of staining changes. Initially, all cells of the distal epithelial tubules are uniformly labelled along their apical and basolateral surfaces. As morphological differentiation of the alveolar epithelium proceeds, type I cell immunoreactivity appears to become restricted to the apical surface of the primitive type I cells in a pattern approaching that seen in the mature lung. We concurrently analyzed developing fetal lung with an antiserum to surfactant apoprotein-A (alpha-SP-A). Consistent with the findings of others, labeling of SP-A was first detectable in scattered cuboidal cells at E18. Careful examination of the double-labeled specimens suggested that some cells were reactive with both the VIII B2 and SP-A antibodies, particularly at E20. Confocal microscopic analysis of such sections from E20 lung confirmed this impression. Three populations of cells were detected: cells labeled only with alpha-SP-A, cells labeled only with mAb VIII B2, and a smaller subset of cells labeled by both.(ABSTRACT TRUNCATED AT 250 WORDS)

  7. Dynamic Regulation of Auxin Response during Rice Development Revealed by Newly Established Hormone Biosensor Markers

    Science.gov (United States)

    Yang, Jing; Yuan, Zheng; Meng, Qingcai; Huang, Guoqiang; Périn, Christophe; Bureau, Charlotte; Meunier, Anne-Cécile; Ingouff, Mathieu; Bennett, Malcolm J.; Liang, Wanqi; Zhang, Dabing

    2017-01-01

    The hormone auxin is critical for many plant developmental processes. Unlike the model eudicot plant Arabidopsis (Arabidopsis thaliana), auxin distribution and signaling in rice tissues has not been systematically investigated due to the absence of suitable auxin response reporters. In this study we observed the conservation of auxin signaling components between Arabidopsis and model monocot crop rice (Oryza sativa), and generated complementary types of auxin biosensor constructs, one derived from the Aux/IAA-based biosensor DII-VENUS but constitutively driven by maize ubiquitin-1 promoter, and the other termed DR5-VENUS in which a synthetic auxin-responsive promoter (DR5rev) was used to drive expression of the yellow fluorescent protein (YFP). Using the obtained transgenic lines, we observed that during the vegetative development, accumulation of DR5-VENUS signal was at young and mature leaves, tiller buds and stem base. Notably, abundant DR5-VENUS signals were observed in the cytoplasm of cortex cells surrounding lateral root primordia (LRP) in rice. In addition, auxin maxima and dynamic re-localization were seen at the initiation sites of inflorescence and spikelet primordia including branch meristems (BMs), female and male organs. The comparison of these observations among Arabidopsis, rice and maize suggests the unique role of auxin in regulating rice lateral root emergence and reproduction. Moreover, protein localization of auxin transporters PIN1 homologs and GFP tagged OsAUX1 overlapped with DR5-VENUS during spikelet development, helping validate these auxin response reporters are reliable markers in rice. This work firstly reveals the direct correspondence between auxin distribution and rice reproductive and root development at tissue and cellular level, and provides high-resolution auxin tools to probe fundamental developmental processes in rice and to establish links between auxin, development and agronomical traits like yield or root architecture. PMID

  8. Development of microsatellite markers in the tetraploid fern Ceratopteris thalictroides (Parkeriaceae) using RAD tag sequencing.

    Science.gov (United States)

    Yang, X Y; Long, Z C; Gichira, A W; Guo, Y H; Wang, Q F; Chen, J M

    2016-02-19

    To understand the genetic variability of the tetraploid fern Ceratopteris thalictroides (Parkeriaceae), we described 30 polymorphic microsatellite markers obtained using the restriction site-associated DNA (RAD) tag sequencing technique. A total of 26 individuals were genotyped for each marker. The number of alleles per locus ranged from 4 to 10, and the expected heterozygosity and the Shannon-Wiener index ranged from 0.264 to 0.852 and 0.676 to 2.032, respectively. Because these 30 microsatellite markers exhibit high degrees of genetic variation, they will be useful tools for studying the adaptive genetic variation and sustainable conservation of C. thalictroides.

  9. SNP2CAPS: a SNP and INDEL analysis tool for CAPS marker development

    OpenAIRE

    Thiel, Thomas; Kota, Raja; Grosse, Ivo; Stein, Nils; Graner, Andreas

    2004-01-01

    With the influx of various SNP genotyping assays in recent years, there has been a need for an assay that is robust, yet cost effective, and could be performed using standard gel-based procedures. In this context, CAPS markers have been shown to meet these criteria. However, converting SNPs to CAPS markers can be a difficult process if done manually. In order to address this problem, we describe a computer program, SNP2CAPS, that facilitates the computational conversion of SNP markers into CA...

  10. Response of larch root development to annual changes of water conditions in eastern Siberia

    Science.gov (United States)

    Takenaka, Chisato; Miyahara, Mie; Ohta, Takeshi; Maximov, Trofim C.

    2016-06-01

    Eastern Siberia is characterized by continuous permafrost, and has recently been exposed to the effects of climate change. Larch, which is the dominant tree species, has been subject to major environmental changes including fluctuations in soil water content. The purpose of this study was to clarify the responses of mature larch tree roots to changes in soil water conditions. We established a treatment plot in a larch forest, and artificially changed the soil water conditions by covering the ground surface with a vinyl sheet, and from 2004 to 2006 monitored root development through root windows. The vinyl sheet maintained high levels of soil water content, even though the ambient conditions varied from dry in 2004 to wet in 2005 and dry in 2006. In the treatment plot the plants adapted to the wet conditions by decreasing vertical root development. In contrast, roots of plants in the control plot developed to the subsurface layer, even in 2005, and did not develop vertically in 2006 despite the drought. We conclude that larch adapted to the annual changes in soil water content by changing the vertical distribution of roots, and that this reflected a memory effect.

  11. Development of di-nucleotide microsatellite markers and construction of genetic linkage map in mango (Mangifera indica L.

    Directory of Open Access Journals (Sweden)

    Chataporn Chunwongse

    2015-04-01

    Full Text Available Forty-two di-nucleotide microsatellite, or simple-sequence repeat (SSR, markers were developed using CA and CTenriched genomic libraries of Mangifera indica L. Six cultivated mangoes and two wild species were tested for primer amplifications. Most loci could amplify M. caloneura Kruz and M. foetida. The average number of alleles per locus was 4.4. The average expected heterozygosity and the maximum polymorphism information content value were 0.57 and 0.53, respectively. The SSRs developed in this study together with 65 SSRs and 145 restriction fragment length polymorphism (RFLP markers reported previously were used in the genetic linkage analysis. A partial genetic linkage map was constructed based on 31 F1 progenies from a cross between ‘Alphonso’ and ‘Palmer’. The map spanned a distance of 529.9 centiMorgan (cM and consisted of 9 microsatellite markers (6 from this study and 67 RFLP markers. The new SSR markers and the present map will be useful for mango genetic studies and breeding applications in the future.

  12. Development of a panel of unigene-derived polymorphic EST-SSR markers in lentil using public database information

    Institute of Scientific and Technical Information of China (English)

    Debjyoti Sen Gupta; Peng Cheng; Gaurav Sablok; Dil Thavarajah; Pushparajah Thavarajah; Clarice J Coyne; Shiv Kumar; Michael Baum; Rebecca J McGee

    2016-01-01

    Lentil (Lens culinaris Medik.), a diploid (2n=14) with a genome size greater than 4000 Mbp, is an important cool season food legume grown worldwide. The availability of genomic resources is limited in this crop species. The objective of this study was to develop polymorphic markers in lentil using publicly available curated expressed sequence tag information (ESTs). In this study, 9513 ESTs were downloaded from the National Center for Biotechnology Information (NCBI) database to develop unigene-based simple sequence repeat (SSR) markers. The ESTs were assembled into 4053 unigenes and then analyzed to identify 374 SSRs using the MISA microsatellite identification tool. Among the 374 SSRs, 26 compound SSRs were observed. Primer pairs for these SSRs were designed using Primer3 version 1.14. To classify the functional annotation of ESTs and EST–SSRs, BLASTx searches (using E-value 1 × 10−5) against the public UniProt (http://www.uniprot.org/) and NCBI (http://www.ncbi.nlh.nih.gov/) data-bases were performed. Further functional annotation was performed using PLAZA (version 3.0) comparative genomics and GO annotation was summarized using the Plant GO slim category. Among the synthesized 312 primers, 219 successfully amplified Lens DNA. A diverse panel of 24 Lens genotypes was used to identify polymorphic markers. A polymorphic set of 57 markers successfully discriminated the test genotypes. This set of polymorphic markers with functional annotation data could be used as molecular tools in lentil breeding.

  13. Molecular authentication of Gynostemma pentaphyllum through development and application of random amplification polymorphic DNA sequence-characterized amplified region marker.

    Science.gov (United States)

    Zhou, J; Wu, Y S; Zhao, R Q; Jiang, J F; Luo, Y; Ma, C T; Qian, J Y

    2015-12-08

    Due to the morphological similarities of aerial parts, it is difficult to distinguish Gynostemma pentaphyllum from Cayratia japonica, which is usually an adulterant of the former. To develop a reliable method for the identification and authentication of G. pentaphyllum, a combination of random amplification polymorphic DNA (RAPD) technique with sequence-characterized amplified region (SCAR) markers was studied. Twenty-five samples of G. pentaphyllum and two samples of C. japonica were collected from different regions in Guangxi or bought from different provinces in China. Through the RAPD analysis, significant genetic polymorphism was observed among the intraspecies samples of G. pentaphyllum. Furthermore, a specific marker, J-750, was obtained for authentication. Therefore, the SCAR marker for G. pentaphyllum (359 bp) was developed from the RAPD amplicon. With PCR amplification using the SCAR primers, a specific band of 359 bp was distinctly visible for all tested samples of G. pentaphyllum, but was absent in the samples of C. japonica. Furthermore, the results revealed that the SCAR marker was useful for the identification and authentication of G. pentaphyllum irrespective of whether samples were fresh, dry, or of commercial origin. The SCAR marker obtained in this study successfully authenticated G. pentaphyllum through an integrated PCR system containing SCAR and control primer combinations of two pairs. In addition, it was also used for simultaneous discrimination of G. pentaphyllum from C. japonica.

  14. Development of 15 genic-ssr markers in oil-tea tree (Camellia oleifera based on transcriptome sequencing

    Directory of Open Access Journals (Sweden)

    Jia Baoguang

    2014-01-01

    Full Text Available Oil-tea tree is one of the most important woody edible oil plants; however, lack of useful molecular markers hinders current genetic research. We performed transcriptome sequencing of developing seeds and characterized microsatellites from transcriptome sequences to identify valuable markers for C. oleifera molecular genetics research. A total of 69,798 unigenes were identified, in which 6,949 putative SSR motifs from 6,042 SSR-containing unique putative transcripts were discovered. Twenty-nine primer pairs corresponding to 29 unigene loci were designed, of which 15 polymorphic genic-SSR markers were developed in 18 varieties and characterized by capillary electrophoresis. The number of alleles per locus (Na ranged from 2 to 14, the expected heterozygosity (He ranged from 0.374 to 0.876, and the polymorphism information content (PIC values ranged from 0.498 to 0.887, respectively. Cross-species amplification was also conducted in 15 varieties of C. japonica. All 15 markers successfully amplified PCR products with expected size in C. japonica and exhibited polymorphisms. The 15 polymorphic genic- SSR markers will have potential for applications in genetic diversity evaluation, molecular fingerprinting identification, comparative genome analysis, and genetic mapping in the C. oleifera and C. japonica.

  15. Verbal markers of epistemic modality and their role in the development of communicative competences

    Directory of Open Access Journals (Sweden)

    Barbara Pihler Ciglič

    2014-12-01

    Full Text Available Modality in language, one of the characteristic phenomena of the process of communication, has to do with, in the broad sense, the mindset that the speaker indicates in his words while describing, questioning, or wanting to draw attention to what he is saying. Traditionally there is a tendency to gather, under the broad label of linguistic modality, a variety of different forms: verbal mode, auxiliary verbs, certain adverbs and particles, intonation, etc. The aim of this study is to analyze the Spanish verbal markers and their possibilities to express epistemic modality, which is defined as the linguistic expression of the degree of commitment that the speaker assumes about the factuality of his statement (Lyons 1977, Palmer 1986. The study focuses, first, on modal verbal periphrases and some of the tenses which can indicate the epistemic modality and/or evidentiality in certain contexts through the so-called »quotative« or »polyphonic« uses. The second part of this study consists of an analysis of the systematization of these resources in six selected manuals of Spanish as a Second Language (SSL; levels B1, B2 and C1 according to CEFR, with special attention to its contribution to the development of communicative competences (linguistic, sociolinguistic and pragmatic competence, again according to CEFR. We believe that the explicit study of epistemic modality in the SSL classroom effectively contributes to a good command of Spanish, and therefore deserves more attention.

  16. Transferability of Newly Developed Pear SSR Markers to Other Rosaceae Species.

    Science.gov (United States)

    Fan, L; Zhang, M-Y; Liu, Q-Z; Li, L-T; Song, Y; Wang, L-F; Zhang, S-L; Wu, J

    2013-01-01

    A set of 120 simple sequence repeats (SSRs) was developed from the newly assembled pear sequence and evaluated for polymorphisms in seven genotypes of pear from different genetic backgrounds. Of these, 67 (55.8 %) primer pairs produced polymorphic amplifications. Together, the 67 SSRs detected 277 alleles with an average of 4.13 per locus. Sequencing of the amplification products from randomly picked loci NAUPy31a and NAUpy53a verified the presence of the SSR loci. When the 67 primer pairs were tested on 96 individual members of eight species in the Rosaceae family, 61.2 % (41/67) of the tested SSRs successfully amplified a PCR product in at least one of the Rosaceae genera. The transferability from pear to different species varied from 58.2 % (apple) to 11.9 % (cherry). The ratio of transferability also reflected the closer relationships within Maloideae over Prunoideae. Two pear SSR markers, NAUpy43c and NAUpy55k, could distinguish the 20 different apple genotypes thoroughly, and UPGMA cluster analysis grouped them into three groups at the similarity level of 0.56. The high level of polymorphism and good transferability of pear SSRs to Rosaceae species indicate their promise for application to future molecular screening, map construction, and comparative genomic studies among pears and other Rosaceae species.

  17. Human Neutrophil Peptides 1-3 – Early Markers in Development of Colorectal Adenomas and Carcinomas

    Science.gov (United States)

    Mothes, Henning; Melle, Christian; Ernst, Günther; Kaufmann, Roland; von Eggeling, Ferdinand; Settmacher, Utz

    2008-01-01

    Expression of Human Neutrophil Peptides (HNP) 1–3 was recently found to be associated with development of colorectal cancer. Raised defensin-expression in tumours is believed to stem from increased infiltration of neutrophils into tumour environment. To further specify the role of α-defensins in tumourigenesis and progression, HNP1–3 were analyzed in colorectal adenomas and carcinomas of 87 patients and quantified in relation to cancer stage and grading. Using the ProteinChip arrays, HNP1–3 were found upregulated in both colorectal adenomas and carcinomas. By combining the array with Laser capture microscopy we were able to confirm that HNP1–3 are expressed by tumour cells but not by neutrophils or other tumour invading cells. These findings suggest that α-defensins are more likely to contribute to tumour growth than they are to mount an effective host anti-tumour response. However, the amount of HNP-expression was not found to be related to tumour stage, grading, and serological tumour markers. PMID:18957723

  18. Novel polymorphic microsatellite markers developed for a common reef sponge, Stylissa carteri

    KAUST Repository

    Giles, E.C.

    2013-04-04

    Despite the ubiquitous role sponges play in reef ecosystem dynamics, little is known about population-level connectivity in these organisms. The general field of population genetics in sponges remains in its infancy. To date, microsatellite markers have only been developed for few sponge species and no sponge population genetics studies using microsatellites have been conducted in the Red Sea. Here, with the use of next-generation sequencing, we characterize 12 novel polymorphic loci for the common reef sponge, Stylissa carteri. The number of alleles per loci ranged between three and eight. Observed heterozygosity frequencies (Ho) ranged from 0.125 to 0.870, whereas expected (He) heterozygosity frequencies ranged from 0.119 to 0.812. Only one locus showed consistent deviations from Hardy-Weinberg equilibrium (HWE) in both populations and two loci consistently showed the possible presence of null alleles. No significant linkage disequilibrium was detected for any pairs of loci. These microsatellites will be of use for numerous ecological studies focused on this common and abundant sponge. 2013 The Author(s).

  19. Membrane-based oligonucleotide array developed from multiple markers for the detection of many Phytophthora species.

    Science.gov (United States)

    Chen, Wen; Djama, Zeinab Robleh; Coffey, Michael D; Martin, Frank N; Bilodeau, Guillaume J; Radmer, Lorien; Denton, Geoff; Lévesque, C André

    2013-01-01

    Most Phytophthora spp. are destructive plant pathogens; therefore, effective monitoring and accurate early detection are important means of preventing potential epidemics and outbreaks of diseases. In the current study, a membrane-based oligonucleotide array was developed that can detect Phytophthora spp. reliably using three DNA regions; namely, the internal transcribed spacer (ITS), the 5' end of cytochrome c oxidase 1 gene (cox1), and the intergenic region between cytochrome c oxidase 2 gene (cox2) and cox1 (cox2-1 spacer). Each sequence data set contained ≈250 sequences representing 98 described and 15 undescribed species of Phytophthora. The array was validated with 143 pure cultures and 35 field samples. Together, nonrejected oligonucleotides from all three markers have the ability to reliably detect 82 described and 8 undescribed Phytophthora spp., including several quarantine or regulated pathogens such as Phytophthora ramorum. Our results showed that a DNA array containing signature oligonucleotides designed from multiple genomic regions provided robustness and redundancy for the detection and differentiation of closely related taxon groups. This array has the potential to be used as a routine diagnostic tool for Phytophthora spp. from complex environmental samples without the need for extensive growth of cultures.

  20. Development and Characterization of Microsatellite Markers for the Pacific Abalone (Haliotis discus) via EST Database Mining

    Institute of Scientific and Technical Information of China (English)

    ZHAN Aibin; BAO Zhenmin; WANG Mingling; CHANG Dan; YUAN Jian; WANG Xiaolong; HU Xiaoli; LIANG Chengzhu; HU Jingjie

    2008-01-01

    The EST database of the Pacific abalone (Haliotis discus) was mined for developing mierosatellite markers. A total of 1476 EST sequences were registered in GenBank when data mining was performed. Fifty sequences (approximately 3.4%) were found to contain one or more mierosatellites. Based on the length and GC content of the flanking regions, duster analysis and BLASTN, 13 microsatellite-containing ESTs were selected for PCR primer design. The results showed that 10 out of 13 primer pairs could amplify seorable PCR products and showed polymorphism. The number of alleles ranged from 2 to 13 and the values of Hoand He varied from 0.1222 to 0.8611 and 0.2449 to 0.9311, respectively. No significant linkage disequilibrium (LD) between any pairs of these loci was found, and 6 of 10 loci conformed to the Hardy-Weinberg equilibrium (HWE). These EST-SSRs are therefore potential tools for studies of intraspecies variation and hybrid identification.

  1. Development of marker-free transgenic Jatropha plants with increased levels of seed oleic acid

    Directory of Open Access Journals (Sweden)

    Qu Jing

    2012-02-01

    Full Text Available Abstract Background Jatropha curcas is recognized as a new energy crop due to the presence of the high amount of oil in its seeds that can be converted into biodiesel. The quality and performance of the biodiesel depends on the chemical composition of the fatty acids present in the oil. The fatty acids profile of the oil has a direct impact on ignition quality, heat of combustion and oxidative stability. An ideal biodiesel composition should have more monounsaturated fatty acids and less polyunsaturated acids. Jatropha seed oil contains 30% to 50% polyunsaturated fatty acids (mainly linoleic acid which negatively impacts the oxidative stability and causes high rate of nitrogen oxides emission. Results The enzyme 1-acyl-2-oleoyl-sn-glycero-3-phosphocholine delta 12-desaturase (FAD2 is the key enzyme responsible for the production of linoleic acid in plants. We identified three putative delta 12 fatty acid desaturase genes in Jatropha (JcFAD2s through genome-wide analysis and downregulated the expression of one of these genes, JcFAD2-1, in a seed-specific manner by RNA interference technology. The resulting JcFAD2-1 RNA interference transgenic plants showed a dramatic increase of oleic acid (> 78% and a corresponding reduction in polyunsaturated fatty acids (Jatropha had around 37% oleic acid and 41% polyunsaturated fatty acids. This indicates that FAD2-1 is the major enzyme responsible for converting oleic acid to linoleic acid in Jatropha. Due to the changes in the fatty acids profile, the oil of the JcFAD2-1 RNA interference seed was estimated to yield a cetane number as high as 60.2, which is similar to the required cetane number for conventional premium diesel fuels (60 in Europe. The presence of high seed oleic acid did not have a negative impact on other Jatropha agronomic traits based on our preliminary data of the original plants under greenhouse conditions. Further, we developed a marker-free system to generate the transgenic Jatropha

  2. Development of optical marker for polyolefin processes; Desenvolvimento de marcador optico para processamento de poliolefinas

    Energy Technology Data Exchange (ETDEWEB)

    Marchini, Leonardo Guedes

    2013-08-01

    Research and publications about luminescent polymers have been developed in the last years for the academic innovation; however the industrial application has been very limited in this area. Processed Optical markers are few explored due the difficult to process luminescent polymeric materials with stable luminescence. The materials used to process luminescent polypropylene (PP) were polyamide 6 (PA6) doped with europium complex [Eu(tta){sub 3}(H{sub 2}O){sub 2}] obtained through the dilution and casting process. The polyolefins because they are inert, do not fit the common procedure of doping, in consequence, in this work luminescent polypropylene was indirectly prepared by polyamide 6 doped with europium complex through extrusion process. Product characterization was done using Thermal gravimetry analysis (TG), Differential Scanning Calorimetric (DSC), X-Ray Diffraction (XRD), Infrared spectroscopy (FTIR) and spectro fluorescence of emission and excitation. The blend PP/PA6:Eu(tta){sub 3} presented luminescent properties, after semi-industrial process, as observed in the narrow bands of intra configuration transitions- 4f{sup 6} relatives to energy levels {sup 7}F{sub 0} {yields} {sup 5}L{sub 6} (394nm), {sup 7}F{sub 0} {yields} {sup 5}D{sub 3} (415nm), {sup 7}F{sub 0} {yields} {sup 5}D{sub 2} (464nm), {sup 7}F{sub 0} {yields} {sup 5}D{sub 1} (525nm) e {sup 7}F{sub 0} {yields} {sup 5}D{sub 0} (578nm) of emission spectrum. Red light of the pellets or film is emitted when excited in UV lamp (365nm). TG results showed under O{sub 2} atmosphere that PP doped with PA6:Eu(tta){sub 3} was more stable than pure PP. In this work was processed luminescent PP/PA6:Eu(tta){sub 3} with properties of thermal and photo stability which can be used as optical marker in polymer processing. (author)

  3. [Development and appraisement of functional molecular marker: intron sequence amplified polymorphism (ISAP)].

    Science.gov (United States)

    Lu, Cai-Rui; Yu, Shu-Xun; Yu, Ji-Wen; Fan, Shu-Li; Song, Mei-Zhen; Wang, Wu; Ma, Shu-Juan

    2008-09-01

    Molecular markers are playing an increasingly important role in map construction, QTL analysis, gene mapping and marker-assisted selection. Researchers hope the target gene and locus are as close as possible, one locus can present one gene, or linked with some important trait, then, individuals with useful trait can be selected through molecular markers selecting, and it's the functional molecular marker. PCR-based molecular markers such as RAPD, SSR, AFLP amplified non-coding regions, or the whole genome randomly, the locus is far away from the gene of targeted trait, this limit the ap-plication of these molecular markers. This study established a kind of functional molecular markers based on intron of gene sequence, trying to link loci with gene sequence to achieve the purpose of its function. It used the conservative consistent sequence of intron splicing sites as its core sequence of amplification. ISAP is a PCR-based marker system, it has two kinds of primers: forward primer and reverse primer, both primers are 18 bases. Any of the primers can be used to construct a primer combination with the other kind of primers. Seventeen primers, 9 forward and 8 reverse, were used to construct 72 primer combinations, 67 of them showed polymorphism in a G. hirsutum cv. CCRI36 x G. barbadense cv. H7124 F2 population and a total of 212 loci were obtained. Together with 164 SRAP loci, these 212 loci were used to construct a genetic linkage map. ISAP markers distributed evenly in the entire linkage group, part of the region had a high saturation, might be the coding sequence-rich region. Sequencing results of 20 fragments showed that 85% of the sequences announced homology with published EST sequence stored in the NCBI which indicated that they were amplified adjacent to expressed sequences. These results showed that ISAP marker system was simple, efficient, reliable, and had a relatively high polymorphism, furthermore, it directly targeted gene sequence, was a functional

  4. Development of microsatellite markers by transcriptome sequencing in two species of Amorphophallus (Araceae)

    OpenAIRE

    Zheng, Xingfei; Pan, Cheng; Diao, Ying; You, Yongning; Yang, Chaozhu; Hu, Zhongli

    2013-01-01

    Background Amorphophallus is a genus of perennial plants widely distributed in the tropics or subtropics of West Africa and South Asia. Its corms contain a high level of water-soluble glucomannan; therefore, it has long been used as a medicinal herb and food source. Genetic studies of Amorphophallus have been hindered by a lack of genetic markers. A large number of molecular markers are required for genetic diversity study and improving disease resistance in Amorphophallus. Here, we report la...

  5. Markers of Adenocarcinoma Characteristic of the Site of Origin: Development of a Diagnostic Algorithm

    OpenAIRE

    Dennis, J. L.; Hvidsten, T. R.; Wit, E.C.; Komorowski, J.; Bell, A.K.; Downie, I.; Mooney, J; Verbeke, C.; Bellamy, C.; Keith, W.N.; Oien, K A

    2005-01-01

    Purpose: Patients with metastatic adenocarcinoma of unknown origin are a common clinical problem. Knowledge of the primary site is important for their management, but histologically, such tumors appear similar. Better diagnostic markers are needed to enable the assignment of metastases to likely sites of origin on pathologic samples. Experimental Design: Expression profiling of 27 candidate markers was done using tissue microarrays and immunohistochemistry. In the first (training) round, we s...

  6. LABORATORY DIRECTED RESEARCH AND DEVELOPMENT ANNUAL REPORT TO THE DEPARTMENT OF ENERGY - DECEMBER 2000.

    Energy Technology Data Exchange (ETDEWEB)

    FOX,K.J.

