WorldWideScience

Sample records for malted finger millet

  1. Bioaccessible mineral content of malted finger millet (Eleusine coracana), wheat (Triticum aestivum), and barley (Hordeum vulgare).

    Science.gov (United States)

    Platel, Kalpana; Eipeson, Sushma W; Srinivasan, Krishnapura

    2010-07-14

    Malted grains are extensively used in weaning and geriatric foods. Malting generally improves the nutrient content and digestibility of foods. The present investigation examined the influence of malting of finger millet, wheat, and barley on the bioaccessibility of iron, zinc, calcium, copper, and manganese. Malting increased the bioaccessibility of iron by >3-fold from the two varieties of finger millet and by >2-fold from wheat, whereas such a beneficial influence was not seen in barley. The bioaccessibility of zinc from wheat and barley increased to an extent of 234 and 100%, respectively, as a result of malting. However, malting reduced the bioaccessibility of zinc from finger millet. Malting marginally increased the bioaccessibility of calcium from white finger millet and wheat. Whereas malting did not exert any influence on bioaccessibility of copper from finger millet and wheat, it significantly decreased (75%) the same from barley. Malting did increase the bioaccessibility of manganese from brown finger millet (17%) and wheat (42%). Thus, malting could be an appropriate food-based strategy to derive iron and other minerals maximally from food grains.

  2. Enhancing micronutrient content of beverage powder by incorporating malted finger millet

    Directory of Open Access Journals (Sweden)

    Jaya Tripathi

    2014-12-01

    Full Text Available Introduction: There is growing interest in the role of the micronutrients in optimizing health, and in prevention or treatment of disease. Micronutrients play a central part in metabolism and in the maintenance of tissue function, an adequate intake therefore is necessary. Rationale: This research work was concerned with the development of micronutrient especially calcium rich instant health beverage powder from malted finger millet (Eleusine coracana and gurhal powder (Hibiscus rosa- sinensis. Aims & Objectives: In this study attempts have been made to investigate that whether the extruded malted finger millet flour and hibiscus flower powder has improved the nutritional and phytochemical quality of instant health beverage powder without deteriorating their sensory properties and whether it can be a supplement for calcium deficit sedentary women. Materials and methods: Instant health beverage powder was prepared by adding malted and extruded finger millet with glucose, hibiscus flower powder, citric acid and vanilla essence. All the ingredients were mixed well. Prior to consumption this powder was dissolved in water and stirred well manually. Further Instant health beverage powder was assessed for nutritional composition. Results: Results shows that beverage powder has very high content of protein (12.25 % and calcium (96.5 % along with highly beneficial neutraceutical properties as compared with the health drinks available in market, it is because of enhanced antioxidant activity resulted due to the incorporation of gurhal leaf powder and malting of the finger millet. Conclusion: This study may prove as a potential step to utilise malted finger millet as a supplement for calcium deficit women. The nutritional composition was found sufficient enough to meet approximately one fourth of RDA of Protein and Calcium as prescribed by NIN, India for sedentary women who are the main sufferers of calcium deficiencies in various life stages

  3. Malting process optimization for protein digestibility enhancement in finger millet grain.

    Science.gov (United States)

    Hejazi, Sara Najdi; Orsat, Valérie

    2016-04-01

    Finger millet (Eleusine coracana) is a nutritious, gluten-free, and drought resistant cereal containing high amounts of protein, carbohydrate, and minerals. However, bio-availability of these nutrients is restricted due to the presence of an excessive level of anti-nutrient components, mainly phytic acid, tannin, and oxalate. It has been shown that a well-designed malting/germination process can significantly reduce these anti-nutrients and consequently enhance the nutrient availability. In the present study, the effects of two important germination factors, duration and temperature, on the enhancement of in-vitro protein digestibility of finger millet were thoroughly investigated and optimized. Based on a central composite design, the grains were germinated for 24, 36, and 48 h at 22, 26, and 30 °C. For all factor combinations, protein, peptide, phytic acid, tannin, and oxalate contents were evaluated and digestibility was assessed. It was shown that during the malting/germinating process, both temperature and duration factors significantly influenced the investigated quantities. Germination of finger millet for 48 h at 30 °C increased protein digestibility from 74 % (for native grain) up to 91 %. Besides, it notably decreased phytic acid, tannin, and oxalate contents by 45 %, 46 %, and 29 %, respectively. Linear correlations between protein digestibility and these anti-nutrients were observed.

  4. Optimization of the malting process for nutritional improvement of finger millet and amaranth flours in the infant weaning food industry.

    Science.gov (United States)

    Najdi Hejazi, Sara; Orsat, Valérie

    2017-06-01

    Malting is a beneficial approach to improve the nutritional value of cereals used in infant preparations. Malted finger millet and amaranth might be considered as potentially appropriate gluten-free alternatives for common wheat-based weaning products, especially in case of those suffering from celiac disease. In this study, the effects of germination temperature and duration on the main nutrients of malted finger millet and amaranth, are evaluated and optimized. Grains were germinated for 24, 36 and 48 h at 22, 26 and 30 °C. In the case of finger millet, germinating for 48 h at 30 °C resulted into 17% increase in protein availability, 10% increase in total energy and 60% reduction in resistant starch (RS). For amaranth, germinating for 48 h at 26 °C was preferable, resulting in 8% increase in protein availability, 11% increase in total energy, 70% reduction in RS and a 10% increase in the linoleic acid.

  5. Effect of malting conditions on pearl millet malt quality

    CSIR Research Space (South Africa)

    Pelembe, LAM

    2002-01-01

    Full Text Available The effect of malting conditions on pearl millet malt quality in two varieties, SDMV 89004 and SDMV 91018, was investigated. Grain was steeped and germinated at four temperatures, 20degrees, 25degrees, 30degrees and 35degreesC, over 5 days...

  6. Malting Characteristics of Some Sorghum and Millet Grain Varieties Grown in Kenya

    International Nuclear Information System (INIS)

    Makokha, A.O; Makwaka, A.M; Oniang'o, R.O; Njoroge, S.M

    1999-01-01

    Industrial malt in Kenya for commercial beer production is made exclusively from barley. This study explored the potential of producing suitable malt from some sorghum and finger millet grain varieties grown in Kenya. Malting characteristics of two sorghum grain varieties, KARI Mtama-1 and local Red variety, and that of finger millet was done and compared to that of barley. Among the grain characteristics determined before malting were water sensitivity, polyphenol (tannin) content and total protein. The grain was malted by striping in water for 48 h, followed by germination for four days at 25 degrees celcious, then kilned at 50 degrees celcious for 24 h. The malting characteristics determined included total soluble N, free amino N, wort pH and fermentable sugars. The local red sorghum and millet had high polyphenol content while KARI Mtama-1 and barley had low levels. KARI Mtama-1 had positive water sensitivity while barley had negative sensitivity. Finger millet and local red sorghum were water insensitive. Free amino N was 113, 125, 144, and 154mg 100g - 1 malt for millet, barley, local Red and KARI Mtama-1, respectively. Total fermentation sugars were 307, 477, 610 and 178 mg 1 - 1 for finger millet, local red, barley and KARI Mtama 1 , respectively. The results showed that that the proteolytic and amyloytic characteristics of the KARI Mtama-1 malt are largely similar to those of barley. Hence the KARI Mtama-1 malt are largely similar to those of barley. Hence the KARI Mtama-1 has good potential fro conventional lager beer production. Malts of local Red sorghum grain and millet may be more suitable for industrial production of opaque/cloudy beer

  7. RETRACTED ARTICLE: Nutritional, technological, and medical approach of finger millet (Eleusine coracana

    Directory of Open Access Journals (Sweden)

    Amir Gull

    2015-12-01

    Full Text Available Finger millet (Eleusine coracana L. is also known as African millet and is commonly called “ragi” in India. It has excellent nutritional value and is even superior to other common cereals. It is a richest source of calcium (344 mg and magnesium (408 mg than other millets. Predominant fatty acids of this millet are oleic (49%, linoleic (25%, and palmitic acids (25%. Finger millet contains both water-soluble and lipo-soluble vitamins. Emerging bakery products prepared from this millet are pasta, noodles, vermicelli, and bread. Being gluten free, it is suitable for individuals suffering from celiac disease. Finger millet grain is a rich source of several phytochemicals. Finger millet possesses blood glucose lowering, cholesterol lowering, and antiulcerative, wound healing properties as indicated by in vitro and in vivo studies. Commonly used processing techniques for this millet are milling, malting, popping, and decortications.

  8. Finger millet (Ragi, Eleusine coracana L.): a review of its nutritional properties, processing, and plausible health benefits.

    Science.gov (United States)

    Shobana, S; Krishnaswamy, K; Sudha, V; Malleshi, N G; Anjana, R M; Palaniappan, L; Mohan, V

    2013-01-01

    Finger millet or ragi is one of the ancient millets in India (2300 BC), and this review focuses on its antiquity, consumption, nutrient composition, processing, and health benefits. Of all the cereals and millets, finger millet has the highest amount of calcium (344mg%) and potassium (408mg%). It has higher dietary fiber, minerals, and sulfur containing amino acids compared to white rice, the current major staple in India. Despite finger millet's rich nutrient profile, recent studies indicate lower consumption of millets in general by urban Indians. Finger millet is processed by milling, malting, fermentation, popping, and decortication. Noodles, vermicilli, pasta, Indian sweet (halwa) mixes, papads, soups, and bakery products from finger millet are also emerging. In vitro and in vivo (animal) studies indicated the blood glucose lowering, cholesterol lowering, antiulcerative, wound healing properties, etc., of finger millet. However, appropriate intervention or randomized clinical trials are lacking on these health effects. Glycemic index (GI) studies on finger millet preparations indicate low to high values, but most of the studies were conducted with outdated methodology. Hence, appropriate GI testing of finger millet preparations and short- and long-term human intervention trials may be helpful to establish evidence-based health benefits. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Finger millet [Eleusine coracana (L.) Gaertn].

    Science.gov (United States)

    Ceasar, Stanislaus Antony; Ignacimuthu, Savarimuthu

    2015-01-01

    Millets are the primary food source for millions of people in tropical regions of the world supplying mineral nutrition and protein. In this chapter, we describe an optimized protocol for the Agrobacterium-mediated transformation of finger millet variety GPU 45. Agrobacterium strain LBA4404 harboring plasmid pCAMBIA1301 which contains hygromycin phosphotransferase (hph) as selectable marker gene and β-glucuronidase (GUS) as reporter gene has been used. This protocol utilizes the shoot apex explants for the somatic embryogenesis and regeneration of finger millet after the transformation by Agrobacterium. Desiccation of explants during cocultivation helps for the better recovery of transgenic plants. This protocol is very useful for the efficient production of transgenic plants in finger millet through Agrobacterium-mediated transformation.

  10. Review of Finger millet (Eleusine coracana (L.) Gaertn): A power house of health benefiting nutrients

    OpenAIRE

    Dinesh Chandra; Satish Chandra; Pallavi; A.K. Sharma

    2016-01-01

    The bulk of the world's millet crop is produced by India, Nigeria, Niger, Mali, Burkina Faso, Chad, and China. Finger millet (Eleusine coracana (L.) Gaertn), little millet (Panicum sumatrense Roth ex Roem. & Schult.), foxtail millet (Setaria italica (L.) P. Beauvois) and proso millet (Panicum miliaceum L.) are most commonly found species among various millet varieties. In India, finger millet occupy the largest area under cultivation among the small millets. Finger millet stands unique among ...

  11. Fusarium verticillioides from finger millet in Uganda.

    Science.gov (United States)

    Saleh, Amgad A; Esele, J P; Logrieco, Antonio; Ritieni, Alberto; Leslie, John F

    2012-01-01

    Finger millet (Eleusine coracana) is a subsistence crop grown in Sub-Saharan Africa and the Indian Sub-continent. Fusarium species occurring on this crop have not been reported. Approximately 13% of the Fusarium isolates recovered from finger millet growing at three different locations in eastern Uganda belong to Fusarium verticillioides, and could produce up to 18,600 µg/g of total fumonisins when cultured under laboratory conditions. These strains are all genetically unique, based on AFLP analyses, and form fertile perithecia when crossed with the standard mating type tester strains for this species. All but one of the strains is female-fertile and mating-type segregates 13:20 Mat-1:Mat-2. Three new sequences of the gene encoding translation elongation factor 1-α were found within the population. These results indicate a potential health risk for infants who consume finger millet gruel as a weaning food, and are consistent with the hypothesis that F. verticillioides originated in Africa and not in the Americas, despite its widespread association with maize grown almost anywhere worldwide.

  12. Cross-genera transferability of rice and finger millet genomic SSRs to barnyard millet (Echinochloa spp.).

    Science.gov (United States)

    Kalyana Babu, B; Sood, Salej; Kumar, Dinesh; Joshi, Anjeli; Pattanayak, A; Kant, Lakshmi; Upadhyaya, H D

    2018-02-01

    Barnyard millet ( Echinochloa spp.) is an important crop from nutritional point of view, nevertheless, the genetic information is very scarce. In the present investigation, rice and finger millet genomic SSRs were used for assessing cross transferability, identification of polymorphic markers, syntenic regions, genetic diversity and population structure analysis of barnyard millet genotypes. We observed 100% cross transferability for finger millet SSRs, of which 91% were polymorphic, while 71% of rice markers were cross transferable with 48% polymorphic out of them. Twenty-nine and sixteen highly polymorphic finger millet and rice SSRs yielded a mean of 4.3 and 3.38 alleles per locus in barnyard millet genotypes, respectively. The PIC values varied from 0.27 to 0.73 at an average of 0.54 for finger millet SSRs, whereas it was from 0.15 to 0.67 at an average of 0.44 for rice SSRs. High synteny was observed for markers related to panicle length, yield-related traits, spikelet fertility, plant height, root traits, leaf senescence, blast and brown plant hopper resistance. Although the rice SSRs located on chromosome 10 followed by chromosome 6 and 11 were found to be more transferable to barnyard millet, the finger millet SSRs were more polymorphic and transferable to barnyard millet genotypes. These SSR data of finger millet and rice individually as well as combined together grouped the 11 barnyard millet genotypes into 2 major clusters. The results of population structure analysis were similar to cluster analysis.

  13. Population Structure and Diversity in Finger Millet (Eleusine coracana) Germplasm.

    Science.gov (United States)

    A genotypic analysis of 79 finger millet accessions (E. coracana subsp. coracana) from 11 African and 5 Asian countries, plus 14 wild E. coracana subsp. africana lines collected in Uganda and Kenya was conducted with 45 SSR markers distributed across the finger millet genome. Phylogenetic and popula...

  14. Evaluation of finger millet incorporated noodles for nutritive value and glycemic index

    OpenAIRE

    Shukla, Kamini; Srivastava, Sarita

    2011-01-01

    The present study was undertaken to develop finger millet incorporated noodles for diabetic patients. Finger millet variety VL-149 was taken. The finger millet flour and refined wheat flour (RWF) were evaluated for nutrient composition. The finger millet flour (FMF) was blended in various proportions (30 to 50%) in refined wheat flour and used for the preparation of noodles. Control consisted of RWF noodles. Sensory quality and nutrient composition of finger millet noodles was evaluated. The ...

  15. Variability and trait relationships among finger millet accessions in ...

    African Journals Online (AJOL)

    ACSS

    A total of 100 accessions were evaluated for morpho-agronomic characters in a ... head blast incidence, productive tillers plant-1 and grain yield. ... Introduction ... protein, iron and calcium, finger millet ... collection and maintenance has been.

  16. Evaluation of nutraceutical and antinutritional properties in barnyard and finger millet varieties grown in Himalayan region.

    Science.gov (United States)

    Panwar, Priyankar; Dubey, Ashutosh; Verma, A K

    2016-06-01

    Five elite varieties of barnyard (Echinochloa frumentacea) and finger (Eleusine coracana) growing at northwestern Himalaya were investigated for nutraceutical and antinutritional properties. Barnyard millet contained higher amount of crude fiber, total dietary fiber, tryptophan content, total carotenoids, α-tocopherol compared to the finger millet whereas the finger millet contains higher amount of methionine and ascorbic acid as compared to the barnyard millet. The secondary metabolites of biological functions were analyzed and found that barnyard millet contained the higher amount of polyphenols, tannins and ortho-dihydroxy phenol content compared to finger millet. Among antinutitional compounds barnyard millet contained lower phytic acid content compare to finger millet whereas no significant difference in trypsin inhibition activity of barnyard millet and finger millet varieties were found. Barnyard millet contained higher acid phosphatase, α-galactosidase and α-amylase inhibitor activity compared to finger millet. Finger millet seeds contained about 10-13 folds higher calcium content and double amount of manganese content in comparison to barnyard millet seeds. Present study suggests that barnyard millet varieties studied under present investigation were found nutritionally superior compared to finger millet varieties.

  17. The genetic map of finger millet, Eleusine coracana.

    Science.gov (United States)

    Dida, Mathews M; Srinivasachary; Ramakrishnan, Sujatha; Bennetzen, Jeffrey L; Gale, Mike D; Devos, Katrien M

    2007-01-01

    Restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), expressed-sequenced tag (EST), and simple sequence repeat (SSR) markers were used to generate a genetic map of the tetraploid finger millet (Eleusine coracana subsp. coracana) genome (2n = 4x = 36). Because levels of variation in finger millet are low, the map was generated in an inter-subspecific F(2) population from a cross between E. coracana subsp. coracana cv. Okhale-1 and its wild progenitor E. coracana subsp. africana acc. MD-20. Duplicated loci were used to identify homoeologous groups. Assignment of linkage groups to the A and B genome was done by comparing the hybridization patterns of probes in Okhale-1, MD-20, and Eleusine indica acc. MD-36. E. indica is the A genome donor to E. coracana. The maps span 721 cM on the A genome and 787 cM on the B genome and cover all 18 finger millet chromosomes, at least partially. To facilitate the use of marker-assisted selection in finger millet, a first set of 82 SSR markers was developed. The SSRs were identified in small-insert genomic libraries generated using methylation-sensitive restriction enzymes. Thirty-one of the SSRs were mapped. Application of the maps and markers in hybridization-based breeding programs will expedite the improvement of finger millet.

  18. Evaluation of nutraceutical and antinutritional properties in barnyard and finger millet varieties grown in Himalayan region

    OpenAIRE

    Panwar, Priyankar; Dubey, Ashutosh; Verma, A. K.

    2016-01-01

    Five elite varieties of barnyard (Echinochloafrumentacea) and finger (Eleusine coracana) growing at northwestern Himalaya were investigated for nutraceutical and antinutritional properties. Barnyard millet contained higher amount of crude fiber, total dietary fiber, tryptophan content, total carotenoids, ��-tocopherol compared to the finger millet whereas the finger millet contains higher amount of methionine and ascorbic acid as compared to the barnyard millet. The secondary metabolites of b...

  19. Prevalence of Finger Millet Diseases in Kaberamaido Subcounty ...

    African Journals Online (AJOL)

    world, the most important disease of finger mil- let is blast caused by the fungus Pyricularia grisea (Cook) Sacc (Adipala, 1980; Emechebe,. 1975i MCrae, 1922). Tar spot, caused by. Phyllachora eleusines P. Hen, is common on fin- ger millet approaching maturity especially in cooler and wetter areas of Uganda (Hen, 1970).

  20. Effect of germination temperatures on proteolysis of the gluten-free grains sorghum and millet during malting and mashing.

    Science.gov (United States)

    Chiba, Y; Bryce, J H; Goodfellow, V; MacKinlay, J; Agu, R C; Brosnan, J M; Bringhurst, T A; Harrison, B

    2012-04-11

    Our study showed that sorghum and millet followed a similar pattern of changes when they were malted under similar conditions. When the malt from these cereals was mashed, both cereal types produced wide spectra of substrates (sugars and amino acids) that are required for yeast fermentation when malted at either lower or higher temperatures. At the germination temperatures of 20, 25, and 30 °C used in malting both cereal types, production of reducing sugars and that of free amino nitrogen (FAN) were similar. This is an important quality attribute for both cereals because it implies that variation in temperature during the malting of sorghum and millet, especially when malting temperature is difficult to control, and also reflecting temperature variations, experienced in different countries, will not have an adverse effect on the production and release of amino acids and sugars required by yeast during fermentation. Such consistency in the availability of yeast food (substrates) for metabolism during fermentation when sorghum and millet are malted at various temperatures is likely to reduce processing issues when their malts are used for brewing. Although sorghum has gained wide application in the brewing industry, and has been used extensively in brewing gluten-free beer on industrial scale, this is not the case with millet. The work described here provides novel information regarding the potential of millet for brewing. When both cereals were malted, the results obtained for millet in this study followed patterns similar to those of sorghum. This suggests that millet, in terms of sugars and amino acids, can play a role similar to that of sorghum in the brewing industry. This further suggests that millet, like sorghum, would be a good raw material for brewing gluten-free beer. Inclusion of millet as a brewing raw material will increase the availability of suitable materials (raw material sustainability) for use in the production of gluten-free beer, beverages, and

  1. RETRACTED ARTICLE: Nutritional, technological, and medical approach of finger millet (Eleusine coracana)

    OpenAIRE

    Amir Gull; Gulzar Ahmad Nayik; Kamlesh Prasad; Pradyuman Kumar

    2015-01-01

    Finger millet (Eleusine coracana L.) is also known as African millet and is commonly called “ragi” in India. It has excellent nutritional value and is even superior to other common cereals. It is a richest source of calcium (344 mg) and magnesium (408 mg) than other millets. Predominant fatty acids of this millet are oleic (49%), linoleic (25%), and palmitic acids (25%). Finger millet contains both water-soluble and lipo-soluble vitamins. Emerging bakery products prepared from this millet are...

  2. Effect of Ethanol on Germination and Enzyme Activities in Finger millet (Eleusine coracana Gaertn.) Seeds

    OpenAIRE

    S.S. Kulkarni; P.D. Chavan

    2014-01-01

    Influence of ethanol the end product of alcoholic fermentation on the growth of finger millet (var. GPU-28, CO-9) seedlings of two finger millet was studied as a means of evaluating growth responses under anoxia. The germination was delayed by ethanol treatment in case of both the cultivars. Ethanol treatment affected the growth of both radicle and coleoptile of seedlings. In this respect the radicle growth is more sensitive to ethanol than the coleoptile in both varieties of finger millet. T...

  3. Evaluation of finger millet incorporated noodles for nutritive value and glycemic index.

    Science.gov (United States)

    Shukla, Kamini; Srivastava, Sarita

    2014-03-01

    The present study was undertaken to develop finger millet incorporated noodles for diabetic patients. Finger millet variety VL-149 was taken. The finger millet flour and refined wheat flour (RWF) were evaluated for nutrient composition. The finger millet flour (FMF) was blended in various proportions (30 to 50%) in refined wheat flour and used for the preparation of noodles. Control consisted of RWF noodles. Sensory quality and nutrient composition of finger millet noodles was evaluated. The 30% finger millet incorporated noodles were selected best on the basis of sensory evaluation. Noodles in that proportion along with control were evaluated for glycemic response. Nutrient composition of noodles showed that 50% finger millet incorporated noodles contained highest amount of crude fat (1.15%), total ash (1.40%), crude fiber (1.28%), carbohydrate (78.54%), physiological energy (351.36 kcal), insoluble dietary fiber (5.45%), soluble dietary fiber (3.71%), iron (5.58%) and calcium (88.39%), respectively. However, control RWF noodles contained highest amount of starch (63.02%), amylose (8.72%) and amylopectin (54.29%). The glycemic index (GI) of 30% finger millet incorporated noodles (best selected by sensory evaluation) was observed significantly lower (45.13) than control noodles (62.59). It was found that finger millet flour incorporated noodles were found nutritious and showed hypoglycemic effect.

  4. Comparative analyses reveal high levels of conserved colinearity between the finger millet and rice genomes.

    Science.gov (United States)

    Srinivasachary; Dida, Mathews M; Gale, Mike D; Devos, Katrien M

    2007-08-01

    Finger millet is an allotetraploid (2n = 4x = 36) grass that belongs to the Chloridoideae subfamily. A comparative analysis has been carried out to determine the relationship of the finger millet genome with that of rice. Six of the nine finger millet homoeologous groups corresponded to a single rice chromosome each. Each of the remaining three finger millet groups were orthologous to two rice chromosomes, and in all the three cases one rice chromosome was inserted into the centromeric region of a second rice chromosome to give the finger millet chromosomal configuration. All observed rearrangements were, among the grasses, unique to finger millet and, possibly, the Chloridoideae subfamily. Gene orders between rice and finger millet were highly conserved, with rearrangements being limited largely to single marker transpositions and small putative inversions encompassing at most three markers. Only some 10% of markers mapped to non-syntenic positions in rice and finger millet and the majority of these were located in the distal 14% of chromosome arms, supporting a possible correlation between recombination and sequence evolution as has previously been observed in wheat. A comparison of the organization of finger millet, Panicoideae and Pooideae genomes relative to rice allowed us to infer putative ancestral chromosome configurations in the grasses.

  5. Effect of domestic processing on the polyphenol content and bioaccessibility in finger millet (Eleusine coracana) and pearl millet (Pennisetum glaucum).

    Science.gov (United States)

    Hithamani, Gavirangappa; Srinivasan, Krishnapura

    2014-12-01

    Finger millet (Eleusine coracana) and pearl millet (Pennisetum glaucum) were evaluated for polyphenolic content and their bioaccessibility. Total polyphenols of native finger millet was 10.2mg/g which reduced by 50% after sprouting or pressure-cooking, while 12-19% reduction was seen after open-pan boiling. Total flavonoids of the grain reduced drastically on sprouting, pressure-cooking or open-pan boiling. Concentration of phenolic acids generally increased during sprouting and roasting of finger millet. Pressure cooking, open-pan boiling and microwave-heating reduced the bioaccessible polyphenols by 30-35%, while the same was increased by 67% by sprouting. Significant reduction of total polyphenols was observed in pressure-cooked, open-pan boiled and microwave-heated pearl millet. Concentration of sinapic and salicylic acids were highest phenolic acids of pearl millet. Total polyphenols reduced during sprouting and pressure-cooking. There was a 20% increase in the bioaccessible polyphenols after sprouting of pearl millet. Thus, sprouting and roasting provided more bioaccessible phenolics from these two common millets studied. Copyright © 2014. Published by Elsevier Ltd.

  6. Review of Finger millet (Eleusine coracana (L. Gaertn: A power house of health benefiting nutrients

    Directory of Open Access Journals (Sweden)

    Dinesh Chandra

    2016-09-01

    Full Text Available The bulk of the world's millet crop is produced by India, Nigeria, Niger, Mali, Burkina Faso, Chad, and China. Finger millet (Eleusine coracana (L. Gaertn, little millet (Panicum sumatrense Roth ex Roem. & Schult., foxtail millet (Setaria italica (L. P. Beauvois and proso millet (Panicum miliaceum L. are most commonly found species among various millet varieties. In India, finger millet occupy the largest area under cultivation among the small millets. Finger millet stands unique among the cereals such as barley, rye and oats with higher nutritional contents and has outstanding properties as a subsistence food crop. It is rich in calcium (0.34%, dietary fiber (18%, phytates (0.48%, protein (6%–13% minerals (2.5%–3.5%, and phenolics (0.3%–3%. Moreover, it is also a rich source of thiamine, riboflavin, iron, methionine, isoleucine, leucine, phenylalanine and other essential amino acids. The abundance of these phytochemicals enhances the nutraceutical potential of finger millet, making it a powerhouse of health benefiting nutrients. It has distinguished health beneficial properties, such as anti-diabetic (type 2 diabetes mellitus, anti-diarrheal, antiulcer, anti-inflammatory, antitumerogenic (K562 chronic myeloid leukemia, atherosclerogenic effects, antimicrobial and antioxidant properties.

  7. Evolution of finger millet: evidence from random amplified polymorphic DNA.

    Science.gov (United States)

    Hilu, K W

    1995-04-01

    Finger millet (Eleusine coracana ssp. coracana) is an annual tetraploid member of a predominantly African genus. The crop is believed to have been domesticated from the tetraploid E. coracana ssp. africana. Cytogenetic and isozyme data point to the allopolyploid nature of the species and molecular information has shown E. indica to be one of the genomic donors. A recent isozyme study questioned the proposed phylogenetic relationship between finger millet and its direct ancestor subspecies africana. An approach using random amplified polymorphic DNA (RAPD) was employed in this study to examine genetic diversity and to evaluate hypotheses concerning the evolution of domesticated and wild annual species of Eleusine. Unlike previous molecular approaches, the RAPD study revealed genetic diversity in the crop. The pattern of genetic variation was loosely correlated to geographic distribution. The allotetraploid nature of the crop was confirmed and molecular markers that can possibly identify the other genomic donor were proposed. Genotypes of subspecies africana did not group closely with those of the crop but showed higher affinities to E. indica, reflecting the pattern of similarity revealed by the isozyme study. The multiple origin of subspecies africana could explain the discrepancy between the isozyme-RAPD evidence and previous information. The RAPD study showed the close genetic affinity of E. tristachya to the E. coracana--E. indica group and understood the distinctness of E. multiflora.

  8. Identification of the ``a'' Genome of Finger Millet Using Chloroplast DNA

    Science.gov (United States)

    Hilu, K. W.

    1988-01-01

    Finger millet (Eleusine corocana subsp. coracana), an important cereal in East Africa and India, is a tetraploid species with unknown genomic components. A recent cytogenetic study confirmed the direct origin of this millet from the tetraploid E. coracana subsp. africana but questioned Eleusine indica as a genomic donor. Chloroplast (ct) DNA sequence analysis using restriction fragment pattern was used to examine the phylogenetic relationships between E. coracana subsp. coracana (domesticated finger millet), E. coracana subspecies africana (wild finger millet), and E. indica. Eleusine tristachya was included since it is the only other annual diploid species in the genus with a basic chromosome number of x = 9 like finger millet. Eight of the ten restriction endonucleases used had 16 to over 30 restriction sites per genome and were informative. E. coracana subsp. coracana and subsp. africana and E. indica were identical in all the restriction sites surveyed, while the ct genome of E. tristachya differed consistently by at least one mutational event for each restriction enzyme surveyed. This random survey of the ct genomes of these species points out E. indica as one of the genome donors (maternal genome donor) of domesticated finger millet contrary to a previous cytogenetic study. The data also substantiate E. coracana subsp. africana as the progenitor of domesticated finger millet. The disparity between the cytogenetic and the molecular approaches is discussed in light of the problems associated with chromosome pairing and polyploidy. PMID:8608927

  9. Identification of the "A" genome of finger millet using chloroplast DNA.

    Science.gov (United States)

    Hilu, K W

    1988-01-01

    Finger millet (Eleusine corocana subsp. coracana), an important cereal in East Africa and India, is a tetraploid species with unknown genomic components. A recent cytogenetic study confirmed the direct origin of this millet from the tetraploid E. coracana subsp. africana but questioned Eleusine indica as a genomic donor. Chloroplast (ct) DNA sequence analysis using restriction fragment pattern was used to examine the phylogenetic relationships between E. coracana subsp. coracana (domesticated finger millet), E. coracana subspecies africana (wild finger millet), and E. indica. Eleusine tristachya was included since it is the only other annual diploid species in the genus with a basic chromosome number of x = 9 like finger millet. Eight of the ten restriction endonucleases used had 16 to over 30 restriction sites per genome and were informative. E. coracana subsp. coracana and subsp. africana and E. indica were identical in all the restriction sites surveyed, while the ct genome of E, tristachya differed consistently by at least one mutational event for each restriction enzyme surveyed. This random survey of the ct genomes of these species points out E. indica as one of the genome donors (maternal genome donor) of domesticated finger millet contrary to a previous cytogenetic study. The data also substantiate E. coracana subsp. africana as the progenitor of domesticated finger millet. The disparity between the cytogenetic and the molecular approaches is discussed in light of the problems associated with chromosome pairing and polyploidy.

  10. pathogen isolates of Pyricularia grisea in GULU-E finger millet last

    African Journals Online (AJOL)

    ACSS

    Finger millet is basis for food security which directly supports the livelihoods of rural majority living in ... that resistance was partially dominant and additive, based on mid parent values from crosses. .... Description under artificial infection.

  11. Ribosomal DNA variation in finger millet and wild species of Eleusine (Poaceae).

    Science.gov (United States)

    Hilu, K W; Johnson, J L

    1992-04-01

    Finger millet is an important cereal crop in the semi-arid regions of Africa and India. The crop belongs to the grass genus Eleusine, which includes nine annual and perennial species native to Africa except for the New World species E. tristachya. Ribosomal DNA (rDNA) variation in finger millet and related wild species was used to provide information on the origin of the genomes of this tetraploid crop and point out genetic relationships of the crop to other species in the genus. The restriction endonucleases used revealed a lack of variability in the rDNA spacer region in domesticated finger millet. All the rDNA variants of the crop were found in the proposed direct tetraploid ancestor, E. coracana subsp. africana. Wild and domesticated finger millet displayed the phenotypes found in diploid E. indica. Diploid Eleusine tristachya showed some similarity to the crop in some restriction sites. The remaining species were quite distinct in rDNA fragment patterns. The study supports the direct origin of finger millet from subspecies africana shows E. indica to be one of the genome donors of the crop, and demonstrates that none of the other species examined could have donated the second genome of the crop. The rDNA data raise the possibility that wild and domesticated finger millet could have originated as infraspecific polyploid hybrids from different varieties of E. indica.

  12. Stable expression of mtlD gene imparts multiple stress tolerance in finger millet.

    Science.gov (United States)

    Hema, Ramanna; Vemanna, Ramu S; Sreeramulu, Shivakumar; Reddy, Chandrasekhara P; Senthil-Kumar, Muthappa; Udayakumar, Makarla

    2014-01-01

    Finger millet is susceptible to abiotic stresses, especially drought and salinity stress, in the field during seed germination and early stages of seedling development. Therefore developing stress tolerant finger millet plants combating drought, salinity and associated oxidative stress in these two growth stages is important. Cellular protection through osmotic adjustment and efficient free radical scavenging ability during abiotic stress are important components of stress tolerance mechanisms in plants. Mannitol, an osmolyte, is known to scavenge hydroxyl radicals generated during various abiotic stresses and thereby minimize stress damage in several plant species. In this study transgenic finger millet plants expressing the mannitol biosynthetic pathway gene from bacteria, mannitol-1-phosphate dehydrogenase (mtlD), were developed through Agrobacterium tumefaciens-mediated genetic transformation. mtlD gene integration in the putative transgenic plants was confirmed by Southern blot. Further, performance of transgenic finger millet under drought, salinity and oxidative stress was studied at plant level in T1 generation and in T1 and T2 generation seedlings. Results from these experiments showed that transgenic finger millet had better growth under drought and salinity stress compared to wild-type. At plant level, transgenic plants showed better osmotic adjustment and chlorophyll retention under drought stress compared to the wild-type. However, the overall increase in stress tolerance of transgenics for the three stresses, especially for oxidative stress, was only marginal compared to other mtlD gene expressing plant species reported in the literature. Moreover, the Agrobacterium-mediated genetic transformation protocol developed for finger millet in this study can be used to introduce diverse traits of agronomic importance in finger millet.

  13. Stable expression of mtlD gene imparts multiple stress tolerance in finger millet.

    Directory of Open Access Journals (Sweden)

    Ramanna Hema

    Full Text Available Finger millet is susceptible to abiotic stresses, especially drought and salinity stress, in the field during seed germination and early stages of seedling development. Therefore developing stress tolerant finger millet plants combating drought, salinity and associated oxidative stress in these two growth stages is important. Cellular protection through osmotic adjustment and efficient free radical scavenging ability during abiotic stress are important components of stress tolerance mechanisms in plants. Mannitol, an osmolyte, is known to scavenge hydroxyl radicals generated during various abiotic stresses and thereby minimize stress damage in several plant species. In this study transgenic finger millet plants expressing the mannitol biosynthetic pathway gene from bacteria, mannitol-1-phosphate dehydrogenase (mtlD, were developed through Agrobacterium tumefaciens-mediated genetic transformation. mtlD gene integration in the putative transgenic plants was confirmed by Southern blot. Further, performance of transgenic finger millet under drought, salinity and oxidative stress was studied at plant level in T1 generation and in T1 and T2 generation seedlings. Results from these experiments showed that transgenic finger millet had better growth under drought and salinity stress compared to wild-type. At plant level, transgenic plants showed better osmotic adjustment and chlorophyll retention under drought stress compared to the wild-type. However, the overall increase in stress tolerance of transgenics for the three stresses, especially for oxidative stress, was only marginal compared to other mtlD gene expressing plant species reported in the literature. Moreover, the Agrobacterium-mediated genetic transformation protocol developed for finger millet in this study can be used to introduce diverse traits of agronomic importance in finger millet.

  14. An endophytic fungus isolated from finger millet (Eleucine coracona produces anti-fungal natural products

    Directory of Open Access Journals (Sweden)

    Walaa Kamel Mousa

    2015-10-01

    Full Text Available Finger millet is an ancient African cereal crop, domesticated 7000 years ago in Ethiopia, reaching India at 3000 BC. Finger millet is reported to be resistant to various fungal pathogens including Fusarium sp. We hypothesized that finger millet may host beneficial endophytes (plant-colonizing microbes that contribute to the antifungal activity. Here we report the first isolation of endophyte(s from finger millet. Five distinct fungal species were isolated from roots and predicted taxonomically based on 18S rDNA sequencing. Extracts from three putative endophytes inhibited growth of F. graminearum and three other pathogenic Fusarium species. The most potent anti-Fusarium strain (WF4, predicted to be a Phoma sp. was confirmed to behave as an endophyte using pathogenicity and confocal microscopy experiments. Bioassay-guided fractionation of the WF4 extract identified four anti-fungal compounds, viridicatol, tenuazonic acid, alternariol and alternariol monomethyl ether. All the purified compounds caused dramatic breakage of F. graminearum hyphae in vitro. These compounds have not previously been reported to have anti-Fusarium activity. None of the compounds, except for tenuazonic acid, have previously been reported to be produced by Phoma. We conclude that the ancient, disease-tolerant crop, finger millet, is a novel source of endophytic anti-fungal natural products. This paper suggests the value of the crops grown by subsistence farmers as sources of endophytes and their natural products. Application of these natural chemicals to solve real world problems will require further validation.

  15. Finger millet (Eleusine coracana) - an economically viable source for antihypercholesterolemic metabolites production by Monascus purpureus.

    Science.gov (United States)

    Venkateswaran, V; Vijayalakshmi, G

    2010-08-01

    Rice, parboiled rice, finger millet, germinated finger millet, broken wheat, njavara (medicinal rice), sorghum and maize were used as substrates for solid state fermentation of Monascus purpureus at 28°C for 7 days using 2% seed medium as inoculum for the production of its metabolites. The fungus exhibited good growth in all the substrates. The fermented substrates were dried at 45°C and analysed for antihypercholesterolemic metabolite statins by standardized HPLC method and dietary sterol contents by spectrophotometric method using reference standards of statin (pravastatin and lovastatin) and cholesterol, respectively. Germinated finger millet yielded higher total statin production of 5.2 g/kg dry wt with pravastatin and lovastatin content of 4.9 and 0.37 g/kg dry wt respectively than other substrates which range from 1.04-4.41 g/kg. In addition to statin, monascus fermented germinated finger millet yielded dietary sterol of 0.053 g/kg dry wt which is 7.6 folds higher than the control. The value addition of finger millet by germination and fermentation with Monascus purpureus provides scope for development of functional food.

  16. An endophytic fungus isolated from finger millet (Eleusine coracana) produces anti-fungal natural products.

    Science.gov (United States)

    Mousa, Walaa K; Schwan, Adrian; Davidson, Jeffrey; Strange, Philip; Liu, Huaizhi; Zhou, Ting; Auzanneau, France-Isabelle; Raizada, Manish N

    2015-01-01

    Finger millet is an ancient African cereal crop, domesticated 7000 years ago in Ethiopia, reaching India at 3000 BC. Finger millet is reported to be resistant to various fungal pathogens including Fusarium sp. We hypothesized that finger millet may host beneficial endophytes (plant-colonizing microbes) that contribute to the antifungal activity. Here we report the first isolation of endophyte(s) from finger millet. Five distinct fungal species were isolated from roots and predicted taxonomically based on 18S rDNA sequencing. Extracts from three putative endophytes inhibited growth of F. graminearum and three other pathogenic Fusarium species. The most potent anti-Fusarium strain (WF4, predicted to be a Phoma sp.) was confirmed to behave as an endophyte using pathogenicity and confocal microscopy experiments. Bioassay-guided fractionation of the WF4 extract identified four anti-fungal compounds, viridicatol, tenuazonic acid, alternariol, and alternariol monomethyl ether. All the purified compounds caused dramatic breakage of F. graminearum hyphae in vitro. These compounds have not previously been reported to have anti-Fusarium activity. None of the compounds, except for tenuazonic acid, have previously been reported to be produced by Phoma. We conclude that the ancient, disease-tolerant crop, finger millet, is a novel source of endophytic anti-fungal natural products. This paper suggests the value of the crops grown by subsistence farmers as sources of endophytes and their natural products. Application of these natural chemicals to solve real world problems will require further validation.

  17. Insights using the molecular model of Lipoxygenase from Finger millet (Eleusine coracana (L.)).

    Science.gov (United States)

    Tiwari, Apoorv; Avashthi, Himanshu; Jha, Richa; Srivastava, Ambuj; Kumar Garg, Vijay; Wasudev Ramteke, Pramod; Kumar, Anil

    2016-01-01

    Lipoxygenase-1 (LOX-1) protein provides defense against pests and pathogens and its presence have been positively correlated with plant resistance against pathogens. Linoleate is a known substrate of lipoxygenase and it induces necrosis leading to the accumulation of isoflavonoid phytoalexins in plant leaves. Therefore, it is of interest to study the structural features of LOX-1 from Finger millet. However, the structure ofLOX-1 from Finger millet is not yet known. A homology model of LOX-1 from Finger millet is described. Domain architecture study suggested the presence of two domains namely PLAT (Phospho Lipid Acyl Transferase) and lipoxygenase. Molecular docking models of linoleate with lipoxygenase from finger millet, rice and sorghum are reported. The features of docked models showed that finger millet have higher pathogen resistance in comparison to other cereal crops. This data is useful for the molecular cloning of fulllength LOX-1 gene for validating its role in improving plant defense against pathogen infection and for various other biological processes.

  18. Genome and Transcriptome sequence of Finger millet (Eleusine coracana (L.) Gaertn.) provides insights into drought tolerance and nutraceutical properties

    OpenAIRE

    Hittalmani, Shailaja; Mahesh, H. B.; Shirke, Meghana Deepak; Biradar, Hanamareddy; Uday, Govindareddy; Aruna, Y. R.; Lohithaswa, H. C.; Mohanrao, A.

    2017-01-01

    Background Finger millet (Eleusine coracana (L.) Gaertn.) is an important staple food crop widely grown in Africa and South Asia. Among the millets, finger millet has high amount of calcium, methionine, tryptophan, fiber, and sulphur containing amino acids. In addition, it has C4 photosynthetic carbon assimilation mechanism, which helps to utilize water and nitrogen efficiently under hot and arid conditions without severely affecting yield. Therefore, development and utilization of genomic re...

  19. Effect of Ethanol on Germination and Enzyme Activities in Finger millet (Eleusine coracana Gaertn. Seeds

    Directory of Open Access Journals (Sweden)

    S.S. Kulkarni

    2014-08-01

    Full Text Available Influence of ethanol the end product of alcoholic fermentation on the growth of finger millet (var. GPU-28, CO-9 seedlings of two finger millet was studied as a means of evaluating growth responses under anoxia. The germination was delayed by ethanol treatment in case of both the cultivars. Ethanol treatment affected the growth of both radicle and coleoptile of seedlings. In this respect the radicle growth is more sensitive to ethanol than the coleoptile in both varieties of finger millet. The activities of enzymes nitrate reductase, ATPase, acid phosphatase, amylase were reduced by alcohol treatment in germinating seeds of both the cultivars. However, lower concentration of alcohol (1% caused stimulation of peroxidase in var. CO-9. In case of var. GPU-28 showed stimulation of enzyme alkaline phosphatase in both concentration of alcohol.

  20. Genotyping-by-Sequencing Analysis for Determining Population Structure of Finger Millet Germplasm of Diverse Origins

    Directory of Open Access Journals (Sweden)

    Anil Kumar

    2016-07-01

    Full Text Available Finger millet [ (L. Gaertn.] is grown mainly by subsistence farmers in arid and semiarid regions of the world. To broaden its genetic base and to boost its production, it is of paramount importance to characterize and genotype the diverse gene pool of this important food and nutritional security crop. However, as a result of nonavailability of the genome sequence of finger millet, the progress could not be made in realizing the molecular basis of unique qualities of the crop. In the present investigation, attempts have been made to characterize the genetically diverse collection of 113 finger millet accessions through whole-genome genotyping-by-sequencing (GBS, which resulted in a genome-wide set of 23,000 single-nucleotide polymorphisms (SNPs segregating across the entire collection and several thousand SNPs segregating within every accession. A model-based population structure analysis reveals the presence of three subpopulations among the finger millet accessions, which are in parallel with the results of phylogenetic analysis. The observed population structure is consistent with the hypothesis that finger millet was domesticated first in Africa, and from there it was introduced to India some 3000 yr ago. A total of 1128 gene ontology (GO terms were assigned to SNP-carrying genes for three main categories: biological process, cellular component, and molecular function. Facilitated access to high-throughput genotyping and sequencing technologies are likely to improve the breeding process in developing countries, and as such, this data will be very useful to breeders who are working for the genetic improvement of finger millet.

  1. Agrobacterium-mediated transformation of finger millet (Eleusine coracana (L.) Gaertn.) using shoot apex explants.

    Science.gov (United States)

    Ceasar, S Antony; Ignacimuthu, S

    2011-09-01

    A new Agrobacterium-mediated transformation system was developed for finger millet using shoot apex explants. The Agrobacterium strain LBA4404 harboring binary vector pCAMBIA1301, which contained hygromycin phosphotransferase (hptII) as selectable marker gene and β-glucuronidase (GUS) as reporter gene, was used for optimization of transformation conditions. Two finger millet genotypes, GPU 45 and CO 14, were used in this study. The optimal conditions for the Agrobacterium-mediated transformation of finger millet were found to be the co-cultivation of explants obtained on the 16th day after callus induction (DACI), exposure of explants for 30 min to agrobacterial inoculum and 3 days of co-cultivation on filter paper placed on medium supplemented with 100 μM acetosyringone (AS). Addition of 100 μM L: -cysteine in the selection medium enhanced the frequency of transformation and transgenic plant recovery. Both finger millet genotypes were transformed by Agrobacterium. A frequency of 19% transient expression with 3.8% stable transformation was achieved in genotype GPU 45 using optimal conditions. Five stably transformed plants were fully characterized by Southern blot analysis. A segregation analysis was also performed in four R(1) progenies, which showed normal Mendelian pattern of transgene segregation. The inheritance of transgenes in R(1) progenies was also confirmed by Southern blot analysis. This is the first report on Agrobacterium-mediated transformation of finger millet. This study underpins the introduction of numerous agronomically important genes into the genome of finger millet in the future.

  2. Genotyping-by-Sequencing Analysis for Determining Population Structure of Finger Millet Germplasm of Diverse Origins.

    Science.gov (United States)

    Kumar, Anil; Sharma, Divya; Tiwari, Apoorv; Jaiswal, J P; Singh, N K; Sood, Salej

    2016-07-01

    Finger millet [ (L.) Gaertn.] is grown mainly by subsistence farmers in arid and semiarid regions of the world. To broaden its genetic base and to boost its production, it is of paramount importance to characterize and genotype the diverse gene pool of this important food and nutritional security crop. However, as a result of nonavailability of the genome sequence of finger millet, the progress could not be made in realizing the molecular basis of unique qualities of the crop. In the present investigation, attempts have been made to characterize the genetically diverse collection of 113 finger millet accessions through whole-genome genotyping-by-sequencing (GBS), which resulted in a genome-wide set of 23,000 single-nucleotide polymorphisms (SNPs) segregating across the entire collection and several thousand SNPs segregating within every accession. A model-based population structure analysis reveals the presence of three subpopulations among the finger millet accessions, which are in parallel with the results of phylogenetic analysis. The observed population structure is consistent with the hypothesis that finger millet was domesticated first in Africa, and from there it was introduced to India some 3000 yr ago. A total of 1128 gene ontology (GO) terms were assigned to SNP-carrying genes for three main categories: biological process, cellular component, and molecular function. Facilitated access to high-throughput genotyping and sequencing technologies are likely to improve the breeding process in developing countries, and as such, this data will be very useful to breeders who are working for the genetic improvement of finger millet. Copyright © 2016 Crop Science Society of America.

  3. Antioxidant properties of digestive enzyme-treated fibre-rich fractions from wheat, finger millet, pearl millet and sorghum: A comparative evaluation

    Directory of Open Access Journals (Sweden)

    Aisha Siddiq A.

    2015-12-01

    Full Text Available Whole grains are rich in antioxidant components (AC, most of which are bound to fibre fraction and released during digestion. The study investigated the effect of digestive enzymes on the antioxidant properties of fibre-rich fractions from wheat (Triticum aestivum, finger millet (Eleusine coracana, pearl millet (Pennisetum typhoides and sorghum (Sorghum bicolor. Coarse (CF and fine fractions (FF of milled flour were separated using a standard sieve and analysed for nutritional composition, AC extractable in different solvents and antioxidant activity (AA in untreated and enzyme-treated fractions. The CF had a higher range of insoluble dietary fibre (17.26–20.93% than FF (10.65–17.29%. The highest amount of polyphenols and flavonoids was extractable in different solvents from finger millet and pearl millet, respectively. FF of pearl millet showed higher total AA in all solvents. Enzyme-treated samples had a much higher content of AC as well as higher total AA. Free radical scavenging assay revealed that enzyme-treated millet flours had higher activity in comparison to wheat. Between fractions, wheat exhibited variable results. Among millets, CF of finger millet and FF of pearl millet and sorghum had higher AA. In conclusion, digestive enzyme treatment released more AC from grains, and exhibited a higher AA.

  4. [Obtaining the transgenic lines of finger millet Eleusine coracana (L.) Gaertn. With dinitroaniline resistance].

    Science.gov (United States)

    Baer, G Ia; Emets, A I; Blium, Ia B

    2014-01-01

    The current data is dedicated to the study of bioballistic and Agrobacterium-mediated transformation of finger millet with the constructs carrying the mutant alpha-tubulin gene (TUAm 1), isolated from R-biotype goosegrass (Eleusine indica L.), for the decision of problem of dinitroaniline-resistance. It was found that 10 microM of trifluralin is optimal for the selection of transgene plants of finger millet. PCR analysis of transformed lines confirmed the transgene nature of plants. The analysis of seed of T1 oftransgene lines confirmed heterozygous character of inheritance of the resistance.

  5. Influence of hydrothermal processing on functional properties and grain morphology of finger millet.

    Science.gov (United States)

    Dharmaraj, Usha; Meera, M S; Reddy, S Yella; Malleshi, Nagappa G

    2015-03-01

    Finger millet was hydrothermally processed followed by decortication. Changes in color, diameter, density, sphericity, thermal and textural characteristics and also some of the functional properties of the millet along with the grain morphology of the kernels after hydrothermal processing and decortication were studied. It was observed that, the millet turned dark after hydrothermal processing and color improved over native millet after decortication. A slight decrease in grain diameter was observed but sphericity of the grains increased on decortication. The soft and fragile endosperm turned into a hard texture and grain hardness increased by about 6 fold. Hydrothermal processing increased solubility and swelling power of the millet at ambient temperature. Pasting profile indicated that, peak viscosity decreased significantly on hydrothermal processing and both hydrothermally processed and decorticated millet exhibited zero breakdown viscosity. Enthalpy was negative for hydrothermally processed millet and positive for decorticated grains. Microscopic studies revealed that the orderly structure of endosperm changed to a coherent mass after hydrothermal processing and the different layers of seed coat get fused with the endosperm.

  6. Genome and Transcriptome sequence of Finger millet (Eleusine coracana (L.) Gaertn.) provides insights into drought tolerance and nutraceutical properties.

    Science.gov (United States)

    Hittalmani, Shailaja; Mahesh, H B; Shirke, Meghana Deepak; Biradar, Hanamareddy; Uday, Govindareddy; Aruna, Y R; Lohithaswa, H C; Mohanrao, A

    2017-06-15

    Finger millet (Eleusine coracana (L.) Gaertn.) is an important staple food crop widely grown in Africa and South Asia. Among the millets, finger millet has high amount of calcium, methionine, tryptophan, fiber, and sulphur containing amino acids. In addition, it has C4 photosynthetic carbon assimilation mechanism, which helps to utilize water and nitrogen efficiently under hot and arid conditions without severely affecting yield. Therefore, development and utilization of genomic resources for genetic improvement of this crop is immensely useful. Experimental results from whole genome sequencing and assembling process of ML-365 finger millet cultivar yielded 1196 Mb covering approximately 82% of total estimated genome size. Genome analysis showed the presence of 85,243 genes and one half of the genome is repetitive in nature. The finger millet genome was found to have higher colinearity with foxtail millet and rice as compared to other Poaceae species. Mining of simple sequence repeats (SSRs) yielded abundance of SSRs within the finger millet genome. Functional annotation and mining of transcription factors revealed finger millet genome harbors large number of drought tolerance related genes. Transcriptome analysis of low moisture stress and non-stress samples revealed the identification of several drought-induced candidate genes, which could be used in drought tolerance breeding. This genome sequencing effort will strengthen plant breeders for allele discovery, genetic mapping, and identification of candidate genes for agronomically important traits. Availability of genomic resources of finger millet will enhance the novel breeding possibilities to address potential challenges of finger millet improvement.

  7. Development of transgenic finger millet (Eleusine coracana (L.) Gaertn.) resistant to leaf blast disease.

    Science.gov (United States)

    Ignacimuthu, S; Ceasar, S Antony

    2012-03-01

    Finger millet plants conferring resistance to leaf blast disease have been developed by inserting a rice chitinase (chi11) gene through Agrobacterium-mediated transformation. Plasmid pHyg-Chi.11 harbouring the rice chitinase gene under the control of maize ubiquitin promoter was introduced into finger millet using Agrobacterium strain LBA4404 (pSB1). Transformed plants were selected and regenerated on hygromycin-supplemented medium. Transient expression of transgene was confirmed by GUS histochemical staining. The incorporation of rice chitinase gene in R0 and R1 progenies was confirmed by PCR and Southern blot analyses. Expression of chitinase gene in finger millet was confirmed by Western blot analysis with a barley chitinase antibody. A leaf blast assay was also performed by challenging the transgenic plants with spores of Pyricularia grisea. The frequency of transient expression was 16.3% to 19.3%. Stable frequency was 3.5% to 3.9%. Southern blot analysis confirmed the integration of 3.1 kb chitinase gene. Western blot analysis detected the presence of 35 kDa chitinase enzyme. Chitinase activity ranged from 19.4 to 24.8. In segregation analysis, the transgenic R1 lines produced three resistant and one sensitive for hygromycin, confirming the normal Mendelian pattern of transgene segregation. Transgenic plants showed high level of resistance to leaf blast disease compared to control plants. This is the first study reporting the introduction of rice chitinase gene into finger millet for leaf blast resistance.

  8. Effect of germination and autoclaving of sprouted finger millet and kidney beans on cyanide content.

    Science.gov (United States)

    Chove, Bernard E; Mamiro, Peter R S

    2010-10-01

    Cyanide contents of locally purchased brown finger millet (Eleusine corocana L. Gaertner) and brown speckled kidney bean seeds (Phaseolus vulgaries var. Rose Coco) were determined using raw, germinated and autoclaved samples. The aim was to establish the extent of cyanide content increase resulting from the germination process and the effectiveness of the autoclaving process on the reduction of cyanide levels in the samples, for safety considerations. Autoclaving was carried out at 121degree C for 20 minutes. It was found that germination increased the cyanide content by 2.11 to 2.14 fold in finger millet for laboratory processed samples. In the case of kidney beans the increment was 1.76 to 1.77 fold for laboratory samples. The increments for field processed samples were in the same range as those for laboratory samples. Autoclaving reduced the cyanide content to between 61.8 and 65.9 % of the original raw contents for finger millet and between 56.6 to 57.8% in the case of kidney beans. The corresponding reductions for field samples were also found to be within the same ranges as the laboratory processed samples. It was concluded that autoclaving significantly reduced the cyanide levels in germinated finger millet and kidney beans.

  9. Transcriptome wide identification and characterization of starch branching enzyme in finger millet.

    Science.gov (United States)

    Tyagi, Rajhans; Tiwari, Apoorv; Garg, Vijay Kumar; Gupta, Sanjay

    2017-01-01

    Starch-branching enzymes (SBEs) are one of the four major enzyme classes involved in starch biosynthesis in plants and play an important role in determining the structure and physical properties of starch granules. Multiple SBEs are involved in starch biosynthesis in plants. Finger millet is calcium rich important serial crop belongs to grass family and the transcriptome data of developing spikes is available on NCBI. In this study it was try to find out the gene sequence of starch branching enzyme and annotate the sequence and submit the sequence for further use. Rice SBE sequence was taken as reference and for characterization of the sequence different in silico tools were used. Four domains were found in the finger millet Starch branching enzyme like alpha amylase catalytic domain from 925 to2172 with E value 0, N-terminal Early set domain from 634 to 915 with E value 1.62 e-42, Alpha amylase, C-terminal all-beta domain from 2224 to 2511 with E value 5.80e-24 and 1,4-alpha-glucan-branching enzyme from 421 to 2517 with E value 0. Major binding interactions with the GLC (alpha-d-glucose), CA (calcium ion), GOL (glycerol), TRS (2-amino-2-hydroxymethylpropane- 1, 3-diol), MG (magnesium ion) and FLC (citrate anion) are fond with different residues. It was found in the phylogenetic study of the finger millet SBE with the 6 species of grass family that two clusters were form A and B. In cluster A, finger millet showed closeness with Oryzasativa and Setariaitalica, Sorghum bicolour and Zea mays while cluster B was formed with Triticumaestivum and Brachypodium distachyon. The nucleotide sequence of Finger millet SBE was submitted to NCBI with the accession no KY648913 and protein structure of SBE of finger millet was also submitted in PMDB with the PMDB id - PM0080938. This research presents a comparative overview of Finger millet SBE and includes their properties, structural and functional characteristics, and recent developments on their post-translational regulation.

  10. SCAR marker specific to detect Magnaporthe grisea infecting finger millets (Eleusine coracana).

    Science.gov (United States)

    Gnanasing Jesumaharaja, L; Manikandan, R; Raguchander, T

    2016-09-01

    To determine the molecular variability and develop specific Sequence Characterized Amplified Region (SCAR) marker for the detection of Magnaporthe grisea causing blast disease in finger millet. Random amplified polymorphic DNA (RAPD) was performed with 14 isolates of M. grisea using 20 random primers. SCAR marker was developed for accurate and specific detection of M. grisea infecting only finger millets. The genetic similarity coefficient within each group and variation between the groups was observed. Among the primers, OPF-08 generated a RAPD polymorphic profile that showed common fragment of 478 bp in all the isolates. This fragment was cloned and sequenced. SCAR primers, Mg-SCAR-FP and Mg-SCAR-RP, were designed using sequence of the cloned product. The specificity of the SCAR primers was evaluated using purified DNA from M. grisea isolates from finger millets and other pathogens viz., Pyricularia oryzae, Colletotrichum gloeosporioides, Colletotrichum falcatum and Colletotrichum capcisi infecting different crops. The SCAR primers amplified only specific 460 bp fragment from DNA of M. grisea isolates and this fragment was not amplified in other pathogens tested. SCAR primers distinguish blast disease of finger millet from rice as there is no amplification in the rice blast pathogen. PCR-based SCAR marker is a convenient tool for specific and rapid detection of M. grisea in finger millets. Genetic diversity in fungal population helps in developing a suitable SCAR marker to identify the blast pathogen at the early stage of infection. © 2016 The Society for Applied Microbiology.

  11. Multiple hybrid de novo genome assembly of finger millet, an orphan allotetraploid crop.

    Science.gov (United States)

    Hatakeyama, Masaomi; Aluri, Sirisha; Balachadran, Mathi Thumilan; Sivarajan, Sajeevan Radha; Patrignani, Andrea; Grüter, Simon; Poveda, Lucy; Shimizu-Inatsugi, Rie; Baeten, John; Francoijs, Kees-Jan; Nataraja, Karaba N; Reddy, Yellodu A Nanja; Phadnis, Shamprasad; Ravikumar, Ramapura L; Schlapbach, Ralph; Sreeman, Sheshshayee M; Shimizu, Kentaro K

    2017-09-05

    Finger millet (Eleusine coracana (L.) Gaertn) is an important crop for food security because of its tolerance to drought, which is expected to be exacerbated by global climate changes. Nevertheless, it is often classified as an orphan/underutilized crop because of the paucity of scientific attention. Among several small millets, finger millet is considered as an excellent source of essential nutrient elements, such as iron and zinc; hence, it has potential as an alternate coarse cereal. However, high-quality genome sequence data of finger millet are currently not available. One of the major problems encountered in the genome assembly of this species was its polyploidy, which hampers genome assembly compared with a diploid genome. To overcome this problem, we sequenced its genome using diverse technologies with sufficient coverage and assembled it via a novel multiple hybrid assembly workflow that combines next-generation with single-molecule sequencing, followed by whole-genome optical mapping using the Bionano Irys® system. The total number of scaffolds was 1,897 with an N50 length >2.6 Mb and detection of 96% of the universal single-copy orthologs. The majority of the homeologs were assembled separately. This indicates that the proposed workflow is applicable to the assembly of other allotetraploid genomes. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  12. Production of improved infant porridges from pearl millet using a lactic acid fermentation step and addition of sorghum malt to reduce viscosity of porridge with high protein, energy and solids (30%) content

    CSIR Research Space (South Africa)

    Thaoge, ML

    2003-04-01

    Full Text Available With the aim of improving the safety and nutritional quality of traditional African weaning porridge, the reduction of the viscosity of high solids fermented pearl millet porridge by addition of sorghum malt (amylase rich flour, ARF...

  13. Use of Mutation Breeding Technique in Improving Finger Millet in Northern Zambia

    International Nuclear Information System (INIS)

    Msikita, R.N.

    2002-01-01

    Many breeders have observed that induced mutation increases genetic variability, and the expose to mutagenic agents increases mutation frequency. Studies have indicated the effect in height reduction, increased yield components,disease resistance, in crop like rice and wheat. A study was conducted in finger millet in thr Northern part of Zambia (Region III), a high rainfall area, aiming at improving finger length, number of fingers till ring capacity in order to increase the yield. the seed of Nyika variety, popular to farmers due to its medium maturity, palm shaped fingers (six fingers on average), and light brown grain. Three quantities of seed were irradiated at 15Kr, 20Kr and 30Kr doses. A dose of 15Kr of gamma rays irradiation continued to create good genetic change in the exposed material. These observations clearly suggest that 15Kr dose of gamma rays is the optimum one to expose/irradiate finger millet to create desired genetic changes. The results of 2000/2001 were not significantly different. However, FMM 165 had better yields (3193 Kg) than FMM 175 in Misamfu, while FMM 175 yielded better (3272 Kg) in Chinsali. During 2001/2002 both FMMs performed well in the national finger number of 10 per head. There were also highly significant differences among finger lengths.FMM 165 had finger length of 10.3 cm. Concerning grain yield FMM 165 and FMM 175 had 3802 and 3864 Kg/ha, respectively, which were above the overall mean 3864 Kg/ha. Grain yield correlated positively with finger number with an r-value of 0.19 and finger length r-value of 0.22 although it was not significant at 1% or 5%. Meanwhile in the advance trial there were significant differences among genotypes in finger number. Both FMMs had 9 fingers above the overall mean of 8.8. In the finger length there were highly significant differences. FMM 175 had a length of 11.5 cm while FMM 165 had 10.4 cm. There were highly significant differences among the genotypes in yield. FMM 165 (4636 Kg) and FMM 175

  14. Identification of SNP and SSR Markers in Finger Millet Using Next Generation Sequencing Technologies.

    Science.gov (United States)

    Gimode, Davis; Odeny, Damaris A; de Villiers, Etienne P; Wanyonyi, Solomon; Dida, Mathews M; Mneney, Emmarold E; Muchugi, Alice; Machuka, Jesse; de Villiers, Santie M

    2016-01-01

    Finger millet is an important cereal crop in eastern Africa and southern India with excellent grain storage quality and unique ability to thrive in extreme environmental conditions. Since negligible attention has been paid to improving this crop to date, the current study used Next Generation Sequencing (NGS) technologies to develop both Simple Sequence Repeat (SSR) and Single Nucleotide Polymorphism (SNP) markers. Genomic DNA from cultivated finger millet genotypes KNE755 and KNE796 was sequenced using both Roche 454 and Illumina technologies. Non-organelle sequencing reads were assembled into 207 Mbp representing approximately 13% of the finger millet genome. We identified 10,327 SSRs and 23,285 non-homeologous SNPs and tested 101 of each for polymorphism across a diverse set of wild and cultivated finger millet germplasm. For the 49 polymorphic SSRs, the mean polymorphism information content (PIC) was 0.42, ranging from 0.16 to 0.77. We also validated 92 SNP markers, 80 of which were polymorphic with a mean PIC of 0.29 across 30 wild and 59 cultivated accessions. Seventy-six of the 80 SNPs were polymorphic across 30 wild germplasm with a mean PIC of 0.30 while only 22 of the SNP markers showed polymorphism among the 59 cultivated accessions with an average PIC value of 0.15. Genetic diversity analysis using the polymorphic SNP markers revealed two major clusters; one of wild and another of cultivated accessions. Detailed STRUCTURE analysis confirmed this grouping pattern and further revealed 2 sub-populations within wild E. coracana subsp. africana. Both STRUCTURE and genetic diversity analysis assisted with the correct identification of the new germplasm collections. These polymorphic SSR and SNP markers are a significant addition to the existing 82 published SSRs, especially with regard to the previously reported low polymorphism levels in finger millet. Our results also reveal an unexploited finger millet genetic resource that can be included in the regional

  15. Identification of SNP and SSR Markers in Finger Millet Using Next Generation Sequencing Technologies.

    Directory of Open Access Journals (Sweden)

    Davis Gimode

    Full Text Available Finger millet is an important cereal crop in eastern Africa and southern India with excellent grain storage quality and unique ability to thrive in extreme environmental conditions. Since negligible attention has been paid to improving this crop to date, the current study used Next Generation Sequencing (NGS technologies to develop both Simple Sequence Repeat (SSR and Single Nucleotide Polymorphism (SNP markers. Genomic DNA from cultivated finger millet genotypes KNE755 and KNE796 was sequenced using both Roche 454 and Illumina technologies. Non-organelle sequencing reads were assembled into 207 Mbp representing approximately 13% of the finger millet genome. We identified 10,327 SSRs and 23,285 non-homeologous SNPs and tested 101 of each for polymorphism across a diverse set of wild and cultivated finger millet germplasm. For the 49 polymorphic SSRs, the mean polymorphism information content (PIC was 0.42, ranging from 0.16 to 0.77. We also validated 92 SNP markers, 80 of which were polymorphic with a mean PIC of 0.29 across 30 wild and 59 cultivated accessions. Seventy-six of the 80 SNPs were polymorphic across 30 wild germplasm with a mean PIC of 0.30 while only 22 of the SNP markers showed polymorphism among the 59 cultivated accessions with an average PIC value of 0.15. Genetic diversity analysis using the polymorphic SNP markers revealed two major clusters; one of wild and another of cultivated accessions. Detailed STRUCTURE analysis confirmed this grouping pattern and further revealed 2 sub-populations within wild E. coracana subsp. africana. Both STRUCTURE and genetic diversity analysis assisted with the correct identification of the new germplasm collections. These polymorphic SSR and SNP markers are a significant addition to the existing 82 published SSRs, especially with regard to the previously reported low polymorphism levels in finger millet. Our results also reveal an unexploited finger millet genetic resource that can be included

  16. Assessment of Genetic Diversity of Some Finger Millet (Eleusine coracana (L. Gaertn. Accessions Using Morphological Markers

    Directory of Open Access Journals (Sweden)

    D.V.S. Kaluthanthri

    2017-03-01

    Full Text Available AbstractGermplasm characterization is an important link between conservation and utilizationof plant genetic resources. The study was conducted to characterize randomly selected 20finger millet germplasm accessions obtained from Plant Genetic Resource Center,Gannoruwa, Sri Lanka using morphological markers. Morphological study was carried outusing Randomized Complete Block Design (RCBD and 15 morphological markers wererecorded. Analysis of variance (ANOVA results for quantitative morphological charactersrevealed that all quantitative morphological characters measured differed significantly(p˂0.05 among the accessions used for the study, indicating higher levels of morphologicaldiversity. According to the ANOVA results, days to flowering and days to maturity showhigh level of predictive capability while flag leaf length and number of productive tillersshow comparatively low level of predictive capability. Principal component analysisindicated that morphological characters such as days to flowering, finger number and yieldper plant were the important traits contributing for the overall variability implying thatbreeding effort on those traits can meet the targeted objective. The clustering pattern ofstudied finger millet accessions based on morphological markers comprised of two majorclusters. Both clusters comprised of Indian accessions those conserved at PGRC, Gannoruwaand as well as Sri Lankan accessions.Results of the study suggest a considerable morphological variability, which couldexist among the studied traits. Furthermore, this study revealed that the genetic diversityexisted irrespective to the geographical origin. This finding justifies the importance ofgermplasm characterization.Keywords: Finger Millet, Morphological Markers, Germplasm Accessions, GeneticDiversity, Crop Improvement

  17. Effect of Fermentation and Cooking on Soluble and Bound Phenolic Profiles of Finger Millet Sour Porridge.

    Science.gov (United States)

    Gabaza, Molly; Shumoy, Habtu; Muchuweti, Maud; Vandamme, Peter; Raes, Katleen

    2016-10-12

    The aim of this study was to evaluate the soluble and bound phenolic content of finger millet and the impact of process induced changes on phenolic profiles of their sour porridge. Finger millet porridge and intermediate products were collected from four groups of households in the Hwedza communal area, Zimbabwe, after which soluble and bound phenolic compounds (PC) including condensed tannins (CT) were quantified. Bound PC and CT contributed 95% of the total PC and CT. The CT were only detected in the red varieties. Major individual PC identified were catechin occurring in the soluble fraction only, while ferulic, sinapic, and salicylic acid were mainly present in the bound fraction. Fermentation and cooking caused a more than 2-fold increase in soluble PC, CT, and individual PC. Improved traditional processing techniques optimized for improved bioavailability and health benefits of phenolics are highly relevant for the low income populations.

