WorldWideScience

Sample records for malaysia phylogenetic groups

  1. Phylogenetic relationships of geckos of the Hemiphyllodactylus harterti group, a new species from Penang Island, Peninsular Malaysia, and a likely case of true cryptic speciation.

    Science.gov (United States)

    Cobos, Anthony; Grismer, L Lee; Wood, Perry L; Quah, Evan S H; Anuar, Shahrul; Muin, Mohd Abdul

    2016-05-03

    An integrative taxonomic analysis based on the mitochondrial gene ND2 and its flanking tRNAs, morphology, and color pattern indicates that a newly discovered gecko described herein as Hemiphyllodactylus cicak sp. nov. from Penang Hill on the Island of Penang, Peninsular Malaysia is a member of the H. harterti group. Hemiphyllodactylus cicak sp. nov. is most closely related to the clade composed of the sister species H. harterti from Bukit Larut, Perak in the Bintang Mountain Range and H. bintik from Gunung Tebu, Terengganu from the Timur Mountain Range. These three allopatric species form a monophyletic group that extends approximately 270 km across three isolated mountain ranges in northern Peninsular Malaysia. The molecular analysis also indicates that H. titiwangsaensis from the Titiwangsa Mountain Range is composed of three genetically distinct allopatric populations. The southern two populations from Fraser's Hill and Genting Highlands, Pahang have an uncorrected pairwise sequence divergence of 3.5% whereas these two populations have 12.4 and 12.8 % sequence divergences, respectively, from the northern population at Cameron Highlands, Pahang. Although the high sequence divergence clearly distinguishes the southern two populations from the former as a different species, all three populations are morphologically indistinguishable, leading to the hypothesis of a true, cryptic speciation event.

  2. Phylogenetic inferences of Nepenthes species in Peninsular Malaysia revealed by chloroplast (trnL intron) and nuclear (ITS) DNA sequences.

    Science.gov (United States)

    Bunawan, Hamidun; Yen, Choong Chee; Yaakop, Salmah; Noor, Normah Mohd

    2017-01-26

    The chloroplastic trnL intron and the nuclear internal transcribed spacer (ITS) region were sequenced for 11 Nepenthes species recorded in Peninsular Malaysia to examine their phylogenetic relationship and to evaluate the usage of trnL intron and ITS sequences for phylogenetic reconstruction of this genus. Phylogeny reconstruction was carried out using neighbor-joining, maximum parsimony and Bayesian analyses. All the trees revealed two major clusters, a lowland group consisting of N. ampullaria, N. mirabilis, N. gracilis and N. rafflesiana, and another containing both intermediately distributed species (N. albomarginata and N. benstonei) and four highland species (N. sanguinea, N. macfarlanei, N. ramispina and N. alba). The trnL intron and ITS sequences proved to provide phylogenetic informative characters for deriving a phylogeny of Nepenthes species in Peninsular Malaysia. To our knowledge, this is the first molecular phylogenetic study of Nepenthes species occurring along an altitudinal gradient in Peninsular Malaysia.

  3. Characterization of Escherichia coli Phylogenetic Groups ...

    African Journals Online (AJOL)

    Background: Escherichia coli strains mainly fall into four phylogenetic groups (A, B1, B2, and D) and that virulent extra‑intestinal strains mainly belong to groups B2 and D. Aim: The aim was to determine the association between phylogenetic groups of E. coli causing extraintestinal infections (ExPEC) regarding the site of ...

  4. Phylogenetic inferences of Nepenthes species in Peninsular Malaysia revealed by chloroplast (trnL intron) and nuclear (ITS) DNA sequences

    OpenAIRE

    Bunawan, Hamidun; Yen, Choong Chee; Yaakop, Salmah; Noor, Normah Mohd

    2017-01-01

    Background The chloroplastic trnL intron and the nuclear internal transcribed spacer (ITS) region were sequenced for 11 Nepenthes species recorded in Peninsular Malaysia to examine their phylogenetic relationship and to evaluate the usage of trnL intron and ITS sequences for phylogenetic reconstruction of this genus. Results Phylogeny reconstruction was carried out using neighbor-joining, maximum parsimony and Bayesian analyses. All the trees revealed two major clusters, a lowland group consi...

  5. Phylogenetic relationships of the Orang Asli and Iban of Malaysia based on maternal markers.

    Science.gov (United States)

    Ang, K C; Leow, J W H; Yeap, W K; Hood, S; Mahani, M C; Md-Zain, B M

    2011-04-12

    Malaysia remains as a crossroad of different cultures and peoples, and it has long been recognized that studying its population history can provide crucial insight into the prehistory of Southeast Asia as a whole. The earliest inhabitants were the Orang Asli in Peninsular Malaysia and the indigenous groups in Sabah and Sarawak. Although they were the earliest migrants in this region, these tribes are divided geographically by the South China Sea. We analyzed DNA sequences of 18 Orang Asli using mitochondrial DNA extracted from blood samples, each representing one sub-tribe, and from five Sarawakian Iban. Mitochondrial DNA was extracted from hair samples in order to examine relationships with the main ethnic groups in Malaysia. The D-loop region and cytochrome b genes were used as the candidate loci. Phylogenetic relationships were investigated using maximum parsimony and neighbor joining algorithms, and each tree was subjected to bootstrap analysis with 1000 replicates. Analyses of the HVS I region showed that the Iban are not a distinct group from the Orang Asli; they form a sub-clade within the Orang Asli. Based on the cytochrome b gene, the Iban clustered with the Orang Asli in the same clade. We found evidence for considerable gene flow between Orang Asli and Iban. We concluded that the Orang Asli, Iban and the main ethnic groups of Malaysia are probably derived from a common ancestor. This is in agreement with a single-route migration theory, but it does not dismiss a two-route migration theory.

  6. Virulence, serotype and phylogenetic groups of diarrhoeagenic ...

    African Journals Online (AJOL)

    Dr DADIE Thomas

    2014-02-17

    Feb 17, 2014 ... The virulence, serotype and phylogenetic traits of diarrhoeagenic Escherichia coli were detected in 502 strains isolated during digestive infections. Molecular detection of the target virulence genes, rfb gene of operon O and phylogenetic grouping genes Chua, yjaA and TSPE4.C2 was performed.

  7. Virulence, serotype and phylogenetic groups of diarrhoeagenic ...

    African Journals Online (AJOL)

    Dr DADIE Thomas

    2014-02-17

    Feb 17, 2014 ... Phylogenetic characteristics play an important role for traceability and knowledge of ... amplification reaction was performed by PCR in a 25 μl reaction ...... Hierarchical grouping to optimize an objective function. J. Am. Statist.

  8. Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

    International Nuclear Information System (INIS)

    Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

  9. Phylogenetic relationships of Malaysia's long-tailed macaques, Macaca fascicularis, based on cytochrome b sequences.

    Science.gov (United States)

    Abdul-Latiff, Muhammad Abu Bakar; Ruslin, Farhani; Fui, Vun Vui; Abu, Mohd-Hashim; Rovie-Ryan, Jeffrine Japning; Abdul-Patah, Pazil; Lakim, Maklarin; Roos, Christian; Yaakop, Salmah; Md-Zain, Badrul Munir

    2014-01-01

    Phylogenetic relationships among Malaysia's long-tailed macaques have yet to be established, despite abundant genetic studies of the species worldwide. The aims of this study are to examine the phylogenetic relationships of Macaca fascicularis in Malaysia and to test its classification as a morphological subspecies. A total of 25 genetic samples of M. fascicularis yielding 383 bp of Cytochrome b (Cyt b) sequences were used in phylogenetic analysis along with one sample each of M. nemestrina and M. arctoides used as outgroups. Sequence character analysis reveals that Cyt b locus is a highly conserved region with only 23% parsimony informative character detected among ingroups. Further analysis indicates a clear separation between populations originating from different regions; the Malay Peninsula versus Borneo Insular, the East Coast versus West Coast of the Malay Peninsula, and the island versus mainland Malay Peninsula populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo's population was distinguished from Peninsula's population (99% and 100% bootstrap value in NJ and MP respectively and 1.00 posterior probability in Bayesian trees). The East coast population was separated from other Peninsula populations (64% in NJ, 66% in MP and 0.53 posterior probability in Bayesian). West coast populations were divided into 2 clades: the North-South (47%/54% in NJ, 26/26% in MP and 1.00/0.80 posterior probability in Bayesian) and Island-Mainland (93% in NJ, 90% in MP and 1.00 posterior probability in Bayesian). The results confirm the previous morphological assignment of 2 subspecies, M. f. fascicularis and M. f. argentimembris, in the Malay Peninsula. These populations should be treated as separate genetic entities in order to conserve the genetic diversity of Malaysia's M. fascicularis. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations in Malaysia.

  10. Descriptive distribution and phylogenetic analysis of feline infectious peritonitis virus isolates of Malaysia

    Directory of Open Access Journals (Sweden)

    Arshad Habibah

    2010-01-01

    Full Text Available Abstract The descriptive distribution and phylogeny of feline coronaviruses (FCoVs were studied in cats suspected of having feline infectious peritonitis (FIP in Malaysia. Ascitic fluids and/or biopsy samples were subjected to a reverse transcription polymerase chain reaction (RT-PCR targeted for a conserved region of 3'untranslated region (3'UTR of the FCoV genome. Eighty nine percent of the sampled animals were positive for the presence of FCoV. Among the FCoV positive cats, 80% of cats were males and 64% were below 2 years of age. The FCoV positive cases included 56% domestic short hair (DSH, 40% Persian, and 4% Siamese cats. The nucleotide sequences of 10 selected amplified products from FIP cases were determined. The sequence comparison revealed that the field isolates had 96% homology with a few point mutations. The extent of homology decreased to 93% when compared with reference strains. The overall branching pattern of phylogenetic tree showed two distinct clusters, where all Malaysian isolates fall into one main genetic cluster. These findings provided the first genetic information of FCoV in Malaysia.

  11. Descriptive distribution and phylogenetic analysis of feline infectious peritonitis virus isolates of Malaysia.

    Science.gov (United States)

    Sharif, Saeed; Arshad, Siti S; Hair-Bejo, Mohd; Omar, Abdul R; Zeenathul, Nazariah A; Fong, Lau S; Rahman, Nor-Alimah; Arshad, Habibah; Shamsudin, Shahirudin; Isa, Mohd-Kamarudin A

    2010-01-06

    The descriptive distribution and phylogeny of feline coronaviruses (FCoVs) were studied in cats suspected of having feline infectious peritonitis (FIP) in Malaysia. Ascitic fluids and/or biopsy samples were subjected to a reverse transcription polymerase chain reaction (RT-PCR) targeted for a conserved region of 3'untranslated region (3'UTR) of the FCoV genome. Eighty nine percent of the sampled animals were positive for the presence of FCoV. Among the FCoV positive cats, 80% of cats were males and 64% were below 2 years of age. The FCoV positive cases included 56% domestic short hair (DSH), 40% Persian, and 4% Siamese cats. The nucleotide sequences of 10 selected amplified products from FIP cases were determined. The sequence comparison revealed that the field isolates had 96% homology with a few point mutations. The extent of homology decreased to 93% when compared with reference strains. The overall branching pattern of phylogenetic tree showed two distinct clusters, where all Malaysian isolates fall into one main genetic cluster. These findings provided the first genetic information of FCoV in Malaysia.

  12. Malaysia.

    Science.gov (United States)

    1988-08-01

    In this discussion of Malaysia, attention is directed to the following: geography; the people; history; government; political conditions; the economy; defense; foreign relations; and relations between the US and Malaysia. In 1987 Malaysia's population was estimated to be 16.5 million with an annual growth rate of 2.6%. The infant mortality rate is 25/1000 with a life expectancy of 66 years. Peninsular Malaysia borders Thailand in the north and is separated from Singapore in the south by the narrow Johore Strait. About 50% of the area is covered by tropical jungle. The population distribution is uneven, with some 13.5 of the 16.5 million residents concentrated on the Peninsular Malaysia lowlands. The Malays, the largest population group, make up 49%. Nearly 1/3 of the Malaysians are Chinese, and Malaysians of Indian descent comprise slightly over 9% of the population. The early Buddhist Malay kingdom of Srivijaya, based at what currently is Palembang, Sumatra, dominated much of the Malay Peninsula from the 9th to the 13th centuries A.D. Full European control over the sultanates of the Malay Peninsula, Sabah, and Sarawak was not achieved until the latter half of the 19th century. During British control, a well-ordered system of public administration was created, public services were extended, and large-scale rubber and tin production was developed. Colonial rule was interrupted by the Japanese invasion and occupation from 1942-45. Malaysia achieved independence on August 31, 1957, and is a constitutional monarchy, nominally headed by the Yang di-Pertuan Agong, or paramount ruler. The ruler also is the leader of the Islamic faith in Malaysia. Executive power is vested in the Cabinet, led by the prime minister. The Malaysian legal system is based on English common law. The currently ruling Barisan Nasional, formed in 1973, includes 13 parties, among them the chief components of the former Alliance, a coalition of community-based parties. Malaysia's economic record is 1

  13. Phylogenetic relationships of Malaysia's pig-tailed macaque Macaca nemestrina based on D-loop region sequences

    Science.gov (United States)

    Abdul-Latiff M. A., B.; Ampeng, A.; Yaakop, S.; Md-Zain B., M.

    2014-09-01

    Phylogenetic relationships among Malaysian pig-tailed macaques have never been established even though the data are crucial in aiding conservation plan for the species. The aims of this study is to establish the phylogenetic relationships of Macaca nemestrina in Malaysia. A total of 21 genetic samples of M. nemestrina yielding 458 bp of D-loop sequences were used in phylogenetic analyses, in addition to one sample of M. fascicularis which was used as an outgroup. Sequence character analysis revealed that D-loop locus contains 23% parsimony informative character detected among the ingroups. Further analysis indicated a clear separation between populations originating from different regions; the Malay Peninsula populations are separated from Borneo Insular population; and Perak population formed a distinctive clade within Peninsular Malaysia populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo population was distinguished from Peninsula population (100% bootstrap value in the NJ, MP, 1.00 posterior probability in Bayesian trees). Perak's population was separated from other Peninsula populations (100% in NJ, 99% in MP and 1.00 in Bayesian). D-loop region of mtDNA is proven to be a suitable locus in studying the separation of M. nemestrina at population level. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations in Malaysia.

  14. Production interdependencies and poverty reduction across ethnic groups in Malaysia

    NARCIS (Netherlands)

    Saari, M. Yusof; Dietzenbacher, Erik; Los, Bart

    2014-01-01

    Production sectors are interdependent and the benefits of output growth for poverty reduction therefore spread over the economy. The role of such interdependencies is explicitly studied in this paper. A social accounting matrix for Malaysia that distinguishes between the major ethnic groups in

  15. Genetic Diversity and Phylogenetic Relationships of Cytochrome C Oxidase Subunit I in Cimex hemipterus (Hemiptera: Cimicidae) Populations in Malaysia.

    Science.gov (United States)

    Seri Masran, Siti Nor Ain; Ab Majid, Abdul Hafiz

    2017-07-01

    The tropical bed bug is scientifically recognized as a significant public health problem. While there is an increased awareness about their resurgence by medical and life science committees, efficient bed bug management still remains unresolved. The solution may soon arise, as information about bed bugs' infestation dynamics and systematics are becoming more distinguishable. Recent developments in studies about bed bugs are based on molecular intervention by determining their genetic variation and phylogeography. The aim of this study is to assess the phylogenetic relationships and genetic diversity among the populations of tropical bed bugs inhabiting Malaysia. A molecular genotyping study was conducted with 22 tropical bed bug populations composed of three individuals per population. The mitochondrial (COI) gene was used as a marker. The data obtained were analyzed using the T-Coffee, ClustalX, MEGA 6.0, and PAUP software. The results showed one main monophyletic clade that consisted of two groups: Ch01 and Ch02. Ch02 consists of samples from the Bandar Hilir population, differing from the other populations studied by one singleton base. However, as there were no changes in the amino acid, this singleton genetic variation was considered to have no effect on genetic differentiation. Ch01 shows similarity with some sequence of Cimex hemipterus (F.) from Thailand, suggesting an international diversity connection. The disparity index apparently suggests that all isolates are homogeneous populations and are supported by the low value of the mean pairwise distance between isolates. This study will increase the knowledge about phylogeographic diversity of tropical bed bug in Malaysia. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  16. Chromosome sizes of phytoplasmas composing major phylogenetic groups and subgroups.

    Science.gov (United States)

    Marcone, C; Neimark, H; Ragozzino, A; Lauer, U; Seemüller, E

    1999-09-01

    ABSTRACT Chromosome sizes of 71 phytoplasmas belonging to 12 major phylogenetic groups including several of the aster yellows subgroups were estimated from electrophoretic mobilities of full-length chromosomes in pulsed-field gels. Considerable variation in genome size, from 660 to 1,130 kilobases (kb), was observed among aster yellows phytoplasmas. Chromosome size heterogeneity was also observed in the stolbur phytoplasma group (range 860 to 1,350 kb); in this group, isolate STOLF contains the largest chromosome found in a phytoplasma to date. A wide range of chromosome sizes, from 670 to 1,075 kb, was also identified in the X-disease group. The other phytoplasmas examined, which included members of the apple proliferation, Italian alfalfa witches' broom, faba bean phyllody, pigeon pea witches' broom, sugarcane white leaf, Bermuda grass white leaf, ash yellows, clover proliferation, and elm yellows groups, all have chromosomes smaller than 1 megabase, and the size ranges within each of these groups is narrower than in the aster yellows, stolbur, and X-disease groups. The smallest chromosome, approximately 530 kb, was found in two Bermuda grass white leaf phytoplasma isolates. This not only is the smallest mollicute chromosome found to date, but also is the smallest chromosome known for any cell. More than one large DNA band was observed in several phytoplasma preparations. Possible explanations for the occurrence of more than one band may be infection of the host plant by different phytoplasmas, the presence of more than one chromosome in the same organism, or the presence of large extrachromosomal DNA elements.

  17. Malaysia

    International Nuclear Information System (INIS)

    2002-10-01

    This document presents the energy profile of Malaysia: national organizations and energy policy (Economic Planning Unit (EPU), Ministry of Energy, Communication and Multi-media, Energy Commission); electric power companies: Tenaga National Brhd (TNB), Sarawak Electricity Supply Corporation (SESCO) and Sabah Electricity Sdn Bhd (SESB); petroleum companies: Petronas and Petronas Carigali; natural gas companies: Petronas Gas Sdn Bhd (PGSB), Malaysia LNG Ltd, Gas Malaysia Sdn Bhd and Sabah Energy Corporation (SEC) as public utility; supplies (resources, electric power, oil and gas); prices; consumption; stakes and perspectives (combined cycle power plants, Trans Thai Malaysia pipeline, refineries, Asean Grid Power project of interconnected power grids, Trans Asean Gas Pipeline (TAGP) project of interconnected gas networks, Bakun dam). (J.S.)

  18. Income Distribution across Ethnic Groups in Malaysia : Results from a New Social Accounting Matrix

    NARCIS (Netherlands)

    Saari, M. Yusof; Dietzenbacher, Erik; Los, Bart

    A new social accounting matrix is constructed for Malaysia for the year 2000 to analyze sources of income inequality among ethnic groups in Malaysia. The analysis reveals that income inequality can be decomposed into the interaction of: (i) hourly wages; (ii) working hours per week; and (iii) number

  19. Analysis of mortality trends by specific ethnic groups and age groups in Malaysia

    Science.gov (United States)

    Ibrahim, Rose Irnawaty; Siri, Zailan

    2014-07-01

    The number of people surviving until old age has been increasing worldwide. Reduction in fertility and mortality have resulted in increasing survival of populations to later life. This study examines the mortality trends among the three main ethnic groups in Malaysia, namely; the Malays, Chinese and Indians for four important age groups (adolescents, adults, middle age and elderly) for both gender. Since the data on mortality rates in Malaysia is only available in age groups such as 1-5, 5-9, 10-14, 15-19 and so on, hence some distribution or interpolation method was essential to expand it to the individual ages. In the study, the Heligman and Pollard model will be used to expand the mortality rates from the age groups to the individual ages. It was found that decreasing trend in all age groups and ethnic groups. Female mortality is significantly lower than male mortality, and the difference may be increasing. Also the mortality rates for females are different than that for males in all ethnic groups, and the difference is generally increasing until it reaches its peak at the oldest age category. Due to the decreasing trend of mortality rates, the government needs to plan for health program to support more elderly people in the coming years.

  20. Phylogenetic study of six species of Anopheles mosquitoes in Peninsular Malaysia based on inter-transcribed spacer region 2 (ITS2) of ribosomal DNA.

    Science.gov (United States)

    Sum, Jia-Siang; Lee, Wenn-Chyau; Amir, Amirah; Braima, Kamil A; Jeffery, John; Abdul-Aziz, Noraishah M; Fong, Mun-Yik; Lau, Yee-Ling

    2014-07-03

    Molecular techniques are invaluable for investigation on the biodiversity of Anopheles mosquitoes. This study aimed at investigating the spatial-genetic variations among Anopheles mosquitoes from different areas of Peninsular Malaysia, as well as deciphering evolutionary relationships of the local Anopheles mosquitoes with the mosquitoes from neighbouring countries using the anopheline ITS2 rDNA gene. Mosquitoes were collected, identified, dissected to check infection status, and DNA extraction was performed for PCR with primers targeting the ITS2 rDNA region. Sequencing was done and phylogenetic tree was constructed to study the evolutionary relationship among Anopheles mosquitoes within Peninsular Malaysia, as well as across the Asian region. A total of 133 Anopheles mosquitoes consisting of six different species were collected from eight different locations across Peninsular Malaysia. Of these, 65 ITS2 rDNA sequences were obtained. The ITS2 rDNA amplicons of the studied species were of different sizes. One collected species, Anopheles sinensis, shows two distinct pools of population in Peninsular Malaysia, suggesting evolvement of geographic race or allopatric speciation. Anopheles mosquitoes from Peninsular Malaysia show close evolutionary relationship with the Asian anophelines. Nevertheless, genetic differences due to geographical segregation can be seen. Meanwhile, some Anopheles mosquitoes in Peninsular Malaysia show vicariance, exemplified by the emergence of distinct cluster of An. sinensis population.

  1. Phylogenetic study of six species of Anopheles mosquitoes in Peninsular Malaysia based on inter-transcribed spacer region 2 (ITS2) of ribosomal DNA

    Science.gov (United States)

    2014-01-01

    Background Molecular techniques are invaluable for investigation on the biodiversity of Anopheles mosquitoes. This study aimed at investigating the spatial-genetic variations among Anopheles mosquitoes from different areas of Peninsular Malaysia, as well as deciphering evolutionary relationships of the local Anopheles mosquitoes with the mosquitoes from neighbouring countries using the anopheline ITS2 rDNA gene. Methods Mosquitoes were collected, identified, dissected to check infection status, and DNA extraction was performed for PCR with primers targeting the ITS2 rDNA region. Sequencing was done and phylogenetic tree was constructed to study the evolutionary relationship among Anopheles mosquitoes within Peninsular Malaysia, as well as across the Asian region. Results A total of 133 Anopheles mosquitoes consisting of six different species were collected from eight different locations across Peninsular Malaysia. Of these, 65 ITS2 rDNA sequences were obtained. The ITS2 rDNA amplicons of the studied species were of different sizes. One collected species, Anopheles sinensis, shows two distinct pools of population in Peninsular Malaysia, suggesting evolvement of geographic race or allopatric speciation. Conclusion Anopheles mosquitoes from Peninsular Malaysia show close evolutionary relationship with the Asian anophelines. Nevertheless, genetic differences due to geographical segregation can be seen. Meanwhile, some Anopheles mosquitoes in Peninsular Malaysia show vicariance, exemplified by the emergence of distinct cluster of An. sinensis population. PMID:24993022

  2. Malaysia

    International Nuclear Information System (INIS)

    1992-01-01

    Malaysia's oil reserves are found in 56 fields, 32 of which are in production. Gas is found in 54 fields, four of which are in production three off Sarawak and one off Terengganu. Oil reserves stand at 3.6 billion barrels and gas at 59 trillion cubic feet respectively. Malaysia's oil reserves are expected to last 12.5 years and gas reserves 73.8 years at current rates of production and consumption. Malaysia's production of crude oil increased in 1991 to 623,100 bpd, from 600,700 bpd in 1990 in response to both increased production capacity and demand. Condensates contribute an additional estimated 22,100 bpd to total output. 57% of the crude comes from 13 oil fields off Terengganu, 20% from nine fields off Sabah and 23% from 10 fields off Sarawak. (Author)

  3. Malaysia.

    Science.gov (United States)

    Van Niel, Eloise Smith; Schelander, Bjorn

    This book provides an overview of Malaysia's history and culture. The book begins with a prehistoric times and continues through nationhood. Each chapter provides background information along with student activities and project suggestions. Chapters include: (1) "Introduction"; (2) "Early Trade and Civilization"; (3) "The…

  4. Molecular Detection, Phylogenetic Analysis, and Identification of Transcription Motifs in Feline Leukemia Virus from Naturally Infected Cats in Malaysia

    Directory of Open Access Journals (Sweden)

    Faruku Bande

    2014-01-01

    Full Text Available A nested PCR assay was used to determine the viral RNA and proviral DNA status of naturally infected cats. Selected samples that were FeLV-positive by PCR were subjected to sequencing, phylogenetic analysis, and motifs search. Of the 39 samples that were positive for FeLV p27 antigen, 87.2% (34/39 were confirmed positive with nested PCR. FeLV proviral DNA was detected in 38 (97.3% of p27-antigen negative samples. Malaysian FeLV isolates are found to be highly similar with a homology of 91% to 100%. Phylogenetic analysis revealed that Malaysian FeLV isolates divided into two clusters, with a majority (86.2% sharing similarity with FeLV-K01803 and fewer isolates (13.8% with FeLV-GM1 strain. Different enhancer motifs including NF-GMa, Krox-20/WT1I-del2, BAF1, AP-2, TBP, TFIIF-beta, TRF, and TFIID are found to occur either in single, duplicate, triplicate, or sets of 5 in different positions within the U3-LTR-gag region. The present result confirms the occurrence of FeLV viral RNA and provirus DNA in naturally infected cats. Malaysian FeLV isolates are highly similar, and a majority of them are closely related to a UK isolate. This study provides the first molecular based information on FeLV in Malaysia. Additionally, different enhancer motifs likely associated with FeLV related pathogenesis have been identified.

  5. Malaysia

    International Nuclear Information System (INIS)

    2007-01-01

    Full text: Malaysia's transition from a production-based economy to a knowledge-based economy is a vital step towards achieving a developed nation status by the year 2020. A large pool of skilled labor force including those with tertiary level education is critical for Malaysia's transition to a knowledge-based economy. Malaysia's policies related to education and training emphasize the need to address the shortage and to enhance the quality of human resources, in particular human resources in science and technology. In this regard, a target has been set for a ratio of 60:40 science to arts students at the secondary school and tertiary level education institutions. The total number of post-graduate enrollment in universities will be increased to 25 per cent of total enrollment by the year 2010. Human resource with tertiary level education, especially at the post-graduate level is essential for upgrading capability in research and development (R and D). The target is to enlarge the pool of researchers from 15.6 researchers per 10,000 labor force in the year 2000 to 60 researchers per 10,000 labor force by the year 2010. The Malaysian Institute for Nuclear Technology Research (MINT), previously known as the Tun Ismail Atomic Research Centre (PUSPATI) was established in 1972 to promote nuclear science and technology development and application. Since nuclear energy is not included as one of Malaysia's energy options, MINT's programs focus on the development and application of nuclear science and technology in medicine, agriculture, industry and environment. MINT operates a 1 MW TRIGA MKII research reactor and several radiation facilities. As the largest employer of nuclear science and technology graduates, MINT has a major role in ensuring the sustainable supply of nuclear workforce and the preservation of nuclear knowledge. In this connection, MINT collaborates with institutions of higher education in the development of human resource in nuclear science and

  6. Phylogenetic groups among Klebsiella pneumoniae isolates from Brazil: relationship with antimicrobial resistance and origin.

    Science.gov (United States)

    de Melo, Maíra Espíndola Silva; Cabral, Adriane Borges; Maciel, Maria Amélia Vieira; da Silveira, Vera Magalhães; de Souza Lopes, Ana Catarina

    2011-05-01

    The objectives of this study were to determine the distribution of phylogenetic groups among Klebsiella pneumoniae isolates from Recife, Brazil and to assess the relationship between the groups and the isolation sites and resistance profile. Ninety four isolates of K. pneumoniae from hospital or community infections and from normal microbiota were analyzed by gyrA PCR-RFLP, antibiotic susceptibility, and adonitol fermentation. The results revealed the distinction of three phylogenetic groups, as it has also been reported in Europe, showing that these clusters are highly conserved within K. pneumoniae. Group KpI was dominantly represented by hospital and community isolates while groups KpII and KpIII displayed mainly normal microbiota isolates. The resistance to third generation cephalosporins, aztreonam, imipenem, amoxicillin/clavulanic acid, and streptomycin was only observed in KpI. The percentage of resistance was higher in KpI, followed by KpII and KpIII. The differences in the distribution of K. pneumoniae phylogenetic groups observed in this study suggest distinctive clinical and epidemiological characteristics among the three groups, which is important to understand the epidemiology of infections caused by this organism. This is the first study in Brazil on K. pneumoniae isolates from normal microbiota and community infections regarding the distribution of phylogenetic groups based on the gyrA gene.

  7. Population genetic structure of peninsular Malaysia Malay sub-ethnic groups.

    Science.gov (United States)

    Hatin, Wan Isa; Nur-Shafawati, Ab Rajab; Zahri, Mohd-Khairi; Xu, Shuhua; Jin, Li; Tan, Soon-Guan; Rizman-Idid, Mohammed; Zilfalil, Bin Alwi

    2011-04-05

    Patterns of modern human population structure are helpful in understanding the history of human migration and admixture. We conducted a study on genetic structure of the Malay population in Malaysia, using 54,794 genome-wide single nucleotide polymorphism genotype data generated in four Malay sub-ethnic groups in peninsular Malaysia (Melayu Kelantan, Melayu Minang, Melayu Jawa and Melayu Bugis). To the best of our knowledge this is the first study conducted on these four Malay sub-ethnic groups and the analysis of genotype data of these four groups were compiled together with 11 other populations' genotype data from Indonesia, China, India, Africa and indigenous populations in Peninsular Malaysia obtained from the Pan-Asian SNP database. The phylogeny of populations showed that all of the four Malay sub-ethnic groups are separated into at least three different clusters. The Melayu Jawa, Melayu Bugis and Melayu Minang have a very close genetic relationship with Indonesian populations indicating a common ancestral history, while the Melayu Kelantan formed a distinct group on the tree indicating that they are genetically different from the other Malay sub-ethnic groups. We have detected genetic structuring among the Malay populations and this could possibly be accounted for by their different historical origins. Our results provide information of the genetic differentiation between these populations and a valuable insight into the origins of the Malay sub-ethnic groups in Peninsular Malaysia.

  8. Population Genetic Structure of Peninsular Malaysia Malay Sub-Ethnic Groups

    Science.gov (United States)

    Hatin, Wan Isa; Nur-Shafawati, Ab Rajab; Zahri, Mohd-Khairi; Xu, Shuhua; Jin, Li; Tan, Soon-Guan; Rizman-Idid, Mohammed; Zilfalil, Bin Alwi

    2011-01-01

    Patterns of modern human population structure are helpful in understanding the history of human migration and admixture. We conducted a study on genetic structure of the Malay population in Malaysia, using 54,794 genome-wide single nucleotide polymorphism genotype data generated in four Malay sub-ethnic groups in peninsular Malaysia (Melayu Kelantan, Melayu Minang, Melayu Jawa and Melayu Bugis). To the best of our knowledge this is the first study conducted on these four Malay sub-ethnic groups and the analysis of genotype data of these four groups were compiled together with 11 other populations' genotype data from Indonesia, China, India, Africa and indigenous populations in Peninsular Malaysia obtained from the Pan-Asian SNP database. The phylogeny of populations showed that all of the four Malay sub-ethnic groups are separated into at least three different clusters. The Melayu Jawa, Melayu Bugis and Melayu Minang have a very close genetic relationship with Indonesian populations indicating a common ancestral history, while the Melayu Kelantan formed a distinct group on the tree indicating that they are genetically different from the other Malay sub-ethnic groups. We have detected genetic structuring among the Malay populations and this could possibly be accounted for by their different historical origins. Our results provide information of the genetic differentiation between these populations and a valuable insight into the origins of the Malay sub-ethnic groups in Peninsular Malaysia. PMID:21483678

  9. Phylogenetic resolution and habitat specificity of members of the Photobacterium phosphoreum species group.

    Science.gov (United States)

    Ast, Jennifer C; Dunlap, Paul V

    2005-10-01

    Substantial ambiguity exists regarding the phylogenetic status of facultatively psychrophilic luminous bacteria identified as Photobacterium phosphoreum, a species thought to be widely distributed in the world's oceans and believed to be the specific bioluminescent light-organ symbiont of several deep-sea fishes. Members of the P. phosphoreum species group include luminous and non-luminous strains identified phenotypically from a variety of different habitats as well as phylogenetically defined lineages that appear to be evolutionarily distinct. To resolve this ambiguity and to begin developing a meaningful knowledge of the geographic distributions, habitats and symbiotic relationships of bacteria in the P. phosphoreum species group, we carried out a multilocus, fine-scale phylogenetic analysis based on sequences of the 16S rRNA, gyrB and luxABFE genes of many newly isolated luminous strains from symbiotic and saprophytic habitats, together with previously isolated luminous and non-luminous strains identified as P. phosphoreum from these and other habitats. Parsimony analysis unambiguously resolved three evolutionarily distinct clades, phosphoreum, iliopiscarium and kishitanii. The tight phylogenetic clustering within these clades and the distinct separation between them indicates they are different species, P. phosphoreum, Photobacterium iliopiscarium and the newly recognized 'Photobacterium kishitanii'. Previously reported non-luminous strains, which had been identified phenotypically as P. phosphoreum, resolved unambiguously as P. iliopiscarium, and all examined deep-sea fishes (specimens of families Chlorophthalmidae, Macrouridae, Moridae, Trachichthyidae and Acropomatidae) were found to harbour 'P. kishitanii', not P. phosphoreum, in their light organs. This resolution revealed also that 'P. kishitanii' is cosmopolitan in its geographic distribution. Furthermore, the lack of phylogenetic variation within 'P. kishitanii' indicates that this facultatively

  10. Malaysia

    Directory of Open Access Journals (Sweden)

    Normi Idris Azrul

    2017-01-01

    Full Text Available Numerical models are capable of simulating various groundwater scenarios and relate it towards groundwater management. A mesh based density dependent flow model, FEFLOW is used to simulate groundwater flow and transport for a coastal island aquifer in Kg. Salang, Tioman Island, Malaysia. FEFLOW is designed to simulate 2D and 3D, variable density groundwater flow and multi-species transport. The impacts of pumping and recharge rates represented by three different groundwater scenarios, which were investigated by means of hydraulic heads, TDS concentrations and water balance components. Scenario A showed the standard saturated groundwater flow and the steady state fluid flow. Over pumping and inconsistency in recharge rate are the stresses shown in Scenarios B and C. Scenario B involved in the maximum pumping rate of 96m3 per day and recharge rate of 300mm per year has shown a drawdown of 1.5 m. Scenario C showed the extreme pumping rate of 1000m3 per day and without recharge has shown a decrease in groundwater levels of 6.3 m.and groundwater storage (50%. Scenario B presented the most promising finding compared with Scenario C. Highest hydraulic heads, lowest mass concentration and positive groundwater storage (2578.6m3/day were obtained in Scenario B. Additionally, and further progress is needed in obtaining the water usage data from each part to determine the best pumping rate. A sustainable groundwater management plan is crucial to maintain the natural resources and social benefits as well as to protect the ecological balance.

  11. The Effect of Group Differences among Church-Related Youth in Indonesia, Malaysia, and Singapore.

    Science.gov (United States)

    Pedersen, Paul

    1983-01-01

    Examines the influence of nationality, ethnicity, language, and beliefs on priority concerns among church related college students in Indonesia (N=122), Malaysia and Singapore (N=341). Results confirm the importance of traditional values with less agreement between groups about peers and adults. Implications for counselors are discussed. (JAC)

  12. Phylogenetics of the Phlebotomine Sand Fly Group Verrucarum (Diptera: Psychodidae: Lutzomyia)

    Science.gov (United States)

    Cohnstaedt, Lee W.; Beati, Lorenza; Caceres, Abraham G.; Ferro, Cristina; Munstermann, Leonard E.

    2011-01-01

    Within the sand fly genus Lutzomyia, the Verrucarum species group contains several of the principal vectors of American cutaneous leishmaniasis and human bartonellosis in the Andean region of South America. The group encompasses 40 species for which the taxonomic status, phylogenetic relationships, and role of each species in disease transmission remain unresolved. Mitochondrial cytochrome c oxidase I (COI) phylogenetic analysis of a 667-bp fragment supported the morphological classification of the Verrucarum group into series. Genetic sequences from seven species were grouped in well-supported monophyletic lineages. Four species, however, clustered in two paraphyletic lineages that indicate conspecificity—the Lutzomyia longiflocosa–Lutzomyia sauroida pair and the Lutzomyia quasitownsendi–Lutzomyia torvida pair. COI sequences were also evaluated as a taxonomic tool based on interspecific genetic variability within the Verrucarum group and the intraspecific variability of one of its members, Lutzomyia verrucarum, across its known distribution. PMID:21633028

  13. Phylogenetics of the phlebotomine sand fly group Verrucarum (Diptera: Psychodidae: Lutzomyia).

    Science.gov (United States)

    Cohnstaedt, Lee W; Beati, Lorenza; Caceres, Abraham G; Ferro, Cristina; Munstermann, Leonard E

    2011-06-01

    Within the sand fly genus Lutzomyia, the Verrucarum species group contains several of the principal vectors of American cutaneous leishmaniasis and human bartonellosis in the Andean region of South America. The group encompasses 40 species for which the taxonomic status, phylogenetic relationships, and role of each species in disease transmission remain unresolved. Mitochondrial cytochrome c oxidase I (COI) phylogenetic analysis of a 667-bp fragment supported the morphological classification of the Verrucarum group into series. Genetic sequences from seven species were grouped in well-supported monophyletic lineages. Four species, however, clustered in two paraphyletic lineages that indicate conspecificity--the Lutzomyia longiflocosa-Lutzomyia sauroida pair and the Lutzomyia quasitownsendi-Lutzomyia torvida pair. COI sequences were also evaluated as a taxonomic tool based on interspecific genetic variability within the Verrucarum group and the intraspecific variability of one of its members, Lutzomyia verrucarum, across its known distribution.

  14. Molecular phylogenetics and character evolution of morphologically diverse groups, Dendrobium section Dendrobium and allies

    Science.gov (United States)

    Takamiya, Tomoko; Wongsawad, Pheravut; Sathapattayanon, Apirada; Tajima, Natsuko; Suzuki, Shunichiro; Kitamura, Saki; Shioda, Nao; Handa, Takashi; Kitanaka, Susumu; Iijima, Hiroshi; Yukawa, Tomohisa

    2014-01-01

    It is always difficult to construct coherent classification systems for plant lineages having diverse morphological characters. The genus Dendrobium, one of the largest genera in the Orchidaceae, includes ∼1100 species, and enormous morphological diversification has hindered the establishment of consistent classification systems covering all major groups of this genus. Given the particular importance of species in Dendrobium section Dendrobium and allied groups as floriculture and crude drug genetic resources, there is an urgent need to establish a stable classification system. To clarify phylogenetic relationships in Dendrobium section Dendrobium and allied groups, we analysed the macromolecular characters of the group. Phylogenetic analyses of 210 taxa of Dendrobium were conducted on DNA sequences of internal transcribed spacer (ITS) regions of 18S–26S nuclear ribosomal DNA and the maturase-coding gene (matK) located in an intron of the plastid gene trnK using maximum parsimony and Bayesian methods. The parsimony and Bayesian analyses revealed 13 distinct clades in the group comprising section Dendrobium and its allied groups. Results also showed paraphyly or polyphyly of sections Amblyanthus, Aporum, Breviflores, Calcarifera, Crumenata, Dendrobium, Densiflora, Distichophyllae, Dolichocentrum, Holochrysa, Oxyglossum and Pedilonum. On the other hand, the monophyly of section Stachyobium was well supported. It was found that many of the morphological characters that have been believed to reflect phylogenetic relationships are, in fact, the result of convergence. As such, many of the sections that have been recognized up to this point were found to not be monophyletic, so recircumscription of sections is required. PMID:25107672

  15. Short notes and reviews Simplifying hydrozoan classification: inappropriateness of the group Hydroidomedusae in a phylogenetic context

    OpenAIRE

    Marques, Antonio C.

    2001-01-01

    The systematics of Hydrozoa is considered from the viewpoint of logical consistency between phylogeny and classification. The validity of the nominal taxon Hydroidomedusae (including all groups of Hydrozoa except the Siphonophorae) is discussed with regard to its distinctness and inclusive relationships. In general, phylogenetic systematic evidence suggest that the use of the term Hydroidomedusae is inappropriate given our current level of understanding. It is concluded that no new, or resurr...

  16. Host-range phylogenetic grouping of capripoxviruses. Genetic typing of CaPVs

    International Nuclear Information System (INIS)

    Le Goff, C.; Chadeyras, A.; Libeau, G.; Albina, E.; Fakhfakh, E.; Hammami, S.; Elexpeter Aba Adulugba; Diallo, A.

    2005-01-01

    Because of their close relationship, specific identification of the CaPVs genus inside the Poxviridae family relies mainly on molecular tools rather than on classical serology. We describe the suitability of the G protein-coupled chemokine receptor (GPCR), for host range phylogenetic grouping. The analysis of 26 CaPVs shows 3 tight genetic clusters consisting of goatpox virus (GPV), lumpy skin disease virus (LSDV), and sheeppox virus (SPV). (author)

  17. Phylogenetic diversity in the core group of Peziza inferred from ITS sequences and morphology

    DEFF Research Database (Denmark)

    Hansen, K.; Læssøe, Thomas; Pfister, D.H.

    2002-01-01

    Species delimitation within the core group of Peziza is highly controversial. The group, typified by P. vesiculosa, is morphologically coherent and in previous analyses of LSU rDNA sequences it formed a highly supported clade. Phylogenetic diversity and species limits were investigated within......), shallowly cup- to disc-shaped apothecia (A) and large (up to 15 cm), deeply cup-shaped to expanded apothecia (B). The overall exciple structure (a stratified or non-stratified medullary layer) and to some degree spore surface relief, likewise support the groupings. Clade A contains taxa with smooth...... that populations on a diverse array of substrates may be closely related, or indeed, conspecific....

  18. A Study of Factors Influencing Consumer Adoption of Group-Buying Sites in Malaysia

    OpenAIRE

    Bohara, Shilpa

    2011-01-01

    Group-buying sites have been the biggest internet phenomena in the recent B2C ecommerce industry. This new development has led to this research’s main objective of identifying factors that influence consumers’ intention to purchase from groupbuying sites, particularly in Malaysia. Using the extended Technology Acceptance Model, the five factors measured against consumers’ behavioral intent to transact are perceived knowledge, perceived benefits of price promotion, personal innovativeness, soc...

  19. Recombination Blurs Phylogenetic Groups Routine Assignment in Escherichia coli: Setting the Record Straight

    Science.gov (United States)

    Turrientes, María-Carmen; González-Alba, José-María; del Campo, Rosa; Baquero, María-Rosario; Cantón, Rafael; Baquero, Fernando; Galán, Juan Carlos

    2014-01-01

    The characterization of population structures plays a main role for understanding outbreaks and the dynamics of bacterial spreading. In Escherichia coli, the widely used combination of multiplex-PCR scheme together with goeBURST has some limitations. The purpose of this study is to show that the combination of different phylogenetic approaches based on concatenated sequences of MLST genes results in a more precise assignment of E. coli phylogenetic groups, complete understanding of population structure and reconstruction of ancestral clones. A collection of 80 Escherichia coli strains of different origins was analyzed following the Clermont and Doumith's multiplex-PCR schemes. Doumith's multiplex-PCR showed only 1.7% of misassignment, whereas Clermont's-2000 protocol reached 14.0%, although the discrepancies reached 30% and 38.7% respectively when recombinant C, F and E phylogroups were considered. Therefore, correct phylogroup attribution is highly variable and depends on the clonal composition of the sample. As far as population structure of these E. coli strains, including 48 E. coli genomes from GenBank, goeBURST provides a quite dispersed population structure; whereas NeighborNet approach reveals a complex population structure. MLST-based eBURST can infer different founder genotypes, for instance ST23/ST88 could be detected as the founder genotypes for STC23; however, phylogenetic reconstructions might suggest ST410 as the ancestor clone and several evolutionary trajectories with different founders. To improve our routine understanding of E. coli molecular epidemiology, we propose a strategy based on three successive steps; first, to discriminate three main groups A/B1/C, D/F/E and B2 following Doumith's protocol; second, visualization of population structure based on MLST genes according to goeBURST, using NeighborNet to establish more complex relationships among STs; and third, to perform, a cost-free characterization of evolutionary trajectories in variants

  20. Taxonomic revision and molecular phylogenetics of the Idarnes incertus species-group (Hymenoptera, Agaonidae, Sycophaginae

    Directory of Open Access Journals (Sweden)

    Fernando H.A. Farache

    2017-01-01

    Full Text Available Sycophaginae is a group of non-pollinating fig wasps considered closely related to the fig pollinators (Agaoninae, Tetrapusiinae, and Kradibiinae in the most recent phylogenetic analyses. They occur in all tropical regions and are associated with Ficus subgenera Urostigma and Sycomorus. There are six described genera of Sycophaginae, and two are native and confined to the Neotropics, namely Idarnes Walker, 1843 and Anidarnes Bouček, 1993. Genus Idarnes is divided into three morphologically distinct groups that were proven to be monophyletic by recent molecular phylogenetic analyses. In this paper we reviewed the Idarnes incertus species-group and provide detailed morphological descriptions and illustrations for the species belonging to this group. Three previously described species were redescribed: I. brasiliensis (Mayr, 1906 comb. nov., I. hansoni Bouček, 1993, and I. incertus (Ashmead, 1900. Seventeen new species are described by Farache and Rasplus: I. amacayacuensis sp. n., I. amazonicus sp. n., I. americanae sp. n., I. badiovertex sp. n., I. brevis sp. n., I. brunneus sp. n., I. comptoni sp. n., I. cremersiae sp. n., I. dimorphicus sp. n., I. flavicrus sp. n., I. flaviventris sp. n., I. gibberosus sp. n., I. gordhi sp. n., I. maximus sp. n., I. nigriventris sp. n., I. pseudoflavus sp. n. and I. ramirezi sp. n. We provided keys for the identification of the species as well as for recognising the different species-groups of Idarnes and a closely related genus (Sycophaga Westwood, 1840. Additionally, phylogenetic relationships among 13 species of the I. incertus species-group were inferred using four molecular markers and discussed in the light of Ficus taxonomy and host specificity.

  1. Identification of Four Distinct Phylogenetic Groups in Flavobacterium columnare With Fish Host Associations

    Directory of Open Access Journals (Sweden)

    Benjamin R. LaFrentz

    2018-03-01

    Full Text Available Columnaris disease, caused by the Gram-negative bacterium Flavobacterium columnare, is one of the most prevalent fish diseases worldwide. An exceptionally high level of genetic diversity among isolates of F. columnare has long been recognized, whereby six established genomovars have been described to date. However, little has been done to quantify or characterize this diversity further in a systematic fashion. The objective of this research was to perform phylogenetic analyses of 16S rRNA and housekeeping gene sequences to decipher the genetic diversity of F. columnare. Fifty isolates and/or genomes of F. columnare, originating from diverse years, geographic locations, fish hosts, and representative of the six genomovars were analyzed in this study. A multilocus phylogenetic analysis (MLPA of the 16S rRNA and six housekeeping genes supported four distinct F. columnare genetic groups. There were associations between genomovar and genetic group, but these relationships were imperfect indicating that genomovar assignment does not accurately reflect F. columnare genetic diversity. To expand the dataset, an additional 90 16S rRNA gene sequences were retrieved from GenBank and a phylogenetic analysis of this larger dataset also supported the establishment of four genetic groups. Examination of isolate historical data indicated biological relevance to the identified genetic diversity, with some genetic groups isolated preferentially from specific fish species or families. It is proposed that F. columnare isolates be assigned to the four genetic groups defined in this study rather than genomovar in order to facilitate a standard nomenclature across the scientific community. An increased understanding of which genetic groups are most prevalent in different regions and/or aquaculture industries may allow for the development of improved targeted control and treatment measures for columnaris disease.

  2. Projection of human immunodeficiency virus among high-risk groups in Malaysia.

    Science.gov (United States)

    Mondal, Md Nazrul Islam; Shitan, Mahendran

    2013-01-01

    Human immunodeficiency virus (HIV)/acquired immunodeficiency syndrome (AIDS) presents a serious healthcare threat to young individuals in Malaysia and worldwide. This study aimed to identify trends in HIV-related risk behaviors among recognized high-risk groups and to estimate HIV transmission up to the year 2015. Data and necessary information were obtained from the Ministry of Health Malaysia, published reports from the World Health Organization and United Nations Program on HIV/AIDS, and other articles. The Estimation and Projection Package was used to estimate HIV transmission. The results of the present study revealed that within the high-risk groups, intravenous drug users (IDUs) had the highest prevalence rate of HIV transmission, followed by patients with sexually transmitted infections (STIs), female sex workers (SWs), and men who have sex with men (MSM). Within these at-risk populations, patients with STIs have the highest prevalence of HIV, followed by IDUs, MSM, and SWs. If the transmission rate continues to increase, the situation will worsen; therefore, there is an urgent need for a comprehensive prevention program to control HIV transmission in Malaysia.

  3. Prevalence of Diego blood group antigen and the antibody in three ethnic population groups in Klang valley of Malaysia

    OpenAIRE

    Cheong Tar Wei; Faisal Muti Al-Hassan; Norris Naim; Aishah Knight; Sanmukh R Joshi

    2013-01-01

    Background: Diego blood group antigen, Di(a), is very rare among Caucasians and Blacks, but relatively common among the South American Indians and Asians of Mongolian origin. The antibody to Di(a) is clinically significant to cause hemolytic disease in a new-born or hemolytic transfusion reaction. Objectives: This study was designed to determine the prevalence of Di(a) antigen among the blood donors from the three major ethnic groups in Klang Valley of Malaysia as well as to find an incidence...

  4. Phylogenetic disassembly of species boundaries in a widespread group of Australian skinks (Scincidae: Ctenotus).

    Science.gov (United States)

    Rabosky, Daniel L; Hutchinson, Mark N; Donnellan, Stephen C; Talaba, Amanda L; Lovette, Irby J

    2014-08-01

    Scincid lizards in the genus Ctenotus represent one of Australia's most species-rich vertebrate clades, with more than 100 recognized species. Formal diagnoses of many species have relied on qualitative assessments of adult color pattern, but the validity of many such species has not been tested in a phylogenetic framework. We used mitochondrial and nuclear DNA to perform the first phylogenetic analysis of species in the Ctenotus inornatus group, a complex of at least 11 nominal forms that are distributed widely across the Australian continent. Mitochondrial and nuclear gene phylogenies support the presence of multiple species in the group, but these clades largely fail to match species boundaries as currently defined. Multivariate analyses of color pattern indicate that extreme intraspecific morphological variation in this character has created a significant impediment to understanding taxonomic diversity in the group. Our results suggest that nearly all species in the C. inornatus group require substantial taxonomic revision, and several geographically widespread forms ("C. saxatilis" and "C. robustus") appear to be polyphyletic taxa drawn from phenotypically similar but genetically distinct lineages. We describe one new species and provide redescriptions for three additional species. We synonymize names applied to a number of genetically incoherent or otherwise poorly-defined forms. The results of our study highlight an acute need for population genetic studies of species boundaries in Australian skinks, many of which are recognized by morphological traits that vary greatly within and between populations. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Serotonin transporter gene polymorphism and its association with bipolar disorder across different ethnic groups in Malaysia.

    Science.gov (United States)

    Mohamed Saini, Suriati; Nik Jaafar, Nik Ruzyanei; Sidi, Hatta; Midin, Marhani; Mohd Radzi, Azizah; Abdul Rahman, Abdul Hamid

    2014-01-01

    The risk variants have been shown to vary substantially across populations and a genetic study in a heterogeneous population might shed a new light in the disease mechanism. This preliminary study aims to determine the frequency of the serotonin transporter gene polymorphism (5-HTTLPR) in the three main ethnic groups in Malaysia and its association with bipolar disorder. This is a candidate gene association study of randomly selected forty five unrelated bipolar disorder probands and sixty six controls. Diagnosis was evaluated using the Mini International Neuropsychiatric Interview (M.I.N.I). The control group consisted of healthy volunteers without personal psychiatric history and family history of mood disorder. Patients' whole blood was collected for genotyping. This study revealed that the frequency of the short variant of 5-HTTLPR in healthy control group was highest in Indians (42.9%) followed by Malays (23.5%) and was absent in Chinese. The association between the homozygous ss genotype of the 5-HTTLPR polymorphism with bipolar disorder was not found in the pooled subjects (χ(2)=1.52, d.f.=1, p=0.218, OR=4.67, 95% C.I.=0.69-7.58) and after stratification into Malays (p=0.315, OR=2.03, 95% CI=0.50-8.17), Indians (p=0.310; OR=0.44, 95% CI=0.21-0.92) and Chinese. The differences in the frequency of the short allele of 5-HTTLPR across the three main ethnic groups in Malaysia were noteworthy. The present study showed no significant association between the homozygous short variant of the 5-HTTLPR and bipolar disorder in the pooled subject and after stratification into the three main ethnic groups in Malaysia. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Phylogenetic relationship among East Asian species of the Stegana genus group (Diptera, Drosophilidae).

    Science.gov (United States)

    Li, Tong; Gao, Jian-jun; Lu, Jin-ming; Ji, Xing-lai; Chen, Hong-wei

    2013-01-01

    The phylogenetic relationship among 27 East Asian species of the Stegana genus group was reconstructed using DNA sequences of mitochondrial (COI and ND2) and nuclear (28S) genes. The results lent support to the current generic/subgeneric taxonomic classification in the genus group with the exceptions of the paraphyly of the genus Parastegana and the subgenus Oxyphortica in the genus Stegana. The ancestral areas and divergence times in the genus group were reconstructed/estimated, and accordingly, the biogeographical history of this important clade was discussed. It was proposed that, the evolution of the plant family Fagaceae, especially Quercus, may have played a certain role in facilitating the diversification of the Stegana genus group. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Phylogenetic trees

    OpenAIRE

    Baños, Hector; Bushek, Nathaniel; Davidson, Ruth; Gross, Elizabeth; Harris, Pamela E.; Krone, Robert; Long, Colby; Stewart, Allen; Walker, Robert

    2016-01-01

    We introduce the package PhylogeneticTrees for Macaulay2 which allows users to compute phylogenetic invariants for group-based tree models. We provide some background information on phylogenetic algebraic geometry and show how the package PhylogeneticTrees can be used to calculate a generating set for a phylogenetic ideal as well as a lower bound for its dimension. Finally, we show how methods within the package can be used to compute a generating set for the join of any two ideals.

  8. Detection of virulence genes and the phylogenetic groups of Escherichia coli isolated from dogs in Brazil

    Directory of Open Access Journals (Sweden)

    Fernanda Morcatti Coura

    2018-02-01

    Full Text Available ABSTRACT: This study identified the virulence genes, pathovars, and phylogenetic groups of Escherichia coli strains obtained from the feces of dogs with and without diarrhea. Virulence genes and phylogenetic group identification were studied using polymerase chain reaction. Thirty-seven E. coli isolates were positive for at least one virulence factor gene. Twenty-one (57.8% of the positive isolates were isolated from diarrheal feces and sixteen (43.2% were from the feces of non-diarrheic dogs. Enteropathogenic E. coli (EPEC were the most frequently (62.2% detected pathovar in dog feces and were mainly from phylogroup B1 and E. Necrotoxigenic E. coli were detected in 16.2% of the virulence-positive isolates and these contained the cytotoxic necrotizing factor 1 (cnf1 gene and were classified into phylogroups B2 and D. All E. coli strains were negative for the presence of enterotoxigenic E. coli (ETEC enterotoxin genes, but four strains were positive for ETEC-related fimbriae 987P and F18. Two isolates were Shiga toxin-producing E. coli strains and contained the toxin genesStx2 or Stx2e, both from phylogroup B1. Our data showed that EPEC was the most frequent pathovar and B1 and E were the most common phylogroups detected in E. coli isolated from the feces of diarrheic and non-diarrheic dogs.

  9. PHYLOGENETIC ANALYSIS WHITHIN THE PRISTIMANTIS UNISTRIGATUS (ANURA, CRAUGASTORIDAE GROUP BASED ON MORPHOLOGICAL CHARACTERS

    Directory of Open Access Journals (Sweden)

    JULIO MARIO HOYOS

    2014-06-01

    Full Text Available We present a phylogenetic analysis within the Pristimantis unistrigatus group (Anura, Craugastoridae of Colombia . Characters from the superficial muscles of the hands and feet as well as external characters were taken for analysis. Most of the muscle characters were observed directly, and some were taken from the literature. Similarly, the external ones were taken mostly from the original descriptions and others from the literature as well. Two matrices were constructed, as the species belonging to this group have changed in recent years with respect to the initially proposed when the group was defined. The results lead us to conclude that the group is not monophyletic, although there are some relationships that are worth to survey because they are kept in the very last cladograms obtained for both proposals. It is suggested that these last relationships should be explored in particular, and the overall group in general, increasing the number of characters and taxa that belong to P. unistrigatus. An open question we left is whether actually is worth to keep these informal taxonomic hierarchy called group within the genera of anurans.

  10. Multiple drug resistance patterns in various phylogenetic groups of uropathogenic E.coli isolated from Faisalabad region of Pakistan

    Directory of Open Access Journals (Sweden)

    Saira Bashir

    2011-12-01

    Full Text Available The objective of this work was the phylogenetic characterization of local clinical isolates of uropathogenic E. coli with respect to drug resistance. A total of 59 uropathogenic E. coli responsible for community acquired urinary tract infections were included in this study. A triplex PCR was employed to segregate each isolate into four different phylogenetic groups (A, B1, B2 and D. Drug resistance was evaluated by disc diffusion method. The drugs used were ampicillin, aztreonam, cefixime, cefoperazone, ceftriaxone, cephradine among β-lactam group; amikacin, gentamicin, and streptomycin among aminoglycosides; nalidixic acid and ciprofloxacin from quinolones; trimethoprim-sulfomethoxazole, and tetracycline. Among 59 uropathogenic E. coli isolates majority belonged to phylogenetic group B2 (50% where as 19% each belonged to groups A and B1, and 12% to group D. All the isolates were multiple drug resistant (MDR. Most effective drugs against Group A, B1, and B2 were gentamicin, amikacin and cefixime; ceftriaxone and quinolones; and ceftriaxone and amikacin, respectively. Group D isolates were found to be highly resistant to all drugs. Our results have shown emergence of MDR isolates among uropathogenic E. coli with dominance of phylogenetic group B2. However, it was found that group D isolates were though less frequent, more drug resistant as compared with group B2. Groups A and B1 were relatively uncommon. Amikacin, ceftriaxone and gentamicin were the most effective drugs in general.

  11. Vegetative compatibility group of Fusarium solani pathogenic to tobacco plant in peninsular Malaysia

    Directory of Open Access Journals (Sweden)

    Mohd Norhafeez bin Jusoh

    2013-12-01

    Full Text Available Five strains of Fusarium solani isolated from root rot of tobacco from Kelantan and Terengganu, Malaysia were tested for the pathogenicity on tobacco seedlings by root dipping method. All 5 isolates showed discoloration on the roots. The nitrate non-utilizing (nit mutants were generated from these pathogenic strains of F. solani and a compatible nit1 and NitM pair was obtained in each strain. Vegetative Compatible Groups (VCGs by nit mutants were determined. All 5 strains of F. solani were assigned to the independent VCGs. Non-pathogenic strains of F. solani previously isolated from root rot of tobacco in Malaysia also generated nit mutants and were assigned to 10 different VCGs. However, complementation of nit mutants between 5 pathogenic strains and 7 non-pathogenic strains of F. solani was not achieved. Both pathogenic and nonpathogenic strains were assigned to the independent VCGs. This suggested that the isolates of F. solani pathogenic to tobacco were derived from the progenies of crossing in the field. However, perithecium formation was not observed in their cultures.

  12. Phylogenetic relationships of the Cochliopinae (Rissooidea: Hydrobiidae): an enigmatic group of aquatic gastropods.

    Science.gov (United States)

    Liu, H P; Hershler, R; Thompson, F G

    2001-10-01

    Phylogenetic analysis based on a partial sequence of the mitochondrial cytochrome c oxidase subunit I gene was performed for 26 representatives of the aquatic gastropod subfamily Cochliopinae, 6 additional members of the family Hydrobiidae, and outgroup species of the families Rissoidae and Pomatiopsidae. Maximum-parsimony analysis yielded a single shortest tree which resolved two monophyletic groups: (1) a clade containing all cochliopine taxa with the exception of Antroselates and (2) a clade composed of Antroselates and the hydrobiid genus Amnicola. The clade containing both of these monophyletic groups was depicted as more closely related to members of the family Pomatiopsidae than to other hydrobiid snails which were basally positioned in our topology. New anatomical evidence supports recognition of the cochliopine and Antroselates-Amnicola clades, and structure within the monophyletic group of cochliopines is largely congruent with genitalic characters. However, the close relationship between the Pomatiopsidae and these clades is in conflict with commonly accepted classifications and suggests that a widely accepted scenario for genitalic evolution in these snails is in need of further study. Copyright 2001 Academic Press.

  13. The implementation of problem-based learning in collaborative groups in a chiropractic program in Malaysia.

    Science.gov (United States)

    Win, Ni Ni; Nadarajah, Vishna Devi V; Win, Daw Khin

    2015-01-01

    Problem-based learning (PBL) is usually conducted in small-group learning sessions with approximately eight students per facilitator. In this study, we implemented a modified version of PBL involving collaborative groups in an undergraduate chiropractic program and assessed its pedagogical effectiveness. This study was conducted at the International Medical University, Kuala Lumpur, Malaysia, and involved the 2012 chiropractic student cohort. Six PBL cases were provided to chiropractic students, consisting of three PBL cases for which learning resources were provided and another three PBL cases for which learning resources were not provided. Group discussions were not continuously supervised, since only one facilitator was present. The students' perceptions of PBL in collaborative groups were assessed with a questionnaire that was divided into three domains: motivation, cognitive skills, and perceived pressure to work. Thirty of the 31 students (97%) participated in the study. PBL in collaborative groups was significantly associated with positive responses regarding students' motivation, cognitive skills, and perceived pressure to work (Plearning resources increased motivation and cognitive skills (Plearning resources.

  14. Effectiveness of group counseling in smoking cessation program amongst adolescent smokers in Malaysia

    Directory of Open Access Journals (Sweden)

    Rohani Ismail

    2010-11-01

    Full Text Available Aim: To assess the effectiveness of groups counseling for smoking cessation among secondary school students.Methods: This study was conducted among secondary school students in two districts in Selangor Malaysia, during July 2005 until August 2006. Upon screening, 346 students were randomly assigned into intervention group (IG (n=158 and non intervention group (NIG (n=188. IG underwent structured group counseling regularly for four months, while no group counseling was given to the NIG but subjected to the regular smoking cessation activities organized by their respective schools.      Knowledge and attitude towards smoking and quit rate were  measured in both groups before intervention, and at 4, 8, and 12 months after intervention.Results: Revealed that students in IG had signifi cantly higher knowledge scores than those in NIG during follow-up visits (24.29+7.97 vs 23.58+8.44 on the fi rst visit, (29.10+8.52 vs 24.09+8.69 on the second visit (26.59+8.26 vs 22.08+8.04 on the third visit and (25.54+8.34 vs 21.26+9.60 on the fourth visit. Attitude scores were not signifi cantly different in both groups. Quit rate at four months after intervention was signifi cantly higher in IG as compared to the NIG (45%; 71/158 vs 32%; 60/188 (P=0.013.Conclusion: Group counseling is very effective in improving the respondents’ knowledge and quite rate, but not their attitudes toward smoking. (Med J Indones 2010; 19:273-9Keywords: attitude, group counseling, intervention, knowledge, smoking cessation

  15. Importance-performance analysis of dental satisfaction among three ethnic groups in malaysia.

    Science.gov (United States)

    Dewi, Fellani Danasra; Gundavarapu, Kalyan C; Cugati, Navaneetha

    2013-01-01

    To find the differences in patient satisfaction related to dental services among three ethnic groups - Chinese, Indian and Malay - at AIMST University Dental Centre and analyse them with an importance-performance grid, identifying the weak and strong points, in order to provide better service. This questionnaire-based study consisted of convenience samples of 174 patients of Chinese, Indian and Malay ethnicity. Importance-performance analysis for 20 attributes were compared using Likert's scale. The data obtained were statistically analysed using the Kruskal-Wallis test. Chinese and Indians both emphasised low performance on the interpersonal relationship attribute in terms of the receptionist's courtesy, whereas the Malay participants were concerned with convenience attributes. All the ethnic groups favoured maintaining existing major attributes towards technical competency, interpersonal relationship and facility factors. This study demonstrated priority differences between the ethnic groups' perception of the quality of dental services, where ethnic Chinese showed the highest gap (measure of dissatisfaction) between importance and performance compared to ethnic Malays, followed by ethnic Indians. The patients from the three major ethnic groups of Malaysia were generally well satisfied. Perhaps more priority should be placed on improving the interpersonal relationship attribute, especially with the receptionists.

  16. The Potamophylax nigricornis group (Trichoptera, Limnephilidae: resolution of phylogenetic species by fine structure analysis

    Directory of Open Access Journals (Sweden)

    Oláh, J.

    2013-11-01

    Full Text Available Applying the phylogenetic species concept and the sexual selection theory we have reviewed some natal aspects of incipient species and their accelerated evolution. How can we recognise early stages of divergence? Which selection pressures are at work during speciation? Which pathways accelerate the speed of speciation? Which kinds of trait variabilities makes difficult to find initial split criteria? Elaborating the principles of Fine Structure Analysis (FSA and the morphological Initial Split Criteria (ISP it was discovered that the European spring dwelling caddisfly Potamophylax nigricornis doesn’tbelong to a single species. It represents an entire species group with seventeen peripatric species evolving on the southernperipheries of the distributional area. Four new species subgroups have been erected: Potamophylax nigricornis new species subgroup, P. elegantulus new species subgroup, P. horgos new species subgroup, P. simas new species subgroup. Eleven new species have been described: Potamophylax apados sp. nov., P. fules sp. nov., P. fureses sp. nov., P. hasas sp. novov., P. horgos sp. nov., P. kethas sp. nov., P. lemezes sp. nov., P. peremes sp. nov., P. simas sp. nov., P. tuskes sp. nov., P. ureges sp. nov. One Potamophylax sp. nov. has been differentiated and three new species status have been documented:Potamophylax elegantulus (Klapálek stat. n., P. mista (Navás stat. nov., P. testaceus (Zetterstedt stat. nov.

  17. Population data of six Alu insertions in indigenous groups from Sabah, Malaysia.

    Science.gov (United States)

    Kee, B P; Chua, K H; Lee, P C; Lian, L H

    2012-01-01

    The present study is the first to report the genetic relatedness of indigenous populations of Sabah, Malaysia, using a set of Indel markers (HS4.32, TPA25, APO, PV92, B65 and HS3.23). The primary aim was to assess the genetic relationships among these populations and with populations from other parts of the world by examining the distribution of these markers. A total of 504 volunteers from the three largest indigenous groups, i.e. Kadazan-Dusun, Bajau and Rungus, were recruited for the study. Six Alu insertions were typed by PCR with specific primer sets. All insertions were found to present at different frequencies, ranging from 0.170-0.970. The heterozygosity of most of the markers was high (>0.4), with the exception of HS3.23 and APO. A genetic differentiation study revealed that these populations are closely related to each other (G(ST) = 0.006). A principle component plot showed that these populations have higher affinity to Mainland South East Asia/East Asia populations, rather than Island Southeast Asia (ISEA) populations. In summary, these indigenous groups were closely associated in terms of their genetic composition. This finding also supports the colonization model of ISEA, which suggests that the inhabitants of this region were mostly descendants from Southern China.