    2000-12-31

    The goals and objectives of BNL's LDRD Program can be inferred from the Program's stated purposes. These are to (1) encourage and support the development of new ideas and technology, (2) promote the early exploration and I exploitation of creative and innovative concepts, and (3) develop new ''fundable'' R&D projects and programs. The emphasis is clearly articulated by BNL to be on supporting exploratory research ''which could lead to new programs, ,projects, and directions'' for the Laboratory. As one of the premier scientific laboratories of the DOE, BNL must continuously foster groundbreaking scientific research. At Brookhaven National Laboratory one such method is through its Laboratory Directed Research and Development Program. This discretionary research and development tool is critical in maintaining the scientific excellence and long-term vitality of the Laboratory. Additionally, it is a means to stimulate the scientific community, fostering new science and technology ideas, which is a major factor in achieving and maintaining staff excellence and a means to address national needs within the overall mission of the DOE and BNL. The LDRD Annual Report contains summaries of all research activities funded during Fiscal Year 2000. The Project Summaries with their accomplishments described in this report reflect the above. Aside from leading to new fundable or promising programs and producing especially noteworthy research, they have resulted in numerous publications in various professional and scientific journals and presentations at meetings and forums. All FY 2000 projects are listed and tabulated in the Project Funding Table. Also included in this Annual Report in Appendix A is a summary of the proposed projects for FY 2001. The BNL LDRD budget authority by DOE in FY 2000 was $6 million. The.actual allocation totaled $5.5 million. The following sections in this report contain the management processes, peer

  7. Development of SSR markers by next-generation sequencing of Korean landraces of chamoe (Cucumis melo var. makuwa).

    Science.gov (United States)

    Park, Inkyu; Kim, Jungeun; Lee, Jeongyeo; Kim, Sewon; Cho, Okhee; Yang, Kyungbong; Ahn, Jongmoon; Nahm, Seokhyeon; Kim, Hyeran

    2013-12-01

    The oriental melon (Cucumis melo var. makuwa), called 'chamoe' in Korean, is a popular fruit crop cultivated mainly in Asia and a high-market value crop in Korea. To provide molecular breeding resources for chamoe, we developed and characterized genomic SSR markers from the preliminary Illumina read assemblies of Gotgam chamoe (one of the major landraces; KM) and SW3 (the breeding parent). Mononucleotide motifs were the most abundant type of markers, followed by di-, tri-, tetra-, and pentanucleotide motifs. The most abundant dinucleotide was AT, followed by AG and AC, and AAT was the most abundant trinucleotide motif in both assemblies. Following our SSR-marker development strategy, we designed a total of 370 primer sets. Of these, 236 primer sets were tested, exhibiting 93 % polymorphism between KM and SW3. Those polymorphic SSRs were successfully amplified in the netted and Kirkagac melons, which respectively exhibited 81 and 76 % polymorphism relative to KM, and 32 and 38 % polymorphism relative to SW3. Seven selected SSR markers with a total of 17 alleles (2-3 alleles per locus) were used to distinguish between KM, SW3, and four chamoe cultivars. Our results represent the first attempt to provide genomic resources for Korean landraces for the purposes of chamoe breeding, as well as to discover a set of SSR markers capable of discriminating chamoe varieties from Korea and the rest of Asia, which possess little genetic diversity. This study establishes a highly efficient strategy for developing SSR markers from preliminary Illumina assemblies of AT-rich genomes.

  8. The development of 7E chromosome-specific molecular markers for Thinopyrum elongatum based on SLAF-seq technology.

    Directory of Open Access Journals (Sweden)

    Shiqiang Chen

    Full Text Available Thinopyrum elongatum is an important relative of wheat, it is favored by many researchers for the disease resistant genes that exist in its E genome. Some studies have showed that the 7E chromosome of Th. elongatum contains resistance genes related to Fusarium head blight and wheat rust. Therefore, developing 7E chromosome-specific molecular markers linked to resistance genes will provide an important tool for exploring and using the resistant genes of Th. elongatum. In addition, it would greatly contribute in the effort to cultivate disease-resistant wheat varieties. Featured in high throughput, high-accuracy and low-cost, SLAF-seq technology has been widely used in molecular breeding, system evolution, and germplasm resource detection. Based on SLAF-seq, 518 specific fragments on the 7E chromosome of Th. elongatum were successfully amplified. A total of 135 primers were designed according to 135 randomly selected fragments, and 89 specific molecular markers of Th. elongatum were developed, with efficiencies up to 65.9%. These markers were all detected in a variety of materials, and they are all proved to be specific and stable. These markers can be used not only for detecting the 7E chromosome of Th. elongatum but also for providing an important theoretical and practical basis for wheat breeding by marker-assisted selection (MAS. This paper reports the first application of SLAF-seq technology with a high success rate in developing specific molecular markers for Th. elongatum, providing a strong case for the application of this new technology.

  9. Development of novel chloroplast microsatellite markers to identify species in the Agrostis complex (Poaceae) and related genera.

    Science.gov (United States)

    Maria L. Zapiola; Richard C. Cronn; Carol A. Mallory-Smith

    2010-01-01

    We needed a reliable way to identify species and confirm potential interspecific and intergeneric hybrids in a landscape-level study of gene flow from transgenic gylphosate-resistant Agrostis stolonifera (Poaceae) to compatible relatives. We developed 12 new polymorphic chloroplast microsatellite markers to aid in identifying species recipient of...

  10. Development of an RAPD-based SCAR marker for smut disease resistance in commercial sugarcane cultivars of Pakistan

    Science.gov (United States)

    Development of RAPD-derived Sequence Characterized Amplified Region (SCAR) marker in order to select Sporisorium scitamineum resistant and susceptible commercial cultivars of sugarcane from Pakistan was achieved. Bulked segregant and RAPD-analysis were conducted using 480 random decamers in initial ...

  11. Development of EST-based SNP and InDel markers and their utilization in tetraploid cotton genetic mapping

    Science.gov (United States)

    Expressed sequence tags (ESTs) were analyzed in silico in order to identify single nucleotide polymorphisms (SNPs) and insertion-deletion polymorphisms (InDels) in cotton. A total of 1349 EST-based SNP and InDel markers were developed by comparing ESTs between Gossypium hirsutum and G. barbadense, m...

  12. Peripheral blood mononuclear cells: a potential source of homeostatic imbalance markers associated with obesity development.

    Science.gov (United States)

    Oliver, Paula; Reynés, Bàrbara; Caimari, Antoni; Palou, Andreu

    2013-04-01

    Peripheral blood mononuclear cells (PBMC) have a great potential for nutrition and obesity studies. PBMC reflect the nutritional response of key organs involved in energy homeostasis maintenance, which is altered in the obese state. Here, we aimed to determine the usefulness of PBMC as a source of early markers of obesity. To that purpose, we analysed whether PBMC could reflect the insensitivity to changes in feeding conditions associated with obesity during the development of this pathology. Expression of key genes central to energy metabolism was measured by Q-PCR in PBMC samples of normoweight (control) and cafeteria-fed (obese) rats in feeding, fasting and refeeding conditions. Samples were obtained monthly from 2 (beginning of cafeteria diet-feeding) to 6 months of age. In general terms, expression of genes related to fatty acid synthesis (Fasn, Srebp1) and adipogenesis (Pparg) decreased with fasting and increased with refeeding. Conversely, the expression of a key gene regulating beta-oxidation (Cpt1a) and the gene for an orexigenic neuropeptide (Npy)-in accordance with their metabolic role-increased with fasting and decreased with refeeding. This expression pattern disappeared in obese rats, in which insensitivity to feeding conditions was observed after only 1 month of cafeteria diet-feeding. Thus, during development, PBMC accurately reflect nutritional regulation of energy homeostasic genes and the insensitivity to feeding associated with obesity, even in the earlier stages with a low degree of overweight. For this reason, this set of blood cells could constitute a potential source of biomarkers of early homeostatic imbalance which would be useful in nutrition studies that could help prevent the occurrence of obesity.

  13. Development of microsatellite markers for the rapid and reliable genotyping of Brettanomyces bruxellensis at strain level.

    Science.gov (United States)

    Albertin, Warren; Panfili, Aurélie; Miot-Sertier, Cécile; Goulielmakis, Aurélie; Delcamp, Adline; Salin, Franck; Lonvaud-Funel, Aline; Curtin, Chris; Masneuf-Pomarede, Isabelle

    2014-09-01

    Although many yeasts are useful for food production and beverage, some species may cause spoilage with important economic loss. This is the case of Dekkera/Brettanomyces bruxellensis, a contaminant species that is mainly associated with fermented beverages (wine, beer, cider and traditional drinks). To better control Brettanomyces spoilage, rapid and reliable genotyping methods are necessary to determine the origins of the spoilage, to assess the effectiveness of preventive treatments and to develop new control strategies. Despite several previously published typing methods, ranging from classical molecular methods (RAPD, AFLP, REA-PFGE, mtDNA restriction analysis) to more engineered technologies (infrared spectroscopy), there is still a lack of a rapid, reliable and universal genotyping approach. In this work, we developed eight polymorphic microsatellites markers for the Brettanomyces/Dekkera bruxellensis species. Microsatellite typing was applied to the genetic analysis of wine and beer isolates from Europe, Australia and South Africa. Our results suggest that B. bruxellensis is a highly disseminated species, with some strains isolated from different continents being closely related at the genetic level. We also focused on strains isolated from two Bordeaux wineries on different substrates (grapes, red wines) and for different vintages (over half a century). We showed that all B. bruxellensis strains within a cellar are strongly related at the genetic level, suggesting that one clonal population may cause spoilage over decades. The microsatellite tool now paves the way for future population genetics research of the B. bruxellensis species. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Update On The Development Of DArT Markers And 454-Sequencing In Festuca/Lolium And Phleum

    DEFF Research Database (Denmark)

    Sandve, Simen R; Bartos, Jan; Kopecky, David;

    Development of genomic resources in perennial grasses for high-throughput applications in genomic research and plant breeding has lagged behind most other crops. The predicted climate changes create novel patterns of biotic and abiotic stresses. Efficient characterization and utilization of genetic...... resources for developing improved cultivars adapted to the future climates depend on modern genomic resources. We will describe our recent activity in developing genomic resources for Festuca/Lolium and Phleum. These resources include the development and mapping of DArT-markers in Festuca pratensis......, application of the DArTFest array in studying freezing tolerance in Festulolium, high-throughput EST sequencing (454-sequencing) targeting cold regulated genes in Festuca and Phleum, and the development of genic SNP markers for these species....

  15. Development of Dietary Patterns Spanning Infancy and Toddlerhood: Relation to Body Size, Composition and Metabolic Risk Markers at Three Years

    DEFF Research Database (Denmark)

    Andersen, Louise B. B.; Mølgaard, Christian; Ejlerskov, Katrine Tschentscher;

    2015-01-01

    Little is known about the development of dietary patterns during toddlerhood and the relation to growth and health. The study objective was to characterise the development of dietary patterns from 9-36 mo of age and investigate the association to body size, body composition and metabolic risk...... markers at 36 mo. Food records were filled out at 9, 18 and 36 mo of age (n = 229). Dietary patterns were identified by principal component analysis (PCA). Three dietary patterns were identified: Transition Food, Healthy Food and Traditional Food. The course of development in dietary patterns from 9-36 mo...... total cholesterol and LDL. Hence, this could represent undesirable development of dietary patterns in toddlers. In conclusion, development of dietary patterns can be exploratory characterised by PCA and related to potential cardiovascular risk markers in toddlers even within a relatively homogeneous...

  16. Isolation of Ty1-copia retrotransposon in myrtle genome and development of S-SAP molecular marker.

    Science.gov (United States)

    Woodrow, Pasqualina; Pontecorvo, Giovanni; Ciarmiello, Loredana F

    2012-04-01

    Long terminal repeat (LTR)-retrotransposons are mobile genetic elements that are ubiquitous in plants and constitute a major portion of their nuclear genomes. LTR- retrotransposons possess unique properties that make them appropriate for investigating relationships between populations, varieties and closely related species. Myrtus communis L. is an evergreen shrub growing spontaneously throughout the Mediterranean area. Accessions show significant variations for agriculturally important traits, so the development of specific molecular markers for conservation and characterization of myrtle germplasm is desirable to conserve biodiversity. In this study, we isolated the first retrotransposon Ty1-copia-like element (Tmc1) in Myrtus communis L. genome and used this as a molecular marker. We successfully employed the S-SAP marker system to specifically characterize four myrtle accessions belonging to different areas in the province of Caserta (Italy). The high level of polymorphism detected in isolated LTRs, make Tmc1 a good molecular marker for this species. Our findings confirm that retrotransposon-based molecular markers are particularly valuable tools for plant molecular characterization studies.

  17. Development of EST Intron-Targeting SNP Markers for Panax ginseng and Their Application to Cultivar Authentication.

    Science.gov (United States)

    Wang, Hongtao; Li, Guisheng; Kwon, Woo-Saeng; Yang, Deok-Chun

    2016-06-04

    Panax ginseng is one of the most valuable medicinal plants in the Orient. The low level of genetic variation has limited the application of molecular markers for cultivar authentication and marker-assisted selection in cultivated ginseng. To exploit DNA polymorphism within ginseng cultivars, ginseng expressed sequence tags (ESTs) were searched against the potential intron polymorphism (PIP) database to predict the positions of introns. Intron-flanking primers were then designed in conserved exon regions and used to amplify across the more variable introns. Sequencing results showed that single nucleotide polymorphisms (SNPs), as well as indels, were detected in four EST-derived introns, and SNP markers specific to "Gopoong" and "K-1" were first reported in this study. Based on cultivar-specific SNP sites, allele-specific polymerase chain reaction (PCR) was conducted and proved to be effective for the authentication of ginseng cultivars. Additionally, the combination of a simple NaOH-Tris DNA isolation method and real-time allele-specific PCR assay enabled the high throughput selection of cultivars from ginseng fields. The established real-time allele-specific PCR assay should be applied to molecular authentication and marker assisted selection of P. ginseng cultivars, and the EST intron-targeting strategy will provide a potential approach for marker development in species without whole genomic DNA sequence information.

  18. Development of Nine Markers and Characterization of the Microsatellite Loci in the Endangered Gymnogobius isaza (Gobiidae

    Directory of Open Access Journals (Sweden)

    Hiroshi Kudoh

    2012-05-01

    Full Text Available Gymnogobius isaza is a freshwater goby endemic to Lake Biwa, Japan. They experienced a drastic demographic bottleneck in the 1950s and 1980s and slightly recovered thereafter, but the population size is still very small. To reveal dynamics of genetic diversity of G. isaza, we developed nine microsatellite markers based on the sequence data of a related goby Chaenogobius annularis. Nine SSR (Simple Sequence Repeats markers were successfully amplified for raw and formalin-fixed fish samples. The number of alleles and expected heterozygosities ranged from one to 10 and from 0.06 to 0.84, respectively, for the current samples, while one to 12 and 0.09 to 0.83 for historical samples. The markers described here will be useful for investigating the genetic diversity and gene flow and for conservation of G. isaza.

  19. Development and characterization of microsatellite markers for Brazilian four-eyed frogs (genus Pleurodema) endemic to the Caatinga biome.

    Science.gov (United States)

    Thomé, M T C; Alexandrino, J; Lopes, S; Haddad, C F B; Sequeira, F

    2014-03-12

    We used pyrosequencing to develop microsatellite markers for the Brazilian four-eyed frog Pleurodema diplolister and tested the microsatellite markers for cross-amplification in its sister Pleurodema alium, which are both endemic species of the Caatinga biome in northeastern Brazil. We used multiplex sets to amplify and genotype 30 individuals of P. diplolister from three different populations and 10 individuals of P. alium from a single population. We successfully amplified 24 loci for P. diplolister, 13 of which we were able to amplify in P. alium. All loci were polymorphic. Significant deviations from the Hardy-Weinberg equilibrium and the presence of null alleles were only consistently detected at one locus (Pleu9). These markers will enable the study of geographic genetic diversity and evolutionary processes in these two Caatinga endemics, and the inclusion of genetic data for conservation planning of the Caatinga biome.

  20. Association of incidental emphysema with annual lung function decline and future development of airflow limitation

    Directory of Open Access Journals (Sweden)

    Koo HK

    2016-01-01

    Full Text Available Hyeon-Kyoung Koo,1 Kwang Nam Jin,2 Deog Kyeom Kim,3 Hee Soon Chung,3 Chang-Hoon Lee3,4 1Department of Internal Medicine, Division of Pulmonary and Critical Care Medicine, College of Medicine, Ilsan Paik Hospital, Inje University, Goyang-si, Gyeonggi-Do, 2Department of Radiology, Seoul Metropolitan Government – Seoul National University Boramae Medical Center, 3Department of Internal Medicine, Division of Pulmonary and Critical Care Medicine, Seoul Metropolitan Government-Seoul National University Boramae Medical Center, 4Department of Internal Medicine, Division of Pulmonary and Critical Care Medicine, Seoul National University College of Medicine, Seoul National University Hospital, Seoul, Republic of Korea Objectives: Emphysema is one of the prognostic factors for rapid lung function decline in patients with COPD, but the impact of incidentally detected emphysema on population without spirometric abnormalities has not been evaluated. This study aimed to determine whether emphysema detected upon computed tomography (CT screening would accelerate the rate of lung function decline and influence the possibility of future development of airflow limitation in a population without spirometric abnormalities.Materials and methods: Subjects who participated in a routine screening for health checkup and follow-up pulmonary function tests for at least 3 years between 2004 and 2010 were retrospectively enrolled. The percentage of low-attenuation area below −950 Hounsfield units (%LAA−950 was calculated automatically. A calculated value of %LAA−950 that exceeded 10% was defined as emphysema. Adjusted annual lung function decline was analyzed using random-slope, random-intercept mixed linear regression models.Results: A total of 628 healthy subjects within the normal range of spriometric values were included. Multivariable analysis showed that the emphysema group exhibited a faster decline in forced vital capacity (−33.9 versus −18.8

  1. Development and Characterization of Simple Sequence Repeat Markers Providing Genome-Wide Coverage and High Resolution in Maize

    Science.gov (United States)

    Xu, Jie; Liu, Ling; Xu, Yunbi; Chen, Churun; Rong, Tingzhao; Ali, Farhan; Zhou, Shufeng; Wu, Fengkai; Liu, Yaxi; Wang, Jing; Cao, Moju; Lu, Yanli

    2013-01-01

    Simple sequence repeats (SSRs) have been widely used in maize genetics and breeding, because they are co-dominant, easy to score, and highly abundant. In this study, we used whole-genome sequences from 16 maize inbreds and 1 wild relative to determine SSR abundance and to develop a set of high-density polymorphic SSR markers. A total of 264 658 SSRs were identified across the 17 genomes, with an average of 135 693 SSRs per genome. Marker density was one SSR every of 15.48 kb. (C/G)n, (AT)n, (CAG/CTG)n, and (AAAT/ATTT)n were the most frequent motifs for mono, di-, tri-, and tetra-nucleotide SSRs, respectively. SSRs were most abundant in intergenic region and least frequent in untranslated regions, as revealed by comparing SSR distributions of three representative resequenced genomes. Comparing SSR sequences and e-polymerase chain reaction analysis among the 17 tested genomes created a new database, including 111 887 SSRs, that could be develop as polymorphic markers in silico. Among these markers, 58.00, 26.09, 7.20, 3.00, 3.93, and 1.78% of them had mono, di-, tri-, tetra-, penta-, and hexa-nucleotide motifs, respectively. Polymorphic information content for 35 573 polymorphic SSRs out of 111 887 loci varied from 0.05 to 0.83, with an average of 0.31 in the 17 tested genomes. Experimental validation of polymorphic SSR markers showed that over 70% of the primer pairs could generate the target bands with length polymorphism, and these markers would be very powerful when they are used for genetic populations derived from various types of maize germplasms that were sampled for this study. PMID:23804557

  2. A Comparison of Three Molecular Markers for the Identification of Populations of Globodera pallida

    OpenAIRE

    Hoolahan, Angelique H.; Blok, Vivian C.; Gibson, Tracey; Dowton, Mark

    2012-01-01

    Potato cyst nematodes cost the potato industry substantial financial losses annually. Through the use of molecular markers, the distribution and infestation routes of these nematodes can be better elucidated, permitting the development of more effective preventative methods. Here we assess the ability of three molecular markers to resolve multiple representatives of five Globodera pallida populations as monophyletic groups. Molecular markers included a region of the rbp-1 gene (an effector), ...

  3. Nevada Test Site-Directed Research and Development FY 2010 Annual Report

    Energy Technology Data Exchange (ETDEWEB)

    Howard Bender, comp.

    2011-04-04

    This annual report of the Site-Directed Research and Development (SDRD) program represents the highly significant R&D accomplishments conducted during fiscal year 2010. This year was noteworthy historically, as the Nevada Test Site was renamed to the Nevada National Security Site (NNSS). This change not only recognizes how the site's mission has evolved, but also heralds a future of new challenges and opportunities for the NNSS. In many ways, since its inception in 2002, the SDRD program has helped shape that evolving mission. As we approach 2012, SDRD will also mark a milestone, having completed its first full decade of innovative R&D in support of the site and national security. The program continues to fund advanced science and technology development across traditional Department of Energy (DOE) nuclear security areas such as stockpile stewardship and non-proliferation while also supporting Department of Homeland Security (DHS) needs, and specialized work for government agencies like the Department of Defense (DoD) and others. The NNSS will also contribute technologies in the areas of treaty verification and monitoring, two areas of increasing importance to national security. Keyed to the NNSS's broadened scope, the SDRD program will continue to anticipate and advance R&D projects that will help the NNSS meet forthcoming challenges.

  4. Nevada National Security Site: Site-Directed Research and Development (SDRD) Fiscal Year 2015 Annual Report

    Energy Technology Data Exchange (ETDEWEB)

    Bender, Howard A. [National Security Technologies, LLC. (NSTec), Mercury, NV (United States). Site-Directed Research and Development Program

    2016-04-01

    This report presents results of multiple research projects, new and ongoing, funded under the Site-Directed Research and Development Program for the Nevada National Security Site during federal fiscal year 2015. The Site's legacy capabilities in remote sensing combined with new paradigms for emergency response and consequence management help drive the need to develop advanced aerial sensor platforms. Likewise, dynamic materials science is a critical area of scientific research for which basic physics issues are still unresolved. New methods of characterizing materials in extreme states are vitally needed, and these efforts are paving the way with new knowledge. Projects selected in FY 2015 for the Exploratory Research portfolio exhibit a strong balance of NNSS mission relevance. Geoscience, seismology, and techniques for detecting underground nuclear events are still essential focus areas. Many of the project reports in the second major section of this annual report are ongoing continuations in multi-year lifecycles. Diagnostic techniques for stockpile and nuclear security science figured prominently as well, with a few key efforts coming to fruition, such as phase transition detection. In other areas, modeling efforts toward better understanding plasma focus physics has also started to pay dividends for major program needs.

  5. Development of RAPD-SCAR markers for different Ganoderma species authentication by improved RAPD amplification and molecular cloning.

    Science.gov (United States)

    Fu, J J; Mei, Z Q; Tania, M; Yang, L Q; Cheng, J L; Khan, M A

    2015-05-25

    The sequence-characterized amplified region (SCAR) is a valuable molecular technique for the genetic identification of any species. This method is mainly derived from the molecular cloning of the amplified DNA fragments achieved from the random amplified polymorphic DNA (RAPD). In this study, we collected DNA from 10 species of Ganoderma mushroom and amplified the DNA using an improved RAPD technique. The amplified fragments were then cloned into a T-vector, and positive clones were screened, indentified, and sequenced for the development of SCAR markers. After designing PCR primers and optimizing PCR conditions, 4 SCAR markers, named LZ1-4, LZ2-2, LZ8-2, and LZ9-15, were developed, which were specific to Ganoderma gibbosum (LZ1-4 and LZ8-2), Ganoderma sinense (LZ2-2 and LZ8-2), Ganoderma tropicum (LZ8-2), and Ganoderma lucidum HG (LZ9-15). These 4 novel SCAR markers were deposited into GenBank with the accession Nos. KM391935, KM391936, KM391937, and KM391938, respectively. Thus, in this study we developed specific SCAR markers for the identification and authentication of different Ganoderma species.

  6. Development of sequence-characterized amplified region (SCAR) markers as a quality standard of inoculants based on Azospirillum.

    Science.gov (United States)

    Reddy Priya, Pasupuleti; Selastin Antony, Raju; Gopalaswamy, Ganesan; Balachandar, Dananjeyan

    2016-04-01

    An attempt was made in this work to develop a strain-level molecular marker for unambiguous authentication of two Azospirillum inoculants, viz. A. lipoferum (strain Az204) and A. brasilense (strain Sp7). The sequence-characterized amplified region (SCAR) markers obtained from DNA fingerprints were designed for discrete detection of the strains. The SCAR primers could successfully amplify the target strain without cross-reaction with other Azospirillum strains, native isolates and other inoculants. The detection limit of SCAR primer for Az204 was 8.00 pg of DNA (approximately 10(5) cells per mL), and for Sp7, it was 0.49 pg of DNA (equal to 10(4) cells per mL). A simplified Sephadex G100-based crude DNA extraction protocol developed in this study was found suitable for SCAR marker-based strain authentication. Further, SCAR primers were assessed for simultaneous authentication as well as quantification of commercially prepared Azospirillum inoculants by quantitative real-time PCR (RT-PCR) and most-probable-number PCR (MPN-PCR). The RT-PCR assay can be able to quantify the commercial formulations as equal to culturable MPN method, while MPN-PCR failed for Az204. The SCAR marker-based strain authentication and presumptive quantification developed in the present work can contribute to improving the quality standard of commercial inoculants.

  7. Chloroplast microsatellite markers for Artocarpus (Moraceae) developed from transcriptome sequences1

    Science.gov (United States)

    Gardner, Elliot M.; Laricchia, Kristen M.; Murphy, Matthew; Ragone, Diane; Scheffler, Brian E.; Simpson, Sheron; Williams, Evelyn W.; Zerega, Nyree J. C.

    2015-01-01

    Premise of the study: Chloroplast microsatellite loci were characterized from transcriptomes of Artocarpus altilis (breadfruit) and A. camansi (breadnut). They were tested in A. odoratissimus (terap) and A. altilis and evaluated in silico for two congeners. Methods and Results: Fifteen simple sequence repeats (SSRs) were identified in chloroplast sequences from four Artocarpus transcriptome assemblies. The markers were evaluated using capillary electrophoresis in A. odoratissimus (105 accessions) and A. altilis (73). They were also evaluated in silico in A. altilis (10), A. camansi (6), and A. altilis × A. mariannensis (7) transcriptomes. All loci were polymorphic in at least one species, with all 15 polymorphic in A. camansi. Per species, average alleles per locus ranged between 2.2 and 2.5. Three loci had evidence of fragment-length homoplasy. Conclusions: These markers will complement existing nuclear markers by enabling confident identification of maternal and clone lines, which are often important in vegetatively propagated crops such as breadfruit. PMID:26421253

  8. Development and characterization of polymorphic microsatellite markers in taro (Colocasia esculenta).

    Science.gov (United States)

    Mace, Emma S; Godwin, Ian D

    2002-10-01

    Microsatellite-containing sequences were isolated from enriched genomic libraries of taro (Colocasia esculenta (L.) Schott). The sequencing of 269 clones yielded 77 inserts containing repeat motifs. The majority of these (81.7%) were dinucleotide or trinucleotide repeats. The GT/CA repeat motif was the most common, accounting for 42% of all repeat types. From a total of 43 primer pairs designed, 41 produced markers within the expected size range. Sixteen (39%) were polymorphic when screened against a restricted set of taro genotypes from Southeast Asia and Oceania, with an average of 3.2 alleles detected on each locus. These markers represent a useful resource for taro germplasm management, genome mapping, and marker-assisted selection.