  18. Phenotypic characterization of Ethiopian finger millet accessions (Eleusine coracana (L. Gaertn, for their agronomically important traits

    Directory of Open Access Journals (Sweden)

    Tesfaye Kassahun

    2017-12-01

    Full Text Available Cereal finger millet (Eleusine coracana (L. Gaertn is one of the most promising vital crops of Asia and Africa in the face of climate change. It has a capacity to adapt to extreme environmental conditions and can be grown under a wide range of wider agroecology. It is believed to be originated in the highlands of Ethiopia and then disseminated across the globe. It is mainly cultivated as dietary staple food for humans, animal feeds and also used as medicinal crop. Though finger millet is recognized as the most important staple crop, particularly for the poor people in dry and semidry areas, it has been neglected and given little concern in mainstreaming the crop for its improvement research.

  19. Immunomodulatory activity of purified arabinoxylans from finger millet (Eleusine coracana, v. Indaf 15) bran.

    Science.gov (United States)

    Savitha Prashanth, M R; Shruthi, R R; Muralikrishna, G

    2015-09-01

    Biological activities of alkali extracted (Barium hydroxide: BE-480 kDa, Potassium hydroxide: KE1-1080 and KE2-40 kDa), purified arabinoxylans (AX) from the finger millet bran varying in their molecular weight, phenolic acid content, arabinose to xylose ratios were evaluated for their immune-stimulatory activities using murine lymphocytes and peritoneal exudate macrophages. All three purified AX displayed significant (p 2 fold) and macrophage phagocytosis than KE1 and KE2. The above results clearly documented that the immunostimulatory activity of arabinoxylans is directly proportional to the amount of ferulic acid content (0.11 mg/100 g), whereas molecular weight as well as arabinose/xylose ratio, did not have any bearing. Purified AX from the finger millet bran can be explored as a potent natural immunomodulator.

  20. Genetic diversity for grain Zn concentration in finger millet genotypes: Potential for improving human Zn nutrition

    Directory of Open Access Journals (Sweden)

    Ramegowda Yamunarani

    2016-06-01

    Full Text Available Nearly half of the world population suffers from micronutrient malnutrition, particularly Zn deficiency. It is important to understand genetic variation for uptake and translocation behaviors of Zn in relevant crop species to increase Zn concentration in edible parts. In the present study, genetic variation in grain Zn concentration of 319 finger millet genotypes was assessed. Large genetic variation was found among the genotypes, with concentrations ranging from 10 to 86 μg g− 1 grain. Uptake and translocation studies with Zn/65Zn application in 12 selected low-Zn genotypes showed wide variation in root uptake and shoot translocation, with genotypes GEC331 and GEC164 showing greater uptake and translocation. Genotypes GEC164 and GEC543 showed increased grain Zn concentration. Genotypes GEC331 and GEC164 also showed improved yield under Zn treatment. Appreciable variation in grain Zn concentration among finger millet genotypes found in this study offers opportunities to improve Zn nutrition through breeding.

  1. Proteomic analysis of JAZ interacting proteins under methyl jasmonate treatment in finger millet.

    Science.gov (United States)

    Sen, Saswati; Kundu, Sangeeta; Dutta, Samir Kr

    2016-11-01

    Jasmonic acid (JA) signaling pathway in plants is activated against various developmental processes as well as biotic and abiotic stresses. The Jasmonate ZIM-domain (JAZ) protein family, the key regulator of plant JA signaling pathway, also participates in phytohormone crosstalk. This is the first study revealing the in vivo interactions of finger millet (Eleusine coracana (L.) Gaertn.) JAZ protein (EcJAZ) under methyl jasmonate (MJ) treatment. The aim of the study was to explore not only the JA signaling pathway but also the phytohormone signaling crosstalk of finger millet, a highly important future crop. From the MJ-treated finger millet seedlings, the EcJAZ interacting proteins were purified by affinity chromatography with the EcJAZ-matrix. Twenty-one proteins of varying functionalities were successfully identified by MALDI-TOF-TOF Mass spectrometry. Apart from the previously identified JAZ binding proteins, most prominently, EcJAZ was found to interact with transcription factors like NAC, GATA and also with Cold responsive protein (COR), etc. that might have extended the range of functionalities of JAZ proteins. Moreover, to evaluate the interactions of EcJAZ in the JA-co-receptor complex, we generated ten in-silico models containing the EcJAZ degron and the COI1-SKP1 of five monocot cereals viz., rice, wheat, maize, Sorghum and Setaria with JA-Ile or coronatine. Our results indicated that the EcJAZ protein of finger millet could act as the signaling hub for the JA and other phytohormone signaling pathways, in response to a diverse set of stressors and developmental cues to provide survival fitness to the plant. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  2. Improved production systems for traditional food crops: The case of finger millet in Western Kenya

    OpenAIRE

    Christina Handschuch; Meike Wollni

    2013-01-01

    Increasing agricultural productivity through the dissemination of improved cropping practices remains one of the biggest challenges of this century. A considerable amount of literature is dedicated to the adoption of improved cropping practices among smallholder farmers in developing countries. While most studies focus on cash crops or main staple crops, traditional food grains like finger millet have received little attention in the past decades. The present study aims to assess the factors ...

  3. Effect of malt pretreatment and fermentation on anti-nutritional factors and mineral bioavailability of pearl millet (Pennisetum glaucum L.)

    International Nuclear Information System (INIS)

    Abdelrahman, S. M.

    2004-11-01

    pearl millet (pennisetum glaucum L.) is a source of carbohydrate, protein and minerals that is comparable to other common cereal grains. However, anti nutrient factors like phytate and polyphenols reduce nutrient bioavailability which can be improved by suitable processing methods such as germination and fermentation with and without malt pretreatment. In this study of 8 pearl millet cultivars Ashana, Dahabaya, Dembi, GB-87-35, Kordofani, Madelkawaya, population 1Shambat and Ugandi were investigated. Results showed that pearl millet contained 7.7-8.9% moisture, 1.6-23% ash, 11.4-13.0% protein, 4.0-7.7% oil and 2.1-3.2% crude fiber. Mineral contents were 13.0-19.4, 370.0-547.5, 70.3-93.3, 49.1-61.9 and 551.0-1290.4 mg/100 g for Na,K,Mg, Ca and P respectively and 1.3-1.8, 7.5-11.7, 0.8-1.7, 0.5-1.5 and 0.062-0.103 mg/100 g for Zn, Fe, Mn, Cu and Co respectively. HCI-extractability of these minerals (an index of their bioavailability to humans) were 63.1-73.3% Na, 64.9-73.3% K, 55.7-61.4% mg, 27.7-88.3% Ca, 31.0-38.5% P, 41.2-45.9% Zn, 22.5-27.7% Fe, 44.3-48.8% Mn, 21.3-28.6% Cu and 85.3-88.6% CO. Phytic acid content ranged from 422.3-1101.0 mg/100 g and polyphenol ranged from 306.7-669.4 mg/100 g. Cooking caused slight increase in mineral content and significantly (p<0.01) improved the bioavailability of all the minerals investigated; phytic acid reduced by 6-10% and polyphenols by 6-8%. Germination for 2,4 and 6- days showed significant (P<0.01) differences in the concentration of minerals during the course of germination.Total content of Fe, Zn and Mn were increased significantly (P<0.01) for all cultivars. The bioavailability of all the minerals was significantly (P<0.01) improved throughout all the time intervals of germination. Phytic acid was reduced by 66.3-81.0% after 6- days of germination while polyphenol content was reduced by 34.3-44.0%. Fermentation of cultivars of : Ashana and Dembi affected the minerals content and significantly (P<0.01) improved the

  4. Bioaccessible nutrients and bioactive components from fortified products prepared using finger millet (Eleusine coracana).

    Science.gov (United States)

    Oghbaei, Morteza; Prakash, Jamuna

    2012-08-30

    Finger millet (Eleusine coracana), a staple food in semi-arid parts of the world, is a rich source of nutrients and bioactive components comparable to rice and wheat but with higher fibre content. Unprocessed and processed finger millet (whole flour (WFM), sieved flour (SFM), wafers and vermicelli with altered matrices (added Fe or Zn or reduced fibre)) were analysed for chemical composition, bioaccessible Fe, Zn and Ca, in vitro digestible starch (IVSD) and protein (IVPD) and bioactive components (polyphenols and flavonoids). WFM and SFM flours differed significantly in their composition. Sieving decreased the content of both nutrients and antinutrients in WFM but increased their digestibility/bioaccessibility. WFM products with Zn and Fe showed highest IVPD, whereas SFM products with Fe showed highest IVSD. Products with externally added Fe and Zn showed maximum bioaccessibility of Fe and Zn respectively. WFM had the highest levels of total polyphenols and flavonoids, 4.18 and 15.85 g kg⁻¹ respectively; however, bioaccessibility was highest in SFM vermicelli. The availability of nutrients and bioactive components was influenced by both processing methods and compositional alterations of the food matrix in finger millet products, and bioaccessibility of all constituents was higher in vermicelli (wet matrix) than in wafers (dry matrix). Copyright © 2012 Society of Chemical Industry.

  5. Harnessing Finger Millet to Combat Calcium Deficiency in Humans: Challenges and Prospects.

    Science.gov (United States)

    Puranik, Swati; Kam, Jason; Sahu, Pranav P; Yadav, Rama; Srivastava, Rakesh K; Ojulong, Henry; Yadav, Rattan

    2017-01-01

    Humans require more than 20 mineral elements for healthy body function. Calcium (Ca), one of the essential macromineral, is required in relatively large quantities in the diet for maintaining a sound overall health. Young children, pregnant and nursing women in marginalized and poorest regions of the world, are at highest risk of Ca malnutrition. Elderly population is another group of people most commonly affected by Ca deficiency mainly in the form of osteoporosis and osteopenia. Improved dietary intake of Ca may be the most cost-effective way to meet such deficiencies. Finger millet [ Eleusine coracana (L.) Gaertn.], a crop with inherently higher Ca content in its grain, is an excellent candidate for understanding genetic mechanisms associated with Ca accumulation in grain crops. Such knowledge will also contribute toward increasing Ca contents in other staple crops consumed on daily basis using plant-breeding (also known as biofortification) methods. However, developing Ca-biofortified finger millet to reach nutritional acceptability faces various challenges. These include identifying and translating the high grain Ca content to an adequately bioavailable form so as to have a positive impact on Ca malnutrition. In this review, we assess some recent advancements and challenges for enrichment of its Ca value and present possible inter-disciplinary prospects for advancing the actual impact of Ca-biofortified finger millet.

  6. Harnessing Finger Millet to Combat Calcium Deficiency in Humans: Challenges and Prospects

    Directory of Open Access Journals (Sweden)

    Swati Puranik

    2017-07-01

    Full Text Available Humans require more than 20 mineral elements for healthy body function. Calcium (Ca, one of the essential macromineral, is required in relatively large quantities in the diet for maintaining a sound overall health. Young children, pregnant and nursing women in marginalized and poorest regions of the world, are at highest risk of Ca malnutrition. Elderly population is another group of people most commonly affected by Ca deficiency mainly in the form of osteoporosis and osteopenia. Improved dietary intake of Ca may be the most cost-effective way to meet such deficiencies. Finger millet [Eleusine coracana (L. Gaertn.], a crop with inherently higher Ca content in its grain, is an excellent candidate for understanding genetic mechanisms associated with Ca accumulation in grain crops. Such knowledge will also contribute toward increasing Ca contents in other staple crops consumed on daily basis using plant-breeding (also known as biofortification methods. However, developing Ca-biofortified finger millet to reach nutritional acceptability faces various challenges. These include identifying and translating the high grain Ca content to an adequately bioavailable form so as to have a positive impact on Ca malnutrition. In this review, we assess some recent advancements and challenges for enrichment of its Ca value and present possible inter-disciplinary prospects for advancing the actual impact of Ca-biofortified finger millet.

  7. Characterization of Antifungal Natural Products Isolated from Endophytic Fungi of Finger Millet (Eleusine coracana).

    Science.gov (United States)

    Mousa, Walaa Kamel; Schwan, Adrian L; Raizada, Manish N

    2016-09-03

    Finger millet is an ancient African-Indian crop that is resistant to many pathogens including the fungus, Fusarium graminearum. We previously reported the first isolation of putative fungal endophytes from finger millet and showed that the crude extracts of four strains had anti-Fusarium activity. However, active compounds were isolated from only one strain. The objectives of this study were to confirm the endophytic lifestyle of the three remaining anti-Fusarium isolates, to identify the major underlying antifungal compounds, and to initially characterize the mode(s) of action of each compound. Results of confocal microscopy and a plant disease assay were consistent with the three fungal strains behaving as endophytes. Using bio-assay guided fractionation and spectroscopic structural elucidation, three anti-Fusarium secondary metabolites were purified and characterized. These molecules were not previously reported to derive from fungi nor have antifungal activity. The purified antifungal compounds were: 5-hydroxy 2(3H)-benzofuranone, dehydrocostus lactone (guaianolide sesquiterpene lactone), and harpagoside (an iridoide glycoside). Light microscopy and vitality staining were used to visualize the in vitro interactions between each compound and Fusarium; the results suggested a mixed fungicidal/fungistatic mode of action. We conclude that finger millet possesses fungal endophytes that can synthesize anti-fungal compounds not previously reported as bio-fungicides against F. graminearum.

  8. Nutraceutical Value of Finger Millet [Eleusine coracana (L.) Gaertn.], and Their Improvement Using Omics Approaches.

    Science.gov (United States)

    Kumar, Anil; Metwal, Mamta; Kaur, Sanveen; Gupta, Atul K; Puranik, Swati; Singh, Sadhna; Singh, Manoj; Gupta, Supriya; Babu, B K; Sood, Salej; Yadav, Rattan

    2016-01-01

    The science of nutritional biology has progressed extensively over the last decade to develop food-based nutraceuticals as a form of highly personalized medicine or therapeutic agent. Finger millet [Eleusine coracana (L.) Gaertn.] is a crop with potentially tremendous but under-explored source of nutraceutical properties as compared to other regularly consumed cereals. In the era of growing divide and drawback of nutritional security, these characteristics must be harnessed to develop finger millet as a novel functional food. In addition, introgression of these traits into other staple crops can improve the well-being of the general population on a global scale. The objective of this review is to emphasize the importance of biofortification of finger millet in context of universal health and nutritional crisis. We have specifically highlighted the role that recent biotechnological advancements have to offer for enrichment of its nutritional value and how these developments can commission to the field of nutritional biology by opening new avenues for future research.

  9. Characterization of Antifungal Natural Products Isolated from Endophytic Fungi of Finger Millet (Eleusine coracana

    Directory of Open Access Journals (Sweden)

    Walaa Kamel Mousa

    2016-09-01

    Full Text Available Finger millet is an ancient African-Indian crop that is resistant to many pathogens including the fungus, Fusarium graminearum. We previously reported the first isolation of putative fungal endophytes from finger millet and showed that the crude extracts of four strains had anti-Fusarium activity. However, active compounds were isolated from only one strain. The objectives of this study were to confirm the endophytic lifestyle of the three remaining anti-Fusarium isolates, to identify the major underlying antifungal compounds, and to initially characterize the mode(s of action of each compound. Results of confocal microscopy and a plant disease assay were consistent with the three fungal strains behaving as endophytes. Using bio-assay guided fractionation and spectroscopic structural elucidation, three anti-Fusarium secondary metabolites were purified and characterized. These molecules were not previously reported to derive from fungi nor have antifungal activity. The purified antifungal compounds were: 5-hydroxy 2(3H-benzofuranone, dehydrocostus lactone (guaianolide sesquiterpene lactone, and harpagoside (an iridoide glycoside. Light microscopy and vitality staining were used to visualize the in vitro interactions between each compound and Fusarium; the results suggested a mixed fungicidal/fungistatic mode of action. We conclude that finger millet possesses fungal endophytes that can synthesize anti-fungal compounds not previously reported as bio-fungicides against F. graminearum.

  10. Evaluation of the nutritional characteristics of a finger millet based complementary food.

    Science.gov (United States)

    Mbithi-Mwikya, Stephen; Van Camp, John; Mamiro, Peter R S; Ooghe, Wilfried; Kolsteren, Patrick; Huyghebaert, Andre

    2002-05-08

    Finger millet (Eleusine coracana), kidney beans (Phaseolus vulgaris), peanuts (Arachis hypogoea), and mango (Mangifera indica) were processed separately and then combined, on the basis of their amino acid scores and energy content, into a complementary food for children of weaning age. The finger millet and kidney beans were processed by germination, autoclaving, and lactic acid fermentation. A mixture containing, on a dry matter basis, 65.2, 19.1, 8.0, and 7.7% of the processed finger millet, kidney beans, peanuts, and mango, respectively, gave a composite protein with an in vitro protein digestibility of 90.2% and an amino acid chemical score of 0.84. This mixture had an energy density of 16.3 kJ.g(-1) of dry matter and a decreased antinutrient content and showed a measurable improvement in the in vitro extractability for calcium, iron, and zinc. A 33% (w/v) pap made from a mix of the processed ingredients had an energy density of 5.4 kJ.g(-1) of pap, which is sufficient to meet the energy requirements of well-nourished children of 6-24 months of age at three servings a day and at the FAO average breast-feeding frequency.

  11. Comparative analysis of solid-state bioprocessing and enzymatic treatment of finger millet for mobilization of bound phenolics.

    Science.gov (United States)

    Yadav, Geetanjali; Singh, Anshu; Bhattacharya, Patrali; Yuvraj, Jude; Banerjee, Rintu

    2013-11-01

    The present work investigates the probable bioprocessing technique to mobilize the bound phenolics naturally found in finger millet cell wall for enriching it with dietary antioxidants. Comparative study was performed between the exogenous enzymatic treatment and solid-state fermentation of grain (SSF) with a food grade organism Rhizopus oryzae. SSF results indicated that at the 6th day of incubation, total phenolic content (18.64 mg gallic acid equivalent/gds) and antioxidant property (DPPH radical scavenging activity of 39.03 %, metal chelating ability of 54 % and better reducing power) of finger millet were drastically enhanced when fermented with GRAS filamentous fungi. During the enzymatic bioprocessing, most of the phenolics released during the hydrolysis, leached out into the liquid portion rather than retaining them within the millet grain, resulting in overall loss of dietary antioxidant. The present study establishes the most effective strategy to enrich the finger millet with phenolic antioxidants.

  12. Finger millet (Eleucine coracana) flour as a vehicle for fortification with zinc.

    Science.gov (United States)

    Tripathi, Bhumika; Platel, Kalpana

    2010-01-01

    Millets, being less expensive compared to cereals and the staple for the poorer sections of population, could be the choice for fortification with micronutrients such as zinc. In view of this, finger millet, widely grown and commonly consumed in southern India, was explored as a vehicle for fortification with zinc in this investigation. Finger millet flour fortified with either zinc oxide or zinc stearate so as to provide 50mg zinc per kg flour, was specifically examined for the bioaccessibility of the fortified mineral, as measured by in vitro simulated gastrointestinal digestion procedure and storage stability. Addition of the zinc salts increased the bioaccessible zinc content by 1.5-3 times that of the unfortified flour. Inclusion of EDTA along with the fortified salt significantly enhanced the bioaccessibility of zinc from the fortified flours, the increase being three-fold. Inclusion of citric acid along with the zinc salt and EDTA during fortification did not have any additional beneficial effect on zinc bioaccessiblity. Moisture and free fatty acid contents of the stored fortified flours indicated the keeping quality of the same, up to 60 days. Both zinc oxide and zinc stearate were equally effective as fortificants, when used in combination with EDTA as a co-fortificant. The preparation of either roti or dumpling from the fortified flours stored up to 60 days did not result in any significant compromise in the bioaccessible zinc content. Thus, the present study has revealed that finger millet flour can effectively be used as a vehicle for zinc fortification to derive additional amounts of bioaccessible zinc, with reasonably good storage stability, to combat zinc deficiency. Copyright 2009 Elsevier GmbH. All rights reserved.

  13. Gene Discovery and Advances in Finger Millet [Eleusine coracana (L.) Gaertn.] Genomics—An Important Nutri-Cereal of Future

    Science.gov (United States)

    Sood, Salej; Kumar, Anil; Babu, B. Kalyana; Gaur, Vikram S.; Pandey, Dinesh; Kant, Lakshmi; Pattnayak, Arunava

    2016-01-01

    The rapid strides in molecular marker technologies followed by genomics, and next generation sequencing advancements in three major crops (rice, maize and wheat) of the world have given opportunities for their use in the orphan, but highly valuable future crops, including finger millet [Eleusine coracana (L.) Gaertn.]. Finger millet has many special agronomic and nutritional characteristics, which make it an indispensable crop in arid, semi-arid, hilly and tribal areas of India and Africa. The crop has proven its adaptability in harsh conditions and has shown resilience to climate change. The adaptability traits of finger millet have shown the advantage over major cereal grains under stress conditions, revealing it as a storehouse of important genomic resources for crop improvement. Although new technologies for genomic studies are now available, progress in identifying and tapping these important alleles or genes is lacking. RAPDs were the default choice for genetic diversity studies in the crop until the last decade, but the subsequent development of SSRs and comparative genomics paved the way for the marker assisted selection in finger millet. Resistance gene homologs from NBS-LRR region of finger millet for blast and sequence variants for nutritional traits from other cereals have been developed and used invariably. Population structure analysis studies exhibit 2–4 sub-populations in the finger millet gene pool with separate grouping of Indian and exotic genotypes. Recently, the omics technologies have been efficiently applied to understand the nutritional variation, drought tolerance and gene mining. Progress has also occurred with respect to transgenics development. This review presents the current biotechnological advancements along with research gaps and future perspective of genomic research in finger millet. PMID:27881984

  14. Gene Discovery and Advances in Finger Millet [Eleusine coracana (L.) Gaertn.] Genomics-An Important Nutri-Cereal of Future.

    Science.gov (United States)

    Sood, Salej; Kumar, Anil; Babu, B Kalyana; Gaur, Vikram S; Pandey, Dinesh; Kant, Lakshmi; Pattnayak, Arunava

    2016-01-01

    The rapid strides in molecular marker technologies followed by genomics, and next generation sequencing advancements in three major crops (rice, maize and wheat) of the world have given opportunities for their use in the orphan, but highly valuable future crops, including finger millet [ Eleusine coracana (L.) Gaertn.]. Finger millet has many special agronomic and nutritional characteristics, which make it an indispensable crop in arid, semi-arid, hilly and tribal areas of India and Africa. The crop has proven its adaptability in harsh conditions and has shown resilience to climate change. The adaptability traits of finger millet have shown the advantage over major cereal grains under stress conditions, revealing it as a storehouse of important genomic resources for crop improvement. Although new technologies for genomic studies are now available, progress in identifying and tapping these important alleles or genes is lacking. RAPDs were the default choice for genetic diversity studies in the crop until the last decade, but the subsequent development of SSRs and comparative genomics paved the way for the marker assisted selection in finger millet. Resistance gene homologs from NBS-LRR region of finger millet for blast and sequence variants for nutritional traits from other cereals have been developed and used invariably. Population structure analysis studies exhibit 2-4 sub-populations in the finger millet gene pool with separate grouping of Indian and exotic genotypes. Recently, the omics technologies have been efficiently applied to understand the nutritional variation, drought tolerance and gene mining. Progress has also occurred with respect to transgenics development. This review presents the current biotechnological advancements along with research gaps and future perspective of genomic research in finger millet.

  15. Gene Discovery and Advances in Finger millet [Eleusine coracana (L. Gaertn.] Genomics - An Important Nutri-cereal of Future

    Directory of Open Access Journals (Sweden)

    Salej Sood

    2016-11-01

    Full Text Available The rapid strides in molecular marker technologies followed by genomics, and next generation sequencing advancements in three major crops (rice, maize and wheat of the world have given opportunities for their use in the orphan, but highly valuable future crops, including finger millet [Eleusine coracana (L. Gaertn.]. Finger millet has many special agronomic and nutritional characteristics, which make it an indispensable crop in arid, semi-arid, hilly and tribal areas of India and Africa. The crop has proven its adaptability in harsh conditions and has shown resilience to climate change. The adaptability traits of finger millet have shown the advantage over major cereal grains under stress conditions, revealing it as a storehouse of important genomic resources for crop improvement. Although new technologies for genomic studies are now available, progress in identifying and tapping these important alleles or genes is lacking. RAPDs were the default choice for genetic diversity studies in the crop until the last decade, but the subsequent development of SSRs and comparative genomics paved the way for the marker assisted selection in finger millet. Resistance gene homologues from NBS-LRR region of finger millet for blast and sequence variants for nutritional traits from other cereals have been developed and used invariably. Population structure analysis studies exhibit 2-4 sub-populations in the finger millet gene pool with separate grouping of Indian and exotic genotypes. Recently, the omics technologies have been efficiently applied to understand the nutritional variation, drought tolerance and gene mining. Progress has also occurred with respect to transgenics development. This review presents the current biotechnological advancements along with research gaps and future perspective of genomic research in finger millet.

  16. Health benefits of finger millet (Eleusine coracana L.) polyphenols and dietary fiber: a review.

    Science.gov (United States)

    Devi, Palanisamy Bruntha; Vijayabharathi, Rajendran; Sathyabama, Sathyaseelan; Malleshi, Nagappa Gurusiddappa; Priyadarisini, Venkatesan Brindha

    2014-06-01

    The growing public awareness of nutrition and health care research substantiates the potential of phytochemicals such as polyphenols and dietary fiber on their health beneficial properties. Hence, there is in need to identify newer sources of neutraceuticals and other natural and nutritional materials with the desirable functional characteristics. Finger millet (Eleusine coracana), one of the minor cereals, is known for several health benefits and some of the health benefits are attributed to its polyphenol and dietary fiber contents. It is an important staple food in India for people of low income groups. Nutritionally, its importance is well recognised because of its high content of calcium (0.38%), dietary fiber (18%) and phenolic compounds (0.3-3%). They are also recognized for their health beneficial effects, such as anti-diabetic, anti-tumerogenic, atherosclerogenic effects, antioxidant and antimicrobial properties. This review deals with the nature of polyphenols and dietary fiber of finger millet and their role with respect to the health benefits associated with millet.

  17. A Review of Nutrient Management Studies Involving Finger Millet in the Semi-Arid Tropics of Asia and Africa

    Directory of Open Access Journals (Sweden)

    Malinda S. Thilakarathna

    2015-06-01

    Full Text Available Finger millet (Eleusine coracana (L. Gaertn is a staple food crop grown by subsistence farmers in the semi-arid tropics of South Asia and Africa. It remains highly valued by traditional farmers as it is nutritious, drought tolerant, short duration, and requires low inputs. Its continued propagation may help vulnerable farmers mitigate climate change. Unfortunately, the land area cultivated with this crop has decreased, displaced by maize and rice. Reversing this trend will involve achieving higher yields, including through improvements in crop nutrition. The objective of this paper is to comprehensively review the literature concerning yield responses of finger millet to inorganic fertilizers (macronutrients and micronutrients, farmyard manure (FYM, green manures, organic by-products, and biofertilizers. The review also describes the impact of these inputs on soils, as well as the impact of diverse cropping systems and finger millet varieties, on nutrient responses. The review critically evaluates the benefits and challenges associated with integrated nutrient management, appreciating that most finger millet farmers are economically poor and primarily use farmyard manure. We conclude by identifying research gaps related to nutrient management in finger millet, and provide recommendations to increase the yield and sustainability of this crop as a guide for subsistence farmers.

  18. In-silico mining, type and frequency analysis of genic microsatellites of finger millet (Eleusine coracana (L.) Gaertn.): a comparative genomic analysis of NBS-LRR regions of finger millet with rice.

    Science.gov (United States)

    Kalyana Babu, B; Pandey, Dinesh; Agrawal, P K; Sood, Salej; Kumar, Anil

    2014-05-01

    In recent years, the increased availability of the DNA sequences has given the possibility to develop and explore the expressed sequence tags (ESTs) derived SSR markers. In the present study, a total of 1956 ESTs of finger millet were used to find the microsatellite type, distribution, frequency and developed a total of 545 primer pairs from the ESTs of finger millet. Thirty-two EST sequences had more than two microsatellites and 1357 sequences did not have any SSR repeats. The most frequent type of repeats was trimeric motif, however the second place was occupied by dimeric motif followed by tetra-, hexa- and penta repeat motifs. The most common dimer repeat motif was GA and in case of trimeric SSRs, it was CGG. The EST sequences of NBS-LRR region of finger millet and rice showed higher synteny and were found on nearly same positions on the rice chromosome map. A total of eight, out of 15 EST based SSR primers were polymorphic among the selected resistant and susceptible finger millet genotypes. The primer FMBLEST5 could able to differentiate them into resistant and susceptible genotypes. The alleles specific to the resistant and susceptible genotypes were sequenced using the ABI 3130XL genetic analyzer and found similarity to NBS-LRR regions of rice and finger millet and contained the characteristic kinase-2 and kinase 3a motifs of plant R-genes belonged to NBS-LRR region. The In-silico and comparative analysis showed that the genes responsible for blast resistance can be identified, mapped and further introgressed through molecular breeding approaches for enhancing the blast resistance in finger millet.

  19. Application of Copper-Chitosan Nanoparticles Stimulate Growth and Induce Resistance in Finger Millet (Eleusine coracana Gaertn.) Plants against Blast Disease.

    Science.gov (United States)

    Sathiyabama, Muthukrishnan; Manikandan, Appu

    2018-02-28

    Copper-chitosan nanoparticle (CuChNp) was synthesized and used to study its effect on finger millet plant as a model plant system. Our objective was to explore the efficacy of CuChNp application to control blast disease of finger millet. CuChNp was applied to finger millet either as a foliar spray or as a combined application (involving seed coat and foliar spray). Both the application methods enhanced growth profile of finger millet plants and increased yield. The increased yield was nearly 89% in combined application method. Treated finger millet plants challenged with Pyricularia grisea showed suppression of blast disease development when compared to control. Nearly 75% protection was observed in the combined application of CuChNp to finger millet plants. In CuChNp treated finger millet plants, a significant increase in defense enzymes was observed, which was detected both qualitatively and quantitatively. The suppression of blast disease correlates well with increased defense enzymes in CuChNp treated finger millet plants.

  20. Effect of different milling methods on glycaemic response of foods made with finger millet (Eucenea coracana) flour.

    Science.gov (United States)

    Jayasinghe, M A; Ekanayake, S; Nugegoda, D B

    2013-12-01

    Compare glycaemic response of foods prepared with finger millet flour, using traditional stone grinding and industrial milling. Crossover study. Healthy volunteers (n=11) consisting of five males and six females), aged between 20 and 30 years, with a body mass index of 18.5-23.5 Kgm-2. Blood glucose concentration was measured at fasting and 30, 45, 60, 90, 120 minutes after ingestion of roti and pittu made with stone ground or industrially milled finger millet flour, containing 50 g of available carbohydrates. Glycaemic Index (GI) values were expressed as the average value of the 11 subjects. Significant differences (p0.05) in proximate compositions of the different foods or raw flours. Foods prepared with finger millet (kurakkan) flour with a larger particle size distribution resulted in a lower glycaemic response.

  1. Compilation of an informative microsatellite set for genetic characterisation of East African finger millet (Eleusine coracana

    Directory of Open Access Journals (Sweden)

    Santie M. De Villiers

    2015-03-01

    Discussion: Five individual samples from an accession captured the largest number of alleles per locus compared to the four different bulked sampling strategies but this difference was not significant. The identified set comprised 20 markers: UGEP24, UGEP53, UGEP84, UGEP27, UGEP98, UGEP95, UGEP64, UGEP33, UGEP67, UGEP106, UGEP110, UGEP57, UGEP96, UGEP66, UGEP46, UGEP79, UGEP20, UGEP12, UGEP73 and UGEP5 and was since used to assess East African finger millet genetic diversity in two separate studies.

  2. Comparative genomics and association mapping approaches for blast resistant genes in finger millet using SSRs.

    Directory of Open Access Journals (Sweden)

    B Kalyana Babu

    Full Text Available The major limiting factor for production and productivity of finger millet crop is blast disease caused by Magnaporthe grisea. Since, the genome sequence information available in finger millet crop is scarce, comparative genomics plays a very important role in identification of genes/QTLs linked to the blast resistance genes using SSR markers. In the present study, a total of 58 genic SSRs were developed for use in genetic analysis of a global collection of 190 finger millet genotypes. The 58 SSRs yielded ninety five scorable alleles and the polymorphism information content varied from 0.186 to 0.677 at an average of 0.385. The gene diversity was in the range of 0.208 to 0.726 with an average of 0.487. Association mapping for blast resistance was done using 104 SSR markers which identified four QTLs for finger blast and one QTL for neck blast resistance. The genomic marker RM262 and genic marker FMBLEST32 were linked to finger blast disease at a P value of 0.007 and explained phenotypic variance (R² of 10% and 8% respectively. The genomic marker UGEP81 was associated to finger blast at a P value of 0.009 and explained 7.5% of R². The QTLs for neck blast was associated with the genomic SSR marker UGEP18 at a P value of 0.01, which explained 11% of R². Three QTLs for blast resistance were found common by using both GLM and MLM approaches. The resistant alleles were found to be present mostly in the exotic genotypes. Among the genotypes of NW Himalayan region of India, VHC3997, VHC3996 and VHC3930 were found highly resistant, which may be effectively used as parents for developing blast resistant cultivars in the NW Himalayan region of India. The markers linked to the QTLs for blast resistance in the present study can be further used for cloning of the full length gene, fine mapping and their further use in the marker assisted breeding programmes for introgression of blast resistant alleles into locally adapted cultivars.

  3. Comparative genomics and association mapping approaches for blast resistant genes in finger millet using SSRs.

    Science.gov (United States)

    Babu, B Kalyana; Dinesh, Pandey; Agrawal, Pawan K; Sood, S; Chandrashekara, C; Bhatt, Jagadish C; Kumar, Anil

    2014-01-01

    The major limiting factor for production and productivity of finger millet crop is blast disease caused by Magnaporthe grisea. Since, the genome sequence information available in finger millet crop is scarce, comparative genomics plays a very important role in identification of genes/QTLs linked to the blast resistance genes using SSR markers. In the present study, a total of 58 genic SSRs were developed for use in genetic analysis of a global collection of 190 finger millet genotypes. The 58 SSRs yielded ninety five scorable alleles and the polymorphism information content varied from 0.186 to 0.677 at an average of 0.385. The gene diversity was in the range of 0.208 to 0.726 with an average of 0.487. Association mapping for blast resistance was done using 104 SSR markers which identified four QTLs for finger blast and one QTL for neck blast resistance. The genomic marker RM262 and genic marker FMBLEST32 were linked to finger blast disease at a P value of 0.007 and explained phenotypic variance (R²) of 10% and 8% respectively. The genomic marker UGEP81 was associated to finger blast at a P value of 0.009 and explained 7.5% of R². The QTLs for neck blast was associated with the genomic SSR marker UGEP18 at a P value of 0.01, which explained 11% of R². Three QTLs for blast resistance were found common by using both GLM and MLM approaches. The resistant alleles were found to be present mostly in the exotic genotypes. Among the genotypes of NW Himalayan region of India, VHC3997, VHC3996 and VHC3930 were found highly resistant, which may be effectively used as parents for developing blast resistant cultivars in the NW Himalayan region of India. The markers linked to the QTLs for blast resistance in the present study can be further used for cloning of the full length gene, fine mapping and their further use in the marker assisted breeding programmes for introgression of blast resistant alleles into locally adapted cultivars.

  4. MILLET

    African Journals Online (AJOL)

    User

    protein metabolism. ... levels of adiponectin hormone but the hypoglycemic effect of millet as a supplement is yet to ... When compared with the diabetic control, the study revealed a ..... a beneficial hormone that helps in energy metabolism, it.

  5. Identification of microRNAs and their targets in Finger millet by high throughput sequencing.

    Science.gov (United States)

    Usha, S; Jyothi, M N; Sharadamma, N; Dixit, Rekha; Devaraj, V R; Nagesh Babu, R

    2015-12-15

    MicroRNAs are short non-coding RNAs which play an important role in regulating gene expression by mRNA cleavage or by translational repression. The majority of identified miRNAs were evolutionarily conserved; however, others expressed in a species-specific manner. Finger millet is an important cereal crop; nonetheless, no practical information is available on microRNAs to date. In this study, we have identified 95 conserved microRNAs belonging to 39 families and 3 novel microRNAs by high throughput sequencing. For the identified conserved and novel miRNAs a total of 507 targets were predicted. 11 miRNAs were validated and tissue specificity was determined by stem loop RT-qPCR, Northern blot. GO analyses revealed targets of miRNA were involved in wide range of regulatory functions. This study implies large number of known and novel miRNAs found in Finger millet which may play important role in growth and development. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. [cDNA library construction from panicle meristem of finger millet].

    Science.gov (United States)

    Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B

    2014-01-01

    The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.

  7. Effect of incorporating finger millet in wheat flour on mixolab behavior, chapatti quality and starch digestibility.

    Science.gov (United States)

    Sharma, Bharati; Gujral, Hardeep Singh; Solah, Vicky

    2017-09-15

    Wheat and finger millet flour (two cultivars) were blended in the ratio (3:1) to form a composite flour and its dough properties were studied on the mixolab. The chapatti making and digestibility behavior of the composite flour was also investigated. The wheat finger millet (WFM) flour blend displayed up to 30.7% higher total phenolic content (TPC), 38.2% higher total flavonoid content (TFC) and 75.4% higher antioxidant activity (AOA) than the wheat flour. Chapattis prepared from the composite blends exhibited lower retrogradation as evident by the mixolab retrogradation index, higher values of soluble starch and soluble amylose in stored chapatti. The slowly digestible starch (SDS) correlated positively (R=0.816, p<0.05) with TPC and water absorption correlated positively (R=0.995, p<0.05) with damage starch content. The chapattis made from the composite flour had higher SDS and resistant starch (RS) values demonstrating potential as a food with functional characteristics. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Intervarietal variations in various oxidative stress markers and antioxidant potential of finger millet (Eleusine coracana) subjected to drought stress.

    Science.gov (United States)

    Bartwal, Arti; Pande, Anjali; Sharma, Priyadarshini; Arora, Sandeep

    2016-07-01

    Drought is a major form of abiotic stress leading to lower crop productivity. Experiment was carried out for selecting the most tolerant genotype among six different genotypes of finger millet under drought stress. Seeds of six finger millet genotypes were sown in pots and grown for 35 days. After this period, drought was induced by withholding watering for stressed plants while control plants were watered regularly for comparison. Among all six different varieties of finger millet screened (PR202, PES400, PRM6107, VL283, VL328 and VL149) under varying intensities of drought stress,PRM6107 and PR202 showed highest stress tolerance by limiting excessive accumulation of reactive oxygen species (ROS) through activation of ROS scavenging antioxidative enzymes. A 200% increase in ascorbate content was recorded in PRM6107 and PR202, while in other varieties limited increase in ascorbate content was observed. Maximum decrease in chlorophyll content was observed in VL328 (83%) while least drop was observed in VL149 (65%). Relative water content indicated that PR202 was able to retain maximum water content under stress, as it recorded least drop in relative water content (55%), contributing to its better survival under stress. In conclusion finger millet genotypes PRM6107 and PR202 possessed maximum drought tolerance potential and thus may be used for allele mining of drought tolerant genes, which can further be employed for the development of more drought stress tolerant staple crops using biotechnological approach.

  9. The extent of variation in salinity tolerance of the minicore collection of finger millet (Eleusine coracana L. Gaertn.) germplasm.

    Science.gov (United States)

    Krishnamurthy, Lakshmanan; Upadhyaya, Hari Deo; Purushothaman, Ramamoorthy; Gowda, Cholenahalli Lakkegowda Laxmipathi; Kashiwagi, Junichi; Dwivedi, Sangam Lal; Singh, Sube; Vadez, Vincent

    2014-10-01

    Finger millet (Eleusine coracana L. Gaertn.) ranks third in production among the dry land cereals. It is widely cultivated in Africa and South Asia where soil salinization is a major production constraint. It is a potential crop for salt affected soils. To identify salt tolerant germplasm, the minicore finger millet germplasm (n=80) was screened for grain yield performance in a soil saturated with NaCl solution of 100 or 125mM. Genotype effect was significant for most traits, while salinity×genotype interaction was significant only in one year. Salinity delayed phenology, marginally reduced shoot biomass and grain yield. There was a large range of genotypic variation in grain yield under salinity and other traits. The yield loss was higher in accessions with prolific growth and yield potential was associated with saline yields. Based on saline yields, accessions were grouped in to four groups and the top tolerant group had 22 accessions with IE 4797 remaining at the top. Salinity had no adverse impact on grain yield of five accessions. Root anatomy in selected genotype of pearl and finger millet showed presence of porous cortex and well fortified endodermis in finger millet that can exclude Na(+) and enhance N absorption. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  10. Comparative assessment of maize, finger millet and sorghum for household food security in the face of increasing climatic risk

    NARCIS (Netherlands)

    Rurinda, J.; Mapfumo, P.; Wijk, van M.T.; Mtambanengwe, F.; Rufino, M.C.; Chikowo, R.; Giller, K.E.

    2014-01-01

    Questions as to which crop to grow, where, when and with what management, will be increasingly challenging for farmers in the face of a changing climate. The objective of this study was to evaluate emergence, yield and financial benefits of maize, finger millet and sorghum, planted at different

  11. A somaclonal line SE7 of finger millet (Eleusine coracana) exhibits modified cytokinin homeostasis and increased grain yield

    Czech Academy of Sciences Publication Activity Database

    Radchuk, V.; Radchuk, R.; Pirko, Y.; Vaňková, Radomíra; Gaudinová, Alena; Korkhovoy, V.; Yemets, A.; Weber, H.; Weschke, W.; Blume, Y. B.

    2012-01-01

    Roč. 63, č. 15 (2012), s. 5497-5506 ISSN 0022-0957 R&D Projects: GA ČR GA522/09/2058 Institutional research plan: CEZ:AV0Z50380511 Keywords : Cytokinin * cytokinin metabolism * finger millet Subject RIV: ED - Physiology Impact factor: 5.242, year: 2012

  12. Transcriptome analysis of salinity responsiveness in contrasting genotypes of finger millet (Eleusine coracana L.) through RNA-sequencing.

    Science.gov (United States)

    Rahman, Hifzur; Jagadeeshselvam, N; Valarmathi, R; Sachin, B; Sasikala, R; Senthil, N; Sudhakar, D; Robin, S; Muthurajan, Raveendran

    2014-07-01

    Finger millet (Eleusine coracana L.) is a hardy cereal known for its superior level of tolerance against drought, salinity, diseases and its nutritional properties. In this study, attempts were made to unravel the physiological and molecular basis of salinity tolerance in two contrasting finger millet genotypes viz., CO 12 and Trichy 1. Physiological studies revealed that the tolerant genotype Trichy 1 had lower Na(+) to K(+) ratio in leaves and shoots, higher growth rate (osmotic tolerance) and ability to accumulate higher amount of total soluble sugar in leaves under salinity stress. We sequenced the salinity responsive leaf transcriptome of contrasting finger millet genotypes using IonProton platform and generated 27.91 million reads. Mapping and annotation of finger millet transcripts against rice gene models led to the identification of salinity responsive genes and genotype specific responses. Several functional groups of genes like transporters, transcription factors, genes involved in cell signaling, osmotic homeostasis and biosynthesis of compatible solutes were found to be highly up-regulated in the tolerant Trichy 1. Salinity stress inhibited photosynthetic capacity and photosynthesis related genes in the susceptible genotype CO 12. Several genes involved in cell growth and differentiation were found to be up-regulated in both the genotypes but more specifically in tolerant genotype. Genes involved in flavonoid biosynthesis were found to be down-regulated specifically in the salinity tolerant Trichy 1. This study provides a genome-wide transcriptional analysis of two finger millet genotypes differing in their level of salinity tolerance during a gradually progressing salinity stress under greenhouse conditions.

  13. Computational Identification of MicroRNAs and Their Targets from Finger Millet (Eleusine coracana).

    Science.gov (United States)

    Usha, S; Jyothi, M N; Suchithra, B; Dixit, Rekha; Rai, D V; Nagesh Babu, R

    2017-03-01

    MicroRNAs are endogenous small RNAs regulating intrinsic normal growth and development of plant. Discovering miRNAs, their targets and further inferring their functions had become routine process to comprehend the normal biological processes of miRNAs and their roles in plant development. In this study, we used homology-based analysis with available expressed sequence tag of finger millet (Eleusine coracana) to predict conserved miRNAs. Three potent miRNAs targeting 88 genes were identified. The newly identified miRNAs were found to be homologous with miR166 and miR1310. The targets recognized were transcription factors and enzymes, and GO analysis showed these miRNAs played varied roles in gene regulation. The identification of miRNAs and their targets is anticipated to hasten the pace of key epigenetic regulators in plant development.

  14. Finger millet arabinoxylan protects mice from high-fat diet induced lipid derangements, inflammation, endotoxemia and gut bacterial dysbiosis.

    Science.gov (United States)

    Sarma, Siddhartha Mahadeva; Singh, Dhirendra Pratap; Singh, Paramdeep; Khare, Pragyanshu; Mangal, Priyanka; Singh, Shashank; Bijalwan, Vandana; Kaur, Jaspreet; Mantri, Shrikant; Boparai, Ravneet Kaur; Mazumder, Koushik; Bishnoi, Mahendra; Bhutani, Kamlesh Kumar; Kondepudi, Kanthi Kiran

    2018-01-01

    Arabinoxylan (AX), a non-starch polysaccharide extracted from cereals such as wheat, rice and millets, is known to impart various health promoting effects. Our earlier study suggested that finger millet (FM) could ameliorate high fat diet (HFD)-induced metabolic derangements. The present study is aimed to evaluate the effect of FM-AX supplementation, a key bioactive from finger millet, on HFD-induced metabolic and gut bacterial derangements. Male Swiss albino mice were fed with normal chow diet (NPD) or HFD (60%kcal from fat) for 10 weeks. FM-AX was orally supplemented at doses of 0.5 and 1.0g/kg bodyweight on every alternate day for 10 weeks. Glucose tolerance, serum hormones, hepatic lipid accumulation and inflammation, white adipose tissue marker gene expression, adipocyte size and inflammation; metagenomic alterations in cecal bacteria; cecal short chain fatty acids and colonic tight junction gene expressions were studied. FM-AX supplementation prevented HFD-induced weight gain, alerted glucose tolerance and serum lipid profile, hepatic lipid accumulation and inflammation. Hepatic and white adipose tissue gene expressions were beneficially modulated. Further, AX supplementation prevented metagenomic alterations in cecum; improved ileal and colonic health and overall prevented metabolic endotoxemia. Present work suggests that AX from finger millet can be developed as a nutraceutical for the management of HFD- induced obesity. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. C2H2 type of zinc finger transcription factors in foxtail millet define response to abiotic stresses.

    Science.gov (United States)

    Muthamilarasan, Mehanathan; Bonthala, Venkata Suresh; Mishra, Awdhesh Kumar; Khandelwal, Rohit; Khan, Yusuf; Roy, Riti; Prasad, Manoj

    2014-09-01

    C2H2 type of zinc finger transcription factors (TFs) play crucial roles in plant stress response and hormone signal transduction. Hence considering its importance, genome-wide investigation and characterization of C2H2 zinc finger proteins were performed in Arabidopsis, rice and poplar but no such study was conducted in foxtail millet which is a C4 Panicoid model crop well known for its abiotic stress tolerance. The present study identified 124 C2H2-type zinc finger TFs in foxtail millet (SiC2H2) and physically mapped them onto the genome. The gene duplication analysis revealed that SiC2H2s primarily expanded in the genome through tandem duplication. The phylogenetic tree classified these TFs into five groups (I-V). Further, miRNAs targeting SiC2H2 transcripts in foxtail millet were identified. Heat map demonstrated differential and tissue-specific expression patterns of these SiC2H2 genes. Comparative physical mapping between foxtail millet SiC2H2 genes and its orthologs of sorghum, maize and rice revealed the evolutionary relationships of C2H2 type of zinc finger TFs. The duplication and divergence data provided novel insight into the evolutionary aspects of these TFs in foxtail millet and related grass species. Expression profiling of candidate SiC2H2 genes in response to salinity, dehydration and cold stress showed differential expression pattern of these genes at different time points of stresses.

  16. Effect of gamma radiation on total antioxidant capacity, total lipid concentration and shelf life of finger millet flour

    International Nuclear Information System (INIS)

    Lathika; Manupriya, B.R.; Shenoy, K.B.; Patil, S.L.; Somashekarappa, H.M.

    2016-01-01

    The present study is an attempt to study the impact of gamma radiation on the shelf life, total antioxidant capacity and total lipid concentration of finger millet (Eleusine coracana L.) flour. Finger millet flour was procured from market. Flour samples of 50 g were taken in triplicates in a polyethylene pouch, air sealed and subjected to gamma irradiation doses ranging from 0.25 to 10 kGy and stored in polyethylene bags and plastic containers for a period of 1 year. Within 24 hours of irradiation, the samples were tested for moisture (2 ± 0.2%), total antioxidant capacity (0.12 ± 0.010 mg) and lipid concentration (15 ± 0.4 mg)

  17. Protein, Calcium, Zinc, and Iron Contents of Finger Millet Grain Response to Varietal Differences and Phosphorus Application in Kenya

    Directory of Open Access Journals (Sweden)

    Wekha N. Wafula

    2018-02-01

    Full Text Available This study was carried out to investigate the influence of phosphorus fertilizers on the concentrations of nutrients, particularly calcium, protein, zinc, and iron in finger millet grains grown in different agro-ecologies in Kenya. The on-station experiments were carried out at Kiboko (Eastern Kenya, Kakamega, and Alupe (Western Kenya in 2015 during the short and long rainy seasons. The trials were laid out in a randomized complete block design (RCBD in a 4 × 3 factorial arrangement with three replicates. The treatments comprised of four levels of phosphorus (0, 12.5, 25.0 and 37.5 kg ha−1 P2O5 and three finger millet varieties (U-15, P-224 and a local variety. Application of phosphorus significantly (p ≤ 0.05 increased the protein content of finger millet grain in varieties in all the three sites. Variety U-15 had the highest protein content (11.0% at 25 kg ha−1 P2O5 with the control (zero P on variety P-224 eliciting the lowest (4.4% at Kiboko. At Kakamega, the 25 kg ha−1 P2O5 treatment with U-15 variety had the highest protein content (15.3% while the same variety at 12.5 kg ha−1 P2O5 rate elicited the highest protein content (15.0% at Alupe. Phosphorus application significantly enhanced the nutritional quality of finger millet grains specifically protein, calcium, iron, and zinc. Variety P-224 had the highest calcium content in all sites and highest iron content at Kakamega while the local varieties had the highest zinc content in all sites. The varieties responded differently to each quality component but generally, based on the protein content, the 25 kg ha−1 P2O5 is recommended.

  18. Some physical and functional properties of finger millet (Eleusine coracana) obtained in sub-Saharan Africa.

    Science.gov (United States)

    Ramashia, S E; Gwata, E T; Meddows-Taylor, S; Anyasi, T A; Jideani, A I O

    2018-02-01

    The study determined the physical properties of finger millet (FM) (Eluesine coracana) grains and the functional properties of FM flour. Physical properties such as colour attributes, sample weight, bulk density, true density, porosity, surface area, sample volume, aspect ratio, sphericity, dimensional properties and moisture content of grain cultivars were determined. Water absorption capacity (WAC), bulk density (BD), dispersibility, viscosity and micro-structure of FM flours were also evaluated. Data collected were analyzed using SPSS statistical software version 23.0. Results showed that milky cream cultivar was significantly higher (pmillet, used as a control, was significantly different from FM flour on all dimensional properties. Moisture content of milky cream showed higher significant difference for both grains and flours as compared to brown and black grain/flours. Milky cream cultivar was significantly different in L*, b*, C*, H* values, WAC, BD and dispersibility for both FM grains and flours. Data showed that brown flour was significantly higher in viscosity than in milky and black flours. Microstructure results revealed that starch granules of raw FM flours had oval/spherical and smooth surface. The study is important for agricultural and food engineers, designers, scientists and processors in the design of equipment for FM grain processing. Results are likely to be useful in assessing the quality of grains used to fortify FM flour. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  19. Expression of Finger Millet EcDehydrin7 in Transgenic Tobacco Confers Tolerance to Drought Stress.

    Science.gov (United States)

    Singh, Rajiv Kumar; Singh, Vivek Kumar; Raghavendrarao, Sanagala; Phanindra, Mullapudi Lakshmi Venkata; Venkat Raman, K; Solanke, Amolkumar U; Kumar, Polumetla Ananda; Sharma, Tilak Raj

    2015-09-01

    One of the critical alarming constraints for agriculture is water scarcity. In the current scenario, global warming due to climate change and unpredictable rainfall, drought is going to be a master player and possess a big threat to stagnating gene pool of staple food crops. So it is necessary to understand the mechanisms that enable the plants to cope with drought stress. In this study, effort was made to prospect the role of EcDehydrin7 protein from normalized cDNA library of drought tolerance finger millet in transgenic tobacco. Biochemical and molecular analyses of T0 transgenic plants were done for stress tolerance. Leaf disc assay, seed germination test, dehydration assay, and chlorophyll estimation showed EcDehydrin7 protein directly link to drought tolerance. Northern and qRT PCR analyses shows relatively high expression of EcDehydrin7 protein compare to wild type. T0 transgenic lines EcDehydrin7(11) and EcDehydrin7(15) shows superior expression among all lines under study. In summary, all results suggest that EcDehydrin7 protein has a remarkable role in drought tolerance and may be used for sustainable crop breeding program in other food crops.

  20. Arabinoxylan from finger millet (Eleusine coracana, v. Indaf 15) bran: purification and characterization.

    Science.gov (United States)

    Savitha Prashanth, M R; Muralikrishna, G

    2014-01-01

    Water unextractable portion from finger millet bran was sequentially extracted with saturated barium hydroxide (BE) and 1M potassium hydroxide (KE) solutions. They consisted preponderantly of arabinose and xylose in different ratios. Ferulic, caffeic, coumaric and vanillic acids were identified as major bound phenolic acids. BE and KE were purified on DEAE-cellulose column by eluting successively with different eluants. The major fractions (0.1 M ammonium carbonate) were resolved into one (BE) and two subfractions (KE1 and KE2) respectively on Sephacryl S-400 gel filtration chromatography and their homogeneity was ascertained by gel filtration, cellulose acetate membrane electrophoresis and capillary electrophoresis. The average molecular weight of BE, KE1 and KE2 were found to be 430, 1028 and 40 kDa respectively. The structural elucidation of the purified polysaccharides by (1)H and (13)C NMR analysis indicated the backbone to be 1,4-β-D-linked xylan with substitution mainly at O-2 or O-3 and/or both by α-l-arabinose residues. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Effect of processing on the microstructure of finger millet by X-ray diffraction and scanning electron microscopy.

    Science.gov (United States)

    Dharmaraj, Usha; Parameswara, P; Somashekar, R; Malleshi, Nagappa G

    2014-03-01

    Finger millet is one of the important minor cereals, and carbohydrates form its major chemical constituent. Recently, the millet is processed to prepare hydrothermally treated (HM), decorticated (DM), expanded (EM) and popped (PM) products. The present research aims to study the changes in the microstructure of carbohydrates using X-ray diffraction and scanning electron microscopy. Processing the millet brought in significant changes in the carbohydrates. The native millet exhibited A-type pattern of X-ray diffraction with major peaks at 2θ values of 15.3, 17.86 and 23.15°, whereas, all other products showed V-type pattern with single major peak at 2θ values ranging from 19.39 to 19.81°. The corresponding lattice spacing and the number of unit cells in a particular direction of reflection also reduced revealing that crystallinity of starch has been decreased depending upon the processing conditions. Scanning electron microscopic studies also revealed that the orderly pattern of starch granules changed into a coherent mass due to hydrothermal treatment, while high temperature short time treatment rendered a honey-comb like structure to the product. However, the total carbohydrates and non-starch polysaccharide contents almost remained the same in all the products except for DM and EM, but the individual carbohydrate components changed significantly depending on the type of processing.

  2. Effect of gamma irradiation on total carbohydrate concentration of finger millet flour

    International Nuclear Information System (INIS)

    Lathika; Patil, Shrikant L.; Bhasker Shenoy, K.; Somashekarappa, H.M.

    2015-01-01

    Ragi or finger millet (Eleusine coracana L.) is one of the common millets in several regions of India. The effect of gamma irradiation, on ragi flour was investigated in the study. Ragi flour is procured from market. Flour samples of 50 gms were taken in triplicates in a polyethylene pouch, air sealed and subjected to gamma irradiation doses ranging from 0.25 to 10 kGy and stored in polyethylene bags and plastic containers for a period of 30 and 90 days. Within 24 hours of irradiation, the samples were tested for total carbohydrate concentration by phenol-sulphuric acid method. The same was repeated after 30 and 90 days of storage. The comparative study showed that, at 0 day, total carbohydrate concentration has decreased slightly when compared to the non-irradiated sample (0.024 mg/ml). The lowest concentration of carbohydrate is seen at 0.025 kGy (0.019mg/ml). The samples stored in polyethylene bag, after 30 days showed both increase (0.056 mg/ml at 0.025 kGy) and decrease (0.04 mg/ml at 10 kGy) in total carbohydrate concentration when compared to control (0.046 mg/ml). 90 days stored samples showed increase in carbohydrate concentration when compared to control (0.029 mg/ml). The highest carbohydrate concentration is seen in 1 kGy dose (0.037 mg/ml). The samples stored at container after 30 days showed both increase (0.045 mg/ml at 5 kGy) and decrease (0.034 mg/ml at 0.025 mg/ml) of carbohydrate concentration when compared to control (0.043 mg/ml). 90 days stored samples showed decrease in carbohydrate concentration when compared to control (0.034 mg/ml). The lowest concentration is seen at 5 kGy (0.022 mg/ml). (author)

  3. Development and evaluation of nutritional, sensory and glycemic properties of finger millet (Eleusine coracana L.) based food products.

    Science.gov (United States)

    Shobana, Shanmugam; Selvi, Ravi Poovizhi; Kavitha, Vasudevan; Gayathri, Nagamuthu; Geetha, Gunasekaran; Gayathri, Rajagopal; Vijayalakshmi, Parthasarthy; Balasubramaniam, K Kandappa Gounder; Ruchi, Vaidya; Sudha, Vasudevan; Anjana, Ranjit Mohan; Unnikrishnan, Ranjit; Malleshi, Nagappa Gurusiddappa; Henry, C Jk; Krishnaswamy, Kamala; Mohan, Viswanathan

    2018-01-01

    Finger millet (Eleusine coracana L.) (FM) is rich in dietary fibre and is therefore expected to elicit a lower glycemic response compared to other grains. However, there is little data on the glycemic properties of FM-based products. We evaluated the nutritional, sensory and glycemic properties of decorticated millet with lower polish (DFM-LDP), flakes (FMF), vermicelli (FMV) and extruded snack (FMES) (both FMV and FMES with 7-8% added soluble fibre). The nutrient contents of the FM products were evaluated by standard AOAC (Association of Official Analytical Chemists) and AACC (American Association of Cereal Chemists) methods. Sensory evaluation was conducted monadically using a 9-point hedonic scale using untrained panel members. GI testing was conducted using a standardized validated protocol. The study was conducted according to the guidelines laid down by the Declaration of Helsinki, and was approved by the Ethics Committee of the Madras Diabetes Research Foundation. The products had dietary fibre (DF) content between 5.8-15.6 g%. FMES was unique in having a very low fat content (0.17%). Evaluation of sensory perception revealed moderate acceptance of millet based products. The glycemic indices (GI) (mean±SEM) of the products were 84.7±7.7%, 82.3±6.4%, 65.5±5.1% and 65.0±6.6% for DFM-LDP, FMF, FMV and FMES respectively. DFM-LDP and FMF (purely finger millet based products) elicited higher glycemic responses. Comparatively, FMV and FMES (with added functional ingredients) exhibited medium GI values and, are healthier dietary options. It is possible to prepare FM products with lower GI by utilizing functional ingredients.

  4. Expression of four phosphate transporter genes from Finger millet (Eleusine coracana L.) in response to mycorrhizal colonization and Pi stress.

    Science.gov (United States)

    Pudake, Ramesh Namdeo; Mehta, Chandra Mohan; Mohanta, Tapan Kumar; Sharma, Suvigya; Varma, Ajit; Sharma, Anil Kumar

    2017-05-01

    Phosphorus (P) is a vital nutrient for plant growth and development, and is absorbed in cells with the help of membrane-spanning inorganic phosphate transporter (Pht) protein. Symbiosis with arbuscular mycorrhiza (AM) also helps in transporting P from the soil to plant and Pht proteins play an important role in it. To understand this phenomenon in Finger Mille plant, we have cloned four Pht genes from Finger millet, which shares the homology with Pht1 protein family of cereals. Expression pattern analysis during the AM infection indicated that EcPT4 gene was AM specific, and its expression was higher in roots where AM colonization percentage was high. The expression level of EcPT1-4 gene under the phosphorous (Pi) stress in seedlings was found to be consistent with its role in acquisition of phosphorus. Homology study of the EcPt proteins with Pht proteins of cereals shows close relationship. The findings of the study indicate that Pht1 family genes from finger millet can serve to be an important resource for the better understanding of phosphorus use efficiency.

  5. Amelioration of hyperglycaemia and its associated complications by finger millet ( Eleusine coracana L.) seed coat matter in streptozotocin-induced diabetic rats.

    Science.gov (United States)

    Shobana, Shanmugam; Harsha, Mysore R; Platel, Kalpana; Srinivasan, Krishnapura; Malleshi, Nagappa G

    2010-12-01

    Finger millet (Eleusine coracana) is extensively cultivated and consumed in India and Africa. The millet seed coat is a rich source of dietary fibre and phenolic compounds. The effect of feeding a diet containing 20% finger millet seed coat matter (SCM) was examined in streptozotocin-induced diabetic rats. Diabetic rats maintained on the millet SCM diet (diabetic experimental (DE) group) for 6 weeks exhibited a lesser degree of fasting hyperglycaemia and partial reversal of abnormalities in serum albumin, urea and creatinine compared with the diabetic control (DC) group. The DE group of rats excreted comparatively lesser amounts of glucose, protein, urea and creatinine and was accompanied by improved body weights compared with their corresponding controls. Hypercholesterolaemia and hypertriacylglycerolaemia associated with diabetes were also notably reversed in the DE group. Slit lamp examination of the eye lens revealed an immature subcapsular cataract with mild lenticular opacity in the DE group of rats compared to the mature cataract with significant lenticular opacity and corneal vascularisation in the DC group. Lower activity of lens aldose reductase, serum advanced glycation end products and blood glycosylated Hb levels were observed in the DE group. The millet SCM feeding showed pronounced ameliorating effects on kidney pathology as reflected by near normal glomerular and tubular structures and lower glomerular filtration rate compared with the shrunken glomerulus, tubular vacuolations in the DC group. Thus, the present animal study evidenced the hypoglycaemic, hypocholesterolaemic, nephroprotective and anti-cataractogenic properties of finger millet SCM, suggesting its utility as a functional ingredient in diets for diabetics.

  6. Whole plant acclimation responses by finger millet to low nitrogen stress

    Directory of Open Access Journals (Sweden)

    Travis Luc Goron

    2015-08-01

    Full Text Available The small grain cereal, finger millet (FM, Eleusine coracana L. Gaertn, is valued by subsistence farmers in India and East Africa as a low-input crop. It is reported by farmers to require no added nitrogen, or only residual N, to produce grain. Exact mechanisms underlying the acclimation responses of FM to low N are largely unknown, both above and below ground. In particular, the responses of FM roots and root hairs to N or any other nutrient have not previously been reported. Given its low N requirement, FM also provides a rare opportunity to study long-term responses to N starvation in a cereal. The objective of this study was to survey the shoot and root morphometric responses of FM, including root hairs, to low N stress. Plants were grown in pails in a semi-hydroponic system on clay containing extremely low background N, supplemented with N or no N. To our surprise, plants grown without deliberately added N grew to maturity, looked relatively normal and produced healthy seed heads. Plants responded to the low N treatment by decreasing shoot, root and seed head biomass. These declines under low N were associated with decreased shoot tiller number, crown root number, total crown root length and total lateral root length, but with no consistent changes in root hair traits. Changes in tiller and crown root number appeared to coordinate the above and below ground acclimation responses to N. We discuss the remarkable ability of FM to grow to maturity without deliberately added N. The results suggest that FM should be further explored to understand this trait. Our observations are consistent with indigenous knowledge from subsistence farmers in Africa and Asia that this crop can survive extreme environments.

  7. Whole plant acclimation responses by finger millet to low nitrogen stress.

    Science.gov (United States)

    Goron, Travis L; Bhosekar, Vijay K; Shearer, Charles R; Watts, Sophia; Raizada, Manish N

    2015-01-01

    The small grain cereal, finger millet (FM, Eleusine coracana L. Gaertn), is valued by subsistence farmers in India and East Africa as a low-input crop. It is reported by farmers to require no added nitrogen (N), or only residual N, to produce grain. Exact mechanisms underlying the acclimation responses of FM to low N are largely unknown, both above and below ground. In particular, the responses of FM roots and root hairs to N or any other nutrient have not previously been reported. Given its low N requirement, FM also provides a rare opportunity to study long-term responses to N starvation in a cereal species. The objective of this study was to survey the shoot and root morphometric responses of FM, including root hairs, to low N stress. Plants were grown in pails in a semi-hydroponic system on clay containing extremely low background N, supplemented with N or no N. To our surprise, plants grown without deliberately added N grew to maturity, looked relatively normal and produced healthy seed heads. Plants responded to the low N treatment by decreasing shoot, root, and seed head biomass. These declines under low N were associated with decreased shoot tiller number, crown root number, total crown root length and total lateral root length, but with no consistent changes in root hair traits. Changes in tiller and crown root number appeared to coordinate the above and below ground acclimation responses to N. We discuss the remarkable ability of FM to grow to maturity without deliberately added N. The results suggest that FM should be further explored to understand this trait. Our observations are consistent with indigenous knowledge from subsistence farmers in Africa and Asia, where it is reported that this crop can survive extreme environments.

  8. Assessment of Nutrient Contents of Modified Finger Millet (Eleusine coracana Starch

    Directory of Open Access Journals (Sweden)

    Tukura Bitrus Wokhe

    2017-02-01

    Full Text Available Modification processes can change the physicochemical and structural properties of native starch, thereby increasing its industrial applications. Finger millet starch (FMS was modified with casava starch (CS, guar gum (GG and xanthan gum (XG modifiers at the ratios of 95:5%, 90:10%, 80:20% and 75: 25%, for each of the modifier. The proximate and mineral compositions of the modified starch were determined using standard methods. Atomic absorption spectrometry method was used to quantify the mineral contents of the modified starch. Proximate contents of the modified FMS starch varied according to the type of the modifier and FMS/modifier ratios. Concentrations of carbohydrate in CS (66.97±0.03%, GG (64.42±0.05% and XG (64.64 ± 0.01% FMS modified starches were highest at 10%, 25% and 5% of the modifier contents repectively. The highest levels of fat in GG (8.91±0.02%, XG (7.89±0.01 and ash (3.55±0.02% in CS modified starches were recorded when the quantity of the modifiers were increased to 25%. Fatty acid levels in the modified starches varied in the order of XG (7.74±0.03% at 20% > GG (7.13±0.02% at 25% > CS (5.14±0.20% at 10%. At 25% modifier contents, levels of mineral element were highest in the modified CS and GG starches. Modifications decreased Mg, Mn, Fe, Zn, and Cu contents, while the concentrations Na, K, Ca and P increased. The modified starches can be used for production of some foods for specific health purposes.

  9. Tracing QTLs for Leaf Blast Resistance and Agronomic Performance of Finger Millet (Eleusine coracana (L. Gaertn. Genotypes through Association Mapping and in silico Comparative Genomics Analyses.

    Directory of Open Access Journals (Sweden)

    M Ramakrishnan

    Full Text Available Finger millet is one of the small millets with high nutritive value. This crop is vulnerable to blast disease caused by Pyricularia grisea, which occurs annually during rainy and winter seasons. Leaf blast occurs at early crop stage and is highly damaging. Mapping of resistance genes and other quantitative trait loci (QTLs for agronomic performance can be of great use for improving finger millet genotypes. Evaluation of one hundred and twenty-eight finger millet genotypes in natural field conditions revealed that leaf blast caused severe setback on agronomic performance for susceptible genotypes, most significant traits being plant height and root length. Plant height was reduced under disease severity while root length was increased. Among the genotypes, IE4795 showed superior response in terms of both disease resistance and better agronomic performance. A total of seven unambiguous QTLs were found to be associated with various agronomic traits including leaf blast resistance by association mapping analysis. The markers, UGEP101 and UGEP95, were strongly associated with blast resistance. UGEP98 was associated with tiller number and UGEP9 was associated with root length and seed yield. Cross species validation of markers revealed that 12 candidate genes were associated with 8 QTLs in the genomes of grass species such as rice, foxtail millet, maize, Brachypodium stacei, B. distachyon, Panicum hallii and switchgrass. Several candidate genes were found proximal to orthologous sequences of the identified QTLs such as 1,4-β-glucanase for leaf blast resistance, cytokinin dehydrogenase (CKX for tiller production, calmodulin (CaM binding protein for seed yield and pectin methylesterase inhibitor (PMEI for root growth and development. Most of these QTLs and their putatively associated candidate genes are reported for first time in finger millet. On validation, these novel QTLs may be utilized in future for marker assisted breeding for the development of

  10. Tracing QTLs for Leaf Blast Resistance and Agronomic Performance of Finger Millet (Eleusine coracana (L.) Gaertn.) Genotypes through Association Mapping and in silico Comparative Genomics Analyses.