  18. Prevalence of Diego blood group antigen and the antibody in three ethnic population groups in Klang valley of Malaysia

    Directory of Open Access Journals (Sweden)

    Cheong Tar Wei

    2013-01-01

    Full Text Available Background: Diego blood group antigen, Di(a, is very rare among Caucasians and Blacks, but relatively common among the South American Indians and Asians of Mongolian origin. The antibody to Di(a is clinically significant to cause hemolytic disease in a new-born or hemolytic transfusion reaction. Objectives: This study was designed to determine the prevalence of Di(a antigen among the blood donors from the three major ethnic groups in Klang Valley of Malaysia as well as to find an incidence of an antibody of the Diego antigen, anti-Di(a, in a tertiary care hospital to ascertain the need to include Di(a+ red cells for an antibody screen cell panel. Materials and Methods: Serological tests were performed by column agglutination technique using commercial reagents and following instruction as per kit insert. Results: Di(a antigen was found with a frequency of 2.1% among the Malaysians donors in three ethnic groups viz, Malay, Chinese and Indian. It was present among 1.25% of 401 Malay, 4.01% of Chinese and 0.88% of 114 Indian origin donors. None of the 1442 patients, including 703 antenatal outpatients, had anti-Di(a in serum. Conclusion: The prevalence of Di(a antigen was found among the donors of all the three ethnic background with varying frequency. Inclusion of Di(a+ red cells in routine antibody screening program would certainly help in detection of this clinically significant antibody and to provide safe blood transfusion in the Klang Valley, though the incidence of antibody appears to be very low in the region.

  19. Prevalence of Diego blood group antigen and the antibody in three ethnic population groups in Klang valley of Malaysia.

    Science.gov (United States)

    Wei, Cheong Tar; Al-Hassan, Faisal Muti; Naim, Norris; Knight, Aishah; Joshi, Sanmukh R

    2013-01-01

    Diego blood group antigen, Di(a), is very rare among Caucasians and Blacks, but relatively common among the South American Indians and Asians of Mongolian origin. The antibody to Di(a) is clinically significant to cause hemolytic disease in a new-born or hemolytic transfusion reaction. This study was designed to determine the prevalence of Di(a) antigen among the blood donors from the three major ethnic groups in Klang Valley of Malaysia as well as to find an incidence of an antibody of the Diego antigen, anti-Di(a), in a tertiary care hospital to ascertain the need to include Di(a+) red cells for an antibody screen cell panel. Serological tests were performed by column agglutination technique using commercial reagents and following instruction as per kit insert. Di(a) antigen was found with a frequency of 2.1% among the Malaysians donors in three ethnic groups viz, Malay, Chinese and Indian. It was present among 1.25% of 401 Malay, 4.01% of Chinese and 0.88% of 114 Indian origin donors. None of the 1442 patients, including 703 antenatal outpatients, had anti-Di(a) in serum. The prevalence of Di(a) antigen was found among the donors of all the three ethnic background with varying frequency. Inclusion of Di(a+) red cells in routine antibody screening program would certainly help in detection of this clinically significant antibody and to provide safe blood transfusion in the Klang Valley, though the incidence of antibody appears to be very low in the region.

  20. Phylogenetic relationships in the "grossulariae" species group of the genus Aphis (Hemiptera: Sternorrhyncha: Aphididae): Molecular evidence

    DEFF Research Database (Denmark)

    Turcinaviciene, Jorga; Rakauskas, Rimantas; Pedersen, Bo Vest

    2006-01-01

    Phylogenetic relationships among Palaearctic Ribes and/or Onagraceae inhabiting Aphis species from five countries were examined using mitochondrial gene cytochrome oxidase I (CO-I) and nuclear gene elongation factor 1 a (EF-1a) sequences. There was no major conflict between the trees obtained fro...

  1. Determination Performance Of Gamma Spectrometry Co-Axial HPGE Detector In Radiochemistry And Environment Group, Nuclear Malaysia

    International Nuclear Information System (INIS)

    Mei-Woo, Y.

    2014-01-01

    Gamma Spectrometry System is used to measure qualitatively and quantitatively a gamma emitting radionuclide. The accuracy of the measurement very much depends on the performance specifications of the HPGe detectors. From this study it found that all the seven co-axial HPGe detectors in Radiochemistry and Environment Group, Nuclear Malaysia are in good working conditions base on the verification of performance specifications namely Resolution, Peak Shape, Peak-to-Compton ratio and Relative Efficiency against the warranted value from the manufacturers. (author)

  2. Phylogenetic grouping and pathotypic comparison of urine and fecal Escherichia coli isolates from children with urinary tract infection

    Directory of Open Access Journals (Sweden)

    Masoumeh Navidinia

    2014-06-01

    Full Text Available The aim of this study was to investigate the phylogenetic background and to assess hlyD (involved in the secretion of haemolysin A and intll (encoding a class 1 integrase in Escherichia coli isolates derived from urinary and fecal specimens. A total of 200 E. coli isolates was collected from patients presenting with urinary tract infection (UTI during September 2009 to September 2010 and screened for hlyD and intll genes by polymerase chain reaction (PCR. Phylogenetic analysis showed that E. coli is composed of four main phylogenetic groups (A, B1, B2 and D and that uropathogenic E. coli (UPEC isolates mainly belong to groups B2 (54% and D (34% whereas group A (44% and D (26% are predominant among commensal E. coli isolates. In this study, hlyD was present in 26% of UPEC and 2% of commensal E. coli isolates. However, hemolytic activity was detected for 42% of UPEC and 6% of commensal E. coli isolates (p < 0.05. intll gene was more frequently expressed in UPEC (24% in comparison with commensal E. coli isolates (12%. Resistance to aztreonam, co-trimoxazole and cefpodoxime were frequently found among UPEC isolates whereas commensal E. coli isolates were commonly resistant to co-trimoxazole, nalidixic acid and cefotaxime. Concluding, a considerable difference between UPEC and commensal E. coli isolates was observed regarding their phylogenetic groups, presence of class 1 integron and hlyD gene, hemolysin activity and resistance pattern. The detection of class 1 integrons and hlyD gene was higher among UPEC compared with commensal E. coli isolates. These findings may contribute for a better understanding of the factors involved in the pathogenesis of UPEC.

  3. Possible sister groups and phylogenetic relationships among selected North Pacific and North Atlantic Rhodophyta

    Science.gov (United States)

    Lindstrom, Sandra C.

    1987-09-01

    Although the cool temperate (boreal) waters of the N. Pacific and N. Atlantic share many similar if not identical species, there have been few studies to test the identity of these species pairs. Whereas such tests are important from a taxonomic perspective, they tell us little if anything about biogeographic relationships. A more useful approach is one employing phylogenetic systematics (cladistics). The interpretation of phylogenetic diagrams (cladograms) in terms of biogeographic area relationships is explained. It is argued that cladistic analyses of taxa occurring in the cool temperate waters of the northern oceans can provide biogeographic tracks, which in turn can suggest the origins and migrations of species and possibly even floras. A number of cool temperate taxa that appear particularly amenable to this approach are discussed, including genera in the Palmariaceae, Corallinaceae, Dumontiaceae, Solieriaceae, Petrocelidaceae, Ceramiaceae and Rhodomelaceae.

  4. Genetic Characterization of a Novel HIV-1 Circulating Recombinant Form (CRF74_01B) Identified among Intravenous Drug Users in Malaysia: Recombination History and Phylogenetic Linkage with Previously Defined Recombinant Lineages.

    Science.gov (United States)

    Cheong, Hui Ting; Chow, Wei Zhen; Takebe, Yutaka; Chook, Jack Bee; Chan, Kok Gan; Al-Darraji, Haider Abdulrazzaq Abed; Koh, Clayton; Kamarulzaman, Adeeba; Tee, Kok Keng

    2015-01-01

    In many parts of Southeast Asia, the HIV-1 epidemic has been driven by the sharing of needles and equipment among intravenous drug users (IDUs). Over the last few decades, many studies have proven time and again that the diversity of HIV-1 epidemics can often be linked to the route of infection transmission. That said, the diversity and complexity of HIV-1 molecular epidemics in the region have been increasing at an alarming rate, due in part to the high tendency of the viral RNA to recombine. This scenario was exemplified by the discovery of numerous circulating recombinant forms (CRFs), especially in Thailand and Malaysia. In this study, we characterized a novel CRF designated CRF74_01B, which was identified in six epidemiologically unlinked IDUs in Kuala Lumpur, Malaysia. The near-full length genomes were composed of CRF01_AE and subtype B', with eight breakpoints dispersed in the gag-pol and nef regions. Remarkably, this CRF shared four and two recombination hotspots with the previously described CRF33_01B and the less prevalent CRF53_01B, respectively. Genealogy-based Bayesian phylogenetic analysis of CRF74_01B genomic regions showed that it is closely related to both CRF33_01B and CRF53_01B. This observation suggests that CRF74_01B was probably a direct descendent from specific lineages of CRF33_01B, CRF53_01B and subtype B' that could have emerged in the mid-1990s. Additionally, it illustrated the active recombination processes between prevalent HIV-1 subtypes and recombinants in Malaysia. In summary, we report a novel HIV-1 genotype designated CRF74_01B among IDUs in Kuala Lumpur, Malaysia. The characterization of the novel CRF74_01B is of considerable significance towards the understanding of the genetic diversity and population dynamics of HIV-1 circulating in the region.

  5. Genetic Characterization of a Novel HIV-1 Circulating Recombinant Form (CRF74_01B Identified among Intravenous Drug Users in Malaysia: Recombination History and Phylogenetic Linkage with Previously Defined Recombinant Lineages.

    Directory of Open Access Journals (Sweden)

    Hui Ting Cheong

    Full Text Available In many parts of Southeast Asia, the HIV-1 epidemic has been driven by the sharing of needles and equipment among intravenous drug users (IDUs. Over the last few decades, many studies have proven time and again that the diversity of HIV-1 epidemics can often be linked to the route of infection transmission. That said, the diversity and complexity of HIV-1 molecular epidemics in the region have been increasing at an alarming rate, due in part to the high tendency of the viral RNA to recombine. This scenario was exemplified by the discovery of numerous circulating recombinant forms (CRFs, especially in Thailand and Malaysia. In this study, we characterized a novel CRF designated CRF74_01B, which was identified in six epidemiologically unlinked IDUs in Kuala Lumpur, Malaysia. The near-full length genomes were composed of CRF01_AE and subtype B', with eight breakpoints dispersed in the gag-pol and nef regions. Remarkably, this CRF shared four and two recombination hotspots with the previously described CRF33_01B and the less prevalent CRF53_01B, respectively. Genealogy-based Bayesian phylogenetic analysis of CRF74_01B genomic regions showed that it is closely related to both CRF33_01B and CRF53_01B. This observation suggests that CRF74_01B was probably a direct descendent from specific lineages of CRF33_01B, CRF53_01B and subtype B' that could have emerged in the mid-1990s. Additionally, it illustrated the active recombination processes between prevalent HIV-1 subtypes and recombinants in Malaysia. In summary, we report a novel HIV-1 genotype designated CRF74_01B among IDUs in Kuala Lumpur, Malaysia. The characterization of the novel CRF74_01B is of considerable significance towards the understanding of the genetic diversity and population dynamics of HIV-1 circulating in the region.

  6. Virulence profile of different phylogenetic groups of locally isolated community acquired uropathogenic E. coli from Faisalabad region of Pakistan

    Directory of Open Access Journals (Sweden)

    Bashir Saira

    2012-08-01

    Full Text Available Abstract Background Uropathogenic E.coli (UPEC are among major pathogens causing urinary tract infections. Virulence factors are mainly responsible for the severity of these emerging infections. This study was planned to investigate the distribution of virulence genes and cytotoxic effects of UPEC isolates with reference to phylogenetic groups (B2, B1, D and A to understand the presence and impact of virulence factors in the severity of infection in Faisalabad region of Pakistan. Methods In this study phylogenetic analysis, virulence gene identification and cytotoxicity of 59 uropathogenic E.coli isolates obtained from non-hospitalized patients was studied. Results Among 59 isolates, phylogenetic group B2 (50% was most dominant followed by groups A, B1 (19% each and D (12%. Isolates present in group D showed highest presence of virulence genes. The prevalence hlyA (37% was highest followed by sfaDE (27%, papC (24%, cnf1 (20%, eaeA (19% and afaBC3 (14%. Highly hemolytic and highly verotoxic isolates mainly belonged to group D and B2. We also found two isolates with simultaneous presence of three fimbrial adhesin genes present on pap, afa, and sfa operons. This has not been reported before and underlines the dynamic nature of these UPEC isolates. Conclusions It was concluded that in local UPEC isolates from non-hospitalized patients, group B2 was more prevalent. However, group D isolates were most versatile as all were equipped with virulence genes and showed highest level of cytotoxicity.

  7. Prevalence and risk factors associated with Entamoeba histolytica/dispar/moshkovskii infection among three Orang Asli ethnic groups in Malaysia.

    Directory of Open Access Journals (Sweden)

    Tengku Shahrul Anuar

    Full Text Available Entamoeba histolytica/Entamoeba dispar/Entamoeba moshkovskii infection is still prevalent in rural Malaysia especially among Orang Asli communities. Currently, information on prevalence of this infection among different ethnic groups of Orang Asli is unavailable in Malaysia. To contribute to a better comprehension of the epidemiology of this infection, a cross-sectional study aimed at providing the first documented data on the prevalence and risk factors associated with E. histolytica/E. dispar/E. moshkovskii infection was carried out among three Orang Asli ethnic groups (Proto-Malay, Negrito, and Senoi in selected villages in Negeri Sembilan, Perak, and Pahang states, Malaysia.Faecal samples were examined by formalin-ether sedimentation and trichrome staining techniques. Of 500 individuals, 8.7% (13/150 of Proto-Malay, 29.5% (41/139 of Negrito, and 18.5% (39/211 of Senoi were positive for E. histolytica/E. dispar/E. moshkovskii, respectively. The prevalence of this infection showed an age-dependency relationship, with higher rates observed among those aged less than 15 years in all ethnic groups studied. Multivariate analysis confirmed that not washing hands after playing with soils or gardening and presence of other family members infected with E. histolytica/E. dispar/E. moshkovskii were significant risk factors of infection among all ethnic groups. However, eating with hands, the consumption of raw vegetables, and close contact with domestic animals were identified as significant risk factors in Senoi.Essentially, the findings highlighted that E. histolytica/E. dispar/E. moshkovskii parasites are still prevalent in Malaysia. Further studies using molecular approaches to distinguish the morphologically identical species of pathogenic, E. histolytica from the non-pathogenic, E. dispar and E. moshkovskii are needed. The establishment of such data will be beneficial for the public health authorities in the planning and implementation of specific

  8. Antimicrobial Resistance Characteristics and Phylogenetic Groups of Escherichia coli Isolated From Diarrheic Calves in Southeast of Iran

    Directory of Open Access Journals (Sweden)

    Zahedeh Naderi

    2016-11-01

    Full Text Available Background: Antimicrobial resistance is one of the main challenges in diarrheal diseases in human and animals. Regardless to the main reason of the disease, approximately all antimicrobial actions including treatment, control and prevention are mostly centralized against Escherichia coli (E. coli strains. Objectives: This work purposed to antimicrobial resistance (AR and determinate virulence genes and phylogenetic groups in E. coli isolates (n=170 obtained from calves with diarrhea. Materials and methods: Isolates were molecular characterized for 17 AR genes and 3 phylogenetic sequences. AR phenotyping were performed on all strains for 12 antimicrobial agents by using disc diffusion method. Results: All AR genes but qnrS were identified with different prevalence in E. coli isolates that the most common genes were aadA (20%, blaTEM (11.7% and sulII (11.2 % belonging to aminoglycoside, β-lactamase and sulphonamide families, respectively. Resistance to the penicillin and sulphamethoxazole drugs was found in 100% of isolates and followed by tetracycline (73.5%, streptomycin (60%, trimethoprim sulphamethoxazole (56.5% and kanamycin (53.5%. The phylogenetic groups A and B1 considerably surrounded the majority of isolates with the frequency of 65.8% and 30.6%, respectively. Conclusions: In Iran, diarrheic calves have an important role as reservoir of resistant E. coli strains against the some drugs which are registered for treatment of calf diarrhea.

  9. Phylogenetic relationships among extinct and extant turtles: the position of Pleurodira and the effects of the fossils on rooting crown-group turtles

    NARCIS (Netherlands)

    Sterli, J.

    2010-01-01

    The origin and evolution of the crown-group of turtles (Cryptodira + Pleurodira) is one of the most interesting topics in turtle evolution, second perhaps only to the phylogenetic position of turtles among amniotes. The present contribution focuses on the former problem, exploring the phylogenetic

  10. Scanning electron microscopy of male terminalia and its application to species recognition and phylogenetic reconstruction in the Drosophila saltans group.

    Science.gov (United States)

    Souza, Tiago Alves Jorge; Noll, Fernando Barbosa; Bicudo, Hermione Elly Melara de Campos; Madi-Ravazzi, Lilian

    2014-01-01

    The Drosophila saltans group consists of five subgroups and 21 species, most of which have been identified only by morphological aspects of the male terminalia revealed by drawings using a camera lucida and a bright-field microscope. However, several species in the group, mainly those included in the saltans subgroup, are difficult to differentiate using only these characteristics. In this study, we used scanning electron microscopy (SEM) to analyze 19 structures of the male terminalia in 10 species from the five saltans subgroups. Among these structures, nine could be identified only through SEM analysis. We aimed to find other characteristics useful for morphological recognition of these species and to use these characteristics for phylogenetic reconstruction. These morphological differences enabled us to effectively distinguish among sibling species. These findings confirmed the monophyly of this group as previously determined in evolutionary studies based on other markers. The single most parsimonious tree (CI = 87 and RI = 90) indicated that the cordata subgroup is the most basal lineage and the saltans subgroup is the most apical lineage, as shown in earlier studies based on morphological data. However, our findings differed somewhat from these studies with respect to the phylogenetic relationships of species in the saltans group indicating that this group is still a puzzle that remains to be deciphered.

  11. Comparative analysis of antibiotic resistance and phylogenetic group patterns in human and porcine urinary tract infectious Escherichia coli

    DEFF Research Database (Denmark)

    Hancock, Viktoria; Nielsen, E.M.; Krag, L.

    2009-01-01

    Urinary tract infections (UTIs) are one of the most common infectious diseases in humans and domestic animals such as pigs. The most frequent infectious agent in such infections is Escherichia coli. Virulence characteristics of E. coli UTI strains range from highly virulent pyelonephritis strains...... to relatively benign asymptomatic bacteriuria strains. Here we analyse a spectrum of porcine and human UTI E. coli strains with respect to their antibiotic resistance patterns and their phylogenetic groups, determined by multiplex PCR. The clonal profiles of the strains differed profoundly; whereas human...

  12. New insights on the phylogenetic relationships among the traditional Philodendron subgenera and the other groups of the Homalomena clade (Araceae).

    Science.gov (United States)

    Vasconcelos, Santelmo; Soares, Maria de Lourdes; Sakuragui, Cássia M; Croat, Thomas B; Oliveira, Guilherme; Benko-Iseppon, Ana M

    2018-05-19

    Philodendron (Araceae) is one of the largest Neotropical plant genera, with approximately 500 species and at least 1000 species predicted. There is a considerable ecological diversity in the group, although most species occur in the humid forests of tropical America. Despite being relatively well-studied in taxonomic analyses, the relationships among the traditional morphological groups of the genus are not well-established, mainly regarding the three traditional subgenera, referred here as Philodendron sensu lato (s.l.), P. subg. Pteromischum, P. subg. Philodendron and P. subg. Meconostigma, which was recently recognized as a separate genus, Thaumatophyllum. Therefore, the present work evaluates the phylogenetic position and the monophyly of Philodendron s.l. and its three main subdivisions, and the sister groups within the Homalomena clade, which also includes the Neotropical genus Adelonema, the two Asian genera Homalomena and Furtadoa, and the two African genera Cercestis and Culcasia, by means of molecular phylogenetic approaches including chloroplast DNA (atpF-atpH, rpl32-trnL, trnQ-5'-rps16 and trnV-ndhC) and nuclear (ITS2) markers. The monophyly of Philodendron s.l. and its three lineages is confirmed and our analyses corroborate previous morphologic data indicating Thaumatophyllum as sister to the clade formed by P. subg. Pteromischum and P. subg. Philodendron. Copyright © 2018 Elsevier Inc. All rights reserved.

  13. Zinc concentrations in marine macroalgae and a lichen from western Ireland in relation to phylogenetic grouping, habitat and morphology

    International Nuclear Information System (INIS)

    Stengel, Dagmar B.; Macken, Ailbhe; Morrison, Liam; Morley, Nicholas

    2004-01-01

    Zinc concentrations in 19 species of marine macroalgae and a lichen from western Ireland (Spiddal, Co. Galway) were analysed by atomic absorption spectrophotometry. Algae were collected from a single site but occupied different shore levels and belonged to distinct phylogenetic groupings and to different (previously recognised) morphological groups. Concentrations ranged from 15-115 μg g -1 dry weight. The greatest variation in concentration occurred amongst the red algal species, containing both maximum and minimum concentrations. Zn concentrations in brown and green algae were generally lower than those in red algae. When grouped according to thallus morphology, thin, branched sheets (which consisted mainly of red algae) contained the highest Zn concentrations. In filamentous algae, Zn levels were higher than in thick-leathery or coarsely branched algae. However, all green algal species examined had similar Zn concentrations, despite their different morphologies. In brown algae, the highest Zn levels were detected in mid-shore fucoids (Fucus vesiculosus and Fucus serratus), while thicker, subtidal and low-shore brown algae (Laminaria digitata, Halydris siliquosa) exhibited lower Zn concentrations. The lowest Zn concentrations were detected in high-intertidal species (Fucus spiralis, Pelvetia canaliculata), the only marine lichen examined (Ramalina siliquosa) and a red crustose alga (Corallina officinalis). In all morphological groups, red algal representatives contained relatively higher levels of Zn, the exception being Corallina officinalis. Zn levels in 4 species from a second, estuarine site in Galway Bay exhibited the same relative differences amongst species, but were all consistently higher than in algae from Spiddal. It is concluded that Zn accumulation in macroalgae is closely related to ecological growth strategies, following a functional-form model. However, the phylogenetic origin of species which determines carbohydrate and phenol composition, and

  14. Zinc concentrations in marine macroalgae and a lichen from western Ireland in relation to phylogenetic grouping, habitat and morphology

    Energy Technology Data Exchange (ETDEWEB)

    Stengel, Dagmar B.; Macken, Ailbhe; Morrison, Liam; Morley, Nicholas

    2004-05-01

    Zinc concentrations in 19 species of marine macroalgae and a lichen from western Ireland (Spiddal, Co. Galway) were analysed by atomic absorption spectrophotometry. Algae were collected from a single site but occupied different shore levels and belonged to distinct phylogenetic groupings and to different (previously recognised) morphological groups. Concentrations ranged from 15-115 {mu}g g{sup -1} dry weight. The greatest variation in concentration occurred amongst the red algal species, containing both maximum and minimum concentrations. Zn concentrations in brown and green algae were generally lower than those in red algae. When grouped according to thallus morphology, thin, branched sheets (which consisted mainly of red algae) contained the highest Zn concentrations. In filamentous algae, Zn levels were higher than in thick-leathery or coarsely branched algae. However, all green algal species examined had similar Zn concentrations, despite their different morphologies. In brown algae, the highest Zn levels were detected in mid-shore fucoids (Fucus vesiculosus and Fucus serratus), while thicker, subtidal and low-shore brown algae (Laminaria digitata, Halydris siliquosa) exhibited lower Zn concentrations. The lowest Zn concentrations were detected in high-intertidal species (Fucus spiralis, Pelvetia canaliculata), the only marine lichen examined (Ramalina siliquosa) and a red crustose alga (Corallina officinalis). In all morphological groups, red algal representatives contained relatively higher levels of Zn, the exception being Corallina officinalis. Zn levels in 4 species from a second, estuarine site in Galway Bay exhibited the same relative differences amongst species, but were all consistently higher than in algae from Spiddal. It is concluded that Zn accumulation in macroalgae is closely related to ecological growth strategies, following a functional-form model. However, the phylogenetic origin of species which determines carbohydrate and phenol composition

  15. Origins and evolution of cinnamon and camphor: A phylogenetic and historical biogeographical analysis of the Cinnamomum group (Lauraceae).

    Science.gov (United States)

    Huang, Jian-Feng; Li, Lang; van der Werff, Henk; Li, Hsi-Wen; Rohwer, Jens G; Crayn, Darren M; Meng, Hong-Hu; van der Merwe, Marlien; Conran, John G; Li, Jie

    2016-03-01

    Tropical and subtropical amphi-Pacific disjunction is among the most fascinating distribution patterns, but received little attention. Here we use the fossil-rich Cinnamomum group, a primarily tropical and subtropical Asian lineage with some species distributed in Neotropics, Australasia and Africa to shed light upon this disjunction pattern. Phylogenetic and biogeographic analyses were carried out using sequences of three nuclear loci from 94 Cinnamomum group and 13 outgroup samples. Results show that although there are three clades within a monophyletic Cinnamomum group, Cinnamomum and previously recognized subdivisions within this genus were all rejected as natural groups. The Cinnamomum group appears to have originated in the widespread boreotropical paleoflora of Laurasia during the early Eocene (ca. 55Ma). The formation and breakup of the boreotropics seems to have then played a key role in the formation of intercontinental disjunctions within the Cinnamomum group. The first cooling interval (50-48Ma) in the late early Eocene resulted in a floristic discontinuity between Eurasia and North America causing the tropical and subtropical amphi-Pacific disjunction. The second cooling interval in the mid-Eocene (42-38Ma) resulted in the fragmentation of the boreotropics within Eurasia, leading to an African-Asian disjunction. Multiple dispersal events from North into South America occurred from the early Eocene to late Miocene and a single migration event from Asia into Australia appears to have occurred in the early Miocene. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Short notes and reviews Simplifying hydrozoan classification: inappropriateness of the group Hydroidomedusae in a phylogenetic context

    NARCIS (Netherlands)

    Marques, Antonio C.

    2001-01-01

    The systematics of Hydrozoa is considered from the viewpoint of logical consistency between phylogeny and classification. The validity of the nominal taxon Hydroidomedusae (including all groups of Hydrozoa except the Siphonophorae) is discussed with regard to its distinctness and inclusive

  17. Phylogenetic Analysis of a Novel Molecular Isolate of Spotted Fever Group Rickettsiae from Northern Peru

    National Research Council Canada - National Science Library

    Jiang, Ju; Blair, Patrick J; Felices, Vidal; Moron, Cecilia; Cespedes, Manuel; Anaya, Elizabeth; Schoeler, George B; Sumner, John W; Olson, James G; Richards, Allen L

    2005-01-01

    ...) collected from two domestic horses living in two separate locations in northern Peru (Coletas and Naranjo) was conducted to more clearly characterize this recently reported novel spotted fever group...

  18. Population structure of Helicobacter pylori among ethnic groups in Malaysia: recent acquisition of the bacterium by the Malay population.

    Science.gov (United States)

    Tay, Chin Yen; Mitchell, Hazel; Dong, Quanjiang; Goh, Khean-Lee; Dawes, Ian W; Lan, Ruiting

    2009-06-19

    Helicobacter pylori is a major gastric bacterial pathogen. This pathogen has been shown to follow the routes of human migration by their geographical origin and currently the global H. pylori population has been divided into six ancestral populations, three from Africa, two from Asia and one from Europe. Malaysia is made up of three major ethnic populations, Malay, Chinese and Indian, providing a good population for studying recent H. pylori migration and admixture. Seventy eight H. pylori isolates, including 27 Chinese, 35 Indian and 16 Malay isolates from Malaysia were analysed by multilocus sequence typing (MLST) of seven housekeeping genes and compared with the global MLST data. STRUCTURE analysis assigned the isolates to previously identified H. pylori ancestral populations, hpEastAsia, hpAsia2 and hpEurope, and revealed a new subpopulation, hspIndia, within hpAsia2. Statistical analysis allowed us to identify population segregation sites that divide the H. pylori populations and the subpopulations. The majority of Malay isolates were found to be grouped together with Indian isolates. The majority of the Malay and Indian H. pylori isolates share the same origin while the Malaysian Chinese H. pylori is distinctive. The Malay population, known to have a low infection rate of H. pylori, was likely to be initially H. pylori free and gained the pathogen only recently from cross infection from other populations.

  19. Population structure of Helicobacter pylori among ethnic groups in Malaysia: recent acquisition of the bacterium by the Malay population

    Directory of Open Access Journals (Sweden)

    Dawes Ian W

    2009-06-01

    Full Text Available Abstract Background Helicobacter pylori is a major gastric bacterial pathogen. This pathogen has been shown to follow the routes of human migration by their geographical origin and currently the global H. pylori population has been divided into six ancestral populations, three from Africa, two from Asia and one from Europe. Malaysia is made up of three major ethnic populations, Malay, Chinese and Indian, providing a good population for studying recent H. pylori migration and admixture. Results Seventy eight H. pylori isolates, including 27 Chinese, 35 Indian and 16 Malay isolates from Malaysia were analysed by multilocus sequence typing (MLST of seven housekeeping genes and compared with the global MLST data. STRUCTURE analysis assigned the isolates to previously identified H. pylori ancestral populations, hpEastAsia, hpAsia2 and hpEurope, and revealed a new subpopulation, hspIndia, within hpAsia2. Statistical analysis allowed us to identify population segregation sites that divide the H. pylori populations and the subpopulations. The majority of Malay isolates were found to be grouped together with Indian isolates. Conclusion The majority of the Malay and Indian H. pylori isolates share the same origin while the Malaysian Chinese H. pylori is distinctive. The Malay population, known to have a low infection rate of H. pylori, was likely to be initially H. pylori free and gained the pathogen only recently from cross infection from other populations.

  20. Spotlight: Malaysia.

    Science.gov (United States)

    Patriquin, W

    1988-03-01

    Focus is on Malaysia -- its population and land area, its total fertility rate and mortality rate, economic development, contraceptive usage, and population policy. In 1987 Malaysia's population was estimated to be 16.1 million with births 31/1000 population and deaths 7/1000 population. The rate of natural increase is 2.4%, the total fertility rate 3.9 children/woman, and the infant mortality rate 30/1000 live births. Ethnically, Malaysia is made up of several distinct groups. Indigenous Malays are the most numerous -- about 50% of the population. Their unique characteristics include that they are Moslem, rural, and usually of lower economic status. Chinese make up the 2nd largest group of Malaysians, nearly 1/3 of the population. This group is active in trade, business, and finance and possesses considerable economic power. About 10% of the population is of Indian descent. Malaysia has experienced much economic growth. Traditional exports grew in volume and value during the 1970; the petroleum sector expanded so rapidly it accounts for 1/4 of all exports. One reason for Malaysia's rapid economic growth is the government's promotion of industrialization and foreign investment. According to the 1982 contraceptive prevalence survey, 42% of currently married women 15-44 years were using contraception. The government considers the current rate of national increase to be satisfactory, but in 1984 it adopted a population policy to more than quadruple its population in 2100 to 70 million. It intends to accomplish this by instituting pronatalist incentives to help the fall in the national growth rate. The government's rationale for more population growth is that a larger domestic population could better support industrial growth that otherwise might be stymied by "protectionist policies practiced by developed countries." Incentives to encourage fertility include income-tax deductions and maternity benefits for women who have up to 5 children.

  1. Permanent dentition occlusion in Chinese, Indian and Malay groups in Malaysia.

    Science.gov (United States)

    Woon, K C; Thong, Y L; Abdul Kadir, R

    1989-03-01

    This survey outlines the proportion of the various features of occlusion in the permanent dentition of the three ethnic races, Chinese, Malay and Indian in Malaysia. The mean age of the high school children surveyed was 16.4 years. The Chinese and Malays had almost similar distribution of the different types of occlusion. There was a significantly higher prevalence of Class III occlusion among the Chinese and Malays as compared to the Indians. In addition, an edge to edge incisor relationship seemed to be a norm in the Chinese (54%) and Malays (50%) whilst the overjet of between 2-4 mm and the overbite of between 1/3 to 2/3 was more normal to Indians (50%). A crowded dentition was also a norm for the three races.

  2. Determination of phylogenetic groups and antibiotic resistance pattern of Enterotoxigenic Escherishia coli isolates from diarrheoic cases in Bam City by PCR

    Directory of Open Access Journals (Sweden)

    Hesam Alizade

    2015-04-01

    Full Text Available Background and Aim: Purposes of this study were to determine the phylogenetic groups, prevalence of enterotoxigenic pathotype and antibiotic resistance of Escherichia coli (E. coli isolates from diarrheic cases in Bam city. Materials and Methods: In this study 155 E. coli were isolated from diarrheic samples in Bam city. Phylogenetic groups of isolates and enterotoxigenic pathotype were determined by detection of chuA, yjaA, TspE4C2 and ST, LT genes respectively. Results: One hundred fifty five examined isolates were distributed in phylogenetic groups: A (71.60%, B1 (3.22%, B2 (9.67% and D (15.48%. The genes for enterotoxigenic pathotype were detected in 52 isolates (33.54%, which ST gene were found in 29 isolates, LT in 16 isolates and LT, ST genes in 7 isolates. Twenty nine ST gene positive isolates were distributed in three phylogenetic groups A (48.28%, D (41.38% and B2 (10.34%. According to the antibiotic susceptibility tests maximum and minimum antibiotic resistance rate was against to trimethoprim/sulfamethoxazole (74.19% and ciprofloxacin and gentamycin (9.67%. Fifteen multiple antibiotic resistance patterns were detected in four phylogenetic groups. Conclusions: Escherichia coli isolates from enterotoxigenic pathotype have a considerable antibiotic resistance rate in Bam city and were distributed in different phylogenetic groups. Since a considerable number of isolates were negative for LT and ST genes, it is necessary to study the other virulence genes and their phylogenetic background in E. coli isolates from diarrheic cases in Bam city.

  3. Mosasauroid phylogeny under multiple phylogenetic methods provides new insights on the evolution of aquatic adaptations in the group.

    Directory of Open Access Journals (Sweden)

    Tiago R Simões

    Full Text Available Mosasauroids were a successful lineage of squamate reptiles (lizards and snakes that radiated during the Late Cretaceous (95-66 million years ago. They can be considered one of the few lineages in the evolutionary history of tetrapods to have acquired a fully aquatic lifestyle, similarly to whales, ichthyosaurs and plesiosaurs. Despite a long history of research on this group, their phylogenetic relationships have only been tested so far using traditional (unweighted maximum parsimony. However, hypotheses of mosasauroid relationships and the recently proposed multiple origins of aquatically adapted pelvic and pedal features in this group can be more thoroughly tested by methods that take into account variation in branch lengths and evolutionary rates. In this study, we present the first mosasauroid phylogenetic analysis performed under different analytical methods, including maximum likelihood, Bayesian inference, and implied weighting maximum parsimony. The results indicate a lack of congruence in the topological position of halisaurines and Dallasaurus. Additionally, the genus Prognathodon is paraphyletic under all hypotheses. Interestingly, a number of traditional mosasauroid clades become weakly supported, or unresolved, under Bayesian analyses. The reduced resolutions in some consensus trees create ambiguities concerning the evolution of fully aquatic pelvic/pedal conditions under many analyses. However, when enough resolution was obtained, reversals of the pelvic/pedal conditions were favoured by parsimony and likelihood ancestral state reconstructions instead of independent origins of aquatic features in mosasauroids. It is concluded that most of the observed discrepancies among the results can be associated with different analytical procedures, but also due to limited postcranial data on halisaurines, yaguarasaurines and Dallasaurus.

  4. Mosasauroid phylogeny under multiple phylogenetic methods provides new insights on the evolution of aquatic adaptations in the group

    Science.gov (United States)

    Vernygora, Oksana; Paparella, Ilaria; Jimenez-Huidobro, Paulina; Caldwell, Michael W.

    2017-01-01

    Mosasauroids were a successful lineage of squamate reptiles (lizards and snakes) that radiated during the Late Cretaceous (95–66 million years ago). They can be considered one of the few lineages in the evolutionary history of tetrapods to have acquired a fully aquatic lifestyle, similarly to whales, ichthyosaurs and plesiosaurs. Despite a long history of research on this group, their phylogenetic relationships have only been tested so far using traditional (unweighted) maximum parsimony. However, hypotheses of mosasauroid relationships and the recently proposed multiple origins of aquatically adapted pelvic and pedal features in this group can be more thoroughly tested by methods that take into account variation in branch lengths and evolutionary rates. In this study, we present the first mosasauroid phylogenetic analysis performed under different analytical methods, including maximum likelihood, Bayesian inference, and implied weighting maximum parsimony. The results indicate a lack of congruence in the topological position of halisaurines and Dallasaurus. Additionally, the genus Prognathodon is paraphyletic under all hypotheses. Interestingly, a number of traditional mosasauroid clades become weakly supported, or unresolved, under Bayesian analyses. The reduced resolutions in some consensus trees create ambiguities concerning the evolution of fully aquatic pelvic/pedal conditions under many analyses. However, when enough resolution was obtained, reversals of the pelvic/pedal conditions were favoured by parsimony and likelihood ancestral state reconstructions instead of independent origins of aquatic features in mosasauroids. It is concluded that most of the observed discrepancies among the results can be associated with different analytical procedures, but also due to limited postcranial data on halisaurines, yaguarasaurines and Dallasaurus. PMID:28467456

  5. Studying the evolutionary relationships and phylogenetic trees of 21 groups of tRNA sequences based on complex networks.

    Science.gov (United States)

    Wei, Fangping; Chen, Bowen

    2012-03-01

    To find out the evolutionary relationships among different tRNA sequences of 21 amino acids, 22 networks are constructed. One is constructed from whole tRNAs, and the other 21 networks are constructed from the tRNAs which carry the same amino acids. A new method is proposed such that the alignment scores of any two amino acids groups are determined by the average degree and the average clustering coefficient of their networks. The anticodon feature of isolated tRNA and the phylogenetic trees of 21 group networks are discussed. We find that some isolated tRNA sequences in 21 networks still connect with other tRNAs outside their group, which reflects the fact that those tRNAs might evolve by intercrossing among these 21 groups. We also find that most anticodons among the same cluster are only one base different in the same sites when S ≥ 70, and they stay in the same rank in the ladder of evolutionary relationships. Those observations seem to agree on that some tRNAs might mutate from the same ancestor sequences based on point mutation mechanisms.

  6. Phylogenetic continuum indicates "galaxies" in the protein universe: preliminary results on the natural group structures of proteins.

    Science.gov (United States)

    Ladunga, I

    1992-04-01

    The markedly nonuniform, even systematic distribution of sequences in the protein "universe" has been analyzed by methods of protein taxonomy. Mapping of the natural hierarchical system of proteins has revealed some dense cores, i.e., well-defined clusterings of proteins that seem to be natural structural groupings, possibly seeds for a future protein taxonomy. The aim was not to force proteins into more or less man-made categories by discriminant analysis, but to find structurally similar groups, possibly of common evolutionary origin. Single-valued distance measures between pairs of superfamilies from the Protein Identification Resource were defined by two chi 2-like methods on tripeptide frequencies and the variable-length subsequence identity method derived from dot-matrix comparisons. Distance matrices were processed by several methods of cluster analysis to detect phylogenetic continuum between highly divergent proteins. Only well-defined clusters characterized by relatively unique structural, intracellular environmental, organismal, and functional attribute states were selected as major protein groups, including subsets of viral and Escherichia coli proteins, hormones, inhibitors, plant, ribosomal, serum and structural proteins, amino acid synthases, and clusters dominated by certain oxidoreductases and apolar and DNA-associated enzymes. The limited repertoire of functional patterns due to small genome size, the high rate of recombination, specific features of the bacterial membranes, or of the virus cycle canalize certain proteins of viruses and Gram-negative bacteria, respectively, to organismal groups.

  7. Whole genome sequencing as a tool for phylogenetic analysis of clinical strains of Mitis group streptococci

    DEFF Research Database (Denmark)

    Rasmusen, L. H.; Dargis, R.; Iversen, Katrine Højholt

    2016-01-01

    observed in single gene analyses. Species identification based on single gene analysis showed their limitations when more strains were included. In contrast, analyses incorporating more sequence data, like MLSA, SNPs and core-genome analyses, provided more distinct clustering. The core-genome tree showed......Identification of Mitis group streptococci (MGS) to the species level is challenging for routine microbiology laboratories. Correct identification is crucial for the diagnosis of infective endocarditis, identification of treatment failure, and/or infection relapse. Eighty MGS from Danish patients...

  8. Another Important News from the Neuronman: Malaysia's Neuroscience Group Moves upwards in Terms of Research, Creativity, and Innovation.

    Science.gov (United States)

    Abdullah, Jafri Malin

    2015-12-01

    12 months ago the first Neuroscience special issue of the Malaysia Journal of Medical Sciences was born with the intention to increase the number of local publication dedicated to neurosciences. Since then many events happened in the neuroscience world of Malaysia, those considered major were the establishment of a Neurotechnology Foresight 2050 task force by the Academy of Medicine Malaysia as well as the launching of Malaysia as the 18th member to join the International Neuroinformatics Coordinating Facility on the 9th October 2015 which was officiated by the Deputy Ministers of Higher Education, Datuk Mary Yap.

  9. Stomatal cell wall composition: distinctive structural patterns associated with different phylogenetic groups.

    Science.gov (United States)

    Shtein, Ilana; Shelef, Yaniv; Marom, Ziv; Zelinger, Einat; Schwartz, Amnon; Popper, Zoë A; Bar-On, Benny; Harpaz-Saad, Smadar

    2017-04-01

    Stomatal morphology and function have remained largely conserved throughout ∼400 million years of plant evolution. However, plant cell wall composition has evolved and changed. Here stomatal cell wall composition was investigated in different vascular plant groups in attempt to understand their possible effect on stomatal function. A renewed look at stomatal cell walls was attempted utilizing digitalized polar microscopy, confocal microscopy, histology and a numerical finite-elements simulation. The six species of vascular plants chosen for this study cover a broad structural, ecophysiological and evolutionary spectrum: ferns ( Asplenium nidus and Platycerium bifurcatum ) and angiosperms ( Arabidopsis thaliana and Commelina erecta ) with kidney-shaped stomata, and grasses (angiosperms, family Poaceae) with dumbbell-shaped stomata ( Sorghum bicolor and Triticum aestivum ). Three distinct patterns of cellulose crystallinity in stomatal cell walls were observed: Type I (kidney-shaped stomata, ferns), Type II (kidney-shaped stomata, angiosperms) and Type III (dumbbell-shaped stomata, grasses). The different stomatal cell wall attributes investigated (cellulose crystallinity, pectins, lignin, phenolics) exhibited taxon-specific patterns, with reciprocal substitution of structural elements in the end-walls of kidney-shaped stomata. According to a numerical bio-mechanical model, the end walls of kidney-shaped stomata develop the highest stresses during opening. The data presented demonstrate for the first time the existence of distinct spatial patterns of varying cellulose crystallinity in guard cell walls. It is also highly intriguing that in angiosperms crystalline cellulose appears to have replaced lignin that occurs in the stomatal end-walls of ferns serving a similar wall strengthening function. Such taxon-specific spatial patterns of cell wall components could imply different biomechanical functions, which in turn could be a consequence of differences in

  10. Permian ultrafelsic A-type granite from Besar Islands group, Johor, peninsular Malaysia

    Science.gov (United States)

    Ghani, Azman A.; Hazad, Fatin Izzani; Jamil, Azmiah; Xiang, Quek Long; Atiqah Wan Ismail, Wan Nur; Chung, Sun-Lin; Lai, Yu-Ming; Roselee, Muhammad Hatta; Islami, Nur; Nyein, Kyaw Kyaw; Amir Hassan, Meor Hakif; Abu Bakar, Mohd Farid; Umor, Mohd Rozi

    2014-12-01

    The granitic rocks of the peninsula have traditionally been divided into two provinces, i.e., Western and Eastern provinces, corresponding to S- and I-type granite respectively. The Western Province granite is characterised by megacrystic and coarse-grained biotite, tin-mineralised, continental collision granite, whereas, the Eastern Province granite is bimodal I-type dominated by granodiorite and associated gabbroic of arc type granite. This paper reports the occurrence of an A-type granite from peninsular Malaysia. The rocks occur in the Besar, Tengah, and Hujung islands located in the southeastern part of the peninsula. The granite is highly felsic with SiO2 ranging from 75.70% to 77.90% (differentiation index = 94.2-97.04). It is weakly peraluminous (average ACNK =1.02), has normative hypersthene (0.09-2.19%) and high alkali content (8.32-8.60%). The granites have many A-type characteristics, among them are shallow level of emplacement, high Ga, FeT/MgO and low P, Sr, Ti, CaO and Nb. Calculated zircon saturation temperatures for the Besar magma ranging from 793 ∘ to 806 ∘C is consistent with high temperature partial melting of a felsic infracrustal source which is taken as one of the mechanisms to produce A-type magma. The occurrence of the A-type granite can be related to the extensional back arc basin in the Indo-China terrane during the earliest Permian.

  11. The effectiveness of group dietary counselling among non insulin dependent diabetes mellitus (NIDDM) patients in resettlement scheme areas in Malaysia.

    Science.gov (United States)

    Talib, R; Ali, O; Arshad, F; Kadir, K A

    1997-06-01

    A study was undertaken in FELDA (Federal Land Development Authority) resettlement scheme areas in Pahang, Malaysia, to determine the effectiveness of group dietary counselling in motivating diabetic patients to achieve good dietary habits, and weight and diabetes control. Sixty-one non-insulin dependent diabetes mellitus (NIDDM) patients were randomly assigned to either the experimental or control group. The experimental group received six sessions of group dietary counselling over 5 months and the control group received mass media diabetes-educational program during the same period. The one hour group dietary counselling sessions discussed general knowledge of diabetes, food groups for meal planning, the importance of dietary fibre-rich foods, types of fat in food, exercise and weight control. The experimental group met monthly with a dietitian as a counsellor. Effectiveness was assessed by improvement in food choice, and decline in percentage glycated haemoglobin (total HbA1) or body mass index (BMI). Measurements were made at a baseline visit, every two months during the six month program, and six months afterwards. Patients in the experimental group improved their food choices, resulting in a healthier diet high in unrefined carbohydrates and dietary fibre rich foods, and low in fat. There were significant reductions of their percentage total HbA1 levels and BMI following the counselling sessions, which decreased further six months after the program compared with patients in the control group. Thus group dietary counselling is effective in motivating NIDDM patients to achieve better food choice, and related weight and glycaemic control in a Malaysian setting.

  12. High prevalence of alpha- and beta-thalassemia in the Kadazandusuns in East Malaysia: challenges in providing effective health care for an indigenous group.

    Science.gov (United States)

    Tan, Jin-Ai Mary Anne; Lee, Ping-Chin; Wee, Yong-Chui; Tan, Kim-Lian; Mahali, Noor Fadzlin; George, Elizabeth; Chua, Kek-Heng

    2010-01-01

    Thalassemia can lead to severe transfusion-dependent anemia, and it is the most common genetic disorder in Malaysia. This paper aims to determine the prevalence of thalassemia in the Kadazandusuns, the largest indigenous group in Sabah, East Malaysia. α- and β-thalassemia were confirmed in 33.6% and 12.8%, of the individuals studied respectively. The high prevalence of α- and β-thalassemia in the Kadazandusuns indicates that thalassemia screening, genetic counseling, and prenatal diagnosis should be included as part of their healthcare system. This preliminary paper serves as a baseline for further investigations into the health and genetic defects of the major indigenous population in Sabah, East Malaysia.

  13. Breast Density Among the Three Major Ethnic Groups of Women in Malaysia from a Full-Filed Digital Mammography System

    International Nuclear Information System (INIS)

    Noriah Jamal; Cheung, H.S.

    2014-01-01

    We carried out a prospective study of breast density Full-Field Digital mammograms performed on 668 Malaysian women from three ethnic groups at a voluntary screening mammographic center in Kuala Lumpur, Malaysia. Of these women, 259 were Malays (38.8 %), 298 were Chinese (44.6 %) and 111 were Indians (16.6 %). The Tabar breast density classification (I-V) was used to evaluate breast density. A Stepwise multiple regression analysis was used to test for significant difference in breast density for the three ethnic groups. Data was also analyzed using descriptive statistics. We found that Pattern I was seen in 49.4 % Malay, 47.3 % Chinese and 40.5 % Indian women. Predominantly fatty breasts (Pattern II and III) were seen on mammograms of 36.3 % Malay, 11.1 % Chinese and 25.2 % Indian women. Dense type IV and V patterns were seen in 20.8 % Malay, 29.5 % Chinese and 42 % Indian women. There was no statistically significant difference (p>0.01) in breast density in the three ethnic groups. The breast density reduces with increasing age in all three ethnic groups. (Author)

  14. How Does Group Affiliation Affect The Diversification Performance Of Family-Controlled Firms In Malaysia? – A Governance Perspective

    OpenAIRE

    Ng Sin Huei

    2014-01-01

    This paper examines the roles of business group affiliations and whether the size and ownership structure of business groups influence the performance outcomes of diversification among family-controlled firms in Malaysia. It presents evidence that agency-driven and thus performance-diminishing firm diversification is more likely to take place in firms affiliated with a family-controlled business group than in independent firms. The findings support the hypothesis that if the benefits of diver...

  15. Reconstruction of phylogenetic relationships in a highly reticulate group with deep coalescence and recent speciation (Hieracium, Asteraceae).

    Science.gov (United States)

    Krak, K; Caklová, P; Chrtek, J; Fehrer, J

    2013-02-01

    Phylogeny reconstruction based on multiple unlinked markers is often hampered by incongruent gene trees, especially in closely related species complexes with high degrees of hybridization and polyploidy. To investigate the particular strengths and limitations of chloroplast DNA (cpDNA), low-copy nuclear and multicopy nuclear markers for elucidating the evolutionary history of such groups, we focus on Hieracium s.str., a predominantly apomictic genus combining the above-mentioned features. Sequences of the trnV-ndhC and trnT-trnL intergenic spacers were combined for phylogenetic analyses of cpDNA. Part of the highly variable gene for squalene synthase (sqs) was applied as a low-copy nuclear marker. Both gene trees were compared with previous results based on the multicopy external transcribed spacer (ETS) of the nuclear ribosomal DNA. The power of the different markers to detect hybridization varied, but they largely agreed on particular hybrid and allopolyploid origins. The same crown groups of species were recognizable in each dataset, but basal relationships were strongly incongruent among cpDNA, sqs and ETS trees. The ETS tree was considered as the best approximation of the species tree. Both cpDNA and sqs trees showed basal polytomies as well as merging or splitting of species groups of non-hybrid taxa. These patterns can be best explained by a rapid diversification of the genus with ancestral polymorphism and incomplete lineage sorting. A hypothetical scenario of Hieracium speciation based on all available (including non-molecular) evidence is depicted. Incorporation of seemingly contradictory information helped to better understand species origins and evolutionary patterns in this notoriously difficult agamic complex.

  16. Admixture patterns and genetic differentiation in negrito groups from West Malaysia estimated from genome-wide SNP data.

    Science.gov (United States)

    Jinam, Timothy A; Phipps, Maude E; Saitou, Naruya

    2013-01-01

    Southeast Asia houses various culturally and linguistically diverse ethnic groups. In Malaysia, where the Malay, Chinese, and Indian ethnic groups form the majority, there exist minority groups such as the "negritos" who are believed to be descendants of the earliest settlers of Southeast Asia. Here we report patterns of genetic substructure and admixture in two Malaysian negrito populations (Jehai and Kensiu), using ~50,000 genome-wide single-nucleotide polymorphism (SNP) data. We found traces of recent admixture in both the negrito populations, particularly in the Jehai, with the Malay through principal component analysis and STRUCTURE analysis software, which suggested that the admixture was as recent as one generation ago. We also identified significantly differentiated nonsynonymous SNPs and haplotype blocks related to intracellular transport, metabolic processes, and detection of stimulus. These results highlight the different levels of admixture experienced by the two Malaysian negritos. Delineating admixture and differentiated genomic regions should be of importance in designing and interpretation of molecular anthropology and disease association studies. Copyright © 2013 Wayne State University Press, Detroit, Michigan 48201-1309.

  17. Religious commitment, attitudes toward suicide, and suicidal behaviors among college students of different ethnic and religious groups in Malaysia.

    Science.gov (United States)

    Foo, Xiang Yi; Alwi, Muhd Najib Mohd; Ismail, Siti Irma Fadhillah; Ibrahim, Normala; Osman, Zubaidah Jamil

    2014-06-01

    The variation in suicide patterns across ethnic groups with different religious background is a puzzling social phenomenon. This study sought to examine the impact of religious commitment and attitudes toward suicide on suicidal behaviors of college students across major ethnic and religious groups in a multicultural society of Malaysia. A total of 139 college students completed Religious Commitment Inventory-10, Attitudes Toward Suicide Scale, and Suicidal Behavior Questionnaire-Revised. Findings showed significant discrepancies in attitudes toward suicide, but not suicidal behaviors across ethnic and religious groups. Suicide acceptance significantly affected suicidal behaviors as well. Although religious commitment is not associated with suicidal behaviors, its deviation is reflected in students' acceptance of suicide. Additionally, college students' suicide risk, lifetime, and recent suicide ideation, as well as their likelihood of future suicide attempt can be associated with their acceptance of suicide. The influence of attitudes toward suicide and religion, therefore, should be taken into consideration while implementing suicide prevention programs as it helps shape the norms about suicide among youths.

  18. Prevalence and risk factors of intestinal parasitism among two indigenous sub-ethnic groups in Peninsular Malaysia.

    Science.gov (United States)

    Chin, Yuee Teng; Lim, Yvonne Ai Lian; Chong, Chun Wie; Teh, Cindy Shuan Ju; Yap, Ivan Kok Seng; Lee, Soo Ching; Tee, Mian Zi; Siow, Vinnie Wei Yin; Chua, Kek Heng

    2016-07-18

    Intestinal parasitic infections (IPIs) among indigenous people have been widely documented in Malaysia, however, the prevalence of these infections remains high. In the past, most studies have focused on specific species of parasites but polyparasitism has received limited attention. In addition, epidemiology studies on indigenous people tend to consider them as a homogenous group, whereas in reality different sub-ethnic groups have different cultural and living practices. Variations in living habits such as personal hygiene practices may predispose different groups to different parasitic infections. To better understand prevalence and risk factors of intestinal parasitism among different sub-ethnic groups, the present study was conducted among two sub-ethnic groups of indigenous people (Temuan and Mah Meri) residing in Selangor state, Malaysia. A cross-sectional study that focused on two distinct sub-ethnic groups was carried out from February to September 2014. Faecal samples were collected from 186 participants and examined using the formalin-ether sedimentation technique. A molecular approach was adopted to conduct a genetic characterisation of the parasites. Additionally, questionnaires were administered to obtain information on the demographics, socio-economic backgrounds and behavioural risks relating to the participants, as well as information about their environments. Statistical analyses (i.e. binary and multivariate logistic regression analyses) were performed to measure risk factors. For Temuan communities, trichuriasis (64.2 %) was the most common infection found, preceding hookworm infection (34 %), ascariasis (7.5 %), giardiasis (14.2 %) and amoebiasis (7.5 %). As for the Mah Meri communities, trichuriasis (77.5 %) prevailed over ascariasis (21.3 %), hookworm (15 %), giardiasis (7.5 %) and amoebiasis (3.8 %). Significant differences in proportions of trichuriasis, ascariasis and hookworm infections were observed between the Temuan and Mah

  19. Phylogenetic Grouping and Phenotypic Detection of Extended-Spectrum β-Lactamases Among Escherichia coli From Calves and Dairy Cows in Khuzestan, Iran

    Directory of Open Access Journals (Sweden)

    Mozhdeh Barzan

    2017-03-01

    Full Text Available Background: Food-producing animals are under suspicion for the reservoir and colonization of ESBL (extended-spectrum beta-lactamase-producing bacteria especially Enterobacteriaceae and therefore infection of the humans with them. The increasing reports on the ESBLs presence in the pathogenic and commensal Escherichia coli isolates have been a concern worldwide. These strains can be attributed to one of the main phylogenetic groups and subgroups. Several studies have shown the relationship between the phylogeny and antimicrobial resistance of E. coli strains. Objectives: The aim of this study was to analyze the phylogenetic group of ESBL-producing E. coli and detect its phenotype using the multiplex polymerase chain reaction (PCR and combined disk method. Materials and Methods: Two hundred five E. coli fecal isolates were obtained from 103 calves (90 healthy and 13 diarrheic and 102 dairy cows (healthy from 8 farms in Khuzestan province, Iran. The triplex PCR method was used to allocate the E. coli isolates based on the presence or absence of 3 genes (chuA, yjaA, and tspE4.C2 to yield 4 definite phylogenetic groups and 7 subgroups. Phenotypic ESBL-producing E. coli was determined using the double disk diffusion method according to the manufacturer’s instructions and Clinical & Laboratory Standards Institute (CLSI guidelines. Results: A total of 65.04% and 22.3% of isolates from calves and 70.5% and 20.5% of isolates from dairy cows belonged to phylogroups B1 and A, respectively. In addition, no isolate from the diarrhoeic calves was found to belong to group B2 and subgroups D2 and A0. A low prevalence (2/205 isolates, 0.97% of ESBL-producing E. coli was found only in the samples of dairy cows which belonged to the phylogenetic group A and phylogenetic subgroup A1. There was no statistically significant relationship between the phylogenetic group and the production of ESBLs (P = 0.11. There was also no difference between the E. coli isolates

  20. Quantitative and phylogenetic study of the Deep Sea Archaeal Group in sediments of the arctic mid-ocean spreading ridge

    Directory of Open Access Journals (Sweden)

    Steffen Leth eJørgensen

    2013-10-01

    Full Text Available In marine sediments archaea often constitute a considerable part of the microbial community, of which the Deep Sea Archaeal Group (DSAG is one of the most predominant. Despite their high abundance no members from this archaeal group have so far been characterized and thus their metabolism is unknown. Here we show that the relative abundance of DSAG marker genes can be correlated with geochemical parameters, allowing prediction of both the potential electron donors and acceptors of these organisms. We estimated the abundance of 16S rRNA genes from Archaea, Bacteria and DSAG in 52 sediment horizons from two cores collected at the slow-spreading Arctic Mid-Ocean Ridge, using qPCR. The results indicate that members of the DSAG make up the entire archaeal population in certain horizons and constitute up to ~ 50% of the total microbial community. The quantitative data were correlated to 30 different geophysical and geochemical parameters obtained from the same sediment horizons. We observed a significant correlation between the relative abundance of DSAG 16S rRNA genes and the content of organic carbon (p < 0.0001. Further, significant co-variation with iron oxide, and dissolved iron and manganese (all p < 0.0000, indicated a direct or indirect link to iron and manganese cycling. Neither of these parameters correlated with the relative abundance of archaeal or bacterial 16S rRNA genes, nor did any other major electron donor or acceptor measured. Phylogenetic analysis of DSAG 16S rRNA gene sequences reveals three monophyletic lineages with no apparent habitat-specific distribution. In this study we support the hypothesis that members of the DSAG are tightly linked to the content of organic carbon and directly or indirectly involved in the cycling of iron and/or manganese compounds. Further, we provide a molecular tool to assess their abundance in environmental samples and enrichment cultures.

  1. MimiLook: A Phylogenetic Workflow for Detection of Gene Acquisition in Major Orthologous Groups of Megavirales.

    Science.gov (United States)

    Jain, Sourabh; Panda, Arup; Colson, Philippe; Raoult, Didier; Pontarotti, Pierre

    2017-04-07

    With the inclusion of new members, understanding about evolutionary mechanisms and processes by which members of the proposed order, Megavirales, have evolved has become a key area of interest. The central role of gene acquisition has been shown in previous studies. However, the major drawback in gene acquisition studies is the focus on few MV families or putative families with large variation in their genetic structure. Thus, here we have tried to develop a methodology by which we can detect horizontal gene transfers (HGTs), taking into consideration orthologous groups of distantly related Megavirale families. Here, we report an automated workflow MimiLook, prepared as a Perl command line program, that deduces orthologous groups (OGs) from ORFomes of Megavirales and constructs phylogenetic trees by performing alignment generation, alignment editing and protein-protein BLAST (BLASTP) searching across the National Center for Biotechnology Information (NCBI) non-redundant (nr) protein sequence database. Finally, this tool detects statistically validated events of gene acquisitions with the help of the T-REX algorithm by comparing individual gene tree with NCBI species tree. In between the steps, the workflow decides about handling paralogs, filtering outputs, identifying Megavirale specific OGs, detection of HGTs, along with retrieval of information about those OGs that are monophyletic with organisms from cellular domains of life. By implementing MimiLook, we noticed that nine percent of Megavirale gene families (i.e., OGs) have been acquired by HGT, 80% OGs were Megaviralespecific and eight percent were found to be sharing common ancestry with members of cellular domains (Eukaryote, Bacteria, Archaea, Phages or other viruses) and three percent were ambivalent. The results are briefly discussed to emphasize methodology. Also, MimiLook is relevant for detecting evolutionary scenarios in other targeted phyla with user defined modifications. It can be accessed at

  2. Estimating phylogenetic relationships despite discordant gene trees across loci: the species tree of a diverse species group of feather mites (Acari: Proctophyllodidae).

    Science.gov (United States)

    Knowles, Lacey L; Klimov, Pavel B

    2011-11-01

    With the increased availability of multilocus sequence data, the lack of concordance of gene trees estimated for independent loci has focused attention on both the biological processes producing the discord and the methodologies used to estimate phylogenetic relationships. What has emerged is a suite of new analytical tools for phylogenetic inference--species tree approaches. In contrast to traditional phylogenetic methods that are stymied by the idiosyncrasies of gene trees, approaches for estimating species trees explicitly take into account the cause of discord among loci and, in the process, provides a direct estimate of phylogenetic history (i.e. the history of species divergence, not divergence of specific loci). We illustrate the utility of species tree estimates with an analysis of a diverse group of feather mites, the pinnatus species group (genus Proctophyllodes). Discord among four sequenced nuclear loci is consistent with theoretical expectations, given the short time separating speciation events (as evident by short internodes relative to terminal branch lengths in the trees). Nevertheless, many of the relationships are well resolved in a Bayesian estimate of the species tree; the analysis also highlights ambiguous aspects of the phylogeny that require additional loci. The broad utility of species tree approaches is discussed, and specifically, their application to groups with high speciation rates--a history of diversification with particular prevalence in host/parasite systems where species interactions can drive rapid diversification.

  3. Antimicrobial resistance and phylogenetic groups in isolates of Escherichia coli from seagulls at the Berlengas nature reserve.

    Science.gov (United States)

    Radhouani, H; Poeta, P; Igrejas, G; Gonçalves, A; Vinué, L; Torres, C

    2009-08-01

    Fifty-three faecal samples from yellow-legged gulls (Larus cachinnans) at the Berlengas nature reserve in Portugal were cultured on Levine agar plates not supplemented with antimicrobial agents, and one Escherichia coli colony was isolated and identified from each sample. The percentages of resistant isolates for each of the drugs were ampicillin (43.4 per cent), tetracycline (39.6 per cent), nalidixic acid (34.0 per cent), streptomycin (32.1 per cent), trimethoprim-sulfamethoxazole (SXT) (26.4 per cent), ciprofloxacin (18.9 per cent), chloramphenicol (18.9 per cent), gentamicin (7.5 per cent), tobramycin (7.5 per cent) amikacin (5.7 per cent) and amoxicillin-clavulanic acid (1.9 per cent). All the isolates were susceptible to cefoxitin, ceftazidime, cefotaxime, aztreonam and imipenem. The following resistance genes were detected: bla(TEM) (17 of 23 ampicillin-resistant isolates), tet(A) and/or tet(B) (18 of 21 tetracycline-resistant isolates), aadA (12 of 17 streptomycin-resistant isolates), cmlA (all chloramphenicol-resistant isolates), aac(3)-II with or without aac(3)-IV (all four gentamicin-resistant isolates), and sul1 and/or sul2 and/or sul3 (all 14 SXT-resistant isolates). The intI1 gene was detected in 10 of 14 SXT-resistant isolates, and three of them also contained class 2 integrons; four different gene cassette arrangements were identified among class 1 integrons (aadA, dfrA1+aadA1, dfrA12+orfF+aadA2 and sat+psp+aadA2) and one among the class 2 integrons (dfrA1+sat+aadA1). Ninety per cent of the isolates were included in the A or B1 phylogenetic groups.

  4. Coalescent-Based Analyses of Genomic Sequence Data Provide a Robust Resolution of Phylogenetic Relationships among Major Groups of Gibbons

    Science.gov (United States)

    Shi, Cheng-Min; Yang, Ziheng

    2018-01-01

    Abstract The phylogenetic relationships among extant gibbon species remain unresolved despite numerous efforts using morphological, behavorial, and genetic data and the sequencing of whole genomes. A major challenge in reconstructing the gibbon phylogeny is the radiative speciation process, which resulted in extremely short internal branches in the species phylogeny and extensive incomplete lineage sorting with extensive gene-tree heterogeneity across the genome. Here, we analyze two genomic-scale data sets, with ∼10,000 putative noncoding and exonic loci, respectively, to estimate the species tree for the major groups of gibbons. We used the Bayesian full-likelihood method bpp under the multispecies coalescent model, which naturally accommodates incomplete lineage sorting and uncertainties in the gene trees. For comparison, we included three heuristic coalescent-based methods (mp-est, SVDQuartets, and astral) as well as concatenation. From both data sets, we infer the phylogeny for the four extant gibbon genera to be (Hylobates, (Nomascus, (Hoolock, Symphalangus))). We used simulation guided by the real data to evaluate the accuracy of the methods used. Astral, while not as efficient as bpp, performed well in estimation of the species tree even in presence of excessive incomplete lineage sorting. Concatenation, mp-est and SVDQuartets were unreliable when the species tree contains very short internal branches. Likelihood ratio test of gene flow suggests a small amount of migration from Hylobates moloch to H. pileatus, while cross-genera migration is absent or rare. Our results highlight the utility of coalescent-based methods in addressing challenging species tree problems characterized by short internal branches and rampant gene tree-species tree discordance. PMID:29087487

  5. Healthcare Utilization by Older Age Groups in Northern States of Peninsular Malaysia: The Role of Predisposing, Enabling and Need Factors.

    Science.gov (United States)

    Samsudin, Shamzaeffa; Abdullah, Norehan

    2017-06-01

    Determining factors that affect healthcare utilization by the elderly is vital for the health system to be more responsive in providing care to this vulnerable group. The main objective of this paper is to identify the effect of the predisposing, enabling, and need factors on doctor visits and in-patient care for the elderly residing in the northern region of Malaysia. A multistage cluster sampling was used in selecting the sample for the study. A total of 1414 respondents aged 60 and over were interviewed face-to-face using a structured questionnaire. A probit model was used in estimating the utilization equations. At a significance level of 0.05, except for age, all predisposing and enabling factors were not statistically significant in affecting the doctor visits. On the other hand, being a male, smoker, medical insurance holder or had not actively involved in social interaction within the reference period increases the likelihood of being in-patient. Health-related variables remain the most significant factors that determine healthcare utilization, including both doctor visits and in-patient stays, in the area of study, which suggests that government policies to improve population health may influence the level of healthcare use in the future.

  6. Measuring Sustainable Indigenous Tourism Indicators: A Case of Mah Meri Ethnic Group in Carey Island, Malaysia

    Directory of Open Access Journals (Sweden)

    Puvaneswaran Kunasekaran

    2017-07-01

    Full Text Available Sustainable tourism emphasises responsible utilisation of economic, socio-cultural and environmental resources for tourism development. Extant literature in sustainable tourism leans towards subjective and qualitative description in explaining the dynamic nature of the trans-disciplinary indicators of sustainability. However, few mechanisms have been proposed or developed to quantify the indicators measuring sustainable tourism in an indigenous ethnic context. The current study measures 61 sustainable indigenous tourism indicators of the Mah Meri ethnic group that comprise three constructs, namely, community resources, community development and sustainable tourism. Simple random sampling was employed for data elicitation and a weighted average score using R software as the basis of analysis was used to produce a sustainable indigenous tourism barometer (SITB. The study identifies 11 sustainability dimensions from the initial three main constructs that are treated as the relationship aspects in this study. Based on the Sustainable Indigenous Tourism Barometer (SITB, community participation, empowerment, economic and socio-cultural sustainability are found to be the main influencing dimensions of sustainability of the Mah Meri ethnic group. However, natural resources, financial resources and environmental sustainability indicated weaker relationships in explaining sustainability of the Mah Meri ethnic group. Based on the SITB, the results demonstrate that the Mah Meri ethnic group are a “potential sustainable” tourism stakeholder.

  7. Phylogenetic analysis of Attalea (Arecaceae): insights on the historical biogeography of a recently diversified Neotropical plant group

    Science.gov (United States)

    Technical Abstract Here we present a dated phylogenetic tree of the neotropical palm genus Attalea (Arecaceae). We used six orthologs from the nuclear WRKY gene family across 98 accessions to address relationships among species and biogeographic hypotheses. Here we found that the formerly recognized...

  8. Phylogenetic evidence for the acquisition of ribosomal RNA introns subsequent to the divergence of some of the major Tetrahymena groups

    DEFF Research Database (Denmark)

    Sogin, M L; Ingold, A; Karlok, M

    1986-01-01

    . In an attempt to evaluate the evolutionary origins of the intervening sequences, we have now determined complete small subunit ribosomal RNA gene sequences from 13 species of Tetrahymena and the absolute number of nucleotide differences between the sequences was used to construct a phylogenetic tree...