  9. A comprehensive resource of drought- and salinity- responsive ESTs for gene discovery and marker development in chickpea (Cicer arietinum L.).

    Science.gov (United States)

    Varshney, Rajeev K; Hiremath, Pavana J; Lekha, Pazhamala; Kashiwagi, Junichi; Balaji, Jayashree; Deokar, Amit A; Vadez, Vincent; Xiao, Yongli; Srinivasan, Ramamurthy; Gaur, Pooran M; Siddique, Kadambot Hm; Town, Christopher D; Hoisington, David A

    2009-11-15

    Chickpea (Cicer arietinum L.), an important grain legume crop of the world is seriously challenged by terminal drought and salinity stresses. However, very limited number of molecular markers and candidate genes are available for undertaking molecular breeding in chickpea to tackle these stresses. This study reports generation and analysis of comprehensive resource of drought- and salinity-responsive expressed sequence tags (ESTs) and gene-based markers. A total of 20,162 (18,435 high quality) drought- and salinity- responsive ESTs were generated from ten different root tissue cDNA libraries of chickpea. Sequence editing, clustering and assembly analysis resulted in 6,404 unigenes (1,590 contigs and 4,814 singletons). Functional annotation of unigenes based on BLASTX analysis showed that 46.3% (2,965) had significant similarity (chickpea. Of 2,965 (46.3%) significant unigenes, only 2,071 (32.3%) unigenes could be functionally categorised according to Gene Ontology (GO) descriptions. A total of 2,029 sequences containing 3,728 simple sequence repeats (SSRs) were identified and 177 new EST-SSR markers were developed. Experimental validation of a set of 77 SSR markers on 24 genotypes revealed 230 alleles with an average of 4.6 alleles per marker and average polymorphism information content (PIC) value of 0.43. Besides SSR markers, 21,405 high confidence single nucleotide polymorphisms (SNPs) in 742 contigs (with > or = 5 ESTs) were also identified. Recognition sites for restriction enzymes were identified for 7,884 SNPs in 240 contigs. Hierarchical clustering of 105 selected contigs provided clues about stress- responsive candidate genes and their expression profile showed predominance in specific stress-challenged libraries. Generated set of chickpea ESTs serves as a resource of high quality transcripts for gene discovery and development of functional markers associated with abiotic stress tolerance that will be helpful to facilitate chickpea breeding. Mapping of

  10. 25 CFR 212.42 - Annual rentals and expenditures for development on leases other than oil and gas, and geothermal...

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Annual rentals and expenditures for development on leases other than oil and gas, and geothermal resources. 212.42 Section 212.42 Indians BUREAU OF INDIAN AFFAIRS... other than oil and gas, and geothermal resources. The provisions of § 211.42 of this subchapter...

  11. Exploiting EST databases for the development and characterization of EST-SSR markers in castor bean (Ricinus communis L.

    Directory of Open Access Journals (Sweden)

    Yang Jun-Bo

    2010-12-01

    Full Text Available Abstract Background The castor bean (Ricinus communis L., a monotypic species in the spurge family (Euphorbiaceae, 2n = 20, is an important non-edible oilseed crop widely cultivated in tropical, sub-tropical and temperate countries for its high economic value. Because of the high level of ricinoleic acid (over 85% in its seed oil, the castor bean seed derivatives are often used in aviation oil, lubricants, nylon, dyes, inks, soaps, adhesive and biodiesel. Due to lack of efficient molecular markers, little is known about the population genetic diversity and the genetic relationships among castor bean germplasm. Efficient and robust molecular markers are increasingly needed for breeding and improving varieties in castor bean. The advent of modern genomics has produced large amounts of publicly available DNA sequence data. In particular, expressed sequence tags (ESTs provide valuable resources to develop gene-associated SSR markers. Results In total, 18,928 publicly available non-redundant castor bean EST sequences, representing approximately 17.03 Mb, were evaluated and 7732 SSR sites in 5,122 ESTs were identified by data mining. Castor bean exhibited considerably high frequency of EST-SSRs. We developed and characterized 118 polymorphic EST-SSR markers from 379 primer pairs flanking repeats by screening 24 castor bean samples collected from different countries. A total of 350 alleles were identified from 118 polymorphic SSR loci, ranging from 2-6 per locus (A with an average of 2.97. The EST-SSR markers developed displayed moderate gene diversity (He with an average of 0.41. Genetic relationships among 24 germplasms were investigated using the genotypes of 350 alleles, showing geographic pattern of genotypes across genetic diversity centers of castor bean. Conclusion Castor bean EST sequences exhibited considerably high frequency of SSR sites, and were rich resources for developing EST-SSR markers. These EST-SSR markers would be particularly

  12. Exploiting EST databases for the development and characterization of EST-SSR markers in castor bean (Ricinus communis L.)

    Science.gov (United States)

    2010-01-01

    Background The castor bean (Ricinus communis L.), a monotypic species in the spurge family (Euphorbiaceae, 2n = 20), is an important non-edible oilseed crop widely cultivated in tropical, sub-tropical and temperate countries for its high economic value. Because of the high level of ricinoleic acid (over 85%) in its seed oil, the castor bean seed derivatives are often used in aviation oil, lubricants, nylon, dyes, inks, soaps, adhesive and biodiesel. Due to lack of efficient molecular markers, little is known about the population genetic diversity and the genetic relationships among castor bean germplasm. Efficient and robust molecular markers are increasingly needed for breeding and improving varieties in castor bean. The advent of modern genomics has produced large amounts of publicly available DNA sequence data. In particular, expressed sequence tags (ESTs) provide valuable resources to develop gene-associated SSR markers. Results In total, 18,928 publicly available non-redundant castor bean EST sequences, representing approximately 17.03 Mb, were evaluated and 7732 SSR sites in 5,122 ESTs were identified by data mining. Castor bean exhibited considerably high frequency of EST-SSRs. We developed and characterized 118 polymorphic EST-SSR markers from 379 primer pairs flanking repeats by screening 24 castor bean samples collected from different countries. A total of 350 alleles were identified from 118 polymorphic SSR loci, ranging from 2-6 per locus (A) with an average of 2.97. The EST-SSR markers developed displayed moderate gene diversity (He) with an average of 0.41. Genetic relationships among 24 germplasms were investigated using the genotypes of 350 alleles, showing geographic pattern of genotypes across genetic diversity centers of castor bean. Conclusion Castor bean EST sequences exhibited considerably high frequency of SSR sites, and were rich resources for developing EST-SSR markers. These EST-SSR markers would be particularly useful for both genetic

  13. Developmental trajectories of EEG sleep slow wave activity as a marker for motor skill development during adolescence: a pilot study.

    Science.gov (United States)

    Lustenberger, Caroline; Mouthon, Anne-Laure; Tesler, Noemi; Kurth, Salome; Ringli, Maya; Buchmann, Andreas; Jenni, Oskar G; Huber, Reto

    2017-01-01

    Reliable markers for brain maturation are important to identify neural deviations that eventually predict the development of mental illnesses. Recent studies have proposed topographical EEG-derived slow wave activity (SWA) during NREM sleep as a mirror of cortical development. However, studies about the longitudinal stability as well as the relationship with behavioral skills are needed before SWA topography may be considered such a reliable marker. We examined six subjects longitudinally (over 5.1 years) using high-density EEG and a visuomotor learning task. All subjects showed a steady increase of SWA at a frontal electrode and a decrease in central electrodes. Despite these large changes in EEG power, SWA topography was relatively stable within each subject during development indicating individual trait-like characteristics. Moreover, the SWA changes in the central cluster were related to the development of specific visuomotor skills. Taken together with the previous work in this domain, our results suggest that EEG sleep SWA represents a marker for motor skill development and further supports the idea that SWA mirrors cortical development during childhood and adolescence. © 2016 Wiley Periodicals, Inc.

  14. Survey and analysis of simple sequence repeats in the Ustilaginoidea virens genome and the development of microsatellite markers.

    Science.gov (United States)

    Yu, Mina; Yu, Junjie; Li, Huanhuan; Wang, Yahui; Yin, Xiaole; Bo, Huiwen; Ding, Hui; Zhou, Yuxin; Liu, Yongfeng

    2016-07-01

    Ustilaginoidea virens is the causal agent of rice false smut, causing quantitative and qualitative losses in rice industry. However, the development and application of simple sequence repeat (SSR) markers for genetic diversity studies in U. virens were limited. This study is the first to perform large-scale development of SSR markers of this pathogen at the genome level, to (1) compare these SSR markers with those of other fungi, (2) analyze the pattern of the SSRs, and (3) obtain more informative genetic markers. U. virens is rich in SSRs, and 13,778 SSRs were identified with a relative abundance of 349.7SSRs/Mb. The most common motifs in the genome or in noncoding regions were mononucleotides, whereas trinucleotides in coding sequences. A total of 6 out of 127 primers were randomly selected to be used to analyze 115 isolates, and these 6 primers showed high polymorphism in U. virens. This study may serve as an important resource for molecular genetic studies in U. virens.

  15. Development and validation of 89 novel expressed sequence tag-derived microsatellite markers in blood clam, Tegillarca granosa

    Science.gov (United States)

    Teng, Shuangshuang; Fang, Jun; Cai, Yilong; Chai, Xueliang; Xiao, Guoqiang

    2017-06-01

    Blood clam, Tegillarca granosa, is an important shellfish in Chinese mariculture industry. Investigative research in this species, such as genetic linkage mapping, requires a large panel of molecular markers. In present study, a total of 89 polymorphic microsatellite markers were developed in T. granosa using the sequence database of Life Sciences Technology 454 next generation sequencing technology. All 89 loci were characterized in 20 individual clams from a natural population inhabiting Yueqing Gulf, Zhejiang Province, China. The number of alleles per polymorphic locus varied between 2 and 15, while the observed heterozygosity, expected heterozygosity and polymorphic information content varied between 0.000 and 1.000, 0.102 and 0.921, and 0.048 and 0.886, respectively. Of the 89 loci identified, 32 loci deviated significantly from Hardy-Weinberg equilibrium following Bonferroni correction. Thirty nine markers, which were shown to be polymorphic in a full-sibling family, were tested in Mendelian segregations. As expected, 32 loci were co-dominantly segregated in a Mendelian fashion. These novel developed microsatellite markers represent useful research tools for investigation of population genetic structure and genetic diversity in this species.

  16. Genome-assisted development of nuclear intergenic sequence markers for entomopathogenic fungi of the Metarhizium anisopliae species complex.

    Science.gov (United States)

    Kepler, R M; Rehner, S A

    2013-03-01

    Entomopathogenic fungi in the genus Metarhizium are useful for biological control programmes against economically important arthropod pests worldwide. However, understanding the true diversity and ecology of these organisms is hampered by convergent morphologies between species. The application of molecular techniques has enabled greater resolution of species than allowed by morphology alone. In particular, the commonly used biocontrol agent M. anisopliae was found to be a species complex composed of nine species. This prior work was conducted with commonly used markers in fungal phylogenetics (BTUB, RPB1, RPB2 and TEF), which likely under-represent diversity in the M. anisopliae complex. Using sequence data from nuclear genomes of M. acridum and M. robertsii we identified regions of conserved gene synteny and developed primers to amplify intergenic regions of seven loci. Using ex-type and authenticated tissue specimens for species in the M. anisopliae complex, we demonstrate that sequence data derived from intergenic loci is more variable and phylogenetically informative than previously available markers. These new markers will facilitate investigations at or below the species level for the M. anisopliae complex. The method of marker development employed here should be extendable to any group with sufficiently divergent genome data available.

  17. Diversity Analysis in Cannabis sativa Based on Large-Scale Development of Expressed Sequence Tag-Derived Simple Sequence Repeat Markers

    OpenAIRE

    Chunsheng Gao; Pengfei Xin; Chaohua Cheng; Qing Tang; Ping Chen; Changbiao Wang; Gonggu Zang; Lining Zhao

    2014-01-01

    Cannabis sativa L. is an important economic plant for the production of food, fiber, oils, and intoxicants. However, lack of sufficient simple sequence repeat (SSR) markers has limited the development of cannabis genetic research. Here, large-scale development of expressed sequence tag simple sequence repeat (EST-SSR) markers was performed to obtain more informative genetic markers, and to assess genetic diversity in cannabis (Cannabis sativa L.). Based on the cannabis transcriptome, 4,577 SS...

  18. Research, development and demonstration of nickel-zinc batteries for electric vehicle propulsion. Annual report, 1978

    Energy Technology Data Exchange (ETDEWEB)

    1979-10-01

    This is the first annual report of progress achieved under ANL Contract 31-109-38-4248. It covers the report period from 15 March 1978 to 15 August 1978. The nickel electrode development program is directed at the optimization of the electrical performance, specifically, in terms of increased cycle life. The work concentrated upon both the development of pilot plant facilities to produce nickel hydroxide and upon optimizing the manufacturing processes to produce nickel hydroxide which has high electrochemical utilization. The primary goal of the zinc electrode studies is to increase the cycle life of this electrode. This effort is primarily concentrating on the effect of additives upon shape change and cycle performance and on the mechanistic processes involved in the shape change. The separator effort has as its major goal the development of a low-cost separator which exhibits stability in the electrolyte, has uniform pores which are of a sufficiently small size to impede the growth of zinc dendrites, and exhibits low electrical resistance and good flexibility. The process itself is now optimized for pilot plant manufacture; hundreds of formulations have been produced and subsequently screened in both the laboratory and in actual cells. Promising formulations are presently being subjected to additional characterization tests and life cycles. The goal of the sealed cell studies is to determine the feasibility of sealed-cell operation. Large numbers of 20-Ah cells have been subjected to accelerated testing. These cells incorporated separator variations, active material additives, and internal design variations. Cycle lives up to 150 deep cycles were achieved. Cell failure modes are analyzed. 51 figures, 20 tables.

  19. Nevada National Security Site-Directed Research and Development FY 2011 Annual Report

    Energy Technology Data Exchange (ETDEWEB)

    Howard Bender, comp.

    2012-04-25

    This fiscal year 2011 annual report of the Site-Directed Research and Development program, the 10th anniversary edition, recognizes a full decade of innovative R&D accomplishments in support of the Nevada National Security Site (NNSS). Last year the NNSS itself was renamed to reflect a diversifying mission, and our R&D program has contributed significantly to shape emerging missions that will continue to evolve. New initiatives in stockpile stewardship science, nonproliferation, and treaty verification and monitoring have had substantial successes in FY 2011, and many more accomplishments are expected. SDRD is the cornerstone on which many of these initiatives rest. Historically supporting our main focus areas, SDRD is also building a solid foundation for new, and non-traditional, emerging national security missions. The program continues its charter to advance science and technology for a broad base of agencies including the U.S. Department of Energy (DOE), U.S. Department of Defense (DoD), U.S. Department of Homeland Security (DHS), and many others.

  20. Production of ethanol from refinery waste gases. Phase 2, technology development, annual report

    Energy Technology Data Exchange (ETDEWEB)

    Arora, D.; Basu, R.; Phillips, J.R.; Wikstrom, C.V.; Clausen, E.C.; Gaddy, J.L.

    1995-07-01

    Oil refineries discharge large volumes of H{sub 2}, CO, and CO{sub 2} from cracking, coking, and hydrotreating operations. This program seeks to develop a biological process for converting these waste gases into ethanol, which can be blended with gasoline to reduce emissions. Production of ethanol from all 194 US refineries would save 450 billion BTU annually, would reduce crude oil imports by 110 million barrels/year and emissions by 19 million tons/year. Phase II efforts has yielded at least 3 cultures (Clostridium ljungdahlii, Isolate O-52, Isolate C-01) which are able to produce commercially viable concentrations of ethanol from CO, CO{sub 2}, and H{sub 2} in petroleum waste gas. Single continuous stirred tank reactor studies have shown that 15-20 g/L of ethanol can be produced, with less than 5 g/L acetic acid byproduct. Culture and reactor optimization in Phase III should yield even higher ethanol concentrations and minimal acetic acid. Product recovery studies showed that ethanol is best recovered in a multi-step process involving solvent extraction/distillation to azeotrope/azeotropic distillation or pervaporation, or direct distillation to the azeotrope/azeotropic distillation or pervaporation. Projections show that the ethanol facility for a typical refinery would require an investment of about $30 million, which would be returned in less than 2 years.

  1. Materials development for solar thermoelectric generators, SOLAR-TEP - 2007 Annual report

    Energy Technology Data Exchange (ETDEWEB)

    Bocher, L.; Weidenkaff, A.

    2007-07-01

    This annual report for the Swiss Federal Office of Energy (SFOE) takes a look at the work done at the Swiss Federal Laboratories for Materials Science and Technology EMPA in 2007 on Thermoelectric applications that are emerging as a potential technology that allows the conversion of heat into electric power. This energy conversion procedure uses the Seebeck effect to generate electricity without using moving parts or any chemical conversion. The Solar-TEP project is based on the idea of the potential use of concentrated solar heat as a source of energy for Solar Thermoelectric Generators (Solar-TEG). The development of novel functional materials with enhanced figures of merit, high temperature stability, and without harmful effects is commented on. The authors state that oxide ceramics can be used at high temperatures due to their chemical stability and their resistance to thermal oxidation in air. The advantages offered by thermoelectric modules based on oxide materials for the generation of power with increased temperature operating ranges are discussed. Additionally, thermoelectric oxide devices which can be realised on the basis of low-cost materials with low toxicity are discussed.

  2. Seasonal, annual, and spatial variation in the development of hard bottom communities

    Science.gov (United States)

    Harms, J.; Anger, K.

    1983-06-01

    The development of hard bottom communities has been studied on test panels in Helgoland Harbour (German Bight) since 1977. Settlement and growth of epibenthic species was examined monthly. Natural variation in different seasons, years, and at three stations (the latter, only in 1981 and 1982) was investigated. At Station A (Binnenhafen), barnacles (Balanus crenatus) and polychaetes (Polydora ciliata) were always among the first settlers in spring. They were followed by other barnacles (Elminius modestus, Balanus improvisus) and by colonial ascidians (Botryllus schlosseri). The latter species often dominated from August to October, and tended to overgrow the barnacle populations. E. modestus showed strong annual variation, probably due to extremely low winter temperatures: after the cold winter of 1978/79, its populations were less dense than in previous years. In 1981 they recovered, and settlement increased again, but the cold winter 1981/82 damaged the population again. At Station B (Nordosthafen), mussels (Mytilus edulis) soon covered barnacles and empty space. By October they had monopolized the fouling community. At Station C (Südhafen), barnacle settlement in spring was followed by an overgrowth of hydrozoans ( Laomedea spec.). In summer, ascidians ( Ciona intestinalis and Ascidiella aspersa) settled and began to dominate. Barnacles were weaker in the competition for space as opposed to later colonizers at all three stations.

  3. Developing ozone critical levels for multi-species canopies of Mediterranean annual pastures.

    Science.gov (United States)

    Calvete-Sogo, H; González-Fernández, I; García-Gómez, H; Alonso, R; Elvira, S; Sanz, J; Bermejo-Bermejo, V

    2017-01-01

    Ozone (O3) critical levels (CLe) are still poorly developed for herbaceous vegetation. They are currently based on single species responses which do not reflect the multi-species nature of semi-natural vegetation communities. Also, the potential effects of other factors like the nitrogen (N) input are not considered in their derivation, making their use uncertain under natural conditions. Exposure- and dose-response relationships were derived from two open-top chamber experiments exposing a mixture of 6 representative annual Mediterranean pasture species growing in natural soil to 4 O3 fumigation levels and 3 N inputs. The Deposition of O3 and Stomatal Exchange model (DO3SE) was modified to account for the multi-species nature of the canopy following a big-leaf approach. This new approach was used for estimating a multi-species phytotoxic O3 dose (PODy-MS). Response relationships were derived based on O3 exposure (AOT40) and flux (PODy-MS) indices. The treatment effects were similar in the two seasons: O3 reduced the aboveground biomass growth and N modulated this response. Gas exchange rates presented a high inter-specific variability and important inter-annual fluctuations as a result of varying growing conditions during the two years. The AOT40-based relationships were not statistically significant except when the highest N input was considered alone. In contrast, PODy-MS relationships were all significant but for the lowest N input level. The influence of the N input on the exposure- and dose-response relationships implies that N can modify the O3 CLe. However, this is an aspect that has not been considered so far in the methodologies for establishing O3 CLe. Averaging across N input levels, a multi-species O3 CLe (CLef-MS) is proposed POD1-MS = 7.9 mmol m(-2), accumulated over 1.5 month with a 95% confidence interval of (5.9, 9.8). Further efforts will be needed for comparing the CLef-MS with current O3 CLef based on single species responses.

  4. Methods for estimating selected low-flow statistics and development of annual flow-duration statistics for Ohio

    Science.gov (United States)

    Koltun, G.F.; Kula, Stephanie P.

    2013-01-01

    This report presents the results of a study to develop methods for estimating selected low-flow statistics and for determining annual flow-duration statistics for Ohio streams. Regression techniques were used to develop equations for estimating 10-year recurrence-interval (10-percent annual-nonexceedance probability) low-flow yields, in cubic feet per second per square mile, with averaging periods of 1, 7, 30, and 90-day(s), and for estimating the yield corresponding to the long-term 80-percent duration flow. These equations, which estimate low-flow yields as a function of a streamflow-variability index, are based on previously published low-flow statistics for 79 long-term continuous-record streamgages with at least 10 years of data collected through water year 1997. When applied to the calibration dataset, average absolute percent errors for the regression equations ranged from 15.8 to 42.0 percent. The regression results have been incorporated into the U.S. Geological Survey (USGS) StreamStats application for Ohio (http://water.usgs.gov/osw/streamstats/ohio.html) in the form of a yield grid to facilitate estimation of the corresponding streamflow statistics in cubic feet per second. Logistic-regression equations also were developed and incorporated into the USGS StreamStats application for Ohio for selected low-flow statistics to help identify occurrences of zero-valued statistics. Quantiles of daily and 7-day mean streamflows were determined for annual and annual-seasonal (September–November) periods for each complete climatic year of streamflow-gaging station record for 110 selected streamflow-gaging stations with 20 or more years of record. The quantiles determined for each climatic year were the 99-, 98-, 95-, 90-, 80-, 75-, 70-, 60-, 50-, 40-, 30-, 25-, 20-, 10-, 5-, 2-, and 1-percent exceedance streamflows. Selected exceedance percentiles of the annual-exceedance percentiles were subsequently computed and tabulated to help facilitate consideration of the

  5. Developing a set of ancestry-sensitive DNA markers reflecting continental origins of humans

    NARCIS (Netherlands)

    P. Kersbergen (Paula); K. van Duijn (Kate); A. Kloosterman (Ate); J.T. den Dunnen (Johan); M.H. Kayser (Manfred); P. de Knijff (Peter)

    2009-01-01

    textabstractBackground: The identification and use of Ancestry-Sensitive Markers (ASMs), i.e. genetic polymorphisms facilitating the genetic reconstruction of geographical origins of individuals, is far from straightforward. Results: Here we describe the ascertainment and application of five

  6. Markers of adenocarcinoma characteristic of the site of origin: Development of a diagnostic algorithm

    NARCIS (Netherlands)

    Dennis, Jayne L.; Hvidsten, Torgeir R.; Wit, Ernst C.; Komorowski, Jan; Bell, Alexandra K.; Downie, Ian; Mooney, Jacqueline; Verbeke, Caroline; Bellamy, Christopher; Keith, W. Nicol; Oien, Karin A.

    2005-01-01

    Purpose: Patients with metastatic adenocarcinoma of unknown origin are a common clinical problem. Knowledge of the primary site is important for their management, but histologically, such tumors appear similar. Better diagnostic markers are needed to enable the assignment of metastases to likely sit

  7. Markers of adenocarcinoma characteristic of the site of origin: Development of a diagnostic algorithm

    NARCIS (Netherlands)

    Dennis, Jayne L.; Hvidsten, Torgeir R.; Wit, Ernst C.; Komorowski, Jan; Bell, Alexandra K.; Downie, Ian; Mooney, Jacqueline; Verbeke, Caroline; Bellamy, Christopher; Keith, W. Nicol; Oien, Karin A.

    2005-01-01

    Purpose: Patients with metastatic adenocarcinoma of unknown origin are a common clinical problem. Knowledge of the primary site is important for their management, but histologically, such tumors appear similar. Better diagnostic markers are needed to enable the assignment of metastases to likely sit

  8. Markers of Adenocarcinoma Characteristic of the Site of Origin : Development of a Diagnostic Algorithm

    NARCIS (Netherlands)

    Dennis, Jayne L.; Hvidsten, Torgeir R.; Wit, Ernst C.; Komorowski, Jan; Bell, Alexandra K.; Downie, Ian; Mooney, Jacqueline; Verbeke, Caroline; Bellamy, Christopher; Keith, W. Nicol; Oien, Karin A.

    2005-01-01

    Purpose: Patients with metastatic adenocarcinoma of unknown origin are a common clinical problem. Knowledge of the primary site is important for their management, but histologically, such tumors appear similar. Better diagnostic markers are needed to enable the assignment of metastases to likely sit

  9. Developing a set of ancestry-sensitive DNA markers reflecting continental origins of humans

    NARCIS (Netherlands)

    P. Kersbergen (Paula); K. van Duijn (Kate); A. Kloosterman (Ate); J.T. den Dunnen (Johan); M.H. Kayser (Manfred); P. de Knijff (Peter)

    2009-01-01

    textabstractBackground: The identification and use of Ancestry-Sensitive Markers (ASMs), i.e. genetic polymorphisms facilitating the genetic reconstruction of geographical origins of individuals, is far from straightforward. Results: Here we describe the ascertainment and application of five differe

  10. Marker-Assisted Backcrossing to Develop an Elite Cytoplasmic Male Sterility Line in Rice

    Directory of Open Access Journals (Sweden)

    Asadollah Ahmadikhah

    2015-07-01

    Full Text Available Cytoplasmic male sterility (CMS is a cornerstone of hybrid production in many crops. In three-line hybrid systems, use of CMS, maintainer, and fertility restorer lines is necessary for production of hybrid seeds. Limited resources of CMS and low variation of CMS lines cause genetic vulnerability to pathogens. Therefore, diversifying the CMS sources is indispensible for a sustainable production system of hybrid seed. In this study, we attempted for the first time to transfer CMS into maintainer line Yosen B in restricted generations using the marker-assisted backcrossing (MABC method. The resultant F hybrid of IR68897 A/Yosen B cross was backcrossed to Yosen B, and CMS plants in each backcross generation (from BCF to BCF were selected based on phenotyping test and MABC. Molecular assessment of backcross progenies was conducted using a mitochondrial CMS-specific marker and 34 polymorphic nuclear simple-sequence repeat (SSR markers in early generations (from BCF to BCF and was continued using 9 additional SSRs and 82 inter-simple sequence repeat (ISSR markers in BCF. A MABC strategy could successfully recover the recurrent parent genome (RPG in BCF generation, and decreased heterozygosity of final CMS plants. Restorability test with known wild-abortive restorer lines (viz. IR36 and IR24 showed that combination of Yosen A × IR24 could produce highly fertile F hybrid. Evaluation of some important agronomic traits of the final CMS line (BCF at field condition showed that it was comparable to the original maintainer fertile counterpart. Phenotypic and marker-assisted selections could considerably decrease the time needed for full recovery of RPG so that final CMS line could show a high similarity to original fertile counterpart.