    Science.gov (United States)

    Ramakrishnan, M; Antony Ceasar, S; Duraipandiyan, V; Vinod, K K; Kalpana, Krishnan; Al-Dhabi, N A; Ignacimuthu, S

    2016-01-01

    Finger millet is one of the small millets with high nutritive value. This crop is vulnerable to blast disease caused by Pyricularia grisea, which occurs annually during rainy and winter seasons. Leaf blast occurs at early crop stage and is highly damaging. Mapping of resistance genes and other quantitative trait loci (QTLs) for agronomic performance can be of great use for improving finger millet genotypes. Evaluation of one hundred and twenty-eight finger millet genotypes in natural field conditions revealed that leaf blast caused severe setback on agronomic performance for susceptible genotypes, most significant traits being plant height and root length. Plant height was reduced under disease severity while root length was increased. Among the genotypes, IE4795 showed superior response in terms of both disease resistance and better agronomic performance. A total of seven unambiguous QTLs were found to be associated with various agronomic traits including leaf blast resistance by association mapping analysis. The markers, UGEP101 and UGEP95, were strongly associated with blast resistance. UGEP98 was associated with tiller number and UGEP9 was associated with root length and seed yield. Cross species validation of markers revealed that 12 candidate genes were associated with 8 QTLs in the genomes of grass species such as rice, foxtail millet, maize, Brachypodium stacei, B. distachyon, Panicum hallii and switchgrass. Several candidate genes were found proximal to orthologous sequences of the identified QTLs such as 1,4-β-glucanase for leaf blast resistance, cytokinin dehydrogenase (CKX) for tiller production, calmodulin (CaM) binding protein for seed yield and pectin methylesterase inhibitor (PMEI) for root growth and development. Most of these QTLs and their putatively associated candidate genes are reported for first time in finger millet. On validation, these novel QTLs may be utilized in future for marker assisted breeding for the development of fungal

  11. Transcriptional expression analysis of genes involved in regulation of calcium translocation and storage in finger millet (Eleusine coracana L. Gartn.).

    Science.gov (United States)

    Mirza, Neelofar; Taj, Gohar; Arora, Sandeep; Kumar, Anil

    2014-10-25

    Finger millet (Eleusine coracana) variably accumulates calcium in different tissues, due to differential expression of genes involved in uptake, translocation and accumulation of calcium. Ca(2+)/H(+) antiporter (CAX1), two pore channel (TPC1), CaM-stimulated type IIB Ca(2+) ATPase and two CaM dependent protein kinase (CaMK1 and 2) homologs were studied in finger millet. Two genotypes GP-45 and GP-1 (high and low calcium accumulating, respectively) were used to understand the role of these genes in differential calcium accumulation. For most of the genes higher expression was found in the high calcium accumulating genotype. CAX1 was strongly expressed in the late stages of spike development and could be responsible for accumulating high concentrations of calcium in seeds. TPC1 and Ca(2+) ATPase homologs recorded strong expression in the root, stem and developing spike and signify their role in calcium uptake and translocation, respectively. Calmodulin showed strong expression and a similar expression pattern to the type IIB ATPase in the developing spike only and indicating developing spike or even seed specific isoform of CaM affecting the activity of downstream target of calcium transportation. Interestingly, CaMK1 and CaMK2 had expression patterns similar to ATPase and TPC1 in various tissues raising a possibility of their respective regulation via CaM kinase. Expression pattern of 14-3-3 gene was observed to be similar to CAX1 gene in leaf and developing spike inferring a surprising possibility of CAX1 regulation through 14-3-3 protein. Our results provide a molecular insight for explaining the mechanism of calcium accumulation in finger millet. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Finger Millet: A "Certain" Crop for an "Uncertain" Future and a Solution to Food Insecurity and Hidden Hunger under Stressful Environments.

    Science.gov (United States)

    Gupta, Sanjay Mohan; Arora, Sandeep; Mirza, Neelofar; Pande, Anjali; Lata, Charu; Puranik, Swati; Kumar, J; Kumar, Anil

    2017-01-01

    Crop growth and productivity has largely been vulnerable to various abiotic and biotic stresses that are only set to be compounded due to global climate change. Therefore developing improved varieties and designing newer approaches for crop improvement against stress tolerance have become a priority now-a-days. However, most of the crop improvement strategies are directed toward staple cereals such as rice, wheat, maize etc., whereas attention on minor cereals such as finger millet [ Eleusine coracana (L.) Gaertn.] lags far behind. It is an important staple in several semi-arid and tropical regions of the world with excellent nutraceutical properties as well as ensuring food security in these areas even during harsh environment. This review highlights the importance of finger millet as a model nutraceutical crop. Progress and prospects in genetic manipulation for the development of abiotic and biotic stress tolerant varieties is also discussed. Although limited studies have been conducted for genetic improvement of finger millets, its nutritional significance in providing minerals, calories and protein makes it an ideal model for nutrition-agriculture research. Therefore, improved genetic manipulation of finger millets for resistance to both abiotic and biotic stresses, as well as for enhancing nutrient content will be very effective in millet improvement. Key message: Apart from the excellent nutraceutical value of finger millet, its ability to tolerate various abiotic stresses and resist pathogens make it an excellent model for exploring vast genetic and genomic potential of this crop, which provide us a wide choice for developing strategies for making climate resilient staple crops.

  13. Finger Millet: A “Certain” Crop for an “Uncertain” Future and a Solution to Food Insecurity and Hidden Hunger under Stressful Environments

    Science.gov (United States)

    Gupta, Sanjay Mohan; Arora, Sandeep; Mirza, Neelofar; Pande, Anjali; Lata, Charu; Puranik, Swati; Kumar, J.; Kumar, Anil

    2017-01-01

    Crop growth and productivity has largely been vulnerable to various abiotic and biotic stresses that are only set to be compounded due to global climate change. Therefore developing improved varieties and designing newer approaches for crop improvement against stress tolerance have become a priority now-a-days. However, most of the crop improvement strategies are directed toward staple cereals such as rice, wheat, maize etc., whereas attention on minor cereals such as finger millet [Eleusine coracana (L.) Gaertn.] lags far behind. It is an important staple in several semi-arid and tropical regions of the world with excellent nutraceutical properties as well as ensuring food security in these areas even during harsh environment. This review highlights the importance of finger millet as a model nutraceutical crop. Progress and prospects in genetic manipulation for the development of abiotic and biotic stress tolerant varieties is also discussed. Although limited studies have been conducted for genetic improvement of finger millets, its nutritional significance in providing minerals, calories and protein makes it an ideal model for nutrition-agriculture research. Therefore, improved genetic manipulation of finger millets for resistance to both abiotic and biotic stresses, as well as for enhancing nutrient content will be very effective in millet improvement. Key message: Apart from the excellent nutraceutical value of finger millet, its ability to tolerate various abiotic stresses and resist pathogens make it an excellent model for exploring vast genetic and genomic potential of this crop, which provide us a wide choice for developing strategies for making climate resilient staple crops. PMID:28487720

  14. Finger Millet: A “Certain” Crop for an “Uncertain” Future and a Solution to Food Insecurity and Hidden Hunger under Stressful Environments

    Directory of Open Access Journals (Sweden)

    Anil Kumar

    2017-04-01

    Full Text Available Crop growth and productivity has largely been vulnerable to various abiotic and biotic stresses that are only set to be compounded due to global climate change. Therefore developing improved varieties and designing newer approaches for crop improvement against stress tolerance have become a priority now-a-days. However, most of the crop improvement strategies are directed toward staple cereals such as rice, wheat, maize etc., whereas attention on minor cereals such as finger millet [Eleusine coracana (L. Gaertn.] lags far behind. It is an important staple in several semi-arid and tropical regions of the world with excellent nutraceutical properties as well as ensuring food security in these areas even during harsh environment. This review highlights the importance of finger millet as a model nutraceutical crop. Progress and prospects in genetic manipulation for the development of abiotic and biotic stress tolerant varieties is also discussed. Although limited studies have been conducted for genetic improvement of finger millets, its nutritional significance in providing minerals, calories and protein makes it an ideal model for nutrition-agriculture research. Therefore, improved genetic manipulation of finger millets for resistance to both abiotic and biotic stresses, as well as for enhancing nutrient content will be very effective in millet improvement.Key message: Apart from the excellent nutraceutical value of finger millet, its ability to tolerate various abiotic stresses and resist pathogens make it an excellent model for exploring vast genetic and genomic potential of this crop, which provide us a wide choice for developing strategies for making climate resilient staple crops.

  15. Root-hair endophyte stacking in finger millet creates a physicochemical barrier to trap the fungal pathogen Fusarium graminearum.

    Science.gov (United States)

    Mousa, Walaa K; Shearer, Charles; Limay-Rios, Victor; Ettinger, Cassie L; Eisen, Jonathan A; Raizada, Manish N

    2016-09-26

    The ancient African crop, finger millet, has broad resistance to pathogens including the toxigenic fungus Fusarium graminearum. Here, we report the discovery of a novel plant defence mechanism resulting from an unusual symbiosis between finger millet and a root-inhabiting bacterial endophyte, M6 (Enterobacter sp.). Seed-coated M6 swarms towards root-invading Fusarium and is associated with the growth of root hairs, which then bend parallel to the root axis, subsequently forming biofilm-mediated microcolonies, resulting in a remarkable, multilayer root-hair endophyte stack (RHESt). The RHESt results in a physical barrier that prevents entry and/or traps F. graminearum, which is then killed. M6 thus creates its own specialized killing microhabitat. Tn5-mutagenesis shows that M6 killing requires c-di-GMP-dependent signalling, diverse fungicides and resistance to a Fusarium-derived antibiotic. Further molecular evidence suggests long-term host-endophyte-pathogen co-evolution. The end result of this remarkable symbiosis is reduced deoxynivalenol mycotoxin, potentially benefiting millions of subsistence farmers and livestock. Further results suggest that the anti-Fusarium activity of M6 may be transferable to maize and wheat. RHESt demonstrates the value of exploring ancient, orphan crop microbiomes.

  16. Novel Phl-producing genotypes of finger millet rhizosphere associated pseudomonads and assessment of their functional and genetic diversity.

    Science.gov (United States)

    Sekar, Jegan; Prabavathy, Vaiyapuri Ramalingam

    2014-07-01

    Genetic diversity of phlD gene, an essential gene in the biosynthesis of 2,4-diacetylphloroglucinol, was studied by restriction fragment length polymorphism (RFLP) in 20 Phl-producing pseudomonads isolated from finger millet rhizosphere. RFLP analysis of phlD gene displayed three patterns with HaeIII and TaqI enzymes. phlD gene sequence closely correlated with RFLP results and revealed the existence of three new genotypes G, H and I. Further, the phylogenetic and concatenated sequence analysis of the 16S rRNA, rpoB, gyrB, rpoD genes supported the hypothesis that these genotypes G, H and I were different from reported genotypes A-F. In all phylogenetic studies, the genotype G formed a distant clade from the groups of Pseudomonas putida and P. aeruginosa (sensu strictu), but the groups H and I were closely related to P. aeruginosa/P. stutzeri group. The Phl-producing pseudomonads exhibited antagonistic activity against Pyricularia grisea (TN508), Gaeumannomyces graminis (DSM1463), Fusarium oxysporum (DSM62297), Xanthomonas campestris (DSM3586) and Erwinia persicina (HMGU155). In addition, these strains exhibited various plant growth-promoting traits. In conclusion, this study displays the existence of novel Phl-producing pseudomonads genotypes G, H and I from finger millet rhizosphere, which formed taxonomically outward phylogenetic lineage from the groups of P. putida and P. aeruginosa (sensu strictu). © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  17. Association mapping of agro-morphological characters among the global collection of finger millet genotypes using genomic SSR markers.

    Science.gov (United States)

    Kalyana Babu, B; Agrawal, P K; Pandey, Dinesh; Jaiswal, J P; Kumar, Anil

    2014-08-01

    Identification of alleles responsible for various agro-morphological characters is a major concern to further improve the finger millet germplasm. Forty-six genomic SSRs were used for genetic analysis and population structure analysis of a global collection of 190 finger millet genotypes and fifteen agro-morphological characters were evaluated. The overall results showed that Asian genotypes were smaller in height, smaller flag leaf length, less basal tiller number, early flowering and early maturity nature, small ear head length, and smaller in length of longest finger. The 46 SSRs yielded 90 scorable alleles and the polymorphism information content values varied from 0.292 to 0.703 at an average of 0.442. The gene diversity was in the range of 0.355 to 0.750 with an average value of 0.528. The 46 genomic SSR loci grouped the 190 finger millet genotypes into two major clusters based on their geographical origin by the both phylogenetic clustering and population structure analysis by STRUCTURE software. Association mapping of QTLs for 15 agro-morphological characters with 46 genomic SSRs resulted in identification of five markers were linked to QTLs of four traits at a significant threshold (P) level of ≤ 0.01 and ≤ 0.001. The QTL for basal tiller number was strongly associated with the locus UGEP81 at a P value of 0.001 by explaining the phenotypic variance (R (2)) of 10.8%. The QTL for days to 50% flowering was linked by two SSR loci UGEP77 and UGEP90, explained 10 and 8.7% of R (2) respectively at a P value of 0.01. The SSR marker, FM9 found to have strong association to two agro-morphological traits, flag leaf width (P-0.001, R(2)-14.1 %) and plant height (P-0.001, R(2)-11.2%). The markers linked to the QTLs for above agro-morphological characters found in the present study can be further used for cloning of the full length gene, fine mapping and their further use in the marker assisted breeding programmes for introgression of alleles into locally well

  18. Calcium Biofortification: Three Pronged Molecular Approaches for Dissecting Complex Trait of Calcium Nutrition in Finger Millet (Eleusine coracana) for Devising Strategies of Enrichment of Food Crops.

    Science.gov (United States)

    Sharma, Divya; Jamra, Gautam; Singh, Uma M; Sood, Salej; Kumar, Anil

    2016-01-01

    Calcium is an essential macronutrient for plants and animals and plays an indispensable role in structure and signaling. Low dietary intake of calcium in humans has been epidemiologically linked to various diseases which can have serious health consequences over time. Major staple food-grains are poor source of calcium, however, finger millet [ Eleusine coracana (L.) Gaertn.], an orphan crop has an immense potential as a nutritional security crop due to its exceptionally high calcium content. Understanding the existing genetic variation as well as molecular mechanisms underlying the uptake, transport, accumulation of calcium ions (Ca 2+ ) in grains is of utmost importance for development of calcium bio-fortified crops. In this review, we have discussed molecular mechanisms involved in calcium accumulation and transport thoroughly, emphasized the role of molecular breeding, functional genomics and transgenic approaches to understand the intricate mechanism of calcium nutrition in finger millet. The objective is to provide a comprehensive up to date account of molecular mechanisms regulating calcium nutrition and highlight the significance of bio-fortification through identification of potential candidate genes and regulatory elements from finger millet to alleviate calcium malnutrition. Hence, finger millet could be used as a model system for explaining the mechanism of elevated calcium (Ca 2+ ) accumulation in its grains and could pave way for development of nutraceuticals or designer crops.

  19. Identification and molecular characterization of 48 kDa calcium binding protein as calreticulin from finger millet (Eleusine coracana) using peptide mass fingerprinting and transcript profiling.

    Science.gov (United States)

    Singh, Manoj; Metwal, Mamta; Kumar, Vandana A; Kumar, Anil

    2016-01-30

    Attempts were made to identify and characterize the calcium binding proteins (CaBPs) in grain filling stages of finger millet using proteomics, bioinformatics and molecular approaches. A distinctly observed blue color band of 48 kDa stained by Stains-all was eluted and analyzed as calreticulin (CRT) using nano liquid chromatography-tandem mass spectrometry (nano LC-MS). Based on the top hits of peptide mass fingerprinting results, conserved primers were designed for isolation of the CRT gene from finger millet using calreticulin sequences of different cereals. The deduced nucleotide sequence analysis of 600 bp amplicon showed up to 91% similarity with CRT gene(s) of rice and other plant species and designated as EcCRT1. Transcript profiling of EcCRT1 showed different levels of relative expression at different stages of developing spikes. The higher expression of EcCRT1 transcripts and protein were observed in later stages of developing spikes which might be due to greater translational synthesis of EcCRT1 protein during seed maturation in finger millet. Preferentially higher synthesis of this CaBP during later stages of grain filling may be responsible for the sequestration of calcium in endoplasmic reticulum of finger millet grains. © 2015 Society of Chemical Industry.

  20. Spermidine sprays alleviate the water deficit-induced oxidative stress in finger millet (Eleusine coracana L. Gaertn.) plants.

    Science.gov (United States)

    Satish, Lakkakula; Rency, Arockiam Sagina; Ramesh, Manikandan

    2018-01-01

    Severe drought stress (water deficit) in finger millet ( Eleusine coracana L. Gaertn.) plants significantly reduced total leaf chlorophyll and relative water content in shoots and roots, whereas electrolyte leakage, concentrations of proline and hydrogen peroxide, as well as caspase-like activity were significantly increased. The role of spermidine in plant defence to water-stress was investigated after subjected to various drought treatments. Three weeks of daily spermidine sprays (0.2 mM) at early flowering stage significantly changed shoot and root growth, in both fresh and dry weights terms. At 75% of water deficit stress, leaves accumulated twice as much proline as unstressed plants, and roots accumulated thrice. Plants treated with spermidine under water stress showed lower electrolyte leakage, hydrogen peroxide and caspase-like activity than unstressed and untreated control.

  1. Identification and characterization of calcium transporter gene family in finger millet in relation to grain calcium content.

    Science.gov (United States)

    Singh, Uma M; Metwal, Mamta; Singh, Manoj; Taj, Gohar; Kumar, Anil

    2015-07-15

    Calcium (Ca) is an essential mineral for proper growth and development of plants as well as animals. In plants including cereals, calcium is deposited in seed during its development which is mediated by specialized Ca transporters. Common cereal seeds contain very low amounts of Ca while the finger millet (Eleusine coracana) contains exceptionally high amounts of Ca in seed. In order to understand the role of Ca transporters in grain Ca accumulation, developing seed transcriptome of two finger millet genotypes (GP-1, low Ca and GP-45 high Ca) differing in seed Ca content was sequenced using Illumina paired-end sequencing technology and members of Ca transporter gene family were identified. Out of 109,218 and 120,130 contigs, 86 and 81 contigs encoding Ca transporters were identified in GP-1 and GP-45, respectively. After removal of redundant sequences, a total of 19 sequences were confirmed as Ca transporter genes, which includes 11 Ca(2+) ATPases, 07 Ca(2+)/cation exchangers and 01 Ca(2+) channel. The differential expressions of all genes were analyzed from transcriptome data and it was observed that 9 and 3 genes were highly expressed in GP-45 and GP-1 genotypes respectively. Validation of transcriptome expression data of selected Ca transporter genes was performed on different stages of developing spikes of both genotypes grown under different concentrations of exogenous Ca. In both genotypes, significant correlation was observed between the expression of these genes, especially EcCaX3, and on the amount of Ca accumulated in seed. The positive correlation of seed mass with the amount of Ca concentration was also observed. The efficient Ca transport property and responsiveness of EcCAX3 towards exogenous Ca could be utilized in future biofortification program. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Finger Millet Growth and Nutrient Uptake Is Improved in Intercropping With Pigeon Pea Through “Biofertilization” and “Bioirrigation” Mediated by Arbuscular Mycorrhizal Fungi and Plant Growth Promoting Rhizobacteria

    Directory of Open Access Journals (Sweden)

    Krishna Saharan

    2018-06-01

    Full Text Available Legume-cereal intercropping is well known in traditional dry land agriculture. Here, we tested whether finger millet, a shallow-rooted cereal, can profit from neighboring pigeon pea, a deep-rooted legume, in the presence of “biofertilization” with arbuscular mycorrhizal fungi (AMF and plant growth-promoting rhizobacteria (PGPR, under drought conditions. We conducted a greenhouse experiment using compartmented microcosms. Pigeon pea was grown in a deep compartment with access to a moist substrate layer at the bottom, whereas finger millet was grown in a neighboring shallow compartment, separated by 25-μm nylon mesh, without access to the moist substrate layer. In the presence of a common mycorrhizal network (CMN, with or without PGPR, a drought condition had little negative effect on the biomass production of the finger millet plant whereas in absence of biofertilization, finger millet biomass production was less than half compared to well-watered condition. Biofertilization strongly increased nitrogen and phosphorus uptake by both plants, both under well-watered and drought conditions. In the presence of AMF, both plants also acquired 15N and 33P, offered in a labeling compartment accessible to fungal hyphae but not to roots. Our results show that “biofertilization” with AMF alleviates the negative effects of drought condition on finger millet, indicating that the CMN connecting pigeon pea and finger millet exert clearly a positive influence in this simulated intercropping system.

  3. Potential of Finger Millet Indigenous Rhizobacterium Pseudomonas sp. MSSRFD41 in Blast Disease Management—Growth Promotion and Compatibility With the Resident Rhizomicrobiome

    Directory of Open Access Journals (Sweden)

    Jegan Sekar

    2018-05-01

    Full Text Available Finger millet [Eleusine coracona (L. Gaertner] “Ragi” is a nutri-cereal with potential health benefits, and is utilized solely for human consumption in semi-arid regions of Asia and Africa. It is highly vulnerable to blast disease caused by Pyricularia grisea, resulting in 50–100% yield loss. Chemical fungicides are used for the management of blast disease, but with great safety concern. Alternatively, bioinoculants are widely used in promoting seedling efficiency, plant biomass, and disease control. Little is known about the impact of introduced indigenous beneficial rhizobacteria on the rhizosphere microbiota and growth promotion in finger millet. Strain MSSRFD41 exhibited a 22.35 mm zone of inhibition against P. grisea, produces antifungal metabolites, siderophores, hydrolytic enzymes, and IAA, and solubilizes phosphate. Environmental SEM analysis indicated the potential of MSSRFD41 to inhibit the growth of P. grisea by affecting cellular functions, which caused deformation in fungal hyphae. Bioprimed finger millet seeds exhibited significantly higher levels of germination, seedling vigor index, and enhanced shoot and root length compared to control seeds. Cross streaking and RAPD analysis showed that MSSRFD41 is compatible with different groups of rhizobacteria and survived in the rhizosphere. In addition, PLFA analysis revealed no significant difference in microbial biomass between the treated and control rhizosphere samples. Field trials showed that MSSRFD41 treatment significantly reduced blast infestation and enhanced plant growth compared to other treatments. A liquid formulated MSSRFD41 product maintained shelf life at an average of 108 CFU ml−1 over 150 days of storage at 25°C. Overall, results from this study demonstrated that Pseudomonas sp. MSSRFD41, an indigenous rhizobacterial strain, is an alternative, effective, and sustainable resource for the management of P. grisea infestation and growth promotion of finger millet.

  4. Potential of Finger Millet Indigenous Rhizobacterium Pseudomonas sp. MSSRFD41 in Blast Disease Management—Growth Promotion and Compatibility With the Resident Rhizomicrobiome

    Science.gov (United States)

    Sekar, Jegan; Raju, Kathiravan; Duraisamy, Purushothaman; Ramalingam Vaiyapuri, Prabavathy

    2018-01-01

    Finger millet [Eleusine coracona (L). Gaertner] “Ragi” is a nutri-cereal with potential health benefits, and is utilized solely for human consumption in semi-arid regions of Asia and Africa. It is highly vulnerable to blast disease caused by Pyricularia grisea, resulting in 50–100% yield loss. Chemical fungicides are used for the management of blast disease, but with great safety concern. Alternatively, bioinoculants are widely used in promoting seedling efficiency, plant biomass, and disease control. Little is known about the impact of introduced indigenous beneficial rhizobacteria on the rhizosphere microbiota and growth promotion in finger millet. Strain MSSRFD41 exhibited a 22.35 mm zone of inhibition against P. grisea, produces antifungal metabolites, siderophores, hydrolytic enzymes, and IAA, and solubilizes phosphate. Environmental SEM analysis indicated the potential of MSSRFD41 to inhibit the growth of P. grisea by affecting cellular functions, which caused deformation in fungal hyphae. Bioprimed finger millet seeds exhibited significantly higher levels of germination, seedling vigor index, and enhanced shoot and root length compared to control seeds. Cross streaking and RAPD analysis showed that MSSRFD41 is compatible with different groups of rhizobacteria and survived in the rhizosphere. In addition, PLFA analysis revealed no significant difference in microbial biomass between the treated and control rhizosphere samples. Field trials showed that MSSRFD41 treatment significantly reduced blast infestation and enhanced plant growth compared to other treatments. A liquid formulated MSSRFD41 product maintained shelf life at an average of 108 CFU ml−1 over 150 days of storage at 25°C. Overall, results from this study demonstrated that Pseudomonas sp. MSSRFD41, an indigenous rhizobacterial strain, is an alternative, effective, and sustainable resource for the management of P. grisea infestation and growth promotion of finger millet. PMID:29875748

  5. Alleviation of nickel toxicity in finger millet (Eleusine coracana L. germinating seedlings by exogenous application of salicylic acid and nitric oxide

    Directory of Open Access Journals (Sweden)

    Kasi Viswanath Kotapati

    2017-06-01

    Full Text Available This study investigated the effect of salicylic acid (SA and sodium nitroprusside (SNP; NO donor on nickel (Ni toxicity in germinating finger millet seedlings. Fourteen-day-old finger millet plants were subjected to 0.5 mmol L−1 Ni overload and treated with 0.2 mmol L−1 salicylic acid and 0.2 mmol L−1 sodium nitroprusside to lessen the toxic effect of Ni. The Ni overload led to high accumulation in the roots of growing plants compared to shoots, causing oxidative stress. It further reduced root and shoot length, dry mass, total chlorophyll, and mineral content. Exogenous addition of either 0.2 mmol L−1 SA or 0.2 mmol L−1 SNP reduced the toxic effect of Ni, and supplementation with both SA and SNP significantly reduced the toxic effect of Ni and increased root and shoot length, chlorophyll content, dry mass, and mineral concentration in Ni-treated plants. The results show that oxidative stress can be triggered in finger millet plants by Ni stress by induction of lipoxygenase activity, increase in levels of proline, O2•− radical, MDA, and H2O2, and reduction in the activity of antioxidant enzymes such as CAT, SOD, and APX in shoots and roots. Exogenous application of SA or SNP, specifically the combination of SA + SNP, protects finger millet plants from oxidative stress observed under Ni treatment.

  6. Functional markers based molecular characterization and cloning of resistance gene analogs encoding NBS-LRR disease resistance proteins in finger millet (Eleusine coracana).

    Science.gov (United States)

    Panwar, Preety; Jha, Anand Kumar; Pandey, P K; Gupta, Arun K; Kumar, Anil

    2011-06-01

    Magnaporthe grisea, the blast fungus is one of the main pathological threats to finger millet crop worldwide. A systematic search for the blast resistance gene analogs was carried out, using functional molecular markers. Three-fourths of the recognition-dependent disease resistance genes (R-genes) identified in plants encodes nucleotide binding site (NBS) leucine-rich repeat (LRR) proteins. NBS-LRR homologs have only been isolated on a limited scale from Eleusine coracana. Genomic DNA sequences sharing homology with NBS region of resistance gene analogs were isolated and characterized from resistant genotypes of finger millet using PCR based approach with primers designed from conserved regions of NBS domain. Attempts were made to identify molecular markers linked to the resistance gene and to differentiate the resistant bulk from the susceptible bulk. A total of 9 NBS-LRR and 11 EST-SSR markers generated 75.6 and 73.5% polymorphism respectively amongst 73 finger millet genotypes. NBS-5, NBS-9, NBS-3 and EST-SSR-04 markers showed a clear polymorphism which differentiated resistant genotypes from susceptible genotypes. By comparing the banding pattern of different resistant and susceptible genotypes, five DNA amplifications of NBS and EST-SSR primers (NBS-05(504,) NBS-09(711), NBS-07(688), NBS-03(509) and EST-SSR-04(241)) were identified as markers for the blast resistance in resistant genotypes. Principal coordinate plot and UPGMA analysis formed similar groups of the genotypes and placed most of the resistant genotypes together showing a high level of genetic relatedness and the susceptible genotypes were placed in different groups on the basis of differential disease score. Our results provided a clue for the cloning of finger millet blast resistance gene analogs which not only facilitate the process of plant breeding but also molecular characterization of blast resistance gene analogs from Eleusine coracana.

  7. Potential of Finger Millet Indigenous Rhizobacterium Pseudomonas sp. MSSRFD41 in Blast Disease Management-Growth Promotion and Compatibility With the Resident Rhizomicrobiome.

    Science.gov (United States)

    Sekar, Jegan; Raju, Kathiravan; Duraisamy, Purushothaman; Ramalingam Vaiyapuri, Prabavathy

    2018-01-01

    Finger millet [ Eleusine coracona (L). Gaertner] "Ragi" is a nutri-cereal with potential health benefits, and is utilized solely for human consumption in semi-arid regions of Asia and Africa. It is highly vulnerable to blast disease caused by Pyricularia grisea , resulting in 50-100% yield loss. Chemical fungicides are used for the management of blast disease, but with great safety concern. Alternatively, bioinoculants are widely used in promoting seedling efficiency, plant biomass, and disease control. Little is known about the impact of introduced indigenous beneficial rhizobacteria on the rhizosphere microbiota and growth promotion in finger millet. Strain MSSRFD41 exhibited a 22.35 mm zone of inhibition against P. grisea , produces antifungal metabolites, siderophores, hydrolytic enzymes, and IAA, and solubilizes phosphate. Environmental SEM analysis indicated the potential of MSSRFD41 to inhibit the growth of P. grisea by affecting cellular functions, which caused deformation in fungal hyphae. Bioprimed finger millet seeds exhibited significantly higher levels of germination, seedling vigor index, and enhanced shoot and root length compared to control seeds. Cross streaking and RAPD analysis showed that MSSRFD41 is compatible with different groups of rhizobacteria and survived in the rhizosphere. In addition, PLFA analysis revealed no significant difference in microbial biomass between the treated and control rhizosphere samples. Field trials showed that MSSRFD41 treatment significantly reduced blast infestation and enhanced plant growth compared to other treatments. A liquid formulated MSSRFD41 product maintained shelf life at an average of 10 8 CFU ml -1 over 150 days of storage at 25°C. Overall, results from this study demonstrated that Pseudomonas sp. MSSRFD41, an indigenous rhizobacterial strain, is an alternative, effective, and sustainable resource for the management of P. grisea infestation and growth promotion of finger millet.

  8. Effect of fermentation and malting on some cereal weaning foods ...

    African Journals Online (AJOL)

    Effect of fermentation and malting on some cereal weaning foods enriched with African locust beans were carried out. Cereals (wheat and millet) were malted for the period of 144 hours and further fermented for 48 hours by natural fermentation. The millet, wheat and locust bean flours were mixed together in the ratio ...

  9. Molecular characterization of EcCIPK24 gene of finger millet (Eleusine coracana) for investigating its regulatory role in calcium transport.

    Science.gov (United States)

    Chinchole, Mahadev; Pathak, Rajesh Kumar; Singh, Uma M; Kumar, Anil

    2017-08-01

    Finger millet grains contain exceptionally high levels of calcium which is much higher compared to other cereals and millets. Since calcium is an important macronutrient in human diet, it is necessary to explore the molecular basis of calcium accumulation in the seeds of finger millet. CIPK is a calcium sensor gene, having role in activating Ca 2+ exchanger protein by interaction with CBL proteins. To know the role of EcCIPK24 gene in seed Ca 2+ accumulation, sequence is retrieved from the transcriptome data of two finger millet genotypes GP1 (low Ca 2+ ) and GP45 (high Ca 2+ ), and the expression was determined through qRT-PCR. The higher expression was found in root, shoot, leaf and developing spike tissue of GP45 compared to GP1; structural analysis showed difference of nine SNPs and one extra beta sheet domain as well as differences in vacuolar localization was predicted; besides, the variation in amino acid composition among both the genotypes was also investigated. Molecular modeling and docking studies revealed that both EcCBL4 and EcCBL10 showed strong binding affinity with EcCIPK24 (GP1) compared to EcCIPK24 (GP45). It indicates a genotypic structural variation, which not only affects the affinity but also calcium transport efficiency after interaction of CIPK-CBL with calcium exchanger ( Ec CAX1b) to pull calcium in the vacuole. Based on the expression and in silico study, it can be suggested that by activating EcCAX1b protein, EcCIPK24 plays an important role in high seed Ca 2+ accumulation.

  10. Expression of miRNAs confers enhanced tolerance to drought and salt stress in Finger millet (Eleusine coracona

    Directory of Open Access Journals (Sweden)

    Nageshbabu R.

    2013-08-01

    Full Text Available Plants respond to the environmental cues in various ways, recent knowledge of RNA interference in conferring stress tolerance had become a new hope of developing tolerant varieties. Here we attempt to unfold the molecular mechanism of stress tolerance through miRNA profiling and expression analysis in Finger millet (Eleusine coracona under salt and drought stress conditions. The expression analysis of 12 stress specific conserved miRNAs was studied using semi-quantitative real time PCR and Northern blot assay. Our studies revealed that, although most of the miRNAs responded to the stresses, the expression of particular miRNA differed with the nature of stress and the tissue. The expression analysis was correlated with the existing data of their target genes. Abiotic stress up-regulated miRNAs are expected to target negative regulators of stress responses or positive regulators of processes that are inhibited by stresses. On the other hand, stress down-regulated miRNAs may repress the expression of positive regulators and/or stress up-regulated genes. Thus the current study of miRNAs and their targets under abiotic stress conditions displays miRNAs may be good candidates to attribute the stress tolerance in plants by transgenic technology.

  11. Isolation and expression analysis of EcbZIP17 from different finger millet genotypes shows conserved nature of the gene.

    Science.gov (United States)

    Chopperla, Ramakrishna; Singh, Sonam; Mohanty, Sasmita; Reddy, Nanja; Padaria, Jasdeep C; Solanke, Amolkumar U

    2017-10-01

    Basic leucine zipper (bZIP) transcription factors comprise one of the largest gene families in plants. They play a key role in almost every aspect of plant growth and development and also in biotic and abiotic stress tolerance. In this study, we report isolation and characterization of EcbZIP17 , a group B bZIP transcription factor from a climate smart cereal, finger millet ( Eleusine coracana L.). The genomic sequence of EcbZIP17 is 2662 bp long encompassing two exons and one intron with ORF of 1722 bp and peptide length of 573 aa. This gene is homologous to AtbZIP17 ( Arabidopsis ), ZmbZIP17 (maize) and OsbZIP60 (rice) which play a key role in endoplasmic reticulum (ER) stress pathway. In silico analysis confirmed the presence of basic leucine zipper (bZIP) and transmembrane (TM) domains in the EcbZIP17 protein. Allele mining of this gene in 16 different genotypes by Sanger sequencing revealed no variation in nucleotide sequence, including the 618 bp long intron. Expression analysis of EcbZIP17 under heat stress exhibited similar pattern of expression in all the genotypes across time intervals with highest upregulation after 4 h. The present study established the conserved nature of EcbZIP17 at nucleotide and expression level.

  12. Expression of a finger millet transcription factor, EcNAC1, in tobacco confers abiotic stress-tolerance.

    Directory of Open Access Journals (Sweden)

    Venkategowda Ramegowda

    Full Text Available NAC (NAM, ATAF1-2, and CUC2 proteins constitute one of the largest families of plant-specific transcription factors and have been shown to be involved in diverse plant processes including plant growth, development, and stress-tolerance. In this study, a stress-responsive NAC gene, EcNAC1, was isolated from the subtracted stress cDNA library generated from a drought adapted crop, finger millet, and characterized for its role in stress-tolerance. The expression analysis showed that EcNAC1 was highly induced during water-deficit and salt stress. EcNAC1 shares high amino acid similarity with rice genes that have been phylogenetically classified into stress-related NAC genes. Our results demonstrated that tobacco transgenic plants expressing EcNAC1 exhibit tolerance to various abiotic stresses like simulated osmotic stress, by polyethylene glycol (PEG and mannitol, and salinity stress. The transgenic plants also showed enhanced tolerance to methyl-viologen (MV induced oxidative stress. Reduced levels of reactive oxygen species (ROS and ROS-induced damage were noticed in pot grown transgenic lines under water-deficit and natural high light conditions. Root growth under stress and recovery growth after stress alleviation was more in transgenic plants. Many stress-responsive genes were found to be up-regulated in transgenic lines expressing EcNAC1. Our results suggest that EcNAC1 overexpression confers tolerance against abiotic stress in susceptible species, tobacco.

  13. Transcriptome wide identification and validation of calcium sensor gene family in the developing spikes of finger millet genotypes for elucidating its role in grain calcium accumulation.

    Directory of Open Access Journals (Sweden)

    Uma M Singh

    Full Text Available BACKGROUND: In finger millet, calcium is one of the important and abundant mineral elements. The molecular mechanisms involved in calcium accumulation in plants remains poorly understood. Transcriptome sequencing of genetically diverse genotypes of finger millet differing in grain calcium content will help in understanding the trait. PRINCIPAL FINDING: In this study, the transcriptome sequencing of spike tissues of two genotypes of finger millet differing in their grain calcium content, were performed for the first time. Out of 109,218 contigs, 78 contigs in case of GP-1 (Low Ca genotype and out of 120,130 contigs 76 contigs in case of GP-45 (High Ca genotype, were identified as calcium sensor genes. Through in silico analysis all 82 unique calcium sensor genes were classified into eight calcium sensor gene family viz., CaM & CaMLs, CBLs, CIPKs, CRKs, PEPRKs, CDPKs, CaMKs and CCaMK. Out of 82 genes, 12 were found diverse from the rice orthologs. The differential expression analysis on the basis of FPKM value resulted in 24 genes highly expressed in GP-45 and 11 genes highly expressed in GP-1. Ten of the 35 differentially expressed genes could be assigned to three documented pathways involved mainly in stress responses. Furthermore, validation of selected calcium sensor responder genes was also performed by qPCR, in developing spikes of both genotypes grown on different concentration of exogenous calcium. CONCLUSION: Through de novo transcriptome data assembly and analysis, we reported the comprehensive identification and functional characterization of calcium sensor gene family. The calcium sensor gene family identified and characterized in this study will facilitate in understanding the molecular basis of calcium accumulation and development of calcium biofortified crops. Moreover, this study also supported that identification and characterization of gene family through Illumina paired-end sequencing is a potential tool for generating the

  14. Transcriptome wide identification and validation of calcium sensor gene family in the developing spikes of finger millet genotypes for elucidating its role in grain calcium accumulation.

    Science.gov (United States)

    Singh, Uma M; Chandra, Muktesh; Shankhdhar, Shailesh C; Kumar, Anil

    2014-01-01

    In finger millet, calcium is one of the important and abundant mineral elements. The molecular mechanisms involved in calcium accumulation in plants remains poorly understood. Transcriptome sequencing of genetically diverse genotypes of finger millet differing in grain calcium content will help in understanding the trait. In this study, the transcriptome sequencing of spike tissues of two genotypes of finger millet differing in their grain calcium content, were performed for the first time. Out of 109,218 contigs, 78 contigs in case of GP-1 (Low Ca genotype) and out of 120,130 contigs 76 contigs in case of GP-45 (High Ca genotype), were identified as calcium sensor genes. Through in silico analysis all 82 unique calcium sensor genes were classified into eight calcium sensor gene family viz., CaM & CaMLs, CBLs, CIPKs, CRKs, PEPRKs, CDPKs, CaMKs and CCaMK. Out of 82 genes, 12 were found diverse from the rice orthologs. The differential expression analysis on the basis of FPKM value resulted in 24 genes highly expressed in GP-45 and 11 genes highly expressed in GP-1. Ten of the 35 differentially expressed genes could be assigned to three documented pathways involved mainly in stress responses. Furthermore, validation of selected calcium sensor responder genes was also performed by qPCR, in developing spikes of both genotypes grown on different concentration of exogenous calcium. Through de novo transcriptome data assembly and analysis, we reported the comprehensive identification and functional characterization of calcium sensor gene family. The calcium sensor gene family identified and characterized in this study will facilitate in understanding the molecular basis of calcium accumulation and development of calcium biofortified crops. Moreover, this study also supported that identification and characterization of gene family through Illumina paired-end sequencing is a potential tool for generating the genomic information of gene family in non-model species.

  15. Transcriptome Wide Identification and Validation of Calcium Sensor Gene Family in the Developing Spikes of Finger Millet Genotypes for Elucidating Its Role in Grain Calcium Accumulation

    Science.gov (United States)

    Singh, Uma M.; Chandra, Muktesh; Shankhdhar, Shailesh C.; Kumar, Anil

    2014-01-01

    Background In finger millet, calcium is one of the important and abundant mineral elements. The molecular mechanisms involved in calcium accumulation in plants remains poorly understood. Transcriptome sequencing of genetically diverse genotypes of finger millet differing in grain calcium content will help in understanding the trait. Principal Finding In this study, the transcriptome sequencing of spike tissues of two genotypes of finger millet differing in their grain calcium content, were performed for the first time. Out of 109,218 contigs, 78 contigs in case of GP-1 (Low Ca genotype) and out of 120,130 contigs 76 contigs in case of GP-45 (High Ca genotype), were identified as calcium sensor genes. Through in silico analysis all 82 unique calcium sensor genes were classified into eight calcium sensor gene family viz., CaM & CaMLs, CBLs, CIPKs, CRKs, PEPRKs, CDPKs, CaMKs and CCaMK. Out of 82 genes, 12 were found diverse from the rice orthologs. The differential expression analysis on the basis of FPKM value resulted in 24 genes highly expressed in GP-45 and 11 genes highly expressed in GP-1. Ten of the 35 differentially expressed genes could be assigned to three documented pathways involved mainly in stress responses. Furthermore, validation of selected calcium sensor responder genes was also performed by qPCR, in developing spikes of both genotypes grown on different concentration of exogenous calcium. Conclusion Through de novo transcriptome data assembly and analysis, we reported the comprehensive identification and functional characterization of calcium sensor gene family. The calcium sensor gene family identified and characterized in this study will facilitate in understanding the molecular basis of calcium accumulation and development of calcium biofortified crops. Moreover, this study also supported that identification and characterization of gene family through Illumina paired-end sequencing is a potential tool for generating the genomic information of

  16. UGbS-Flex, a novel bioinformatics pipeline for imputation-free SNP discovery in polyploids without a reference genome: finger millet as a case study.

    Science.gov (United States)

    Qi, Peng; Gimode, Davis; Saha, Dipnarayan; Schröder, Stephan; Chakraborty, Debkanta; Wang, Xuewen; Dida, Mathews M; Malmberg, Russell L; Devos, Katrien M

    2018-06-15

    Research on orphan crops is often hindered by a lack of genomic resources. With the advent of affordable sequencing technologies, genotyping an entire genome or, for large-genome species, a representative fraction of the genome has become feasible for any crop. Nevertheless, most genotyping-by-sequencing (GBS) methods are geared towards obtaining large numbers of markers at low sequence depth, which excludes their application in heterozygous individuals. Furthermore, bioinformatics pipelines often lack the flexibility to deal with paired-end reads or to be applied in polyploid species. UGbS-Flex combines publicly available software with in-house python and perl scripts to efficiently call SNPs from genotyping-by-sequencing reads irrespective of the species' ploidy level, breeding system and availability of a reference genome. Noteworthy features of the UGbS-Flex pipeline are an ability to use paired-end reads as input, an effective approach to cluster reads across samples with enhanced outputs, and maximization of SNP calling. We demonstrate use of the pipeline for the identification of several thousand high-confidence SNPs with high representation across samples in an F 3 -derived F 2 population in the allotetraploid finger millet. Robust high-density genetic maps were constructed using the time-tested mapping program MAPMAKER which we upgraded to run efficiently and in a semi-automated manner in a Windows Command Prompt Environment. We exploited comparative GBS with one of the diploid ancestors of finger millet to assign linkage groups to subgenomes and demonstrate the presence of chromosomal rearrangements. The paper combines GBS protocol modifications, a novel flexible GBS analysis pipeline, UGbS-Flex, recommendations to maximize SNP identification, updated genetic mapping software, and the first high-density maps of finger millet. The modules used in the UGbS-Flex pipeline and for genetic mapping were applied to finger millet, an allotetraploid selfing species

  17. Development and molecular characterization of genic molecular markers for grain protein and calcium content in finger millet (Eleusine coracana (L.) Gaertn.).

    Science.gov (United States)

    Nirgude, M; Babu, B Kalyana; Shambhavi, Y; Singh, U M; Upadhyaya, H D; Kumar, Anil

    2014-03-01

    Finger millet (Eleusine coracana (L.) Gaertn), holds immense agricultural and economic importance for its high nutraceuticals quality. Finger millets seeds are rich source of calcium and its proteins are good source of essential amino acids. In the present study, we developed 36 EST-SSR primers for the opaque2 modifiers and 20 anchored-SSR primers for calcium transporters and calmodulin for analysis of the genetic diversity of 103 finger millet genotypes for grain protein and calcium contents. Out of the 36 opaque2 modifiers primers, 15 were found polymorphic and were used for the diversity analysis. The highest PIC value was observed with the primer FMO2E33 (0.26), while the lowest was observed FMO2E27 (0.023) with an average value of 0.17. The gene diversity was highest for the primer FMO2E33 (0.33), however it was lowest for FMO2E27 (0.024) at average value of 0.29. The percentage polymorphism shown by opaque2 modifiers primers was 68.23%. The diversity analysis by calcium transporters and calmodulin based anchored SSR loci revealed that the highest PIC was observed with the primer FMCA8 (0.30) and the lowest was observed for FMCA5 (0.023) with an average value of 0.18. The highest gene diversity was observed for primer FMCA8 (0.37), while lowest for FMCA5 (0.024) at an average of 0.21. The opaque2 modifiers specific EST-SSRs could able to differentiate the finger millet genotypes into high, medium and low protein containing genotypes. However, calcium dependent candidate gene based EST-SSRs could broadly differentiate the genotypes based on the calcium content with a few exceptions. A significant negative correlation between calcium and protein content was observed. The present study resulted in identification of highly polymorphic primers (FMO2E30, FMO2E33, FMO2-18 and FMO2-14) based on the parameters such as percentage of polymorphism, PIC values, gene diversity and number of alleles.

  18. Effect of germination moisture and time on pearl millet malt quality - with respect to its opaque and lager beer brewing potential

    CSIR Research Space (South Africa)

    Pelembe, LAM

    2004-01-01

    Full Text Available .H., Effect of calcium ions in sor- ghum beer mashing. Journal of the Institute of Brewing, 1988, 94, 68?70. VOL. 110, NO. 4, 2004 325 29. Hardie, D.G., Manners, D.J. and Yellowlees, D., The limit dex- trinase from malted sorghum (Sorghum vulgare...

  19. Finger millet bran supplementation alleviates obesity-induced oxidative stress, inflammation and gut microbial derangements in high-fat diet-fed mice.

    Science.gov (United States)

    Murtaza, Nida; Baboota, Ritesh K; Jagtap, Sneha; Singh, Dhirendra P; Khare, Pragyanshu; Sarma, Siddhartha M; Podili, Koteswaraiah; Alagesan, Subramanian; Chandra, T S; Bhutani, K K; Boparai, Ravneet K; Bishnoi, Mahendra; Kondepudi, Kanthi Kiran

    2014-11-14

    Several epidemiological studies have shown that the consumption of finger millet (FM) alleviates diabetes-related complications. In the present study, the effect of finger millet whole grain (FM-WG) and bran (FM-BR) supplementation was evaluated in high-fat diet-fed LACA mice for 12 weeks. Mice were divided into four groups: control group fed a normal diet (10 % fat as energy); a group fed a high-fat diet; a group fed the same high-fat diet supplemented with FM-BR; a group fed the same high-fat diet supplemented with FM-WG. The inclusion of FM-BR at 10 % (w/w) in a high-fat diet had more beneficial effects than that of FM-WG. FM-BR supplementation prevented body weight gain, improved lipid profile and anti-inflammatory status, alleviated oxidative stress, regulated the expression levels of several obesity-related genes, increased the abundance of beneficial gut bacteria (Lactobacillus, Bifidobacteria and Roseburia) and suppressed the abundance of Enterobacter in caecal contents (P≤ 0·05). In conclusion, FM-BR supplementation could be an effective strategy for preventing high-fat diet-induced changes and developing FM-BR-enriched functional foods.

  20. The membrane tethered transcription factor EcbZIP17 from finger millet promotes plant growth and enhances tolerance to abiotic stresses.

    Science.gov (United States)

    Ramakrishna, Chopperla; Singh, Sonam; Raghavendrarao, Sangala; Padaria, Jasdeep C; Mohanty, Sasmita; Sharma, Tilak Raj; Solanke, Amolkumar U

    2018-02-01

    The occurrence of various stresses, as the outcome of global climate change, results in the yield losses of crop plants. Prospecting of genes in stress tolerant plant species may help to protect and improve their agronomic performance. Finger millet (Eleusine coracana L.) is a valuable source of superior genes and alleles for stress tolerance. In this study, we isolated a novel endoplasmic reticulum (ER) membrane tethered bZIP transcription factor from finger millet, EcbZIP17. Transgenic tobacco plants overexpressing this gene showed better vegetative growth and seed yield compared with wild type (WT) plants under optimal growth conditions and confirmed upregulation of brassinosteroid signalling genes. Under various abiotic stresses, such as 250 mM NaCl, 10% PEG6000, 400 mM mannitol, water withdrawal, and heat stress, the transgenic plants showed higher germination rate, biomass, primary and secondary root formation, and recovery rate, compared with WT plants. The transgenic plants exposed to an ER stress inducer resulted in greater leaf diameter and plant height as well as higher expression of the ER stress-responsive genes BiP, PDIL, and CRT1. Overall, our results indicated that EcbZIP17 improves plant growth at optimal conditions through brassinosteroid signalling and provide tolerance to various environmental stresses via ER signalling pathways.

  1. Salt tolerance and activity of antioxidative enzymes of transgenic finger millet overexpressing a vacuolar H(+)-pyrophosphatase gene (SbVPPase) from Sorghum bicolor.

    Science.gov (United States)

    Anjaneyulu, Ediga; Reddy, Palle Surender; Sunita, Merla Srilakshmi; Kishor, Polavarapu B Kavi; Meriga, Balaji

    2014-06-15

    A vacuolar proton pyrophosphatase cDNA clone was isolated from Sorghum bicolor (SbVPPase) using end-to-end gene-specific primer amplification. It showed 80-90% homology at the nucleotide and 85-95% homology at the amino acid level with other VPPases. The gene was introduced into expression vector pCAMBIA1301 under the control of the cauliflower mosaic virus 35S (CaMV35S) promoter and transformed into Agrobacterium tumifaciens strain LBA4404 to infect embryogenic calli of finger millet (Eleusine coracana). Successful transfer of SbVPPase was confirmed by a GUS histochemical assay and PCR analysis. Both, controls and transgenic plants were subjected to 100 and 200mM NaCl and certain biochemical and physiological parameters were studied. Relative water content (RWC), plant height, leaf expansion, finger length and width and grain weight were severely reduced (50-70%), and the flowering period was delayed by 20% in control plants compared to transgenic plants under salinity stress. With increasing salt stress, the proline and chlorophyll contents as well as the enzyme activities of superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX), guaiacol peroxidase (GPX) and glutathione reductase (GR) increased by 25-100% in transgenics, while malondialdehyde (MDA) showed a 2-4-fold decrease. The increased activities of antioxidant enzymes and the reduction in the MDA content suggest efficient scavenging of reactive oxygen species (ROS) in transgenics and, as a consequence, probably alleviation of salt stress. Also, the leaf tissues of the transgenics accumulated 1.5-2.5-fold higher Na(+) and 0.4-0.8-fold higher K(+) levels. Together, these results clearly demonstrate that overexpression of SbVPPase in transgenic finger millet enhances the plant's performance under salt stress. Copyright © 2014 Elsevier GmbH. All rights reserved.

  2. Assessment of genetic diversity, population structure and relationships in Indian and non-Indian genotypes of finger millet (Eleusine coracana (L.) Gaertn) using genomic SSR markers.

    Science.gov (United States)

    Ramakrishnan, M; Antony Ceasar, S; Duraipandiyan, V; Al-Dhabi, N A; Ignacimuthu, S

    2016-01-01

    We evaluated the genetic variation and population structure in Indian and non-Indian genotypes of finger millet using 87 genomic SSR primers. The 128 finger millet genotypes were collected and genomic DNA was isolated. Eighty-seven genomic SSR primers with 60-70 % GC contents were used for PCR analysis of 128 finger millet genotypes. The PCR products were separated and visualized on a 6 % polyacrylamide gel followed by silver staining. The data were used to estimate major allele frequency using Power Marker v3.0. Dendrograms were constructed based on the Jaccard's similarity coefficient. Statistical fitness and population structure analyses were performed to find the genetic diversity. The mean major allele frequency was 0.92; the means of polymorphic alleles were 2.13 per primer and 1.45 per genotype; the average polymorphism was 59.94 % per primer and average PIC value was 0.44 per primer. Indian genotypes produced an additional 0.21 allele than non-Indian genotypes. Gene diversity was in the range from 0.02 to 0.35. The average heterozygosity was 0.11, close to 100 % homozygosity. The highest inbreeding coefficient was observed with SSR marker UGEP67. The Jaccard's similarity coefficient value ranged from 0.011 to 0.836. The highest similarity value was 0.836 between genotypes DPI009-04 and GPU-45. Indian genotypes were placed in Eleusine coracana major cluster (EcMC) 1 along with 6 non-Indian genotypes. AMOVA showed that molecular variance in genotypes from various geographical regions was 4 %; among populations it was 3 % and within populations it was 93 %. PCA scatter plot analysis showed that GPU-28, GPU-45 and DPI009-04 were closely dispersed in first component axis. In structural analysis, the genotypes were divided into three subpopulations (SP1, SP2 and SP3). All the three subpopulations had an admixture of alleles and no pure line was observed. These analyses confirmed that all the genotypes were genetically diverse and had been grouped based on

  3. Identification of putative QTLs for seedling stage phosphorus starvation response in finger millet (Eleusine coracana L. Gaertn. by association mapping and cross species synteny analysis.

    Directory of Open Access Journals (Sweden)

    M Ramakrishnan

    Full Text Available A germplasm assembly of 128 finger millet genotypes from 18 countries was evaluated for seedling-stage phosphorus (P responses by growing them in P sufficient (Psuf and P deficient (Pdef treatments. Majority of the genotypes showed adaptive responses to low P condition. Based on phenotype behaviour using the best linear unbiased predictors for each trait, genotypes were classified into, P responsive, low P tolerant and P non-responsive types. Based on the overall phenotype performance under Pdef, 10 genotypes were identified as low P tolerants. The low P tolerant genotypes were characterised by increased shoot and root length and increased root hair induction with longer root hairs under Pdef, than under Psuf. Association mapping of P response traits using mixed linear models revealed four quantitative trait loci (QTLs. Two QTLs (qLRDW.1 and qLRDW.2 for low P response affecting root dry weight explained over 10% phenotypic variation. In silico synteny analysis across grass genomes for these QTLs identified putative candidate genes such as Ser-Thr kinase and transcription factors such as WRKY and basic helix-loop-helix (bHLH. The QTLs for response under Psuf were mapped for traits such as shoot dry weight (qHSDW.1 and root length (qHRL.1. Putative associations of these QTLs over the syntenous regions on the grass genomes revealed proximity to cytochrome P450, phosphate transporter and pectin methylesterase inhibitor (PMEI genes. This is the first report of the extent of phenotypic variability for P response in finger millet genotypes during seedling-stage, along with the QTLs and putative candidate genes associated with P starvation tolerance.

  4. Identification of putative QTLs for seedling stage phosphorus starvation response in finger millet (Eleusine coracana L. Gaertn.) by association mapping and cross species synteny analysis.

    Science.gov (United States)

    Ramakrishnan, M; Ceasar, S Antony; Vinod, K K; Duraipandiyan, V; Ajeesh Krishna, T P; Upadhyaya, Hari D; Al-Dhabi, N A; Ignacimuthu, S

    2017-01-01

    A germplasm assembly of 128 finger millet genotypes from 18 countries was evaluated for seedling-stage phosphorus (P) responses by growing them in P sufficient (Psuf) and P deficient (Pdef) treatments. Majority of the genotypes showed adaptive responses to low P condition. Based on phenotype behaviour using the best linear unbiased predictors for each trait, genotypes were classified into, P responsive, low P tolerant and P non-responsive types. Based on the overall phenotype performance under Pdef, 10 genotypes were identified as low P tolerants. The low P tolerant genotypes were characterised by increased shoot and root length and increased root hair induction with longer root hairs under Pdef, than under Psuf. Association mapping of P response traits using mixed linear models revealed four quantitative trait loci (QTLs). Two QTLs (qLRDW.1 and qLRDW.2) for low P response affecting root dry weight explained over 10% phenotypic variation. In silico synteny analysis across grass genomes for these QTLs identified putative candidate genes such as Ser-Thr kinase and transcription factors such as WRKY and basic helix-loop-helix (bHLH). The QTLs for response under Psuf were mapped for traits such as shoot dry weight (qHSDW.1) and root length (qHRL.1). Putative associations of these QTLs over the syntenous regions on the grass genomes revealed proximity to cytochrome P450, phosphate transporter and pectin methylesterase inhibitor (PMEI) genes. This is the first report of the extent of phenotypic variability for P response in finger millet genotypes during seedling-stage, along with the QTLs and putative candidate genes associated with P starvation tolerance.

  5. Identification and characterization of finger millet OPAQUE2 transcription factor gene under different nitrogen inputs for understanding their role during accumulation of prolamin seed storage protein.

    Science.gov (United States)

    Gaur, Vikram Singh; Kumar, Lallan; Gupta, Supriya; Jaiswal, J P; Pandey, Dinesh; Kumar, Anil

    2018-03-01

    In this study, we report the isolation and characterization of the mRNA encoding OPAQUE2 (O2) like TF of finger millet (FM) ( Eleusine coracana) ( EcO2 ). Full-length EcO2 mRNA was isolated using conserved primers designed by aligning O2 mRNAs of different cereals followed by 3' and 5' RACE (Rapid Amplification of cDNA Ends). The assembled full-length EcO2 mRNA was found to contain an ORF of 1248-nt coding the 416 amino acids O2 protein. Domain analysis revealed the presence of the BLZ and bZIP-C domains which is a characteristic feature of O2 proteins. Phylogenetic analysis of EcO2 protein with other bZIP proteins identified using finger millet transcriptome data and O2 proteins of other cereals showed that EcO2 shared high sequence similarity with barley BLZ1 protein. Transcripts of EcO2 were detected in root, stem, leaves, and seed development stages. Furthermore, to investigate nitrogen responsiveness and the role of EcO2 in regulating seed storage protein gene expression, the expression profiles of EcO2 along with an α-prolamin gene were studied during the seed development stages of two FM genotypes (GE-3885 and GE-1437) differing in grain protein content (13.8 and 6.2%, respectively) grown under increasing nitrogen inputs. Compared to GE-1437, the EcO2 was relatively highly expressed during the S2 stage of seed development which further increased as nitrogen input was increased. The Ecα - prolamin gene was strongly induced in the high protein genotype (GE-3885) at all nitrogen inputs. These results indicate the presence of nitrogen responsiveness regulatory elements which might play an important role in accumulating protein in FM genotypes through modulating EcO2 expression by sensing plant nitrogen status.

  6. Over-expression of a NAC 67 transcription factor from finger millet (Eleusine coracana L.) confers tolerance against salinity and drought stress in rice.

    Science.gov (United States)

    Rahman, Hifzur; Ramanathan, Valarmathi; Nallathambi, Jagedeeshselvam; Duraialagaraja, Sudhakar; Muthurajan, Raveendran

    2016-05-11

    NAC proteins (NAM (No apical meristem), ATAF (Arabidopsis transcription activation factor) and CUC (cup-shaped cotyledon)) are plant-specific transcription factors reported to be involved in regulating growth, development and stress responses. Salinity responsive transcriptome profiling in a set of contrasting finger millet genotypes through RNA-sequencing resulted in the identification of a NAC homolog (EcNAC 67) exhibiting differential salinity responsive expression pattern. Full length cDNA of EcNAC67 was isolated, characterized and validated for its role in abiotic stress tolerance through agrobacterium mediated genetic transformation in a rice cultivar ASD16. Bioinformatics analysis of putative NAC transcription factor (TF) isolated from a salinity tolerant finger millet showed its genetic relatedness to NAC67 family TFs in related cereals. Putative transgenic lines of rice over-expressing EcNAC67 were generated through Agrobacterium mediated transformation and presence/integration of transgene was confirmed through PCR and southern hybridization analysis. Transgenic rice plants harboring EcNAC67 showed enhanced tolerance against drought and salinity under greenhouse conditions. Transgenic rice plants were found to possess higher root and shoot biomass during stress and showed better revival ability upon relief from salinity stress. Upon drought stress, transgenic lines were found to maintain higher relative water content and lesser reduction in grain yield when compared to non-transgenic ASD16 plants. Drought induced spikelet sterility was found to be much lower in the transgenic lines than the non-transgenic ASD16. Results revealed the significant role of EcNAC67 in modulating responses against dehydration stress in rice. No detectable abnormalities in the phenotypic traits were observed in the transgenic plants under normal growth conditions. Results indicate that EcNAC67 can be used as a novel source for engineering tolerance against drought and salinity

  7. Nitrate signals determine the sensing of nitrogen through differential expression of genes involved in nitrogen uptake and assimilation in finger millet.

    Science.gov (United States)

    Gupta, Alok Kumar; Gaur, Vikram Singh; Gupta, Sanjay; Kumar, Anil

    2013-06-01

    In order to understand the molecular basis of high nitrogen use efficiency of finger millet, five genes (EcHNRT2, EcLNRT1, EcNADH-NR, EcGS, and EcFd-GOGAT) involved in nitrate uptake and assimilation were isolated using conserved primer approaches. Expression profiles of these five genes along with the previously isolated EcDof1 was studied under increased KNO3 concentrations (0.15 to 1,500 μM) for 2 h as well as at 1.5 μM for 24 h in the roots and shoots of 25 days old nitrogen deprived two contrasting finger millet genotypes (GE-3885 and GE-1437) differing in grain protein content (13.76 and 6.15 %, respectively). Time kinetics experiment revealed that, all the five genes except EcHNRT2 in the leaves of GE-3885 were induced within 30 min of nitrate exposure indicating that there might be a greater nitrogen deficit in leaves and therefore quick transportation of nitrate signals to the leaves. Exposing the plants to increasing nitrate concentrations for 2 h showed that in roots of GE-3885, NR was strongly induced while GS was repressed; however, the pattern was found to be reversed in leaves of GE-1437 indicating that in GE-3885, most of the nitrate might be reduced in the roots but assimilated in leaves and vice-versa. Furthermore, compared with the low-protein genotype, expression of HNRT2 was strongly induced in both roots and shoots of high-protein genotype at the least nitrate concentration supplied. This further indicates that GE-3885 is a quick sensor of nitrogen compared with the low-protein genotype. Furthermore, expression of EcDof1 was also found to overlap the expression of NR, GS, and GOGAT indicating that Dof1 probably regulates the expression of these genes under different conditions by sensing the nitrogen fluctuations around the root zone.

  8. Effect of Fermentation and Malting on Some Cereal Weaning Foods ...

    African Journals Online (AJOL)

    ADOWIE PERE

    Two hundred gram (200g) of malted millet and wheat samples were ... The milled grains were sieved through a fine mesh sieve to obtain ... A sterile wire loop was used to pick a .... genera isolated at steeping phase during malting period were ...

  9. Characterization of metabolic network of oxalic acid biosynthesis through RNA seq data analysis of developing spikes of finger millet (Eleusine coracana): Deciphering the role of key genes involved in oxalate formation in relation to grain calcium accumulation.

    Science.gov (United States)

    Akbar, Naved; Gupta, Supriya; Tiwari, Apoorv; Singh, K P; Kumar, Anil

    2018-04-05

    In the present study, we identified seven major genes of oxalic acid biosynthesis pathway (SGAT, GGAT, ICL, GLO, MHAR, APO and OXO) from developing spike transcriptome of finger millet using rice as a reference. Sequence alignment of identified genes showed high similarity with their respective homolog in rice except for OXO and GLO. Transcript abundance (FPKM) reflects the higher accumulation of identified genes in GP-1 (low calcium genotype) as compared to GP-45 (high calcium genotype) which was further confirmed by qRT-PCR analysis, indicating differential oxalate formation in both genotypes. Determination of oxalic acid and tartaric acid content in developing spikes explain that higher oxalic acid content in GP-1 however, tartaric acid content was more in GP-45. Higher calcium content in GP-45 and lower oxalate accumulation may be due to the diversion of more ascorbic acid into tartaric acid and may correspond to less formation of calcium oxalate. Our results suggest that more than one pathway for oxalic acid biosynthesis might be present in finger millet with probable predominance of ascorbate-tartarate pathway rather than glyoxalate-oxalate conversion. Thus, finger millet can be use as an excellent model system for understanding more specific role of nutrients-antinutrients interactions, as evident from the present study. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Isolation, characterization and immunolocalization of a seed dominant CaM from finger millet (Eleusine coracana L. Gartn.) for studying its functional role in differential accumulation of calcium in developing grains.

    Science.gov (United States)

    Kumar, Anil; Mirza, Neelofar; Charan, Tara; Sharma, Netrapal; Gaur, Vikram Singh

    2014-03-01

    To understand the exceptional high grain calcium accumulation in finger millet grains, a calmodulin (CaM) gene that is strongly expressed during developing spikes of high grain calcium genotype was further characterized. Using 5'-3' RACE, the full-length CaM open reading frame (ORF) was isolated and the deduced protein sequence showed the presence of four characteristic EF motifs. Phylogenetic analysis showed that the finger millet CaM (Eleusine coracana calmodulin [EcCaM]) was identical to the rice CaM 1-1. Southern hybridization showed the presence of at least four copies of CaM gene that might be located on different regions of the finger millet "AABB" genome. Immunodetection using monospecific polyclonal anti-EcCaM antibodies revealed that EcCaM is localized in the embryo and aleurone layer and accumulates in higher amounts in high grain calcium genotype compared to the low grain calcium genotype. Furthermore, in silico analysis showed that EcCaM interacts with aquaporin which indicates that calcium is probably delivered to developing spike via mass flow of water. These results indicate that higher expression of CaM might cause greater stimulation of the downstream calcium transport machinery operative in the aleurone layer leading to the higher calcium accumulation in the grains of high grain calcium genotype.

  11. Relationship of Nitrogen Use Efficiency with the Activities of Enzymes Involved in Nitrogen Uptake and Assimilation of Finger Millet Genotypes Grown under Different Nitrogen Inputs

    Directory of Open Access Journals (Sweden)

    Nidhi Gupta

    2012-01-01

    Full Text Available Nitrogen responsiveness of three-finger millet genotypes (differing in their seed coat colour PRM-1 (brown, PRM-701 (golden, and PRM-801 (white grown under different nitrogen doses was determined by analyzing the growth, yield parameters and activities of nitrate reductase (NR, glutamine synthetase (GS, glutamate synthase; GOGAT, and glutamate dehydrogenase (GDH at different developmental stages. High nitrogen use efficiency and nitrogen utilization efficiency were observed in PRM-1 genotype, whereas high nitrogen uptake efficiency was observed in PRM-801 genotype. At grain filling nitrogen uptake efficiency in PRM-1 negatively correlated with NR, GS, GOGAT activities whereas it was positively correlated in PRM-701 and PRM-801, however, GDH showed a negative correlation. Growth and yield parameters indicated that PRM-1 responds well at high nitrogen conditions while PRM-701 and PRM-801 respond well at normal and low nitrogen conditions respectively. The study indicates that PRM-1 is high nitrogen responsive and has high nitrogen use efficiency, whereas golden PRM-701 and white PRM-801 are low nitrogen responsive genotypes and have low nitrogen use efficiency. However, the crude grain protein content was higher in PRM-801 genotype followed by PRM-701 and PRM-1, indicating negative correlation of nitrogen use efficiency with source to sink relationship in terms of seed protein content.

  12. Studies on mutagenic effectiveness and efficiency of gamma rays and its effect on quantitative traits in finger millet (Eleusine coracana L. Gaertn

    Directory of Open Access Journals (Sweden)

    A.R. Ambavane

    2015-01-01

    Full Text Available Dry seeds (12% moisture of two finger millet cultivar viz., Dapoli-1 and Dapoli Safed were irradiated with four doses of gamma-rays viz., 400 Gy, 500 Gy, 600 Gy and 700 Gy at BARC, Mumbai. In laboratory test, root and shoot lengths of seedlings were decreased with increase in dose of gamma rays. Similarly, germination percentage and survival rate of seedlings were decreased with increase in dose of gamma irradiation during field study. In M1 generation, three types of chlorophyll mutations viz., albino, xantha and viridis were observed. Albino and xantha were observed in all treatments, whereas, viridis observed only in lower doses viz., 400 Gy and 500 Gy. Based on the chlorophyll mutation frequency on M1 plants, mutagenic effectiveness and efficiency were computed. In Dapoli-1 variety, two early maturing mutants and three high yielding mutants were isolated from 500 Gy dose and 600 Gy dose, respectively. In M2 generation, the mutagenic treatments were effective in inducing various types of chlorophyll and morphological macro mutants, few of those show significant change in flowering, maturity and plant height character and few of them have good breeding value.

  13. Enhanced sensitivity to mutagens - EMS, MH, SM by pre-soaking - A taxometric study based on M{sub 1} parameters in finger millet

    Energy Technology Data Exchange (ETDEWEB)

    Singh, B; Sinha, S.K. [Plant Breeding and Genetics, OUAT, Bhubaneswar (India)], E-mail: sing_baburam@yahoo.co.in

    2008-07-01

    Pre-soaking seeds before treatment enhances sensitivity to many chemical mutagens; but little work has been done with maleic hydrazide (MH), a chromosome breaking agent and preferential inducer of micromutation and streptomycin (SM), a cytoplasmic mutagen. In the present investigation on pre-soaking (PS) effects in finger millet (Eleusine coracana, Gaertn), we included these two mutagens, besides one commonly used mutagen, EMS to determine a common effective PS range usingM{sub 1}seedling traits. Since differentM{sub 1}parameters, mutagens and their doses showed different peaks of response, we adopted a taxometric approach using all characters together. Combinations of chemicals, doses and sixM{sub 1}seedling attributes gave 48 characters for the numerical classification of PS periods (0, 8, 10, 12, 14, 16 and 18 h) as OTUs. Dendrogram from the similarity matrix using UPGMA clustering showed two clusters : (1) Cl. 1 of three OTUs (0, 8 and 10 h PS) and (2) Cl.2 of four OTUs(12-18h PS).We considered 12-18h as effective PS range and 0-10h as ineffective for all kinds of mutagens. The effective range would contain the major peak of sensitivity; the ineffective range might show a small peak. We confirmed these inferences with SM induced albinism as an indicator of plastid mutations. Higher doses shifted the peak within the effective range towards lower PS and low dose towards longer PS. Taxometrics could be usefully adopted in mutagenesis studies. (author)

  14. Beneficial Effects of ragi (Finger Millet) on Hematological Parameters, Body Mass Index, and Scholastic Performance among Anemic Adolescent High-School Girls (AHSG).