  9. VEGETATIVE COMPATIBILITY GROUPS OF FUSARIUM OXYSPORUM, THE CAUSAL ORGANISM OF VASCULAR WILT ON ROSELLE IN MALAYSIA

    Directory of Open Access Journals (Sweden)

    K.H. Ooi

    1999-01-01

    Full Text Available Forty strains of Fusarium oxysporvm isolated from roselle (Hibiscus sabdariffa var. sabdariffa showing vascular wilt symptoms in three states (Terengganu, Penang and Ipoh in the northern Malaysian Peninsula were used to investigate the vegetative co mpatibility. Nitrate-nonutilizing (nil mutants were recovered from all the strains tested and subsequently used to study vegetative compatibility groups (VCG within the population by nit mutants pairings on minimal medium. Thirteen VCGs were found and none were vegetatively compatible with those of other formae speciales (f. spp. such as asparagi and cubense, and non-pathogenic strains from paddy and oil palm. The results indicate that there is substantial genetic diversity in F. oxysporum that causes vascular wilt disease on roselle as reflected by multiple VCGs, but the distribution of strains into the VCGs is not even as there are 26 representatives in VCG-1001M, two in VCG-1003M and VCG-1013M and only one in the other VCGs. This study may provide new insight into the establishment of a new forma specialis off. oxysporum.

  10. 9 July 2012 - Academy of Sciences Malaysia (ASM), Chairman, Mathematical and Physical Sciences Discipline Group M. Yahaya FASc and his delegation visiting the LHC superconducting magnet test hall with Technology Department G. De Rijk.

    CERN Multimedia

    Maximilien Brice

    2012-01-01

    9 July 2012 - Academy of Sciences Malaysia (ASM), Chairman, Mathematical and Physical Sciences Discipline Group M. Yahaya FASc and his delegation visiting the LHC superconducting magnet test hall with Technology Department G. De Rijk.

  11. Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia.

    Science.gov (United States)

    Tan, Jin Ai Mary Anne; Chin, Pui See; Wong, Yean Ching; Tan, Kim Lian; Chan, Lee Lee; George, Elizabeth

    2006-10-01

    In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations. DNA from 173 beta-thalassaemia carriers and five beta-thalassaemia major patients from the Malay, Chinese and Indian ethnic groups were first analysed by ARMS and gap-PCR. Ninety-five per cent (174/183) of the 183 beta-globin genes studied were characterised using these two techiques. The remaining nine uncharacterised beta-globin genes (4.9%) were analysed using genomic sequencing of a 904 bp amplified PCR product consisting of the promoter region, exon 1, intervening sequence (IVS) 1, exon 2 and the 5' IVS2 regions of the beta-globin gene. The rare beta-globin mutations detected in the Chinese patients were CD27/28 (+C) and CD43 (GAG-TAG), and -88 (C-T) in an Indian patient. Beta-globin mutations at CD16 (-C), IVS1-1 (G-A), IVS2-1 (G-A), -86 (C-G) and Haemoglobin South Florida (CD1, GTG-ATG) were confirmed in the Malay patients. The seven rare beta-globin mutations and a rare haemoglobin variant confirmed in this study have been described in other populations but have not been previously described in Malaysian beta-thalassemia patients.

  12. Phylogenetic diversity and biodiversity indices on phylogenetic networks.

    Science.gov (United States)

    Wicke, Kristina; Fischer, Mareike

    2018-04-01

    In biodiversity conservation it is often necessary to prioritize the species to conserve. Existing approaches to prioritization, e.g. the Fair Proportion Index and the Shapley Value, are based on phylogenetic trees and rank species according to their contribution to overall phylogenetic diversity. However, in many cases evolution is not treelike and thus, phylogenetic networks have been developed as a generalization of phylogenetic trees, allowing for the representation of non-treelike evolutionary events, such as hybridization. Here, we extend the concepts of phylogenetic diversity and phylogenetic diversity indices from phylogenetic trees to phylogenetic networks. On the one hand, we consider the treelike content of a phylogenetic network, e.g. the (multi)set of phylogenetic trees displayed by a network and the so-called lowest stable ancestor tree associated with it. On the other hand, we derive the phylogenetic diversity of subsets of taxa and biodiversity indices directly from the internal structure of the network. We consider both approaches that are independent of so-called inheritance probabilities as well as approaches that explicitly incorporate these probabilities. Furthermore, we introduce our software package NetDiversity, which is implemented in Perl and allows for the calculation of all generalized measures of phylogenetic diversity and generalized phylogenetic diversity indices established in this note that are independent of inheritance probabilities. We apply our methods to a phylogenetic network representing the evolutionary relationships among swordtails and platyfishes (Xiphophorus: Poeciliidae), a group of species characterized by widespread hybridization. Copyright © 2018 Elsevier Inc. All rights reserved.

  13. Novel Method To Identify Source-Associated Phylogenetic Clustering Shows that Listeria monocytogenes Includes Niche-Adapted Clonal Groups with Distinct Ecological Preferences

    DEFF Research Database (Denmark)

    Nightingale, K. K.; Lyles, K.; Ayodele, M.

    2006-01-01

    population are identified (TreeStats test). Analysis of sequence data for 120 L. monocytogenes isolates revealed evidence of clustering between isolates from the same source, based on the phylogenies inferred from actA and inlA (P = 0.02 and P = 0.07, respectively; SourceCluster test). Overall, the Tree...... are biologically valid. Overall, our data show that (i) the SourceCluster and TreeStats tests can identify biologically meaningful source-associated phylogenetic clusters and (ii) L. monocytogenes includes clonal groups that have adapted to infect specific host species or colonize nonhost environments......., including humans, animals, and food. If the null hypothesis that the genetic distances for isolates within and between source populations are identical can be rejected (SourceCluster test), then particular clades in the phylogenetic tree with significant overrepresentation of sequences from a given source...

  14. Continental monophyly and molecular divergence of Peninsular Malaysia's Macaca fascicularis fascicularis.

    Science.gov (United States)

    Abdul-Latiff, Muhammad Abu Bakar; Ruslin, Farhani; Faiq, Hamdan; Hairul, Mohd Salleh; Rovie-Ryan, Jeffrine Japning; Abdul-Patah, Pazil; Yaakop, Salmah; Md-Zain, Badrul Munir

    2014-01-01

    The phylogenetic relationships of long-tailed macaque (Macaca fascicularis fascicularis) populations distributed in Peninsular Malaysia in relation to other regions remain unknown. The aim of this study was to reveal the phylogeography and population genetics of Peninsular Malaysia's M. f. fascicularis based on the D-loop region of mitochondrial DNA. Sixty-five haplotypes were detected in all populations, with only Vietnam and Cambodia sharing four haplotypes. The minimum-spanning network projected a distant relationship between Peninsular Malaysian and insular populations. Genetic differentiation (F(ST), Nst) results suggested that the gene flow among Peninsular Malaysian and the other populations is very low. Phylogenetic tree reconstructions indicated a monophyletic clade of Malaysia's population with continental populations (NJ = 97%, MP = 76%, and Bayesian = 1.00 posterior probabilities). The results demonstrate that Peninsular Malaysia's M. f. fascicularis belonged to Indochinese populations as opposed to the previously claimed Sundaic populations. M. f. fascicularis groups are estimated to have colonized Peninsular Malaysia ~0.47 million years ago (MYA) directly from Indochina through seaways, by means of natural sea rafting, or through terrestrial radiation during continental shelf emersion. Here, the Isthmus of Kra played a central part as biogeographical barriers that then separated it from the remaining continental populations.

  15. Attitude toward depression, its complications, prevention and barriers to seeking help among ethnic groups in Penang, Malaysia

    Science.gov (United States)

    2009-01-01

    This study aims to explore attitudes towards, complications of and preventive measures for depression and the barriers that result in delays in seeking help among the various ethnic groups in Penang, Malaysia. In June 2007 a questionnaire‐based survey was undertaken in Penang. Face‐to‐face interviews were conducted, and 1855 respondents were approached to participate in the study by adopting a cluster random sampling method. A 25‐item questionnaire was used to explore public attitudes towards, complications of and preventive measures for depression and delays in seeking help. A total of 1149 (61.94%) showed willingness to participate in the survey. Ethnically, 490 (42.6%) of the respondents who participated in the survey were Malay, while 413 (35.9%) were Chinese, 149 (13%) Indian and 97 (8.4%) from other ethnic minorities. The mean age of the respondents was 30 years (SD ± 11.5). In evaluating public attitudes, the majority (n = 910, 79.2%) agreed with the statement that family and friends can enhance the depression recovery process by providing more care and attention to the patient and this was found to be statistically significant (P ≤0.001). More than one‐third of the respondents (n = 437, 38.0%) perceived depression as a normal medical condition and believed that it subsides automatically. The majority (n = 830, 72.2%) stated that depression results in social problems, while some felt that it can lead to raised blood pressure (n = 518, 45.1%). In terms of prevention, most of the respondents indicated that one can prevent depression by maintaining a good social life. In evaluating the barriers to seeking professional help, the majority (n = 582, 50.7%) stated that they did not believe they were at risk, with the next largest group identifying a lack of awareness regarding the signs and symptoms. However, a positive attitude was observed towards the complications and prevention of depression. Initiatives to increase mental health literacy will

  16. Testing the Metabolic Theory of Ecology with marine bacteria: Different temperature sensitivity of major phylogenetic groups during the spring phytoplankton bloom

    KAUST Repository

    Arandia-Gorostidi, Nestor

    2017-08-24

    Although temperature is a key driver of bacterioplankton metabolism, the effect of ocean warming on different bacterial phylogenetic groups remains unclear. Here, we conducted monthly short-term incubations with natural coastal bacterial communities over an annual cycle to test the effect of experimental temperature on the growth rates and carrying capacities of four phylogenetic groups: SAR11, Rhodobacteraceae, Gammaproteobacteria and Bacteroidetes. SAR11 was the most abundant group year-round as analysed by CARD-FISH, with maximum abundances in summer, while the other taxa peaked in spring. All groups, including SAR11, showed high temperature-sensitivity of growth rates and/or carrying capacities in spring, under phytoplankton bloom or post-bloom conditions. In that season, Rhodobacteraceae showed the strongest temperature response in growth rates, estimated here as activation energy (E, 1.43 eV), suggesting an advantage to outcompete other groups under warmer conditions. In summer E values were in general lower than 0.65 eV, the value predicted by the Metabolic Theory of Ecology (MTE). Contrary to MTE predictions, carrying capacity tended to increase with warming for all bacterial groups. Our analysis confirms that resource availability is key when addressing the temperature response of heterotrophic bacterioplankton. We further show that even under nutrient-sufficient conditions, warming differentially affected distinct bacterioplankton taxa. This article is protected by copyright. All rights reserved.

  17. Distribution of Helicobacter pylori cagA, cagE and vacA in different ethnic groups in Kuala Lumpur, Malaysia.

    Science.gov (United States)

    Tan, Huck Joo; Rizal, Abdul Manaf; Rosmadi, Mohamed-Yusoff; Goh, Khean-Lee

    2005-04-01

    There is a geographic variation in Helicobacter pylori (HP) genotypes and virulence factors. Cytotoxin associated genes A (cagA) and E (cagE), and certain vacuolating cytotoxin (vacA) genotypes are associated with peptic ulcer disease (PUD). There is also a different prevalence of PUD among different ethnic groups in Malaysia. The present study compared the distribution of vacA alleles and cagA and cagE status in three ethnic groups residing in Kuala Lumpur, Malaysia, and their association with clinical outcome. All patients with cultured positive HP were recruited prospectively. DNA was extracted and polymerase chain reaction was carried out to determine the cagA and cagE status and vacA alleles. The results of 127 patients (72 men and 55 women) were included. The mean age was 55.53 +/- 12.52 years. The ethnic distribution was 59 Chinese, 38 Indian and 30 Malay patients. The predominant genotype was s1a among the Malay (76.6%) and Indian patients (71.0%), and s1c among the Chinese patients (66.1%). The vacA middle region sequence m1 was detected in 66.7% of Malay, 54.2% of Chinese and 76.3% of Indian patients. Of the Malay, Chinese and Indian patients, 76.6%, 86.4% and 86.8%, respectively, were cagA positive, and 70.0%, 39.0% and 81.6%, respectively, were cagE positve. HP cagA, cagE and vacA were not associated with PUD. There is a distinctive difference in the HP strains among the three ethnic groups in Malaysia. There was no association between cagA, cagE or vacA genotypes and clinical outcome in the patients. None of these markers are helpful in predicting the clinical presentation of a HP infection.

  18. Phylogenetic Analysis of Seven WRKY Genes across the Palm Subtribe Attaleinae (Arecaceae) Identifies Syagrus as Sister Group of the Coconut

    Science.gov (United States)

    Meerow, Alan W.; Noblick, Larry; Borrone, James W.; Couvreur, Thomas L. P.; Mauro-Herrera, Margarita; Hahn, William J.; Kuhn, David N.; Nakamura, Kyoko; Oleas, Nora H.; Schnell, Raymond J.

    2009-01-01

    Background The Cocoseae is one of 13 tribes of Arecaceae subfam. Arecoideae, and contains a number of palms with significant economic importance, including the monotypic and pantropical Cocos nucifera L., the coconut, the origins of which have been one of the “abominable mysteries” of palm systematics for decades. Previous studies with predominantly plastid genes weakly supported American ancestry for the coconut but ambiguous sister relationships. In this paper, we use multiple single copy nuclear loci to address the phylogeny of the Cocoseae subtribe Attaleinae, and resolve the closest extant relative of the coconut. Methodology/Principal Findings We present the results of combined analysis of DNA sequences of seven WRKY transcription factor loci across 72 samples of Arecaceae tribe Cocoseae subtribe Attaleinae, representing all genera classified within the subtribe, and three outgroup taxa with maximum parsimony, maximum likelihood, and Bayesian approaches, producing highly congruent and well-resolved trees that robustly identify the genus Syagrus as sister to Cocos and resolve novel and well-supported relationships among the other genera of the Attaleinae. We also address incongruence among the gene trees with gene tree reconciliation analysis, and assign estimated ages to the nodes of our tree. Conclusions/Significance This study represents the as yet most extensive phylogenetic analyses of Cocoseae subtribe Attaleinae. We present a well-resolved and supported phylogeny of the subtribe that robustly indicates a sister relationship between Cocos and Syagrus. This is not only of biogeographic interest, but will also open fruitful avenues of inquiry regarding evolution of functional genes useful for crop improvement. Establishment of two major clades of American Attaleinae occurred in the Oligocene (ca. 37 MYBP) in Eastern Brazil. The divergence of Cocos from Syagrus is estimated at 35 MYBP. The biogeographic and morphological congruence that we see for

  19. Antimicrobial resistance and molecular characterization of virulence genes, phylogenetic groups of Escherichia coli isolated from diarrheic and healthy camel-calves in Tunisia.

    Science.gov (United States)

    Bessalah, Salma; Fairbrother, John Morris; Salhi, Imed; Vanier, Ghyslaine; Khorchani, Touhami; Seddik, Mouldi Mabrouk; Hammadi, Mohamed

    2016-12-01

    This study was conducted to determine the prevalence of virulence genes, serogroups, antimicrobial resistance and phylogenetic groups of Escherichia coli strains isolated from diarrheic and healthy camel calves in Tunisia. From 120 fecal samples (62 healthy and 58 diarrheic camel calves aged less than 3 months), 70 E. coli isolates (53 from diarrheic herds and 17 from healthy herds) were examined by PCR for detection of the virulence genes associated with pathogenic E. coli in animals. A significantly greater frequency of the f17 gene was observed in individual camels and in herds with diarrhea, this gene being found in 44.7% and 41.5% of isolates from camels and herds with diarrhea versus 22.5% and 11.7% in camels (p=0.05) and herds without diarrhea (p=0.02). The aida, cnf1/2, f18, stx2 and paa genes were found only in isolates from camels with diarrhea, although at a low prevalence, 1.8%, 3.7%, 1.8%, 3.7% and 11.3%, respectively. Prevalence of afa8, cdtB, eae, east1, iroN, iss, kpsMTII, paa, sfa, tsh and papC genes did not differ significantly between herds with or without diarrhea. Genes coding for faeG, fanC, f41, estI, estII, CS31a and eltA were not detected in any isolates. All isolates were sensitive to amikacin, chloramphenicol, ciprofloxacin, gentamicin and ceftiofur and the highest frequency of resistance was observed to tetracycline, and ampicillin (52.8% and 37.1% respectively). The phylogenetic groups were identified by conventional triplex PCR. Results showed that E. coli strains segregated mainly in phylogenetic group B1, 52.8% in diarrheic herds and 52.9% in healthy herds. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Agent-based and phylogenetic analyses reveal how HIV-1 moves between risk groups: injecting drug users sustain the heterosexual epidemic in Latvia

    Science.gov (United States)

    Graw, Frederik; Leitner, Thomas; Ribeiro, Ruy M.

    2012-01-01

    Injecting drug users (IDU) are a driving force for the spread of HIV-1 in Latvia and other Baltic States, accounting for a majority of cases. However, in recent years, heterosexual cases have increased disproportionately. It is unclear how the changes in incidence patterns in Latvia can be explained, and how important IDU are for the heterosexual sub-epidemic. We introduce a novel epidemic model and use phylogenetic analyses in parallel to examine the spread of HIV-1 in Latvia between 1987 and 2010. Using a hybrid framework with a mean-field description for the susceptible population and an agent-based model for the infecteds, we track infected individuals and follow transmission histories dynamically formed during the simulation. The agent-based simulations and the phylogenetic analysis show that more than half of the heterosexual transmissions in Latvia were caused by IDU, which sustain the heterosexual epidemic. Indeed, we find that heterosexual clusters are characterized by short transmission chains with up to 63% of the chains dying out after the first introduction. In the simulations, the distribution of transmission chain sizes follows a power law distribution, which is confirmed by the phylogenetic data. Our models indicate that frequent introductions reduced the extinction probability of an autonomously spreading heterosexual HIV-1 epidemic, which now has the potential to dominate the spread of the overall epidemic in the future. Furthermore, our model shows that social heterogeneity of the susceptible population can explain the shift in HIV-1 incidence in Latvia over the course of the epidemic. Thus, the decrease in IDU incidence may be due to local heterogeneities in transmission, rather than the implementation of control measures. Increases in susceptibles, through social or geographic movement of IDU, could lead to a boost in HIV-1 infections in this risk group. Targeting individuals that bridge social groups would help prevent further spread of the

  1. Group B streptococcal bacteremia in a major teaching hospital in Malaysia: a case series of eighteen patients.

    Science.gov (United States)

    Eskandarian, N; Neela, V; Ismail, Z; Puzi, S M; Hamat, R A; Desa, M N M; Nordin, S A

    2013-09-01

    Group B Streptococcus (GBS) is a leading cause of infections such as meningitis and septicemia in neonates and pregnant women; however the significance of invasive GBS disease has not been clearly defined in non-pregnant adults. We reviewed the hospital records of 18 cases with GBS bacteremia who attended the Universiti Kebangsaan Malaysia Medical Centre from June 2010 to October 2011. We analyzed the clinical findings of both bacteremic adults and neonates and compared them to previous studies of GBS bacteremia. Serotyping was done by latex agglutination test using 10 distinct antisera (Ia, Ib, and II-IX). During the period of 1 year and 4 months, there were 18 patients with GBS bacteremia. Five cases occurred in neonates, one in a parturient woman, and 12 in other adults. All neonates with bacteremia were males and two of them were premature. Septicemia was the most common clinical presentation in neonates. They were treated with intravenous (IV) penicillin G and gentamicin. The adults included nine men (69%) and four women (31%). Their mean age was 60 years and all patients had more than two underlying conditions. The most common clinical syndrome was pneumonia (n=6, 46.5%). The others were peritonitis (n=3, 23.1%), primary bacteremia (n=2, 15.5%), septic arthritis (n=2, 15.5%), skin and soft tissue infection (n=1, 7.7%), meningitis (n=1, 8%), urinary tract infection (n=1, 8%), and intravascular device infection (n=1, 7.7%). Cardiovascular diseases (n=7, 53.8%) were the most common underlying conditions, and diabetes mellitus (n=5, 38.5%) was second. The other co-morbid conditions were hyperlipidemia (n=3, 23.1%), renal disease (n=3, 23.1%), liver disease and/or alcohol abuse (n=3, 23.1%), autoimmune disease or immunosuppressive condition (n=2, 15.5%), malignancy (n=2, 15.5%), respiratory disease (n=1, 8%), and postpartum condition (n=1, 8%), as well as miscellaneous conditions including intravenous drug abuse, HIV infection, and trauma (n=2, 15

  2. Solar photovoltaics for vernacular housing in rural malaysia: towards energy security and equitability of low income groups

    OpenAIRE

    Ahmad, Nur; Byrd, Hugh

    2011-01-01

    Since the 1970s, Malaysia’s economic expansion has been powered by cheap oil and gas making it dependent on and addicted to using large amounts of fossil fuels. As a country that is primarily reliant on fossil fuels for generating power supply, Malaysia needs to take account of long-term energy security due to fossil fuel depletion and peak oil which could threaten the development of the country. The ‘South China Sea Conflict’, concerning territorial rights to the oil and gas fields of t...

  3. Understanding the biogeography of a group of earthworms in the Mediterranean basin--the phylogenetic puzzle of Hormogastridae (Clitellata: Oligochaeta).

    Science.gov (United States)

    Novo, Marta; Almodóvar, Ana; Fernández, Rosa; Giribet, Gonzalo; Díaz Cosín, Darío J

    2011-10-01

    Traditional earthworm taxonomy is hindered due to their anatomical simplicity and the plasticity of the characteristics often used for diagnosing species. Making phylogenetic inferences based on these characters is more than difficult. In this study we use molecular tools to unravel the phylogeny of the clitellate family Hormogastridae. The family includes species of large to mid-sized earthworms distributed almost exclusively in the western Mediterranean region where they play an important ecological role. We analyzed individuals from 46 locations spanning the Iberian Peninsula to Corsica and Sardinia, representing the four described genera in the family and 20 species. Molecular markers include mitochondrial regions of the cytochrome c oxidase subunit I gene (COI), 16S rRNA and tRNAs for Leu, Ala, and Ser, two nuclear ribosomal genes (nearly complete 18S rRNA and a fragment of 28S rRNA) and two nuclear protein-encoding genes (histones H3 and H4). Analyses of the data using different approaches corroborates monophyly of Hormogastridae, but the genus Hormogaster is paraphyletic and Hormogaster pretiosa appears polyphyletic, stressing the need for taxonomic revisionary work in the family. The genus Vignysa could represent an early offshoot in the family, although the relationships with other genera are uncertain. The genus Hemigastrodrilus is related to the Hormogaster elisae complex and both are found in the Atlantic drainage of the Iberian Peninsula and France. From a biogeographic perspective Corsica and Sardinia include members of two separate hormogastrid lineages. The species located in Corsica and Northern Sardinia are related to Vignysa, whereas Hormogaster pretiosa pretiosa, from Southern Sardinia, is closely related to the Hormogaster species from the NE Iberian Peninsula. A molecular dating of the tree using the separation of the Sardinian microplate as a calibration point (at 33 MY) and assuming a model of vicariance indicates that the diversification of

  4. Potential loss of revenue due to errors in clinical coding during the implementation of the Malaysia diagnosis related group (MY-DRG®) Casemix system in a teaching hospital in Malaysia.

    Science.gov (United States)

    Zafirah, S A; Nur, Amrizal Muhammad; Puteh, Sharifa Ezat Wan; Aljunid, Syed Mohamed

    2018-01-25

    The accuracy of clinical coding is crucial in the assignment of Diagnosis Related Groups (DRGs) codes, especially if the hospital is using Casemix System as a tool for resource allocations and efficiency monitoring. The aim of this study was to estimate the potential loss of income due to an error in clinical coding during the implementation of the Malaysia Diagnosis Related Group (MY-DRG ® ) Casemix System in a teaching hospital in Malaysia. Four hundred and sixty-four (464) coded medical records were selected, re-examined and re-coded by an independent senior coder (ISC). This ISC re-examined and re-coded the error code that was originally entered by the hospital coders. The pre- and post-coding results were compared, and if there was any disagreement, the codes by the ISC were considered the accurate codes. The cases were then re-grouped using a MY-DRG ® grouper to assess and compare the changes in the DRG assignment and the hospital tariff assignment. The outcomes were then verified by a casemix expert. Coding errors were found in 89.4% (415/424) of the selected patient medical records. Coding errors in secondary diagnoses were the highest, at 81.3% (377/464), followed by secondary procedures at 58.2% (270/464), principal procedures of 50.9% (236/464) and primary diagnoses at 49.8% (231/464), respectively. The coding errors resulted in the assignment of different MY-DRG ® codes in 74.0% (307/415) of the cases. From this result, 52.1% (160/307) of the cases had a lower assigned hospital tariff. In total, the potential loss of income due to changes in the assignment of the MY-DRG ® code was RM654,303.91. The quality of coding is a crucial aspect in implementing casemix systems. Intensive re-training and the close monitoring of coder performance in the hospital should be performed to prevent the potential loss of hospital income.

  5. Validity of the Malay version of the Internet Addiction Test: a study on a group of medical students in Malaysia.

    Science.gov (United States)

    Guan, Ng Chong; Isa, Saramah Mohammed; Hashim, Aili Hanim; Pillai, Subash Kumar; Harbajan Singh, Manveen Kaur

    2015-03-01

    The use of the Internet has been increasing dramatically over the decade in Malaysia. Excessive usage of the Internet has lead to a phenomenon called Internet addiction. There is a need for a reliable, valid, and simple-to-use scale to measure Internet addiction in the Malaysian population for clinical practice and research purposes. The aim of this study was to validate the Malay version of the Internet Addiction Test, using a sample of 162 medical students. The instrument displayed good internal consistency (Cronbach's α = .91), parallel reliability (intraclass coefficient = .88, P students with and without Internet dependence. Principal component analysis with varimax rotation identified a 5-factor model. The Malay version of the Internet Addiction Test appeared to be a valid instrument for assessing Internet addiction in Malaysian university students. © 2012 APJPH.

  6. Investigation of class 1 integrons in Klebsiella pneumoniae clinical and microbiota isolates belonging to different phylogenetic groups in Recife, State of Pernambuco

    Directory of Open Access Journals (Sweden)

    Alexsandra Maria Silva Lima

    2014-04-01

    Full Text Available Introduction The high prevalence of Klebsiella pneumoniae infections is related to the ability of K. pneumoniae to acquire and disseminate exogenous genes associated with mobile elements, such as R plasmids, transposons and integrons. This study investigated the presence of class 1 integrons in clinical and microbiota isolates of K. pneumoniae belonging to different phylogenetic groups and correlated these results with the antimicrobial resistance profiles of the studied isolates. Methods Of the 51 isolates of K. pneumoniae selected for this study, 29 were from multidrug-resistant clinical isolates, and 22 were from children's microbiota. The susceptibility profile was determined using the disk diffusion method, and class 1 integrons were detected through polymerase chain reaction (PCR. Results The results showed that none of the 22 microbiota isolates carried class 1 integrons. Among the 29 clinical isolates, 19 (65.5% contained class 1 integrons, and resistance to sulfamethoxazole/trimethoprim was identified in 18 of these isolates (94.7%. Among the K. pneumoniae isolates with class 1 integrons, 47% belonged to the KpI phylogenetic group, and one isolate (14.3% carrying these genetic elements belonged to the KpIII group. Conclusions The wide variety of detected class 1 integrons supports the presence of high rates of antimicrobial resistance, genetic variability, and rapid dissemination of beta-lactamase genes among K. pneumoniae clinical isolates in recent years in hospitals in Recife-PE, Brazil. The findings of this study indicate that the surveillance of K. pneumoniae integrons in clinical isolates could be useful for monitoring the spread of antibiotic resistance genes in the hospital environment.

  7. PCOGR: Phylogenetic COG ranking as an online tool to judge the specificity of COGs with respect to freely definable groups of organisms

    Directory of Open Access Journals (Sweden)

    Kaufmann Michael

    2004-10-01

    Full Text Available Abstract Background The rapidly increasing number of completely sequenced genomes led to the establishment of the COG-database which, based on sequence homologies, assigns similar proteins from different organisms to clusters of orthologous groups (COGs. There are several bioinformatic studies that made use of this database to determine (hyperthermophile-specific proteins by searching for COGs containing (almost exclusively proteins from (hyperthermophilic genomes. However, public software to perform individually definable group-specific searches is not available. Results The tool described here exactly fills this gap. The software is accessible at http://www.uni-wh.de/pcogr and is linked to the COG-database. The user can freely define two groups of organisms by selecting for each of the (current 66 organisms to belong either to groupA, to the reference groupB or to be ignored by the algorithm. Then, for all COGs a specificity index is calculated with respect to the specificity to groupA, i. e. high scoring COGs contain proteins from the most of groupA organisms while proteins from the most organisms assigned to groupB are absent. In addition to ranking all COGs according to the user defined specificity criteria, a graphical visualization shows the distribution of all COGs by displaying their abundance as a function of their specificity indexes. Conclusions This software allows detecting COGs specific to a predefined group of organisms. All COGs are ranked in the order of their specificity and a graphical visualization allows recognizing (i the presence and abundance of such COGs and (ii the phylogenetic relationship between groupA- and groupB-organisms. The software also allows detecting putative protein-protein interactions, novel enzymes involved in only partially known biochemical pathways, and alternate enzymes originated by convergent evolution.

  8. PCOGR: phylogenetic COG ranking as an online tool to judge the specificity of COGs with respect to freely definable groups of organisms.

    Science.gov (United States)

    Meereis, Florian; Kaufmann, Michael

    2004-10-15

    The rapidly increasing number of completely sequenced genomes led to the establishment of the COG-database which, based on sequence homologies, assigns similar proteins from different organisms to clusters of orthologous groups (COGs). There are several bioinformatic studies that made use of this database to determine (hyper)thermophile-specific proteins by searching for COGs containing (almost) exclusively proteins from (hyper)thermophilic genomes. However, public software to perform individually definable group-specific searches is not available. The tool described here exactly fills this gap. The software is accessible at http://www.uni-wh.de/pcogr and is linked to the COG-database. The user can freely define two groups of organisms by selecting for each of the (current) 66 organisms to belong either to groupA, to the reference groupB or to be ignored by the algorithm. Then, for all COGs a specificity index is calculated with respect to the specificity to groupA, i. e. high scoring COGs contain proteins from the most of groupA organisms while proteins from the most organisms assigned to groupB are absent. In addition to ranking all COGs according to the user defined specificity criteria, a graphical visualization shows the distribution of all COGs by displaying their abundance as a function of their specificity indexes. This software allows detecting COGs specific to a predefined group of organisms. All COGs are ranked in the order of their specificity and a graphical visualization allows recognizing (i) the presence and abundance of such COGs and (ii) the phylogenetic relationship between groupA- and groupB-organisms. The software also allows detecting putative protein-protein interactions, novel enzymes involved in only partially known biochemical pathways, and alternate enzymes originated by convergent evolution.

  9. Limitations of Species Delimitation Based on Phylogenetic Analyses: A Case Study in the Hypogymnia hypotrypa Group (Parmeliaceae, Ascomycota.

    Directory of Open Access Journals (Sweden)

    Xinli Wei

    Full Text Available Delimiting species boundaries among closely related lineages often requires a range of independent data sets and analytical approaches. Similar to other organismal groups, robust species circumscriptions in fungi are increasingly investigated within an empirical framework. Here we attempt to delimit species boundaries in a closely related clade of lichen-forming fungi endemic to Asia, the Hypogymnia hypotrypa group (Parmeliaceae. In the current classification, the Hypogymnia hypotrypa group includes two species: H. hypotrypa and H. flavida, which are separated based on distinctive reproductive modes, the former producing soredia but absent in the latter. We reexamined the relationship between these two species using phenotypic characters and molecular sequence data (ITS, GPD, and MCM7 sequences to address species boundaries in this group. In addition to morphological investigations, we used Bayesian clustering to identify potential genetic groups in the H. hypotrypa/H. flavida clade. We also used a variety of empirical, sequence-based species delimitation approaches, including: the "Automatic Barcode Gap Discovery" (ABGD, the Poisson tree process model (PTP, the General Mixed Yule Coalescent (GMYC, and the multispecies coalescent approach BPP. Different species delimitation scenarios were compared using Bayes factors delimitation analysis, in addition to comparisons of pairwise genetic distances, pairwise fixation indices (FST. The majority of the species delimitation analyses implemented in this study failed to support H. hypotrypa and H. flavida as distinct lineages, as did the Bayesian clustering analysis. However, strong support for the evolutionary independence of H. hypotrypa and H. flavida was inferred using BPP and further supported by Bayes factor delimitation. In spite of rigorous morphological comparisons and a wide range of sequence-based approaches to delimit species, species boundaries in the H. hypotrypa group remain uncertain

  10. Malaysia; Malaisie

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2002-10-01

    This document presents the energy profile of Malaysia: national organizations and energy policy (Economic Planning Unit (EPU), Ministry of Energy, Communication and Multi-media, Energy Commission); electric power companies: Tenaga National Brhd (TNB), Sarawak Electricity Supply Corporation (SESCO) and Sabah Electricity Sdn Bhd (SESB); petroleum companies: Petronas and Petronas Carigali; natural gas companies: Petronas Gas Sdn Bhd (PGSB), Malaysia LNG Ltd, Gas Malaysia Sdn Bhd and Sabah Energy Corporation (SEC) as public utility; supplies (resources, electric power, oil and gas); prices; consumption; stakes and perspectives (combined cycle power plants, Trans Thai Malaysia pipeline, refineries, Asean Grid Power project of interconnected power grids, Trans Asean Gas Pipeline (TAGP) project of interconnected gas networks, Bakun dam). (J.S.)

  11. Ethnic Tourism: A Case Study of Language and Culture Preservation of the Bateq Indigenous Group of Orang Asli in Peninsular Malaysia

    Directory of Open Access Journals (Sweden)

    Che Lah Salasiah

    2014-01-01

    Full Text Available Malaysia provides ethnic tourism which is related to the more popularly known as nature or eco-tourism where an indigenous or traditional group of people who live in this environment will interact with and provide services to the tourists who would like to experience ethnic tourism. Ethnic tourism refers to travel motivated by the search for the first hand, authentic and sometimes intimate contact with people whose ethnic and/or cultural background is different from the tourists. Tourists are also driven by the desire to see some of the threatened cultures that may soon disappear through assimilation into the nation’s majority. This paper aims to explore ethnic tourism as a preservation strategy for language and culture in a selected community of Bateq Orang Asli group in Peninsular Malaysia in relation the language and cultural preservation of this community. An in-depth interview, a qualitative research technique, was selected as a method of data collection. The multimedia data was also collected including the recordings of the indigenous languages, still pictures and videotapes of the indigenous and cultural activities. The findings of this study show that the Bateq Orang Asli groups have preferences of their languages even though there is a pattern that a high number of lexical items have been borrowed from Malay. Language shift among younger speakers is also becoming a trend. In terms of the preservation of cultural heritage, the Bateq Orang Asli are still very positive about keeping their practices and lifestyles. The involvement of Bateq Orang Asli in promoting ethnic tourism in the surrounding areas near their settlements has contributed to their language and cultural preservation.

  12. PHYLOGENETIC RELATIONSHIPS AMONGST 10 Durio SPECIES BASED ON PCR-RFLP ANALYSIS OF TWO CHLOROPLAST GENES

    Directory of Open Access Journals (Sweden)

    Panca J. Santoso

    2013-07-01

    Full Text Available Twenty seven species of Durio have been identified in Sabah and Sarawak, Malaysia, but their relationships have not been studied. This study was conducted to analyse phylogenetic relationships amongst 10 Durio species in Malaysia using PCR-RFLP on two chloroplast DNA genes, i.e. ndhC-trnV and rbcL. DNAs were extracted from young leaves of 11 accessions from 10 Durio species collected from the Tenom Agriculture Research Station, Sabah, and University Agriculture Park, Universiti Putra Malaysia. Two pairs of oligonucleotide primers, N1-N2 and rbcL1-rbcL2, were used to flank the target regions ndhC-trnV and rbcL. Eight restriction enzymes, HindIII, BsuRI, PstI, TaqI, MspI, SmaI, BshNI, and EcoR130I, were used to digest the amplicons. Based on the results of PCR-RFLP on ndhC-trnV gene, the 10 Durio species were grouped into five distinct clusters, and the accessions generally showed high variations. However, based on the results of PCR-RFLP on the rbcL gene, the species were grouped into three distinct clusters, and generally showed low variations. This means that ndhC-trnV gene is more reliable for phylogenetic analysis in lower taxonomic level of Durio species or for diversity analysis, while rbcL gene is reliable marker for phylogenetic analysis at higher taxonomic level. PCR-RFLP on the ndhC-trnV and rbcL genes could therefore be considered as useful markers to phylogenetic analysis amongst Durio species. These finding might be used for further molecular marker assisted in Durio breeding program.

  13. The emergence of lobsters: phylogenetic relationships, morphological evolution and divergence time comparisons of an ancient group (decapoda: achelata, astacidea, glypheidea, polychelida).

    Science.gov (United States)

    Bracken-Grissom, Heather D; Ahyong, Shane T; Wilkinson, Richard D; Feldmann, Rodney M; Schweitzer, Carrie E; Breinholt, Jesse W; Bendall, Matthew; Palero, Ferran; Chan, Tin-Yam; Felder, Darryl L; Robles, Rafael; Chu, Ka-Hou; Tsang, Ling-Ming; Kim, Dohyup; Martin, Joel W; Crandall, Keith A

    2014-07-01

    Lobsters are a ubiquitous and economically important group of decapod crustaceans that include the infraorders Polychelida, Glypheidea, Astacidea and Achelata. They include familiar forms such as the spiny, slipper, clawed lobsters and crayfish and unfamiliar forms such as the deep-sea and "living fossil" species. The high degree of morphological diversity among these infraorders has led to a dynamic classification and conflicting hypotheses of evolutionary relationships. In this study, we estimated phylogenetic relationships among the major groups of all lobster families and 94% of the genera using six genes (mitochondrial and nuclear) and 195 morphological characters across 173 species of lobsters for the most comprehensive sampling to date. Lobsters were recovered as a non-monophyletic assemblage in the combined (molecular + morphology) analysis. All families were monophyletic, with the exception of Cambaridae, and 7 of 79 genera were recovered as poly- or paraphyletic. A rich fossil history coupled with dense taxon coverage allowed us to estimate and compare divergence times and origins of major lineages using two drastically different approaches. Age priors were constructed and/or included based on fossil age information or fossil discovery, age, and extant species count data. Results from the two approaches were largely congruent across deep to shallow taxonomic divergences across major lineages. The origin of the first lobster-like decapod (Polychelida) was estimated in the Devonian (∼409-372 Ma) with all infraorders present in the Carboniferous (∼353-318 Ma). Fossil calibration subsampling studies examined the influence of sampling density (number of fossils) and placement (deep, middle, and shallow) on divergence time estimates. Results from our study suggest including at least 1 fossil per 10 operational taxonomic units (OTUs) in divergence dating analyses. [Dating; decapods; divergence; lobsters; molecular; morphology; phylogenetics.]. © The

  14. Food irradiation in Malaysia

    International Nuclear Information System (INIS)

    Mohd Ghazali Hj Abd Rahman.

    1985-01-01

    Food irradiation has recently been visited as a technology that can contribute to the solution of problems associated with food preservation of Malaysia's agriculture produce and products thereby improving the economic status of the rural sector. However, the history of food irradiation in Malaysia is very recent. Research carried out on food irradiation only began in 1974 as a result of the installation of a 60 Co facility (initially 10,000 Ci) at the National University of Malaysia. Since its installation several studies have been carried out pertaining to the food irradiation. Presently its development has been slow. Research in this area has been confined to laboratory scale and purely academic. This limitation is due to a number of reasons, among others are: a) limited number of facilities; b) lack of expertise to conduct its research; c) other preservation methods can be improved with lower capital output. An important step towards its development was made when Malaysia actively participated in the RCA/IAEA food irradiation project, viz. the irradiation of pepper which was carried out at the National University of Malaysia in the 80's. As a result of this venture, research and development activities in food irradiation have been geared toward semi-plot scale with the view ot commercialization in the future. In 1982, a group of researchers was formed to conduct feasibility studies using irradiation techniques in trying to overcome several problems associated with our local paddy and rice. Another group is being organized by the National University of Malaysia to look into the problems associated with the preservation of frozen shrimps. (author)

  15. Strong conservation of rhoptry-associated-protein-1 (RAP-1) locus organization and sequence among Babesia isolates infecting sheep from China (Babesia motasi-like phylogenetic group).

    Science.gov (United States)

    Niu, Qingli; Valentin, Charlotte; Bonsergent, Claire; Malandrin, Laurence

    2014-12-01

    Rhoptry-associated-protein 1 (RAP-1) is considered as a potential vaccine candidate due to its involvement in red blood cell invasion by parasites in the genus Babesia. We examined its value as a vaccine candidate by studying RAP-1 conservation in isolates of Babesia sp. BQ1 Ningxian, Babesia sp. Tianzhu and Babesia sp. Hebei, responsible for ovine babesiosis in different regions of China. The rap-1 locus in these isolates has very similar features to those described for Babesia sp. BQ1 Lintan, another Chinese isolate also in the B. motasi-like phylogenetic group, namely the presence of three types of rap-1 genes (rap-1a, rap-1b and rap-1c), multiple conserved rap-1b copies (5) interspaced with more or less variable rap-1a copies (6), and the 3' localization of one rap-1c. The isolates Babesia sp. Tianzhu, Babesia sp. BQ1 Lintan and Ningxian were almost identical (average nucleotide identity of 99.9%) over a putative locus of about 31 Kb, including the intergenic regions. Babesia sp. Hebei showed a similar locus organization but differed in the rap-1 locus sequence, for each gene and intergenic region, with an average nucleotide identity of 78%. Our results are in agreement with 18S rDNA phylogenetic studies performed on these isolates. However, in extremely closely related isolates the rap-1 locus seems more conserved (99.9%) than the 18S rDNA (98.7%), whereas in still closely related isolates the identities are much lower (78%) compared with the 18S rDNA (97.7%). The particularities of the rap-1 locus in terms of evolution, phylogeny, diagnosis and vaccine development are discussed. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  16. Phylogenetic Position of Barbus lacerta Heckel, 1843

    Directory of Open Access Journals (Sweden)

    Mustafa Korkmaz

    2015-11-01

    As a result, five clades come out from phylogenetic reconstruction and in phylogenetic tree Barbus lacerta determined to be sister group of Barbus macedonicus, Barbus oligolepis and Barbus plebejus complex.

  17. Aphis (Hemiptera: Aphididae) species groups found in the Midwestern United States and their contribution to the phylogenetic knowledge of the genus.

    Science.gov (United States)

    Lagos, Doris M; Voegtlin, David J; Coeur d'acier, Armelle; Giordano, Rosanna

    2014-06-01

    A phylogeny of the genus Aphis Linnaeus, 1 758 was built primarily from specimens collected in the Midwest of the United States. A data matrix was constructed with 68 species and 41 morphological characters with respective character states of alate and apterous viviparous females. Dendrogram topologies of analyses performed using UPGMA (Unweighted Pair Group Method with Arithmetic Mean), Maximum Parsimony and Bayesian analysis of Cytochrome Oxidase I, Elongation Factor 1-α and primary endosymbiont Buchnera aphidicola 16S sequences were not congruent. Bayesian analysis strongly supported most terminal nodes of the phylogenetic trees. The phylogeny was strongly supported by EF1-α, and analysis of COI and EF1-α molecular data combined with morphological characters. It was not supported by single analysis of COI or Buchnera aphidicola 16S. Results from the Bayesian phylogeny show 4 main species groups: asclepiadis, fabae, gossypii, and middletonii. Results place Aphis and species of the genera Protaphis Börner, 1952, Toxoptera Koch, and Xerobion Nevsky, 1928 in a monophyletic clade. Morphological characters support this monophyly as well. The phylogeny shows that the monophyletic clade of the North American middletonii species group belong to the genus Protaphis: P. debilicornis (Gillette & Palmer, 1929), comb. nov., P. echinaceae (Lagos and Voegtlin, 2009), comb. nov., and P. middletonii (Thomas, 1879). The genus Toxoptera should be considered a subgenus of Aphis (stat. nov.). The analysis also indicates that the current genus Iowana Frison, 1954 should be considered a subgenus of Aphis (stat. nov.). © 2013 Institute of Zoology, Chinese Academy of Sciences.

  18. Collodictyon triciliatum and Diphylleia rotans (=Aulacomonas submarina) form a new family of flagellates (Collodictyonidae) with tubular mitochondrial cristae that is phylogenetically distant from other flagellate groups.

    Science.gov (United States)

    Brugerolle, Guy; Bricheux, Geneviève; Philippe, Hervé; Coffea, Gérard

    2002-03-01

    Comparative electron microscopic studies of Collodictyon triciliatum and Diphylleia rotans (=Aulacomonas submarina) showed that they share a distinctive flagellar transitional zone and a very similar flagellar apparatus. In both species, the basic couple of basal bodies and flagella #1 and #2 are connected to the dorsal and ventral roots, respectively. Collodictyon triciliatum has two additional basal bodies and flagella, #3 and #4, situated on each side of the basic couple, each of which also bears a dorsal root. The horseshoe-shaped arrangement of dictyosomes, mitochondria with tubular cristae and the deep ventral groove are very similar to those of Diphylleia rotans. These two genera have very specific features and are placed in a new family, Collodictyonidae, distinct from other eukaryotic groups. Electron microscopic observation of mitotic telophase in Diphylleia rotans revealed two chromosomal masses, surrounded by the nuclear envelope, within the dividing parental nucleus, as in the telophase stage of the heliozoan Actinophrys and the helioflagellate Dimorpha. Spindle microtubules arise from several MTOCs outside the nucleus, and several microtubules penetrate within the dividing nucleus, via pores at the poles. This semi-open type of orthomitosis is reminiscent of that of actinophryids. The SSU rDNA sequence of Diphylleia rotans was compared with that of all the eukaryotic groups that have a slow-evolving rDNA. Diphylleia did not strongly assemble with any group and emerged in a very poorly resolved part of the eukaryotic phylogenetic tree.

  19. Three phylogenetic groups of nodA and nifH genes in Sinorhizobium and Mesorhizobium isolates from leguminous trees growing in Africa and Latin America.

    Science.gov (United States)

    Haukka, K; Lindström, K; Young, J P

    1998-02-01

    The diversity and phylogeny of nodA and nifH genes were studied by using 52 rhizobial isolates from Acacia senegal, Prosopis chilensis, and related leguminous trees growing in Africa and Latin America. All of the strains had similar host ranges and belonged to the genera Sinorhizobium and Mesorhizobium, as previously determined by 16S rRNA gene sequence analysis. The restriction patterns and a sequence analysis of the nodA and nifH genes divided the strains into the following three distinct groups: sinorhizobia from Africa, sinorhizobia from Latin America, and mesorhizobia from both regions. In a phylogenetic tree also containing previously published sequences, the nodA genes of our rhizobia formed a branch of their own, but within the branch no correlation between symbiotic genes and host trees was apparent. Within the large group of African sinorhizobia, similar symbiotic gene types were found in different chromosomal backgrounds, suggesting that transfer of symbiotic genes has occurred across species boundaries. Most strains had plasmids, and the presence of plasmid-borne nifH was demonstrated by hybridization for some examples. The nodA and nifH genes of Sinorhizobium teranga ORS1009T grouped with the nodA and nifH genes of the other African sinorhizobia, but Sinorhizobium saheli ORS609T had a totally different nodA sequence, although it was closely related based on the 16S rRNA gene and nifH data. This might be because this S. saheli strain was originally isolated from Sesbania sp., which belongs to a different cross-nodulation group than Acacia and Prosopis spp. The factors that appear to have influenced the evolution of rhizobial symbiotic genes vary in importance at different taxonomic levels.

  20. Antibiotic resistance, phylogenetic grouping and virulence potential of Escherichia coli isolated from the faeces of intensively farmed and free range poultry.

    Science.gov (United States)

    Obeng, Akua Serwaah; Rickard, Heather; Ndi, Olasumbo; Sexton, Margaret; Barton, Mary

    2012-01-27

    Antibiotic use in poultry production is a risk factor for promoting the emergence of resistant Escherichia coli. To ascertain differences in different classes of chickens, the resistance profile, some virulence genes and phylogenetic grouping on 251 E. coli isolates from intensive meat (free range and indoor commercial) and free range egg layer chickens collected between December 2008 and June 2009 in South Australia were performed. Among the 251 strains, 102 (40.6%) and 67 (26.7%) were found to be resistant to tetracycline and ampicillin respectively. Resistance was also observed to trimethoprim-sulfamethoxazole (12.4%), streptomycin (10.8%), spectinomycin (9.6%), neomycin (6.0%) and florfenicol (2.0%) but no resistance was found to ceftiofur, ciprofloxacin or gentamicin. Amplification of DNA of the isolates by polymerase chain reaction revealed the presence of genes that code for resistant determinants: tetracycline (tet(A), tet(B) and tet(C)), ampicillin (bla(TEM) and bla(SHV)), trimethoprim (dhfrV and dhfrXIII), sulphonamide (sulI and sulII), neomycin (aph(3)-Ia(aphA1)), and spectinomycin-streptinomycin (aadA2). In addition, 32.3-39.4% of the isolates were found to belong to commensal groups (A and B1) and 11.2-17.1% belonged to the virulent groups (B2 and D). Among the 251 E. coli isolates, 25 (10.0%) carried two or more virulence genes typical of Extraintestinal pathogenic E. coli (ExPEC). Furthermore, 17 of the isolates with multi-resistance were identified to be groups B2 and D. Although no significant difference was observed between isolates from free range and indoor commercial meat chickens (P>0.05), significant differences was observed between the different classes of meat chickens (free range and indoor commercial) and egg layers (Pzoonotic potential of poultry E. coli isolates. Copyright © 2011. Published by Elsevier B.V.

  1. Incompletely resolved phylogenetic trees inflate estimates of phylogenetic conservatism.

    Science.gov (United States)

    Davies, T Jonathan; Kraft, Nathan J B; Salamin, Nicolas; Wolkovich, Elizabeth M

    2012-02-01

    The tendency for more closely related species to share similar traits and ecological strategies can be explained by their longer shared evolutionary histories and represents phylogenetic conservatism. How strongly species traits co-vary with phylogeny can significantly impact how we analyze cross-species data and can influence our interpretation of assembly rules in the rapidly expanding field of community phylogenetics. Phylogenetic conservatism is typically quantified by analyzing the distribution of species values on the phylogenetic tree that connects them. Many phylogenetic approaches, however, assume a completely sampled phylogeny: while we have good estimates of deeper phylogenetic relationships for many species-rich groups, such as birds and flowering plants, we often lack information on more recent interspecific relationships (i.e., within a genus). A common solution has been to represent these relationships as polytomies on trees using taxonomy as a guide. Here we show that such trees can dramatically inflate estimates of phylogenetic conservatism quantified using S. P. Blomberg et al.'s K statistic. Using simulations, we show that even randomly generated traits can appear to be phylogenetically conserved on poorly resolved trees. We provide a simple rarefaction-based solution that can reliably retrieve unbiased estimates of K, and we illustrate our method using data on first flowering times from Thoreau's woods (Concord, Massachusetts, USA).

  2. a Morphometric Analysis of HYLARANA SIGNATA Group (previously Known as RANA SIGNATA and RANA PICTURATA) of Malaysia

    Science.gov (United States)

    Zainudin, Ramlah; Sazali, Siti Nurlydia

    A study on morphometrical variations of Malaysian Hylarana signata group was conducted to reveal the morphological relationships within the species group. Twenty-seven morphological characters from 18 individuals of H. signata and H. picturata were measured and recorded. The numerical data were analysed using Discriminant Function Analysis in SPSS program version 16.0 and UPGMA Cluster Analysis in Minitab program version 14.0. The results show the complexity clustering between the examined species that might be due to ancient polymorphism of the lineages or cryptic species within the group. Hence, further study should include more representatives in order to fully elucidate the morphological relationships of H. signata group.

  3. Molecular phylogenetic and scanning electron microscopical analyses places the Choanephoraceae and the Gilbertellaceae in a monophyletic group within the Mucorales (Zygomycetes, Fungi).

    Science.gov (United States)

    Voigt, Kerstin; Olsson, L

    2008-09-01

    A multi-gene genealogy based on maximum parsimony and distance analyses of the exonic genes for actin (act) and translation elongation factor 1 alpha (tef), the nuclear genes for the small (18S) and large (28S) subunit ribosomal RNA (comprising 807, 1092, 1863, 389 characters, respectively) of all 50 genera of the Mucorales (Zygomycetes) suggests that the Choanephoraceae is a monophyletic group. The monotypic Gilbertellaceae appears in close phylogenetic relatedness to the Choanephoraceae. The monophyly of the Choanephoraceae has moderate to strong support (bootstrap proportions 67% and 96% in distance and maximum parsimony analyses, respectively), whereas the monophyly of the Choanephoraceae-Gilbertellaceae clade is supported by high bootstrap values (100% and 98%). This suggests that the two families can be joined into one family, which leads to the elimination of the Gilbertellaceae as a separate family. In order to test this hypothesis single-locus neighbor-joining analyses were performed on nuclear genes of the 18S, 5.8S, 28S and internal transcribed spacer (ITS) 1 ribosomal RNA and the translation elongation factor 1 alpha (tef) and beta tubulin (betatub) nucleotide sequences. The common monophyletic origin of the Choanephoraceae-Gilbertellaceae clade could be confirmed in all gene trees and by investigation of their ultrastructure. Sporangia with persistent, sutured walls splitting in half at maturity and ellipsoidal sporangiospores with striated ornamentations and polar ciliate appendages arising from spores in persistent sporangia and dehiscent sporangiola represent synapomorphic characters of this group. We discuss our data in the context of the historical development of their taxonomy and physiology and propose a reduction of the two families to one family, the Choanephoraceae sensu lato comprising species which are facultative plant pathogens and parasites, especially in subtropical to tropical regions.

  4. Incidence and risk factors for breast cancer subtypes in three distinct South-East Asian ethnic groups: Chinese, Malay and natives of Sarawak, Malaysia.

    Science.gov (United States)

    Devi, C R Beena; Tang, Tieng Swee; Corbex, Marilys

    2012-12-15

    We determined the incidences of the estrogen receptor (ER), progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2) subtypes among breast cancer cases in Sarawak, Malaysia and their correlation with various risk factors in the three ethnic groups: Chinese, Malay and native. Subtype status was ascertained for 1,034 cases of female breast cancer (93% of all cases diagnosed since 2003), and the age-standardized incidence rates (ASRs) of each subtype were inferred. Case-case comparisons across subtypes were performed for reproductive risk factors. We found 48% luminal A (ER+/PR+/HER2-), 29% triple-negative (ER-/PR-/HER2-), 12% triple-positive (ER+/PR+/HER2+) and 11% HER2-overexpressing (ER-/PR-/HER2+) subtypes, with ASRs of 10.6, 6.0, 2.8 and 2.8 per 100,000, respectively. The proportions of subtypes and ASRs differed significantly by ethnic groups: HER2-positive cases were more frequent in Malays (29%; 95% CI [23;35]) than Chinese (22%; [19;26] and natives (21%; [16;26]); triple-negative cases were less frequent among Chinese (23%; [20;27]) than Malays (33%; [27;39]) and natives (37%; [31;43]). The results of the case-case comparison were in accordance with those observed in western case series. Some uncommon associations, such as between triple-negative subtype and older age at menopause (OR, 1.59; p < 0.05), were found. The triple-negative and HER2+ subtypes predominate in our region, with significant differences among ethnic groups. Our results support the idea that the risk factors for different subtypes vary markedly. Westernized populations are more likely to have factors that increase the risk for the luminal A type, while risk factors for the triple-negative type are more frequent in local populations. Copyright © 2012 UICC.

  5. Malaysia power

    Energy Technology Data Exchange (ETDEWEB)

    Husin, Z.A. (Tenaga Nasional Berhad (Malaysia))

    1994-09-01

    Describes the organisation of the Malaysian electric power industry and the role of natural gas and coal in power generation in the country. At present, electricity is produced by three utilities: Tenaga Nasional Berhad (TNB) which was fully privatised in May 1992 with the Government holding about 73% of the equity, Sarawak Electricity Supply Corporation (SESCO) which the Government plans to privatise soon, and Sabah Electricity Board (SEB). These have installed capacities of 7000 MW, 400 MW and 350 MW, respectively. Five independent power producers have been given licences to build, own and operate power plants with a total installed capacity of 4000 MW. Natural gas is expected to account for about 72% of Malaysia's power generating fuel by the year 2010, compared to about 50% at present. Malaysia currently has only one coal-fired plant, but its expansion is in the final stage of contract awards. A number of small capacity coal-fired plants are being planned for Sabah and Sarawak where the bulk of Malaysia's coal resources are located. 3 figs., 1 photo.

  6. Application of unweighted pair group methods with arithmetic average (UPGMA) for identification of kinship types and spreading of ebola virus through establishment of phylogenetic tree

    Science.gov (United States)

    Andriani, Tri; Irawan, Mohammad Isa

    2017-08-01

    Ebola Virus Disease (EVD) is a disease caused by a virus of the genus Ebolavirus (EBOV), family Filoviridae. Ebola virus is classifed into five types, namely Zaire ebolavirus (ZEBOV), Sudan ebolavirus (SEBOV), Bundibugyo ebolavirus (BEBOV), Tai Forest ebolavirus also known as Cote d'Ivoire ebolavirus (CIEBOV), and Reston ebolavirus (REBOV). Identification of kinship types of Ebola virus can be performed using phylogenetic trees. In this study, the phylogenetic tree constructed by UPGMA method in which there are Multiple Alignment using Progressive Method. The results concluded that the phylogenetic tree formation kinship ebola virus types that kind of Tai Forest ebolavirus close to Bundibugyo ebolavirus but the layout state ebola epidemic spread far apart. The genetic distance for this type of Bundibugyo ebolavirus with Tai Forest ebolavirus is 0.3725. Type Tai Forest ebolavirus similar to Bundibugyo ebolavirus not inuenced by the proximity of the area ebola epidemic spread.

  7. Molecular Evolution and Phylogenetic Analysis of Eight COL Superfamily Genes in Group I Related to Photoperiodic Regulation of Flowering Time in Wild and Domesticated Cotton (Gossypium) Species

    Science.gov (United States)

    Zhang, Rui; Ding, Jian; Liu, Chunxiao; Cai, Caiping; Zhou, Baoliang; Zhang, Tianzhen; Guo, Wangzhen

    2015-01-01

    Flowering time is an important ecological trait that determines the transition from vegetative to reproductive growth. Flowering time in cotton is controlled by short-day photoperiods, with strict photoperiod sensitivity. As the CO-FT (CONSTANS-FLOWER LOCUS T) module regulates photoperiodic flowering in several plants, we selected eight CONSTANS genes (COL) in group I to detect their expression patterns in long-day and short-day conditions. Further, we individually cloned and sequenced their homologs from 25 different cotton accessions and one outgroup. Finally, we studied their structures, phylogenetic relationship, and molecular evolution in both coding region and three characteristic domains. All the eight COLs in group I show diurnal expression. In the orthologous and homeologous loci, each gene structure in different cotton species is highly conserved, while length variation has occurred due to insertions/deletions in intron and/or exon regions. Six genes, COL2 to COL5, COL7 and COL8, exhibit higher nucleotide diversity in the D-subgenome than in the A-subgenome. The Ks values of 98.37% in all allotetraploid cotton species examined were higher in the A-D and At-Dt comparison than in the A-At and D-Dt comparisons, and the Pearson’s correlation coefficient (r) of Ks between A vs. D and At vs. Dt also showed positive, high correlations, with a correlation coefficient of at least 0.797. The nucleotide polymorphism in wild species is significantly higher compared to G. hirsutum and G. barbadense, indicating a genetic bottleneck associated with the domesticated cotton species. Three characteristic domains in eight COLs exhibit different evolutionary rates, with the CCT domain highly conserved, while the B-box and Var domain much more variable in allotetraploid species. Taken together, COL1, COL2 and COL8 endured greater selective pressures during the domestication process. The study improves our understanding of the domestication-related genes/traits during cotton

  8. Phylogenetic relationship and virulence inference of Streptococcus Anginosus Group: curated annotation and whole-genome comparative analysis support distinct species designation

    Science.gov (United States)

    2013-01-01

    Background The Streptococcus Anginosus Group (SAG) represents three closely related species of the viridans group streptococci recognized as commensal bacteria of the oral, gastrointestinal and urogenital tracts. The SAG also cause severe invasive infections, and are pathogens during cystic fibrosis (CF) pulmonary exacerbation. Little genomic information or description of virulence mechanisms is currently available for SAG. We conducted intra and inter species whole-genome comparative analyses with 59 publically available Streptococcus genomes and seven in-house closed high quality finished SAG genomes; S. constellatus (3), S. intermedius (2), and S. anginosus (2). For each SAG species, we sequenced at least one numerically dominant strain from CF airways recovered during acute exacerbation and an invasive, non-lung isolate. We also evaluated microevolution that occurred within two isolates that were cultured from one individual one year apart. Results The SAG genomes were most closely related to S. gordonii and S. sanguinis, based on shared orthologs and harbor a similar number of proteins within each COG category as other Streptococcus species. Numerous characterized streptococcus virulence factor homologs were identified within the SAG genomes including; adherence, invasion, spreading factors, LPxTG cell wall proteins, and two component histidine kinases known to be involved in virulence gene regulation. Mobile elements, primarily integrative conjugative elements and bacteriophage, account for greater than 10% of the SAG genomes. S. anginosus was the most variable species sequenced in this study, yielding both the smallest and the largest SAG genomes containing multiple genomic rearrangements, insertions and deletions. In contrast, within the S. constellatus and S. intermedius species, there was extensive continuous synteny, with only slight differences in genome size between strains. Within S. constellatus we were able to determine important SNPs and changes in

  9. Phylogenetic comparative methods on phylogenetic networks with reticulations.

    Science.gov (United States)

    Bastide, Paul; Solís-Lemus, Claudia; Kriebel, Ricardo; Sparks, K William; Ané, Cécile

    2018-04-25

    The goal of Phylogenetic Comparative Methods (PCMs) is to study the distribution of quantitative traits among related species. The observed traits are often seen as the result of a Brownian Motion (BM) along the branches of a phylogenetic tree. Reticulation events such as hybridization, gene flow or horizontal gene transfer, can substantially affect a species' traits, but are not modeled by a tree. Phylogenetic networks have been designed to represent reticulate evolution. As they become available for downstream analyses, new models of trait evolution are needed, applicable to networks. One natural extension of the BM is to use a weighted average model for the trait of a hybrid, at a reticulation point. We develop here an efficient recursive algorithm to compute the phylogenetic variance matrix of a trait on a network, in only one preorder traversal of the network. We then extend the standard PCM tools to this new framework, including phylogenetic regression with covariates (or phylogenetic ANOVA), ancestral trait reconstruction, and Pagel's λ test of phylogenetic signal. The trait of a hybrid is sometimes outside of the range of its two parents, for instance because of hybrid vigor or hybrid depression. These two phenomena are rather commonly observed in present-day hybrids. Transgressive evolution can be modeled as a shift in the trait value following a reticulation point. We develop a general framework to handle such shifts, and take advantage of the phylogenetic regression view of the problem to design statistical tests for ancestral transgressive evolution in the evolutionary history of a group of species. We study the power of these tests in several scenarios, and show that recent events have indeed the strongest impact on the trait distribution of present-day taxa. We apply those methods to a dataset of Xiphophorus fishes, to confirm and complete previous analysis in this group. All the methods developed here are available in the Julia package PhyloNetworks.

  10. Phylogenetic classification of bony fishes.

    Science.gov (United States)

    Betancur-R, Ricardo; Wiley, Edward O; Arratia, Gloria; Acero, Arturo; Bailly, Nicolas; Miya, Masaki; Lecointre, Guillaume; Ortí, Guillermo

    2017-07-06

    Fish classifications, as those of most other taxonomic groups, are being transformed drastically as new molecular phylogenies provide support for natural groups that were unanticipated by previous studies. A brief review of the main criteria used by ichthyologists to define their classifications during the last 50 years, however, reveals slow progress towards using an explicit phylogenetic framework. Instead, the trend has been to rely, in varying degrees, on deep-rooted anatomical concepts and authority, often mixing taxa with explicit phylogenetic support with arbitrary groupings. Two leading sources in ichthyology frequently used for fish classifications (JS Nelson's volumes of Fishes of the World and W. Eschmeyer's Catalog of Fishes) fail to adopt a global phylogenetic framework despite much recent progress made towards the resolution of the fish Tree of Life. The first explicit phylogenetic classification of bony fishes was published in 2013, based on a comprehensive molecular phylogeny ( www.deepfin.org ). We here update the first version of that classification by incorporating the most recent phylogenetic results. The updated classification presented here is based on phylogenies inferred using molecular and genomic data for nearly 2000 fishes. A total of 72 orders (and 79 suborders) are recognized in this version, compared with 66 orders in version 1. The phylogeny resolves placement of 410 families, or ~80% of the total of 514 families of bony fishes currently recognized. The ordinal status of 30 percomorph families included in this study, however, remains uncertain (incertae sedis in the series Carangaria, Ovalentaria, or Eupercaria). Comments to support taxonomic decisions and comparisons with conflicting taxonomic groups proposed by others are presented. We also highlight cases were morphological support exist for the groups being classified. This version of the phylogenetic classification of bony fishes is substantially improved, providing resolution

  11. Older Consumers in Malaysia

    Directory of Open Access Journals (Sweden)

    David R. Phillips

    2007-07-01

    Full Text Available The main objective of this study was to understand the concerns and problems faced by older people in an industrializing middle-income country, Malaysia, in their process of acquiring products to meet their everyday needs. Respondents aged 55 and over were interviewed in eight states throughout Peninsular Malaysia providing 1356 usable questionnaires; two-thirds from urban and one-third from rural areas. Education, health status, and life satisfaction were recorded. Service patronage behaviour was examined for four main categories of commonly-sought consumer goods: groceries, health supplements, apparel, eating outlets, plus selected services (public transport, vacation packages and financial services. The findings showed that older adults in Malaysia are rather discerning consumers. Many respondents are price conscious and have developed consumer attitudes with regard to attitude of staff and assistance rendered. Many display a good ability to discriminate and to select, especially on the basis of price and durability of products and many appear to be acting as effectively as consumers in any other age group.

  12. Phylogenetic footprints in organizational behavior

    OpenAIRE

    Witt, Ulrich; Schwesinger, Georg

    2012-01-01

    An evolutionary tool kit is applied in this paper to explain how innate social behavior traits evolved in early human groups. These traits were adapted to the particular production requirements of the group in human phylogeny. They shaped the group members' attitudes towards contributing to the group's goals and towards other group members. We argue that these attitudes are still present in modern humans and leave their phylogenetic footprints also in present-day organizational life. We discu...

  13. STR data for the AmpFlSTR Profiler loci from the three main ethnic population groups (Malay, Chinese and Indian) in Malaysia.

    Science.gov (United States)

    Lim, K B; Jeevan, N H; Jaya, P; Othman, M I; Lee, Y H

    2001-06-01

    Allele frequencies for the nine STRs genetic loci included in the AmpFlSTR Profiler kit were obtained from samples of unrelated individuals comprising 139-156 Malays, 149-153 Chinese and 132-135 Indians, residing in Malaysia.

  14. Unrealistic phylogenetic trees may improve phylogenetic footprinting.

    Science.gov (United States)

    Nettling, Martin; Treutler, Hendrik; Cerquides, Jesus; Grosse, Ivo

    2017-06-01

    The computational investigation of DNA binding motifs from binding sites is one of the classic tasks in bioinformatics and a prerequisite for understanding gene regulation as a whole. Due to the development of sequencing technologies and the increasing number of available genomes, approaches based on phylogenetic footprinting become increasingly attractive. Phylogenetic footprinting requires phylogenetic trees with attached substitution probabilities for quantifying the evolution of binding sites, but these trees and substitution probabilities are typically not known and cannot be estimated easily. Here, we investigate the influence of phylogenetic trees with different substitution probabilities on the classification performance of phylogenetic footprinting using synthetic and real data. For synthetic data we find that the classification performance is highest when the substitution probability used for phylogenetic footprinting is similar to that used for data generation. For real data, however, we typically find that the classification performance of phylogenetic footprinting surprisingly increases with increasing substitution probabilities and is often highest for unrealistically high substitution probabilities close to one. This finding suggests that choosing realistic model assumptions might not always yield optimal predictions in general and that choosing unrealistically high substitution probabilities close to one might actually improve the classification performance of phylogenetic footprinting. The proposed PF is implemented in JAVA and can be downloaded from https://github.com/mgledi/PhyFoo. : martin.nettling@informatik.uni-halle.de. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press.