  11. Rapid development of molecular markers by next-generation sequencing linked to a gene conferring phomopsis stem blight disease resistance for marker-assisted selection in lupin (Lupinus angustifolius L.) breeding.

    Science.gov (United States)

    Yang, Huaan; Tao, Ye; Zheng, Zequn; Shao, Di; Li, Zhenzhong; Sweetingham, Mark W; Buirchell, Bevan J; Li, Chengdao

    2013-02-01

    development of markers for molecular plant breeding.

  12. Hydrothermal processing of Hanford tank waste. Organic destruction technology development task annual report -- FY 1993

    Energy Technology Data Exchange (ETDEWEB)

    Orth, R.J.; Schmidt, A.J.; Zacher, A.H. [and others

    1993-09-01

    Low-temperature hydrothermal processing (HTP) is a thermal-chemical autogenous processing method that can be used to destroy organics and ferrocyanide in Hanford tank waste at temperatures from 250 C to 400 C. With HTP, organics react with oxidants, such as nitrite and nitrate, already present in the waste. Ferrocyanides and free cyanide will hydrolyze at similar temperatures and may also react with nitrates or other oxidants in the waste. No air or oxygen or additional chemicals need to be added to the autogenous HTP system. However, enhanced kinetics may be realized by air addition, and, if desired, chemical reductants can be added to the system to facilitate complete nitrate/nitrate destruction. Tank waste can be processed in a plug-flow, tubular reactor, or a continuous-stirred tank reactor system designed to accommodate the temperature, pressure, gas generation, and heat release associated with decomposition of the reactive species. The work described in this annual report was conducted in FY 1993 for the Organic Destruction Technology Development Task of Hanford`s Tank Waste Remediation System (TWRS). This task is part of an overall program to develop organic destruction technologies originally funded by TWRS to meet tank safety and waste form disposal criteria and condition the feed for further pretreatment. During FY 1993 the project completed seven experimental test plans, a 30-hr pilot-scale continuous run, over 200 hr of continuous bench-scale HTP testing, and 20 batch HTP tests; two contracts were established with commercial vendors, and a commercial laboratory reactor was procured and installed in a glovebox for HTP testing with actual Hanford tank waste.

  13. Challenges and Opportunities for Developing Robust Annually Resolved Paleoenvironmental Reconstructions from the Oceans

    Science.gov (United States)

    Wanamaker, A. D.; Griffin, S. M.; Whitney, N.; Kreutz, K. J.; Black, B.; Lower, E. E.; Introne, D.

    2016-02-01

    With recent progress in sclerochronology, several multi-century long, annually resolved and carefully crossdated marine records have been developed. Many of these records have shown to be sensitive to environmental conditions, including seawater temperature. Considering that the global ocean covers more than 70% of Earth's surface, these records are required to develop a more complete understanding of oceanic processes (e.g., circulation dynamics and carbon cycling), detail past marine climate variability and determine how the oceans interact with other components of the climate system. However, robust reconstructions of past seawater temperatures with calibration and verification statistics have been hindered largely in part due to inadequate instrumental records and monitoring programs in the ocean environment. To further exacerbate this problem, there are often large spatial differences in hydrographic conditions both in the vertical and horizontal dimensions, especially in dynamic oceanic regions. This latter problem is somewhat unique to the marine environment as the lower atmosphere is generally more homogenous over fairly large distances compared to coastal ocean environments. Thus, calibration and verification procedures used in dendrochronology are not always feasible in the marine environment, especially at depth where few instrumental series exist. Bootstrapping techniques may provide a reasonable approach to reconstruct paleoenvironmental conditions with relatively short instrumental series. However, rigorous error analysis of these records is difficult without relatively lengthy (> 40 years) and appropriately located instrumental series. As such research efforts move forward, the location of future research sites should be carefully considered not only for the scientific potential of a particular oceanic site but also whether or not long-term instrumental series representing multiple depths in the ocean are present.

  14. Development of novel microsatellite markers for the Northern Goshawk (Accipiter gentilis) and their utility in cross-species amplification

    Science.gov (United States)

    Haughey, Christy; Sage, George K.; Degange, Gabriel; Sonsthagen, Sarah A.; Talbot, Sandra

    2016-01-01

    The Northern Goshawk (Accipiter gentilis) is a large forest raptor with a Holarctic distribution and, in some portions of its range, a species of conservation concern. To augment previously reported genetic markers, 13 novel polymorphic microsatellite markers were developed to establish individual identification and familial relationships, to assess levels of genetic diversity, and to identify diagnostic markers. Of the 22 loci tested, 13 were polymorphic, seven were monomorphic, and two failed to amplify. This suite of microsatellite loci yielded a combined probability of parental exclusion of 98%; a single individual sampled from a North American population can be reliably identified using a combination of seven of the 13 polymorphic loci. Cross-species screening in Cooper's Hawks (A. cooperii) and Sharp-shinned Hawks (A. striatus) of the 20 loci that successfully amplified in Northern Goshawks identified 13 loci as polymorphic in each species. Six of these loci (Age1303, Age1308, Age1309, Age1312, and Age1314) appeared to be useful in distinguishing between Accipiter species. These markers will be useful to researchers investigating populations of North American accipiters.

  15. Development of polysomic microsatellite markers for characterization of population structuring and phylogeography in the shortnose sturgeon (Acipenser brevirostrum)

    Science.gov (United States)

    Henderson, Anne P.; King, Tim L.

    2012-01-01

    Shortnose sturgeon Acipenser brevirostrum is an endangered polyploid fish species for which no nuclear DNA markers previously existed. To address this need, 86 polysomic loci were developed and characterized in 20 A. brevirostrum from five river systems and eight members (parents and six progeny) of a captive-bred family. All markers proved to be polymorphic, polysomic, and demonstrated direct inheritance when tested in a captive family. Eleven loci were included in a range-wide survey of 561 fish sampled from 17 geographic collections. Allelic diversity at these markers ranged from 7 to 24 alleles/locus and averaged 16.5 alleles/locus; sufficient diversity to produce unique multilocus genotypes. In the range-wide survey, a Mantel comparison of an ecological (1-Jaccard’s) and genetic (ΦPT; an analog to FST) distance metrics, identified a strong positive correlation (r = 0.98, P PT represents a viable metric for assessing genetic relatedness using this class of marker.

  16. Development and Characterization of 1,906 EST-SSR Markers from Unigenes in Jute (Corchorus spp.).

    Science.gov (United States)

    Zhang, Liwu; Li, Yanru; Tao, Aifen; Fang, Pingping; Qi, Jianmin

    2015-01-01

    Jute, comprising white and dark jute, is the second important natural fiber crop after cotton worldwide. However, the lack of expressed sequence tag-derived simple sequence repeat (EST-SSR) markers has resulted in a large gap in the improvement of jute. Previously, de novo 48,914 unigenes from white jute were assembled. In this study, 1,906 EST-SSRs were identified from these assembled uingenes. Among these markers, di-, tri- and tetra-nucleotide repeat types were the abundant types (12.0%, 56.9% and 21.6% respectively). The AG-rich or GA-rich nucleotide repeats were the predominant. Subsequently, a sample of 116 SSRs, located in genes encoding transcription factors and cellulose synthases, were selected to survey polymorphisms among12 diverse jute accessions. Of these, 83.6% successfully amplified at least one fragment and detected polymorphism among the 12diverse genotypes, indicating that the newly developed SSRs are of good quality. Furthermore, the genetic similarity coefficients of all the 12 accessions were evaluated using 97 polymorphic SSRs. The cluster analysis divided the jute accessions into two main groups with genetic similarity coefficient of 0.61. These EST-SSR markers not only enrich molecular markers of jute genome, but also facilitate genetic and genomic researches in jute.

  17. Development and Characterization of 1,906 EST-SSR Markers from Unigenes in Jute (Corchorus spp..

    Directory of Open Access Journals (Sweden)

    Liwu Zhang

    Full Text Available Jute, comprising white and dark jute, is the second important natural fiber crop after cotton worldwide. However, the lack of expressed sequence tag-derived simple sequence repeat (EST-SSR markers has resulted in a large gap in the improvement of jute. Previously, de novo 48,914 unigenes from white jute were assembled. In this study, 1,906 EST-SSRs were identified from these assembled uingenes. Among these markers, di-, tri- and tetra-nucleotide repeat types were the abundant types (12.0%, 56.9% and 21.6% respectively. The AG-rich or GA-rich nucleotide repeats were the predominant. Subsequently, a sample of 116 SSRs, located in genes encoding transcription factors and cellulose synthases, were selected to survey polymorphisms among12 diverse jute accessions. Of these, 83.6% successfully amplified at least one fragment and detected polymorphism among the 12diverse genotypes, indicating that the newly developed SSRs are of good quality. Furthermore, the genetic similarity coefficients of all the 12 accessions were evaluated using 97 polymorphic SSRs. The cluster analysis divided the jute accessions into two main groups with genetic similarity coefficient of 0.61. These EST-SSR markers not only enrich molecular markers of jute genome, but also facilitate genetic and genomic researches in jute.

  18. Development and Validation of 697 Novel Polymorphic Genomic and EST-SSR Markers in the American Cranberry (Vaccinium macrocarpon Ait.

    Directory of Open Access Journals (Sweden)

    Brandon Schlautman

    2015-01-01

    Full Text Available The American cranberry, Vaccinium macrocarpon Ait., is an economically important North American fruit crop that is consumed because of its unique flavor and potential health benefits. However, a lack of abundant, genome-wide molecular markers has limited the adoption of modern molecular assisted selection approaches in cranberry breeding programs. To increase the number of available markers in the species, this study identified, tested, and validated microsatellite markers from existing nuclear and transcriptome sequencing data. In total, new primers were designed, synthesized, and tested for 979 SSR loci; 697 of the markers amplified allele patterns consistent with single locus segregation in a diploid organism and were considered polymorphic. Of the 697 polymorphic loci, 507 were selected for additional genetic diversity and segregation analyses in 29 cranberry genotypes. More than 95% of the 507 loci did not display segregation distortion at the p < 0.05 level, and contained moderate to high levels of polymorphism with a polymorphic information content >0.25. This comprehensive collection of developed and validated microsatellite loci represents a substantial addition to the molecular tools available for geneticists, genomicists, and breeders in cranberry and Vaccinium.

  19. Development of Reproducible EST-derived SSR Markers and Assessment of Genetic Diversity in Panax ginseng Cultivars and Related Species

    Science.gov (United States)

    Choi, Hong-Il; Kim, Nam Hoon; Kim, Jun Ha; Choi, Beom Soon; Ahn, In-Ok; Lee, Joon-Soo; Yang, Tae-Jin

    2011-01-01

    Little is known about the genetics or genomics of Panax ginseng. In this study, we developed 70 expressed sequence tag-derived polymorphic simple sequence repeat markers by trials of 140 primer pairs. All of the 70 markers showed reproducible polymorphism among four Panax speciesand 19 of them were polymorphic in six P. ginseng cultivars. These markers segregated 1:2:1 manner of Mendelian inheritance in an F2 population of a cross between two P. ginseng cultivars, ‘Yunpoong’ and ‘Chunpoong’, indicating that these are reproducible and inheritable mappable markers. A phylogenetic analysis using the genotype data showed three distinctive groups: a P. ginseng-P. japonicus clade, P. notoginseng and P. quinquefolius, with similarity coefficients of 0.70. P. japonicus was intermingled with P. ginseng cultivars, indicating that both species have similar genetic backgrounds. P. ginseng cultivars were subdivided into three minor groups: an independent cultivar ‘Chunpoong’, a subgroup with three accessions including two cultivars, ‘Gumpoong’ and ‘Yunpoong’ and one landrace ‘Hwangsook’ and another subgroup with two accessions including one cultivar, ‘Gopoong’ and one landrace ‘Jakyung’. Each primer pair produced 1 to 4 bands, indicating that the ginseng genome has a highly replicated paleopolyploid genome structure. PMID:23717085

  20. Development of microsatellite markers in Caryophyllaeus laticeps (Cestoda: Caryophyllidea), monozoic fish tapeworm, using next-generation sequencing approach.

    Science.gov (United States)

    Králová-Hromadová, Ivica; Minárik, Gabriel; Bazsalovicsová, Eva; Mikulíček, Peter; Oravcová, Alexandra; Pálková, Lenka; Hanzelová, Vladimíra

    2015-02-01

    Caryophyllaeus laticeps (Pallas 1781) (Cestoda: Caryophyllidea) is a monozoic tapeworm of cyprinid fishes with a distribution area that includes Europe, most of the Palaearctic Asia and northern Africa. Broad geographic distribution, wide range of definitive fish hosts and recently revealed high morphological plasticity of the parasite, which is not in an agreement with molecular findings, make this species to be an interesting model for population biology studies. Microsatellites (short tandem repeat (STR) markers), as predominant markers for population genetics, were designed for C. laticeps using a next-generation sequencing (NGS) approach. Out of 165 marker candidates, 61 yielded PCR products of the expected size and in 25 of the candidates a declared repetitive motif was confirmed by Sanger sequencing. After the fragment analysis, six loci were proved to be polymorphic and tested for heterozygosity, Hardy-Weinberg equilibrium and the presence of null alleles on 59 individuals coming from three geographically widely separated populations (Slovakia, Russia and UK). The number of alleles in particular loci and populations ranged from two to five. Significant deficit of heterozygotes and the presence of null alleles were found in one locus in all three populations. Other loci showed deviations from Hardy-Weinberg equilibrium and the presence of null alleles only in some populations. In spite of relatively low polymorphism and the potential presence of null alleles, newly developed microsatellites may be applied as suitable markers in population genetic studies of C. laticeps.

  1. Development and validation of a microbial source tracking marker for the detection of fecal pollution by muskrats.

    Science.gov (United States)

    Marti, Romain; Zhang, Yun; Lapen, David R; Topp, Edward

    2011-10-01

    Surface waters in mixed-activity watersheds can be compromised by fecal pollution from livestock production, sewage outflows or leaking septic systems, or avian or mammalian wildlife. While undertaking water quality research in Eastern Ontario Canada, we observed an abundance of muskrats (Ondatra zibethicus) in some waterways, and sought to determine their significance with respect to fecal pollution loads. To that end, we developed and validated here a sensitive and specific marker, designated MuBa01, based on the 16S rRNA gene that distinguishes muskrat feces from human, livestock, or other wildlife sources. DNA from waterways inhabited by muskrats carried the marker. The widely used pig-specific marker Pig-2-Bac yielded a product with some muskrat feces, suggesting that it lacks specificity required to establish the significance of swine production in areas inhabited by muskrats. Overall, the MuBa01 marker will be useful for distinguishing the significance of this wide-ranging semi-aquatic mammal in the context of other fecal pollution sources.

  2. Development and application of marker-assisted reverse breeding using hybrid maize germplasm

    Institute of Scientific and Technical Information of China (English)

    GUAN Yi-Xin; WANG Bao-hua; FENG Yan; LI Ping

    2015-01-01

    Humankind has been through different periods of agricultural improvement aiming at enhancing our food supply and the performance of food crops. In recent years, whole genome sequencing and deep understanding of genetic and epigenetic mechanisms have facilitated new plant breeding approaches to meet the chalenge of growing population, dwindling re-sources, and changing climate. Here we proposed a simple and fast molecular breeding method, marker-assisted reverse breeding (MARB), which wil revert any maize hybrid into inbred lines with any level of required similarity to its original parent lines. Since al the pericarp DNA of a hybrid is from the maternal parent, whereas one half of the embryo DNA is from the maternal parent and the other half from the paternal parent, so we ifrstly extract DNA from seed embryo and pericarp of a selected elite hybrid separately and then we derived the genotypes of the two parents with high-density single nucleotide polymorphism (SNP) chips. The folowing marker-assisted selection was performed based on an Ilumina low-density SNP chip designed with 192 SNPs polymorphic between the two parental genotypes, which were uniformly distributed on 10 maize chromosomes. This method has the advantages of fast speed, ifxed heterotic mode, and quick recovery of beneifcial parental genotypes compared to traditional pedigree breeding using elite hybrids. Meanwhile, MARB has the advantage of not requiring sophisticated transformation and double haploid (DH) technologies over RNA interference (RNAi)-mediated reverse breeding. In addition, MARB can also be used with feed corn harvested from big farms, which is often similar to F2 populations, and the relevant transgenes in the population can be eliminated by marker-assisted selection. As a result, the whole global commercial maize hybrids can be utilized as germplasm for breeding with MARB technology. Starting with an F2 population derived from an elite hybrid, our experiment indicates that with three

  3. Development, characterization and cross species amplification of polymorphic microsatellite markers from expressed sequence tags of turmeric (Curcuma longa L.).

    Science.gov (United States)

    Siju, S; Dhanya, K; Syamkumar, S; Sasikumar, B; Sheeja, T E; Bhat, A I; Parthasarathy, V A

    2010-02-01

    Expressed sequence tags (ESTs) from turmeric (Curcuma longa L.) were used for the screening of type and frequency of Class I (hypervariable) simple sequence repeats (SSRs). A total of 231 microsatellite repeats were detected from 12,593 EST sequences of turmeric after redundancy elimination. The average density of Class I SSRs accounts to one SSR per 17.96 kb of EST. Mononucleotides were the most abundant class of microsatellite repeat in turmeric ESTs followed by trinucleotides. A robust set of 17 polymorphic EST-SSRs were developed and used for evaluating 20 turmeric accessions. The number of alleles detected ranged from 3 to 8 per loci. The developed markers were also evaluated in 13 related species of C. longa confirming high rate (100%) of cross species transferability. The polymorphic microsatellite markers generated from this study could be used for genetic diversity analysis and resolving the taxonomic confusion prevailing in the genus.

  4. Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton.

    Science.gov (United States)

    Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa

    2013-06-01

    Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and

  5. Development of highly variable microsatellite markers for the tetraploid Silene stellata (Caryophyllaceae)1

    Science.gov (United States)

    Zhou, Juannan; Dudash, Michele R.; Fenster, Charles B.; Zimmer, Elizabeth A.

    2016-01-01

    Premise of the study: We designed and tested microsatellite markers for the North American native species Silene stellata (Caryophyllaceae) to investigate its population genetic structure and identify selection on floral design through male reproductive success. Methods and Results: A total of 153 candidate microsatellite loci were isolated based on next-generation sequencing. We identified 18 polymorphic microsatellite loci in three populations of S. stellata, with di- or trinucleotide repeats. Genotyping results showed the number of alleles per locus ranged from six to 45 and expected heterozygosity ranged from 0.511 to 0.951. Five of these loci were successfully amplified in S. virginica and S. caroliniana and were also polymorphic. Conclusions: The microsatellite markers reported here provide a valuable tool for paternity analysis in S. stellata. They will also be useful for investigating the population genetic structures of S. stellata and related species. PMID:28101439

  6. Development of 57 Novel Polymorphic Microsatellite Markers in Half-Smooth Tongue Sole (Cynoglossus semilaevis)

    Institute of Scientific and Technical Information of China (English)

    MIAO Guidong; XU Ying; WANG Di; CHEN Songlin; FAN Tingjun; TIAN Yongsheng

    2011-01-01

    Half-smooth tongue sole (Cynoglossus semilaevis) is a promising species for aquaculture in China.The wild population of C.semilaevis is under threat from environmental factors.Microsatellite markers are very suitable for assessing genetic diversity.Four microsatellite-enriched libraries of half smooth tongue sole (Cynoglossus semilaevis) were constructed,from which 57 polymorphic microsatellites were isolated and characterized.The polymorphism of these microsatellites was assessed by genotyping in 30 individual fish.The number of alleles ranged from 2 to 11,with an average of 4.614 alleles per locus.The values of observed and expected heterozygosities ranged from 0.1000 to 1.0000 and from 0.0966 to 0.8847 respectively.Polymorphism information content (PIC) ranged from 0.0905 to 0.862.These markers would be useful for population structure assessment,genetic linkage map construction and parentage analysis for this species.

  7. Development of Genetic Markers for Environmental DNA (eDNA) Monitoring of Sturgeon

    Science.gov (United States)

    2014-09-01

    phylogeny of the “ancient fish .” Molecular Phylogenetics and Evolution 26:110-120. Jerde, C. L., A. R. Mahon, W. L. Chadderton, and D. M. Lodge. 2011...sturgeon markers were tested for specificity against a battery of 32 non-target fish species common to the Mississippi and Illinois River watersheds...techniques. Such methods, including fishing , netting, seining, and electrofishing, can often be logistically complex and require considerable outlays of

  8. Development of microsatellite markers and detection of genetic variation between Goniozus wasp populations.

    Science.gov (United States)

    Khidr, Sahand K; Hardy, Ian C W; Zaviezo, Tania; Mayes, Sean

    2014-03-20

    Molecular genetic markers reveal differences between genotypes according to the presence of alleles (the same or different) at target loci. Microsatellite markers are especially useful co-dominant markers that have been used in a wide range of studies to elucidate the population structure and dynamics of a range of organisms, including agriculturally beneficial insects such as parasitic wasps (parasitoids). In the present study, twelve primer pairs were designed for the south Asian , Goniozus nephantidis (Muesebeck) (Hymenoptera: Bethylidae), and 24 for its New World congener, Goniozus legneri Gordh, parasitoids of the larvae of the lepidopteran coconut pest Opisina arenosella Walker (Lepidoptera: Crytophasidae) and other lepidopteran pests, respectively, in order to investigate polymorphism within and between populations. The wasps fingerprinted were a total of 85 G. nephantidis and G. legneri, including individuals belonging to three putatively different strains of G. legneri. Annealing gradient tests (50-65°C) were conducted to study the quality of the PCR amplification across an annealing temperature gradient using a mixed genotype DNA template from each species separately. Seven primer pairs, which amplified clear products of approximately the expected size of G. nephantidis and 18 of G. legneri, were then selected for capillary analysis for fragment size determination on a Beckmann CEQ 8000. Neither G. nephantidis nor G. legneri were polymorphic within populations. However, there were six primer pairs that did show polymorphism between G. legneri populations that originated from different geographical areas within South America (Uruguay and Chile). Furthermore, one primer pair revealed diversity between the two strains collected within Chile. One of the markers was subsequently used to provide unbiased assessment of primary sex ratio in G. legneri.

  9. Microsatellite marker development by multiplex ion torrent PGM sequencing: a case study of the endangered Odorrana narina complex of frogs.

    Science.gov (United States)

    Igawa, Takeshi; Nozawa, Masafumi; Nagaoka, Mai; Komaki, Shohei; Oumi, Shohei; Fujii, Tamotsu; Sumida, Masayuki

    2015-01-01

    The endangered Ryukyu tip-nosed frog Odorrana narina and its related species, Odorrana amamiensis, Odorrana supranarina, and Odorrana utsunomiyaorum, belong to the family Ranidae and are endemically distributed in Okinawa (O. narina), Amami and Tokunoshima (O. amamiensis), and Ishigaki and Iriomote (O. supranarina and O. utsunomiyaorum) Islands. Because of varying distribution patterns, this species complex is an intrinsic model for speciation and adaptation. For effective conservation and molecular ecological studies, further genetic information is needed. For rapid, cost-effective development of several microsatellite markers for these and 2 other species, we used next-generation sequencing technology of Ion Torrent PGM™. Distribution patterns of repeat motifs of microsatellite loci in these modern frog species (Neobatrachia) were similarly skewed. We isolated and characterized 20 new microsatellite loci of O. narina and validated cross-amplification in the three-related species. Seventeen, 16, and 13 loci were cross-amplified in O. amamiensis, O. supranarina, and O. utsunomiyaorum, respectively, reflecting close genetic relationships between them. Mean number of alleles and expected heterozygosity of newly isolated loci varied depending on the size of each inhabited island. Our findings suggested the suitability of Ion Torrent PGM™ for microsatellite marker development. The new markers developed for the O. narina complex will be applicable in conservation genetics and molecular ecological studies.

  10. Development and application of a positive-negative selectable marker system for use in reverse genetics in Plasmodium.

    Science.gov (United States)

    Braks, Joanna A M; Franke-Fayard, Blandine; Kroeze, Hans; Janse, Chris J; Waters, Andrew P

    2006-03-14

    A limitation of transfection of malaria parasites is the availability of only a low number of positive selectable markers for selection of transformed mutants. This is exacerbated for the rodent parasite Plasmodium berghei as selection of mutants is performed in vivo in laboratory rodents. We here report the development and application of a negative selection system based upon transgenic expression of a bifunctional protein (yFCU) combining yeast cytosine deaminase and uridyl phosphoribosyl transferase (UPRT) activity in P.berghei followed by in vivo selection with the prodrug 5-fluorocytosine (5-FC). The combination of yfcu and a positive selectable marker was used to first achieve positive selection of mutant parasites with a disrupted gene in a conventional manner. Thereafter through negative selection using 5-FC, mutants were selected where the disrupted gene had been restored to its original configuration as a result of the excision of the selectable markers from the genome through homologous recombination. This procedure was carried out for a Plasmodium gene (p48/45) encoding a protein involved in fertilization, the function of which had been previously implied through gene disruption alone. Such reversible recombination can therefore be employed for both the rapid analysis of the phenotype by targeted disruption of a gene and further associate phenotype and function by genotype restoration through the use of a single plasmid and a single positive selectable marker. Furthermore the negative selection system may also be adapted to facilitate other procedures such as 'Hit and Run' and 'vector recycling' which in principle will allow unlimited manipulation of a single parasite clone. This is the first demonstration of the general use of yFCU in combination with a positive selectable marker in reverse genetics approaches and it should be possible to adapt its use to many other biological systems.