    Science.gov (United States)

    Karkada, Suja; Upadhya, Sharmila; Upadhya, Subramanya; Bhat, Gopalakrishna

    2018-03-29

    Adolescence is a period characterized by rapid physical, emotional, and mental growth and changes potentially resulting in health challenges. Anemia, which is a fairly common complication in this age group, is reported to negatively affect the cognitive ability of adolescents. Traditionally, ragi (Finger millet: Eleusine coracana), a cereal available in India, has been recommended as nutritional supplement to combat anemia because of its high protein and mineral content as well as anti-microbial property. This study sought to establish the effect of ragi in improving hematological parameters, body mass index, and scholastic performance among adolescent school girls. Sixty adolescent girls were randomly selected and divided into intervention (n = 30) and control groups (n = 30). The effect of dietary supplementation of ragi porridge on hematological parameters was evaluated on the intervention group at 45 and 90 days. Both groups were monitored for changes in body mass index and scholastic performance. A statistically significant increase in hemoglobin levels was observed in the intervention group after 90 days (from a mean of 11.3 g% to 12.54 g%; t (29)  = 7.514, p < .0001), with no significant changes in the control group. No statistically significant differences between the two groups were observed for mean corpuscular hemoglobin, mean corpuscular hemoglobin concentration, mean corpuscular volume, red cell distribution width, body mass index, and scholastic performance. The data show that daily dietary supplementation with ragi porridge has a positive effect on hemoglobin levels in adolescent high schools girls. A well planned nutrition education with dietary supplementation is thus recommended for better outcomes.

  15. Evaluation of nutraceutical properties of selected small millets.

    Science.gov (United States)

    Rao, B Raghavendra; Nagasampige, Manojkumar H; Ravikiran, M

    2011-04-01

    The aim of this study was to evaluate the nutraceutical properties and nutritional value of grains of four selected small millets viz. finger millet, foxtail millet, prosomillet and khodomillet. The qualitative analysis of phytochemicals viz. phenolics, flavonoids, alkaloids and saponins present in the four small millets was done. The water-soluble proteins, crude fiber content and the reducing power of the grains of these four millets were analyzed. The khodomillet showed maximum phenolic content (10.3%) and foxtail millet showed minimum phenolics (2.5%). As far as reducing capacity was concerned, finger millet was highest (5.7%). The prosomillet showed least reducing property (2.6%). The finger millet (391.3 mg/g each) showed maximum reducing sugar content. The prosomillet showed minimum reducing sugar (195 mg/g). The foxtail millet showed maximum protein content (305.76 mg/g) and prosomillet showed minimum protein content (144.23 mg/g). The khodomillet showed maximum crude fiber content (14.3%).The finger millet showed maximum reducing sugar content (391.3 mg/g) whereas, the khodomillet showed minimum reducing sugar (130.43 mg/g).

  16. Evaluation of nutraceutical properties of selected small millets

    Directory of Open Access Journals (Sweden)

    B Raghavendra Rao

    2011-01-01

    Full Text Available Objective: The aim of this study was to evaluate the nutraceutical properties and nutritional value of grains of four selected small millets viz. finger millet, foxtail millet, prosomillet and khodomillet. Materials and Methods: The qualitative analysis of phytochemicals viz. phenolics, flavonoids, alkaloids and saponins present in the four small millets was done. The water-soluble proteins, crude fiber content and the reducing power of the grains of these four millets were analyzed. Results and Conclusions: The khodomillet showed maximum phenolic content (10.3% and foxtail millet showed minimum phenolics (2.5%. As far as reducing capacity was concerned, finger millet was highest (5.7%. The prosomillet showed least reducing property (2.6%. The finger millet (391.3 mg/g each showed maximum reducing sugar content. The prosomillet showed minimum reducing sugar (195 mg/g. The foxtail millet showed maximum protein content (305.76 mg/g and prosomillet showed minimum protein content (144.23 mg/g. The khodomillet showed maximum crude fiber content (14.3%.The finger millet showed maximum reducing sugar content (391.3 mg/g whereas, the khodomillet showed minimum reducing sugar (130.43 mg/g.

  17. Níveis de grão de capim-pé-de-galinha (Eleusine coracana em dietas para ovinos: consumo e digestibilidade Finger millet grain levels in sheep diets: intake and digestibility

    Directory of Open Access Journals (Sweden)

    José Walter dos Santos

    2008-10-01

    Full Text Available Objetivou-se avaliar em ovinos o consumo e a digestibilidade de nutrientes de dietas contendo grão de capim-pé-de-galinha (Eleusine coracana. Foram utilizados 20 ovinos com peso vivo inicial de 18,90 kg, em delineamento inteiramente casualizado, com cinco tratamentos e quatro repetições. Os animais foram alimentados com dietas isoprotéicas formuladas com 50% de volumoso e 50% de concentrado contendo 0; 16,0; 32,5; 48,0 ou 67,0% de grão de capim-pé-de-galinha em substituição ao fubá de milho. Utilizou-se a fibra indigestível em detergente neutro (FDNi como indicador para estimativa da excreção fecal. Os níveis de grão de pé-de-galinha não influenciaram os consumos de MS, NDT e FDN. Os valores médios de consumo de matéria seca foram de 1,2 kg/animal/dia e 3,2% do peso vivo. O coeficiente de digestibilidade da matéria seca (CDMS e o NDT reduziram linearmente em 0,1425 e 0,1612%, respectivamente, a cada 1% de grão de capim-pé-de-galinha no concentrado, o que está relacionado aos maiores teores de FDN e FDNi desse alimento. Os coeficientes de digestibilidade de MO e FDN apresentaram valores máximos de 57,64 e 53,60% nos níveis de 42,36 e 39,56% de grão de capim-pé-de-galinha no concentrado. Os valores médios de digestibilidade aparente de PB e EE foram 56,90 e 66,86%, respectivamente. A substituição do fubá de milho por grão do capim pé-de-galinha na dieta de ovinos não influenciou o consumo de matéria seca dos nutrientes, mas reduziu o coeficiente de digestibilidade da matéria seca, da matéria orgânica, dos carboidratos totais e os nutrientes digestíveis totais, logo, esse ingrediente pode substituir até 50% do fubá de milho no concentrado para ovinos.The objective was to evaluate in sheep the intake and apparent digestibility of nutrients diets containing finger millet grain (Eleusine coracana. Twenty lambs were used with average initial 18.90 kg BW, in a completely randomized design, with five diets and

  18. The Effect of Organic and Inorganic Fertilizers on the Yield of Two Contrasting Soybean Varieties and Residual Nutrient Effects on a Subsequent Finger Millet Crop

    Directory of Open Access Journals (Sweden)

    Zerihun Abebe

    2017-06-01

    Full Text Available The problems of low soil fertility resulting from continuous monocropping, crop residue removal and limited fertilizer use represent key challenges to produce surplus food for the ever increasing population of Ethiopia. However, the practices of crop rotation and integrated sources of fertilizer uses could potentially improve soil fertility and productivity. In 2012 and 2014, soybean with different trials consisting of two soybean varieties (Boshe and Ethio-ugozilavia, three levels of farm yard manure (FYM (3, 6 and 9 t/ha and three phosphorus levels (8, 16 and 24 kg P ha−1 were combinedin2×3×3factorialarrangements. Twosoybeanvarietiesreceivingnofertilizerapplication followed by finger millet receiving a recommended rate (20 kg P/ha were included. The experiment was laid out in a randomized complete block design with three replications. In 2013 and 2015, finger millet was planted on each soybean plot as per previous treatment arrangements to evaluate the effect of the precursor crop (soybean and integrated fertilizer application on yield performance of the subsequent finger millet. Soil pH, organic carbon, total nitrogen and available phosphorus before planting and after crop harvest of soybean in each year showed treatment differences. Both precursor crop and fertilizer application had a positive effect on soil fertility status and, hence, improved the performance of the subsequent finger millet. On the other hand, since the rainfall amount and distribution were different in the 2012 and 2014 seasons, the response of soybean varieties to applied fertilizers was significantly affected, and the correlation between soybean yield and annual rainfall was strongly positive. Use of an early maturing soybean variety (Boshe with the lowest rates of organicandinorganicfertilizersgavesignificantlyhigheryieldin2012(shortrainyseasoncompared with other treatment combinations. In the 2014 cropping season, however, ‘Ethio-ugozilavia’ showed

  19. Fluctuation of Dof1/Dof2 expression ratio under the influence of varying nitrogen and light conditions: involvement in differential regulation of nitrogen metabolism in two genotypes of finger millet (Eleusine coracana L.).

    Science.gov (United States)

    Gupta, Supriya; Gupta, Sanjay Mohan; Gupta, Alok Kumar; Gaur, Vikram Singh; Kumar, Anil

    2014-08-10

    In order to gain insights into the mechanism of high nitrogen use efficiency (NUE) of finger millet (FM) the role of Dof2 transcription factor (TF), which is a repressor of genes involved in C/N metabolism was investigated. The partial cDNA fragment of EcDof2 (912-bp; GenBank acc. no. KF261117) was isolated and characterized from finger millet (FM) that showed 63% and 58% homology with Dof2 of Zea mays at nucleotide and protein level, respectively. Its expression studies were carried out along with the activator EcDof1 in two genotypes (GE3885, high protein genotype (HPG); GE1437, low protein genotype (LPG)) of FM differing in grain protein contents (13.8% and 6.2%) showed that EcDof2 is expressed in both shoot and root tissues with significantly (p≤0.05) higher expression in the roots. The diurnal expression of both EcDof1 and EcDof2 in shoots was differential having different time of peak expression indicating a differential response to diurnal condition. Under continuous dark conditions, expression of EcDof1 and EcDof2 oscillated in both the genotypes whereas on illumination, the fold expression of EcDof1 was higher as compared to EcDof2. Under increasing nitrate concentration, EcDof2 expression increases in roots and shoots of LPG while it remains unchanged in HPG. However, the EcDof1 expression was found to increase in both genotypes. Further, time kinetics studies under single nitrate concentration revealed that EcDof2 was repressed in the roots of both genotypes whereas EcDof1 oscillated with time. The EcDof1/EcDof2 ratio measured showed differential response under different light and nitrogen conditions. It was higher in the roots of HPG indicating higher activation of genes involved in N uptake and assimilation resulting in high grain protein accumulation. The results indicate that both light and nitrogen concentration influence Dof1 and Dof2 expression and suggests a complex pattern of regulation of genes influenced by these plant specific TFs. In

  20. Small millets, big potential

    International Development Research Centre (IDRC) Digital Library (Canada)

    consumption of small millets, mainly due to limited productivity, high ... for effective integration of small millets in the ... replicated in other cities. ... to micro-, small- and medium-entrepreneurs producing millet-based ... and Activities Network,.

  1. Biofortification in Millets: A Sustainable Approach for Nutritional Security.

    Science.gov (United States)

    Vinoth, A; Ravindhran, R

    2017-01-01

    Nutritional insecurity is a major threat to the world's population that is highly dependent on cereals-based diet, deficient in micronutrients. Next to cereals, millets are the primary sources of energy in the semi-arid tropics and drought-prone regions of Asia and Africa. Millets are nutritionally superior as their grains contain high amount of proteins, essential amino acids, minerals, and vitamins. Biofortification of staple crops is proved to be an economically feasible approach to combat micronutrient malnutrition. HarvestPlus group realized the importance of millet biofortification and released conventionally bred high iron pearl millet in India to tackle iron deficiency. Molecular basis of waxy starch has been identified in foxtail millet, proso millet, and barnyard millet to facilitate their use in infant foods. With close genetic-relatedness to cereals, comparative genomics has helped in deciphering quantitative trait loci and genes linked to protein quality in finger millet. Recently, transgenic expression of zinc transporters resulted in the development of high grain zinc while transcriptomics revealed various calcium sensor genes involved in uptake, translocation, and accumulation of calcium in finger millet. Biofortification in millets is still limited by the presence of antinutrients like phytic acid, polyphenols, and tannins. RNA interference and genome editing tools [zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and clustered regularly interspaced short palindromic repeats (CRISPR)] needs to be employed to reduce these antinutrients. In this review paper, we discuss the strategies to accelerate biofortification in millets by summarizing the opportunities and challenges to increase the bioavailability of macro and micronutrients.

  2. Influence of moisture content on physical properties of minor millets.

    Science.gov (United States)

    Balasubramanian, S; Viswanathan, R

    2010-06-01

    Physical properties including 1000 kernel weight, bulk density, true density, porosity, angle of repose, coefficient of static friction, coefficient of internal friction and grain hardness were determined for foxtail millet, little millet, kodo millet, common millet, barnyard millet and finger millet in the moisture content range of 11.1 to 25% db. Thousand kernel weight increased from 2.3 to 6.1 g and angle of repose increased from 25.0 to 38.2°. Bulk density decreased from 868.1 to 477.1 kg/m(3) and true density from 1988.7 to 884.4 kg/m(3) for all minor millets when observed in the moisture range of 11.1 to 25%. Porosity decreased from 63.7 to 32.5%. Coefficient of static friction of minor millets against mild steel surface increased from 0.253 to 0.728 and coefficient of internal friction was in the range of 1.217 and 1.964 in the moisture range studied. Grain hardness decreased from 30.7 to 12.4 for all minor millets when moisture content was increased from 11.1 to 25% db.

  3. Imaging of MALT lymphomas

    International Nuclear Information System (INIS)

    Rodallec, M.; Guermazi, A.; Attal, P.; Zagdanski, A.M.; Frija, J.; De Kerviler, E.; Brice, P.

    2002-01-01

    The broad category of non-Hodgkin's lymphoma includes a large variety of different diseases including indolent as well as aggressive lymphomas. Mucosa-associated lymphoid tissue (MALT) lymphoma arises in the extranodal mucosal lymphoid tissue and has only been recognised as a distinct entity in recent years. It affects one or several extranodal structures such as the stomach, the lung, the eye and salivary glands. The lymphoma is generally of low grade and has indolent course. The aim of this article is to exemplify the most common radiological patterns of MALT lymphoma. (orig.)

  4. Comparison of phenolic content and antioxidant activities of millet varieties grown in different locations in Sri Lanka.

    Science.gov (United States)

    Kumari, Disna; Madhujith, Terrence; Chandrasekara, Anoma

    2017-05-01

    Soluble and bound phenolic compounds were extracted from different varieties of millet types namely, finger millet, foxtail, and proso millet cultivated at dry and intermediate climatic zones in Sri Lanka. The extracts were examined for their total phenolic content (TPC), total flavonoid content (TFC), and proanthocyanidin content (PC). The antioxidant activities were meassured by reducing power (RP), trolox equivalent antioxidant capacity (TEAC), 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activity, ferrous ion chelating ability (FICA), and using a β carotene linoleate model system. The ferulic acid content of extracts were determined using high-performance liquid chromatoghraphy (HPLC). Finger millet showed the highest phenolic content and antioxidant activities compared to proso and foxtail millets. The phenolic content as well as antioxidant activites of soluble and bound phenolic extracts of millets were affected by variety and cultivated location. The highest phenolic content and antioxidant activites were reported for millet samples cultivated in areas belonging to the dry zone in Sri Lanka.

  5. Malting barley BRS Borema

    Directory of Open Access Journals (Sweden)

    Euclydes Minella

    2006-01-01

    Full Text Available BRS Borema is an early maturing, two-rowed spring barley registered in 2003 for commercial production inSouthern Brazil, bred by Embrapa Trigo. It combines good yield potential with superior malting quality and a reasonable levelof disease (net blotch, powdery mildew, leaf rust resistance. It is well-adapted to all major production regions of maltingbarley in Brazil.

  6. Optimization and functionality of millet supplemented pasta

    Directory of Open Access Journals (Sweden)

    Amir Gull

    2015-01-01

    Full Text Available AbstractMillets are having superior nutritional qualities and health benefits; hence they can be used for supplementation of pasta. Pasta was prepared using composite flour (CF of durum wheat semolina (96% and carrot pomace (4% supplemented with finger millet flour (FMF, 0-20g, pearl millet flour (PMF, 0-30g and carboxy methyl cellulose (CMC, 2-4g. Second order polynomial described the effect of FMF, PMF and CMC on lightness, firmness, gruel loss and overall acceptability of extruded pasta products. Results indicate that an increasing proportion of finger and pearl millet flour had signed (p≤0.05 negative effect on lightness, firmness, gruel loss and overall acceptability. However, CMC addition showed significant (p≤0. 05 positive effect on firmness, overall acceptability and negative effect on gruel loss of cooked pasta samples. Numeric optimization results showed that optimum values for extruded pasta were 20g FMF, 12g PMF and 4g CMC per 100g of CF and 34ml water with 0.981 desirability. The pasta developed is nutritionally rich as it contains protein (10.16g, fat (6g, dietary fiber (16.71g, calcium (4.23mg, iron (3.99mg and zinc (1.682mg per 100g.

  7. Setaria viridis as a model system to advance millet genetics and genomics

    Directory of Open Access Journals (Sweden)

    Pu Huang

    2016-11-01

    Full Text Available Millet is a common name for a group of polyphyletic, small-seeded cereal crops that include pearl, finger and foxtail millet. Millet species are an important source of calories for many societies, often in developing countries. Compared to major cereal crops such as rice and maize, millets are generally better adapted to dry and hot environments. Despite their food security value, the genetic architecture of agronomically important traits in millets, including both morphological traits and climate resilience remains poorly studied. These complex traits have been challenging to dissect in large part because of the lack of sufficient genetic tools and resources. In this article, we review the phylogenetic relationship among various millet species and discuss the value of a genetic model system for millet research. We propose that a broader adoption of green foxtail (Setaria viridis as a model system for millets could greatly accelerate the pace of gene discovery in the millets, and summarize available and emerging resources in S. viridis and its domesticated relative S. italica. These resources have value in forward genetics, reverse genetics and high throughput phenotyping. We describe methods and strategies to best utilize these resources to facilitate the genetic dissection of complex traits. We envision that coupling cutting-edge technologies and the use of S. viridis for gene discovery will accelerate genetic research in millets in general. This will enable strategies and provide opportunities to increase productivity, especially in the semi-arid tropics of Asia and Africa where millets are staple food crop.

  8. Setaria viridis as a Model System to Advance Millet Genetics and Genomics.

    Science.gov (United States)

    Huang, Pu; Shyu, Christine; Coelho, Carla P; Cao, Yingying; Brutnell, Thomas P

    2016-01-01

    Millet is a common name for a group of polyphyletic, small-seeded cereal crops that include pearl, finger and foxtail millet. Millet species are an important source of calories for many societies, often in developing countries. Compared to major cereal crops such as rice and maize, millets are generally better adapted to dry and hot environments. Despite their food security value, the genetic architecture of agronomically important traits in millets, including both morphological traits and climate resilience remains poorly studied. These complex traits have been challenging to dissect in large part because of the lack of sufficient genetic tools and resources. In this article, we review the phylogenetic relationship among various millet species and discuss the value of a genetic model system for millet research. We propose that a broader adoption of green foxtail ( Setaria viridis ) as a model system for millets could greatly accelerate the pace of gene discovery in the millets, and summarize available and emerging resources in S. viridis and its domesticated relative S. italica . These resources have value in forward genetics, reverse genetics and high throughput phenotyping. We describe methods and strategies to best utilize these resources to facilitate the genetic dissection of complex traits. We envision that coupling cutting-edge technologies and the use of S. viridis for gene discovery will accelerate genetic research in millets in general. This will enable strategies and provide opportunities to increase productivity, especially in the semi-arid tropics of Asia and Africa where millets are staple food crops.

  9. Content of insoluble bound phenolics in millets and their contribution to antioxidant capacity.

    Science.gov (United States)

    Chandrasekara, Anoma; Shahidi, Fereidoon

    2010-06-09

    Soluble and insoluble-bound phenolic extracts of several varieties of millet (kodo, finger, foxtail, proso, pearl, and little millets) whole grains were evaluated for their phenolic contents and antioxidative efficacy using trolox equivalent antioxidant capacity (TEAC), reducing power (RP), and beta-carotene-linoleate model system as well as ferrous chelating activity. In addition, ferulic and p-coumaric acids were present in soluble and bound phenolic fractions of millets, and their contents were determined using high-performance liquid chromatography (HPLC) and HPLC-mass spectrometry (MS). Kodo millet had the highest total phenolic content, whereas proso millet possessed the least. All millet varieties showed high antioxidant activities, although the order of their efficacy was assay dependent. HPLC analysis of millet phenolic extracts demonstrated that the bound fractions contained more ferulic and p-coumaric acids compared to their soluble counterparts. The results of this study showed that soluble as well as bound fractions of millet grains are rich sources of phenolic compounds with antioxidant, metal chelating, and reducing power. The potential of whole millets as natural sources of antioxidants depends on the variety used. The importance of the insoluble bound fraction of millet as a source of ferulic acid and p-coumaric acid was established, and their contribution to the total phenolic content must be taken into account in the assessment of the antioxidant activity of millets.

  10. Setaria viridis as a Model System to Advance Millet Genetics and Genomics

    Science.gov (United States)

    Huang, Pu; Shyu, Christine; Coelho, Carla P.; Cao, Yingying; Brutnell, Thomas P.

    2016-01-01

    Millet is a common name for a group of polyphyletic, small-seeded cereal crops that include pearl, finger and foxtail millet. Millet species are an important source of calories for many societies, often in developing countries. Compared to major cereal crops such as rice and maize, millets are generally better adapted to dry and hot environments. Despite their food security value, the genetic architecture of agronomically important traits in millets, including both morphological traits and climate resilience remains poorly studied. These complex traits have been challenging to dissect in large part because of the lack of sufficient genetic tools and resources. In this article, we review the phylogenetic relationship among various millet species and discuss the value of a genetic model system for millet research. We propose that a broader adoption of green foxtail (Setaria viridis) as a model system for millets could greatly accelerate the pace of gene discovery in the millets, and summarize available and emerging resources in S. viridis and its domesticated relative S. italica. These resources have value in forward genetics, reverse genetics and high throughput phenotyping. We describe methods and strategies to best utilize these resources to facilitate the genetic dissection of complex traits. We envision that coupling cutting-edge technologies and the use of S. viridis for gene discovery will accelerate genetic research in millets in general. This will enable strategies and provide opportunities to increase productivity, especially in the semi-arid tropics of Asia and Africa where millets are staple food crops. PMID:27965689

  11. Estado nutricional e produção do capim-pé-de-galinha e da soja cultivada em sucessão em sistema antecipado de adubação Nutritional condition and yield of finger millet and soybean grown in succession in a system of anticipated fertilization

    Directory of Open Access Journals (Sweden)

    Eros Artur Bohac Francisco

    2007-01-01

    practices should be maintained. The objective of this research was to evaluate the effect of the anticipation of soybean fertilization on: (i the dry matter yield and nutrients uptake of finger millet, and (ii the dry matter yield, nutrients exportation, and grain yield of soybean cultivated after finger millet [Eleusine coracana (L. Gaertn.]. The experiment was carried out in Piracicaba, State of São Paulo, during the 2001/2002 growing season, in a randomized complete blocks design with three replications. The anticipation of the soybean fertilization did not interfere in the dry matter yield, grain yield, and the nutrient exportation by soybean. Finger millet responded to the soybean fertilization increasing its dry matter yield and nutrient uptake. The management of fertilization to adequate the production system and optimize the sowing process performance can be used in order to install the soybean crop in the field within the proper time.

  12. Proximate, mineral composition and antioxidant activity of traditional small millets cultivated and consumed in Rayalaseema region of south India.

    Science.gov (United States)

    Vali Pasha, Kotwal; Ratnavathi, Chamarthy Venkata; Ajani, Jayanna; Raju, Dugyala; Manoj Kumar, Sriramoju; Beedu, Sashidhar Rao

    2018-01-01

    Millets are a diverse group of small seeded grasses, widely grown around the world as cereal foods. This communication details the proximate, mineral profile and antioxidant activity of six different small millets (Finger, Foxtail, Proso, Little, Barnyard and Kodo millets) and their 21 cultivars that are traditionally cultivated and consumed in the region of Ralayaseema, south India. The proximate analysis revealed that these millets are rich in protein, fat, ash (mineral), total dietary fibre and total phenols with appreciable antioxidant activity. However, starch and amylose content was comparatively lower as compared to major millet sorghum. ICP-MS analysis of small millets demonstrated that they are rich in minerals such as Ca, P, K, Mg, Fe, Cu, Zn, Mn, Cr, Mo and Se. Finger and kodo millets were found to be nutritionally superior over other small millets. The results suggest that small millets have a potential to provide food security and can combat micronutrient malnutrition. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  13. Trigger finger

    Science.gov (United States)

    ... digit; Trigger finger release; Locked finger; Digital flexor tenosynovitis ... cut or hand Yellow or green drainage from the cut Hand pain or discomfort Fever If your trigger finger returns, call your surgeon. You may need another surgery.

  14. Mutation breeding in malting barley

    Energy Technology Data Exchange (ETDEWEB)

    Hiraki, Makoto; Sanada, Matsuyoshi

    1984-03-01

    The released varieties of malting barley through mutation breeding is more than ten in number, including foreign varieties. In Japan four varieties has been released so far. We started mutation breeding in 1956 together with cross breeding that we employed before. Until now, Gamma 4, Amagi Nijo 1 and Fuji Nijo 2 have been produced from the direct use of induced mutations and Nirasaki Nijo 8 from the indirect use of them. Mutation breeding has been used mainly in the partial improvement of agronomic characteristics since the selection for malting quality was very complicated. As the variety bred by induced mutation is usually equivalent to the original variety in malting quality, both this new variety and the original one could be cultivated in the same area without any problem on later malt production. Particularly when one farmer cultivates barley in an extensive acreage, he can harvest at the best time according to the different maturing time of each variety. From these points of view, mutation breeding is an efficient tool in malting barley breeding. Mutagens we have used so far are X-rays, ..gamma..-rays, neutron and chemicals such as dES. From our experience in selection, the low dose of radiation and chemical mutagens are more effective in selection of point mutation than the high dose of radiation which tends to produce many abnormal but few practical mutants. (author).

  15. Molecular Pathogenesis of MALT Lymphoma

    Directory of Open Access Journals (Sweden)

    Katharina Troppan

    2015-01-01

    Full Text Available Approximately 8% of all non-Hodgkin lymphomas are extranodal marginal zone B cell lymphoma of mucosa associated lymphoid tissue (MALT, also known as MALT lymphoma, which was first described in 1983 by Isaacson and Wright. MALT lymphomas arise at a wide range of different extranodal sites, with the highest frequency in the stomach, followed by lung, ocular adnexa, and thyroid, and with a low percentage in the small intestine. Interestingly, at least 3 different, apparently site-specific, chromosomal translocations and missense and frameshift mutations, all pathway-related genes affecting the NF-κB signal, have been implicated in the development and progression of MALT lymphoma. However, these genetic abnormalities alone are not sufficient for malignant transformation. There is now increasing evidence suggesting that the oncogenic product of translocation cooperates with immunological stimulation in oncogenesis, that is, the association with chronic bacterial infection or autoaggressive process. This review mainly discusses MALT lymphomas in terms of their genetic aberration and association with chronic infections and summarizes recent advances in their molecular pathogenesis.

  16. Genetic diversity and genomic resources available for the small millet crops to accelerate a New Green Revolution.

    Science.gov (United States)

    Goron, Travis L; Raizada, Manish N

    2015-01-01

    Small millets are nutrient-rich food sources traditionally grown and consumed by subsistence farmers in Asia and Africa. They include finger millet (Eleusine coracana), foxtail millet (Setaria italica), kodo millet (Paspalum scrobiculatum), proso millet (Panicum miliaceum), barnyard millet (Echinochloa spp.), and little millet (Panicum sumatrense). Local farmers value the small millets for their nutritional and health benefits, tolerance to extreme stress including drought, and ability to grow under low nutrient input conditions, ideal in an era of climate change and steadily depleting natural resources. Little scientific attention has been paid to these crops, hence they have been termed "orphan cereals." Despite this challenge, an advantageous quality of the small millets is that they continue to be grown in remote regions of the world which has preserved their biodiversity, providing breeders with unique alleles for crop improvement. The purpose of this review, first, is to highlight the diverse traits of each small millet species that are valued by farmers and consumers which hold potential for selection, improvement or mechanistic study. For each species, the germplasm, genetic and genomic resources available will then be described as potential tools to exploit this biodiversity. The review will conclude with noting current trends and gaps in the literature and make recommendations on how to better preserve and utilize diversity within these species to accelerate a New Green Revolution for subsistence farmers in Asia and Africa.

  17. Genetic diversity and genomic resources available for the small millet crops to accelerate a New Green Revolution

    Directory of Open Access Journals (Sweden)

    Travis Luc Goron

    2015-03-01

    Full Text Available Small millets are nutrient-rich food sources traditionally grown and consumed by subsistence farmers in Asia and Africa. They include finger millet (Eleusine coracana, foxtail millet (Setaria italica, kodo millet (Paspalum scrobiculatum, proso millet (Panicum miliaceum, barnyard millet (Echinochloa spp., and little millet (Panicum sumatrense. Local farmers value the small millets for their nutritional and health, tolerance to extreme stress including drought, and ability to grow under low nutrient input conditions, ideal in an era of climate change and steadily depleting natural resources. Little scientific attention has been paid to these crops, hence they have been termed orphan cereals. Despite this challenge, an advantageous quality of the small millets is that they continue to be grown in remote regions of the world which has preserved their biodiversity, providing breeders with unique alleles for crop improvement. The purpose of this review, first, is to highlight the diverse traits of each small millet species that are valued by farmers and consumers (e.g. nutritional quality which hold potential for selection, improvement or mechanistic study. For each species, the germplasm, genetic and genomic resources available will then be described as potential tools to exploit this biodiversity. The review will conclude with noting current trends and gaps in the literature and make recommendations on how to better preserve and utilize diversity within these species to accelerate a New Green Revolution for subsistence farmers in Asia and Africa.

  18. Heat pumps at the maltings

    Energy Technology Data Exchange (ETDEWEB)

    1987-11-01

    Heat pumps have halved the energy costs of producing finished malt at two of the country's maltsters. The fuel-fired kilning processes described are now performed by heat pumps with considerable energy and production benefits at the maltings of J.P. Simpson and Co. (Alnwick) Ltd, in Tivetshall St Margaret, Norfolk, and of Munton and Fison Plc of Stowmarket, Suffolk. The heat pump system installed at the Station Malting of J.P. Simpson was devised by the Electricity Council Research Centre at Capenhurst near Chester. Energy cost benefits of Pound 6,000 a month are being realised at Simpsons, but there is the added benefit that the system has been designed to provide conditioned air to the germination cycle to ensure that the correct temperature is maintained throughout the year. At the Cedars factory of Munton and Fison, heat pumps were used on a trial basis for plant micropropagation and for a fish farming unit.

  19. Minor Millets as a Central Element for Sustainably Enhanced Incomes, Empowerment, and Nutrition in Rural India

    Directory of Open Access Journals (Sweden)

    Stefano Padulosi

    2015-07-01

    Full Text Available Minor millets comprise a group of cereal species that are genetically diverse and adapted to a range of marginal growing conditions where major cereals such as wheat, rice, and maize are relatively unsuccessful. Millets require few inputs and withstand severe biotic and abiotic stresses. They are also more nutritious than major cereals. Despite these advantages, neglect in several arenas has resulted in a steady decline in the cultivation of minor millets in India over the past few decades. As part of a United Nations global project on underutilized species, we undertook action research intended to stem the decline in cultivation and enhance the conservation and use of minor millets in 753 households spread across 34 villages in four states of India. Our aim was to improve incomes, nutritional status, and empowerment, especially for women. Overall, our holistic approach to mainstreaming species such as finger millet, little millet, foxtail millet, and barnyard millet indicates that these neglected and underutilized species can play a strategic role in improving many dimensions of livelihoods.

  20. Millet's Shooting Stars

    Science.gov (United States)

    Beech, M.

    1988-12-01

    In this essay two paintings by the French artist Jean-Francois Millet are described. These paintings, Les Etoiles Filantes and Nuit Etoilée are particularly interesting since they demonstrate the rare artistic employment of the shooting-star image and metaphor.

  1. The fungal community structure of barley malts from diverse geographical regions correlates with malt quality parameters.

    Science.gov (United States)

    Kaur, Mandeep; Bowman, John P; Stewart, Doug C; Evans, David E

    2015-12-23

    Malt is a preferred base for fermentations that produce beer or whisky. Barley for malt is grown under diverse environments in different geographical locations. Malt provides an ecological niche for a varied range of microorganisms with both positive and negative effects on its quality for brewing. Little information exists in the literature on the microbial community structure of Australian malt as well as broader global geographical differences in the associated fungal and bacterial communities. The aims of the present study were to compare the bacterial and fungal community structures of Australian commercial malt with its international counterparts originating from different geographical regions using terminal restriction fragment length polymorphism (TRFLP) fingerprinting and clone library analyses of ribosomal RNA genes. Further, the relationship between malt associated microbial communities and conventional malt quality parameters was also compared. Results showed that differences in fungal communities of malts from different geographical location were more pronounced than bacterial communities. TRFLP analysis discriminated high quality commercial malts with low fungal loads from malts deliberately infected with fungal inocula (Fusarium/Penicillium). Malt moisture, beta-amylase, α-amylase and limit dextrinase contents showed significant correlations with fungal community structure. This investigation concluded that fungal community structure was more important to subsequent malt quality outcomes than bacteria. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Nickel accumulation and its effect on growth, physiological and biochemical parameters in millets and oats.

    Science.gov (United States)

    Gupta, Vibha; Jatav, Pradeep Kumar; Verma, Raini; Kothari, Shanker Lal; Kachhwaha, Sumita

    2017-10-01

    With the boom in industrialization, there is an increase in the level of heavy metals in the soil which drastically affect the growth and development of plants. Nickel is an essential micronutrient for plant growth and development, but elevated level of Ni causes stunted growth, chlorosis, nutrient imbalance, and alterations in the defense mechanism of plants in terms of accumulation of osmolytes or change in enzyme activities like guiacol peroxidase (POD), catalase (CAT), and superoxide dismutase (SOD). Ni-induced toxic response was studied in seedlings of finger millet, pearl millet, and oats in terms of seedling growth, lipid peroxidation, total chlorophyll, proline content, and enzymatic activities. On the basis of germination and growth parameters of the seedling, finger millet was found to be the most tolerant. Nickel accumulation was markedly lower in the shoots as compared to the roots, which was the highest in finger millet and the lowest in shoots of oats. Plants treated with a high concentration of Ni showed significant reduction in chlorophyll and increase in proline content. Considerable difference in level of malondialdehyde (MDA) content and activity of antioxidative enzymes indicates generation of redox imbalance in plants due to Ni-induced stress. Elevated activities of POD and SOD were observed with high concentrations of Ni while CAT activity was found to be reduced. It was observed that finger millet has higher capability to maintain homeostasis by keeping the balance between accumulation and ROS scavenging system than pearl millet and oats. The data provide insight into the physiological and biochemical changes in plants adapted to survive in Ni-rich environment. This study will help in selecting the more suitable crop species to be grown on Ni-rich soils.

  3. Antioxidant activity of commonly consumed cereals, millets, pulses and legumes in India.

    Science.gov (United States)

    Sreeramulu, D; Reddy, C Vijaya Kumar; Raghunath, M

    2009-02-01

    Plant foods are important due to their antioxidant activity (AOA) attributed to the phenolics which are known to protect organisms against harmful effects of oxygen radicals. However, information on antioxidant activity of Indian plant foods is scanty. Therefore, the present study evaluated the AOA of cereals, millets, pulses and legumes, commonly consumed in India and assessed the relationship with their total phenolic content (TPC). AOA was assessed by DPPH (2,2-Diphenyl-1-picryl hydrazyl) radical scavenging assay, ferric reducing antioxidant power (FRAP) assay and reducing power. DPPH scavenging activity ranged from 0.24 and 1.73 mg/g, whereas FRAP ranged from 16.21 to 471.71 micromoles/g. Finger millet (Eleusine cora cana) and Rajmah (Phaseolus vulgaris) had the highest FRAP 471.71, 372.76 and DPPH scavenging activity 1.73, 1.07. Similar trends were observed with reducing power. Among cereals and legumes, Finger millet (Ragi) and black gram dhal (Phaseolus mungo Roxb) had the highest TPC, the values being 373 and 418 mg/100 g respectively, while rice (Oryza sativa) and green gram dhal (Phaseolus aureus Roxb) showed the least (47.6 and 62.4 mg/100 g). In the present study, FRAP (r = 0.91) and reducing power (r = 0.90) showed significant correlation with TPC in cereals and millets, but not in pulses and legumes. The results suggest that TPC contributes significantly to the AOA of Indian cereals and millets.

  4. Hydroxycinnamic acid bound arabinoxylans from millet brans-structural features and antioxidant activity.

    Science.gov (United States)

    Bijalwan, Vandana; Ali, Usman; Kesarwani, Atul Kumar; Yadav, Kamalendra; Mazumder, Koushik

    2016-07-01

    Hydroxycinnamic acid bound arabinoxylans (HCA-AXs) were extracted from brans of five Indian millet varieties and response surface methodology was used to optimize the extraction conditions. The optimal condition to obtain highest yield of millet HCA-AXs was determined as follows: time 61min, temperature 66°C, ratio of solvent to sample 12ml/g. Linkage analysis indicated that hydroxycinnamic acid bound arabinoxylan from kodo millet (KM-HCA-AX) contained comparatively low branched arabinoxylan consisting of 14.6% mono-substituted, 1.2% di-substituted and 41.2% un-substituted Xylp residues. The HPLC analysis of millet HCA-AXs showed significant variation in the content of three major bound hydroxycinnamic acids (caffeic, p-coumaric and ferulic acid). The antioxidant activity of millet HCA-AXs were evaluated using three in vitro assay methods (DPPH, FRAP and β-carotene linoleate emulsion assays) which suggested both phenolic acid composition and structural characteristics of arabinoxylans could be correlated to their antioxidant potential, the detailed structural analysis revealed that low substituted KM-HCA-AX exhibited relatively higher antioxidant activity compared to other medium and highly substituted HCA-AXs from finger (FM), proso (PM), barnyard (BM) and foxtail (FOXM) millet. Copyright © 2016. Published by Elsevier B.V.

  5. MALT lymphoma in different locations

    International Nuclear Information System (INIS)

    Izquierdo Calzado, Ana Dolores; Espinosa Exposito, Juan Carlos; Jardon Caballero, Jose

    2012-01-01

    Three cases of patients with MALT lymphoma are described, who were diagnosed, treated and followed up at the hematology department of 'Saturnino Lora' Teaching Provincial Hospital in Santiago de Cuba, to which they were referred by gastroenterologists, otolaryngologists and maxillofacial specialists of that institution. One of those patients presented with a nasopharyngeal and gastric mass, which appeared at different times; another patient had lymphoid tumor of the hard palate, which recurred in infradiaphragmatic lymph nodes; and a third one had a lymphoid node in the unilateral salivary parotid gland with recurrence in regional nodes after having been removed. All experienced a good clinical response at the beginning of conventional treatment, but in 2 of them non-local recurrences of the disease process were confirmed

  6. Trigger Finger

    Science.gov (United States)

    ... in a bent position. People whose work or hobbies require repetitive gripping actions are at higher risk ... developing trigger finger include: Repeated gripping. Occupations and hobbies that involve repetitive hand use and prolonged gripping ...

  7. SPRING BARLEY BREEDING FOR MALTING QUALITY

    Directory of Open Access Journals (Sweden)

    Alžbeta Žofajová

    2010-05-01

    Full Text Available The aim of this contribution is to illustrate the results of spring barley breeding for malting quality and point out an important position of variety in production of  qualitative  raw material for maltinq and beer  industry as well as the system of evaluation the qualitative parameters of breeding materials and adaptation of barley breeding programms to the  new requirements of  malting and beer industry. As an example of the results obtained most recently description is made of the Ezer, Levan, Donaris, Sladar spring barley varieties with very good malting quality and effective resistance to  powdery mildew.  Cultivation of these varieties  and malting barley production with  reduced use  of pesticidies is environmentally friedly alternative. doi:10.5219/50

  8. Physicochemical Characteristic of Malt Vinegar with Spices

    Directory of Open Access Journals (Sweden)

    Andrei Borşa

    2015-11-01

    Full Text Available The malt vinegar is very popular in England, being prepared from barley malt using a method resembling to the one used to produce the wine vinegar. It has a strong taste and a medium acidity. Regarding the fact that it is not very common in Romania, the aim of the study was flavouring the malt vinegar with seasoning plants for a high concentration of antioxidants, flavour and also for making it more popular amongst consumers. Two types of flavoured malt vinegar were obtained, one of them with turmeric and the other one with rosemary, pepper and grain mustard. In order to characterize the new products, several physicochemical analyses were conducted (antioxidant capacity, total extract and acidity. 

  9. Development of transgenic finger millet (Eleusine coracana (L ...

    Indian Academy of Sciences (India)

    2012-01-18

    Jan 18, 2012 ... plants engineered with chitinase gene have been found to be effective in .... primers (forward: 5′ GCTTCTACACCTACGACGCCTT 3′; reverse: ..... and Toppan A 1996 Field tolerance to fungal pathogens of. Brassica napus ...

  10. Finger millet: An alternative crop for the Southern High Plains

    Science.gov (United States)

    In the Southern High Plains, dairies are expanding to take advantage of favorable climatic conditions. Currently, corn (Zea mays L.) and forage sorghum [Sorghum bicolor (L.) Moench] are the two major crops grown in the region to meet silage demands for the expanding dairy industry, but they have rel...

  11. An induced early mutant in finger millet Eleusin coranaca Gaertn

    International Nuclear Information System (INIS)

    Shivashankar, G.; Kempanna, C.; Viswanatha, S.R.

    1975-01-01

    Among the several collections of ragi (Eleusine coracana. Gaertn.) from all over the world, the strain 'H.E.S.927' has been found to be the highest yielder compared to other cultivars. Mutation studies have been conducted on this variety at Bangalore in India to make it suitable for the rainfall pattern of the ragi tract of the Karnataka state. A mutant induced by gamma radiation at 30 K rad has been stabilized. This mutant is early by 30-35 days with comparatively better straw quality. Various morphological characters concerning the yield and yield attributes and the possibility of exploiting it as a genotype for future breeding work and as a promising variety is discussed. Another promising mutant with earhead measuring 15 cm as against the earhead length of 5 to 10 cm of the cultivated varieties is illustrated. (K.B.)

  12. Study of genetic diversity in finger millet (Eleusine coracana L ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-07-19

    Jul 19, 2010 ... Radioactive detection. Yes/No. No. Yes/No. No. Yes/No. Yes/No. Development costs. Medium. Low. Medium. Medium/High. High. Medium. Start-up costs. Medium/High. Low. Medium. High. High. Medium. Applications. Genetic diversity, polyploidy, hybridization, phylogeny, mating system. Fingerprinting,.

  13. Inheritance of male sterility in finger millet | Gupta | African Crop ...

    African Journals Online (AJOL)

    African Crop Science Journal. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 7, No 2 (1999) >. Log in or Register to get access to full text downloads.

  14. Climate Change, Millet and Ritual Relationship with the Magars of Argal, Baglung, Nepal

    Directory of Open Access Journals (Sweden)

    Man Bahadur Khattri

    2013-08-01

    Full Text Available This paper focuses on cultural analysis and how people are coping with new situation created by climate change in production of millet. Changes relating to climate change are observed; perceived and understood on a local level. This is an important area of study for anthropologists and it is interest of climate scientists as well. This paper is based on anthropological analysis on climate change effects on finger millet production in Argal VDC of Baglung district, West of Nepal. Millet is a staple food of people of Argal and most of Hill people of Nepal. Millet is not only staple food and associated with nutrition of people. It's also associated with rituals during production and as well as during consumption. Increasing temperature, changing rainfall patterns, extreme weather events are linked with climate change which has direct effect on life of all people but also millet production and ritual activities. DOI: http://dx.doi.org/10.3126/dsaj.v6i0.8481 Dhaulagiri Journal of Sociology and Anthropology Vol. 6, 2012 107-124

  15. analysis and correlation of stability parameters in malting barley

    African Journals Online (AJOL)

    Administrator

    food, feed, medicinal purposes and malt of alcoholic beverages. Stability parameters are ... and animal food, health benefits and malting and brewing in many ..... targeted for environmental conditions which are ... Market Update. Available at ...

  16. Phytoliths analysis for the discrimination of Foxtail millet (Setaria italica) and Common millet (Panicum miliaceum).

    Science.gov (United States)

    Lu, Houyuan; Zhang, Jianping; Wu, Naiqin; Liu, Kam-Biu; Xu, Deke; Li, Quan

    2009-01-01

    Foxtail millet (Setaria italica) and Common millet (Panicum miliaceum) are the oldest domesticated dry farming crops in Eurasia. Identifying these two millets in the archaeobotanical remains are still problematic, especially because the millet grains preserve only when charred. Phytoliths analysis provides a viable method for identifying this important crop. However, to date, the identification of millet phytoliths has been questionable, because very little study has been done on their morphometry and taxonomy. Particularly, no clear diagnostic feature has been used to distinguish between Foxtail millet and Common millet. Here we examined the anatomy and silicon structure patterns in the glumes, lemmas, and paleas from the inflorescence bracts in 27 modern plants of Foxtail millet, Common millet, and closely related grasses, using light microscopy with phase-contrast and microscopic interferometer. Our research shows that five key diagnostic characteristics in phytolith morphology can be used to distinguish Foxtail millet from Common millet based on the presence of cross-shaped type, regularly arranged papillae, Omega-undulated type, endings structures of epidermal long cell, and surface ridgy line sculpture in the former species. We have established identification criteria that, when used together, give the only reliable way of distinguishing between Foxtail millet and Common millet species based on their phytoliths characteristics, thus making a methodological contribution to phytolith research. Our findings also have important implications in the fields of plant taxonomy, agricultural archaeology, and the culture history of ancient civilizations.

  17. Phytoliths analysis for the discrimination of Foxtail millet (Setaria italica and Common millet (Panicum miliaceum.

    Directory of Open Access Journals (Sweden)

    Houyuan Lu

    Full Text Available Foxtail millet (Setaria italica and Common millet (Panicum miliaceum are the oldest domesticated dry farming crops in Eurasia. Identifying these two millets in the archaeobotanical remains are still problematic, especially because the millet grains preserve only when charred. Phytoliths analysis provides a viable method for identifying this important crop. However, to date, the identification of millet phytoliths has been questionable, because very little study has been done on their morphometry and taxonomy. Particularly, no clear diagnostic feature has been used to distinguish between Foxtail millet and Common millet. Here we examined the anatomy and silicon structure patterns in the glumes, lemmas, and paleas from the inflorescence bracts in 27 modern plants of Foxtail millet, Common millet, and closely related grasses, using light microscopy with phase-contrast and microscopic interferometer. Our research shows that five key diagnostic characteristics in phytolith morphology can be used to distinguish Foxtail millet from Common millet based on the presence of cross-shaped type, regularly arranged papillae, Omega-undulated type, endings structures of epidermal long cell, and surface ridgy line sculpture in the former species. We have established identification criteria that, when used together, give the only reliable way of distinguishing between Foxtail millet and Common millet species based on their phytoliths characteristics, thus making a methodological contribution to phytolith research. Our findings also have important implications in the fields of plant taxonomy, agricultural archaeology, and the culture history of ancient civilizations.

  18. Effects of gamma irradiation of barley and malt on malting quality

    International Nuclear Information System (INIS)

    Köksel, H.; ÇElik, S.; ÖZkara, R.

    1998-01-01

    Two two-rowed barley cultivars, Tokak and Clerine, were irradiated at two different dose ranges (0.05–0.75 kGy and 0.5–5.0 kGy) using a 60Co source. Irradiation of barley at the medium levels before malting had detrimental effects on most of the malt quality criteria. The detrimental effects of irradiation was lower at doses up to 0.25 kGy. Irradiation of malt samples caused either slight or no deterioration of quality characteristics

  19. 21 CFR 172.590 - Yeast-malt sprout extract.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Yeast-malt sprout extract. 172.590 Section 172.590... CONSUMPTION Flavoring Agents and Related Substances § 172.590 Yeast-malt sprout extract. Yeast-malt sprout... prescribed conditions: (a) The additive is produced by partial hydrolysis of yeast extract (derived from...

  20. Optimisation of wort production from rice malt using enzymes and ...

    African Journals Online (AJOL)

    Commercially, rice malt has never been successfully used in brewing because of its low free α-amino nitrogen (FAN) content. This study was designed to optimise rice malt replacement for barley malt in wort production and to improve FAN by adding α-amylase and protease. The response surface methodology (RSM) ...

  1. SPRING BARLEY BREEDING FOR MALTING QUALITY

    OpenAIRE

    Alžbeta Žofajová; Jozef Gubiš; Ľudovít Sleziak; Klára Križanová; Vratislav Psota

    2010-01-01

    The aim of this contribution is to illustrate the results of spring barley breeding for malting quality and point out an important position of variety in production of  qualitative  raw material for maltinq and beer  industry as well as the system of evaluation the qualitative parameters of breeding materials and adaptation of barley breeding programms to the  new requirements of  malting and beer industry. As an example of the results obtained most recently descripti...

  2. Lymphoma type MALT of the parotid gland

    International Nuclear Information System (INIS)

    Frometa Neirai, Carlos; Gonzalez Gomez, Juan Manuel; Arredondo Lopez, Miguel

    2010-01-01

    The lymphomas type MALT or the mucosa-associated lymphoid tissue, are the most recent variety of non-Hodgkin lymphomas present mainly in the gastric mucosa associated with Helycobacter pylori infection and in the thyroid gland in relation to Hashimoto's thyroiditis. Frequently the origin of this lesion can't be determined only by cytology study, thus it is necessary the histopathology analysis for a definitive diagnosis in most cases. Present paper includes the case of male patient with bilateral volume increase of both parotid glands and a diagnosis cytopathological of a benign lymphoepithelial process and the development of a type MALT lymphoma in relation to the right parotid gland. (author)

  3. THE MALT EXTRACT, RELATIVE EXTRACT AND DIASTATIC POWER AS A VARIETAL CHARACTERISTIC OF MALTING BARLEY

    Directory of Open Access Journals (Sweden)

    Štefan Dráb

    2014-02-01

    Full Text Available Malting quality of barley depends on genetic and agro-ekological factors. Chemical composition of malting barley and its technological parameters are very important for malting and brewing, due to this fact the quality of barley must be strictly evaluated. The aim of this work was to evaluate the influence of variety, locality and year of production on the 5 technological parameters of malt: extract, relative extract at 45 °C, Kolbach index, diastatic power and friability. It was found out that the barley variety significantly influenced the following parameters: extract, relative extract and diastatic power. The growing locality weakly influenced qualitative parameters i.e. Kolbach index and relative extract at 45°C. The study confirmed the most significant impact of the year on the Kolbach index and friability.

  4. Orbital MALT Lymphoma: A Case Report

    Directory of Open Access Journals (Sweden)

    Shobha G Pai

    2004-08-01

    Full Text Available A case of orbital MALT (mucous associated lymphoid tissue lymphoma is reported for its rarity. It presented as a large tumor obscuring the whole eye with loss of vision, without any signs of dissemination and remained free of recurrence or metastasis 12 months after undergoing simple surgical excision.

  5. Evaluation of disease incidence and severity and yield loss of finger ...

    African Journals Online (AJOL)

    SARAH

    2014-01-31

    Jan 31, 2014 ... greenhouse on three finger millet varieties also indicated that among P.grisea isolates, Pg.11, Pg.41 and Pg.40 showed the highest .... collection sites and major towns in the regions. Isolation of .... Figure 2: Microphotograph showing conidial mass of P. grisea with different shapes and size (45 and 100X).

  6. Robotic hand and fingers

    Science.gov (United States)

    Salisbury, Curt Michael; Dullea, Kevin J.

    2017-06-06

    Technologies pertaining to a robotic hand are described herein. The robotic hand includes one or more fingers releasably attached to a robotic hand frame. The fingers can abduct and adduct as well as flex and tense. The fingers are releasably attached to the frame by magnets that allow for the fingers to detach from the frame when excess force is applied to the fingers.

  7. Replacement Value of fermented millet ( Pennisetum americanum ...

    African Journals Online (AJOL)

    The replacement value of fermented millet for maize in the diets of Clarias gariepinus fingerlings reared in a recirculation system was determined. Five isonitrogenous diets were formulated to contain graded levels of fermented millet meal replacing 0, 20, 40, 60 and 80% of maize and fed to triplicate groups of fingerlings ...

  8. Increasing gender equality among small millet farmers in South Asia ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    29 avr. 2016 ... Gender equality among small millet. More than 1,600 women were involved in testing small millet varieties. One reason for the decline in small millet cultivation is the drudgery involved in their processing, a task that traditionally falls to women. The Revalorizing small millets in South Asia (RESMISA) project ...

  9. Low grade gastric MALT lymphoma: Radiographic findings

    International Nuclear Information System (INIS)

    Brown, J.A.; Carson, B.W.; Gascoyne, R.D.; Cooperberg, P.L.; Connors, J.M.; Mason, A.C.

    2000-01-01

    AIMS: Gastric MALT (mucosa-associated lymphoid tissue) lymphoma is now recognized as a distinct entity within extranodal non-Hodgkin's lymphoma. The purpose of this study was to describe the radiographic findings in low grade gastric MALT lymphoma. MATERIALS AND METHODS: We retrospectively reviewed the radiographic findings in 22 cases of low-grade gastric MALT lymphoma. The study group consisted of 15 men and seven women (median age 68 years, range 41-91 years). Lesions were designated as infiltrative or polypoid by consensus of two radiologists. Polypoid lesions were categorized by number and size. Anatomical site within the stomach and presence of transpyloric or oesophagogastric extension was determined for each case. The presence of abdominal lymphadenopathy was categorized as regional or distant. The presence of Helicobacter pylori was determined from endoscopic and surgical biopsies. RESULTS: Computed tomography (CT) revealed abnormalities of the stomach in 19 cases of the 21 in which it was performed. There were 14 infiltrative lesions and five polypoid lesions. Of the 14 infiltrative lesions, the mean gastric wall thickness was 2.2 cm (range 0.8-6.0 cm). There were three single and two multiple polypoid lesions (mean size 2.2 cm, range 1.5-2.7 cm). Transpyloric extension was observed in two cases and oesophagogastric extension in one. Abdominal lymphadenopathy was observed in 10 of 21 patients. Helicobacter pylori was found in 19 of 22 cases (86%). CONCLUSION: Low grade B cell gastric MALT lymphomas present with an infiltrative form on CT in about three-quarters of cases and a polypoid pattern in the remainder. Abdominal lymphadenopathy is seen in approximately one-half of cases. There is a high association with Helicobacter pylori. Brown, J.A. 2000. Clinical Radiology 55, 384-389

  10. [Gastric perforation by MALT lymphoma. Case report].

    Science.gov (United States)

    López-Zamudio, José; Ramírez-González, Luis Ricardo; Núñez-Márquez, Julia; Fuentes Orozco, Clotilde; González Ojeda, Alejandro; Leonher-Ruezga, Karla Lisseth

    2015-01-01

    Gastric non-Hodgkin lymphoma is a rare tumour that represents approximately 7% of all stomach cancers and 2% of all lymphomas. The most frequent location of gastric MALT (mucosa associated lymphoid tissue) lymphomas is in the antrum in 41% of the cases, and 33% can be multifocal. The risk of spontaneous perforation of a gastric MALT lymphoma is 4-10%. 24 year old male patient carrying the Human Immunodeficiency Virus, who began with signs and symptoms of acute abdomen and fever 72 hours before arriving in the emergency room. A computed tomography was performed that showed free fluid in the cavity, and gastric wall thickening. The patient underwent a laparotomy, finding absence of the anterior wall of the stomach, sealed with the left lobe of the liver, colon and omentum. Total gastrectomy, with oesophagosty and jejunostomy tube, was performed. Gastric perforation secondary to a MALT lymphoma is rare, with high mortality. There is limited information reported of this complication and should be highly suspected in order to provide appropriate treatment for a complication of this type. Copyright © 2015 Academia Mexicana de Cirugía A.C. Published by Masson Doyma México S.A. All rights reserved.

  11. Breeding of proanthocyanidin free malting barley

    International Nuclear Information System (INIS)

    Andersen, Anna Maria

    1990-01-01

    Full text: Haze formation in stored beer is due to colloidal precipitation of proteins with polyphenols of which proanthocyanidins are the most important group. 70-80% of proanthocyanidin in beer are from barley malt. Today breweries attain haze stability by using enzymes, additives or adsorbents. A better solution would be to remove proanthocyanidins. Carlsberg Plant Breeding uses induced mutations to breed proanthocyanidin-free malting barley. After mutagen treatment with sodium azide M1 seeds are planted in the field and M2 seeds are harvested in bulk. A single seed, non-destructive method has been developed to identify mutant kernels lacking proanthocyanidins in the testa. The method involves the inclusion of M2 seeds - 50 at a time - in semisolid clay blocks, whereafter a small part of the endosperm, testa and pericarp are exposed by sanding the seeds. The clay block is then placed in a vanillin-HCI solution so that the uncovered tissues can react with the solution. A red colour will develop in the testa of normal seeds, whereas the testa layers of proanthocyanid-free seeds remain colourless. So far, more than 600 mutants have been induced in over 100 barley varieties, spring as well as winter-types, from barley producing areas around the world. The mutants can be assigned to at least 7 loci, all of which can block the biosynthetic pathway for the proanthocyanidins. Mutants in the ant-18 and ant-19 loci show poor kernel development. Only a few mutants are known in the ant-12, ant-22 and ant-25 loci. Breeding work is focussed on mutants belonging to the ant-13 and ant-17 loci. Whereas the malting quality of ant-17 lines suffer from apparent abnormal enzyme development in the aleurone layer, this defect does not exist in ant-13 lines. Brewing trials with proanthocyanidin-free malt have shown excellent haze stability without changes in beer flavour. Breeding work based on the ant-13 lines led to disease resistant lines with good malting quality, while grain yield

  12. Effects of malting conditions on the amino acid compositions of final ...

    African Journals Online (AJOL)

    Administrator

    2010-12-27

    Dec 27, 2010 ... parameter to the yeast growth and metabolism in malt wort. To increase ... This study identified various important malting conditions that may lead to improvements in malt ... The difference in amino acid contents will affect beer.

  13. Effect of irradiation on the malting quality of barley

    International Nuclear Information System (INIS)

    Avtar, S.; Tejinder, S.; Bains, G.S.

    1985-01-01

    Two six-row barley cultivars, DL 70 and C164 were subjected to Co 60 gamma irradiation in the range of 0 to 250 Krad and malted with and without gibberellic acid treatment. Barley irradiated with doses up to 75 Krad produced normal malts when compared to the controls. Irradiation doses of 125 and 250 Krad significantly increased the malt yields but considerably decreased the α-amylase activity. Gibberellic acid significantly increased the enzyme activity and degree of modification of the irradiated and the control malts. (author)

  14. Iron and zinc bioaccessibility of fermented maize, sorghum and millets from five locations in Zimbabwe.

    Science.gov (United States)

    Gabaza, Molly; Shumoy, Habtu; Muchuweti, Maud; Vandamme, Peter; Raes, Katleen

    2018-01-01

    The present study is an evaluation of iron and zinc bioaccessibility of fermented maize, sorghum, pearl millet and finger millet from five different locations in Zimbabwe. Iron and zinc contents ranged between 3.22 and 49.7 and 1.25-4.39mg/100gdm, respectively. Fermentation caused a reduction of between 20 and 88% of phytic acid (PA) while a general increase in soluble phenolic compounds (PC) and a decrease of the bound (PC) was observed. Bioaccessibility of iron and zinc ranged between 2.77 and 26.1% and 0.45-12.8%, respectively. The contribution of the fermented cereals towards iron and zinc absolute requirements ranged between 25 and 411% and 0.5-23% with higher contribution of iron coming from cereals that were contaminated with extrinsic iron. Populations subsisting on cereals could be more at risk of zinc rather than iron deficiency. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Development of micronutrients rich homemade extruded food products with the incorporation of processed foxtail millet, wheat and chickpea

    Directory of Open Access Journals (Sweden)

    L Gautam

    2014-12-01

    Full Text Available Background: Food based approaches are recognized as an essential part of an urgently needed more comprehensive strategy for improving nutrition by increasing the availability and consumption to combat iron and other micronutrient deficiencies. Aims & Objective: The specific objective of the study was utilization of Foxtail millet (Setariaitalica along with other flour for production of micronutrients rich ready-to-eat snack products using homemade extrusion cooking. Material and methods: Methods Composite flour were prepared using processed Foxtail millet flour (FMF and other processed flours namely; wheat flour (WF, and chick pea flour (CPF. Nutritional properties of the blends were analyzed by using standard procedure. Two homemade extruded products namely; namkeensev, seviyan were prepared with four treatments T0, T1, T2, & T3. The commonly consumed recipes were developed by incorporating 50%, 75% and 100% of best result malted composite flour (FMF+CPF+WF. Results: The organoleptic qualities of these extruded samples were analyzed by panelists on a 9 point hedonic scale. The result indicate that the processed composite flour (FMF+CPF+WF based products were significantly accepted at the level of p<0.05 50% incorporation followed by 75% and 100% respectively. Conclusions: The present study conclude that, processed composite flour (Foxtail millet; wheat; chickpea in the ratios of (50:50 could be used to produce nutritive quality of homemade extrudates with acceptable sensory properties as they deliver vehicles for malnourished children.

  16. Effect of Malting on the Chemical Composition of Cowpea ( Vigna ...

    African Journals Online (AJOL)

    The out-of-steep grains were germinated in the dark for 72 hours and oven dried at 50 °C. The malts were analyzed for diastatic activity and their contents of moisture, protein, sugar, fat, peroxidation products, phytate, tannin and trypsin inhibitor. Results: After malting, the diastatic activity of cowpea increased from 28.87 to ...

  17. EFFECT OF MALTING ON PROTEIN DIGESTIBILITY OF SOME ...

    African Journals Online (AJOL)

    Protein digestibility of sorghum is generally low. Malting is one of the processing methods which can be applied to improve this digestibility. It is a method whose technology is well known by local communities in Kenya. The objective of this study was to investigate the effect of malting on the digestibility of some varieties of ...

  18. The Microbiology of Malting and Brewing

    Science.gov (United States)

    Bokulich, Nicholas A.

    2013-01-01

    SUMMARY Brewing beer involves microbial activity at every stage, from raw material production and malting to stability in the package. Most of these activities are desirable, as beer is the result of a traditional food fermentation, but others represent threats to the quality of the final product and must be controlled actively through careful management, the daily task of maltsters and brewers globally. This review collates current knowledge relevant to the biology of brewing yeast, fermentation management, and the microbial ecology of beer and brewing. PMID:23699253

  19. MALT LYMPHOMA OF PALATE AND ORBIT

    Directory of Open Access Journals (Sweden)

    VIVIANA ANDREA CIFUENTES NAVAS

    2018-05-01

    Full Text Available TITLE: Malt palate and orbit lymphoma  Authors: CIFUENTES NAVAS-Viviana Andrea; MARTÍN PASCUAL- María Consolación; FERNÁNDEZ RODRÍGUEZ- Ana; ALONSO MESONERO- Marta; CHAVIANO GRAHJERA-Juan; MORAIS PÉREZ-Darío. INTRODUCTIONMALT-type lymphomas are lymphoid proliferations originated in the glandular epithelium of organs like the stomach, the salivary and lacrimal glands, and even, we can find lymphoid neoformations of non-epithelial localization, like in the orbital soft tissue. The lymphomas of the mucosal-associated lymphatic tissue (MALT represent only 0.2-0.3% and constitute a well-defined group of non-Hodgkin lymphomas of B origin. In the field of oral pathology, the salivary glands, tonsils and palate are mainly affected, it is more rare to find it in jugal mucosa.We present a rare case of MALT lymphoma with involvement of the palate and orbit. MATERIAL AND METHODS84-year-old patient with multiple pathologies. Derived from his primary care physician due to pharyngeal complaints of 4 to 5 days of evolution, associated with a painful palate lesion.He presented in right hemipaladar a tumoration of elastic consistency in submucosa, ulcerated in the center, with normal neck. Also left orbital tumor that limits the visual field. RESULTSCT and MRI of the neck report mass of 4x4 x2.5 cm in right hemipaladar, noninfiltrating concordant with possible lymphoma. The orbital MRI describes an intra and extra nasal left nasal lesion of 2.3x1.2x2 cm with characteristics consistent with lymphoma. CT of the neck: It demostrates a great mass of right hemipaladar, with lobulated contours and homogeneous enhancement of 40x32x25 mm, in intimate contact with medial pterygoid muscle, although there were no signs of infiltration, the rest of the edges being well delimited. Images characteristics look like a lymphoma, without being able to rule out other etiologies. MRI of the neck: It demostrates a diffuse thickening of right side of the soft palate that

  20. The microbiology of malting and brewing.

    Science.gov (United States)

    Bokulich, Nicholas A; Bamforth, Charles W

    2013-06-01

    Brewing beer involves microbial activity at every stage, from raw material production and malting to stability in the package. Most of these activities are desirable, as beer is the result of a traditional food fermentation, but others represent threats to the quality of the final product and must be controlled actively through careful management, the daily task of maltsters and brewers globally. This review collates current knowledge relevant to the biology of brewing yeast, fermentation management, and the microbial ecology of beer and brewing.

  1. Increasing millet production in South Asia

    International Development Research Centre (IDRC) Digital Library (Canada)

    Asia, which has put the emphasis on cash crops and cereals ... aims to increase production and consumption of minor ... practices. They will then develop sustainable agriculture tool kits to help farmers to increase millet production in these.

  2. Fate of Fusarium Toxins during the Malting Process.

    Science.gov (United States)

    Habler, Katharina; Hofer, Katharina; Geißinger, Cajetan; Schüler, Jan; Hückelhoven, Ralph; Hess, Michael; Gastl, Martina; Rychlik, Michael

    2016-02-17

    Little is known about the fate of Fusarium mycotoxins during the barley malting process. To determine the fungal DNA and mycotoxin concentrations during malting, we used barley grain harvested from field plots that we had inoculated with Fusarium species that produce type A or type B trichothecenes or enniatins. Using a recently developed multimycotoxin liquid chromatography-tandem mass stable isotope dilution method, we identified Fusarium-species-specific behaviors of mycotoxins in grain and malt extracts and compared toxin concentrations to amounts of fungal DNA in the same samples. In particular, the type B trichothecenes and Fusarium culmorum DNA contents were increased dramatically up to 5400% after kilning. By contrast, the concentrations of type A trichothecenes and Fusarium sporotrichioides DNA decreased during the malting process. These data suggest that specific Fusarium species that contaminate the raw grain material might have different impacts on malt quality.

  3. Fingers that change color

    Science.gov (United States)

    ... gov/ency/article/003249.htm Fingers that change color To use the sharing features on this page, please enable JavaScript. Fingers or toes may change color when they are exposed to cold temperatures or ...

  4. Effects of malting conditions on the amino acid compositions of final ...

    African Journals Online (AJOL)

    Barley has been widely used for the production of malt in the brewing industry. Malt was the main raw material indispensable for beer brewing. The fermentability of malt wort is dependent on an adequate supply of the essential nutrients required by yeast. The amino acid content is an important malt parameter to the yeast ...

  5. Quality evaluation of millet-soy blended extrudates formulated through linear programming.

    Science.gov (United States)

    Balasubramanian, S; Singh, K K; Patil, R T; Onkar, Kolhe K

    2012-08-01

    Whole pearl millet, finger millet and decorticated soy bean blended (millet soy) extrudates formulations were designed using a linear programming (LP) model to minimize the total cost of the finished product. LP formulated composite flour was extruded through twin screw food extruder at different feed rate (6.5-13.5 kg/h), screw speed (200-350 rpm, constant feed moisture (14% wb), barrel temperature (120 °C) and cutter speed (15 rpm). The physical, functional, textural and pasting characteristics of extrudates were examined and their responses were studied. Expansion index (2.31) and sectional expansion index (5.39) was found to be was found maximum for feed rate and screw speed combination 9.5 kg/h and 250 rpm. However, density (0.25 × 10(-3) g/mm(3)) was maximum for 9.5 kg/h and 300 rpm combination. Maximum color change (10.32) was found for 9.5 kg/h feed rate and 200 rpm screw speed. The lower hardness was obtained for the samples extruded at lowest feed rate (6.5 kg/h) for all screw speed and feed rate at 9.5 kg/h for 300-350 rpm screw speed. Peak viscosity decreases with all screw speed of 9.5 kg/h feed rate.

  6. Assessment of Metallic Contaminants in Grinded Millet using ...

    African Journals Online (AJOL)

    OLUWASOGO

    Separate grinding discs were used for different millet forms, while the same quantity of millet ... have bad effects on human health (Normayo et al, 2010, Edem et al, 2012 .... grinding discs to have close contact due to the hardness of the millet.

  7. Sjogren's syndrome combined with MALT lymphoma

    International Nuclear Information System (INIS)

    Han, Won Jeong; Cha, Sang Yun; Kim, Eun Kyung

    2000-01-01

    Sjogren's syndrome is a chronic inflammatory disease that predominantly affects salivary, lacrimal, and other exocrine glands. We report a case of Sjogren's syndrome combined with MALT (mucose associated lymphoid tissue) lymphoma which occurred in the parotid gland. A 57-year-old female with the complaint of painful swelling and lymph node enlargement was referred to our department. Sialograms of both parotid glands showed globular collections of contrast material uniformly distributed throughout the parotid gland. Salivary scintigraphy showed decreased uptake of the parotid gland. CT scan showed larger, slightly more dense parotid gland than normal and honeycomb glandular appearance. Also, It showed discrete, slightly more enhanced round mass in the left parotid gland. Histopathological finding showed replacement of salivary gland parenchyma with dense small lymphocytic infiltration having the feature of epimyoepithelial islands. Kappa light chain restriction of interglandular plasma cell could be seen.