  15. Polymorphisms of UGT1A1*6, UGT1A1*27 & UGT1A1*28 in three major ethnic groups from Malaysia.

    Science.gov (United States)

    Teh, L K; Hashim, H; Zakaria, Z A; Salleh, M Z

    2012-08-01

    Genetic polymorphisms of uridine diphosphate glucuronyltransferase 1A1 (UGT1A1) have been associated with a wide variation of responses among patients prescribed with irinotecan. Lack of this enzyme is known to be associated with a high incidence of severe toxicity. The objective of this study was to investigate the prevalence of three different variants of UGT1A1 (UGT1A1*6, UGT1A1*27 and UGT1A1*28), which are associated with reduced enzyme activity and increased irinotecan toxicity, in the three main ethnic groups in Malaysia (Malays, Chinese and Indians). A total of 306 healthy unrelated volunteers were screened for UGT1A1*28, UGT1A1*6 and UGT1A1*27. Blood samples (5 ml) were obtained from each subject and DNA was extracted. PCR based methods were designed and validated for detection of UGT1A1*, UUGT1A1*27 and UUGT1A1*28. Direct DNA sequencing was performed to validate the results of randomly selected samples. Malays and Indian have two-fold higher frequency of homozygous of UGT1A1*28 (7TA/7TA) which was 8 and 8.8 per cent, respectively compared to the Chinese (4.9%). However, the distribution of UGT1A1*6 and UGT1A1*27 showed no significant differences among them. UGT1A1*27 which has not been detected in Caucasian and African American population, was found in the Malaysian Malays (3.33%) and Malaysian Chinese (2.0%). There was interethnic variability in the frequency of UGT1A1*28 in the Malaysian population. Our results suggest that genotyping of UUGT1A1*6, UGT1A1*28 and UGT1A1*27 need to be performed before patients are prescribed with irinotecan due to their high prevalence of allelic variant which could lead to adverse drug reaction.

  16. Molecular epidemiology of tuberculosis in Malaysia.

    Science.gov (United States)

    Dale, J W; Nor, R M; Ramayah, S; Tang, T H; Zainuddin, Z F

    1999-05-01

    Molecular typing with IS6110 was applied to Mycobacterium tuberculosis isolates from all parts of Malaysia. The degree of clustering increased with patient age, suggesting that reactivation may contribute to clustering. Identical banding patterns were also obtained for isolates from widely separate regions. Therefore, the use of clustering as a measure of recent transmission must be treated with caution. Strains related to the Beijing family were common in Peninsular Malaysia but were less common in Sabah and Sarawak, while a distinct group of strains comprised nearly 40% of isolates from East Malaysia but such strains were rare in Peninsular Malaysia. Single-copy strains, common in South and Southeastern Asia, constituted nearly 20% of isolates from the peninsula but were virtually absent in East Malaysia. The marked geographical difference in the prevailing strains indicates not only a restricted dissemination of M. tuberculosis but also a considerable degree of stability in the banding patterns.

  17. The development and validation of the Satisfaction Questionnaire for Osteoporosis Prevention in Malaysia

    OpenAIRE

    Lai, Pauline Siew Mei; Toh,Li Shean; Wong,Kok Thong; Tan,Alex Tong Boon; Low,Bee Yean; Anderson,Claire; Wu,David Bin-Chia

    2014-01-01

    Li Shean Toh,1 Pauline Siew Mei Lai,2 David Bin-Chia Wu,3 Kok Thong Wong,1 Bee Yean Low,1 Alexander Tong Boon Tan,4 Claire Anderson5 1School of Pharmacy, University of Nottingham, Semenyih, Malaysia; 2Department of Primary Care Medicine, University of Malaya Primary Care Research Group, University of Malaya, Kuala Lumpur, Malaysia; 3School of Pharmacy, Monash University Malaysia, Bandar Sunway, Malaysia; 4Department of Medicine, University of Malaya, Kuala Lumpur, Malaysia; 5Division of Soci...

  18. Origin and evolution of group XI secretory phospholipase A2 from flax (Linum usitatissimum) based on phylogenetic analysis of conserved domains.

    Science.gov (United States)

    Gupta, Payal; Saini, Raman; Dash, Prasanta K

    2017-07-01

    Phospholipase A 2 (PLA 2 ) belongs to class of lipolytic enzymes (EC 3.1.1.4). Lysophosphatidic acid (LPA) and free fatty acids (FFAs) are the products of PLA 2 catalyzed hydrolysis of phosphoglycerides at sn-2 position. LPA and FFA that act as second mediators involved in the development and maturation of plants and animals. Mining of flax genome identified two phospholipase A 2 encoding genes, viz., LusPLA 2 I and LusPLA 2 II (Linum usitatissimum secretory phospholipase A 2 ). Molecular simulation of LusPLA 2 s with already characterized plant sPLA 2 s revealed the presence of conserved motifs and signature domains necessary to classify them as secretory phospholipase A 2 . Phylogenetic analysis of flax sPLA 2 with representative sPLA 2 s from other organisms revealed that they evolved rapidly via gene duplication/deletion events and shares a common ancestor. Our study is the first report of detailed phylogenetic analysis for secretory phospholipase A 2 in flax. Comparative genomic analysis of two LusPLA 2 s with earlier reported plant sPLA 2 s, based on their gene architectures, sequence similarities, and domain structures are presented elucidating the uniqueness of flax sPLA 2 .

  19. Phylogenetic relationships among Maloideae species

    Science.gov (United States)

    The Maloideae is a highly diverse sub-family of the Rosaceae containing several agronomically important species (Malus sp. and Pyrus sp.) and their wild relatives. Previous phylogenetic work within the group has revealed extensive intergeneric hybridization and polyploidization. In order to develop...

  20. Parallel phylogenetic analyses using the N, G or Nv gene from a fixed group of VHSV isolates reveal the same overall genetic typing

    DEFF Research Database (Denmark)

    Einer-Jensen, Katja; Ahrens, Peter; Lorenzen, Niels

    2005-01-01

    . The overall genotyping of the selected isolates was identical for the 7 target regions, but separation of Genotype I sub-lineages was best when the analysis was performed on the full length G gene (1524 nucleotides, nt). Good resolution was furthermore obtained using smaller sequencing windows represented...... by a G gene fragment (nt 360 to 720) or the Nv gene (366 nt), although these regions had different characteristics with respect to resolution of Genotype I sublineages and resolution within Sub-lineage Ia. Phylogenetic analysis based on the deduced amino acid sequences was also performed...... genotyping and serotyping with neutralising (G protein specific) antibodies was observed, stressing that epidemiological analysis based on phenotypic characteristics such as serotype could be misleading....

  1. Phylogenetic reconstruction methods: an overview.

    Science.gov (United States)

    De Bruyn, Alexandre; Martin, Darren P; Lefeuvre, Pierre

    2014-01-01

    Initially designed to infer evolutionary relationships based on morphological and physiological characters, phylogenetic reconstruction methods have greatly benefited from recent developments in molecular biology and sequencing technologies with a number of powerful methods having been developed specifically to infer phylogenies from macromolecular data. This chapter, while presenting an overview of basic concepts and methods used in phylogenetic reconstruction, is primarily intended as a simplified step-by-step guide to the construction of phylogenetic trees from nucleotide sequences using fairly up-to-date maximum likelihood methods implemented in freely available computer programs. While the analysis of chloroplast sequences from various Vanilla species is used as an illustrative example, the techniques covered here are relevant to the comparative analysis of homologous sequences datasets sampled from any group of organisms.

  2. Prevalence and zoonotic potential of canine hookworms in Malaysia

    Directory of Open Access Journals (Sweden)

    Mahdy Mohammed AK

    2012-05-01

    Full Text Available Abstract Background Canine hookworm infection is endemic in Southeast Asian countries with a prevalence ranging from 70% to 100%, with zoonotic transmission representing a potentially significant public health concern. However, there are limited data available on the prevalence of canine hookworms in Malaysia. This study was conducted to determine the prevalence of hookworm and Ancylostoma species among dogs in Malaysia. Methods Faecal samples were collected from 221 dogs living in urban areas, rural areas and animal shelters in Selangor. Faecal samples were processed using the formal-ether concentration technique followed by wet mount preparation and iodine staining for the detection of hookworm eggs. Samples positive for hookworm eggs were examined using PCR, targeting ITS2 and 28 s rRNA region, and subsequently sequenced in both directions. The sequences were phylogenetically analysed using MrBayes for Bayesian Inference. Results The overall prevalence of hookworm among dogs was 48% (95%CI; 41.41–54.95. Rural stray dogs had the highest prevalence 71.4% (95%CI; 61.13–81.49 followed by urban stray dogs, recording 48% (95%CI; 34.15–61.85 and lastly dogs in shelters with 28.7% (95%CI; 19.56–37.84. Logistic regression identified rural stray dogs as a high risk group (OR = 4.55, 95%; 2.50–8.31 and keeping dogs in shelters as a protective factor (OR = 0.24, 95%; 0.14–0.43. Molecular methods identified both Ancylostoma ceylanicum and Ancylostoma caninum with A. ceylanicum being predominant among urban stray dogs. Rural dogs had a higher prevalence of A. caninum than A. ceylanicum, while both species showed equal distribution among dogs in shelters. Phylogenetic analysis placed A. ceylanicum isolated from dogs in one group with A. ceylanicum human isolates. Conclusion This study indicates that dogs have the potential to act as reservoir hosts of human hookworm infection in Malaysia. This finding necessitates the inclusion of dogs

  3. Review of sarcocystosis in Malaysia.

    Science.gov (United States)

    Kan, S P; Pathmanathan, R

    1991-12-01

    Sarcocystis is a tissue coccidian with an obligatory two-host life cycle. The sexual generations of gametogony and sporogony occur in the lamina propria of the small intestine of definitive hosts which shed infective sporocysts in their stools and present with intestinal sarcocystosis. Asexual multiplication occurs in the skeletal and cardiac muscles of intermediate hosts which harbor Sarcocystis cysts in their muscles and present with muscular sarcocystosis. In Malaysia, Sarcocystis cysts have been reported from many domestic and wild animals, including domestic and field rats, moonrats, bandicoots, slow loris, buffalo, and monkey, and man. The known definitive hosts for some species of Sarcocystis are the domestic cat, dog and the reticulated python. Human muscular sarcocystosis in Malaysia is a zoonotic infection acquired by contamination of food or drink with sporocysts shed by definitive hosts. The cysts reported in human muscle resembled those seen in the moonrat, Echinosorex gymnurus, and the long-tailed monkey, Macaca fascicularis. While human intestinal sarcocystosis has not been reported in Malaysia so far, it can be assumed that such cases may not be infrequent in view of the occurrence of Sarcocystis cysts in meat animals, such as buffalo. The overall seroprevalence of 19.8% reported among the main racial groups in Malaysia indicates that sarcocystosis (both the intestinal and muscular forms) may be emerging as a significant food-borne zoonotic infection in the country.

  4. Undergraduate Students’ Difficulties in Reading and Constructing Phylogenetic Tree

    Science.gov (United States)

    Sa'adah, S.; Tapilouw, F. S.; Hidayat, T.

    2017-02-01

    Representation is a very important communication tool to communicate scientific concepts. Biologists produce phylogenetic representation to express their understanding of evolutionary relationships. The phylogenetic tree is visual representation depict a hypothesis about the evolutionary relationship and widely used in the biological sciences. Phylogenetic tree currently growing for many disciplines in biology. Consequently, learning about phylogenetic tree become an important part of biological education and an interesting area for biology education research. However, research showed many students often struggle with interpreting the information that phylogenetic trees depict. The purpose of this study was to investigate undergraduate students’ difficulties in reading and constructing a phylogenetic tree. The method of this study is a descriptive method. In this study, we used questionnaires, interviews, multiple choice and open-ended questions, reflective journals and observations. The findings showed students experiencing difficulties, especially in constructing a phylogenetic tree. The students’ responds indicated that main reasons for difficulties in constructing a phylogenetic tree are difficult to placing taxa in a phylogenetic tree based on the data provided so that the phylogenetic tree constructed does not describe the actual evolutionary relationship (incorrect relatedness). Students also have difficulties in determining the sister group, character synapomorphy, autapomorphy from data provided (character table) and comparing among phylogenetic tree. According to them building the phylogenetic tree is more difficult than reading the phylogenetic tree. Finding this studies provide information to undergraduate instructor and students to overcome learning difficulties of reading and constructing phylogenetic tree.

  5. Sequence comparison and phylogenetic analysis of core gene of ...

    African Journals Online (AJOL)

    Phylogenetic analysis suggests that our sequences are clustered with sequences reported from Japan. This is the first phylogenetic analysis of HCV core gene from Pakistani population. Our sequences and sequences from Japan are grouped into same cluster in the phylogenetic tree. Sequence comparison and ...

  6. Sequence and organization of the rhoptry-associated-protein-1 (rap-1) locus for the sheep hemoprotozoan Babesia sp. BQ1 Lintan (B. motasi phylogenetic group).

    Science.gov (United States)

    Niu, Qingli; Bonsergent, Claire; Guan, Guiquan; Yin, Hong; Malandrin, Laurence

    2013-11-15

    Babesiosis is a frequent infection of animals worldwide by tick borne pathogen Babesia, and several species are responsible for ovine babesiosis. Recently, several Babesia motasi-like isolates were described in sheep in China. In this study, we sequenced the multigenic rap-1 gene locus of one of these isolates, Babesia sp. BQ1 Lintan. The RAP-1 proteins are involved in the process of red blood cells invasion and thus represent a potential target for vaccine development. A complex composition and organization of the rap-1 locus was discovered with: (1) the presence of 3 different types of rap-1 sequences (rap-1a, rap-1b and rap-1c); (2) the presence of multiple copies of rap-1a and rap-1b; (3) polymorphism among the rap-1a copies, with two classes (named rap-1a61 and rap-1a67) having a similarity of 95.7%, each class represented by two close variants; (4) polymorphism between rap-1a61-1 and rap-1a61-2 limited to three nucleotide positions; (5) a difference of eight nucleotides between rap-1a67-1 and rap-1a67-2 from position 1270 to the putative stop site of rap-1a67-1 which might produce two putative proteins of slightly different sizes; (6) the ratio of rap-1a copies corresponding to one rap-1a67, one rap-1a61-1 and one rap-1a61-2; (7) the presence of three different intergenic regions separating rap-1a, rap-1b and rap-1c; (8) interspacing of the rap-1a copies with rap-1b copies; and (9) the terminal position of rap-1c in the locus. A 31kb locus composed of 6 rap-1a sequences interspaced with 5 rap-1b sequences and with a terminal rap-1c copy was hypothesized. A strikingly similar sequence composition (rap-1a, rap-1b and rap-1c), as well as strong gene identities and similar locus organization with B. bigemina were found and highlight the conservation of synteny at this locus in this phylogenetic clade. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Competition Law In Malaysia

    OpenAIRE

    Hussein, Safinaz Mohd

    2012-01-01

    Meningkatnya kesadaran akan pentingnya persaingan usaha menimbulkan munculnya regulasi tertentu di tingkat nasional dan hal inilah yang terjadi di Malaysia, yakni dengan berlakunya Undang-Undang Persaingan Usaha Malaysia 2010. Disahkannya hukum persaingan umum seperti Undang-Undang Persaingan Usaha Malaysia 2010 pasti akan berdampak pada undang-undang sektoral seperti ketentuan dalam Peraturan Ekonomi CMA 1998. Biasanya hukum persaingan usaha memang di atas undangundang sektoral, kecuali j...

  8. Manufacturing halal in Malaysia

    DEFF Research Database (Denmark)

    Fischer, Johan

    2016-01-01

    In Arabic, halal literally means ‘permissible’ or ‘lawful’. Halal is no longer an expression of an esoteric form of production, trade and consumption, but part of a huge and expanding globalized market in which certification, standards and technoscience play important roles. Over the past three...... production, trade and consumption. Based on fieldwork in Malaysia, this article explores how manufacturing companies understand and practise halal certification, standards and technoscience. I argue that while existing studies of halal overwhelmingly explore micro-social aspects such as the everyday...... consumption among Muslim groups, ‘the bigger institutional picture’ that frames such consumption production and regulation are not well understood. By studying halal production, I provide an ethnography of the overlapping technologies and techniques of production and regulation that together warrant a product...

  9. Molecular phylogenetic analysis of the Persea group (Lauraceae) and its biogeographic implications on the evolution of tropical and subtropical Amphi-Pacific disjunctions.

    Science.gov (United States)

    Li, Lang; Li, Jie; Rohwer, Jens G; van der Werff, Henk; Wang, Zhi-Hua; Li, Hsi-Wen

    2011-09-01

    The Persea group (Lauraceae) has a tropical and subtropical amphi-pacific disjunct distribution with most of its members, and it includes two Macaronesian species. The relationships within the group are still controversial, and its intercontinental disjunction has not been investigated with extensive sampling and precise time dating. • ITS and LEAFY intron II sequences of 78 Persea group species and nine other Lauraceae species were analyzed with maximum parsimony and Bayesian inference. Divergence time estimation employed Bayesian Markov chain Monte Carlo method under a relaxed clock. • Several traditional genera or subgenera within the Persea group form well-supported monophyletic groups except Alseodaphne and Dehaasia. The divergence time of the Persea group is estimated as ∼55.3 (95% higher posterior densities [HPD] 41.4-69.9) million years ago (mya). Two major divergences within the Persea group are estimated as ∼51.9 (95% HPD 38.9-63.9) mya and ∼48.5 (95% HPD 35.9-59.9) mya. • Persea can be retained as a genus by the inclusion of Apollonias barbujana and exclusion a few species that do not fit into the established subgenera. A major revision is recommended for the delimitation between Alseodaphne, Dehaasia, and Nothaphoebe. We suggest that the Persea group originated from the Perseeae-Laureae radiation in early Eocene Laurasia. Its amphi-pacific disjunction results from the disruption of boreotropical flora by climatic cooling during the mid- to late Eocene. The American-Macaronesian disjunction may be explained by the long-distance dispersal.

  10. Phylogenetic Trees From Sequences

    Science.gov (United States)

    Ryvkin, Paul; Wang, Li-San

    In this chapter, we review important concepts and approaches for phylogeny reconstruction from sequence data.We first cover some basic definitions and properties of phylogenetics, and briefly explain how scientists model sequence evolution and measure sequence divergence. We then discuss three major approaches for phylogenetic reconstruction: distance-based phylogenetic reconstruction, maximum parsimony, and maximum likelihood. In the third part of the chapter, we review how multiple phylogenies are compared by consensus methods and how to assess confidence using bootstrapping. At the end of the chapter are two sections that list popular software packages and additional reading.

  11. Phylogenetic placement of an unusual coral mushroom challenges the classic hypothesis of strict coevolution in the apterostigma pilosum group ant-fungus mutualism.

    Science.gov (United States)

    Dentinger, Bryn T M; Lodge, D Jean; Munkacsi, Andrew B; Desjardin, Dennis E; McLaughlin, David J

    2009-08-01

    The approximately 50 million-year-old fungus-farming ant mutualism is a classic example of coevolution, involving ants that subsist on asexual, fungal biomass, in turn propagating the fungus clonally through nest-to-nest transmission. Most mutualistic ants cultivate two closely related groups of gilled mushrooms, whereas one small group of ants in the genus Apterostigma cultivates a distantly related lineage comprised of the G2 and G4 groups. The G2 and G4 fungi were previously shown to form a monophyletic group sister to the thread-like coral mushroom family Pterulaceae. Here, we identify an enigmatic coral mushroom that produces both fertile and sterile fruiting structures as the closest free-living relative of the G4 fungi, challenging the monophyly of the Apterostigma-cultivated fungi for the first time. Both nonparametric bootstrap and Bayesian posterior probability support the node leading to the G4 cultivars and a free-living Pterula mushroom. These data suggest three scenarios that contradict the hypothesis of strict coevolution: (1) multiple domestications, (2) escape from domestication, (3) selection of single cultivar lineages from an ancestral mixed-fungus garden. These results illustrate how incomplete phylogenies for coevolved symbionts impede our understanding of the patterns and processes of coevolution.

  12. Testing the Metabolic Theory of Ecology with marine bacteria: Different temperature sensitivity of major phylogenetic groups during the spring phytoplankton bloom

    KAUST Repository

    Arandia-Gorostidi, Nestor; Huete-Stauffer, Tamara Megan; Alonso-Sá ez, Laura; Moran, Xose Anxelu G.

    2017-01-01

    in general lower than 0.65 eV, the value predicted by the Metabolic Theory of Ecology (MTE). Contrary to MTE predictions, carrying capacity tended to increase with warming for all bacterial groups. Our analysis confirms that resource availability is key when

  13. Evolution of Chemical Diversity in a Group of Non-Reduced Polyketide Gene Clusters: Using Phylogenetics to Inform the Search for Novel Fungal Natural Products

    Directory of Open Access Journals (Sweden)

    Kurt Throckmorton

    2015-09-01

    Full Text Available Fungal polyketides are a diverse class of natural products, or secondary metabolites (SMs, with a wide range of bioactivities often associated with toxicity. Here, we focus on a group of non-reducing polyketide synthases (NR-PKSs in the fungal phylum Ascomycota that lack a thioesterase domain for product release, group V. Although widespread in ascomycete taxa, this group of NR-PKSs is notably absent in the mycotoxigenic genus Fusarium and, surprisingly, found in genera not known for their secondary metabolite production (e.g., the mycorrhizal genus Oidiodendron, the powdery mildew genus Blumeria, and the causative agent of white-nose syndrome in bats, Pseudogymnoascus destructans. This group of NR-PKSs, in association with the other enzymes encoded by their gene clusters, produces a variety of different chemical classes including naphthacenediones, anthraquinones, benzophenones, grisandienes, and diphenyl ethers. We discuss the modification of and transitions between these chemical classes, the requisite enzymes, and the evolution of the SM gene clusters that encode them. Integrating this information, we predict the likely products of related but uncharacterized SM clusters, and we speculate upon the utility of these classes of SMs as virulence factors or chemical defenses to various plant, animal, and insect pathogens, as well as mutualistic fungi.

  14. Genome analysis of Betanodavirus from cultured marine fish species in Malaysia.

    Science.gov (United States)

    Ransangan, Julian; Manin, Benny Obrain

    2012-04-23

    Betanodavirus is the causative agent of the viral nervous necrosis (VNN) or viral encephalopathy and retinopathy disease in marine fish. This disease is responsible for most of the mass mortalities that occurred in marine fish hatcheries in Malaysia. The genome of this virus consists of two positive-sense RNA molecules which are the RNA1 and RNA2. The RNA1 molecule contains the RdRp gene which encodes for the RNA-dependent RNA polymerase and the RNA2 molecule contains the Cp gene which encodes for the viral coat protein. In this study, total RNAs were extracted from 32 fish specimens representing the four most cultured marine fish species in Malaysia. The fish specimens were collected from different hatcheries and aquaculture farms in Malaysia. The RNA1 was successfully amplified using three pairs of overlapping PCR primers whereas the RNA2 was amplified using a pair of primers. The nucleotide analysis of RdRp gene revealed that the Betanodavirus in Malaysia were 94.5-99.7% similar to the RGNNV genotype, 79.8-82.1% similar to SJNNV genotype, 81.5-82.4% similar to BFNNV genotype and 79.8-80.7% similar to TPNNV genotype. However, they showed lower similarities to FHV (9.4-14.2%) and BBV (7.2-15.7%), respectively. Similarly, the Cp gene revealed that the viruses showed high nucleotide similarity to RGNNV (95.9-99.8%), SJNNV (72.2-77.4%), BFNNV (80.9-83.5%), TPNNV (77.2-78.1%) and TNV (75.1-76.5%). However, as in the RdRp gene, the coat protein gene was highly dissimilar to FHV (3.0%) and BBV (2.6-4.1%), respectively. Based on the genome analysis, the Betanodavirus infecting cultured marine fish species in Malaysia belong to the RGNNV genotype. However, the phylogenetic analysis of the genes revealed that the viruses can be further divided into nine sub-groups. This has been expected since various marine fish species of different origins are cultured in Malaysia. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. PCOGR: Phylogenetic COG ranking as an online tool to judge the specificity of COGs with respect to freely definable groups of organisms

    OpenAIRE

    Meereis, Florian; Kaufmann, Michael

    2004-01-01

    Abstract Background The rapidly increasing number of completely sequenced genomes led to the establishment of the COG-database which, based on sequence homologies, assigns similar proteins from different organisms to clusters of orthologous groups (COGs). There are several bioinformatic studies that made use of this database to determine (hyper)thermophile-specific proteins by searching for COGs containing (almost) exclusively proteins from (hyper)thermophilic genomes. However, public softwar...

  16. Phylogenetic molecular function annotation

    International Nuclear Information System (INIS)

    Engelhardt, Barbara E; Jordan, Michael I; Repo, Susanna T; Brenner, Steven E

    2009-01-01

    It is now easier to discover thousands of protein sequences in a new microbial genome than it is to biochemically characterize the specific activity of a single protein of unknown function. The molecular functions of protein sequences have typically been predicted using homology-based computational methods, which rely on the principle that homologous proteins share a similar function. However, some protein families include groups of proteins with different molecular functions. A phylogenetic approach for predicting molecular function (sometimes called 'phylogenomics') is an effective means to predict protein molecular function. These methods incorporate functional evidence from all members of a family that have functional characterizations using the evolutionary history of the protein family to make robust predictions for the uncharacterized proteins. However, they are often difficult to apply on a genome-wide scale because of the time-consuming step of reconstructing the phylogenies of each protein to be annotated. Our automated approach for function annotation using phylogeny, the SIFTER (Statistical Inference of Function Through Evolutionary Relationships) methodology, uses a statistical graphical model to compute the probabilities of molecular functions for unannotated proteins. Our benchmark tests showed that SIFTER provides accurate functional predictions on various protein families, outperforming other available methods.

  17. Malaysia and forced migration

    Directory of Open Access Journals (Sweden)

    Arzura Idris

    2012-06-01

    Full Text Available This paper analyzes the phenomenon of “forced migration” in Malaysia. It examines the nature of forced migration, the challenges faced by Malaysia, the policy responses and their impact on the country and upon the forced migrants. It considers forced migration as an event hosting multifaceted issues related and relevant to forced migrants and suggests that Malaysia has been preoccupied with the issue of forced migration movements. This is largely seen in various responses invoked from Malaysia due to “south-south forced migration movements.” These responses are, however, inadequate in terms of commitment to the international refugee regime. While Malaysia did respond to economic and migration challenges, the paper asserts that such efforts are futile if she ignores issues critical to forced migrants.

  18. Molecular typing of Sporothrix schenckii isolates from cats in Malaysia.

    Science.gov (United States)

    Kano, Rui; Okubo, Miki; Siew, Han Hock; Kamata, Hiroshi; Hasegawa, Atsuhiko

    2015-04-01

    Epidemiological data on the aetiologic agents of feline sporotrichosis in Malaysia have not been reported, though human sporotrichosis in Malaysia is reported to be transmitted primarily via cat scratch. To the best of our knowledge, the present report is the first study of the molecular epidemiology of Sporothrix schenckii isolates from cats with sporotrichosis in Malaysia. In the present work, we characterised 18 clinical isolates from cats in Malaysia based on molecular properties, including sequence analyses of the calmodulin gene and the rDNA ITS region and selective PCR of mating type (MAT) loci. In this study, isolates from feline sporotrichosis were identified as a S. schenckii sensu stricto by sequence analyses of the calmodulin gene and the internal transcribed spacer (ITS) region. Notably, phylogenetic analysis of the ITS confirmed assignment to clinical clade D (and not C) of S. schenckii sensu stricto. Therefore, clinical clade D of S. schenckii sensu stricto appeared to be the prevailing source of feline sporotrichosis in Malaysia. The ratio of MAT1-1-1:MAT1-2-1 in these Malaysian isolates was found to be 1 : 0. This result suggested that a clonal strain of S. schenckii is the prevailing causative agent of feline sporotrichosis in Malaysia. © 2015 Blackwell Verlag GmbH.

  19. Islamist Civil Society Activism Malaysia Abdullah: Angkatan Belia Islam Malaysia (ABIM) Darul Arqam

    OpenAIRE

    Hamid, Ahmad Fauzi Abdul

    2009-01-01

    Without discounting the relevance of such a framework, this article seeks to look at the phenomenon of Islamism in Malaysia from the angle of Islamist civil society movements that are not directly involved in the domain of electoral politics, but that have nonetheless significantly in fenced political behavior of especially the majority Malay-Muslim population of Malaysia. The provisional impact of these new groupings form the main thread in our discussion, which narrows down to an inv...

  20. Morphological characterization and phylogenetic distance among ...

    African Journals Online (AJOL)

    The genetic diversity was calculated with Nei and Li's index, and the phylogenetic tree (dendrogram) was generated with a neighbor-joining program. The dendrogram indicates the diversity of the genotypes, which are grouped into three distinctive large groups. The largest group includes species from the Mediolobivia and ...

  1. Hidden among Sea Anemones: The First Comprehensive Phylogenetic Reconstruction of the Order Actiniaria (Cnidaria, Anthozoa, Hexacorallia) Reveals a Novel Group of Hexacorals

    Science.gov (United States)

    Rodríguez, Estefanía; Barbeitos, Marcos S.; Brugler, Mercer R.; Crowley, Louise M.; Grajales, Alejandro; Gusmão, Luciana; Häussermann, Verena; Reft, Abigail; Daly, Marymegan

    2014-01-01

    Sea anemones (order Actiniaria) are among the most diverse and successful members of the anthozoan subclass Hexacorallia, occupying benthic marine habitats across all depths and latitudes. Actiniaria comprises approximately 1,200 species of solitary and skeleton-less polyps and lacks any anatomical synapomorphy. Although monophyly is anticipated based on higher-level molecular phylogenies of Cnidaria, to date, monophyly has not been explicitly tested and at least some hypotheses on the diversification of Hexacorallia have suggested that actiniarians are para- or poly-phyletic. Published phylogenies have demonstrated the inadequacy of existing morphological-based classifications within Actiniaria. Superfamilial groups and most families and genera that have been rigorously studied are not monophyletic, indicating conflict with the current hierarchical classification. We test the monophyly of Actiniaria using two nuclear and three mitochondrial genes with multiple analytical methods. These analyses are the first to include representatives of all three currently-recognized suborders within Actiniaria. We do not recover Actiniaria as a monophyletic clade: the deep-sea anemone Boloceroides daphneae, previously included within the infraorder Boloceroidaria, is resolved outside of Actiniaria in several of the analyses. We erect a new genus and family for B. daphneae, and rank this taxon incerti ordinis. Based on our comprehensive phylogeny, we propose a new formal higher-level classification for Actiniaria composed of only two suborders, Anenthemonae and Enthemonae. Suborder Anenthemonae includes actiniarians with a unique arrangement of mesenteries (members of Edwardsiidae and former suborder Endocoelantheae). Suborder Enthemonae includes actiniarians with the typical arrangement of mesenteries for actiniarians (members of former suborders Protantheae, Ptychodacteae, and Nynantheae and subgroups therein). We also erect subgroups within these two newly-erected suborders

  2. Hidden among sea anemones: the first comprehensive phylogenetic reconstruction of the order Actiniaria (Cnidaria, Anthozoa, Hexacorallia reveals a novel group of hexacorals.

    Directory of Open Access Journals (Sweden)

    Estefanía Rodríguez

    Full Text Available Sea anemones (order Actiniaria are among the most diverse and successful members of the anthozoan subclass Hexacorallia, occupying benthic marine habitats across all depths and latitudes. Actiniaria comprises approximately 1,200 species of solitary and skeleton-less polyps and lacks any anatomical synapomorphy. Although monophyly is anticipated based on higher-level molecular phylogenies of Cnidaria, to date, monophyly has not been explicitly tested and at least some hypotheses on the diversification of Hexacorallia have suggested that actiniarians are para- or poly-phyletic. Published phylogenies have demonstrated the inadequacy of existing morphological-based classifications within Actiniaria. Superfamilial groups and most families and genera that have been rigorously studied are not monophyletic, indicating conflict with the current hierarchical classification. We test the monophyly of Actiniaria using two nuclear and three mitochondrial genes with multiple analytical methods. These analyses are the first to include representatives of all three currently-recognized suborders within Actiniaria. We do not recover Actiniaria as a monophyletic clade: the deep-sea anemone Boloceroides daphneae, previously included within the infraorder Boloceroidaria, is resolved outside of Actiniaria in several of the analyses. We erect a new genus and family for B. daphneae, and rank this taxon incerti ordinis. Based on our comprehensive phylogeny, we propose a new formal higher-level classification for Actiniaria composed of only two suborders, Anenthemonae and Enthemonae. Suborder Anenthemonae includes actiniarians with a unique arrangement of mesenteries (members of Edwardsiidae and former suborder Endocoelantheae. Suborder Enthemonae includes actiniarians with the typical arrangement of mesenteries for actiniarians (members of former suborders Protantheae, Ptychodacteae, and Nynantheae and subgroups therein. We also erect subgroups within these two newly

  3. THE CONCEPT OF 1MALAYSIA FROM ISLAMIC PERSPECTIVES

    Directory of Open Access Journals (Sweden)

    Amini Amir ABDULLAH

    2010-07-01

    Full Text Available The 1Malaysia concept (People First, Performance Now is a vision introduced by the sixth Malaysian Prime Minister YAB. Datuk Seri Mohd. Najib Tun Abdul Razak on 3 rd of April 2009 soon after his sworn-in ceremony. The 1Malaysia concept protects the rights of all ethnic groups in the country and is able to bring Malaysia forward. The concept of 1Malaysia does not stray a single inch from the provisions of the Federal Constitution or the Rukun Negara (Five Pillars of the nation. The opposition parties claimed that they have introduced earlier the so called Middle Malaysia vision (originally from their Malaysian Malaysia slogan. Actually they were worried that the 1Malaysia concept has been accepted by most ethnic groups in Malaysia and there was a renewed spirit among the people to bring the country to greater heights. The government wants the Malaysian people to adopt th e attitude of acceptance instead of tolerance. This is because tolerance carried a connotation that people were too much exposed to a painful or unpleasant condition because of their religious and ethnic differences whereas acceptance meant all Malaysians accepted and understood the diversity of Malaysian multiracial society which was a greatest source of strength. A very determined effort by the multiracial society will ensure that all citizens of Malaysia either the rich or poor will achieve real accept ance and integration. Malaysians should accept the reality and conditi on of its multiracial society and various faiths. The Malays should honour the non-Malays as equal to their rights in the constitution and to deal with them honestly. What is interesting however is that a lot of what Datuk Seri Mohd. Najib clarified was blended with Islamic teachings and religious ideas. This paper covers major elements of the 1Malaysia concept with its values and outlines the challenges faced by Malaysian multiracial society in adapting the 1Malaysia concept.

  4. Malaysia: oil, gas, petrochemicals

    International Nuclear Information System (INIS)

    1990-01-01

    Petronas or Petroliam Nasional Berhad was established on 17 August 1974 as the national petroleum corporation of Malaysia. The Petroleum Development Act, passed by the Malaysian Parliament in October of that same year, vested in Petronas the entire ownership of all oil and natural gas resources in the country. These resources are considerable and Malaysia is poised to become one of the major petrochemical producers in the region. This report outlines the extent of oil, gas and petrochemicals production in Malaysia, lists companies holding licences and contracts from Petronas and provides a directory of the Malaysian oil industry. (Author)

  5. The phylogenetic likelihood library.

    Science.gov (United States)

    Flouri, T; Izquierdo-Carrasco, F; Darriba, D; Aberer, A J; Nguyen, L-T; Minh, B Q; Von Haeseler, A; Stamatakis, A

    2015-03-01

    We introduce the Phylogenetic Likelihood Library (PLL), a highly optimized application programming interface for developing likelihood-based phylogenetic inference and postanalysis software. The PLL implements appropriate data structures and functions that allow users to quickly implement common, error-prone, and labor-intensive tasks, such as likelihood calculations, model parameter as well as branch length optimization, and tree space exploration. The highly optimized and parallelized implementation of the phylogenetic likelihood function and a thorough documentation provide a framework for rapid development of scalable parallel phylogenetic software. By example of two likelihood-based phylogenetic codes we show that the PLL improves the sequential performance of current software by a factor of 2-10 while requiring only 1 month of programming time for integration. We show that, when numerical scaling for preventing floating point underflow is enabled, the double precision likelihood calculations in the PLL are up to 1.9 times faster than those in BEAGLE. On an empirical DNA dataset with 2000 taxa the AVX version of PLL is 4 times faster than BEAGLE (scaling enabled and required). The PLL is available at http://www.libpll.org under the GNU General Public License (GPL). © The Author(s) 2014. Published by Oxford University Press, on behalf of the Society of Systematic Biologists.

  6. Focus on Malaysia.

    Science.gov (United States)

    Forman, L T

    1979-01-01

    Prospects for a stable, prospering economy in Malaysia appear threatened by an uneven distribution of wealth among non-Malay, particularly Chinese, residents. Native Malays, Bumiputra, have benefitted from the government's 20 year New Economic Policy, a system of subsidies to correct economic imbalances among the races. Malay corporate ownership has increased from 2.4% in 1970 to 28% in 1979. However, equity must increase by 26% annually to meet NEP targets. Without the GNP expanding 7-8% yearly, the government will be tempted to acquire assets at low prices. 70% of the total Malay ownership was held by public enterprises holding equity in trust. An elite group of Bumiputra will own a fair number of shares reserved by 1970. 1/5 of the population of Kuala Lumpur are squatters. Among these groups, communal tension is high. The Chinese businessmen are most resistant to native management. Since they control private domestic investment, they have political power. The Industrial Coordination Act (ICA), which gives power to civil servants through a licensing system, protects the system. The Asian Foundation supports management training, business development, and university demonstration projects in legal aid, solar energy, and community psychiatry. Malaysian competence in English enables widespread distribution of the Books for Asia program.

  7. Functional & phylogenetic diversity of copepod communities

    Science.gov (United States)

    Benedetti, F.; Ayata, S. D.; Blanco-Bercial, L.; Cornils, A.; Guilhaumon, F.

    2016-02-01

    The diversity of natural communities is classically estimated through species identification (taxonomic diversity) but can also be estimated from the ecological functions performed by the species (functional diversity), or from the phylogenetic relationships among them (phylogenetic diversity). Estimating functional diversity requires the definition of specific functional traits, i.e., phenotypic characteristics that impact fitness and are relevant to ecosystem functioning. Estimating phylogenetic diversity requires the description of phylogenetic relationships, for instance by using molecular tools. In the present study, we focused on the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. First, we implemented a specific trait database for the most commonly-sampled and abundant copepod species of the Mediterranean Sea. Our database includes 191 species, described by seven traits encompassing diverse ecological functions: minimal and maximal body length, trophic group, feeding type, spawning strategy, diel vertical migration and vertical habitat. Clustering analysis in the functional trait space revealed that Mediterranean copepods can be gathered into groups that have different ecological roles. Second, we reconstructed a phylogenetic tree using the available sequences of 18S rRNA. Our tree included 154 of the analyzed Mediterranean copepod species. We used these two datasets to describe the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. The replacement component (turn-over) and the species richness difference component (nestedness) of the beta diversity indices were identified. Finally, by comparing various and complementary aspects of plankton diversity (taxonomic, functional, and phylogenetic diversity) we were able to gain a better understanding of the relationships among the zooplankton community, biodiversity, ecosystem function, and environmental forcing.

  8. RAP-1a is the main rhoptry-associated-protein-1 (RAP-1) recognized during infection with Babesia sp. BQ1 (Lintan) (B. motasi-like phylogenetic group), a pathogen of sheep in China.

    Science.gov (United States)

    Niu, Qingli; Bonsergent, Claire; Rogniaux, Hélène; Guan, Guiquan; Malandrin, Laurence; Moreau, Emmanuelle

    2016-12-15

    Babesia sp. BQ1 (Lintan) is one of the parasites isolated from infected sheep in China that belongs to the B. motasi-like phylogenetic group. The rhoptry-associated-protein 1 (rap-1) locus in this group consists of a complex organization of 12 genes of three main types: 6 rap-1a variants intercalated with 5 identical copies of rap-1b and a single 3' ending rap-1c gene. In the present study, transcription analysis performed by standard RT-PCR demonstrated that the three different rap-1 gene types and the four rap-1a variants were transcribed by the parasite cultivated in vitro. Peptides, specific for each rap-1 type gene, were selected in putative linear B-epitopes and used to raise polyclonal rabbit antisera. Using these sera, the same expression pattern of RAP-1 proteins was found in parasites cultivated in vitro or collected from acute infection whereas only RAP-1a67 was detectable in merozoite extracts. However, ELISA performed with recombinant RAP-1a67, RAP-1b or RAP-1c and sera from infected sheep demonstrated that RAP-1a67 is the main RAP-1 recognized during infection, even if some infected sheep also recognized RAP-1b and/or RAP-1c. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Erwinia mallotivora sp., a New Pathogen of Papaya (Carica papaya in Peninsular Malaysia

    Directory of Open Access Journals (Sweden)

    Noriha Mat Amin

    2010-12-01

    Full Text Available Erwinia mallotivora was isolated from papaya infected with dieback disease showing the typical symptoms of greasy, water-soaked lesions and spots on leaves. Phylogenetic analysis of 16S rRNA gene sequences showed that the strain belonged to the genus Erwinia and was united in a monophyletic group with E. mallotivora DSM 4565 (AJ233414. Earlier studies had indicated that the causal agent for this disease was E. papayae. However, our current studies, through Koch’s postulate, have confirmed that papaya dieback disease is caused by E. mallotivora. To our knowledge, this is the first new discovery of E. mallotivora as a causal agent of papaya dieback disease in Peninsular Malaysia. Previous reports have suggested that E. mallotivora causes leaf spot in Mallotus japonicus. However, this research confirms it also to be pathogenic to Carica papaya.

  10. Informed Questions on Malaysia

    National Research Council Canada - National Science Library

    Heng, Lim; Tay, BG

    2003-01-01

    .... This is despite the vitriolic, anti-west outbursts of Dr Mahathir, its controversial Prime Minister of 22 years, who has set the objective of Malaysia becoming a fully developed country by the year 2020...

  11. Informed Questions on Malaysia

    National Research Council Canada - National Science Library

    Heng, Lim; Tay, BG

    2003-01-01

    While Indonesia gets the attention of policy makers on South East (SE) Asia because of its size and population, Malaysia has increasingly been courted as an example of an Islamic country that is moderate and progressive...

  12. Competition Policy in Malaysia

    OpenAIRE

    Lee, Cassey

    2004-01-01

    Malaysia does not have a national competition law. Competition is regulated at the sectoral level in the country. Two economic sectors have legal provisions for competition law but these have been relatively ineffectively enforced. The benefits of Malaysia's industrial policy as well as the policy reforms in regulation and trade have been compromised by the lack of a formal institution to address competition related issues. Hence, the future priority and direction of regulatory reform is obvi...

  13. Older Consumers in Malaysia

    OpenAIRE

    David R. Phillips; Fon Sim Ong

    2007-01-01

    The main objective of this study was to understand the concerns and problems faced by older people in an industrializing middle-income country, Malaysia, in their process of acquiring products to meet their everyday needs. Respondents aged 55 and over were interviewed in eight states throughout Peninsular Malaysia providing 1356 usable questionnaires; two-thirds from urban and one-third from rural areas. Education, health status, and life satisfaction were recorded. Service patronage behaviou...

  14. Characterization of Escherichia coli Phylogenetic Groups ...

    African Journals Online (AJOL)

    tract infection (UTI), bacteremia, pneumonia, soft-tissue infection, and ... Keywords: Drug resistance, Escherichia coli, Extraintestinal infections, Polymerase chain reaction, .... gynecology, 12 from orthopedics and 5 from pediatrics units.

  15. A Universal Phylogenetic Tree.

    Science.gov (United States)

    Offner, Susan

    2001-01-01

    Presents a universal phylogenetic tree suitable for use in high school and college-level biology classrooms. Illustrates the antiquity of life and that all life is related, even if it dates back 3.5 billion years. Reflects important evolutionary relationships and provides an exciting way to learn about the history of life. (SAH)

  16. Complete Deletion of the Fucose Operon in Haemophilus influenzae Is Associated with a Cluster in Multilocus Sequence Analysis-Based Phylogenetic Group II Related to Haemophilus haemolyticus: Implications for Identification and Typing.

    Science.gov (United States)

    de Gier, Camilla; Kirkham, Lea-Ann S; Nørskov-Lauritsen, Niels

    2015-12-01

    Nonhemolytic variants of Haemophilus haemolyticus are difficult to differentiate from Haemophilus influenzae despite a wide difference in pathogenic potential. A previous investigation characterized a challenging set of 60 clinical strains using multiple PCRs for marker genes and described strains that could not be unequivocally identified as either species. We have analyzed the same set of strains by multilocus sequence analysis (MLSA) and near-full-length 16S rRNA gene sequencing. MLSA unambiguously allocated all study strains to either of the two species, while identification by 16S rRNA sequence was inconclusive for three strains. Notably, the two methods yielded conflicting identifications for two strains. Most of the "fuzzy species" strains were identified as H. influenzae that had undergone complete deletion of the fucose operon. Such strains, which are untypeable by the H. influenzae multilocus sequence type (MLST) scheme, have sporadically been reported and predominantly belong to a single branch of H. influenzae MLSA phylogenetic group II. We also found evidence of interspecies recombination between H. influenzae and H. haemolyticus within the 16S rRNA genes. Establishing an accurate method for rapid and inexpensive identification of H. influenzae is important for disease surveillance and treatment. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  17. Strategies of Indian University Students in Malaysia

    DEFF Research Database (Denmark)

    Svensson, Christian Franklin

    2014-01-01

    can challenge existing conceptions of the role of the nation-state, cultural mechanisms and hierarchies. He further contributes to the debate by demonstrating how social imagination evolves from the Indian students’ contested social position as a minority group in Malaysia....

  18. Malaysia (country/area statements).

    Science.gov (United States)

    1985-09-01

    According to this statement presented to the Committee on Population of the UN Economic and Social Commission for Asia and the Pacific, Malaysia by 1984 achieved a crude death rate of 5.3/1000, an infant mortality rate of 17/1000 live births, and a 1983 life expectancy at birth of 67.6 for males and 72.3 for females due primarily to socioeconomic development, better nutrition, and a health system covering 95% of the rural population. Substantial mortality differentials still exist between Peninsular Malaysia, Sabah, and Sarawak, between urban and rural areas, and among ethnic groups. Differences in the coverage and quality of mortality statistics also exist. 83.2% of Malaysia's total population of 15.5 million is in Peninsular Malaysia, 7.3% in Sabah, and 9.5% in Sarawak. In Peninsular Malaysia, 55.1% are Malays, 33.9% Chinese, and 10.3% Indians. About 40% of the population is urban, and 39% is under age 15. The average annual rate of growth declined from 2.6% in the 1960s to 2.3% in the 1970s. The total fertility rate fell from 5.1 children in 1970 to 4.1 in 1980. A rise in age at 1st marriage and reduction in marital fertility have been partly offset by an increase in the proportion of women of childbearing age. The population is projected to grow to about 22 million by the year 2000. Chinese and Indians are expected to approach replacement level fertility by that year, but Malay fertility is expected to remain high for some time. Internal migration, 45% of which is intrarural, increased markedly in the 1970s, probably due to rapid modernization, industrialization, land development, and regional imbalances in economic development. In absolute terms a total of 410,000 persons moved from rural to urban areas during the 1970s. Important progress has been made in regional development programs, but further regional development requires resolution of problems related to internal migration and greater efforts to relocate industries in the less developed areas. The

  19. Minority Language Education in Malaysia: Four Ethnic Communities' Experiences.

    Science.gov (United States)

    Smith, Karla J.

    2003-01-01

    Discusses minority language education in Malaysia, a multilingual and multicultural country. Looks at four language minority groups and what they have done to to provide beginning education programs for their children that use the children's native languages. (Author/VWL)

  20. Malaysian Emergencies: Anthropological Factors in the Success of Malaysia's Counterinsurgency

    National Research Council Canada - National Science Library

    Yadi, Mohd Z

    2004-01-01

    .... Instead Malaysia has chosen to adopt the more encompassing approach that defines national security as "the capacity of the society to protect individuals groups and the nation from physical and socioeconomic danger...

  1. Distinct genetic difference between the Duffy binding protein (PkDBPαII) of Plasmodium knowlesi clinical isolates from North Borneo and Peninsular Malaysia.

    Science.gov (United States)

    Fong, Mun-Yik; Rashdi, Sarah A A; Yusof, Ruhani; Lau, Yee-Ling

    2015-02-21

    Plasmodium knowlesi is one of the monkey malaria parasites that can cause human malaria. The Duffy binding protein of P. knowlesi (PkDBPαII) is essential for the parasite's invasion into human and monkey erythrocytes. A previous study on P. knowlesi clinical isolates from Peninsular Malaysia reported high level of genetic diversity in the PkDBPαII. Furthermore, 36 amino acid haplotypes were identified and these haplotypes could be separated into allele group I and allele group II. In the present study, the PkDBPαII of clinical isolates from the Malaysian states of Sarawak and Sabah in North Borneo was investigated, and compared with the PkDBPαII of Peninsular Malaysia isolates. Blood samples from 28 knowlesi malaria patients were used. These samples were collected between 2011 and 2013 from hospitals in North Borneo. The PkDBPαII region of the isolates was amplified by PCR, cloned into Escherichia coli, and sequenced. The genetic diversity, natural selection and phylogenetics of PkDBPαII haplotypes were analysed using MEGA5 and DnaSP ver. 5.10.00 programmes. Forty-nine PkDBPαII sequences were obtained. Comparison at the nucleotide level against P. knowlesi strain H as reference sequence revealed 58 synonymous and 102 non-synonymous mutations. Analysis on these mutations showed that PkDBPαII was under purifying (negative) selection. At the amino acid level, 38 different PkDBPαII haplotypes were identified. Twelve of the 28 blood samples had mixed haplotype infections. Phylogenetic analysis revealed that all the haplotypes were in allele group I, but they formed a sub-group that was distinct from those of Peninsular Malaysia. Wright's FST fixation index indicated high genetic differentiation between the North Borneo and Peninsular Malaysia haplotypes. This study is the first to report the genetic diversity and natural selection of PkDBPαII of P. knowlesi from Borneo Island. The PkDBPαII haplotypes found in this study were distinct from those from

  2. Malaysia; Financial Sector Stability Assessment

    OpenAIRE

    International Monetary Fund

    2013-01-01

    This assessment is a review of the financial environment of Malaysia. Like many other Asian countries, Malaysia experienced financial distress in the late 1990s, but the country’s policy reforms have moved it to a successful economy. A ten-year financial plan (2001–10) by Bank Negara Malaysia restructured the financial sector. Banks were well capitalized, household debts were strengthened, and securities and insurances were developed. Malaysia thus became the global center for Islamic finance...

  3. Family Support and Loneliness among Older Persons in Multiethnic Malaysia

    OpenAIRE

    Teh, Jane Kimm Lii; Tey, Nai Peng; Ng, Sor Tho

    2014-01-01

    This study investigates factors affecting older persons' state of loneliness in multiethnic Malaysia using data from the 2004 Malaysian Population and Family Survey, the first nationally representative sample in Malaysia. The study sample was extracted to include Malays, Chinese, Indians and other Indigenous groups aged 60 and above, and who had children (n = 1791). Cross tabulations and ordinal logistic regression methods were used in the analysis. Among the ethnic groups, older Malays were ...

  4. Halolactibacillus halophilus gen. nov., sp. nov. and Halolactibacillus miurensis sp. nov., halophilic and alkaliphilic marine lactic acid bacteria constituting a phylogenetic lineage in Bacillus rRNA group 1.

    Science.gov (United States)

    Ishikawa, Morio; Nakajima, Kazuyuki; Itamiya, Yuko; Furukawa, Sayumi; Yamamoto, Yasushi; Yamasato, Kazuhide

    2005-11-01

    Eleven novel strains of marine-inhabiting lactic acid bacteria that were isolated from living and decaying marine organisms collected from a temperate area of Japan are described. The isolates were motile with peritrichous flagella and non-sporulating. They lacked catalase, quinones and cytochromes. Fermentation products from glucose were lactate, formate, acetate and ethanol. Lactate yield as percentage conversion from glucose was affected by the pH of the fermentation medium: approximately 55 % at the optimal growth pH of 8.0, greater than approximately 70 % at pH 7.0 and less than approximately 30 % at pH 9.0. The molar ratio of the other three products was the same at each cultivation pH, approximately 2 : 1 : 1. Carbohydrates and related compounds were aerobically metabolized to acetate and pyruvate as well as lactate. The isolates were slightly halophilic, highly halotolerant and alkaliphilic. The optimum NaCl concentration for growth was 2.0-3.0 % (w/v), with a range of 0-25.5 %. The optimum pH for growth was 8.0-9.5, with a range of 6.0-10.0. The G+C content of the DNA was 38.5-40.7 mol%. The isolates constituted two genomic species (DNA-DNA relatedness of less than 41 %) each characterized by sugar fermentation profiles. The cell-wall peptidoglycan of both phenotypes contained meso-diaminopimelic acid. The major cellular fatty acids were C(16 : 0) and a-C(13 : 0). Comparative sequence analysis of the 16S rRNA genes revealed that these isolates represent novel species constituting a phylogenetic unit outside the radiation of typical lactic acid bacteria and an independent line of descent within the group composed of the halophilic/halotolerant/alkaliphilic and/or alkalitolerant species in Bacillus rRNA group 1, with 94.8-95.1 % similarity to the genus Paraliobacillus, 93.7-94.1 % to the genus Gracilibacillus and 93.8-94.2 % to Virgibacillus marismortui. On the basis of possession of physiological and biochemical characteristics common to typical lactic acid

  5. Significant genotype difference in the CYP2E1 PstI polymorphism of indigenous groups in Sabah, Malaysia with Asian and non-Asian populations.

    Science.gov (United States)

    Goh, Lucky Poh Wah; Chong, Eric Tzyy Jiann; Chua, Kek Heng; Chuah, Jitt Aun; Lee, Ping-Chin

    2014-01-01

    CYP2E1 PstI polymorphism G-1259C (rs3813867) genotype distributions vary significantly among different populations and are associated with both diseases, like cancer, and adverse drug effects. To date, there have been limited genotype distributions and allele frequencies of this polymorphism reported in the three major indigenous ethnic groups (KadazanDusun, Bajau, and Rungus) in Sabah, also known as North Borneo. The aim of this study was to investigate the genotype distributions and allele frequencies of the CYP2E1 PstI polymorphism G-1259C in these three major indigenous peoples in Sabah. A total of 640 healthy individuals from the three dominant indigenous groups were recruited for this study. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) at G-1259C polymorphic site of CYP2E1 gene was performed using the Pst I restriction enzyme. Fragments were analyzed using agarose gel electrophoresis and confirmed by direct sequencing. Overall, the allele frequencies were 90.3% for c1 allele and 9.7% for c2 allele. The genotype frequencies for c1/c1, c1/c2 and c2/c2 were observed as 80.9%, 18.8%, and 0.3%, respectively. A highly statistical significant difference (ppopulations. However, among these three indigenous groups, there was no statistical significant difference (p>0.001) in their genotype distributions. The three major indigenous ethnic groups in Sabah show unique genotype distributions when compared with other populations. This finding indicates the importance of establishing the genotype distributions of CYP2E1 PstI polymorphism in the indigenous populations.

  6. Preparing for Molybdenum-99 Production In Malaysia [Country report: Malaysia

    International Nuclear Information System (INIS)

    Dahalan, Rehir; Masood, Zarina; Zulkifli, Mohd Hashim; Yusof, Mohd Abd Wahab

    2015-01-01

    -cell and processing facility. However, in case the current situation remains then additional alternative supply arrangement for 99 Mo will be necessary in order to ensure security of local 99 Mo supply. In additional to this mission from the IAEA, a team from Gamma-Service Group International (GSG) also assessed the facilities in Malaysia and provided a proposal based on its technology for establishing a local production facility for fission 99 Mo using LEU within the confines of existing available space subject to similar research reactor power and neutron flux upgrade. (author)

  7. Visualizing phylogenetic tree landscapes.

    Science.gov (United States)

    Wilgenbusch, James C; Huang, Wen; Gallivan, Kyle A

    2017-02-02

    Genomic-scale sequence alignments are increasingly used to infer phylogenies in order to better understand the processes and patterns of evolution. Different partitions within these new alignments (e.g., genes, codon positions, and structural features) often favor hundreds if not thousands of competing phylogenies. Summarizing and comparing phylogenies obtained from multi-source data sets using current consensus tree methods discards valuable information and can disguise potential methodological problems. Discovery of efficient and accurate dimensionality reduction methods used to display at once in 2- or 3- dimensions the relationship among these competing phylogenies will help practitioners diagnose the limits of current evolutionary models and potential problems with phylogenetic reconstruction methods when analyzing large multi-source data sets. We introduce several dimensionality reduction methods to visualize in 2- and 3-dimensions the relationship among competing phylogenies obtained from gene partitions found in three mid- to large-size mitochondrial genome alignments. We test the performance of these dimensionality reduction methods by applying several goodness-of-fit measures. The intrinsic dimensionality of each data set is also estimated to determine whether projections in 2- and 3-dimensions can be expected to reveal meaningful relationships among trees from different data partitions. Several new approaches to aid in the comparison of different phylogenetic landscapes are presented. Curvilinear Components Analysis (CCA) and a stochastic gradient decent (SGD) optimization method give the best representation of the original tree-to-tree distance matrix for each of the three- mitochondrial genome alignments and greatly outperformed the method currently used to visualize tree landscapes. The CCA + SGD method converged at least as fast as previously applied methods for visualizing tree landscapes. We demonstrate for all three mtDNA alignments that 3D

  8. Phylogenetic Origins of Brain Organisers

    Directory of Open Access Journals (Sweden)

    Ellen Robertshaw

    2012-01-01

    Full Text Available The regionalisation of the nervous system begins early in embryogenesis, concomitant with the establishment of the anteroposterior (AP and dorsoventral (DV body axes. The molecular mechanisms that drive axis induction appear to be conserved throughout the animal kingdom and may be phylogenetically older than the emergence of bilateral symmetry. As a result of this process, groups of patterning genes that are equally well conserved are expressed at specific AP and DV coordinates of the embryo. In the emerging nervous system of vertebrate embryos, this initial pattern is refined by local signalling centres, secondary organisers, that regulate patterning, proliferation, and axonal pathfinding in adjacent neuroepithelium. The main secondary organisers for the AP neuraxis are the midbrain-hindbrain boundary, zona limitans intrathalamica, and anterior neural ridge and for the DV neuraxis the notochord, floor plate, and roof plate. A search for homologous secondary organisers in nonvertebrate lineages has led to controversy over their phylogenetic origins. Based on a recent study in hemichordates, it has been suggested that the AP secondary organisers evolved at the base of the deuterostome superphylum, earlier than previously thought. According to this view, the lack of signalling centres in some deuterostome lineages is likely to reflect a secondary loss due to adaptive processes. We propose that the relative evolutionary flexibility of secondary organisers has contributed to a broader morphological complexity of nervous systems in different clades.

  9. Molecular characterization and phylogenetic relationships among ...

    African Journals Online (AJOL)

    Molecular characterization and phylogenetic relationships among and within species of Phalaenopsis (Epidendroideae: Orchidaceae) based on RAPD analysis. ... Ph. parishii, Ph. labbi nepal, Ph. speciosa, Ph. lobbi yellow, Ph. venosa, Ph. hieroglyphica, and Ph. maculata; the third group consisted of Ph. minho princess, ...

  10. Mercury pollution in Malaysia.

    Science.gov (United States)

    Hajeb, Parvaneh; Jinap, S; Ismail, Ahmad; Mahyudin, Nor Ainy

    2012-01-01

    Although several studies have been published on levels of mercury contamination of the environment, and of food and human tissues in Peninsular Malaysia, there is a serious dearth of research that has been performed in East Malaysia (Sabah and Sarawak). Industry is rapidly developing in East Malaysia, and, hence, there is a need for establishing baseline levels of mercury contamination in environmental media in that part of the country by performing monitoring studies. Residues of total mercury and inorganic in food samples have been determined in nearly all previous studies that have been conducted; however, few researchers have analyzed samples for the presence of methlymercury residues. Because methylmercury is the most toxic form of mercury, and because there is a growing public awareness of the risk posed by methylmercury exposure that is associated with fish and seafood consumption, further monitoring studies on methylmercury in food are also essential. From the results of previous studies, it is obvious that the economic development in Malaysia, in recent years, has affected the aquatic environment of the country. Primary areas of environmental concern are centered on the rivers of the west Peninsular Malaysian coast, and the coastal waters of the Straits of Malacca, wherein industrial activities are rapidly expanding. The sources of existing mercury input to both of these areas of Malaysia should be studied and identified. Considering the high levels of mercury that now exists in human tissues, efforts should be continued, and accelerated in the future, if possible, to monitor mercury contamination levels in the coastal states, and particularly along the west Peninsular Malaysian coast. Most studies that have been carried out on mercury residues in environmental samples are dated, having been conducted 20-30 years ago; therefore, the need to collect much more and more current data is urgent. Furthermore, establishing baseline levels of mercury exposure to

  11. Systematics and natural history of Southeast Asian Rock Geckos (genus Cnemaspis Strauch, 1887) with descriptions of eight new species from Malaysia, Thailand, and Indonesia.

    Science.gov (United States)

    Grismer, L Lee; Wood, Perry L; Anuar, Shahrul; Riyanto, Awal; Ahmad, Norhayati; Muin, Mohd A; Sumontha, Montri; Grismer, Jesse L; Onn, Chan Kin; Quah, Evan S H; Pauwels, Olivier S A

    2014-10-31

    A well-supported and well-resolved phylogeny based on a concatenated data set from one mitochondrial and two nuclear genes, six morphological characters, and nine color pattern characters for 44 of the 50 species of the Southeast Asian Rock Geckos (genus Cnemaspis Strauch, 1887) is consistent with the previous taxonomy of Cnemaspis based solely on morphology and color pattern. Cnemaspis is partitioned into four major clades that collectively contain six species groups. The monophyly of all clades and species groups is strongly supported and they are parapatrically distributed across well-established, biogeographical regions ranging from southern Vietnam westward through southern Indochina, southward through the Thai-Malay Peninsula, then eastward to Borneo. Eight new species (Cnemaspis omari sp. nov. from the Thai-Malaysian border; C. temiah sp. nov. from Cameron Highlands, Pahang, Malaysia; C. stongensis sp. nov. from Gunung Stong, Kelantan, Malaysia; C. hangus sp. nov. from Bukit Hangus, Pahang, Malaysia; C. sundagekko sp. nov. from Pulau Siantan, Indonesia; C. peninsularis sp. nov. from southern Peninsular Malaysia and Singapore, and C. mumpuniae sp. nov. and C. sundainsula sp. nov. from Pulau Natuna Besar, Indonesia) are described based on morphology and color pattern and all but C. sundagekko sp. nov. are included in the phylogenetic analyses. Cnemaspis kendallii is polyphyletic and a composite of six species. An updated taxonomy consistent with the phylogeny is proposed for all 50 species and is based on 25 morphological and 53 color pattern characters scored across 594 specimens. Cladogenetic events and biogeographical relationships within Cnemaspis were likely influenced by this group's low vagility and the cyclical patterns of geographical and environmental changes in Sundaland over the last 25 million years and especially within the last 2.5 million years. The phylogeny indicates that nocturnality, diurnality, substrate preferences, and the presence of

  12. Fourier transform inequalities for phylogenetic trees.

    Science.gov (United States)

    Matsen, Frederick A

    2009-01-01

    Phylogenetic invariants are not the only constraints on site-pattern frequency vectors for phylogenetic trees. A mutation matrix, by its definition, is the exponential of a matrix with non-negative off-diagonal entries; this positivity requirement implies non-trivial constraints on the site-pattern frequency vectors. We call these additional constraints "edge-parameter inequalities". In this paper, we first motivate the edge-parameter inequalities by considering a pathological site-pattern frequency vector corresponding to a quartet tree with a negative internal edge. This site-pattern frequency vector nevertheless satisfies all of the constraints described up to now in the literature. We next describe two complete sets of edge-parameter inequalities for the group-based models; these constraints are square-free monomial inequalities in the Fourier transformed coordinates. These inequalities, along with the phylogenetic invariants, form a complete description of the set of site-pattern frequency vectors corresponding to bona fide trees. Said in mathematical language, this paper explicitly presents two finite lists of inequalities in Fourier coordinates of the form "monomial < or = 1", each list characterizing the phylogenetically relevant semialgebraic subsets of the phylogenetic varieties.

  13. Phylogenetic system and zoogeography of the Plecoptera.

    Science.gov (United States)

    Zwick, P

    2000-01-01

    Information about the phylogenetic relationships of Plecoptera is summarized. The few characters supporting monophyly of the order are outlined. Several characters of possible significance for the search for the closest relatives of the stoneflies are discussed, but the sister-group of the order remains unknown. Numerous characters supporting the presently recognized phylogenetic system of Plecoptera are presented, alternative classifications are discussed, and suggestions for future studies are made. Notes on zoogeography are appended. The order as such is old (Permian fossils), but phylogenetic relationships and global distribution patterns suggest that evolution of the extant suborders started with the breakup of Pangaea. There is evidence of extensive recent speciation in all parts of the world.

  14. Source apportionment and health risk assessment among specific age groups during haze and non-haze episodes in Kuala Lumpur, Malaysia.

    Science.gov (United States)

    Sulong, Nor Azura; Latif, Mohd Talib; Khan, Md Firoz; Amil, Norhaniza; Ashfold, Matthew J; Wahab, Muhammad Ikram Abdul; Chan, Kok Meng; Sahani, Mazrura

    2017-12-01

    This study aims to determine PM 2.5 concentrations and their composition during haze and non-haze episodes in Kuala Lumpur. In order to investigate the origin of the measured air masses, the Numerical Atmospheric-dispersion Modelling Environment (NAME) and Global Fire Assimilation System (GFAS) were applied. Source apportionment of PM 2.5 was determined using Positive Matrix Factorization (PMF). The carcinogenic and non-carcinogenic health risks were estimated using the United State Environmental Protection Agency (USEPA) method. PM 2.5 samples were collected from the centre of the city using a high-volume air sampler (HVS). The results showed that the mean PM 2.5 concentrations collected during pre-haze, haze and post-haze periods were 24.5±12.0μgm -3 , 72.3±38.0μgm -3 and 14.3±3.58μgm -3 , respectively. The highest concentration of PM 2.5 during haze episode was five times higher than World Health Organisation (WHO) guidelines. Inorganic compositions of PM 2.5 , including trace elements and water soluble ions were determined using inductively coupled plasma-mass spectrometry (ICP-MS) and ion chromatography (IC), respectively. The major trace elements identified were K, Al, Ca, Mg and Fe which accounted for approximately 93%, 91% and 92% of the overall metals' portions recorded during pre-haze, haze and post-haze periods, respectively. For water-soluble ions, secondary inorganic aerosols (SO 4 2- , NO 3 - and NH 4 + ) contributed around 12%, 43% and 16% of the overall PM 2.5 mass during pre-haze, haze and post-haze periods, respectively. During haze periods, the predominant source identified using PMF was secondary inorganic aerosol (SIA) and biomass burning where the NAME simulations indicate the importance of fires in Sumatra, Indonesia. The main source during pre-haze and post-haze were mix SIA and road dust as well as mineral dust, respectively. The highest non-carcinogenic health risk during haze episode was estimated among the infant group (HI=1

  15. Fast phylogenetic DNA barcoding

    DEFF Research Database (Denmark)

    Terkelsen, Kasper Munch; Boomsma, Wouter Krogh; Willerslev, Eske

    2008-01-01

    We present a heuristic approach to the DNA assignment problem based on phylogenetic inferences using constrained neighbour joining and non-parametric bootstrapping. We show that this method performs as well as the more computationally intensive full Bayesian approach in an analysis of 500 insect...... DNA sequences obtained from GenBank. We also analyse a previously published dataset of environmental DNA sequences from soil from New Zealand and Siberia, and use these data to illustrate the fact that statistical approaches to the DNA assignment problem allow for more appropriate criteria...... for determining the taxonomic level at which a particular DNA sequence can be assigned....

  16. Print Advertisements in Malaysia

    Science.gov (United States)

    Hashim, Azirah

    2010-01-01

    This paper examines print advertisements in Malaysia to determine how advertisers seek to achieve their primary goal of persuading or influencing an audience by the use of both language and visuals. It describes the main component moves and rhetorical strategies used by writers to articulate the communicative purpose of the genre and the language…

  17. Education Reforms in Malaysia.

    Science.gov (United States)

    Yunus, Aida Suraya Muhammad

    Malaysia's agenda in the late 1990s involved making the transition from an industrial economy to a knowledge-based economy. Thus, the more traditional purpose of education, that is, to produce an educated person, needs to be reevaluated. If the nation's Vision 2020 is to become a reality, the educational program needs to make a fundamental shift…

  18. Competition Law in Malaysia

    OpenAIRE

    Anand Raj; Cynthia Lian; Wen-Ly Chin

    2015-01-01

    There is still some way for Malaysia to go and the lack of merger control (for the foreseeable future) remains a significant shortcoming in the Malaysian competition law regime at this stage. Anand Raj, Cynthia Lian, & Wen-Ly Chin (Shearn Delamore & Co., Kuala Lumpur)

  19. Country Profiles, Malaysia.

    Science.gov (United States)

    Marzuki, Ariffin Bin; Peng, J. Y.