  11. Genome-wide mining, characterization, and development of microsatellite markers in Marsupenaeus japonicus by genome survey sequencing

    Science.gov (United States)

    Lu, Xia; Luan, Sheng; Kong, Jie; Hu, Longyang; Mao, Yong; Zhong, Shengping

    2017-01-01

    The kuruma prawn, Marsupenaeus japonicus, is one of the most cultivated and consumed species of shrimp. However, very few molecular genetic/genomic resources are publically available for it. Thus, the characterization and distribution of simple sequence repeats (SSRs) remains ambiguous and the use of SSR markers in genomic studies and marker-assisted selection is limited. The goal of this study is to characterize and develop genome-wide SSR markers in M. japonicus by genome survey sequencing for application in comparative genomics and breeding. A total of 326 945 perfect SSRs were identified, among which dinucleotide repeats were the most frequent class (44.08%), followed by mononucleotides (29.67%), trinucleotides (18.96%), tetranucleotides (5.66%), hexanucleotides (1.07%), and pentanucleotides (0.56%). In total, 151 541 SSR loci primers were successfully designed. A subset of 30 SSR primer pairs were synthesized and tested in 42 individuals from a wild population, of which 27 loci (90.0%) were successfully amplified with specific products and 24 (80.0%) were polymorphic. For the amplified polymorphic loci, the alleles ranged from 5 to 17 (with an average of 9.63), and the average PIC value was 0.796. A total of 58 256 SSR-containing sequences had significant Gene Ontology annotation; these are good functional molecular marker candidates for association studies and comparative genomic analysis. The newly identified SSRs significantly contribute to the M. japonicus genomic resources and will facilitate a number of genetic and genomic studies, including high density linkage mapping, genome-wide association analysis, marker-aided selection, comparative genomics analysis, population genetics, and evolution.

  12. Application of next-generation sequencing for rapid marker development in molecular plant breeding: a case study on anthracnose disease resistance in Lupinus angustifolius L.

    Directory of Open Access Journals (Sweden)

    Yang Huaan

    2012-07-01

    Full Text Available Abstract Background In the last 30 years, a number of DNA fingerprinting methods such as RFLP, RAPD, AFLP, SSR, DArT, have been extensively used in marker development for molecular plant breeding. However, it remains a daunting task to identify highly polymorphic and closely linked molecular markers for a target trait for molecular marker-assisted selection. The next-generation sequencing (NGS technology is far more powerful than any existing generic DNA fingerprinting methods in generating DNA markers. In this study, we employed a grain legume crop Lupinus angustifolius (lupin as a test case, and examined the utility of an NGS-based method of RAD (restriction-site associated DNA sequencing as DNA fingerprinting for rapid, cost-effective marker development tagging a disease resistance gene for molecular breeding. Results Twenty informative plants from a cross of RxS (disease resistant x susceptible in lupin were subjected to RAD single-end sequencing by multiplex identifiers. The entire RAD sequencing products were resolved in two lanes of the 16-lanes per run sequencing platform Solexa HiSeq2000. A total of 185 million raw reads, approximately 17 Gb of sequencing data, were collected. Sequence comparison among the 20 test plants discovered 8207 SNP markers. Filtration of DNA sequencing data with marker identification parameters resulted in the discovery of 38 molecular markers linked to the disease resistance gene Lanr1. Five randomly selected markers were converted into cost-effective, simple PCR-based markers. Linkage analysis using marker genotyping data and disease resistance phenotyping data on a F8 population consisting of 186 individual plants confirmed that all these five markers were linked to the R gene. Two of these newly developed sequence-specific PCR markers, AnSeq3 and AnSeq4, flanked the target R gene at a genetic distance of 0.9 centiMorgan (cM, and are now replacing the markers previously developed by a traditional DNA

  13. Application of next-generation sequencing for rapid marker development in molecular plant breeding: a case study on anthracnose disease resistance in Lupinus angustifolius L.

    Science.gov (United States)

    Yang, Huaan; Tao, Ye; Zheng, Zequn; Li, Chengdao; Sweetingham, Mark W; Howieson, John G

    2012-07-17

    In the last 30 years, a number of DNA fingerprinting methods such as RFLP, RAPD, AFLP, SSR, DArT, have been extensively used in marker development for molecular plant breeding. However, it remains a daunting task to identify highly polymorphic and closely linked molecular markers for a target trait for molecular marker-assisted selection. The next-generation sequencing (NGS) technology is far more powerful than any existing generic DNA fingerprinting methods in generating DNA markers. In this study, we employed a grain legume crop Lupinus angustifolius (lupin) as a test case, and examined the utility of an NGS-based method of RAD (restriction-site associated DNA) sequencing as DNA fingerprinting for rapid, cost-effective marker development tagging a disease resistance gene for molecular breeding. Twenty informative plants from a cross of RxS (disease resistant x susceptible) in lupin were subjected to RAD single-end sequencing by multiplex identifiers. The entire RAD sequencing products were resolved in two lanes of the 16-lanes per run sequencing platform Solexa HiSeq2000. A total of 185 million raw reads, approximately 17 Gb of sequencing data, were collected. Sequence comparison among the 20 test plants discovered 8207 SNP markers. Filtration of DNA sequencing data with marker identification parameters resulted in the discovery of 38 molecular markers linked to the disease resistance gene Lanr1. Five randomly selected markers were converted into cost-effective, simple PCR-based markers. Linkage analysis using marker genotyping data and disease resistance phenotyping data on a F8 population consisting of 186 individual plants confirmed that all these five markers were linked to the R gene. Two of these newly developed sequence-specific PCR markers, AnSeq3 and AnSeq4, flanked the target R gene at a genetic distance of 0.9 centiMorgan (cM), and are now replacing the markers previously developed by a traditional DNA fingerprinting method for marker

  14. Application of next-generation sequencing for rapid marker development in molecular plant breeding: a case study on anthracnose disease resistance in Lupinus angustifolius L.

    OpenAIRE

    2012-01-01

    Abstract Background In the last 30 years, a number of DNA fingerprinting methods such as RFLP, RAPD, AFLP, SSR, DArT, have been extensively used in marker development for molecular plant breeding. However, it remains a daunting task to identify highly polymorphic and closely linked molecular markers for a target trait for molecular marker-assisted selection. The next-generation sequencing (NGS) technology is far more powerful than any existing generic DNA fingerprinting methods in generating ...

  15. Characterization of the miiuy croaker (Miichthys miiuy transcriptome and development of immune-relevant genes and molecular markers.

    Directory of Open Access Journals (Sweden)

    Rongbo Che

    Full Text Available BACKGROUND: The miiuy croaker (Miichthys miiuy is an important species of marine fish that supports capture fisheries and aquaculture. At present commercial scale aquaculture of this species is limited due to diseases caused by pathogens and parasites which restrict production and limit commercial value. The lack of transcriptomic and genomic information for the miiuy croaker limits the ability of researchers to study the pathogenesis and immune system of this species. In this study we constructed a cDNA library from liver, spleen and kidney which was sequenced using Illumina paired-end sequencing to enable gene discovery and molecular marker development. PRINCIPAL FINDINGS: In our study, a total of 69,071 unigenes with an average length of 572 bp were obtained. Of these, 45,676 (66.13% were successfully annotated in public databases. The unigenes were also annotated with Gene Ontology, Clusters of Orthologous Groups and KEGG pathways. Additionally, 498 immune-relevant genes were identified and classified. Furthermore, 14,885 putative simple sequence repeats (cSSRs and 8,510 putative single nucleotide polymorphisms (SNPs were identified from the 69,071 unigenes. CONCLUSION: The miiuy croaker (Miichthys miiuy transcriptome data provides a large resource to identify new genes involved in many processes including those involved in the response to pathogens and diseases. Furthermore, the thousands of potential cSSR and SNP markers found in this study are important resources with respect to future development of molecular marker assisted breeding programs for the miiuy croaker.

  16. A PCR-based forward genetics screening, using expression domain-specific markers, identifies mutants in endosperm transfer cell development

    Directory of Open Access Journals (Sweden)

    Luis Miguel Muñiz

    2014-04-01

    Full Text Available Mutant collections are an invaluable source of material on which forward genetic approaches allow the identification of genes affecting a wide variety of biological processes. However, some particular developmental stages and morphological structures may resist analysis due to their physical inaccessibility or to deleterious effects associated to their modification. Furthermore, lethal mutations acting early in development may escape detection. We have approached the characterisation of 101 maize seed mutants, selected from a collection of 27500 visually screened Mu-insertion lines, using a molecular marker approach based on a set of genes previously ascribed to different tissue compartments within the early developing kernel. A streamlined combination of qRT-PCR assays has allowed us to preliminary pinpoint the affected compartment, establish developmental comparisons to WT siblings and select mutant lines with alterations in the different compartments. Furthermore, clusters of markers co-affected by the underlying mutation were identified. We have analysed more extensively a set of lines presenting significant variation in transfer cell-associated expression markers, and have performed morphological observations, and immunolocalization experiments to confirm the results, validating this approach as an efficient mutant description tool.

  17. Argonne National Laboratory annual report of Laboratory Directed Research and Development Program Activities FY 2009.

    Energy Technology Data Exchange (ETDEWEB)

    Office of the Director

    2010-04-09

    I am pleased to submit Argonne National Laboratory's Annual Report on its Laboratory Directed Research and Development (LDRD) activities for fiscal year 2009. Fiscal year 2009 saw a heightened focus by DOE and the nation on the need to develop new sources of energy. Argonne scientists are investigating many different sources of energy, including nuclear, solar, and biofuels, as well as ways to store, use, and transmit energy more safely, cleanly, and efficiently. DOE selected Argonne as the site for two new Energy Frontier Research Centers (EFRCs) - the Institute for Atom-Efficient Chemical Transformations and the Center for Electrical Energy Storage - and funded two other EFRCs to which Argonne is a major partner. The award of at least two of the EFRCs can be directly linked to early LDRD-funded efforts. LDRD has historically seeded important programs and facilities at the lab. Two of these facilities, the Advanced Photon Source and the Center for Nanoscale Materials, are now vital contributors to today's LDRD Program. New and enhanced capabilities, many of which relied on LDRD in their early stages, now help the laboratory pursue its evolving strategic goals. LDRD has, since its inception, been an invaluable resource for positioning the Laboratory to anticipate, and thus be prepared to contribute to, the future science and technology needs of DOE and the nation. During times of change, LDRD becomes all the more vital for facilitating the necessary adjustments while maintaining and enhancing the capabilities of our staff and facilities. Although I am new to the role of Laboratory Director, my immediate prior service as Deputy Laboratory Director for Programs afforded me continuous involvement in the LDRD program and its management. Therefore, I can attest that Argonne's program adhered closely to the requirements of DOE Order 413.2b and associated guidelines governing LDRD. Our LDRD program management continually strives to be more efficient. In

  18. [Development of a semi-autonomous mobile robot for reactor containments]. 1992 annual summary of activity

    Energy Technology Data Exchange (ETDEWEB)

    Wehe, D.K.

    1993-02-10

    The University of Michigan reports its progress on this project on a bimonthly or quarterly reporting frequency. As a result, the detailed annual summary of activity is derived from the integration of these progress reports. They are attached here to form a permanent record of the University`s contribution to this program.

  19. Developing Management Techniques For Black Walnut to Stabilize the Annual Nut Supply

    Science.gov (United States)

    Felix, Jr. Ponder; James E. Jones; Rita Mueller

    2001-01-01

    Two studies involving cultural methods to increase nut production of plantation black walnut are presented. In the first study, nut production was measured for 5 years to determine the effect of nitrogen (N) and potassium (K) fertilization separately, in combination, and with and without phosphorus (P) broadcast annually for 4 years at two rates. Fertilization...

  20. Development of rapidly evolving intron markers to estimate multilocus species trees of rodents.

    Directory of Open Access Journals (Sweden)

    Ana Rodríguez-Prieto

    Full Text Available One of the major challenges in the analysis of closely related species, speciation and phylogeography is the identification of variable sequence markers that allow the determination of genealogical relationships in multiple genomic regions using coalescent and species tree approaches. Rodent species represent nearly half of the mammalian diversity, but so far no systematic study has been carried out to detect suitable informative markers for this group. Here, we used a bioinformatic pipeline to extract intron sequences from rodent genomes available in databases and applied a series of filters that allowed the identification of 208 introns that adequately fulfilled several criteria for these studies. The main required characteristics of the introns were that they had the maximum possible mutation rates, that they were part of single-copy genes, that they had an appropriate sequence length for amplification, and that they were flanked by exons with suitable regions for primer design. In addition, in order to determine the validity of this approach, we chose ten of these introns for primer design and tested them in a panel of eleven rodent species belonging to different representative families. We show that all these introns can be amplified in the majority of species and that, overall, 79% of the amplifications worked with minimum optimization of the annealing temperature. In addition, we confirmed for a pair of sister species the relatively high level of sequence divergence of these introns. Therefore, we provide here a set of adequate intron markers that can be applied to different species of Rodentia for their use in studies that require significant sequence variability.

  1. Development of AFLP and RAPD markers linked to a locus associated with twisted growth in corkscrew willow (Salix matsudana 'Tortuosa').

    Science.gov (United States)

    Lin, Juan; Gunter, Lee E; Harding, Scott A; Kopp, Richard F; McCord, Rachel P; Tsai, Chung-Jui; Tuskan, Gerald A; Smart, Lawrence B

    2007-11-01

    Salix matsudana Koidz. cultivar 'Tortuosa' (corkscrew willow) is characterized by extensive stem bending and curling of leaves. To investigate the genetic basis of this trait, controlled crosses were made between a corkscrew female (S. matsudana 'Tortuosa') and a straight-stemmed, wild-type male (Salix alba L. Clone 99010). Seventy-seven seedlings from this family (ID 99270) were grown in the field for phenotypic observation. Among the progeny, 39 had straight stems and leaves and 38 had bent stems and curled leaves, suggesting that a dominant allele at a single locus controls this phenotype. As a first step in characterizing the locus, we searched for amplified fragment length polymorphism (AFLP) and randomly amplified polymorphic DNA (RAPD) markers linked to the tortuosa allele using bulked segregant analysis. Samples of DNA from 10 corkscrew individuals were combined to produce a corkscrew pool, and DNA from 10 straight progeny was combined to make a wild-type pool. Sixty-four AFLP primer combinations and 640 RAPD primers were screened to identify marker bands amplified from the corkscrew parent and progeny pool, but not from the wild-type parent or progeny pool. An AFLP marker and a RAPD marker linked to and flanking the tortuosa locus were placed on a preliminary linkage map constructed based on segregation among the 77 progeny. Sectioning and analysis of shoot tips revealed that the corkscrew phenotype is associated with vascular cell collapse, smaller cell size in regions near the cambium and less developed phloem fibers than in wild-type progeny. Identification of a gene associated with this trait could lead to greater understanding of the control of normal stem development in woody plants.

  2. De novo assembly, gene annotation and marker development using Illumina paired-end transcriptome sequences in celery (Apium graveolens L..

    Directory of Open Access Journals (Sweden)

    Nan Fu

    Full Text Available BACKGROUND: Celery is an increasing popular vegetable species, but limited transcriptome and genomic data hinder the research to it. In addition, a lack of celery molecular markers limits the process of molecular genetic breeding. High-throughput transcriptome sequencing is an efficient method to generate a large transcriptome sequence dataset for gene discovery, molecular marker development and marker-assisted selection breeding. PRINCIPAL FINDINGS: Celery transcriptomes from four tissues were sequenced using Illumina paired-end sequencing technology. De novo assembling was performed to generate a collection of 42,280 unigenes (average length of 502.6 bp that represent the first transcriptome of the species. 78.43% and 48.93% of the unigenes had significant similarity with proteins in the National Center for Biotechnology Information (NCBI non-redundant protein database (Nr and Swiss-Prot database respectively, and 10,473 (24.77% unigenes were assigned to Clusters of Orthologous Groups (COG. 21,126 (49.97% unigenes harboring Interpro domains were annotated, in which 15,409 (36.45% were assigned to Gene Ontology(GO categories. Additionally, 7,478 unigenes were mapped onto 228 pathways using the Kyoto Encyclopedia of Genes and Genomes Pathway database (KEGG. Large numbers of simple sequence repeats (SSRs were indentified, and then the rate of successful amplication and polymorphism were investigated among 31 celery accessions. CONCLUSIONS: This study demonstrates the feasibility of generating a large scale of sequence information by Illumina paired-end sequencing and efficient assembling. Our results provide a valuable resource for celery research. The developed molecular markers are the foundation of further genetic linkage analysis and gene localization, and they will be essential to accelerate the process of breeding.

  3. Hypervariable spacer regions are good sites for developing specific PCR-RFLP markers and PCR primers for screening actinorhizal symbionts

    Indian Academy of Sciences (India)

    Rajani Varghese; Vineeta S Chauhan; Arvind K Misra

    2003-06-01

    While the ribosomal RNA like highly conserved genes are good molecular chronometers for establishing phylogenetic relationships, they can also be useful in securing the amplification of adjoining hyper-variable regions. These regions can then be used for developing specific PCR primers or PCR-RFL profiles to be used as molecular markers. We report here the use of ITS region of rrn operon of Frankia for developing PCR-RFL profiles capable of discriminating between closely related frankiae. We have also made use of the ITS1 region of the nuclear rrn operon of Alnus nepalensis (D Don) for designing a PCR primer for specific amplification of nuclear DNA of this tree.

  4. Development and characterization of 1,827 expressed sequence tag-derived simple sequence repeat markers for ramie (Boehmeria nivea L. Gaud.

    Directory of Open Access Journals (Sweden)

    Touming Liu

    Full Text Available Ramie (Boehmeria nivea L. Gaud is one of the most important natural fiber crops, and improvement of fiber yield and quality is the main goal in efforts to breed superior cultivars. However, efforts aimed at enhancing the understanding of ramie genetics and developing more effective breeding strategies have been hampered by the shortage of simple sequence repeat (SSR markers. In our previous study, we had assembled de novo 43,990 expressed sequence tags (ESTs. In the present study, we searched these previously assembled ESTs for SSRs and identified 1,685 ESTs (3.83% containing 1,878 SSRs. Next, we designed 1,827 primer pairs complementary to regions flanking these SSRs, and these regions were designated as SSR markers. Among these markers, dinucleotide and trinucleotide repeat motifs were the most abundant types (36.4% and 36.3%, respectively, whereas tetranucleotide, pentanucleotide, and hexanucleotide motifs represented <10% of the markers. The motif AG/CT was the most abundant, accounting for 28.74% of the markers. One hundred EST-SSR markers (97 SSRs located in genes encoding transcription factors and 3 SSRs in genes encoding cellulose synthases were amplified using polymerase chain reaction for detecting 24 ramie varieties. Of these 100 markers, 98 markers were successfully amplified and 81 markers were polymorphic, with 2-6 alleles among the 24 varieties. Analysis of the genetic diversity of all 24 varieties revealed similarity coefficients that ranged from 0.51 to 0.80. The EST-SSRs developed in this study represent the first large-scale development of SSR markers for ramie. These SSR markers could be used for development of genetic and physical maps, quantitative trait loci mapping, genetic diversity studies, association mapping, and cultivar fingerprinting.

  5. Application of in silico bulked segregant analysis for rapid development of markers linked to Bean common mosaic virus resistance in common bean

    Science.gov (United States)

    Common bean was one of the first crops that benefited from the development and utilization of molecular markers in tagging major disease resistance genes for marker-assisted selection (MAS). Efficiency of MAS breeding in common bean is still hampered; however, due to the dominance, linkage phase, an...

  6. Identification of degenerate nuclei and development of a SCAR marker for Flammulina velutipes.

    Directory of Open Access Journals (Sweden)

    Sun Young Kim

    Full Text Available Flammulina velutipes is one of the major edible mushrooms in the world. Recently, abnormalities that have a negative impact on crop production have been reported in this mushroom. These symptoms include slow vegetative growth, a compact mycelial mat, and few or even no fruiting bodies. The morphologies and fruiting capabilities of monokaryons of wild-type and degenerate strains that arose through arthrospore formation were investigated through test crossing. Only one monokaryotic group of the degenerate strains and its hybrid strains showed abnormal phenotypes. Because the monokaryotic arthrospore has the same nucleus as the parent strain, these results indicated that only one aberrant nucleus of the two nuclei in the degenerate strain was responsible for the degeneracy. A sequence-characterized amplified region marker that is linked to the degenerate monokaryon was identified based on a polymorphic sequence that was generated using random primers. Comparative analyses revealed the presence of a degenerate-specific genomic region in a telomere, which arose via the transfer of a genomic fragment harboring a putative helicase gene. Our findings have narrowed down the potential molecular targets responsible for this phenotype for future studies and have provided a marker for the detection of degenerate strains.

  7. Phylogeny of the glomeromycota (arbuscular mycorrhizal fungi): recent developments and new gene markers.

    Science.gov (United States)

    Redecker, Dirk; Raab, Philipp

    2006-01-01

    The fungal symbionts of arbuscular mycorrhiza form a monophyletic group in the true Fungi, the phylum Glomeromycota. Fewer than 200 described species currently are included in this group. The only member of this clade known to form a different type of symbiosis is Geosiphon pyriformis, which associates with cyanobacteria. Because none of these fungi has been cultivated without their plant hosts or cyanobacterial partners, progress in obtaining multigene phylogenies has been slow and the nuclear-encoded ribosomal RNA genes have remained the only widely accessible molecular markers. rDNA phylogenies have revealed considerable polyphyly of some glomeromycotan genera that has been used to reassess taxonomic concepts. Environmental studies using phylogenetic methods for molecular identification have recovered an amazing diversity of unknown phylotypes, suggesting considerable cryptic species diversity. Protein gene sequences that have become available recently have challenged the rDNA-supported sister group relationship of the Glomeromycota with Asco/Basidiomycota. However the number of taxa analyzed with these new markers is still too small to provide a comprehensive picture of intraphylum relationships. We use nuclear-encoded rDNA and rpb1 protein gene sequences to reassess the phylogeny of the Glomeromycota and discuss possible implications.

  8. Dynamic Expression Patterns of Progenitor and Pyramidal Neuron Layer Markers in the Developing Human Hippocampus.

    Science.gov (United States)

    Cipriani, Sara; Nardelli, Jeannette; Verney, Catherine; Delezoide, Anne-Lise; Guimiot, Fabien; Gressens, Pierre; Adle-Biassette, Homa

    2016-03-01

    The molecular mechanisms underlying the formation of hippocampus are unknown in humans. To improve our knowledge of molecules that potentially regulate pyramidal neurogenesis and layering in various hippocampal fields, we investigated the expression of progenitor markers and cell fate molecules from gestational week (GW) 9 to GW 20. At GW 9, the progenitor cell compartment of the hippocampal formation mainly consisted of PAX6(+) cells in the ventricular zone. Between GW 9 and 11, a second germinal area, the subventricular zone (SVZ), was formed, as shown by TBR2 labeling. Postmitotic markers (TBR1, CTIP2, SATB2, and CUX1) might reflect the inside-out layering of the plate from GW 11 onwards. TBR1(+) neurons appeared in the deep plate, whereas CTIP2(+), SATB2(+), and CUX1(+) neurons occupied the upper layers. From GW 16, differences in layer segregation were observed between the ammonic and subicular plates. Moreover, an ammonic-to-subicular maturation gradient was observed in germinal/postmitotic areas. Taken together, these findings demonstrate for the first time the presence of an SVZ in the hippocampus of human fetuses and laminar differences in transcription factor expression in the pyramidal layer of the human ammonic and subicular plate, and provide new information to further investigate the connectivity of the hippocampal formation.

  9. Short communication: Development of a new polymorphic genetic marker in Araucaria araucana (Mol) K. Koch

    Energy Technology Data Exchange (ETDEWEB)

    Drake, F.; Martin, M. A.; Alvarez, A.; Molina, J. R.; Alvarez, J. B.; Herrera, M. A.; Martin, L. M.

    2012-11-01

    Seed storage proteins have been used as genetic marker in forest species to evaluate genetic variability, demonstrating its effectiveness both in conifers and broad-leaved. In conifers, megagametophyte storage proteins are particularly useful because of their haploid nature. The aim of this study was to determine whether these proteins could be used as a new marker of genetic diversity in Araucaria araucana, one of the oldest conifers of South America and a representative symbol of Chilean forest biodiversity. For this, megagametophytes from two A. araucana populations were assessed to identify polymorphic bands and to obtain a preliminary estimation of the genetic diversity. The results revealed that globulin is the best fraction for measuring the variability in the species, due to their high level of variation (20 identified bands, 11 of them polymorphic). Both populations showed high genetic diversity, with more than 92% of the variation within populations. The study highlighted that these proteins can be used to measure the genetic diversity in A. araucana, providing good information to ensure the preservation of the species genetic resources. (Author) 29 refs.

  10. Development of novel, cross-species microsatellite markers for Acropora corals using next-generation sequencing technology

    Directory of Open Access Journals (Sweden)

    Chuya eShinzato

    2014-05-01

    Full Text Available The genus Acropora (Scleractinia, Acroporidae is one of the most widespread coral genera, comprising the largest number of extant species among scleractinian (reef-building corals. Molecular phylogenetic studies have suggested that A. tenuis belongs to the most basal clade (clade I while A. digitifera belongs to a derived clade (clade IV. In order to develop microsatellite markers that would be useful for most Acropora species, we sequenced the genomic DNA of A. tenuis, using a next generation sequencer (Illumina MiSeq, and designed primer sets that amplify microsatellite loci. Afterward we selected primer pairs with perfectly matched nucleotide sequences from which at least one primer was uniquely mapped to the A. digitifera genome. Fourteen microsatellite markers showed non-significant departure from Hardy–Weinberg equilibrium (HWE in both A. tenuis and A. digitifera. Thus these markers could be used for wide range of species and may provide powerful tools for population genetics studies and conservation of Acropora corals.

  11. De novo characterization of Larimichthys crocea transcriptome for growth-/immune-related gene identification and massive microsatellite (SSR) marker development

    Science.gov (United States)

    Han, Zhaofang; Xiao, Shijun; Liu, Xiande; Liu, Yang; Li, Jiakai; Xie, Yangjie; Wang, Zhi Yong

    2016-04-01

    The large yellow croaker, Larimichthys crocea is an important marine fish in China with a high economic value. In the last decade, the stock conservation and aquaculture industry of this species have been facing severe challenges because of wild population collapse and degeneration of important economic traits. However, genes contributing to growth and immunity in L. crocea have not been thoroughly analyzed, and available molecular markers are still not sufficient for genetic resource management and molecular selection. In this work, we sequenced the transcriptome in L. crocea liver tissue with a Roche 454 sequencing platform and assembled the transcriptome into 93 801 transcripts. Of them, 38 856 transcripts were successfully annotated in nt, nr, Swiss-Prot, InterPro, COG, GO and KEGG databases. Based on the annotation information, 3 165 unigenes related to growth and immunity were identified. Additionally, a total of 6 391 simple sequence repeats (SSRs) were identified from the transcriptome, among which 4 498 SSRs had enough flanking regions to design primers for polymerase chain reactions (PCR). To access the polymorphism of these markers, 30 primer pairs were randomly selected for PCR amplification and validation in 30 individuals, and 12 primer pairs (40.0%) exhibited obvious length polymorphisms. This work applied RNA-Seq to assemble and analyze a live transcriptome in L. crocea. With gene annotation and sequence information, genes related to growth and immunity were identified and massive SSR markers were developed, providing valuable genetic resources for future gene functional analysis and selective breeding of L. crocea.