  8. Fungal growth during malting of barley

    Directory of Open Access Journals (Sweden)

    Kocić-Tanackov Sunčica D.

    2005-01-01

    Full Text Available Fungi were isolated and identified in two samples of winter two-row barley (SSK3 and SSK6 harvested in 2003, Kragujevac location, during micromalting. Fungi were isolated and identified in barley before the micromalting, after the 1st, 2nd and 3rd day of steeping, the first day and after the germination after kilning and after malt degermination. The total fungi count was followed in both barley samples, during the mentioned phases. The total count of fungi was also determined in the steeping water, and the isolation and identification was performed after the steeping process. Change of the total count of fungi during barley micromalting was exponentional. During barley micromalting nine fungi genera were isolated: Phoma, Alternaria, Fusarium aspergillus, Cladosporium, Geotrichum, Scopulariopsis, Aureobasidium and Mucor. The most frequent genera were: Phoma, Alternaria and Fusarium. In water for steeping, five genera were identified: Geotrichum, Fusarium, Phoma Cladosporium and Mucor. The most frequent genera was Phoma.

  9. Tracking the progress of congress mashing with osmolyte concentrations and malt extract values in North American barley cultivars ... osmolyte concentrations, malt extract values and ASBC measures of malt quality

    Science.gov (United States)

    This study was conducted to test three hypotheses: (1) that barley malt osmolyte concentration (OC) would increase more rapidly during mashing than malt extract (ME), (2) OC would better discriminate between differing barley malts during mashing than ME, and (3) that OC after mashing would better co...

  10. Preparation of malts for production of special beers

    OpenAIRE

    Kábelová-Ficová, Hana; Kráčmar, Stanislav; Gregor, Tomáš; Fišera, Miroslav; Golian, Jozef; Kubáň, Vlastimil; Šopík, Tomáš

    2017-01-01

    The article deals with production of various malts intended for manufacture of special types of beer. The malts were used to brew samples of beer with alcoholic strength ranging between 8 - 12% EPM. The above range of original wort content was chosen due to its suitability for sensory evaluation and properties; in stronger types of beer, (more than 12% EPM), nature of the beverage can be drown by mashy flavour. In the experimental samples, the actual residual extract oscillated between 4.0 - ...

  11. Gastric low-grade MALT lymphoma, high-grade MALT lymphoma and diffuse large B cell lymphoma show different frequencies of trisomy

    NARCIS (Netherlands)

    Hoeve, M A; Gisbertz, I A; Schouten, H C; Schuuring, E; Bot, F J; Hermans, J; Hopman, A; Kluin, P M; Arends, J E; van Krieken, J H

    1999-01-01

    Gastric MALT lymphoma is a distinct entity related to Helicobacter pylori gastritis. Some studies suggest a role for trisomy 3 in the genesis of these lymphomas, but they mainly focused on low-grade MALT lymphoma. Gastric MALT lymphoma, however, comprises a spectrum from low- to high-grade cases.

  12. Great Western Malting Company geothermal project, Pocatello, Idaho. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Christensen, N.T.; McGeen, M.A.; Corlett, D.F.; Urmston, R.

    1981-12-23

    The Great Western Malting Company recently constructed a barley malting facility in Pocatello, Idaho, designed to produce 6.0 million bushels per year of brewing malt. This facility uses natural gas to supply the energy for germination and kilning processes. The escalating cost of natural gas has prompted the company to look at alternate and more economical sources of energy. Trans Energy Systems has investigated the viabiity of using geothermal energy at the new barley processing plant. Preliminary investigations show that a geothermal resource probably exists, and payback on the installation of a system to utilize the resource will occur in under 2 years. The Great Western Malting plant site has geological characteristics which are similar to areas where productive geothermal wells have been established. Geological investigations indicate that resource water temperatures will be in the 150 to 200/sup 0/F range. Geothermal energy of this quality will supply 30 to 98% of the heating requirements currently supplied by natural gas for this malting plant. Trans Energy Systems has analyzed several systems of utilizing the geothermal resource at the Great Western barley malting facility. These systems included: direct use of geothermal water; geothermal energy heating process water through an intermediary heat exchanger; coal or gas boosted geothermal systems; and heat pump boosted geothermal system. The analysis examined the steps that are required to process the grain.

  13. Mercury Sorption onto Malt Spent Rootlets

    Science.gov (United States)

    Manariotis, I. D.; Anagnostopoulos, V.; Karapanagioti, H. K.; Chrysikopoulos, C.

    2011-12-01

    Mercury is a metal of particular concern due to its toxicity even at relatively low concentrations. The maximum permissible level for mercury in drinking water set by the European Union is 0.001 mg/L. Mercury is released into the environment via four principal pathways: (1) natural processes; i.e. a volcanic eruption, (2) incidental to some other activity; i.e. coal burning power plants, (3) accidentally during the manufacture, breakage or disposal of products that have mercury put into them deliberately, and (4) direct use in industrial settings. The present study focuses on the removal of mercury (II) from aqueous solutions via sorption onto Malt Spent Rootlets (MSR). Batch experiments were conducted employing MSR with size ranging from 0.18 to 1 mm. The effects of pH, mercury concentration, contact time, and solid to liquid ratio on mercury sorption onto MSR were investigated. The highest mercury removal from the aqueous phase, of 41%, was observed at pH of 5.

  14. Endoproteolytic activity assay in malting barley

    Directory of Open Access Journals (Sweden)

    Blanca Gómez Guerrero

    2013-12-01

    Full Text Available Hydrolysis of barley proteins into peptides and amino acids is one of the most important processes during barley germination.The degradation of the endosperm stored proteins facilitates water and enzyme movements, enhances modification, liberates starch granules and increases soluble amino nitrogen. Protease activity is the result of the activities of a mixture of exo- and endo-proteases. The barley proteins are initially solubilized by endo-proteases and the further by exo-proteases. Four classes of endo-proteases have been described: serine-proteases, cysteine-proteases, aspartic-proteases and metallo-proteases. The objective of this work was to develop a rapid and colorimetric enzymatic assay to determine the endo-proteolytic activity of the four endo-protease classes using two different substrates: azo-gelatin and azo-casein. Optimum conditions for the assays such as: pH,reaction time and temperature and absorbance scale were determined. Azo-gelatin presented several difficulties in standardizing an “in solution” assay. On the other hand, azo-casein allowed standardization of the assay for the four enzyme classes to produce consistent results. The endo-proteoteolytic method developed was applied to determine the endo-protease activity in barley, malt and wort.

  15. Striga: A Persistent Problem on Millets

    KAUST Repository

    Kountche, Boubacar Amadou

    2017-01-07

    Striga are obligate root-parasitic plants of the major agricultural cereal crops, including millets, in tropical and semi-arid regions of Africa, Middle East, Asia, and Australia. Consequently, they cause severe to even complete losses in crop grain yield. Though limited in their efficiency, the control strategies available today represent major progress toward combating Striga when compared with the absence of any means some years ago. Hence, efforts have led to the development of powerful approaches for understanding and exploiting the complex intricate host-parasitic plant interactions. It is widely agreed that genetic resistance is the most practical and economically feasible method for sustainable control of Striga. Hence, research efforts have been deployed over the past decades to identify resistance sources in certain millet crops, principally sorghum and pearl millet, to characterize the mechanisms underlying the resistance and to understand the genetic basis of the identified resistance phenotype. Furthermore, application of the modern breeding tools, such as molecular markers, has revolutionized the field of search for Striga resistance. Information thus generated have been extensively used to identify several sources of resistance to Striga and individual genes/QTLs conferring host-plant resistance have been deployed for improving Striga resistance in sorghum varieties. More interestingly, we are facing an accelerated progress in the genomic and biotechnological research that should soon provide important understanding of some crucial developmental mechanisms in both the parasite and their host plants, thereby enhancing the efficiency of breeding for Striga resistance in millets. In this paper we provide a detailed state-of-the-art account on the recent progress and perspectives for Striga research and management in millets.

  16. Striga: A Persistent Problem on Millets

    KAUST Repository

    Kountche, Boubacar Amadou; Al-Babili, Salim; Haussmann, B.I.G.

    2017-01-01

    Striga are obligate root-parasitic plants of the major agricultural cereal crops, including millets, in tropical and semi-arid regions of Africa, Middle East, Asia, and Australia. Consequently, they cause severe to even complete losses in crop grain yield. Though limited in their efficiency, the control strategies available today represent major progress toward combating Striga when compared with the absence of any means some years ago. Hence, efforts have led to the development of powerful approaches for understanding and exploiting the complex intricate host-parasitic plant interactions. It is widely agreed that genetic resistance is the most practical and economically feasible method for sustainable control of Striga. Hence, research efforts have been deployed over the past decades to identify resistance sources in certain millet crops, principally sorghum and pearl millet, to characterize the mechanisms underlying the resistance and to understand the genetic basis of the identified resistance phenotype. Furthermore, application of the modern breeding tools, such as molecular markers, has revolutionized the field of search for Striga resistance. Information thus generated have been extensively used to identify several sources of resistance to Striga and individual genes/QTLs conferring host-plant resistance have been deployed for improving Striga resistance in sorghum varieties. More interestingly, we are facing an accelerated progress in the genomic and biotechnological research that should soon provide important understanding of some crucial developmental mechanisms in both the parasite and their host plants, thereby enhancing the efficiency of breeding for Striga resistance in millets. In this paper we provide a detailed state-of-the-art account on the recent progress and perspectives for Striga research and management in millets.

  17. Malt quality of 4 barley (Hordeum vulgare L.) grain varieties grown ...

    African Journals Online (AJOL)

    user

    2011-01-31

    Jan 31, 2011 ... Grain flour starch pasting and malt qualities were analyzed. .... bags and stored in a cool place (ca. ... Pasting properties of four malting barely varieties grain flour starches and the effect of three fungicide (propiconazole) spray.

  18. Development of micronutrients rich homemade extruded food products with the incorporation of processed foxtail millet, wheat and chickpea

    Directory of Open Access Journals (Sweden)

    L Gautam

    2014-12-01

    Full Text Available Background: Food based approaches are recognized as an essential part of an urgently needed more comprehensive strategy for improving nutrition by increasing the availability and consumption to combat iron and other micronutrient deficiencies. Aims & Objective: The specific objective of the study was utilization of Foxtail millet (Setariaitalica along with other flour for production of micronutrients rich ready-to-eat snack products using homemade extrusion cooking. Material and methods: Methods Composite flour were prepared using processed Foxtail millet flour (FMF and other processed flours namely; wheat flour (WF, and chick pea flour (CPF. Nutritional properties of the blends were analyzed by using standard procedure. Two homemade extruded products namely; namkeensev, seviyan were prepared with four treatments T0, T1, T2, & T3. The commonly consumed recipes were developed by incorporating 50%, 75% and 100% of best result malted composite flour (FMF+CPF+WF. Results: The organoleptic qualities of these extruded samples were analyzed by panelists on a 9 point hedonic scale. The result indicate that the processed composite flour (FMF+CPF+WF based products were significantly accepted at the level of p<0.05 50% incorporation followed by 75% and 100% respectively. Conclusions: The present study conclude that, processed composite flour (Foxtail millet; wheat; chickpea in the ratios of (50:50 could be used to produce nutritive quality of homemade extrudates with acceptable sensory properties as they deliver vehicles for malnourished children.

  19. Comparison of Rheological Properties of Hopped Wort and Malt Wort

    Directory of Open Access Journals (Sweden)

    Petr Trávníček

    2015-01-01

    Full Text Available The aim of this work is determination rheological properties of hopped wort and malt wort and their comparison. In the paper following rheological properties has been described: the dependence of viscosity on a temperature of a sample and hysteresis loop test. The time dependence test was performed for a confirmation thixotropic behaviour. Based on measured values Arrhenius mathematical model has been applied. The activation energy was determined by using of this model. Tests have been carried out in the temperature range from 5 °C to 40 °C. Rheological tests proved that malt wort behaves as Newtonian fluid in all temperatures and hopped wort behaves as non-Newtonian fluid at low temperatures. Thixotropic behaviour is caused by the content of the rests of hops heads or malt scraps.

  20. Four cases of MALT lymphoma arising in the lingual tonsil

    International Nuclear Information System (INIS)

    Ogihara, Hitomi; Yuta, Atsushi; Yamaguchi, Motoko; Miyamoto, Yukiko; Hattori, Reiko; Imai, Hiroshi; Majima, Yuichi; Tanaka, Chikako

    2007-01-01

    We report four cases of lingual tonsillar MALT (mucosal associated lymphoid tissue) lymphoma. The cases consisted of a 68-year-old woman, a 60-year-old woman, a 55-year-old woman, and a 75-year-old man. The clinical stages of these cases were IIA, IA, IV (invasion to bone marrow) and IA, respectively. As some types of lingual tonsillar MALT lymphomas show hypertrophy of the lymphoid tissue but not a mass, it is not easy to make a diagnosis of MALT lymphoma only by fiberscopic findings. Furthermore, the small size of biopsy specimens or tissue damaged by forceps can show a false negative consult. Repeat biopsies are sometimes required for a definitive diagnosis. It is important to take large biopsy specimens with little damage, and to discuss well with pathologists. (author)

  1. Multiple Fingers - One Gestalt.

    Science.gov (United States)

    Lezkan, Alexandra; Manuel, Steven G; Colgate, J Edward; Klatzky, Roberta L; Peshkin, Michael A; Drewing, Knut

    2016-01-01

    The Gestalt theory of perception offered principles by which distributed visual sensations are combined into a structured experience ("Gestalt"). We demonstrate conditions whereby haptic sensations at two fingertips are integrated in the perception of a single object. When virtual bumps were presented simultaneously to the right hand's thumb and index finger during lateral arm movements, participants reported perceiving a single bump. A discrimination task measured the bump's perceived location and perceptual reliability (assessed by differential thresholds) for four finger configurations, which varied in their adherence to the Gestalt principles of proximity (small versus large finger separation) and synchrony (virtual spring to link movements of the two fingers versus no spring). According to models of integration, reliability should increase with the degree to which multi-finger cues integrate into a unified percept. Differential thresholds were smaller in the virtual-spring condition (synchrony) than when fingers were unlinked. Additionally, in the condition with reduced synchrony, greater proximity led to lower differential thresholds. Thus, with greater adherence to Gestalt principles, thresholds approached values predicted for optimal integration. We conclude that the Gestalt principles of synchrony and proximity apply to haptic perception of surface properties and that these principles can interact to promote multi-finger integration.

  2. Volatile organic compound (VOC) emissions during malting and beer manufacture

    Science.gov (United States)

    Gibson, Nigel B.; Costigan, Gavin T.; Swannell, Richard P. J.; Woodfield, Michael J.

    Estimates have been made of the amounts of volatile organic compounds (VOCs) released during different stages of beer manufacture. The estimates are based on recent measurements and plant specification data supplied by manufacturers. Data were obtained for three main manufacturing processes (malting, wort processing and fermentation) for three commercial beer types. Some data on the speciation of emitted compounds have been obtained. Based on these measurements, an estimate of the total unabated VOC emission. from the U.K. brewing industry was calculated as 3.5 kta -1, over 95% of which was generated during barley malting. This value does not include any correction for air pollution control.

  3. Visceral leishmaniasis diagnosed in a patient with MALT lymphoma

    DEFF Research Database (Denmark)

    Kaae, Jeanette; Nørgaard, Peter; Himmelstrup, B

    2007-01-01

    We report a case of visceral leishmaniasis in a 66-year-old female with a history of MALT lymphoma in the gastrointestinal tract. The patient presented with major hemorrhage per rectum and perforation of the small intestine. Due to unexplained decreasing platelets, lymphoma bone marrow involvement...... was suspected and bone marrow examination was performed. Surprisingly, Leishman-Donovan bodies were detected. The low platelet count, caused by the combination of MALT lymphoma and visceral leishmaniasis, appears to have aggravated the symptoms of the intestinal lymphoma. Leishmaniasis should be suspected even...... among asymptomatic patients with immune compromising illnesses and a travel history to areas where leishmaniasis is endemic....

  4. A gradient of mercury concentrations in Scottish single malt whiskies.

    Science.gov (United States)

    Rose, Neil L; Yang, Handong; Turner, Simon D

    2016-02-01

    Mercury (Hg) concentrations were measured in 26 Scottish single malt whiskies, and all found to be very low (mercury emissions and deposition over the last 200 years affecting concentrations in local waters used in whisky production. As UK atmospheric emissions of mercury have declined by 90 % since the 1970s, we suggest that whisky being produced today should have even lower Hg concentrations when consumed in 10- to 15-years time. This reduction may be compromised by the remobilisation of contaminants stored in catchment soils being transferred to source waters, but is very unlikely to raise the negligible health risk due to Hg from Scottish single malt whisky consumption.

  5. Cultivation of tea fungus on malt extract medium

    Directory of Open Access Journals (Sweden)

    Cvetković Dragoljub D.

    2002-01-01

    Full Text Available The possibility of application of malt extract as a source of carbohydrate in a medium for tea fungus was investigated. The beverage obtained on such medium was compared with that prepared in a traditional way with sucrose medium. The presence of easily adoptable sugars, glucose and fructose, as dominant in malt medium results in a very effective fermentation, which gives much more sour beverage for the same time and makes it possible to reduce the fermentation period. The obtained beverage has satisfactory sensorial characteristics.

  6. Mutation breeding of pearl millet and sorghum

    Energy Technology Data Exchange (ETDEWEB)

    Hanna, W W [United States Department of Agriculture, Agricultural Research Service, University of Georgia, College of Agricultural Experiment Stations, Coastal Plain Station, Agronomy Department, Tifton, GA (United States)

    1982-07-01

    Pearl millet and sorghum are important food and feed crops grown mostly in semi-arid regions of the world. Although there exists a large amount of genetic variability in both species, it does not always satisfy the needs of plant breeders in improving varieties with regard to yield, quality, resistance or environmental adaptation. Plant breeders interested in using induced mutations for variety improvement will find in this review information about the techniques used by others. (author)

  7. Mutation breeding of pearl millet and sorghum

    International Nuclear Information System (INIS)

    Hanna, W.W.

    1982-01-01

    Pearl millet and sorghum are important food and feed crops grown mostly in semi-arid regions of the world. Although there exists a large amount of genetic variability in both species, it does not always satisfy the needs of plant breeders in improving varieties with regard to yield, quality, resistance or environmental adaptation. Plant breeders interested in using induced mutations for variety improvement will find in this review information about the techniques used by others. (author)

  8. Nutritional and sensory evaluation of food formulations from malted ...

    African Journals Online (AJOL)

    Malting and fermentation were investigated as simple technologies for improving the nutritional and organoleptic properties of maize/sesame food formulations. Various maize flour samples were blended with defatted sesame flour, by material balancing, to give four food formulations consisting of unmalted maize + defatted ...

  9. Effect of enzyme supplementation on the nutritive value of malted ...

    African Journals Online (AJOL)

    The composition of malted sorghum sprout (MSP) and its nutritive value when supplemented with an exogenous enzyme was investigated using weanling albino rats. A nitrogen free basal diet was formulated along with a soya bean meal (SBM) reference diet (10% CP) and two test diets each containing 10% CP supplied ...

  10. Factors influencing beta-amylase activity in sorghum malt

    CSIR Research Space (South Africa)

    Taylor, JRN

    1993-09-01

    Full Text Available isozyme of pI approximately 4.4-4.5, unlike the many isozymes all of higher pI in barley. However, like barley, sorghum beta-amylase was more temperature-labile than its alpha-amylase. Beta-amylase activity in sorghum malt was increased by germination time...

  11. Anti-Hyperprolactinemic Effect of Formula Malt Decoction, a Chinese ...

    African Journals Online (AJOL)

    Purpose: To investigate the anti-hyperprolactinemic activity of Formula Malt Decoction (FMD), a. Chinese herbal mixture. Methods: The effect of FMD on serum prolactin (PRL), estradiol (E2), progesterone (PGN), follicle stimulating hormone (FSH) and luteinizing hormone (LH) levels were investigated in hyperprolactinemic.

  12. Determination of improved steeping conditions for sorghum malting

    CSIR Research Space (South Africa)

    Dewar, J

    1997-07-01

    Full Text Available The effect of various steeping conditions (time, temperature and aeration) on the quality of sorghum malt for brewing (in terms of diastatic power, free amino nitrogen and hot water extract) was examined. Steeping time and temperature had a highly...

  13. CT appearances of mucosa-associated lymphoid tissue (MALT) lymphoma

    International Nuclear Information System (INIS)

    Kessar, P.; Norton, A.; Rohatiner, A.Z.S.; Lister, T.A.; Reznek, R.H.

    1999-01-01

    Mucosa-associated lymphoid tissue (MALT) lymphoma is a low-grade lymphoma that differs from high-grade non-Hodgkin lymphoma both clinically and histologically. The CT appearances of MALT lymphoma are described. Of 40 patients referred with biopsy-proven MALT lymphoma, only seven had not had gastrectomy or chemotherapy prior to CT examination. The CT scans of these seven cases were analysed for the degree and extent of gastric wall thickening, enlargement of abdominal and extra-abdominal lymph nodes, and presence of extranodal disease. In all patients the stomach was distended with oral contrast medium and scans performed at narrow collimation, after intravenous administration of 20 mg hyoscine butylbromide. In six patients focal thickening of the gastric wall was 1 cm or less. One patient had thickening of over 4 cm. There was no enlargement of abdominal or extra-abdominal lymph nodes or extension to adjacent organs. Thus on CT, at presentation, MALT lymphoma results in minimal gastric wall thickening, unlike high-grade non-Hodgkin lymphoma, which typically causes bulky gastric disease, nodal enlargement and extension into adjacent organs. CT is therefore of limited value in monitoring response to treatment. With disease greater than minimal thickening, transformation to a higher grade should be considered. (orig.)

  14. Influence of variety and management level on pearl millet production ...

    African Journals Online (AJOL)

    Pearl millet [Pennisetum glaucum (L.)R. Br.] is generally grown on nutrient-poor soils and low rainfall conditions in Niger. Nitrogen and P accumulation and utilisation are very important factors in pearl millet growth, and are affected by environment and management. An understanding of seasonal N and P accumulation is ...

  15. Small millet farmers increase yields through participatory varietal ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Small millets, despite being rich in micronutrients and dietary fibre and known for their low glycemic index and tolerance of water stress, are in decline in South Asia. Existing varieties suffer from low yield and farmers lack access to improved varieties. The Revalorising Small Millets in Rainfed Regions of South Asia ...

  16. Optimization of drying process of Zea Mays malt to use as alternative source of amylolytics enzymes

    Directory of Open Access Journals (Sweden)

    Joana Paula Menezes Biazus

    2005-06-01

    Full Text Available This work aimed to study the drying process optimization of maize (Zea Mays malt for obtaining maize malt, without affecting enzymatic activity of alpha e beta-amylases from maize malt. Results showed that dryer operation must occur in zone at 54°C and 5.18-6 h process time. The maize malt obtained had good enzymatic properties.Este trabalho objetivou a otimização da secagem do malte de milho (Zea Mays para obter um malte sem afetar a atividade das enzimas presentes neste, alfa e beta -amilases. Os resultados mostraram que a operação do secador deve ser feita a 54°C e entre 5,18-6 h de processo. O malte obtido possuiu boas propriedades enzimáticas.

  17. Kinetics Investigation on Mushroom Tyrosinase Inhibition of Proso Millet

    Directory of Open Access Journals (Sweden)

    Wen-Ying Huang

    2018-01-01

    Full Text Available Proso millet (Panicum miliaceum is rich in nutritive components and is widely used as a human food, feed and forage for animals, and fuel. This study investigated the effect of a proso millet extract on the inhibition of tyrosinase, a key enzyme in melanogenesis. High performance liquid chromatography analysis indicated that the proso millet extract contained phenolic tyrosinase inhibitors, such as syringic acid, p-coumaric acid, and ferulic acid. The extract had an IC50 for inhibition of tyrosinase activity of 14.02 mg/mL. A Lineweaver-Burk double reciprocal plot showed that the proso millet extract functioned as a mixed competitive and noncompetitive inhibitor. Proso millet has potential as a tyrosinase inhibitor that may have applications in the cosmetics industry.

  18. FmMDb: a versatile database of foxtail millet markers for millets and bioenergy grasses research.

    Directory of Open Access Journals (Sweden)

    Venkata Suresh B

    Full Text Available The prominent attributes of foxtail millet (Setaria italica L. including its small genome size, short life cycle, inbreeding nature, and phylogenetic proximity to various biofuel crops have made this crop an excellent model system to investigate various aspects of architectural, evolutionary and physiological significances in Panicoid bioenergy grasses. After release of its whole genome sequence, large-scale genomic resources in terms of molecular markers were generated for the improvement of both foxtail millet and its related species. Hence it is now essential to congregate, curate and make available these genomic resources for the benefit of researchers and breeders working towards crop improvement. In view of this, we have constructed the Foxtail millet Marker Database (FmMDb; http://www.nipgr.res.in/foxtail.html, a comprehensive online database for information retrieval, visualization and management of large-scale marker datasets with unrestricted public access. FmMDb is the first database which provides complete marker information to the plant science community attempting to produce elite cultivars of millet and bioenergy grass species, thus addressing global food insecurity.

  19. Multi-fingered robotic hand

    Science.gov (United States)

    Ruoff, Carl F. (Inventor); Salisbury, Kenneth, Jr. (Inventor)

    1990-01-01

    A robotic hand is presented having a plurality of fingers, each having a plurality of joints pivotally connected one to the other. Actuators are connected at one end to an actuating and control mechanism mounted remotely from the hand and at the other end to the joints of the fingers for manipulating the fingers and passing externally of the robot manipulating arm in between the hand and the actuating and control mechanism. The fingers include pulleys to route the actuators within the fingers. Cable tension sensing structure mounted on a portion of the hand are disclosed, as is covering of the tip of each finger with a resilient and pliable friction enhancing surface.

  20. Mixing methods, tasting fingers

    DEFF Research Database (Denmark)

    Mann, Anna; Mol, Annemarie; Satalkar, Priya

    2011-01-01

    This article reports on an ethnographic experiment. Four finger eating experts and three novices sat down for a hot meal and ate with their hands. Drawing on the technique of playing with the familiar and the strange, our aim was not to explain our responses, but to articulate them. As we seek...... words to do so, we are compelled to stretch the verb "to taste." Tasting, or so our ethnographic experiment suggests, need not be understood as an activity confined to the tongue. Instead, if given a chance, it may viscously spread out to the fingers and come to include appreciative reactions otherwise...

  1. A Finger Exoskeleton Robot for Finger Movement Rehabilitation

    Directory of Open Access Journals (Sweden)

    Tzu-Heng Hsu

    2017-07-01

    Full Text Available In this study, a finger exoskeleton robot has been designed and presented. The prototype device was designed to be worn on the dorsal side of the hand to assist in the movement and rehabilitation of the fingers. The finger exoskeleton is 3D-printed to be low-cost and has a transmission mechanism consisting of rigid serial links which is actuated by a stepper motor. The actuation of the robotic finger is by a sliding motion and mimics the movement of the human finger. To make it possible for the patient to use the rehabilitation device anywhere and anytime, an Arduino™ control board and a speech recognition board were used to allow voice control. As the robotic finger follows the patients voice commands the actual motion is analyzed by Tracker image analysis software. The finger exoskeleton is designed to flex and extend the fingers, and has a rotation range of motion (ROM of 44.2°.

  2. Production and characterization of amylases from Zea mays malt

    Directory of Open Access Journals (Sweden)

    Joana Paula Menezes Biazus

    2009-08-01

    Full Text Available In this work the α and β-amylase enzymes were obtained from maize (Zea mays malt and were biochemistry characterized. A germination study to obtain the maize malt with good amylase activity was made. The maize seeds were germinated in laboratory and the enzymatic activity was measured daily. Activity dependence to germination time were fitted to an exponential model (A=A0eµt, which showed that the behaviour of enzymatic activity in the germination process was similar to the growth of the microorganism. Its model could be applied to describe the mechanism of α-amylase production for each maize varieties and others cereals. Maize malt characterization showed that α and β-amylase had optimal pH between 4-6.5, optimal temperature 50 and 90ºC, and molecular weight of 67.4 and 47.5kDa, respectively. This work contributed with the advances in biotechnology generating of conditions for application of a new and of low price amylases source.Neste trabalho as enzimas α e β-amilases foram obtidas de malte de milho e depois foram caracterizadas bioquimicamente. Um estudo da germinação foi feito para obtenção do malte com boa atividade amilásica. A germinação ocorreu em escala laboratorial e a atividade enzimática foi medida diariamente. Um modelo exponencial do tipo A=A0eµt foi ajustado a dependência do tempo de germinação com a atividade, mostrando que o comportamento da atividade enzimática no processo de germinação é semelhante ao crescimento de microorganismos. Este modelo pode ser aplicado para descrever o mecanismo de produção da α-amilase para cada variedade de milho e de outros cereais. A caracterização do malte de milho mostrou que as α e β-amilase têm pH ótimo entre 4,0-6,5, temperatura ótima de 50 e 90ºC, e massa molar de 67,4 e 47,5 kDa, respectivamente. Este trabalho contribuiu com os avanços da biotecnologia gerando condições de emprego de uma nova e barata fonte de amilases.

  3. Mixing methods, tasting fingers

    DEFF Research Database (Denmark)

    Mann, Anna; Mol, Annemarie; Satalkar, Priya

    2011-01-01

    This article reports on an ethnographic experiment. Four finger eating experts and three novices sat down for a hot meal and ate with their hands. Drawing on the technique of playing with the familiar and the strange, our aim was not to explain our responses, but to articulate them. As we seek wo...

  4. Trigger Finger (Stenosing Tenosynovitis)

    Science.gov (United States)

    ... All Topics A-Z Videos Infographics Symptom Picker Anatomy Bones Joints Muscles Nerves Vessels Tendons About Hand Surgery What is a Hand Surgeon? What is a Hand Therapist? Media Find a Hand Surgeon Home Anatomy Trigger Finger Email to a friend * required fields ...

  5. Population genetics of foxtail millet and its wild ancestor

    Directory of Open Access Journals (Sweden)

    Wang Yongfang

    2010-10-01

    Full Text Available Abstract Background Foxtail millet (Setaria italica (L. P. Beauv., one of the most ancient domesticated crops, is becoming a model system for studying biofuel crops and comparative genomics in the grasses. However, knowledge on the level of genetic diversity and linkage disequilibrium (LD is very limited in this crop and its wild ancestor, green foxtail (Setaria viridis (L. P. Beauv.. Such information would help us to understand the domestication process of cultivated species and will allow further research in these species, including association mapping and identification of agricultural significant genes involved in domestication. Results In this study, we surveyed DNA sequence for nine loci across 50 accessions of cultivated foxtail millet and 34 of its wild progenitor. We found a low level of genetic diversity in wild green foxtail (θ = 0.0059, θ means Watterson's estimator of θ. Despite of a 55% loss of its wild diversity, foxtail millet still harbored a considerable level of diversity (θ = 0.0027 when compared to rice and sorghum (θ = 0.0024 and 0.0034, respectively. The level of LD in the domesticated foxtail millet extends to 1 kb, while it decayed rapidly to a negligible level within 150 bp in wild green foxtail. Using coalescent simulation, we estimated the bottleneck severity at k = 0.6095 when ρ/θ = 1. These results indicated that the domestication bottleneck of foxtail millet was more severe than that of maize but slightly less pronounced than that of rice. Conclusions The results in this study establish a general framework for the domestication history of foxtail millet. The low level of genetic diversity and the increased level of LD in foxtail millet are mainly caused by a population bottleneck, although gene flow from foxtail millet to green foxtail is another factor that may have shaped the pattern of genetic diversity of these two related gene pools. The knowledge provided in this study will benefit future population

  6. Current status and future of MALT, The University of Tokyo

    International Nuclear Information System (INIS)

    Matsuzaki, H.; Tsuchiya, Y.S.; Nakano, C.

    2013-01-01

    MALT (Micro Analysis Laboratory, Tandem accelerator, The University of Tokyo) is designed for highly sensitive and precise elemental and isotopic microanalysis system using ion beam generated by MC-SNICSTM solid state ion sources and Pelletron TM 5UD tandem accelerator. Currently multi-nuclide AMS ( 10 Be, 14 C, 26 Al, 36 Cl, 129 I) system and other beam analysis techniques (PIXE, NRA, ERDA) are available and show good performance. After the 2011 earthquake-disaster and the Fukushima Daiichi Nuclear Power Plant (FDNPP) accident, investigation of 129 I distribution and behavior in the environment originated the accident has come to be an important mission at MALT as well as many collaborating scientific projects such as 'Study on natural and anthropogenic iodine isotope system', 'Application of in situ cosmogenic radio nuclides to the geomorphologic processes', and 'Analysis of cosmogenic radio nuclides in the Antarctic ice core', so on. (author)

  7. Scope of millet grains as an extender in meat products.

    Science.gov (United States)

    Talukder, Suman; Sharma, B D

    2015-01-01

    India stood first for millet production in the world and plays a significant role in meat production and consumption too. To meet the demand of health conscious consumers for healthy and nutritious meat food item, the incorporation of millet grains and its byproducts to the meat products by the processors can serve the purpose. The multidimensional positive nutritional and functional characteristics millet grain not only improve the acceptability of the meat products but also increase its own demand as a main coarse food grain in competition to the wheat and rice over the world.

  8. The breeding of new malting barley variety 'yangpi NO.3'

    International Nuclear Information System (INIS)

    Wang Jinrong; Chen Xiulan; He Zhentian; Han Yuepeng; Wang Jianhua; Zhang Rong

    2009-01-01

    'Yangpi No 3' is a spring and two-rowed new malting barley variety. It was selected by the radiation-induced mutations. Its yield was about 6750 kg/hm 2 and the maturity was slightly later. The variety is with good agronomic traits, strong resistance, top quality and planted mainly in Huainan of Jiangsu Province. It had been qualified by Crop Variety Evaluation Committee of Jiangsu Province in Feb, 2009(200901). (authors)

  9. The breeding of new malting barley variety 'Yangpi No.2'

    International Nuclear Information System (INIS)

    Chen Xiulan; He Zhentian; Han Yuepeng; Wang Jinrong; Yang Hefeng

    2005-01-01

    'Yangpi No.2' barley pasted the examination of Jiangsu province in 2002, is the new spring two-rowed malting barley variety selected by which irradiation mutated the early-maturing of barley. The yield capacity of 'Yangpi No.2' barley is about 6750 kg/hm 2 , it had the characters of early-maturing, good agronomic characters, strong anti-adversity, high quality, and adapted well to everywhere in Jiangsu province. (authors)

  10. Taste-active Components of Beers from Emmer Wheat (Triticum dicoccum Malt

    Directory of Open Access Journals (Sweden)

    Benedetti P.

    2016-06-01

    Full Text Available Emmer wheat (EW, Triticum dicoccum grows under adverse climatic and soil conditions in the hilly areas of Italy and other temperate regions. So far, EW has been used for pasta or bakery products. The malt obtained from EW was used to produce a light beer, a double malt beer, and beers with 50% (B50 and 30% (B30 EW malt combined with barley malt. These top-fermented beers showed a sweet, fruity, citrus character. The different sensory impact and chemical composition (betaglucans and flavanoids of the beers was related to the germinative energy of EW and the different proportions of malted EW and barley malt. The light beer combines the moderate alcohol (3% vol. with a good intake of natural antioxidants (total phenolic content, TPC, 85 mg l−1, whereas B50 showed a high TPC (109 mg l−1 and the highest beta-glucan content (27 mg l−1.

  11. [Fluctuant pulmonary nodules as presentation of a MALT lymphoma].

    Science.gov (United States)

    Dolz Aspas, R; Toyas Miazza, C; Ruiz Ruiz, F; Morales Rull, J L; Pérez Calvo, J I

    2003-11-01

    Mucosa associated lymphoid tissue (MALT) lymphomas are a group of non- Hodgkin"s lymphomas of low malignancy degree. The most frequent location is the gastrointestinal tract. Its primary pulmonary presentation is unusual and heterogeneous from point of view radiological. Woman 61 years old with antecedents of vitiligo, gastric ulcus, cirrhosis by VHC, that go into the hospital by sudden disnea, thoracic paint with pleural characterises and fever of 38.5 degrees C, Her thorax radiography and thoracic TAC showed nodes that affect to different pulmonary lobes. The cytology by PAAF confirms their malignant nature. In subsequent radiological controls it was notice the nodels took away completely and returns in different pulmonary place in each recurrence. The presentation like fluctuant pulmonary nodes is exceptional in a MALT lymphoma. It was described a higher incidence of VHC infection and tumour. The evidence of chronic hepatitis by virus C disease, and local chronic inflammatory process as well as autoimmune disorders may be considerate like a factor that contribute to MALT lymphoma.

  12. Linfoma tipo MALT de la glándula parótida Lymphoma type MALT of the parotid gland

    Directory of Open Access Journals (Sweden)

    Carlos Frómeta Neira

    2010-09-01

    Full Text Available Los linfomas tipo MALT (tejido linfoideo asociado a mucosa, constituyen la variedad más recientemente descubierta de los linfomas no Hodgkin, tienen lugar fundamentalmente en la mucosa gástrica asociados a infección por Helycobacter pylori, y en la glándula tiroides en relación con la tiroiditis de Hashimoto. Sin embargo, internacionalmente se han descrito casos en glándulas salivales asociados a linfoadenitis. La naturaleza de la lesión a menudo no puede ser determinada solo por el estudio citológico; se hace necesario el análisis histopatológico para el diagnóstico definitivo en la mayoría de los casos. El presente estudio muestra un paciente masculino con aumento de volumen bilateral de ambas glándulas parótidas y diagnóstico citohistopatológico de un proceso linfoepitelial benigno, el cual desarrolló un linfoma tipo MALT en relación con la glándula parótida derecha.The lymphomas type MALT or the mucosa-associated lymphoid tissue, are the most recent variety of non-Hodgkin lymphomas present mainly in the gastric mucosa associated with Helycobacter pylori infection and in the thyroid gland in relation to Hashimoto's thyroiditis. Frequently the origin of this lesion can't be determined only by cytology study, thus it is necessary the histopathology analysis for a definitive diagnosis in most cases. Present paper includes the case of male patient with bilateral volume increase of both parotid glands and a diagnosis cytopathological of a benign lymphoepithelial process and the development of a type MALT lymphoma in relation to the right parotid gland.

  13. Small millets, big potential: diverse, nutritious, and climate smart ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2016-04-29

    Apr 29, 2016 ... Integrated and focused public support is now needed for ... Include small millets in the Indian public distribution system (PDS) to 10 kg per ... but post-harvest losses, due to factors such as poor handling, transport, and.

  14. Small millet farmers increase yields through participatory varietal

    International Development Research Centre (IDRC) Digital Library (Canada)

    When farmers adopt a variety along with ones they already ... Increased access to quality seed of promising ... Figure 1: Potential increases in yield of small millet preferred varieties. 0. 200 ... terms of both product (farmers preferred varieties ...

  15. Metagenomic insights into the rumen microbial fibrolytic enzymes in Indian crossbred cattle fed finger millet straw.

    Science.gov (United States)

    Jose, V Lyju; Appoothy, Thulasi; More, Ravi P; Arun, A Sha

    2017-12-01

    The rumen is a unique natural habitat, exhibiting an unparalleled genetic resource of fibrolytic enzymes of microbial origin that degrade plant polysaccharides. The objectives of this study were to identify the principal plant cell wall-degrading enzymes and the taxonomic profile of rumen microbial communities that are associated with it. The cattle rumen microflora and the carbohydrate-active enzymes were functionally classified through a whole metagenomic sequencing approach. Analysis of the assembled sequences by the Carbohydrate-active enzyme analysis Toolkit identified the candidate genes encoding fibrolytic enzymes belonging to different classes of glycoside hydrolases(11,010 contigs), glycosyltransferases (6366 contigs), carbohydrate esterases (4945 contigs), carbohydrate-binding modules (1975 contigs), polysaccharide lyases (480 contigs), and auxiliary activities (115 contigs). Phylogenetic analysis of CAZyme encoding contigs revealed that a significant proportion of CAZymes were contributed by bacteria belonging to genera Prevotella, Bacteroides, Fibrobacter, Clostridium, and Ruminococcus. The results indicated that the cattle rumen microbiome and the CAZymes are highly complex, structurally similar but compositionally distinct from other ruminants. The unique characteristics of rumen microbiota and the enzymes produced by resident microbes provide opportunities to improve the feed conversion efficiency in ruminants and serve as a reservoir of industrially important enzymes for cellulosic biofuel production.

  16. Studies on the induced dwarfs and ear mutations in finger millet

    International Nuclear Information System (INIS)

    Nayar, K.M.D.; Hanumanthappa, H.S.; Seetharam, A.

    1975-01-01

    Seeds of five varieties of ragi viz., Purna, Annapurna, Cauvery, H 22 and Hamsa were treated with gamma rays (20 kr and 30 kr), Fast Neutrons (0.8 kr and 1.2 kr) and Ethyl methane sulphonate (0.2% and 0.3% for 16 hrs.) with a view to isolate agronomically desirable dwarf mutants in Purna, Annapurna, Cauvery and H 22 and desirable earhead mutants in Hamsa. In M 1 generation, biological effects of these mutagens on germination, seedling growth, pollen and seed fertility were studied. In the M 2 generation, a total of 60 dwarfs were isolated from all the treatments. Out of these, after subsequent testing, two dwarfs in Purna, three in Annapurna, two in Cauvery and one in H 22 were found to be promising. Some of the induced dwarfs were having better harvest index. The dwarf mutant of H 22 had a height of 30 cm., in contrast to 100 cm., in original parent. Although this mutant has a very low yield potential, it can form an excellent breeding material in hybridization programmes. In Hamsa, mutants for earhead shape and size were isolated with a gradation from extreme fist type to completely open and lax ears. The yield potential of the earhead mutants was either significantly lower or on par with the original Hamsa. (author)

  17. Effect of autoclaving of sprouted Kidney beans and finger millet on ...

    African Journals Online (AJOL)

    1Department of Food Science and Technology, Sokoine University of Agriculture, P.O. .... ingredients promoted in preparation of complementary foods in Tanzania, .... Cooking does little to reduce this toxicity since most of the toxin occurs as ...

  18. La promotion des produits alimentaires nourrissants à base de millet ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Le millet possède des qualités nutritives supérieures et une plus grande résilience au climat, mais sa production et sa consommation demeurent faibles dans de nombreux pays de l'Asie du Sud, comme l'Inde. Ce projet relèvera ce défi grâce à une recherche visant la mise en valeur de la transformation du millet et des ...

  19. Ribosomal DNA intergenic spacer sequence in foxtail millet, Setaria italica (L.) P. Beauv. and its characterization and application to typing of foxtail millet landraces.

    Science.gov (United States)

    Fukunaga, Kenji; Ichitani, Katsuyuki; Taura, Satoru; Sato, Muneharu; Kawase, Makoto

    2005-02-01

    We determined the sequence of ribosomal DNA (rDNA) intergenic spacer (IGS) of foxtail millet isolated in our previous study, and identified subrepeats in the polymorphic region. We also developed a PCR-based method for identifying rDNA types based on sequence information and assessed 153 accessions of foxtail millet. Results were congruent with our previous works. This study provides new findings regarding the geographical distribution of rDNA variants. This new method facilitates analyses of numerous foxtail millet accessions. It is helpful for typing of foxtail millet germplasms and elucidating the evolution of this millet.

  20. MALT1 Controls Attenuated Rabies Virus by Inducing Early Inflammation and T Cell Activation in the Brain.

    Science.gov (United States)

    Kip, E; Staal, J; Verstrepen, L; Tima, H G; Terryn, S; Romano, M; Lemeire, K; Suin, V; Hamouda, A; Kalai, M; Beyaert, R; Van Gucht, S

    2018-04-15

    MALT1 is involved in the activation of immune responses, as well as in the proliferation and survival of certain cancer cells. MALT1 acts as a scaffold protein for NF-κB signaling and a cysteine protease that cleaves substrates, further promoting the expression of immunoregulatory genes. Deregulated MALT1 activity has been associated with autoimmunity and cancer, implicating MALT1 as a new therapeutic target. Although MALT1 deficiency has been shown to protect against experimental autoimmune encephalomyelitis, nothing is known about the impact of MALT1 on virus infection in the central nervous system. Here, we studied infection with an attenuated rabies virus, Evelyn-Rotnycki-Abelseth (ERA) virus, and observed increased susceptibility with ERA virus in MALT1 -/- mice. Indeed, after intranasal infection with ERA virus, wild-type mice developed mild transient clinical signs with recovery at 35 days postinoculation (dpi). Interestingly, MALT1 -/- mice developed severe disease requiring euthanasia at around 17 dpi. A decreased induction of inflammatory gene expression and cell infiltration and activation was observed in MALT1 -/- mice at 10 dpi compared to MALT1 +/+ infected mice. At 17 dpi, however, the level of inflammatory cell activation was comparable to that observed in MALT1 +/+ mice. Moreover, MALT1 -/- mice failed to produce virus-neutralizing antibodies. Similar results were obtained with specific inactivation of MALT1 in T cells. Finally, treatment of wild-type mice with mepazine, a MALT1 protease inhibitor, also led to mortality upon ERA virus infection. These data emphasize the importance of early inflammation and activation of T cells through MALT1 for controlling the virulence of an attenuated rabies virus in the brain. IMPORTANCE Rabies virus is a neurotropic virus which can infect any mammal. Annually, 59,000 people die from rabies. Effective therapy is lacking and hampered by gaps in the understanding of virus pathogenicity. MALT1 is an intracellular

  1. 19 CFR 11.6 - Distilled spirits, wines, and malt liquors in bulk.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Distilled spirits, wines, and malt liquors in bulk...; DEPARTMENT OF THE TREASURY PACKING AND STAMPING; MARKING Packing and Stamping § 11.6 Distilled spirits, wines... conveying imported distilled spirits, wines, and malt liquors, in accordance with 19 U.S.C. 467. (b) Marks...

  2. Acha ( Digitaria exilis ) Malt as a Source of Enzyme for Bio-Ethanol ...

    African Journals Online (AJOL)

    ... exilis ) Malt as a Source of Enzyme for Bio-Ethanol Production from Starchy Materials. ... Incubating a mixture of raw starch and acha malt at 50oC for 30 minutes ... has great potential application in brewery and ethanol production industries.

  3. Acha (Digitaria exilis) Malt as a Source of Enzyme for Bio-Ethanol ...

    African Journals Online (AJOL)

    Prof. Ogunji

    ethanol fermentation under various conditions showed that acha malt enzyme is superior to koji enzyme (microbial enzymes) under the three conditions investigated. The superiority of acha malt over koji enzymes may be because of the high β-amylase content as reported by. (Nzelibe and Nwasika 2007) which is the major.

  4. Effects of Net Blotch ( Pyrenophora teres ) on Malt Barley Yield and ...

    African Journals Online (AJOL)

    Barley (Hordeum vulgare L.) production is constrained by diseases such as net blotch caused by Pyrenophora teres Drechsl. The objectives of this study were to assess the effects of net blotch disease on malt barley yield and grain quality under natural infection. Four malt barley varieties (Beka, HB 120, HB 52 and Holker), ...

  5. Is barley malt safe as a food ingredient?

    DEFF Research Database (Denmark)

    Duedahl-Olesen, Lene; Olesen, P. A.

    hydrocarbons (PAH) are such process contaminants previously identified in e.g. smoked fish [3]. Germinated barley is smoke treated and for many whisky malt dried over peat-fuelled furnace for flavour addition probably with increased health risks for spent grain consumers as a result. To evaluate our concern we...... for animal feed and recently the high nutritive value has made it feasible as bread flour supplement [1] and therefore human food. Process contamination such as the genotoxic acrylamide formed due to Maillard reactions between reducing sugars and amino acids at raised temperature could appear during drying...

  6. Robotic Finger Assembly

    Science.gov (United States)

    Ihrke, Chris A. (Inventor); Bridgwater, Lyndon (Inventor); Diftler, Myron A. (Inventor); Linn, Douglas Martin (Inventor); Platt, Robert J., Jr. (Inventor); Hargrave, Brian (Inventor); Askew, Scott R. (Inventor); Valvo, Michael C. (Inventor)

    2014-01-01

    A robotic hand includes a finger with first, second, and third phalanges. A first joint rotatably connects the first phalange to a base structure. A second joint rotatably connects the first phalange to the second phalange. A third joint rotatably connects the third phalange to the second phalange. The second joint and the third joint are kinematically linked such that the position of the third phalange with respect to the second phalange is determined by the position of the second phalange with respect to the first phalange.

  7. Hidradenocarcinoma of the finger.

    Science.gov (United States)

    Nazerali, Rahim S; Tan, Cynthia; Fung, Maxwell A; Chen, Steven L; Wong, Michael S

    2013-04-01

    Hidradenocarcinoma is a rare adnexal neoplasm representing the malignant counterpart of hidradenoma derived from eccrine sweat glands. Misdiagnosis of this disease is common due to the wide variety of histological patterns and rarity of this malignancy. We report an 87-year-old man presenting with a rare case of biopsy-proven hidradenocarcinoma of the finger. There is no standard care of treatment of hidradenocarcinoma, especially of those tumors in rare locations such as the fingers, given its rarity, variable tumor behavior and histology. Although limited treatment strategies exist, detailed data including TNM, location, histologic type and grade, and patient age should be gathered for optimal treatment strategy. The literature supports a 3-fold approach to these malignancies involving margin-free resection, sentinel lymph node biopsy to evaluate possible metastasis, and long-term follow-up given high risk of recurrence. Our treatment strategy involved a 4-fold, multidisciplinary approach involving reconstruction to optimize tumor-free remission and hand function.

  8. Purificação de amilases de malte de Zea mays Purification of amylases from Zea mays malt

    Directory of Open Access Journals (Sweden)

    Joana Paula Menezes Biazus

    2010-03-01

    Full Text Available Neste trabalho realizou-se a purificação das enzimas α e β-amilases de malte de milho combinando os processos de adsorção em leito expandido com o fracionamento por etanol. Alimentaram-se 5 mL de uma solução a 2% de malte de milho em tampão fosfato 0,05 M a pH 5 em uma coluna contendo as resinas de troca iônica Amberlite IRA 410, em leito fixo de 4 cm fluidizado para 8 cm. A eluição foi promovida com NaCl 0,25M com 14 mL/minuto de vazão descendente e o material eluído foi fracionado com álcool etílico nas concentrações de 40-70%, 50-80% e 60-90% (v/v a 20 e 30 ºC. A recuperação da atividade e o fator de purificação foram de 95% e 23 vezes, respectivamente, na primeira etapa. A melhor condição de fracionamento das enzimas foi apresentada a 50-80% de álcool e 20 ºC, e o fator de purificação ficou acima de 100 vezes.In the present work the purification of α and β-amylase enzymes of maize malt was carried out by expanded bed adsorption and ethanol fractionation downstream processes. 5 mL of 2% maize malt solution in 0.05 M phosphate buffer at pH was injected into a chromatographic column containing Amberlite 410 ion-exchange resin, on a 4 cm fixed bed fluidized to 8 cm. 0.25 M NaCl solution at 14 mL/ minuto of descending flux was used for promotion of the elution, the eluted matter was fractioned by 40-70, 50-80 and 60-90% ethyl alcohol concentration at 20 and 30 ºC. Activity recovery and purification factor were of 95% and 23 times, respectively, in the first step. 50-80% alcohol concentration at 20ºC was the best condition, in which a purification factor of more than 100 times was achieved.

  9. Malting and Brewing Industries Encounter Fusarium spp. Related Problems

    Directory of Open Access Journals (Sweden)

    Kristina Mastanjević

    2018-01-01

    Full Text Available Versatile microbiota are inevitably naturally present on cereals. Fungi, yeasts and bacteria and their metabolites all contribute to the quality and safety of the final products derived from most common beer cereals—barley and wheat. The microorganisms that are most often associated with the safety and quality of cereals for beer production belong to the Fusarium spp. They greatly influence yields from the field, and can modify and diminish economic success for farmers. However, the real problem is their harmful metabolites—mycotoxins—that affect the health of humans and animals. In the era of emerging analytical methodologies, the spectrum of known toxins originating from microorganisms that can pose a threat to humans has grown tremendously. Therefore, it is necessary to monitor microflora throughout the productive “barley to beer” chain and to act suppressive on the proliferation of unwanted microorganisms, before and during malting, preventing the occurrence of mycotoxins in final products and by-products. Multi-mycotoxin analyses are very advanced and useful tools for the assessment of product safety, and legislation should follow up and make some important changes to regulate as yet unregulated, but highly occurring, microbial toxins in malt and beer.

  10. Energy and exergy analyses of malt drink production in Nigeria

    International Nuclear Information System (INIS)

    Fadare, D.A.; Nkpubre, D.O.; Oni, A.O.; Falana, A.; Waheed, M.A.; Bamiro, O.A.

    2010-01-01

    Energy requirements and exergy inefficiencies for processing of malt drink were estimated for a Nigerian brewery. The process was divided into twenty-one basic unit operations and grouped into four main group operations: silo house, brew house, filter room and packaging house. The energy intensity for processing a batch of 9.8 tonnes brew grains to 562 hl of malt drink was estimated as 261.63 MJ/hl consisting of electrical (41.01%), thermal (58.81%) and manual (0.19%) of the total energy. The most energy intensive group operation was the Packaging House operation, followed by the Brew House operation with energy intensities of 223.19 and 35.94 MJ/hl, respectively. The exergy analysis revealed that the packaging house operation was responsible for most of the inefficiency (92.16%) followed by brew house operation (7.17%) and the silo house and filter room operations with less than 1% of the total exergy lost. The most exergy loss took place in the pasteurizer, which accounted for 59.75% of the overall system inefficiency. Modification in the pasteurizer and use of spent grains as alternate source of energy in the steam boiler were recommended to improve the energy efficiency of the system.

  11. Energy and exergy analyses of malt drink production in Nigeria

    Energy Technology Data Exchange (ETDEWEB)

    Fadare, D.A.; Nkpubre, D.O.; Oni, A.O.; Falana, A.; Bamiro, O.A. [Mechanical Engineering Department, University of Ibadan, P. M.B. 1, Ibadan, Oyo State (Nigeria); Waheed, M.A. [Mechanical Engineering Department, University of Agriculture, P. M.B. 2240, Abeokuta, Ogun State (Nigeria)

    2010-12-15

    Energy requirements and exergy inefficiencies for processing of malt drink were estimated for a Nigerian brewery. The process was divided into twenty-one basic unit operations and grouped into four main group operations: silo house, brew house, filter room and packaging house. The energy intensity for processing a batch of 9.8 tonnes brew grains to 562 hl of malt drink was estimated as 261.63 MJ/hl consisting of electrical (41.01%), thermal (58.81%) and manual (0.19%) of the total energy. The most energy intensive group operation was the Packaging House operation, followed by the Brew House operation with energy intensities of 223.19 and 35.94 MJ/hl, respectively. The exergy analysis revealed that the packaging house operation was responsible for most of the inefficiency (92.16%) followed by brew house operation (7.17%) and the silo house and filter room operations with less than 1% of the total exergy lost. The most exergy loss took place in the pasteurizer, which accounted for 59.75% of the overall system inefficiency. Modification in the pasteurizer and use of spent grains as alternate source of energy in the steam boiler were recommended to improve the energy efficiency of the system. (author)

  12. Differences in finger localisation performance of patients with finger agnosia.

    Science.gov (United States)

    Anema, Helen A; Kessels, Roy P C; de Haan, Edward H F; Kappelle, L Jaap; Leijten, Frans S; van Zandvoort, Martine J E; Dijkerman, H Chris

    2008-09-17

    Several neuropsychological studies have suggested parallel processing of somatosensory input when localising a tactile stimulus on one's own by pointing towards it (body schema) and when localising this touched location by pointing to it on a map of a hand (body image). Usually these reports describe patients with impaired detection, but intact sensorimotor localisation. This study examined three patients with a lesion of the angular gyrus with intact somatosensory processing, but with selectively disturbed finger identification (finger agnosia). These patients performed normally when pointing towards the touched finger on their own hand but failed to indicate this finger on a drawing of a hand or to name it. Similar defects in the perception of other body parts were not observed. The findings provide converging evidence for the dissociation between body image and body schema and, more importantly, reveal for the first time that this distinction is also present in higher-order cognitive processes selectively for the fingers.

  13. Primary syphilis of the fingers

    OpenAIRE

    Starzycki, Z

    1983-01-01

    Six patients were seen with primary syphilitic chancres on their fingers between 1965 and 1980. Of these, two had bipolar chancres on their fingers and genitals resulting from sexual foreplay. Because syphilis is rarely suspected in such cases diagnostic errors are common.

  14. Emotional Communication in Finger Braille

    Directory of Open Access Journals (Sweden)

    Yasuhiro Matsuda

    2010-01-01

    Full Text Available We describe analyses of the features of emotions (neutral, joy, sadness, and anger expressed by Finger Braille interpreters and subsequently examine the effectiveness of emotional expression and emotional communication between people unskilled in Finger Braille. The goal is to develop a Finger Braille system to teach emotional expression and a system to recognize emotion. The results indicate the following features of emotional expression by interpreters. The durations of the code of joy were significantly shorter than the durations of the other emotions, the durations of the code of sadness were significantly longer, and the finger loads of anger were significantly larger. The features of emotional expression by unskilled subjects were very similar to those of the interpreters, and the coincidence ratio of emotional communication was 75.1%. Therefore, it was confirmed that people unskilled in Finger Braille can express and communicate emotions using this communication medium.

  15. Surgery for trigger finger.

    Science.gov (United States)

    Fiorini, Haroldo Junior; Tamaoki, Marcel Jun; Lenza, Mário; Gomes Dos Santos, Joao Baptista; Faloppa, Flávio; Belloti, Joao Carlos

    2018-02-20

    Trigger finger is a common clinical disorder, characterised by pain and catching as the patient flexes and extends digits because of disproportion between the diameter of flexor tendons and the A1 pulley. The treatment approach may include non-surgical or surgical treatments. Currently there is no consensus about the best surgical treatment approach (open, percutaneous or endoscopic approaches). To evaluate the effectiveness and safety of different methods of surgical treatment for trigger finger (open, percutaneous or endoscopic approaches) in adults at any stage of the disease. We searched CENTRAL, MEDLINE, Embase and LILACS up to August 2017. We included randomised or quasi-randomised controlled trials that assessed adults with trigger finger and compared any type of surgical treatment with each other or with any other non-surgical intervention. The major outcomes were the resolution of trigger finger, pain, hand function, participant-reported treatment success or satisfaction, recurrence of triggering, adverse events and neurovascular injury. Two review authors independently selected the trial reports, extracted the data and assessed the risk of bias. Measures of treatment effect for dichotomous outcomes calculated risk ratios (RRs), and mean differences (MDs) or standardised mean differences (SMD) for continuous outcomes, with 95% confidence intervals (CIs). When possible, the data were pooled into meta-analysis using the random-effects model. GRADE was used to assess the quality of evidence for each outcome. Fourteen trials were included, totalling 1260 participants, with 1361 trigger fingers. The age of participants included in the studies ranged from 16 to 88 years; and the majority of participants were women (approximately 70%). The average duration of symptoms ranged from three to 15 months, and the follow-up after the procedure ranged from eight weeks to 23 months.The studies reported nine types of comparisons: open surgery versus steroid injections (two

  16. Evaluation of radiation use efficiency and its relationship with dry matter accumulation in three millet species

    Directory of Open Access Journals (Sweden)

    behnam kamkar

    2009-06-01

    Full Text Available A factorial arrangement of three millets species (Panicum miliaceum, Pennisetum glaucum, and Setaria italica and two sowing dates with three replications were used in a completely randomized design to evaluate the radiation use efficiency and its relationship with dry matter accumulation. Leaf area index was used in daily intervals to calculate daily intercepted radiation. Light extinction coefficient was calculated as the slope of regression line between log transformed fraction of intercepted radiation and leaf area index during growing season. Radiation use efficiency was calculated as the slope of linear regression between cumulative intercepted radiation and cumulative biomass during growing season. Results showed that light extinction coefficient and radiation use efficiency for proso, pearl and foxtail millets were 0.75, 0.66, 0.57 and 1.43, 1.83, 1.74 g/MJ in terms of total radiation, respectively. Differences in biomass production were not significant between proso and pearl millets. Proso millet had higher intercepted radiation, but lower radiation use efficiency in comparison with pearl millet. Foxtail millet had lower intercepted radiation than proso and pearl millets, but its radiation use efficiency was higher than pearl millet. Total biomass of foxtail millet was lower than other species. Results indicated that proso and pearl millets can produce more biomass than foxtail millet.

  17. Peculiarities of Japanese millet growing on radionuclide contaminated territories

    International Nuclear Information System (INIS)

    Sedukova, G.V.; Samusev, A.M.; Yurchenko, N.V.

    2010-01-01

    In the conditions of the Republic of Belarus on the lands polluted with radionuclides there were presented results of field experiments directed to study of the influence of mineral fertilizers on the yield, 137Cs and 90Sr transfer parameters, and economical viability of Indian barnyard millet or Japanese millet (Echinochloa frumentacea) growing. There were three variants of the test: control variant (without any fertilizers), variants with entering of N70P40K80 and N90P60K100 kg/ha. Research results showed that entering of N70P40K80 increased Japanese millet yield till 450-500 c/ha. Maximum productivity of green mass, minimum radionuclide transfer factors and the highest profitability were after application of entering of N70P60K100. Entering of N90K60K100 increased the green mass yield in phase of heads appearing in 80 c/ha, in milk-wax stage – in 53 c/ha. Zootechnical quality of millet green mass was defined. Parameters of 137Cs and 90Sr transition were 0,03 and 2,6-6,4 Bq/kg:kBq/m2 correspondingly. Contamination densities of sod-podzolic loamy soils were determined to assure regulatory clean millet green mass production to be used as fodder for milk stock in order to produce whole milk and raw milk for processing. Japanese millet green mass grown for cattle feeding with purpose of milk getting could be produced at density 90Sr pollution of 0,2 Ci/km2. Sod-podzolic sandy soils with density 90Sr pollution less 1,5Ci/km2 were suitable for getting processing milk

  18. Covering the Dorsal Finger Defect with Reverse Cross Finger Flap

    Directory of Open Access Journals (Sweden)

    Kaan Gurbuz

    2014-12-01

    Full Text Available Reconstruction of finger extensor zone defects with or without tendon gaps still remains a challenge for surgeons. Although surgical treatments may differ, and range from the use of local, regional, to free flaps, the outcomes for all cases are not satisfactory. In this case report, we present a case of a 3rd finger extensor side crush injury including a defect of Dd (Digit Dorsal 1, Dd2 and Dd3 defects of extensor zones with tendon gap. Tendon gap was reconstructed using m. palmaris longus tendon graft and the defect was covered with reversed cross-finger flap (random pattern with good cosmetic and excellent functional results.

  19. Genome sequence of foxtail millet (Setaria italica) provides insights into grass evolution and biofuel potential.

    Science.gov (United States)

    Zhang, Gengyun; Liu, Xin; Quan, Zhiwu; Cheng, Shifeng; Xu, Xun; Pan, Shengkai; Xie, Min; Zeng, Peng; Yue, Zhen; Wang, Wenliang; Tao, Ye; Bian, Chao; Han, Changlei; Xia, Qiuju; Peng, Xiaohua; Cao, Rui; Yang, Xinhua; Zhan, Dongliang; Hu, Jingchu; Zhang, Yinxin; Li, Henan; Li, Hua; Li, Ning; Wang, Junyi; Wang, Chanchan; Wang, Renyi; Guo, Tao; Cai, Yanjie; Liu, Chengzhang; Xiang, Haitao; Shi, Qiuxiang; Huang, Ping; Chen, Qingchun; Li, Yingrui; Wang, Jun; Zhao, Zhihai; Wang, Jian

    2012-05-13

    Foxtail millet (Setaria italica), a member of the Poaceae grass family, is an important food and fodder crop in arid regions and has potential for use as a C(4) biofuel. It is a model system for other biofuel grasses, including switchgrass and pearl millet. We produced a draft genome (∼423 Mb) anchored onto nine chromosomes and annotated 38,801 genes. Key chromosome reshuffling events were detected through collinearity identification between foxtail millet, rice and sorghum including two reshuffling events fusing rice chromosomes 7 and 9, 3 and 10 to foxtail millet chromosomes 2 and 9, respectively, that occurred after the divergence of foxtail millet and rice, and a single reshuffling event fusing rice chromosome 5 and 12 to foxtail millet chromosome 3 that occurred after the divergence of millet and sorghum. Rearrangements in the C(4) photosynthesis pathway were also identified.

  20. Predominant lactic acid bacteria associated with the traditional malting of sorghum grains

    DEFF Research Database (Denmark)

    Sawadogo-Lingani, H.; Diawara, B.; Glover, R.K.

    2010-01-01

    dominated the microbiota from sorghum grains to malted sorghum. These isolates had technological properties comparable to those responsible for the acidification of sorghum beer (dolo, pito) wort produced from sorghum malt (previously studied), suggesting their potential for use as starter cultures....... Suitable isolates of L. fermentum are promising candidates to be used as starter cultures from the initial step of malting, that is, the steeping and are expected to inhibit the growth and survival of pathogens and spoilage microflora, and to control the lactic fermentation of dolo and pito wort or other...

  1. Using natural and synthetic growth regulators of plants in industrial mycology and malting

    Directory of Open Access Journals (Sweden)

    O. V. Kuznetcova

    2010-07-01

    Full Text Available Data on the expansion of the use the plants growth regulators in different areas are presented. The positive impact of the growth stimulators on the development of the Pleurotus ostreatus mycelium’s on agar nutrient media during surface cultivation is shown. The results for growth regulators stimulating effect on the fungus biosynthetic activity in submerged cultures are obtained. The possibility of using fumar and heteroauxin for malting is considered. The decline of malting time and increase of amylolytic activity of the malt are recorded.

  2. UASB reactor start up in real scale for malting effluent

    International Nuclear Information System (INIS)

    Lopez, I.; Passeggi, M.; Boix, C.; Barcia, R.; Borzacconi, L.; Liebermann, L.

    2005-01-01

    An Imhoff tank was reconstructed into a 250 m3 UASB reactor in order to treat a malting plant wastewater.The UASB was inoculated with sludge from an anaerobic lagoon used for slaughterhouse wastewater treatment.The fat present in the inoculated sludge did not affect the start up performance. After two month of operation the reactor achieved full load with COD removal higher than 80% and a biogas production of 300 m3/day. The mean diameter of granules was 0a.milimeters and the Specific Methanogenic Activity was 0.25 g COD/gVSS.d The banquet development throughout time (solids concentrations at different heights, granule size, methanogenic activity) was monitored. A yield coefficient of 0.09 gVSS/g COD rem was found

  3. Sjogren's syndrome combined with MALT lymphoma

    Energy Technology Data Exchange (ETDEWEB)

    Han, Won Jeong; Cha, Sang Yun; Kim, Eun Kyung [Dept. of Oral and Maxillofacial Radiology, School of Dentistry, Dankook University, Yongin (Korea, Republic of)

    2000-06-15

    Sjogren's syndrome is a chronic inflammatory disease that predominantly affects salivary, lacrimal, and other exocrine glands. We report a case of Sjogren's syndrome combined with MALT (mucose associated lymphoid tissue) lymphoma which occurred in the parotid gland. A 57-year-old female with the complaint of painful swelling and lymph node enlargement was referred to our department. Sialograms of both parotid glands showed globular collections of contrast material uniformly distributed throughout the parotid gland. Salivary scintigraphy showed decreased uptake of the parotid gland. CT scan showed larger, slightly more dense parotid gland than normal and honeycomb glandular appearance. Also, It showed discrete, slightly more enhanced round mass in the left parotid gland. Histopathological finding showed replacement of salivary gland parenchyma with dense small lymphocytic infiltration having the feature of epimyoepithelial islands. Kappa light chain restriction of interglandular plasma cell could be seen.

  4. The sustainable utilization of malting industry wastewater biological treatment sludge

    Science.gov (United States)

    Vasilenko, T. A.; Svintsov, A. V.; Chernysh, I. V.

    2018-01-01

    The article deals with the research of using the sludge from malting industry wastewater’s biological treatment and the calcium carbonate slurry as organo-mineral fertilizing additives. The sludge, generated as a result of industrial wastewater biological treatment, is subject to dumping at solid domestic waste landfills, which has a negative impact on the environment, though its properties and composition allow using it as an organic fertilizer. The physical and chemical properties of both wastes have been studied; the recommendations concerning the optimum composition of soil mix, containing the above-mentioned components, have been provided. The phytotoxic effect on the germination capacity and sprouts of cress (Lepidium sativum), barley (Hordéum vulgáre) and oats (Avena sativa) in soil mixes has been determined. The heavy metals and arsenic contents in the sludge does not exceed the allowable level; it is also free of pathogenic flora and helminthes.