    A profile of Malaysia is sketched in this paper. Emphasis is placed on the nature, scope, and accomplishments of population activities in the country. Topics and sub-topics include: location and description of the country; population (size, growth patterns, age structure, urban/rural distribution, ethnic and religious composition, migration,…

  20. IDRC in Malaysia

    International Development Research Centre (IDRC) Digital Library (Canada)

    Malaysia was one of the first. Southeast Asian countries in which IDRC supported research, in 1971. Over the following two decades, more than 100 IDRC- funded activities contributed to better policies, technologies, and research capacity in sectors such as agriculture, fisheries, education, health, and science.

  1. Education in Malaysia: 1980.

    Science.gov (United States)

    Ministry of Education, Kuala Lumpur (Malaysia).

    Malaysia's education system has experienced a variety of situations and circumstances since May 1956, when the Razak Education Committee laid the foundation for a national system of education. Discussed in this publication are the history of educational development; educational organization and administration; the structure of education;…

  2. Review of toxoplasmosis in Malaysia.

    Science.gov (United States)

    Yahaya, N

    1991-12-01

    Various studies on toxoplasmosis in Malaysia have shown that specific antibodies to Toxoplasma gondii are common among Malaysians. Among the ethnic groups, the Malays have the highest prevalence rate followed by Indians, Orang Aslis (aborigines) and Chinese. Antibody is acquired early in life and increases with age. There is no significant difference in the prevalence rate between males and females. The disease is apparently more prevalent among rural dwellers and those in the lower socioeconomic group. It appears that the prevalence rate is also influenced by environmental conditions, occupation, diet and cultural habits. Studies with animals have shown the presence of antibody to T. gondii, but this does not seem to be the source of infection since Malaysians normally cook their meat well.

  3. Host specialization and phylogenetic diversity of Corynespora cassiicola.

    Science.gov (United States)

    Dixon, L J; Schlub, R L; Pernezny, K; Datnoff, L E

    2009-09-01

    The fungus Corynespora cassiicola is primarily found in the tropics and subtropics, and is widely diverse in substrate utilization and host association. Isolate characterization within C. cassiicola was undertaken to investigate how genetic diversity correlates with host specificity, growth rate, and geographic distribution. C. cassiicola isolates were collected from 68 different plant species in American Samoa, Brazil, Malaysia, and Micronesia, and Florida, Mississippi, and Tennessee within the United States. Phylogenetic analyses using four loci were performed with 143 Corynespora spp. isolates, including outgroup taxa obtained from culture collections: C. citricola, C. melongenae, C. olivacea, C. proliferata, C. sesamum, and C. smithii. Phylogenetic trees were congruent from the ribosomal DNA internal transcribed spacer region, two random hypervariable loci (caa5 and ga4), and the actin-encoding locus act1, indicating a lack of recombination within the species and asexual propagation. Fifty isolates were tested for pathogenicity on eight known C. cassiicola crop hosts: basil, bean, cowpea, cucumber, papaya, soybean, sweet potato, and tomato. Pathogenicity profiles ranged from one to four hosts, with cucumber appearing in 14 of the 16 profiles. Bootstrap analyses and Bayesian posterior probability values identified six statistically significant phylogenetic lineages. The six phylogenetic lineages correlated with host of origin, pathogenicity, and growth rate but not with geographic location. Common fungal genotypes were widely distributed geographically, indicating long-distance and global dispersal of clonal lineages. This research reveals an abundance of previously unrecognized genetic diversity within the species and provides evidence for host specialization on papaya.

  4. Profile of men's health in Malaysia: problems and challenges

    OpenAIRE

    Tong, Seng Fah; Low, Wah Yun; Ng, Chirk Jenn

    2011-01-01

    Men's health concerns have evolved from the traditional andrology and male sexual health to a more holistic approach that encompasses male psychological, social and physical health. The poor state of health in men compared to their female counterparts is well documented. A review of the epidemiological data from Malaysia noted a similar trend in which men die at higher rates in under 1 and above 15 years old groups and most disease categories compared to women. In Malaysia, the main causes of...

  5. treespace: Statistical exploration of landscapes of phylogenetic trees.

    Science.gov (United States)

    Jombart, Thibaut; Kendall, Michelle; Almagro-Garcia, Jacob; Colijn, Caroline

    2017-11-01

    The increasing availability of large genomic data sets as well as the advent of Bayesian phylogenetics facilitates the investigation of phylogenetic incongruence, which can result in the impossibility of representing phylogenetic relationships using a single tree. While sometimes considered as a nuisance, phylogenetic incongruence can also reflect meaningful biological processes as well as relevant statistical uncertainty, both of which can yield valuable insights in evolutionary studies. We introduce a new tool for investigating phylogenetic incongruence through the exploration of phylogenetic tree landscapes. Our approach, implemented in the R package treespace, combines tree metrics and multivariate analysis to provide low-dimensional representations of the topological variability in a set of trees, which can be used for identifying clusters of similar trees and group-specific consensus phylogenies. treespace also provides a user-friendly web interface for interactive data analysis and is integrated alongside existing standards for phylogenetics. It fills a gap in the current phylogenetics toolbox in R and will facilitate the investigation of phylogenetic results. © 2017 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

  6. The genetic history of Peninsular Malaysia.

    Science.gov (United States)

    Norhalifah, Hanim Kamis; Syaza, Fatnin Hisham; Chambers, Geoffrey Keith; Edinur, Hisham Atan

    2016-07-15

    This article explores the genetic history of the various sub-populations currently living in Peninsular Malaysia. This region has received multiple waves of migrants like the Orang Asli in prehistoric times and the Chinese, Indians, Europeans and Arabs during historic times. There are three highly distinct lineages that make up the Orang Asli; Semang, Senoi and Proto-Malays. The Semang, who have 'Negrito' characteristics, represent the first human settlers in Peninsular Malaysia arriving from about 50,000ya. The Senoi later migrated from Indochina and are a mix between an Asian Neolithic population and the Semang. These Asian genomes probably came in before Austroasiatic languages arrived between 5000 and 4000years ago. Semang and Senoi both now speak Austro-Asiatic languages indicative of cultural diffusion from Senoi to Semang. In contrast, the Proto-Malays who came last to the southern part of this region speak Austronesian language and are Austronesians with some Negrito admixture. It is from this group that the contemporary Malays emerged. Here we provide an overview of the best available genetic evidences (single nucleotide polymorphisms, mitochondrial DNA, Y-chromosome, blood groups, human platelet antigen, human leukocyte antigen, human neutrophil antigen and killer-cell immunoglobulin-like receptor) supporting the complex genetic history of Peninsular Malaysia. Large scale sampling and high throughput genetic screening programmes such as those using genome-wide single nucleotide polymorphism analyses have provided insights into various ancestral and admixture genetic fractions in this region. Given the now extensive admixture present in the contemporary descendants of ancient sub-populations in Peninsular Malaysia, improved reconstruction of human migration history in this region will require new evidence from ancient DNA in well-preserved skeletons. All other aspects of the highly diverse and complex genetic makeup in Peninsular Malaysia should be

  7. A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the 'true citrus fruit trees' group (Citrinae, Rutaceae) and the origin of cultivated species.

    Science.gov (United States)

    Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

    2013-01-01

    Despite differences in morphology, the genera representing 'true citrus fruit trees' are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial 'species' of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between 'true citrus fruit trees' were clarified. Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the

  8. A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the ‘true citrus fruit trees’ group (Citrinae, Rutaceae) and the origin of cultivated species

    Science.gov (United States)

    Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

    2013-01-01

    Background and Aims Despite differences in morphology, the genera representing ‘true citrus fruit trees’ are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial ‘species’ of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between ‘true citrus fruit trees’ were clarified. Methods Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. Key Results A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Conclusions Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will

  9. Phylogenetic trees in bioinformatics

    Energy Technology Data Exchange (ETDEWEB)

    Burr, Tom L [Los Alamos National Laboratory

    2008-01-01

    Genetic data is often used to infer evolutionary relationships among a collection of viruses, bacteria, animal or plant species, or other operational taxonomic units (OTU). A phylogenetic tree depicts such relationships and provides a visual representation of the estimated branching order of the OTUs. Tree estimation is unique for several reasons, including: the types of data used to represent each OTU; the use ofprobabilistic nucleotide substitution models; the inference goals involving both tree topology and branch length, and the huge number of possible trees for a given sample of a very modest number of OTUs, which implies that fmding the best tree(s) to describe the genetic data for each OTU is computationally demanding. Bioinformatics is too large a field to review here. We focus on that aspect of bioinformatics that includes study of similarities in genetic data from multiple OTUs. Although research questions are diverse, a common underlying challenge is to estimate the evolutionary history of the OTUs. Therefore, this paper reviews the role of phylogenetic tree estimation in bioinformatics, available methods and software, and identifies areas for additional research and development.

  10. A new species of Tropidophorus Duméril & Bibron, 1839 (Squamata: Sauria: Scincidae) from Sarawak, East Malaysia (Borneo).

    Science.gov (United States)

    Pui, Yong Min; Karin, Benjamin R; Bauer, Aaron M; Das, Indraneil

    2017-05-03

    A new species of the genus Tropidophorus is described from Putai, upper Baleh, Kapit districts, Sarawak, East Malaysia (Borneo). Tropidophorus sebi sp. nov. is diagnosable from congeners from Borneo by the combination of the following characters: head shields present, dorsal and lateral scales smooth; parietal scales in two pairs; supraciliaries eight; supraoculars four; supralabials seven; infralabials four; postmental undivided; longitudinal scale rows 58; ventrals 53; transverse scale rows at midbody 34; subcaudals 98; preanals enlarged, single; and subdigital lamellae of Toe IV 19. In addition, we determine the phylogenetic position of this species within the Tropidophorus group based on mitochondrial markers, and present a key to identification of the known Bornean species in the genus.

  11. A Study of Quality Assurance Practices in the Universiti Sains Malaysia (USM), Malaysia

    Science.gov (United States)

    Sim, Helen Khoo Chooi; Idrus, Rozhan M.

    2004-01-01

    This article looks at the quality assurance practices amongst three (3) groups of staff in the School of Distance Education, Universiti Sains Malaysia, i.e. lecturers, resident tutors and support staff. 9 dimensions of the Quality Assurance Practices i.e. Staff Development, Planning, Work Process, Team Work, Prioritise Customers, Performance…

  12. Reconstructing phylogenetic networks using maximum parsimony.

    Science.gov (United States)

    Nakhleh, Luay; Jin, Guohua; Zhao, Fengmei; Mellor-Crummey, John

    2005-01-01

    Phylogenies - the evolutionary histories of groups of organisms - are one of the most widely used tools throughout the life sciences, as well as objects of research within systematics, evolutionary biology, epidemiology, etc. Almost every tool devised to date to reconstruct phylogenies produces trees; yet it is widely understood and accepted that trees oversimplify the evolutionary histories of many groups of organims, most prominently bacteria (because of horizontal gene transfer) and plants (because of hybrid speciation). Various methods and criteria have been introduced for phylogenetic tree reconstruction. Parsimony is one of the most widely used and studied criteria, and various accurate and efficient heuristics for reconstructing trees based on parsimony have been devised. Jotun Hein suggested a straightforward extension of the parsimony criterion to phylogenetic networks. In this paper we formalize this concept, and provide the first experimental study of the quality of parsimony as a criterion for constructing and evaluating phylogenetic networks. Our results show that, when extended to phylogenetic networks, the parsimony criterion produces promising results. In a great majority of the cases in our experiments, the parsimony criterion accurately predicts the numbers and placements of non-tree events.

  13. Foreign Direct Investment and Electronics Exports: Exploratory Empirical Evidence from Malaysia's Top Five Electronics Exports

    OpenAIRE

    Tuck Cheong Tang; Koi Nyen Wong

    2007-01-01

    The foreign direct investment (FDI) has contributed significantly to Malaysia's electronics exports as well as the growth and development of the electronics industry as a result of the export-oriented industrialization initiatives undertaken since 1970s. The aim of this study is to explore the causation between FDI and electronics exports by using Malaysia''s top five electronics exports by SITC (Standard International Trade Classification) product groups. The findings show a bi-directional c...

  14. Transforming phylogenetic networks: Moving beyond tree space

    OpenAIRE

    Huber, Katharina T.; Moulton, Vincent; Wu, Taoyang

    2016-01-01

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent reticulate evolution. Unrooted phylogenetic networks form a special class of such networks, which naturally generalize unrooted phylogenetic trees. In this paper we define two operations on unrooted phylogenetic networks, one of which is a generalization of the well-known nearest-neighbor interchange (NNI) operation on phylogenetic trees. We show that any unrooted phylogenetic network can be transforme...

  15. Corporate Governance Disclosure in Malaysia

    OpenAIRE

    ONG, Wei Jiin

    2006-01-01

    This research provides evidence on corporate governance disclosure in Malaysia based on a sample of 25 Malaysian public listed companies on the Kuala Lumpur Composite Index (KLCI) in the year 1998 and 2005 that are listed on the Bursa Malaysia. The purpose of this dissertation is to examine whether after the launch of the Malaysian Code on Corporate Governance (HLFC, 2000) following the 1997/98 financial crisis, corporate governance in Malaysia has improved in terms of disclosure information ...

  16. Comparison of sequence-based and structure-based phylogenetic ...

    Indian Academy of Sciences (India)

    Prakash

    phylogenetic tree construction methods, has been considered as an equivalent of .... Further detailed analysis described is restricted to the first two groups only. ..... Aspartate-ammonia ligase. Plant virus ..... enzymatic activities?; Trends ...

  17. Phylogenetic networks do not need to be complex: using fewer reticulations to represent conflicting clusters

    NARCIS (Netherlands)

    Iersel, van L.J.J.; Kelk, S.M.; Rupp, R.; Huson, D.H.

    2010-01-01

    Phylogenetic trees are widely used to display estimates of how groups of species are evolved. Each phylogenetic tree can be seen as a collection of clusters, subgroups of the species that evolved from a common ancestor. When phylogenetic trees are obtained for several datasets (e.g. for different

  18. Malaysia country overview

    International Nuclear Information System (INIS)

    Look, Chong Ah.

    1998-01-01

    The threat of global warming and climate change caused by escalating anthropogenic emissions of carbon dioxide and other greenhouse gases into the atmosphere calls for deliberate efforts by the global community to address this issue. Article 2 of the Framwork Convention on Climate Change (FCCC) sets the objective of the Convention to stabilize greenhouse gas concentrations in the atmosphere at a level that would prevent dangerous anthropogenic interference with the climate system. Malaysia signed the Convention on 9 June 1993 and ratified it on 17 July 1994. As a party to the Convention, Malaysia is committed to fulfilling its obligations including the communication of information to the Conference of the Parties (COP) in accordance with Articles 4 and 12 of the FCCC. (au)

  19. The 1995 Parliamentary Elections in Malaysia

    Directory of Open Access Journals (Sweden)

    Abdul Rashid Moten

    1995-06-01

    Full Text Available The parliamentary elections in Malaysia have brought about a significant change in the distribution of partisanship in the electorate. It redefined the relationships between social groups and party support and have enhanced the political stability of the country. The Barisan Nasional's victory, attributable to a booming economy, full employment, and superior organization and finance, signalled a vote of confidence in the politics of accommodation characterised by tolerance, mutual cooperation, and compromise.

  20. Assimilation of Baba and Nyonya in Malaysia

    OpenAIRE

    Razaleigh Muhamat Kawangit

    2015-01-01

    This research set outs to explore the exact level of the social aspect of assimilation between Baba and Nyonya and their Malay counterparts in Malaysia. It was sure that assimilation in social aspect is a dilemma which Baba and Nyonya face when they interact with Malays as a dominant ethnic group. It suggests that when the process of interaction, their behavior changes in line with the identity of the Malays. This is because the majority influenced the minority in the Malaysian context. Whils...

  1. The politics of meritocracy in Malaysia

    OpenAIRE

    Ali, Hamzah Bin

    2003-01-01

    Approved for public release; distribution is unlimited. The effort to achieve development in Malaysia raises the question of how to develop a country where inequality between racial groups is significant. Of the various efforts made to achieve this goal, the most important is the New Economic Policy (NEP), a corrective policy to assist the Malays in socio-economic development. In essence, this was an affirmative action policy for a majority of the population that was economically behind th...

  2. The 1995 Parliamentary Elections in Malaysia

    OpenAIRE

    Abdul Rashid Moten; Tunku Mohar bin Tunku M. Mokhtar

    1995-01-01

    The parliamentary elections in Malaysia have brought about a significant change in the distribution of partisanship in the electorate. It redefined the relationships between social groups and party support and have enhanced the political stability of the country. The Barisan Nasional's victory, attributable to a booming economy, full employment, and superior organization and finance, signalled a vote of confidence in the politics of accommodation characterised by tolerance, mutual cooperation...

  3. Malaysia; Selected Issues

    OpenAIRE

    International Monetary Fund

    1998-01-01

    This Selected Issues paper on Malaysia highlights quantitative assessment of additional measures required during the medium term to achieve fiscal targets. The authorities aim to lower the budget deficit to about 3 percent of GDP by 2015, down from 4.0 percent in 2013, and to balance the budget by 2020. It suggests that ranking fiscal instruments under different fiscal policy goals can help policymakers identify the composition of fiscal adjustment based on their preferences. By combining ran...

  4. Internetcensur i Malaysia

    OpenAIRE

    Rask, Kasper; Bach, Katinka

    2013-01-01

    This project examines the background of the implementation of the Internet censorship legislation in Malaysia in 2012 by the Malaysian government. This is illustrated by an empirical analysis of the two largest pro-government Malaysian newspapers New Straits Times and The Stars coverage of the need for Internet censorship between the two parliamentary elections in 2008 and the recent one in 2013. The government suffered its worst-ever election performance in these elections, and this project ...

  5. Population mobility in Peninsular Malaysia.

    Science.gov (United States)

    Jones, G W; Sidh, M S

    1979-12-01

    1970 census materials were used to analyze migration patterns in Peninsular Malaysia. Inter-state migration patterns were analyzed by comparing birth place and current place of residence data, and inter-district and intra-district migration patterns were assessed using information on previous and current place of residence. The proportion of inter-state migrants in the total population increased from 4.7%-10.9% from 1947-1970. 53% of the inter-state migrants were Malays, 33% were Chinese, and 13% were Indian. The states of Selangor and Pahang had the highest net migration gains and Perak had the highest number of out-migrants. Selangor attracted migrants because it was a major industrial, administrative and educational center. Migrants were attracted to Pahang because of recent efforts by the government to promote agricultural development in the state. Areas which showed a net migration loss were experiencing slow economic growth. 48.4% of the inter-state migrants migrated to either rural or suburban areas, 26% moved to cities with populations of 75,000 or more, and 26% moved to towns with populations of 1000-10,000. 48.6% of the inter-state migrants were females. When all types of internal migration were taken into account it was estimated that approximately 30% of the population had moved at some point in their life time. During the early 1900s, Peninsular Malaysia received many immigrants from China, India, and other countries, and the Chinese became the dominant group in many urban areas and in many economic sectors. In 1950 the government, fearing that the Malays would become a minority group in their own country, halted international immigration. The recent increase in internal migration has contributed toward equalizing the influence and power of the Chinese and the Malays in urban areas and in various economic sectors.

  6. Open Reading Frame Phylogenetic Analysis on the Cloud

    Directory of Open Access Journals (Sweden)

    Che-Lun Hung

    2013-01-01

    Full Text Available Phylogenetic analysis has become essential in researching the evolutionary relationships between viruses. These relationships are depicted on phylogenetic trees, in which viruses are grouped based on sequence similarity. Viral evolutionary relationships are identified from open reading frames rather than from complete sequences. Recently, cloud computing has become popular for developing internet-based bioinformatics tools. Biocloud is an efficient, scalable, and robust bioinformatics computing service. In this paper, we propose a cloud-based open reading frame phylogenetic analysis service. The proposed service integrates the Hadoop framework, virtualization technology, and phylogenetic analysis methods to provide a high-availability, large-scale bioservice. In a case study, we analyze the phylogenetic relationships among Norovirus. Evolutionary relationships are elucidated by aligning different open reading frame sequences. The proposed platform correctly identifies the evolutionary relationships between members of Norovirus.

  7. Re-evaluation of the taxonomy of the Mitis group of the genus Streptococcus based on whole genome phylogenetic analyses, and proposed reclassification of Streptococcus dentisani as Streptococcus oralis subsp. dentisani comb. nov., Streptococcus tigurinus as Streptococcus oralis subsp. tigurinus comb. nov., and Streptococcus oligofermentans as a later synonym of Streptococcus cristatus.

    Science.gov (United States)

    Jensen, Anders; Scholz, Christian F P; Kilian, Mogens

    2016-11-01

    The Mitis group of the genus Streptococcus currently comprises 20 species with validly published names, including the pathogen S. pneumoniae. They have been the subject of much taxonomic confusion, due to phenotypic overlap and genetic heterogeneity, which has hampered a full appreciation of their clinical significance. The purpose of this study was to critically re-examine the taxonomy of the Mitis group using 195 publicly available genomes, including designated type strains for phylogenetic analyses based on core genomes, multilocus sequences and 16S rRNA gene sequences, combined with estimates of average nucleotide identity (ANI) and in silico and in vitro analyses of specific phenotypic characteristics. Our core genomic phylogenetic analyses revealed distinct clades that, to some extent, and from the clustering of type strains represent known species. However, many of the genomes have been incorrectly identified adding to the current confusion. Furthermore, our data show that 16S rRNA gene sequences and ANI are unsuitable for identifying and circumscribing new species of the Mitis group of the genus Streptococci. Based on the clustering patterns resulting from core genome phylogenetic analysis, we conclude that S. oligofermentans is a later synonym of S. cristatus. The recently described strains of the species Streptococcus dentisani includes one previously referred to as 'S. mitis biovar 2'. Together with S. oralis, S. dentisani and S. tigurinus form subclusters within a coherent phylogenetic clade. We propose that the species S. oralis consists of three subspecies: S. oralis subsp. oralis subsp. nov., S. oralis subsp. tigurinus comb. nov., and S. oralis subsp. dentisani comb. nov.

  8. Ecological and phylogenetic influences on maxillary dentition in snakes

    Directory of Open Access Journals (Sweden)

    Kate Jackson

    2010-12-01

    Full Text Available The maxillary dentition of snakes was used as a system with which to investigate the relative importance of the interacting forces of ecological selective pressures and phylogenetic constraints indetermining morphology. The maxillary morphology of three groups of snakes having different diets, with each group comprising two distinct lineages — boids and colubroids — was examined. Our results suggest that dietary selective pressures may be more significantthan phylogenetic history in shaping maxillary morphology.

  9. Peat in Malaysia

    Energy Technology Data Exchange (ETDEWEB)

    Ambak, K. [MARDI - Integrated Peat Research Station, Johor (Malaysia); Ah Chye, L. [MARDI Jalan Kebun, Selangor (Malaysia). Vegetable Research Centre

    1996-12-31

    Malaysian peatlands occur mostly in the water-saturated basins of the coastal lowlands. They are approximately 25 000 km{sup 2} in extent, of which about 10 000 km{sup 2} are in Peninsular Malaysia and another 15 000 km{sup 2} are distributed in Sarawak and Sabah. In Peninsular Malaysia, peatland classification is based mainly on peat depth and loss on ignition. In Sarawak, a more comprehensive approach is adopted, based on peat depth and the type of underlying mineral materials. As for Sabah, the classification follows FAD/UNESCO guidelines. Malaysian peatland is utilised mainly for agriculture. At present, about 32 % of the peatland area in Peninsular Malaysia is used for this purpose. In Sarawak, a much smaller percentage is used for agriculture. The main crops grown are oil-palm, rubber, coconut, padi and pineapple. Based on {sup 14}C datings, it has been estimated that peat in this region began to form between 4 000 and 5 000 years ago. The overall rate of accumulation of the peat since its initial formation has been about 2.81 mm ye` whereas the average rate during the early stages of formation ( 12-10 m) was 4.76 mm ye. In the intermediate stage (10-5 m), the average annual accumulation rate decreased to 3.14 mm, and to 2.22 mm in the final phase (5 m to the surface). (orig.) (17 refs.)

  10. Ultrafast Approximation for Phylogenetic Bootstrap

    NARCIS (Netherlands)

    Bui Quang Minh, [No Value; Nguyen, Thi; von Haeseler, Arndt

    Nonparametric bootstrap has been a widely used tool in phylogenetic analysis to assess the clade support of phylogenetic trees. However, with the rapidly growing amount of data, this task remains a computational bottleneck. Recently, approximation methods such as the RAxML rapid bootstrap (RBS) and

  11. A format for phylogenetic placements.

    Directory of Open Access Journals (Sweden)

    Frederick A Matsen

    Full Text Available We have developed a unified format for phylogenetic placements, that is, mappings of environmental sequence data (e.g., short reads into a phylogenetic tree. We are motivated to do so by the growing number of tools for computing and post-processing phylogenetic placements, and the lack of an established standard for storing them. The format is lightweight, versatile, extensible, and is based on the JSON format, which can be parsed by most modern programming languages. Our format is already implemented in several tools for computing and post-processing parsimony- and likelihood-based phylogenetic placements and has worked well in practice. We believe that establishing a standard format for analyzing read placements at this early stage will lead to a more efficient development of powerful and portable post-analysis tools for the growing applications of phylogenetic placement.

  12. Molecular phylogenetics of mastodon and Tyrannosaurus rex.

    Science.gov (United States)

    Organ, Chris L; Schweitzer, Mary H; Zheng, Wenxia; Freimark, Lisa M; Cantley, Lewis C; Asara, John M

    2008-04-25

    We report a molecular phylogeny for a nonavian dinosaur, extending our knowledge of trait evolution within nonavian dinosaurs into the macromolecular level of biological organization. Fragments of collagen alpha1(I) and alpha2(I) proteins extracted from fossil bones of Tyrannosaurus rex and Mammut americanum (mastodon) were analyzed with a variety of phylogenetic methods. Despite missing sequence data, the mastodon groups with elephant and the T. rex groups with birds, consistent with predictions based on genetic and morphological data for mastodon and on morphological data for T. rex. Our findings suggest that molecular data from long-extinct organisms may have the potential for resolving relationships at critical areas in the vertebrate evolutionary tree that have, so far, been phylogenetically intractable.

  13. Obesity in Malaysia.

    Science.gov (United States)

    Ismail, M N; Chee, S S; Nawawi, H; Yusoff, K; Lim, T O; James, W P T

    2002-08-01

    This study was undertaken to assess the recent data on Malaysian adult body weights and associations of ethnic differences in overweight and obesity with comorbid risk factors, and to examine measures of energy intake, energy expenditure, basal metabolic rate (BMR) and physical activity changes in urban and rural populations of normal weight. Three studies were included (1) a summary of a national health morbidity survey conducted in 1996 on nearly 29 000 adults > or =20 years of age; (2) a study comparing energy intake, BMR and physical activity levels (PALs) in 409 ethnically diverse, healthy adults drawn from a population of 1165 rural and urban subjects 18-60 years of age; and (3) an examination of the prevalence of obesity and comorbid risk factors that predict coronary heart disease and type 2 diabetes in 609 rural Malaysians aged 30-65 years. Overweight and obesity were calculated using body mass index (BMI) measures and World Health Organization (WHO) criteria. Energy intake was assessed using 3-d food records, BMR and PALs were assessed with Douglas bags and activity diaries, while hypertension, hyperlipidaemia and glucose intolerance were specified using standard criteria. The National Health Morbidity Survey data revealed that in adults, 20.7% were overweight and 5.8% obese (0.3% of whom had BMI values of >40.0 kg m(-2)); the prevalence of obesity was clearly greater in women than in men. In women, obesity rates were higher in Indian and Malay women than in Chinese women, while in men the Chinese recorded the highest obesity prevalences followed by the Malay and Indians. Studies on normal healthy subjects indicated that the energy intake of Indians was significantly lower than that of other ethnic groups. In women, Malays recorded a significantly higher energy intake than the other groups. Urban male subjects consumed significantly more energy than their rural counterparts, but this was not the case in women. In both men and women, fat intakes (%) were

  14. Federation of Malaysia. Country profile.

    Science.gov (United States)

    Newcomb, L

    1985-01-01

    The 1984 population of Malaysia has been estimated at 14.7 million and the population growth rate averaged 2.3% in 1970-80. Population growth is officially encouraged to form a substantial home market for economic development. Toward this end, the 1985 budget has increased tax deductions for families with 5 children. The capital city of Kuala Lumpur is the largest metropolitan area (1 million population) and the Federal Territory is the most densely populated region. Immigration is strictly controlled by the government, and the percentage of foreign-born citizens was 5% in 1980. China, India, and Pakistan are decreasing in importance as countries of origin. Internal mobility, however, is increasing. Rural-rural migration accounted for 45% of internal migration in 1970-80 and was largely motivated by family reasons. Only 7% of Malaysians are estimated to move in search of work. Racial tensions led the government to grant special economic privileges to native-born Islamic Malays. The greatest proportion of the population is centered in the lowest age groups. The percentage of females 15-29 years of age rose from 26% in 1970 to 30% in 1980 and is expected to continue to rise. Fertility is on the decline. The majority of households in the country involve nuclear families. There has been an increase in the number of men and women who delay marriage or remain single. Education is widely available for children aged 6-15 years and those who meet certain academic standards receive free education up to age 19 years. The current labor force is estimated at 5.4 million, with an annual growth rate of 3.1%. Malaysia's per capita income (US $1860 in 1982) is among the highest in Southeast Asia and the gross national product increased by an average annual rate of 8% in 1970-81. The government plans to move toward the development of heavier industries and more manufacturing concerns.

  15. The Convolvulaceae of Malaysia, VII

    NARCIS (Netherlands)

    Ooststroom, van S.J.

    1952-01-01

    In addition to my papers on the genus Argyreia in Malaysia I can here give a few descriptions of new species, mainly from Sumatra and Borneo, and some critical notes on others. A revision of the species of Malaysia as a whole, including those of the Malay Peninsula and the Philippine Islands will be

  16. Daphniphyllum (Daphniphyllaceae) in Peninsular Malaysia

    OpenAIRE

    Kiew, R.; Rafidah, A.R.

    2008-01-01

    Three species of Daphniphyllum occur in Peninsular Malaysia: D. glaucescens Blume var. lancifolium (Hook.f.) T.C.Huang, D. laurinum (Benth.) Baill. and D. scortechinii Hook.f. Daphniphyllum glaucescens var. glaucescens and var. blumeanum (Baill. ex Müll.Arg.) J.J.Sm. do not occur in Peninsular Malaysia and specimens identified as such belong to D. glaucescens var. lancifolium.

  17. Holistic BIM Adoption and Diffusion in Malaysia

    Directory of Open Access Journals (Sweden)

    Mamter Shahela

    2016-01-01

    Full Text Available Building Information Modeling is modeling technology and associated set of processes to produce, communicate and analyze digital information models for construction life cycle. Although many benefits can gain by the implementation of BIM, the pace adoption of BIM in Malaysia is still slow. There is an abundance of theories and models purporting to describe the drivers and mechanisms of how new technologies are adopted or diffused into a particular section of society or by individuals or stake players. In addition, many acceptance theories, which imply the adoption of new technologies and can be applied in every sector. This paper aims to present a review of the existing literature of BIM adoption and diffusion theory/model/framework in Malaysia. Researcher revealed the list of driven factors of Holistic BIM Adoption. In addition, it will deal with how to work effectively with groups that initially are relatively

  18. Exploring cycle crash characteristics in Malaysia

    Directory of Open Access Journals (Sweden)

    Hamzah A.

    2017-01-01

    Full Text Available This paper explains the cycle road crash trend, characteristics and injuries in Malaysia. It analyses the in-depth road crash investigation data collected by the Royal Malaysian Police which was made available to MIROS crash database. Fatality data was utilized due to its consistency. Cycle casualties reflected a continual downward pattern for year 2009 to 2014 in which the number of cycle crash involvement reduced by 49% and fatalities dropped by 42%. Among the prevalent factors of cycle fatalities are >60 age group, federal and state roads and straight road sections, rural and small towns, evening peak hours, and mainly involving cars and motorcycles. It is hoped that all these information would spark interests to improve cycle safety in Malaysia.

  19. phangorn: phylogenetic analysis in R.

    Science.gov (United States)

    Schliep, Klaus Peter

    2011-02-15

    phangorn is a package for phylogenetic reconstruction and analysis in the R language. Previously it was only possible to estimate phylogenetic trees with distance methods in R. phangorn, now offers the possibility of reconstructing phylogenies with distance based methods, maximum parsimony or maximum likelihood (ML) and performing Hadamard conjugation. Extending the general ML framework, this package provides the possibility of estimating mixture and partition models. Furthermore, phangorn offers several functions for comparing trees, phylogenetic models or splits, simulating character data and performing congruence analyses. phangorn can be obtained through the CRAN homepage http://cran.r-project.org/web/packages/phangorn/index.html. phangorn is licensed under GPL 2.

  20. On Nakhleh's metric for reduced phylogenetic networks

    OpenAIRE

    Cardona, Gabriel; Llabrés, Mercè; Rosselló, Francesc; Valiente Feruglio, Gabriel Alejandro

    2009-01-01

    We prove that Nakhleh’s metric for reduced phylogenetic networks is also a metric on the classes of tree-child phylogenetic networks, semibinary tree-sibling time consistent phylogenetic networks, and multilabeled phylogenetic trees. We also prove that it separates distinguishable phylogenetic networks. In this way, it becomes the strongest dissimilarity measure for phylogenetic networks available so far. Furthermore, we propose a generalization of that metric that separates arbitrary phyl...

  1. The Malaysia LNG experience

    International Nuclear Information System (INIS)

    Muhammed, M.

    1991-01-01

    This paper summarizes the nature of the LNG trade, the essential components and characteristics of an LNG project, and relates the Malaysia LNG experience to project realization with some emphasis on the financial aspects of the project. Twelve offshore lending institutions were involved in the total project loop providing U.S. dollar equivalents of 4.0 billions with interest rates ranging from 5% to 8%. The total project was completed on schedule and within budget except for the ships which got caught in the political development of the Malaysian petroleum industry at that time

  2. Malaysia; Background Paper

    OpenAIRE

    International Monetary Fund

    1996-01-01

    This Background Paper on Malaysia examines developments and trends in the labor market since the mid-1980s. The paper describes the changes in the employment structure and the labor force. It reviews wages and productivity trends and their effects on unit labor cost. The paper highlights that Malaysia’s rapid growth, sustained since 1987, has had a major impact on the labor market. The paper outlines the major policy measures to address the labor constraints. It also analyzes Malaysia’s recen...

  3. On the information content of discrete phylogenetic characters.

    Science.gov (United States)

    Bordewich, Magnus; Deutschmann, Ina Maria; Fischer, Mareike; Kasbohm, Elisa; Semple, Charles; Steel, Mike

    2017-12-16

    Phylogenetic inference aims to reconstruct the evolutionary relationships of different species based on genetic (or other) data. Discrete characters are a particular type of data, which contain information on how the species should be grouped together. However, it has long been known that some characters contain more information than others. For instance, a character that assigns the same state to each species groups all of them together and so provides no insight into the relationships of the species considered. At the other extreme, a character that assigns a different state to each species also conveys no phylogenetic signal. In this manuscript, we study a natural combinatorial measure of the information content of an individual character and analyse properties of characters that provide the maximum phylogenetic information, particularly, the number of states such a character uses and how the different states have to be distributed among the species or taxa of the phylogenetic tree.

  4. Suicide and ethnicity in Malaysia.

    Science.gov (United States)

    Murty, Om Prakash; Cheh, Lo Boon; Bakit, Pangie Anak; Hui, Foo Jhi; Ibrahim, Zarina Binti; Jusoh, Nazirah Binti

    2008-03-01

    This article highlights methods of ending life in different ethnic groups. This inference is drawn from analysis of data from suicidal cases from the University Malaya Medical Centre mortuary. This study also looked at sex, age, social, and employment factors. Kuala Lumpur has sizeable populations of Muslims, Chinese, Indians and Indonesian, etc. This study is based on 251 cases of suicide that were reported at the University Malaya Medical Centre from 2000 to 2004. Malaysia has a population of 22,662,365 people with 3 major ethnic groups: Malay (58%), Chinese (24%), and Indians (8%) with a minority of "others" (10%), which includes foreigners, Sabahan, and Sarawakian. This research found suicides of 164 male (65%) and 87 female (35%) victims. Their age ranged from 15 to 80 years. The age group from 21 to 30 had the highest total cases of suicide (83 of 251; 33.1%). Among ethnic groups highest rate of suicide was among Chinese with a total of 120 cases (120 of 251; 47.8%). As far as lone method of suicide is concerned, hangings accounted for the highest proportion of cases (108 of 251; 43%). Among ethnic groups, jumping from height was the commonest method used by Chinese (49 of 120; 41%), Malay (9 of 16; 56%), and others (15 of 28; 53.4%); whereas, hanging was the commonest method of committing suicide by Indians (49 of 87); Muslims showed the lowest cases of suicide (18 of 251; 7.2%). In poisoning group Indian was the highest ethnic group who used this method (20 of 37; 54.1%).

  5. Marine turtle mitogenome phylogenetics and evolution

    DEFF Research Database (Denmark)

    Duchene, Sebastián; Frey, Amy; Alfaro-Núñez, Luis Alonso

    2012-01-01

    The sea turtles are a group of cretaceous origin containing seven recognized living species: leatherback, hawksbill, Kemp's ridley, olive ridley, loggerhead, green, and flatback. The leatherback is the single member of the Dermochelidae family, whereas all other sea turtles belong in Cheloniidae...... distributions, shedding light on complex migration patterns and possible geographic or climatic events as driving forces of sea-turtle distribution. We have sequenced complete mitogenomes for all sea-turtle species, including samples from their geographic range extremes, and performed phylogenetic analyses...... to assess sea-turtle evolution with a large molecular dataset. We found variation in the length of the ATP8 gene and a highly variable site in ND4 near a proton translocation channel in the resulting protein. Complete mitogenomes show strong support and resolution for phylogenetic relationships among all...

  6. Point estimates in phylogenetic reconstructions

    OpenAIRE

    Benner, Philipp; Bacak, Miroslav; Bourguignon, Pierre-Yves

    2013-01-01

    Motivation: The construction of statistics for summarizing posterior samples returned by a Bayesian phylogenetic study has so far been hindered by the poor geometric insights available into the space of phylogenetic trees, and ad hoc methods such as the derivation of a consensus tree makeup for the ill-definition of the usual concepts of posterior mean, while bootstrap methods mitigate the absence of a sound concept of variance. Yielding satisfactory results with sufficiently concentrated pos...

  7. Phylogenetic reconstruction of transmission events from individuals with acute HIV infection: toward more-rigorous epidemiological definitions

    NARCIS (Netherlands)

    Brown, Alison E.; Gifford, Robert J.; Clewley, Jonathan P.; Kucherer, Claudia; Masquelier, Bernard; Porter, Kholoud; Balotta, Claudia; Back, Nicole K. T.; Jorgensen, Louise Bruun; de Mendoza, Carmen; Bhaskaran, Krishnan; Gill, O. Noel; Johnson, Anne M.; Pillay, Deenan; del Amo, Julia; Meyer, Laurence; Bucher, Heiner; Chene, Genevieve; Prins, Maria; Rosinska, Magda; Sabin, Caroline; Touloumi, Giota; Lodi, Sara; Walker, Sarah; Babiker, Abdel; Darbyshire, Janet; de Luca, Andrea; Fisher, Martin; Muga, Roberto; Kaldor, John; Kelleher, Tony; Ramacciotti, Tim; Gelgor, Linda; Cooper, David; Smith, Don; Gill, John; Nielsen, Claus; Pedersen, Court; Lutsar, Irja; Dabis, Francois; Thiebaut, Rodolphe; Costagliola, Dominique; Guiguet, Marguerite; Vanhems, Philippe; Boufassa, Faroudy; Hamouda, Osamah; Pantazis, Nikos; Hatzakis, Angelos; Geskus, Ronald; Coutinho, Roel

    2009-01-01

    Phylogenetic reconstructions of transmission events from individuals with acute human immunodeficiency virus (HIV) infection are conducted to illustrate this group's heightened infectivity. Varied definitions of acute infection and assumptions about observed phylogenetic clusters may produce

  8. Malaysia in international regional relationships

    International Nuclear Information System (INIS)

    Kamarulnizam Abdullah

    2010-01-01

    The changes in the international system saw the structure and survival issues that grip the country will also change. The main challenge to the nation is how to adapt these changes that running quite rapidly and outside the country's ability to cope alone. Issues and global structural changes also affect the international system of East Asia region that contains two important sub-Southeast Asia and Northeast Asia. Changes inherent in both these sub certainly affect the foreign policy and diplomacy, security and bilateral relations between Malaysia and other countries. Malaysia is not a global power capable of changing the international system. However, Malaysia is an important country in East Asia that has contributed to the prosperity of this region. The big question is how to adapt these changes into the Malaysia international regional policy and bilateral relations? What extent international issues affecting the regional survival of the country? What is the contribution to regional stability of Malaysia? This book explores the impact of selective regional issues to Malaysia, while also discussing the role and response to changes in regional Malaysia since the country gained independence. (author)

  9. Childhood drowning in Malaysia.

    Science.gov (United States)

    Hss, Amar-Singh; Tan, Pui San; Hashim, Lina

    2014-01-01

    This study aimed to collate data on childhood drowning in Malaysia and review existing drowning prevention measures. This study used secondary data from governmental and non-governmental agencies. All reported fatal drownings from 2000 to 2007 and all reported non-fatal drownings from 2000 to 2008 were included. Data were analysed to provide understanding of the epidemiology of drowning incidents, risk factors and available preventive efforts. On average 286 (range 248-344) children died yearly due to drowning with a death rate of 3.05 per 100,000 annually. An additional average of 207 children drowned but survived annually (1.99 per 100,000). The estimated burden of drowning in children (death and non-death) is 5 per 100,000. There was no reduction in annual drowning fatalities over time. Most drowning took place in east coast regions during the annual monsoon season. It was 3.52 (2.80-4.41) times more common in boys and most prevalent among 10-14 years. Most prevalent sites of all-age drowning were seas and rivers. Limited water safety regulations are currently available in the country. This is the first comprehensive national study in Malaysia on paediatric drowning and highlights the magnitude of the problem. It calls for concerted effort to devise effective national drowning prevention measures.

  10. A review of human leptospirosis in Malaysia.

    Science.gov (United States)

    El Jalii, I M; Bahaman, A R

    2004-12-01

    This paper reviews the literature on human leptospirosis in Malaysia from its first description in 1925 until the present day. Fletcher diagnosed the first case of human leptospirosis in Malaysia in 1925. Following Fletcher, many investigations on human leptospirosis in Malaysia disclosed a high prevalence of infection. These investigations indicated that the disease was endemic in the country. Examination of 1993 suspected human cases of leptospirosis by Tan indicated 28 % of the cases were positive. In a recent survey, 2190 serum samples from patients with different clinical manifestations in the country disclosed 12.6% were positive for antibodies to leptospires. The risk to leptospiral infection with respect to occupation, location, sex, race and age groups was demonstrated. Both civilians and military personnel were affected. Thirty-seven serovars from thirteen serogroups have been identified in the country. Recent studies on animal leptospirosis showed that the disease was highly endemic in the animal population. It is considered that the majority of leptospirosis cases in humans were due to association of man with animals and disease-infected environment.

  11. Molecular identification of blow flies recovered from human cadavers during crime scene investigations in Malaysia.

    Science.gov (United States)

    Kavitha, Rajagopal; Nazni, Wasi Ahmad; Tan, Tian Chye; Lee, Han Lim; Isa, Mohd Noor Mat; Azirun, Mohd Sofian

    2012-12-01

    Forensic entomology applies knowledge about insects associated with decedent in crime scene investigation. It is possible to calculate a minimum postmortem interval (PMI) by determining the age and species of the oldest blow fly larvae feeding on decedent. This study was conducted in Malaysia to identify maggot specimens collected during crime scene investigations. The usefulness of the molecular and morphological approach in species identifications was evaluated in 10 morphologically identified blow fly larvae sampled from 10 different crime scenes in Malaysia. The molecular identification method involved the sequencing of a total length of 2.2 kilo base pairs encompassing the 'barcode' fragments of the mitochondrial cytochrome oxidase I (COI), cytochrome oxidase II (COII) and t-RNA leucine genes. Phylogenetic analyses confirmed the presence of Chrysomya megacephala, Chrysomya rufifacies and Chrysomya nigripes. In addition, one unidentified blow fly species was found based on phylogenetic tree analysis.

  12. Labor markets and economic development in Malaysia.

    Science.gov (United States)

    Smith, J P

    1991-01-01

    A researcher analyzed data on male workers from 1262 households from Peninsular Malaysia (1976-1977 Malaysian Family Life Survey) to identify the leading effects of economic development for earnings and employment patterns within labor markets. All 3 major ethnic groups in Malaysia profited from the increasing levels of real income over time. The relative income of ethnic Malays, the poorest socioeconomic class, increased more so than the Chinese and Indians. Yet the income of Chinese was 108% higher than Malays and that of Indians was 60%. The difference between Malays and Chinese grew considerably as men aged. Further economic growth resulted in higher earnings for young men than for older men. In addition, the more educated men were the higher their earnings. In fact, education was the most significant determinant of time related growth in incomes. Further, income of men who participated in job training programs grew 2 times as fast than that of men who did not participate in job training programs. Lastly, economic growth increased earnings of men in urban areas more so than those in rural areas. Malaysia had put a lot of time and resources in research and development in rubber and rice production which has resulted in continual introduction of new varieties of rubber trees and rice. These new varieties have increased production considerably. In conclusion, Malaysia was able to experience economic growth because it invested in education and job training for male workers and in research and development to advance production of its 2 most important commodities--rubber and rice.

  13. Distribution of the Sunda Colugo (Galeopterus variegatus) in Malaysia (Peninsular, Sabah, Sarawak).

    Science.gov (United States)

    Nasir, Muhammad Dzulhelmi Muhammad; Abdullah, Mohd Tajuddin

    2010-12-01

    There is not much information available on the distribution of the Sunda colugo (Galeopterus variegates) in Malaysia, despite it being one of only two known species in the order Dermoptera. Data on the presence of the Sunda colugo and the vernacular names used by various ethnic groups throughout Malaysia were collected and compiled from various primary and secondary sources. There were 27 locations from Peninsular, 11 locations from Sabah and 34 locations from Sarawak that reported the presence of the Sunda colugo throughout Malaysia. The various ethnic groups of Malaysia adopted 37 different vernacular names to describe the Sunda colugo. This baseline data can be useful for the management authorities in conducting periodic monitoring and will enhance our knowledge of the population dynamics of the Sunda colugo in Malaysia.

  14. Phylogenetic lineages in Pseudocercospora.

    Science.gov (United States)

    Crous, P W; Braun, U; Hunter, G C; Wingfield, M J; Verkley, G J M; Shin, H-D; Nakashima, C; Groenewald, J Z

    2013-06-30

    Pseudocercospora is a large cosmopolitan genus of plant pathogenic fungi that are commonly associated with leaf and fruit spots as well as blights on a wide range of plant hosts. They occur in arid as well as wet environments and in a wide range of climates including cool temperate, sub-tropical and tropical regions. Pseudocercospora is now treated as a genus in its own right, although formerly recognised as either an anamorphic state of Mycosphaerella or having mycosphaerella-like teleomorphs. The aim of this study was to sequence the partial 28S nuclear ribosomal RNA gene of a selected set of isolates to resolve phylogenetic generic limits within the Pseudocercospora complex. From these data, 14 clades are recognised, six of which cluster in Mycosphaerellaceae. Pseudocercospora s. str. represents a distinct clade, sister to Passalora eucalypti, and a clade representing the genera Scolecostigmina, Trochophora and Pallidocercospora gen. nov., taxa formerly accommodated in the Mycosphaerella heimii complex and characterised by smooth, pale brown conidia, as well as the formation of red crystals in agar media. Other clades in Mycosphaerellaceae include Sonderhenia, Microcyclosporella, and Paracercospora. Pseudocercosporella resides in a large clade along with Phloeospora, Miuraea, Cercospora and Septoria. Additional clades represent Dissoconiaceae, Teratosphaeriaceae, Cladosporiaceae, and the genera Xenostigmina, Strelitziana, Cyphellophora and Thedgonia. The genus Phaeomycocentrospora is introduced to accommodate Mycocentrospora cantuariensis, primarily distinguished from Pseudocercospora based on its hyaline hyphae, broad conidiogenous loci and hila. Host specificity was considered for 146 species of Pseudocercospora occurring on 115 host genera from 33 countries. Partial nucleotide sequence data for three gene loci, ITS, EF-1α, and ACT suggest that the majority of these species are host specific. Species identified on the basis of host, symptomatology and general

  15. Phylogenetic and biogeographic analysis of sphaerexochine trilobites.

    Directory of Open Access Journals (Sweden)

    Curtis R Congreve

    Full Text Available BACKGROUND: Sphaerexochinae is a speciose and widely distributed group of cheirurid trilobites. Their temporal range extends from the earliest Ordovician through the Silurian, and they survived the end Ordovician mass extinction event (the second largest mass extinction in Earth history. Prior to this study, the individual evolutionary relationships within the group had yet to be determined utilizing rigorous phylogenetic methods. Understanding these evolutionary relationships is important for producing a stable classification of the group, and will be useful in elucidating the effects the end Ordovician mass extinction had on the evolutionary and biogeographic history of the group. METHODOLOGY/PRINCIPAL FINDINGS: Cladistic parsimony analysis of cheirurid trilobites assigned to the subfamily Sphaerexochinae was conducted to evaluate phylogenetic patterns and produce a hypothesis of relationship for the group. This study utilized the program TNT, and the analysis included thirty-one taxa and thirty-nine characters. The results of this analysis were then used in a Lieberman-modified Brooks Parsimony Analysis to analyze biogeographic patterns during the Ordovician-Silurian. CONCLUSIONS/SIGNIFICANCE: The genus Sphaerexochus was found to be monophyletic, consisting of two smaller clades (one composed entirely of Ordovician species and another composed of Silurian and Ordovician species. By contrast, the genus Kawina was found to be paraphyletic. It is a basal grade that also contains taxa formerly assigned to Cydonocephalus. Phylogenetic patterns suggest Sphaerexochinae is a relatively distinctive trilobite clade because it appears to have been largely unaffected by the end Ordovician mass extinction. Finally, the biogeographic analysis yields two major conclusions about Sphaerexochus biogeography: Bohemia and Avalonia were close enough during the Silurian to exchange taxa; and during the Ordovician there was dispersal between Eastern Laurentia and

  16. Locating a tree in a phylogenetic network

    NARCIS (Netherlands)

    Iersel, van L.J.J.; Semple, C.; Steel, M.A.

    2010-01-01

    Phylogenetic trees and networks are leaf-labelled graphs that are used to describe evolutionary histories of species. The Tree Containment problem asks whether a given phylogenetic tree is embedded in a given phylogenetic network. Given a phylogenetic network and a cluster of species, the Cluster

  17. Malaysia-China Friendship Evening 2009”Held

    Institute of Scientific and Technical Information of China (English)

    Our Staff Reporter

    2009-01-01

    <正>The CPAFFC, the Embassy of Malaysia in China, the Malaysia-China Friendship Association and the Malaysia-China Business Council jointly hosted the "Malaysia-China Friendship Evening 2009"at the Conference Hall of the Chi-

  18. A Consistent Phylogenetic Backbone for the Fungi

    Science.gov (United States)

    Ebersberger, Ingo; de Matos Simoes, Ricardo; Kupczok, Anne; Gube, Matthias; Kothe, Erika; Voigt, Kerstin; von Haeseler, Arndt

    2012-01-01

    The kingdom of fungi provides model organisms for biotechnology, cell biology, genetics, and life sciences in general. Only when their phylogenetic relationships are stably resolved, can individual results from fungal research be integrated into a holistic picture of biology. However, and despite recent progress, many deep relationships within the fungi remain unclear. Here, we present the first phylogenomic study of an entire eukaryotic kingdom that uses a consistency criterion to strengthen phylogenetic conclusions. We reason that branches (splits) recovered with independent data and different tree reconstruction methods are likely to reflect true evolutionary relationships. Two complementary phylogenomic data sets based on 99 fungal genomes and 109 fungal expressed sequence tag (EST) sets analyzed with four different tree reconstruction methods shed light from different angles on the fungal tree of life. Eleven additional data sets address specifically the phylogenetic position of Blastocladiomycota, Ustilaginomycotina, and Dothideomycetes, respectively. The combined evidence from the resulting trees supports the deep-level stability of the fungal groups toward a comprehensive natural system of the fungi. In addition, our analysis reveals methodologically interesting aspects. Enrichment for EST encoded data—a common practice in phylogenomic analyses—introduces a strong bias toward slowly evolving and functionally correlated genes. Consequently, the generalization of phylogenomic data sets as collections of randomly selected genes cannot be taken for granted. A thorough characterization of the data to assess possible influences on the tree reconstruction should therefore become a standard in phylogenomic analyses. PMID:22114356

  19. Computing the Skewness of the Phylogenetic Mean Pairwise Distance in Linear Time

    DEFF Research Database (Denmark)

    Tsirogiannis, Constantinos; Sandel, Brody Steven

    2014-01-01

    The phylogenetic Mean Pairwise Distance (MPD) is one of the most popular measures for computing the phylogenetic distance between a given group of species. More specifically, for a phylogenetic tree and for a set of species R represented by a subset of the leaf nodes of , the MPD of R is equal...... to the average cost of all possible simple paths in that connect pairs of nodes in R. Among other phylogenetic measures, the MPD is used as a tool for deciding if the species of a given group R are closely related. To do this, it is important to compute not only the value of the MPD for this group but also...

  20. Molecular epidemiology and evolutionary histories of human coronavirus OC43 and HKU1 among patients with upper respiratory tract infections in Kuala Lumpur, Malaysia.

    Science.gov (United States)

    Al-Khannaq, Maryam Nabiel; Ng, Kim Tien; Oong, Xiang Yong; Pang, Yong Kek; Takebe, Yutaka; Chook, Jack Bee; Hanafi, Nik Sherina; Kamarulzaman, Adeeba; Tee, Kok Keng

    2016-02-25

    Despite the worldwide circulation of human coronavirus OC43 (HCoV-OC43) and HKU1 (HCoV-HKU1), data on their molecular epidemiology and evolutionary dynamics in the tropical Southeast Asia region is lacking. The study aimed to investigate the genetic diversity, temporal distribution, population history and clinical symptoms of betacoronavirus infections in Kuala Lumpur, Malaysia between 2012 and 2013. A total of 2,060 adults presented with acute respiratory symptoms were screened for the presence of betacoronaviruses using multiplex PCR. The spike glycoprotein, nucleocapsid and 1a genes were sequenced for phylogenetic reconstruction and Bayesian coalescent inference. A total of 48/2060 (2.4 %) specimens were tested positive for HCoV-OC43 (1.3 %) and HCoV-HKU1 (1.1 %). Both HCoV-OC43 and HCoV-HKU1 were co-circulating throughout the year, with the lowest detection rates reported in the October-January period. Phylogenetic analysis of the spike gene showed that the majority of HCoV-OC43 isolates were grouped into two previously undefined genotypes, provisionally assigned as novel lineage 1 and novel lineage 2. Sign of natural recombination was observed in these potentially novel lineages. Location mapping showed that the novel lineage 1 is currently circulating in Malaysia, Thailand, Japan and China, while novel lineage 2 can be found in Malaysia and China. Molecular dating showed the origin of HCoV-OC43 around late 1950s, before it diverged into genotypes A (1960s), B (1990s), and other genotypes (2000s). Phylogenetic analysis revealed that 27.3 % of the HCoV-HKU1 strains belong to genotype A while 72.7 % belongs to genotype B. The tree root of HCoV-HKU1 was similar to that of HCoV-OC43, with the tMRCA of genotypes A and B estimated around the 1990s and 2000s, respectively. Correlation of HCoV-OC43 and HCoV-HKU1 with the severity of respiratory symptoms was not observed. The present study reported the molecular complexity and evolutionary dynamics of human

  1. Radioisotope production in Malaysia

    Energy Technology Data Exchange (ETDEWEB)

    Wan Awang, Wan Anuar [Medical Technology Div., Malaysian Inst. for Nuclear Technology Research (MINT) (Malaysia)

    1998-10-01

    Production of Mo-99 by neutron activation of Mo-99 in Malaysia began as early as 1984. Regular supply of the Tc-99m extracted from it to the hospitals began in early 1988 after going through formal registration with the Malaysian Ministry of Health. Initially, the weekly demand was about 1.2 Ci of Mo-99 which catered the needs of 3 nuclear medicine centres. Sensitive to the increasing demand of Tc-99m, we have producing our own Tc-99m generator from imported TeO{sub 2} because irradiation TeO{sub 2} with our reactor give low yield of I-131. We have established the production of radioisotope for industrial use. By next year, Sm-153 EDTMP will be produce after we have license from our competent authority. (author)

  2. Locating a tree in a phylogenetic network

    OpenAIRE

    van Iersel, Leo; Semple, Charles; Steel, Mike

    2010-01-01

    Phylogenetic trees and networks are leaf-labelled graphs that are used to describe evolutionary histories of species. The Tree Containment problem asks whether a given phylogenetic tree is embedded in a given phylogenetic network. Given a phylogenetic network and a cluster of species, the Cluster Containment problem asks whether the given cluster is a cluster of some phylogenetic tree embedded in the network. Both problems are known to be NP-complete in general. In this article, we consider t...

  3. Telecommunication Value Network in Malaysia

    OpenAIRE

    Ong, Li Chien

    2009-01-01

    Business network is believed to offer a superior way of managing the challenges related to the uncertainty and complexity of the contemporary business environment in Malaysia telecommunication industry. This study strives to analyze the value business network in Malaysia telecommunication industry with emphasize on the market leader, Maxis Communication Bhd in its mobile content services. The business network represents the form of organization where the focal company focuses on certain key a...

  4. Charles Darwin, beetles and phylogenetics

    Science.gov (United States)

    Beutel, Rolf G.; Friedrich, Frank; Leschen, Richard A. B.

    2009-11-01

    . This has changed dramatically. With very large data sets and high throughput sampling, phylogenetic questions can be addressed without prior knowledge of morphological characters. Nevertheless, molecular studies have not lead to the great breakthrough in beetle systematics—yet. Especially the phylogeny of the extremely species rich suborder Polyphaga remains incompletely resolved. Coordinated efforts of molecular workers and of morphologists using innovative techniques may lead to more profound insights in the near future. The final aim is to develop a well-founded phylogeny, which truly reflects the evolution of this immensely species rich group of organisms.

  5. Charles Darwin, beetles and phylogenetics.

    Science.gov (United States)

    Beutel, Rolf G; Friedrich, Frank; Leschen, Richard A B

    2009-11-01

    changed dramatically. With very large data sets and high throughput sampling, phylogenetic questions can be addressed without prior knowledge of morphological characters. Nevertheless, molecular studies have not lead to the great breakthrough in beetle systematics--yet. Especially the phylogeny of the extremely species rich suborder Polyphaga remains incompletely resolved. Coordinated efforts of molecular workers and of morphologists using innovative techniques may lead to more profound insights in the near future. The final aim is to develop a well-founded phylogeny, which truly reflects the evolution of this immensely species rich group of organisms.

  6. A molecular phylogenetic and fruit evolutionary analysis of the major groups of the paleotropical woody bamboos (Gramineae: Bambusoideae) based on nuclear ITS, GBSSI gene and plastid trnL-F DNA sequences.

    Science.gov (United States)

    Yang, Han-Qi; Yang, Jun-Bo; Peng, Zhen-Hua; Gao, Jian; Yang, Yu-Ming; Peng, Sheng; Li, De-Zhu

    2008-09-01

    This study presented the first molecular phylogenetic analysis of the major clades of woody bamboos of the Old World tropics based on nuclear and chloroplast sequences (ITS, GBSSI and trnL-F). Sequence data from 53 species, representing 17 paleotropical woody bamboo genera, were analyzed using the maximum parsimony and Bayesian inference methods. All examined ingroup taxa were clustered into two clades, i.e., the Bambusinae+Dinochloa clade and the Melocanninae clade. The former clade included Bambusa, Bonia, Dendrocalamus, Dendrocalamopsis, Dinochloa, Gigantochloa, Molecalamus, Neomicrocalamus, Neosinocalamus, Oxytenanthera s. str. (sensu stricto), Racemobambos and Thyrsostachys. The Melocanninae clade consisted of Cephalostachyum, Leptocanna (better treated as part of Cephalostachyum), Melocanna, Pseudostachyum and Schizostachyum s. str. The subtribe Racemobambosinae and tribes Dendrocalameae and Oxytenanthereae were not supported and may be better placed in subtribe Bambusinae. The ovary characters seemed to be good criteria to distinguish these two clades. The reconstruction of ancestral fruit characters indicated that the bacoid caryopsis, namely, fleshy or berry-like fruits, was found to be scattered in three lineages of the examined paleotropical woody bamboos. Fruit characters are thus not reliable indicators of phylogeny and bacoid caryopsis likely represents a specialization for particular ecological conditions.

  7. Interpreting the universal phylogenetic tree

    Science.gov (United States)

    Woese, C. R.

    2000-01-01

    The universal phylogenetic tree not only spans all extant life, but its root and earliest branchings represent stages in the evolutionary process before modern cell types had come into being. The evolution of the cell is an interplay between vertically derived and horizontally acquired variation. Primitive cellular entities were necessarily simpler and more modular in design than are modern cells. Consequently, horizontal gene transfer early on was pervasive, dominating the evolutionary dynamic. The root of the universal phylogenetic tree represents the first stage in cellular evolution when the evolving cell became sufficiently integrated and stable to the erosive effects of horizontal gene transfer that true organismal lineages could exist.

  8. National Integration in Multicultural School Setting in Malaysia

    Science.gov (United States)

    Nordin, Abu Bakar; Alias, Norlidah; Siraj, Saedah

    2013-01-01

    Malaysia is a multicultural country constituting three major ethno-cultural groups, Malay and Bumiputera, Chinese and Indian. Owing to its diverse cultures attempts through a number of channels, politics, economics and social were made to bring about national integration. School is thought to be the most effective platform to bring about national…

  9. IT and Multimedia in Technical and Vocational Education in Malaysia.

    Science.gov (United States)

    Mustapha, Ramlee B.

    Development of information technology (IT) and the Multimedia Super Corridor (MSC) project has placed Malaysia within the global interconnectivity along with other developed nations. Types of IT applications are e-learning, e-mail, discussion group mailing lists, bulletin board systems, chat mode, newsgroups, Internet, tutorial, hypermedia, and…

  10. Ethnicity and Accommodation: Malay-Chinese Relations in Kelantan, Malaysia.

    Science.gov (United States)

    Raybeck, Douglas

    1980-01-01

    Argues that despite antipathy toward the Chinese manifested at state and urban levels, the Malay-Chinese relations at the village level in Kelantan, Malaysia, are better than corresponding relationships in the country's more developed states. Suggests both cultural and political reasons for the success of the Chinese group. (Author/GC)

  11. Molecular Phylogenetic: Organism Taxonomy Method Based on Evolution History

    Directory of Open Access Journals (Sweden)

    N.L.P Indi Dharmayanti

    2011-03-01

    Full Text Available Phylogenetic is described as taxonomy classification of an organism based on its evolution history namely its phylogeny and as a part of systematic science that has objective to determine phylogeny of organism according to its characteristic. Phylogenetic analysis from amino acid and protein usually became important area in sequence analysis. Phylogenetic analysis can be used to follow the rapid change of a species such as virus. The phylogenetic evolution tree is a two dimensional of a species graphic that shows relationship among organisms or particularly among their gene sequences. The sequence separation are referred as taxa (singular taxon that is defined as phylogenetically distinct units on the tree. The tree consists of outer branches or leaves that represents taxa and nodes and branch represent correlation among taxa. When the nucleotide sequence from two different organism are similar, they were inferred to be descended from common ancestor. There were three methods which were used in phylogenetic, namely (1 Maximum parsimony, (2 Distance, and (3 Maximum likehoood. Those methods generally are applied to construct the evolutionary tree or the best tree for determine sequence variation in group. Every method is usually used for different analysis and data.

  12. Reconstruction of phylogenetic trees of prokaryotes using maximal common intervals.

    Science.gov (United States)

    Heydari, Mahdi; Marashi, Sayed-Amir; Tusserkani, Ruzbeh; Sadeghi, Mehdi

    2014-10-01

    One of the fundamental problems in bioinformatics is phylogenetic tree reconstruction, which can be used for classifying living organisms into different taxonomic clades. The classical approach to this problem is based on a marker such as 16S ribosomal RNA. Since evolutionary events like genomic rearrangements are not included in reconstructions of phylogenetic trees based on single genes, much effort has been made to find other characteristics for phylogenetic reconstruction in recent years. With the increasing availability of completely sequenced genomes, gene order can be considered as a new solution for this problem. In the present work, we applied maximal common intervals (MCIs) in two or more genomes to infer their distance and to reconstruct their evolutionary relationship. Additionally, measures based on uncommon segments (UCS's), i.e., those genomic segments which are not detected as part of any of the MCIs, are also used for phylogenetic tree reconstruction. We applied these two types of measures for reconstructing the phylogenetic tree of 63 prokaryotes with known COG (clusters of orthologous groups) families. Similarity between the MCI-based (resp. UCS-based) reconstructed phylogenetic trees and the phylogenetic tree obtained from NCBI taxonomy browser is as high as 93.1% (resp. 94.9%). We show that in the case of this diverse dataset of prokaryotes, tree reconstruction based on MCI and UCS outperforms most of the currently available methods based on gene orders, including breakpoint distance and DCJ. We additionally tested our new measures on a dataset of 13 closely-related bacteria from the genus Prochlorococcus. In this case, distances like rearrangement distance, breakpoint distance and DCJ proved to be useful, while our new measures are still appropriate for phylogenetic reconstruction. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  13. Health Information in Malay (Bahasa Malaysia)

    Science.gov (United States)

    ... You Are Here: Home → Multiple Languages → Malay (Bahasa Malaysia) URL of this page: https://medlineplus.gov/languages/malay.html Health Information in Malay (Bahasa Malaysia) To use the sharing features on this page, ...

  14. Aging in Multi-ethnic Malaysia.

    Science.gov (United States)

    Tey, Nai Peng; Siraj, Saedah Binti; Kamaruzzaman, Shahrul Bahyah Binti; Chin, Ai Vyrn; Tan, Maw Pin; Sinnappan, Glaret Shirley; Müller, Andre Matthias

    2016-08-01

    Multiethnic Malaysia provides a unique case study of divergence in population aging of different sociocultural subgroups within a country. Malaysia represents 3 major ethnicities in Asia-the Malay, Chinese, and Indian. The 3 ethnic groups are at different stages of population aging, as they have undergone demographic transition at different pace amidst rapid social and economic changes. Between 1991 and 2010, the Malaysian population aged 60 and over has more than doubled from about 1 million to 2.2 million, and this is projected to rise to about 7 million or 17.6% of the projected population of 40 million by 2040. In 2010, the aging index ranged from 22.8% among the Bumiputera (Malays and other indigenous groups), to 31.4% among the Indians and 55.0% among the Chinese. Population aging provides great challenges for Malaysia's social and economic development. The increasing prevalence of noncommunicable diseases in older adults, coupled with the erosion of the traditional family support system has increased demands on health care services with an overwhelming need for multidisciplinary and specialized geriatric care. Following the adoption of the National Policy for the Elderly in 1995, issues of population aging have gained increasing attention, especially among researchers. There is an urgent need to increase public awareness, develop infrastructure, as well as support action oriented research that will directly translate to comprehensive and cohesive social strategies, policies, and legislation to protect not just the current older Malaysians but the future of all Malaysians. © The Author 2015. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Phylogenetics of neotropical Platymiscium (Leguminosae

    DEFF Research Database (Denmark)

    Saslis-Lagoudakis, C. Haris; Chase, Mark W; Robinson, Daniel N

    2008-01-01

    Platymiscium is a neotropical legume genus of forest trees in the Pterocarpus clade of the pantropical "dalbergioid" clade. It comprises 19 species (29 taxa), distributed from Mexico to southern Brazil. This study presents a molecular phylogenetic analysis of Platymiscium and allies inferred from...