  12. De novo characterization of Larimichthys crocea transcriptome for growth-/immune-related gene identification and massive microsatellite (SSR) marker development

    Science.gov (United States)

    Han, Zhaofang; Xiao, Shijun; Liu, Xiande; Liu, Yang; Li, Jiakai; Xie, Yangjie; Wang, Zhiyong

    2017-03-01

    The large yellow croaker, Larimichthys crocea is an important marine fish in China with a high economic value. In the last decade, the stock conservation and aquaculture industry of this species have been facing severe challenges because of wild population collapse and degeneration of important economic traits. However, genes contributing to growth and immunity in L. crocea have not been thoroughly analyzed, and available molecular markers are still not sufficient for genetic resource management and molecular selection. In this work, we sequenced the transcriptome in L. crocea liver tissue with a Roche 454 sequencing platform and assembled the transcriptome into 93 801 transcripts. Of them, 38 856 transcripts were successfully annotated in nt, nr, Swiss-Prot, InterPro, COG, GO and KEGG databases. Based on the annotation information, 3 165 unigenes related to growth and immunity were identified. Additionally, a total of 6 391 simple sequence repeats (SSRs) were identified from the transcriptome, among which 4 498 SSRs had enough flanking regions to design primers for polymerase chain reactions (PCR). To access the polymorphism of these markers, 30 primer pairs were randomly selected for PCR amplification and validation in 30 individuals, and 12 primer pairs (40.0%) exhibited obvious length polymorphisms. This work applied RNA-Seq to assemble and analyze a live transcriptome in L. crocea. With gene annotation and sequence information, genes related to growth and immunity were identified and massive SSR markers were developed, providing valuable genetic resources for future gene functional analysis and selective breeding of L. crocea.

  13. Development and Characterization of Microsatellite Markers in Brassica rapa ssp.chinensis and Transferability Among Related Species

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Simple sequence repeat (SSR) or microsatellite marker is a valuable tool for several purposes, such as mapping, fingerprinting,and breeding.In the present study, an inter-simple sequence repeat (ISSR)-PCR technique was applied for developing SSR markers in non-heading Chinese cabbage (Brassica rapa). A total of 190 SSRs were obtained. Among these, AG or CT (54.7%) was the most frequent repeat, followed by AC or GT (31.6%) of the microsatellites. The average number of the SSRs length array was 16 and 10 times, respectively. Based on the determined SSR sequences, 143 SSR primer pairs were designed to evaluate their transferabilities among the related species of Brassica. The number of alleles produced per marker averaged 2.91, and the polymorphism information content (PIC) value ranged from 0 to 0.863 with an average of 0.540. Monomorphism was observed in 16 primer pairs. The transferability percentage in CC genome was higher than in BB genome. More loci occurred in the BBCC genome. This result supported the hypothesis that BB genome was divergent from A and C genomes, and AA and CC genomes were relatively close. The polymorphic primers can be exploited for further evolution, fingerprinting, and variety identification.

  14. Development of SSR Markers Based on Transcriptome Sequencing and Association Analysis with Drought Tolerance in Perennial Grass Miscanthus from China

    Directory of Open Access Journals (Sweden)

    Gang Nie

    2017-05-01

    Full Text Available Drought has become a critical environmental stress affecting on plant in temperate area. As one of the promising bio-energy crops to sustainable biomass production, the genus Miscanthus has been widely studied around the world. However, the most widely used hybrid cultivar among this genus, Miscanthus × giganteus is proved poor drought tolerance compared to some parental species. Here we mainly focused on Miscanthus sinensis, which is one of the progenitors of M. × giganteus providing a comparable yield and well abiotic stress tolerance in some places. The main objectives were to characterize the physiological and photosynthetic respond to drought stress and to develop simple sequence repeats (SSRs markers associated with drought tolerance by transcriptome sequencing within an originally collection of 44 Miscanthus genotypes from southwest China. Significant phenotypic differences were observed among genotypes, and the average of leaf relative water content (RWC were severely affected by drought stress decreasing from 88.27 to 43.21%, which could well contribute to separating the drought resistant and drought sensitive genotype of Miscanthus. Furthermore, a total of 16,566 gene-associated SSRs markers were identified based on Illumina RNA sequencing under drought conditions, and 93 of them were randomly selected to validate. In total, 70 (75.3% SSRs were successfully amplified and the generated loci from 30 polymorphic SSRs were used to estimate the genetic differentiation and population structure. Finally, two optimum subgroups of the population were determined by structure analysis and based on association analysis, seven significant associations were identified including two markers with leaf RWC and five markers with photosynthetic traits. With the rich sequencing resources annotation, such associations would serve an efficient tool for Miscanthus drought response mechanism study and facilitate genetic improvement of drought resistant for

  15. De novo assembly and transcriptome analysis of the rubber tree (Hevea brasiliensis and SNP markers development for rubber biosynthesis pathways.

    Directory of Open Access Journals (Sweden)

    Camila Campos Mantello

    Full Text Available Hevea brasiliensis (Willd. Ex Adr. Juss. Muell.-Arg. is the primary source of natural rubber that is native to the Amazon rainforest. The singular properties of natural rubber make it superior to and competitive with synthetic rubber for use in several applications. Here, we performed RNA sequencing (RNA-seq of H. brasiliensis bark on the Illumina GAIIx platform, which generated 179,326,804 raw reads on the Illumina GAIIx platform. A total of 50,384 contigs that were over 400 bp in size were obtained and subjected to further analyses. A similarity search against the non-redundant (nr protein database returned 32,018 (63% positive BLASTx hits. The transcriptome analysis was annotated using the clusters of orthologous groups (COG, gene ontology (GO, Kyoto Encyclopedia of Genes and Genomes (KEGG, and Pfam databases. A search for putative molecular marker was performed to identify simple sequence repeats (SSRs and single nucleotide polymorphisms (SNPs. In total, 17,927 SSRs and 404,114 SNPs were detected. Finally, we selected sequences that were identified as belonging to the mevalonate (MVA and 2-C-methyl-D-erythritol 4-phosphate (MEP pathways, which are involved in rubber biosynthesis, to validate the SNP markers. A total of 78 SNPs were validated in 36 genotypes of H. brasiliensis. This new dataset represents a powerful information source for rubber tree bark genes and will be an important tool for the development of microsatellites and SNP markers for use in future genetic analyses such as genetic linkage mapping, quantitative trait loci identification, investigations of linkage disequilibrium and marker-assisted selection.

  16. De novo assembly and transcriptome analysis of the rubber tree (Hevea brasiliensis) and SNP markers development for rubber biosynthesis pathways.

    Science.gov (United States)

    Mantello, Camila Campos; Cardoso-Silva, Claudio Benicio; da Silva, Carla Cristina; de Souza, Livia Moura; Scaloppi Junior, Erivaldo José; de Souza Gonçalves, Paulo; Vicentini, Renato; de Souza, Anete Pereira

    2014-01-01

    Hevea brasiliensis (Willd. Ex Adr. Juss.) Muell.-Arg. is the primary source of natural rubber that is native to the Amazon rainforest. The singular properties of natural rubber make it superior to and competitive with synthetic rubber for use in several applications. Here, we performed RNA sequencing (RNA-seq) of H. brasiliensis bark on the Illumina GAIIx platform, which generated 179,326,804 raw reads on the Illumina GAIIx platform. A total of 50,384 contigs that were over 400 bp in size were obtained and subjected to further analyses. A similarity search against the non-redundant (nr) protein database returned 32,018 (63%) positive BLASTx hits. The transcriptome analysis was annotated using the clusters of orthologous groups (COG), gene ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), and Pfam databases. A search for putative molecular marker was performed to identify simple sequence repeats (SSRs) and single nucleotide polymorphisms (SNPs). In total, 17,927 SSRs and 404,114 SNPs were detected. Finally, we selected sequences that were identified as belonging to the mevalonate (MVA) and 2-C-methyl-D-erythritol 4-phosphate (MEP) pathways, which are involved in rubber biosynthesis, to validate the SNP markers. A total of 78 SNPs were validated in 36 genotypes of H. brasiliensis. This new dataset represents a powerful information source for rubber tree bark genes and will be an important tool for the development of microsatellites and SNP markers for use in future genetic analyses such as genetic linkage mapping, quantitative trait loci identification, investigations of linkage disequilibrium and marker-assisted selection.

  17. Annual Report Nucelar Energy Research and Development Program Nuclear Energy Research Initiative

    Energy Technology Data Exchange (ETDEWEB)

    Hively, LM

    2003-02-13

    NERI Project No.2000-0109 began in August 2000 and has three tasks. The first project year addressed Task 1, namely development of nonlinear prognostication for critical equipment in nuclear power facilities. That work is described in the first year's annual report (ORNLTM-2001/195). The current (second) project year (FY02) addresses Task 2, while the third project year will address Tasks 2-3. This report describes the work for the second project year, spanning August 2001 through August 2002, including status of the tasks, issues and concerns, cost performance, and status summary of tasks. The objective of the second project year's work is a compelling demonstration of the nonlinear prognostication algorithm using much more data. The guidance from Dr. Madeline Feltus (DOE/NE-20) is that it would be preferable to show forewarning of failure for different kinds of nuclear-grade equipment, as opposed to many different failure modes from one piece of equipment. Long-term monitoring of operational utility equipment is possible in principle, but is not practically feasible for the following reason. Time and funding constraints for this project do not allow us to monitor the many machines (thousands) that will be necessary to obtain even a few failure sequences, due to low failure rates (<10{sup -3}/year) in the operational environment. Moreover, the ONLY way to guarantee a controlled failure sequence is to seed progressively larger faults in the equipment or to overload the equipment for accelerated tests. Both of these approaches are infeasible for operational utility machinery, but are straight-forward in a test environment. Our subcontractor has provided such test sequences. Thus, we have revised Tasks 2.1-2.4 to analyze archival test data from such tests. The second phase of our work involves validation of the nonlinear prognostication over the second and third years of the proposed work. Recognizing the inherent limitations outlined in the previous

  18. Annual re-habituation of calving caribou to oilfields in northern Alaska : implications for expanding development

    Energy Technology Data Exchange (ETDEWEB)

    Haskell, S.P.; Ballard, W.B. [Texas Tech Univ., Lubbock, TX (United States). Dept. of Natural Resources Management

    2008-07-15

    Studies have suggested that calving caribou are rehabituated to human activities related to the petroleum industry over time as well as annually after Spring migrations. This study used predictor variables of annual and Spring snowmelt indices to evaluate caribou responses to human activities. Response variables included calf percentage and sighting rates of calving caribou along a high traffic road system from 1982 to 1990, and again from 2000 to 2002. Local calf percentages were considered. Caribou density was evaluated by aerial surveys. Results of the study showed no evidence of habituation to human activities over longer periods of time. An analysis of post hoc models showed a slight tolerance response. However, calving caribou were under-represented near the road system. The behavioural adaptability of calving caribou suggested that a no-hunt policy is appropriate. It was concluded that habitat selection and forage availability must also be considered when interpreting avoidance behaviour. 92 refs., 3 tabs., 3 figs.

  19. Development of expressed sequence tag and expressed sequence tag–simple sequence repeat marker resources for Musa acuminata

    Science.gov (United States)

    Passos, Marco A. N.; de Oliveira Cruz, Viviane; Emediato, Flavia L.; de Camargo Teixeira, Cristiane; Souza, Manoel T.; Matsumoto, Takashi; Rennó Azevedo, Vânia C.; Ferreira, Claudia F.; Amorim, Edson P.; de Alencar Figueiredo, Lucio Flavio; Martins, Natalia F.; de Jesus Barbosa Cavalcante, Maria; Baurens, Franc-Christophe; da Silva, Orzenil Bonfim; Pappas, Georgios J.; Pignolet, Luc; Abadie, Catherine; Ciampi, Ana Y.; Piffanelli, Pietro; Miller, Robert N. G.

    2012-01-01

    Background and aims Banana (Musa acuminata) is a crop contributing to global food security. Many varieties lack resistance to biotic stresses, due to sterility and narrow genetic background. The objective of this study was to develop an expressed sequence tag (EST) database of transcripts expressed during compatible and incompatible banana–Mycosphaerella fijiensis (Mf) interactions. Black leaf streak disease (BLSD), caused by Mf, is a destructive disease of banana. Microsatellite markers were developed as a resource for crop improvement. Methodology cDNA libraries were constructed from in vitro-infected leaves from BLSD-resistant M. acuminata ssp. burmaniccoides Calcutta 4 (MAC4) and susceptible M. acuminata cv. Cavendish Grande Naine (MACV). Clones were 5′-end Sanger sequenced, ESTs assembled with TGICL and unigenes annotated using BLAST, Blast2GO and InterProScan. Mreps was used to screen for simple sequence repeats (SSRs), with markers evaluated for polymorphism using 20 diploid (AA) M. acuminata accessions contrasting in resistance to Mycosphaerella leaf spot diseases. Principal results A total of 9333 high-quality ESTs were obtained for MAC4 and 3964 for MACV, which assembled into 3995 unigenes. Of these, 2592 displayed homology to genes encoding proteins with known or putative function, and 266 to genes encoding proteins with unknown function. Gene ontology (GO) classification identified 543 GO terms, 2300 unigenes were assigned to EuKaryotic orthologous group categories and 312 mapped to Kyoto Encyclopedia of Genes and Genomes pathways. A total of 624 SSR loci were identified, with trinucleotide repeat motifs the most abundant in MAC4 (54.1 %) and MACV (57.6 %). Polymorphism across M. acuminata accessions was observed with 75 markers. Alleles per polymorphic locus ranged from 2 to 8, totalling 289. The polymorphism information content ranged from 0.08 to 0.81. Conclusions This EST collection offers a resource for studying functional genes, including

  20. Development and characterization of microsatellite markers of the eastern keelback mullet (Liza affinis).

    Science.gov (United States)

    Liu, L; Gao, T X; Han, Z Q; Li, C H; Sun, D R; Song, N

    2016-06-17

    Twenty-four polymorphic microsatellite loci were isolated and characterized for Liza affinis using a (GT)13-enriched genomic library. The number of alleles per locus ranged from 3 to 9, with a mean number of 6.250. The observed and expected heterozygosities ranged from 0.417 to 1.000 and from 0.550 to 0.861, with an average of 0.859 and 0.779, respectively. Deviation from Hardy-Weinberg proportions was detected at three loci. Evidence of null alleles was found at two loci. These markers will be useful in further studies investigating the genetic variation and population structure of this species, and may provide insights into the maintenance and efficient management of eastern keelback mullet resources.

  1. Development of 35 novel microsatellite markers for the two-band anemonefish Amphiprion bicinctus

    KAUST Repository

    Nanninga, Gerrit B.

    2012-12-18

    To investigate population genetic patterns of the anemonefish Amphiprion bicinctus in the Red Sea, we isolated and characterized 35 microsatellite loci using 454-sequencing. Microsatellite sequences were identified using the Tandem Repeats Finder program. The 35 loci were tested on 80 individuals sampled from two spatially separated populations along the Saudi Arabian Red Sea coast. We found a mean of 10. 9 alleles per locus and observed levels of heterozygosity ranged from 0. 4 to 0. 98. All loci were polymorphic, none deviated significantly from Hardy-Weinberg equilibrium, no linkage disequilibrium was observed and there was no evidence for -alleles in both populations. The markers reported here constitute the first specific set for this species, and they are expected to contribute to future studies of connectivity in the Red Sea region. © 2012 Springer Science+Business Media Dordrecht.

  2. Assessment of Environmental and Hereditary Influence on Development of Pituitary Tumors Using Dermatoglyphic Traits and Their Potential as Screening Markers.

    Science.gov (United States)

    Gradiser, Marina; Matovinovic Osvatic, Martina; Dilber, Dario; Bilic-Curcic, Ines

    2016-03-17

    The aim of this study was to assess environmental and hereditary influence on development of pituitary tumors using dermatoglyphic traits. The study was performed on 126 patients of both genders with pituitary tumors (60 non-functional and 66 functional pituitary tumor patients) in comparison to the control group of 400 phenotypically healthy individuals. Statistical analysis of quantitative and qualitative traits of digito-palmar dermatoglyphics was performed, and hormonal status was determined according to the standard protocols. Although we did not find markers that could specifically distinguish functional from non-functional tumors, we have found markers predisposing to the development of tumors in general (a small number of ridges between triradius of both hands, a smaller number of ridges between the triradius of c-d rc R), those for endocrine dysfunction (increased number of arches and reduced number of whorls, difference of pattern distribution in the I3 and I4 interdigital space), and some that could potentially be attributed to patients suffering from pituitary tumors (small number of ridges for variables FRR 5, smaller number of ridges in the FRL 4 of both hands and difference of pattern distribution at thenar of I1 and I2 interdigital space). The usage of dermatoglyphic traits as markers of predisposition of pituitary tumor development could facilitate the earlier detection of patients in addition to standard methods, and possibly earlier treatment and higher survival rate. Finally, our results are consistent with the hypothesis about multifactorial nature of pituitary tumor etiology comprised of both gene instability and environmental factors.

  3. Development of rat tibia innervation: colocalization of autonomic nerve fiber markers with growth-associated protein 43.

    Science.gov (United States)

    Gajda, Mariusz; Litwin, Jan A; Tabarowski, Zbigniew; Zagólski, Olaf; Cichocki, Tadeusz; Timmermans, Jean-Pierre; Adriaensen, Dirk

    2010-01-01

    Development of autonomic innervation of the tibia was investigated in rat fetuses on gestational days (GD) 17-21 and in juvenile animals on postnatal days (PD) 1-28. Double immunofluorescence combined with confocal microscopy was applied to study colocalization of neuronal growth- associated protein 43 (GAP-43) and panneuronal marker protein gene product 9.5 (PGP) with markers of the autonomic nervous system: neuropeptide Y (NPY) and dopamine beta-hydroxylase (DbetaH) for adrenergic, as well as vasoactive intestinal polypeptide (VIP) and vesicular acetylcholine transporter (VAChT) for cholinergic fibers. The first GAP-43-immunoreactive (GAP-IR) nerve fibers were seen on GD17 in the perichondrium of the proximal epiphysis. Further GAP- and PGP-IR innervation appeared in the perichondrium/periosteum of the diaphysis and in the distal epiphysis (GD19), then in the bone marrow and in the intercondylar eminence (GD21). On PD1, NPY-IR and DbetaH-IR fibers appeared within the diaphyseal periosteum and on PD4 within the bone marrow. From PD14, GAP-43 immunoreactivity of NPY-positive fibers decreased. From PD7 on, NPY-IR fibers were observed in cartilage canals of both epiphyses and in the intercondylar eminence. In secondary ossification centers, NPY-IR fibers were seen from PD10, and in the bone marrow of the epiphyses from PD14. First VIP-IR and VAChT-IR fibers were observed on PD4 within the periosteum, bone marrow and patellar ligament. From PD10 on, VIP-positive fibers were seen in the intercondylar eminence, and from PD14 in secondary ossification centers. GAP-43 proved to be superior to PGP 9.5 as marker of growing nerve fibers, mostly due to its earlier appearance. The presence of specific nerve fibers may suggest possible involvement of autonomic innervation in regulation of bone development.

  4. Development of Transcriptomic Markers for Population Analysis Using Restriction Site Associated RNA Sequencing (RARseq.

    Directory of Open Access Journals (Sweden)

    Magdy S Alabady

    Full Text Available We describe restriction site associated RNA sequencing (RARseq, an RNAseq-based genotype by sequencing (GBS method. It includes the construction of RNAseq libraries from double stranded cDNA digested with selected restriction enzymes. To test this, we constructed six single- and six-dual-digested RARseq libraries from six F2 pitcher plant individuals and sequenced them on a half of a Miseq run. On average, the de novo approach of population genome analysis detected 544 and 570 RNA SNPs, whereas the reference transcriptome-based approach revealed an average of 1907 and 1876 RNA SNPs per individual, from single- and dual-digested RARseq data, respectively. The average numbers of RNA SNPs and alleles per loci are 1.89 and 2.17, respectively. Our results suggest that the RARseq protocol allows good depth of coverage per loci for detecting RNA SNPs and polymorphic loci for population genomics and mapping analyses. In non-model systems where complete genomes sequences are not always available, RARseq data can be analyzed in reference to the transcriptome. In addition to enriching for functional markers, this method may prove particularly useful in organisms where the genomes are not favorable for DNA GBS.

  5. Developing a set of ancestry-sensitive DNA markers reflecting continental origins of humans

    Directory of Open Access Journals (Sweden)

    den Dunnen Johan T

    2009-10-01

    Full Text Available Abstract Background The identification and use of Ancestry-Sensitive Markers (ASMs, i.e. genetic polymorphisms facilitating the genetic reconstruction of geographical origins of individuals, is far from straightforward. Results Here we describe the ascertainment and application of five different sets of 47 single nucleotide polymorphisms (SNPs allowing the inference of major human groups of different continental origin. For this, we first used 74 cell lines, representing human males from six different geographical areas and screened them with the Affymetrix Mapping 10K assay. In addition to using summary statistics estimating the genetic diversity among multiple groups of individuals defined by geography or language, we also used the program STRUCTURE to detect genetically distinct subgroups. Subsequently, we used a pairwise FST ranking procedure among all pairs of genetic subgroups in order to identify a single best performing set of ASMs. Our initial results were independently confirmed by genotyping this set of ASMs in 22 individuals from Somalia, Afghanistan and Sudan and in 919 samples from the CEPH Human Genome Diversity Panel (HGDP-CEPH Conclusion By means of our pairwise population FST ranking approach we identified a set of 47 SNPs that could serve as a panel of ASMs at a continental level.

  6. Development of SSR markers from ESTs of gramineous species and their chromosome location on wheat

    Institute of Scientific and Technical Information of China (English)

    Linzhi Li; Sishen Li; Junjun Wang; Ying Guo; Fangshan Jiang; Yunfeng Xu; Yingying Wang; Haitao Pan; Guanzhu Han; Ruijun Li

    2008-01-01

    A total of 407,663 expressed sequence tags (ESTs) of wheat,barley,maize,rice,and sorghum,obtained from GenBank/dbEST,were used to search for simple sequence repeats (SSRs).A total of 10,253 EST-SSRs,which accounted for 2.52% of all the ESTs,were iden-tiffed.Using Primer Premier 5.0,1367 EST-SSR primer pairs were designed,of which 715 with high quality were synthesized.The 715 primer pairs were tested on wheat,rice,maize,cotton,and soybean under the same PCR conditions,and the effective primer pairs in the five crops were 500 (69.93%),383 (53.57%),452 (63.22%),357 (49.93%),and 388 (56.27%),respectively.This indicated a high transfer-ability of EST-SSR markers between far-ranging species.In addition,139 EST-SSR primer pairs with 240 loci were localized on all the 21 wheat chromosomes by using Chinese Spring nulli-tetrasomic lines of wheat.

  7. Development of Selectable Marker-Free Transgenic Rice Plants with Enhanced Seed Tocopherol Content through FLP/FRT-Mediated Spontaneous Auto-Excision.

    Directory of Open Access Journals (Sweden)

    Hee-Jong Woo

    Full Text Available Development of marker-free transgenic plants is a technical alternative for avoiding concerns about the safety of selectable marker genes used in genetically modified (GM crops. Here, we describe the construction of a spontaneous self-excision binary vector using an oxidative stress-inducible modified FLP/FRT system and its successful application to produce marker-free transgenic rice plants with enhanced seed tocopherol content. To generate selectable marker-free transgenic rice plants, we constructed a binary vector using the hpt selectable marker gene and the rice codon-optimized FLP (mFLP gene under the control of an oxidative stress-inducible promoter between two FRT sites, along with multiple cloning sites for convenient cloning of genes of interest. Using this pCMF binary vector with the NtTC gene, marker-free T1 transgenic rice plants expressing NtTC were produced by Agrobacterium-mediated stable transformation using hygromycin as a selective agent, followed by segregation of selectable marker genes. Furthermore, α-, γ-, and total tocopherol levels were significantly increased in seeds of the marker-free transgenic TC line compared with those of wild-type plants. Thus, this spontaneous auto-excision system, incorporating an oxidative stress-inducible mFLP/FRT system to eliminate the selectable marker gene, can be easily adopted and used to efficiently generate marker-free transgenic rice plants. Moreover, nutritional enhancement of rice seeds through elevation of tocopherol content coupled with this marker-free strategy may improve human health and public acceptance of GM rice.

  8. Development of a Simple and Efficient System for Excising Selectable Markers in Arabidopsis Using a Minimal Promoter::Cre Fusion Construct

    OpenAIRE

    2011-01-01

    The development of rapid and efficient strategies to generate selectable marker-free transgenic plants could help increase the consumer acceptance of genetically modified (GM) plants. To produce marker-free transgenic plants without conditional treatment or the genetic crossing of offspring, we have developed a rapid and convenient DNA excision method mediated by the Cre/loxP recombination system under the control of a -46 minimal CaMV 35S promoter. The results of a transient expression assay...

  9. Using combinatorial bioinformatics methods to analyze annual perspective changes of influenza viruses and to accelerate development of effective vaccines

    Directory of Open Access Journals (Sweden)

    Yu-Jen Hu

    2015-08-01

    Full Text Available The standard World Health Organization procedure for vaccine development has provided a guideline for influenza viruses, but no systematic operational model. We recently designed a systemic analysis method to evaluate annual perspective sequence changes of influenza virus strains. We applied dnaml of PHYLIP 3.69, developed by Joseph Felsenstein of Washington University, and ClustalX2, developed by Larkin et al, for calculating, comparing, and localizing the most plausible vaccine epitopes. This study identified the changes in biological sequences and associated alignment alterations, which would ultimately affect epitope structures, as well as the plausible hidden features to search for the most conserved and effective epitopes for vaccine development. Addition our newly designed systemic analysis method to supplement the WHO guidelines could accelerate the development of urgently needed vaccines that might concurrently combat several strains of viruses within a shorter period.

  10. Development of β-carotene rich maize hybrids through marker-assisted introgression of β-carotene hydroxylase allele.

    Directory of Open Access Journals (Sweden)

    Vignesh Muthusamy

    Full Text Available Development of vitamin A-rich cereals can help in alleviating the widespread problem of vitamin A deficiency. We report here significant enhancement of kernel β-carotene in elite maize genotypes through accelerated marker-assisted backcross breeding. A favourable allele (543 bp of the β-carotene hydroxylase (crtRB1 gene was introgressed in the seven elite inbred parents, which were low (1.4 µg/g in kernel β-carotene, by using a crtRB1-specific DNA marker for foreground selection. About 90% of the recurrent parent genome was recovered in the selected progenies within two backcross generations. Concentration of β-carotene among the crtRB1-introgressed inbreds varied from 8.6 to 17.5 µg/g - a maximum increase up to 12.6-fold over recurrent parent. The reconstituted hybrids developed from improved parental inbreds also showed enhanced kernel β-carotene as high as 21.7 µg/g, compared to 2.6 µg/g in the original hybrid. The reconstituted hybrids evaluated at two locations possessed similar grain yield to that of original hybrids. These β-carotene enriched high yielding hybrids can be effectively utilized in the maize biofortification programs across the globe.