  5. Finger Forces in Clarinet Playing

    Directory of Open Access Journals (Sweden)

    Alex Hofmann

    2016-08-01

    Full Text Available Clarinettists close and open multiple tone holes to alter the pitch of the tones. Their fingering technique must be fast, precise, and coordinated with the tongue articulation. In this empirical study, finger force profiles and tongue techniques of clarinet students (N = 17 and professional clarinettists (N = 6 were investigated under controlled performance conditions. First, in an expressive-performance task, eight selected excerpts from the first Weber Concerto were performed. These excerpts were chosen to fit in a 2 x 2 x 2 design (register: low--high; tempo: slow--fast, dynamics: soft--loud. There was an additional condition controlled by the experimenter, which determined the expression levels (low--high of the performers. Second, a technical-exercise task, an isochronous 23-tone melody was designed that required different effectors to produce the sequence (finger-only, tongue-only, combined tongue-finger actions. The melody was performed in three tempo conditions (slow, medium, fast in a synchronization-continuation paradigm. Participants played on a sensor-equipped Viennese clarinet, which tracked finger forces and reed oscillations simultaneously. From the data, average finger force (Fmean and peak force (Fmax were calculated. The overall finger forces were low (Fmean = 1.17 N, Fmax = 3.05 N compared to those on other musical instruments (e.g. guitar. Participants applied the largest finger forces during the high expression level performance conditions (Fmean = 1.21 N.For the technical exercise task, timing and articulation information were extracted from the reed signal. Here, the timing precision of the fingers deteriorated the timing precision of the tongue for combined tongue-finger actions, especially for faster tempi. Although individual finger force profiles were overlapping, the group of professional players applied less finger force overall (Fmean = 0.54 N. Such sensor instruments provide useful insights into player

  6. Genome-wide characterization of the SiDof gene family in foxtail millet (Setaria italica).

    Science.gov (United States)

    Zhang, Li; Liu, Baoling; Zheng, Gewen; Zhang, Aiying; Li, Runzhi

    2017-01-01

    Dof (DNA binding with one finger) proteins, which constitute a class of transcription factors found exclusively in plants, are involved in numerous physiological and biochemical reactions affecting growth and development. A genome-wide analysis of SiDof genes was performed in this study. Thirty five SiDof genes were identified and those genes were unevenly distributed across nine chromosomes in the Seteria italica genome. Protein lengths, molecular weights, and theoretical isoelectric points of SiDofs all vary greatly. Gene structure analysis demonstrated that most SiDof genes lack introns. Phylogenetic analysis of SiDof proteins and Dof proteins from Arabidopsis thaliana, rice, sorghum, and Setaria viridis revealed six major groups. Analysis of RNA-Seq data indicated that SiDof gene expression levels varied across roots, stems, leaves, and spike. In addition, expression profiling of SiDof genes in response to stress suggested that SiDof 7 and SiDof 15 are involved in drought stress signalling. Overall, this study could provide novel information on SiDofs for further investigation in foxtail millet. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  7. Viscous fingering with permeability heterogeneity

    International Nuclear Information System (INIS)

    Tan, C.; Homsy, G.M.

    1992-01-01

    Viscous fingering in miscible displacements in the presence of permeability heterogeneities is studied using two-dimensional simulations. The heterogeneities are modeled as stationary random functions of space with finite correlation scale. Both the variance and scale of the heterogeneities are varied over modest ranges. It is found that the fingered zone grows linearly in time in a fashion analogous to that found in homogeneous media by Tan and Homsy [Phys. Fluids 31, 1330 (1988)], indicating a close coupling between viscous fingering on the one hand and flow through preferentially more permeable paths on the other. The growth rate of the mixing zone increases monotonically with the variance of the heterogeneity, as expected, but shows a maximum as the correlation scale is varied. The latter is explained as a ''resonance'' between the natural scale of fingers in homogeneous media and the correlation scale

  8. Registration of a High Yielding Malt Barley Variety HB1454 for the ...

    African Journals Online (AJOL)

    else

    Bayeh and Berhane 2011). Even though Ethiopia has favorable environment and .... malting profile for HB1454 is better than Beka for kernel weight, plump kernels, hectoliter weight and grain protein. HB1454 has shown relatively low percentage.

  9. Replacement value of millet for maize on performance and ...

    African Journals Online (AJOL)

    The experiment was conducted to determine the performance characteristics and haematological indices of broiler chickens fed varying levels of millet as a replacement for maize. Three hundred and thirty day old Marshal Broiler chickens were assigned to 5 dietary treatment groups. Each treatment was replicated 3 times ...

  10. Increasing gender equality among small millet farmers in South Asia ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2016-04-29

    Apr 29, 2016 ... More than 1,600 women were involved in testing small millet varieties. ... has had a special focus on women, working to increase their role in research, ... In Kolli Hills, Tamil Nadu, monocropping of a single, non-edible variety ...

  11. Forage Potential of Photoperiod-Sensitive millet ( Pennisetum ...

    African Journals Online (AJOL)

    To determine its potential as an annual forage, 'Maiwa', which is a short-day photoperiod-sensitive millet (Pennisetum americanum (Linn.) ... Improvement in the level and seasonal distribution of 'maiwa' herbage production as well as quality can be realised through suitable agronomic practices as well as breeding.

  12. Toxicologic screening of fungi isolated from millet (pennisetum spp ...

    African Journals Online (AJOL)

    AJB SERVER

    Key words: Fungi, aflatoxin B1, mycotoxins, millet, Niger State, Nigeria. INTRODUCTION ..... above the current internationally set safe limit of 20 µg/kg or 20 ppb. .... at http:// www.unep.ch/etu/etp/events/Agriculture/nigeria/pdf. African crops ...

  13. The genetic makeup of a global barnyard millet germplasm collection

    Science.gov (United States)

    Barnyard millet (Echinochloa spp.) is an important crop for many smallholder farmers in southern and eastern Asia. It is valued for its drought tolerance, rapid maturation, and superior nutritional qualities. Despite these characteristics there are almost no genetic or genomic resources for this cro...

  14. Immobilization of starch phosphorylase from seeds of Indian millet ...

    African Journals Online (AJOL)

    SERVER

    2007-12-03

    Dec 3, 2007 ... Starch phosphorylase has been isolated from the seeds of millet (Pennisetum typhoides) variety KB560 and partially .... After storage for 5 h, it was centrifuged at 15000 x g for 20 ..... The property of reuse up to so many times.

  15. 7 CFR 457.165 - Millet crop insurance provisions.

    Science.gov (United States)

    2010-01-01

    ... costs associated with normal harvesting, handling, and marketing of the millet; except, if the value of... pounds per bushel; or (ii) Substances or conditions are present that are identified by the Food and Drug... after it has been conditioned by the cost of conditioning but not lower than the value of the production...

  16. Mechanical properties of millet husk ash bitumen stabilized soil block

    African Journals Online (AJOL)

    This study presents an investigation into the improvement of strength and durability properties of lateritic soil blocks using Millet Husk Ash (MHA) and Bitumen as additives so as to reduce its high cost and find alternative disposal method for agricultural waste. The lateritic soil samples were selected and treated with 0%, ...

  17. Mechanical Properties of Millet Husk Ash Bitumen Stabilized Soil ...

    African Journals Online (AJOL)

    Akorede

    lateritic soil blocks using Millet Husk Ash (MHA) and Bitumen as additives so as to reduce its high cost and find ... eliminating the need for air-conditioning and are warm during the cold ... The mix properties were used in producing soil bricks of ...

  18. Seedling characters at different temperatures in pearl millet ...

    African Journals Online (AJOL)

    The effect of six temperatures ranging from 20 to 45°C on the germination and seedling length of six grain pearl millet genotypes (KS, AM, HG, EC, ZZ and D) was determined. There was significant variation in germination and seedling length across temperatures and among genotypes. As a result, significant temperature ...

  19. Genetic diversity analysis of pearl millet ( Pennisetum glauccum [L ...

    African Journals Online (AJOL)

    between genotype PT 2835/1 and PT 5552 and lowest similarity index was observed between PT 5554 and PT 2835/1. Analysis of RAPD data appears to be helpful in determining the genetic relationship among 20 pearl millet genotypes. The associations among the 20 genotypes were also examined with Principle ...

  20. Reducing barriers to millet production and consumption in India ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    This project will scale up use of two small millet production innovations developed ... business development support to small- and medium-sized enterprises, training ... The project will also increase skills and knowledge at 10 small enterprises (e.g., ... au programme du sommet mondial sur le gouvernement ouvert à Mexico.

  1. Enhancement of Short Chain Fatty Acid Production from Millet Fibres ...

    African Journals Online (AJOL)

    Pharmacotherapy Group, Faculty of Pharmacy, University of Benin, Benin City, 300001 Nigeria. ... Methods: The effect of millet dietary fibre fermentation on production of short chain fatty ... fildes PYF enrichment solution was used as the .... where Pa is the peak area of SCFA, Ps is the ..... enzymatic- gravimetric method.

  2. In vitro transformation of pearl millet ( Pennisetum glaucum (L). R ...

    African Journals Online (AJOL)

    The plasmids pULGU1 and pEmuGN were introduced by biolistics in embryogenic cell suspensions of pearl millet, Pennisetum glaucum. The plasmid pULGU1 contained the mutant acetolactate synthase (ALS) gene of Arabidopsis thaliana, responsible for resistance to the chlorsulfuron herbicide. The plasmid pEmuGN ...

  3. Polytopic dystelephalangy of the fingers

    International Nuclear Information System (INIS)

    Sugiura, Y.

    1989-01-01

    An 11-year old girl with dystelephalangy (Kirner deformity) of the right middle, ring, and little, and the left index through little fingers is reported. To the author's best knowledge, such polytopic affection with dystelephalangy has not yet been reported. The parents, one of the siblings and maternal grandfather showed dystelephalangy of the little finger. So, the patient was considered to be a homozygous state of dystelephalangy gene. (orig.)

  4. Evaluation of ecophysiological characteristics of intercropping of millet (Panicum miliaceum L. and cowpea (Vigna unguiculata L.

    Directory of Open Access Journals (Sweden)

    A. Ghanbari

    2016-04-01

    Full Text Available In order to evaluate millet (Panicum miliaceum L. and cowpea (Vigna unguiculata L. intercropping, an experiment was conducted during 2008-2009 at Agriculture Research Center of Zabol University, Iran. The experiment was as randomized complete block design with three replications. Treatment s consisted of sole crop of millet, sole crop of cowpea, 25% millet + 100% cowpea, 50% millet + 50% cowpea, 75% millet + 100% cowpea and 100% millet + 100% cowpea. The results showed that intercropping treatments had significant effect (P < 1% on millet and bean seed yield, LER, dry matter of weeds, PAR, temperature and (P < 5% on soil moisture content. The highest seed yield of millet and cowpea obtained from treatments of sole crops. The LER for most intercrops was greater than one which indicated that intercropping had advantage over sole crop. For weeds management and control the results indicated that weed suppressing effects in intercropping treatments is better than sole crops treatment, so that the lowest dry matter of weeds obtained from 100% millet + 100% cowpea treatment. PAR in all of stages showed that the highest PAR interception obtained from intercropping treatments specially 100% millet + 100% cowpea treatment. In addition to the lowest of soil moisture content and temperature obtained from this treatment.

  5. Phytolith analysis for differentiating between foxtail millet (Setaria italica) and green foxtail (Setaria viridis).

    Science.gov (United States)

    Zhang, Jianping; Lu, Houyuan; Wu, Naiqin; Yang, Xiaoyan; Diao, Xianmin

    2011-05-06

    Foxtail millet (Setaria italica) is one of the oldest domesticated cereal crops in Eurasia, but identifying foxtail millets, especially in charred grains, and differentiating it from its wild ancestor, green foxtail (Setaria viridis), in the archaeobotanical remains, is still problematic. Phytolithic analysis provides a meaningful method for identifying this important crop. In this paper, the silicon structure patterns in the glumes, lemmas, and paleas from inflorescence bracts in 16 modern plants of foxtail millet and green foxtail from China and Europe are examined using light microscopy with phase-contrast and a microscopic interferometer. Our research shows that the silicon structure of ΩIII from upper lemmas and paleas in foxtail millet and green foxtail can be correspondingly divided into two groups. The size of ΩIII type phytolith of foxtail millet is bigger than that from green foxtail. Discriminant function analysis reveals that 78.4% of data on foxtail millet and 76.9% of data on green foxtail are correctly classified. This means certain morphotypes of phytoliths are relatively reliable tools for distinguishing foxtail millet from green foxtail. Our results also revealed that the husk phytolith morphologies of foxtail millets from China and Eastern Europe are markedly different from those from Western Europe. Our research gives a meaningful method of separating foxtail millet and green foxtail. The implications of these findings for understanding the history of foxtail millet domestication and cultivation in ancient civilizations are significant.

  6. Phytolith analysis for differentiating between foxtail millet (Setaria italica and green foxtail (Setaria viridis.

    Directory of Open Access Journals (Sweden)

    Jianping Zhang

    2011-05-01

    Full Text Available Foxtail millet (Setaria italica is one of the oldest domesticated cereal crops in Eurasia, but identifying foxtail millets, especially in charred grains, and differentiating it from its wild ancestor, green foxtail (Setaria viridis, in the archaeobotanical remains, is still problematic. Phytolithic analysis provides a meaningful method for identifying this important crop. In this paper, the silicon structure patterns in the glumes, lemmas, and paleas from inflorescence bracts in 16 modern plants of foxtail millet and green foxtail from China and Europe are examined using light microscopy with phase-contrast and a microscopic interferometer. Our research shows that the silicon structure of ΩIII from upper lemmas and paleas in foxtail millet and green foxtail can be correspondingly divided into two groups. The size of ΩIII type phytolith of foxtail millet is bigger than that from green foxtail. Discriminant function analysis reveals that 78.4% of data on foxtail millet and 76.9% of data on green foxtail are correctly classified. This means certain morphotypes of phytoliths are relatively reliable tools for distinguishing foxtail millet from green foxtail. Our results also revealed that the husk phytolith morphologies of foxtail millets from China and Eastern Europe are markedly different from those from Western Europe. Our research gives a meaningful method of separating foxtail millet and green foxtail. The implications of these findings for understanding the history of foxtail millet domestication and cultivation in ancient civilizations are significant.

  7. Caracterização da atividade amilásica do malte de milho (Zea mays L. = Characterization of amylase activity from maize (Zea mays L. malt

    Directory of Open Access Journals (Sweden)

    Joana Paula Menezes Biazus

    2006-01-01

    Full Text Available Este trabalho objetivou estudar o processo de germinação e a caracterização da atividade bioquímica das amilases do malte de milho (Zea mays L. para gerar uma fonte de amilase de baixo custo e boa atividade enzimática. A atividade enzimática foi monitorada todos os dias durante a germinação das sementes para se obter a melhor condição de produção do malte. Os resultados mostraram que a atividade enzimática nas sementes foi maior no 4º. dia de germinação. A caracterização bioquímica mostrou que as amilases do malte apresentam faixa ótima de pH entre 4,3 e 6, com temperaturas ótimas a 50°C e 80ºC e os valores de Km e Vmax para hidrólise do amido foram de 7,69.10-2 g/L e 7,69.102g/L.min, respectivamente.This work aimed to study the germination process and characterization of the amylolytic activity of the maize (Zea mays L. malt aiming to obtain source amylases at lower cost. Enzymatic activity was monitored all days during the seed germination, for obtaining thebest condition of malt production. Results showed that the enzymatic activity from maize seeds was larger in 4° germination day. Enzymes characterization showed that the maize malt amylases have optimal zone of pH between 4.3 and 6, with optimal temperatures of 50°C and 80ºC. The Km and Vmax values for starch hydrolysis were 7.69.10-2 g/L and 7.69.102g/L.min, respectively.

  8. Integration of tactile input across fingers in a patient with finger agnosia.

    NARCIS (Netherlands)

    Anema, H.A.; Overvliet, K.E.; Smeets, J.B.J.; Brenner, E.; Dijkerman, H.C.

    2011-01-01

    Finger agnosia has been described as an inability to explicitly individuate between the fingers, which is possibly due to fused neural representations of these fingers. Hence, are patients with finger agnosia unable to keep tactile information perceived over several fingers separate? Here, we tested

  9. Integration of gene-based markers in a pearl millet genetic map for identification of candidate genes underlying drought tolerance quantitative trait loci

    Directory of Open Access Journals (Sweden)

    Sehgal Deepmala

    2012-01-01

    Full Text Available Abstract Background Identification of genes underlying drought tolerance (DT quantitative trait loci (QTLs will facilitate understanding of molecular mechanisms of drought tolerance, and also will accelerate genetic improvement of pearl millet through marker-assisted selection. We report a map based on genes with assigned functional roles in plant adaptation to drought and other abiotic stresses and demonstrate its use in identifying candidate genes underlying a major DT-QTL. Results Seventy five single nucleotide polymorphism (SNP and conserved intron spanning primer (CISP markers were developed from available expressed sequence tags (ESTs using four genotypes, H 77/833-2, PRLT 2/89-33, ICMR 01029 and ICMR 01004, representing parents of two mapping populations. A total of 228 SNPs were obtained from 30.5 kb sequenced region resulting in a SNP frequency of 1/134 bp. The positions of major pearl millet linkage group (LG 2 DT-QTLs (reported from crosses H 77/833-2 × PRLT 2/89-33 and 841B × 863B were added to the present consensus function map which identified 18 genes, coding for PSI reaction center subunit III, PHYC, actin, alanine glyoxylate aminotransferase, uridylate kinase, acyl-CoA oxidase, dipeptidyl peptidase IV, MADS-box, serine/threonine protein kinase, ubiquitin conjugating enzyme, zinc finger C- × 8-C × 5-C × 3-H type, Hd3, acetyl CoA carboxylase, chlorophyll a/b binding protein, photolyase, protein phosphatase1 regulatory subunit SDS22 and two hypothetical proteins, co-mapping in this DT-QTL interval. Many of these candidate genes were found to have significant association with QTLs of grain yield, flowering time and leaf rolling under drought stress conditions. Conclusions We have exploited available pearl millet EST sequences to generate a mapped resource of seventy five new gene-based markers for pearl millet and demonstrated its use in identifying candidate genes underlying a major DT-QTL in this species. The reported gene

  10. Preparation of malts for production of special beers

    Directory of Open Access Journals (Sweden)

    Hana Kábelová-Ficová

    2017-01-01

    Full Text Available The article deals with production of various malts intended for manufacture of special types of beer. The malts were used to brew samples of beer with alcoholic strength ranging between 8 - 12% EPM. The above range of original wort content was chosen due to its suitability for sensory evaluation and properties; in stronger types of beer, (more than 12% EPM, nature of the beverage can be drown by mashy flavour. In the experimental samples, the actual residual extract oscillated between 4.0 - 6.5%. The content of ethanol corresponded to the degree of fermentation and thereby also to the residual actual extract in balance equilibrium specifying that higher residual extract corresponds to lower content of alcohol by volume. It ranged between 2.5 - 5.0%. The sample 1 contained the highest amount of ethanol by mass (3.9% and the sample 13 showed the lowest one (1.9%; alike trend of ethanol content by volume was revealed (5 and 2.44%, respectively. The highest content of actual and apparent extract was found in the sample 2 (6.6 and 5.2%, respectively; the sample 13 showed the lowest levels (4.0 and 3.1%, respectively. The original wort extract content averaged 9.9% in most of the samples; the sample 1 showed distinctly higher value (12.6% and, on the contrary, the sample 13 demonstrated the lowest one (7.4%. The highest relative density was revealed in the sample 2 (1.02% and the lowest one in the sample 13 (1.01%. Considering differences in osmotic pressure, the sample 1 exhibited the highest value (1045 mOs and the sample 13 the lowest one (551 mOs. The highest level of fermentation was found in the sample 19 (61.7%, the lowest one was proved in the sample 19 (44.0%. Sensory analysis corresponded to originality and characteristics of each sample. The sample of beer made from spring barley was evaluated to be the best one.

  11. Response of Pearl Millet to nitrogen as affected by water deficit

    OpenAIRE

    Diouf , O.; Brou , Yao Télesphore; Diouf , M.; Sarr , B.; Eyletters , M.; Roy-Macauley , H.; Delhaye , J.

    2004-01-01

    International audience; In the Sahelian zone, low soil N could be as limiting as drought in pearl millet production. Although growth and crop productivity depend on several biochemical reactions in which the nitrogen metabolism plays a great role, there is little information available on how N uptake and key enzymes, nitrate reductase and glutamine synthetase, are affected by nitrogen and water interaction in millet. For this purpose, the millet variety cv. Souna III was grown in the field du...

  12. Redox-dependent interaction between thaumatin-like protein and β-glucan influences malting quality of barley.

    Science.gov (United States)

    Singh, Surinder; Tripathi, Rajiv K; Lemaux, Peggy G; Buchanan, Bob B; Singh, Jaswinder

    2017-07-18

    Barley is the cornerstone of the malting and brewing industry. It is known that 250 quantitative trait loci (QTLs) of the grain are associated with 19 malting-quality phenotypes. However, only a few of the contributing genetic components have been identified. One of these, on chromosome 4H, contains a major malting QTL, QTL2, located near the telomeric region that accounts, respectively, for 28.9% and 37.6% of the variation in the β-glucan and extract fractions of malt. In the current study, we dissected the QTL2 region using an expression- and microsynteny-based approach. From a set of 22 expressed sequence tags expressed in seeds at the malting stage, we identified a candidate gene, TLP8 ( thaumatin-like protein 8 ), which was differentially expressed and influenced malting quality. Transcript abundance and protein profiles of TLP8 were studied in different malt and feed varieties using quantitative PCR, immunoblotting, and enzyme-linked immunosorbent assay (ELISA). The experiments demonstrated that TLP8 binds to insoluble (1, 3, 1, 4)-β-D glucan in grain extracts, thereby facilitating the removal of this undesirable polysaccharide during malting. Further, the binding of TLP8 to β-glucan was dependent on redox. These findings represent a stride forward in our understanding of the malting process and provide a foundation for future improvements in the final beer-making process.

  13. Effect of malt milling for wort extract content

    Directory of Open Access Journals (Sweden)

    Gábor Géczi

    2014-02-01

    Full Text Available Beer manufacturing is one of the most ancient procedures of food manufacturing. The four (in many cases much more ingredients, the great numbers of technological steps and variations of technological parameters (temperature, time, pressure etc. have a major influence on both type and quality of the final product. As a result of this, studying beer brewing may offer a great deal of possibilities for numerous researches, scientific examinations, and can provide useful informations for the manufacturing companies as well. At the „Slovak University of Agriculture in Nitra" we examined an entire beer brewing process in October 2013, utilising the Ahlborn sensors, which were integrated in the instruments. Simultaneously, in Gödöllő at the Szent István University, we analysed the effect of malt milling on extract yield and the filterability of wort. We used the brewing parameters (temperature, time, volume ratios, which were experienced in the microbrewery and published in professional literature. Our results verify the conclusions drawn in the professional literature, however they point out the importance of grinding. Results performed on the yields with different grain-constitution might directly be utilised for the specialists of recently in Slovakia and Hungary spreading small-scale, handicraft, and homemade beer brewing.

  14. MALT90 Kinematic Distances to Dense Molecular Clumps

    Energy Technology Data Exchange (ETDEWEB)

    Whitaker, J. Scott [Physics Department, Boston University, 590 Commonwealth Avenue, Boston, MA 02215 (United States); Jackson, James M.; Sanhueza, Patricio; Stephens, Ian W. [Institute for Astrophysical Research, Boston University, Boston, MA 02215 (United States); Rathborne, J. M. [CSIRO Astronomy and Space Science, P.O. Box 76, Epping NSW 1710 (Australia); Foster, J. B. [Department of Astronomy, Yale University, P.O. Box 28101, New Haven, CT 06520-8101 (United States); Contreras, Y. [Leiden Observatory, Leiden University, P.O. Box 9513, 2300 RA Leiden (Netherlands); Longmore, S. N., E-mail: scott@bu.edu [Astrophysics Research Institute, Liverpool John Moores University, Egerton Wharf, Birkenhead CH41 1LD (United Kingdom)

    2017-10-01

    Using molecular-line data from the Millimetre Astronomy Legacy Team 90 GHz Survey (MALT90), we have estimated kinematic distances to 1905 molecular clumps identified in the ATLASGAL 870 μ m continuum survey over the longitude range 295° <  l  < 350°. The clump velocities were determined using a flux-weighted average of the velocities obtained from Gaussian fits to the HCO{sup +}, HNC, and N{sub 2}H{sup +} (1–0) transitions. The near/far kinematic distance ambiguity was addressed by searching for the presence or absence of absorption or self-absorption features in 21 cm atomic hydrogen spectra from the Southern Galactic Plane Survey. Our algorithm provides an estimation of the reliability of the ambiguity resolution. The Galactic distribution of the clumps indicates positions where the clumps are bunched together, and these locations probably trace the locations of spiral arms. Several clumps fall at the predicted location of the far side of the Scutum–Centaurus arm. Moreover, a number of clumps with positive radial velocities are unambiguously located on the far side of the Milky Way at galactocentric radii beyond the solar circle. The measurement of these kinematic distances, in combination with continuum or molecular-line data, now enables the determination of fundamental parameters such as mass, size, and luminosity for each clump.

  15. Dynamic viscosity study of barley malt and chicory concentrates

    Directory of Open Access Journals (Sweden)

    G. O. Magomedov

    2016-01-01

    Full Text Available The purpose of research is to find optimal conditions for dispersing and subsequent dehydration of liquid food environments in the nozzle spray drying chamber through the study of dynamic changes in viscosity according to temperature, velocities gradients and dry residue content. The objects of study were roasted chicory and malt barley concentrates with dry residue content of 20, 40, 60 and 80%. Research of dynamic viscosity were carried out at the measuring complex based on the rotational viscometer Rheotest II, analog-to-digital converter, module Laurent and a personal computer with a unique software that allows to record in real time (not only on a tape recorder, but also in the form of graphic files the behavior of the viscosity characteristics of concentrates. Registration of changes of dynamic viscosity was carried out at a shear rate gradient from 1,0 с -1 to 27,0 с -1 and the products temperature thermostating : 35, 55, 75˚ C. The research results are presented in the form of graphic dependences of effective viscosity on shear rate and flow curves (dependencies of shear stresses on the velocity gradient, which defined flow regimes, the optimal modes of dispersion concentrates into spray dryer chambers in obtaining of powdered semi-finished products and instanting were found: dry residue content - 40 %, concentrate temperature - 75 ˚C, velocity gradient in the air channel of the nozzle at least 20 c-1

  16. Use of MVR in a malt whisky distillery

    Energy Technology Data Exchange (ETDEWEB)

    Kerr, S.H. [Howden Compressors Ltd. (United Kingdom); Hodgett, D.L. [EA Technology Ltd. (United Kingdom)

    1992-12-31

    A steam heat pump was installed in the Auchroisk malt whiskey distillery of International Distillers and Vintners Ltd. as a result of a four year research and development program. Distillation accounts for 67 million CJ of energy use per annum in the UK, much of which is provided by steam and most of which is ejected into the environment by cooling towers. A closed cycle heat pump with water/steam as the working fluid which uses heat exchangers designed to give low approach temperatures can have a high coefficient of performance (COP) which would ensure a large energy saving and a good economic return. The installation has shown that a heat pump can produce large energy savings in distillation. In this instance, the heat pump has achieved over 90 % of its design performance and operated continuously. The use of steam as a working fluid was shown to have advantages over other fluids, mostly in the area of integration with the existing steam services. 3 refs., 9 figs.

  17. Treatment of low-grade gastric malt lymphoma using Helicobacter pylori eradication

    Directory of Open Access Journals (Sweden)

    Grgov Saša

    2015-01-01

    Full Text Available Background/Aim. Lymphoma of mucosa-associated lymphoid tissue (MALT lymphoma of the stomach usually occurs as a consequence of Helicobacter pylori (H. pylori infection. The aim of this study was to investigate the long-term effect of treatment of low-grade gastric MALT lymphoma with the H. pylori eradication method. Methods. In the period 2002-2012 in 20 patients with dyspepsia, mean age 55.1 years, the endoscopic and histologic diagnosis of gastric MALT lymphoma in the early stages were made. Histological preparations of endoscopic biopsy specimens were stained with hematoxyllineosin (HE, histochemical and immunohistochemical methods. Results. Endoscopic findings of gastritis were documented in 25% of the patients, and 75% of the patients had hypertrophic folds, severe mucosal hyperemia, fragility, nodularity, exulcerations and rigidity. Histopathologically, pathognomonic diagnostic criterion were infiltration and destruction of glandular epithelium with neoplastic lymphoid cells, the so-called lymphoepithelial lesions. In all 20 patients H. pylori was verified by rapid urease test and Giemsa stain. After the triple eradication therapy complete remission of MALT lymphoma was achieved in 85% of the patients, with no recurrence of lymphoma and H. pylori infection in the average follow-up period of 48 months. In 3 (15% of the patients, there was no remission of MALT lymphoma 12 months after the eradication therapy. Of these 3 patients 2 had progression of MALT lymphoma to diffuse large-cell lymphoma. Conclusion. Durable complete re-mission of low-grade gastric MALT lymphoma is achieved in a high percentage after eradication of H. pylori infection, thus preventing the formation of diffuse large-cell lymphoma and gastric adenocarcinoma.

  18. Diagnostic role of 18F-FDG PET in gastric MALT lymphoma

    International Nuclear Information System (INIS)

    Ambrosini, V.; Castellucci, P.; Nanni, C.; Farsad, M.; Fanti, S.; Rubello, D.; Zinzani, P.; Alavi, A.; Tehranipour, N.; Al-Nahhas, A.

    2006-01-01

    The aim of the study was to evaluate the usefulness of 18 F-FDG-PET in patients with gastric lymphoma, in particular those affected by mucosa-associated lymphoid tissue (MALT) type and aggressive gastric non-Hodgkin's lymphoma (NHL). The study group consists of 15 patients with a previous diagnosis of gastric NHL referred to our PET centres in Bologna Hospital and Rovigo Hospital, Italy, in the period 2003-2004. In 9/15 patients the subsequent histological evaluation was consistent with a gastric MALT lymphoma, while aggressive gastric NHL was diagnosed in the other 6/15. PET scan was carried out in patients with known active disease in order to stage or re-stage disease prior to treatment or in patients in complete clinical remission to monitor disease during follow up. Patients were considered in complete clinical remission if free from disease for at least 8 months after chemotherapy or surgery. 18 F-FDG PET was performed following standard procedures. 18 F-FDG-PET was true positive in all cases of gastric MALT and non-MALT aggressive NHL with known active disease, while no pathological 18 F-FDG uptake was evident in the subjects who were in complete clinical remission. The degree of 18 F-FDG uptake (mean SUVmax values) in MALT lymphoma was much less intense in comparison to aggressive gastric NHL, suggesting a prognostic role of SUV calculation in gastric lymphomas. Our data demonstrate the significant accuracy of 18 F-FDG-PET in detecting active disease in gastric lymphoma of both MALT and non-MALT NHL type. A higher SUV value appears to be related to a more aggressive disease. (author)

  19. Mesofluidic controlled robotic or prosthetic finger

    Science.gov (United States)

    Lind, Randall F; Jansen, John F; Love, Lonnie J

    2013-11-19

    A mesofluidic powered robotic and/or prosthetic finger joint includes a first finger section having at least one mesofluidic actuator in fluid communication with a first actuator, a second mesofluidic actuator in fluid communication with a second actuator and a second prosthetic finger section pivotally connected to the first finger section by a joint pivot, wherein the first actuator pivotally cooperates with the second finger to provide a first mechanical advantage relative to the joint point and wherein the second actuator pivotally cooperates with the second finger section to provide a second mechanical advantage relative to the joint point.

  20. Histopathological Assessment and Immunohistochemical Study of Nasopharyngeal Low Grade MALT Lymphoma

    International Nuclear Information System (INIS)

    El-Hawary, A.K.

    2006-01-01

    Introduction: MALT lymphoma arises in a variety of body tissues, but most often in the stomach. Though relatively rare, these MALT lymphomas may arise within several sites in the head and neck, and often present diagnostic and therapeutic challenges. Immunohistochemical analysis are helpful in confirming the diagnosis between the MALT-lymphoma and the reactive lymphoid hyperplasia. MALT-type lymphoma demonstrated characteristic negative staining for CD3, CD5 and CD43, positive staining for CD20, and monotypic staining for either kappa or lambda light chain immunoglobulin markers, whereas reactive lymphoid hyperplasia all expressed Band T cell markers. Material and Methods: 41 cases of nasopharyngeal masses were obtained from the files at pathology department, Mansoura Faculty of Medicine through the period from 2002 till 2006. 31 cases were corresponded histomorphologically to low-grade B-cell lymphoma of mucosa associated lymphoid tissue (MALT) type and 10 patients with reactive lymphoid hyperplasia of the adenoid. Hematoxylin-eosin-stained slides were reviewed to confirm the diagnosis. Immunohistochemical studies were performed on formalin-fixed, paraffin-embedded sections using the labeled streptavidin-biotin-peroxidase complex method with DAB as chromogen. The following antibodies were evaluated CD20, CD3, Kappa, lambda and cytokeratin antibodies. Results: All cases of low grade MALT lymphoma show Iymphoepitheliallesion and proliferation of centrocyte like cells. 14 cases (45.1 %) show subepithelial plasma cells. Dutcher bodies were demonstrated in 10 cases (32.2%). Monocytoid B-cells were seen in 12 cases (38.7%). Six (60%) out of the ten cases of adenoids show transmigrating lymphocyte without formation of lymphoepithelial lesion. All cases with MALT-type lymphoma expressed CD20 and not CD3 whereas 10 cases of adenoid, all expressed Band T cell markers. Immunohistochemical staining showed that 31 cases of low grade MALT lymphoma were positive for immunoglobin

  1. Genetic structure of landraces in foxtail millet (Setaria italica (L.) P. Beauv.) revealed with transposon display and interpretation to crop evolution of foxtail millet.

    Science.gov (United States)

    Hirano, Ryoko; Naito, Ken; Fukunaga, Kenji; Watanabe, Kazuo N; Ohsawa, Ryo; Kawase, Makoto

    2011-06-01

    Although the origin and domestication process of foxtail millet (Setaria italica subsp. italica (L.) P. Beauv.) has been studied by several groups, the issue is still ambiguous. It is essential to resolve this issue by studying a large number of accessions with sufficient markers covering the entire genome. Genetic structures were analyzed by transposon display (TD) using 425 accessions of foxtail millet and 12 of the wild ancestor green foxtail (Setaria italica subsp. viridis (L.) P. Beauv.). We used three recently active transposons (TSI-1, TSI-7, and TSI-10) as genome-wide markers and succeeded in demonstrating geographical structures of the foxtail millet. A neighbor-joining dendrogram based on TD grouped the foxtail millet accessions into eight major clusters, each of which consisted of accessions collected from adjacent geographical areas. Eleven out of 12 green foxtail accessions were grouped separately from the clusters of foxtail millet. These results indicated strong regional differentiations and a long history of cultivation in each region. Furthermore, we discuss the relationship between foxtail millet and green foxtail and suggest a monophyletic origin of foxtail millet domestication.

  2. Harnessing sorghum and millet biotechnology for food and health

    CSIR Research Space (South Africa)

    O'Kennedy, MM

    2006-11-01

    Full Text Available , the causal agent of rust disease, and the oomycete S. graminicola, causal agent of downy mildew, resulted in a significant reduction of disease symptoms in comparison to wild type control plants. The disease resistance of pearl millet was increased by up... of a wound-inducible promoter from a maize protease inhibitor gene (mpi) were produced via particle bombardment of shoot apices (Girijashankar et al., 2005). Although reductions in leaf damage (60%), larval mortality (40%) and larval weight (36...

  3. FERMENTATION ACTIVITY OF LACTOSE-FERMENTATION YEAST IN WHEY-MALT WORT

    Directory of Open Access Journals (Sweden)

    E. V. Greek

    2013-04-01

    Full Text Available The main parameters of fermentation of whey-malt wort with the use of different strains of lactose-fermentation yeast was investigated experimentally. According to the findings of investigation of fermentive activity for different types of lactose-fermentation microorganisms in whey-malt wort it was found that the most active spirituous fermentation for all parameters was in wort fermented by microorganisms Zygosaccharomyces lactis 868-K and Saccharomyces lactis 95. High capacity for utilization of malt carbohydrates represented by easily metabolized carbohydrates of malt extract was determined. Also organoleptic analysis of fermented whey drinks derived from the renewed mixtures of dry whey and fermented malt and yeast Zygosaccharomyces lactis 868-K and Saccharomyces lactis 95 was carried out. It was found that the drink fermented with yeast Zygosaccharomyces lactis 868-K had intense refreshing flavor of rye bread with fruit tones. Intensity growth of aromatization for complex of sample with microorganisms Saccharomyces lactis 95, indicating high organoleptic indexes of the drink was observed.

  4. Helicobacter pylori-Negative Primary Rectal MALT Lymphoma: Complete Remission after Radiotherapy

    Directory of Open Access Journals (Sweden)

    Takuma Okamura

    2012-05-01

    Full Text Available Rectal mucosa-associated lymphoid tissue (MALT lymphoma is a rare condition. Although the majority of patients undergo surgical resection, a definitive treatment for rectal MALT lymphoma has not yet been established. In the present study, we report the outcome of radiotherapy in 3 patients with rectal MALT lymphoma. Our cohort ranged from 56 to 65 years of age. The male/female ratio was 1:2, and all patients were in stage I (Lugano classification of the disease. Endoscopic findings revealed elevated lesions resembling submucosal tumors in 2 patients, and a sessile elevated lesion with a nodular surface in 1 patient. One of the 3 patients underwent magnifying endoscopy with crystal violet staining that demonstrated a type I pit pattern (Kudo’s classification lesion with a broad intervening area caused by the upthrust of the tumor from the submucosa. All patients tolerated radiotherapy at doses of 30 Gy without major complications and achieved complete remission. Follow-up ranged from 13 to 75 months (mean 51.0 months, revealing no recurrence of MALT lymphoma. As such, we propose radiotherapy to be a safe and effective means for treating rectal MALT lymphoma.

  5. Mucosa associated lymphoid tissue (MALT lymphoma) of the urinary bladder: a case report

    International Nuclear Information System (INIS)

    Tsang, T.; Masters, J.; Chan, K.; Jose, C.

    2003-01-01

    Full text: Mucosa associated lymphoid tissue (MALT lymphoma) of the urinary bladder is a rare condition. The best treatment approach for this disease is controversial. A case report on a patient with MALT lymphoma of the urinary bladder. The relevant current literature was reviewed. A 79 year old lady presented with haematuria in 2002. Ultrasound of the pelvis showed a large tumour in the bladder. Cystoscopy revealed a mass arising from the bladder. Transurethral resection of the tumour was performed. Histology showed Non Hodgkin's lymphoma of MALT type. CT showed a 8.9 X 7.6 cm solid tumour involving almost whole of the bladder. The patient could not tolerate anti helicobacter treatment and was then treated with radiotherapy. The pelvis was treated with 18 MV photons with a 3 field technique in 2 phases, with CT planning. In phase 1, the pelvis was treated to 24 Gy in 12 fractions, over 2.5 weeks. Phase 2 was treated to a reduced pelvic field, to a dose of 16 Gy in 8 fractions over 1.5 weeks. Five months after radiotherapy, repeat cystoscopy and biopsy of bladder base showed no evidence of malignancy. MALT lymphoma of the urinary bladder responds well to radiotherapy and permits bladder preservation. The current literature in management of MALT lymphoma of urinary bladder is reviewed

  6. Recruiting a representative sample in adherence research-The MALT multisite prospective cohort study experience.

    Science.gov (United States)

    Shemesh, Eyal; Mitchell, Jeffrey; Neighbors, Katie; Feist, Susan; Hawkins, Andre; Brown, Amanda; Wanrong, Yin; Anand, Ravinder; Stuber, Margaret L; Annunziato, Rachel A

    2017-12-01

    Medication adherence is an important determinant of transplant outcomes. Attempts to investigate adherence are frequently undermined by selection bias: It is very hard to recruit and retain non-adherent patients in research efforts. This manuscript presents recruitment strategies and results from the MALT (Medication Adherence in children who had a Liver Transplant) multisite prospective cohort study. MALT sites recruited 400 pediatric liver transplant patients who agreed to be followed for 2 years. The primary purpose was to determine whether a marker of adherence, the Medication Level Variability Index (MLVI), predicts rejection outcomes. The present manuscript describes methods used in MALT to ensure that a representative sample was recruited, and presents detailed recruitment results. MALT sites were able to recruit a nationally representative sample, as determined by a comparison between the MALT cohort and a national sample of transplant recipients. Strategies that helped ensure that the sample was representative included monitoring of the outcome measure in comparison with a national sample, drastically limiting patient burden, and specific recruitment methods. We discuss the importance of a representative sample in adherence research and recommend that future efforts to study adherence pay special attention to sample characteristics. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. EMG finger movement classification based on ANFIS

    Science.gov (United States)

    Caesarendra, W.; Tjahjowidodo, T.; Nico, Y.; Wahyudati, S.; Nurhasanah, L.

    2018-04-01

    An increase number of people suffering from stroke has impact to the rapid development of finger hand exoskeleton to enable an automatic physical therapy. Prior to the development of finger exoskeleton, a research topic yet important i.e. machine learning of finger gestures classification is conducted. This paper presents a study on EMG signal classification of 5 finger gestures as a preliminary study toward the finger exoskeleton design and development in Indonesia. The EMG signals of 5 finger gestures were acquired using Myo EMG sensor. The EMG signal features were extracted and reduced using PCA. The ANFIS based learning is used to classify reduced features of 5 finger gestures. The result shows that the classification of finger gestures is less than the classification of 7 hand gestures.

  8. X-Ray Exam: Finger

    Science.gov (United States)

    ... Staying Safe Videos for Educators Search English Español X-Ray Exam: Finger KidsHealth / For Parents / X-Ray Exam: ... Muscles, and Joints Broken Bones Getting an X-ray (Video) X-Ray (Video) View more Partner Message About Us ...

  9. Heredity, physiology and malt quality analysis of albino-lemma barley

    International Nuclear Information System (INIS)

    Jin Ting; Wu Kuanran; Yang Jianming; Jia Qiaojun; Wang Junmei; Hua Wei; Chen He; Qiao Hailong

    2013-01-01

    The barley 0601 is a spontaneous albino-lemma mutant from beer barley cultivar Supi3. Genetic control of albino-lemma trait in the mutant 0601 and, the agronomic traits (thousand kernel weight, kernel plumpness), physiological traits (chlorophyll content, proanthocyanidin content) and major malt qualities (diastatic power, malt extract, Kolbach index) were investigated. The results showed that the albino-lemma trait is controlled by one recessive gene, and there were significant differences between the mutant and its wild-type in thousand kernel weight, kernel plumpness, chlorophyll content, diastatic power, and the malt extract, whereas no significant difference in proanthocyanidin content was found. These results provide the basis on mapping and cloning the albino-lemma gene and also provide good material for genetic research. (authors)

  10. 75 FR 81949 - Disclosure of Cochineal Extract and Carmine in the Labeling of Wines, Distilled Spirits, and Malt...

    Science.gov (United States)

    2010-12-29

    ... Extract and Carmine in the Labeling of Wines, Distilled Spirits, and Malt Beverages; Comment Period... Extract and Carmine in the Labeling of Wines, Distilled Spirits, and Malt Beverages, a notice of proposed... attorney Lynne J. Omlie on behalf of the Distilled Spirits Council of the United States, Inc. (DISCUS), a...

  11. Transcriptome analysis of a breeding program pedigree examines gene expression diversity and reveals target genes for malting quality improvement

    Science.gov (United States)

    Advanced cycle breeding utilizes crosses among elite lines and is a successful method to develop new inbreds. However, it results in a reduction in genetic diversity within the breeding population. The development of malting barley varieties requires the adherence to a narrow malting quality profile...

  12. Consecutive regression of MALT lymphomas coexisting in the pharyngeal and gastric tissue after the eradication of Helicobacter pylori

    Directory of Open Access Journals (Sweden)

    Giuseppe Ivan Potente

    2012-09-01

    Full Text Available The stomach is one of the most common organs in which mucosa-associated lymphoid tissue (MALT lymphoma develops. It is well established that Helicobacter pylori (Hp infection plays a major role in the development of gastric MALT lymphoma and that the presence of Hp in the gastric mucosa is connected with mucosa-associated lymphatic tissue (MALT.The same tissue is located in the oral cavity and pharynx in Waldayer’s circuit. Recently, the oral cavity was proposed as an extragastric reservoir of Hp infection. We report the case of a 79-year-old female patient with concomitant pharyngeal (MALT lymphoma and Hp-related gastric MALT lymphoma. Gastric MALT lymphoma was detected both through endoscopic examination as well as in biopsies. Pharyngeal MALT lymphoma was also detected in biopsies. Hp has been recognized in the gastric mucosa by positive serum H. pylori antibody and urease tests. Treatment of the Hp infection in our patient using antibiotics led to the regression of both lesions. This is the first case report on the regression of a pharyngeal MALT lymphoma after Hp eradication.

  13. 40 CFR 180.522 - Fumigants for processed grains used in production of fermented malt beverage; tolerances for...

    Science.gov (United States)

    2010-07-01

    ... production of fermented malt beverage; tolerances for residues. 180.522 Section 180.522 Protection of... PESTICIDE CHEMICAL RESIDUES IN FOOD Specific Tolerances § 180.522 Fumigants for processed grains used in production of fermented malt beverage; tolerances for residues. (a) General. Fumigants for processed grain...

  14. Millet manuring as a driving force for the Late Neolithic agricultural expansion of north China

    DEFF Research Database (Denmark)

    Wang, Xin; Fuller, Benjamin T.; Zhang, Phengcheng

    2018-01-01

    in Chinese archaeology. Here we present an isotopic dataset for archaeological foxtail millet (Setaria italica) and common millet (Panicum miliaceum) grains as well as associated faunal remains (both domesticated and wild) from seven sites in the Baishui Valley of north China, in order to find direct...

  15. An appraisal of irrigated temperate and tropical millet varieties in the ...

    African Journals Online (AJOL)

    Pearl millet (Pennisetum glaucum (L). R. Br.) constitutes a major food crop in the semiarid region of West Africa but yields are extremely low in subsistence cropping systems because of inappropriate management and scarcity of water. This study was designed to see if pearl millet could become a component of crop rotation ...

  16. HELICOBACTER PYLORI AND t(11;18(q21;q21 TRANSLOCATION IN GASTRIC MALT LYMPHOMA

    Directory of Open Access Journals (Sweden)

    Karine Sampaio LIMA

    2014-04-01

    Full Text Available Context Gastric mucosa-associated lymphoid tissue (MALT lymphoma is clearly associated with Helicobacter pylori gastritis and can be cured with anti- H pylori therapy alone. The presence of t(11;18(q21;q21 translocation is thought to predict a lower response rate to anti- H pylori treatment. Objectives To study the presence of t(11;18(q21;q21 genetic translocation and its clinical impact in low-grade gastric MALT lymphoma Brazilian patients. Methods A consecutive series of eight patients with gastric MALT lymphoma were submitted to gastroscopy, endoscopic ultrasound, histopathological examination, H pylori search and RT-PCR-based methodology. All patients received anti-H pylori treatment. Eradicated patients were followed-up every 3-6 months for 2 years. Results Eight patients were studied. All patients had tumor involvement restricted to the mucosa or submucosa and seven patients had low-grade gastric MALT lymphoma. All infected patients achieved H pylori eradication. Histological tumor regression was observed in 5/7 (71% of the low-grade gastric MALT lymphoma patients. The presence of t(11;18(q21;q21 translocation was found in 4 (57% of these patients; among them only two had histological tumor regression following H pylori eradication. Conclusions RT-PCR is a feasible and efficient method to detect t(11;18(q21;q21 translocation, being carried out in routine molecular biology laboratories. The early detection of such translocation can be very helpful for better targeting the therapy to be applied to gastric MALT lymphoma patients.

  17. Impact of the Soak and the Malt on the Physicochemical Properties of the Sorghum Starches

    Directory of Open Access Journals (Sweden)

    Huiming Zhou

    2010-08-01

    Full Text Available Starches were isolated from soaked and malted sorghum and studied to understand their physicochemical and functional properties. The swelling power (SP and the water solubility index (WSI of both starches were nearly similar at temperatures below 50 °C, but at more than 50 °C, the starch isolated from malted sorghum showed lower SP and high WSI than those isolated from raw and soaked sorghum. The pasting properties of starches determined by rapid visco-analyzer (RVA showed that malted sorghum starch had a lower viscosity peak value (86 BU/RVU than raw sorghum starch (454 BU/RVU. For both sorghum, X-ray diffractograms exhibited an A-type diffraction pattern, typical of cereal starches and the relative degrees of crystallinity ranged from 9.62 to 15.50%. Differential scanning calorimetry (DSC revealed that raw sorghum starch showed an endotherm with a peak temperature (Tp at 78.06 °C and gelatinization enthalpies of 2.83 J/g whereas five-day malted sorghum starch had a Tp at 47.22 °C and gelatinization enthalpies of 2.06 J/g. Storage modulus (G′ and loss modulus (G″ of all starch suspensions increased steeply to a maximum at 70 °C and then decreased with continuous heating. The structural analysis of malted sorghum starch showed porosity on the granule’s surface susceptible to the amylolysis. The results showed that physicochemical and functional properties of sorghum starches are influenced by soaking and malting methods.

  18. Features of obtaining malt with use of aqueous solutions of organic acids

    Directory of Open Access Journals (Sweden)

    O. Pivovarov

    2017-12-01

    Full Text Available Recently, the traditional formulations of essential food products are actively including malt – a valuable dietary product rich in extractives and hydrolytic enzymes, obtained by germination in artificially created conditions. Containing a full set of essential amino acids and a high saccharifying ability of malt, obtained from grain cereals, determines its wide use in the production of beer, alcohol, mono- and poly-malt extracts, bakery products, special types of flour, food additives, cereals, non-alcoholic beverages, lactic acid products and, in particular, in the production of natural coffee substitutes. However, the classical germination technology, which includes 2-3 days of soaking and 5-8 days of germination due to the considerable duration and laboriousness of the process, does not meet the requirements of modern technology and the constantly growing rates of industrial production, so this problem requires finding new and improving existing scientific and technical solutions. The features of malt production using organic acids of different concentrations are presented. The malt production technology has been analyzed and investigated. It includes washing, disinfection, air and water soaking of grains, germination and drying. The feature of the technology under investigation is using of aqueous solutions of butadiene, 3-pyridinecarboxylic acid and pteroylglutamic acid. The results of the inquiry of the effect of these organic acids on energy and the ability of germination of the grain are presented. The optimal values of concentrations of active substances in solutions are revealed. The influence of organic acids on the absorption of grain moisture has been investigated. It has been established that in comparison with the classical technology, the use of these acids as a growth stimulator can reduce the overall length of the reproduction process of the material from 1.5 to 2 times and increase the yield of flour grains in the batch of

  19. MALT lymphoma and concurrent adenocarcinoma of the prostate: a rare case report and review of the literature.

    Directory of Open Access Journals (Sweden)

    Jung Julie Kang

    2010-07-01

    Full Text Available Primary MALT lymphoma of the prostate is a rare disease which characteristically follows an indolent course. It is believed that infection or chronic inflammation may be triggers for malignant transformation in the prostate, but it is of unknown etiology. Reports of MALT lymphomas of the prostate with other concurrent primary prostate cancers are even more limited. We present the unique case of a 67 year old male with concurrent adenocarcinoma of the prostate and primary MALT lymphoma of the prostate. The patient was treated with standard therapy for prostate adenocarcinoma, which also sufficiently would treat a primary MALT lymphoma. He has been disease-free for over one year for both his primary malignancies. This case confirms that MALT lymphoma can arise concurrently with adenocarcinoma of the prostate.

  20. Profile of the alcohols produced in fermentations with malt contaminated with trichothecenes

    Directory of Open Access Journals (Sweden)

    Reinehr Christian Oliveira

    2003-01-01

    Full Text Available In order to study the influence of mycotoxins on the production of alcohols, a fermentative process on a laboratorial scale was simulated. Malt was contaminated with deoxynivalenol and T-2 in different ratios (up to 500 ppb, according to a 3² factorial design, and the alcohols obtained after the fermentation were determined through gas chromatography. The results showed that trichothecenes influenced the profile of the alcohols produced by Saccharomyces cerevisiae during the fermentative process of malt, especially the profile of methyl and isoamyl alcohols.

  1. Occurrence of Viruses Infecting Foxtail Millet (Setaria italica in South Korea

    Directory of Open Access Journals (Sweden)

    Chung Youl Park

    2017-03-01

    Full Text Available In 2015, a nationwide survey was carried out to investigate about occurrence pattern of virus infecting foxtail millet. A total 100 foxtail millet leaf samples showing virus-like and abnormal symptoms were collected in the seven main cultivated regions of Korea. Four viruses were identified using reverse transcription polymerase chain reaction and RNA sequencing. Of the collected 100 foxtail millet samples, 10 were Barley virus G (BVG, 4 were Rice stripe virus (RSV, 1 was Northern cereal mosaic virus (NCMV, and 1 was Sugarcane yellow leaf virus (ScYLV infection. To our best knowledge, this is the first report of BVG and NCMV infecting foxtail millet in Korea and ScYLV is expected as new Polerovirus species. This research will be useful in breeding for improved disease-resistant foxtail millet cultivars.

  2. [When doors slam, fingers jam!].

    Science.gov (United States)

    Claudet, I; Toubal, K; Carnet, C; Rekhroukh, H; Zelmat, B; Debuisson, C; Cahuzac, J-P

    2007-08-01

    Epidemiological analysis in a universitary paediatric emergency unit of children admitted after accidental injuries resulting from fingers crushed in a door. Prospective, descriptive cohort study from September 6th, 2004 to July 1st, 2005 included all children admitted for finger injuries crushed in a non-automatic door. included accidents due to automatic doors, toy's or refrigerator doors, families who refused to participate to the study or families who had left the waiting area before medical examination. Collected data were patient and family characteristics, accident characteristics and its management. Three hundred and forty children affected by 427 digital lesions were included. The mean age was 5.5+/-3.8 years (range 4 months - 15.5 years). Male/female ratio was equal to 1.2: 1. Fifty-eight percent of patients belonged to families composed of 3 or more siblings. Ninety-three per cent of families came to hospital within the first 2 hours after the accident (mean delay 99+/-162 min, median range 54 minutes). Location of the accident was: domestic (62%, at home (64%)), at school (17%). Locations within the home were: the bedroom (33%), bathroom and toilets (21%). An adult was present in 75% of cases and responsible for the trauma in 25% of accidents, another child in 44%. The finger or fingers were trapped on the hinge side in 57% of patients. No specific safeguard devices were used by 94% of families. Among victims, 20% had several crushed digits; left and right hand were injured with an equal frequency. The commonest involved digits were: the middle finger (29%), the ring finger (23%). The nail plate was damaged in 60% of digital lesions, associated with a wound (50%), a distal phalanx fracture (P3) (12%). Six children had a partial or complete amputation of P3, 2 children a lesion of the extensor tendon, 1 child had a rupture of the external lateral ligament. Three percent of children required an admission to the paediatric orthopaedic surgery unit. Post

  3. Impact of Finger Type in Fingerprint Authentication

    Science.gov (United States)

    Gafurov, Davrondzhon; Bours, Patrick; Yang, Bian; Busch, Christoph

    Nowadays fingerprint verification system is the most widespread and accepted biometric technology that explores various features of the human fingers for this purpose. In general, every normal person has 10 fingers with different size. Although it is claimed that recognition performance with little fingers can be less accurate compared to other finger types, to our best knowledge, this has not been investigated yet. This paper presents our study on the topic of influence of the finger type into fingerprint recognition performance. For analysis we employ two fingerprint verification software packages (one public and one commercial). We conduct test on GUC100 multi sensor fingerprint database which contains fingerprint images of all 10 fingers from 100 subjects. Our analysis indeed confirms that performance with small fingers is less accurate than performance with the others fingers of the hand. It also appears that best performance is being obtained with thumb or index fingers. For example, performance deterioration from the best finger (i.e. index or thumb) to the worst fingers (i.e. small ones) can be in the range of 184%-1352%.

  4. Optimization for Guitar Fingering on Single Notes

    Science.gov (United States)

    Itoh, Masaru; Hayashida, Takumi

    This paper presents an optimization method for guitar fingering. The fingering is to determine a unique combination of string, fret and finger corresponding to the note. The method aims to generate the best fingering pattern for guitar robots rather than beginners. Furthermore, it can be applied to any musical score on single notes. A fingering action can be decomposed into three motions, that is, a motion of press string, release string and move fretting hand. The cost for moving the hand is estimated on the basis of Manhattan distance which is the sum of distances along fret and string directions. The objective is to minimize the total fingering costs, subject to fret, string and finger constraints. As a sequence of notes on the score forms a line on time series, the optimization for guitar fingering can be resolved into a multistage decision problem. Dynamic programming is exceedingly effective to solve such a problem. A level concept is introduced into rendering states so as to make multiple DP solutions lead a unique one among the DP backward processes. For example, if two fingerings have the same value of cost at different states on a stage, then the low position would be taken precedence over the high position, and the index finger would be over the middle finger.

  5. Integration of tactile input across fingers in a patient with finger agnosia.

    Science.gov (United States)

    Anema, Helen A; Overvliet, Krista E; Smeets, Jeroen B J; Brenner, Eli; Dijkerman, H Chris

    2011-01-01

    Finger agnosia has been described as an inability to explicitly individuate between the fingers, which is possibly due to fused neural representations of these fingers. Hence, are patients with finger agnosia unable to keep tactile information perceived over several fingers separate? Here, we tested a finger agnosic patient (GO) on two tasks that measured the ability to keep tactile information simultaneously perceived by individual fingers separate. In experiment 1 GO performed a haptic search task, in which a target (the absence of a protruded line) needed to be identified among distracters (protruded lines). The lines were presented simultaneously to the fingertips of both hands. Similarly to the controls, her reaction time decreased when her fingers were aligned as compared to when her fingers were stretched and in an unaligned position. This suggests that she can keep tactile input from different fingers separate. In experiment two, GO was required to judge the position of a target tactile stimulus to the index finger, relatively to a reference tactile stimulus to the middle finger, both in fingers uncrossed and crossed position. GO was able to indicate the relative position of the target stimulus as well as healthy controls, which indicates that she was able to keep tactile information perceived by two neighbouring fingers separate. Interestingly, GO performed better as compared to the healthy controls in the finger crossed condition. Together, these results suggest the GO is able to implicitly distinguish between tactile information perceived by multiple fingers. We therefore conclude that finger agnosia is not caused by minor disruptions of low-level somatosensory processing. These findings further underpin the idea of a selective impaired higher order body representation restricted to the fingers as underlying cause of finger agnosia. Copyright © 2010 Elsevier Ltd. All rights reserved.

  6. Viscous Fingering in Deformable Systems

    Science.gov (United States)

    Guan, Jian Hui; MacMinn, Chris

    2017-11-01

    Viscous fingering is a classical hydrodynamic instability that occurs when an invading fluid is injected into a porous medium or a Hele-Shaw cell that contains a more viscous defending fluid. Recent work has shown that viscous fingering in a Hele-Shaw cell is supressed when the flow cell is deformable. However, the mechanism of suppression relies on a net volumetric expansion of the flow area. Here, we study flow in a novel Hele-Shaw cell consisting of a rigid bottom plate and a flexible top plate that deforms in a way that is volume-conserving. In other words, fluid injection into the flow cell leads to a local expansion of the flow area (outward displacement of the flexible surface) that must be coupled to non-local contraction (inward displacement of the flexible surface). We explore the impact of this volumetric confinement on steady viscous flow and on viscous fingering. We would like to thank EPSRC for the funding for this work.

  7. Ecological aspects study of replacement intercropping patterns of Soybean (Glycine max L. and Millet (Panicum miliaceum L.

    Directory of Open Access Journals (Sweden)

    Goudarz Ahmadvand

    2016-03-01

    Full Text Available Intercropping is considered for increasing and stability of yield in per unit. In order to study the effects of soybean (Glycine max L. and millet (Panicum miliaceum L. replacement intercropping on agronomic traits, diversity of weeds and soil biological activity, an experiment was conducted at the Research Station of Agricultural Faculty, of Bu-Ali Sina University, in 2014. The experiment was carried out as a randomized complete block design with three replications. The replacement intercropping series consisted of monoculture of soybean, monoculture of millet, 75% soybean+ 25% millet, 50% soybean+ 50% millet and 25% soybean+ 75% millet. The results showed that the highest seed yield of 219.8 and 171.9 gm-2 belonged to monoculture of soybean and monoculture of millet, respectively. Intercropping reduced maximum leaf area index of soybean and millet but leaf chlorophyll content of soybean and millet were increased. The highest number of pods per plant, number of seeds per plant in soybean and panicle number per plant in millet were obtained in 50S:50M ratio. Mean soil respiration rate in intercropping treatments was 4 and 8 % higher than the monoculture of soybean and millet, respectively. Intercropping patterns of 50S:50M and 25S:75M were successful in reducing weed plant density and diversity in comparison with soybean monoculture. Results showed that in all intercropping treatments, land equivalent ratio was more than one. Maximum value of land equivalent ratio (2.20 was achieved in 50S:50M treatment. Soybean and millet intercropping at different levels of replacement, didn’t have actual yield loss. Calculating the aggressivity showed that millet was more dominate than soybean. The maximum relative crowding coefficient of soybean was observed in 75S:25M, however that of millet was obtained in 25S:75M and 50S:50M intercroppings indicating that millet is more competitor than soybean.

  8. Glycaemic response of proso millet-based (Panicum miliaceum) products.

    Science.gov (United States)

    McSweeney, Matthew B; Ferenc, Agota; Smolkova, Katarina; Lazier, Alexander; Tucker, Amy; Seetharaman, Koushik; Wright, Amanda; Duizer, Lisa M; Ramdath, D Dan

    2017-11-01

    The glycaemic response of millet foods and the effect of processing are not known. Therefore, decorticated proso millet was used to produce four types of common food products (biscuits, couscous, porridge and an extruded snack). Postprandial blood glucose response of these products (all containing 50 g of total starch) was compared to the same foods produced with refined corn, in a crossover human study with 12 healthy male participants (age 26.3 ± 3.8 yr; BMI 23.3 ± 2.8 kg/m 2 ). Capillary blood samples were collected and glycaemic response was determined; differences were assessed using repeat measures ANOVA. Overall, the mean (±SEM) incremental area under the blood glucose response curve (mmol min/l) of the proso millet products was different from the corn products, but individual products (couscous = 66.7 ± 11.6, biscuit = 82.6 ± 13.7, extrudate = 198.7 ± 20.9, porridge = 40.1 ± 5.8) were not significantly lower (couscous = 43.5 ± 5.8, biscuit = 102.0 ± 10.3, extrudate = 198.7 ± 20.9, porridge = 52.2 ± 8.1) (p > .05). Glycaemic response of the products was not dependent on the grain type, but rather product matrix.

  9. There's Trouble in Paradise: Problems with Educational Metadata Encountered during the MALTED Project.

    Science.gov (United States)

    Monthienvichienchai, Rachada; Sasse, M. Angela; Wheeldon, Richard

    This paper investigates the usability of educational metadata schemas with respect to the case of the MALTED (Multimedia Authoring Language Teachers and Educational Developers) project at University College London (UCL). The project aims to facilitate authoring of multimedia materials for language learning by allowing teachers to share multimedia…

  10. Role of alpha-glucosidase in the fermentable sugar composition of sorghum malt mashes

    CSIR Research Space (South Africa)

    Taylor, JRN

    1994-11-01

    Full Text Available The cause of the high glucose to maltose ratio in sorghum malt worts was studied. Mashing temperature and pH strongly affected both the amount of glucose and the proportion of glucose relative to total fermentable sugars. The relative proportion...

  11. Isolation of α-amylase from malted rice (Wita 7) extract using ...

    African Journals Online (AJOL)

    The crude α-amylase from the 8th day malt extract was subsequently purified using starch column procedure. The purified extract recorded an estimated activity of 75.549 U/ml. The project further examined the effects of varying the ratios of starch adsorbent height to column diameter (L/D) during the purification step. For the ...

  12. STUDY OF THE DEVELOPMENT OF FREE AMINO NITROGEN DURING SORGHUM MALTING

    Directory of Open Access Journals (Sweden)

    Yanet Boffill Rodríguez

    2017-04-01

    Full Text Available In the brewing process, barley malt is used as main raw material. Sorghum is one of the most suitable cereals to replace barley because of its high nutritional value. However, the sorghum beer supply is still insufficient in the global market due to the low quality of its malt. The aim of this research was to study the development of free amino nitrogen (FAN during sorghum malting for brewing process by using Response Surface Methodology (RSM. A Central Composite Rotatable Design (CCD was used to develop a statistical model for the optimization of process variables such as NaOH concentration (0,2 - 0,5%(w/v, steeping time (12 - 36 h, and germination time (48 - 72 h. Data obtained from RSM on FAN production were subjected to the analysis of variance (ANOVA and were analyzed using a second order polynomial equation. Optimum malting conditions for the highest FAN value (350,00 mg L-1 were: NaOH concentration 0,35%, steeping time 26 h and germination time 63 h.

  13. MicroRNA-150 Is up-regulated in extranodal marginal zone lymphoma of MALT type.

    Science.gov (United States)

    Gebauer, Niklas; Kuba, Johannes; Senft, Andrea; Schillert, Arne; Bernard, Veronica; Thorns, Christoph

    2014-01-01

    The mechanisms promoting malignant transformation from chronic Helicobacter pylori-gastritis to gastric extranodal marginal zone lymphoma (MALT lymphoma) are insufficiently characterized. This follow-up study aimed to validate candidate microRNAs (miRs) in the process of neoplastic transformation. MicroRNA expression signatures (n=20) were generated for a total of 60 cases of gastric lesions ranging from Wotherspoon 0-5 employing a quantitative real-time polymerase chain reaction (PCR) approach. Morphological and immunohistochemical characterization of the cohort was supplemented by PCR-based immunoglobulin heavy chain recombination studies. Quantitative expression of miR-150, miR-142.3p, miR-375 and miR-494 was significantly de-regulated in samples from MALT lymphoma compared to those from gastritis. The previously reported up-regulation of miR-150 in marginal zone lymphoma of MALT type was verified in an independent cohort of lymphoma samples employing a modified methodology. This further substantiates the role of miR-150 as a potential oncomiR in MALT lymphoma.

  14. Adopting local alcohol policies: a case study of community efforts to regulate malt liquor sales.

    Science.gov (United States)

    McKee, Patricia A; Nelson, Toben F; Toomey, Traci L; Shimotsu, Scott T; Hannan, Peter J; Jones-Webb, Rhonda J

    2012-01-01

    To learn how the local context may affect a city's ability to regulate alcohol products such as high-alcohol-content malt liquor, a beverage associated with heavy drinking and a spectrum of nuisance crimes in urban areas. An exploratory, qualitative case study comparing cities that adopted policies to restrict malt liquor sales with cities that considered, but did not adopt policies. Nine large U.S. cities in seven states. City legislators and staff, alcohol enforcement personnel, police, neighborhood groups, business associations, alcohol retailers, and industry representatives. Qualitative data were obtained from key informant interviews (n = 56) and media articles (n = 360). The data were coded and categorized. Similarities and differences in major themes among and across Adopted and Considered cities were identified. Cities faced multiple barriers in addressing malt liquor-related problems, including a lack of enforcement tools, alcohol industry opposition, and a lack of public and political will for alcohol control. Compared to cities that did not adopt malt liquor sales restrictions, cities that adopted restrictions appeared to have a stronger public mandate for a policy and were less influenced by alcohol industry opposition and lack of legislative authority for alcohol control. Strategies common to successful policymaking efforts are discussed. Understanding the local context may be a critical step in winning support for local alcohol control policies.

  15. 27 CFR 8.22 - Contracts to purchase distilled spirits, wine, or malt beverages.

    Science.gov (United States)

    2010-04-01

    ... AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS EXCLUSIVE OUTLETS Prohibited..., or malt beverages from the industry member beyond a single sales transaction is prohibited. Examples of such contracts are: (a) An advertising contract between an industry member and a retailer with the...

  16. Ronald Malt or Chen Zhongwei: Who performed the first surgical replantation?

    Science.gov (United States)

    Fan, Ka-Wai

    2018-01-01

    This article discusses the contributions of the two pioneers of the surgical procedure of replantation-Ronald Malt in the US and Chen Zhongwei in China. Ronald Malt performed the reattachment surgery on a boy who had an accident in 1962, but he published his case report two years later in 1964. Chen Zhongwei performed a similar surgery on a worker who cut off his forearm in 1963, but he published his case report the same year. There is some debate about which one of these reputed surgeons should be given credit for being the first one to perform this breakthrough surgery, because although Malt was the first to perform the procedure, Zhongwei was the first to report it. To shed light on this controversy, criteria for scientific priority suggested by Ronald Vale and Anthony Hyman were applied. Although the criteria mainly favored Zhongwei as the pioneer of this procedure, he did not entirely fulfill one of the criteria. Therefore, the article could not present a definitive answer to the question, and it concludes by pointing out the highly commendable achievements and contributions of both Ronald Malt and Chen Zhongwei.

  17. Isolation of α-amylase from malted rice (Wita 7) extract using ...

    African Journals Online (AJOL)

    user

    microbial α-amylase enzymes has led to the studies in cereal malting (Hammond ... beta amylase and other starch degrading enzymes lead to an absolute ... water in a plastic container at a temperature of 28±1°C for 24 h. The soaked grains ...

  18. Malt quality of 4 barley ( Hordeum vulgare L.) grain varieties grown ...

    African Journals Online (AJOL)

    propiconazole) spray intervals (7, 14, 21 day) and no spray control were arranged in a RCBD in 4 replications to assess net blotch (Pyrenophora teres) effect on malt quality. The varieties were grown at Holetta agricultural research center in 2005, ...

  19. Aspects of legal communitarianism in Greece: between Millet and citizenship

    Directory of Open Access Journals (Sweden)

    Konstantinos Tsitselikis

    2012-12-01

    Full Text Available Legal and political percepts pertaining to ethnic belonging in Greece are closely linked to the ideological understanding of Greekness, a legacy of the Ottoman Greek-Orthodox millet system. Complementary to this image of the national self, minority protection law on Muslims and Jews was and still is partially formed through millet-like paradigms. Greece’s territorial expansion made all inhabitants of the annexed provinces Greek citizens en masse: in addition to those that were deemed eligible to belong to the Greek nation, Jewish and Muslim communities also acquired Greek citizenship. For these communities the self-autonomy of the Ottoman millet structure in education and religious matters was transformed into minority protection, through special rights (community schools, Moufti’s jurisdiction, Muslim foundations, military conscription attributable through religion to citizens of the state. En Grecia, la interpretación ideológica del carácter griego está estrechamente relacionada con los preceptos legales y políticos relativos a la pertenencia étnica, legado del sistema millet otomano griego-ortodoxo. Como complemento a esta percepción de la identidad nacional, la ley de protección de las minorías musulmanas y judías estuvo, y todavía está parcialmente formada por paradigmas milletianos. La expansión territorial de Grecia convirtió de forma masiva a los habitantes de las provincias anexadas en ciudadanos griegos: entre los que se consideró que reunían los requisitos necesarios para pertenecer a la nación griega, se encontraban las comunidades judías y musulmanas. En ambos casos, la autonomía en temas de educación y religión que disfrutaban dentro de la estructura milletiana de los otomanos, se transformó en protección minoritaria, a través de derechos especiales (escuelas de la comunidad, jurisdicción Moufti, fundaciones musulmanas, el reclutamiento militar atribuibles a los ciudadanos del estado a través de la

  20. Identification of MALT1 as both a prognostic factor and a potential therapeutic target of regorafenib in cholangiocarcinoma patients.