  16. Phylogeny of economically important insect pests that infesting several crops species in Malaysia

    Science.gov (United States)

    Ghazali, Siti Zafirah; Zain, Badrul Munir Md.; Yaakop, Salmah

    2014-09-01

    This paper reported molecular data on insect pests of commercial crops in Peninsular Malaysia. Fifteen insect pests (Metisa plana, Calliteara horsefeldii, Cotesia vestalis, Bactrocera papayae, Bactrocera carambolae, Bactrocera latifrons, Conopomorpha cramella, Sesamia inferens, Chilo polychrysa, Rhynchophorus vulneratus, and Rhynchophorus ferrugineus) of nine crops were sampled (oil palm, coconut, paddy, cocoa, starfruit, angled loofah, guava, chili and mustard) and also four species that belong to the fern's pest (Herpetogramma platycapna) and storage and rice pests (Tribolium castaneum, Oryzaephilus surinamensis and Cadra cautella). The presented phylogeny summarized the initial phylogenetic hypothesis, which concerning by implementation of the economically important insect pests. In this paper, phylogenetic relationships among 39 individuals of 15 species that belonging to three orders under 12 genera were inferred from DNA sequences of mitochondrial marker, cytochrome oxidase subunit I (COI) and nuclear marker, ribosomal DNA 28S D2 region. The phylogenies resulted from the phylogenetic analyses of both genes are relatively similar, but differ in the sequence of evolution. Interestingly, this most recent molecular data of COI sequences data by using Bayesian Inference analysis resulted a more-resolved phylogeny that corroborated with traditional hypotheses of holometabolan relationships based on traditional hypotheses of holometabolan relationships and most of recently molecular study compared to 28S sequences. This finding provides the information on relationships of pests species, which infested several crops in Malaysia and also estimation on Holometabola's order relationships. The identification of the larval stages of insect pests could be done accurately, without waiting the emergence of adults and supported by the phylogenetic tree.

  17. International Women's Day observed in Malaysia.

    Science.gov (United States)

    1999-12-01

    On the eve of International Women's Day, 80 women representing five women's groups in Malaysia, including Persatuan Sahabat Wanita, CAW's network member, marched from Petaling Jaya to Penang to attend the Women's Day celebration. The group had organized the visitation in order to strengthen its networking. During their meeting with some reporters before their departure to Penang, they demanded that the women's groups be consulted before any guideline on the prevention and handling of sexual harassment at the workplace is drawn up. They said that they have been handling several complaints and their input would help the Human Resource Ministry formulate a comprehensive set of guidelines. This demand by the women's group was in response to the announcement by the Human Resource Minister Datuk Lim Ah Lek that in a month time a code would be ready on guidelines about the establishment and implementation of in-house preventive and redress mechanisms for dealing with sexual harassment. full text

  18. Phenotypic and molecular characterization of Colletotrichum species associated with anthracnose of banana (Musa spp) in Malaysia.

    Science.gov (United States)

    Intan Sakinah, M A; Suzianti, I V; Latiffah, Z

    2014-05-09

    Anthracnose caused by Colletotrichum species is a common postharvest disease of banana fruit. We investigated and identified Colletotrichum species associated with anthracnose in several local banana cultivars based on morphological characteristics and sequencing of ITS regions and of the β-tubulin gene. Thirty-eight Colletotrichum isolates were encountered in anthracnose lesions of five local banana cultivars, 'berangan', 'mas', 'awak', 'rastali', and 'nangka'. Based on morphological characteristics, 32 isolates were identified as Colletotrichum gloeosporioides and 6 isolates as C. musae. C. gloeosporioides isolates were divided into two morphotypes, with differences in colony color, shape of the conidia and growth rate. Based on ITS regions and β-tubulin sequences, 35 of the isolates were identified as C. gloeosporioides and only 3 isolates as C. musae; the percentage of similarity from BLAST ranged from 95-100% for ITS regions and 97-100% for β-tubulin. C. gloeosporioides isolates were more prevalent compared to C. musae. This is the first record of C. gloeosporioides associated with banana anthracnose in Malaysia. In a phylogenetic analysis of the combined dataset of ITS regions and β-tubulin using a maximum likelihood method, C. gloeosporioides and C. musae isolates were clearly separated into two groups. We concluded that C. gloeosporioides and C. musae isolates are associated with anthracnose in the local banana cultivars and that C. gloeosporioides is more prevalent than C. musae.

  19. Problem Etnisitas India Dalam Cerita Pendek Malaysia

    OpenAIRE

    M. Shoim Anwar

    2015-01-01

    Karya sastra adalah dokumen kemanusiaan dan kebudayaan. Kumpulan cerita pendek Menara 7 (1998), terutama enam cerpen yang ditulis oleh pengarang Malaysia beretnis India, memberi gambaran problem kehidupan etnis India di Malaysia. Dengan meminjam teori etnisitas sebagai landasan, tulisan ini bertujuan mengungkap problem etnisitas India di Malaysia. Problem etnis India terkait dengan kemiskinan, pendidikan, gender, religi, budaya, dan persatuan. Keberadaan etnis India di Malaysia secara histori...

  20. Utility of COX1 phylogenetics to differentiate between locally acquired and imported Plasmodium knowlesi infections in Singapore

    Science.gov (United States)

    Loh, Jin Phang; Gao, Qiu Han Christine; Lee, Vernon J; Tetteh, Kevin; Drakeley, Chris

    2016-01-01

    INTRODUCTION Although there have been several phylogenetic studies on Plasmodium knowlesi (P. knowlesi), only cytochrome c oxidase subunit 1 (COX1) gene analysis has shown some geographical differentiation between the isolates of different countries. METHODS Phylogenetic analysis of locally acquired P. knowlesi infections, based on circumsporozoite, small subunit ribosomal ribonucleic acid (SSU rRNA), merozoite surface protein 1 and COX1 gene targets, was performed. The results were compared with the published sequences of regional isolates from Malaysia and Thailand. RESULTS Phylogenetic analysis of the circumsporozoite, SSU rRNA and merozoite surface protein 1 gene sequences for regional P. knowlesi isolates showed no obvious differentiation that could be attributed to their geographical origin. However, COX1 gene analysis showed that it was possible to differentiate between Singapore-acquired P. knowlesi infections and P. knowlesi infections from Peninsular Malaysia and Sarawak, Borneo, Malaysia. CONCLUSION The ability to differentiate between locally acquired P. knowlesi infections and imported P. knowlesi infections has important utility for the monitoring of P. knowlesi malaria control programmes in Singapore. PMID:26805667

  1. Utility of COX1 phylogenetics to differentiate between locally acquired and imported Plasmodium knowlesi infections in Singapore.

    Science.gov (United States)

    Loh, Jin Phang; Gao, Qiu Han Christine; Lee, Vernon J; Tetteh, Kevin; Drakeley, Chris

    2016-12-01

    Although there have been several phylogenetic studies on Plasmodium knowlesi (P. knowlesi), only cytochrome c oxidase subunit 1 (COX1) gene analysis has shown some geographical differentiation between the isolates of different countries. Phylogenetic analysis of locally acquired P. knowlesi infections, based on circumsporozoite, small subunit ribosomal ribonucleic acid (SSU rRNA), merozoite surface protein 1 and COX1 gene targets, was performed. The results were compared with the published sequences of regional isolates from Malaysia and Thailand. Phylogenetic analysis of the circumsporozoite, SSU rRNA and merozoite surface protein 1 gene sequences for regional P. knowlesi isolates showed no obvious differentiation that could be attributed to their geographical origin. However, COX1 gene analysis showed that it was possible to differentiate between Singapore-acquired P. knowlesi infections and P. knowlesi infections from Peninsular Malaysia and Sarawak, Borneo, Malaysia. The ability to differentiate between locally acquired P. knowlesi infections and imported P. knowlesi infections has important utility for the monitoring of P. knowlesi malaria control programmes in Singapore. Copyright: © Singapore Medical Association

  2. International Atomic Energy Agency: activities in Malaysia

    Energy Technology Data Exchange (ETDEWEB)

    Hayati, Ainul [Nuclear Energy Unit, Bangi, Selangor (Malaysia)

    1994-12-31

    The two main IAEA activities participated by Malaysia - technical cooperation programme (TC) and regional cooperative agreement programme (RCA/IAEA AND IAEA/RCA/UNDP). This article highlighted some of the IAEA technical cooperation activities in Malaysia (i.e. Medicine, Agriculture, Industry, Strategic, Social Science), assistance, funding and contribution made by Malaysia to the IAEA since 1989.

  3. International Atomic Energy Agency: activities in Malaysia

    International Nuclear Information System (INIS)

    Ainul Hayati

    1994-01-01

    The two main IAEA activities participated by Malaysia - technical cooperation programme (TC) and regional cooperative agreement programme (RCA/IAEA AND IAEA/RCA/UNDP). This article highlighted some of the IAEA technical cooperation activities in Malaysia (i.e. Medicine, Agriculture, Industry, Strategic, Social Science), assistance, funding and contribution made by Malaysia to the IAEA since 1989

  4. One tree to link them all: a phylogenetic dataset for the European tetrapoda.

    Science.gov (United States)

    Roquet, Cristina; Lavergne, Sébastien; Thuiller, Wilfried

    2014-08-08

    Since the ever-increasing availability of phylogenetic informative data, the last decade has seen an upsurge of ecological studies incorporating information on evolutionary relationships among species. However, detailed species-level phylogenies are still lacking for many large groups and regions, which are necessary for comprehensive large-scale eco-phylogenetic analyses. Here, we provide a dataset of 100 dated phylogenetic trees for all European tetrapods based on a mixture of supermatrix and supertree approaches. Phylogenetic inference was performed separately for each of the main Tetrapoda groups of Europe except mammals (i.e. amphibians, birds, squamates and turtles) by means of maximum likelihood (ML) analyses of supermatrix applying a tree constraint at the family (amphibians and squamates) or order (birds and turtles) levels based on consensus knowledge. For each group, we inferred 100 ML trees to be able to provide a phylogenetic dataset that accounts for phylogenetic uncertainty, and assessed node support with bootstrap analyses. Each tree was dated using penalized-likelihood and fossil calibration. The trees obtained were well-supported by existing knowledge and previous phylogenetic studies. For mammals, we modified the most complete supertree dataset available on the literature to include a recent update of the Carnivora clade. As a final step, we merged the phylogenetic trees of all groups to obtain a set of 100 phylogenetic trees for all European Tetrapoda species for which data was available (91%). We provide this phylogenetic dataset (100 chronograms) for the purpose of comparative analyses, macro-ecological or community ecology studies aiming to incorporate phylogenetic information while accounting for phylogenetic uncertainty.

  5. On the Quirks of Maximum Parsimony and Likelihood on Phylogenetic Networks

    OpenAIRE

    Bryant, Christopher; Fischer, Mareike; Linz, Simone; Semple, Charles

    2015-01-01

    Maximum parsimony is one of the most frequently-discussed tree reconstruction methods in phylogenetic estimation. However, in recent years it has become more and more apparent that phylogenetic trees are often not sufficient to describe evolution accurately. For instance, processes like hybridization or lateral gene transfer that are commonplace in many groups of organisms and result in mosaic patterns of relationships cannot be represented by a single phylogenetic tree. This is why phylogene...

  6. Public awareness in promotion of tissue transplantation in Malaysia

    International Nuclear Information System (INIS)

    Abd Rani Samsudin; Hasim Mohammad

    1999-01-01

    Malaysia is a developing country in South East Asia with a population of 21 million. The population is multiracial, multicultural and multireligion and it is one of the few countries in the world which possess a multicomplexity way of life among its ethnic groups. The health care system in Malaysia is divided into two main system, i.e. government based or public service and private based health care practice. The idea about organ donation and transplant science has a rise in Malaysia some 30 years ago, and the first historical event of a kidney transplant from a cadaveric donor took place in 1976. 22 years down the line, the first heart transplant was performed in Malaysia. Over the last 22 years between 1976 and 1998 many programmes promoting the idea of organ and tissue transplantation has been came out throughout the country led by government based bodies and non governmental Organisation. In terms of government funding, supporting a transplant programme is not a cheap exercise and this aspect of health care financial burden must be given due consideration by government and non governmental bodies for success of the programme. Besides financial burden, there are the common dilemma of culture and religious barrier for the success of the programme, but this problem has been tackled extremely well by the government. The setting up of two tissue banks in Malaysia in 1991 has further enhanced the idea of organ and tissue transplantation in this country, and the establishment of the national transplant resource centre based at Hospital Kuala Lumpur provides a national coordination service system for both organ and tissue procurement services for the whole country. Organ and tissue donation programme-ne and finally the success of a national transplant programme will certainly depend on the health status and health priorities of the country, the standard of general education, the quality of life style while cultural and religious factors in Malaysia will play a minor

  7. Phylogenetic Signal in AFLP Data Sets

    NARCIS (Netherlands)

    Koopman, W.J.M.

    2005-01-01

    AFLP markers provide a potential source of phylogenetic information for molecular systematic studies. However, there are properties of restriction fragment data that limit phylogenetic interpretation of AFLPs. These are (a) possible nonindependence of fragments, (b) problems of homology assignment

  8. History of Neurosurgery in Malaysia.

    Science.gov (United States)

    Raffiq, Azman; Abdullah, Jafri Malin; Haspani, Saffari; Adnan, Johari Siregar

    2015-12-01

    The development of neurosurgical services and training in Malaysia began in 1963, with the first centre established in its capital city at Hospital Kuala Lumpur, aimed to provide much needed neurosurgical services and training in the field of neurology and neurosurgery. This center subsequently expanded in 1975 with the establishment of the Tunku Abdul Rahman Neuroscience Institute (IKTAR); which integrated the three allied interdependent disciplines of neurosurgery, neurology and psychiatry. The establishment of this institute catalysed the rapid expansion of neurosurgical services in Malaysia and paved the way for development of comprehensive training for doctors, nurses, and paramedics. This culminated in the establishments of a local comprehensive neurosurgery training program for doctors in 2001; followed by a training program for nurses and paramedics in 2006. To date, there are more than 60 neurosurgeons providing expert care in 11 centers across Malaysia, along with trained personnel in the field of neurosciences.

  9. U.S. Department of Education Fulbright-Hays Seminars Abroad Program, Malaysia June 26 - July 24, 1993. Participants' Reports.

    Science.gov (United States)

    Malaysian-American Commission on Educational Exchange, Kuala Lumpur.

    This document contains reports by 14 participants of a Fulbright-Hays seminar in Malaysia. Participants were introduced to Malaysia and the Malaysian way of life through talks, discussion and field trips to schools, and educational institutions and cultural centers throughout the country. At every location the group was given presentations on…

  10. Orthology prediction at scalable resolution by phylogenetic tree analysis

    Directory of Open Access Journals (Sweden)

    Huynen Martijn A

    2007-03-01

    Full Text Available Abstract Background Orthology is one of the cornerstones of gene function prediction. Dividing the phylogenetic relations between genes into either orthologs or paralogs is however an oversimplification. Already in two-species gene-phylogenies, the complicated, non-transitive nature of phylogenetic relations results in inparalogs and outparalogs. For situations with more than two species we lack semantics to specifically describe the phylogenetic relations, let alone to exploit them. Published procedures to extract orthologous groups from phylogenetic trees do not allow identification of orthology at various levels of resolution, nor do they document the relations between the orthologous groups. Results We introduce "levels of orthology" to describe the multi-level nature of gene relations. This is implemented in a program LOFT (Levels of Orthology From Trees that assigns hierarchical orthology numbers to genes based on a phylogenetic tree. To decide upon speciation and gene duplication events in a tree LOFT can be instructed either to perform classical species-tree reconciliation or to use the species overlap between partitions in the tree. The hierarchical orthology numbers assigned by LOFT effectively summarize the phylogenetic relations between genes. The resulting high-resolution orthologous groups are depicted in colour, facilitating visual inspection of (large trees. A benchmark for orthology prediction, that takes into account the varying levels of orthology between genes, shows that the phylogeny-based high-resolution orthology assignments made by LOFT are reliable. Conclusion The "levels of orthology" concept offers high resolution, reliable orthology, while preserving the relations between orthologous groups. A Windows as well as a preliminary Java version of LOFT is available from the LOFT website http://www.cmbi.ru.nl/LOFT.

  11. The transposition distance for phylogenetic trees

    OpenAIRE

    Rossello, Francesc; Valiente, Gabriel

    2006-01-01

    The search for similarity and dissimilarity measures on phylogenetic trees has been motivated by the computation of consensus trees, the search by similarity in phylogenetic databases, and the assessment of clustering results in bioinformatics. The transposition distance for fully resolved phylogenetic trees is a recent addition to the extensive collection of available metrics for comparing phylogenetic trees. In this paper, we generalize the transposition distance from fully resolved to arbi...

  12. Developing a Malaysia flood model

    Science.gov (United States)

    Haseldine, Lucy; Baxter, Stephen; Wheeler, Phil; Thomson, Tina

    2014-05-01

    Faced with growing exposures in Malaysia, insurers have a need for models to help them assess their exposure to flood losses. The need for an improved management of flood risks has been further highlighted by the 2011 floods in Thailand and recent events in Malaysia. The increasing demand for loss accumulation tools in Malaysia has lead to the development of the first nationwide probabilistic Malaysia flood model, which we present here. The model is multi-peril, including river flooding for thousands of kilometres of river and rainfall-driven surface water flooding in major cities, which may cause losses equivalent to river flood in some high-density urban areas. The underlying hazard maps are based on a 30m digital surface model (DSM) and 1D/2D hydraulic modelling in JFlow and RFlow. Key mitigation schemes such as the SMART tunnel and drainage capacities are also considered in the model. The probabilistic element of the model is driven by a stochastic event set based on rainfall data, hence enabling per-event and annual figures to be calculated for a specific insurance portfolio and a range of return periods. Losses are estimated via depth-damage vulnerability functions which link the insured damage to water depths for different property types in Malaysia. The model provides a unique insight into Malaysian flood risk profiles and provides insurers with return period estimates of flood damage and loss to property portfolios through loss exceedance curve outputs. It has been successfully validated against historic flood events in Malaysia and is now being successfully used by insurance companies in the Malaysian market to obtain reinsurance cover.

  13. Using tree diversity to compare phylogenetic heuristics.

    Science.gov (United States)

    Sul, Seung-Jin; Matthews, Suzanne; Williams, Tiffani L

    2009-04-29

    Evolutionary trees are family trees that represent the relationships between a group of organisms. Phylogenetic heuristics are used to search stochastically for the best-scoring trees in tree space. Given that better tree scores are believed to be better approximations of the true phylogeny, traditional evaluation techniques have used tree scores to determine the heuristics that find the best scores in the fastest time. We develop new techniques to evaluate phylogenetic heuristics based on both tree scores and topologies to compare Pauprat and Rec-I-DCM3, two popular Maximum Parsimony search algorithms. Our results show that although Pauprat and Rec-I-DCM3 find the trees with the same best scores, topologically these trees are quite different. Furthermore, the Rec-I-DCM3 trees cluster distinctly from the Pauprat trees. In addition to our heatmap visualizations of using parsimony scores and the Robinson-Foulds distance to compare best-scoring trees found by the two heuristics, we also develop entropy-based methods to show the diversity of the trees found. Overall, Pauprat identifies more diverse trees than Rec-I-DCM3. Overall, our work shows that there is value to comparing heuristics beyond the parsimony scores that they find. Pauprat is a slower heuristic than Rec-I-DCM3. However, our work shows that there is tremendous value in using Pauprat to reconstruct trees-especially since it finds identical scoring but topologically distinct trees. Hence, instead of discounting Pauprat, effort should go in improving its implementation. Ultimately, improved performance measures lead to better phylogenetic heuristics and will result in better approximations of the true evolutionary history of the organisms of interest.

  14. High-resolution phylogenetic microbial community profiling

    Energy Technology Data Exchange (ETDEWEB)

    Singer, Esther; Coleman-Derr, Devin; Bowman, Brett; Schwientek, Patrick; Clum, Alicia; Copeland, Alex; Ciobanu, Doina; Cheng, Jan-Fang; Gies, Esther; Hallam, Steve; Tringe, Susannah; Woyke, Tanja

    2014-03-17

    The representation of bacterial and archaeal genome sequences is strongly biased towards cultivated organisms, which belong to merely four phylogenetic groups. Functional information and inter-phylum level relationships are still largely underexplored for candidate phyla, which are often referred to as microbial dark matter. Furthermore, a large portion of the 16S rRNA gene records in the GenBank database are labeled as environmental samples and unclassified, which is in part due to low read accuracy, potential chimeric sequences produced during PCR amplifications and the low resolution of short amplicons. In order to improve the phylogenetic classification of novel species and advance our knowledge of the ecosystem function of uncultivated microorganisms, high-throughput full length 16S rRNA gene sequencing methodologies with reduced biases are needed. We evaluated the performance of PacBio single-molecule real-time (SMRT) sequencing in high-resolution phylogenetic microbial community profiling. For this purpose, we compared PacBio and Illumina metagenomic shotgun and 16S rRNA gene sequencing of a mock community as well as of an environmental sample from Sakinaw Lake, British Columbia. Sakinaw Lake is known to contain a large age of microbial species from candidate phyla. Sequencing results show that community structure based on PacBio shotgun and 16S rRNA gene sequences is highly similar in both the mock and the environmental communities. Resolution power and community representation accuracy from SMRT sequencing data appeared to be independent of GC content of microbial genomes and was higher when compared to Illumina-based metagenome shotgun and 16S rRNA gene (iTag) sequences, e.g. full-length sequencing resolved all 23 OTUs in the mock community, while iTags did not resolve closely related species. SMRT sequencing hence offers various potential benefits when characterizing uncharted microbial communities.

  15. Climatic variability of east Malaysia

    International Nuclear Information System (INIS)

    Camerlengo, A.L.; Saadon, M.N.; Awang, M.; Somchit, H.; Rang, L.Y.

    2001-01-01

    The objective of this paper is to learn the variability of atmospheric pressure, relative humidity and insolation in East Malaysia. The main results of our study are: (1) a gentle pressure gradient is observed at the east coast in the boreal winter, (2) smaller atmospheric pressure values are noted during the first inter-monsoon period all across East Malaysia, (3) lesser insolation values are observed in Sarawak and at the east coast during the boreal winter as compared to the boreal summer, and (4) a poleward increase of insolation is registered. (author)

  16. Proton - Malaysia's national car project

    DEFF Research Database (Denmark)

    Fleming, Daniel; Søborg, Henrik

    2017-01-01

    The rise and development of the Malaysian national car project. How this project has become an esential part of the industrial development in Malaysia and how it has underpinned a growing middle class consumption culture with house and car as it pivotal goods.......The rise and development of the Malaysian national car project. How this project has become an esential part of the industrial development in Malaysia and how it has underpinned a growing middle class consumption culture with house and car as it pivotal goods....

  17. Norm waste management in Malaysia

    International Nuclear Information System (INIS)

    Muhamat Omar

    2000-01-01

    There are a number of industries generating NORM wastes in Malaysia. These include oil and gas and minerals/ores processing industries. A safe management of radioactive wastes is required. The existing guidelines are insufficient to help the management of oil and gas wastes. More guidelines are required to deal with NORM wastes from minerals/ores processing industries. To ensure that radioactive wastes are safely managed and disposed of, a National Policy on the Safe Management of Radioactive Waste is being developed which also include NORM waste. This paper describes the current status of NORM waste management in Malaysia. (author)

  18. Diversity and Evolutionary Histories of Human Coronaviruses NL63 and 229E Associated with Acute Upper Respiratory Tract Symptoms in Kuala Lumpur, Malaysia.

    Science.gov (United States)

    Al-Khannaq, Maryam Nabiel; Ng, Kim Tien; Oong, Xiang Yong; Pang, Yong Kek; Takebe, Yutaka; Chook, Jack Bee; Hanafi, Nik Sherina; Kamarulzaman, Adeeba; Tee, Kok Keng

    2016-05-04

    The human alphacoronaviruses HCoV-NL63 and HCoV-229E are commonly associated with upper respiratory tract infections (URTI). Information on their molecular epidemiology and evolutionary dynamics in the tropical region of southeast Asia however is limited. Here, we analyzed the phylogenetic, temporal distribution, population history, and clinical manifestations among patients infected with HCoV-NL63 and HCoV-229E. Nasopharyngeal swabs were collected from 2,060 consenting adults presented with acute URTI symptoms in Kuala Lumpur, Malaysia, between 2012 and 2013. The presence of HCoV-NL63 and HCoV-229E was detected using multiplex polymerase chain reaction (PCR). The spike glycoprotein, nucleocapsid, and 1a genes were sequenced for phylogenetic reconstruction and Bayesian coalescent inference. A total of 68/2,060 (3.3%) subjects were positive for human alphacoronavirus; HCoV-NL63 and HCoV-229E were detected in 45 (2.2%) and 23 (1.1%) patients, respectively. A peak in the number of HCoV-NL63 infections was recorded between June and October 2012. Phylogenetic inference revealed that 62.8% of HCoV-NL63 infections belonged to genotype B, 37.2% was genotype C, while all HCoV-229E sequences were clustered within group 4. Molecular dating analysis indicated that the origin of HCoV-NL63 was dated to 1921, before it diverged into genotype A (1975), genotype B (1996), and genotype C (2003). The root of the HCoV-229E tree was dated to 1955, before it diverged into groups 1-4 between the 1970s and 1990s. The study described the seasonality, molecular diversity, and evolutionary dynamics of human alphacoronavirus infections in a tropical region. © The American Society of Tropical Medicine and Hygiene.

  19. Maximum Parsimony on Phylogenetic networks

    Science.gov (United States)

    2012-01-01

    Background Phylogenetic networks are generalizations of phylogenetic trees, that are used to model evolutionary events in various contexts. Several different methods and criteria have been introduced for reconstructing phylogenetic trees. Maximum Parsimony is a character-based approach that infers a phylogenetic tree by minimizing the total number of evolutionary steps required to explain a given set of data assigned on the leaves. Exact solutions for optimizing parsimony scores on phylogenetic trees have been introduced in the past. Results In this paper, we define the parsimony score on networks as the sum of the substitution costs along all the edges of the network; and show that certain well-known algorithms that calculate the optimum parsimony score on trees, such as Sankoff and Fitch algorithms extend naturally for networks, barring conflicting assignments at the reticulate vertices. We provide heuristics for finding the optimum parsimony scores on networks. Our algorithms can be applied for any cost matrix that may contain unequal substitution costs of transforming between different characters along different edges of the network. We analyzed this for experimental data on 10 leaves or fewer with at most 2 reticulations and found that for almost all networks, the bounds returned by the heuristics matched with the exhaustively determined optimum parsimony scores. Conclusion The parsimony score we define here does not directly reflect the cost of the best tree in the network that displays the evolution of the character. However, when searching for the most parsimonious network that describes a collection of characters, it becomes necessary to add additional cost considerations to prefer simpler structures, such as trees over networks. The parsimony score on a network that we describe here takes into account the substitution costs along the additional edges incident on each reticulate vertex, in addition to the substitution costs along the other edges which are

  20. A Distance Measure for Genome Phylogenetic Analysis

    Science.gov (United States)

    Cao, Minh Duc; Allison, Lloyd; Dix, Trevor

    Phylogenetic analyses of species based on single genes or parts of the genomes are often inconsistent because of factors such as variable rates of evolution and horizontal gene transfer. The availability of more and more sequenced genomes allows phylogeny construction from complete genomes that is less sensitive to such inconsistency. For such long sequences, construction methods like maximum parsimony and maximum likelihood are often not possible due to their intensive computational requirement. Another class of tree construction methods, namely distance-based methods, require a measure of distances between any two genomes. Some measures such as evolutionary edit distance of gene order and gene content are computational expensive or do not perform well when the gene content of the organisms are similar. This study presents an information theoretic measure of genetic distances between genomes based on the biological compression algorithm expert model. We demonstrate that our distance measure can be applied to reconstruct the consensus phylogenetic tree of a number of Plasmodium parasites from their genomes, the statistical bias of which would mislead conventional analysis methods. Our approach is also used to successfully construct a plausible evolutionary tree for the γ-Proteobacteria group whose genomes are known to contain many horizontally transferred genes.

  1. Molecular phylogenetics and historical biogeography of Rhinolophus bats.

    Science.gov (United States)

    Stoffberg, Samantha; Jacobs, David S; Mackie, Iain J; Matthee, Conrad A

    2010-01-01

    The phylogenetic relationships within the horseshoe bats (genus Rhinolophus) are poorly resolved, particularly at deeper levels within the tree. We present a better-resolved phylogenetic hypothesis for 30 rhinolophid species based on parsimony and Bayesian analyses of the mitochondrial cytochrome b gene and three nuclear introns (TG, THY and PRKC1). Strong support was found for the existence of two geographic clades within the monophyletic Rhinolophidae: an African group and an Oriental assemblage. The relaxed Bayesian clock method indicated that the two rhinolophid clades diverged approximately 35 million years ago and results from Dispersal Vicariance (DIVA) analysis suggest that the horseshoe bats arose in Asia and subsequently dispersed into Europe and Africa.

  2. Assessment Profile of Malaysia: High-Stakes External Examinations Dominate

    Science.gov (United States)

    Ong, Saw Lan

    2010-01-01

    Malaysia is a federation of 13 states located in South-east Asia. The country consists of two geographical regions; Peninsular Malaysia (also known as West Malaysia) and Malaysian Borneo (also known as East Malaysia) separated by the South China Sea. The educational administration in Malaysia is highly centralised with four hierarchical levels;…

  3. Transforming phylogenetic networks: Moving beyond tree space.

    Science.gov (United States)

    Huber, Katharina T; Moulton, Vincent; Wu, Taoyang

    2016-09-07

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent reticulate evolution. Unrooted phylogenetic networks form a special class of such networks, which naturally generalize unrooted phylogenetic trees. In this paper we define two operations on unrooted phylogenetic networks, one of which is a generalization of the well-known nearest-neighbor interchange (NNI) operation on phylogenetic trees. We show that any unrooted phylogenetic network can be transformed into any other such network using only these operations. This generalizes the well-known fact that any phylogenetic tree can be transformed into any other such tree using only NNI operations. It also allows us to define a generalization of tree space and to define some new metrics on unrooted phylogenetic networks. To prove our main results, we employ some fascinating new connections between phylogenetic networks and cubic graphs that we have recently discovered. Our results should be useful in developing new strategies to search for optimal phylogenetic networks, a topic that has recently generated some interest in the literature, as well as for providing new ways to compare networks. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Mitochondrial DNA analyses reveal low genetic diversity in Culex quinquefasciatus from residential areas in Malaysia.

    Science.gov (United States)

    Low, V L; Lim, P E; Chen, C D; Lim, Y A L; Tan, T K; Norma-Rashid, Y; Lee, H L; Sofian-Azirun, M

    2014-06-01

    The present study explored the intraspecific genetic diversity, dispersal patterns and phylogeographic relationships of Culex quinquefasciatus Say (Diptera: Culicidae) in Malaysia using reference data available in GenBank in order to reveal this species' phylogenetic relationships. A statistical parsimony network of 70 taxa aligned as 624 characters of the cytochrome c oxidase subunit I (COI) gene and 685 characters of the cytochrome c oxidase subunit II (COII) gene revealed three haplotypes (A1-A3) and four haplotypes (B1-B4), respectively. The concatenated sequences of both COI and COII genes with a total of 1309 characters revealed seven haplotypes (AB1-AB7). Analysis using tcs indicated that haplotype AB1 was the common ancestor and the most widespread haplotype in Malaysia. The genetic distance based on concatenated sequences of both COI and COII genes ranged from 0.00076 to 0.00229. Sequence alignment of Cx. quinquefasciatus from Malaysia and other countries revealed four haplotypes (AA1-AA4) by the COI gene and nine haplotypes (BB1-BB9) by the COII gene. Phylogenetic analyses demonstrated that Malaysian Cx. quinquefasciatus share the same genetic lineage as East African and Asian Cx. quinquefasciatus. This study has inferred the genetic lineages, dispersal patterns and hypothetical ancestral genotypes of Cx. quinquefasciatus. © 2013 The Royal Entomological Society.

  5. The Convolvulaceae of Malaysia, I

    NARCIS (Netherlands)

    Ooststroom, van S.J.

    1938-01-01

    This is the first contribution to a series of papers dealing with the Convolvulaceae of Malaysia (Malay Peninsula and Archipelago, Philippines and New Guinea). As far as possible the contributions will be published in accordance with the systematical arrangement of the genera. For a survey on this

  6. Anurans Collected in West Malaysia

    DEFF Research Database (Denmark)

    Cedhagen, Tomas

    1997-01-01

    Distributional records and natural history noles are given for anurans collected in West Malaysia 1976. Rano baramica was observed when it was caught by an Ahaetulfa nasula (Serpentes: Colubridae). Rhacophorus leucomystax, Limnonectes limnociulris and Microhyla heymonsi were all found al night on...

  7. The Mountaineer-Malaysia Connection.

    Science.gov (United States)

    Young, Jeff

    1997-01-01

    A 26-day summer field course of West Virginia University's (WVU) Recreation and Parks Department took students to Malaysia's mountains and rainforests to observe how Malaysians are managing national parks, problem elephants, and population pressures on parks. The adventure provided powerful learning experiences. Further exchanges between WVU and…

  8. Primary Teacher Education in Malaysia

    Science.gov (United States)

    Ching, Chin Phoi; Yee, Chin Peng

    2012-01-01

    In Malaysia the training of primary school teachers is solely carried out by teacher training institutes which offer the Bachelor of Teaching with Honors (Primary education) program and was first launched in 2007. This program prepares primary school teachers specializing in various subjects or major and is carried out in 27 teacher training…

  9. Imported yaws in Johor, Malaysia.

    Science.gov (United States)

    Mohamed, K N

    1988-12-01

    Yaws was detected in a six-member family in the southern Malaysia state of Johor. This stresses the need to be vigilant against a long-forgotten disease of childhood which was of great public health concern in the past.

  10. Malaysia Economic Monitor, June 2013

    OpenAIRE

    World Bank

    2013-01-01

    Following a strong performance in 2012, Malaysia's economy hit a soft patch in the first quarter of 2013. Economic growth has been supported by the strong, broad-based performance of domestic consumption and investment from public and private sources. The acceleration of investment growth has been a key feature of the recent growth trend. Public and private consumption has also underpinned...

  11. Child Care Services in Malaysia

    Science.gov (United States)

    Pheng, Liew Sau

    2007-01-01

    Malaysia is a multi-ethnic, multi-racial, and multi-religious country with a population of more than 25 million people who live in the Peninsular and the States of Sabah and Sarawak on Borneo Island. It is a harmonious and peaceful nation comprised of Malays, who are the ethnic majority, followed by Chinese, Indians, Ibans, Kadazandusuns, and…

  12. Daphniphyllum (Daphniphyllaceae) in Peninsular Malaysia

    NARCIS (Netherlands)

    Kiew, R.; Rafidah, A.R.

    2008-01-01

    Three species of Daphniphyllum occur in Peninsular Malaysia: D. glaucescens Blume var. lancifolium (Hook.f.) T.C.Huang, D. laurinum (Benth.) Baill. and D. scortechinii Hook.f. Daphniphyllum glaucescens var. glaucescens and var. blumeanum (Baill. ex Müll.Arg.) J.J.Sm. do not occur in Peninsular

  13. Is invasion success of Australian trees mediated by their native biogeography, phylogenetic history, or both?

    Science.gov (United States)

    Miller, Joseph T; Hui, Cang; Thornhill, Andrew; Gallien, Laure; Le Roux, Johannes J; Richardson, David M

    2016-12-30

    For a plant species to become invasive it has to progress along the introduction-naturalization-invasion (INI) continuum which reflects the joint direction of niche breadth. Identification of traits that correlate with and drive species invasiveness along the continuum is a major focus of invasion biology. If invasiveness is underlain by heritable traits, and if such traits are phylogenetically conserved, then we would expect non-native species with different introduction status (i.e. position along the INI continuum) to show phylogenetic signal. This study uses two clades that contain a large number of invasive tree species from the genera Acacia and Eucalyptus to test whether geographic distribution and a novel phylogenetic conservation method can predict which species have been introduced, became naturalized, and invasive. Our results suggest that no underlying phylogenetic signal underlie the introduction status for both groups of trees, except for introduced acacias. The more invasive acacia clade contains invasive species that have smoother geographic distributions and are more marginal in the phylogenetic network. The less invasive eucalyptus group contains invasive species that are more clustered geographically, more centrally located in the phylogenetic network and have phylogenetic distances between invasive and non-invasive species that are trending toward the mean pairwise distance. This suggests that highly invasive groups may be identified because they have invasive species with smoother and faster expanding native distributions and are located more to the edges of phylogenetic networks than less invasive groups. Published by Oxford University Press on behalf of the Annals of Botany Company.

  14. Nonbinary Tree-Based Phylogenetic Networks.

    Science.gov (United States)

    Jetten, Laura; van Iersel, Leo

    2018-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can, for example, represent gene transfer events. Such phylogenetic networks are called tree-based. Here, we consider two possible generalizations of this concept to nonbinary networks, which we call tree-based and strictly-tree-based nonbinary phylogenetic networks. We give simple graph-theoretic characterizations of tree-based and strictly-tree-based nonbinary phylogenetic networks. Moreover, we show for each of these two classes that it can be decided in polynomial time whether a given network is contained in the class. Our approach also provides a new view on tree-based binary phylogenetic networks. Finally, we discuss two examples of nonbinary phylogenetic networks in biology and show how our results can be applied to them.

  15. Functional and phylogenetic ecology in R

    CERN Document Server

    Swenson, Nathan G

    2014-01-01

    Functional and Phylogenetic Ecology in R is designed to teach readers to use R for phylogenetic and functional trait analyses. Over the past decade, a dizzying array of tools and methods were generated to incorporate phylogenetic and functional information into traditional ecological analyses. Increasingly these tools are implemented in R, thus greatly expanding their impact. Researchers getting started in R can use this volume as a step-by-step entryway into phylogenetic and functional analyses for ecology in R. More advanced users will be able to use this volume as a quick reference to understand particular analyses. The volume begins with an introduction to the R environment and handling relevant data in R. Chapters then cover phylogenetic and functional metrics of biodiversity; null modeling and randomizations for phylogenetic and functional trait analyses; integrating phylogenetic and functional trait information; and interfacing the R environment with a popular C-based program. This book presents a uni...

  16. Surveying Ethnical Policies in Iran and Malaysia

    Directory of Open Access Journals (Sweden)

    Hamed Wendt

    2016-04-01

    Full Text Available On the bases of culture and ethnic nowadays the world is a plural world, in way that it’s reasonable to say nowhere could be exempted fro this classification. Researches conducted in this field have classified all countries whether developed or developing into lingual, religion, racial and cultural classes.As result of religious, cultural and ethnical overlapping between the countries and cases of unsatisfied needs and request by such group, local, national and even disputes between theses group and their governments is a common case through the ages.this study was conducted while having a historical look on the issue of ethnics in two countries including Iran and Malaysia and also surveying current situation and place of this challenge in the two countries, and also determining courses of ethnical and tradition reconstruction.

  17. Nuclear energy in Malaysia

    International Nuclear Information System (INIS)

    Jacob, F.X.

    1996-01-01

    The Malaysian Vision 2020 envisages doubling of the its economy every ten years for the next three decades. The Second Outline Perspective plan 1991-2000 (OPP2), also known as the National Development Policy (NDP) will set the pace to enable Malaysia to become a fully developed nation by the year 2020. The Malaysian economy is targeted to grow at 7 percent per annum in the decade of OPP2. In view of the targets set under Vision 2020, it is important to ensure that energy does not become a constraint to growth, and this sector develops in a least cost basis. Energy is crucial for industrialization and no modern industrial state can function without it. The paper presents a description of the main utilities in the country. Their installed capacities, maximum demand, generation mix and customers served are discussed. The electricity demand forecast till the year 2020 is presented. The paper presents this for 4 scenarios - a low growth, business as usual scenario, a moderate growth, business as usual scenario, a moderate growth, energy efficient scenario and a targeted growth, energy efficient scenario. The energy resources in the country is described together with its energy policy. The country's four-fuel policy is elaborated with the various options discussed. The environmental and pricing policies with regards to energy is also briefly given. Finally the nuclear option is presented in this context of the country's energy policy. The country had undertaken various studies for the nuclear option. These studies are given in the paper. The purpose of these studies and what the government decided is also discussed. Finally the prospects for the nuclear option in the future for the country is discussed. It is concluded that while, for the present, the nuclear option is not considered by the government, this may not be so in the future. The various reasons for this is given and the paper concludes that it may be prudent to keep this option under constant review. (J.P.N.)

  18. Phylogenetic analysis and systematic position of two new species of the ant genus Crematogaster (Hymenoptera, Formicidae from Southeast Asia

    Directory of Open Access Journals (Sweden)

    Shingo Hosoishi

    2017-11-01

    Full Text Available Two distinct new species of the ant genus Crematogaster, C. khmerensis sp. nov. and C. pfeifferi sp. nov., are described from Cambodia and Malaysia, respectively. The two species are unique among Asian Crematogaster in that they have vertically directed propodeal spines, but their systematic positions have not been determined based on morphological characters alone. Molecular phylogenetic analysis of 89 Crematogaster taxon matrices previously published plus C. khmerensis sp. nov., using nuclear genes, reveals that C. khmerensis sp. nov. is nested within the Australo-Asian Crematogaster clade. Morphological assignment of the developed pronotal shoulders implies a close relationship between C. khmerensis sp. nov. and the C. tetracantha-group. Based on molecular and morphological evidence, we erect a new species group, C. khmerensis-group, to contain C. khmerensis sp. nov. and C. pfeifferi sp. nov. Divergence time estimates using MCMCTree shows that the root node of the C. khmerensis sp. nov. terminal is estimated to be of middle Miocene age at 15 million years old. The position of the C. khmerensis-group well supports the Oriental- to Australian-region dispersal history that has been proposed for the Australo-Asian Crematogaster clade.

  19. Distribution of the Sunda Colugo (Galeopterus variegatus) in Malaysia (Peninsular, Sabah, Sarawak)

    OpenAIRE

    Nasir, Muhammad Dzulhelmi Muhammad; Abdullah, Mohd Tajuddin

    2010-01-01

    There is not much information available on the distribution of the Sunda colugo (Galeopterus variegates) in Malaysia, despite it being one of only two known species in the order Dermoptera. Data on the presence of the Sunda colugo and the vernacular names used by various ethnic groups throughout Malaysia were collected and compiled from various primary and secondary sources. There were 27 locations from Peninsular, 11 locations from Sabah and 34 locations from Sarawak that reported the presen...

  20. Pola Konsumsi Penduduk Kota Batam terhadap Produk Makanan Ringan Buatan Malaysia dengan Metode Etnografi

    OpenAIRE

    Universitas Putera Batam, Jurnal Ilmiah Manajemen

    2018-01-01

    The purpose of this study is to analyze the pattern of Batam City residents consumption of snack products produced by Malaysia. This goal is motivated by the population of Batam City comes from various ethnic groups in Indonesia and the pattern of consumption of snacks produced by Malaysia is very high. The approach used in this research is qualitative with ethnography method. The ethnographic form used is realistic ethnography that is an objective report of the situation, usually written in ...

  1. FACTORS ASSOCIATED WITH PREGNANCY AMONG UNMARRIED WOMEN IN MALAYSIA.

    Science.gov (United States)

    Zain, Norhasmah Mohd; Low, Wah Yun; Othman, Sajaratulnisah

    2015-05-01

    Pregnancy among unmarried women may have negative social and health implications in Malaysia. The number of pregnancies among unmarried women has increased in Malaysia, but the socio-demographic profile of these women is unclear. This study aims to evaluate the characteristics of unmarried pregnant women and the factors associated with unmarried pregnancies among young women in Malaysia. We conducted a cross sectional study at six hospitals and six women's shelters in Peninsular Malaysia during 2011-2012. Unmarried pregnant women were compared with married pregnant women. Participants were interviewed using a structured questionnaire asking for socio-demographic data, family background, risky sexual behavior, social support and pregnancy details. A total of 484 women (239 unmarried and 245 married) were included in the study. Most unmarried subjects were adolescents, from urban areas, from a low socioeconomic group, and lived with parents prior to pregnancy. Age (OR=0.67; 95% CI: 0.61-0.74), studying status (OR=17.33; 95% CI: 2.65-113.19), alcohol use (OR=40.46; 95% CI: 2.51-652.38) exposure to pornographic material (OR=13.48; 95% CI: 3.24-56.01), contraceptive use (OR=0.20; 95% CI: 0.08-0.51), and social support (OR=0.90; 95% CI: 0.86-0.94) were all associated with unmarried pregnancy. These factors need to be considered when.designing an intervention program.

  2. Monogenean anchor morphometry: systematic value, phylogenetic signal, and evolution

    Science.gov (United States)

    Soo, Oi Yoon Michelle; Tan, Wooi Boon; Lim, Lee Hong Susan

    2016-01-01

    Background. Anchors are one of the important attachment appendages for monogenean parasites. Common descent and evolutionary processes have left their mark on anchor morphometry, in the form of patterns of shape and size variation useful for systematic and evolutionary studies. When combined with morphological and molecular data, analysis of anchor morphometry can potentially answer a wide range of biological questions. Materials and Methods. We used data from anchor morphometry, body size and morphology of 13 Ligophorus (Monogenea: Ancyrocephalidae) species infecting two marine mugilid (Teleostei: Mugilidae) fish hosts: Moolgarda buchanani (Bleeker) and Liza subviridis (Valenciennes) from Malaysia. Anchor shape and size data (n = 530) were generated using methods of geometric morphometrics. We used 28S rRNA, 18S rRNA, and ITS1 sequence data to infer a maximum likelihood phylogeny. We discriminated species using principal component and cluster analysis of shape data. Adams’s Kmult was used to detect phylogenetic signal in anchor shape. Phylogeny-correlated size and shape changes were investigated using continuous character mapping and directional statistics, respectively. We assessed morphological constraints in anchor morphometry using phylogenetic regression of anchor shape against body size and anchor size. Anchor morphological integration was studied using partial least squares method. The association between copulatory organ morphology and anchor shape and size in phylomorphospace was used to test the Rohde-Hobbs hypothesis. We created monogeneaGM, a new R package that integrates analyses of monogenean anchor geometric morphometric data with morphological and phylogenetic data. Results. We discriminated 12 of the 13 Ligophorus species using anchor shape data. Significant phylogenetic signal was detected in anchor shape. Thus, we discovered new morphological characters based on anchor shaft shape, the length between the inner root point and the outer root

  3. Phylogenetic trees and Euclidean embeddings.

    Science.gov (United States)

    Layer, Mark; Rhodes, John A

    2017-01-01

    It was recently observed by de Vienne et al. (Syst Biol 60(6):826-832, 2011) that a simple square root transformation of distances between taxa on a phylogenetic tree allowed for an embedding of the taxa into Euclidean space. While the justification for this was based on a diffusion model of continuous character evolution along the tree, here we give a direct and elementary explanation for it that provides substantial additional insight. We use this embedding to reinterpret the differences between the NJ and BIONJ tree building algorithms, providing one illustration of how this embedding reflects tree structures in data.

  4. The rhabdoviruses: biodiversity, phylogenetics, and evolution.

    Science.gov (United States)

    Kuzmin, I V; Novella, I S; Dietzgen, R G; Padhi, A; Rupprecht, C E

    2009-07-01

    Rhabdoviruses (family Rhabdoviridae) include a diversity of important pathogens of animals and plants. They share morphology and genome organization. The understanding of rhabdovirus phylogeny, ecology and evolution has progressed greatly during the last 30 years, due to enhanced surveillance and improved methodologies of molecular characterization. Along with six established genera, several phylogenetic groups at different levels were described within the Rhabdoviridae. However, comparative relationships between viral phylogeny and taxonomy remains incomplete, with multiple representatives awaiting further genetic characterization. The same is true for rhabdovirus evolution. To date, rather simplistic molecular clock models only partially describe the evolutionary dynamics of postulated viral lineages. Ongoing progress in viral evolutionary and ecological investigations will provide the platform for future studies of this diverse family.

  5. Phylogenetic Conservatism in Plant Phenology

    Science.gov (United States)

    Davies, T. Jonathan; Wolkovich, Elizabeth M.; Kraft, Nathan J. B.; Salamin, Nicolas; Allen, Jenica M.; Ault, Toby R.; Betancourt, Julio L.; Bolmgren, Kjell; Cleland, Elsa E.; Cook, Benjamin I.; hide

    2013-01-01

    Phenological events defined points in the life cycle of a plant or animal have been regarded as highly plastic traits, reflecting flexible responses to various environmental cues. The ability of a species to track, via shifts in phenological events, the abiotic environment through time might dictate its vulnerability to future climate change. Understanding the predictors and drivers of phenological change is therefore critical. Here, we evaluated evidence for phylogenetic conservatism the tendency for closely related species to share similar ecological and biological attributes in phenological traits across flowering plants. We aggregated published and unpublished data on timing of first flower and first leaf, encompassing 4000 species at 23 sites across the Northern Hemisphere. We reconstructed the phylogeny for the set of included species, first, using the software program Phylomatic, and second, from DNA data. We then quantified phylogenetic conservatism in plant phenology within and across sites. We show that more closely related species tend to flower and leaf at similar times. By contrasting mean flowering times within and across sites, however, we illustrate that it is not the time of year that is conserved, but rather the phenological responses to a common set of abiotic cues. Our findings suggest that species cannot be treated as statistically independent when modelling phenological responses.Closely related species tend to resemble each other in the timing of their life-history events, a likely product of evolutionarily conserved responses to environmental cues. The search for the underlying drivers of phenology must therefore account for species' shared evolutionary histories.

  6. Population trends in Malaysia: 1970-2010

    Science.gov (United States)

    Rashid, Saharani Abdul; Ghani, Puzziawati Ab; Daud, Noorizam

    2014-12-01

    The size of population in Malaysia had reached 28.3 million in 2010 and is expected to increase to 38.6 million in the next 30 years. This demographic milestone that is causing renewed attention to the challenges caused by population growth. This paper looks at the last 40 years of changes in Malaysia population structure due to the changes in demographic phenomenon using data obtained from the Department of Statistics Malaysia. The principal finding of this research indicates that population structure in Malaysia had changed dramatically from the year 1970 to 2010. At the same time, Malaysia has completed its demographic transition in less than four decades. The fall in fertility and mortality rates have led to an improvement in the life expectancy of the population which has resulted an ageing population in Malaysia.

  7. Molecular Phylogenetics: Concepts for a Newcomer.

    Science.gov (United States)

    Ajawatanawong, Pravech

    Molecular phylogenetics is the study of evolutionary relationships among organisms using molecular sequence data. The aim of this review is to introduce the important terminology and general concepts of tree reconstruction to biologists who lack a strong background in the field of molecular evolution. Some modern phylogenetic programs are easy to use because of their user-friendly interfaces, but understanding the phylogenetic algorithms and substitution models, which are based on advanced statistics, is still important for the analysis and interpretation without a guide. Briefly, there are five general steps in carrying out a phylogenetic analysis: (1) sequence data preparation, (2) sequence alignment, (3) choosing a phylogenetic reconstruction method, (4) identification of the best tree, and (5) evaluating the tree. Concepts in this review enable biologists to grasp the basic ideas behind phylogenetic analysis and also help provide a sound basis for discussions with expert phylogeneticists.

  8. Phylogenetic Analysis Using Protein Mass Spectrometry.

    Science.gov (United States)

    Ma, Shiyong; Downard, Kevin M; Wong, Jason W H

    2017-01-01

    Through advances in molecular biology, comparative analysis of DNA sequences is currently the cornerstone in the study of molecular evolution and phylogenetics. Nevertheless, protein mass spectrometry offers some unique opportunities to enable phylogenetic analyses in organisms where DNA may be difficult or costly to obtain. To date, the methods of phylogenetic analysis using protein mass spectrometry can be classified into three categories: (1) de novo protein sequencing followed by classical phylogenetic reconstruction, (2) direct phylogenetic reconstruction using proteolytic peptide mass maps, and (3) mapping of mass spectral data onto classical phylogenetic trees. In this chapter, we provide a brief description of the three methods and the protocol for each method along with relevant tools and algorithms.

  9. Phylogenetic inertia and Darwin's higher law.

    Science.gov (United States)

    Shanahan, Timothy

    2011-03-01

    The concept of 'phylogenetic inertia' is routinely deployed in evolutionary biology as an alternative to natural selection for explaining the persistence of characteristics that appear sub-optimal from an adaptationist perspective. However, in many of these contexts the precise meaning of 'phylogenetic inertia' and its relationship to selection are far from clear. After tracing the history of the concept of 'inertia' in evolutionary biology, I argue that treating phylogenetic inertia and natural selection as alternative explanations is mistaken because phylogenetic inertia is, from a Darwinian point of view, simply an expected effect of selection. Although Darwin did not discuss 'phylogenetic inertia,' he did assert the explanatory priority of selection over descent. An analysis of 'phylogenetic inertia' provides a perspective from which to assess Darwin's view. Copyright © 2010 Elsevier Ltd. All rights reserved.

  10. Microbial keratitis in West and East Malaysia

    OpenAIRE

    Vanitha Ratnalingam; Thiageswari Umapathy; Kala Sumugam; Hanida Hanafi; Shamala Retnasabapathy

    2017-01-01

    AIM: To evaluate the epidemiological and etiological factors of microbial keratitis seen in tertiary hospitals in West and East Malaysia.METHODS: A total of 207 patients were enrolled. Patients referred for microbial keratitis to Sungai Buloh Hospital and Kuala Lumpur Hospital in West Malaysia and Queen Elizabeth Hospital and Kuching General Hospital in East Malaysia were recruited. Risk factors were documented. Corneal scrapings for microscopy and culture were performed.RESULTS: The most com...

  11. Seremban Urban Park, Malaysia: a Preference Study

    OpenAIRE

    Maulan, Suhardi

    2002-01-01

    Unlike the West, where many studies have explored how peopleâ s needs are fulfilled by urban parks, Malaysia has received very little attention from researchers. One reason for this is the fact that Malaysia has only a short public park tradition. Although folk art and stories have chronicled a long history of gardens and other parks, these spaces were only accessible to royal family members and autocrats. In Malaysia, the concept of free public parks is relatively recent, having been introd...

  12. Development of Consumer Credit Laws in Malaysia

    OpenAIRE

    Rahman, Ahmad Saufi Abdul

    2007-01-01

    Consumer Credit is a branch of Commercial Law, which has been developing in recent years inMalaysia. The purpose of this paper is to summarize the latest amendments in the consumer credit laws inMalaysia and to highlight its significance. The discussion will be limited to the three most important laws ofconsumer credit in Malaysia: the hire-purchase, money lending and pawn broking laws.

  13. Malaysia : the lucky man of Asia?

    OpenAIRE

    Kind, Hans Jarle; Ismail, Mohd Nazari

    2001-01-01

    Malaysia has been labelled the Lucky Man of Asia due to its wealth of natural resources, such as tin, rubber, palm oil, pepper, tropical timber, petroleum and a very fertile soil. There is no doubt that this richness has helped Malaysia to achieve impressive growth rates over the last decades, but history has taught us that large endowments of natural resources by far are sufficient to generate development. Since the early 1970s Malaysia has led a relatively successful racial integration poli...

  14. Combating Smuggling in Persons: A Malaysia Experience

    OpenAIRE

    Rahim Rohani Abdul; Ahmad Tajuddin Muhammad Afiq bin; Abu Bakar Kamaruddin bin Hj.; Abdul Rahim Mohammad Nizamuddin Bin

    2015-01-01

    Malaysia continues to face various challenges derived from the widespread of international migratory movement because of various economic reasons. Malaysia strategic geographical location, in the center of the South East Asian region made the country an attractive destination for human smuggling and trafficking in persons activities. Some of the smuggled persons may end up being trafficked victims base on the definition adopted by Malaysian laws on “trafficked victims”. Malaysia Anti-Traffick...

  15. Association of ABO blood groups with diabetes mellitus | Kamil ...

    African Journals Online (AJOL)

    Objective: So far no studies have been performed in Malaysia to look at association of diabetes mellitus (DM) with blood groups. We studied the association of ABO blood groups with DM type 2. Patients and methodology: It was a case control study conducted at Kepala Batas Hospital Batas, Penang, Malaysia in the year ...

  16. Nonbinary tree-based phylogenetic networks

    OpenAIRE

    Jetten, Laura; van Iersel, Leo

    2016-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can for example represent gene transfer events. Such phylogenetic networks are called tree-based. Here, we consider two possible generalizations of this concept to nonbinary networks, which we call tree-based and st...

  17. Retrospective Study of Leptospirosis in Malaysia.

    Science.gov (United States)

    Garba, Bashiru; Bahaman, Abdul Rani; Khairani-Bejo, Siti; Zakaria, Zunita; Mutalib, Abdul Rahim

    2017-06-01

    Leptospirosis is a bacterial disease transmitted to humans and animals by direct or indirect contact with urine or body fluids from infected animals especially rodents. Infection can be associated with wide clinical spectrum varying from asymptomatic to severe multi-organ syndrome with life-threatening consequences. We conducted a review of published studies on incidences, case reports, sero-epidemiological surveys from year 2000 to 2015 using different electronic data bases. Our study revealed that majority of the studies were conducted in Peninsular Malaysia and predominantly among high-risk human groups. Most of the studies on domestic animals were conducted in the 1980s; hence, the current status of leptospirosis among domestic animal population remains largely unknown. There tend to be a sharp rise in incidence rate among human population in the year 2014 which was attributed to flooding and heavy rainfall experienced as well as recreational activities. Several gaps in epidemiological knowledge were also disclosed.

  18. FORECASTING TOURIST ARRIVALS TO LANGKAWI ISLAND MALAYSIA

    Directory of Open Access Journals (Sweden)

    Kamarul Ariffin MANSOR

    2015-06-01

    Full Text Available Tourism is the act of travelling for a person or group of people from their own locality to a specific destination in a short term or long term period either for leisure or business purposes. Tourism is an important sector in the Malaysian economy where tourism development will lead to the positive economic development of the country and in general improve the quality of life for all citizens. Therefore, forecasting tourist arrivals with high accuracy becomes important since it may ensure the development and the readiness of all tourism related industries such as hotels, transportation, food and services industries and their best shape. This study focuses on tourist arrivals in Langkawi Island as one of the major tourist attractions situated in the northerly region of Peninsular Malaysia. Importantly, this paper attempts to measure and compare the performance of forecasting with Exponential Smoothing, ARIMA and ARFIMA models using the R software package.

  19. Risk group characteristics and viral transmission clusters in South-East Asian patients infected with HIV-1 circulating recombinant form (CRF)01_AE and subtype B

    Science.gov (United States)

    Oyomopito, Rebecca A; Chen, Yen-Ju; Sungkanuparph, Somnuek; Kantor, Rami; Merati, Tuti; Yam, Wing-Cheong; Sirisanthana, Thira; Li, Patrick CK; Kantipong, Pacharee; Phanuphak, Praphan; Lee, Chris KC; Kamarulzaman, Adeeba; Ditangco, Rossana; Huang, Szu-Wei; Sohn, Annette H; Law, Matthew; Chen, Yi Ming A

    2016-01-01

    HIV-1 epidemics in Asian countries are driven by varying exposures. The epidemiology of the regional pandemic has been changing with the spread of HIV-1 to lower-risk populations through sexual transmission. Common HIV-1 genotypes include subtype B and circulating recombinant form (CRF)01_AE. Our objective was to use HIV-1 genotypic data to better quantify local epidemics. TASER-M is a multi-centre prospective cohort of HIV-infected patients. Associations between HIV-exposure, patient gender, country of sample origin and HIV-1 genotype were evaluated by multivariate logistic regression. Phylogenetic methods were used on genotypic data to investigate transmission relationships. A total of 1086 patients from Thailand, Hong Kong, Malaysia and the Philippines were included in analyses. Proportions of males within countries varied (Thailand: 55.6%, Hong Kong: 86.1%, Malaysia: 81.4%, Philippines: 93.8%; p Malaysia: 47.8%, Philippines: 25.0%; p <0.001). After adjustment, we found increased subtype B infection among men-who-have-sex with-men, relative to heterosexual-reported exposures (OR = 2.4, p <0.001). We further describe four transmission clusters of 8–15 treatment naive, predominantly symptomatic patients (two each for subtype B and CRF01_AE). Risk-group sub-populations differed with respect to the infecting HIV-1 genotype. Homosexual exposure patients had a higher odds of being infected with subtype B. Where HIV-1 genotypes circulate within countries or patient risk-groups, local monitoring of genotype-specific transmissions may play a role in focussing public health prevention strategies. Phylogenetic evaluations provide complementary information for surveillance and monitoring of viruses with high mutation rates such as HIV-1 and Ebola. PMID:26362956

  20. Malaysia commercial energy flow: status and structure

    International Nuclear Information System (INIS)

    Ridzuan Abdul Mutalib; Maragatham Kumar; Nik Arlina Nik Ali; Abi Muttaqin Jalal Bayar; Aisya Raihan Abdul Kadir; Muhammed Zulfakar Zolkaffly; Azlinda Aziz; Jamal Khaer Ibrahim

    2008-08-01

    With further growth of Malaysia economy, future development of the energy sector in Malaysia is vital to ensure targeted growth. Commercial Energy continues to play a major role in ensuring a balanced energy mix for power generation due to a potential increase in energy demand from various sectors, especially the industrial sector. This paper presents the status and structure of Malaysia Commercial Energy Flow, which gives an overview of the flow of all types of energy sources from primary energy supply to final energy use, and also the potential for nuclear power in electricity generation in Malaysia. (Author)

  1. Malaysia implements the integrated approach.

    Science.gov (United States)

    1977-01-01

    Malaysia has implemented an integrated approach in providing family planning services to eligible couples. In 1964 the government of Malaysia adopted a national family planning program, and implementation began in the urban areas and extended into the rural areas. Other agencies are involved in providing family planning services and information including the Federation of Family Planning Associations, the Ministry of Health, the National Family Planning Board, and the Federal Land Development Authority. The number of women practicing contraception has increased from 20,726 in 1967 to 533,646 by 1976. and other methods, 3.9%, respectively. There has been an increase in the percentage of acceptors between ages 15-29 from 56% in 1968 to 71.3% in 1975. The 2nd Malaysian national plan will use a multidisciplinary approach to the problem.

  2. Improved Maximum Parsimony Models for Phylogenetic Networks.

    Science.gov (United States)

    Van Iersel, Leo; Jones, Mark; Scornavacca, Celine

    2018-05-01

    Phylogenetic networks are well suited to represent evolutionary histories comprising reticulate evolution. Several methods aiming at reconstructing explicit phylogenetic networks have been developed in the last two decades. In this article, we propose a new definition of maximum parsimony for phylogenetic networks that permits to model biological scenarios that cannot be modeled by the definitions currently present in the literature (namely, the "hardwired" and "softwired" parsimony). Building on this new definition, we provide several algorithmic results that lay the foundations for new parsimony-based methods for phylogenetic network reconstruction.

  3. New data on Rhyacophila (Trichoptera: Rhyacophilidae) from West Malaysia and Indonesia (Lombok and Bali) with descriptions of two new species.

    Science.gov (United States)

    Ivanov, Vladimir D; Melnitsky, Stanislav I

    2013-01-01

    A new species, Rhyacophila langkawia sp. n., belonging to the R. curvata Group sensu Schmid (1970) is described. The samples provide also material of the previously undescribed species cited by Schmid (1970) as R. schmidi, a nomen nudum; this species is described as R. schmidirossia sp. n., also in the R. curvata Group. Other sampled species were Rhyacophila curvata Morton, recorded for the first time from Negeri Sembilan (West Malaysia) and Lombok (Indonesia); Rhyacophila stheneboia Malicky & Prommi (Pahang and Negeri Sembilan, West Malaysia), and Rhyacophila anakbatukau Malicky, recorded for the first time from Lombok (Indonesia). Updated lists of the Rhyacophila species found in West Malaysia and Indonesia are provided.

  4. Disaggregated export demand of Malaysia: evidence from the electronics industry

    OpenAIRE

    Koi Nyen Wong

    2008-01-01

    This study estimates the determinants of foreign demand for Malaysia's top five electronics exports by SITC (Standard International Trade Classification) product groups from 1990 to 2001. Cointegration results indicate a unique long-run relationship between export demand for electronic products and relative prices and foreign income. Both the estimated long-run income and price elasticities of export demand are greater than 1, conforming to a pattern found in most fast-growing economies and i...

  5. DEMAND FOR MALAYSIA'S EXPORTS: EVIDENCE FROM THE ELECTRONICS INDUSTRY

    OpenAIRE

    Koi Nyen Wong

    2006-01-01

    This study estimates the determinants of foreign demand for Malaysia's top five electronics exports by SITC (Standard International Trade Classification) product groups from 1990 to 2001. Cointegration results indicate a unique long-run relationship between export demand for electronic products and relative prices and foreign income. Both the estimated long-run income and price elasticities of export demand are greater than 1, conforming to a pattern found in most fast-growing economies and i...

  6. Scalp hair as an indicator of environmental pollution in Malaysia

    International Nuclear Information System (INIS)

    Sarmani, S.; Koshy, T.; Zakaria, Z.

    1985-01-01

    The concentration of trace elements such as As, Br, Co, Cr, Fe, Hg, Sb, Se and Zn in the hair of the two population groups living in different regions of Malaysia were analysed by Instrumental Neutron Activation Analysis. The results for all elements analysed, except mercury, do not differ significantly from reported values for other regions of the world. Mercury from the urban sample is about twice the concentration of the rural sample. (author)

  7. Reducing income disparity for stability and development Malaysia's experience

    OpenAIRE

    Mohammad, Kamaruddin bin

    2002-01-01

    Approved for public release; distribution is unlimited Malaysia, a plural nation comprising of the indigenous Malays (Bumiputeras), and the immigrant Chinese and Indians has embarked on a unique program called the "New Economic Policy" (NEP) to ensure a fairer share of wealth, income, prosperity and opportunities between the ethnic groups. The NEP aimed to promote national unity by pursuing the twin objectives of the eradication of poverty and the restructuring of society to eliminate iden...

  8. A Review of Smoking Research In Malaysia.

    Science.gov (United States)

    Wee, L H; Chan, C M H; Yogarabindranath, S N

    2016-06-01

    Two hundred and seventy one original published materials related to tobacco use were found in a search through a database dedicated to indexing all original data relevant to Medicine and Health in Malaysia from 1996 - 2015. A total of 147 papers were selected and reviewed on the basis of their relevance and implications for future research. Findings were summarised, categorised and presented according to epidemiology, behaviour, clinical features and management of smoking. Most studies are cross-sectional with small sample sizes. Studies on smoking initiation and prevalence showed mixed findings with many small scale studies within the sub-groups. The majority of the studies were related to factors that contribute to initiation in adolescents. Nonetheless, there are limited studies on intervention strategies to curb smoking among this group. There is a lack of clinical studies to analyse tobacco use and major health problems in Malaysia. In addition, studies on the best treatment modalities on the use of pharmacotherapy and behavioural counselling have also remained unexplored. Reasons why smokers do not seek clinic help to quit smoking need further exploration. A finding on the extent of effort carried out by healthcare providers in assisting smokers to make quit attempts is not known. Studies on economic and government initiatives on policies and tobacco use focus mainly on the effects of cigarette bans, increased cigarettes taxes and the influence of the tobacco industry. Recommendations are given for the government to increase efforts in implementing smoke-free legislation, early and tailored interventions. Clinical studies in this area are lacking, as are opportunities to research on ways to reduce smoking initiation age and the most effective quit smoking strategies.

  9. Electricity energy outlook in Malaysia

    International Nuclear Information System (INIS)

    Tan, C S; Leong, Y P; Maragatham, K

    2013-01-01

    Population and income growth are the key drivers behind the growing demand for energy. Demand for electricity in Malaysia is always growing in tandem with its Gross Domestic Product (GDP) growth. The growth for electricity in Malaysia forecasted by Economic Planning Unit (EPU) has shown an increase of 3.52% in 2012 compared to 3.48% in 2011. This growth has been driven by strong demand growth from commercial and domestic sectors. The share of electricity consumption to total energy consumption has increased from 17.4% in 2007 to 21.7% in 2012. The total electricity production was reported at 122.12TWh in 2012, where gas is still the major fuel source contributing to 52.7% of the total generation fuel mix of electricity followed by Coal, 38.9%, hydro, 7.3%, oil, 1% and others, 0.2%. This paper aims to discuss the energy outlook particularly the electricity production and ways toward greener environment in electricity production in Malaysia

  10. Electricity energy outlook in Malaysia

    Science.gov (United States)

    Tan, C. S.; Maragatham, K.; Leong, Y. P.

    2013-06-01

    Population and income growth are the key drivers behind the growing demand for energy. Demand for electricity in Malaysia is always growing in tandem with its Gross Domestic Product (GDP) growth. The growth for electricity in Malaysia forecasted by Economic Planning Unit (EPU) has shown an increase of 3.52% in 2012 compared to 3.48% in 2011. This growth has been driven by strong demand growth from commercial and domestic sectors. The share of electricity consumption to total energy consumption has increased from 17.4% in 2007 to 21.7% in 2012. The total electricity production was reported at 122.12TWh in 2012, where gas is still the major fuel source contributing to 52.7% of the total generation fuel mix of electricity followed by Coal, 38.9%, hydro, 7.3%, oil, 1% and others, 0.2%. This paper aims to discuss the energy outlook particularly the electricity production and ways toward greener environment in electricity production in Malaysia

  11. Solid waste management in Malaysia

    International Nuclear Information System (INIS)

    Nadzri Yahaya

    2010-01-01

    All of the countries over the world have their own policies about how waste were managed. Malaysia as one of the developing country also faces this problems. So, the government was established Department of National Solid Waste Management under Ministry of Housing and Local Government to control and make sure all of these problem on waste will managed systematically. Guiding principle on these issues was mentioned in 3rd Outline Perspective Plan (2000 until 2010), National Policy on Solid Waste Management, National Strategic Plan on Solid Waste Management and also 10th Malaysian Plan. In 10th Malaysian Plan, the government will complete restructuring efforts in this Solid Waste Management sector with the federalization of solid waste management and public cleansing and full enforcement of the Solid Waste and Public Cleansing Management Act 2007. The key outcomes of these efforts will include providing support to local authorities, delivering comprehensive and sanitary services and ensuring that waste is managed in a sustainable manner. These presentations cover all aspect of solid waste management in Malaysia. What are guiding principle, paradigm shift, strategies approach, monitoring and enforcement and also mention about some issues and constraint that appear in Solid waste management in Malaysia.