  11. A fast and cost-effective approach to develop and map EST-SSR markers: oak as a case study

    Directory of Open Access Journals (Sweden)

    Cherubini Marcello

    2010-10-01

    Full Text Available Abstract Background Expressed Sequence Tags (ESTs are a source of simple sequence repeats (SSRs that can be used to develop molecular markers for genetic studies. The availability of ESTs for Quercus robur and Quercus petraea provided a unique opportunity to develop microsatellite markers to accelerate research aimed at studying adaptation of these long-lived species to their environment. As a first step toward the construction of a SSR-based linkage map of oak for quantitative trait locus (QTL mapping, we describe the mining and survey of EST-SSRs as well as a fast and cost-effective approach (bin mapping to assign these markers to an approximate map position. We also compared the level of polymorphism between genomic and EST-derived SSRs and address the transferability of EST-SSRs in Castanea sativa (chestnut. Results A catalogue of 103,000 Sanger ESTs was assembled into 28,024 unigenes from which 18.6% presented one or more SSR motifs. More than 42% of these SSRs corresponded to trinucleotides. Primer pairs were designed for 748 putative unigenes. Overall 37.7% (283 were found to amplify a single polymorphic locus in a reference full-sib pedigree of Quercus robur. The usefulness of these loci for establishing a genetic map was assessed using a bin mapping approach. Bin maps were constructed for the male and female parental tree for which framework linkage maps based on AFLP markers were available. The bin set consisting of 14 highly informative offspring selected based on the number and position of crossover sites. The female and male maps comprised 44 and 37 bins, with an average bin length of 16.5 cM and 20.99 cM, respectively. A total of 256 EST-SSRs were assigned to bins and their map position was further validated by linkage mapping. EST-SSRs were found to be less polymorphic than genomic SSRs, but their transferability rate to chestnut, a phylogenetically related species to oak, was higher. Conclusion We have generated a bin map for oak

  12. Diversity analysis in Cannabis sativa based on large-scale development of expressed sequence tag-derived simple sequence repeat markers.

    Science.gov (United States)

    Gao, Chunsheng; Xin, Pengfei; Cheng, Chaohua; Tang, Qing; Chen, Ping; Wang, Changbiao; Zang, Gonggu; Zhao, Lining

    2014-01-01

    Cannabis sativa L. is an important economic plant for the production of food, fiber, oils, and intoxicants. However, lack of sufficient simple sequence repeat (SSR) markers has limited the development of cannabis genetic research. Here, large-scale development of expressed sequence tag simple sequence repeat (EST-SSR) markers was performed to obtain more informative genetic markers, and to assess genetic diversity in cannabis (Cannabis sativa L.). Based on the cannabis transcriptome, 4,577 SSRs were identified from 3,624 ESTs. From there, a total of 3,442 complementary primer pairs were designed as SSR markers. Among these markers, trinucleotide repeat motifs (50.99%) were the most abundant, followed by hexanucleotide (25.13%), dinucleotide (16.34%), tetranucloetide (3.8%), and pentanucleotide (3.74%) repeat motifs, respectively. The AAG/CTT trinucleotide repeat (17.96%) was the most abundant motif detected in the SSRs. One hundred and seventeen EST-SSR markers were randomly selected to evaluate primer quality in 24 cannabis varieties. Among these 117 markers, 108 (92.31%) were successfully amplified and 87 (74.36%) were polymorphic. Forty-five polymorphic primer pairs were selected to evaluate genetic diversity and relatedness among the 115 cannabis genotypes. The results showed that 115 varieties could be divided into 4 groups primarily based on geography: Northern China, Europe, Central China, and Southern China. Moreover, the coefficient of similarity when comparing cannabis from Northern China with the European group cannabis was higher than that when comparing with cannabis from the other two groups, owing to a similar climate. This study outlines the first large-scale development of SSR markers for cannabis. These data may serve as a foundation for the development of genetic linkage, quantitative trait loci mapping, and marker-assisted breeding of cannabis.

  13. Diversity analysis in Cannabis sativa based on large-scale development of expressed sequence tag-derived simple sequence repeat markers.

    Directory of Open Access Journals (Sweden)

    Chunsheng Gao

    Full Text Available Cannabis sativa L. is an important economic plant for the production of food, fiber, oils, and intoxicants. However, lack of sufficient simple sequence repeat (SSR markers has limited the development of cannabis genetic research. Here, large-scale development of expressed sequence tag simple sequence repeat (EST-SSR markers was performed to obtain more informative genetic markers, and to assess genetic diversity in cannabis (Cannabis sativa L.. Based on the cannabis transcriptome, 4,577 SSRs were identified from 3,624 ESTs. From there, a total of 3,442 complementary primer pairs were designed as SSR markers. Among these markers, trinucleotide repeat motifs (50.99% were the most abundant, followed by hexanucleotide (25.13%, dinucleotide (16.34%, tetranucloetide (3.8%, and pentanucleotide (3.74% repeat motifs, respectively. The AAG/CTT trinucleotide repeat (17.96% was the most abundant motif detected in the SSRs. One hundred and seventeen EST-SSR markers were randomly selected to evaluate primer quality in 24 cannabis varieties. Among these 117 markers, 108 (92.31% were successfully amplified and 87 (74.36% were polymorphic. Forty-five polymorphic primer pairs were selected to evaluate genetic diversity and relatedness among the 115 cannabis genotypes. The results showed that 115 varieties could be divided into 4 groups primarily based on geography: Northern China, Europe, Central China, and Southern China. Moreover, the coefficient of similarity when comparing cannabis from Northern China with the European group cannabis was higher than that when comparing with cannabis from the other two groups, owing to a similar climate. This study outlines the first large-scale development of SSR markers for cannabis. These data may serve as a foundation for the development of genetic linkage, quantitative trait loci mapping, and marker-assisted breeding of cannabis.

  14. Marker chromosomes.

    Science.gov (United States)

    Rao, Kiran Prabhaker; Belogolovkin, Victoria

    2013-04-01

    Marker chromosomes are a morphologically heterogeneous group of structurally abnormal chromosomes that pose a significant challenge in prenatal diagnosis. Phenotypes associated with marker chromosomes are highly variable and range from normal to severely abnormal. Clinical outcomes are very difficult to predict when marker chromosomes are detected prenatally. In this review, we outline the classification, etiology, cytogenetic characterization, and clinical consequences of marker chromosomes, as well as practical approaches to prenatal diagnosis and genetic counseling.

  15. The first set of EST resource for gene discovery and marker development in pigeonpea (Cajanus cajan L.

    Directory of Open Access Journals (Sweden)

    Byregowda Munishamappa

    2010-03-01

    Full Text Available Abstract Background Pigeonpea (Cajanus cajan (L. Millsp is one of the major grain legume crops of the tropics and subtropics, but biotic stresses [Fusarium wilt (FW, sterility mosaic disease (SMD, etc.] are serious challenges for sustainable crop production. Modern genomic tools such as molecular markers and candidate genes associated with resistance to these stresses offer the possibility of facilitating pigeonpea breeding for improving biotic stress resistance. Availability of limited genomic resources, however, is a serious bottleneck to undertake molecular breeding in pigeonpea to develop superior genotypes with enhanced resistance to above mentioned biotic stresses. With an objective of enhancing genomic resources in pigeonpea, this study reports generation and analysis of comprehensive resource of FW- and SMD- responsive expressed sequence tags (ESTs. Results A total of 16 cDNA libraries were constructed from four pigeonpea genotypes that are resistant and susceptible to FW ('ICPL 20102' and 'ICP 2376' and SMD ('ICP 7035' and 'TTB 7' and a total of 9,888 (9,468 high quality ESTs were generated and deposited in dbEST of GenBank under accession numbers GR463974 to GR473857 and GR958228 to GR958231. Clustering and assembly analyses of these ESTs resulted into 4,557 unique sequences (unigenes including 697 contigs and 3,860 singletons. BLASTN analysis of 4,557 unigenes showed a significant identity with ESTs of different legumes (23.2-60.3%, rice (28.3%, Arabidopsis (33.7% and poplar (35.4%. As expected, pigeonpea ESTs are more closely related to soybean (60.3% and cowpea ESTs (43.6% than other plant ESTs. Similarly, BLASTX similarity results showed that only 1,603 (35.1% out of 4,557 total unigenes correspond to known proteins in the UniProt database (≤ 1E-08. Functional categorization of the annotated unigenes sequences showed that 153 (3.3% genes were assigned to cellular component category, 132 (2.8% to biological process, and 132 (2

  16. Development of SSR Markers in Hickory (Carya cathayensis Sarg.) and Their Transferability to Other Species of Carya.

    Science.gov (United States)

    Li, Juan; Zeng, Yanru; Shen, Dengfeng; Xia, Guohua; Huang, Yinzhi; Huang, Youjun; Chang, Jun; Huang, Jianqin; Wang, Zhengjia

    2014-10-01

    Hickory (Carya cathayensis Sarg.), an important nut-producing species in Southeastern China, has high economic value, but so far there has been no cultivar bred under species although it is mostly propagated by seeding and some elite individuals have been found. It has been found recently that this species has a certain rate of apomixis and poor knowledge of its genetic background has influenced development of a feasible breeding strategy. Here in this paper we first release SSR (Simple sequence repeat) markers developed in this species and their transferability to other three species of the same genus, Carya. A total of 311 pairs of SSR primers in hickory were developed based on sequenced cDNAs of a fruit development-associated cDNA library and RNA-seq data of developing female floral buds and could be used to distinguish hickory, C. hunanensis Cheng et R. H. Chang ex R. H. Chang et Lu, C. illinoensis K. Koch (pecan) and C. dabieshanensis M. C. Liu et Z. J. Li, but they were monomorphic in both hickory and C. hunanensis although multi-alleles have been identified in all the four species. There is a transferability rate of 63.02% observed between hickory and pecan and the markers can be applied to study genetic diversity of accessions in pecan. When used in C. dabieshanensis, it was revealed that C. dabieshanensis had the number of alleles per locus ranging from 2 to 4, observed heterozygosity from 0 to 0.6667 and expected heterozygosity from 0.333 to 0.8667, respectively, which supports the existence of C. dabieshanensis as a separate species different from hickory and indicates that there is potential for selection and breeding in this species.

  17. Development of Dietary Patterns Spanning Infancy and Toddlerhood: Relation to Body Size, Composition and Metabolic Risk Markers at Three Years

    Directory of Open Access Journals (Sweden)

    Louise BB Andersen

    2015-07-01

    Full Text Available Little is known about the development of dietary patterns during toddlerhood and the relation to growth and health. The study objective was to characterise the development of dietary patterns from 9-36 mo of age and investigate the association to body size, body composition and metabolic risk markers at 36 mo. Food records were filled out at 9, 18 and 36 mo of age (n = 229. Dietary patterns were identified by principal component analysis (PCA. Three dietary patterns were identified: Transition Food, Healthy Food and Traditional Food. The course of development in dietary patterns from 9-36 mo indicated tracking for a relatively large group of participants in the three patterns. Transition Food and Healthy Food were associated with some of the investigated outcomes. Children with lower adherence to the Transition Food pattern than average at 18 and 36 mo irrespectively of intake at 9 mo had higher BMI z-scores at 36 mo. Similar trend was identified for higher fat mass indices. Children with lower adherence to the Healthy Food pattern than average at all three ages compared to children with higher adherence to the Healthy Food pattern at the first two registrations, 9 and 18 mo had higher total cholesterol and LDL. Hence, this could represent undesirable development of dietary patterns in toddlers. In conclusion, development of dietary patterns can be exploratory characterised by PCA and related to potential cardiovascular risk markers in toddlers even within a relatively homogeneous population with a high socioeconomic status. The tracking of dietary patterns from 9 mo of age indicates a need for early and sustained promotion of healthy diets.

  18. Survey and analysis of simple sequence repeats in the Laccaria bicolor genome, with development of microsatellite markers

    Energy Technology Data Exchange (ETDEWEB)

    Labbe, Jessy L [ORNL; Murat, Claude [INRA, Nancy, France; Morin, Emmanuelle [INRA, Nancy, France; Le Tacon, F [UMR, France; Martin, Francis [INRA, Nancy, France

    2011-01-01

    It is becoming clear that simple sequence repeats (SSRs) play a significant role in fungal genome organization, and they are a large source of genetic markers for population genetics and meiotic maps. We identified SSRs in the Laccaria bicolor genome by in silico survey and analyzed their distribution in the different genomic regions. We also compared the abundance and distribution of SSRs in L. bicolor with those of the following fungal genomes: Phanerochaete chrysosporium, Coprinopsis cinerea, Ustilago maydis, Cryptococcus neoformans, Aspergillus nidulans, Magnaporthe grisea, Neurospora crassa and Saccharomyces cerevisiae. Using the MISA computer program, we detected 277,062 SSRs in the L. bicolor genome representing 8% of the assembled genomic sequence. Among the analyzed basidiomycetes, L. bicolor exhibited the highest SSR density although no correlation between relative abundance and the genome sizes was observed. In most genomes the short motifs (mono- to trinucleotides) were more abundant than the longer repeated SSRs. Generally, in each organism, the occurrence, relative abundance, and relative density of SSRs decreased as the repeat unit increased. Furthermore, each organism had its own common and longest SSRs. In the L. bicolor genome, most of the SSRs were located in intergenic regions (73.3%) and the highest SSR density was observed in transposable elements (TEs; 6,706 SSRs/Mb). However, 81% of the protein-coding genes contained SSRs in their exons, suggesting that SSR polymorphism may alter gene phenotypes. Within a L. bicolor offspring, sequence polymorphism of 78 SSRs was mainly detected in non-TE intergenic regions. Unlike previously developed microsatellite markers, these new ones are spread throughout the genome; these markers could have immediate applications in population genetics.

  19. Characterization of guinea pig antibody responses to salivary proteins of Triatoma infestans for the development of a triatomine exposure marker.

    Directory of Open Access Journals (Sweden)

    Veronika Dorňáková

    2014-04-01

    Full Text Available BACKGROUND: Salivary proteins of Triatoma infestans elicit humoral immune responses in their vertebrate hosts. These immune responses indicate exposure to triatomines and thus can be a useful epidemiological tool to estimate triatomine infestation. In the present study, we analyzed antibody responses of guinea pigs to salivary antigens of different developmental stages of four T. infestans strains originating from domestic and/or peridomestic habitats in Argentina, Bolivia, Chile and Peru. We aimed to identify developmental stage- and strain-specific salivary antigens as potential markers of T. infestans exposure. METHODOLOGY AND PRINCIPAL FINDINGS: In SDS-PAGE analysis of salivary proteins of T. infestans the banding pattern differed between developmental stages and strains of triatomines. Phenograms constructed from the salivary profiles separated nymphal instars, especially the 5th instar, from adults. To analyze the influence of stage- and strain-specific differences in T. infestans saliva on the antibody response of guinea pigs, twenty-one guinea pigs were exposed to 5th instar nymphs and/or adults of different T. infestans strains. Western blot analyses using sera of exposed guinea pigs revealed stage- and strain-specific variations in the humoral response of animals. In total, 27 and 17 different salivary proteins reacted with guinea pig sera using IgG and IgM antibodies, respectively. Despite all variations of recognized salivary antigens, an antigen of 35 kDa reacted with sera of almost all challenged guinea pigs. CONCLUSION: Salivary antigens are increasingly considered as an epidemiological tool to measure exposure to hematophagous arthropods, but developmental stage- and strain-specific variations in the saliva composition and the respective differences of immunogenicity are often neglected. Thus, the development of a triatomine exposure marker for surveillance studies after triatomine control campaigns requires detailed

  20. De novo transcriptomic analysis and development of EST-SSR markers in the Siberian tiger (Panthera tigris altaica).

    Science.gov (United States)

    Lu, Taofeng; Sun, Yujiao; Ma, Qin; Zhu, Minghao; Liu, Dan; Ma, Jianzhang; Ma, Yuehui; Chen, Hongyan; Guan, Weijun

    2016-12-01

    The Siberian tiger, Panthera tigris altaica, is an endangered species, and much more work is needed to protect this species, which is still vulnerable to extinction. Conservation efforts may be supported by the genetic assessment of wild populations, for which highly specific microsatellite markers are required. However, only a limited amount of genetic sequence data is available for this species. To identify the genes involved in the lung transcriptome and to develop additional simple sequence repeat (SSR) markers for the Siberian tiger, we used high-throughput RNA-Seq to characterize the Siberian tiger transcriptome in lung tissue (designated 'PTA-lung') and a pooled tissue sample (designated 'PTA'). Approximately 47.5 % (33,187/69,836) of the lung transcriptome was annotated in four public databases (Nr, Swiss-Prot, KEGG, and COG). The annotated genes formed a potential pool for gene identification in the tiger. An analysis of the genes differentially expressed in the PTA lung, and PTA samples revealed that the tiger may have suffered a series of diseases before death. In total, 1062 non-redundant SSRs were identified in the Siberian tiger transcriptome. Forty-three primer pairs were randomly selected for amplification reactions, and 26 of the 43 pairs were also used to evaluate the levels of genetic polymorphism. Fourteen primer pairs (32.56 %) amplified products that were polymorphic in size in P. tigris altaica. In conclusion, the transcriptome sequences will provide a valuable genomic resource for genetic research, and these new SSR markers comprise a reasonable number of loci for the genetic analysis of wild and captive populations of P. tigris altaica.

  1. First Microsatellite Markers Developed from Cupuassu ESTs: Application in Diversity Analysis and Cross-Species Transferability to Cacao.

    Science.gov (United States)

    Ferraz Dos Santos, Lucas; Moreira Fregapani, Roberta; Falcão, Loeni Ludke; Togawa, Roberto Coiti; Costa, Marcos Mota do Carmo; Lopes, Uilson Vanderlei; Peres Gramacho, Karina; Alves, Rafael Moyses; Micheli, Fabienne; Marcellino, Lucilia Helena

    2016-01-01

    The cupuassu tree (Theobroma grandiflorum) (Willd. ex Spreng.) Schum. is a fruitful species from the Amazon with great economical potential, due to the multiple uses of its fruit´s pulp and seeds in the food and cosmetic industries, including the production of cupulate, an alternative to chocolate. In order to support the cupuassu breeding program and to select plants presenting both pulp/seed quality and fungal disease resistance, SSRs from Next Generation Sequencing ESTs were obtained and used in diversity analysis. From 8,330 ESTs, 1,517 contained one or more SSRs (1,899 SSRs identified). The most abundant motifs identified in the EST-SSRs were hepta- and trinucleotides, and they were found with a minimum and maximum of 2 and 19 repeats, respectively. From the 1,517 ESTs containing SSRs, 70 ESTs were selected based on their functional annotation, focusing on pulp and seed quality, as well as resistance to pathogens. The 70 ESTs selected contained 77 SSRs, and among which, 11 were polymorphic in cupuassu genotypes. These EST-SSRs were able to discriminate the cupuassu genotype in relation to resistance/susceptibility to witches' broom disease, as well as to pulp quality (SST/ATT values). Finally, we showed that these markers were transferable to cacao genotypes, and that genome availability might be used as a predictive tool for polymorphism detection and primer design useful for both Theobroma species. To our knowledge, this is the first report involving EST-SSRs from cupuassu and is also a pioneer in the analysis of marker transferability from cupuassu to cacao. Moreover, these markers might contribute to develop or saturate the cupuassu and cacao genetic maps, respectively.

  2. First Microsatellite Markers Developed from Cupuassu ESTs: Application in Diversity Analysis and Cross-Species Transferability to Cacao.

    Directory of Open Access Journals (Sweden)

    Lucas Ferraz Dos Santos

    Full Text Available The cupuassu tree (Theobroma grandiflorum (Willd. ex Spreng. Schum. is a fruitful species from the Amazon with great economical potential, due to the multiple uses of its fruit´s pulp and seeds in the food and cosmetic industries, including the production of cupulate, an alternative to chocolate. In order to support the cupuassu breeding program and to select plants presenting both pulp/seed quality and fungal disease resistance, SSRs from Next Generation Sequencing ESTs were obtained and used in diversity analysis. From 8,330 ESTs, 1,517 contained one or more SSRs (1,899 SSRs identified. The most abundant motifs identified in the EST-SSRs were hepta- and trinucleotides, and they were found with a minimum and maximum of 2 and 19 repeats, respectively. From the 1,517 ESTs containing SSRs, 70 ESTs were selected based on their functional annotation, focusing on pulp and seed quality, as well as resistance to pathogens. The 70 ESTs selected contained 77 SSRs, and among which, 11 were polymorphic in cupuassu genotypes. These EST-SSRs were able to discriminate the cupuassu genotype in relation to resistance/susceptibility to witches' broom disease, as well as to pulp quality (SST/ATT values. Finally, we showed that these markers were transferable to cacao genotypes, and that genome availability might be used as a predictive tool for polymorphism detection and primer design useful for both Theobroma species. To our knowledge, this is the first report involving EST-SSRs from cupuassu and is also a pioneer in the analysis of marker transferability from cupuassu to cacao. Moreover, these markers might contribute to develop or saturate the cupuassu and cacao genetic maps, respectively.

  3. Characterization of Guinea Pig Antibody Responses to Salivary Proteins of Triatoma infestans for the Development of a Triatomine Exposure Marker

    Science.gov (United States)

    Dorňáková, Veronika; Salazar-Sanchez, Renzo; Borrini-Mayori, Katty; Carrion-Navarro, Oscar; Levy, Michael Z.; Schaub, Günter A.; Schwarz, Alexandra

    2014-01-01

    Background Salivary proteins of Triatoma infestans elicit humoral immune responses in their vertebrate hosts. These immune responses indicate exposure to triatomines and thus can be a useful epidemiological tool to estimate triatomine infestation. In the present study, we analyzed antibody responses of guinea pigs to salivary antigens of different developmental stages of four T. infestans strains originating from domestic and/or peridomestic habitats in Argentina, Bolivia, Chile and Peru. We aimed to identify developmental stage- and strain-specific salivary antigens as potential markers of T. infestans exposure. Methodology and Principal Findings In SDS-PAGE analysis of salivary proteins of T. infestans the banding pattern differed between developmental stages and strains of triatomines. Phenograms constructed from the salivary profiles separated nymphal instars, especially the 5th instar, from adults. To analyze the influence of stage- and strain-specific differences in T. infestans saliva on the antibody response of guinea pigs, twenty-one guinea pigs were exposed to 5th instar nymphs and/or adults of different T. infestans strains. Western blot analyses using sera of exposed guinea pigs revealed stage- and strain-specific variations in the humoral response of animals. In total, 27 and 17 different salivary proteins reacted with guinea pig sera using IgG and IgM antibodies, respectively. Despite all variations of recognized salivary antigens, an antigen of 35 kDa reacted with sera of almost all challenged guinea pigs. Conclusion Salivary antigens are increasingly considered as an epidemiological tool to measure exposure to hematophagous arthropods, but developmental stage- and strain-specific variations in the saliva composition and the respective differences of immunogenicity are often neglected. Thus, the development of a triatomine exposure marker for surveillance studies after triatomine control campaigns requires detailed investigations. Our study resulted

  4. Development, genetic mapping and QTL association of cotton PHYA, PHYB, and HY5-specific CAPS and dCAPS markers

    Science.gov (United States)

    Among SNP markers that become increasingly valuable in molecular breeding of crop plants are the CAP and dCAP markers derived from the genes of interest. To date, the number of such gene-based markers is small in polyploid crop plants such as tetraploid cotton that has A and D subgenomes. The obje...

  5. Annual Proceedings of Selected Research and Development Papers Presented at the Annual Convention of the Association for Educational Communications and Technology (36th, Anaheim, California, 2013). Volume 1

    Science.gov (United States)

    Simonson, Michael, Ed.

    2013-01-01

    For the thirty-sixth year, the Research and Theory Division of the Association for Educational Communications and Technology (AECT) is sponsoring the publication of these Proceedings. Papers published in this volume were presented at the annual AECT Convention in Anaheim, California. The Proceedings of AECT's Convention are published in two…

  6. Annual Proceedings of Selected Research and Development Papers Presented at the Annual Convention of the Association for Educational Communications and Technology (38th, Indianapolis, Indiana, 2015). Volume 1

    Science.gov (United States)

    Simonson, Michael, Ed.

    2015-01-01

    For the thirty-eighth time, the Research and Theory Division of the Association for Educational Communications and Technology (AECT) is sponsoring the publication of these Proceedings. Papers published in this volume were presented at the annual AECT Convention in Indianapolis, Indiana. The Proceedings of AECT's Convention are published in two…

  7. Annual Proceedings of Selected Research and Development Papers Presented at the Annual Convention of the Association for Educational Communications and Technology (37th, Jacksonville, Florida, 2014). Volume 1

    Science.gov (United States)

    Simonson, Michael, Ed.

    2014-01-01

    For the thirty-seventh year, the Research and Theory Division and the Division of Instructional Design of the Association for Educational Communications and Technology (AECT) sponsored the publication of these Proceedings. Papers published in this volume were presented at the annual AECT Convention in Jacksonville, Florida. This year's Proceedings…

  8. Annual Proceedings of Selected Research and Development Papers Presented at the Annual Convention of the Association for Educational Communications and Technology (36th, Anaheim, California, 2013). Volume 2

    Science.gov (United States)

    Simonson, Michael, Ed.

    2013-01-01

    For the thirty-sixth year, the Research and Theory Division of the Association for Educational Communications and Technology (AECT) is sponsoring the publication of these Proceedings. Papers published in this volume were presented at the annual AECT Convention in Anaheim, California. The Proceedings of AECT's Convention are published in two…

  9. Development and Initial Validation of Brief Public Domain RIASEC Marker Scales

    Science.gov (United States)

    Armstrong, Patrick Ian; Allison, Wyndolyn; Rounds, James

    2008-01-01

    Although commercially developed interest measures based on Holland's RIASEC types are effectively used in a variety of applied settings, these measures have somewhat limited research utility due to their length and copyright restrictions placed by the test publishers. In the present study, two sets of 8-item RIASEC scales were developed using…

  10. Molecular marker databases.

    Science.gov (United States)

    Lai, Kaitao; Lorenc, Michał Tadeusz; Edwards, David

    2015-01-01

    The detection and analysis of genetic variation plays an important role in plant breeding and this role is increasing with the continued development of genome sequencing technologies. Molecular genetic markers are important tools to characterize genetic variation and assist with genomic breeding. Processing and storing the growing abundance of molecular marker data being produced requires the development of specific bioinformatics tools and advanced databases. Molecular marker databases range from species specific through to organism wide and often host a variety of additional related genetic, genomic, or phenotypic information. In this chapter, we will present some of the features of plant molecular genetic marker databases, highlight the various types of marker resources, and predict the potential future direction of crop marker databases.