    Science.gov (United States)

    Yeh, Chun-Nan; Chang, Yu-Chan; Su, Yeu; Shin-Shian Hsu, Dennis; Cheng, Chi-Tung; Wu, Ren-Chin; Chung, Yi-Hsiu; Chiang, Kun-Chun; Yeh, Ta-Sen; Lu, Meng-Lun; Liu, Chun-Yu; Mu-Hsin Chang, Peter; Chen, Ming-Han; Huang, Chi-Ying F; Hsiao, Michael; Chen, Ming-Huang

    2017-12-26

    Intrahepatic cholangiocarcinoma (CCA) is an aggressive cancer that lacks an effective targeted therapy. Here, we assessed the therapeutic efficacy of regorafenib in CCA, as well as elucidated its underlying mechanism. We first demonstrated that regorafenib not only inhibited growth but also induced apoptosis in human CCA cells. Subsequently, we used in silico approaches to identify MALT1 (Mucosa-associated lymphoid tissue protein 1), which plays an important role in activating NF-κB, as a potential target of regorafenib. Overexpression of Elk-1, but not Ets-1, in HuCCT1 cells markedly reduced their sensitivity to regorafenib, which might be attributed to a significant increase in MALT1 levels. Our results further demonstrated that this drug drastically inhibited MALT1 expression by suppressing the Raf/Erk/Elk-1 pathway. The efficacy of regorafenib in decreasing in vivo CCA growth was confirmed in animal models. Regorafenib efficacy was observed in two MALT1-positive CCA patients who failed to respond to several other lines of therapy. Finally, MALT1 was also identified as an independent poor prognostic factor for patients with intrahepatic CCA. In conclusion, our study identified MALT1 to be a downstream mediator of the Raf/Erk/Elk-1 pathway and suggested that MALT1 may be a new therapeutic target for successful treatment of CCA by regorafenib.

  1. Characteristics associated with the consumption of malted drinks among Malaysian primary school children: findings from the MyBreakfast study.

    Science.gov (United States)

    Jan Mohamed, Hamid Jan B; Loy, S L; Mohd Taib, Mohd Nasir; Karim, Norimah A; Tan, S Y; Appukutty, M; Abdul Razak, Nurliyana; Thielecke, F; Hopkins, S; Ong, M K; Ning, C; Tee, E S

    2015-12-30

    The consumption of beverages contributes to diet quality and overall nutrition. Studies on malted drinks, one of the widely consumed beverage choices among children in Asia, however, have received limited attention. This study aimed to examine the prevalence of malted drink consumption and explored associations of sociodemographic characteristics, nutrient intakes, weight status and physical activity levels with malted drink consumption among primary school children in Malaysia. Data for this analysis were from the MyBreakfast Study, a national cross-sectional study conducted from April to October 2013 throughout all regions in Malaysia. A total of 2065 primary school children aged 6 to 12 years were included in the present analysis. Data on two days 24-h dietary recall or record, anthropometry, physical activity and screen time were recorded. Associations between malted drink consumption and related factors were examined using binary logistic regression, adjusting for region, area, gender, ethnicity and household income. Among children aged 6 to 12 years, 73.5% reported consuming malted drinks for at least once per week. Consumption of malted drinks was significantly associated with region (χ(2) = 45.64, p Malaysian primary school children, particularly higher among boys, indigenous children and those who lived in the East Coast region of Malaysia. Consuming malted drinks is associated with higher micronutrient intakes and higher levels of physical activity, but not with body weight status.

  2. Optimization of Bread Preparation from Wheat Flour and Malted Rice Flour

    Directory of Open Access Journals (Sweden)

    Subajiny VELUPPILLAI

    2010-03-01

    Full Text Available The feasibility of partially replacing wheat flour with malted rice flour in bread making was evaluated in several formulations, aiming to find a formulation for the production of malted rice-wheat bread with better nutritional quality and consumer acceptance. The whole grains of a local rice variety (Oryza sativa L. subsp. indica var. Mottaikaruppan were steeped in distilled water (12 h, 30°C and germinated for 3 days to obtain high content of soluble materials and amylase activity in bread making. The quality of bread was evaluated by considering the physical and sensorial parameters. When the wheat flour was substituted with malted rice flour, 35% substitution level and the malted rice flour from 3 days of germination was the best according to the physical and sensory qualities of bread. The quality of bread was improved by the addition of 20 g of margarine, 20 g of baking powder and 20 g of yeast in 1 kg of flour. Among different ratios of yeast and baking powder, 2:1 was the best. Bread improver containing amylases and oxidizing agents at the concentration of 40 g/kg was selected as the best concentration. When comparing the final formulation made in the bakery with wheat bread, malted rice-wheat bread contains more soluble dietary fiber (0.62%, insoluble dietary fiber (3.95%, total dietary fiber (4.57% and free amino acid content (0.64 g/kg than those in wheat bread (0.5%, 2.73%, 3.23% and 0.36 g/kg, respectively.

  3. Current status of ultrasonography of the finger

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Seun Ah; Kim, Baek Hyun [Dept. of Radiology, Korea University Ansan Hospital, Korea University College of Medicine, Ansan (Korea, Republic of); Kim, Seon Jeong [Dept. of Radiology, Myongji Hospital, Seonam University College of Medicine, Goyang (Korea, Republic of); Kim, Ji Na [Dept. of Radiology, Chungnam National University Hospital, Chungnam National University School of Medicine, Daejeon (Korea, Republic of); Park, Sun Young [Dept. of Radiology, Hallym University Sacred Heart Hospital, Hallym University College of Medicine, Anyang (Korea, Republic of); Choi, Kyung Hee [Incheon Baek Hospital, Incheon (Korea, Republic of)

    2016-03-15

    The recent development of advanced high-resolution transducers has enabled the fast, easy, and dynamic ultrasonographic evaluation of small, superficial structures such as the finger. In order to best exploit these advances, it is important to understand the normal anatomy and the basic pathologies of the finger, as exemplified by the following conditions involving the dorsal, volar, and lateral sections of the finger: sagittal band injuries, mallet finger, and Boutonnière deformity (dorsal aspect); flexor tendon tears, trigger finger, and volar plate injuries (volar aspect); gamekeeper’s thumb (Stener lesions) and other collateral ligament tears (lateral aspect); and other lesions. This review provides a basis for understanding the ultrasonography of the finger and will therefore be useful for radiologists.

  4. Current status of ultrasonography of the finger

    Directory of Open Access Journals (Sweden)

    Seun Ah Lee

    2016-04-01

    Full Text Available The recent development of advanced high-resolution transducers has enabled the fast, easy, and dynamic ultrasonographic evaluation of small, superficial structures such as the finger. In order to best exploit these advances, it is important to understand the normal anatomy and the basic pathologies of the finger, as exemplified by the following conditions involving the dorsal, volar, and lateral sections of the finger: sagittal band injuries, mallet finger, and Boutonnière deformity (dorsal aspect; flexor tendon tears, trigger finger, and volar plate injuries (volar aspect; gamekeeper’s thumb (Stener lesions and other collateral ligament tears (lateral aspect; and other lesions. This review provides a basis for understanding the ultrasonography of the finger and will therefore be useful for radiologists.

  5. Translocation of 14C-photosynthates under normal and moisture stress conditions in finger millet (Eleusine coracana) gaertin

    International Nuclear Information System (INIS)

    Udayakumar, M.; Rama Rao, S.; Krishna Sastry, K.S.

    1981-01-01

    Translocation of photosynthates into different sinks was studied following feeding a single leaf with 14 CO 2 in 40 day old stressed and non-stressed plants of Eleusine coracana. The rate of efflux of 14 C-photosynthates was twice as much in non-stressed plants compared to stressed plants. Young developing leaves, stem apex and stem which are the potential sinks under non-stressed conditions received very little activity under stress conditions. Percent activity in the roots was enhanced under stress suggesting the pattern of translocation was altered under stress conditions. In the plants subjected to moisture stress, after feeding with 14 CO 2 the rate of efflux of 14 C-photosynthates from the fed leaf decreased and the pattern of translocation was altered. Though the effect of stress seems to be directly on the translocation system, the photosynthetic rate appears to be more sensitive to stress than translocation. (author)

  6. Influence of single and combination treatments of physical and chemical mutagen on chlorophyll mutations in Finger Millet

    International Nuclear Information System (INIS)

    Kumar, Binod; Mahto, Jaylal; Haider, Z.A.

    1993-01-01

    Gamma rays, ethyl methane sulfonate (EMS) and their combined treatments influenced differently in producing chlorophyll mutations. A good number of chlorophyll mutants with varied frequencies were recorded in M 2 generation. The frequency of chlorophyll mutants was higher at lower doses of gamma rays, EMS and their combination treatments. The most frequently observed mutant was Albino type. The other chlorophyll mutants isolated were Xantha, Viridis, Striata and Tigrina. The frequency of tigrina and striata was lowest in variety A-404 and Hr-374, respectively. The efficiency and effectiveness was high at the lower doses of mutagens in both the varieties. EMS (0.2%) was more effective than the corresponding lower dose of gamma rays for both the varieties. (author). 10 refs., 4 tabs

  7. Impacts of heterogeneity in soil fertility on legume-finger millet productivity, farmers ' targeting and economic benefits

    NARCIS (Netherlands)

    Ebanyat, P.; Ridder, de N.; Jager, de A.; Delve, R.J.; Bekunda, M.; Giller, K.E.

    2010-01-01

    Targeting of integrated management practices for smallholder agriculture in sub-Saharan Africa is necessary due to the great heterogeneity in soil fertility. Experiments were conducted to evaluate the impacts of landscape position and field type on the biomass yield, N accumulation and N2-fixation

  8. Induced mutagenesis in finger-millet (Eleusine coracana Gaertn.) with gamma-rays and ethyl methane sulphonate

    International Nuclear Information System (INIS)

    Aradhya, R.S.; Madhavamenon, P.

    1979-01-01

    The seeds of CO-1 variety were treated with gamma-rays and EMS, each in 5 doses, 10 to 50 kR and 0.5 to 2.5% respectively. The chlorophyll mutation rate was characterized by linearity at low to medium doses and saturation as well as erratic behavior at high doses. As per mutation rate, estimated on the basis of M 2 plants, EMS induced as high frequency. The spectrum consisted of albina, chlorina zantha, albo-viridis, tigrina (3 types) and striata (2 types), with tigrina being predominant. The treatments varied in their spectrum, with 2.0% yielding the widest spectrum of mutants. (author)

  9. Comparative study on nutritional and sensory quality of barnyard and foxtail millet food products with traditional rice products.

    Science.gov (United States)

    Verma, Suman; Srivastava, Sarita; Tiwari, Neha

    2015-08-01

    Millets have the potential to contribute to food security and nutrition, but still these are underutilized crops. The present study was undertaken with a view to analyse the physico-chemical, functional and nutritional composition of foxtail millet, barnyard millet and rice and to compare the sensory quality and nutritive value of food products from foxtail and barnyard millet with rice. Analysis of physico- chemical and functional characteristics revealed that the thousand kernel weight of foxtail millet, barnyard millet and rice was 2.5, 3.0 and 18.3 g, respectively and thousand kernel volume was 1.6, 13 2.0 and 7.1 ml, respectively. The water absorption capacity of foxtail millet, barnyard millet and rice was 1.90, 1.96 and 1.98 ml/g, respectively and water solubility index was 2.8, 1.2 and 1.0 %, respectively. Viscosity was measured for foxtail millet (1650.6 cps), barnyard millet (1581 cps) and rice (1668.3 cps). Analysis of nutritional composition showed that the moisture content of foxtail millet, barnyard millet and rice was 9.35, 11.93 and 11.91 %, respectively. The total ash, crude protein, crude fat, crude fibre and carbohydrate of foxtail millet were 3.10, 10.29, 3.06, 4.25 and 69.95 %, respectively, for barnyard millet were 4.27, 6.93, 2.02, 2.98 and 71.87 %, respectively and the corresponding values for rice were 0.59, 6.19, 0.53, 0.21 and 80.58 %, respectively. The energy value for foxtail millet, barnyard millet and rice was 349, 407 and 352 Kcal, respectively. The foxtail millet contained 30.10 mg/100 g calcium and 3.73 mg/100 g iron whereas barnyard millet contained 23.16 mg/100 g calcium and 6.91 mg/100 g iron. Values of 10 mg/100 g calcium and 0.10 mg/100 g iron were observed for rice. The formulated products viz. laddu, halwa and biryani from foxtail millet, barnyard millet and rice (control) were analysed for their sensory qualities. Among the products prepared, there was non significant difference with regard to the

  10. Draft genome sequence of Sclerospora graminicola, the pearl millet downy mildew pathogen

    Directory of Open Access Journals (Sweden)

    S. Chandra Nayaka

    2017-12-01

    Full Text Available Sclerospora graminicola pathogen is the most important biotic production constraints of pearl millet in India, Africa and other parts of the world. We report a de novo whole genome assembly and analysis of pathotype 1, one of the most virulent pathotypes of S. graminicola from India. The draft genome assembly contained 299,901,251 bp with 65,404 genes. This study may help understand the evolutionary pattern of pathogen and aid elucidation of effector evolution for devising effective durable resistance breeding strategies in pearl millet. Keywords: Sclerospora graminicola, Pathotype 1, Pearl millet, Downy mildew, Whole genome sequence

  11. In the finger it lingers

    Directory of Open Access Journals (Sweden)

    Irfan Mohamad

    2017-08-01

    Full Text Available A previously healthy 80-year-old woman presented with a history of a thorn prick injury over the distal phalange of her left finger obtained while gardening two months ago. She claimed to have a non-healing cut with a nodular lesion, which progressively increased in size, extending upwards towards the region of her left arm. There was no fever or palpable lymph nodes in the axillary region. She had been prescribed antibiotics from the local hospital but her condition did not improve.

  12. Instrumented Glove Measures Positions Of Fingers

    Science.gov (United States)

    Bozeman, Richard J., Jr.

    1993-01-01

    Glove instrumented with flat membrane potentiometers to obtain crude measurements of relative positions of fingers. Resistance of each potentiometer varies with position of associated finger; translator circuit connected to each potentiometer converts analog reading to 1 of 10 digital levels. Digitized outputs from all fingers fed to indicating, recording, and/or data-processing equipment. Gloves and circuits intended for use in biomedical research, training in critical manual tasks, and other specialized applications.

  13. Generating and analyzing synthetic finger vein images

    OpenAIRE

    Hillerström, Fieke; Kumar, Ajay; Veldhuis, Raymond N.J.

    2014-01-01

    Abstract: The finger-vein biometric offers higher degree of security, personal privacy and strong anti-spoofing capabilities than most other biometric modalities employed today. Emerging privacy concerns with the database acquisition and lack of availability of large scale finger-vein database have posed challenges in exploring this technology for large scale applications. This paper details the first such attempt to synthesize finger-vein images and presents analysis of synthesized images fo...

  14. Application of autoradiography in finger print analysis

    International Nuclear Information System (INIS)

    Stverak, B.; Kopejtko, J.; Simek, J.

    1983-01-01

    In order to broaden the possibilities of developing latent finger prints a tracer technique has been developed using sup(110m)Ag and autoradiographic imaging. This method has been tested on glass, paper and certain plastics. On paper it is possible to visualize finger prints even after previous development using Ninhydrin. It is shown that usable finger prints may be obtained also from materials from which they cannot be obtained using classical methods, e.g., polyethylene and simulated leather. (author)

  15. Endoscopic staging of low-grade gastric malt lymphoma Estadificación por ecoendoscopia en el linfoma gástrico tipo malt de bajo grado

    Directory of Open Access Journals (Sweden)

    M. J. Varas

    2006-03-01

    Full Text Available Introduction: endoscopic ultrasonography (EUS has already proven useful in the assessment of submucosal lesions, and the staging of gastrointestinal cancer, particularly gastric MALT-type lymphoma. The goal of this paper was EUS staging. Patients and method: 24 patients (10 females, 14 males with a median age of 56 years and possibly gastric MALT lymphoma (25 cases were studied using videoendoscopy, biopsies, and echoendoscopy with 7.5- and 20-MHz radial EUS, and also with 12- and 20-MHz miniprobes (MPs. Nineteen patients were definitely evaluated (7 females, 12 males as having 20 MALT-type lymphomas, as five patients were post-hoc disregarded when an invasive, high-grade gastric lymphoma (3c or plasmocytoma (2c was subsequently demonstrated. Of these 19 patients, all had T1 lesions except for two with T2 lesions; one patient had a gastroduodenal T1 lymphoma. Echographic findings with MPs were compared to EUS (gold standard and histology both before and after eradication. Then, patients were followed up every 1-3-6 months using videoendoscopy and MPs. Results: echoendoscopy correctly identified T stages in 90% of cases. MPs identified T stages in 88% of cases, and N stages in 33% of cases, with results being slightly inferior to those obtained with conventional EUS (91 vs. 45%; they were consequently used for follow-up. After eradication, all but two patients are in complete remission and have been followed every 1-3-6 months using MPs without echographic abnormalities, except for a patient who relapsed.Introducción: la ultrasonografía endoscópica (USE ha demostrado ya su utilidad en la evaluación de las lesiones submucosas, en la estadificación del cáncer digestivo en general, y del linfoma gástrico tipo MALT en particular. El objetivo de este trabajo fue la estadificación por USE. Pacientes y método: veinticuatro enfermos (10 mujeres y 14 varones con edad media de 56 años y con posible linfoma gástrico tipo MALT (25 casos fueron

  16. Effect of genotype and environment on branching in weedy green millet (Setaria viridis) and domesticated foxtail millet (Setaria italica) (Poaceae).

    Science.gov (United States)

    Doust, Andrew N; Kellogg, Elizabeth A

    2006-04-01

    Many domesticated crops are derived from species whose life history includes weedy characteristics, such as the ability to vary branching patterns in response to environmental conditions. However, domesticated crop plants are characterized by less variable plant architecture, as well as by a general reduction in vegetative branching compared to their progenitor species. Here we examine weedy green millet and its domesticate foxtail millet that differ in the number of tillers (basal branches) and axillary branches along each tiller. Branch number in F(2:3) progeny of a cross between the two species varies with genotype, planting density, and other environmental variables, with significant genotype-environment interactions (GEI). This is shown by a complex pattern of reaction norms and by variation in the pattern of significant quantitative trait loci (QTL) amongst trials. Individual and joint analyses of high and low density trials indicate that most QTL have significant GEI. Dominance and epistasis also explain some variation in branching. Likely candidate genes underlying the QTL (based on map position and phenotypic effect) include teosinte branched1 and barren stalk1. Phytochrome B, which has been found to affect response to shading in other plants, explains little or no variation. Much variation in branching is explained by QTL that do not have obvious candidate genes from maize or rice.

  17. Gibberellic acid (GA3) induced changes in proanthocyanidins and malt quality of two- and six-row husked barleys.

    Science.gov (United States)

    Yadav, S K; Luthra, Y P; Sood, D R; Aggarwal, N K

    2000-01-01

    Analysis of husked barleys for proanthocyanidins and malt quality attributes has shown that not a single variety is free of proanthocyanidins. The proanthocyanidins in barley grains varied from 3.85 to 4.94 mg/g as catechin equivalent. The concentration of proanthocyanidins decreased, while total soluble sugars, reducing sugars, diastatic power and beta-amylase activity increased during maltings as well as with exogenous gibberellic acid (GA3) application. Alfa 93 (two-row) and RD2560 (six-row) varieties appeared to be superior for malting and brewing purposes on the basis of proanthocyanidins, total phenols, diastatic power and beta-amylase activity. It is suggested that exogenous application of GA3 at 15 ppm may be useful for producing good quality malt from barley grains.

  18. Effects of hydrolyzed Chlorella vulgaris by malted barley on the immunomodulatory response in ICR mice and in Molt-4 cells.

    Science.gov (United States)

    Kim, Na-Hyung; Kim, Kyu-Yeob; Jeong, Hyun-Ja; Kim, Hyung-Min; Hong, Seung-Heon; Um, Jae-Young

    2010-07-01

    Chlorella vulgaris is a unicellular and microscopic algae that is currently used in a variety of forms of tablets, capsules and liquid as a biological response modifier. The aim of this study was to investigate the effects of hydrolyzed Chlorella vulgaris by malted barley for its potential reduction of the immobility time in ICR mice and on the cytokine regulation in human T cell line, Molt-4. After a forced swimming test, the changes in aspects of blood biochemical parameters due to the administration of hydrolyzed Chlorella vulgaris by malted barley were examined. The effect of hydrolyzed Chlorella vulgaris by the malted barley-treated group for 14 days on the immobility time was significantly reduced in comparison with that of the control group (P cells. These results indicate that hydrolyzed Chlorella vulgaris by malted barley is useful for immune function improvements, enhanced physical stamina, and as a candidate for an anti-fatigue or antidepressant agent.

  19. Primary mucosa-associated lymphoid tissue (MALT) lymphoma of thyroid gland arising from coexisting Hashimoto's thyroiditis: a case report

    International Nuclear Information System (INIS)

    Lee, Sang Kwon; Kwon, Sun Young; Kim, Young Hwan; Choi, Jin Soo; Sohn, Chul Ho; Lee, Hee Jung; Woo, Seong Ku; Suh, Soo Ji

    2006-01-01

    We report herein on a case of primary mucosa-associated lymphoid tissue (MALT) lymphoma of the thyroid gland in a 57-year-old woman with coexisting Hashimoto's thyroiditis, and we include its characteristic imaging, histopathologic and immunohistochemical findings

  20. Isolation and culture of protoplasts of Côte d'Ivoire's pearl millet ...

    African Journals Online (AJOL)

    SARAH

    2015-08-31

    . Journal of Biology and Chemical Science 8 (5):. 2222-2231. Timbo de Oliveira AL, Davide LC, Pereira Pinto JEB,. Pereira AV, 2010. Protoplast production from. Napier grass and Pearl millet triploid hybrids.Ciens.Agrotec.

  1. Aflatoxin B1 occurrence in millet, sorghum and maize from four agro ...

    African Journals Online (AJOL)

    PROMOTING ACCESS TO AFRICAN RESEARCH ... African Journal of Food, Agriculture, Nutrition and Development ... This study investigated the occurrence of aflatoxins in maize, millet and sorghum from five counties in Kenya (Kwale, Isiolo, ...

  2. Assessment of aflatoxigenicAspergillusand other fungi in millet and sesame from Plateau State, Nigeria

    DEFF Research Database (Denmark)

    Ezekiel, C.N.; Udom, I.E.; Frisvad, Jens Christian

    2014-01-01

    . Diverse moulds includingAlternaria,Aspergillus,Cercospora,Fusarium,Mucor,Penicillium,RhizopusandTrichodermawere isolated.Aspergilluswas predominantly present in both crops (46–48%), and amongst the potentially aflatoxigenicAspergillusspecies,A. flavusrecorded the highest incidence (68% in fonio millet; 86...

  3. Scaling Up Small Millet Post-Harvest and Nutritious Food Products ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Technology solutions to improve processing Processing millets for modern food ... Small scale, large impact By the end of the project, two new business models will be ... The Royal Institution for the Advancement of Learning/McGill University.

  4. Responses of reniform nematode and browntop millet to tillage, cover crop, and herbicides in cotton

    Science.gov (United States)

    Cropping practices that reduce competition from reniform nematode (Rotylenchulus reniformis) and browntop millet (Urochlora ramosum) may help minimize losses in cotton (Gossypium hirsutum). The impacts of tillage, rye cover crop, and preemergence and postemergence herbicides on cotton yields, renifo...

  5. Multiresidue determination of pesticides in malt beverages by capillary gas chromatography with mass spectrometry and selected ion monitoring.

    Science.gov (United States)

    Wong, Jon W; Webster, Michael G; Bezabeh, Dawit Z; Hengel, Mathew J; Ngim, Kenley K; Krynitsky, Alexander J; Ebeler, Susan E

    2004-10-20

    A method was developed to determine pesticides in malt beverages using solid phase extraction on a polymeric cartridge and sample cleanup with a MgSO4-topped aminopropyl cartridge, followed by capillary gas chromatography with electron impact mass spectrometry in the selected ion monitoring mode [GC-MS(SIM)]. Three GC injections were required to analyze and identify organophosphate, organohalogen, and organonitrogen pesticides. The pesticides were identified by the retention times of peaks of the target ion and qualifier-to-target ion ratios. GC detection limits for most of the pesticides were 5-10 ng/mL, and linearity was determined from 50 to 5000 ng/mL. Fortification studies were performed at 10 ng/mL for three malt beverages that differ in properties such as alcohol content, solids, and appearance. The recoveries from the three malt beverages were greater than 70% for 85 of the 142 pesticides (including isomers) studied. The data showed that the different malt beverage matrixes had no significant effect on the recoveries. This method was then applied to the screening and analysis of malt beverages for pesticides, resulting in the detection of the insectide carbaryl and the fungicide dimethomorph in real samples. The study indicates that pesticide levels in malt beverages are significantly lower than the tolerance levels set by the United States Environmental Protection Agency for malt beverage starting ingredients. The use of the extraction/cleanup procedure and analysis by GC-MS(SIM) proved effective in screening malt beverages for a wide variety of pesticides. Copyright 2004 American Chemical Society

  6. Is there a link between the lipopolysaccharide of Helicobacter pylori gastric MALT lymphoma associated strains and lymphoma pathogenesis?

    Directory of Open Access Journals (Sweden)

    Philippe Lehours

    Full Text Available The aim of this study was to investigate the Lewis antigen expression in Helicobacter pylori gastric MALT lymphoma associated strains in comparison to chronic gastritis only strains. Forty MALT strains (19 cagPAI (- and 21 cagPAI (+ and 39 cagPAI frequency-matched gastritis strains (17 cagPAI (- and 22 cagPAI (+ were included in this study. The lipopolyssacharide for each strain was extracted using a hot phenol method and the expression of Le(x and Le(y were investigated using Western Blot. The data were analyzed according to the strains' cagPAI status and vacA genotype. Le(x was identified in 21 (52.5% MALT strains and 29 (74.3% gastritis strains. Le(y was identified in 30 (75% MALT strains and 31 (79.5% gastritis strains. There was an association between cagPAI positivity and Le(x expression among MALT strains (p<0.0001, but not in gastritis strains (p = 0.64. Among cagPAI (- strains, isolates expressing solely Le(y were associated with MALT with an odds ratio of 64.2 (95% CI 4.9-841.0 when compared to strains expressing both Le(x and Le(y. vacA genotypes did not modify the association between Lewis antigen expression and disease status. In conclusion, cagPAI (- MALT strains have a particular Lewis antigen profile which could represent an adaptive mechanism to the host response or participate in MALT lymphomagenesis.

  7. F-18-FDG-PET in a patient with Hashimoto's thyroiditis and MALT lymphoma recurrence of the thyroid

    International Nuclear Information System (INIS)

    Mikosch, P.; Gallowitsch, H.-J.; Kresnik, E.; Lind, P.; Wuertz, F.G.

    2003-01-01

    We report on the case of a 86-year-old male patient with a rapidly growing nodule within the right lobe of the thyroid gland, which after hemithyroidectomy, turned out to be a mucosa-associated lymphoid tissue (MALT) lymphoma of the thyroid gland. In addition, Hashimoto's thyroiditis was reported in the thyroid tissue adjacent to the MALT lymphoma. During follow-up a second nodule emerged within the left lobe and, because of evidence of MALT lymphoma recurrence, F-18-FDG-PET was performed. F-18-FDG-PET imaged a clearly in-creased accumulation within the whole left lobe and isthmus. Thus, no differences in the degree of hypermetabolism could be imaged between the nodule and the adjacent thyroid tissue. To our knowledge, this is the first report about F-18-FDG-PET in a patient with MALT lymphoma of the thyroid. Literature search revealed only a few cases of MALT lymphomas in locations other than the thyroid gland that were studied with F-18-FDG-PET. In no case was F-18 FDG accumulation seen in the MALT lesions. However, clear F-18 FDG accumulation was reported in some patients with Hashimoto's thyroiditis. It is concluded that the intensive F-18-FDG accumulation within the whole left lobe and isthmus of the presented case was due to the coexisting Hashimoto's thyroiditis. Consequently, F-18-FDG-PET imaging does not seem to be indicated in a patient with MALT lymphoma and known Hashimoto's thyroiditis in order to evaluate the status of the MALT lymphoma. (author)

  8. Evaluation of the Efficiency of the Foxtail Millet Vacuum Cushion in Skin Cancer Radiation Treatment

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Shin; Cheol; Lee, Kyung Jae; Jung, Sung Min; Oh, Tae Seong; Park, Jong Il; Shin, Hyun Kye [Dept. of Radiation Oncology, Ewha Womans University Mokdong Hospital, Seoul (Korea, Republic of)

    2012-09-15

    The sufficiency of skin dose and the reemergence of patient set-up position to the success of skin cancer radiation treatment is a very important element. But the conventional methods to increase the skin dose were used to vacuum cushion, bolus and water tank have several weak points. For this reason, we produced Foxtail Millet Vacuum Cushion and evaluated the efficiency of the Foxtail Millet Vacuum Cushion in skin cancer Radiation treatment. We measured absolute dose for 3 materials (Foxtail Millet Vacuum Cushion, bolus and solid water phantom) and compared each dose distribution. We irradiated 6 MV 100 MU photon radiation to every material of 1 cm, 2 cm, 3 cm thickness at three times. We measured absolute dose and compared dose distribution. Finally we inspected the CT simulation and radiation therapy planing using the Foxtail Millet Vacuum Cushion. Absolute dose of Foxtail Millet Vacuum Cushion was similar to absolute dose of bolus and solid water phantom's result in each thickness. it Showed only the difference of 0.1-0.2% between each material. Also the same result in dose distribution comparison. About 97% of the dose distribution was within the margin of error in the prescribed ranges (100{+-}3%), and achieved the enough skin dose (Gross Tumor Volume dose : 100{+-}5%) in radiation therapy planing. We evaluated important fact that Foxtail Millet Vacuum Cushion is no shortage of time to replace the soft tissue equivalent material and normal vacuum cushion at the low energy radiation transmittance. Foxtail Millet Vacuum Cushion can simultaneously achieve the enough skin dose in radiation therapy planing with maintaining normal vacuum cushion' function. Therefore as above We think that Foxtail Millet Vacuum Cushion is very useful in skin cancer radiation treatment.

  9. Meiosis in elephant grass (Pennisetum purpureum), pearl millet (Pennisetum glaucum) (Poaceae, Poales) and their interspecific hybrids

    OpenAIRE

    Techio, Vânia Helena; Davide, Lisete Chamma; Pereira, Antônio Vander

    2006-01-01

    The cultivated and sexually compatible species Pennisetum purpureum (elephant grass, 2n = 4x = 28) and Pennisetum glaucum (pearl millet, 2n = 2x = 14) can undergo hybridization which favors the amplification of their genetic background and the introgression of favorable alleles into breeding programs. The main problem with interspecific hybrids of these species is infertility due to triploidy (2n = 3x = 21). This study describes meiosis in elephant grass x pearl millet hybrids and their proge...

  10. Phytolith analysis for differentiating between foxtail millet (Setaria italica) and green foxtail (Setaria viridis).

    OpenAIRE

    Jianping Zhang; Houyuan Lu; Naiqin Wu; Xiaoyan Yang; Xianmin Diao

    2011-01-01

    Foxtail millet (Setaria italica) is one of the oldest domesticated cereal crops in Eurasia, but identifying foxtail millets, especially in charred grains, and differentiating it from its wild ancestor, green foxtail (Setaria viridis), in the archaeobotanical remains, is still problematic. Phytolithic analysis provides a meaningful method for identifying this important crop. In this paper, the silicon structure patterns in the glumes, lemmas, and paleas from inflorescence bracts in 16 modern p...

  11. Generating and analyzing synthetic finger vein images

    NARCIS (Netherlands)

    Hillerström, Fieke; Kumar, Ajay; Veldhuis, Raymond N.J.

    2014-01-01

    Abstract: The finger-vein biometric offers higher degree of security, personal privacy and strong anti-spoofing capabilities than most other biometric modalities employed today. Emerging privacy concerns with the database acquisition and lack of availability of large scale finger-vein database have

  12. Surgical Treatment of Trigger Finger: Open Release

    Directory of Open Access Journals (Sweden)

    Firat Ozan

    2016-01-01

    Full Text Available In this study, open A1 pulley release results were evaluated in patients with a trigger finger diagnosis. 45 patients (29 females, 16 males, mean age 50.7 ± 11.9; range (24-79, 45 trigger fingers were released via open surgical technique. On the 25 of 45 cases were involved in the right hand and 16 of them were at the thumb, 2 at index, 6 at the middle and 1 at ring finger. Similarly, at the left hand, 15 of 20 cases were at the thumb, 1 at the index finger, 2 at middle finger and 2 at ring finger. Average follow-up time was 10.2 ± 2.7 (range, 6-15 months. Comorbidities in patients were; diabetes mellitus at 6 cases (13.3%, hypertension at 11 cases (24.4%, hyperthyroidism at 2 cases (4.4%, dyslipidemia at 2 cases (4.4% and lastly 2 cases had carpal tunnel syndrome operation. The mean time between the onset of symptoms to surgery was 6.9 ± 4.8 (range, 2-24 months. Patient satisfaction was very good in 34 cases (75.4% and good in 11 (24.6% patients. The distance between the pulpa of the operated finger and the palm was normal in every case postoperatively. We have not encountered any postoperative complications. We can recommend that; A1 pulley release via open incision is an effective and reliable method in trigger finger surgery.

  13. Number to finger mapping is topological.

    NARCIS (Netherlands)

    Plaisier, M.A.; Smeets, J.B.J.

    2011-01-01

    It has been shown that humans associate fingers with numbers because finger counting strategies interact with numerical judgements. At the same time, there is evidence that there is a relation between number magnitude and space as small to large numbers seem to be represented from left to right. In

  14. Association Mapping of Malting Quality Quantitative Trait Loci in Winter Barley: Positive Signals from Small Germplasm Arrays

    Directory of Open Access Journals (Sweden)

    Lucía Gutiérrez

    2011-11-01

    Full Text Available Malting quality comprises one of the most economically relevant set of traits in barley ( L.. It is a complex phenotype, expensive and difficult to measure, that would benefit from a marker-assisted selection strategy. Malting quality is a target of the U.S. Barley Coordinated Agricultural Project (CAP and development of winter habit malting barley varieties is a key objective of the U.S. barley research community. The objective of this work was to detect quantitative trait loci (QTL for malting quality traits in a winter breeding program that is a component of the U.S. Barley CAP. We studied the association between five malting quality traits and 3072 single nucleotide polymorphisms (SNPs from the barley oligonucleotide pool assay (BOPA 1 and 2, assayed in advanced inbred lines from the Oregon State University (OSU breeding program from three germplasm arrays (CAP I, CAP II, and CAP III. After comparing 16 models we selected a structured association model with posterior probabilities inferred from software STRUCTURE (QK approach to use on all germplasm arrays. Most of the marker-trait associations are germplasm- and environment-specific and close to previously mapped genes and QTL relevant for malt and beer quality. We found alleles fixed by random genetic drift, novel unmasked alleles, and genetic-background interaction. In a relatively small population size study we provide strong evidence for detecting true QTL.

  15. Rheological, thermo-mechanical, and baking properties of wheat-millet flour blends.

    Science.gov (United States)

    Aprodu, Iuliana; Banu, Iuliana

    2015-07-01

    Millet has long been known as a good source of fiber and antioxidants, but only lately started to be exploited by food scientists and food industry as a consequence of increased consumer awareness. In this study, doughs and breads were produced using millet flour in different ratios (10, 20, 30, 40, and 50%) to white, dark, and whole wheat flour. The flour blends were evaluated in terms of rheological and thermo-mechanical properties. Fundamental rheological measurements revealed that the viscosity of the flour formulations increases with wheat flour-extraction rate and decreases with the addition of millet flour. Doughs behavior during mixing, overmixing, pasting, and gelling was established using the Mixolab device. The results of this bread-making process simulation indicate that dough properties become critical for the flour blends with millet levels higher than 30%. The breads were evaluated for volume, texture, and crumb-grain characteristics. The baking test and sensory evaluation results indicated that substitution levels of up to 30% millet flour could be used in composite bread flour. High levels of millet flour (40 and 50%) negatively influenced the loaf volume, crumb texture, and taste. © The Author(s) 2014.

  16. Utilization of Foxtail Millet (Setaria italica from Papua as an Alternative Feedstuff to Substitute Corn

    Directory of Open Access Journals (Sweden)

    Siska Tirajoh

    2016-09-01

    Full Text Available Papua foxtail millet (Setaria italica is a plant which has been used as a source of carbohydrate, but it has not been used optimally. High demand in consuming corn as a poultry feeds provides an opportunity for Papua foxtail millet to be used as a substitute for corn in feed. Evaluation of nutritive values and antinutrient shows that Papua foxtail millet potential to be used as feed stuff. Studies on cultivation technology, evaluation of the nutritive values and antinutrient and its benefits as an alternative feed are relatively limited. The results shows that the Papua foxtail millet contains dry matter (88.37%, ash (0.86%, protein (12.07%, fat (2.76%, crude fiber (1.93%, metabolizable energy (3,139 kcal/kg and anti-nutritional factors (3.07% of phytate and 0.01% of tannins. Several studies reported that the use of Papua foxtail millet at various levels (25-100% in feed, can substitute corn and give a positive response on consumption, daily weight gain, feed conversion, carcass composition and percentages and egg production. It can be concluded that the Papua foxtail millet can be used as a corn substitution in poultry feed.

  17. Genetic diversity and population structure of Chinese foxtail millet [Setaria italica (L.) Beauv.] landraces.

    Science.gov (United States)

    Wang, Chunfang; Jia, Guanqing; Zhi, Hui; Niu, Zhengang; Chai, Yang; Li, Wei; Wang, Yongfang; Li, Haiquan; Lu, Ping; Zhao, Baohua; Diao, Xianmin

    2012-07-01

    As an ancient cereal of great importance for dryland agriculture even today, foxtail millet (Setaria italica) is fast becoming a new plant genomic model crop. A genotypic analysis of 250 foxtail millet landraces, which represent 1% of foxtail millet germplasm kept in the Chinese National Gene Bank (CNGB), was conducted with 77 SSRs covering the foxtail millet genome. A high degree of molecular diversity among the landraces was found, with an average of 20.9 alleles per locus detected. STRUCTURE, neighbor-jointing, and principal components analyses classify the accessions into three clusters (topmost hierarchy) and, ultimately, four conservative subgroups (substructuring within the topmost clusters) in total, which are in good accordance with eco-geographical distribution in China. The highest subpopulation diversity was identified in the accessions of Pop3 from the middle regions of the Yellow River, followed by accessions in Pop1 from the downstream regions of the Yellow River, suggesting that foxtail millet was domesticated in the Yellow River drainage area first and then spread to other parts of the country. Linkage disequilibrium (LD) decay of less than 20 cM of genetic distance in the foxtail millet landrace genome was observed, which suggests that it could be possible to achieve resolution down to the 20 cM level for association mapping.

  18. Critical role of climate change in plant selection and millet domestication in North China.

    Science.gov (United States)

    Yang, Xiaoyan; Wu, Wenxiang; Perry, Linda; Ma, Zhikun; Bar-Yosef, Ofer; Cohen, David J; Zheng, Hongbo; Ge, Quansheng

    2018-05-18

    While North China is one of the earliest independent centers for cereal domestication in the world, the earliest stages of the long process of agricultural origins remain unclear. While only millets were eventually domesticated in early sedentary societies there, recent archaeobotanical evidence reported here indicates that grasses from the Paniceae (including millets) and Triticeae tribes were exploited together by foraging groups from the Last Glacial Maximum to the mid-Holocene. Here we explore how and why millets were selected for domestication while Triticeae were abandoned. We document the different exploitation and cultivation trajectories of the two tribes employing ancient starch data derived from nine archaeological sites dating from 25,000 to 5500 cal BP (LGM through mid-Holocene) in North China. With this diachronic overview, we can place the trajectories into the context of paleoclimatic reconstructions for this period. Entering the Holocene, climatic changes increased the yield stability, abundance, and availability of the wild progenitors of millets, with growing conditions increasingly favoring millets while becoming more unfavorable for grasses of the Triticeae tribe. We thus hypothesize that climate change played a critical role in the selection of millet species for domestication in North China, with early domestication evidenced by 8700 cal BP.

  19. Assessment of Important Sensory Attributes of Millet Based Snacks and Biscuits.

    Science.gov (United States)

    McSweeney, Matthew B; Duizer, Lisa M; Seetharaman, Koushik; Dan Ramdath, D

    2016-05-01

    There is an increasing push by consumers for new food products that can provide health benefits. To develop these products, sometimes it is necessary to look to alternative crops, 1 of which is millet. For millet to be successfully adopted by consumers, it is necessary to identify and develop product types that are acceptable to North Americans. Biscuits and extruded snacks were produced using varying amounts of refined proso millet flour (0%, 25%, 75%, and 100%). Sensory analysis was conducted on 8 products (4 types of biscuits and 4 types of extruded snack) in 2 separate tests (1 for biscuits and 1 for snacks). Preferred Attribute Elicitation (PAE), a relatively new sensory method, was used to determine attributes affecting liking of the products. Results indicated that as the amount of millet in the biscuits and extruded snacks increased, the liking of the flavor, texture and overall liking decreased. Millet contributed to a bitter taste and bitter aftertaste, and resulted in gritty and dry food products. Further work is required to refine the products tested as well as to identify further products that can be added to the diet in order to take advantage of the health benefits that millet provides. © 2016 Institute of Food Technologists®

  20. Generic Automated Multi-function Finger Design

    Science.gov (United States)

    Honarpardaz, M.; Tarkian, M.; Sirkett, D.; Ölvander, J.; Feng, X.; Elf, J.; Sjögren, R.

    2016-11-01

    Multi-function fingers that are able to handle multiple workpieces are crucial in improvement of a robot workcell. Design automation of multi-function fingers is highly demanded by robot industries to overcome the current iterative, time consuming and complex manual design process. However, the existing approaches for the multi-function finger design automation are unable to entirely meet the robot industries’ need. This paper proposes a generic approach for design automation of multi-function fingers. The proposed approach completely automates the design process and requires no expert skill. In addition, this approach executes the design process much faster than the current manual process. To validate the approach, multi-function fingers are successfully designed for two case studies. Further, the results are discussed and benchmarked with existing approaches.

  1. Successful treatment of radiation retinopathy with panretinal photocoagulation (PRP) in a patient of orbital MALT lymphoma

    International Nuclear Information System (INIS)

    Okamoto, Hiroyuki; Chikuda, Makoto; Kadoya, Kouji

    2012-01-01

    Report a case of satisfactory progress radiation retinopathy after radiation for mucosa-associated lymphoid tissue (MALT) lymphoma. A 26-year-old male patient, referred to our department for lacrimal sac tumor. Biopsy was done by otolaryngology and radiation therapy was performed (total irradiation of 41.4 Gy) as pathological examination revealed MALT lymphoma. Soft exudates and macula edema appeared in posterior pole of the right fundus after radiotherapy. Right vision became 0.5 because of macula edema, and panretinal photocoagulation (PRP) was performed. After PRP, macula edema withdrew and right vision improved to 1.2. It is suggested that the fundus must be monitored after radiation therapy, and early treatment, such as PRP is effective in radiation retinopathy. (author)

  2. A comparative assessment of antioxidant properties, total phenolic content of einkorn, wheat, barley and their malts.

    Science.gov (United States)

    Fogarasi, Attila-Levente; Kun, Szilárd; Tankó, Gabriella; Stefanovits-Bányai, Eva; Hegyesné-Vecseri, Beáta

    2015-01-15

    Two einkorn wheat, one barley, three optional winter cultivation wheat and five winter cultivation wheat samples harvested in Hungary in 2011, and their malts were evaluated for their DPPH radical and ABTS radical cation scavenging activity, ferric reduction capacity (FRAP) and total phenolic content (TPC). All einkorn and barley samples exhibited significant antioxidant activities determined by DPPH and ABTS radical scavenging activities. The einkorn samples show higher polyphenol content than the other wheat samples. In all cases the barley sample had the highest antioxidant potential and polyphenol content. The einkorn malts had high DPPH and ABTS radical cation scavenging activities, but the phenolic content was lower against wheat samples. There was significant difference between the antioxidant potential of optional and winter cultivation wheat samples except on ABTS scavenging activities. Einkorn wheat is potentially a new raw material to produce organic beer that might have beneficial effects with its increased antioxidant potential. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Electrokinetic Control of Viscous Fingering

    Science.gov (United States)

    Mirzadeh, Mohammad; Bazant, Martin Z.

    2017-10-01

    We present a theory of the interfacial stability of two immiscible electrolytes under the coupled action of pressure gradients and electric fields in a Hele-Shaw cell or porous medium. Mathematically, our theory describes a phenomenon of "vector Laplacian growth," in which the interface moves in response to the gradient of a vector-valued potential function through a generalized mobility tensor. Physically, we extend the classical Saffman-Taylor problem to electrolytes by incorporating electrokinetic (EK) phenomena. A surprising prediction is that viscous fingering can be controlled by varying the injection ratio of electric current to flow rate. Beyond a critical injection ratio, stability depends only upon the relative direction of flow and current, regardless of the viscosity ratio. Possible applications include porous materials processing, electrically enhanced oil recovery, and EK remediation of contaminated soils.

  4. Progress Report Natsurv 1 K5_2285/3 The Malt Brewing Industry

    CSIR Research Space (South Africa)

    Ramukhwatho, Fhumulani R

    2014-07-01

    Full Text Available of brewing process cycle The generic brewing processes for beer production (Varman and Sutherland, 1994; Unicer, SA, 2005) 5 Breweries Classification Large = 10 Medium = ? Small = 77 Per Barrel produced: Large: > 6 000 000 Medium: ≥ 15 000 ≤ 6... in study 10 Loci of Malt Breweries in SA 11 Key Brewing Processes Brewing Fermentation Storage Bottling Barrelling 12 Preliminary Results from Questionnaire/ literature • Results based on 8 responses (breweries) • Data to date was synthesized...

  5. Two quantitative character selection following neutron and EMS treatment in malt barley. An applied micromutation experiment

    Energy Technology Data Exchange (ETDEWEB)

    Haensel, H; Simon, W; Ehrendorfer, K [Hochschule fuer Bodenkultur, Vienna (Austria)

    1975-01-01

    Mutation experiments in spring barley are described aimed at increasing the grain yield and ''classification'' (i.e. weight percent of caryopsis greater than 2.5 mm). The course of selection up to the M/sub 8/-generation obtained by self-pollination is given. A comparison is presented with materials obtained after neutron and ethyl methanesulfonate treatment. The possibilities are also discussed of using the methods of micromutation breeding for barley crop yield and its malt quality improvement.

  6. Preparation of Hulu-mur flavored carbonated beverage based on Feterita sorghum (Sorghum bicolor malt

    Directory of Open Access Journals (Sweden)

    Sara F. A. Baidab

    2016-10-01

    Full Text Available  In this study, sorghum Feterita malt extract was used to prepare carbonated beverages flavored with traditional Hulu-mur spices extract.  The beverages produced were assessed for their physicochemical, sensory, and nutritional qualities. Malting (3–5 days of the Feterita grains showed significant (P ≤ 0.05 differences in proximate composition from that of unmalted grains. Protein and sugars increased significantly (P ≤ 0.05 with increased the malting time (days, while there was a significant (P ≤ 0.05 reduction in oil and starch  content  during malting progress. The kilning temperature of 150°C for 20 minutes was found to produce the most acceptable Hulu-mur carbonated beverage analogue in terms of flavor and taste. Significant differences (P ≤ 0.05 were observed in physicochemical and nutritional qualities between the Hulu-mur analogue carbonated beverage and commercial non-alcoholic beverage. The Hulu-mur carbonated beverage analogue was rich in Na, K, Ca, and Fe (26.45, 21.84, 24.00, and 0.57 mg /100 g, respectively compared to levels of the same minerals in the non-alcoholic beverage (22.31, 8.19, 22.00 and 0.15 mg/100 g, respectively. The Hulu-mur analogue also had a higher calorific value (35.85 kcal /100 mL compared to the non-alcoholic beverage (32.96 kcal/100 mL.

  7. Cell wall polysaccharides hydrolysis of malting barley (Hordeum vulgare L.: a review

    Directory of Open Access Journals (Sweden)

    Jamar, C.

    2011-01-01

    Full Text Available Malting quality results from the different steps of the malting process. Malting uses internal changes of the seed occurring during germination, such as enzymes synthesis, to obtain a good hydrolysis process and the components required. Among the three main hydrolytic events observed, that are namely starch degradation, cell wall breakdown and protein hydrolysis, an efficient cell wall polysaccharides hydrolysis is an essential condition for a final product of quality. Indeed, because of the physical barrier of the cell wall, cell wall polysaccharides hydrolysis is one of the first steps expected from the process to gain access to the cell components. Moreover, viscosity problem and haze formation in malting industry are related to their presence during the process when inefficient degradation occurs, leading to increased production time and cost. Understanding the key elements in cell wall degradation is important for a better control. (1-3,1-4-β-glucans and arabinoxylans are the main constituents of cell wall. (1-3,1-4-β-glucans are unbranched chains of β-D-glucopyranose residues with β-(1,3 linkages and β-(1,4 linkages. Arabinoxylan consists in a backbone of D-xylanopyranosyl units linked by β-(1-4 bonds connected to single L-arabinofuranose by α-(1→2 or α-(1→3-linkages. Degradation of (1-3,1-4-β-glucans is processed by the (1-3,1-4-β-glucanases, the β-glucosidases and the β-glucane exohydrolases. It seems that the (1-3-β-glucanases are also involved. Arabinoxylans are mainly decomposed by (1-4-β-xylan endohydrolase, arabinofuranosidase and β-xylosidase.

  8. Differing Dynamics of Intrapersonal and Interpersonal Coordination: Two-finger and Four-Finger Tapping Experiments.

    Directory of Open Access Journals (Sweden)

    Kentaro Kodama

    Full Text Available Finger-tapping experiments were conducted to examine whether the dynamics of intrapersonal and interpersonal coordination systems can be described equally by the Haken-Kelso-Bunz model, which describes inter-limb coordination dynamics. This article reports the results of finger-tapping experiments conducted in both systems. Two within-subject factors were investigated: the phase mode and the number of fingers. In the intrapersonal experiment (Experiment 1, the participants were asked to tap, paced by a gradually hastening auditory metronome, looking at their fingers moving, using the index finger in the two finger condition, or the index and middle finger in the four-finger condition. In the interpersonal experiment (Experiment 2, pairs of participants performed the task while each participant used the outside hand, tapping with the index finger in the two finger condition, or the index and middle finger in the four-finger condition. Some results did not agree with the HKB model predictions. First, from Experiment 1, no significant difference was observed in the movement stability between the in-phase and anti-phase modes in the two finger condition. Second, from Experiment 2, no significant difference was found in the movement stability between the in-phase and anti-phase mode in the four-finger condition. From these findings, different coordination dynamics were inferred between intrapersonal and interpersonal coordination systems against prediction from the previous studies. Results were discussed according to differences between intrapersonal and interpersonal coordination systems in the availability of perceptual information and the complexity in the interaction between limbs derived from a nested structure.

  9. Present status of tandem accelerator research facility (MALT) in University of Tokyo

    Energy Technology Data Exchange (ETDEWEB)

    Kobayashi, Koichi; Hatori, Satoshi; Nakano, Chuichiro; Sunohara, Yoko [Tokyo Univ. (Japan). Research Center for Nuclear Science and Technology

    1996-12-01

    The tandem accelerator in University of Tokyo, which was renewed from 1991 to March, 1994 started the joint utilization within the University since April, 1995 after about one year of the period of adjustment. The time of operation exceeding 3500 hours in one year was recorded. This facility is that for carrying out the minute analysis such as AMS, PIXE, NRA and others and the research of atomic and molecular physics, and called microanalysis laboratory-tandem accelerator (MALT). Support has been done by placing emphasis on the development of AMS measurement which enables the microanalysis of {sup 14}C,{sup 10}Be and {sup 26}Al, but the accuracy of {sup 14}C AMS did not attain the practical level. {sup 10}Be and {sup 26}Al AMS reached almost the practical level, and the measurement of actual samples has been carried out. The state of operation and utilization of the MALT is reported. As to the recent troubles and the countermeasures in the MALT, the voltage instability of the accelerator, the unstable ion source support mechanism and the poor transmissivity of beam in the accelerator are described. (K.I.)

  10. METABOLIC AND BIOCHEMICAL CHARACTERISTICS OF PROBIOTIC CULTURE IN MILK SUPPLEMENTED WITH RYE FLAKES AND MALT EXTRACT

    Directory of Open Access Journals (Sweden)

    Elena Bărăscu

    2010-01-01

    Full Text Available Rye flakes and malt extract were added to milk in order to stimulate growth and fermentative activity of probioticbacteria and to obtain a probiotic product with pleasant sensory attributes. Probiotic culture used in this study containsbifidobacteria, Lb. acidophilus, Lactobacilus lactis and Streptococcus thermophilus.Rye flakes have a stimulating effect more pronounced than malt extract on acidification capacity of the probioticculture, and to achieve an increase of the milk acidity of 7g lactic acid /dm3 (in 6h at 39oC the two ingredients must beadded in concentration of 2% and, respectively, 0.2%..The probiotic culture reach the greatest proteolytic activity when rye flakes are added in the proportion of 3% andmalt extract in the proportion of 0.1% and the amino acids released rate was 764.6 μg%. The lactose bioconversionrate was greater in the milk supplemented with rye flakes 3% and malt extract 0.1% and residual lactose was 3.84%.

  11. Emission factor development for the malt beverage, wine, and distilled spirits industries

    Energy Technology Data Exchange (ETDEWEB)

    Lapp, T.; Shrager, B. [Midwest Research Institute, Cary, NC (United States); Safriet, D. [Environmental Protection Agency, Research Triangle Park, NC (United States)

    1996-12-31

    Midwest Research Institute is currently developing emission factors for inclusion in AP-42 Chapter 9, Food and Agricultural Industries. Three of the sections cover the production of malt beverages, wine, and distilled spirits. The malt beverage segment focuses on the development of ethanol emission factors for filling operations, which were recently identified as the large source of brewery ethanol emissions. The discussion includes a description of the production process and emissions factors for breweries, a history of emission factories for breweries, a description of emission testing conducted at two large breweries, and a presentation of some of the emission factors for malt beverage production. The wine industry segment focuses on emissions from the fermentation stage for red and white wines, the pomace screen and pomace press for red wines, and bottling of white wine. Emission factors are presented for ethanol emissions from each of these sources as well as other VOC emissions from the fermentation process. A discussion of the wine production process is presented. A discussion of the emission sources and available emission factors is presented for the distilled spirits industry segment. Factors are presented for the fermentation and aging stages. A process description is presented for the production of Bourbon whisky.

  12. Flavour generation during commercial barley and malt roasting operations: a time course study.

    Science.gov (United States)

    Yahya, Hafiza; Linforth, Robert S T; Cook, David J

    2014-02-15

    The roasting of barley and malt products generates colour and flavour, controlled principally by the time course of product temperature and moisture content. Samples were taken throughout the industrial manufacture of three classes of roasted product (roasted barley, crystal malt and black malt) and analysed for moisture content, colour and flavour volatiles. Despite having distinct flavour characteristics, the three products contained many compounds in common. The product concentrations through manufacture of 15 flavour compounds are used to consider the mechanisms (Maillard reaction, caramelisation, pyrolysis) by which they were formed. The use of water sprays resulted in transient increases in formation of certain compounds (e.g., 2-cyclopentene-1,4-dione) and a decrease in others (e.g., pyrrole). The study highlights rapid changes in colour and particularly flavour which occur at the end of roasting and onwards to the cooling floor. This highlights the need for commercial maltsters to ensure consistency of procedures from batch to batch. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Regression of gastric malt-lymphoma under specific therapy may be predict by endoscopic ultrasound.

    Science.gov (United States)

    Gheorghe, Cristian; Băncilă, Ion; Stoia, Răzvan; Gheorghe, Liana; Becheanu, Gabriel; Dobre, Camelia; Brescan, Raluca

    2004-06-01

    Mucosa-associated lymphoid tissue (MALT) lymphomas represent a relatively new described class of rare lymphomas, characterized by an indolent course and favourable outcome with specific therapy. Gastric MALT lymphomas are associated with chronic Helicobacter pylori (HP) infection. We report the case of a 67 year old man admitted for an 8-month history of epigastric pain, anorexia and progressive weight loss. He was diagnosed with low-grade primary gastric MALT lymphoma by endoscopy, histopathological examination of gastric mucosa (light microscopy and immunohistochemistry) and endoscopic ultrasonography (EUS). The patient received a 2-week course of anti-HP therapy and chemotherapy with Chlorambucil 0.1 mg/kg/day was started. During the follow-up, continuous improvement of clinical status, endoscopic and EUS appearance was noted. We conclude that, facing the trend toward nonsurgical treatment modalities for primary gastric lymphoma, EUS appears an important tool for staging the disease and defining cases suitable for anti-HP, radio- and chemotherapy, as well as for the detection of local recurrence.

  14. The prevalence and impact of Fusarium head blight pathogens and mycotoxins on malting barley quality in UK

    Science.gov (United States)

    Nielsen, L.K.; Cook, D.J.; Edwards, S.G.; Ray, R.V.

    2014-01-01

    Fusarium head blight (FHB) caused by Fusarium and Microdochium species can significantly affect the yield of barley grain as well as the quality and safety of malt and beer. The present study provides new knowledge on the impacts of the FHB pathogen complex on the malting and brewing quality parameters of naturally infected barley. Quantitative real-time PCR and liquid chromatography double mass spectrometry were used to quantify the predominant FHB pathogens and Fusarium mycotoxins, respectively, in commercially grown UK malting barley samples collected between 2007 and 2011. The predominant Fusarium species identified across the years were F. poae, F. tricinctum and F. avenaceum. Microdochium majus was the predominant Microdochium species in 2007, 2008, 2010 and 2011 whilst Microdochium nivale predominated in 2009. Deoxynivalenol and zearalenone quantified in samples collected between 2007 and 2009 were associated with F. graminearum and F. culmorum, whilst HT-2 and T-2, and nivalenol in samples collected between 2010 and 2011 correlated positively with F. langsethiae and F. poae, respectively. Analysis of the regional distribution and yearly variation in samples from 2010 to 2011 showed significant differences in the composition of the FHB species complex. In most regions (Scotland, the South and North of England) the harvest in 2010 had higher concentrations of Fusarium spp. than in 2011, although no significant difference was observed in the Midlands between the two years. Microdochium DNA was significantly higher in 2011 and in the North of England and Scotland compared to the South or Midlands regions. Pathogens of the FHB complex impacted negatively on grain yield and quality parameters. Thousand grain weight of malting barley was affected significantly by M. nivale and M. majus whilst specific weight correlated negatively with F. avenaceum and F. graminearum. To determine the impact of sub-acute infections of the identified Fusarium and Microdochium

  15. Prebiotic and synbiotic effects on rats fed malted barley with selected bacteria strains

    Directory of Open Access Journals (Sweden)

    Yadong Zhong

    2014-10-01

    Full Text Available Background: Butyric acid, one of the key products formed when β-glucans are degraded by the microbiota in the colon, has been proposed to be important for colonic health. Glutamine bound to the fibre may have similar effects once it has been liberated from the fibre in the colon. Both β-glucans and glutamine are found in high amounts in malted barley. Lactobacillus rhamnosus together with malt has been shown to increase the formation of butyric acid further in rats. Objective: To investigate whether Lactobacillus rhamnosus 271, Lactobacillus paracasei 87002, Lactobacillus plantarum HEAL 9 and 19, and Bifidobacterium infantis CURE 21 affect the levels of short-chain fatty acids and glutamine in caecum and portal blood of rats fed barley malt. Design: The experimental diets were fed for 12 days. The daily dose of the probiotic strain was 1×109 colony forming units and the intake of fibre 0.82 g/day. Results: The malt mostly contained insoluble fibre polymers (93%, consisting of glucose and xylose (38–41 g/kg and some arabinose (21 g/kg. The fibre polysaccharides were quite resistant to fermentation in the rats, regardless of whether or not probiotics were added (25–30% were fermented. Caecal and portal levels of acetic acid decreased in the rats after the addition of L. plantarum HEAL 9 and L. rhamnosus 271, and also the levels of butyric acid. Viable counts of Lactobacillus, Bifidobacterium and Enterobacteriaceae were unaffected, while the caecal composition of Lactobacilli was influenced by the type of strain administrated. Portal levels of glutamine were unchanged, but glycine levels increased with L. plantarum HEAL 9 and 19 and phenylalanine with L. rhamnosus 271. Conclusions: Although the probiotic strains survived and reached the caecum, except B. infantis CURE 21, there were no effects on viable counts or in the fermentation of different fibre components, but the formation of some bacterial metabolites decreased. This may be due to

  16. MaLT - Combined Motor and Language Therapy Tool for Brain Injury Patients Using Kinect.

    Science.gov (United States)

    Wairagkar, Maitreyee; McCrindle, Rachel; Robson, Holly; Meteyard, Lotte; Sperrin, Malcom; Smith, Andy; Pugh, Moyra

    2017-03-23

    The functional connectivity and structural proximity of elements of the language and motor systems result in frequent co-morbidity post brain injury. Although rehabilitation services are becoming increasingly multidisciplinary and "integrated", treatment for language and motor functions often occurs in isolation. Thus, behavioural therapies which promote neural reorganisation do not reflect the high intersystem connectivity of the neurologically intact brain. As such, there is a pressing need for rehabilitation tools which better reflect and target the impaired cognitive networks. The objective of this research is to develop a combined high dosage therapy tool for language and motor rehabilitation. The rehabilitation therapy tool developed, MaLT (Motor and Language Therapy), comprises a suite of computer games targeting both language and motor therapy that use the Kinect sensor as an interaction device. The games developed are intended for use in the home environment over prolonged periods of time. In order to track patients' engagement with the games and their rehabilitation progress, the game records patient performance data for the therapist to interrogate. MaLT incorporates Kinect-based games, a database of objects and language parameters, and a reporting tool for therapists. Games have been developed that target four major language therapy tasks involving single word comprehension, initial phoneme identification, rhyme identification and a naming task. These tasks have 8 levels each increasing in difficulty. A database of 750 objects is used to programmatically generate appropriate questions for the game, providing both targeted therapy and unique gameplay every time. The design of the games has been informed by therapists and by discussions with a Public Patient Involvement (PPI) group. Pilot MaLT trials have been conducted with three stroke survivors for the duration of 6 to 8 weeks. Patients' performance is monitored through MaLT's reporting facility

  17. Mucosa-associated lymphoid tissue (MALT lymphoma of the stomach: features of pathomorphological diagnostics

    Directory of Open Access Journals (Sweden)

    V. A. Tumanskiy

    2013-04-01

    Full Text Available On the base of our own observations and literature data it was determined that the distinctive pathologic features of MALT-lymphoma of the stomach are the presence of a dense diffuse lymphocytic infiltrate of centrocyte-like tumor cells of marginal zone (small cells resembling centrocytes with distinct bright rim of cytoplasm, with small nuclei of irregular shape, sometimes – split, containing coarse chromatin and indistinct nucleoli in the lamina propria between the reactive lymph follicles and glands of the mucous membrane, monocytoid B-lymphocytes characterized by clear cell borders, broad light cytoplasm and bean-like nucleus, plasma cells, which may contain Dutcher bodies – intranuclear inclusions of immunoglobulins; single large centroblast-like or immunoblast-like cells having round-oval or slightly irregular in shape nuclei with 1-3 nucleoli, or vesicular-like round in shape nuclei with compact, centrally located nucleolus; small lymphocytes. Infiltration looks as tumorcell layers or, more rarely, fuzzy nodular cellular formations. An important diagnostic criterion is the presence of "lymphoepithelial lesions" zones of glands due to infiltration by 3 or more centrocyte-like tumor cell aggregates with glands’ basement membranes destruction. In the damaged glands epithelium edema and eosinophilia are marked, but if extensive infiltration is present among the lymphoid infiltrate there are only clusters of degenerated cells at the site of destroyed epithelium. Low-grade MALT-lymphoma is characterized by the absence of distinct macroscopic changes and the prevalence of "mature" tumor cells over the blasts in histological picture. MALT-lymphoma with signs of transformation into high-grade lymphoma is characterized macroscopically by distinct exophytic component, hyperplasia of folds with ulcerous defects up to 1-2 cm in diameter. Histologic picture displays a significant amount of blast cells – both in the infiltrate and in the areas

  18. Genome-wide characterization of microRNA in foxtail millet (Setaria italica).

    Science.gov (United States)

    Yi, Fei; Xie, Shaojun; Liu, Yuwei; Qi, Xin; Yu, Jingjuan

    2013-12-13

    MicroRNAs (miRNAs) are a class of short non-coding, endogenous RNAs that play key roles in many biological processes in both animals and plants. Although many miRNAs have been identified in a large number of organisms, the miRNAs in foxtail millet (Setaria italica) have, until now, been poorly understood. In this study, two replicate small RNA libraries from foxtail millet shoots were sequenced, and 40 million reads representing over 10 million unique sequences were generated. We identified 43 known miRNAs, 172 novel miRNAs and 2 mirtron precursor candidates in foxtail millet. Some miRNA*s of the known and novel miRNAs were detected as well. Further, eight novel miRNAs were validated by stem-loop RT-PCR. Potential targets of the foxtail millet miRNAs were predicted based on our strict criteria. Of the predicted target genes, 79% (351) had functional annotations in InterPro and GO analyses, indicating the targets of the miRNAs were involved in a wide range of regulatory functions and some specific biological processes. A total of 69 pairs of syntenic miRNA precursors that were conserved between foxtail millet and sorghum were found. Additionally, stem-loop RT-PCR was conducted to confirm the tissue-specific expression of some miRNAs in the four tissues identified by deep-sequencing. We predicted, for the first time, 215 miRNAs and 447 miRNA targets in foxtail millet at a genome-wide level. The precursors, expression levels, miRNA* sequences, target functions, conservation, and evolution of miRNAs we identified were investigated. Some of the novel foxtail millet miRNAs and miRNA targets were validated experimentally.

  19. Radiosynoviorthesis in osteoarthritis of finger joints

    International Nuclear Information System (INIS)

    Moedder, G.

    2006-01-01

    This is an overview about osteoarthritis of the finger joints. The scientific publications according to the therapy of this disease by means of radiosynoviorthesis are presented, comparing the results in rheumatoid arthritis. Additionally own experience and results are reported. (orig.)

  20. Two-finger (TF) SPUDT cells.

    Science.gov (United States)

    Martin, Guenter; Biryukov, Sergey V; Schmidt, Hagen; Steiner, Bernd; Wall, Bert

    2011-03-01

    SPUDT cells including two fingers are only known thus far for so-called NSPUDT directions. In that case, usual solid-finger cells are used. The purpose of the present paper is to find SPUDT cell types consisting of two fingers only for pure mode directions. Two-finger (TF) cells for pure mode directions on substrates like 128°YX LiNbO(3) and YZ LiNbO(3) were found by means of an optimization procedure. The forward direction of a TF-cell SPUDT on 128°YX LiNbO(3) was determined experimentally. The properties of the new cells are compared with those of conventional SPUDT cells. The reflectivity of TF cells on 128°YX LiNbO(3) turns out to be two to three times larger than that of distributed acoustic reflection transducer (DART) and Hanma-Hunsinger cells at the same metal layer thickness.

  1. Finger prosthesis: a boon to handicapped.

    Science.gov (United States)

    Gupta, Ridhima; Kumar, Lakshya; Rao, Jitendra; Singh, Kamleshwar

    2013-08-29

    This is a clinical case report of a 52-year-old male patient with four partially missing fingers of the left hand. The article describes the clinical and laboratory procedure of making prosthesis with modern silicone material. A wax pattern was fabricated using the right hand of the patient. A special type of wax was formulated to make the pattern so that it can be easily moulded and carved. Intrinsic and extrinsic staining was also performed to match the adjacent skin colour. The patient was given the finger prosthesis and was asked to use a half glove (sports) to mask the junction between the prosthesis and the normal tissue. It also provides additional retention to the artificial fingers. The patient felt his social acceptance improved after wearing the finger prosthesis.

  2. Stainless steel quadralatch finger test report

    International Nuclear Information System (INIS)

    Deichelbohrer, P.R.

    1996-01-01

    The design of the quadralatch on the universal samplers was changed in response to flammable gas operating constraints. Additional redesign of the fingers was included to facilitate manufacturability. The new design was tested to assure satisfactory performance. It was shown that the fingers can hold a sampler in place with an upward force of at least 2200 N (500 pounds) and that the mechanical remote latch unit can release the quadralatch under this condition of maximum upward force

  3. Helicobacter pylori and Gastric Mucosa-associated Lymphoid Tissue (MALT) Lymphoma: Updated Review of Clinical Outcomes and the Molecular Pathogenesis.

    Science.gov (United States)

    Suzuki, Hidekazu; Saito, Yoshimasa; Hibi, Toshifumi

    2009-06-01

    In most H. pylori-positive patients, gastric low-grade mucosa-associated lymphoid tissue (MALT) lymphomas regress both endoscopically and histopathologically after H. pylori eradication, but no factors that can be predictive of the response to the eradication have been definitively identified, and there is little information on how to determine the optimal observation period before additional treatment can be started. Here, clinical studies dealing with the diagnosis and treatment of gastric MALT lymphomas and H. pylori published during the last 5 years were systematically reviewed, and studies identifying the molecular approaches involved in the pathogenesis were summarized. Most of the clinical studies indicate a favorable effect of H. pylori eradication on the clinical outcome of gastric MALT lymphomas. Some studies suggest the necessity of additional treatment in nonresponders to H. pylori eradication, while others suggest the adoption of a watch-and-wait strategy. The molecular characteristics of MALT lymphomas could play an important role in prognostic prediction and the selection of further therapeutic intervention after the eradication. This updated review of gastric MALT lymphomas illustrates the potential efficacy of H. pylori eradication in tumor remission, but further molecular characterization is necessary to establish the most suitable therapeutic strategy for patients who do not respond to eradication.