  12. The Kuznets process in Malaysia.

    Science.gov (United States)

    Randolph, S

    1990-10-01

    This study looks at how the Kuznets process, the structural determinants of the aggregate inequality trend during the course of economic development, is transpiring in Malaysia. A time-series test of Kuznets's hypothesis concerning the trend in participation income in the course of economic growth and its underlying structural components is conducted using data from the Malaysian Family Life Survey. The study covers the period 1968-76 during which the equalizing phase of growth was expected to take hold. Analysis determined that while many of the underlying processes which Kuznets speculated combined to generate the aggregate trend in participation income are at work in Malaysia, others are either absent or their phasing has been altered. The equalizing phase in the course of development has been delayed in arriving. Inequality in the nonagricultural sector exceeded that in the agricultural sector, and the wage gap which opened during the early phase of development declined with further development. These findings conform with Kuznets's expectations. Available time-series evidence from other currently developing countries suggests that inequality is typically higher in the nonagricultural sector during the early phase of development and that an increasing and subsequently decreasing between-sector wage gap is a broadly shared experience. This study's findings also support Kuznets's expectation that inequality within the agricultural sector can worsen in the face of dualistic agricultural development. Finally, Malaysia's trend in inequality within the nonagricultural sector exerted the greatest influence upon the aggregate trend in inequality per Kuznets's hypothesis.

  13. Geobacillus zalihae sp. nov., a thermophilic lipolytic bacterium isolated from palm oil mill effluent in Malaysia.

    Science.gov (United States)

    Abd Rahman, Raja Noor Zaliha Raja; Leow, Thean Chor; Salleh, Abu Bakar; Basri, Mahiran

    2007-08-10

    Thermophilic Bacillus strains of phylogenetic Bacillus rRNA group 5 were described as a new genus Geobacillus. Their geographical distribution included oilfields, hay compost, hydrothermal vent or soils. The members from the genus Geobacillus have a growth temperatures ranging from 35 to 78 degrees C and contained iso-branched saturated fatty acids (iso-15:0, iso-16:0 and iso-17:0) as the major fatty acids. The members of Geobacillus have similarity in their 16S rRNA gene sequences (96.5-99.2%). Thermophiles harboring intrinsically stable enzymes are suitable for industrial applications. The quest for intrinsically thermostable lipases from thermophiles is a prominent task due to the laborious processes via genetic modification. Twenty-nine putative lipase producers were screened and isolated from palm oil mill effluent in Malaysia. Of these, isolate T1T was chosen for further study as relatively higher lipase activity was detected quantitatively. The crude T1 lipase showed high optimum temperature of 70 degrees C and was also stable up to 60 degrees C without significant loss of crude enzyme activity. Strain T1T was a Gram-positive, rod-shaped, endospore forming bacterium. On the basic of 16S rDNA analysis, strain T1T was shown to belong to the Bacillus rRNA group 5 related to Geobacillus thermoleovorans (DSM 5366T) and Geobacillus kaustophilus (DSM 7263T). Chemotaxonomic data of cellular fatty acids supported the affiliation of strain T1T to the genus Geobacillus. The results of physiological and biochemical tests, DNA/DNA hybridization, RiboPrint analysis, the length of lipase gene and protein pattern allowed genotypic and phenotypic differentiation of strain T1T from its validly published closest phylogenetic neighbors. Strain T1T therefore represents a novel species, for which the name Geobacillus zalihae sp. nov. is proposed, with the type strain T1T (=DSM 18318T; NBRC 101842T). Strain T1T was able to secrete extracellular thermostable lipase into culture

  14. Geobacillus zalihae sp. nov., a thermophilic lipolytic bacterium isolated from palm oil mill effluent in Malaysia

    Directory of Open Access Journals (Sweden)

    Salleh Abu

    2007-08-01

    Full Text Available Abstract Background Thermophilic Bacillus strains of phylogenetic Bacillus rRNA group 5 were described as a new genus Geobacillus. Their geographical distribution included oilfields, hay compost, hydrothermal vent or soils. The members from the genus Geobacillus have a growth temperatures ranging from 35 to 78°C and contained iso-branched saturated fatty acids (iso-15:0, iso-16:0 and iso-17:0 as the major fatty acids. The members of Geobacillus have similarity in their 16S rRNA gene sequences (96.5–99.2%. Thermophiles harboring intrinsically stable enzymes are suitable for industrial applications. The quest for intrinsically thermostable lipases from thermophiles is a prominent task due to the laborious processes via genetic modification. Results Twenty-nine putative lipase producers were screened and isolated from palm oil mill effluent in Malaysia. Of these, isolate T1T was chosen for further study as relatively higher lipase activity was detected quantitatively. The crude T1 lipase showed high optimum temperature of 70°C and was also stable up to 60°C without significant loss of crude enzyme activity. Strain T1T was a Gram-positive, rod-shaped, endospore forming bacterium. On the basic of 16S rDNA analysis, strain T1T was shown to belong to the Bacillus rRNA group 5 related to Geobacillus thermoleovorans (DSM 5366T and Geobacillus kaustophilus (DSM 7263T. Chemotaxonomic data of cellular fatty acids supported the affiliation of strain T1T to the genus Geobacillus. The results of physiological and biochemical tests, DNA/DNA hybridization, RiboPrint analysis, the length of lipase gene and protein pattern allowed genotypic and phenotypic differentiation of strain T1T from its validly published closest phylogenetic neighbors. Strain T1T therefore represents a novel species, for which the name Geobacillus zalihae sp. nov. is proposed, with the type strain T1T (=DSM 18318T; NBRC 101842T. Conclusion Strain T1T was able to secrete extracellular

  15. ISLAM AND MINORITIES: Managing Identity in Malaysia

    Directory of Open Access Journals (Sweden)

    Ahmad Suaedy

    2010-02-01

    Full Text Available The Malaysian general election in March 2008 raised an interesting and new phenomenon. For the first time since independence in 1957, the ruling alliance known as the National Front (Barisan Nasional, BN failed to secure two thirds of seats in parliament and lost control of five of Malaysia’s 13 states. This was due to the challenge presented by the new opposition alliance known as the Alternative Front (Barisan Alternatif, BA or the People’s Alliance (Pakatan Rakyat, PK which won more than 36% of seats in parliament and gained control of the five states. In the 2004 election, BN secured the largest ever percentage of seats in parliament with 91%. What is interesting is that it seems that this significant increase in support for the opposition is  due to their offer to change the way minorities and ethnicity is managed. They  propose a move from “Bumiputera Supremacy”, or affirmative action for the approximately 65% of “Bumiputera” Malaysians (the rest being largely of Chinese or Indian ethnicity, to “The People’s Supremacy”, which involves eradicating affirmative action based on ethnicity, basing it instead on need, for  instance need due to poverty. This would potentially increase the likelihood  of justice and equality for all ethnic or racial groups. This paper connects the phenomenon of change, as seen in the about turn in the results between the  2004 and 2008 elections, to the more global trend in which minorities are standing up to demand their rights in this era of globalization, and to the challenge multiculturalism presents to parts of the Muslim world such as Malaysia. Malaysia, a Muslim majority nation that has formally declared Islam the official state religion with Yang di-Pertuan Agong (the King as  Head of the State and symbol of Islam, is one example, though not necessarily  representative, of how Islam and Muslims manage minorities and identity or  multiculturalism within the process of globalization

  16. Phylogenetic turnover during subtropical forest succession across environmental and phylogenetic scales

    OpenAIRE

    Purschke, Oliver; Michalski, Stefan G.; Bruelheide, Helge; Durka, Walter

    2017-01-01

    Abstract Although spatial and temporal patterns of phylogenetic community structure during succession are inherently interlinked and assembly processes vary with environmental and phylogenetic scales, successional studies of community assembly have yet to integrate spatial and temporal components of community structure, while accounting for scaling issues. To gain insight into the processes that generate biodiversity after disturbance, we combine analyses of spatial and temporal phylogenetic ...

  17. Multiple Sclerosis in Malaysia: Demographics, Clinical Features, and Neuroimaging Characteristics

    Directory of Open Access Journals (Sweden)

    S. Viswanathan

    2013-01-01

    Full Text Available Background. Multiple sclerosis (MS is an uncommon disease in multiracial Malaysia. Diagnosing patients with idiopathic inflammatory demyelinating diseases has been greatly aided by the evolution in diagnostic criterion, the identification of new biomarkers, and improved accessibility to neuroimaging in the country. Objectives. To investigate the spectrum of multiple sclerosis in Malaysia. Methods. Retrospective analysis with longitudinal follow-up of patients referred to a single tertiary medical center with neurology services in Malaysia. Results. Out of 245 patients with idiopathic inflammatory demyelinating disease, 104 patients had multiple sclerosis. Female to male ratio was 5 : 1. Mean age at onset was 28.6 ± 9.9 years. The Malays were the predominant racial group affected followed by the Chinese, Indians, and other indigenous groups. Subgroup analysis revealed more Chinese having neuromyelitis optica and its spectrum disorders rather than multiple sclerosis. Positive family history was reported in 5%. Optic neuritis and myelitis were the commonest presentations at onset of disease, and relapsing remitting course was the commonest disease pattern observed. Oligoclonal band positivity was 57.6%. At disease onset, 61.5% and 66.4% fulfilled the 2005 and 2010 McDonald’s criteria for dissemination in space. Mean cord lesion length was 1.86 ± 1.65 vertebral segments in the relapsing remitting group as opposed to 6.25 ± 5.18 vertebral segments in patients with neuromyelitis optica and its spectrum disorders. Conclusion. The spectrum of multiple sclerosis in Malaysia has changed over the years. Further advancement in diagnostic criteria will no doubt continue to contribute to the evolution of this disease here.

  18. Multiple Sclerosis in Malaysia: Demographics, Clinical Features, and Neuroimaging Characteristics

    Science.gov (United States)

    Viswanathan, S.; Rose, N.; Masita, A.; Dhaliwal, J. S.; Puvanarajah, S. D.; Rafia, M. H.; Muda, S.

    2013-01-01

    Background. Multiple sclerosis (MS) is an uncommon disease in multiracial Malaysia. Diagnosing patients with idiopathic inflammatory demyelinating diseases has been greatly aided by the evolution in diagnostic criterion, the identification of new biomarkers, and improved accessibility to neuroimaging in the country. Objectives. To investigate the spectrum of multiple sclerosis in Malaysia. Methods. Retrospective analysis with longitudinal follow-up of patients referred to a single tertiary medical center with neurology services in Malaysia. Results. Out of 245 patients with idiopathic inflammatory demyelinating disease, 104 patients had multiple sclerosis. Female to male ratio was 5 : 1. Mean age at onset was 28.6 ± 9.9 years. The Malays were the predominant racial group affected followed by the Chinese, Indians, and other indigenous groups. Subgroup analysis revealed more Chinese having neuromyelitis optica and its spectrum disorders rather than multiple sclerosis. Positive family history was reported in 5%. Optic neuritis and myelitis were the commonest presentations at onset of disease, and relapsing remitting course was the commonest disease pattern observed. Oligoclonal band positivity was 57.6%. At disease onset, 61.5% and 66.4% fulfilled the 2005 and 2010 McDonald's criteria for dissemination in space. Mean cord lesion length was 1.86 ± 1.65 vertebral segments in the relapsing remitting group as opposed to 6.25 ± 5.18 vertebral segments in patients with neuromyelitis optica and its spectrum disorders. Conclusion. The spectrum of multiple sclerosis in Malaysia has changed over the years. Further advancement in diagnostic criteria will no doubt continue to contribute to the evolution of this disease here. PMID:24455266

  19. Schooling Policy in Malaysia.

    Science.gov (United States)

    De Tray, Dennis

    This paper presents the educational implications of an empirical study aimed at establishing current attendance rates, identifying the factors that influence attendance, and understanding how important these factors are for different groups in the Malaysian population through simulations and projections. Part 1 introduces the design and…

  20. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    NIRAJ SINGH

    for phylogenetic analysis of Gladiolus and related taxa using combined datasets from chloroplast genome. The psbA–trnH ... phylogenetic relationships among cultivars could be useful for hybridization programmes for further improvement of the crop. [Singh N. ... breeding in nature, and exhibited diverse pollination mech-.

  1. Nonbinary Tree-Based Phylogenetic Networks

    NARCIS (Netherlands)

    Jetten, L.; van Iersel, L.J.J.

    2018-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can for example

  2. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    Navya

    2 attached at the base of tree as the diverging Iridaceae relative's lineage. Present study revealed that psbA-trnH region are useful in addressing questions of phylogenetic relationships among the Gladiolus cultivars, as these intergenic spacers are more variable and have more phylogenetically informative sites than the ...

  3. A checklist of the bats of Peninsular Malaysia and progress towards a DNA barcode reference library.

    Science.gov (United States)

    Lim, Voon-Ching; Ramli, Rosli; Bhassu, Subha; Wilson, John-James

    2017-01-01

    Several published checklists of bat species have covered Peninsular Malaysia as part of a broader region and/or in combination with other mammal groups. Other researchers have produced comprehensive checklists for specific localities within the peninsula. To our knowledge, a comprehensive checklist of bats specifically for the entire geopolitical region of Peninsular Malaysia has never been published, yet knowing which species are present in Peninsular Malaysia and their distributions across the region are crucial in developing suitable conservation plans. Our literature search revealed that 110 bat species have been documented in Peninsular Malaysia; 105 species have precise locality records while five species lack recent and/or precise locality records. We retrieved 18 species from records dated before the year 2000 and seven species have only ever been recorded once. Our search of Barcode of Life Datasystems (BOLD) found that 86 (of the 110) species have public records of which 48 species have public DNA barcodes available from bats sampled in Peninsular Malaysia. Based on Neighbour-Joining tree analyses and the allocation of DNA barcodes to Barcode Index Number system (BINs) by BOLD, several DNA barcodes recorded under the same species name are likely to represent distinct taxa. We discuss these cases in detail and highlight the importance of further surveys to determine the occurences and resolve the taxonomy of particular bat species in Peninsular Malaysia, with implications for conservation priorities.

  4. Spatial distribution of malaria in Peninsular Malaysia from 2000 to 2009.

    Science.gov (United States)

    Alias, Haridah; Surin, Johari; Mahmud, Rohela; Shafie, Aziz; Mohd Zin, Junaidden; Mohamad Nor, Mahadzir; Ibrahim, Ahmad Shah; Rundi, Christina

    2014-04-15

    Malaria is still an endemic disease of public health importance in Malaysia. Populations at risk of contracting malaria includes indigenous people, traditional villagers, mobile ethnic groups and land scheme settlers, immigrants from malaria endemic countries as well as jungle workers and loggers. The predominant species are Plasmodium falciparum and P. vivax. An increasing number of P. knowlesi infections have also been encountered. The principal vectors in Peninsular Malaysia are Anopheles maculatus and An. cracens. This study aims to determine the changes in spatial distribution of malaria in Peninsular Malaysia from year 2000-2009. Data for the study was collected from Ministry of Health, Malaysia and was analysed using Geographic Information System (GIS). Changes for a period of 10 years of malaria spatial distribution in 12 states of Peninsular Malaysia were documented and discussed. This is illustrated by digital mapping according to five variables; incidence rate (IR), fatality rate (FR), annual blood examination rate (ABER), annual parasite index (API) and slide positivity rate (SPR). There is a profound change in the spatial distribution of malaria within a 10-year period. This is evident from the digital mapping of the infection in Peninsular Malaysia.

  5. Lesson Learned from Conditioning of Disused Sealed Radioactive Sources (DSRS) in Malaysia

    International Nuclear Information System (INIS)

    Nik Marzukee Nik Ibrahim; Mohd Abdul Wahab Yusof; Norasalwa Zakaria

    2016-01-01

    This paper presents the conditioning of disused sealed radioactive source (DSRS) in Malaysia. In Malaysia, sealed radioactive sources (SRS) are widely used in Malaysia especially in industry, medicine and research. Once SRS are no longer in use, they are declared disused and managed as radioactive waste. In order to reduce the risk associated with disused sealed radioactive sources (DSRS), the first priority would be to bring them under appropriate controls. This paper describes the experience developed and activities performed by Nuclear Malaysia throughout the period in conditioning of DSRS as well as future programme to further enhancing the infrastructure. Collaborative efforts with the various relevant groups such as Loji and Prototaip Development Centre (PDC) and Industrial Technology Division (BTI) provide an effective avenue in ensuring successful implementation of the programme. Currently, until August 2015, Malaysia has in possession about 12,154 unit of DSRS categories 3-5 and 4 units of DSRS category 2 sources which being stored at the interim storage facility Nuclear Malaysia. A national activity was implemented for the on-the-job training of personnel tasked with the conditioning of DSRS, at the Waste Technology Development Centre (WasTeC) facilities. This is part of -cradle-to-grave- control of radioactive sources to protect the workers and public from the hazards of ionizing radiation. (author)

  6. Molecular phylogenetics of porcini mushrooms (Boletus section Boletus).

    Science.gov (United States)

    Dentinger, Bryn T M; Ammirati, Joseph F; Both, Ernst E; Desjardin, Dennis E; Halling, Roy E; Henkel, Terry W; Moreau, Pierre-Arthur; Nagasawa, Eiji; Soytong, Kasem; Taylor, Andy F; Watling, Roy; Moncalvo, Jean-Marc; McLaughlin, David J

    2010-12-01

    Porcini (Boletus section Boletus: Boletaceae: Boletineae: Boletales) are a conspicuous group of wild, edible mushrooms characterized by fleshy fruiting bodies with a poroid hymenophore that is "stuffed" with white hyphae when young. Their reported distribution is with ectomycorrhizal plants throughout the Northern Hemisphere. Little progress has been made on the systematics of this group using modern molecular phylogenetic tools because sampling has been limited primarily to European species and the genes employed were insufficient to resolve the phylogeny. We examined the evolutionary history of porcini by using a global geographic sampling of most known species, new discoveries from little explored areas, and multiple genes. We used 78 sequences from the fast-evolving nuclear internal transcribed spacers and are able to recognize 18 reciprocally monophyletic species. To address whether or not porcini form a monophyletic group, we compiled a broadly sampled dataset of 41 taxa, including other members of the Boletineae, and used separate and combined phylogenetic analysis of sequences from the nuclear large subunit ribosomal DNA, the largest subunit of RNA polymerase II, and the mitochondrial ATPase subunit six gene. Contrary to previous studies, our separate and combined phylogenetic analyses support the monophyly of porcini. We also report the discovery of two taxa that expand the known distribution of porcini to Australia and Thailand and have ancient phylogenetic connections to the rest of the group. A relaxed molecular clock analysis with these new taxa dates the origin of porcini to between 42 and 54 million years ago, coinciding with the initial diversification of angiosperms, during the Eocene epoch when the climate was warm and humid. These results reveal an unexpected diversity, distribution, and ancient origin of a group of commercially valuable mushrooms that may provide an economic incentive for conservation and support the hypothesis of a tropical

  7. Phylogenetic congruence and ecological coherence in terrestrial Thaumarchaeota.

    Science.gov (United States)

    Oton, Eduard Vico; Quince, Christopher; Nicol, Graeme W; Prosser, James I; Gubry-Rangin, Cécile

    2016-01-01

    Thaumarchaeota form a ubiquitously distributed archaeal phylum, comprising both the ammonia-oxidising archaea (AOA) and other archaeal groups in which ammonia oxidation has not been demonstrated (including Group 1.1c and Group 1.3). The ecology of AOA in terrestrial environments has been extensively studied using either a functional gene, encoding ammonia monooxygenase subunit A (amoA) or 16S ribosomal RNA (rRNA) genes, which show phylogenetic coherence with respect to soil pH. To test phylogenetic congruence between these two markers and to determine ecological coherence in all Thaumarchaeota, we performed high-throughput sequencing of 16S rRNA and amoA genes in 46 UK soils presenting 29 available contextual soil characteristics. Adaptation to pH and organic matter content reflected strong ecological coherence at various levels of taxonomic resolution for Thaumarchaeota (AOA and non-AOA), whereas nitrogen, total mineralisable nitrogen and zinc concentration were also important factors associated with AOA thaumarchaeotal community distribution. Other significant associations with environmental factors were also detected for amoA and 16S rRNA genes, reflecting different diversity characteristics between these two markers. Nonetheless, there was significant statistical congruence between the markers at fine phylogenetic resolution, supporting the hypothesis of low horizontal gene transfer between Thaumarchaeota. Group 1.1c Thaumarchaeota were also widely distributed, with two clusters predominating, particularly in environments with higher moisture content and organic matter, whereas a similar ecological pattern was observed for Group 1.3 Thaumarchaeota. The ecological and phylogenetic congruence identified is fundamental to understand better the life strategies, evolutionary history and ecosystem function of the Thaumarchaeota.

  8. International Nuclear Information System in Malaysia

    International Nuclear Information System (INIS)

    Samsurdin Ahamad

    1984-01-01

    Practice of the International Nuclear Information System (INIS) in Malaysia is reviewed. The Nuclear Energy Unit, a participating representative of Malaysia, holds the responsibilities of disseminating information through this system. Its available services relevant to the aims of INIS are discussed

  9. An Exploration of African Students in Malaysia

    Science.gov (United States)

    Lian, Irene Tan Ai

    2011-01-01

    The exploratory study is an attempt to understand the reasons that prompted African students to study in Malaysia, the challenges encountered and the coping strategies used. The research on such topics among international students is well documented, but studies on international students in Malaysia are scarce. The sample included 155 African…

  10. The Evolution of Special Education in Malaysia

    Science.gov (United States)

    Lee, Lay Wah; Low, Hui Min

    2014-01-01

    This article traces the evolution of special education in Malaysia across four chronological stages: before and during the early colonial period (before 1900), pre-independence (1900-1957), post-independence (1957-1990) and modern Malaysia (1990 to the present), through document analysis. By placing current issues and trends within a historical…

  11. Homeschool in Malaysia: A Foresight Study

    Science.gov (United States)

    Kim-Soon, Ng; Rahman Bin Ahmad, Abd; Bin Sulaiman, Muhammad Ibrahim; Sirisa, Ng Mei Xin

    2015-01-01

    Homeschooling in Malaysia is a form of alternative education that emphasizes quality education based on moral values and beliefs while strengthening family bonds. This alternative form of education is being practiced by a growing number of families in Malaysia. As such, the Ministry of Education has given the green light for intending parents who…

  12. Partners for development: Expert assistant in Malaysia

    International Nuclear Information System (INIS)

    Daud, A.H.

    1996-01-01

    This report reviews the expert assignments received by Malaysia under the TC programme over the 1980-95 time period. It provides data about the type of assignments and expert services, the institutions receiving the experts, and duration of the assignment. Also reviewed is the process of requesting and implementing an expert assignment in Malaysia, as well as the country's related objectives and plans

  13. Workplace Learning in Malaysia: The Learner's Perspective

    Science.gov (United States)

    Muhamad, Mazanah; Idris, Khairuddin

    2005-01-01

    This paper offers a scenario of workplace learning as practiced in Malaysia. Based on survey research, the article describes learner profiles, learning provision and pattern. The analysis shows that Malaysians participate in formal workplace learning as part of their employment activities. Workplace learning in Malaysia is contextual, promoted by…

  14. Selected Malaysia air quality pollutants assessment using ...

    African Journals Online (AJOL)

    Analysis of PCA, FA, KMO and Bartlett's test were done on five main air quality pollutants (O3, NO2, SO2, CO and PM10) from all around Malaysia. From the data analysis obtained, the concentrations of air quality pollutants all around Malaysia starting from 2008 to 2011 were acceptable and the most dominant major ...

  15. Economic Education in Malaysia: A Brief Report.

    Science.gov (United States)

    Rao, C. A.

    1978-01-01

    This report provides a brief description of economic education in Malaysia and indicates interest, on the part of various Asian countries, i.e., Malaysia, Singapore, Indonesia, Thailand, and the Philippines, in the establishment of economic education programs. (Editor/RK)

  16. Notes on the Lecythidaceae of Peninsular Malaysia

    NARCIS (Netherlands)

    Prance, G.T.

    2010-01-01

    In preparation for the account of Lecythidaceae for the Flora of Peninsular Malaysia some changes involving new names are needed. The genus Abdulmajidia is reduced to synonymy with Barringtonia and the necessary new combinations are made. Three new species of Barringtonia from Malaysia are

  17. Notes on the Lecythidaceae of Peninsular Malaysia

    OpenAIRE

    Prance, G.T.

    2010-01-01

    In preparation for the account of Lecythidaceae for the Flora of Peninsular Malaysia some changes involving new names are needed. The genus Abdulmajidia is reduced to synonymy with Barringtonia and the necessary new combinations are made. Three new species of Barringtonia from Malaysia are described, B. badia, B. glomerata and B. norshamii.

  18. Global patterns of amphibian phylogenetic diversity

    DEFF Research Database (Denmark)

    Fritz, Susanne; Rahbek, Carsten

    2012-01-01

    Aim  Phylogenetic diversity can provide insight into how evolutionary processes may have shaped contemporary patterns of species richness. Here, we aim to test for the influence of phylogenetic history on global patterns of amphibian species richness, and to identify areas where macroevolutionary...... processes such as diversification and dispersal have left strong signatures on contemporary species richness. Location  Global; equal-area grid cells of approximately 10,000 km2. Methods  We generated an amphibian global supertree (6111 species) and repeated analyses with the largest available molecular...... phylogeny (2792 species). We combined each tree with global species distributions to map four indices of phylogenetic diversity. To investigate congruence between global spatial patterns of amphibian species richness and phylogenetic diversity, we selected Faith’s phylogenetic diversity (PD) index...

  19. On the quirks of maximum parsimony and likelihood on phylogenetic networks.

    Science.gov (United States)

    Bryant, Christopher; Fischer, Mareike; Linz, Simone; Semple, Charles

    2017-03-21

    Maximum parsimony is one of the most frequently-discussed tree reconstruction methods in phylogenetic estimation. However, in recent years it has become more and more apparent that phylogenetic trees are often not sufficient to describe evolution accurately. For instance, processes like hybridization or lateral gene transfer that are commonplace in many groups of organisms and result in mosaic patterns of relationships cannot be represented by a single phylogenetic tree. This is why phylogenetic networks, which can display such events, are becoming of more and more interest in phylogenetic research. It is therefore necessary to extend concepts like maximum parsimony from phylogenetic trees to networks. Several suggestions for possible extensions can be found in recent literature, for instance the softwired and the hardwired parsimony concepts. In this paper, we analyze the so-called big parsimony problem under these two concepts, i.e. we investigate maximum parsimonious networks and analyze their properties. In particular, we show that finding a softwired maximum parsimony network is possible in polynomial time. We also show that the set of maximum parsimony networks for the hardwired definition always contains at least one phylogenetic tree. Lastly, we investigate some parallels of parsimony to different likelihood concepts on phylogenetic networks. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Some epidemiological aspects and economic costs of injuries in Malaysia.

    Science.gov (United States)

    Arokiasamy, J T; Krishnan, R

    1994-01-01

    Injuries are one of the leading causes of death in the world. In Malaysia, injuries form one of the three main causes of mortality. They are also an important cause of permanent and temporary disability and work absenteeism in the productive age group. Increasing affluence and industrialization coupled with growing population and transportation needs in rapidly developing countries like Malaysia have resulted in a surge of road and occupational injuries. Three quarters of fatalities due to road, occupational, drowning and home injuries occur in those below 45 years of age. A majority of injuries in these categories are attributed to "human" factors and therefore can be prevented by public education and enforced training of workers. The total annual economic loss due to all types of injuries is estimated to be 2 billion Malaysian Ringgit (US$1 = MR2.76 approximately). The government is currently in the process of setting up full-time departments for road safety and occupational health and safety.

  1. Rare earth industries; Moving Malaysia's Green Economy Forward

    International Nuclear Information System (INIS)

    2011-08-01

    There is a famous saying, Where there is risk, there is opportunity. Rare earths present both health and environmental risks as well as potential economic opportunities. However, the risks are manageable thanks to improved technologies and a better understanding of the implications on health and the environment. This explains why there is a rush by many countries to reopen old mines and increase investment in the production of rare earths concentrate and their high value downstream products. Why is there such a scramble to risk money on rare earths? What have ignited global demand? Where are the opportunities? How are the risks associated with rare earths managed? Can Malaysia benefit from this new growth industry? What should be our strategies? This report, produced by the joint Working Group of the Academy of Sciences Malaysia (ASM) and the Majlis Professor Negara (MPN), discusses the science of rare earths and their business prospects; and proposes some strategic directions for Malaysia. The analysis is based on information culled from various secondary sources as well as the groups engagement with experts from the Rare Earths Society of China. (author)

  2. A Study of Quality Assurance Practices in the Universiti Sains Malaysia (USM, Malaysia

    Directory of Open Access Journals (Sweden)

    Helen KHOO Chooi Sim; Rozhan M. IDRUS

    2004-01-01

    Full Text Available This article looks at the quality assurance practices amongst three (3 groups of staff in the School of Distance Education, Universiti Sains Malaysia, i.e. lecturers, resident tutors and support staff. 9 dimensions of the Quality Assurance Practices i.e. Staff Development, Planning, Work Process, Team Work, Prioritise Customers, Performance Evaluation, System For Sending Of Learning Materials, System For Receiving Of Assignments From Students and Management of Students’ Records are identified in this study. The results show that quality assurances practices amongst three groups are different. Profile Analysis used in this research shows that quality assurance practices amongst lecturers and support staff are parallel. Results also show that quality assurance practices of resident tutors have profiles that differ from the lecturers and support staff.

  3. Carotenogenesis diversification in phylogenetic lineages of Rhodophyta.

    Science.gov (United States)

    Takaichi, Shinichi; Yokoyama, Akiko; Mochimaru, Mari; Uchida, Hiroko; Murakami, Akio

    2016-06-01

    Carotenoid composition is very diverse in Rhodophyta. In this study, we investigated whether this variation is related to the phylogeny of this group. Rhodophyta consists of seven classes, and they can be divided into two groups on the basis of their morphology. The unicellular group (Cyanidiophyceae, Porphyridiophyceae, Rhodellophyceae, and Stylonematophyceae) contained only β-carotene and zeaxanthin, "ZEA-type carotenoids." In contrast, within the macrophytic group (Bangiophyceae, Compsopogonophyceae, and Florideophyceae), Compsopogonophyceae contained antheraxanthin in addition to ZEA-type carotenoids, "ANT-type carotenoids," whereas Bangiophyceae contained α-carotene and lutein along with ZEA-type carotenoids, "LUT-type carotenoids." Florideophyceae is divided into five subclasses. Ahnfeltiophycidae, Hildenbrandiophycidae, and Nemaliophycidae contained LUT-type carotenoids. In Corallinophycidae, Hapalidiales and Lithophylloideae in Corallinales contained LUT-type carotenoids, whereas Corallinoideae in Corallinales contained ANT-type carotenoids. In Rhodymeniophycidae, most orders contained LUT-type carotenoids; however, only Gracilariales contained ANT-type carotenoids. There is a clear relationship between carotenoid composition and phylogenetics in Rhodophyta. Furthermore, we searched open genome databases of several red algae for references to the synthetic enzymes of the carotenoid types detected in this study. β-Carotene and zeaxanthin might be synthesized from lycopene, as in land plants. Antheraxanthin might require zeaxanthin epoxydase, whereas α-carotene and lutein might require two additional enzymes, as in land plants. Furthermore, Glaucophyta contained ZEA-type carotenoids, and Cryptophyta contained β-carotene, α-carotene, and alloxanthin, whose acetylenic group might be synthesized from zeaxanthin by an unknown enzyme. Therefore, we conclude that the presence or absence of the four enzymes is related to diversification of carotenoid

  4. Lenovo Group Ltd. : Achieving Competitive Advantages for its Hardware Business in Emerging Markets by Developing a Sustainable Business Model for its Software and Peripherals Business-The Malaysia Scenario.

    OpenAIRE

    Chin, Andrew Beng Huat

    2010-01-01

    From a humble beginning in late 1984, not much dufferent from how Hewlett-Packard Co. and Apple Inc. began from their family home garages, Lenovo Group Ltd., previously known as Legend Group Ltd. until 2003, is today the pride and joy in home country the People's Republic of China. By 1998, Lenovo had shipped its millionth personal computer (PC), and then Intel chairman, Andy Grove took the Legend PC back for Intel's museum collection. In 2003, Lenovo built and launched its second supercomput...

  5. Phylogenetic analysis of fungal ABC transporters.

    Science.gov (United States)

    Kovalchuk, Andriy; Driessen, Arnold J M

    2010-03-16

    The superfamily of ABC proteins is among the largest known in nature. Its members are mainly, but not exclusively, involved in the transport of a broad range of substrates across biological membranes. Many contribute to multidrug resistance in microbial pathogens and cancer cells. The diversity of ABC proteins in fungi is comparable with those in multicellular animals, but so far fungal ABC proteins have barely been studied. We performed a phylogenetic analysis of the ABC proteins extracted from the genomes of 27 fungal species from 18 orders representing 5 fungal phyla thereby covering the most important groups. Our analysis demonstrated that some of the subfamilies of ABC proteins remained highly conserved in fungi, while others have undergone a remarkable group-specific diversification. Members of the various fungal phyla also differed significantly in the number of ABC proteins found in their genomes, which is especially reduced in the yeast S. cerevisiae and S. pombe. Data obtained during our analysis should contribute to a better understanding of the diversity of the fungal ABC proteins and provide important clues about their possible biological functions.

  6. Malaysia Economic Monitor, June 2016 : Leveraging Trade Agreements

    OpenAIRE

    World Bank

    2016-01-01

    The MEM is the World Bank's biannual flagship publication on Malaysia. It provides analysis of recent economic developments and the near-term outlook for Malaysia. Each publication also focuses on a special topic related to Malaysia's transformation into a high-income economy. Malaysia is at the forefront of a "new generation" of trade agreements that will shape trade and investment over t...

  7. Malaysia mental health country profile.

    Science.gov (United States)

    Parameshvara Deva, M

    2004-01-01

    Malaysia is a tropical country in the heart of south east Asia with a population of 24 million people of diverse ethnic, cultural and religious backgrounds living in harmony in 330,000 km(2) of land on the Asian mainland and Borneo. Malaysia, which lies on the crossroads of trade between east and west Asia, has an ancient history as a centre of trading attracting commerce between Europe, west Asia, India and China. It has had influences from major powers that dominated the region throughout its history. Today the country, after independence in 1957, has embarked on an ambitious development project to make it a developed country by 2020. In this effort the economy has changed from one producing raw material to one manufacturing consumer goods and services and the colonial health system has been overhauled and social systems strengthened to provide better services for its people. The per capita income, which was under 1,000 US dollars at independence, has now passed 4,000 US dollars and continues to grow, with the economy largely based on strong exports that amount to over 100 billion US dollars. The mental health system that was based on institutional care in four mental hospitals at independence from British colonial rule in 1957 with no Malaysian psychiatrists is today largely based on over 30 general hospital psychiatric units spread throughout the country. With three local postgraduate training programmes in psychiatry and 12 undergraduate departments of psychiatry in the country--all started after independence--there is now a healthy development of mental health services. This is being supplemented by a newly established primary care mental health service that covers community mental health by integrating mental health into primary health care. Mental health care at the level of psychiatrists rests with about 140 psychiatrists most of whom had undertaken a four-year masters course in postgraduate psychiatry in Malaysia since 1973. However, there continues to be

  8. ISMS Implementation in Nuclear Malaysia

    International Nuclear Information System (INIS)

    Radhiah Jamalludin; Siti Nurbahyah Hamdan; Mohd Dzul Aiman Aslan

    2015-01-01

    Nuclear Malaysia provides important services and functions that depend on the resources including information. Use of the information assets must be consistent with good professional practices and procedures and legal requirements, regulations and contracts and the need to ensure the confidentiality, integrity and availability of all information assets of the Agency. ISO / IEC 27001, the international safety standard for information security management system provides the mandatory requirement to implement, review and continuously improve the Information Security Management System (ISMS). Information security policies and the implementation of ISMS is important to protect information assets from all threats; internal or external; intentionally or unintentionally. (author)

  9. The ethnobotany of psychoactive plant use: a phylogenetic perspective

    Directory of Open Access Journals (Sweden)

    Nashmiah Aid Alrashedy

    2016-10-01

    Full Text Available Psychoactive plants contain chemicals that presumably evolved as allelochemicals but target certain neuronal receptors when consumed by humans, altering perception, emotion and cognition. These plants have been used since ancient times as medicines and in the context of religious rituals for their various psychoactive effects (e.g., as hallucinogens, stimulants, sedatives. The ubiquity of psychoactive plants in various cultures motivates investigation of the commonalities among these plants, in which a phylogenetic framework may be insightful. A phylogeny of culturally diverse psychoactive plant taxa was constructed with their psychotropic effects and affected neurotransmitter systems mapped on the phylogeny. The phylogenetic distribution shows multiple evolutionary origins of psychoactive families. The plant families Myristicaceae (e.g., nutmeg, Papaveraceae (opium poppy, Cactaceae (peyote, Convolvulaceae (morning glory, Solanaceae (tobacco, Lamiaceae (mints, Apocynaceae (dogbane have a disproportionate number of psychoactive genera with various indigenous groups using geographically disparate members of these plant families for the same psychoactive effect, an example of cultural convergence. Pharmacological traits related to hallucinogenic and sedative potential are phylogenetically conserved within families. Unrelated families that exert similar psychoactive effects also modulate similar neurotransmitter systems (i.e., mechanistic convergence. However, pharmacological mechanisms for stimulant effects were varied even within families suggesting that stimulant chemicals may be more evolutionarily labile than those associated with hallucinogenic and sedative effects. Chemically similar psychoactive chemicals may also exist in phylogenetically unrelated lineages, suggesting convergent evolution or differential gene regulation of a common metabolic pathway. Our study has shown that phylogenetic analysis of traditionally used psychoactive plants

  10. Phylogenetic stratigraphy in the Guerrero Negro hypersaline microbial mat.

    Science.gov (United States)

    Harris, J Kirk; Caporaso, J Gregory; Walker, Jeffrey J; Spear, John R; Gold, Nicholas J; Robertson, Charles E; Hugenholtz, Philip; Goodrich, Julia; McDonald, Daniel; Knights, Dan; Marshall, Paul; Tufo, Henry; Knight, Rob; Pace, Norman R

    2013-01-01

    The microbial mats of Guerrero Negro (GN), Baja California Sur, Mexico historically were considered a simple environment, dominated by cyanobacteria and sulfate-reducing bacteria. Culture-independent rRNA community profiling instead revealed these microbial mats as among the most phylogenetically diverse environments known. A preliminary molecular survey of the GN mat based on only ∼1500 small subunit rRNA gene sequences discovered several new phylum-level groups in the bacterial phylogenetic domain and many previously undetected lower-level taxa. We determined an additional ∼119,000 nearly full-length sequences and 28,000 >200 nucleotide 454 reads from a 10-layer depth profile of the GN mat. With this unprecedented coverage of long sequences from one environment, we confirm the mat is phylogenetically stratified, presumably corresponding to light and geochemical gradients throughout the depth of the mat. Previous shotgun metagenomic data from the same depth profile show the same stratified pattern and suggest that metagenome properties may be predictable from rRNA gene sequences. We verify previously identified novel lineages and identify new phylogenetic diversity at lower taxonomic levels, for example, thousands of operational taxonomic units at the family-genus levels differ considerably from known sequences. The new sequences populate parts of the bacterial phylogenetic tree that previously were poorly described, but indicate that any comprehensive survey of GN diversity has only begun. Finally, we show that taxonomic conclusions are generally congruent between Sanger and 454 sequencing technologies, with the taxonomic resolution achieved dependent on the abundance of reference sequences in the relevant region of the rRNA tree of life.

  11. The space of ultrametric phylogenetic trees.

    Science.gov (United States)

    Gavryushkin, Alex; Drummond, Alexei J

    2016-08-21

    The reliability of a phylogenetic inference method from genomic sequence data is ensured by its statistical consistency. Bayesian inference methods produce a sample of phylogenetic trees from the posterior distribution given sequence data. Hence the question of statistical consistency of such methods is equivalent to the consistency of the summary of the sample. More generally, statistical consistency is ensured by the tree space used to analyse the sample. In this paper, we consider two standard parameterisations of phylogenetic time-trees used in evolutionary models: inter-coalescent interval lengths and absolute times of divergence events. For each of these parameterisations we introduce a natural metric space on ultrametric phylogenetic trees. We compare the introduced spaces with existing models of tree space and formulate several formal requirements that a metric space on phylogenetic trees must possess in order to be a satisfactory space for statistical analysis, and justify them. We show that only a few known constructions of the space of phylogenetic trees satisfy these requirements. However, our results suggest that these basic requirements are not enough to distinguish between the two metric spaces we introduce and that the choice between metric spaces requires additional properties to be considered. Particularly, that the summary tree minimising the square distance to the trees from the sample might be different for different parameterisations. This suggests that further fundamental insight is needed into the problem of statistical consistency of phylogenetic inference methods. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  12. Politico-Islamic Issues in Malaysia in 1999

    OpenAIRE

    Abubakar, Ibrahim

    2001-01-01

    Tulisan ini merupakan kajian singkat sekitar isu politik Islam di Malaysia tahun 1999. Pada November 1999, Malaysia menyelenggarakan pemilihan Federal dan Negara Bagian yang ke-10. Titik berat tulisan ini ada pada beberapa isu politik Islam yang dipublikasikan di koran-koran Malaysia yang dilihat dari perspektif partai-partai politik serta para pendukmgnya. Partai politik di Malaysia cukup banyak, dan disini diangkat empat partai politik yaitu: Organisasi Nasional Malaysia Bersatu (UMNO), Aso...

  13. On Tree-Based Phylogenetic Networks.

    Science.gov (United States)

    Zhang, Louxin

    2016-07-01

    A large class of phylogenetic networks can be obtained from trees by the addition of horizontal edges between the tree edges. These networks are called tree-based networks. We present a simple necessary and sufficient condition for tree-based networks and prove that a universal tree-based network exists for any number of taxa that contains as its base every phylogenetic tree on the same set of taxa. This answers two problems posted by Francis and Steel recently. A byproduct is a computer program for generating random binary phylogenetic networks under the uniform distribution model.

  14. Molecular Phylogenetics: Mathematical Framework and Unsolved Problems

    Science.gov (United States)

    Xia, Xuhua

    Phylogenetic relationship is essential in dating evolutionary events, reconstructing ancestral genes, predicting sites that are important to natural selection, and, ultimately, understanding genomic evolution. Three categories of phylogenetic methods are currently used: the distance-based, the maximum parsimony, and the maximum likelihood method. Here, I present the mathematical framework of these methods and their rationales, provide computational details for each of them, illustrate analytically and numerically the potential biases inherent in these methods, and outline computational challenges and unresolved problems. This is followed by a brief discussion of the Bayesian approach that has been recently used in molecular phylogenetics.

  15. Effectiveness and sustainability of a structured group-based educational program (MEDIHEALTH) in improving medication adherence among Malay patients with underlying type 2 diabetes mellitus in Sarawak State of Malaysia: study protocol of a randomized controlled trial.

    Science.gov (United States)

    Ting, Chuo Yew; Ahmad Zaidi Adruce, Shahren; Hassali, Mohamed Azmi; Ting, Hiram; Lim, Chien Joo; Ting, Rachel Sing-Kiat; Abd Jabar, Abu Hassan Alshaari; Osman, Nor Anizah; Shuib, Izzul Syazwan; Loo, Shing Chyi; Sim, Sui Theng; Lim, Su Ee; Morisky, Donald E

    2018-06-05

    Amidst the high disease burden, non-adherence to medications among patients with type 2 diabetes mellitus (T2DM) has been reported to be common and devastating. Sarawak Pharmaceutical Services Division has formulated a pharmacist-led, multiple-theoretical-grounding, culturally sensitive and structured group-based program, namely "Know Your Medicine - Take if for Health" (MEDIHEALTH), to improve medication adherence among Malay patients with T2DM. However, to date, little is known about the effectiveness and sustainability of the Program. This is a prospective, parallel-design, two-treatment-group randomized controlled trial to evaluate the effectiveness and sustainability of MEDIHEALTH in improving medication adherence. Malay patients who have underlying T2DM, who obtain medication therapy at Petra Jaya Health Clinic and Kota Samarahan Health Clinic, and who have a moderate to low adherence level (8-item Morisky Medication Adherence Scale, Malaysian specific, score sustainability of the Program will be triangulated by findings from semi-structured interviews with five selected participants conducted 1 month after the intervention and in-depth interviews with two main facilitators and two managerial officers in charge of the Program 12 months after the intervention. Statistical analyses of quantitative data were conducted using SPSS version 22 and Stata version 14. Thematic analysis for qualitative data were conducted with the assistance of ATLAS.ti 8. This study provides evidence on the effectiveness and sustainability of a structured group-based educational program that employs multiple theoretical grounding and a culturally sensitive approach in promoting medication adherence among Malays with underlying T2DM. Both the quantitative and qualitative findings of this study could assist in the future development of the Program. National Medical Research Register, NMRR-17-925-35875 (IIR). Registered on 19 May 2017. ClinicalTrials.gov, NCT03228706 . Registered on 25

  16. Problem Etnisitas India Dalam Cerita Pendek Malaysia

    Directory of Open Access Journals (Sweden)

    M. Shoim Anwar

    2015-12-01

    Full Text Available Karya sastra adalah dokumen kemanusiaan dan kebudayaan. Kumpulan cerita pendek Menara 7 (1998, terutama enam cerpen yang ditulis oleh pengarang Malaysia beretnis India, memberi gambaran problem kehidupan etnis India di Malaysia. Dengan meminjam teori etnisitas sebagai landasan, tulisan ini bertujuan mengungkap problem etnisitas India di Malaysia. Problem etnis India terkait dengan kemiskinan, pendidikan, gender, religi, budaya, dan persatuan. Keberadaan etnis India di Malaysia secara historis merupakan bagian dari kolonialisme Inggris di masa lampau. Residu kolonialisme menciptakan jejak hitam kemanusiaan yang mendalam. Sebagai pendatang, tersirat ada ketegangan sosial-budaya yang dialami etnis India, tetapi bukan konflik. Problem etnis India dalam cerpen Malaysia adalah sarana untuk becermin bagi masyarakat dalam negara yang multietnis. Abstract: Literature is a document of humanity and culture. A collection of short stories Menara 7 (1998, especially five short stories written by Malaysian Indian, gives an overview of Indian ethnic problems in Malaysia. Using postcolonial theory as an anchor, their problems are poverty, education, gender, religion, culture, and unity. The existence Malaysian Indian was British colonial legacy. The leftover of colonialism deeply creates dark footprints of humanity. As a newcomer, it’s implied there was social-cultural tension, but not conflict, experienced by Malaysian Indian. The problems in Malaysia short stories are a tool of reflection in a multiethnic society. Key Words: problem, ethnic, ethnicity, short story

  17. Medical Tourism in Malaysia: Prospect and Challenges.

    Science.gov (United States)

    Sarwar, Abdullah

    2013-08-01

    Tourism, combined with the phrase medical, seems to be a new form of tourism which has gained huge popularity in recent decades. Though, a number of literatures available with regard to the tourism industry and the competitiveness of the destination, however, the major aspects which determine the satisfaction of medical tourists are hardly focused specifically on Malaysia. There is a lack of empirical evidence in this area of study which needs to be bridged. Hence, this study aimed at investigating the various factors contributing towards the development of medical tourism in Malaysia. As the purpose of the research was to find out various factors contributing towards the development of medical tourism in Malaysia, so this study used Structural Equation modeling (SEM) for data analysis. The target population for this study consisted of the medical tourists coming to Malaysia with the primary intension of seeking medical procedures other than sightseeing. A total sample size of 266 was collected through non-probability judgment sampling during the period between December 2012 and February 2013. The result confirms that destination competitiveness and service quality play an important role in the medical tourist's mind towards medical tourism aspect in Malaysia. Thus, Malaysia need to promote various medical success stories together with the services they offer to attract more foreign patients. This study contributes to the theoretical development in the tourism industry by offering the structured relationship among various aspects contributing towards the development of medical tourism in Malaysia.

  18. Rotavirus genotypes in Malaysia and Universal rotavirus vaccination

    Science.gov (United States)

    Lee, Way Seah; Lim, Benjamin Tze Ying; Chai, Pei Fan; Kirkwood, Carl D.; Lee, Jimmy Kok Foo

    2012-01-01

    Group A rotavirus (RV-A) genotypes isolated in Malaysia was studied to estimate the effectiveness of a universal RV-A vaccination in Malaysia. A simple mathematical model was used, with input from a two-year, two-center, prospective study on hospitalization of RV-A gastroenteritis (RVGE) in young children, published data on RV-A hospitalizations and genotypes, mortality on childhood GE and published genotype-specific efficacy data on two RV-A vaccines. Assuming a 95% vaccine coverage, the overall projected effectiveness was 75.7 to 88.1% for Rotateq® and 78.7 to 90.6% for Rotarix® against RVGE-related hospitalizations. The projected annual reduction in RVGE-related deaths was 27 to 32 deaths (from 34 deaths) for Rotateq® and 28 to 32 deaths annually forRotarix®. A universal RV-A vaccine is efficacious in reducing RVGE-related hospitalizations and mortality in Malaysia. PMID:23022710

  19. A RAD-based phylogenetics for Orestias fishes from Lake Titicaca.

    Science.gov (United States)

    Takahashi, Tetsumi; Moreno, Edmundo

    2015-12-01

    The fish genus Orestias is endemic to the Andes highlands, and Lake Titicaca is the centre of the species diversity of the genus. Previous phylogenetic studies based on a single locus of mitochondrial and nuclear DNA strongly support the monophyly of a group composed of many of species endemic to the Lake Titicaca basin (the Lake Titicaca radiation), but the relationships among the species in the radiation remain unclear. Recently, restriction site-associated DNA (RAD) sequencing, which can produce a vast number of short sequences from various loci of nuclear DNA, has emerged as a useful way to resolve complex phylogenetic problems. To propose a new phylogenetic hypothesis of Orestias fishes of the Lake Titicaca radiation, we conducted a cluster analysis based on morphological similarities among fish samples and a molecular phylogenetic analysis based on RAD sequencing. From a morphological cluster analysis, we recognised four species groups in the radiation, and three of the four groups were resolved as monophyletic groups in maximum-likelihood trees based on RAD sequencing data. The other morphology-based group was not resolved as a monophyletic group in molecular phylogenies, and some members of the group were diverged from its sister group close to the root of the Lake Titicaca radiation. The evolution of these fishes is discussed from the phylogenetic relationships. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. A review of depression research in malaysia.

    Science.gov (United States)

    Ng, C G

    2014-08-01

    Depression is a debilitating illness and has become a leading cause of morbidity globally. We aim to summarise the evidence available in regard to the prevalence, type of assessment tools used and treatment options for depression in Malaysia. Two hundred and forty seven articles related to depression were found in a search through a database dedicated to indexing all original data relevant to medicine published in Malaysia between the years 2000-2013. Fifty seven articles were selected and reviewed on the basis of clinical relevance and future research implications. Findings were summarised, categorised and presented according to prevalence of depression, depression in women, depression in clinical condition, assessment tools, and treatment of depression. The prevalence of depression in Malaysia was estimated to be between 8 and 12%. The figures were higher among women of low socio-economic background or those with comorbid medical condition. The common assessment tools used in Malaysia include Beck Depression Inventory (BDI), Depression, Anxiety and Stress Scale (DASS), Patient Health Questionnaire 9 (PHQ-9) and Hospital Anxiety and Depression Scale (HADS). They were translated into the Malay language and their psychometric properties were established. Both pharmacological treatment and psychotherapy were commonly used in Malaysia, and were highly recommended in local clinical practice guidelines. There are discrepancies in the reported rates of depression in Malaysia and this needs to be addressed. There were lack of studies looking into the depression among subgroups in Malaysia especially in the male population. There were several instruments available for assessment of depression in Malaysia but their suitability for the local setting need further research. Both pharmacotherapy and psychotherapy were recommended in the local treatment guideline in Malaysia. With the emergence of generic medication, we need to compare their clinical efficacy and tolerability

  1. Green commercial building insurance in Malaysia

    Science.gov (United States)

    Yang, Yu Xin Ou; Chew, Boon Cheong; Loo, Heoy Shin; Tan, Lay Hong

    2017-03-01

    Green building construction is growing tremendously globally even in Malaysia. Currently, there are approximate 636 buildings have registered and to be certified with Green Building Index. Among these buildings, 45 buildings have already fulfilled the requirements and fully certified. The other buildings still under provisional certification stage. Malaysia had adopted Green Building Index in 2009 to support a move to promote green building concept. Malaysia starts to move towards green building because Malaysian construction and building industry realizes that both energy consumed and waste produced are reduced without irreversible impacts to ecosystems. Consequently, insurance companies such as Fireman's Fund from America has started the green building insurance policies for their green building in the year of 2006, while Malaysia still remain the coverage for green buildings using conventional property insurance. There are lacks of efforts to be seen from insurance companies to propose green building insurance for these green buildings. There are a few factors which can take into consideration for insurance companies to start the very first green building insurance in Malaysia. Although there are challenges, some efficient strategies have been identified to overcome the problems. The methods used in this research topic is qualitative research. The results obtained shows that green commercial building insurance has a huge business opportunity in Malaysia because the number of green commercial buildings are increasing tremendously in Malaysia. It is a favor to implement green building insurance in Malaysia. Furthermore, insurance companies can consider to add in extra coverage in standard building policy to provide extra protection for non-certified green buildings which have the intention to rebuilt in green when damage happens. Generally, it is very important to introduce green commercial buildings insurance into Malaysia so that all of the green commercial

  2. DNA barcodes and citizen science provoke a diversity reappraisal for the "ring" butterflies of Peninsular Malaysia (Ypthima: Satyrinae: Nymphalidae: Lepidoptera).

    Science.gov (United States)

    Jisming-See, Shi-Wei; Sing, Kong-Wah; Wilson, John-James

    2016-10-01

    The "rings" belonging to the genus Ypthima are amongst the most common butterflies in Peninsular Malaysia. However, the species can be difficult to tell apart, with keys relying on minor and often non-discrete ring characters found on the hindwing. Seven species have been reported from Peninsular Malaysia, but this is thought to be an underestimate of diversity. DNA barcodes of 165 individuals, and wing and genital morphology, were examined to reappraise species diversity of this genus in Peninsular Malaysia. DNA barcodes collected during citizen science projects-School Butterfly Project and Peninsular Malaysia Butterfly Count-recently conducted in Peninsular Malaysia were included. The new DNA barcodes formed six groups with different Barcode Index Numbers (BINs) representing four species reported in Peninsular Malaysia. When combined with public DNA barcodes from the Barcode Of Life Datasystems, several taxonomic issues arose. We consider the taxon Y. newboldi, formerly treated as a subspecies of Y. baldus, as a distinct species. DNA barcodes also supported an earlier suggestion that Y. nebulosa is a synonym under Y. horsfieldii humei. Two BINs of the genus Ypthima comprising DNA barcodes collected during citizen science projects did not correspond to any species previously reported in Peninsular Malaysia.

  3. ANTARA BENCI DAN RINDU: HUBUNGAN INDONESIA-MALAYSIA DAN ISU TENAGA KERJA ILEGAL DI MALAYSIA

    OpenAIRE

    Maiwan, Mohammad

    2012-01-01

    The objective of this research is to get adeguate explanation and understanding to Indonesia-Malaysia relation in related to solving problem of the illegal workers. The method was using descriptive and qualitative. This study shows, that illegal workers was a serious problem which give impact to the Indonesia-Malaysia relations. In Malaysia contexs, its can be impact to the economy, social, security and etc. Nevertheless, Indonesian government must be take integrative and comprehensive progra...

  4. Atelinae phylogenetic relationships: the trichotomy revived?

    Science.gov (United States)

    Collins, A C

    2004-08-01

    This research examines phylogenetic relationships between members of the Atelinae subfamily (Alouatta, Ateles, Brachyteles, and Lagothrix), based on analysis of three genetic regions. Two loci, cytochrome c oxidase subunit II (COII) and the hypervariable I portion of the control region, are part of the mitochondrial genome. The other is a single-copy nuclear gene, Aldolase A Intron V. Analysis of these genetic regions provides support for tribe Alouattini containing the Alouatta species, while tribe Atelini contains the other three genera. However, these three genetic regions produce conflicting results for relationships among tribe Atelini members. Previous genetic studies supported grouping Brachyteles with Lagothrix, leaving Ateles in a separate subclade. The present data sets vary based on the genetic region analyzed and method of analysis suggesting all possible cladistic relationships. These results are more consistent with investigations of morphology and behavior among these primates. The primary cause of discrepancy between this study and previous genetic studies is postulated to reside in increased sampling in the present study of genetic variation among members of the Atelinae, specifically Ateles. The present study utilized samples of Ateles from all postulated species for this genetically variable primate, while previous studies used only one or two species of Ateles. This paper demonstrates that shifting relationships are produced when different species of Ateles are used to reconstruct phylogenies. This research concludes that a trichotomy should still be supported between members of tribe Atelini until further analyses, which include additional Atelinae haplotypes are conducted. Copyright 2003 Wiley-Liss, Inc.

  5. Phylogenetic Analyses of Quasars and Galaxies

    Energy Technology Data Exchange (ETDEWEB)

    Fraix-Burnet, Didier [University Grenoble Alpes, CNRS, IPAG, Grenoble (France); D' Onofrio, Mauro [Osservatorio Astronomico di Padova (INAF), Padua (Italy); Marziani, Paola, E-mail: didier.fraix-burnet@univ-grenoble-alpes.fr [Dipartimento di Fisica e Astronomia, Università di Padova, Padua (Italy)

    2017-10-10

    Phylogenetic approaches have proven to be useful in astrophysics. We have recently published a Maximum Parsimony (or cladistics) analysis on two samples of 215 and 85 low-z quasars (z < 0.7) which offer a satisfactory coverage of the Eigenvector 1-derived main sequence. Cladistics is not only able to group sources radiating at higher Eddington ratios, to separate radio-quiet (RQ) and radio-loud (RL) quasars and properly distinguishes core-dominated and lobe-dominated quasars, but it suggests a black hole mass threshold for powerful radio emission as already proposed elsewhere. An interesting interpretation from this work is that the phylogeny of quasars may be represented by the ontogeny of their central black hole, i.e. the increase of the black hole mass. However these exciting results are based on a small sample of low-z quasars, so that the work must be extended. We are here faced with two difficulties. The first one is the current lack of a larger sample with similar observables. The second one is the prohibitive computation time to perform a cladistic analysis on more that about one thousand objects. We show in this paper an experimental strategy on about 1,500 galaxies to get around this difficulty. Even if it not related to the quasar study, it is interesting by itself and opens new pathways to generalize the quasar findings.

  6. Ultrastructure, biology, and phylogenetic relationships of kinorhyncha.

    Science.gov (United States)

    Neuhaus, Birger; Higgins, Robert P

    2002-07-01

    The article summarizes current knowledge mainly about the (functional) morphology and ultrastructure, but also about the biology, development, and evolution of the Kinorhyncha. The Kinorhyncha are microscopic, bilaterally symmetrical, exclusively free-living, benthic, marine animals and ecologically part of the meiofauna. They occur throughout the world from the intertidal to the deep sea, generally in sediments but sometimes associated with plants or other animals. From adult stages 141 species are known, but 38 species have been described from juvenile stages. The trunk is arranged into 11 segments as evidenced by cuticular plates, sensory spots, setae or spines, nervous system, musculature, and subcuticular glands. The ultrastructure of several organ systems and the postembryonic development are known for very few species. Almost no data are available about the embryology and only a single gene has been sequenced for a single species. The phylogenetic relationships within Kinorhyncha are unresolved. Priapulida, Loricifera, and Kinorhyncha are grouped together as Scalidophora, but arguments are found for every possible sistergroup relationship within this taxon. The recently published Ecdysozoa hypothesis suggests a closer relationship of the Scalidophora, Nematoda, Nematomorpha, Tardigrada, Onychophora, and Arthropoda.

  7. Tanglegrams: A Reduction Tool for Mathematical Phylogenetics.

    Science.gov (United States)

    Matsen, Frederick A; Billey, Sara C; Kas, Arnold; Konvalinka, Matjaz

    2018-01-01

    Many discrete mathematics problems in phylogenetics are defined in terms of the relative labeling of pairs of leaf-labeled trees. These relative labelings are naturally formalized as tanglegrams, which have previously been an object of study in coevolutionary analysis. Although there has been considerable work on planar drawings of tanglegrams, they have not been fully explored as combinatorial objects until recently. In this paper, we describe how many discrete mathematical questions on trees "factor" through a problem on tanglegrams, and how understanding that factoring can simplify analysis. Depending on the problem, it may be useful to consider a unordered version of tanglegrams, and/or their unrooted counterparts. For all of these definitions, we show how the isomorphism types of tanglegrams can be understood in terms of double cosets of the symmetric group, and we investigate their automorphisms. Understanding tanglegrams better will isolate the distinct problems on leaf-labeled pairs of trees and reveal natural symmetries of spaces associated with such problems.

  8. Phylogenetic Analyses of Quasars and Galaxies

    International Nuclear Information System (INIS)

    Fraix-Burnet, Didier; D'Onofrio, Mauro; Marziani, Paola

    2017-01-01

    Phylogenetic approaches have proven to be useful in astrophysics. We have recently published a Maximum Parsimony (or cladistics) analysis on two samples of 215 and 85 low-z quasars (z < 0.7) which offer a satisfactory coverage of the Eigenvector 1-derived main sequence. Cladistics is not only able to group sources radiating at higher Eddington ratios, to separate radio-quiet (RQ) and radio-loud (RL) quasars and properly distinguishes core-dominated and lobe-dominated quasars, but it suggests a black hole mass threshold for powerful radio emission as already proposed elsewhere. An interesting interpretation from this work is that the phylogeny of quasars may be represented by the ontogeny of their central black hole, i.e. the increase of the black hole mass. However these exciting results are based on a small sample of low-z quasars, so that the work must be extended. We are here faced with two difficulties. The first one is the current lack of a larger sample with similar observables. The second one is the prohibitive computation time to perform a cladistic analysis on more that about one thousand objects. We show in this paper an experimental strategy on about 1,500 galaxies to get around this difficulty. Even if it not related to the quasar study, it is interesting by itself and opens new pathways to generalize the quasar findings.

  9. Students Awareness towards Traditional Cultural Dances in Sarawak, Malaysia

    Directory of Open Access Journals (Sweden)

    Ahmad R. Albattat

    2016-07-01

    Full Text Available Malaysia has many ethnic groups, and each ethnic group has own custom and tradition that most Malaysians are not aware, especially traditional dances. Among the Malaysian states, Sabah and Sarawak, situated in the Borneo Island have the most diverse ethnic groups in Sarawak. It has more than 30 ethnic groups. Each of the ethnic groups has its own language, cultures and lifestyle. In this regards, this research focuses on the main ethnic groups of Sarawak which are Orang Ulu, Malays, Melanau, Bidayuh, Chinese and Ibans. The aim of this study is to investigate the level of awareness among the Management and Science University (MSU students regarding their level of awareness and knowledge about traditional dances of Sarawak. The data were gathered by distributing questionnaires among MSU students. The data were then analysed using SPSS system version 18.0. Results concluded that, most of MSU students have limited knowledge about Sarawak traditional dances. Interests, internet, performing arts clubs and family background are the independent variable factors to learn and gain knowledge about Sarawak traditional dances. The level of awareness among MSU students towards Sarawak traditional dances can be enhanced through events and special occasions to increase level of awareness towards Sarawak cultures. The government plays a major role in introducing Sarawak cultures to the whole of Malaysia. Future studies could focus on factors that influence the level of awareness towards Sarawak traditional dances, and the contribution of Sarawak’s traditional dances to Malaysia’s cultural and heritage tourism.

  10. Phylogenetic signal dissection identifies the root of starfishes.

    Directory of Open Access Journals (Sweden)

    Roberto Feuda

    Full Text Available Relationships within the class Asteroidea have remained controversial for almost 100 years and, despite many attempts to resolve this problem using molecular data, no consensus has yet emerged. Using two nuclear genes and a taxon sampling covering the major asteroid clades we show that non-phylogenetic signal created by three factors--Long Branch Attraction, compositional heterogeneity and the use of poorly fitting models of evolution--have confounded accurate estimation of phylogenetic relationships. To overcome the effect of this non-phylogenetic signal we analyse the data using non-homogeneous models, site stripping and the creation of subpartitions aimed to reduce or amplify the systematic error, and calculate Bayes Factor support for a selection of previously suggested topological arrangements of asteroid orders. We show that most of the previous alternative hypotheses are not supported in the most reliable data partitions, including the previously suggested placement of either Forcipulatida or Paxillosida as sister group to the other major branches. The best-supported solution places Velatida as the sister group to other asteroids, and the implications of this finding for the morphological evolution of asteroids are presented.

  11. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    2017-03-03

    Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.

  12. Phenotypic diversity and phylogenetic relationship between the ...

    African Journals Online (AJOL)

    Phenotypic diversity and phylogenetic relationship between the Bakosi/Baweri and other pig breeds ( Sus scrofa Domesticus ) in the humid forest with monomodal rainfall agro-ecological zone of Cameroon.

  13. Phylogenetic structure in tropical hummingbird communities

    DEFF Research Database (Denmark)

    Graham, Catherine H; Parra, Juan L; Rahbek, Carsten

    2009-01-01

    How biotic interactions, current and historical environment, and biogeographic barriers determine community structure is a fundamental question in ecology and evolution, especially in diverse tropical regions. To evaluate patterns of local and regional diversity, we quantified the phylogenetic...... composition of 189 hummingbird communities in Ecuador. We assessed how species and phylogenetic composition changed along environmental gradients and across biogeographic barriers. We show that humid, low-elevation communities are phylogenetically overdispersed (coexistence of distant relatives), a pattern...... that is consistent with the idea that competition influences the local composition of hummingbirds. At higher elevations communities are phylogenetically clustered (coexistence of close relatives), consistent with the expectation of environmental filtering, which may result from the challenge of sustaining...

  14. The Drosophila bipectinata species complex: phylogenetic ...

    Indian Academy of Sciences (India)

    PARUL BANERJEE

    c Indian Academy of Sciences. RESEARCH ARTICLE. The Drosophila bipectinata species complex: phylogenetic relationship among different members based on chromosomal variations. PARUL BANERJEE and BASHISTH N. SINGH. ∗. Genetics Laboratory, Department of Zoology, Banaras Hindu University, Varanasi ...

  15. The phylogenetics of succession can guide restoration

    DEFF Research Database (Denmark)

    Shooner, Stephanie; Chisholm, Chelsea Lee; Davies, T. Jonathan

    2015-01-01

    Phylogenetic tools have increasingly been used in community ecology to describe the evolutionary relationships among co-occurring species. In studies of succession, such tools may allow us to identify the evolutionary lineages most suited for particular stages of succession and habitat...... rehabilitation. However, to date, these two applications have been largely separate. Here, we suggest that information on phylogenetic community structure might help to inform community restoration strategies following major disturbance. Our study examined phylogenetic patterns of succession based...... for species sorting along abiotic gradients (slope and aspect) on the mine sites that had been abandoned for the longest. Synthesis and applications. Understanding the trajectory of succession is critical for restoration efforts. Our results suggest that early colonizers represent a phylogenetically random...

  16. Phylogenetic search through partial tree mixing

    Science.gov (United States)

    2012-01-01

    Background Recent advances in sequencing technology have created large data sets upon which phylogenetic inference can be performed. Current research is limited by the prohibitive time necessary to perform tree search on a reasonable number of individuals. This research develops new phylogenetic algorithms that can operate on tens of thousands of species in a reasonable amount of time through several innovative search techniques. Results When compared to popular phylogenetic search algorithms, better trees are found much more quickly for large data sets. These algorithms are incorporated in the PSODA application available at http://dna.cs.byu.edu/psoda Conclusions The use of Partial Tree Mixing in a partition based tree space allows the algorithm to quickly converge on near optimal tree regions. These regions can then be searched in a methodical way to determine the overall optimal phylogenetic solution. PMID:23320449

  17. Constructing phylogenetic trees using interacting pathways.

    Science.gov (United States)

    Wan, Peng; Che, Dongsheng

    2013-01-01

    Phylogenetic trees are used to represent evolutionary relationships among biological species or organisms. The construction of phylogenetic trees is based on the similarities or differences of their physical or genetic features. Traditional approaches of constructing phylogenetic trees mainly focus on physical features. The recent advancement of high-throughput technologies has led to accumulation of huge amounts of biological data, which in turn changed the way of biological studies in various aspects. In this paper, we report our approach of building phylogenetic trees using the information of interacting pathways. We have applied hierarchical clustering on two domains of organisms-eukaryotes and prokaryotes. Our preliminary results have shown the effectiveness of using the interacting pathways in revealing evolutionary relationships.