  11. Institutional Oversight of the Graduate Medical Education Enterprise: Development of an Annual Institutional Review

    Science.gov (United States)

    Amedee, Ronald G.; Piazza, Janice C.

    2016-01-01

    Background: The Accreditation Council for Graduate Medical Education (ACGME) fully implemented all aspects of the Next Accreditation System (NAS) on July 1, 2014. In lieu of periodic accreditation site visits of programs and institutions, the NAS requires active, ongoing oversight by the sponsoring institutions (SIs) to maintain accreditation readiness and program quality. Methods: The Ochsner Health System Graduate Medical Education Committee (GMEC) has instituted a process that provides a structured, process-driven improvement approach at the program level, using a Program Evaluation Committee to review key performance data and construct an annual program evaluation for each accredited residency. The Ochsner GMEC evaluates the aggregate program data and creates an Annual Institutional Review (AIR) document that provides direction and focus for ongoing program improvement. This descriptive article reviews the 2014 process and various metrics collected and analyzed to demonstrate the program review and institutional oversight provided by the Ochsner graduate medical education (GME) enterprise. Results: The 2014 AIR provided an overview of performance and quality of the Ochsner GME program for the 2013-2014 academic year with particular attention to program outcomes; resident supervision, responsibilities, evaluation, and compliance with duty‐hour standards; results of the ACGME survey of residents and core faculty; and resident participation in patient safety and quality activities and curriculum. The GMEC identified other relevant institutional performance indicators that are incorporated into the AIR and reflect SI engagement in and contribution to program performance at the individual program and institutional levels. Conclusion: The Ochsner GME office and its program directors are faced with the ever-increasing challenges of today's healthcare environment as well as escalating institutional and program accreditation requirements. The overall commitment of

  12. Development of Gene-Based SSR Markers in Winged Bean (Psophocarpus tetragonolobus (L.) DC.) for Diversity Assessment

    Science.gov (United States)

    Wong, Quin Nee; Tanzi, Alberto Stefano; Ho, Wai Kuan; Malla, Sunir; Blythe, Martin; Karunaratne, Asha; Massawe, Festo; Mayes, Sean

    2017-01-01

    Winged bean (Psophocarpus tetragonolobus) is an herbaceous multipurpose legume grown in hot and humid countries as a pulse, vegetable (leaves and pods), or root tuber crop depending on local consumption preferences. In addition to its different nutrient-rich edible parts which could contribute to food and nutritional security, it is an efficient nitrogen fixer as a component of sustainable agricultural systems. Generating genetic resources and improved lines would help to accelerate the breeding improvement of this crop, as the lack of improved cultivars adapted to specific environments has been one of the limitations preventing wider use. A transcriptomic de novo assembly was constructed from four tissues: leaf, root, pod, and reproductive tissues from Malaysian accessions, comprising of 198,554 contigs with a N50 of 1462 bp. Of these, 138,958 (70.0%) could be annotated. Among 9682 genic simple sequence repeat (SSR) motifs identified (excluding monomer repeats), trinucleotide-repeats were the most abundant (4855), followed by di-nucleotide (4500) repeats. A total of 18 SSR markers targeting di- and tri-nucleotide repeats have been validated as polymorphic markers based on an initial assessment of nine genotypes originated from five countries. A cluster analysis revealed provisional clusters among this limited, yet diverse selection of germplasm. The developed assembly and validated genic SSRs in this study provide a foundation for a better understanding of the plant breeding system for the genetic improvement of winged bean. PMID:28282950

  13. t-10, c-12 CLA dietary supplementation inhibits atherosclerotic lesion development despite adverse cardiovascular and hepatic metabolic marker profiles.

    Science.gov (United States)

    Mitchell, Patricia L; Karakach, Tobias K; Currie, Deborah L; McLeod, Roger S

    2012-01-01

    Animal and human studies have indicated that fatty acids such as the conjugated linoleic acids (CLA) found in milk could potentially alter the risk of developing metabolic disorders including diabetes and cardiovascular disease (CVD). Using susceptible rodent models (apoE(-/-) and LDLr(-/-) mice) we investigated the interrelationship between mouse strain, dietary conjugated linoleic acids and metabolic markers of CVD. Despite an adverse metabolic risk profile, atherosclerosis (measured directly by lesion area), was significantly reduced with t-10, c-12 CLA and mixed isomer CLA (Mix) supplementation in both apoE(-/-) (pCLA supplemented animals having distinct patterns, suggestive of hepatic insulin resistance, regardless of mouse strain. The effect of CLA supplementation on hepatic lipid and fatty acid composition was explored in the LDLr(-/-) strain. Dietary supplementation with t-10, c-12 CLA significantly increased liver weight (pCLA also increased the ratio of 18∶1 to 18∶0 fatty acid in the liver suggesting an increase in the activity of stearoyl-CoA desaturase. Changes in plasma adiponectin and liver weight with t-10, c-12 CLA supplementation were evident within 3 weeks of initiation of the diet. These observations provide evidence that the individual CLA isomers have divergent mechanisms of action and that t-10, c-12 CLA rapidly changes plasma and liver markers of metabolic syndrome, despite evidence of reduction in atherosclerosis.

  14. Development of COS-SNP and HRM markers for high-throughput and reliable haplotype-based detection of Lr14a in durum wheat (Triticum durum Desf.).

    Science.gov (United States)

    Terracciano, Irma; Maccaferri, Marco; Bassi, Filippo; Mantovani, Paola; Sanguineti, Maria C; Salvi, Silvio; Simková, Hana; Doležel, Jaroslav; Massi, Andrea; Ammar, Karim; Kolmer, James; Tuberosa, Roberto

    2013-04-01

    Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a-resistant gene present in the durum wheat cv. Creso and its derivative cv. Colosseo is one of the best characterized leaf-rust resistance sources deployed in durum wheat breeding. Lr14a has been mapped close to the simple sequence repeat markers gwm146, gwm344 and wmc10 in the distal portion of the chromosome arm 7BL, a gene-dense region. The objectives of this study were: (1) to enrich the Lr14a region with single nucleotide polymorphisms (SNPs) and high-resolution melting (HRM)-based markers developed from conserved ortholog set (COS) genes and from sequenced Diversity Array Technology (DArT(®)) markers; (2) to further investigate the gene content and colinearity of this region with the Brachypodium and rice genomes. Ten new COS-SNP and five HRM markers were mapped within an 8.0 cM interval spanning Lr14a. Two HRM markers pinpointed the locus in an interval of COS-SNPs were mapped 2.1-4.1 cM distal to Lr14a. Each marker was tested for its capacity to predict the state of Lr14a alleles (in particular, Lr14-Creso associated to resistance) in a panel of durum wheat elite germplasm including 164 accessions. Two of the most informative markers were converted into KASPar(®) markers. Single assay markers ubw14 and wPt-4038-HRM designed for agarose gel electrophoresis/KASPar(®) assays and high-resolution melting analysis, respectively, as well as the double-marker combinations ubw14/ubw18, ubw14/ubw35 and wPt-4038-HRM-ubw35 will be useful for germplasm haplotyping and for molecular-assisted breeding.

  15. Development of environmental DNA markers for three aquatic invasive species for Savannah National Wildlife Refuge

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The report concerns the development of species specific primers for Mayan cichlids, Asian Swamp Eels, and the lion fish which are considered aquatic invasive...

  16. The Power of Integrative Approaches to Develop Markers for Maize Molecular Breeding

    Institute of Scientific and Technical Information of China (English)

    J.M. Ribaut

    2007-01-01

    @@ Recent advances in genomics and bioinformatics now offer real opportunities for dissecting complex traits into their component sub-traits, which will simplify the process of developing the tools necessary to manipulate the underlying genes (Varshney et al., 2005).

  17. Transcriptional markers of sub-optimal nutrition in developing Apis mellifera nurse workers

    OpenAIRE

    Corby-Harris, Vanessa; Jones, Beryl M.; Walton, Alexander; Schwan, Melissa R; Kirk E Anderson

    2014-01-01

    Background Honey bees (Apis mellifera) contribute substantially to the worldwide economy and ecosystem health as pollinators. Pollen is essential to the bee’s diet, providing protein, lipids, and micronutrients. The dramatic shifts in physiology, anatomy, and behavior that accompany normal worker development are highly plastic and recent work demonstrates that development, particularly the transition from nurse to foraging roles, is greatly impacted by diet. However, the role that diet plays ...

  18. Development of Expressed Sequence Tag (EST)-based Cleaved Amplified Polymorphic Sequence (CAPS) markers of tea plant and their application to cultivar identification.

    Science.gov (United States)

    Ujihara, Tomomi; Taniguchi, Fumiya; Tanaka, Jun-Ichi; Hayashi, Nobuyuki

    2011-03-09

    To develop cleaved amplified polymorphic sequence (CAPS) markers for cultivar identification of the tea leaf, 5 primer pairs designed on the basis of genes that encode proteins related to nitrogen assimilation and 26 primer pairs based on expressed sequence tag (EST) sequences of the root of tea plant were screened. From combinations of primer pair and restriction enzyme that showed polymorphism among tea plants, 16 markers were selected and applied to DNA fingerprinting of Japanese tea cultivars. Sixty-three cultivars, except for a bud sport (Kiraka) and its original cultivar (Yabukita) and a pair that was the progeny of the same crossing parent (Harumoegi and Sakimidori), were distinguished from one another. By combining the 16 markers with previously developed CAPS markers and observing the physical appearance, 67 cultivars were distinguishable. The cultivars involve approximately 95% of total tea cultivating area in Japan; therefore, about 95% of tea leaves produced in Japan can be authenticated by labeling their cultivars.

  19. Development and detection efficiency of sequence characterized amplified region markers for authentication of medicinal plant Ruta graveolens and its adulterant Euphorbia dracunculoides

    Directory of Open Access Journals (Sweden)

    Irum Gul

    2016-01-01

    Full Text Available Background: With the increase in demand of herbal medicines, adulteration in these drugs is also gaining momentum and remains an indispensable problem in domestic and export markets. Correct identification is the first step toward assuring quality, safety, and efficacy of indigenous herbal medicines. Materials and Methods: In this study, sequence characterized amplified region (SCAR markers were developed to discriminate Ruta graveolens from its adulterant Euphorbia dracunculoides. Random amplified polymorphic DNA (RAPD was performed and subsequently converted into SCAR markers. Results: After performing RAPD, SCAR primers were designed from the selected unique RAPD amplicons of the genuine drug as well as its adulterant. These primers produced 670 bp and 750 bp SCAR markers with genomic DNA sample of R. graveolens and E. dracunculoides, respectively. Conclusion: Development of these markers will help in the quality control of herbal drugs and monitoring widespread adulteration of these drugs by pharmaceutical industries and government agencies.

  20. Development of new genomic microsatellite markers from robusta coffee (Coffea canephora Pierre ex A. Froehner showing broad cross-species transferability and utility in genetic studies

    Directory of Open Access Journals (Sweden)

    Hendre Prasad

    2008-04-01

    Full Text Available Abstract Background Species-specific microsatellite markers are desirable for genetic studies and to harness the potential of MAS-based breeding for genetic improvement. Limited availability of such markers for coffee, one of the most important beverage tree crops, warrants newer efforts to develop additional microsatellite markers that can be effectively deployed in genetic analysis and coffee improvement programs. The present study aimed to develop new coffee-specific SSR markers and validate their utility in analysis of genetic diversity, individualization, linkage mapping, and transferability for use in other related taxa. Results A small-insert partial genomic library of Coffea canephora, was probed for various SSR motifs following conventional approach of Southern hybridisation. Characterization of repeat positive clones revealed a very high abundance of DNRs (1/15 Kb over TNRs (1/406 kb. The relative frequencies of different DNRs were found as AT >> AG > AC, whereas among TNRs, AGC was the most abundant repeat. The SSR positive sequences were used to design 58 primer pairs of which 44 pairs could be validated as single locus markers using a panel of arabica and robusta genotypes. The analysis revealed an average of 3.3 and 3.78 alleles and 0.49 and 0.62 PIC per marker for the tested arabicas and robustas, respectively. It also revealed a high cumulative PI over all the markers using both sib-based (10-6 and 10-12 for arabicas and robustas respectively and unbiased corrected estimates (10-20 and 10-43 for arabicas and robustas respectively. The markers were tested for Hardy-Weinberg equilibrium, linkage dis-equilibrium, and were successfully used to ascertain generic diversity/affinities in the tested germplasm (cultivated as well as species. Nine markers could be mapped on robusta linkage map. Importantly, the markers showed ~92% transferability across related species/genera of coffee. Conclusion The conventional approach of genomic

  1. Development of new genomic microsatellite markers from robusta coffee (Coffea canephora Pierre ex A. Froehner) showing broad cross-species transferability and utility in genetic studies.

    Science.gov (United States)

    Hendre, Prasad Suresh; Phanindranath, Regur; Annapurna, V; Lalremruata, Albert; Aggarwal, Ramesh K

    2008-04-30

    Species-specific microsatellite markers are desirable for genetic studies and to harness the potential of MAS-based breeding for genetic improvement. Limited availability of such markers for coffee, one of the most important beverage tree crops, warrants newer efforts to develop additional microsatellite markers that can be effectively deployed in genetic analysis and coffee improvement programs. The present study aimed to develop new coffee-specific SSR markers and validate their utility in analysis of genetic diversity, individualization, linkage mapping, and transferability for use in other related taxa. A small-insert partial genomic library of Coffea canephora, was probed for various SSR motifs following conventional approach of Southern hybridisation. Characterization of repeat positive clones revealed a very high abundance of DNRs (1/15 Kb) over TNRs (1/406 kb). The relative frequencies of different DNRs were found as AT > AG > AC, whereas among TNRs, AGC was the most abundant repeat. The SSR positive sequences were used to design 58 primer pairs of which 44 pairs could be validated as single locus markers using a panel of arabica and robusta genotypes. The analysis revealed an average of 3.3 and 3.78 alleles and 0.49 and 0.62 PIC per marker for the tested arabicas and robustas, respectively. It also revealed a high cumulative PI over all the markers using both sib-based (10-6 and 10-12 for arabicas and robustas respectively) and unbiased corrected estimates (10-20 and 10-43 for arabicas and robustas respectively). The markers were tested for Hardy-Weinberg equilibrium, linkage dis-equilibrium, and were successfully used to ascertain generic diversity/affinities in the tested germplasm (cultivated as well as species). Nine markers could be mapped on robusta linkage map. Importantly, the markers showed ~92% transferability across related species/genera of coffee. The conventional approach of genomic library was successfully employed although with low

  2. Development and Application of Genetic Markers for Population Structure Analysis of the Blue Coral Reef Starfish, Linckia laevigata (Linn.) (Echinodermata: Asteroidea)

    OpenAIRE

    Richard Magsino; Marie Antonette Juinio-Meñez; Rachel Ravago

    2000-01-01

    The tropical blue coral reef starfish, Linckia laevigata, is a good model species for examining genetic affinities among reef populations. Allozyme and mtDNA PCR-RFLP genetic markers were developed for this species. A total of nine (9) polymorphic and three (3) monomorphic allozyme marker loci were resolved out of 25 enzyme systems assessed for genetic activity in three electrophoretic buffers used. Polymorphic mitochondrial DNA gene segments of the control region with flanking sequences and ...

  3. Aberrant crypt foci in the colo-rectal mucosa as reliable markers of tumor development

    DEFF Research Database (Denmark)

    Thorup, Inger

    The aim of the present thesis has been to evaluate a recently developed short term in vivo model, the aberrant crypt foci bioassay (ACF), for its ability to predict the development of colo-rectal tumors. Based on the knowledge obtained during the last decade, it can be stated that no simple...... connection exists between occurrence of ACF (neither qualitatively nor quantita- tively) and later development of tumors. However, the literature has shown that part of the ACF show morphologic and genetic features characteristic for the tumorigenic process and a recent investigation indicate that all ACF...... belong to the same unity with basically the same chances for gradual progressing into tumors. It may be speculated that the progression depends on promo- tional conditions in the environment....

  4. Transcriptional markers of sub-optimal nutrition in developing Apis mellifera nurse workers.

    Science.gov (United States)

    Corby-Harris, Vanessa; Jones, Beryl M; Walton, Alexander; Schwan, Melissa R; Anderson, Kirk E

    2014-02-15

    Honey bees (Apis mellifera) contribute substantially to the worldwide economy and ecosystem health as pollinators. Pollen is essential to the bee's diet, providing protein, lipids, and micronutrients. The dramatic shifts in physiology, anatomy, and behavior that accompany normal worker development are highly plastic and recent work demonstrates that development, particularly the transition from nurse to foraging roles, is greatly impacted by diet. However, the role that diet plays in the developmental transition of newly eclosed bees to nurse workers is poorly understood. To further understand honey bee nutrition and the role of diet in nurse development, we used a high-throughput screen of the transcriptome of 3 day and 8 day old worker bees fed either honey and stored pollen (rich diet) or honey alone (poor diet) within the hive. We employed a three factor (age, diet, age x diet) analysis of the transcriptome to determine whether diet affected nurse worker physiology and whether poor diet altered the developmental processes normally associated with aging. Substantial changes in gene expression occurred due to starvation. Diet-induced changes in gene transcription occurring in younger bees were largely a subset of those occurring in older bees, but certain signatures of starvation were only evident 8 day old workers. Of the 18,542 annotated transcripts in the A. mellifera genome, 150 transcripts exhibited differential expression due to poor diet at 3d of age compared with 17,226 transcripts that differed due to poor diet at 8d of age, and poor diet caused more frequent down-regulation of gene expression in younger bees compared to older bees. In addition, the age-related physiological changes that accompanied early adult development differed due to the diet these young adult bees were fed. More frequent down-regulation of gene expression was observed in developing bees fed a poor diet compared to those fed an adequate diet. Functional analyses also suggest that

  5. Developement of an Immunoradiometric Assay for Tumour Marker CA19-9

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    A two-site sandwich immunoradiometric assay for quantifying CA19-9 in serum is developed byusing two monoclonal antibodies. One of CA19-9 antibodies is labeled with 125I as a tracer and the othermonoclonal antibody is immobilized on plastic tubes as the solid phase. The sensitivity of the assay is 2

  6. Genomic tools for developing markers for postharvest disease resistance in Rosaceae fruit crops

    Science.gov (United States)

    A wealth of new plant genomic information and molecular tools have been developed over the past ten years and now the challenge is to learn how to apply this information to address critical production problems, such as disease resistance and abiotic stress tolerance. Malus sieversii, an apple speci...

  7. Human Neutrophil Peptides 1-3 – Early Markers in Development of Colorectal Adenomas and Carcinomas

    Directory of Open Access Journals (Sweden)

    Henning Mothes

    2008-01-01

    Full Text Available Expression of Human Neutrophil Peptides (HNP 1–3 was recently found to be associated with development of colorectal cancer. Raised defensin-expression in tumours is believed to stem from increased infiltration of neutrophils into tumour environment.

  8. Identification of Pancreatic Cancer Specific Cell-Surface Markers for Development of Targeting Ligands

    Science.gov (United States)

    Morse, David L.; Hostetter, Galen; Balagurunathan, Yoganand; Gillies, Robert J.; Han, Haiyong

    2014-01-01

    Pancreatic cancer is generally detected at later stages with a poor prognosis and a high-mortality rate. Development of theranostic imaging agents that non-invasively target pancreatic cancer by gene expression and deliver therapies directly to malignant cells could greatly improve therapeutic outcomes. Small-peptide ligands that bind cell-surface proteins and are conjugated to imaging moieties have demonstrated efficacy in cancer imaging. Identification of cancer specific targets is a major bottleneck in the development of such agents. Herein, a method is presented that uses DNA microarray expression profiling of large sets of normal and cancer tissues to identify targets expressed in cancer but not expressed in relevant normal tissues. Identified targets are subsequently validated for protein expression using tissue microarray. Further validations are performed by quantifying expression in pancreatic cancer cells by quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR), by immunocytochemistry and immunohistochemistry and by reviewing data and literature in public databases. Validated targets are selected for ligand development based on the existence of a known ligand or by known structure activity relationships useful for development of novel ligands. PMID:20217597

  9. Development of microsatellite markers in Lupinus luteus (Fabaceae) and cross-species amplification in other lupine species.

    Science.gov (United States)

    Gonzalez, Lorena B Parra; Straub, Shannon C K; Doyle, Jeff J; Ortega, Paula E Mora; Garrido, Haroldo E Salvo; Butler, Iván J Maureira

    2010-08-01

    Microsatellite primers were developed in Lupinus luteus L., an emerging temperate protein crop, to investigate genetic diversity, population structure, and to facilitate the generation of better yellow lupine varieties. • Thirteen polymorphic primer sets were evaluated in a European and Eastern European accession collection of L. luteus. The primers amplified di-, tri-, and tetranucleotide repeats with 2-4 alleles per locus. These revealed a moderate to low level of genetic variation, as indicated by an average observed heterozygosity of 0.0126. Select loci also amplified successfully in the closely related species L. hispanicus Boiss. & Reut. and in the New World species L. mutabilis Sweet. • These results indicate the utility of primers for the study of genetic diversity across L. luteus populations and related lupine species. The use of these microsatellite markers will facilitate the implementation of several molecular breeding strategies in yellow lupine.

  10. Rapid development of polymorphic microsatellite markers for the Amur sturgeon (Acipenser schrenckii) using next-generation sequencing technology.

    Science.gov (United States)

    Li, L M; Wei, L; Jiang, H Y; Zhang, Y; Zhang, X J; Yuan, L H; Chen, J P

    2015-07-14

    Anthropogenic activities have seriously impacted wild resources of the Amur sturgeon, Acipenser schrenckii, and more information on local and regional population genetic structure is required to aid the conservation of this species. In this study, we report the development of 12 novel polymorphic microsatellite loci using next-generation sequencing technology, and the genotyping of 24 individuals collected from a sturgeon farm. The results show that the mean number of ob-served alleles per locus is 6.6 (ranging from 2 to 17). Observed and expected heterozygosity values ranged from 0 to 0.958 and from 0.508 to 0.940, respectively. Not a single locus showed significant departure from Hardy-Weinberg equilibrium and no linkage disequilibrium was observed among any pairwise loci. These highly informative microsatellite markers will be useful for genetic diversity and population structure analyses of A. schrenckii and other species of this genus.

  11. Development of new polymorphic microsatellite markers in topmouth culter (Culter alburnus) and determination of their applicability in Culter mongolicus.

    Science.gov (United States)

    Qi, P-Z; Xie, C-X; Guo, B-Y; Wu, C-W; Lu, S-M; Duan, Y-J

    2013-05-21

    Fifteen new polymorphic microsatellite markers were developed for Culter alburnus. In 32 individuals representing a wild population of the Danjiangkou Reservoir, Hubei, China, the number of alleles at these loci varied between 2 and 10, with an average of 5.5. The average observed and expected heterozygosities were 0.664 and 0.681, respectively. The polymorphism information content of 11 loci was more than 0.5 whereas that of the other 4 loci was less than 0.5 but more than 0.25. In addition, the genomes of 30 C. mongolicus individuals were successfully amplified with these primer pairs, indicating that the primer pairs were applicable for the related species, C. mongolicus.

  12. t-10, c-12 CLA dietary supplementation inhibits atherosclerotic lesion development despite adverse cardiovascular and hepatic metabolic marker profiles.

    Directory of Open Access Journals (Sweden)

    Patricia L Mitchell

    Full Text Available Animal and human studies have indicated that fatty acids such as the conjugated linoleic acids (CLA found in milk could potentially alter the risk of developing metabolic disorders including diabetes and cardiovascular disease (CVD. Using susceptible rodent models (apoE(-/- and LDLr(-/- mice we investigated the interrelationship between mouse strain, dietary conjugated linoleic acids and metabolic markers of CVD. Despite an adverse metabolic risk profile, atherosclerosis (measured directly by lesion area, was significantly reduced with t-10, c-12 CLA and mixed isomer CLA (Mix supplementation in both apoE(-/- (p<0.05, n = 11 and LDLr(-/- mice (p<0.01, n = 10. Principal component analysis was utilized to delineate the influence of multiple plasma and tissue metabolites on the development of atherosclerosis. Group clustering by dietary supplementation was evident, with the t-10, c-12 CLA supplemented animals having distinct patterns, suggestive of hepatic insulin resistance, regardless of mouse strain. The effect of CLA supplementation on hepatic lipid and fatty acid composition was explored in the LDLr(-/- strain. Dietary supplementation with t-10, c-12 CLA significantly increased liver weight (p<0.05, n = 10, triglyceride (p<0.01, n = 10 and cholesterol ester content (p<0.01, n = 10. Furthermore, t-10, c-12 CLA also increased the ratio of 18∶1 to 18∶0 fatty acid in the liver suggesting an increase in the activity of stearoyl-CoA desaturase. Changes in plasma adiponectin and liver weight with t-10, c-12 CLA supplementation were evident within 3 weeks of initiation of the diet. These observations provide evidence that the individual CLA isomers have divergent mechanisms of action and that t-10, c-12 CLA rapidly changes plasma and liver markers of metabolic syndrome, despite evidence of reduction in atherosclerosis.

  13. Development of Agrobacterium-mediated virus-induced gene silencing and performance evaluation of four marker genes in Gossypium barbadense.

    Directory of Open Access Journals (Sweden)

    Jinhuan Pang

    Full Text Available Gossypiumbarbadense is a cultivated cotton species and possesses many desirable traits, including high fiber quality and resistance to pathogens, especially Verticilliumdahliae (a devastating pathogen of Gossypium hirsutum, the main cultivated species. These elite traits are difficult to be introduced into G. hirsutum through classical breeding methods. In addition, genetic transformation of G. barbadense has not been successfully performed. It is therefore important to develop methods for evaluating the function and molecular mechanism of genes in G. barbadense. In this study, we had successfully introduced a virus-induced gene silencing (VIGS system into three cultivars of G. barbadense by inserting marker genes into the tobacco rattle virus (TRV vector. After we optimized the VIGS conditions, including light intensity, photoperiod, seedling age and Agrobacterium strain, 100% of plants agroinfiltrated with the GaPDS silencing vector showed white colored leaves. Three other marker genes, GaCLA1, GaANS and GaANR, were employed to further test this VIGS system in G. barbadense. The transcript levels of the endogenous genes in the silenced plants were reduced by more than 99% compared to control plants; these plants presented phenotypic symptoms 2 weeks after inoculation. We introduced a fusing sequence fragment of GaPDS and GaANR gene silencing vectors into a single plant, which resulted in both photobleaching and brownish coloration. The extent of silencing in plants agroinfiltrated with fusing two-gene-silencing vector was consistent with plants harboring a single gene silencing vector. The development of this VIGS system should promote analysis of gene function in G. barbadense, and help to contribute desirable traits for breeding of G. barbadense and G. hirsutum.

  14. Predictors of early person reference development: maternal language input, attachment and neurodevelopmental markers.

    Science.gov (United States)

    Lemche, Erwin; Joraschky, Peter; Klann-Delius, Gisela

    2013-12-01

    In a longitudinal natural language development study in Germany, the