  4. Effect of sorghum type and malting on production of free amino nitrogen in conjunction with exogenous protease enzymes.

    Science.gov (United States)

    Dlamini, Bhekisisa C; Buys, Elna M; Taylor, John R N

    2015-01-01

    Sorghum types suitable for brewing and bioethanol production are required. The effect of sorghum type (white non-tannin versus white type II tannin) on free amino nitrogen (FAN) production from sorghum grain and malt using exogenous protease enzymes was investigated over extended incubation at moderate temperature (45 °C). With grain in the absence of exogenous proteases, white non-tannin sorghum produced substantially higher levels of FAN than white type II tannin sorghum, due to the tannins in the latter. Incubating sorghum grain with neutral proteinase and amino-peptidase in combination improved FAN production. The two sorghum types produced similar FAN levels when malted and incubated in the absence of the exogenous proteases. When both sorghums were malted and incubated with neutral proteinase alone substantially more FAN yield (124-126 mg 100 g(-1)) occurred than with grains (61-84 mg 100 g(-1)). The combination of amino-peptidase and proteinase did not improve FAN further. Neither, did malting influence wort free amino acid profile. Group B amino acids constituted the highest percentage (42-47%). With grain, white non-tannin sorghum plus proteinase and amino-peptidase yields the highest FAN, with malt both white non-tannin and white type II tannin sorghums plus proteinase yield the highest FAN. © 2014 Society of Chemical Industry.

  5. Genetic diversity and population structure of elite foxtail millet [Setaria italica (L.) P. Beauv.] germplasm in China

    Science.gov (United States)

    China is among the countries that have the most severe water deficiency. Due to its excellent drought tolerance, foxtail millet [Setaria italica (L.) P. Beauv.] has become one of the important cereal crops in China. Information on genetic diversity and population structure of foxtail millet may faci...

  6. Genome-wide identification, phylogeny and expression analyses of SCARECROW-LIKE(SCL) genes in millet (Setaria italica).

    Science.gov (United States)

    Liu, Hongyun; Qin, Jiajia; Fan, Hui; Cheng, Jinjin; Li, Lin; Liu, Zheng

    2017-07-01

    As a member of the GRAS gene family, SCARECROW - LIKE ( SCL ) genes encode transcriptional regulators that are involved in plant information transmission and signal transduction. In this study, 44 SCL genes including two SCARECROW genes in millet were identified to be distributed on eight chromosomes, except chromosome 6. All the millet genes contain motifs 6-8, indicating that these motifs are conserved during the evolution. SCL genes of millet were divided into eight groups based on the phylogenetic relationship and classification of Arabidopsis SCL genes. Several putative millet orthologous genes in Arabidopsis , maize and rice were identified. High throughput RNA sequencing revealed that the expressions of millet SCL genes in root, stem, leaf, spica, and along leaf gradient varied greatly. Analyses combining the gene expression patterns, gene structures, motif compositions, promoter cis -elements identification, alternative splicing of transcripts and phylogenetic relationship of SCL genes indicate that the these genes may play diverse functions. Functionally characterized SCL genes in maize, rice and Arabidopsis would provide us some clues for future characterization of their homologues in millet. To the best of our knowledge, this is the first study of millet SCL genes at the genome wide level. Our work provides a useful platform for functional analysis of SCL genes in millet, a model crop for C 4 photosynthesis and bioenergy studies.

  7. Effect of food processing of pearl millet (Pennisetum glaucum) IKMP-5 on the level of phenolics, phytate, iron and zinc

    NARCIS (Netherlands)

    Zanabria Eyzaguirre, R.; Nienaltowska, K.; Jong, de L.E.Q.; Hasenack, B.B.E.; Nout, M.J.R.

    2006-01-01

    Pearl millet is consumed as a staple food in semi-arid tropical regions. With a view to upgrading the micronutrient status of pearl millet-based foods, the effects of single operations and of porridge preparation scenarios on levels and in vitro solubility (IVS) of iron and zinc and mineral

  8. Genome sequence of foxtail millet (Setaria italica) provides insights into grass evolution and biofuel potential

    DEFF Research Database (Denmark)

    Zhang, Gengyun; Liu, Xin; Quan, Zhiwu

    2012-01-01

    Foxtail millet (Setaria italica), a member of the Poaceae grass family, is an important food and fodder crop in arid regions and has potential for use as a C(4) biofuel. It is a model system for other biofuel grasses, including switchgrass and pearl millet. We produced a draft genome (∼423 Mb) an...

  9. Finger Search in the Implicit Model

    DEFF Research Database (Denmark)

    Brodal, Gerth Stølting; Nielsen, Jesper Asbjørn Sindahl; Truelsen, Jakob

    2012-01-01

    We address the problem of creating a dictionary with the finger search property in the strict implicit model, where no information is stored between operations, except the array of elements. We show that for any implicit dictionary supporting finger searches in q(t) = Ω(logt) time, the time to move...... the finger to another element is Ω(q− 1(logn)), where t is the rank distance between the query element and the finger. We present an optimal implicit static structure matching this lower bound. We furthermore present a near optimal implicit dynamic structure supporting search, change-finger, insert......, and delete in times $\\mathcal{O}(q(t))$, $\\mathcal{O}(q^{-1}(\\log n)\\log n)$, $\\mathcal{O}(\\log n)$, and $\\mathcal{O}(\\log n)$, respectively, for any q(t) = Ω(logt). Finally we show that the search operation must take Ω(logn) time for the special case where the finger is always changed to the element...

  10. Finger replantation: surgical technique and indications.

    Science.gov (United States)

    Barbary, S; Dap, F; Dautel, G

    2013-12-01

    In this article, we discuss the surgical technique of finger replantation in detail, distinguishing particularities of technique in cases of thumb amputation, children fingertip replantation, ring finger avulsion, and very distal replantations. We emphasize the principles of bone shortening, the spare part concept, the special importance of nerve sutures and the use of vein graft in case of avulsion or crushing. However, even if finger replantation is now a routine procedure, a clear distinction should be made between revascularization and functional success. The indications for finger replantation are then detailed in the second part of this paper. The absolute indications for replantation are thumb, multiple fingers, transmetacarpal or hand, and any upper extremity amputation in a child whatever the level. Fingertip amputations distal to the insertion of the Flexor digitorum superficialis (FDS) are also a good indication. Other cases are more controversial because of the poor functional outcome, especially for the index finger, which is often functionally excluded. Copyright © 2013. Published by Elsevier SAS.

  11. Evaluation of milled pearl millet in the feeding of growing rabbits

    Directory of Open Access Journals (Sweden)

    Fernanda Catelan

    2012-08-01

    Full Text Available Two experiments were carried out in order to estimate the nutritional value and the performance of growing rabbits fed different levels of pearl millet (ADR 7010. In the digestibility trial, nutritional values of pearl millet were determined in 22 45-day-old New Zealand White rabbits, allotted in a completely randomized design, subjected to two treatments - a reference diet and a test diet with 70% of its volume composed of reference diet and 30% of pearl millet - and 11 replications. The apparent digestibility values of dry matter, crude protein, neutral detergent fiber and gross energy of the pearl millet were 88.7, 85.4, 24.4 and 75.0%, respectively. In the performance trial, 120 32-day-old New Zealand White rabbits were used. Rabbits were allotted in a completely randomized design and subjected to six treatments, with 10 replications and two animals for each experimental unit. The diets were formulated with increasing levels of pearl millet (20, 40, 60, 80 and 100%, substituting the corn in the reference diet, according to the digestible energy. No differences were observed in daily feed intake, daily weight gain, feed conversion, carcass traits and feed cost per kilogram of rabbit. Regardless of the amount of corn substituted, pearl can replace corn in diets for growing rabbits.

  12. Characterization of Pearl Millet Root Architecture and Anatomy Reveals Three Types of Lateral Roots

    Science.gov (United States)

    Passot, Sixtine; Gnacko, Fatoumata; Moukouanga, Daniel; Lucas, Mikaël; Guyomarc’h, Soazig; Ortega, Beatriz Moreno; Atkinson, Jonathan A.; Belko, Marème N.; Bennett, Malcolm J.; Gantet, Pascal; Wells, Darren M.; Guédon, Yann; Vigouroux, Yves; Verdeil, Jean-Luc; Muller, Bertrand; Laplaze, Laurent

    2016-01-01

    Pearl millet plays an important role for food security in arid regions of Africa and India. Nevertheless, it is considered an orphan crop as it lags far behind other cereals in terms of genetic improvement efforts. Breeding pearl millet varieties with improved root traits promises to deliver benefits in water and nutrient acquisition. Here, we characterize early pearl millet root system development using several different root phenotyping approaches that include rhizotrons and microCT. We report that early stage pearl millet root system development is characterized by a fast growing primary root that quickly colonizes deeper soil horizons. We also describe root anatomical studies that revealed three distinct types of lateral roots that form on both primary roots and crown roots. Finally, we detected significant variation for two root architectural traits, primary root lenght and lateral root density, in pearl millet inbred lines. This study provides the basis for subsequent genetic experiments to identify loci associated with interesting early root development traits in this important cereal. PMID:27379124

  13. Development of non-lodging mutants through gamma irradiation in little millet (Panicum sumatrense Roth.)

    International Nuclear Information System (INIS)

    Nirmalakumari, A.; Muthiah, A.R.; Senthil, N.; Souframanien, J.

    2009-01-01

    The little millet is widely cultivated as a millet crop across India, China, Sri Lanka, Nepal and Western Burma. Being the first crop to be harvested in the season, it produces the much needed food grain among the tribals and is the staple food for millions in many parts of the world. It is resilient and can adjust to diverse growing environments differing in soil, rainfall and weather. The grain is a good source of nutrients. Variability in a population decides the scope for selection particularly when it is controlled more by genetic factors rather than by environment. The grain yield of millet and macromutants for high productive tillering, ear head length, compactness, bold grain and non lodging of little millet can be improved through gamma rays. The experimental materials consisted of M6 mutants of CO 3 and CO (samai) 4 varieties irradiated with 300, 400, 500, 600 and 700 Gray of gamma rays from 60 Co, source at BARC, Mumbai and conducted at Millet Breeding Station, Centre for Plant Breeding and Genetics, Tamil Nadu Agricultural University, Coimbatore 641003, India. From M6 generation finally six best non- lodging mutants were selected and subjected to multilocation trials for studying their stability. (author)

  14. Water fluxes in maize, millet and soybean plant-residue mulches used in direct seeding

    International Nuclear Information System (INIS)

    Silva, Fernando Antonio Macena da; Pinto, Hilton Silveira; Scopel, Eric; Corbeels, Marc; Affholder, Francois

    2006-01-01

    The objective of this work was to evaluate the effects of crop residue mulches from maize, millet and soybean on water storage capacity, water evaporation, soil cover, solar radiation interception and surface water run-off as well as to incorporate these effects in a crop growth model. The mulch of millet and maize presented higher capacity for water storage than soybean mulch: 3.26, 3.24 and 2.62 g of water per gram of dry matter, respectively. Water losses from wet mulches were related to the potential evapotranspiration. The soil cover levels were similar among the three types of material. The three types of mulch intercepted similar quantities of photosynthetically active radiation and infrared radiation. The mulch of maize straw was slightly more efficient in intercepting radiation than that from millet or soybean. Mulching with millet residues was efficient in the control of surface water run-off: only 45.5 mm of water (out of 843.5 mm rainfall) was lost through runoff under the no-till system with millet as cover crop, whereas 222.5 mm of water was lost in the conventional system with tillage. Most of the relations derived in this work could be described by exponential models. (author)

  15. Foxtail millet: nutritional and eating quality, and prospects for genetic improvement

    Directory of Open Access Journals (Sweden)

    Lu HE,Bin ZHANG,Xingchun WANG,Hongying LI,Yuanhuai HAN

    2015-06-01

    Full Text Available Foxtail millet is a minor yet important crop in some areas of the world, particularly northern China. It has strong adaptability to abiotic stresses, especially drought, and poor soil. It also has high nutritional value. Foxtail millet is rich in essential amino acids, fatty acids and minerals, and is considered to be one of the most digestible and non-allergenic grains available and has significant importance for human health. Given foxtail milletrsquo;s ability to adapt to abiotic stresses associated with climate change, it is more important than ever to develop breeding strategies that facilitate the increasing demand for high quality grain that better satisfies consumers. Here we review research on foxtail millet quality evaluation, appearance, cooking and eating quality at the phenotypic level. We review analysis of the main nutrients in foxtail millet, their relationships and the biochemical and genetic factors affecting their accumulation. In addition, we review past progress in breeding this regionally important crop, outline current status of breeding of foxtail millet, and make suggestions to improve grain quality.

  16. IRON STATUS OF WOMEN OF REPRODUCTIVE AGE LIVING IN PEARL MILLET CONSUMING AREAS OF BANASKANTHA, GUJARAT

    Directory of Open Access Journals (Sweden)

    Vanisha S Nambiar

    2015-12-01

    Full Text Available Anemia is a major health problem in India, especially among women and children (NFHS III, 2006.  The Indian Council of medical Research study reported the prevalence of anemia among pregnant women was 84.9% and in adolescent girls was 90.1% based on their study from 16 districts of India (Food and Nutrition Bulletin, 2006.   Pearl millet (Pennisetum glaucum (Bajra, grown extensively in the arid and semi-arid tropical regions of the world, is one of the most important cereals for food security and consumed as a staple food for rural and tribal population dwelling in this area. Pearl millet has high amounts of iron (8mg/100g, NIN 2010 along with several other factors such as phytates, oxalates and polyphones, which may decrease the bio available iron. IFPRI (Pray and Nagarjan, 2009 has identified Banaskantha, district in Gujarat as one of the important pearl millet producing belts of India. The present study aimed to assess the background information, morbidity profile and dietary intake focusing on the pearl millet consumption of women residing in the pearl millet producing belts of Banaskantha and to assess the status and immunity profile from a subsample of this population.

  17. Differential gene expression in foxtail millet during incompatible interaction with Uromyces setariae-italicae.

    Directory of Open Access Journals (Sweden)

    Zhi Yong Li

    Full Text Available Foxtail millet (Setaria italica is an important food and fodder grain crop that is grown for human consumption. Production of this species is affected by several plant diseases, such as rust. The cultivar Shilixiang has been identified as resistant to the foxtail millet rust pathogen, Uromyces setariae-italicae. In order to identify signaling pathways and genes related to the plant's defense mechanisms against rust, the Shilixiang cultivar was used to construct a digital gene expression (DGE library during the interaction of foxtail millet with U. setariae-italicae. In this study, we determined the most abundant differentially expressed signaling pathways of up-regulated genes in foxtail millet and identified significantly up-regulated genes. Finally, quantitative real-time polymerase chain reaction (qRT-PCR analysis was used to analyze the expression of nine selected genes, and the patterns observed agreed well with DGE analysis. Expression levels of the genes were also compared between a resistant cultivar Shilixiang and a susceptible cultivar Yugu-1, and the result indicated that expression level of Shilixiang is higher than that of Yugu-1. This study reveals the relatively comprehensive mechanisms of rust-responsive transcription in foxtail millet.

  18. IRON STATUS OF WOMEN OF REPRODUCTIVE AGE LIVING IN PEARL MILLET CONSUMING AREAS OF BANASKANTHA, GUJARAT

    Directory of Open Access Journals (Sweden)

    Vanisha S Nambiar

    2015-01-01

    Full Text Available Anemia is a major health problem in India, especially among women and children (NFHS III, 2006.  The Indian Council of medical Research study reported the prevalence of anemia among pregnant women was 84.9% and in adolescent girls was 90.1% based on their study from 16 districts of India (Food and Nutrition Bulletin, 2006. Pearl millet (Pennisetum glaucum (Bajra, grown extensively in the arid and semi-arid tropical regions of the world, is one of the most important cereals for food security and consumed as a staple food for rural and tribal population dwelling in this area. Pearl millet has high amounts of iron (8mg/100g, NIN 2010 along with several other factors such as phytates, oxalates and polyphones, which may decrease the bio available iron. IFPRI (Pray and Nagarjan, 2009 has identified Banaskantha, district in Gujarat as one of the important pearl millet producing belts of India. The present study aimed to assess the background information, morbidity profile and dietary intake focusing on the pearl millet consumption of women residing in the pearl millet producing belts of Banaskantha and to assess the status and immunity profile from a subsample of this population.

  19. Transcriptomic analysis, genic SSR development, and genetic diversity of proso millet (Panicum miliaceum; Poaceae).

    Science.gov (United States)

    Hou, Siyu; Sun, Zhaoxia; Li, Yaoshen; Wang, Yijie; Ling, Hubin; Xing, Guofang; Han, Yuanhuai; Li, Hongying

    2017-07-01

    Proso millet ( Panicum miliaceum ; Poaceae) is a minor crop with good nutritional qualities and strong tolerance to drought stress and soil infertility. However, studies on genetic diversity have been limited due to a lack of efficient genetic markers. Illumina sequencing technology was used to generate short read sequences of proso millet, and de novo transcriptome assemblies were used to develop a de novo assembly of proso millet. Genic simple sequence repeat (SSR) markers were identified and used to detect polymorphism among 56 accessions. Population structure and genetic similarity coefficient were estimated. In total, 25,341 unique gene sequences and 4724 SSR loci were obtained from the transcriptome, of which 229 pairs of SSR primers were validated, which resulted in 14 polymorphic genic SSR primers exhibiting 43 total alleles. According to the ratio of polymorphic markers (6.1%, 14/229), there are potentially 288 polymorphic genic SSR markers available for genetic assay development in the future. Bayesian population analyses showed that the 56 accessions comprised two distinct groups. A genetic structure and cluster assay indicated that the accessions from the Loess Plateau of China shared a high genetic similarity coefficient with those from other regions and that there was no correlation between genetic diversity and geographic origin. The transcriptome sequencing data and millet-specific SSR markers developed in this study establish an excellent resource for gene discovery and may improve the development of breeding programs in proso millet in the future.

  20. Transcriptomic analysis, genic SSR development, and genetic diversity of proso millet (Panicum miliaceum; Poaceae)1

    Science.gov (United States)

    Hou, Siyu; Sun, Zhaoxia; Li, Yaoshen; Wang, Yijie; Ling, Hubin; Xing, Guofang; Han, Yuanhuai; Li, Hongying

    2017-01-01

    Premise of the study: Proso millet (Panicum miliaceum; Poaceae) is a minor crop with good nutritional qualities and strong tolerance to drought stress and soil infertility. However, studies on genetic diversity have been limited due to a lack of efficient genetic markers. Methods: Illumina sequencing technology was used to generate short read sequences of proso millet, and de novo transcriptome assemblies were used to develop a de novo assembly of proso millet. Genic simple sequence repeat (SSR) markers were identified and used to detect polymorphism among 56 accessions. Population structure and genetic similarity coefficient were estimated. Results: In total, 25,341 unique gene sequences and 4724 SSR loci were obtained from the transcriptome, of which 229 pairs of SSR primers were validated, which resulted in 14 polymorphic genic SSR primers exhibiting 43 total alleles. According to the ratio of polymorphic markers (6.1%, 14/229), there are potentially 288 polymorphic genic SSR markers available for genetic assay development in the future. Bayesian population analyses showed that the 56 accessions comprised two distinct groups. Discussion: A genetic structure and cluster assay indicated that the accessions from the Loess Plateau of China shared a high genetic similarity coefficient with those from other regions and that there was no correlation between genetic diversity and geographic origin. The transcriptome sequencing data and millet-specific SSR markers developed in this study establish an excellent resource for gene discovery and may improve the development of breeding programs in proso millet in the future. PMID:28791202

  1. Health promoting properties of Alternanthera brasiliana leaves and Hibiscus sabdariffa calyces used in fortification of maize-bambara groundnut malt and maize-cowpea malt complementary foods

    Directory of Open Access Journals (Sweden)

    Attaugwu, R.N.

    2017-06-01

    Full Text Available The study evaluated the chemical and antioxidant properties of Alternanthera brasiliana leaves and Hibiscus sabdariffa calyces used in iron and zinc fortification of maizebambara groundnut malt and maize-cowpea malt complementary foods. A. brasiliana leaves and H. sabdariffa calyces were freshly harvested, dried at 50oC for 48 hours and analyzed for the relevant chemical components and antioxidant activities. The vitamin A content was 6996 and 745.6 μgRE/kg while the vitamin C was 238.26 and 294.78 mg/kg respectively. The aqueous extracts of A. brasiliana and H. sabdariffa calyces contained 509.5 mg/kg and 5234.72 mg/kg of alkaloids, 1545 mg/kg and 384 mg/kg of anthocyanins, 767.3 and 235.83 mg/kg of carotenoids, 14,702.8 and 26,428.3 mg/kg of phenols, 1043.5 and 897.63 mg/kg steroids and 462.0 mg/kg and 1006.5 mg/kg of flavonoids respectively. A. brasiliana and H. sabdariffa extracts had concentration-dependent DPPH activity with IC50 of 1.76 mg/ml and 5.745 mg/ml, nitric oxide scavenging activity with IC50 of 0.675 mg/ml and 3.976 mg/ml while the ferric reducing power had an absorbance range of 0.5 – 0.982 and 0.959 – 0.986 respectively. The study revealed that A.brasiliana leaves and H. sabdariffa calyces contain components that will impact positively on the health of the infants when used to formulate complementary foods.

  2. New Finger Biometric Method Using Near Infrared Imaging

    Science.gov (United States)

    Lee, Eui Chul; Jung, Hyunwoo; Kim, Daeyeoul

    2011-01-01

    In this paper, we propose a new finger biometric method. Infrared finger images are first captured, and then feature extraction is performed using a modified Gaussian high-pass filter through binarization, local binary pattern (LBP), and local derivative pattern (LDP) methods. Infrared finger images include the multimodal features of finger veins and finger geometries. Instead of extracting each feature using different methods, the modified Gaussian high-pass filter is fully convolved. Therefore, the extracted binary patterns of finger images include the multimodal features of veins and finger geometries. Experimental results show that the proposed method has an error rate of 0.13%. PMID:22163741

  3. Finger multibiometric cryptosystems: fusion strategy and template security

    Science.gov (United States)

    Peng, Jialiang; Li, Qiong; Abd El-Latif, Ahmed A.; Niu, Xiamu

    2014-03-01

    We address two critical issues in the design of a finger multibiometric system, i.e., fusion strategy and template security. First, three fusion strategies (feature-level, score-level, and decision-level fusions) with the corresponding template protection technique are proposed as the finger multibiometric cryptosystems to protect multiple finger biometric templates of fingerprint, finger vein, finger knuckle print, and finger shape modalities. Second, we theoretically analyze different fusion strategies for finger multibiometric cryptosystems with respect to their impact on security and recognition accuracy. Finally, the performance of finger multibiometric cryptosystems at different fusion levels is investigated on a merged finger multimodal biometric database. The comparative results suggest that the proposed finger multibiometric cryptosystem at feature-level fusion outperforms other approaches in terms of verification performance and template security.

  4. Development of eSSR-Markers in Setaria italica and Their Applicability in Studying Genetic Diversity, Cross-Transferability and Comparative Mapping in Millet and Non-Millet Species.

    Directory of Open Access Journals (Sweden)

    Kajal Kumari

    Full Text Available Foxtail millet (Setariaitalica L. is a tractable experimental model crop for studying functional genomics of millets and bioenergy grasses. But the limited availability of genomic resources, particularly expressed sequence-based genic markers is significantly impeding its genetic improvement. Considering this, we attempted to develop EST-derived-SSR (eSSR markers and utilize them in germplasm characterization, cross-genera transferability and in silico comparative mapping. From 66,027 foxtail millet EST sequences 24,828 non-redundant ESTs were deduced, representing ~16 Mb, which revealed 534 (~2% eSSRs in 495 SSR containing ESTs at a frequency of 1/30 kb. A total of 447 pp were successfully designed, of which 327 were mapped physically onto nine chromosomes. About 106 selected primer pairs representing the foxtail millet genome showed high-level of cross-genera amplification at an average of ~88% in eight millets and four non-millet species. Broad range of genetic diversity (0.02-0.65 obtained in constructed phylogenetic tree using 40 eSSR markers demonstrated its utility in germplasm characterizations and phylogenetics. Comparative mapping of physically mapped eSSR markers showed considerable proportion of sequence-based orthology and syntenic relationship between foxtail millet chromosomes and sorghum (~68%, maize (~61% and rice (~42% chromosomes. Synteny analysis of eSSRs of foxtail millet, rice, maize and sorghum suggested the nested chromosome fusion frequently observed in grass genomes. Thus, for the first time we had generated large-scale eSSR markers in foxtail millet and demonstrated their utility in germplasm characterization, transferability, phylogenetics and comparative mapping studies in millets and bioenergy grass species.

  5. Development of eSSR-Markers in Setaria italica and Their Applicability in Studying Genetic Diversity, Cross-Transferability and Comparative Mapping in Millet and Non-Millet Species.

    Science.gov (United States)

    Kumari, Kajal; Muthamilarasan, Mehanathan; Misra, Gopal; Gupta, Sarika; Subramanian, Alagesan; Parida, Swarup Kumar; Chattopadhyay, Debasis; Prasad, Manoj

    2013-01-01

    Foxtail millet (Setariaitalica L.) is a tractable experimental model crop for studying functional genomics of millets and bioenergy grasses. But the limited availability of genomic resources, particularly expressed sequence-based genic markers is significantly impeding its genetic improvement. Considering this, we attempted to develop EST-derived-SSR (eSSR) markers and utilize them in germplasm characterization, cross-genera transferability and in silico comparative mapping. From 66,027 foxtail millet EST sequences 24,828 non-redundant ESTs were deduced, representing ~16 Mb, which revealed 534 (~2%) eSSRs in 495 SSR containing ESTs at a frequency of 1/30 kb. A total of 447 pp were successfully designed, of which 327 were mapped physically onto nine chromosomes. About 106 selected primer pairs representing the foxtail millet genome showed high-level of cross-genera amplification at an average of ~88% in eight millets and four non-millet species. Broad range of genetic diversity (0.02-0.65) obtained in constructed phylogenetic tree using 40 eSSR markers demonstrated its utility in germplasm characterizations and phylogenetics. Comparative mapping of physically mapped eSSR markers showed considerable proportion of sequence-based orthology and syntenic relationship between foxtail millet chromosomes and sorghum (~68%), maize (~61%) and rice (~42%) chromosomes. Synteny analysis of eSSRs of foxtail millet, rice, maize and sorghum suggested the nested chromosome fusion frequently observed in grass genomes. Thus, for the first time we had generated large-scale eSSR markers in foxtail millet and demonstrated their utility in germplasm characterization, transferability, phylogenetics and comparative mapping studies in millets and bioenergy grass species.

  6. A haplotype map of genomic variations and genome-wide association studies of agronomic traits in foxtail millet (Setaria italica).

    Science.gov (United States)

    Jia, Guanqing; Huang, Xuehui; Zhi, Hui; Zhao, Yan; Zhao, Qiang; Li, Wenjun; Chai, Yang; Yang, Lifang; Liu, Kunyan; Lu, Hengyun; Zhu, Chuanrang; Lu, Yiqi; Zhou, Congcong; Fan, Danlin; Weng, Qijun; Guo, Yunli; Huang, Tao; Zhang, Lei; Lu, Tingting; Feng, Qi; Hao, Hangfei; Liu, Hongkuan; Lu, Ping; Zhang, Ning; Li, Yuhui; Guo, Erhu; Wang, Shujun; Wang, Suying; Liu, Jinrong; Zhang, Wenfei; Chen, Guoqiu; Zhang, Baojin; Li, Wei; Wang, Yongfang; Li, Haiquan; Zhao, Baohua; Li, Jiayang; Diao, Xianmin; Han, Bin

    2013-08-01

    Foxtail millet (Setaria italica) is an important grain crop that is grown in arid regions. Here we sequenced 916 diverse foxtail millet varieties, identified 2.58 million SNPs and used 0.8 million common SNPs to construct a haplotype map of the foxtail millet genome. We classified the foxtail millet varieties into two divergent groups that are strongly correlated with early and late flowering times. We phenotyped the 916 varieties under five different environments and identified 512 loci associated with 47 agronomic traits by genome-wide association studies. We performed a de novo assembly of deeply sequenced genomes of a Setaria viridis accession (the wild progenitor of S. italica) and an S. italica variety and identified complex interspecies and intraspecies variants. We also identified 36 selective sweeps that seem to have occurred during modern breeding. This study provides fundamental resources for genetics research and genetic improvement in foxtail millet.

  7. Physical, chemical and sensory properties of gluten-free kibbeh formulated with millet flour (Pennisetum glaucum (L. R. Br.

    Directory of Open Access Journals (Sweden)

    Tcherena Amorim Brasil

    2015-06-01

    Full Text Available Pearl millet flour was utilized in kibbeh formulations instead of whole-wheat flour. Physicochemical properties, oxidation stability and sensorial characteristics of control kibbeh made with whole-wheat flour (CT were compared with kibbehs prepared with millet flour (roasted or wet and stored for 90 days (–18 °C. Kibbeh prepared with millet flour presented good oxidation stability (TBARS concentration. Baked kibbehs (with roasted millet flour presented good acceptability and kibbeh samples did not differ significantly (p > 0.05 from the whole-wheat flour sample, when global appearance, texture and flavor were evaluated. Millet flour could be a suitable ingredient for kibbeh formulations, maintaining their nutritional value and sensorial quality in addition to being a gluten-free product.

  8. A Survey of Viral Diseases of Proso Millet (Panicum miliaceum L. and Sorghum (Sorghum bicolor L. in South Korea

    Directory of Open Access Journals (Sweden)

    Hyun-Geun Min

    2017-09-01

    Full Text Available Throughout year 2015 to 2016, 101 proso millet and 200 sorghum samples were collected from five provinces in South Korea. The samples were subjected to paired-end RNA sequencing and further analyzed by RT-PCR. The results indicated that Rice black-streaked dwarf virus (RBSDV was detected from sorghum collected in Gyeongsang province. The other four viruses, including RBSDV, Rice stripe virus (RSV, Barley virus G (BVG, and Cereal yellow dwarf virus (CYDV, were detected from proso millet. Among four viruses, both RSV and RBSDV were identified high frequency from proso millet collected from Gyeongsang province. Otherwise, BVG was nearly equally identified from five provinces, suggesting that the virus was supposedly widespread nationwide. RBSDV was first identified from both proso millet and sorghum in South Korea. The other virus annotated CYDV identified proso millet was shown to have relatively low identities compared to CYDV previously reported, suggesting that the virus might be new member of Polerovirus.

  9. Rehabilitation of single finger amputation with customized silicone prosthesis

    OpenAIRE

    Yadav, Niharika; Chand, Pooran; Jurel, Sunit Kumar

    2016-01-01

    Finger amputations are common in accidents at home, work, and play. Apart from trauma, congenital disease and deformity also leads to finger amputation. This results in loss of function, loss of sensation as well as loss of body image. Finger prosthesis offers psychological support and social acceptance in such cases. This clinical report describes a method to fabricate ring retained silicone finger prosthesis in a patient with partial finger loss.

  10. Finger tapping ability in healthy elderly and young adults.

    Science.gov (United States)

    Aoki, Tomoko; Fukuoka, Yoshiyuki

    2010-03-01

    The maximum isometric force production capacity of the fingers decreases with age. However, little information is available on age-related changes in dynamic motor capacity of individual fingers. The purpose of this study was to compare the dynamic motor function of individual fingers between elderly and young adults using rapid single-finger and double-finger tapping. Fourteen elderly and 14 young adults performed maximum frequency tapping by the index, middle, ring, or little finger (single-finger tapping) and with alternate movements of the index-middle, middle-ring, or ring-little finger-pair (double-finger tapping). The maximum pinch force between the thumb and each finger, tactile sensitivity of each fingertip, and time taken to complete a pegboard test were also measured. Compared with young subjects, the older subjects had significantly slower tapping rates in all fingers and finger-pairs in the tapping tasks. The age-related decline was also observed in the tactile sensitivities of all fingers and in the pegboard test. However, there was no group difference in the pinch force of any finger. The tapping rate of each finger did not correlate with the pinch force or tactile sensitivity for the corresponding finger in the elderly subjects. Maximum rate of finger tapping was lower in the elderly adults compared with the young adults. The decline of finger tapping ability in elderly adults seems to be less affected by their maximum force production capacities of the fingers as well as tactile sensitivities at the tips of the fingers.

  11. Natural Contamination with Mycotoxins Produced by Fusarium graminearum and Fusarium poae in Malting Barley in Argentina

    Science.gov (United States)

    Nogueira, María Soledad; Decundo, Julieta; Martinez, Mauro; Dieguez, Susana Nelly; Moreyra, Federico; Moreno, Maria Virginia

    2018-01-01

    Two of the most common species of toxin-producing Fusarium contaminating small cereal grains are Fusarium graminearum and F. poae; with both elaborating diverse toxins, especially deoxynivalenol (DON) and nivalenol (NIV), respectively. The objective of our work during the 2012–2014 growing seasons was to screen crops for the most commonly isolated Fusarium species and to quantify DON and NIV toxins in natural malting-barley samples from different producing areas of Argentina. We identified 1180 Fusarium isolates in the 119 samples analyzed, with 51.2% being F. graminearum, 26.2% F. poae and 22.6% other species. We found high concentrations of mycotoxins, at maximum values of 12 μg/g of DON and 7.71 μg/g of NIV. Of the samples, 23% exhibited DON at an average of 2.36 μg/g, with 44% exceeding the maximum limits (average of 5.24 μg/g); 29% contained NIV at an average of 2.36 μg/g; 7% contained both DON and NIV; and 55% were without DON or NIV. Finally, we report the mycotoxin contamination of the grain samples produced by F. graminearum and F. poae, those being the most frequent Fusarium species present. We identified the main Fusarium species affecting natural malting-barley grains in Argentina and documented the presence of many samples with elevated concentrations of DON and NIV. To our knowledge, the investigation reported here was the first to quantify the contamination by Fusarium and its toxins in natural samples of malting barley in Argentina. PMID:29439459

  12. Natural Contamination with Mycotoxins Produced by Fusarium graminearum and Fusarium poae in Malting Barley in Argentina

    Directory of Open Access Journals (Sweden)

    María Soledad Nogueira

    2018-02-01

    Full Text Available Two of the most common species of toxin-producing Fusarium contaminating small cereal grains are Fusarium graminearum and F. poae; with both elaborating diverse toxins, especially deoxynivalenol (DON and nivalenol (NIV, respectively. The objective of our work during the 2012–2014 growing seasons was to screen crops for the most commonly isolated Fusarium species and to quantify DON and NIV toxins in natural malting-barley samples from different producing areas of Argentina. We identified 1180 Fusarium isolates in the 119 samples analyzed, with 51.2% being F. graminearum, 26.2% F. poae and 22.6% other species. We found high concentrations of mycotoxins, at maximum values of 12 μg/g of DON and 7.71 μg/g of NIV. Of the samples, 23% exhibited DON at an average of 2.36 μg/g, with 44% exceeding the maximum limits (average of 5.24 μg/g; 29% contained NIV at an average of 2.36 μg/g; 7% contained both DON and NIV; and 55% were without DON or NIV. Finally, we report the mycotoxin contamination of the grain samples produced by F. graminearum and F. poae, those being the most frequent Fusarium species present. We identified the main Fusarium species affecting natural malting-barley grains in Argentina and documented the presence of many samples with elevated concentrations of DON and NIV. To our knowledge, the investigation reported here was the first to quantify the contamination by Fusarium and its toxins in natural samples of malting barley in Argentina.

  13. Fear and Fascination in the Big City: Rilke's Use of George Simmel in The Notebooks of Malte Laurids Brigge

    Directory of Open Access Journals (Sweden)

    Neil H. Donahue

    1992-06-01

    Full Text Available This essay examines Rainer Maria Rilke's The Notebooks of Malte Laurids Brigge (1910 as one corner in a triangle of reciprocal influence and affinity in early twentieth-century modernity consisting of Rilke, the sociologist Georg Simmel, and the art theorist Wilhelm Worringer. In the notes, this essay documents the biographical relations among the three, but in its text it demonstrates through textual analysis how Rilke's descriptions of Malte in Paris enact Simmel's categories of psychological response for man in the metropolis, as delineated in his essay "The Metropolis and Mental Life"(1903. Rilke's descriptions of Malte's attempts to overcome his fears of the metropolis coincide then with Worringer's thesis in his Abstraction and Empathy (1908 on the psychological origins of abstract art and Joseph Frank's later elaboration of that thesis into an aesthetics of spatial form.

  14. Effects of nitrogen application rate on dry matter redistribution, grain yield, nitrogen use efficiency and photosynthesis in malting barley

    DEFF Research Database (Denmark)

    Cai, J; Jiang, D; Wollenweber, Bernd

    2012-01-01

    The harmonious combination of malting barley yield, quality and nitrogen (N) use-efficiency under nitrogen (N) rates applications was greatly conducive to production in China. The malting barley cultivar Supi 3 was planted during the growing seasons 2005 and 2006 at two contrasting sites in China....... Five nitrogen (N) application rates (0, 75, 150, 225 and 300 kg ha−1) were applied for research of effects of N rates application on grain yield, protein content and N use-efficiency. At both sites and in both years, grain yield increased with increasing N application rates up to 225 kg N ha−1...... with a quadrant model, the optimum N application rates for high grain yield with high nitrogen use-efficiency in malting barley could be indicated. So, the higher yields could be mainly ascribed to the higher accumulation of photoassimilates between anthesis and maturity. In order to achieve high grain yield...

  15. Une activité sous contrôle : l’esclavage à Malte à l’époque moderne

    OpenAIRE

    Brogini, Anne

    2014-01-01

    La pratique de l’esclavage n’est pas nouvelle pour les Hospitaliers de Saint-Jean de Jérusalem à l’époque moderne, ni pour l’île de Malte. Mais l’essor formidable de l’activité corsaire aux xvie et xviie siècles transforme Malte en plaque-tournante de l’esclavage méditerranéen. L’arrivée massive d’esclaves non-chrétiens, puis leur résidence dans le port conduit l’Ordre de Malte à structurer et à règlementer progressivement la pratique corsaire et commerciale (modes et lieux de capture, lieux ...

  16. 18F-FDG PET/CT in gastric MALT lymphoma: a bicentric experience

    Energy Technology Data Exchange (ETDEWEB)

    Albano, Domenico; Bertoli, Mattia [Nuclear Medicine, Spedali Civili Brescia, Brescia (Italy); University Milano-Bicocca, Milan (Italy); Ferro, Paola [University Milano-Bicocca, Milan (Italy); Fallanca, Federico; Gianolli, Luigi; Picchio, Maria [IRCCS San Raffaele Scientific Institute, Department of Nuclear Medicine, Milan (Italy); Giubbini, Raffaele; Bertagna, Francesco [University of Brescia and Spedali Civili Brescia, Nuclear Medicine, Brescia (Italy)

    2017-04-15

    The role of 18F-FDG-PET/CT in evaluating gastric MALT lymphoma is still controversial. In the literature the detection rate of 18F-FDG-PET/CT in patients with gastric MALT lymphoma is variable, and the reason for this heterogeneity is not still clear. Our aim was to investigate the particular metabolic behavior of these lymphoma. Sixty-nine patients (26 female, 43 male) with histologically confirmed gastric MALT lymphoma who underwent a 18F-FDG-PET/CT for initial staging from two centers were included. The PET images were analyzed visually and semi-quantitatively by measuring the maximum standardized uptake value (SUVmax), lesion-to-liver SUVmax ratio, and lesion-to-blood pool SUVmax ratio and compared with Ann Arbor stage, epidemiological (age, sex), histological (presence of gastritis, ulcer, H. pylori infection, plasmacytic differentiation, Ki-67 index), and morphological (tumor size, superficial lesions or mass-forming) characteristics. Thirty-six patients (52 %) had positive PET/CT (average SUVmax was 9±6.7; lesion-to-liver SUVmax ratio 3.7±2.6, lesion-to-blood pool SUVmax ratio 4.8±3.3) at the corresponding gastric lesion; the remaining 33 were not 18F-FDG-avid. In the univariate analysis, 18F-FDG avidity was significantly associated with morphological features (mass forming p<0.001 and high maximum diameter p<0.001), Ann Arbor stage (p=0.010), and Ki67 index (p<0.001) and not correlated with age, sex, presence of gastritis, ulcer, Helicobacter pylori infection, and plasmacytic differentiation. In the multivariate analysis, the correlations with gross morphological appearance, Ann Arbor stage, and Ki-67 score were confirmed. SUVmax, lesion-to-liver SUVmax ratio, and lesion-to-blood pool SUVmax ratio correlated significantly only with Ki67 index (p=0.047; p=0.012; p=0.042). 18F-FDG avidity was noted in 52 % of gastric MALT lymphoma and this avidity is correlated with gross morphological characteristics, tumor stage, and Ki-67 index. SUVmax, lesion

  17. 18F-FDG PET/CT in gastric MALT lymphoma: a bicentric experience

    International Nuclear Information System (INIS)

    Albano, Domenico; Bertoli, Mattia; Ferro, Paola; Fallanca, Federico; Gianolli, Luigi; Picchio, Maria; Giubbini, Raffaele; Bertagna, Francesco

    2017-01-01

    The role of 18F-FDG-PET/CT in evaluating gastric MALT lymphoma is still controversial. In the literature the detection rate of 18F-FDG-PET/CT in patients with gastric MALT lymphoma is variable, and the reason for this heterogeneity is not still clear. Our aim was to investigate the particular metabolic behavior of these lymphoma. Sixty-nine patients (26 female, 43 male) with histologically confirmed gastric MALT lymphoma who underwent a 18F-FDG-PET/CT for initial staging from two centers were included. The PET images were analyzed visually and semi-quantitatively by measuring the maximum standardized uptake value (SUVmax), lesion-to-liver SUVmax ratio, and lesion-to-blood pool SUVmax ratio and compared with Ann Arbor stage, epidemiological (age, sex), histological (presence of gastritis, ulcer, H. pylori infection, plasmacytic differentiation, Ki-67 index), and morphological (tumor size, superficial lesions or mass-forming) characteristics. Thirty-six patients (52 %) had positive PET/CT (average SUVmax was 9±6.7; lesion-to-liver SUVmax ratio 3.7±2.6, lesion-to-blood pool SUVmax ratio 4.8±3.3) at the corresponding gastric lesion; the remaining 33 were not 18F-FDG-avid. In the univariate analysis, 18F-FDG avidity was significantly associated with morphological features (mass forming p<0.001 and high maximum diameter p<0.001), Ann Arbor stage (p=0.010), and Ki67 index (p<0.001) and not correlated with age, sex, presence of gastritis, ulcer, Helicobacter pylori infection, and plasmacytic differentiation. In the multivariate analysis, the correlations with gross morphological appearance, Ann Arbor stage, and Ki-67 score were confirmed. SUVmax, lesion-to-liver SUVmax ratio, and lesion-to-blood pool SUVmax ratio correlated significantly only with Ki67 index (p=0.047; p=0.012; p=0.042). 18F-FDG avidity was noted in 52 % of gastric MALT lymphoma and this avidity is correlated with gross morphological characteristics, tumor stage, and Ki-67 index. SUVmax, lesion

  18. Meningoencefalite necrotizante de cão Maltês Necrotizing meningoencephalitis of Maltese dog

    Directory of Open Access Journals (Sweden)

    Kalan Bastos Violin

    2008-06-01

    Full Text Available A Meningoencefalite Necrotizante (MEN é uma encefalopatia causada por uma disfunção inflamatória de característica necrotizante. O objetivo deste relato é descrever os aspectos clínicos e anatomopatológicos da Meningoencefalite Necrotizante (MEN em um cão Maltês. A doença tem um caráter necrótico único e está relacionada intimamente à Encefalite do Cão Pug (ECP devido a suas semelhanças, bem como à Leucoencefalite Necrotizante (LEN. Embora o primeiro relato de caso de ECP tenha mais de 15 anos e o primeiro relato de caso de MEN em Maltês tenha 11 anos, há muito a ser revelado sobre a etiologia e os mecanismos imunopatológicos da doença. Neste trabalho, relata-se o caso de um cão Maltês com sinais que foram compatíveis com a MEN. Foram detectadas nas imagens macroscópicas, cavitação cerebral, e na microscopia, perda de células do parênquima em certas regiões do córtex cerebral. A partir dessas descobertas descreve-se o primeiro caso de MEN em cão Maltês no Brasil.The Necrotizing Meningoencephalitis (NME is an encephalopathy caused by an inflammatory dysfunction with necrotic characterization. The aim of this report is to describe the anatomopathological features of the NME in a Maltese dog. The disease has a unique necrotic pattern and is closely related to Pug Dog Encephalitis (PDE because of their similarity as well as to Necrotizing Leukoencephalitis (NLE. Although the first PDE report has more than 15 years and the first Maltese NME report has 11 years there is a lot to be unveiled about the etiologic and the immunopathologic mechanisms of the disease. Here we report one case of a Maltese dog with signs that were compatible with NME. The gross morphology pictures with the cerebral cavitation and the histological loss of parenchymal cells in some regions of the cerebral cortex were detected. Based on these findings, we describe the first case of NME in Maltese dog in Brazil.

  19. Social capital and transaction costs in millet markets.

    Science.gov (United States)

    Jacques, Damien Christophe; Marinho, Eduardo; d'Andrimont, Raphaël; Waldner, François; Radoux, Julien; Gaspart, Frédéric; Defourny, Pierre

    2018-01-01

    In sub-Saharan Africa, transaction costs are believed to be the most significant barrier that prevents smallholders and farmers from gaining access to markets and productive assets. In this study, we explore the impact of social capital on millet prices for three contrasted years in Senegal. Social capital is approximated using a unique data set on mobile phone communications between 9 million people allowing to simulate the business network between economic agents. Our approach is a spatial equilibrium model that integrates a diversified set of data. Local supply and demand were respectively derived from remotely sensed imagery and population density maps. The road network was used to establish market catchment areas, and transportation costs were derived from distances between markets. Results demonstrate that accounting for the social capital in the transaction costs explained 1-9% of the price variance depending on the year. The year-specific effect remains challenging to assess but could be related to a strengthening of risk aversion following a poor harvest.

  20. Social capital and transaction costs in millet markets

    Directory of Open Access Journals (Sweden)

    Damien Christophe Jacques

    2018-01-01

    Full Text Available In sub-Saharan Africa, transaction costs are believed to be the most significant barrier that prevents smallholders and farmers from gaining access to markets and productive assets. In this study, we explore the impact of social capital on millet prices for three contrasted years in Senegal. Social capital is approximated using a unique data set on mobile phone communications between 9 million people allowing to simulate the business network between economic agents. Our approach is a spatial equilibrium model that integrates a diversified set of data. Local supply and demand were respectively derived from remotely sensed imagery and population density maps. The road network was used to establish market catchment areas, and transportation costs were derived from distances between markets. Results demonstrate that accounting for the social capital in the transaction costs explained 1–9% of the price variance depending on the year. The year-specific effect remains challenging to assess but could be related to a strengthening of risk aversion following a poor harvest.

  1. Characterization of Barnyard Millet Starch Films Containing Borage Seed Oil

    Directory of Open Access Journals (Sweden)

    Thi Luyen Cao

    2017-11-01

    Full Text Available In this study, barnyard millet starch (BMS was used to prepare edible films. Antioxidant activity was conferred to the BMS film by incorporating borage seed oil (BO. The physical, optical, and thermal properties as well as antioxidant activities of the films were evaluated. The incorporation of BO into the BMS films decreased the tensile strength from 9.46 to 4.69 MPa and increased the elongation at break of the films from 82.49% to 103.87%. Water vapor permeability, water solubility, and moisture content of the BMS films decreased with increasing BO concentration, whereas Hunter b value and opacity increased, L and a values of the films decreased. The BMS films containing BO exhibited antioxidant activity that increased proportionally with increased BO concentration. In particular, the BMS film with 1.0% BO exhibited the highest antioxidant activity and light barrier properties among the BMS films. Therefore, the BMS films with added BO can be used as an antioxidant packaging material.

  2. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica.

    Directory of Open Access Journals (Sweden)

    Shui-Lian He

    Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  3. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

    Science.gov (United States)

    He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

    2015-01-01

    Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  4. Design and preliminary evaluation of the FINGER rehabilitation robot: controlling challenge and quantifying finger individuation during musical computer game play.

    Science.gov (United States)

    Taheri, Hossein; Rowe, Justin B; Gardner, David; Chan, Vicki; Gray, Kyle; Bower, Curtis; Reinkensmeyer, David J; Wolbrecht, Eric T

    2014-02-04

    This paper describes the design and preliminary testing of FINGER (Finger Individuating Grasp Exercise Robot), a device for assisting in finger rehabilitation after neurologic injury. We developed FINGER to assist stroke patients in moving their fingers individually in a naturalistic curling motion while playing a game similar to Guitar Hero. The goal was to make FINGER capable of assisting with motions where precise timing is important. FINGER consists of a pair of stacked single degree-of-freedom 8-bar mechanisms, one for the index and one for the middle finger. Each 8-bar mechanism was designed to control the angle and position of the proximal phalanx and the position of the middle phalanx. Target positions for the mechanism optimization were determined from trajectory data collected from 7 healthy subjects using color-based motion capture. The resulting robotic device was built to accommodate multiple finger sizes and finger-to-finger widths. For initial evaluation, we asked individuals with a stroke (n = 16) and without impairment (n = 4) to play a game similar to Guitar Hero while connected to FINGER. Precision design, low friction bearings, and separate high speed linear actuators allowed FINGER to individually actuate the fingers with a high bandwidth of control (-3 dB at approximately 8 Hz). During the tests, we were able to modulate the subject's success rate at the game by automatically adjusting the controller gains of FINGER. We also used FINGER to measure subjects' effort and finger individuation while playing the game. Test results demonstrate the ability of FINGER to motivate subjects with an engaging game environment that challenges individuated control of the fingers, automatically control assistance levels, and quantify finger individuation after stroke.

  5. Admittance Control of a Multi-Finger Arm Based on Manipulability of Fingers

    Directory of Open Access Journals (Sweden)

    Jian Huang

    2011-09-01

    Full Text Available In the previous studies, admittance control and impedance control for a finger-arm robot using the manipulability of the finger were studied and methods of realizing the controls have been proposed. In this study, two 3-DOF fingers are attached to the end-effector of a 6-DOF arm to configure a multi-finger arm robot. Based on the previous methods, the authors have proposed an admittance control for a multi-finger arm robot using the manipulability of the fingers in this study. Algorithms of the averaging method and the mini-max method were introduced to establish a manipulability criterion of the two fingers in order to generate a cooperative movement of the arm. Comparison of the admittance controls combined with the top search method and local optimization method for the multi-finger arm robot was made and features of the control methods were also discussed. The stiffness control and damping control were experimentally evaluated to demonstrate the effectiveness of the proposed methods.

  6. Quantifying Parkinson's disease finger-tapping severity by extracting and synthesizing finger motion properties.

    Science.gov (United States)

    Sano, Yuko; Kandori, Akihiko; Shima, Keisuke; Yamaguchi, Yuki; Tsuji, Toshio; Noda, Masafumi; Higashikawa, Fumiko; Yokoe, Masaru; Sakoda, Saburo

    2016-06-01

    We propose a novel index of Parkinson's disease (PD) finger-tapping severity, called "PDFTsi," for quantifying the severity of symptoms related to the finger tapping of PD patients with high accuracy. To validate the efficacy of PDFTsi, the finger-tapping movements of normal controls and PD patients were measured by using magnetic sensors, and 21 characteristics were extracted from the finger-tapping waveforms. To distinguish motor deterioration due to PD from that due to aging, the aging effect on finger tapping was removed from these characteristics. Principal component analysis (PCA) was applied to the age-normalized characteristics, and principal components that represented the motion properties of finger tapping were calculated. Multiple linear regression (MLR) with stepwise variable selection was applied to the principal components, and PDFTsi was calculated. The calculated PDFTsi indicates that PDFTsi has a high estimation ability, namely a mean square error of 0.45. The estimation ability of PDFTsi is higher than that of the alternative method, MLR with stepwise regression selection without PCA, namely a mean square error of 1.30. This result suggests that PDFTsi can quantify PD finger-tapping severity accurately. Furthermore, the result of interpreting a model for calculating PDFTsi indicated that motion wideness and rhythm disorder are important for estimating PD finger-tapping severity.

  7. Robotic finger perturbation training improves finger postural steadiness and hand dexterity.

    Science.gov (United States)

    Yoshitake, Yasuhide; Ikeda, Atsutoshi; Shinohara, Minoru

    2018-02-01

    The purpose of the study was to understand the effect of robotic finger perturbation training on steadiness in finger posture and hand dexterity in healthy young adults. A mobile robotic finger training system was designed to have the functions of high-speed mechanical response, two degrees of freedom, and adjustable loading amplitude and direction. Healthy young adults were assigned to one of the three groups: random perturbation training (RPT), constant force training (CFT), and control. Subjects in RPT and CFT performed steady posture training with their index finger using the robot in different modes: random force in RPT and constant force in CFT. After the 2-week intervention period, fluctuations of the index finger posture decreased only in RPT during steady position-matching tasks with an inertial load. Purdue pegboard test score improved also in RPT only. The relative change in finger postural fluctuations was negatively correlated with the relative change in the number of completed pegs in the pegboard test in RPT. The results indicate that finger posture training with random mechanical perturbations of varying amplitudes and directions of force is effective in improving finger postural steadiness and hand dexterity in healthy young adults. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Primary Breast Mucosa-Associated Lymphoid Tissue (MALT Lymphoma Transformation to Diffuse Large B-cell Lymphoma: A Case Report

    Directory of Open Access Journals (Sweden)

    Şerife Hülya Arslan

    2012-09-01

    Full Text Available Primary non-Hodgkin’s lymphoma (NHL of the breast constitutes 0.04%-0.53% of all malignancies and 2.2% of extra nodal lymphomas. In total, 7%-8% of all B-cell lymphomas are the mucosa-associated lymphoid tissue (MALT type, of which up to 50% of primary gastric MALT lymphoma. Herein we present a patient with breast MALT lymphoma that transformed to diffuse large B-cell lymphoma (DLBCL. A 69-year-old female presented with a mass on her left breast. Physical examination showed a 3 × 3-cm mass located 1 cm from the areola on the upper lateral quadrant of the breast at the 1 o’clock position, which was fixed and firm. Excisional biopsy was performed and pathologic examination of the specimen showed MALT lymphoma transformation to DLBCL. The patient was staged as II-EA. The rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisolone (R-CHOP protocol was scheduled as treatment. Following 6 courses of R-CHOP, 2 additional courses of rituximab were administered. Positron emission tomography (PET-CT was done at the end of the treatment. PET showed that the patient was in complete remission. At the time this report was written, the patient was being followed-up at the outpatient clinic on a regular basis. Lymphoma of the breast is a rarity among malignant tumors of the breast. The most common type of lymphoma is DLBCL. Breast MALT lymphoma is extremely rare. Primary MALT lymphoma of the breast can transform from low grade to high grade and recurrence is possible; therefore, such patients should be monitored carefully for transformation.

  9. A Novel Millet-Based Probiotic Fermented Food for the Developing World

    Directory of Open Access Journals (Sweden)

    Elisa Di Stefano

    2017-05-01

    Full Text Available Probiotic yogurt, comprised of a Fiti sachet containing Lactobacillus rhamnosus GR-1 and Streptococcus thermophilus C106, has been used in the developing world, notably Africa, to alleviate malnutrition and disease. In sub-Saharan African countries, fermentation of cereals such as millet, is culturally significant. The aim of this study was to investigate the fermentation capability of millet when one gram of the Fiti sachet consortium was added. An increase of 1.8 and 1.4 log CFU/mL was observed for S. thermophilus C106 and L. rhamnosus GR-1 when grown in 8% millet in water. Single cultures of L. rhamnosus GR-1 showed the highest μmax when grown in the presence of dextrose, galactose and fructose. Single cultures of S. thermophilus C106 showed the highest μmax when grown in the presence of sucrose and lactose. All tested recipes reached viable counts of the probiotic bacteria, with counts greater than 106 colony-forming units (CFU/mL. Notably, a number of organic acids were quantified, in particular phytic acid, which was shown to decrease when fermentation time increased, thereby improving the bioavailability of specific micronutrients. Millet fermented in milk proved to be the most favorable, according to a sensory evaluation. In conclusion, this study has shown that sachets being provided to African communities to produce fermented milk, can also be used to produce fermented millet. This provides an option for when milk supplies are short, or if communities wish to utilize the nutrient-rich qualities of locally-grown millet.

  10. Effects of processing method and solute interactions on pepsin digestibility of cooked proso millet flour.

    Science.gov (United States)

    Gulati, Paridhi; Sabillón, Luis; Rose, Devin J

    2018-07-01

    Previous studies have reported a substantial decline in in vitro digestibility of proso millet protein upon cooking. In this study, several processing techniques and cooking solutions were tested with the objective of preventing the loss in pepsin digestibility. Proso millet flour was subjected to the following processing techniques: high pressure processing (200 and 600 MPa for 5 and 20 min); germination (96 h); fermentation (48 h); roasting (dry heating); autoclaving (121 °C, 3 h), and treatment with transglutaminase (160 mg/g protein, 37 °C, 2 h). To study the interaction of millet proteins with solutes, millet flour was heated with sucrose (3-7 M); NaCl (2-6 M); and CaCl 2 (0.5-3 M). All processing treatments failed to prevent the loss in pepsin digestibility except germination and treatment with transglutaminase, which resulted in 23 and 39% increases in digestibility upon cooking, respectively, when compared with unprocessed cooked flours. Heating in concentrated solutions of sucrose and NaCl were effective in preventing the loss in pepsin digestibility, an effect that was attributed to a reduction in water activity (a w ). CaCl 2 was also successful in preventing the loss in digestibility but its action was similar to chaotrops like urea. Thus, a combination of enzymatic modification and cooking of millet flour with either naturally low a w substances or edible sources of chaotropic ions may be useful in processing of proso millet for development of novel foods without loss in digestibility. However, more research is required to determine optimum processing conditions. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. Foxtail millet: a model crop for genetic and genomic studies in bioenergy grasses.

    Science.gov (United States)

    Lata, Charu; Gupta, Sarika; Prasad, Manoj

    2013-09-01

    Foxtail millet is one of the oldest domesticated diploid C4 Panicoid crops having a comparatively small genome size of approximately 515 Mb, short life cycle, and inbreeding nature. Its two species, Setaria italica (domesticated) and Setaria viridis (wild progenitor), have characteristics that classify them as excellent model systems to examine several aspects of architectural, evolutionary, and physiological importance in Panicoid grasses especially the biofuel crops such as switchgrass and napiergrass. Foxtail millet is a staple crop used extensively for food and fodder in parts of Asia and Africa. In its long history of cultivation, it has been adapted to arid and semi-arid areas of Asia, North Africa, South and North America. Foxtail millet has one of the largest collections of cultivated as well as wild-type germplasm rich with phenotypic variations and hence provides prospects for association mapping and allele-mining of elite and novel variants to be incorporated in crop improvement programs. Most of the foxtail millet accessions can be primarily abiotic stress tolerant particularly to drought and salinity, and therefore exploiting these agronomic traits can enhance its efficacy in marker-aided breeding as well as in genetic engineering for abiotic stress tolerance. In addition, the release of draft genome sequence of foxtail millet would be useful to the researchers worldwide in not only discerning the molecular basis of biomass production in biofuel crops and the methods to improve it, but also for the introgression of beneficial agronomically important characteristics in foxtail millet as well as in related Panicoid bioenergy grasses.

  12. Evaluation of the relationship of sowing qualities and yielding properties of millet seed (Panicum meliaceum L..

    Directory of Open Access Journals (Sweden)

    С. П. Полторецький

    2016-07-01

    Full Text Available Purpose. Determination and analysis of relationship of sowing qualities and yield properties of millet seed (Panicum meliaceum L. to be formed by the action of predecessors and conditions of mineral nutrition in the context of unstable moistening in the Right-Bank Forest-Steppe zone of Ukraine. Methods. Mathematico-statistical ones (correlation, regression. Results. The use of correlation pleiades method allowed to analyze multifactor relations of sowing qualities and yield properties of millet seed and establish that there was a direct correlation relationship of medium strength (r = 0.52 ± 0.01 between yielding of maternal and millet plants of the first seed progeny. It was found that maternal plants yielding is strongly correlated with laboratory and technological indicators of seed quality that interrelated through integrated quality parameter of seed material (r = 0.56 ± 0.01 and millet output (r = 0.98 ± 0.00. Integrated quality parameter as well as each of the studied laboratory parameters of seed material quality taken separately have a high-level (r = 0.87…0.96 ± 0.00 effect on the formation of grain yield of the first seed progeny plants. Such physical and technological parameters of the quality of maternal plants yield as a content of protein and fat in seed, seed weight, its uniformity can directly, and millet output, thousand-grain weight and hull content – indirectly indicate peculiarities of forming future grain yield of plants of the first seed progeny. Conclusions. The use of the correlation pleiades method allows to analyze objectively the sowing qualities of millet seed and predict the yield properties in the next generation.

  13. Correlation of 18F-FDG PET/CT and Endoscopic Findings of Twin Mucosa-Associated Lymphoid Tissue (MALT) Lymphoma of the Stomach: Report of a Case

    International Nuclear Information System (INIS)

    Bahk, Yong Whee; Choi, Jin Wook

    2008-01-01

    Mucosa-associated lymphoid tissue (MALT) type lymphoma arises from extranodal marginal zone B-cell. It is etiologically associated with Helicobacter pylori infection and, hence, can be cured by antibiotic treatment. MALT type lymphoma is the most common variety of gastric lymphoma that is rare in the stomach). The published data of clinical studies on the usefulness of 18F-FDG PET in the diagnosis of MALT type lymphoma varied according to authors. Thus, the result of Hoffmann et al. was discouraging whereas a high diagnostic accuracy was reported by Ambrosini et al. The latter group further went to suggest that higher 18F-FDG uptake in gastric MALT type lymphoma would positively relate to the aggressiveness of neoplasm. The clinical studies conducted by other groups on MALT lymphomas of the stomach, lung, orbit and parotid gland and the stomach, lung, parotid gland, skin, orbit, mandible, esophagus and uterus confirmed that 18F-FDG scan is valuable

  14. Effects of split nitrogen fertilization on post-anthesis photoassimilates, nitrogen use efficiency and grain yield in malting barley

    DEFF Research Database (Denmark)

    Cai, Jian; Jiang, Dong; Liu, Fulai

    2011-01-01

    photosynthesis after anthesis, dry matter accumulation and assimilates remobilization, nitrogen use efficiency and grain yield to fraction of topdressed nitrogen treatments were investigated in malting barley. Net photosynthetic rate of the penultimate leaf, leaf area index and light extinction coefficient...... assimilation rate and nitrogen use efficiency resulting in higher grain yields and proper grain protein content in malting barley.......Split nitrogen applications are widely adopted to improve grain yield and enhance nitrogen use effective in crops. In a twoyear field experiment at two eco-sites, five fractions of topdressed nitrogen of 0%, 20%, 30%, 40% and 50% were implemented. Responses of radiation interception and leaf...

  15. Millet response to water and soil fertility management in the Sahelian Niger : experiments and modeling

    OpenAIRE

    Akponikpe, Pierre

    2008-01-01

    In the 400-600 mm annual rainfall zone of the Sahel, soil fertility is the main determinant of yield in rainfed millet cropping systems in all but the driest years. Numerous on-farm and on-station experiments have addressed the issue of improving soil fertility. Yet the widespread use of the experimental results is restricted by the highly site specific millet response to fertility management practices due to high spatially variable soil properties as well as high intra- and inter-annual rain...

  16. Viscoelastic fingering with a pulsed pressure signal

    International Nuclear Information System (INIS)

    Corvera Poire, E; Rio, J A del

    2004-01-01

    We derive a generalized Darcy's law in the frequency domain for a linear viscoelastic fluid flowing in a Hele-Shaw cell. This leads to an analytic expression for the dynamic permeability that has maxima which are several orders of magnitude larger than the static permeability. We then follow an argument of de Gennes (1987 Europhys. Lett. 2 195) to obtain the smallest possible finger width when viscoelasticity is important. Using this and a conservation law, we obtain the lowest bound for the width of a single finger displacing a viscoelastic fluid. When the driving force consists of a constant pressure gradient plus an oscillatory signal, our results indicate that the finger width varies in time following the frequency of the incident signal. Also, the amplitude of the finger width in time depends on the value of the dynamic permeability at the imposed frequency. When the finger is driven with a frequency that maximizes the permeability, variations in the amplitude are also maximized. This gives results that are very different for Newtonian and viscoelastic fluids. For the former ones the amplitude of the oscillation decays with frequency. For the latter ones on the other hand, the amplitude has maxima at the same frequencies that maximize the dynamic permeability

  17. Saffman-Taylor fingers with kinetic undercooling

    KAUST Repository

    Gardiner, Bennett P. J.

    2015-02-23

    © 2015 American Physical Society. The mathematical model of a steadily propagating Saffman-Taylor finger in a Hele-Shaw channel has applications to two-dimensional interacting streamer discharges which are aligned in a periodic array. In the streamer context, the relevant regularization on the interface is not provided by surface tension but instead has been postulated to involve a mechanism equivalent to kinetic undercooling, which acts to penalize high velocities and prevent blow-up of the unregularized solution. Previous asymptotic results for the Hele-Shaw finger problem with kinetic undercooling suggest that for a given value of the kinetic undercooling parameter, there is a discrete set of possible finger shapes, each analytic at the nose and occupying a different fraction of the channel width. In the limit in which the kinetic undercooling parameter vanishes, the fraction for each family approaches 1/2, suggesting that this "selection" of 1/2 by kinetic undercooling is qualitatively similar to the well-known analog with surface tension. We treat the numerical problem of computing these Saffman-Taylor fingers with kinetic undercooling, which turns out to be more subtle than the analog with surface tension, since kinetic undercooling permits finger shapes which are corner-free but not analytic. We provide numerical evidence for the selection mechanism by setting up a problem with both kinetic undercooling and surface tension and numerically taking the limit that the surface tension vanishes.

  18. Saffman-Taylor fingers with kinetic undercooling

    KAUST Repository

    Gardiner, Bennett P. J.; McCue, Scott W.; Dallaston, Michael C.; Moroney, Timothy J.

    2015-01-01

    © 2015 American Physical Society. The mathematical model of a steadily propagating Saffman-Taylor finger in a Hele-Shaw channel has applications to two-dimensional interacting streamer discharges which are aligned in a periodic array. In the streamer context, the relevant regularization on the interface is not provided by surface tension but instead has been postulated to involve a mechanism equivalent to kinetic undercooling, which acts to penalize high velocities and prevent blow-up of the unregularized solution. Previous asymptotic results for the Hele-Shaw finger problem with kinetic undercooling suggest that for a given value of the kinetic undercooling parameter, there is a discrete set of possible finger shapes, each analytic at the nose and occupying a different fraction of the channel width. In the limit in which the kinetic undercooling parameter vanishes, the fraction for each family approaches 1/2, suggesting that this "selection" of 1/2 by kinetic undercooling is qualitatively similar to the well-known analog with surface tension. We treat the numerical problem of computing these Saffman-Taylor fingers with kinetic undercooling, which turns out to be more subtle than the analog with surface tension, since kinetic undercooling permits finger shapes which are corner-free but not analytic. We provide numerical evidence for the selection mechanism by setting up a problem with both kinetic undercooling and surface tension and numerically taking the limit that the surface tension vanishes.

  19. Perceiving fingers in single-digit arithmetic problems

    Directory of Open Access Journals (Sweden)

    Ilaria eBerteletti

    2015-03-01

    Full Text Available In this study, we investigate in children the neural underpinnings of finger representation and finger movement involved in single-digit arithmetic problems. Evidence suggests that finger representation and finger-based strategies play an important role in learning and understanding arithmetic. Because different operations rely on different networks, we compared activation for subtraction and multiplication problems in independently localized finger somatosensory and motor areas and tested whether activation was related to skill. Brain activations from children between 8 and 13 years of age revealed that only subtraction problems significantly activated finger motor areas, suggesting reliance on finger-based strategies. In addition, larger subtraction problems yielded greater somatosensory activation than smaller problems, suggesting a greater reliance on finger representation for larger numerical values. Interestingly, better performance in subtraction problems was associated with lower activation in the finger somatosensory area. Our results support the importance of fine-grained finger representation in arithmetical skill and are the first neurological evidence for a functional role of the somatosensory finger area in proficient arithmetical problem solving, in particular for those problems requiring quantity manipulation. From an educational perspective, these results encourage investigating whether different finger-based strategies facilitate arithmetical understanding and encourage educational practices aiming at integrating finger representation and finger-based strategies as a tool for instilling stronger numerical sense.

  20. Perceiving fingers in single-digit arithmetic problems.

    Science.gov (United States)

    Berteletti, Ilaria; Booth, James R

    2015-01-01

    In this study, we investigate in children the neural underpinnings of finger representation and finger movement involved in single-digit arithmetic problems. Evidence suggests that finger representation and finger-based strategies play an important role in learning and understanding arithmetic. Because different operations rely on different networks, we compared activation for subtraction and multiplication problems in independently localized finger somatosensory and motor areas and tested whether activation was related to skill. Brain activations from children between 8 and 13 years of age revealed that only subtraction problems significantly activated finger motor areas, suggesting reliance on finger-based strategies. In addition, larger subtraction problems yielded greater somatosensory activation than smaller problems, suggesting a greater reliance on finger representation for larger numerical values. Interestingly, better performance in subtraction problems was associated with lower activation in the finger somatosensory area. Our results support the importance of fine-grained finger representation in arithmetical skill and are the first neurological evidence for a functional role of the somatosensory finger area in proficient arithmetical problem solving, in particular for those problems requiring quantity manipulation. From an educational perspective, these results encourage investigating whether different finger-based strategies facilitate arithmetical understanding and encourage educational practices aiming at integrating finger representation and finger-based strategies as a tool for instilling stronger numerical sense.