  18. Government intervention in women entrepreneurship development: opportunities and challenges for Bumiputera women entrepreneurs (BWEs) in the handicraft industry in Malaysia

    OpenAIRE

    Topimin, S

    2015-01-01

    This study provides insights into the influences of government intervention on the business survival of Bumiputera women entrepreneurs in the handicraft industry in Malaysia in which Bumiputera refers to the indigenous people and the largest population group in the country. The Malaysian handicraft industry is largely made up of Bumiputera women entrepreneurs (BWEs). While very little is known about how BWEs in the handicraft industry in Malaysia manage the survival of their businesses, the i...

  19. Phylogenetic relationships of Hemiptera inferred from mitochondrial and nuclear genes.

    Science.gov (United States)

    Song, Nan; Li, Hu; Cai, Wanzhi; Yan, Fengming; Wang, Jianyun; Song, Fan

    2016-11-01

    Here, we reconstructed the Hemiptera phylogeny based on the expanded mitochondrial protein-coding genes and the nuclear 18S rRNA gene, separately. The differential rates of change across lineages may associate with long-branch attraction (LBA) effect and result in conflicting estimates of phylogeny from different types of data. To reduce the potential effects of systematic biases on inferences of topology, various data coding schemes, site removal method, and different algorithms were utilized in phylogenetic reconstruction. We show that the outgroups Phthiraptera, Thysanoptera, and the ingroup Sternorrhyncha share similar base composition, and exhibit "long branches" relative to other hemipterans. Thus, the long-branch attraction between these groups is suspected to cause the failure of recovering Hemiptera under the homogeneous model. In contrast, a monophyletic Hemiptera is supported when heterogeneous model is utilized in the analysis. Although higher level phylogenetic relationships within Hemiptera remain to be answered, consensus between analyses is beginning to converge on a stable phylogeny.

  20. Assembly and phylogenetic structure of Neotropical palm communities

    DEFF Research Database (Denmark)

    Eiserhardt, Wolf L.; Svenning, J.-C.; Balslev, Henrik

    Diversity, composition and dynamics of Neotropical palm communities are receiving an increasing amount of attention due to their economic importance, but also because their high species richness and functional diversity render them valuable model systems for overall forest biodiversity. However......, to better understand these palm communities, it is crucial to gain insight into the mechanisms responsible for their assembly. These can be dispersal limitation, environmental filtering, or biotic interactions. If the degree of niche conservatism is known for a group of organisms, patterns of community...... an unspecific assumption of “general niche conservatism”, phylogenetic signal will be analysed for Neotropical palms. Moreover, as an example for evolutionary mechanisms disrupting phylogenetic signal, speciation modes will be examined in selected genera. With the combined results we aim to show the relative...

  1. Phylogenetic relationships of Malayan gaur with other species of the genus Bos based on cytochrome b gene DNA sequences.

    Science.gov (United States)

    Rosli, M K A; Zakaria, S S; Syed-Shabthar, S M F; Zainal, Z Z; Shukor, M N; Mahani, M C; Abas-Mazni, O; Md-Zain, B M

    2011-03-22

    The Malayan gaur (Bos gaurus hubbacki) is one of the three subspecies of gaurs that can be found in Malaysia. We examined the phylogenetic relationships of this subspecies with other species of the genus Bos (B. javanicus, B. indicus, B. taurus, and B. grunniens). The sequence of a key gene, cytochrome b, was compared among 20 Bos species and the bongo antelope, used as an outgroup. Phylogenetic reconstruction was employed using neighbor joining and maximum parsimony in PAUP and Bayesian inference in MrBayes 3.1. All tree topologies indicated that the Malayan gaur is in its own monophyletic clade, distinct from other species of the genus Bos. We also found significant branching differences in the tree topologies between wild and domestic cattle.

  2. Phylogenetically Acquired Representations and Evolutionary Algorithms.

    OpenAIRE

    Wozniak , Adrianna

    2006-01-01

    First, we explain why Genetic Algorithms (GAs), inspired by the Modern Synthesis, do not accurately model biological evolution, being rather an artificial version of artificial, rather than natural selection. Being focused on optimisation, we propose two improvements of GAs, with the aim to successfully generate adapted, desired behaviour. The first one concerns phylogenetic grounding of meaning, a way to avoid the Symbol Grounding Problem. We give a definition of Phylogenetically Acquired Re...

  3. Molecular Phylogenetics of the Serranid Subfamily Epinephelinae: Speciation and Biogeography in a Nearshore Marine Fish Clade

    OpenAIRE

    Craig, Matthew T,

    2005-01-01

    The processes that shape present day distributions of marine organisms have remained a central topic in evolutionary biology, conservation biology, and ecology. In this thesis, genetic data from mitochondrial and nuclear genes were used to create a phylogenetic hypothesis for the groupers of the subfamily Epinephelinae as a means of evaluating the current taxonomy of the group and the geography of speciation in marine organisms. The molecular phylogenetic hypothesis presented in Chap...

  4. How does cognition evolve? Phylogenetic comparative psychology.

    Science.gov (United States)

    MacLean, Evan L; Matthews, Luke J; Hare, Brian A; Nunn, Charles L; Anderson, Rindy C; Aureli, Filippo; Brannon, Elizabeth M; Call, Josep; Drea, Christine M; Emery, Nathan J; Haun, Daniel B M; Herrmann, Esther; Jacobs, Lucia F; Platt, Michael L; Rosati, Alexandra G; Sandel, Aaron A; Schroepfer, Kara K; Seed, Amanda M; Tan, Jingzhi; van Schaik, Carel P; Wobber, Victoria

    2012-03-01

    Now more than ever animal studies have the potential to test hypotheses regarding how cognition evolves. Comparative psychologists have developed new techniques to probe the cognitive mechanisms underlying animal behavior, and they have become increasingly skillful at adapting methodologies to test multiple species. Meanwhile, evolutionary biologists have generated quantitative approaches to investigate the phylogenetic distribution and function of phenotypic traits, including cognition. In particular, phylogenetic methods can quantitatively (1) test whether specific cognitive abilities are correlated with life history (e.g., lifespan), morphology (e.g., brain size), or socio-ecological variables (e.g., social system), (2) measure how strongly phylogenetic relatedness predicts the distribution of cognitive skills across species, and (3) estimate the ancestral state of a given cognitive trait using measures of cognitive performance from extant species. Phylogenetic methods can also be used to guide the selection of species comparisons that offer the strongest tests of a priori predictions of cognitive evolutionary hypotheses (i.e., phylogenetic targeting). Here, we explain how an integration of comparative psychology and evolutionary biology will answer a host of questions regarding the phylogenetic distribution and history of cognitive traits, as well as the evolutionary processes that drove their evolution.

  5. How does cognition evolve? Phylogenetic comparative psychology

    Science.gov (United States)

    Matthews, Luke J.; Hare, Brian A.; Nunn, Charles L.; Anderson, Rindy C.; Aureli, Filippo; Brannon, Elizabeth M.; Call, Josep; Drea, Christine M.; Emery, Nathan J.; Haun, Daniel B. M.; Herrmann, Esther; Jacobs, Lucia F.; Platt, Michael L.; Rosati, Alexandra G.; Sandel, Aaron A.; Schroepfer, Kara K.; Seed, Amanda M.; Tan, Jingzhi; van Schaik, Carel P.; Wobber, Victoria

    2014-01-01

    Now more than ever animal studies have the potential to test hypotheses regarding how cognition evolves. Comparative psychologists have developed new techniques to probe the cognitive mechanisms underlying animal behavior, and they have become increasingly skillful at adapting methodologies to test multiple species. Meanwhile, evolutionary biologists have generated quantitative approaches to investigate the phylogenetic distribution and function of phenotypic traits, including cognition. In particular, phylogenetic methods can quantitatively (1) test whether specific cognitive abilities are correlated with life history (e.g., lifespan), morphology (e.g., brain size), or socio-ecological variables (e.g., social system), (2) measure how strongly phylogenetic relatedness predicts the distribution of cognitive skills across species, and (3) estimate the ancestral state of a given cognitive trait using measures of cognitive performance from extant species. Phylogenetic methods can also be used to guide the selection of species comparisons that offer the strongest tests of a priori predictions of cognitive evolutionary hypotheses (i.e., phylogenetic targeting). Here, we explain how an integration of comparative psychology and evolutionary biology will answer a host of questions regarding the phylogenetic distribution and history of cognitive traits, as well as the evolutionary processes that drove their evolution. PMID:21927850

  6. Nodal distances for rooted phylogenetic trees.

    Science.gov (United States)

    Cardona, Gabriel; Llabrés, Mercè; Rosselló, Francesc; Valiente, Gabriel

    2010-08-01

    Dissimilarity measures for (possibly weighted) phylogenetic trees based on the comparison of their vectors of path lengths between pairs of taxa, have been present in the systematics literature since the early seventies. For rooted phylogenetic trees, however, these vectors can only separate non-weighted binary trees, and therefore these dissimilarity measures are metrics only on this class of rooted phylogenetic trees. In this paper we overcome this problem, by splitting in a suitable way each path length between two taxa into two lengths. We prove that the resulting splitted path lengths matrices single out arbitrary rooted phylogenetic trees with nested taxa and arcs weighted in the set of positive real numbers. This allows the definition of metrics on this general class of rooted phylogenetic trees by comparing these matrices through metrics in spaces M(n)(R) of real-valued n x n matrices. We conclude this paper by establishing some basic facts about the metrics for non-weighted phylogenetic trees defined in this way using L(p) metrics on M(n)(R), with p [epsilon] R(>0).

  7. Maximizing the phylogenetic diversity of seed banks.

    Science.gov (United States)

    Griffiths, Kate E; Balding, Sharon T; Dickie, John B; Lewis, Gwilym P; Pearce, Tim R; Grenyer, Richard

    2015-04-01

    Ex situ conservation efforts such as those of zoos, botanical gardens, and seed banks will form a vital complement to in situ conservation actions over the coming decades. It is therefore necessary to pay the same attention to the biological diversity represented in ex situ conservation facilities as is often paid to protected-area networks. Building the phylogenetic diversity of ex situ collections will strengthen our capacity to respond to biodiversity loss. Since 2000, the Millennium Seed Bank Partnership has banked seed from 14% of the world's plant species. We assessed the taxonomic, geographic, and phylogenetic diversity of the Millennium Seed Bank collection of legumes (Leguminosae). We compared the collection with all known legume genera, their known geographic range (at country and regional levels), and a genus-level phylogeny of the legume family constructed for this study. Over half the phylogenetic diversity of legumes at the genus level was represented in the Millennium Seed Bank. However, pragmatic prioritization of species of economic importance and endangerment has led to the banking of a less-than-optimal phylogenetic diversity and prioritization of range-restricted species risks an underdispersed collection. The current state of the phylogenetic diversity of legumes in the Millennium Seed Bank could be substantially improved through the strategic banking of relatively few additional taxa. Our method draws on tools that are widely applied to in situ conservation planning, and it can be used to evaluate and improve the phylogenetic diversity of ex situ collections. © 2014 Society for Conservation Biology.

  8. Inferring Phylogenetic Networks Using PhyloNet.

    Science.gov (United States)

    Wen, Dingqiao; Yu, Yun; Zhu, Jiafan; Nakhleh, Luay

    2018-07-01

    PhyloNet was released in 2008 as a software package for representing and analyzing phylogenetic networks. At the time of its release, the main functionalities in PhyloNet consisted of measures for comparing network topologies and a single heuristic for reconciling gene trees with a species tree. Since then, PhyloNet has grown significantly. The software package now includes a wide array of methods for inferring phylogenetic networks from data sets of unlinked loci while accounting for both reticulation (e.g., hybridization) and incomplete lineage sorting. In particular, PhyloNet now allows for maximum parsimony, maximum likelihood, and Bayesian inference of phylogenetic networks from gene tree estimates. Furthermore, Bayesian inference directly from sequence data (sequence alignments or biallelic markers) is implemented. Maximum parsimony is based on an extension of the "minimizing deep coalescences" criterion to phylogenetic networks, whereas maximum likelihood and Bayesian inference are based on the multispecies network coalescent. All methods allow for multiple individuals per species. As computing the likelihood of a phylogenetic network is computationally hard, PhyloNet allows for evaluation and inference of networks using a pseudolikelihood measure. PhyloNet summarizes the results of the various analyzes and generates phylogenetic networks in the extended Newick format that is readily viewable by existing visualization software.

  9. Efficient parsimony-based methods for phylogenetic network reconstruction.

    Science.gov (United States)

    Jin, Guohua; Nakhleh, Luay; Snir, Sagi; Tuller, Tamir

    2007-01-15

    Phylogenies--the evolutionary histories of groups of organisms-play a major role in representing relationships among biological entities. Although many biological processes can be effectively modeled as tree-like relationships, others, such as hybrid speciation and horizontal gene transfer (HGT), result in networks, rather than trees, of relationships. Hybrid speciation is a significant evolutionary mechanism in plants, fish and other groups of species. HGT plays a major role in bacterial genome diversification and is a significant mechanism by which bacteria develop resistance to antibiotics. Maximum parsimony is one of the most commonly used criteria for phylogenetic tree inference. Roughly speaking, inference based on this criterion seeks the tree that minimizes the amount of evolution. In 1990, Jotun Hein proposed using this criterion for inferring the evolution of sequences subject to recombination. Preliminary results on small synthetic datasets. Nakhleh et al. (2005) demonstrated the criterion's application to phylogenetic network reconstruction in general and HGT detection in particular. However, the naive algorithms used by the authors are inapplicable to large datasets due to their demanding computational requirements. Further, no rigorous theoretical analysis of computing the criterion was given, nor was it tested on biological data. In the present work we prove that the problem of scoring the parsimony of a phylogenetic network is NP-hard and provide an improved fixed parameter tractable algorithm for it. Further, we devise efficient heuristics for parsimony-based reconstruction of phylogenetic networks. We test our methods on both synthetic and biological data (rbcL gene in bacteria) and obtain very promising results.

  10. Genetic clustering and polymorphism of the merozoite surface protein-3 of Plasmodium knowlesi clinical isolates from Peninsular Malaysia.

    Science.gov (United States)

    De Silva, Jeremy Ryan; Lau, Yee Ling; Fong, Mun Yik

    2017-01-03

    The simian malaria parasite Plasmodium knowlesi has been reported to cause significant numbers of human infection in South East Asia. Its merozoite surface protein-3 (MSP3) is a protein that belongs to a multi-gene family of proteins first found in Plasmodium falciparum. Several studies have evaluated the potential of P. falciparum MSP3 as a potential vaccine candidate. However, to date no detailed studies have been carried out on P. knowlesi MSP3 gene (pkmsp3). The present study investigates the genetic diversity, and haplotypes groups of pkmsp3 in P. knowlesi clinical samples from Peninsular Malaysia. Blood samples were collected from P. knowlesi malaria patients within a period of 4 years (2008-2012). The pkmsp3 gene of the isolates was amplified via PCR, and subsequently cloned and sequenced. The full length pkmsp3 sequence was divided into Domain A and Domain B. Natural selection, genetic diversity, and haplotypes of pkmsp3 were analysed using MEGA6 and DnaSP ver. 5.10.00 programmes. From 23 samples, 48 pkmsp3 sequences were successfully obtained. At the nucleotide level, 101 synonymous and 238 non-synonymous mutations were observed. Tests of neutrality were not significant for the full length, Domain A or Domain B sequences. However, the dN/dS ratio of Domain B indicates purifying selection for this domain. Analysis of the deduced amino acid sequences revealed 42 different haplotypes. Neighbour Joining phylogenetic tree and haplotype network analyses revealed that the haplotypes clustered into two distinct groups. A moderate level of genetic diversity was observed in the pkmsp3 and only the C-terminal region (Domain B) appeared to be under purifying selection. The separation of the pkmsp3 into two haplotype groups provides further evidence of the existence of two distinct P. knowlesi types or lineages. Future studies should investigate the diversity of pkmsp3 among P. knowlesi isolates in North Borneo, where large numbers of human knowlesi malaria infection

  11. Phylogenetic distribution of fungal sterols.

    Directory of Open Access Journals (Sweden)

    John D Weete

    Full Text Available BACKGROUND: Ergosterol has been considered the "fungal sterol" for almost 125 years; however, additional sterol data superimposed on a recent molecular phylogeny of kingdom Fungi reveals a different and more complex situation. METHODOLOGY/PRINCIPAL FINDINGS: The interpretation of sterol distribution data in a modern phylogenetic context indicates that there is a clear trend from cholesterol and other Delta(5 sterols in the earliest diverging fungal species to ergosterol in later diverging fungi. There are, however, deviations from this pattern in certain clades. Sterols of the diverse zoosporic and zygosporic forms exhibit structural diversity with cholesterol and 24-ethyl -Delta(5 sterols in zoosporic taxa, and 24-methyl sterols in zygosporic fungi. For example, each of the three monophyletic lineages of zygosporic fungi has distinctive major sterols, ergosterol in Mucorales, 22-dihydroergosterol in Dimargaritales, Harpellales, and Kickxellales (DHK clade, and 24-methyl cholesterol in Entomophthorales. Other departures from ergosterol as the dominant sterol include: 24-ethyl cholesterol in Glomeromycota, 24-ethyl cholest-7-enol and 24-ethyl-cholesta-7,24(28-dienol in rust fungi, brassicasterol in Taphrinales and hypogeous pezizalean species, and cholesterol in Pneumocystis. CONCLUSIONS/SIGNIFICANCE: Five dominant end products of sterol biosynthesis (cholesterol, ergosterol, 24-methyl cholesterol, 24-ethyl cholesterol, brassicasterol, and intermediates in the formation of 24-ethyl cholesterol, are major sterols in 175 species of Fungi. Although most fungi in the most speciose clades have ergosterol as a major sterol, sterols are more varied than currently understood, and their distribution supports certain clades of Fungi in current fungal phylogenies. In addition to the intellectual importance of understanding evolution of sterol synthesis in fungi, there is practical importance because certain antifungal drugs (e.g., azoles target reactions in

  12. Phylogenetic relationships of Malaysia’s long-tailed macaques, Macaca fascicularis, based on cytochrome b sequences

    Science.gov (United States)

    Abdul-Latiff, Muhammad Abu Bakar; Ruslin, Farhani; Fui, Vun Vui; Abu, Mohd-Hashim; Rovie-Ryan, Jeffrine Japning; Abdul-Patah, Pazil; Lakim, Maklarin; Roos, Christian; Yaakop, Salmah; Md-Zain, Badrul Munir

    2014-01-01

    Abstract Phylogenetic relationships among Malaysia’s long-tailed macaques have yet to be established, despite abundant genetic studies of the species worldwide. The aims of this study are to examine the phylogenetic relationships of Macaca fascicularis in Malaysia and to test its classification as a morphological subspecies. A total of 25 genetic samples of M. fascicularis yielding 383 bp of Cytochrome b (Cyt b) sequences were used in phylogenetic analysis along with one sample each of M. nemestrina and M. arctoides used as outgroups. Sequence character analysis reveals that Cyt b locus is a highly conserved region with only 23% parsimony informative character detected among ingroups. Further analysis indicates a clear separation between populations originating from different regions; the Malay Peninsula versus Borneo Insular, the East Coast versus West Coast of the Malay Peninsula, and the island versus mainland Malay Peninsula populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo’s population was distinguished from Peninsula’s population (99% and 100% bootstrap value in NJ and MP respectively and 1.00 posterior probability in Bayesian trees). The East coast population was separated from other Peninsula populations (64% in NJ, 66% in MP and 0.53 posterior probability in Bayesian). West coast populations were divided into 2 clades: the North-South (47%/54% in NJ, 26/26% in MP and 1.00/0.80 posterior probability in Bayesian) and Island-Mainland (93% in NJ, 90% in MP and 1.00 posterior probability in Bayesian). The results confirm the previous morphological assignment of 2 subspecies, M. f. fascicularis and M. f. argentimembris, in the Malay Peninsula. These populations should be treated as separate genetic entities in order to conserve the genetic diversity of Malaysia’s M. fascicularis. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations

  13. Cage culture of sea bass in Malaysia

    OpenAIRE

    1994-01-01

    The article discusses the cage culture practice of sea bass (Lates calcarifer) in Malaysia. Problems on feed and seed supply and overcrowding are also discussed. Despite these problems, seabass cage culture still continuously booms.

  14. International Atomic Energy Agency and Malaysia

    International Nuclear Information System (INIS)

    Abd Rahim Mohd Nor

    1985-01-01

    A review on IAEA (International Atomic Energy Agency) and its relation with Malaysia is given. This article also discusses the background history of IAEA, its organization and functions in the field of nuclear energy

  15. Sustainable rice production in Malaysia beyond 2000

    International Nuclear Information System (INIS)

    Nashriyah Mat; Ho Nai Kin; Ismail Sahid; Ahyaudin Ali; Lum Keng Yeang; Mashhor Mansor

    2002-01-01

    This book is a compendium of works carried out by various institutions on subjects related to sustainable rice production. The institutions comprise Department of Agriculture, Malaysian Agricultural Research and Development Institute, Malaysian Institute for Nuclear Technology Research, Muda Agricultural Development Authority, Universiti Kebangsaan Malaysia, Universiti Putra Malaysia, Universiti Sains Malaysia, International Islamic University of Malaysia and the Agrochemical Company Mosanto. Integrated Biodiversity Management parallel with the Integrated Weed / Pest / Disease Management, rice-fish farming networking, agrochemical residue monitoring in rice and marine ecosystems, and application of biotechnology in rice productivity are taken as the future direction towards achieving sustainable rice production beyond 2000. Challenges from social and technical agroecosystem constraints, agricultural input management and maintenance of agroecosystem biodiversity are highlighted. It is imperative that the challenges are surmounted to attain the target that would be reflected by tangible rice output of 10 t/ha, and at the same time maintaining the well-being of rice-farmers. (Author)

  16. Feed-in tariff outlook in Malaysia

    International Nuclear Information System (INIS)

    Chua, Shing Chyi; Oh, Tick Hui; Goh, Wei Wei

    2011-01-01

    This paper aims to present the feed-in tariff (FiT) outlook in Malaysia, which is in the process of being enacted through a Renewable Energy (RE) Policy by the Government of Malaysia (GoM). A brief in policies leading towards the RE policy and the potential of each RE sources under FiT mechanism have been discussed. The successful utilisation of RE source in electricity generation and the FiT implementation globally are positive indicators to implement FiT in Malaysia. Potentials of FiT on biomass, biogas and solid waste energy are currently very promising in Malaysia, but it is solar energy which is predicted to be the main RE of the future, surpassing all other REs. (author)

  17. Islam and Economic Growth in Malaysia

    National Research Council Canada - National Science Library

    bin

    2003-01-01

    .... This thesis discusses nation building by fusing Islam, pluralism, democracy, and modernity. It argues that Malaysia's religious tolerance and adherence to western development models fostered economic growth since its independence...

  18. Sustainable development and construction industry in Malaysia

    Directory of Open Access Journals (Sweden)

    Suliman L. Kh. M.

    2009-12-01

    Full Text Available Sustainable construction is a way for the building and infrastructure industry to move towards achieving sustainable development, taking into account environmental, socioeconomic and cultural issues. Differing approaches and differing economic markets lead to different priorities. This paper presents the construction scenario of Malaysia and the developments in sustainable construction taking place in this country. Barriers to the implementation of sustainable construction are discussed. A list of recommendation was proposed to drive sustainable construction in this country. In conclusion, the status of sustainable construction in Malaysia is still in its infancy. The lack of awareness, training and education, ineffective procurement systems, existing public policies and regulatory frameworks are among the major barriers for sustainable construction in Malaysia. Besides the needs for capacities, technologies and tools, total and ardent commitment by all players in the construction sectors including the governments and the public atlarge are required in order to achieve sustainable construction in Malaysia.

  19. [A phylogenetic analysis of plant communities of Teberda Biosphere Reserve].

    Science.gov (United States)

    Shulakov, A A; Egorov, A V; Onipchenko, V G

    2016-01-01

    Phylogenetic analysis of communities is based on the comparison of distances on the phylogenetic tree between species of a community under study and those distances in random samples taken out of local flora. It makes it possible to determine to what extent a community composition is formed by more closely related species (i.e., "clustered") or, on the opposite, it is more even and includes species that are less related with each other. The first case is usually interpreted as a result of strong influence caused by abiotic factors, due to which species with similar ecology, a priori more closely related, would remain: In the second case, biotic factors, such as competition, may come to the fore and lead to forming a community out of distant clades due to divergence of their ecological niches: The aim of this' study Was Ad explore the phylogenetic structure in communities of the northwestern Caucasus at two spatial scales - the scale of area from 4 to 100 m2 and the smaller scale within a community. The list of local flora of the alpine belt has been composed using the database of geobotanic descriptions carried out in Teberda Biosphere Reserve at true altitudes exceeding.1800 m. It includes 585 species of flowering plants belonging to 57 families. Basal groups of flowering plants are.not represented in the list. At the scale of communities of three classes, namely Thlaspietea rotundifolii - commumties formed on screes and pebbles, Calluno-Ulicetea - alpine meadow, and Mulgedio-Aconitetea subalpine meadows, have not demonstrated significant distinction of phylogenetic structure. At intra level, for alpine meadows the larger share of closely related species. (clustered community) is detected. Significantly clustered happen to be those communities developing on rocks (class Asplenietea trichomanis) and alpine (class Juncetea trifidi). At the same time, alpine lichen proved to have even phylogenetic structure at the small scale. Alpine (class Salicetea herbaceae) that

  20. Hepatitis in Malaysia: Past, Present, and Future.

    Science.gov (United States)

    Raihan, Ruksana

    2016-01-01

    Malaysia is multiethnic, with a population of 31,127,247 comprising a mixture of Malays (50.1%), Chinese (22.6%), Indians (6.7%), Aborigines (11.8%), others (0.7%), and noncitizens (8.2%). Like other countries in the region, viral hepatitis is an important public health problem in Malaysia. The 3 most common causes for hepatitis in Malaysia are hepatitis A, B, and C. Hepatitis A has been a reportable disease in Malaysia since 1988. Due to the introduction of government control programs, the national incidence rate has dropped steadily. It is now estimated that 50% of Malaysians less than 30 years of age do not have antibodies to hepatitis A and are therefore susceptible to the disease, which can be prevented by reinforcing the hygiene status of the general population. Malaysia is a country of medium seroprevalence for the hepatitis B virus (HBV) surface antigen (HBsAg) in the general population (1.5-9.8%). The major route of transmission is from infected mother to fetus. There are an estimated 1 million people chronically infected with hepatitis B in Malaysia. Approximately 75% of all viral hepatitis cases are due to hepatitis B infection, with a male-to-female ratio of 2:1. Chronic hepatitis B (CHB) accounts for more than 80% of the hepatocellular carcinoma (HCC) cases seen in Malaysia and HCC is the 3rd most common malignant neoplasm and among the 10 leading causes of death. Most common genotypes are B and C. Incidence rates among Chinese, Malays, and Indians are 36, 26, and 15% respectively. The hepatitis B vaccination program for children was introduced in 1989, which successfully managed to reduce the seroprevalence of infection among Malaysians to 0.01% (graph 4, 2014). But the disease burden will still remain high for some time as the infected people are getting older and living longer. Hepatitis C virus (HCV) infection is a growing problem in Malaysia. An estimated 453,700 people were living with HCV infection in Malaysia in 2009 (2.5% of the population

  1. Malaysia: World Oil Report 1991

    International Nuclear Information System (INIS)

    Khin, J.A.

    1991-01-01

    This paper reports that the Malaysian government announced tax incentives for fiscal year 1991/92 by cutting export duties on crude oil to encourage companies to develop more oil fields. The export duty exemption on cost recovery oil was increased from the current 20% to 50% on April 1, 1991. Nearly 115,200 sq mi of shallow-water acreage off Malaysia has been awarded to PS contractors, leaving only about five blocks remaining. Therefore, Petronas plans to award deeper water blocks (water depths of 655 ft or more) in the second half of this year, once terms are finalized. It is understood that these areas will be offshore of Sarawak and Sabah, covering in excess of 38,000 sq mi. Petronas the that there would be some improvement in the PSC terms for the deep-water areas

  2. MARITIME VIOLENCE : IMPLICATIONS TO MALAYSIA

    Directory of Open Access Journals (Sweden)

    Nurulizwan Ahmad Zubir

    2014-04-01

    Full Text Available Abstract Maritime Piracy has been a serious threat to the international community especially in the SoutheastAsia region. This threat has caused tremendous implications towards the world economy, environment,political stability of the nations involved because 45% of the shipping company passes through theSoutheast Asia. The worrying fact is that these attacks were committed by terrorists as well as traditionalmaritime pirates. This paper examines on the implications of maritime crime in Malaysia and discusseswhether the definition of piracy under the International Law could be applied to these attacks. Thispaper concludes that cooperation between the region’s states and the enhancement of a good securitysystem of one state are needed to combat maritime violence. Thus it is imperative that the internationallaw need to be changed in order to enhance the meaning of piracy and also to include sea terrorism. Key words: piracy, maritime, terrorist

  3. Determinants of Commercial Banks' Profitability in Malaysia

    OpenAIRE

    Trofimov, Ivan D.; Md. Aris, Nazaria; Ying Ying, Jovena Kho

    2018-01-01

    This study aims to examine the relationship between non-performing loans (NPLs) and commercial banks' performance in Malaysia, alongside other factors. It considers the effect of NPLs, cost efficiency and bank size on commercial banks' profitability by using panel data regression (Pooled OLS model), covering the period of 2010-2015. The findings of the study show that NPLs and cost efficiency have a significant negative relationship with commercial banks' performances in Malaysia. On the othe...

  4. Stabilisasi Harga Pangan Nonberas Di Malaysia

    OpenAIRE

    Sayaka, Bambang; Adhie, Setyo

    2016-01-01

    Malaysian Government applies policy on non-rice price stabilization through farmers' product purchase, incentives for farmers, and retail price control. This paper aims (i) to review Malaysia's policy on food production; (ii) to assess price control and farmers' protection policy; and (iii) to learn a lesson from Malaysia's success in stabilizing strategic goods prices. Ministry of Domestic Trade, Co-operatives and Consumerism (MDTCC) controls strategic goods price established by Malaysian Go...

  5. Public Debt and Economic Growth in Malaysia

    OpenAIRE

    Siew-Peng Lee; Yan-Ling Ng

    2015-01-01

    Public debt in the Malaysia increased because of fiscal expansions. This study examines whether public debt contributed to the economic growth in Malaysia over the period 1991 to 2013. It also examines whether other indicators of debt burden, such as budget deficit, budget expenditure, and external debt service and government consumption, have an impact on economic growth. The results of this study are consistent with the existing literature that found a negative association between diet and ...

  6. Islam Observed: the Case of Contemporary Malaysia

    OpenAIRE

    Metzger, Laurent

    1998-01-01

    The phenomenon of the rise of Islam in Malaysia does not attract much attention of observers when compared with the same phenomenon in the countries of the Middle East, North Africa, Central or South Asia. This paper attempted to review comprehensively the development of Islam in Malaysia since obtaining its independence from Britain in August 1957.Copyright (c) 2014 by SDI. All right reserved.DOI: 10.15408/sdi.v5i2.753

  7. Financial Analysis Report: Malaysia Airlines 2007 - 2011

    OpenAIRE

    Gilbert O'Neil Mushure

    2014-01-01

    This work is an analysis of the annual reports of Malaysia Airlines Berhad from 2007 to 2011. Profitability analysis was done on the financial statements of the company from 2007 to 2011. Cash and working capital management analysis were done on the financial statements of 2010 and 2011. It was found that Malaysia Airlines Berhad was constantly suffering from high costs of operations which resulted in consecutive negative gross profit over the years.Net profit remained positive only as a resu...

  8. Foreign Students’ Motivation for Studying In Malaysia

    OpenAIRE

    Muh. Amin; Sugiyanto; Keppi Sukesi; Ismadi

    2013-01-01

    Purpose – With the recognition of the importance of education in economy different countries are responding with changes within their education systems. Education is recognized as a foundation to the continued growth of a country but with the globalization of business, is education becoming a commodity?Objective - This paper examines international students’ motivation for studying in Malaysia. The second objective is to analyze educational policies and their implementation within Malaysia.Des...

  9. Internationalization of Boost Juice to Malaysia

    OpenAIRE

    Jane L. Menzies; Stuart C. Orr

    2014-01-01

    This case describes the process that the Australian juice retail chain, Boost Juice, has used to internationalize to Malaysia. The main objective of this case is to demonstrate good practice in regard to internationalization. The case provides the background of the juice bar industry in Malaysia and determines that it is an attractive market for new start-up juice bars. An analysis of Boost Juice's capability determined that the company utilized the skills of its staff, product innovations, b...

  10. Brand Awareness and Consumer Loyalty in Malaysia

    OpenAIRE

    Firend, A.R; Alvandi, S.

    2015-01-01

    The objectives of this study is to evaluate consumer's awareness of brand by studying the relationship between brand awareness and variables such as customer loyalty, customer satisfaction, customer trust and quality of services. The study examines the relationship through a quantitative research methodology conducted in main peninsula Malaysia. The examined brand Air Asia airline's services in Malaysia. This study finds the existence of crucial association between customer loyalty, trust, sa...

  11. Recent and prospective population trends in Malaysia.

    Science.gov (United States)

    Jones, G W; Tan, P C

    1985-09-01

    Recent population trends in Malaysia are reviewed, with the focus on Peninsular Malaysia. Separate consideration is given to population growth between 1970 and 1980; mortality trends; period and cohort fertility trends; factors affecting fertility, including changes in age structure, nuptiality, and other socioeconomic and demographic changes; and the recent development of a pro-natalist policy involving a goal of a population of 70 million by 2050.

  12. Maritime Security: Malaysia’s Persistent Problem

    Science.gov (United States)

    2012-01-01

    navies, and air forces of the littoral states.”20 In his keynote address at the 2011 Shangri-La Dialogue, Prime Minister Dato’ Sri Najib Tun Razak ...Monitor, Vol. 4 No. 3, 2006. Razak , Dato’ Sri Najib Tun, Prime Minister Malaysia. Keynote Address. Shangri-La Dialogue. Singapore, June 3, 2011... Razak , Dato’ Sri Najib , Deputy Prime Minister Malaysia, Address. Shangri-La Dialogue. Enhancing Maritime Security Cooperation. Singapore, 2005

  13. Renewable energy technology acceptance in Peninsular Malaysia

    International Nuclear Information System (INIS)

    Kardooni, Roozbeh; Yusoff, Sumiani Binti; Kari, Fatimah Binti

    2016-01-01

    Despite various policies, renewable energy resources have not been developed in Malaysia. This study investigates the factors that influence renewable energy technology acceptance in Peninsular Malaysia and attempts to show the impact of cost and knowledge on the perceived ease of use and perceived usefulness of renewable energy technology. The results show that cost of renewable energy has an indirect effect on attitudes towards using renewable energy through the associated impact on the perceived ease of use and perceived usefulness. The results also indicate that public knowledge in Peninsular Malaysia does not affect perceived ease of use, although the positive impact of knowledge on perceived usefulness is supported. Furthermore, our results show that the current business environment in Peninsular Malaysia does not support the adoption of renewable energy technology, and thus, renewable energy technology is not commercially viable in Peninsular Malaysia. Additionally, the population of Peninsular Malaysia associates the use of renewable energy with a high level of effort and therefore has a negative attitude towards the use of renewable energy technology. There is, therefore, a definite need to pay more attention to the role of public perception and awareness in the successes and failures of renewable energy policy. - Highlights: • Public acceptance is an essential element in the diffusion of renewable energy. • Perceived ease of use and perceived usefulness affect intention to use renewables. • It is important to reduce the cost of renewable energy, particularly for end users. • Renewable energy policies should address issues of public perception and awareness.

  14. Rearrangement moves on rooted phylogenetic networks.

    Science.gov (United States)

    Gambette, Philippe; van Iersel, Leo; Jones, Mark; Lafond, Manuel; Pardi, Fabio; Scornavacca, Celine

    2017-08-01

    Phylogenetic tree reconstruction is usually done by local search heuristics that explore the space of the possible tree topologies via simple rearrangements of their structure. Tree rearrangement heuristics have been used in combination with practically all optimization criteria in use, from maximum likelihood and parsimony to distance-based principles, and in a Bayesian context. Their basic components are rearrangement moves that specify all possible ways of generating alternative phylogenies from a given one, and whose fundamental property is to be able to transform, by repeated application, any phylogeny into any other phylogeny. Despite their long tradition in tree-based phylogenetics, very little research has gone into studying similar rearrangement operations for phylogenetic network-that is, phylogenies explicitly representing scenarios that include reticulate events such as hybridization, horizontal gene transfer, population admixture, and recombination. To fill this gap, we propose "horizontal" moves that ensure that every network of a certain complexity can be reached from any other network of the same complexity, and "vertical" moves that ensure reachability between networks of different complexities. When applied to phylogenetic trees, our horizontal moves-named rNNI and rSPR-reduce to the best-known moves on rooted phylogenetic trees, nearest-neighbor interchange and rooted subtree pruning and regrafting. Besides a number of reachability results-separating the contributions of horizontal and vertical moves-we prove that rNNI moves are local versions of rSPR moves, and provide bounds on the sizes of the rNNI neighborhoods. The paper focuses on the most biologically meaningful versions of phylogenetic networks, where edges are oriented and reticulation events clearly identified. Moreover, our rearrangement moves are robust to the fact that networks with higher complexity usually allow a better fit with the data. Our goal is to provide a solid basis for

  15. Rearrangement moves on rooted phylogenetic networks.

    Directory of Open Access Journals (Sweden)

    Philippe Gambette

    2017-08-01

    Full Text Available Phylogenetic tree reconstruction is usually done by local search heuristics that explore the space of the possible tree topologies via simple rearrangements of their structure. Tree rearrangement heuristics have been used in combination with practically all optimization criteria in use, from maximum likelihood and parsimony to distance-based principles, and in a Bayesian context. Their basic components are rearrangement moves that specify all possible ways of generating alternative phylogenies from a given one, and whose fundamental property is to be able to transform, by repeated application, any phylogeny into any other phylogeny. Despite their long tradition in tree-based phylogenetics, very little research has gone into studying similar rearrangement operations for phylogenetic network-that is, phylogenies explicitly representing scenarios that include reticulate events such as hybridization, horizontal gene transfer, population admixture, and recombination. To fill this gap, we propose "horizontal" moves that ensure that every network of a certain complexity can be reached from any other network of the same complexity, and "vertical" moves that ensure reachability between networks of different complexities. When applied to phylogenetic trees, our horizontal moves-named rNNI and rSPR-reduce to the best-known moves on rooted phylogenetic trees, nearest-neighbor interchange and rooted subtree pruning and regrafting. Besides a number of reachability results-separating the contributions of horizontal and vertical moves-we prove that rNNI moves are local versions of rSPR moves, and provide bounds on the sizes of the rNNI neighborhoods. The paper focuses on the most biologically meaningful versions of phylogenetic networks, where edges are oriented and reticulation events clearly identified. Moreover, our rearrangement moves are robust to the fact that networks with higher complexity usually allow a better fit with the data. Our goal is to provide

  16. Phylogenetic diversity and relationships among species of genus ...

    African Journals Online (AJOL)

    Fifty six Nicotiana species were used to construct phylogenetic trees and to asses the genetic relationships between them. Genetic distances estimated from RAPD analysis was used to construct phylogenetic trees using Phylogenetic Inference Package (PHYLIP). Since phylogenetic relationships estimated for closely ...

  17. Phylogenetic tests of distribution patterns in South Asia: towards

    Indian Academy of Sciences (India)

    The last four decades have seen an increasing integration of phylogenetics and biogeography. However, a dearth of phylogenetic studies has precluded such biogeographic analyses in South Asia until recently. Noting the increase in phylogenetic research and interest in phylogenetic biogeography in the region, we ...

  18. Phylogenetic analysis of hepatitis B virus in pakistan

    International Nuclear Information System (INIS)

    Baig, S.; Hasnain, N.U.

    2008-01-01

    To identify the distribution pattern of Hepatitis B Virus (HBV) genotype in a group of patients and to study its phylogenetic divergence. Two hundred and one HBV infected patients were genotyped for this study. All HbsAg positive individuals, either healthy carriers or suffering from conditions such as acute or chronic hepatitis, cirrhosis and hepatocellular carcinoma were included. Hepatitis B patients co-infected with other hepatic viruses were excluded. Hepatitis B virus DNA was extracted from serum, and subjected to a nested PCR, using the primers type-specific for genotype detection. Phylogenetic analysis was performed in the pre-S1 through S genes of HBV. The divergence was studied through 15 sequences of 967bp submitted to the DBJ/EMBL/GenBank databases accessible under accession number EF584640 through EF584654. Out of 201 patients tested, 156 were males and 45 were females. Genotype D was the predominant type found in 128 (64%) patients followed by A in 47 (23%) and mixed A/D in 26 (13%). Phylogenetic analysis confirmed the dominance of genotype D and subtype ayw2. There was dominance of genotype D subtype ayw2. It had a close resemblance with HBV strains that circulate in Iran, India and Japan. (author)

  19. Extended molecular phylogenetics and revised systematics of Malagasy scincine lizards.

    Science.gov (United States)

    Erens, Jesse; Miralles, Aurélien; Glaw, Frank; Chatrou, Lars W; Vences, Miguel

    2017-02-01

    Among the endemic biota of Madagascar, skinks are a diverse radiation of lizards that exhibit a striking ecomorphological variation, and could provide an interesting system to study body-form evolution in squamate reptiles. We provide a new phylogenetic hypothesis for Malagasy skinks of the subfamily Scincinae based on an extended molecular dataset comprising 8060bp from three mitochondrial and nine nuclear loci. Our analysis also increases taxon sampling of the genus Amphiglossus by including 16 out of 25 nominal species. Additionally, we examined whether the molecular phylogenetic patterns coincide with morphological differentiation in the species currently assigned to this genus. Various methods of inference recover a mostly strongly supported phylogeny with three main clades of Amphiglossus. However, relationships among these three clades and the limb-reduced genera Grandidierina, Voeltzkowia and Pygomeles remain uncertain. Supported by a variety of morphological differences (predominantly related to the degree of body elongation), but considering the remaining phylogenetic uncertainty, we propose a redefinition of Amphiglossus into three different genera (Amphiglossus sensu stricto, Flexiseps new genus, and Brachyseps new genus) to remove the non-monophyly of Amphiglossus sensu lato and to facilitate future studies on this fascinating group of lizards. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Bayesian nonparametric clustering in phylogenetics: modeling antigenic evolution in influenza.

    Science.gov (United States)

    Cybis, Gabriela B; Sinsheimer, Janet S; Bedford, Trevor; Rambaut, Andrew; Lemey, Philippe; Suchard, Marc A

    2018-01-30

    Influenza is responsible for up to 500,000 deaths every year, and antigenic variability represents much of its epidemiological burden. To visualize antigenic differences across many viral strains, antigenic cartography methods use multidimensional scaling on binding assay data to map influenza antigenicity onto a low-dimensional space. Analysis of such assay data ideally leads to natural clustering of influenza strains of similar antigenicity that correlate with sequence evolution. To understand the dynamics of these antigenic groups, we present a framework that jointly models genetic and antigenic evolution by combining multidimensional scaling of binding assay data, Bayesian phylogenetic machinery and nonparametric clustering methods. We propose a phylogenetic Chinese restaurant process that extends the current process to incorporate the phylogenetic dependency structure between strains in the modeling of antigenic clusters. With this method, we are able to use the genetic information to better understand the evolution of antigenicity throughout epidemics, as shown in applications of this model to H1N1 influenza. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  1. Detection and phylogenetic analysis of bacteriophage WO in spiders (Araneae).

    Science.gov (United States)

    Yan, Qian; Qiao, Huping; Gao, Jin; Yun, Yueli; Liu, Fengxiang; Peng, Yu

    2015-11-01

    Phage WO is a bacteriophage found in Wolbachia. Herein, we represent the first phylogenetic study of WOs that infect spiders (Araneae). Seven species of spiders (Araneus alternidens, Nephila clavata, Hylyphantes graminicola, Prosoponoides sinensis, Pholcus crypticolens, Coleosoma octomaculatum, and Nurscia albofasciata) from six families were infected by Wolbachia and WO, followed by comprehensive sequence analysis. Interestingly, WO could be only detected Wolbachia-infected spiders. The relative infection rates of those seven species of spiders were 75, 100, 88.9, 100, 62.5, 72.7, and 100 %, respectively. Our results indicated that both Wolbachia and WO were found in three different body parts of N. clavata, and WO could be passed to the next generation of H. graminicola by vertical transmission. There were three different sequences for WO infected in A. alternidens and two different WO sequences from C. octomaculatum. Only one sequence of WO was found for the other five species of spiders. The discovered sequence of WO ranged from 239 to 311 bp. Phylogenetic tree was generated using maximum likelihood (ML) based on the orf7 gene sequences. According to the phylogenetic tree, WOs in N. clavata and H. graminicola were clustered in the same group. WOs from A. alternidens (WAlt1) and C. octomaculatum (WOct2) were closely related to another clade, whereas WO in P. sinensis was classified as a sole cluster.

  2. Phylogenetic and recombination analysis of tomato spotted wilt virus.

    Directory of Open Access Journals (Sweden)

    Sen Lian

    Full Text Available Tomato spotted wilt virus (TSWV severely damages and reduces the yield of many economically important plants worldwide. In this study, we determined the whole-genome sequences of 10 TSWV isolates recently identified from various regions and hosts in Korea. Phylogenetic analysis of these 10 isolates as well as the three previously sequenced isolates indicated that the 13 Korean TSWV isolates could be divided into two groups reflecting either two different origins or divergences of Korean TSWV isolates. In addition, the complete nucleotide sequences for the 13 Korean TSWV isolates along with previously sequenced TSWV RNA segments from Korea and other countries were subjected to phylogenetic and recombination analysis. The phylogenetic analysis indicated that both the RNA L and RNA M segments of most Korean isolates might have originated in Western Europe and North America but that the RNA S segments for all Korean isolates might have originated in China and Japan. Recombination analysis identified a total of 12 recombination events among all isolates and segments and five recombination events among the 13 Korea isolates; among the five recombinants from Korea, three contained the whole RNA L segment, suggesting reassortment rather than recombination. Our analyses provide evidence that both recombination and reassortment have contributed to the molecular diversity of TSWV.

  3. Hypertension in Malaysia: An Analysis of Trends From the National Surveys 1996 to 2011.

    Science.gov (United States)

    Naing, Cho; Yeoh, Peng Nam; Wai, Victor Nyunt; Win, Ni Ni; Kuan, Lai Pei; Aung, Kyan

    2016-01-01

    This study aimed to determine trends in prevalence, awareness, and control of hypertension in Malaysia and to assess the relationship between socioeconomic determinants and prevalence of hypertension in Malaysia.The distribution of hypertension in Malaysia was assessed based on available data in 3 National Health and Morbidity Surveys (NHMSs) and 1 large scale non-NHMS during the period of 1996 to 2011. Summary statistics was used to characterize the included surveys. Differences in prevalence, awareness, and control of hypertension between any 2 surveys were expressed as ratios. To assess the independent associations between the predictors and the outcome variables, regression analyses were employed with prevalence of hypertension as an outcome variable.Overall, there was a rising trend in the prevalence of hypertension in adults ≥30 years: 32.9% (30%-35.8%) in 1996, 42.6% (37.5%-43.5%) in 2006, and 43.5% (40.4%-46.6%) in 2011. There were significant increase of 32% from 1996 to 2011 (P Malaysia improved from 1996 to 2006. A change in the control of hypertension was 13% higher in women than in men.The findings suggest that the magnitude of hypertension in Malaysia needs additional attention. Strengthening the screening for hypertension in primary health-care settings in the high-risk groups and frequent health promotion to the community to enhance individual awareness and commitment to healthy living would be of immense value.

  4. Radio Astronomy in Malaysia: Current Status and Outreach Activities

    Science.gov (United States)

    Hashim, N.; Abidin, Z. Z.; Ibrahim, U. F. S. U.; Umar, R.; Hassan, M. S. R.; Rosli, Z.; Hamidi, Z. S.; Ibrahim, Z. A.

    2011-12-01

    In this paper, we will present the current status of radio astronomical research and outreach in Malaysia. We will also present a short history of our research group, which is currently the only radio astronomical facility in Malaysia. Our group is called the Radio Cosmology Research Lab and was established in 2005 by Dr Zamri Zainal Abidin and Prof Dr Zainol Abidin Ibrahim. We will discuss the future plans for this group including our keen interest in being part of a more global network of radio astronomers. We are already an active member of the South-East Asia Astronomy Network (SEAAN) and aims to have a radio astronomical facility in order to join the Global Very Long Baseline Interferometer (VLBI) as well becoming a research hub for the future Square Kilometer Array (SKA) project. We will also present some of the scientific goals of our group including providing a platform for radio astronomers to be able to do observations of weak and high red-shifted radio objects such as galaxy clusters and supernovae.

  5. Malaysia urges ASEAN to tackle AIDS crisis.

    Science.gov (United States)

    2000-08-07

    Urgent action is needed to fight the alarming spread of HIV/AIDS that infected 1.3 million people in Southeast Asia last year alone, Malaysia's foreign minister said July 24, 2000. Syed Hamid said the Association of Southeast Asian Nations (ASEAN) should tackle at regional and national level an epidemic that was taking its most drastic toll among the region's youth. "HIV/AIDS not only represents a major public health and social problem but is a serious challenge to development as well," Syed Hamid told the opening ceremony of ASEAN's 33rd annual foreign ministers' meeting. The crisis requires commitment at the "highest political level," he said, warning that HIV/AIDS could become a transnational problem within the 10-member group. Foreign ministers have recommended their leaders discuss the crisis later this year at an informal summit in Singapore and hold a summit on HIV/AIDS in conjunction with the 7th ASEAN Summit in Brunei next year. "I think people recognized the importance and the adverse impacts on our social development," Syed Hamid told reporters later. "I think it is a real issue that we cannot run away from." Among ASEAN members, Thailand, Cambodia, and Myanmar have some of the highest infection rates in Asia of HIV, the virus that causes AIDS. full text

  6. Communication competencies of oncology nurses in Malaysia.

    Science.gov (United States)

    Maskor, Nor Aida; Krauss, Steven Eric; Muhamad, Mazanah; Nik Mahmood, Nik Hasnaa

    2013-01-01

    This paper reports on part of a large study to identify competencies of oncology nurses in Malaysia. It focuses on oncology nurses' communications-related competency. As an important cancer care team member, oncology nurses need to communicate effectively with cancer patients. Literature shows that poor communication can make patients feel anxious, uncertain and generally not satisfied with their nurses' care. This paper deliberates on the importance of effective communication by oncology nurses in the context of a public hospital. Four focus group discussions were used in this study with 17 oncology/cancer care nurses from Malaysian public hospitals. The main inclusion criterion was that the nurses had to have undergone a post-basic course in oncology, or have work experience as a cancer care nurse. The findings indicated that nurses do communicate with their patients, patients' families and doctors to provide information about the disease, cancer treatment, disease recurrence and side effects. Nurses should have good communication skills in order to build relationships as well as to provide quality services to their patients. The paper concludes by recommending how oncology nursing competencies can be improved.

  7. PAEDIATRIC OCULAR TRAUMA IN KUCHING, SARAWAK, MALAYSIA

    Directory of Open Access Journals (Sweden)

    INTAN G

    2011-01-01

    Full Text Available Purpose: To evaluate the demography, aetiology, type and outcome of paediatric ocular trauma in tertiary centre in Malaysia. Method: We retrospectively studied 118 eyes from 117 patients over a period of 36 months (January 2006 to December 2008. All ocular injuries in patients aged 12 and below seen in the Ophthalmology Department for the first time were included in thisstudy. Results: Mean age of patients was 6.1±3.0 years. 68 cases (58.2% occurred in pre-school children, whereas 49 (41.9% in school-aged children. Boys accounted for 65.8% of cases. There was no predilection for either right or the left eye. 47% of cases (56 patients occurred in Malay. Most of the injuries took place at home when the children were alone (p<0.05. Sharp objects were the commonest cause (45 cases, 38.1%. The majority of cases (103, 87.3% were considered preventable. The frequency of open and closed globe injury was similar. Hyphema was more common in closed globe injury compared to open globe injury (p<0.05. Other associated injuries such as cataract, vitreous hemorrhage and retinal hemorrhage are similar between the two groups. Visual outcome is generally poor with only 34 eyes (28.8% had no visual impairment. Conclusion: Ocular trauma in children is an important cause of visual loss. Most cases occurred at home and were preventable. Prevention through education is the best approach.

  8. Phylogenetic tree based on complete genomes using fractal and correlation analyses without sequence alignment

    Directory of Open Access Journals (Sweden)

    Zu-Guo Yu

    2006-06-01

    Full Text Available The complete genomes of living organisms have provided much information on their phylogenetic relationships. Similarly, the complete genomes of chloroplasts have helped resolve the evolution of this organelle in photosynthetic eukaryotes. In this review, we describe two algorithms to construct phylogenetic trees based on the theories of fractals and dynamic language using complete genomes. These algorithms were developed by our research group in the past few years. Our distance-based phylogenetic tree of 109 prokaryotes and eukaryotes agrees with the biologists' "tree of life" based on the 16S-like rRNA genes in a majority of basic branchings and most lower taxa. Our phylogenetic analysis also shows that the chloroplast genomes are separated into two major clades corresponding to chlorophytes s.l. and rhodophytes s.l. The interrelationships among the chloroplasts are largely in agreement with the current understanding on chloroplast evolution.

  9. Data for constructing insect genome content matrices for phylogenetic analysis and functional annotation

    Directory of Open Access Journals (Sweden)

    Jeffrey Rosenfeld

    2016-03-01

    Full Text Available Twenty one fully sequenced and well annotated insect genomes were used to construct genome content matrices for phylogenetic analysis and functional annotation of insect genomes. To examine the role of e-value cutoff in ortholog determination we used scaled e-value cutoffs and a single linkage clustering approach.. The present communication includes (1 a list of the genomes used to construct the genome content phylogenetic matrices, (2 a nexus file with the data matrices used in phylogenetic analysis, (3 a nexus file with the Newick trees generated by phylogenetic analysis, (4 an excel file listing the Core (CORE genes and Unique (UNI genes found in five insect groups, and (5 a figure showing a plot of consistency index (CI versus percent of unannotated genes that are apomorphies in the data set for gene losses and gains and bar plots of gains and losses for four consistency index (CI cutoffs.

  10. The phylogenetic relationships among infraorders and superfamilies of Diptera based on morphological evidence

    DEFF Research Database (Denmark)

    Lambkin, Christine L.; Sinclair, Bradley J.; Pape, Thomas

    2013-01-01

    Members of the megadiverse insect order Diptera (flies) have successfully colonized all continents and nearly all habitats. There are more than 154 000 described fly species, representing 1012% of animal species. Elucidating the phylogenetic relationships of such a large component of global...... biodiversity is challenging, but significant advances have been made in the last few decades. Since Hennig first discussed the monophyly of major groupings, Diptera has attracted much study, but most researchers have used non-numerical qualitative methods to assess morphological data. More recently......, quantitative phylogenetic methods have been used on both morphological and molecular data. All previous quantitative morphological studies addressed narrower phylogenetic problems, often below the suborder or infraorder level. Here we present the first numerical analysis of phylogenetic relationships...

  11. Conformation of phylogenetic relationship of Penaeidae shrimp based on morphometric and molecular investigations.

    Science.gov (United States)

    Rajakumaran, P; Vaseeharan, B; Jayakumar, R; Chidambara, R

    2014-01-01

    Understanding of accurate phylogenetic relationship among Penaeidae shrimp is important for academic and fisheries industry. The Morphometric and Randomly amplified polymorphic DNA (RAPD) analysis was used to make the phylogenetic relationsip among 13 Penaeidae shrimp. For morphometric analysis forty variables and total lengths of shrimp were measured for each species, and removed the effect of size variation. The size normalized values obtained was subjected to UPGMA (Unweighted Pair-Group Method with Arithmetic Mean) cluster analysis. For RAPD analysis, the four primers showed reliable differentiation between species, and used correlation coefficient between the DNA banding patterns of 13 Penaeidae species to construct UPGMA dendrogram. Phylogenetic relationship from morphometric and molecular analysis for Penaeidae species found to be congruent. We concluded that as the results from morphometry investigations concur with molecular one, phylogenetic relationship obtained for the studied Penaeidae are considered to be reliable.

  12. Encoding phylogenetic trees in terms of weighted quartets.

    Science.gov (United States)

    Grünewald, Stefan; Huber, Katharina T; Moulton, Vincent; Semple, Charles

    2008-04-01

    One of the main problems in phylogenetics is to develop systematic methods for constructing evolutionary or phylogenetic trees. For a set of species X, an edge-weighted phylogenetic X-tree or phylogenetic tree is a (graph theoretical) tree with leaf set X and no degree 2 vertices, together with a map assigning a non-negative length to each edge of the tree. Within phylogenetics, several methods have been proposed for constructing such trees that work by trying to piece together quartet trees on X, i.e. phylogenetic trees each having four leaves in X. Hence, it is of interest to characterise when a collection of quartet trees corresponds to a (unique) phylogenetic tree. Recently, Dress and Erdös provided such a characterisation for binary phylogenetic trees, that is, phylogenetic trees all of whose internal vertices have degree 3. Here we provide a new characterisation for arbitrary phylogenetic trees.

  13. Assessment of phylogenetic sensitivity for reconstructing HIV-1 epidemiological relationships.

    Science.gov (United States)

    Beloukas, Apostolos; Magiorkinis, Emmanouil; Magiorkinis, Gkikas; Zavitsanou, Asimina; Karamitros, Timokratis; Hatzakis, Angelos; Paraskevis, Dimitrios

    2012-06-01

    Phylogenetic analysis has been extensively used as a tool for the reconstruction of epidemiological relations for research or for forensic purposes. It was our objective to assess the sensitivity of different phylogenetic methods and various phylogenetic programs to reconstruct epidemiological links among HIV-1 infected patients that is the probability to reveal a true transmission relationship. Multiple datasets (90) were prepared consisting of HIV-1 sequences in protease (PR) and partial reverse transcriptase (RT) sampled from patients with documented epidemiological relationship (target population), and from unrelated individuals (control population) belonging to the same HIV-1 subtype as the target population. Each dataset varied regarding the number, the geographic origin and the transmission risk groups of the sequences among the control population. Phylogenetic trees were inferred by neighbor-joining (NJ), maximum likelihood heuristics (hML) and Bayesian methods. All clusters of sequences belonging to the target population were correctly reconstructed by NJ and Bayesian methods receiving high bootstrap and posterior probability (PP) support, respectively. On the other hand, TreePuzzle failed to reconstruct or provide significant support for several clusters; high puzzling step support was associated with the inclusion of control sequences from the same geographic area as the target population. In contrary, all clusters were correctly reconstructed by hML as implemented in PhyML 3.0 receiving high bootstrap support. We report that under the conditions of our study, hML using PhyML, NJ and Bayesian methods were the most sensitive for the reconstruction of epidemiological links mostly from sexually infected individuals. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. galaxieEST: addressing EST identity through automated phylogenetic analysis.

    Science.gov (United States)

    Nilsson, R Henrik; Rajashekar, Balaji; Larsson, Karl-Henrik; Ursing, Björn M

    2004-07-05

    Research involving expressed sequence tags (ESTs) is intricately coupled to the existence of large, well-annotated sequence repositories. Comparatively complete and satisfactory annotated public sequence libraries are, however, available only for a limited range of organisms, rendering the absence of sequences and gene structure information a tangible problem for those working with taxa lacking an EST or genome sequencing project. Paralogous genes belonging to the same gene family but distinguished by derived characteristics are particularly prone to misidentification and erroneous annotation; high but incomplete levels of sequence similarity are typically difficult to interpret and have formed the basis of many unsubstantiated assumptions of orthology. In these cases, a phylogenetic study of the query sequence together with the most similar sequences in the database may be of great value to the identification process. In order to facilitate this laborious procedure, a project to employ automated phylogenetic analysis in the identification of ESTs was initiated. galaxieEST is an open source Perl-CGI script package designed to complement traditional similarity-based identification of EST sequences through employment of automated phylogenetic analysis. It uses a series of BLAST runs as a sieve to retrieve nucleotide and protein sequences for inclusion in neighbour joining and parsimony analyses; the output includes the BLAST output, the results of the phylogenetic analyses, and the corresponding multiple alignments. galaxieEST is available as an on-line web service for identification of fungal ESTs and for download / local installation for use with any organism group at http://galaxie.cgb.ki.se/galaxieEST.html. By addressing sequence relatedness in addition to similarity, galaxieEST provides an integrative view on EST origin and identity, which may prove particularly useful in cases where similarity searches return one or more pertinent, but not full, matches and

  15. Molecular characterization of partial fusion gene and C-terminus extension length of haemagglutinin-neuraminidase gene of recently isolated Newcastle disease virus isolates in Malaysia

    Directory of Open Access Journals (Sweden)

    Berhanu Ayalew

    2010-08-01

    Full Text Available Abstract Background Newcastle disease (ND, caused by Newcastle disease virus (NDV, is a highly contagious disease of birds and has been one of the major causes of economic losses in the poultry industry. Despite routine vaccination programs, sporadic cases have occasionally occurred in the country and remain a constant threat to commercial poultry. Hence, the present study was aimed to characterize NDV isolates obtained from clinical cases in various locations of Malaysia between 2004 and 2007 based on sequence and phylogenetic analysis of partial F gene and C-terminus extension length of HN gene. Results The coding region of eleven NDV isolates fusion (F gene and carboxyl terminal region of haemagglutinin-neuraminidase (HN gene including extensions were amplified by reverse transcriptase PCR and directly sequenced. All the isolates have shown to have non-synonymous to synonymous base substitution rate ranging between 0.081 - 0.264 demonstrating presence of negative selection. Analysis based on F gene showed the characterized isolates possess three different types of protease cleavage site motifs; namely 112RRQKRF117, 112RRRKRF117 and 112GRQGRL117 and appear to show maximum identities with isolates in the region such as cockatoo/14698/90 (Indonesia, Ch/2000 (China, local isolate AF2240 indicating the high similarity of isolates circulating in the South East Asian countries. Meanwhile, one of the isolates resembles commonly used lentogenic vaccine strains. On further characterization of the HN gene, Malaysian isolates had C-terminus extensions of 0, 6 and 11 amino acids. Analysis of the phylogenetic tree revealed that the existence of three genetic groups; namely, genotype II, VII and VIII. Conclusions The study concluded that the occurrence of three types of NDV genotypes and presence of varied carboxyl terminus extension lengths among Malaysian isolates incriminated for sporadic cases.

  16. Molecular characterization of partial fusion gene and C-terminus extension length of haemagglutinin-neuraminidase gene of recently isolated Newcastle disease virus isolates in Malaysia.

    Science.gov (United States)

    Berhanu, Ayalew; Ideris, Aini; Omar, Abdul R; Bejo, Mohd Hair

    2010-08-08

    Newcastle disease (ND), caused by Newcastle disease virus (NDV), is a highly contagious disease of birds and has been one of the major causes of economic losses in the poultry industry. Despite routine vaccination programs, sporadic cases have occasionally occurred in the country and remain a constant threat to commercial poultry. Hence, the present study was aimed to characterize NDV isolates obtained from clinical cases in various locations of Malaysia between 2004 and 2007 based on sequence and phylogenetic analysis of partial F gene and C-terminus extension length of HN gene. The coding region of eleven NDV isolates fusion (F) gene and carboxyl terminal region of haemagglutinin-neuraminidase (HN) gene including extensions were amplified by reverse transcriptase PCR and directly sequenced. All the isolates have shown to have non-synonymous to synonymous base substitution rate ranging between 0.081 - 0.264 demonstrating presence of negative selection. Analysis based on F gene showed the characterized isolates possess three different types of protease cleavage site motifs; namely 112RRQKRF117, 112RRRKRF117 and 112GRQGRL117 and appear to show maximum identities with isolates in the region such as cockatoo/14698/90 (Indonesia), Ch/2000 (China), local isolate AF2240 indicating the high similarity of isolates circulating in the South East Asian countries. Meanwhile, one of the isolates resembles commonly used lentogenic vaccine strains. On further characterization of the HN gene, Malaysian isolates had C-terminus extensions of 0, 6 and 11 amino acids. Analysis of the phylogenetic tree revealed that the existence of three genetic groups; namely, genotype II, VII and VIII. The study concluded that the occurrence of three types of NDV genotypes and presence of varied carboxyl terminus extension lengths among Malaysian isolates incriminated for sporadic cases.

  17. Malay divorce in Peninsular Malaysia: the near-disappearance of an institution.

    Science.gov (United States)

    Tan, P C; Jones, G W

    1990-01-01

    The authors explore factors affecting the sharp decline in divorce rates among the Malay population of Peninsular Malaysia during the period 1950-1985. They consider the rise in marriage age, trends away from arranged marriage and polygamy, and the contributions of Islamic reform movements and women's groups. The focus is on the changes in attitudes toward marriage and divorce. Data are from the 1981-1982 Study on Marriage and Marital Dissolution in Peninsular Malaysia. Appendixes containing laws and statutes concerning divorce are included.

  18. Phylogenetic turnover during subtropical forest succession across environmental and phylogenetic scales.

    Science.gov (United States)

    Purschke, Oliver; Michalski, Stefan G; Bruelheide, Helge; Durka, Walter

    2017-12-01

    Although spatial and temporal patterns of phylogenetic community structure during succession are inherently interlinked and assembly processes vary with environmental and phylogenetic scales, successional studies of community assembly have yet to integrate spatial and temporal components of community structure, while accounting for scaling issues. To gain insight into the processes that generate biodiversity after disturbance, we combine analyses of spatial and temporal phylogenetic turnover across phylogenetic scales, accounting for covariation with environmental differences. We compared phylogenetic turnover, at the species- and individual-level, within and between five successional stages, representing woody plant communities in a subtropical forest chronosequence. We decomposed turnover at different phylogenetic depths and assessed its covariation with between-plot abiotic differences. Phylogenetic turnover between stages was low relative to species turnover and was not explained by abiotic differences. However, within the late-successional stages, there was high presence-/absence-based turnover (clustering) that occurred deep in the phylogeny and covaried with environmental differentiation. Our results support a deterministic model of community assembly where (i) phylogenetic composition is constrained through successional time, but (ii) toward late succession, species sorting into preferred habitats according to niche traits that are conserved deep in phylogeny, becomes increasingly important.

  19. Folding and unfolding phylogenetic trees and networks.

    Science.gov (United States)

    Huber, Katharina T; Moulton, Vincent; Steel, Mike; Wu, Taoyang

    2016-12-01

    Phylogenetic networks are rooted, labelled directed acyclic graphswhich are commonly used to represent reticulate evolution. There is a close relationship between phylogenetic networks and multi-labelled trees (MUL-trees). Indeed, any phylogenetic network N can be "unfolded" to obtain a MUL-tree U(N) and, conversely, a MUL-tree T can in certain circumstances be "folded" to obtain aphylogenetic network F(T) that exhibits T. In this paper, we study properties of the operations U and F in more detail. In particular, we introduce the class of stable networks, phylogenetic networks N for which F(U(N)) is isomorphic to N, characterise such networks, and show that they are related to the well-known class of tree-sibling networks. We also explore how the concept of displaying a tree in a network N can be related to displaying the tree in the MUL-tree U(N). To do this, we develop aphylogenetic analogue of graph fibrations. This allows us to view U(N) as the analogue of the universal cover of a digraph, and to establish a close connection between displaying trees in U(N) and reconciling phylogenetic trees with networks.

  20. Tree-Based Unrooted Phylogenetic Networks.

    Science.gov (United States)

    Francis, A; Huber, K T; Moulton, V

    2018-02-01

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent non-tree-like evolutionary histories that arise in organisms such as plants and bacteria, or uncertainty in evolutionary histories. An unrooted phylogenetic network on a non-empty, finite set X of taxa, or network, is a connected, simple graph in which every vertex has degree 1 or 3 and whose leaf set is X. It is called a phylogenetic tree if the underlying graph is a tree. In this paper we consider properties of tree-based networks, that is, networks that can be constructed by adding edges into a phylogenetic tree. We show that although they have some properties in common with their rooted analogues which have recently drawn much attention in the literature, they have some striking differences in terms of both their structural and computational properties. We expect that our results could eventually have applications to, for example, detecting horizontal gene transfer or hybridization which are important factors in the evolution of many organisms.